|
--- |
|
task_categories: |
|
- conversational |
|
- fill-mask |
|
language: |
|
- en |
|
tags: |
|
- biology |
|
- medical |
|
pretty_name: genome database |
|
size_categories: |
|
- 10M<n<100M |
|
--- |
|
# Dataset Card for Dataset Name |
|
|
|
## Dataset Description |
|
|
|
- **Homepage:** |
|
- **Repository:** |
|
- **Paper:** |
|
- **Leaderboard:** |
|
- **Point of Contact:** |
|
|
|
### Dataset Summary |
|
This dataset contains datas being collected from Genbank. The dataset is organized in a way that it separate all the genes from an DNA , and was classified according to the region and coding type. In that way, people could get more detailed information regarding each DNA sequences. |
|
This dataset generally include five type of regions including regulator, repeat region, mRNA, tRNA, rRNA and 'CDS' |
|
|
|
|
|
### Supported Tasks and Leaderboards |
|
|
|
[More Information Needed] |
|
|
|
### Languages |
|
|
|
[More Information Needed] |
|
|
|
## Dataset Structure |
|
|
|
### Data Instances |
|
```python |
|
{DNA id: AP013063.1 |
|
Organism: Serratia marcescens SM39 |
|
gene id: SM39_0001 |
|
region type:coding |
|
coding type: BAO32072.1 |
|
sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA |
|
gc_content:0.52173913 |
|
translation code: MRNISLKTTIITTTDTTGNGAG} |
|
``` |
|
|
|
### Data Fields |
|
__DNA id__: id number for the whole DNA sequence, sequences with same DNA id are from same DNA |
|
__Organism__: Organism of the DNA |
|
__gene id__: locus tag of the gene, sequences with same gene id are from same gene |
|
__region type__: determine whether the region is coding or non-coding; if the region is the type of regulator, it would be classified according to the class of regulators, such as terminator, ribosome binding ste, etc. |
|
__coding type__: if the sequence is coding sequence, it would be classified according to their production type. sequence that produce protein would be marked with protein id. Sequences that produce either rRNA or tRNA would be marked as rRNA or tRNA. |
|
__sequence__: the actual sequence |
|
__gc_content__: the gc_content of the sequence |
|
__translation code__: if the sequence produce protein, then the translation code would be provided as a reference |
|
|
|
### Data Splits |
|
|
|
[More Information Needed] |
|
|
|
## Dataset Creation |
|
|
|
### Curation Rationale |
|
|
|
[More Information Needed] |
|
|
|
### Source Data |
|
The data collected are all from the most recent release of genbank, genbank 255. |
|
#### Initial Data Collection and Normalization |
|
|
|
[More Information Needed] |
|
|
|
#### Who are the source language producers? |
|
|
|
[More Information Needed] |
|
|
|
### Annotations |
|
|
|
#### Annotation process |
|
|
|
[More Information Needed] |
|
|
|
#### Who are the annotators? |
|
|
|
[More Information Needed] |
|
|
|
### Personal and Sensitive Information |
|
|
|
[More Information Needed] |
|
|
|
## Considerations for Using the Data |
|
|
|
### Social Impact of Dataset |
|
|
|
[More Information Needed] |
|
|
|
### Discussion of Biases |
|
|
|
[More Information Needed] |
|
|
|
### Other Known Limitations |
|
|
|
[More Information Needed] |
|
|
|
## Additional Information |
|
|
|
### Dataset Curators |
|
|
|
[More Information Needed] |
|
|
|
### Licensing Information |
|
|
|
[More Information Needed] |
|
|
|
### Citation Information |
|
|
|
[More Information Needed] |
|
|
|
### Contributions |
|
|
|
[More Information Needed] |
