task_categories:
- conversational
- fill-mask
language:
- en
tags:
- biology
- medical
pretty_name: genome database
size_categories:
- 10M<n<100M
Dataset Card for Dataset Name
Dataset Description
- Homepage:
- Repository:
- Paper:
- Leaderboard:
- Point of Contact:
Dataset Summary
This dataset contains datas being collected from Genbank. The dataset is organized in a way that it separate all the genes from an DNA , and was classified according to the region and coding type. In that way, people could get more detailed information regarding each DNA sequences. This dataset generally include five type of regions including regulator, repeat region, mRNA, tRNA, rRNA and 'CDS'
Supported Tasks and Leaderboards
[More Information Needed]
Languages
[More Information Needed]
Dataset Structure
Data Instances
{DNA id: AP013063.1
Organism: Serratia marcescens SM39
gene id: SM39_0001
region type:coding
coding type: BAO32072.1
sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA
gc_content:0.52173913
translation code: MRNISLKTTIITTTDTTGNGAG}
Data Fields
DNA id: id number for the whole DNA sequence, sequences with same DNA id are from same DNA
Organism: Organism of the DNA
gene id: locus tag of the gene, sequences with same gene id are from same gene
region type: determine whether the region is coding or non-coding; if the region is the type of regulator, it would be classified according to the class of regulators, such as terminator, ribosome binding ste, etc.
coding type: if the sequence is coding sequence, it would be classified according to their production type. sequence that produce protein would be marked with protein id. Sequences that produce either rRNA or tRNA would be marked as rRNA or tRNA.
sequence: the actual sequence
gc_content: the gc_content of the sequence
translation code: if the sequence produce protein, then the translation code would be provided as a reference
Data Splits
[More Information Needed]
Dataset Creation
Curation Rationale
[More Information Needed]
Source Data
The data collected are all from the most recent release of genbank, genbank 255.
Initial Data Collection and Normalization
[More Information Needed]
Who are the source language producers?
[More Information Needed]
Annotations
Annotation process
[More Information Needed]
Who are the annotators?
[More Information Needed]
Personal and Sensitive Information
[More Information Needed]
Considerations for Using the Data
Social Impact of Dataset
[More Information Needed]
Discussion of Biases
[More Information Needed]
Other Known Limitations
[More Information Needed]
Additional Information
Dataset Curators
[More Information Needed]
Licensing Information
[More Information Needed]
Citation Information
[More Information Needed]
Contributions
[More Information Needed]