Update README.md

README.md

@@ -38,25 +38,25 @@ This dataset generally include five type of regions including regulator, repeat
 
 ### Data Instances
 ```python
-{'DNA id': AP013063.1  
-'Organism': Serratia marcescens SM39  
-'gene id': SM39_0001  
-'region type':coding  
-'coding type': BAO32072.1  
-'sequence': ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA  
-'gc_content':0.52173913  
-'translation code': MRNISLKTTIITTTDTTGNGAG}  
+{DNA id: AP013063.1  
+Organism: Serratia marcescens SM39  
+gene id: SM39_0001  
+region type:coding  
+coding type: BAO32072.1  
+sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA  
+gc_content:0.52173913  
+translation code: MRNISLKTTIITTTDTTGNGAG}  
 ```
 
 ### Data Fields
-'__DNA id__': id number for the whole DNA sequence, sequences with same DNA id are from same DNA  
-'__Organism__': Organism of the DNA  
-'__gene id__': locus tag of the gene, sequences with same gene id are from same gene      
-'__region type__': determine whether the region is coding or non-coding; if the region is the type of regulator, it would be classified according to the class of regulators, such as terminator, ribosome binding ste, etc.  
-'__coding type__': if the sequence is coding sequence, it would be classified according to their production type. sequence that produce protein would be marked with protein id. Sequences that produce either rRNA or tRNA would be marked as rRNA or tRNA.  
-'__sequence__': the actual sequence   
-'__gc_content__': the gc_content of the sequence  
-'__translation code__': if the sequence produce protein, then the translation code would be provided as a reference  
+__DNA id__: id number for the whole DNA sequence, sequences with same DNA id are from same DNA  
+__Organism__: Organism of the DNA  
+__gene id__: locus tag of the gene, sequences with same gene id are from same gene      
+__region type__: determine whether the region is coding or non-coding; if the region is the type of regulator, it would be classified according to the class of regulators, such as terminator, ribosome binding ste, etc.  
+__coding type__: if the sequence is coding sequence, it would be classified according to their production type. sequence that produce protein would be marked with protein id. Sequences that produce either rRNA or tRNA would be marked as rRNA or tRNA.  
+__sequence__: the actual sequence   
+__gc_content__: the gc_content of the sequence  
+__translation code__: if the sequence produce protein, then the translation code would be provided as a reference  
 
 ### Data Splits