texts
sequence
meta
dict
scores
sequence
avg_score
float64
0
0.34
num_sents
int64
5
5
[ "[5E547A4D-90E60795-C:45]\nName=All-Star Baseball 2000 (U)\nCheat0=\"Infinite\\Strikes\",8006E4E1 0000\nCheat1=\"Infinite\\Balls\",8006E4DF 0000\nCheat2=\"Infinite\\Outs\",8006E4E3 0000\nCheat3=\"Infinite\\Character Creation Points\",81103350 4170\nCheat4=\"Infinite\\Pitch Type Creation Points\",811039BC 4170,811039C0 4170\nCheat5=\"Character Creation\\Max\\Accuracy\",81115A20 4170\nCheat6=\"Character Creation\\Max\\Stamina\",81115A24 4170\nCheat7=\"Character Creation\\Max\\Contact\",81115A28 4170\nCheat8=\"Character Creation\\Max\\Power\",81115A2C 4170\nCheat9=\"Character Creation\\Max\\VS LHP\",81115A30 4170\nCheat10=\"Character Creation\\Max\\VS RHP\",81115A34 4170\nCheat11=\"Character Creation\\Max\\Bunting\",81115A38 4170\nCheat12=\"Character Creation\\Max\\VS LHB\",81115A3C 4170\nCheat13=\"Character Creation\\Max\\VS RHB\",81115A40 4170\nCheat14=\"Character Creation\\Max\\Speed\",81115A44 4170\nCheat15=\"Character Creation\\Max\\Defense\",81115A48 4170\nCheat16=\"Character Creation\\Max\\Arm Str.", "\",81115A4C 4170\nCheat17=\"Character Creation\\Max\\Streak\",81115A50 4170\nCheat18=\"Character Creation\\Max\\Clutch\",81115A54 4170\n" ]
{ "pile_set_name": "Github" }
[ 0.007478632478632479, 0 ]
0.003739
5
[ "[Transient intestinal pseudo-obstruction syndrome in premature infants].", "\nA chronic intestinal pseudo-obstruction is sometimes seen in premature neonates who are fed early and subsequently suffer from digestive intolerance for several weeks. ", "Seven premature babies (mean gestational age: 30.5 weeks, mean birthweight: 950 g) suffered from abdominal distension and failure to pass stools at a mean age of 2.5 days (extremes: 1 to 6 days); 2 of them also had vomiting. ", "X-ray examination showed dilated loops of bowel throughout the abdomen without obstructive changes; barium or Gastrografin studies demonstrated inertia of the colon without obstructive changes or abrupt changes in caliber. ", "Histological examination of enteric nerve cells in 2 cases showed normal maturation. ", "Parenteral nutrition was necessary in all patients for 30 to 78 days (mean: 47), followed by continuous enteral feeding for 24 to 48 days (mean: 37). ", "Septicemia complicated parenteral nutrition in 4 babies and was responsible for the death of 1 of them. ", "Normal evacuation of stools occurred between day 27 and day 91 (mean day 46) allowing normal enteral feeding. ", "All 6 patients, now aged 2.5 to 8 years (mean 3.5 years) are in good health, and have no digestive problems. ", "Immaturity of intestinal motility may occur in some premature neonates suffering from intestinal ileus. ", "Parenteral nutrition may be necessary for several weeks, but spontaneous recovery is usual. ", "This transient intestinal pseudo-obstruction of premature babies is different from the classical chronic pseudo-obstruction for which surgery is often needed." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0.004484304932735426, 0, 0, 0.009615384615384616, 0, 0, 0, 0, 0 ]
0.001175
5
[ "in 0.44, 1/8, -2.72?", "\n1/8\nWhat is the nearest to 1 in 5/15191, 2, 4/9?", "\n4/9\nWhat is the closest to -363 in -12, -0.2, 446, -0.3?", "\n-12\nWhich is the nearest to -2/7? ", " (a) 1 (b) -5 (c) -3 (d) 5 (e) -2/33 (f) 15\ne\nWhat is the nearest to -18 in -5, -198, 1, -1/3, 0.6?", "\n-5\nWhich is the nearest to -1/3? ", " (a) 1 (b) 0 (c) -3345 (d) 0.683\nb\nWhich is the closest to -1/4? ", " (a) -4796 (b) 1/7 (c) -0.6 (d) 5.6\nc\nWhich is the closest to -58? ", " (a) 153 (b) -1/2 (c) 1273\nb\nWhich is the closest to -1/2? ", " (a) 95 (b) 2 (c) -2.2\nc\nWhat is the nearest to 0.0425 in 1628, 5, 1/5?", "\n1/5\nWhat is the nearest to -9210.96 in -0.2, -5, -7, 1/7, 0.1?", "\n-7\nWhich is the nearest to -23? ", " (a) -3/4 (b) -1 (c) 36.878\nb\nWhat is the nearest to 9 in -7503/7, 1/3, 2/3, 0.4?", "\n2/3\nWhich is the closest to -105? ", " (a) -5 (b) -1 (c) -2/59 (d) 4/11 (e) -0.3\na\nWhat is the nearest to -1.5 in 0.1, 3, -0.2, 18/5233?", "\n-0.2\nWhich is the closest to 7? ", " (a) 28/29 (b) -7 (c) 2/15 (d) 1/5 (e) 1/6 (f) 3/7\na\nWhich is the closest to -0.14? ", " (a) -3 (b) 1 (c) -15928\nb\nWhich is the closest to -43.6? ", " (a) 1/4 (b) -11 (c) -0.5 (d) 0 (e) 2 (f) -7\nb\nWhich is the nearest to -10605? ", " (a) 88 (b) 2 (c) 1/3 (d) -2\nd\nWhich is the closest to -0.07? ", " (a) 33/7 (b) -53 (c) -0.4 (d) 5 (e) 0.02\ne\nWhat is the closest to 2 in -84, 72, -2/7, 12?", "\n-2/7\nWhich is the nearest to 3215? ", " (a) -18.032 (b) -0.5 (c) 0.5 (d) 2/3\nd\nWhich is the nearest to 0? ", " (a) 4 (b) 3787 (c) 77 (d) -9\na\nWhich is the closest to 3/10? ", " (a) 23 (b) -1973 (c) 31\na\nWhat is the nearest to 1/2 in 0, 1/6, -40/7, -1852.2?", "\n1/6\nWhat is the nearest to 1/4 in -28, -2.8, 4, 2/3?", "\n2/3\nWhich is the nearest to 15? ", " (a) 0 (b) 0.084 (c) 75 (d) 0.2 (e) 0.4 (f) 0.1\ne\nWhich is the closest to 0.08688? ", " (a) -3/16 (b) 2 (c) 1.05\na\nWhat is the nearest to -9 in -0.2, 0.4, -16, 3.2, 148, -5?", "\n-5\nWhat is the closest to -5.31 in 0.1, -1/4, -3, 1/7, -0.1?", "\n-3\nWhat is the nearest to -32 in 2/143, -8793, -1?", "\n-1\nWhat is the nearest to -257/18 in 1.9, -1/2, 5, 1?", "\n-1/2\nWhich is the closest to -31? ", " (a) 3 (b) -6 (c) 468/41 (d) -1/6\nb\nWhat is the closest to 0.1 in -1, -1/701, 87.6, 3, -42?", "\n-1/701\nWhich is the nearest to -25? ", " (a) 0 (b) 2/21 (c) 3.15 (d) 8/7 (e) -4\ne\nWhat is the nearest to -1/6 in 11, 5.3531, 1?", "\n1\nWhich is the nearest to 0? ", " (a) 0.12 (b) 1 (c) -10140/11 (d) -26\na\nWhich is the closest to 0? ", " (a) -3 (b) -2/33 (c) 33/10 (d) -2 (e) 69\nb\nWhat is the nearest to -632 in 4, 2/7, -25/151?", "\n-25/151\nWhich is the closest to -1/2? ", " (a) 29/1765 (b) -2/203 (c) -4 (d) 2/7\nb\nWhat is the closest to 0 in -2/15, 317.6, 0.28, -7, 5, 4?", "\n-2/15\nWhat is the nearest to -1856 in 6, 160, 0?", "\n0\nWhich is the closest to 1? ", " (a) 254798 (b) -3 (c) -0.5\nc\nWhat is the nearest to 0.3 in 3, 0, -0.1, 1/201, 9, 6.1?", "\n1/201\nWhat is the closest to -0.073 in 0, 5, -14, 0.01, -0.4?", "\n0\nWhat is the closest to 0 in 342, 1/20, 20, 6?", "\n1/20\nWhat is the nearest to 1/8 in 0.16623, -2, -6/13?", "\n0.16623\nWhich is the closest to -5? ", " (a) 270 (b) 5.6 (c) 63\nb\nWhat is the closest to -0.05 in -4/157, -7, -0.3?", "\n-4/157\nWhat is the closest to 46 in -1/16, -2, 0, 3/7, -1/3, -3/7?", "\n3/7\nWhich is the closest to -6/19? ", " (a) -4 (b) 2/21 (c) 0.189\nb\nWhich is the closest to 0? ", " (a) 2/3 (b) 1 (c) 15 (d) 1455 (e) 0.18 (f) -3\ne\nWhat is the nearest to -41 in 0.542, 5, -3/8, -1/4, 0?", "\n-3/8\nWhich is the nearest to 14/5? ", " (a) 2/25 (b) 5 (c) 2.84\nc\nWhat is the nearest to 0 in 8, 3/38677, -6?", "\n3/38677\nWhat is the closest to 4 in 1/4, 2, -38.336, -2/9, 0.1?", "\n2\nWhat is the nearest to 0.044 in -0.2, -63, -127, -6?", "\n-0.2\nWhich is the nearest to -1/4? ", " (a) 0.4 (b) -278/13 (c) 15/11 (d) 11\na\nWhat is the nearest to -1 in 5, -0.63, -17/3615, -0.5?", "\n-0.63\nWhich is the nearest to -4? ", " (a) 7 (b) -7 (c) -2/9 (d) -4 (e) -0.02 (f) 1320\nd\nWhich is the nearest to -1/5? ", " (a) 0.5 (b) -13 (c) 1/6 (d) 1.25 (e) 1/4\nc\nWhich is the closest to -25647/43? ", " (a) 1 (b) -0.1 (c) 5\nb\nWhat is the closest to -1 in 3/68, 4/411, 2.9?", "\n4/411\nWhat is the closest to 0 in 138, -57, 10.745?", "\n10.745\nWhat is the closest to 2.1 in -46, 3, 5, 62, -1/33?", "\n3\nWhich is the nearest to -0.2? ", " (a) 525 (b) 3/4 (c) 1927\nb\nWhat is the nearest to -1/4 in 0.09, -46, -408, 0.015?", "\n0.015\nWhich is the nearest to -1/48? ", " (a) 7/33 (b) -2/1235 (c) 1\nb\nWhich is the nearest to 11? ", " (a) -5 (b) -527 (c) -273.3\na\nWhich is the closest to -2/5? ", " (a) -6651 (b) 5 (c) 4 (d) -3 (e) -10\nd\nWhich is the nearest to 0.3? ", " (a) 4 (b) 7.5 (c) -3 (d) 1 (e) 10\nd\nWhat is the closest to 2/3 in -0.09, 4, -3, -0.02426?", "\n-0.02426\nWhich is the closest to 1/12? ", " (a) -5 (b) -23207 (c) 4\nc\nWhat is the closest to 8 in 75.67, -0.1, 1/3, 4/9, 0.5?", "\n0.5\nWhich is the closest to -0.4289? ", " (a) 4 (b) 0.3 (c) 19 (d) -2\nb\nWhich is the closest to -2/5? ", " (a) -1/26 (b) -2 (c) -0.2 (d) -0.2058 (e) -2/29\nd\nWhich is the closest to 2/3? ", " (a) 6 (b) 4.112 (c) 5 (d) 2\nd\nWhich is the nearest to 1/31? ", " (a) 0.056 (b) 20 (c) -38 (d) 3/2\na\nWhat is the nearest to 0 in 4, 4/9, 16166?", "\n4/9\nWhat is the nearest to 5 in -868807, 0.3, 2/5?", "\n2/5\nWhat is the nearest to 2/5 in 20906.7, -0.4, 1?", "\n1\nWhat is the nearest to 9 in -1, 2, -174, 0, 0.05?", "\n2\nWhich is the closest to 0.1? ", " (a) 0 (b) 3 (c) 3/629 (d) 205 (e) 4\nc\nWhich is the closest to 2? ", " (a) -1 (b) 91 (c) 16 (d) 0.041\nd\nWhat is the nearest to -0.2 in 15, -8.4, 0.1003?", "\n0.1003\nWhat is the nearest to -1/8 in -0.01, -12, 4, 133/25, 0.3?", "\n-0.01\nWhich is the nearest to 0.1? ", " (a) 2/51 (b) -22 (c) -3/179\na\nWhich is the nearest to 0.1? ", " (a) 4 (b) 50 (c) 453\na\nWhich is the closest to 1/4? ", " (a) -0.281 (b) -6/17 (c) -27\na\nWhich is the closest to -0.013? ", " (a) 1/7 (b) 78 (c) -1/2 (d) -3 (e) -0.4 (f) 0.3\na\nWhich is the closest to -0.12? ", " (a) -0.29 (b) 36 (c) -1/3 (d) 3/2\na\nWhat is the closest to 45 in 5, -0.2, -6, 1060, 1?", "\n5\nWhich is the nearest to -4318? ", " (a) -0.1 (b) 2/9 (c) 7 (d) 3/11\na\nWhat is the nearest to 4 in -0.2, 0.674, 1.27, 2, 2/7, 1?", "\n2\nWhich is the nearest to -0.1? ", " (a) 2 (b) -2/9 (c) -2802337\nb\nWhich is the nearest to 1? ", " (a) -2/11 (b) 830 (c) 2.136\nc\nWhat is the closest to -125 in -6, -11, -0.4, -0.3, 0.21?", "\n-11\nWhat is the closest to 0 in -77873, -3, 2, 2/9, -5, -55/8?", "\n2/9\nWhat is the nearest to 3/11 in -20, -5, 2/17, 0.15, -6/5?", "\n0.15\nWhat is the nearest to 6150 in 10.35, -2, 1?", "\n10.35\nWhat is the closest to -3/2 in -1/3, -1, 2/159, 18, 2/35, -2/3?", "\n-1\nWhich is the nearest to -4/21? ", " (a) -0.5 (b) 23 (c) 0.051 (d) -5 (e) 2/9\nc\nWhich is the nearest to 1/2? ", " (a) 5 (b) 0.4 (c) -1312 (d) 0.2694 (e) -4/9\nb\nWhat is the nearest to -0.4 in 2/15, -0.3, 0.09, -1/4, -0.0756?", "\n-0.3\nWhich is the closest to 8? ", " (a) 0.3 (b) -48 (c) 0.07 (d) 1/3 (e) -4\nd\nWhich is the closest to 0.02? ", " (a) -71 (b) -5 (c) 66 (d) -472\nb\nWhat is the closest to 0.04 in 3/8, -6, 4, 1.6, 562?", "\n3/8\nWhich is the closest to -396? ", " (a) 0.7 (b) -3.3 (c) 4/7\nb\nWhich is the nearest to 0.206237? ", " (a) -5 (b) 0 (c) -20\nb\nWhich is the nearest to -20? ", " (a) -19 (b) 3 (c) -0.2 (d) -10 (e) 6.3\na\nWhich is the closest to -24? ", " (a) -7 (b) 3 (c) 3/11 (d) -0.18 (e) 23/6\na\nWhat is the closest to -1/15 in 2/3, -8, -29, 3/11, -1/5?", "\n-1/5\nWhich is the nearest to -243? ", " (a) 145 (b) -2/9 (c) -0.1\nb\nWhich is the closest to 2/43? ", " (a) -0.496 (b) -3/8 (c) -0.1 (d) -3 (e) 1/2\nc\nWhich is the closest to 0? ", " (a) 1/8 (b) -3/8 (c) 1.05 (d) -3/5\na\nWhat is the closest to 4 in -0.5, 1/7, -4/27, -4/9, 180?", "\n1/7\nWhich is the nearest to 1/2? ", " (a) 1070 (b) 2 (c) 0.1 (d) 21\nc\nWhat is the closest to -8 in -15, -1.5, 218/7?", "\n-1.5\nWhich is the nearest to 9/7? ", " (a) -133 (b) -0.34 (c) -2 (d) 7 (e) -1\nb\nWhat is the closest to -374.9 in 1.6, -3, -1?", "\n-3\nWhich is the closest to -3.4787? ", " (a) 0.3 (b) -1 (c) 0.2 (d) -0.4 (e) 4\nb\nWhat is the nearest to -100 in 110/7, 2/3, -0.2, 5, -0.5?", "\n-0.5\nWhat is the closest to -0.093 in -0.3, -5, -297?", "\n-0.3\nWhich is the closest to 2? ", " (a) 0.3 (b) -0.1 (c) 0.84 (d) -1.2 (e) -1/14 (f) 0.03\nc\nWhat is the nearest to 27/904 in 5/12, 17, 0.2?", "\n0.2\nWhich is the nearest to 46373? ", " (a) 0 (b) 4 (c) 19 (d) -0.5 (e) -0.4\nc\nWhat is the closest to 10 in -2, 1168, -13, 1/4?", "\n1/4\nWhat is the closest to 52 in -1/3, 1445, 1.3?", "\n1.3\nWhich is the closest to 2? ", " (a) -0.5 (b) 2 (c) 3 (d) 1.2205 (e) -2 (f) 4\nb\nWhich is the nea" ]
{ "pile_set_name": "DM Mathematics" }
[ 0, 0, 0, 0, 0.009615384615384616, 0, 0, 0, 0, 0, 0, 0, 0.012048192771084338, 0, 0.00980392156862745, 0, 0, 0.03333333333333333, 0.011904761904761904, 0, 0, 0, 0, 0, 0, 0.018867924528301886, 0, 0, 0, 0, 0.0392156862745098, 0.018518518518518517, 0.02857142857142857, 0.031914893617021274, 0.02702702702702703, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015625, 0, 0, 0.010309278350515464, 0, 0, 0, 0.013888888888888888, 0, 0, 0, 0.011904761904761904, 0.02631578947368421, 0, 0, 0, 0.010638297872340425, 0, 0, 0.02631578947368421, 0, 0, 0, 0, 0, 0, 0.019230769230769232, 0, 0, 0.011764705882352941, 0.015151515151515152, 0, 0, 0, 0.015151515151515152, 0.011494252873563218, 0, 0, 0, 0, 0, 0.011111111111111112, 0, 0.016129032258064516, 0, 0.014285714285714285, 0.02857142857142857, 0, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0, 0.009523809523809525, 0, 0, 0, 0.020618556701030927, 0, 0, 0, 0.03296703296703297, 0, 0.00980392156862745, 0, 0, 0, 0, 0.010869565217391304, 0, 0, 0 ]
0.004548
5
[ "Go to the bottom of the post to see the extension after the ************************************************\n\nIt sounds like an interesting experiment to do for SD starter. ", "I can use up to 20g of stater making 200 g of 80% hydration levain over 12 hours in the winter time and kitchen temperatures around 60-65 F. That 200 g levain would normally go into 800 g of flour and 600 g of water and then developed over a couple of hours. ", "In the winter time it could possibly ferment and proof 6-8 hours on the counter before needing to go in the oven. ", "With yeast water we have gone 12 hours.", "\n\nI suppose that if one would use 1 g of SD starter and mix it with the entire 900 g of flour and 675 g of water and 2% salt (no levain build) it would take a while for it to be ready to bake, How long we will have to find out - unless someone has already done this test. ", "I'm not sure, perhaps someone here knows this too, but yeast only lives about 6 days or so before croaking.", "\n\nNo collapse after 24 hours,\n\nSo my apprentice took 1 g of starter and tried it out on 100 g of flour and 75 g of water, 2 g of salt to see what happens. ", "She started at 9 AM, Oct 26, 68.2 F kitchen temp and level marked with a rubber band. ", "Lets see how long it takes to double and make a couple knotted rolls out of it :-) Here is a pix exactly 24 hours later the levain had nearly tripled but had not collapsed. ", "Amazing for 1 g of starter and 100 g of flour.", "\n\n9 AM - Oct 26 9 AM - Oct 27.", "\n\nHere is a picture of the top of the levain too. ", "I've decided to eventually make some bagels out of some of this and a lower hydration will slow this train down some too. ", "Also want to get some whole grains in the mix too. ", "So we will divide the dough in half and add another 86 g of flour, 44 g of water to get the hydration down to 60% from 75% and a little less than 2 g of salt to each half. ", "One half got 86 g of whole grain flours (50%rye, 32% WW and 18% spelt). ", "The other half got 86 g of AP and 44 g of water and less than 2 g of salt - to keep the control of white flour intact.", "\n\n10 AM - Oct 27 after the 24 hour mark split into two levains one has some Whole Grains now and one is still AP only.", "\n\nThis should perhaps get us from 24 to 48 hours on the counter. ", "The temperature fell to 70 F this morning from a high yesterday of 81 F in the afternoon fall kitchen.", "\n\nThe whole grain levain on the left doubled again at the 32 hour mark and was put in the fridge for a 24 hour retard and the white flour levain doubled at the 36 hour mark and also went into the fridge for a 24 hour retard. ", "Looks like 36 hours is as far as we would want to go before refrigerating or using. ", "Retarding the starter should make the sour really come out.", "\n\nNow that we know it takes 24 hours for our 1g of our Desem /Rye SD starter tpo double 100g of flour at 75% hydration, we are going to extend the experiment to see if we can do a 36 hour bread on the counter top.", "\n\nWe mixed 7 g of 67% hydro starter with 50 g of water to thin it out and liquefy it. ", "We then added 22 g each of home ground whole: spelt, rye and wheat along with 2 g each of white and red malts made from the same flours and mixed it up well. ", "We then added another 455 g of water and mixed again before adding 315 g each of bread and AP flour and mixing again. ", "This gave us a 72% hydration dough that has 10% whole grains and 1% SD starter.", "\n\nWe let the dough autolyse for 30 minutes before adding 11 g of salt and starting 15 minutes of French Slap and folds. ", "We expect to let the dough ferment for 24 hours before letting it rise again for 12 hours before baking. ", "The gluten was well developed after the slap and folds and the dough ball looked like this:\n\nMichael Wilson has had a positive effect on my dough balls! ", "Can't wait to try out his panettone !", "\n\nIt only took 20 hours to double in volume starting with 1% starter to flour ratio. ", "Time to split it up and and proof a loaf of fig, pistachio, sunflower and pumpkin seed bread and one plain old SFSF - and see how long they take to double. ", "The round is SFSD.", "\n\nThe reality was that the dough had doubled again in 4 hours and was ready for Big Old Betsy to bake up so we did. ", "At our hot kitchen temp of nearly 79 F Doc.", "Dough spreadsheet said we would ne ready to bake in less time but we might have over proofed it a little too.", "\n\nHere they are proofed. ", "24 hours on the counter from mixing the dough to baking it off worked for this starter, flour and hydration combination.", "\n\nI will do another post to cover the bread itself which baked up very well.", "\n\nComments\n\nFew days ago I prepared a loaf with 60% durum wheat and 40% soft wheat flour, both quite poor in gluten. ", "I made the dough proof 24 hours because out of town and because I wanted to see how long it would last. ", "In the oven it even sprang a bit, but not much.", "\n\nIn my opinion the only factor that determines how long your dough can proof is its gluten structure, that in turn depends on how much you knead it and how extensible and elastic your gluten is. ", "It took me a while to understand the importance and the effects of the extensive kneading that txfarmer and mwilson have shown us countles times, but that I've taken the concept... I'm getting great loaves even with weaker flours:-)\n\nhas me doing long French slap and folds ever since I tried to do his 100% white spelt 100% hydration but using 100% whole spelt instead (sifting it to 78% extraction and then adding the bran back into the mix with a last S & F). ", "Also tried it out on 100% Kamut too. ", "He has me believing in good gluten development. ", "I'm in training to do one of his panettone's for the Holidays :-)\n\nI don't know how much gluten structure I got with these levian's by just mixing them with a spoon for a short time and letting them go on the counter for 24 hours but they could have gone longer before I split it, feed it and let it go 12 hours longer after some kneading.", "\n\nI used to think that bread would turn to goo if you let it proof for 24 hours on the counter but I'm beginning to think that if a very small amount of starter was used, say 8 g for a 800 g loaf at 72% hydration and the gluten was developed enough, a loaf should be able to go 24 hours on the counter if the temperature was around 72 F and still bake off nicely as you have already found out with your durum bread.", "\n\nIt is different for LAB (35 hrs) than for the yeast (37 hrs). ", "And at the very high dilution ratio you should add one additional doubling time (~4 hrs @ 20°C) to Ganzle's model results to account for a longer lag phase, but your 24 hr photo looks like it has another few hours to go so 36 hrs is probably pretty close. ", "With such long times, the temperature sensitivity is quite high as well so predicting exact times is not as easy as you might like. ", "Just use it when it is ripe.", "\n\nof your hand Doc! ", "I agree. ", "I'm pretty sure than the first 24 hour phase could have been extended to 36 hours like you suggest. ", "Without a proofer it is hard to control the kitchen temperature in the fall with the A/C off and 68 compared to 80 F is a huge swing and the little beasts react fast to even more modest temperature swings.", "\n\nI'm going to try a 36 hour test using 8 g of starter and 800 g of flour and see what happens over the next couple of days. ", "It would be so much easier to leave shaped bread on the counter rather than retarding it ans still get that SD tang.", "\n\nThirty six hours is an inconvenient time to either start or complete any operation. ", "Maybe 0700 one day to 1900 the next day is as good as you can make it (or 1900 to 0700, depending on how much work comes after the end point). ", "Better to adjust the ratio if you can't control the temperature.", "\n\nI built an Excel model from Ganzel's dissertation results and it has provided exceptionally good guidance for times and temperatures. ", "I suppose you could integrate it over the fermentation time using measured temperatures, but I am not sure it is worth the effort.", "\n\nfind your Excel spreadsheet? ", "I saw the 36 hours was going to work after finishing the Slap and Folds at 11 AM. ", "That would have me finishing up the bake at midnight. ", "So I decided to do an 8-12 hour 37 F retard in the fridge, right after we put it in the basket for final proof. ", "That way we can finish it up at a decent time in the morning - but it becomes a 44 hour bread then :-)\n\nSet the temperature (°C) in cell B62; read the elapsed time (hrs) in column A; read how much LAB (column C) and yeast (column E) you have relative to how much you started with. ", "This does not add the one doubling time allowance for the lag phase delay. ", "To find the doubling time, look down the appropriate column (C or E) and find a number close to 2, then look in column A to get the doubling time.", "\n\nThere is more functionality but I don't have time to write the instruction manual. ", "You will have to tease out the details. ", "Nothing is locked so you can change it as much as you want (in your version).", "\n\nAll original site content copyright 2018 The Fresh Loaf unless stated otherwise. ", "Content posted by community members is their own. ", "The Fresh Loaf is not responsible for community member content. ", "If you see anything inappropriate on the site or have any questions, contact me at floydm at thefreshloaf dot com. ", "This site is powered by Drupal and Mollom." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00847457627118644, 0.01694915254237288, 0, 0, 0, 0, 0, 0.004694835680751174, 0, 0, 0.00847457627118644, 0, 0.008333333333333333, 0, 0.006535947712418301, 0, 0, 0, 0.05555555555555555, 0, 0.023255813953488372, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008620689655172414, 0, 0, 0, 0.007352941176470588, 0, 0, 0, 0.018518518518518517, 0, 0.0035587188612099642, 0, 0, 0, 0, 0, 0, 0, 0, 0.008695652173913044, 0 ]
0.002238
5
[ "The Penguin Dance\n\nSaturday, 27 May 2017\n\nArt is no food,\nBut the fire underneath.", "\nArt rests on retina\nas an inverted image\nof misery.", "\nArt is glucose to the brain\nand credit to the soul.", "\nArt is the fear\nof creating a little too much.", "\nIt is a refreshment, served\nat the dinner of machines.", "\nArt never means you had time,\nbut that you reflected on time.", "\nArt is long,\nA by-product of half fed stomach,\nor in the quest to beat death.", "\nArt is free,\nAmid the hurricanes of exhaustion.", "\nArt is the beloved, air lives for...\nIt is a secret ingredient to God.", "\n\nTuesday, 28 February 2017\n\nPower to the language,\nthe language of age.", "\nThe highs and the lows\nThe show on the stage.", "\nSoft, subtle but deep\nMessage that it holds\nWounds it does bestow\nEars that it hits\nto make bleed, aflow.", "\nA language learnt with age\nabout age.", "\nWhat an inescapable cage\nthis course of time\nLiving under the hope\nOf memory so human\nof miracles so awaited\nof deeds so unrewarding\nof death so imminent.", "\nA thick book of regrets\nEver written by a hero.", "\n\nFrom toothful lies\nTo the toothless truths\nAll, ever has been spoken\nThe language of age.", "\n\nWith you goes away my will to write;\nNo poem, no wish to suffer in dim light\nOld days seem so old as if a previous life\nNew days, so new-a rewardful afterlife\nNo more do I walk with a wish to be loved\nNo more do I talk with a fear of being cuffed\nThrough you have I been blessed with a cause\nThat race i was in, beautifully has a pause.", "\n\nSaturday, 16 July 2016\n\nDear step on the ladder to heavens!", "\nYou ought not be stepped upon\nAnd touched by the sole of the feet\nSit up on the curve of the lashes\nAnd be the crownly pride of my head\nDear step on the ladder to heavens!", "\nStep on my back and grow as wings\nBe trampoline to my baby dreams\nAnd help them jump to the realities divine." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0, 0.01282051282051282, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.000641
5
[ "\n689 N.W.2d 579 (2004)\n268 Neb. 934\nSTATE of Nebraska, appellee,\nv.\nVictor HERNANDEZ, appellant.", "\nNo. ", "S-03-1365.", "\nSupreme Court of Nebraska.", "\nDecember 10, 2004.", "\n*582 Christopher J. Lathrop, Omaha, for appellant.", "\nJon Bruning, Attorney General, and James D. Smith, Lincoln, for appellee.", "\nHENDRY, C.J., WRIGHT, CONNOLLY, GERRARD, STEPHAN, McCORMACK, and MILLER-LERMAN, JJ.", "\nCONNOLLY, J.\nVictor Hernandez appeals his jury convictions for first degree murder and use of a deadly weapon to commit a felony. ", "He contends that (1) an affidavit for a search warrant was not supported by probable cause; (2) his counsel was ineffective for failing to request a hearing under Franks v. Delaware, 438 U.S. 154, 98 S.Ct. ", "2674, 57 L.Ed.2d 667 (1978); (3) he should have been rearraigned after the information was amended to include language charging aiding and abetting; (4) DNA evidence was improperly admitted; and (5) a Spanish language Miranda advisory form failed to properly inform him of his rights. ", "We affirm.", "\nOn May 26, 2002, the victim, Mindy Schrieber, was murdered during a robbery at her place of employment. ", "The cause of death was multiple stab wounds, and she had additionally been driven over by a vehicle. ", "In connection with the death, Hernandez and Luis Fernando-Granados, also known as Luis Vargas, were later charged and convicted for first degree murder and use of a deadly weapon to commit a felony.", "\n\n\n*583 BACKGROUND\n\nAFFIDAVIT AND SEARCH WARRANT\nAfter the murder, the Omaha police received an anonymous telephone call from a person subsequently identified as Meagan Kane. ", "Kane provided information about the crime. ", "She stated that the vehicle involved in the homicide was parked behind an apartment building near 31st and California Streets in Omaha, and she described it as a blue 1991 or 1992 Ford Escort on blocks. ", "She stated that the vehicle's owner, \"Victor,\" a Hispanic male about 21 years old, bragged about killing Schrieber. ", "She also gave Hernandez' telephone number. ", "It was later determined that Kane was Fernando-Granados' girl friend, although the officers did not know that at the time the call was taken.", "\nSgt. ", "Mark Gentile of the Douglas County Sheriff's office determined that the telephone number was listed to Hernandez and obtained the address for the number. ", "He went with another officer to the 31st and California Streets area and then to Hernandez' address, where they located a Ford Escort in a parking lot; the vehicle was registered to Hernandez. ", "The officers compared photographs of tire tread taken from Schrieber's pants to the left front tire of the Escort. ", "In an application for a search warrant, the officers averred that the Escort was blue and that the tire tread matched. ", "The officers examined the vehicle's undercarriage and averred in the warrant application that it matched an imprint on Schrieber's pants. ", "The officers also observed small, thick, tissue-type substances splattered on the undercarriage in the same general area as a red and brown substance. ", "The officers believed the substances to be bodily fluids such as blood and body tissue.", "\nThe officers described Kane's telephone call and their observations in an application for a search warrant. ", "After the warrant was obtained, they seized various property, including a certificate of title showing that Hernandez owned the vehicle.", "\n\nHERNANDEZ' CONFESSION\nOn June 6, 2002, Hernandez gave a statement in Spanish to officers in Douglas County. ", "Deputy Robert Jones — who is fluent in Spanish — used a Spanish language form to advise Hernandez of his Miranda rights. ", "Hernandez stated that he understood his rights and did not request an attorney; he then confessed his involvement in the crime.", "\nAfter Hernandez spoke with the officers, they obtained a search warrant for a residence where Hernandez had told them Fernando-Granados hid money. ", "The officers found currency with blood on it that was sent to a forensic laboratory for testing.", "\n\nPRETRIAL PROCEEDINGS\nBefore trial, Hernandez moved to suppress evidence obtained from the search warrant. ", "In the application for the warrant, Gentile averred that the tread and oil pan patterns \"matched\" photographs taken at the crime scene. ", "However, at the hearing on the motion, Gentile stated that the patterns were \"similar\" to the photographs. ", "Hernandez' motion was overruled, and the certificate of title and photographs showing the vehicle's license plates were admitted into evidence at trial.", "\nHernandez also moved to suppress his statements, arguing that that the Spanish Miranda warning was improperly worded so that it insufficiently explained that the accused had a right to an attorney. ", "The motion was overruled.", "\nFinally, a Daubert hearing was held about admissibility of the results of DNA testing on the currency using a polymerase chain reaction amplification (PCR) and *584 short tandem repeat (STR) analysis. ", "See Daubert v. Merrell Dow Pharmaceuticals, Inc., 509 U.S. 579, 113 S.Ct. ", "2786, 125 L.Ed.2d 469 (1993). ", "The person who performed the test testified about the methods, his qualifications, and the laboratory's accreditation. ", "The court determined that the test results were admissible.", "\nIn July 2002, Hernandez was initially charged with first degree murder and use of a deadly weapon to commit a felony. ", "Hernandez was arraigned and pleaded not guilty. ", "In September 2003, an amended information was filed charging aiding and abetting first degree murder. ", "The record is silent whether Hernandez was rearraigned on the amended information. ", "A jury found Hernandez guilty, and he received consecutive sentences of life in prison for the murder conviction and 10 to 20 years' imprisonment for the use of a deadly weapon to commit a felony conviction.", "\n\nASSIGNMENTS OF ERROR\nHernandez assigns that the district court erred by (1) overruling his motion to suppress evidence seized as a result of the search warrant, (2) failing to rearraign him on the amended information, (3) overruling his motion to suppress his statements, and (4) admitting the DNA test results. ", "He also assigns that his counsel was ineffective for failing to seek a hearing about officer misrepresentations in the affidavit for the application for a search warrant.", "\n\nSTANDARD OF REVIEW\nWhen dispositive issues on appeal present questions of law, an appellate court has an obligation to reach an independent conclusion irrespective of the decision made by the court below. ", "State v. Thomas, 268 Neb. 570, 685 N.W.2d 69 (2004).", "\n\nANALYSIS\n\nMOTION TO SUPPRESS EVIDENCE SEIZED FROM SEARCH WARRANT\nHernandez contends that the court should have sustained his motion to suppress because the affidavit failed to show probable cause for a search warrant. ", "In arguing there was no probable cause, Hernandez points to the anonymous call, differences between where the vehicle was reported to be and actually found, and differences between information provided in the affidavit and in later testimony. ", "In particular, he contends that the officers' comparison of photographs of tread marks and oil pan marks to the vehicle and statement that there was a \"match\" was not sufficient for probable cause. ", "Instead, he contends that information from a crime laboratory was required to establish probable cause.", "\nA search warrant, to be valid, must be supported by an affidavit which establishes probable cause. ", "Probable cause sufficient to justify issuance of a search warrant means a fair probability that contraband or evidence of a crime will be found. ", "State v. Lammers, 267 Neb. 679, 676 N.W.2d 716 (2004). ", "The magistrate who is evaluating the probable cause question must make a practical, commonsense decision whether, given the totality of the circumstances set forth in the affidavit before him or her, including the veracity of and basis of knowledge of the persons supplying hearsay information, there is a fair probability that contraband or evidence of a crime will be found in a particular place. ", "The question is whether the issuing magistrate had a \"substantial basis\" for finding that the affidavit established probable cause. ", "State v. Thomas, 267 Neb. 339, 673 N.W.2d 897 (2004).", "\nIn evaluating the sufficiency of an affidavit used to obtain a search warrant, *585 an appellate court is restricted to consideration of the information and circumstances contained within the four corners of the affidavit, and evidence which emerges after the warrant is issued has no bearing on whether the warrant was validly issued. ", "State v. Lammers, supra.", "\nAn informant's reliability may be established by showing in the affidavit to obtain a search warrant that (1) the informant has given reliable information to police officers in the past, (2) the informant is a citizen informant, (3) the informant has made a statement that is against his or her penal interest, or (4) a police officer's independent investigation establishes the informant's reliability or the reliability of the information the informant has given. ", "State v. Lammers, supra.", "\nHere, the officers independently established the informant's reliability. ", "They established that the telephone number was registered to a person named \"Victor\" and discovered a vehicle of the same reported model at the parking lot behind his residence. ", "At this point, the officers could plainly observe further items that led to probable cause. ", "Comparing photographs of tread and oil pan marks to the vehicle, the officers determined that there was a \"match.\" ", "They also observed what they believed was body fluid on the vehicle's undercarriage.", "\nWe also disagree with Hernandez' argument that a crime laboratory specialist should have provided information about the tread and oil pan marks before probable cause could be established. ", "The statements provided in the affidavit were sufficient for a magistrate to believe there was a fair probability that contraband or evidence of a crime would be found in Hernandez' residence. ", "We determine that the district court did not err when it overruled Hernandez' motion to suppress.", "\n\nINEFFECTIVE ASSISTANCE OF COUNSEL\nHernandez contends that his counsel was ineffective because he failed to challenge the affidavit for the search warrant by filing a motion based on Franks v. Delaware, 438 U.S. 154, 98 S.Ct. ", "2674, 57 L.Ed.2d 667 (1978). ", "In Franks, the Court held:\n[W]here the defendant makes a substantial preliminary showing that a false statement knowingly and intentionally, or with reckless disregard for the truth, was included by the affiant in the warrant affidavit, and if the allegedly false statement is necessary to the finding of probable cause, the Fourth Amendment requires that a hearing be held at the defendant's request. ", "In the event that at that hearing the allegation of perjury or reckless disregard is established by the defendant by a preponderance of the evidence, and, with the affidavit's false material set to one side, the affidavit's remaining content is insufficient to establish probable cause, the search warrant must be voided and the fruits of the search excluded to the same extent as if probable cause was lacking on the face of the affidavit.", "\n438 U.S. at 155-56, 98 S.Ct. ", "2674.", "\nHernandez argues he was entitled to a Franks hearing because evidence later showed that the vehicle was black instead of blue and points to testimony where the officers said at the suppression hearing that the tread and oil pan marks looked \"similar\" instead of stating that they \"matched.\"", "\nUnder the test enunciated in Strickland v. Washington, 466 U.S. 668, 104 S.Ct. ", "2052, 80 L.Ed.2d 674 (1984), to sustain a claim of ineffective assistance of counsel as a violation of the Sixth Amendment to the U.S. Constitution and Neb. Const. ", "art. ", "I, § 11, a defendant must show that (1) counsel's performance was *586 deficient and (2) such deficient performance prejudiced the defendant, that is, the defendant must demonstrate a reasonable probability that but for counsel's deficient performance, the result of the proceeding would have been different. ", "State v. McDermott, 267 Neb. 761, 677 N.W.2d 156 (2004).", "\nAlthough the record shows that Hernandez' counsel did not request a Franks hearing, we determine that such a failure did not demonstrate deficient performance by counsel. ", "We have noted that under Franks, the defendant must make a substantial preliminary showing, including allegations of deliberate falsehood or of reckless disregard for the truth, supported by an offer of proof. ", "State v. Ildefonso, 262 Neb. 672, 634 N.W.2d 252 (2001). ", "Further, no hearing is required if, when the material which is the subject of the alleged falsity or reckless disregard is set aside, there remains sufficient content in the warrant affidavit to support a finding of probable cause. ", "Id.\nHere, the facts do not suggest that any statement in the affidavit was a deliberate falsehood or showed reckless disregard for the truth. ", "A review of the record shows that when the officers stated in the affidavit that the tread and oil pan marks \"matched,\" it was because the marks were \"similar\" to the patterns available in the pictures that the officers used for comparison. ", "Hernandez' complaint about the use of the word \"match\" as compared to the word \"similar\" raises nothing more than a debate about differing interpretations of the words used and does not raise questions of deliberate or reckless falsehoods. ", "Although the record states that the vehicle was black instead of blue, Hernandez does not point to any intent of the officers to deceive. ", "Further, we determine that without information about the vehicle's color, the warrant would still be sufficient to support a finding of probable cause. ", "We conclude that Hernandez has not demonstrated that his trial counsel was ineffective for failing to request a Franks hearing. ", "See State v. Ildefonso, supra.", "\n\nAMENDED INFORMATION\nHernandez argues that he should have been rearraigned when the information was amended to add language about aiding and abetting. ", "Neb.Rev.Stat. § ", "29-1816 (Reissue 1995) provides in part:\nThe accused shall be arraigned by reading to him or her the indictment or information, unless the reading is waived by the accused when the nature of the charge is made known to him or her. ", "The accused shall then be asked whether he or she is guilty or not guilty of the offense charged. ", "If the accused appears in person and by counsel and goes to trial before a jury regularly impaneled and sworn, he or she shall be deemed to have waived arraignment and a plea of not guilty shall be deemed to have been made.", "\nHere, Hernandez appeared, was represented by counsel, and went to trial. ", "Accordingly, he has waived any argument that he should have been rearraigned.", "\nAt oral argument, Hernandez argued that he should have also been provided proper notice of the amended information to prepare for trial and that the trial court had a duty to make a record to show that his counsel never raised the issue. ", "Hernandez' assignment of error, however, addresses only the possibility that the court failed to rearraign him. ", "An appellate court does not consider errors which are argued but not assigned. ", "State v. Tyma, 264 Neb. 712, 651 N.W.2d 582 (2002). ", "We conclude that Hernandez' assignment of error is without merit.", "\n\n\n*587 MIRANDA ADVISORY FORM AND ADMISSIBILITY OF DNA TESTS\nWe recently decided the issues raised about the Miranda advisory form and admissibility of DNA tests in State v. Fernando-Granados, 268 Neb. 290, 682 N.W.2d 266 (2004). ", "Based on Fernando-Granados, we conclude that these assignments of error are without merit.", "\n\nCONCLUSION\nWe conclude that there was sufficient evidence to support a finding of probable cause to issue the search warrant and that Hernandez' counsel was not ineffective by failing to request a Franks hearing. ", "We further conclude that the district court did not err when it did not rearraign Hernandez or make a record showing that he had been rearraigned. ", "Finally, the court did not err when it overruled Hernandez' motion to suppress statements and when it admitted into the evidence the results of DNA tests.", "\nAFFIRMED.", "\n" ]
{ "pile_set_name": "FreeLaw" }
[ 0.020833333333333332, 0, 0, 0, 0, 0.0196078431372549, 0.04054054054054054, 0.047619047619047616, 0.007633587786259542, 0.0048543689320388345, 0, 0, 0.009523809523809525, 0, 0.015151515151515152, 0.005714285714285714, 0.023255813953488372, 0.009852216748768473, 0, 0.023255813953488372, 0.014184397163120567, 0, 0.01948051948051948, 0.015544041450777202, 0.008695652173913044, 0, 0, 0, 0, 0.009174311926605505, 0.007352941176470588, 0.00909090909090909, 0.008264462809917356, 0, 0.02027027027027027, 0, 0.009259259259259259, 0, 0.009345794392523364, 0.006578947368421052, 0, 0, 0.009900990099009901, 0.013513513513513514, 0, 0, 0, 0.008403361344537815, 0, 0, 0.012048192771084338, 0, 0, 0, 0, 0.019230769230769232, 0, 0.00411522633744856, 0, 0, 0, 0, 0, 0, 0, 0.018867924528301886, 0, 0, 0, 0, 0, 0, 0, 0.008695652173913044, 0, 0.005291005291005291, 0.0051813471502590676, 0.010309278350515464, 0.004405286343612335, 0, 0.004975124378109453, 0, 0, 0, 0, 0.0125, 0.006097560975609756, 0, 0, 0, 0.005813953488372093, 0.004761904761904762, 0, 0, 0, 0, 0, 0.007246376811594203, 0, 0.0078125, 0.03333333333333333, 0, 0, 0, 0, 0, 0.013513513513513514, 0, 0.0041841004184100415, 0, 0, 0.019230769230769232, 0.015384615384615385, 0.008695652173913044, 0.011111111111111112, 0.004651162790697674, 0.006802721088435374, 0.006493506493506494, 0, 0 ]
0.00548
5
[ "Île Louviers\n\nThe Île Louviers, also known as the Île aux Javiaux, was an island in the Seine in Paris, France, that was attached to the bank in the nineteenth century. ", "In the Early Middle Ages it was used for executions.", "\n\nGeography\nThe island was situated in the river slightly upstream of the Île Saint-Louis. ", "In 1408 the island belonged to the Nicolas de Louviers, whose name remained attached to it to the end. ", "It was a low-lying ait in the river, used for pasturage as it was prone to flooding. ", "The city of Paris purchased it in 1700 and let it out to timber merchants, whose supplies were floated downstream. ", "As late as 1742 it was still scarcely inhabited (see the map of 1742 as illustration).", "\n\nA three-arched bridge, the Pont de Grammont, connecting it to Quai St-Bernard across the backwater called the bras de Grammont, was under construction in 1836, according to Galignani's New Paris Guide, but in 1847 the narrow space separating it from the Right Bank was filled in and joined to Quai Morland. ", "During the Revolution of 1848 the new ground was temporarily used for an encampment of the army.", "\n\nReferences\nThéophile Lavallée, Histoire de Paris depuis le temps des Gaulois jusqu'à nos jours, 2e ed. ", "1857, vol. ", "II, chap. ", "2, p. 8\n\nCategory:Landforms of Paris\nLouviers\nLouviers\nCategory:Islands of Île-de-France\nCategory:Île-de-France region articles needing translation from French Wikipedia" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0, 0, 0, 0, 0, 0, 0, 0.019417475728155338, 0, 0.02857142857142857, 0, 0.1, 0.005917159763313609 ]
0.011839
5
[ "The Ohio-based anchor of the affordable pistol market is promising to break from their traditional mold and move into a more modern handgun offering.", "\n\nHi-Point, which is in the midst of a rebranding of sorts now some three years after their founders death, has few details of their new pistol set for release later this month, but has confirmed that it will include a threaded barrel and will have a standard capacity of larger than 10-rounds, both of which are a departure from their normal fare.", "\n\n“This is not an old model with a few tweaks like the latest version of someone’s 1911,” said Shults Media, Hi-Point’s PR company. “", "This is an entirely new pistol of a more contemporary design and yet will retain Hi-Point’s affordable pricing, reliability, robust construction, accuracy and owner following lifetime warranty.”", "\n\nFounded by Tom Deeb in Mansfield, Ohio in 1993 during the federal assault weapons ban, the company’s first handgun model was the sub-$200 C-9, a simple yet reliable blowback action handgun with a single-stack 8-round capacity. ", "The model is still in production today in a number of finishes and, while Hi-Point offers magazines with a higher capacity than the basic 8-round as the AWB has long since expired, they are still single stacks. ", "Likewise, the company has long shied away from production threaded barrel offerings even though the use of suppressors has expanded phenomenally in the past decade.", "\n\nAccording to the most recent data available from federal regulators, Hi-Point, manufacturing as Strassels Machine in Mansfield, produced no less than 69,900 9mm pistols in 2016, a figure only bested in the same category by Glock, Ruger, Sig, S&W and SCCY." ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0, 0.007518796992481203, 0, 0.004366812227074236, 0, 0, 0.01556420233463035 ]
0.003431
5
[ "Thu June 7, 2012\n\nHow The Housing Industry Affects Students' Future\n\nWe're going to hear now about some surprising consequences of the weak housing market in this country. ", "It turns out that the value - even on a paper - of a home can affect the college choices that a family makes.", "\n\nNPR science correspondent Shankar Vedantam regularly joins us to discuss social science research. ", "He's here this morning to talk about those new findings. ", "And good morning.", "\n\nSHANKAR VEDANTAM, BYLINE: Hi, Renee.", "\n\nMONTAGNE: This new research, describe it for us.", "\n\nVEDANTAM: Well, we've known for a long time, Renee, that a bad economy affects all kinds of things. ", "So when young people graduate from college and they enter a weak economy, it affects their wages over the course of their entire lifetimes.", "\n\nNow, this one economist I spoke with - his name is Michael Lovenheim; he's at Cornell University. ", "He decided to look at one, specific part of the economy: the housing market. ", "And he finds that the effects of the housing market influence where students are going to college. ", "Here he is.", "\n\nMICHAEL LOVENHEIM: What we see is that students who obtain more housing wealth when they were in high school were more likely to go to flagship schools; were less likely to go to community colleges; were more likely to graduate. ", "These educational outcomes, and the earnings that you get from going to higher-quality schools, have effects on people's lives.", "\n\nMONTAGNE: Now, how much are students affected by housing prices? ", "I mean, is it just a little bit, or is it significant?", "\n\nVEDANTAM: Well, Lovenheim told me it's actually quite a bit, and this is especially true for families that are making less than $75,000 a year. ", "And so when you look at the typical increase, and the decrease, in housing values for those kinds of families across the United States, it seems to affect the college choice by as much as 25 to 30 percent. ", "So in other words, in a bad housing market, students might be 30 percent less likely to go to the flagship schools, rather than a community college.", "\n\nMONTAGNE: Why would that be? ", "Because if a family is living in a home and not needing to sell it, why would the lower value of a house have such a large effect on where their children might go to college?", "\n\nVEDANTAM: So, I think there are multiple possible explanations for that, Renee. ", "The first is the rational, straightforward explanation - which is that families are borrowing against the value of their homes in order to send their kids to college. ", "And so in a weak housing market, they have less equity in the house, and they may even have less liquidity that can come out of the house. ", "And so it limits their choices in where kids can go to college.", "\n\nBut there's another factor, and the other factor is probably psychological. ", "What Lovenheim thinks is happening, is that many students are internalizing how poor their parents feel in a bad housing market, and this is limiting their choices about where to go, because it's not the case that students are applying to the flagship schools, getting in, and then finding out that they can't get financial aid, or they can't afford it. ", "They're simply not applying to those schools at all.", "\n\nMONTAGNE: Does this not apply so much to the 1 percent - or at least, the higher-income families?", "\n\nVEDANTAM: Well, I certainly think that people who are wealthy are probably insulated from this quite a bit. ", "It also turns out that there is a legislative reason that we find ourselves in the boat that we do. ", "Back in 1992, Congress passed a law which said the value of your home can't be taken into account when you're applying for financial aid in college. ", "And this was wonderful during the boom years, because the value of your home could go up, and you could still qualify for financial aid in college. ", "But now, during a recession when housing values have dropped, it turns out you can't go to a school and say look, the value of my home has dropped by 25 percent. ", "Could you please give me some financial aid?", "\n\nMONTAGNE: But what about the idea that, you know, if you can overcome the psychological barrier, the feeling of being poor, that applying to a college is the same as it had been before the housing crash?", "\n\nVEDANTAM: I think this is actually what Lovenheim is saying, Renee. ", "He is saying that students should still apply to the flagship schools and see if they can qualify for financial aid, see if they can take out a loan. ", "I mean, he's an economist. ", "Part of the point that he's making is that the benefits of college, and the benefits of a good college, play out in your life over a matter of decades. ", "And being 10,000 or $20,000 extra in debt in a student loan, you know, is more than compensated for in the long-term returns of college.", "\n\nMONTAGNE: That's Shankar Vedantam, who joins us to talk about interesting social science research, on a regular basis. ", "You can find him on Twitter: @HiddenBrain. ", "And while you're at, you can follow this program: @MORNINGEDITION. ", "Transcript provided by NPR, Copyright NPR." ]
{ "pile_set_name": "Pile-CC" }
[ 0.005813953488372093, 0, 0.02, 0, 0, 0.02631578947368421, 0, 0.00980392156862745, 0, 0.02, 0, 0, 0, 0.004329004329004329, 0, 0, 0, 0.00684931506849315, 0, 0, 0, 0, 0.012195121951219513, 0, 0, 0, 0, 0.002824858757062147, 0.019230769230769232, 0, 0, 0, 0.006711409395973154, 0, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0, 0.008264462809917356, 0.023255813953488372, 0.014925373134328358, 0.047619047619047616 ]
0.005581
5
[ "The same scene in the final cut of the movie showed the couple embracing and looking positively gleeful as they prepared to spend some quality time together.", "\n\nSo did something change drastically during reshoots?", "\n\nMargot Robbie might not have always been so well-treated by her on-screen boyfriend in Suicide Squad (Picture: Barcroft Media)\n\nIt’s known that there are two versions of the film, and the one released in cinemas is notably lighter in tone, following extensive reshoots to add jokes.", "\n\nPerhaps more gentlemanly behaviour from Mr J was also added to the mix.", "\n\nEarly promotion of the film saw Margot Robbie describe Harley and the Joker as having ‘an incredibly dysfunctional relationship’, which seems like an exaggeration considering how their (small) part of the film turned out.", "\n\nHarley and the Joker in his car (Picture: Warner Bros)\n\nRegardless of how their relationship was set up in the comics, this image – published in Rolling Stone Brazil – seems to suggest director David Ayer originally intended there to be a lot less harmony in the Joker and Harley’s love affair than fans ended up seeing." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0.007042253521126761, 0, 0.013452914798206279, 0.018633540372670808 ]
0.006521
5
[ "Fluoxetine Modulates Spontaneous and Conditioned Behaviors to Carbon Dioxide (CO2) Inhalation and Alters Forebrain-Midbrain Neuronal Activation.", "\nPanic disorder (PD), a prevalent anxiety disorder, is characterized by unexpected panic attacks, persistent anxiety and avoidance of panic contexts. ", "Selective serotonin reuptake inhibitors (SSRIs) are effective in treating PD; however, the mechanisms underlying SSRI efficacy are poorly understood. ", "Using CO2-inhalation, a PD-relevant translational paradigm, we examined the effect of chronic SSRI (fluoxetine) treatment on unconditioned and context-conditioned defensive behaviors, as well as respiratory responses, in mice. ", "In addition, cFos expression was evaluated as a measure of the functional activity and interregional correlation matrices were used to explore the neurocircuitry recruited in CO2-conditioned behavior and SSRI treatment response. ", "Chronic fluoxetine attenuated CO2-induced passive (freezing) behavior during inhalation and active (rearing) behavior on re-exposure to context, in addition to reducing CO2-evoked respiratory responses. ", "Brain mapping in CO2-context-conditioned mice revealed altered regional neuronal activation within and correlations across midbrain regions subserving defensive behaviors (periaqueductal gray (PAG) and raphe nuclei) and forebrain emotional and contextual processing loci (medial prefrontal cortex, insular cortex and hippocampus). ", "Importantly, fluoxetine treatment normalized these alterations. ", "Collectively, our results provide novel information on fluoxetine modulation of panic-relevant defensive behaviors and neurocircuitry, facilitating increased understanding of panic neurobiology in the context of treatment response." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.006944444444444444, 0, 0, 0, 0.004366812227074236, 0, 0.0030211480362537764, 0, 0 ]
0.001592
5
[ "Q:\n\nTensorflow transform on beams with flink runner\n\nIt may seem stupid but it is my very first post here. ", "Sorry for doing anything wrong.", "\nI am currently building a simple ML pipeline with TFX 0.11 (i.e. tfdv-tft-tfserving) and tensorflow 1.11, using python2.7. ", "I currently have a apache-flink cluster and I want to use that for TFX. ", "I know the framework behind TFX is apache-beams 2.8, and it (apache-beams) supports flink with python SDK currently through a portable runner layer.", "\nBut the problem is how I can code in TFX (tfdv-tft) using apache-beams with flink runner through this portable runner concept, as TFX currently seems to only support DirectRunner and DataFlowRunner (Google Cloud). ", "\nI have been searching through the web for some time, and see the last line in TFX website,\n\"Please direct any questions about working with tf.", "Transform to Stack Overflow using the tensorflow-transform tag.\"", "\nAnd that's why I am here. ", "Any idea or workaround is really appreciated. ", "Thank you!", "\n\nA:\n\nThanks for the question.", "\nDisclaimer: Portable Flink Runner is still in experimental phase will only work with trivial amount of input data.", "\nHere is how you can run TFX on Flink via Beam.", "\nPrerequisite\n\nLinux\nDocker\nBeam Repo: https://github.com/apache/beam\nDistributed file system for input and output. ", "\n\nInstructions to run a python pipeline: https://beam.apache.org/roadmap/portability/#python-on-flink\nNote: We currently only support Flink 1.5.5\nInstructions\n1) Build Worker Containers:\n\nGo to Beam checkout dir\nRun gradle command: ./gradlew :beam-sdks-python-container:docker\n\n2) Run Beam JobServer for Flink:\n\nGo to Beam checkout dir\nRun gradle command: ./gradlew beam-runners-flink_2.11-job-server:runShadow\nNote: this command will not finish as it starts the job server and keep it running.", "\n\n3) Submit a pipeline\n\nPlease refer to https://github.com/angoenka/model-analysis/blob/hack_1/examples/chicago_taxi/preprocess_flink.sh\nNote: make sure to pass following flags to your pipeline\n\n --experiments=beam_fn_api \n --runner PortableRunner \n --job_endpoint=localhost:8099 \n --experiments=worker_threads=100 \n --execution_mode_for_batch=BATCH_FORCED\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0.008064516129032258, 0.013888888888888888, 0.013513513513513514, 0.009302325581395349, 0.006993006993006993, 0, 0, 0, 0, 0, 0.008695652173913044, 0.02127659574468085, 0.008620689655172414, 0.010121457489878543, 0.00267379679144385 ]
0.006068
5
[ "Lexi has promised to divert her slave after weeks of frustration from chastity now. ", "She strokes and then teases his cock into the edge repeatedly stuffs his rock hard prick back into the steel chastity cage where it goes." ]
{ "pile_set_name": "Pile-CC" }
[ 0.011904761904761904, 0 ]
0.005952
5
[ "Adenovirus mediated expression of human paraoxonase 2 protects against the development of atherosclerosis in apolipoprotein E-deficient mice.", "\nAccumulating evidence suggests that the oxidative modification of low-density lipoprotein (LDL) plays an integral role in the initiation and progression of atherosclerosis. ", "We have previously reported that human paraoxonase (PON)2 possesses antioxidant properties and is capable of preventing LDL oxidation in vitro. ", "The objective of this study was to determine whether elevated levels of PON2 could protect against the development of atherosclerosis in vivo. ", "Six-month-old apolipoprotein E-deficient mice (apoE(-/-)) were injected intravenously with either PBS or 3 x 10(11) particles of adenovirus expressing GFP (AdGFP) or human PON2 (AdPON2). ", "Three weeks post-injection, lesion area was significantly lower in mice treated with AdPON2 compared to their control counterparts. ", "Serum from AdPON2 treated mice contained significantly lower levels of lipid hydroperoxides and exhibited an enhanced potential to efflux cholesterol from cholesterol-loaded macrophages. ", "In addition, LDL from AdPON2 treated mice was less susceptible to oxidation, while HDL from these same mice was significantly more capable of protecting LDL against oxidation. ", "These results demonstrate for the first time that elevated levels of PON2 can enhance the efflux potential and antioxidant capacity of serum, increase the anti-inflammatory properties of HDL, and protect against the development of atherosclerosis in vivo." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0.006944444444444444, 0, 0.0106951871657754, 0, 0, 0.005681818181818182, 0.00392156862745098 ]
0.003027
5
[ "Q:\n\nSwift Eureka forms: how do you limit the number of rows in a multivalued section?", "\n\nI am using Eureka to build a form in iOS using Swift. ", "I have created a multivalued section, e.g.:\nform +++ MultivaluedSection(multivaluedOptions: [.Insert, .Delete], header: \"My Header\", footer: \"My footer\") { section in\n section.tag = \"mySectionTag\"\n section.addButtonProvider = { _ in\n return ButtonRow() { row in\n row.title = \"Add row\"\n }\n }\n\n section.multivaluedRowToInsertAt = { index in\n return TimeInlineRow() { row in\n row.title = \"My row title\"\n }\n }\n // initialize form with any times that have already been set previously, times: [Date]\n for time in times {\n section <<< TimeInlineRow(tag) { row in\n row.value = time\n row.title = \"My row title\"\n }\n}\n\nI would like to limit the number of rows you can insert into my multi valued section. ", "Was thinking about doing it by hiding the ButtonRow using some kind of Condition but I'm not sure how to connect it. ", "Alternatively could just present an alert if you tap the button row when the count of values() in the section is too high, but then how do you block the actual inserting?", "\nWas also considering that I could do something inside multivaluedRowToInsertAt based on index but still not sure what.", "\nLooked through the issues and was surprised not to find anything on this already, so I can only assume I'm missing something obvious.", "\nAnother thought I had was to set a Condition on the ButtonRow in the addButtonProvider that returns true if the row with a certain max row tag (that I create) is not nil in the form (i.e. no such row exists), and then in the multivaluedRowToInsertAt it would check if the index is greater than the max allowable index and if so it applies the max tag when creating that row. ", "But it seems the green + insert button is automatically applied to the last row of the section regardless of the type. ", "Then I tried changing the multivaluedOptions to just .Delete when the max rows are reached but I'm having trouble figuring out how to get it to go back to allowing inserting after a row is deleted.", "\nAlso tried putting a condition on the ButtonRow's disabled property based on a similar method as above (with a max row) but it also runs into duplicate row tag issues and the green add button still responds to taps, and the showInsertIconInAddButton property has no effect.", "\nEven if I get this method working, it seems unnecessarily convoluted and I would have expected there to be a much simpler solution since it seems like this would be the kind of functionality a lot of people would need.", "\n\nA:\n\nAs laid out in Mahbub's answer and hinted at in the original question, one can check the index in the multivaluedRowToInsertAt block and update the multivaluedOptions and hide the button row accordingly.", "\nProperties in FormViewController:\nprivate var myButtonRow: ButtonRow! // ", "Can also just refer to it by tag\nlet kMaxCount = 5\n\nInside a setup function in FormViewController: (not shown, setting up the section / button row / add provider etc)\nsection.multivaluedRowToInsertAt = { index in\n if index >= self.kMaxCount - 1 {\n section.multivaluedOptions = [.Delete] \n\n self.myButtonRow.hidden = true\n\n DispatchQueue.main.async() { // I'm not sure why this is necessary\n self.myButtonRow.evaluateHidden()\n }\n }\n\n return TimeRow() { row in // any row type you want — although inline rows probably mess this up\n row.title = title\n row.value = Date()\n }\n}\n\nThe changes to the button row inside multivaluedRowToInsertAt didn't seem to take hold until the 6th row was added, regardless of when the hidden method is called and what the max count is set to, and the last row that inserts goes in the second last place. ", "So then I tried the code as written above, with a dispatch call delaying evaluateHidden() and it seems to work. ", "I'm not sure why, presumably some conflicting race condition. ", "Note, when the insert method is called it is on the main thread, so it's not about changing UI on a background thread.", "\nThen for when rows are deleted there is a function called rowsHaveBeenRemoved you can override in a FormViewController subclass that is called whenever a row (in any section) is removed:\noverride func rowsHaveBeenRemoved(_ rows: [BaseRow], at indexes: [IndexPath]) {\n super.rowsHaveBeenRemoved(rows, at: indexes)\n if let index = indexes.first?.section, let section = form.allSections[index] as? ", "MultivaluedSection {\n if section.count < kMaxCount {\n section.multivaluedOptions = [.Insert, .Delete]\n myButtonRow.hidden = false // or could \n myButtonRow.evaluateHidden()\n }\n }\n}\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0.0012610340479192938, 0.008547008547008548, 0, 0, 0, 0.010638297872340425, 0, 0.005076142131979695, 0.0072992700729927005, 0, 0, 0.02702702702702703, 0.0032751091703056767, 0, 0, 0.00847457627118644, 0.0024875621890547263, 0.004310344827586207 ]
0.00392
5
[ "\"You called the dispatcher, right?\" \"", "We've got multiple vehicles, possible DOAs, multiple injuries.\" \"", "Major accident.\" \"", "We'll need more ambulances.\" \"", "All units have been deployed.\" \"", "I don't have an ETA.\" \"", "l need those medics.\" \"", "I'll do the best I can.\" \"", "Just get them over here.\" \"", "Can you hear me?\" \"", "Listen to me.\" \"", "Listen to me!\" \"", "Look at me.\" \"", "Look in my eyes.\" \"", "Can you feel that?\" \"", "That's my hand.\" \"", "Go on, hold it.\" \"", "We'll get you out of here.\" \"", "I need some help over here!\" \"", "It's okay.\" \"", "You're safe now, all right?\" \"", "You'll be okay.\" \"", "Just hang on.\" \"", "All right?\" \"", "You're doing fine.\" \"", "Don't let go.\" \"", "Don't let me go.\" \"", "Stay with me.\" \"", "Come on!\" \"", "Stay with me, all right?\" \"", "Stay with me.\" \"", "Good.\" \"", "Stay with me.\" \"", "What are you doing?\" \"", "That's my car.\" \"", "Nothing, I just\" \"What'd you take?\" \"", "l turned off\" \"Did you take something?\" \"", "You take my phone, huh?\" \"", "Wake up!\" \"", "Wake up!\" \"", "I helped you.\" \"", "I helped you.\" \"", "I'm sorry.\" \"", "That's the fiirst question people ask.\" \"", "Have I ever killed anyone?\" \"", "So casually, like asking me what kind of car l drive.\" \"", "Why don't they ever ask if I ever saved anyone?\" \"", "Have you?\" \"", "Saved anyone, I mean.\" \"", "My mother would argue that God's the only one that saves.\" \"", "It must be pretty exciting, though, catching bad guys.\" \"", "is this all we're gonna talk about?\" \"", "Look, I'm sorry.\" \"", "I'm not very good at dating.\" \"", "I take it your date sucked.\" \"", "I don't need to tell my story to a stranger.\" \"\"", "What do you do, where are you from?\"\" \"", "Your problem wasn't that he asked too many questions.\" \"", "You just didn't want to clean his little pipes.\" \"", "No, all I wanted to do was clean his pipes.\" \"", "The conversation pissed me off.\" \"", "Baby girl, if it's a servicing you need....\" \"Shut the fuck up.\" \"", "We've talked about this every week for six months.\" \"", "We've talked about this a thousand times.\" \"", "Come on.\" \"", "No!\" \"", "I am not having this conversation with you again.\" \"", "Hang on.\" \"", "None of your goddamn business.\" \"", "Hang on.\" \"", "What?\" \"", "Your keys are in the door.\" \"", "Then hang up. ", "I don't care.\" \"", "You're in 21 5, right?\" \"", "Then fuck you!\" \"", "Not you. ", "I'm talking to this idiot.\" \"", "You know what?\" \"", "Don't bother.\" \"", "Candace.\" \"", "I'm Catch.\" \"", "Charlie was just about to go to bed, weren't you?\" \"", "Bye.\" \"", "And I just ordered a pizza so I don't know if you're hungry-- l gotta go.\" \"", "See you around.\" \"", "I didn't see his van, so....\" \"Yeah, he's not here.\" \"", "How you doing?\" \"", "I'm okay.\" \"", "And Cathy and Larry, Jr.?\" \"", "I bet he's big now.\" \"", "He's growing fast.\" \"", "Does he look like you, or did he get lucky?\" \"", "He's got Cathy's looks and my strength.\" \"", "You should feel his grip.\" \"", "So what's with the cryptic message?\" \"\"", "Call me, we have to talk.\" ", "Sounds like bad news.\" \"", "Mom and Dad are renewing their vows.\" \"", "Church, priest, the whole thing.\" \"", "Renewing their vows?\" \"", "With a party at the house afterwards.\" \"", "Mom wants you to come.\" \"", "Does he?\" \"", "We're working on Dad.\" \"", "Over 10 years, and he won't let it go\" \"No, Sharon!\" \"", "I won't go into that hole with you.\" \"", "I'm over that shit.\" \"", "You're still scared of him.\" \"", "You know what?\" \"", "You shouldn't come here in your uniform.\" \"", "People will think we're in trouble.\" \"", "Nice seeing you too.\" \"", "Yeah.\" \"", "Cocksucker!\" \"", "Get off of me!\" \"", "l'll kill you!\" \"", "Shut up!\" \"", "Motherfuck-- l'm gonna bend you over the car, bitch!\" \"", "Motherfucker!\" \"", "Shut up.\" \"", "You're under arrest!\" \"", "Fucking bitch!\" \"", "You are a crazy one.\" \"", "You are a pretty one, senorita!\" \"", "Those honey-brown eyes\" \" Fuck you!\" \"", "I'll take you in the back and do you, baby.\" \"", "You can suck my dick.\" \"", "This is 7673.\" \"", "We're bringing in one for processing.\" \"", "Look good in that uniform.\" \"", "Why don't you take it off?\" \"", "Take my handcuffs off too, you fucking bitch!\" \"", "Just one touch.\" \"", "Cut it out.\" \"", "You're gonna bust me!\" \"", "Give me one sweet touch.\" \"", "Fuck.\" \"", "Fuck you, faggot.\" \"", "Smells like bacon in here.\" \"", "That's not the touch I want, honey!\" \"", "Sit here.\" \"", "I ain't got time to babysit you.\" \"", "Put your hand on top of your head.\" \"", "Turn around.\" \"", "Sit down.\" \"", "Sit the fuck down!\" \"", "Fuck!\" \"", "Mike, you got another booking sheet?\" \"", "Fucking bitch!\" \"", "He needs a rag.\" \"", "Let me talk to you.\" \"", "Do we need to have another conversation?\" \"", "You'd just let him grab your balls?\" \"", "I saw you plan that in the car.\" \"", "Just waiting to do something to him.\" \"", "If I was out of line, put it in a report.\" \"", "I hate the graveyard shift. ", "lt fucks my system.\" \"", "All the shit you eat is fucking up your system.\" \"", "I love graveyard.\" \"", "No traffic.\" \"", "Nothing's worse than a 459 crosstown during rush hour.\" \"", "Might as well pull over, because you're gonna be late.\" \"", "You like graveyard because you have insomnia.\" \"", "I know what puts me to sleep.\" \"", "The sound of your own voice?\" \"", "That puts your wife to sleep.\" \"", "Get down!\" \"", "Down!\" \"", "Heads down!\" \"", "Do it now!\" \"", "Call 91 1 !\" \"", "Stop!\" \"", "Hold it right there!\" \"", "Hold it!\" \"", "Hold it!\" \"", "Heading south, University Field!\" \"", "Get down!\" \"", "Wait, damn it!\" \"", "Get up here!\" \"", "Drop the gun!\" \"", "Drop the gun!\" \"", "Pogo, what's your 20?\" \"", "Damn it!\" \"", "This one's for my brother, bitch!\" \"", "Drop the fucking gun!\" \"", "Drop the fucking gun!\" \"", "I said drop it!\" \"", "Get up!\" \"", "Put your hands on top of your head.\" \"", "Pogue, are you all right?\" \"", "You all right?\" \"", "Don't you move!\" \"", "Get down!\" \"", "Stay away from the gun!\" \"", "Are you all right?\" \"", "Yeah!\" \"", "I'm good. ", "I'm okay!\" \"", "Don't move!\" \"", "Put your hands on your head!\" \"", "He's okay!\" \"", "l told you to wait!\" \"", "I got you nectarines.\" \"", "The peaches were as hard as rocks.\" \"", "Your coat's all dirty.\" \"", "I tackled a guy.\" \"", "Why did you tackle a guy?\" \"", "He was going for a touchdown.\" \"", "Can you be serious?\" \"", "What day is it today?\" \"", "Wednesday.\" \"", "No.\" \"", "l met somebody today.\" \"", "Good.\" \"", "Oh, you got the broccolini.\" \"", "Thank you.\" \"", "It was a woman.\" \"", "You didn't tackle her too, did you?\" \"", "She's a police officer.\" \"", "Are you in trouble?\" \"", "l don't think so.\" \"", "Well, that's a good thing.\" \"", "I better go now.\" \"", "See you next week.\" \"", "Okay.\" \"", "Suddenly I see what's happening.\" \"", "Where are all the baby pigeons?\" \"", "I see nests with tiny eggs, but I don't see tiny pigeons.\" \"", "Why?\" \"", "You always ask the big questions.\" \"", "I got a big question for you.\" \"", "I can only ask you....\" \"Here, use this.\" \"", "Call your wife.\" \"", "Ask her instead.\" \"", "It's the hospital.\" \"", "Yeah.\" \"", "Gonna be okay?\" \"", "Yeah.\" \"", "Brian's gonna be all right.\" \"", "Didn't I tell you?\" \"", "He's tough.\" \"", "Tomorrow?\" \"", "We'll be there.\" \"", "Where's your partner?\" \"", "He has a wife.\" \"", "l got a wife.\" \"", "But his wife actually likes him.\" \"", "Where you going?\" \"", "The head.\" \"", "All right?\" \"", "To fix her makeup.\" \"", "Pogue wears makeup?\" \"", "Right, I need that lipstick you borrowed back.\" \"", "I didn't think you'd show.\" \"", "Why are you sitting here?\" \"", "I don't talk to a lot of people.\" \"", "Would you like to sit down?\" \"", "Yeah.\" \"", "Yeah, sure.\" \"", "l didn't thank you. ", "I'm Sharon Pogue.\" \"", "l'm Catch.\" \"", "Just Catch?\" \"", "Just Catch.\" \"", "Why would you do that, Catch?\" \"", "Jump somebody with a gun?\" \"", "He was gonna kill you.\" \"", "He could have killed you.\" \"", "You got a death wish?\" \"", "I guess I didn't have time to think about it.\" \"", "Hey!\" \"", "Hey, Pogo!\" \"", "What do you think about it now?\" \"", "lt was worth the risk.\" \"", "For somebody you don't even know?\" \"", "Yeah.\" \"", "And for what you do.\" \"", "I think cops are great.\" \"", "Trying to keep it safe for everybody.\" \"", "Tough job.\" \"", "Firemen they're heros. ", "lKids wave at them.\" \"", "People should wave at cops.\" \"", "What are you laughing at?\" \"", "Nothing.\" \"", "Ever think of how many people are here because you saved them?\" \"", "Or helped them, or arrested somebody who would've hurt them?\" \"", "Never thought about it.\" \"", "Or just because you did your job.\" \"", "Now I'm walking around because of you.\" \"", "Maybe you should be the cop.\" \"", "Wow, I don't know.\" \"", "I don't look really good in hats.\" \"", "What do you do?\" \"", "Where do you live?\" \"", "Where do you work?\" \"", "Okay.\" \"", "I'm sorry.\" \"", "Every time I talk to people, it comes out like an interrogation.\" \"", "You have a nice smile.\" \"", "Thank you.\" \"", "You gonna let us meet your hero?\" \"", "Catch, this is Ray.\" \"", "Hi, Ray.\" \"", "Catch.\" \"", "Why don't you join us?\" \"", "We want to buy you dinner for saving Pogo's ass.\" \"", "You know, I'm kind of tired.\" \"", "I'm gonna head home.\" \"", "Did I interrupt something?\" \"", "All right.\" \"", "I'll walk you to your car if you'd like.\" \"", "Yeah.\" \"", "Sure.\" \"", "It's a bad neighborhood.\" \"", "Maybe I should walk you to your car.\" \"", "I don't have a car.\" \"", "You want a ride home?\" \"", "No, thank you. ", "I'd like to walk.\" \"", "Are you okay to drive?\" \"", "I'm not drunk.\" \"", "You think I am?\" \"", "You'll know when I'm drunk. ", "I'll be throwing up.\" \"", "And I never throw up, so....\" \"Don't worry about it, okay?\" \"", "Get in the car, will you?\" \"", "I'm on Ashland, off 18th street.\" \"", "l never drive.\" \"", "Why not?\" \"", "What?\" \"", "I was trying to picture you without your clothes.\" \"", "Excuse me?\" \"", "l didn't mean it like that.\" \"", "I mean, I'm trying to picture you out of uniform.\" \"", "On your day off, in regular clothes.\" \"", "I don't live here.\" \"", "I know.\" \"", "This is where l live.\" \"", "You know those guys at the bar?\" \"", "They're my friends.\" \"", "Sort of.\" \"", "We work together, we tell jokes, we bullshit.\" \"", "I can't say to them....\" \"What?\" \"", "Every time I shut my eyes, I see that damn gun.\" \"", "I hear that pop.\" \"", "I feel a bullet slamming into my chest and....\" \"l don't know why I'm telling you, except you were there....\" \"l must be drunk.\" \"", "I want to know why you were walking by the stadium at that minute.\" \"", "What if you hadn't been there?\" \"", "I guess we were supposed to meet.\" \"", "If you want, you can come in for a bit.\" \"", "Okay.\" \"", "You want a drink?\" \"", "No, thanks.\" \"", "Mind getting the door?\" \"", "Sit down or something.\" \"", "I'm circling a while.\" \"", "Don't look.\" \"", "I didn't straighten up.\" \"", "So?\" \"", "It's more real this way.\" \"", "It's rude.\" \"", "Now I'm here, you seem mad about it.\" \"", "Trust me, when I'm mad, you'll know it.\" \"", "It's just I'm not used to letting anybody up here.\" \"", "But you're here, so....\" \"Anyway....\" \"Let's talk about something stupid.\" \"", "You first.\" \"", "What's that \"supposed to\" business?\" \"", "That we were supposed to meet?\" \"", "It sounds a little too Psychic Friends Network to me.\" \"", "Some people say we each give off a particular odor that can only be detected by one other person's brain.\" \"", "So we smell each other.\" \"", "Who says that?\" \"", "l have no idea.\" \"", "You're crazy.\" \"", "Thanks for coming up here.\" \"", "Does that mean I'm going?\" \"", "No!\" \"", "I mean, you don't have to.\" \"", "So you're okay now.\" \"", "What, are you here as a medic?\" \"", "is this the \"mad\" part?\" \"", "Maybe going is a good idea.\" \"", "Can I come back sometime?\" \"", "Why?\" \"", "Must be the smell.\" \"", "I gotta go.\" \"", "Oh, God....\" \"What's the matter, you blind?\" \"", "Fucking idiot.\" \"", "What are you guys doing here?\" \"", "Hey, you!\" \"", "Your mom's been bugging us to come for lunch.\" \"", "Mom, can we go now?\" \"", "ln a minute.\" \"", "So how is she?\" \"", "She's really good.\" \"", "She'll be happy to see you.\" \"", "My dad's not here?\" \"", "So you talked to Larry?\" \"", "He told me.\" \"", "Yeah.\" \"", "He told me about this renewing-the-vows thing.\" \"", "You're gonna come, I hope?\" \"", "Come, Shar.\" \"", "I think you should.\" \"", "Aunt Sharon, can I see your police car?\" \"", "Come on, Mom!\" \"", "Hold on. ", "I gotta go.\" \"", "Bye.\" \"", "Looks the same.\" \"", "Still smells like cigarettes.\" \"", "Thought he quit.\" \"", "Only six a day.\" \"", "Larry told you I stopped by?\" \"", "is that why you called?\" \"", "I called you because we want you to come when we renew our vows.\" \"", "How come you're renewing your vows?\" \"", "It's a sort of a fresh start.\" \"", "Your idea?\" \"", "Both of us.\" \"", "It's a way of having the marriage blessed.\" \"", "Wasn't it blessed before?\" \"", "Of course it was blessed before.\" \"", "You just....\" \"l just what, Ma?\" \"", "You just think of the bad.\" \"", "You never remember the good.\" \"", "I wish you remembered that.\" \"", "I wish I remembered it too.\" \"", "Does Dad?\" \"", "Does he remember anything good about me?\" \"", "He doesn't hate you.\" \"", "He just still feels hurt.\" \"", "Hurt?\" \"", "I hurt him?\" \"", "Being arrested like that?\" \"", "Nobody forgets that.\" \"", "How did you forget what he did to you?\" \"", "It wasn't as bad\" \"You make it sound worse.\" \"", "It hadn't been like this for years.\" \"", "I'm glad it hasn't been that way.\" \"", "That means it worked!\" \"", "That's why I did it!\" \"", "Why do I get punished for this?\" \"", "Nobody's punishing you.\" \"", "We're inviting you.\" \"", "Will you come?\" \"", "Do you have a machine?\" \"", "What?\" \"", "Do you have an answering machine?\" \"", "Yes.\" \"", "Hang up, and I'll call your machine.\" \"", "Why?\" \"", "Please leave a message after the tone.\" \"", "It's Sharon.\" \"", "Maybe we can have breakfast or something.\" \"", "I usually get up early to run in Lincoln Park.\" \"", "There's a coffee shop across the street.\" \"", "Like 8 or so?\" \"", "If you're there, you're there.\" \"", "Please leave a message after the tone.\" \"", "Hi.\" \"", "Don'tpick up.\" \"", "Look I didn't get much sleep and maybe this was a bad idea anyway.\" \"", "I was feeling kind of weird last night.\" \"", "Anyway, I'm fline now.\" \"", "So let's just leave it where it's at.\" \"", "Fuck!\" \"", "What?\" \"", "Who is it?\" \"", "What?\" \"", "I was just getting to sleep, finally.\" \"", "We made a date.\" \"", "It wasn't a date.\" \"", "An appointment.\" \"", "I keep my appointments.\" \"", "Do you have door issues?\" \"", "I called you at 7:00.\" \"", "I get up early. ", "I walked there.\" \"", "I waited for you.\" \"", "Check your messages.\" \"", "I need sleep.\" \"", "Come back in a month.\" \"", "Why do you think I'd come back?\" \"", "Why are you here?\" \"", "When you tell somebody you'll be somewhere that person rearranges his life.\" \"", "Be aware of that.\" \"", "And more considerate\" \"What's in the bag?\" \"", "What?\" \"", "What's in the bag?\" \"", "None of your business.\" \"", "Got coffee?\" \"", "You think you deserve coffee?\" \"", "What about food?\" \"", "You definitely don't deserve food.\" \"", "l got coffee, sugar, sweetener\" \"Black.\" \"", "Whatever.\" \"", "Just black.\" \"", "So what kind of life did you rearrange to get coffee?\" \"", "You never talk about yourself.\" \"", "What do you do?\" \"", "What's the difference?\" \"", "What's the difference?\" \"", "You're standing in my bedroom, looking through my panty drawer.\" \"", "That's the difference.\" \"", "Who are you?\" \"", "Somebody who keeps his appointments.\" \"", "Shit, you're married!\" \"", "Give me my coffee.\" \"", "Give it here.\" \"", "What--!\" \"", "I know, you're a criminal.\" \"", "Probably a felon.\" \"", "That's great.\" \"", "That's all I need.\" \"", "My name is Catch.\" \"", "I don't commit crimes.\" \"", "I like being with you.\" \"", "That's bullshit.\" \"", "I let you in here.\" \"", "I'm not gonna know anything about you?\" \"", "I need details.\" \"", "l need to start from here.\" \"", "That's ridiculous!\" \"", "Why?\" \"", "Because that's the way it is.\" \"", "Oh, your rules.\" \"", "My rules.\" \"", "Fine, I didn't want to know you that much anyway.\" \"", "I don't need this shit. ", "I'm tired.\" \"", "Haven't slept all night.\" \"", "Bye.\" \"", "Can I come in?\" \"", "Yeah.\" \"", "Come in.\" \"", "Thanks.\" \"", "Get that door thing under control.\" \"", "You live here?\" \"", "Nobody lives here.\" \"", "What is this, some kind of front?\" \"", "ls this what you told me about?\" \"", "What?\" \"", "Your interrogation.\" \"", "So do I need a lawyer?\" \"", "I don't like being jerked around.\" \"", "I'm not.\" \"", "Then tell me straight.\" \"", "Who are you?\" \"", "What are you looking for?\" \"", "Your life.\" \"", "I don't want any surprises.\" \"", "This is it. ", "I sleep here. ", "I walk around town.\" \"", "That's all.\" \"", "That's all of it?\" \"", "Except for you.\" \"", "The way I feel about you.\" \"", "Which is...?\" \"", "Surprising.\" \"", "I thought it was impossible.\" \"", "I thought I was....\" \"You thought you were what?\" \"", "Gay?\" \"", "Dead.\" \"", "Am I supposed to understand that?\" \"", "No, you're not.\" \"", "Do you ever wonder what \"scratch\" means?\" \"", "What people mean when they say, \"Let's start from scratch\"?\" \"", "This is scratch.\" \"", "This is scratch, all right.\" \"", "So this cat knows where you live?\" \"", "He's not dangerous.\" \"", "He's in no databases.\" \"", "There's no Catch anywhere\" \"You ran his name through?\" \"", "He's a ghost.\" \"", "l can't believe you did that!\" \"", "l'm just looking out for you.\" \"", "l don't need you to look out for me.\" \"", "No last name.\" \"", "That shit's weird.\" \"", "Oh, I remember that.\" \"", "That was a smile.\" \"", "You know the cop?\" \"", "The woman cop?\" \"", "She visited me.\" \"", "You're seeing her?\" \"", "She asks lots of questions.\" \"", "She wants to know everything.\" \"", "Of course she does.\" \"", "Everybody does.\" \"", "Talk to her.\" \"", "Talk to her about what?\" \"", "Talk to her, Catch.\" \"", "Talk to somebody.\" \"", "It's been almost a year.\" \"", "Every time I talk to somebody, it gets a little easier.\" \"", "I'm not saying it goes away\" \"She nice?\" \"", "She's tough.\" \"", "She pretty?\" \"", "That doesn't matter.\" \"", "She's pretty.\" \"", "She's sort of pissed off at me.\" \"", "Apologize.\" \"", "For what?\" \"", "lt doesn't matter.\" \"", "We like it when men apologize.\" \"", "I thought I'd get your machine.\" \"", "Want to call back?\" \"", "I won't answer.\" \"", "I thought you'd be working.\" \"", "I wish I was.\" \"", "Can't sleep?\" \"", "Me neither.\" \"", "Want to go somewhere?\" \"", "Now?\" \"", "It's 3 a.m. The whole world is sleeping.\" \"", "Not the whole world.\" \"", "is this a date?\" \"", "Just an appointment.\" \"", "We can rest, if you want.\" \"", "Well, then rest.\" \"", "See you later.\" \"", "I wish we could go swimming.\" \"", "Why can't we?\" \"", "In our clothes?\" \"", "Oh, my God!\" \"", "You can't take off your clothes in a state park!\" \"", "You need to learn to take a day off.\" \"", "Come on!\" \"", "Where are you going?\" \"", "I'm gonna tell!\" \"", "Oh, my God.\" \"", "Oh, God!\" \"", "Freezing!\" \"", "lKiss me someplace I've never been kissed.\" \"", "lKiss me someplace I've never been kissed.\" \"", "Thank you.\" \"", "What did I tell you about leaving the apartment without me?\" \"", "Gotta go.\" \"", "1034 to Rob-67, location confiirmed as Pogue residence possible 415.\" \"", "Neighbor is standing outside.\" \"", "Where's Larry?\" \"", "Calm down.\" \"", "Where is he?\" \"", "We waited to book him.\" \"", "Where is he?\" \"", "You gonna calm down?\" \"", "Don't talk to me like I'm a child!\" \"", "He's out back with Denny.\" \"", "lKathy's inside with the kid.\" \"", "Vanessa's with him.\" \"", "I'm gonna kill you!\" \"", "I'm getting nowhere with her.\" \"", "Maybe you can try.\" \"", "Got it.\" \"", "Are you okay?\" \"", "Neighbors moved in two weeks ago, and they're calling the police.\" \"", "Welcome to the neighborhood.\" \"", "Must've gotten pretty loud.\" \"", "We had a fight.\" \"", "People fight.\" \"", "Why don't you tell me\" \"Oh, my\" \"Shit!\" \"", "Don't make it worse.\" \"", "lt gets worse?\" \"", "lt's never happened before.\" \"", "Oh, first time for everything.\" \"", "Don't fucking patronize me.\" \"", "I don't need this shit.\" \"", "Look at you.\" \" ", "Look at you, in my house!\" \"", "Policing my family!\" \"", "Where do you get off?\" \"", "It's me. ", "I didn't hit you.\" \"", "I don't want your fucking pity, okay?\" \"", "It happened, all right?\" \"", "He's torn up about it.\" \"", "He's torn up about it?\" \"", "Fuck him!\" \"", "He's torn up?\" \"", "Has he hit Larry, Jr. yet?\" \"", "He'd never do that.\" \"", "He's a good man, Sharon.\" \"", "That's what my mother said to us.\" \"\"", "Your father's a good man.\" \"", "He's torn up about it.\"\" \"", "Get out of my house.\" \"", "Get the fuck out of my house!\" \"", "Have you looked into counseling?\" \"", "Want to hit a woman?\" \"", "Hit me!\" \"", "Fuck!\" \"", "Here we go.\" \"", "Calm\" \"Back off.\" \"", "lt was an accident.\" \"", "lt looks more like a car accident.\" \"", "Very funny.\" \"", "Look\" \"Shut up!\" \"", "You disgust me, you fucking coward!\" \"", "You're a fucking cunt!\" \"", "What are you doing?\" \"", "Let go!\" \"", "Get off!\" \"", "You guys saw that.\" \"", "You saw that.\" \"", "You're witnesses.\" \"", "That's assault!\" \"", "I'll press charges.\" \"", "Let him press charges!\" \"", "What are you talking about?\" \"", "I'm bleeding!\" \"", "I saw nothing.\" \"", "I saw you trip and fall.\" \"", "Look at her!\" \"", "She's crazy!\" \"", "You lay a hand on her again and I'll arrest you myself!\" \"", "You're just like him!\" \"", "Yeah, and what about you?\" \"", "Get some help.\" \"", "Okay.\" \"", "All right.\" \"", "Thanks for coming down.\" \"", "My mother always said it was a family thing.\" \"", "That I'd broken some kind of sacred oath. ", "I don't know.\" \"", "When we walked in that day and saw him beating her....\" \"What was I supposed to do?\" \"", "Larry was the one who'd always jump in and protect her.\" \"", "And he always paid for it.\" \"", "I never did anything.\" \"", "I just ran and hide.\" \"", "You did the right thing.\" \"", "You called for help.\" \"", "A lot of good it did me.\" \"", "But you didn't do it for you.\" \"", "All those years my dad never hurt me.\" \"", "Not once.\" \"", "Yes, he did.\" \"", "Stop right there!\" \"", "Stop!\" \"", "Freeze!\" \"", "Shit!\" \"", "I got constitutionality issues for my attorney!\" \"", "Mr. Steak lKnife has \"constitutionality issues.\"\" \"", "Bitch, that ain't mine.\" \"", "Watch your mouth.\" \"", "He's trying to stick up for his lady.\" \"", "You want to share love with your partner, right, Officer Ho?\" \"", "Ho!\" \"", "Officer Ho!\" \"", "Or Officer Bitch?\" \"", "Which one is it?\" \"", "You ain't seen nothing.\" \"", "Fuck up your life, I don't care.\" \"", "You want this life for your little brother?\" \"", "Banging until he's shot in the head like your older brother?\" \"", "He's a kid.\" \"", "He's got a chance.\" \"", "l ain't got a chance?\" \"", "No, I'm saying this is your chance.\" \"", "Are you smart enough to recognize it?\" \"", "Come on, get in back.\" \"", "What, you found God or something?\" \"", "Don't bust my balls, all right?\" \"", "Come in!\" \"", "Hey, you got some new furniture.\" \"", "And a new friend.\" \"", "Who's this?\" \"", "Bob.\" \"", "You named your dog Bob.\" \"", "No, that was his name.\" \"", "He told you that?\" \"", "Yeah.\" \"", "I got something too.\" \"", "An invitation to my parents' renewal of vows.\" \"", "It came today.\" \"", "Found it the mailbox this morning.\" \"", "Are you gonna go?\" \"", "I don't know.\" \"", "Would you?\" \"", "Are you asking me to go with you?\" \"", "Why, would you do that?\" \"", "Can Bob come?\" \"", "Sure.\" \"", "Now that we got that settled....\" \"Feed me. ", "I'm hungry.\" \"", "I'll get my jacket.\" \"", "And change your T-shirt.\" \"", "You smell like dog.\" \"", "What are you doing?\" \"", "What's with the toys?\" \"", "Don't go through my things.\" \"", "I wasn't. ", "lt was open.\" \"", "Why do you have all these toys?\" \"", "I didn't mean to upset you.\" \"", "Come on.\" \"", "Let's just go.\" \"", "What?\" \"", "Nothing.\" \"", "Let's go.\" \"", "Be good, Bob.\" \"", "You know everybody?\" \"", "How you doing?\" \"", "Going uphill, man.\" \"", "You try it.\" \"", "No....\" \"Go ahead.\" \"", "I feel like a jerk.\" \"", "Try again.\" \"", "What?\" \"", "You like blues?\" \"", "Come on, let's go in.\" \"", "Come on.\" \"", "Take off your coat.\" \"", "Let's stay a while.\" \"", "Come on.\" \"", "That was incredible!\" \"", "I didn't know you played.\" \"", "Why didn't you tell me?\" \"", "l don't know.\" \"", "Why'd you leave?\" \"", "It was great!\" \"", "Steve!\" \"", "Oh, man, I don't believe this!\" \"", "Steve Lambert!\" \"", "How you doing?\" \"", "You okay?\" \"", "It's been\" \"You have me confused with somebody else.\" \"", "You kidding me?\" \"", "Stevie, it's me.\" \"", "Tony!\" \"", "l don't know a Steve.\" \"", "is it a joke?\" \"", "I was up in my office and I heard that sound, your sound.\" \"", "I don't know who you are.\" \"", "Get away from me!\" \"", "You mind explaining this to me?\" \"", "Who is that?\" \"", "You owe him money or something?\" \"", "I don't know who he is.\" \"", "is your name Steve?\" \"", "My name's Catch.\" \"", "What do you want?\" \"", "The truth!\" \"", "Who's Steve Lambert?\" \"", "l don't know.\" \"", "Are we living some kind of lie?\" \"", "What'll I find out next?\" \"", "That you are married?\" \"", "Where are you going?\" \"", "What do you want me to say?\" \"", "I don't want you to say anything!\" \"", "Don't say anything.\" \"", "You want to go?\" \"", "Go.\" \"", "Please leave a message after the tone.\" \"", "Catch, it's me.\" \"", "Can you pick up?\" \"", "Listen, I was wondering if we could meet tomorrow.\" \"", "At this place called Enrico's.\" \"", "It's on Halsted and Marion.\" \"", "Around 2:00, okay?\" \"", "Okay.\" \"", "Bye.\" \"", "About the other day\" \"You don't have to explain.\" \"", "I probably do.\" \"", "But....\" \"I'm fine.\" \"", "Come on.\" \"", "I thought we were having coffee.\" \"", "You can trust me, you know.\" \"", "l know that.\" \"", "I'd never hurt you.\" \"", "Remember when you said some people were meant to meet each other?\" \"", "Maybe we were meant to meet that night.\" \"", "The night I held your hand.\" \"", "What do you mean?\" \"", "Maybe you don't remember.\" \"", "You were unconscious\" \"No, I don't.\" \"", "I was there.\" \"", "It was me that was there that night.\" \"", "At the accident?\" \"", "What are you talking about?\" \"", "Maybe it's why we met again.\" \"", "What are you doing?\" \"", "Trying to help.\" \"", "With what?\" \"", "I'm fine.\" \"", "l don't think you are.\" \"", "You pretend-- -l'm not pretending!\" \"", "You're lying.\" \"", "l'm not lying!\" \"", "Then walk in there.\" \"", "And I'll walk in there with you.\" \"", "Why are you doing this?\" \"", "Because you had a family.\" \"", "Shut up.\" \"", "Stop.\" \"", "You had a wife and a child.\" \"", "I'm so sorry it happened.\" \"", "I want you to have a life.\" \"", "I have a life.\" \"", "We don't need\" \"Please!\" \"", "It happened.\" \"", "We don't need to go into this.\" \"", "Please\" \"You like to push people, don't you?\" \"", "I just want to understand you, to know who you are.\" \"", "I can't do that if you don't let me.\" \"", "I know it's hard, I can imagine\" \"You can't imagine anything!\" \"", "You have no idea how it feels to do what I did\" \"What?\" \"", "Stay with me, okay?\" \"", "It's not your fault.\" \"", "I was there, I saw the reports.\" \"", "That truck, it just\" \" Catch, please.\" \"", "I'm trying to tell you something, okay?\" \"", "I'm trying to tell you that....\" \"You're not alone.\" \"", "l'm trying to tell you that I....\" \"Don't.\" \"", "You're supposed to be his dad!\" \"", "Can't you take him?\" \"", "I'll be busy!\" \"", "I won't have time today!\" \"", "And I have time?\" \"", "That's a hell of a greeting.\" \"", "What's up with you?\" \"", "You don't return my calls.\" \"", "Haven't shown up for work three, four days.\" \"", "You don't look like you got the flu.\" \"", "l take it Freak Show dumped you?\" \"", "Fuck you.\" \"", "I wish I could say I'm sorry, but I ain't.\" \"", "I think it's best for everybody.\" \"", "Really?\" \"", "And who's \"everybody\"?\" \"", "Me.\" \"", "Martha Stewart, you gonna pour your partner a cup?\" \"", "He had you.\" \"", "He got you, didn't he?\" \"", "I'm gonna give you some real strong advice.\" \"", "Change the subject.\" \"", "Charlene's pregnant.\" \"", "That's great.\" \"", "Congratulations.\" \"", "I'm not sure I'm ready to be a daddy yet.\" \"", "I haven't gotten over Miss Stillwell.\" \"", "Who?\" \"", "Tenth-grade English teacher.\" \"", "Hot buttered Stillwell.\" \"", "I know you gotta go through this.\" \"", "I'll tell the boss I stopped by to see you.\" \"", "You as sick as a dog, coughing up organs and shit.\" \"", "But I can't let this go on much longer.\" \"", "We got us a job to do out there.\" \"", "We gotta clean these streets before my baby gets here.\" \"", "You know what I'm saying?\" \"", "Has he been here?\" \"", "I was expecting him this morning.\" \"", "He shops for me.\" \"", "I give him money from the settlement every week.\" \"", "Can't talk about that with him.\" \"", "When he comes here, do you ever talk about the accident?\" \"", "Does he ever mention the past?\" \"", "No.\" \"", "Why not?\" \"", "I try to let him find his own way through.\" \"", "I feel he needs that.\" \"", "Why are you here, Sharon?\" \"", "I want to know how to help him.\" \"", "You are helping him.\" \"", "l don't think so.\" \"", "What makes you think that?\" \"", "I took him to the cemetery\" \"The cemetery?\" \"", "I thought it might help.\" \"", "He needs to face it.\" \"", "He will face it, in his time.\" \"", "He built a wall around that whole day and that night.\" \"", "My daughter and my grandson.\" \"", "He can't help it.\" \"", "A cemetery....\" \"Do you know how hard it is for me to go to the cemetery?\" \"", "I was just trying to help him get back to some kind of life.\" \"", "He was coming back.\" \"", "Don't you realize how he's changed these past weeks?\" \"", "His apartment, his life?\" \"", "He fell in love.\" \"", "Why do you want to rush things?\" \"", "Why does everybody rush things these days?\" \"", "I was scared.\" \"", "Scared of what?\" \"", "Of losing him.\" \"", "And I guess that's what I did.\" \"", "I lost him.\" \"", "You were just trying to find your way.\" \"", "What else can we do?\" \"", "You think I'm always sure about what I should or shouldn't say to him?\" \"", "I just try to do what's right and hope that he'll find the love in it.\" \"", "Look at you so worried now, and miserable.\" \"", "There's love in that.\" \"\"", "l just wanted to wish you both the best.\"\" \"\"", "l just want to wish you both well and say congratulations.\"\" \"\"", "Hi, Mom, Dad.\" \"", "I just stopped by to say congratulations and I think it's great.\"\" \"", "These shoes, no.\" \"", "Please leave a message after the tone.\" \"", "Catch?\" \"", "Can you pick up?\" \"", "Will you call me?\" \"", "You declared your love for one another in the presence of Christ.\" \"", "He consecrated you in baptism enriched and strengthened you in the sacrament of matrimony so you can carry out the duties of marriage in lasting fidelity.\" \"", "congratulates you and rejoices with you on reaching this milestone in your journey.\" \"", "Are you prepared to give yourselves again to that union larger than yourselves that union already blessed by God?\" \"", "Yes.\" \"", "Yes, we are.\" \"", "Face each other and join hands please, and say after me:\" \"l, Carl...\" \"l, Carl...\" \"...take thee, Josephine...\" \"...take thee, Josephine...\" \"...to be my wife.\" \"...", "to be my wife.\" \"", "l, Josephine...\" \"l, Josephine...\" \"...take you, Carl...\" \"...take you, Carl...\" \"...to be my husband.\" \"...", "to be my husband.\" \"", "I promise to be true to you in good times and in bad in sickness and in health.\" \"", "I promise to love you and honor you till death do us part.\" \"", "Annie.\" \"", "Max.\" \"", "I don't want you to think I forgot you.\" \"", "It's just that I couldn't find you.\" \"", "I woke up and you were gone.\" \"", "Everything was gone.\" \"", "It just disappeared in one minute.\" \"", "I couldn't remember that minute.\" \"", "I lost it.\" \"", "But I think I found it all now.\" \"", "I used a calculator, see.\" \"", "Do you know we get about 1400 minutes a day?\" \"", "So I figured it out.\" \"", "I was 29 years old three months and eight days.\" \"", "So it was minute number 1 7,810,200 or so.\" \"", "That's the one I lost.\" \"", "When I lost that minute, I guess I....\" \"l tried to lose it all all the memories because it hurt so bad.\" \"", "I tried, but....\" \"But I couldn't do it.\" \"", "Max, you were sick that day, remember?\" \"", "It was your birthday and you ate too much.\" \"", "Annie, you said:\" \"\"Slow down, it's wet, okay?\"\" \"", "And you were right.\" \"", "I should have slowed down.\" \"", "I should have slowed down lots of times.\" \"", "But I didn't always listen.\" \"", "I didn't listen when you when you said, \"Steve, just please spend more time.\"\" \"", "That day I made you smile, Max, remember?\" \"", "You looked at me and I made a face and then we all smiled.\" \"", "It was a great minute.\" \"", "It was.\" \"", "I'm so glad I found that minute.\" \"", "And no matter what no matter what, I won't forget anymore.\" \"", "Daddy!\" \"", "I won't forget anymore.\" \"", "I love you.\" \"", "Don't make him talk about anything today.\" \"", "I know.\" \"", "It was a nice ceremony.\" \"", "We're running out of chicken.\" \"", "Nobody's eating the ham.\" \"", "It's still a great party.\" \"", "You look happy.\" \"", "30 years and still in love, huh?\" \"", "You think that's wrong, don't you?\" \"", "Of course not.\" \"", "You're beautiful.\" \"", "Dad.\" \"", "Don't walk away, okay?\" \"", "What?\" \"", "is it working?\" \"", "Do you need to check it?\" \"", "lt's fine.\" \"", "Dad\" \"What the hell are you doing?\" \"", "Sharon, please.\" \"", "Please, please what?\" \"", "Why do you always protect him?\" \"\"", "Don't bother your father.\"\" \"", "I'm gonna bother you for a minute.\" \"", "Can you handle that?\" \"", "You get the hell\" \"This is between me and my father.\" \"", "So both of you, just leave us alone for one goddamn minute!\" \"", "How about you, Dad?\" \"", "You want me to go?\" \"", "lt's up to you.\" \"", "l'm asking you.\" \"", "Am I welcome here?\" \"", "You're here, aren't you?\" \"", "What do you want?\" \"", "l want to know.\" \"", "Do you want me here?\" \"", "Do you still love me?\" \"", "I want to know.\" \"", "I feel like....\" \"You feel like what, Dad?\" \"", "I feel like I don't have a daughter anymore.\" \"", "Well you do.\" \"", "And it's a shame that you'll miss knowing her.\" \"", "I'm next.\" \"", "Hi, Mom, Dad.\" \"", "Congratulations.\" \"", "You know, being in this house reminds of something.\" \"", "I was about 10 years old.\" \"", "Me and Larry were playing alien invasion.\" \"", "Remember, Lar?\" \"", "Anyway, we were making a lot of noise.\" \"", "Dad came home from work, tired and pissed off.\" \"", "We were yelling like mad.\" \"", "He burst into the room and he yells:\" \"\"What the hell are you doing?\"\" \"", "And I was scared.\" \"", "I was really scared.\" \"", "And I said:\" \"\"We're playing alien invasion.\"\" \"", "And he said, \"l'll show you a damn alien invasion!\"\" \"", "He picks me up.\" \"", "He picks me up off the floor and he throws me on the couch.\" \"", "Then he grabs Larry and picks him up and throws him on the couch.\" \"", "And then....\" \"Then he starts making monster noises.\" \"", "He says, \"We came to Earth to kick ass!\"\" \"", "Me and Larry, we're running and jumping at him.\" \"", "We're laughing so hard I almost wet myself.\" \"", "And we keep running and jumping on him, and he keeps tossing us.\" \"", "And growling and beeping.\" \"", "It was great.\" \"", "It was great.\" \"", "I'll never forget that.\" \"", "And I miss that.\" \"", "I miss it.\" \"", "Anyway, I just wanted to say thanks for that, Dad.\" \"", "Thanks.\" \"", "Bye.\" \"", "What are you doing here?\" \"", "You invited me.\" \"", "Are you okay?\" \"", "Yeah, I'm okay.\" \"", "I wanted to apologize.\" \"", "For what?\" \"", "For wanting everything to be perfect.\" \"", "You were right, I was pushing you.\" \"", "Then I realized that it doesn't have to be perfect.\" \"", "I mean.... lt can be whatever it is.\" \"", "They don't like me very much in there.\" \"", "They're lucky to have you in there.\" \"", "That's a nice thing to say.\" \"", "lt's not a nice thing.\" \"", "It's the truth.\" \"", "Why do you try so hard not to cry?\" \"", "It's not fair.\" \"", "I did the right thing.\" \"", "I know I did.\" \"", "It's not fair that they're shutting me out.\" \"", "There's nothing I can do anymore.\" \"", "I went, Sharon.\" \"", "I went to see my wife and my son today.\" \"", "I told them that I love them and that I miss them.\" \"", "And then I told them about you.\" \"", "I told them how much I love you.\" \"", "I love you.\" \"", "I love you too.\" \"", "I'll drive.\"" ]
{ "pile_set_name": "OpenSubtitles" }
[ 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0.07142857142857142, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0.019230769230769232, 0, 0, 0, 0, 0, 0, 0.07142857142857142, 0, 0, 0, 0.023809523809523808, 0, 0, 0, 0, 0.02564102564102564, 0.02857142857142857, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02564102564102564, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0.03333333333333333, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017857142857142856, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0.023809523809523808, 0, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.029411764705882353, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.029411764705882353, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.058823529411764705, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0.03125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06896551724137931, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017241379310344827, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0.015873015873015872, 0.16666666666666666, 0.07142857142857142, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.14285714285714285, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.1111111111111111, 0, 0.058823529411764705, 0, 0, 0, 0, 0, 0.125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.030303030303030304, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018867924528301886, 0, 0, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.024096385542168676, 0, 0.018518518518518517, 0, 0, 0, 0.1111111111111111, 0.14285714285714285, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.024390243902439025, 0, 0.02, 0, 0, 0, 0, 0.0125, 0.022727272727272728, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.022222222222222223, 0, 0, 0, 0, 0, 0, 0, 0, 0.022727272727272728, 0.058823529411764705, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014705882352941176, 0, 0, 0.04, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0, 0, 0 ]
0.002866
5
[ "Rosemann\n\nRosemann is a surname. ", "Notable people with the surname include:\n\nRosemann of Isenburg-Kempenich, Lord of Isenburg-Kempenich co-ruling with his brothers Salentin and Theodoric II, and eventually his nephew Theodoric III\nJulius Rosemann (1878–1933), German politician of the Independent Social Democratic Party\nMichael Rosemann (born 1967), German information systems researcher, professor and Director of the Centre for Future Enterprise, QUT, Brisbane, Australia, Australia\nPhilipp Rosemann (born 1964), German philosopher and Professor and Chair of Philosophy at Maynooth University\n\nSee also\nRoseman\nRosman (disambiguation)" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0, 0.02159468438538206 ]
0.010797
5
[ "La Chaussée\n\nLa Chausée may refer to:\n\nPeople\n Pierre-Claude Nivelle de La Chaussée, a French dramatist\n\nPlaces\n La Chaussée, Seine-Maritime, a commune of France in the Seine-Maritime department\n La Chaussée, Vienne, a commune of France in the Vienne department\n La Chaussée-d'Ivry, a commune of France in the Eure-et-Loir department\n La Chaussée-Saint-Victor, a commune of France in the Loir-et-Cher department\n La Chaussée-sur-Marne, a commune of France in the Marne department\n La Chaussée-Tirancourt, a commune of France in the Somme department" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.014598540145985401 ]
0.014599
5
[ "Who is Leonardo DiCaprio dating? ", "Who Leonardo DiCaprio dated; list of Leonardo DiCaprio loves, ex girlfriends; breakup rumors. ", "The loves, exes and relationships of Leonardo DiCaprio, listed by most recent. ", "From Bar Refaeli up are rumored flings and one-night stands. ", "From his list of exes, it looks like Leo has really gotten around! ", "Leo fans will also enjoy leaked secrets about his romance life, cute photos of young DiCaprio, and awesome stories of Leo being Leo.", "\n\nIf you're wondering who Leonardo DiCaprio's wife is, stop - he has never married! ", "Expect to see many models in Leonardo DiCaprio's dating history.", "\n\nSince May 2016, Leonardo DiCaprio has been dating Danish model Nina Agdal.", "\n\nWho are Leonardo DiCaprio's ex-girlfriends? ", "It's actually kind of funny to see that the Leonardo DiCaprio movies list has less items than his romances list. ", "But, if you were Leonardo wouldn't you take advantage of your fame and good looks too?" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.030303030303030304, 0.02127659574468085, 0.012658227848101266, 0, 0.014925373134328358, 0.022727272727272728, 0.011904761904761904, 0.015625, 0.013157894736842105, 0.021739130434782608, 0, 0.011627906976744186 ]
0.014662
5
[ "A BILL to amend article four, chapter seven of the code of West\nVirginia, one thousand nine hundred thirty-one, as amended,\nby adding thereto a new section, designated section six,\nrelating to the creation of the West Virginia prosecuting\nattorneys institute and its executive council and its\nexecutive director; the appointment of special prosecutors\nto serve in the various counties where the elected\nprosecuting attorney in that county is disqualified from\nthe prosecution of a criminal case in that county; assessing\nthe cost of the operation of the West Virginia prosecuting\nattorneys institute upon the various counties; providing for the termination of the West Virginia prosecuting attorneys\ninstitute; and annual reporting to the Legislature.", "\n\nBe it enacted by the Legislature of West Virginia:\nThat article four, chapter seven of the code of West\nVirginia, one thousand nine hundred thirty-one, as amended, be\namended by adding thereto a new section, designated section six,\nto read as follows:ARTICLE 4. ", "PROSECUTING ATTORNEY, REWARDS AND LEGAL ADVICE.", "\n§7-4-6. ", "West Virginia Prosecuting Attorneys Institute.", "\n(a) There is hereby created the West Virginia Prosecuting\nAttorneys Institute, a public body whose membership shall consist\nof the fifty-five elected county prosecuting attorneys in the\nstate. ", "The institute shall meet at least once each calendar\nyear, and the presence of twenty-eight of the fifty-five\nprosecutors at any such meeting shall constitute a quorum for the\nconduct of the institute's business.", "\n(b) There is hereby created the executive council of the\nWest Virginia Prosecuting Attorneys Institute which shall consist\nof five prosecuting attorneys elected by the membership of the\nWest Virginia Prosecuting Attorneys Institute at its annual\nmeeting and two persons appointed annually by the county\ncommissioner's association of West Virginia. ", "The executive\ncouncil shall elect one member of the council to serve as chairman of the institute for a term of one year without\ncompensation. ", "The executive council shall serve as the regular\nexecutive body of the institute.", "\n(c) There is hereby created the position of executive\ndirector of the West Virginia Prosecuting Attorneys Institute to\nbe employed by the executive council of the institute. ", "The\nexecutive director of the West Virginia Prosecuting Attorneys\nInstitute shall serve at the will and pleasure of the executive\ncouncil of the institute at an annual salary equal to that\nprovided to prosecutors in Class I counties as set forth in\nsection four, article seven, chapter seven of this code. ", "The\nexecutive director shall be licensed to practice law in the state\nof West Virginia and shall devote full-time to his or her\nofficial duties and may not engage in the private practice of\nlaw.", "\n(d) The duties and responsibilities of the institute, as\nimplemented by and through its executive council and its\nexecutive director, shall include the following:\n(1) To provide for special prosecuting attorneys to pursue\na criminal matter in any county upon the request of a circuit\ncourt judge of that county and upon the approval of the executive\ncouncil;\n(2) To establish and to implement general and specialized\ntraining programs for prosecuting attorneys and their\nprofessional staffs;\n(3) To provide materials for prosecuting attorneys and their\nprofessional staffs, including legal research, technical\nassistance, technical and professional publications;\n(4) To compile and disseminate information on behalf of\nprosecuting attorneys and their professional staffs on current\ndevelopments and changes in the law and the administration of\ncriminal justice;\n(5) To establish and to implement uniform reporting\nprocedures for prosecuting attorneys and their professional\nstaffs in order to maintain and to provide accurate and timely\ndata and information relative to criminal prosecutorial matters;\n(6) To accept and expend funds, grants, and gifts and accept\nservices from any public or private source;\n(7) To enter into agreements and contracts with public or\nprivate agencies or educational institutions;\n(8) To identify experts and other resources for use by\nprosecutors in criminal matters; and\n(9) To make such recommendations to the Legislature or the\nsupreme court of appeals of the state of West Virginia on measures required, or procedural rules to be promulgated, to make\nuniform the processing of juvenile cases in the fifty-five\ncounties of the state.", "\n(e) Each prosecuting attorney shall be subject to\nappointment by the institute to serve as a special prosecuting\nattorney in any county where the prosecutor for that county or\nhis or her office has been disqualified from participating in a\nparticular criminal case. ", "The circuit judge of any county of\nthis state, who disqualifies the prosecutor or his or her office\nfrom participating in a particular criminal case in that county,\nshall seek the appointment by the institute of a special\nprosecuting attorney to substitute for the disqualified\nprosecutor. ", "The executive director of the institute shall, upon\nwritten request to the institute by any circuit judge, and upon\napproval of the executive council, appoint a prosecuting attorney\nto serve as a special prosecuting attorney. ", "The special\nprosecuting attorney so appointed shall serve without any further\ncompensation other than that paid to him or her by his or her\ncounty, except that he or she shall be entitled to be reimbursed\nfor his or her legitimate expenses associated with travel,\nmileage, room and board from the county to which he or she is\nappointed as a prosecutor, and provided further the county commission in which county he or she is special prosecutor shall\nbe responsible for all expenses associated with the prosecution\nof the criminal action.", "\n(f) The executive director of the institute shall maintain\nan appointment list that shall include the names of all\nfifty-five prosecuting attorneys and that shall also include the\nnames of any assistant prosecuting attorney who wishes to serve\nas a special prosecuting attorney upon the same terms and\nconditions as set forth in this section. ", "The executive director\nof the institute, with the approval of the executive council,\nshall appoint special prosecuting attorneys from the appointment\nlist for any particular matter giving due consideration to the\nproximity of the proposed special prosecuting attorney's home\ncounty to the county requesting a special prosecutor and giving\ndue consideration to the expertise of the special prosecuting\nattorney.", "\n(g) Commencing on the first day of July, one thousand nine\nhundred ninety-five, each county commission shall pay, on a\nmonthly basis, a special prosecution premium to the treasurer of\nthe state for the funding of the West Virginia Prosecuting\nAttorneys Institute. ", "Such monthly premiums shall be paid\naccording to the following schedule:\n\nUpon receipt of any such premium, the treasurer shall deposit the\npremium into a special revenue fund to be known as the West\nVirginia Prosecuting Attorneys Institute Fund. ", "All costs of\noperating the West Virginia Prosecuting Attorneys Institute shall\nbe paid from the West Virginia Prosecuting Attorneys Institute\nFund upon proper authorization by the executive council or by the executive director of the institute and subject to annual\nappropriation by the Legislature of the amounts contained within\nthe fund.", "\n(h) The West Virginia Prosecuting Attorneys Institute shall\ncontinue to exist until the first day of July, one thousand nine\nhundred ninety-seven, unless continued by an act of the\nLegislature. ", "The institute shall annually by the first day of\nthe regular legislative session provide the joint committee of\ngovernment and finance with a report setting forth the activities\nof the institute, its activities and suggestions for legislative\naction.", "\nNOTE: The purpose of this bill is to create a prosecuting\nattorneys institute funded by county contributions. ", "The\ninstitute would provide training for prosecutors and would\nprovide special prosecutors to counties when the elected\nprosecutor is disqualified from prosecuting a case." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0013315579227696406, 0.003787878787878788, 0, 0, 0.021739130434782608, 0, 0, 0.0057306590257879654, 0, 0, 0.005714285714285714, 0.0032679738562091504, 0, 0.0005995203836930455, 0, 0, 0, 0, 0, 0, 0, 0.004048582995951417, 0.0058823529411764705, 0.005128205128205128, 0, 0, 0 ]
0.00212
5
[ "Sauna for enjoyment AND survival\n\nSaunas in rural and lake areas are as much for enjoyment as they are for survival.", "\n\nWith his wife and two girls, Jeff Forrester built a wood burning sauna on his minimally developed land on an Island in Northern Minnesota. ", "In this short interview, Jeff describes how their sauna is critical to camping in sub zero weather, and just recently, while on a cold wet deer hunting trip with one of his daughters.", "\n\n“Just because a sleeping bag is rated -20f, doesn’t mean it will work if you’re body is cold.” ", "Sleeping bags are great for containing one’s body heat, but if you’re cold to begin with, forget about it.", "\n\nMany things were invented with survival in mind.", "\n\nThen they became popular in everyday use. ", "You can think of your own example next time you grab for your cell phone." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0.0070921985815602835, 0.00546448087431694, 0, 0, 0, 0, 0 ]
0.00157
5
[ "\n123 Wn.2d 854 (1994)\n873 P.2d 492\nMICHAEL RORVIG, ET AL, Petitioners,\nv.\nJOEL DOUGLAS, ET AL., ", "Respondents.", "\nNo. ", "60183-6.", "\nThe Supreme Court of Washington, En Banc.", "\nMay 19, 1994.", "\nPhilip E. Rosellini and Jeffrey D. Thomas, for petitioners.", "\nReed McClure, by William R. Hickman and Marilee C. Erickson, for respondents.", "\nJOHNSON, J.\nPetitioners were denied recovery of the legal expenses incurred in the quiet title portion of their successful slander of title action. ", "Legal expenses, including attorney fees, incurred in clearing the slandered title have not been recoverable as damages in accordance with the rule set out in McGuinness v. Hargiss, 56 Wash. 162, 105 P. 233 (1909). ", "Petitioners request this court to overrule McGuinness *856 and hold such fees are recoverable as special damages. ", "Respondents have cross-petitioned the ruling of the Court of Appeals affirming the trial court's findings that the parties did not have an enforceable contract and the elements of slander of title had been met, and the trial court's method of calculating damages. ", "We hold in a successful slander of title action, recoverable damages include attorney fees. ", "Further, we affirm the Court of Appeals on the issues raised in the cross petition.", "\nPetitioners Pam and Michael Rorvig purchased three unimproved lots located adjacent to a subdivision owned and developed by the Respondents, Barbara and Joel Douglas. ", "The Douglases had bid on the unimproved lots, hoping to include them within their development. ", "However, the Rorvigs submitted the winning bid and signed a purchase and sale agreement for the property on August 8, 1989.", "\nShortly thereafter, the Douglases began pressuring the Rorvigs to abandon the purchase. ", "The Douglases suggested the situation be resolved by the parties entering into a joint development agreement for the property. ", "The Rorvigs began negotiations with the Douglases.", "\nThe Douglases submitted several drafts of agreements to the Rorvigs. ", "After rejecting these, the Rorvigs prepared their own agreement. ", "The agreement provided for cooperation in the vacation of an unimproved city street, for performance by the Douglases of site development, and for payment by the Rorvigs to the Douglases of development costs on a per-lot basis. ", "The agreement also stated that a memorandum of the contract would be recorded with the county auditor.", "\nOn September 25, 1989, Pam Rorvig signed the agreement. ", "Michael Rorvig then took the agreement to the Douglases' office. ", "After Joel Douglas reviewed the agreement, he and Michael Rorvig agreed to two changes, which they inserted into the agreement and initialed. ", "They both signed the agreement. ", "Rorvig then presented the agreement to Barbara Douglas. ", "She requested some time to review the *857 document before signing it. ", "Michael Rorvig left the agreement with Mrs. Douglas.", "\nSometime after Michael Rorvig left the office, the Douglases made three material changes to the agreement. ", "The changes would have increased the Rorvigs' obligation under the contract by $15,000, and would have allowed the Douglases to opt out of providing various improvements if they could not agree to terms with the Rorvigs. ", "Barbara Douglas signed the agreement, and both Douglases initialed the changes. ", "Beside their own initials, the Douglases marked spaces for the Rorvigs to insert their initials.", "\nThe Rorvigs received the contract back the next day. ", "They found the Douglases' changes unacceptable. ", "When a Douglas employee contacted Rorvig a week later to find out the Rorvigs' response, Michael Rorvig said he and his wife were rejecting the Douglases' counteroffer.", "\nDuring a series of telephone calls between the parties, Michael Rorvig repeatedly denied they had an agreement. ", "Mr. Douglas asserted an agreement existed. ", "At the same time, he continued to propose a variety of new agreements and to remind the Rorvigs that litigation was expensive. ", "The Douglases prepared and recorded a memorandum of agreement on the property despite the Rorvigs' contention no finalized agreement existed.", "\nNot long after the Douglases recorded the memorandum, David Edelstein, a local contractor, submitted an earnest money agreement to the Rorvigs offering to purchase the three lots. ", "Rorvig informed Edelstein of the Douglas memorandum. ", "After verifying with the title company that the Rorvigs could not provide clear title, Edelstein withdrew his offer.", "\nOn December 26, 1989, the Rorvigs filed suit. ", "They requested the court quiet title in the Rorvigs, and award damages for slander of title. ", "The Douglases counterclaimed for enforcement of the memorandum.", "\nAt trial, Judge Moynihan held the memorandum was not an enforceable contract. ", "He further held the Douglases were *858 liable for slander of title, and awarded damages of $7,406.26. ", "The trial court denied the Rorvigs' request for attorney fees, other than statutory fees of $125.", "\nBoth parties appealed. ", "In an unpublished opinion, the Court of Appeals affirmed the judgment in all respects. ", "On the issue of awarding attorney fees for the quiet title portion of the action, both the trial court and the Court of Appeals felt bound by McGuinness v. Hargiss, 56 Wash. 162, 105 P. 233 (1909), which held attorney fees are not recoverable as costs or as damages in a slander of title action.", "\n\nI\nInitially, we consider the issues raised in the Douglases' cross petition. ", "The Douglases make three arguments: (1) the trial court erred in holding no contract was formed between the parties; (2) the trial court erred in holding Petitioners had established all the elements of slander of title; and (3) the trial court erred in the calculation of damages. ", "First we consider whether the trial court erred in concluding no contract was formed between the parties.", "\n[1, 2] It is a basic rule of contract formation that \"[a]n expression of assent that changes the terms of the offer in any material respect may be operative as a counteroffer; but it is not an acceptance and consummates no contract\". ", "Blue Mt. Constr. ", "Co. v. Grant Cy. ", "Sch. ", "Dist. ", "150-204, 49 Wn.2d 685, 688, 306 P.2d 209 (1957). ", "On the other hand, an acceptance that requests modification of terms may consummate a contract unless the additional terms are conditions of acceptance. ", "Such an acceptance must be unequivocal. ", "Restatement (Second) of Contracts § 61 comment a (1981).", "\nThe trial court found a contract had not been formed between the Douglases and the Rorvigs because the handwritten modifications made by the Douglases constituted a counteroffer which the Rorvigs rejected. ", "The Douglases disagree, asserting they accepted the Rorvig contract as modified on September 25, 1989, they returned it the next day with proposed changes, and the additional terms were not conditions of acceptance.", "\n*859 The evidence, however, does not support the Douglases' contentions. ", "Although the Douglases returned the contract with a cover letter stating, \"we suggest a minimum of four tracts\", that change and other changes were actually written into the contract and initialed by the Douglases. ", "Therefore, the \"suggested\" changes were actually incorporated into the proposed contract. ", "These changes constituted a counteroffer and not an unequivocal acceptance of the Rorvigs' offer. ", "The Douglases' conduct confirmed that no agreement had been reached. ", "After learning the Rorvigs had rejected their proposal, the Douglases proposed other agreements. ", "In addition, during a telephone conversation with Michael Rorvig, Mr. Douglas stated, \"I suppose we don't have an agreement, unless you — unless you and Pam agree to it, but that could take $20,000 and two years for the Court to decide\". ", "Report of Proceedings, at 74.", "\nEven if the Douglases' changes are viewed as requests for changes to the contract rather than conditions of acceptance, no contract was formed because there was no unequivocal acceptance of the original terms. ", "When Michael Rorvig left the Douglases' office on September 25, 1989, Barbara Douglas had not signed the contract and Michael Rorvig had no clear indication that she would assent to it. ", "It is clear from the facts that her approval was necessary before any offer could be accepted and, when the proposed contract was left with her, she indicated she needed some time to review it. ", "The next day when the Douglases returned the contract with additional changes, no clear statement indicated the Rorvigs were accepting its original terms. ", "Therefore, the trial court was correct in holding no contract was formed because there was never unequivocal, mutual assent to any one contract proposal.", "\n[3] Next, the Douglases assert the court erred in concluding the Rorvigs established all the elements of slander of title. ", "Slander of title is defined as: (1) false words; (2) maliciously published; (3) with reference to some pending sale or purchase of property; (4) which go to defeat plaintiff's title; and (5) result in plaintiff's pecuniary loss. ", "Pay 'N Save *860 Corp. v. Eads, 53 Wn. ", "App. ", "443, 448, 767 P.2d 592 (1989) (citing Brown v. Safeway Stores, Inc., 94 Wn.2d 359, 375, 617 P.2d 704 (1980)).", "\n[4] The Douglases contend the evidence did not establish the element of falsity. ", "The Douglases cite several cases from other jurisdictions which hold the good faith recording of an unenforceable agreement does not render an agreement false for purposes of slander of title. ", "However, the cases cited by Respondents involved honestly held assertions made in good faith. ", "In this case, the record supports the trial court's finding that the Douglases recorded the memorandum of agreement, which falsely declared a valid contract existed, even though the Douglases knew no agreement had been reached. ", "The element of falsity was sufficiently established.", "\nThe Respondents also contend the Rorvigs failed to establish the element of \"pending sale\". ", "They rely primarily on Clarkston Comm'ty Corp. v. Asotin Cy. ", "Port Dist., ", "3 Wn. ", "App. ", "1, 472 P.2d 558 (1970). ", "In Clarkston, no negotiations or offers to purchase had taken place when the alleged slander occurred. ", "The court pointed out that the plaintiff had a mere expectation that a potential buyer would begin negotiations for the property, and thus had failed to establish the pending sale element. ", "Clarkston, 3 Wn. ", "App. ", "at 4.", "\n[5] The Douglases argue Edelstein's earnest money agreement is analogous to the anticipatory negotiations in Clarkston. ", "However, the evidence produced at trial shows the Edelstein offer went beyond a mere expectation of negotiations. ", "Edelstein made an offer to purchase the property, which he withdrew only when the title company verified the existence and effect of the Douglases' memorandum. ", "Further, Edelstein testified he would have purchased the property except for the encumbrance on the title.", "\n[6] The Douglases also contend the trial court erred in finding the element of malice was established. ", "The element of malice is met when the slanderous statement is not made in good faith or is not prompted by a reasonable belief in its veracity. ", "Brown v. Safeway Stores, Inc., 94 Wn.2d 359, 375, *861 617 P.2d 704 (1980). ", "The evidence at trial supported the court's finding that the Douglases were prompted to file the memorandum for the specific purpose of preventing the proposed sale of the property and with full knowledge no agreement existed.", "\n[7] Finally, the Respondents argue the trial court's method of calculating damages was improper. ", "The trial court heard evidence and awarded damages based on the interest incurred on the Petitioners' mortgage debt while the memorandum recorded by the Douglases remained on the title. ", "The Douglases offered no evidence to support an alternate method of calculating damages. ", "Evidence of damages is sufficient if it affords a reasonable basis for estimating the loss and does not subject the trier of fact to mere speculation or conjecture. ", "Haner v. Quincy Farm Chems., ", "Inc., 97 Wn.2d 753, 757, 649 P.2d 828 (1982). ", "Based on the evidence presented, the trial court's method provided a reasonably certain basis for determining damages under the facts of this case.", "\n\nII\nPetitioners request we overrule McGuinness v. Hargiss, 56 Wash. 162, 105 P. 233 (1909), which held \"attorney's fees, either as damages or costs, other than statutory, are not recoverable\". ", "McGuinness, 56 Wash. at 164-65. ", "We revisit the attorney fees argument for the first time in 85 years. ", "A review of analogous cases, recent decisions in other jurisdictions, and the Restatement (Second) of Torts, persuades us that McGuinness represents an outdated approach. ", "Therefore, we hold attorney fees are recoverable as special damages in a slander of title action.", "\n[8] It is well established that we adhere to the American rule, which states that absent a contract, statute, or recognized ground of equity, the prevailing party does not recover attorney fees as costs of litigation. ", "Haner, 97 Wn.2d at 757. ", "Nevertheless, we have also recognized \"certain circumstances\" where attorney fees should be recovered as damages. ", "State ex rel. ", "Macri v. Bremerton, 8 Wn.2d 93, 113, 111 P.2d 612 (1941).", "\n*862 In malicious prosecution and wrongful attachment or garnishment, we have held attorney fees are recoverable as special damages. ", "In malicious prosecution, it has long been the rule that damages include the attorney fees for the underlying action made necessary by the defendant's wrongful act. ", "Aldrich v. Inland Empire Tel. & ", "Tel. ", "Co., 62 Wash. 173, 176-77, 113 P. 264 (1911). ", "Similarly, in wrongful attachment or garnishment actions, and in actions to dissolve a wrongful temporary injunction, attorney fees are a \"necessary expense incurred\" in relieving the plaintiff of the wrongful attachment or temporary injunction, and are recoverable. ", "James v. Cannell, 135 Wash. 80, 83, 237 P. 8 (1925), aff'd, 139 Wash. 702 (1926); Cecil v. Dominy, 69 Wn.2d 289, 294, 418 P.2d 233 (1966).", "\n[9] Slander of title is analogous to these actions. ", "It is the defendant who by intentional and calculated action leaves the plaintiff with only one course of action: that is, litigation. ", "In malicious prosecution, wrongful attachment, and slander of title, the defendants actually know their conduct forces the plaintiff to litigate. ", "In addition, similar to malicious prosecution and wrongful attachment, actual damages are difficult to establish and often times are minimal in slander of title. ", "Fairness requires the plaintiff to have some recourse against the intentional malicious acts of the defendant.", "\nThe majority of jurisdictions that have considered the question in recent years have adopted this rule. ", "See, e.g., Rayl v. Shull Enters., ", "Inc., 108 Idaho 524, 700 P.2d 567 (1984); Summa Corp. v. Greenspun, 98 Nev. 528, 655 P.2d 513 (1982); Rogers v. Home Invs. ", "Fund, 10 Ill. App.3d 840, 295 N.E.2d 85 (1973); Dowse v. Doris Trust Co., 116 Utah 106, 208 P.2d 956 (1949). ", "The trend is to recognize that attorney fees and other legal expenses incurred in clearing the disparaged title are recoverable as damages in the common law action of slander of title. ", "James O. Pearson, Jr., Annotation, What Constitutes Special Damages in Action for Slander of Title, 4 A.L.R.4th 532, 560 (1981).", "\nFurthermore, the Restatement (Second) of Torts supports allowing recovery of attorney fees in a slander of title *863 action. ", "It describes slander of title as a form of the general tort of publication of an injurious falsehood. ", "Thus, the rules on liability for the publication of an injurious falsehood also apply to slander of title. ", "Restatement (Second) of Torts § 633 comment b (1977). ", "The Restatement provides:\n(1) The pecuniary loss for which a publisher of injurious falsehood is subject to liability is restricted to\n(a) the pecuniary loss that results directly and immediately from the effect of the conduct of third persons, including impairment of vendibility or value caused by disparagement, and\n(b) the expense of measures reasonably necessary to counteract the publication, including litigation to remove the doubt cast upon vendibility or value by disparagement.", "\n\n(Italics ours.) ", "Restatement (Second) of Torts § 633. ", "Attorney fees incurred in removing the cloud from the title and restoring vendibility are necessary expenses of counteracting the effects of the slander. ", "Restatement (Second) of Torts § 633.", "\n\nIII\nWe affirm on the issues of sufficiency of evidence and calculation of damages raised by the Douglases' cross petition. ", "We reverse the trial court on the issue of attorney fees, and remand for the purpose of determining and awarding as damages the attorney fees necessarily incurred in removing the cloud from the Rorvigs' title.", "\nUTTER, BRACHTENBACH, SMITH, and GUY, JJ., ", "concur.", "\nDOLLIVER, J. (concurring in part, dissenting in part)\nI concur in the conclusions reached by the majority in section I of its opinion. ", "I cannot concur, however, with its decision to overrule McGuinness v. Hargiss, 56 Wash. 162, 105 P. 233 (1909) and make attorney fees recoverable in a slander of title action. ", "As the majority recognizes, Washington has long followed the American rule that attorney fees are not recoverable as costs of litigation absent a contract, statute, or recognized ground of equity. ", "Majority, at 861. ", "The majority, *864 however, abandons this solid precedent and uses common law to expand the availability of attorney fees. ", "We have consistently left such decisions to the Legislature, and until the Legislature acts to change the current rule, I would adhere to the long-established precedent that attorney fees are not recoverable in a slander of title action. ", "Therefore, I dissent.", "\nANDERSEN, C.J., and MADSEN, J., concur with DOLLIVER, J.\n" ]
{ "pile_set_name": "FreeLaw" }
[ 0.020833333333333332, 0, 0, 0, 0.023809523809523808, 0, 0.03333333333333333, 0.02564102564102564, 0, 0.004672897196261682, 0, 0.003787878787878788, 0, 0.012048192771084338, 0.023809523809523808, 0.010526315789473684, 0.008130081300813009, 0.011235955056179775, 0.007874015748031496, 0.04, 0.02857142857142857, 0, 0, 0, 0, 0.03076923076923077, 0.014084507042253521, 0, 0.017857142857142856, 0, 0.038461538461538464, 0.018518518518518517, 0.013574660633484163, 0.0125, 0.010416666666666666, 0.018518518518518517, 0.020833333333333332, 0.02976190476190476, 0.008849557522123894, 0.023255813953488372, 0, 0.014184397163120567, 0.016574585635359115, 0.03773584905660377, 0.017241379310344827, 0.02127659574468085, 0.010752688172043012, 0.015873015873015872, 0.012658227848101266, 0, 0.010309278350515464, 0, 0.011494252873563218, 0.006779661016949152, 0.012658227848101266, 0.0071174377224199285, 0, 0, 0.058823529411764705, 0.058823529411764705, 0, 0, 0, 0, 0, 0.017857142857142856, 0.014492753623188406, 0.009302325581395349, 0.013513513513513514, 0.004651162790697674, 0, 0.01020408163265306, 0.014492753623188406, 0.020618556701030927, 0.012605042016806723, 0, 0.004739336492890996, 0.021505376344086023, 0, 0.012903225806451613, 0, 0.016129032258064516, 0, 0, 0, 0.009174311926605505, 0, 0.0051813471502590676, 0.010638297872340425, 0.0043859649122807015, 0, 0.021505376344086023, 0.03278688524590164, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008264462809917356, 0.008771929824561403, 0.0125, 0.009433962264150943, 0.009615384615384616, 0, 0.02631578947368421, 0.004424778761061947, 0.01020408163265306, 0.010752688172043012, 0.011235955056179775, 0, 0, 0, 0, 0.005154639175257732, 0, 0, 0.005847953216374269, 0, 0, 0.08333333333333333, 0, 0, 0.017543859649122806, 0, 0, 0.03125, 0, 0, 0, 0.014492753623188406, 0, 0, 0, 0, 0, 0, 0.029411764705882353, 0.032520325203252036, 0.01834862385321101, 0, 0.015625, 0, 0, 0, 0.018518518518518517, 0, 0, 0.02702702702702703, 0, 0.027777777777777776, 0.008, 0.004784688995215311, 0.023255813953488372, 0, 0.007352941176470588, 0.005681818181818182, 0, 0, 0, 0.008403361344537815, 0, 0.05172413793103448 ]
0.009809
5
[ "Introduction {#s1}\n============\n\nViral proteases play an important part both in the generation of mature viral proteins and in the modulation of cellular functions [@pone.0025699-Dougherty1], [@pone.0025699-Tong1]. ", "Three proteases have been described in different picornavirus species: 2A^pro^, L^pro^ and 3C^pro^ [@pone.0025699-Foeger1].This last protease, 3C^pro^, and its precursor 3CD^pro^, are present in all picornavirus species and are responsible for most proteolytic cleavages of the viral polyprotein . ", "The three proteases are capable of cis-autoproteolysis, by which they are excised from the viral polyprotein. ", "It seems reasonable to think that the main purpose of PV 2A^pro^ and FMDV L^pro^ is to modify cellular functions. ", "Indeed, both proteases bisect eIF4G at a position close to each other. ", "The cleavage site of PV 2A^pro^ on eIF4GI is located between amino acids 681--682 [@pone.0025699-Castello1]. ", "Bisection of eIF4G takes place soon after PV infection, leading to inhibition of cellular translation, while the bulk of PV proteins is synthesized at late times when virtually all eIF4G has been proteolyzed. ", "Thus, hydrolysis of eIF4G by PV 2A^pro^ inhibits the canonical mechanism of translation, which is cap-dependent and promotes a non-canonical mechanism in which eIF4E and cap recognition are not necessary [@pone.0025699-Castello1]. ", "Apart from this cleavage, PV 2A^pro^ can hydrolyze other cellular proteins, although the exact degradome for this protease has still not been defined. ", "Some of these hydrolytic events associated with PV 2A^pro^ involve the proteolysis of nucleoporins, thereby altering RNA and protein trafficking between nucleus and cytoplasm [@pone.0025699-Castello1]. ", "Therefore, PV 2A^pro^ blocks cap-dependent translation upon eIF4G cleavage and interferes with mRNA export to the cytoplasm; both events abolish cellular gene expression and abrogate cellular responses to viral infection.", "\n\nThe translation initiation factor eIF4G is a large polypeptide which can interact with several cellular and viral proteins. ", "Two forms of eIF4G encoded by two different genes are known, eIF4GI and eIF4GII [@pone.0025699-Gradi1]. ", "The exact functioning of each of these two forms in the process of translation remains unclear, although it has been suggested that these forms are functionally interchangeable. ", "Three regions have been distinguished in eIF4G, each of which harbours the interaction sites with several cellular proteins. ", "Binding of eIF4E and eIF4A to eIF4G gives rise to the formation of the eIF4F complex [@pone.0025699-Merrick1], [@pone.0025699-Sonenberg1]. ", "Interaction of eIF4F with mRNA may take place directly or indirectly. ", "Thus, eIF4E directly binds to the cap structure present at the 5′ end of mRNAs, while eIF4A unwinds the secondary structure of the mRNA leader sequence. ", "In addition, eIF4G itself interacts with picornavirus IRESs by means of its central domain [@pone.0025699-Belsham1], [@pone.0025699-deBreyne1], [@pone.0025699-Yanagiya1]. ", "Apart from these direct interactions of the eIF4F complex with mRNAs, eIF4G also interacts with eIF3 and PABP, both of which also can directly bind to mRNA. ", "Joining of the eIF4F complex to the 40S ribosomal subunit is mediated by the interaction between eIF4G and eIF3. ", "Therefore, during the initiation of translation, eIF4G plays a pivotal role as a scaffolding molecule organizing the architecture of different initiation factors, mRNA and the preinitiation complex [@pone.0025699-Merrick1], [@pone.0025699-Sonenberg1]. ", "The central role of eIF4G in mRNA translation makes it a key target for a variety of animal viruses. ", "Indeed, modulation of eIF4G activity by viral proteins may be essential for cytopathic viruses to control translation. ", "Calicivirus as well as some picornavirus and retrovirus species encode proteases that hydrolyze eIF4G during infection [@pone.0025699-Castello1], [@pone.0025699-Alvarez1], [@pone.0025699-Ventoso1], [@pone.0025699-Willcocks1]. ", "Alternatively, a number of viral proteins are able to interact with eIF4G, modulating its activity. ", "This is the case of rotavirus NSP3 [@pone.0025699-Piron1], influenza virus NS1 and PB2 [@pone.0025699-Aragon1], [@pone.0025699-Burgui1] and adenovirus 100 K protein [@pone.0025699-Xi1]. ", "Cleavage of eIF4G by picornavirus proteases 2A^pro^ or L^pro^ leads to the stimulation of IRES-driven translation [@pone.0025699-Castello1]. ", "Pestova and colaborators demonstrated that the central domain of eIF4G together with eIF4A interacts with EMCV IRES and promotes the formation of the preinitiation complex [@pone.0025699-Lomakin1], [@pone.0025699-Pestova1]. ", "Consistent with this finding, the C-terminal fragment or even the core domain of eIF4G suffices to promote IRES-driven translation both in vivo and in cell free systems [@pone.0025699-Hundsdoerfer1], [@pone.0025699-Kaiser1].", "\n\neIF4F activity is regulated in eukaryotic cells by extra- and intracellular signals through phosphorylation [@pone.0025699-Castello1]. ", "eIF4E activity is also controlled by phosphorylation by the protein kinase Mnk1 or by interaction with eIF4G, which is modulated by eIF4E binding proteins (4E-BPs) [@pone.0025699-Sonenberg1]. ", "Phosphorylation also represents the most important mechanism to regulate eIF2 activity. ", "Factor eIF2 is composed of three subunits, known as α, β and γ [@pone.0025699-Merrick1], [@pone.0025699-Pestova2]. ", "Several kinases target eIF2α leading to phosphorylation of Ser-51 residue. ", "The function of eIF2 is to bind Met-tRNA~i~ and GTP to form the ternary complex Met-tRNA~i~-eIF2-GTP, which interacts with the 40S ribosomal subunit, establishing the interaction between the initiator AUG codon with the anticodon present in Met-tRNA~i~ [@pone.0025699-Merrick1], [@pone.0025699-Sonenberg1]. ", "The hydrolysis of eIF2-bound GTP is promoted by eIF5, while the eIF5B--GTP complex facilitates recruitment of the 60S subunit to the 48S initiation complex. ", "This joining promotes that the translation initiation factors except for eIF5B--GTP and eIF1A are displaced. ", "The eIF2-GDP complex is recycled to eIF2-GTP by the activity of the recycling factor eIF2B. Phosphorylation of eIF2α impairs the GDP-GTP recycling catalyzed by eIF2B. Therefore, the ternary complex Met-tRNA~i~ -eIF2-GTP is not generated and thus, binding of this complex to the 40S ribosome is hampered. ", "Even partial phosphorylation of eIF2 can lead to substantial abrogation of translation. ", "Some reports suggested that this factor remained unphosphorylated after poliovirus (PV) infection [@pone.0025699-Ransone1], [@pone.0025699-Ransone2], while other workers found substantial eIF2 phosphorylation under the same conditions after PV infection, particularly at late times [@pone.0025699-Black1], [@pone.0025699-ONeill1]. ", "Of interest, Protein Kinase R (PKR) becomes highly activated, yet it is hydrolyzed in PV-infected cells although this hydrolysis is not directly executed by any of the PV proteases (2A or 3C) [@pone.0025699-Black1], [@pone.0025699-ONeill1], [@pone.0025699-Black2]. ", "All these findings pointed to the idea that active eIF2 was necessary to sustain picornavirus translation. ", "In contrast to this idea, we described recently that several picornaviruses do not require active eIF2 at late times of infection [@pone.0025699-Welnowska1], similar findings have been reported for PV-infected cells [@pone.0025699-White1]. ", "In the present work we provide evidence that cleavage of eIF4G by PV 2A^pro^ in mammalian cells modifies the requirement for eIF2 in translation directed by picornavirus IRESs. ", "Thus, cleavage of eIF4G by PV 2A^pro^ establishes a mechanism for IRES-driven translation that is cap- and eIF2 independent. ", "These unexpected findings indicate that PV 2A ^pro^ induces eIF2 independence IRES-driven translation by a mechanism that is still unknown.", "\n\nResults {#s2}\n=======\n\nDual mode for translation of PV RNA {#s2a}\n-----------------------------------\n\nSome viral mRNAs, when they are translated in virus-infected cells, have different requirements for eIFs as compared to cell-free systems or transfected cells [@pone.0025699-Garrey1], [@pone.0025699-Sanz1]. ", "This is the case of Sindbis virus 26S mRNA, which does not require intact eIF4G [@pone.0025699-Castello2] or active eIF2 [@pone.0025699-Ventoso2] for translation in the infected cells, whereas these eIFs are necessary to initiate protein synthesis on this viral mRNA in cell-free systems [@pone.0025699-Sanz1]. ", "Although it is generally accepted that picornavirus RNA needs eIF2 to initiate translation, there is some evidence that this factor can be phosphorylated at late times of infection [@pone.0025699-ONeill1], [@pone.0025699-Neznanov1]. ", "Indeed, recently we found that several picornaviruses exhibit this dual mode for translation of the viral mRNA [@pone.0025699-Welnowska1]. ", "So we hypothesized that this factor might be dispensable at late times in the PV life cycle, when the bulk of viral proteins are being synthesized. ", "To test this possibility, eIF2 was inactivated by treating culture cells with Ars to induce phosphorylation of eIF2α. ", "This compound induces oxidative stressand has been widely used to inactivate eIF2 [@pone.0025699-Fernandez1], [@pone.0025699-Terenin1], [@pone.0025699-Wehner1]. ", "A PV replicon (pRLuc31) containing the luciferase (luc) gene replacing the viral structural proteins was used [@pone.0025699-Andino1]. ", "As controls, cells were also electroporated with Cap-luc or CrPV IGR-luc mRNAs [@pone.0025699-Welnowska1], [@pone.0025699-White1] and at 1 hpe cells were treated with different concentrations of Ars (0, 50, 100 and 200 µM) for 1 h. Electroporation of these RNAs into BHK-21 cells gives rise to luc synthesis from the beginning of transfection. ", "This early luc synthesis was produced by translation of the input RNA and was drastically blocked by Ars treatment in the case of PV replicon to an extent similar to that found with a capped mRNA whereas CrPV IGR-luc was inhibited by only 20% ([Figure 1A](#pone-0025699-g001){ref-type=\"fig\"}). ", "At 7 hours post transfection (hpt), PV proteins can be detected by radioactive labelling because cellular protein synthesis is abrogated. ", "Notably, Ars treatment has little inhibitory effect on the translation of PV RNA, whereas translation of cellular mRNAs was blocked by about 90% under the same conditions ([Figure 1B](#pone-0025699-g001){ref-type=\"fig\"}). ", "It should be noted that Ars interferes with the cleavage of the PV polyprotein as already observed [@pone.0025699-Welnowska1], [@pone.0025699-White1]. ", "Certainly, Ars treatment led to eIF2α phosphorylation, both in control and in PV RNA transfected cells. ", "Of interest was that phosphorylation of eIF2α was also found in PV-replicating cells in the absence of Ars ([Figure 1C](#pone-0025699-g001){ref-type=\"fig\"}, middle panel). ", "In addition, cleavage of eIF4G was progressively observed along the PV replication cycle ([Figure S1B](#pone.0025699.s001){ref-type=\"supplementary-material\"}, upper panel). ", "Analysis of eIF2α phosphorylation throughout the time course of PV replication provides evidence that this factor became phosphorylated at times when PV protein synthesis was maximal and eIF4G had been cleaved ([Figure S1A](#pone.0025699.s001){ref-type=\"supplementary-material\"}). ", "These findings demonstrate that PV RNA exhibits a dual mechanism for the initiation of translation as regards the participation of eIF2. ", "At early times, before viral RNA replication has occurred, active eIF2 is required to translate PV RNA, whereas this factor is dispensable at late times when massive production of viral proteins is taking place.", "\n\n![", "Effect of eIF2 phosphorylation induced by Ars on PV protein synthesis.\\\nA) Cap-luc, PV replicon-luc or CrPV IGR-luc mRNAs synthesized *in vitro* by T7 RNA polymerase were electroporated in BHK-21 cells and seeded in DMEM (10% FCS). ", "Different amounts of Ars (0, 50, 100 and 200 µM) were added and cells were incubated for 60 min before harvesting to analyze luc. ", "Error bars indicate standard deviations (SD) obtained from three measurements of each sample. ", "B) BHK-21 cells were electroporated with RNA of PV replicon. ", "At 7 hpe cells were treated with different concentrations of Ars and labelled with \\[^35^S\\]Met/Cys for 45 minutes. ", "Samples were analyzed by SDS-PAGE (17.5%) followed by fluorography and autoradiography. ", "Arrows indicate viral proteins. ", "C) eIF4GI, eIF2α and phosphorylated eIF2α were detected by western blot.](pone.0025699.g001){#pone-0025699-g001}\n\nAnalysis of PV non-structural proteins that confer eIF2 independence for viral RNA translation {#s2b}\n----------------------------------------------------------------------------------------------\n\nSince the PV replicon tested above only encodes PV non-structural proteins in addition to luc, we reasoned that perhaps extensive individual expression of each PV non-structural protein might establish conditions similar to those observed during PV replication. ", "Under these conditions of high PV protein synthesis, active eIF2 might not be necessary to translate PV RNA. ", "Moreover, it may be that synthesis of a single PV protein was able to confer eIF2-independence for IRES-driven translation. ", "To test this possibility, the system used was the BHKT7 cell line, which stably expresses T7 RNA polymerase. ", "Although this polymerase is devoid of capping activity, transfection of plasmids encoding different PV non-structural proteins under the control of a T7 promoter gives rise to extensive translation of mRNAs bearing a picornavirus IRES sequence. ", "The different pTM1 constructs encoding for each PV non-structural protein were transfected into BHKT7 cells and the synthesis of PV proteins was analyzed by radioactive labelling in presence or absence of Ars ([Figure 2A](#pone-0025699-g002){ref-type=\"fig\"}), as well as by western blot ([Figure 2B](#pone-0025699-g002){ref-type=\"fig\"}). ", "As shown in [Figure 2A](#pone-0025699-g002){ref-type=\"fig\"}, all PV proteins can be clearly detected by radioactive labelling in absence of Ars. ", "Strikingly, PV 2A^pro^ is extensively synthesized even in the presence of Ars, when eIF2α has become phosphorylated. ", "Thus, Ars inhibited cellular translation more than 90%, whereas the synthesis of PV 2A^pro^ was blocked by only 35% ([Figure 2C](#pone-0025699-g002){ref-type=\"fig\"}). ", "The inhibition of the other PV non-structural proteins by Ars treatment was around 80% ([Figure 2C](#pone-0025699-g002){ref-type=\"fig\"}) and in some cases such as 2B, 3A and 3C their synthesis was almost undetectable ([Figure 2A](#pone-0025699-g002){ref-type=\"fig\"}). ", "Therefore, the expression of one individual PV protein, 2A^pro^, can confer independence from active eIF2 for picornavirus--IRES-driven translation.", "\n\n![", "Individual expression of PV non structural proteins.\\\nAction of eIF2 phosphorylation. ", "BHKT7 cells were transfected with pTM1 plasmids encoding different PV non-structural proteins and were(+) or were not(−) treated with Ars. ", "A) After 2 hpt cells were pre-treated with 200 µM Ars for 15 minutes and then labelled with \\[^35^S\\]Met/Cys for 45 minutes in presence of the inhibitor. ", "Then, samples were processed by SDS-PAGE (17.5%), fluorography and autoradiography. ", "Western blot of total eIF2α and phosphorylated eIF2α using the same samples is shown at the bottom of this panel. ", "B) PV non-structural proteins were detected by western-blot. ", "C) The percentage of actin (\\*) and each PV protein synthesis was estimated by densitometric scanning of the corresponding band (arrows) from three independent experiments. ", "Error bars indicate SD.](pone.0025699.g002){#pone-0025699-g002}\n\nTranslation of mRNAs containing different picornavirus IRESs in the presence of 2A^pro^: Requirement for active eIF2α {#s2c}\n---------------------------------------------------------------------------------------------------------------------\n\nOur next goal was to assess whether PV 2A^pro^ was able to confer eIF2 independence *in trans* for the translation of other mRNAs bearing a picornavirus IRES. ", "To this end, the synthesis of luc directed by EMCV-, PV- and HAV-IRES was tested in the presence or absence of Ars, when culture cells did or did not co-express PV 2A^pro^. The synthesis of this protease in culture cells rescues the inhibition of Ars by about 70% when EMCV or PV IRESs are tested ([Figure 3A](#pone-0025699-g003){ref-type=\"fig\"}). ", "Notably, translation driven by HAV IRES is abolished when co-expressed with PV 2A^pro^ in presence or absence of Ars. ", "These results agree well with previous studies indicating that HAV IRES requires the intact form of eIF4F for functionality [@pone.0025699-Ali1], [@pone.0025699-Borman1], [@pone.0025699-Whetter1]. ", "Similar results were obtained in the human hepatoma Huh7-T7 cell line ([Figure S2](#pone.0025699.s002){ref-type=\"supplementary-material\"}). ", "Therefore, translation of luc mRNA bearing different picornavirus IRESs is hampered when eIF2α phosphorylation is induced by Ars. ", "Of interest, PV 2A^pro^ is able to confer translatability to EMCV and PV IRESs, but not to HAV IRES under these conditions.", "\n\n![", "Inhibition of translation directed by PV or EMCV IRES by Ars.\\\nRescue by PV 2A^pro^. A) BHKT7 cells were transfected with plasmids containing EMCV IRES-luc, PV IRES-luc or HAV IRES-luc alone or co-transfected with pTM1-2A. At 2 hpt cells were treated or not with Ars for 1 hour. ", "Then, cells were harvested and lysated in luciferase buffer and luc activity was measured (as described in [Materials and Methods](#s4){ref-type=\"sec\"}) and represented from at least three independent experiments. ", "Error bars indicate standard deviation (SD). ", "B) eIF4GI, eIF2α and phosphorylated eIF2α were detected by western blot.](pone.0025699.g003){#pone-0025699-g003}\n\nIn addition to Ars, there are other treatments for inducing phosphorylation of eIF2α, such as incubation of culture cells with hypertonic medium or Thapsigargin (Tg) [@pone.0025699-Garrey1], [@pone.0025699-Novoa1]. ", "To assay the effect of these treatments on IRES-directed translation, BHKT7 cells were transfected with pTM1-luc, pTM1-2A or co-transfected with pTM1-luc and pTM1-2A. Extensive inhibition of cellular translation was observed when cells were treated either with Ars, hypertonic medium or both ([Figure 4A](#pone-0025699-g004){ref-type=\"fig\"}). ", "Inhibition of luc synthesis also occurs when pTM1-luc is transfected alone. ", "However, when PV 2A^pro^ is synthesized under these conditions, significant levels of IRES-2A translation are detected ([Figure 4A](#pone-0025699-g004){ref-type=\"fig\"}). ", "Hypertonic medium promotes eIF2α phosphorylation, particularly when combined with Ars ([Figure 4B](#pone-0025699-g004){ref-type=\"fig\"}). ", "A similar conclusion can be drawn when cells are transfected with pTM1-2A and treated with Tg ([Figure 4C](#pone-0025699-g004){ref-type=\"fig\"}) or with dithiothreitol (results not shown). ", "These findings support the idea that translation of IRES-2A mRNA is resistant to different compounds and treatments that induce phosphorylation of eIF2α when high levels of PV 2A^pro^ are synthesized.", "\n\n![", "Effect of different inducers of eIF2α phosphorylation on IRES-driven translation.\\\nA) BHKT7 cells were transfected with pTM1-luc, pTM1-2A or both. ", "At 2 hpt cells were pretreated with Ars(−/+), NaCl(+/−) or both(+/+) for 15 minutes and then labelled with \\[^35^S\\]Met/Cys for 45 minutes in presence of the inhibitors. ", "After labelling, the proteins were analyzed by SDS-PAGE(17.5%), fluorography and autoradiography. ", "B) Western blot analysis of samples from panel A using anti-eIF4GI, anti-Luc, anti-phosphorylated eIF2α and anti-total eIF2 antibodies. ", "C) Cells were mock transfected or transfected with pTM1-2A. At 2 hpt cells were pretreated with 1 µM Tg or additional 120 mM NaCl or both for 15 minutes and then were labelled with \\[^35^S\\]Met/Cys for 45 minutes in presence of the inhibitors. ", "After labelling, proteins were analyzed by SDS-PAGE, fluorography and autoradiography. ", "Numbers below each lane indicate the percentage of cell protein (\\*) and PV 2A^pro^ synthesis in cells treated with inhibitor compared with untreated cells quantified by densitometry of the corresponding bands. ", "A western blot using antibodies against eIF2α and phosphorylated eIF2α was performed.](pone.0025699.g004){#pone-0025699-g004}\n\nPV infection induces partial PKR degradation, as well as its phosphorylation which correlates with increased eIF2α phosphorylation as infection progresses. ", "To test whether PV 2A^pro^ expression diminished the amount of PKR in our culture cells, a western blot analysis was carried out using specific antibodies against PKR. ", "The levels of this enzyme were similar in cells that either did or did not express PV 2A^pro^ ([Figure S3](#pone.0025699.s003){ref-type=\"supplementary-material\"}).", "\n\nProteolytic activity of PV 2A^pro^ is necessary to confer eIF2 independence {#s2d}\n---------------------------------------------------------------------------\n\nNext, we wished to examine the effect of eIF2 phosphorylation on IRES-driven translation when eIF4G remained uncleaved. ", "To this end, a PV 2A^pro^ variant bearing a point mutation (G60R) devoid of eIF4G cleavage activity [@pone.0025699-Barco1], [@pone.0025699-Ventoso3] was employed. ", "In this case, plasmid pTM1-2C was co-transfected with pTM1-2A or pTM1-2A (G60R). ", "As a control, the same constructs were expressed alone. ", "PV 2A^pro^ and 2C synthesis were analyzed both in the presence or absence of Ars. ", "Cellular translation was abolished by Ars, as well as the synthesis of PV 2C and PV 2A (G60R) ([Figure 5A](#pone-0025699-g005){ref-type=\"fig\"}). ", "By contrast, PV proteins 2C and 2A^pro^ are still synthesized in presence of Ars, when PV 2A^pro^ is expressed alone or when PV 2C is co-expressed with PV 2A^pro^. The labelled proteins separated by SDS-PAGE were quantified by densitometric analyses ([Figure 5C](#pone-0025699-g005){ref-type=\"fig\"}). ", "Synthesis of PV 2C was inhibited by only 30--35% in presence of Ars and PV 2A^pro^, while this inhibition was of 85--90% when 2A^pro^ (G60R) was present ([Figure 5C](#pone-0025699-g005){ref-type=\"fig\"}, lower graphs). ", "This result indicates that the presence of high levels of 2A^pro^ in the absence of eIF4G cleavage does not induce eIF2 independence for IRES-directed translation.", "\n\n![", "Proteolytic activity is necessary for eIF2α independent translation.\\\nBHKT7 cells were transfected or co-transfected with either pTM1-2A or pTM1-2A G60R, which encodes for an inactive 2A^pro^, and pTM1-2C. A) At 2 hpt cells were treated with different Ars concentrations and incubated with \\[^35^S\\]Met/Cys for 45 minutes. ", "Samples were analyzed by SDS-PAGE (17.5%), fluorography and autoradiography. ", "B) eIF4GI, phosphorylated eIF2α and total eIF2α of the same samples were detected by western blot. ", "C) The percentage of cellular and viral protein synthesis, measured by densitometric scanning of the corresponding band from at least three independent experiments, is shown. ", "Upper panels show the synthesis of actin (representing cellular protein synthesis), 2A wt, 2C and 2A G60R when they are expressed by separate. ", "Lower panels show the synthesis of PV 2C protein alone, either in presence of 2A wt or in presence of 2A G60R. All data are shown as the mean ±SD of at least three independent experiments. ", "D) BHKT7 cells were first transfected with IRES-2A mRNA. ", "After 2 hpt, cell monolayers were washed and incubated in fresh medium (DMEM plus 5% FCS) for 1 h to accomplish the cleavage of eIF4G. Then, pTM1-luc was transfected during 2 h, afterwards transfection medium was removed and cells were incubated in fresh medium and after 15 minutes were treated or not with 200 µM Ars during 1 h . ", "Finally, cell monolayers were harvested in luciferase buffer and luc activity was measured and represented. ", "E) Cleavage of eIF4GI of the samples used in panel D was detected by western blot.](pone.0025699.g005){#pone-0025699-g005}\n\nAnother approach to abolishing eIF4G cleavage is to use PV 2A^pro^ inhibitors. ", "Addition of methoxysucciniyl-Ala-Ala-Pro-Val-chloromethylketone (MPCMK) strongly blocks cleavage of eIF4G [@pone.0025699-Molla1] even when high levels of PV 2A^pro^ are synthesized in BHKT7 cells. ", "The presence of this 2A^pro^ inhibitor abolishes eIF2 independence for translation of picornavirus IRES (see below). ", "In conclusion, cleavage of eIF4G (together with other putative cellular protein (s)) accomplished by active 2A^pro^ is necessary for this phenomenon.", "\n\nCleavage of eIF4G is not sufficient to provide eIF2-independent translation {#s2e}\n---------------------------------------------------------------------------\n\nThe only known direct effect of PV 2A^pro^ on translation is that this protease cleaves eIF4G, leading to stimulation of picornavirus RNA translation [@pone.0025699-Belsham1]. ", "Thus, it is possible that eIF2-independent translation is the consequence of the generation of the two eIF4G fragments after bisection by PV 2A^pro^. Alternatively, it is possible that in addition to eIF4G, other host proteins could be hydrolyzed by this protease providing eIF2-independent translation. ", "Moreover, the presence of PV 2A^pro^ itself could be necessary, and in this scenario 2A might play an IRES trans-acting role. ", "To distinguish between these possibilities different experiments were conducted. ", "Initially, we tested the effect of Ars on EMCV IRES-driven translation in the presence of low or high levels of PV 2A^pro^. Low amounts of this protease are produced in cells when in vitro synthesized IRES-2A mRNA is transfected [@pone.0025699-Castello3], whereas high levels of 2A^pro^ are found in culture cells using the system described in this work. ", "Under both conditions, eIF4G becomes extensively cleaved. ", "Addition of Ars to cell cultures transfected with IRES 2A mRNA and later with plasmid encoding IRES-luc (pTM1-luc) profoundly blocked translation, irrespective of whether or not PV 2A^pro^ was present ([Figure 5D](#pone-0025699-g005){ref-type=\"fig\"}). ", "Under those conditions, eIF4G was almost totally cleaved and both eIF4G fragments were present ([Figure 5E](#pone-0025699-g005){ref-type=\"fig\"}), but the levels of 2A^pro^ are low and do not confer eIF2-independence. ", "By contrast, when high amounts of PV 2A^pro^ are synthesized in BHKT7 cells, Ars has little inhibitory effect on EMCV IRES-driven translation. ", "These findings support the notion that the presence of eIF4G fragments (or the cleavage of other cellular proteins) is necessary but not sufficient to confer eIF2 independence for picornavirus IRES-driven translation.", "\n\nTo provide further support for this conclusion, the two eIF4G fragments generated by PV 2A^pro^ cleavage were synthesized in BHKT7 cells by transfection of the corresponding pTM1 plasmids. ", "These two fragments correspond to the cleavage products of eIF4G accomplished by PV 2A^pro^. The synthesis of each fragment was detected by immunoblotting ([Figure 6B](#pone-0025699-g006){ref-type=\"fig\"}). ", "Synthesis of luc from EMCV -luc was sensitive to Ars even when cells expressed either of the eIF4G fragments ([Figure 6A](#pone-0025699-g006){ref-type=\"fig\"}). ", "A densitometric analysis of the corresponding products synthesized is represented in [Figure 6C](#pone-0025699-g006){ref-type=\"fig\"}. ", "The inhibition of luc synthesis by Ars is around 40% when PV 2A^pro^ is present but is greater than 80% when luc is expressed either alone or with the N-terminal or C-terminal fragments of eIF4GI. ", "In conclusion, the idea that the C-terminus fragment of eIF4GI interacts with EMCV IRES thereby allowing mRNA to be translated without eIF2 is not supported by these results. ", "In fact, we demonstrate that high levels of PV 2A^pro^ must be present to translate picornavirus RNA when eIF2α is phosphorylated.", "\n\n![", "Influence on IRES-directed translation of expression of eIF4G fragments.\\\npTM1-luc was co-transfected with a combination of the next plasmids: pTM1-2A , pTM1-eIF4Gnt and pTM1-eIF4Gct. ", "A) At 2 hpe cells were pre-treated with 200 µM Ars for 15 minutes and then labelled with \\[^35^S\\]Met/Cys for 45 minutes in presence of the inhibitor. ", "Samples were processed by SDS-PAGE (17.5%) followed by fluorography and autoradiography. ", "B) The amount of eIF4GI, eIF2α and phosphorylated eIF2α of the samples were detected by western blot. ", "C) The percentage of luc synthesis, measured by densitometric scanning of the corresponding band, was represented. ", "Error bars indicate SD from at least two independent experiments. ", "D) BHKT7 cells were co-transfected with pTM1-luc and either pTM1-2A wt or pTM1-2A G60R. To each mixture, plasmid expressing c-terminal fragment of eIF4GI was or was not added. ", "At 3 hpt samples were first pretreated with Ars for 15 minutes and then radiolabeled with \\[^35^S\\]Met/Cys for 45 minutes and were or were not treated with Ars. ", "Samples were then processed by SDS-PAGE (17.5%) followed by fluorography and autoradiography. ", "E) eIF4GI, eIF2α and phosphorylated eIF2α were detected by western blot. ", "F) The percentage of luc synthesis, measured by densitometric scanning of the corresponding band, was represented. ", "Error bars indicate SD from at least three independent experiments.](pone.0025699.g006){#pone-0025699-g006}\n\nIn addition, we tested whether the presence of high levels of both the inactive mutant 2A G60R and the carboxy fragment of eIF4G can switch translation to an eIF2-independent mode. ", "When PV 2A^pro^ is or is not synthesized together with the C-fragment of eIF4GI, Ars has little effect on translation driven by EMCV IRES ([Figure 6D](#pone-0025699-g006){ref-type=\"fig\"}). ", "In fact, the synthesis of the C-terminal fragment of eIF4G is stimulated when co-expressed with PV 2A^pro^. The percentage of luc synthesis is about 70% in presence of Ars when is co-expressed with PV 2A^pro^ with or without the eIF4GI C terminal fragment ([Figure 6F](#pone-0025699-g006){ref-type=\"fig\"}). ", "However, luc synthesis is notably diminished by Ars to around 20% when luc is synthesized either with PV 2A (G60R) alone or with PV 2A (G60R) together with the C-terminal fragment of eIF4GI. ", "These observations indicate that to achieve resistance to eIF2 phosphorylation, both the cleavage of eIF4G (or other cellular protein (s)) and the synthesis of high levels of active PV 2A^pro^ are necessary.", "\n\nTwo possibilities can be envisaged to account for the above findings. ", "One is that PV 2A^pro^ cleaves a putative cellular protein other than eIF4G when present at high levels. ", "This putative cleavage would be necessary to confer eIF2 independence. ", "Another possibility is that active 2A^pro^ must be present to observe this phenomenon. ", "To distinguish between these two possibilities, cells were transfected with pTM1-2A and after 1 h of incubation, when eIF4G and other putative cellular proteins had been cleaved, pTM1-luc was transfected in the presence or absence of MPCMK, which is an inhibitor of the proteolytic activity of 2A^pro^ ([Figure 7A](#pone-0025699-g007){ref-type=\"fig\"}) . ", "Addition of this inhibitor, even after PV 2A^pro^ has exerted its proteolytic activity renders IRES-driven translation dependent on active eIF2 ([Figure 7B](#pone-0025699-g007){ref-type=\"fig\"}). ", "These findings therefore demonstrate that cleavage of other putative cellular protein is not involved in this phenomenon. ", "In conclusion, both cleavage of eIF4G and active PV 2A^pro^ are required to render IRES driven translation independent of eIF2.", "\n\n![", "Active PV 2A^pro^ is necessary for eIF2 independence.\\\nA) BHKT7 cells were transfected or not with pTM1-2A and at the same time, in the mixture of transfection, cells were incubated without or with (−/+) 750 µM MPCMK. ", "The transfection mixture was removed and cell monolayers were incubated for 1 h with or without (−/+) the inhibitor. ", "To analyze the inhibitory effect on the proteolytic activity of PV 2A^pro^, eIF4GI was detected by western blot. ", "B) BHKT7 cells were transfected with pTM1-2A. After, cell cultures were incubated for 1 h at 37°C, then cells were transfected with pTM1-luc for 30 minutes. ", "Afterwards, transfection mixture was removed and cells were incubated with or without 750 µM MPCMK (+/−), with 200 µM Ars (−/+) or both of them (+/+) for 1 h. Finally, cells were harvested and lysated in luciferase buffer and luc activity was measured and represented from at least three independent experiments. ", "Error bars indicate SD. ", "C) The samples obtained in panel B were used to examine eIF4GI by western blot. ", "Phosphorylated eIF2α also was detected by western blot.](pone.0025699.g007){#pone-0025699-g007}\n\nDiscussion {#s3}\n==========\n\nProgressive inactivation of eIF2 by phosphorylation takes place upon infection of culture cells with some PV variants and other picornaviruses [@pone.0025699-Ransone2], [@pone.0025699-ONeill1], [@pone.0025699-Neznanov1]. ", "This eIF2 inactivation was previously thought to play a role in the abrogation of cellular and viral protein synthesis at late times of infection, since the prevailing idea was that picornavirus RNA translation needs active eIF2. ", "Our present data demonstrate that significant phosphorylation of eIF2α is found in PV-replicating cells from about 3 hpi. ", "Moreover, induction of substantial eIF2 phosphorylation by Ars has little effect on PV protein synthesis, while cellular translation is drastically abolished under these conditions. ", "Our present results are in good agreement with recent findings indicating that several picornaviruses, including PV, can translate their mRNA when eIF2α is phosphorylated at late times of infection [@pone.0025699-Welnowska1], [@pone.0025699-White1]. ", "The claim that cleavage of eIF5B by PV 3C^pro^ as responsible for eIF2-independent translation [@pone.0025699-White1] is not supported by our results illustrating that upon the individual expression of each PV protein only 2A^pro^ is endowed with this activity. ", "If this is so, the mechanism of picornavirus RNA translation may be more similar to the situation reported for flaviviruses, since translation of their viral RNAs may not use eIF2, when this factor is absent [@pone.0025699-Terenin1], [@pone.0025699-Lukavsky1], [@pone.0025699-Skabkin1]. ", "We also have demonstrated that the individual expression of PV 2A^pro^, but not other PV non-structural proteins, is sufficient to render picornavirus IRES-driven translation independent for active eIF2. ", "This effect is observed both in *cis* and in *trans* on mRNAs bearing picornavirus IRES elements. ", "These mRNAs are little affected upon phosphorylation of eIF2 induced by different inhibitors when high levels of PV 2A^pro^ are synthesized.", "\n\nPV 2A^pro^ is a multifunctional protease that targets a number of cellular processes, including translation [@pone.0025699-Castello1], [@pone.0025699-Hambidge1]. ", "Indeed, this viral protease bisects eIF4G thereby disrupting cap-dependent translation of the vast majority of cellular mRNAs. ", "By contrast, this modification of eIF4G enhances PV protein synthesis [@pone.0025699-Belsham1]. ", "Most evidence indicated that simple cleavage of eIF4G is not sufficient for this stimulation [@pone.0025699-Kaiser1], [@pone.0025699-Roberts1]. ", "Indirect evidence points to a direct activity of 2A^pro^ in PV RNA translation [@pone.0025699-Hambidge1], [@pone.0025699-Macadam1], thus the actual presence of 2A^pro^ together with cellular protein cleavage would be necessary to stimulate IRES-driven translation. ", "The C-terminal fragment of eIF4G is able to replace the entire factor in cell free systems [@pone.0025699-Lomakin1]. ", "However, overexpression of this fragment in intact cells does not stimulate picornavirus IRES-driven translation [@pone.0025699-Kaiser1], [@pone.0025699-Roberts1], [@pone.0025699-DeGregorio1]. ", "Consistent with these findings, our present observations indicate that the expression of either the N-or C-terminus fragments of eIF4G in our system does not stimulate translation directed by EMCV IRES. ", "Our findings support the concept that for eIF2 independence during initiation of IRES-containing mRNAs, both cellular protein cleavage and the presence of high levels of PV 2A^pro^ are necessary.", "\n\nIt is most striking that after several decades of studies on the mechanism of picornavirus translation, the possibility that eIF2 may not participate in this process has not been uncovered. ", "It is generally thought that translation on picornavirus RNA requires active eIF2 [@pone.0025699-Pestova2]. ", "This mechanism has been supported by many studies using cell free systems. ", "However, to our knowledge the idea that eIF2 might not participate in the initiation of translation of PV RNA in the infected cells has not been investigated. ", "Notably, PV translation is blocked by Ars during the early period of infection, supporting the notion that PV RNA exhibits a dual mode for its translation, as occurs for instance with Sindbis virus 26S mRNA [@pone.0025699-Sanz1]. ", "Therefore, PV RNA may follow two different mechanisms for the initiation of translation: one canonical mechanism using entire eIF4G and eIF2 early during infection and another mechanism at the late phase of the virus life cycle. ", "This last mechanism does not require intact eIF4G or active eIF2. ", "Remarkably, the presence of PV 2A^pro^ alone suffices to provide independence from active eIF2.", "\n\nThe new and unsuspected findings that the translation of mRNAs bearing picornavirus IRESs takes place when eIF2 has been inactivated by phosphorylation open a future area for research in the field of picornavirus translation. ", "In addition, the fact that PV 2A^pro^ can switch picornavirus RNA translation from an eIF2 dependent mechanism to a different mode of initiation establishes the first molecular basis for this phenomenon. ", "Future work will target the elucidation of potential cellular proteins or factors that can replace eIF2 during picornavirus RNA translation. ", "It is even possible that in the infected cells or in the presence of PV 2A^pro^ the IRES structure is sufficient to signal the initiation codon in a way akin to that described for Cricket paralysis virus IGR IRES [@pone.0025699-Deniz1], [@pone.0025699-Wilson1]. ", "Several reports have appeared about the potential replacement of eIF2 by other cellular proteins for the translation of hepatitis C virus (HCV) RNA [@pone.0025699-Skabkin1], [@pone.0025699-Dmitriev1], but these experiments have always been carried out in *in vitro* systems in the absence of any viral protein. ", "Some authors believe that eIF5B can replace eIF2 for the translation of HCV RNA in reconstituted cell free systems [@pone.0025699-Terenin1]. ", "A recent report suggests that ligatin (also known as eIF2D) could replace eIF2 for HCV, but not EMCV RNA translation [@pone.0025699-Skabkin1]. ", "Although cell free systems have been very useful for unravelling the mechanisms of protein synthesis, they may provide some artefacts. ", "Therefore, the observations found in *in vitro* systems must be contrasted with the situation present in intact cells and in virus-infected cells.", "\n\nMaterials and Methods {#s4}\n=====================\n\nCell Cultures {#s4a}\n-------------\n\nBaby Hamster Kidney (BHK-21 and clon BSR-T7/5, designated as BHKT7) cells [@pone.0025699-Buchholz1] and Huh7-T7 (Human Hepatoma,) were used in this work. ", "Cells were grown at 37°C in Dulbecco\\'s Modified Eagle\\'s Medium (DMEM) supplemented with 5% or 10% fetal calf serum (FCS) and non-essential amino acids. ", "Cells BHKT7 were additionally provided with Geneticin G418 (Sigma) on every third passage at a final concentration of 2 mg ml^−1^ cell culture medium. ", "For Huh7-T7 cells the medium was supplemented with Zeocin (5 µM).", "\n\nPlasmids and transfections {#s4b}\n--------------------------\n\nThe pTM1-derived plasmids containing the poliovirus proteins were described in detail earlier [@pone.0025699-Ventoso3], [@pone.0025699-Aldabe1], [@pone.0025699-Aldabe2], [@pone.0025699-Aldabe3] . ", "The constructs pKs.", "Luc and pTM1-luc have been already described [@pone.0025699-Sanz2]. ", "The pTM1-eIF4GInt and pTM1-eIF4GIct were constructed using the pcDNA3 HAeIF4G-I [@pone.0025699-Gradi1] as DNA template. ", "In the case of N-terminal fragment, were used the primers 5′NcoI4GInt: GCGCGCCCCATGGCCACGCCTTCTCAG and 3′BclI4GInt: GCGCTGATCATTAGCCAAGGTTGGCCAAG and, in the case of C-terminal the primers used were 5′EcoRI4GIct: GCGCGCAAATTCGGACAACCCTTAGC and 3′BclI4GIct: CCGCTGATCAGTTGTGGTCAGACTCCTCC. ", "The PCR products were digested with NcoI/BclI or EcoRI/BclI respectively and inserted into the pTM1, previousy digested with the same enzymes. ", "BHKT7 cells were transfected using Lipofectamine 2000 (Invitrogen). ", "Cells were transfected or co-transfected with 1 µg of plasmid DNA or a mixture comprising 1 µg of each plasmid; in the case of RNA transfection, 2 µg of 2A mRNA were added plus 2 µl of Lipofectamine per well in Opti-mem medium (Invitrogen) for 2 hours at 37°C. ", "After 2 hours, Lipofectamine was removed, and the cells were supplemented with fresh medium containing 5% FCS. ", "BHK-21 cells were electroporated with *in vitro* synthesized mRNAs using as DNA templates the PV replicon, pKS.Luc or T7 Rluc ΔEMCV IGR-Fluc (this plasmid was employed to obtain CrPV IGR-luc mRNA). ", "To obtain Cap-luc mRNA from pKS.luc, an m^7^G(5′)ppp(5′)G cap analog was added to the transcription mixture. ", "Transcription reactions were carried out with T7 RNA polymerase (Promega) according to the manufacturer\\'s instructions. ", "For transfection, subconfluent BHK cells were harvested, washed with ice-cold phosphate-buffered saline (PBS), and resuspended at a density of approximately 2.5×10^6^ cells/ml in the same buffer. ", "Subsequently, 40 µg of *in vitro* transcribed RNA were added to 0.8 ml cell suspension and the mixture was transferred to a 4-mm cuvette (Bio-Rad). ", "Electroporation was performed at room temperature by generating one pulse at 350 V and 975 µF using a Gene Pulser II apparatus (Bio-Rad). ", "Finally, cells were diluted in DMEM supplemented with 10% FCS and seeded onto culture plates.", "\n\nInhibitor treatments and analysis of protein synthesis by radioactive labelling {#s4c}\n-------------------------------------------------------------------------------\n\nBHKT7 cells were transfected or co-transfected with the corresponding plasmids. ", "At different time points, after two hours of incubation with transfection mixture, cells were pre-treated with 200 µM sodium arsenite (Ars) (Riedel-de Haën) or 2 µM Thapsigargin (Tg) (Sigma) for 15 min at 37°C, or left untreated. ", "Next, proteins were radiolabelled for 45 min with \\[^35^S\\]Met/Cys (Promix; Amersham Pharmacia) in methionine/cysteine-free DMEM in the presence or absence of the corresponding concentration of Ars or Tg. ", "Finally, cells were collected in sample buffer, boiled for 4 min and analysed by SDS-PAGE (17,5%) and fluorography. ", "Protein synthesis was quantified by densitometry using a GS-710 calibrated Imaging Densitometer (Bio-Rad). ", "In the case of NaCl treatment, a methionine/cysteine-free DMEM with a final concentration of 265 (120+145) mM NaCl was used. ", "Proteins were then radiolabelled for 45 minutes. ", "Finally, cell monolayers were resuspended in sample buffer and processed as described above.", "\n\nWestern blotting {#s4d}\n----------------\n\nTransfected cells were collected in sample buffer, boiled and processed by SDS-PAGE. ", "After electrophoresis, proteins were transferred to a nitrocellulose membrane as described previously [@pone.0025699-Barco2]. ", "To detect PV non-structural proteins, specific rabbit polyclonal antibodies [@pone.0025699-Barco1], [@pone.0025699-Barco2], [@pone.0025699-Rodriguez1] were used at dilution 1∶1000. ", "To detect eIF4GI a rabbit antibodies mix against the N-terminal and C-terminal portion of this protein [@pone.0025699-Aldabe4] were used at dilutions of 1∶1000. ", "Polyclonal rabbit antibodies against eIF2α (Santa Cruz biotechnologies) and phosphorylated eIF2α (Cell Signaling) were used at a 1∶1000 dilution. ", "Rabbit antisera were raised against firefly luciferase (Promega). ", "Incubation with primary antibodies was performed for 2 h at room temperature, and then the membrane was washed three times with PBS containing 0.2% Tween-20 and incubated for 1 h with horseradish peroxidase-conjugated anti-mouse (Promega) or anti-rabbit IgG antibodies (Amersham) at a 1∶5000 dilution. ", "After washing three times, protein bands were visualized with the ECL detection system (Amersham).", "\n\nMeasurement of Luciferase Activity {#s4e}\n----------------------------------\n\nCells were recovered in a buffer containing 25 mM glycylglycine (pH 7.8), 0.5% Triton X-100 and 1 mM dithiothreitol. ", "Luc activity was determined using *luciferase assay system* (Promega) and Mononlight 2010 apparatus (Analytical Luminescence Laboratory) as described previously [@pone.0025699-Alvarez1], [@pone.0025699-Ventoso1].", "\n\nSupporting Information {#s5}\n======================\n\n###### \n\n**Kinetics of PV Replicon.** ", "BHKT7 cells were transfected withPV replicon. ", "A) Protein synthesis was determined by labelling with \\[^35^S\\]Met-Cys for 45 minutes every two hours from 1 to 7 hpt. ", "B) Western blot analysis of the samples obtained in panel A using anti-eIF4G, anti-Luciferase and anti-phospho-eIF2α.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\n**Rescue of picornavirus IRES translation by PV 2A^pro^ in Huh7-T7 cells.** ", "A) Hepatoma cells were transfected with plasmids encoding EMCV IRES-luc, PV IRES-luc or HAV IRES-luc alone or co-transfected with pTM1-2A. At 2 hpt cells were treated or not with 200 µM Ars for 1 hour. ", "Then, cells were harvested and lysated in luciferase buffer and luc activity was measured and represented as percentage from at least three independent experiments. ", "Error bars indicate SD. ", "B) eIF4GI were detected by western blot.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\n**Effect of 2A^pro^ on PKR.** ", "BHKT7 cells were mock- or transfected with pTM1-2A in presence or absence of Ars. ", "Protein kinase RNA-activated (PKR) was detected by western blot.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\nWe wish to express our gratitude to Dr. Y. Kusov for kindly providing us with plasmid pRLuc31 encoding the poliovirus replicon and plasmids encoding HAV and PV IRES-luc, Dr. P. Sarnow for plasmid T7 Rluc ΔEMCV IGR-Fluc, Dr. J. Berlanga for antibodies against PKR and Dr R. Bartenschlager for Huh7-T7. ", "Dr. A. Castelló is acknowledged for critical reading of this manuscript.", "\n\n**Competing Interests:**The authors have declared that no competing interests exist.", "\n\n**Funding:**This study was supported by a DGICYT (Direccion General de Investigacion Cientifica y Tecnica. ", "Ministerio de Educacion y Ciencia. ", "SPAIN) grant (BFU2009-07352). ", "NR and EW are holders of FPI (Formación de Personal Investigador) and FPU (Formación de Profesorado Universitario) fellowships, respectively. ", "The Institutional Grant awarded to the Centro de Biología Molecular \"Severo Ochoa\" by the Fundación Ramón Areces is acknowledged. ", "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.", "\n\n[^1]: Conceived and designed the experiments: NR LC. ", "Performed the experiments: NR MAS EW. ", "Analyzed the data: NR MAS LC. ", "Wrote the paper: NR MAS LC.", "\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0.009302325581395349, 0.003355704697986577, 0, 0.008771929824561403, 0, 0.009174311926605505, 0, 0.008658008658008658, 0.006622516556291391, 0.009900990099009901, 0, 0, 0.009615384615384616, 0, 0, 0.02158273381294964, 0, 0.013071895424836602, 0.017543859649122806, 0.006369426751592357, 0, 0.007936507936507936, 0.009900990099009901, 0.008403361344537815, 0.017699115044247787, 0, 0.03225806451612903, 0.014184397163120567, 0.013392857142857142, 0.008928571428571428, 0.0072992700729927005, 0.015625, 0, 0.017391304347826087, 0.013333333333333334, 0.016286644951140065, 0.006369426751592357, 0, 0.009868421052631578, 0, 0.012084592145015106, 0.018867924528301886, 0, 0.008333333333333333, 0.011299435028248588, 0.008, 0, 0.00641025641025641, 0.012861736334405145, 0.012875536480686695, 0.007194244604316547, 0, 0.00847457627118644, 0.018633540372670808, 0.007407407407407408, 0.011627906976744186, 0.006802721088435374, 0, 0, 0.013245033112582781, 0.009615384615384616, 0.005813953488372093, 0.005780346820809248, 0.0035587188612099642, 0, 0.004739336492890996, 0, 0.008620689655172414, 0, 0, 0.01639344262295082, 0, 0.011363636363636364, 0, 0.005226480836236934, 0, 0, 0.009174311926605505, 0, 0, 0, 0.008547008547008548, 0, 0.007462686567164179, 0, 0, 0, 0, 0, 0.011904761904761904, 0.017543859649122806, 0, 0, 0.004273504273504274, 0.005747126436781609, 0, 0.015228426395939087, 0, 0.007692307692307693, 0.008130081300813009, 0, 0, 0, 0, 0.015197568389057751, 0, 0, 0, 0.0072992700729927005, 0.005319148936170213, 0.005, 0, 0.006802721088435374, 0.0058823529411764705, 0.01020408163265306, 0.014705882352941176, 0, 0.011494252873563218, 0, 0.014134275618374558, 0.017857142857142856, 0, 0, 0.024539877300613498, 0.024691358024691357, 0, 0, 0.006896551724137931, 0.006644518272425249, 0.009174311926605505, 0, 0, 0.0030959752321981426, 0.012987012987012988, 0.020202020202020204, 0, 0, 0, 0, 0, 0, 0.0049261083743842365, 0.01015228426395939, 0, 0, 0.005917159763313609, 0, 0.007936507936507936, 0, 0.0028169014084507044, 0, 0, 0, 0, 0, 0, 0.0048543689320388345, 0, 0, 0, 0, 0.015384615384615385, 0, 0.005434782608695652, 0, 0.011235955056179775, 0.0196078431372549, 0, 0, 0.005681818181818182, 0.006211180124223602, 0.010638297872340425, 0.0273972602739726, 0, 0.0034482758620689655, 0, 0.003257328990228013, 0.010471204188481676, 0, 0, 0, 0, 0, 0.002824858757062147, 0.005128205128205128, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0.011527377521613832, 0.004347826086956522, 0.00819672131147541, 0, 0.012, 0.003816793893129771, 0.013937282229965157, 0, 0, 0, 0.012195121951219513, 0, 0.010416666666666666, 0.013888888888888888, 0.007547169811320755, 0.017094017094017096, 0.015544041450777202, 0, 0, 0, 0.018518518518518517, 0, 0, 0.008695652173913044, 0.004366812227074236, 0, 0, 0, 0.004901960784313725, 0.0070921985815602835, 0.011450381679389313, 0.00964630225080386, 0.0070921985815602835, 0.013986013986013986, 0, 0, 0.012345679012345678, 0, 0.006622516556291391, 0.015384615384615385, 0.015384615384615385, 0.05263157894736842, 0.014705882352941176, 0.008333333333333333, 0.003472222222222222, 0.02097902097902098, 0.014705882352941176, 0.007662835249042145, 0.009009009009009009, 0.005050505050505051, 0.009174311926605505, 0.024793388429752067, 0.00510204081632653, 0.006756756756756757, 0, 0, 0, 0, 0.014634146341463415, 0.008620689655172414, 0.009345794392523364, 0.016, 0, 0, 0.007751937984496124, 0.007936507936507936, 0.016574585635359115, 0.006211180124223602, 0.02054794520547945, 0.015151515151515152, 0.009933774834437087, 0, 0.005076142131979695, 0.014150943396226415, 0, 0.021739130434782608, 0, 0, 0.018518518518518517, 0.011494252873563218, 0, 0, 0.041666666666666664, 0, 0.018518518518518517, 0.024390243902439025, 0, 0.015625, 0.018518518518518517, 0.0165016501650165, 0.013888888888888888, 0, 0, 0.02857142857142857, 0, 0.014084507042253521, 0.007692307692307693, 0, 0.01818181818181818, 0, 0, 0, 0 ]
0.006546
5

No dataset card yet

New: Create and edit this dataset card directly on the website!

Contribute a Dataset Card
Downloads last month
44
Add dataset card

Models trained or fine-tuned on tomekkorbak/pii-pile-chunk3-50000-100000