Datasets:

tomekkorbak

/

detoxify-pile-chunk3-4050000-4100000

like 0

[ "There is a lot that can be read into the bizarre, jubilant press conference Donald Trump and Paul Ryan gave five days ago, after a bill repealing Obamacare narrowly passed the House. ", "Trump is phenomenally needy, and at its most basic level the press conference was about affirmation. “", "Hey I’m president! ", "Can you believe that?” ", "Trump asked quizzically, as if he was still surprised that he was, in fact, president. ", "But more than anything, it was a message to the Senate: Repeal has momentum. “", "I know that our friends over in the Senate are eager to get to work,” Ryan joked passive-aggressively.", "\n\nOver the last five days we’ve learned exactly how eager. ", "While a working committee—consisting of 13 men—has been formed, every indication is that the upper chamber is going to take its sweet time. ", "On Monday, Senator Chris Coons, a Democrat, told Morning Joe that he didn’t expect the American Health Care Act to go to conference—if it gets that far—until after the midterm elections in 2018.", "\n\nOn @Morning_Joe @ChrisCoons predicts @SenateMajLdr will go slow on health care, w/ no conference bill until after 11/18. (!!) — ", "Mark Halperin (@MarkHalperin) May 8, 2017\n\nAxios Presented By Spectre, meanwhile, reports that fall 2017 is a more likely target—which is still a very long ways away, especially for a famously impatient president. ", "Axios also reports that “some key Republicans are pessimistic that tax reform can be finalized this year,” as it has to follow the 2018 budget. ", "Infrastructure, meanwhile, has no momentum with conservatives in the House or the Senate—and the Freedom Caucus, which essentially has veto power in the House, is far from excited about it.", "\n\nThe Rose Garden press conference increasingly looks like it came from a position of weakness, rather than strength. ", "And if the Senate is able to pass a bill, it will likely be very different from the House’s. ", "The result produced by conference committee would likely end up alienating either moderates or hard-liners. ", "More importantly, the clock is already ticking. ", "Yes, the midterms are a whole 18 months away, but many are already predicting a bloodbath. ", "The closer we get to the midterms the harder it will be to corral skittish and vulnerable Republicans to cast a vote that could cost them their seats.", "\n\nDemocrats, of course, were able to do this in 2010, when the Affordable Care Act became law. ", "But there’s a key difference between the effort to pass Obamacare and the effort to repeal it. ", "Democrats believed very deeply in passing health care reform and their leadership was willing to accept political costs to do it. ", "Republican leadership, meanwhile, is moving toward repeal because it seems like the least bad option. ", "Either they repeal the bill and energize the Democratic base or they don’t and risk primary challenges from the right." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.001196353929117322, 0.0006587281823158264, 0.0014135930687189102, 0.0012171006528660655, 0.0007205114816315472, 0.0005935081280767918, 0.0006120296893641353, 0.0005802280502393842, 0.0005682711489498615, 0.0007394774002023041, 0.0010015462758019567, 0.0005988939083181322, 0.007854996249079704, 0.0006932997494004667, 0.000715883681550622, 0.0006433697417378426, 0.0008636753191240132, 0.000944688799791038, 0.021754121407866478, 0.024606643244624138, 0.0007693523657508194, 0.0005990018253214657, 0.0011980462586507201, 0.0006921672611497343, 0.001873317756690085 ]

[ "A very exciting new journey lies ahead of you when you become pregnant! ", "Document this special time in your life with the beautiful Great Expectations collection by Digital Scrapbook Ingredients. ", "It’s perfect for capturing all the important moments during your pregnancy and make something precious to look back on years from now!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.04199882596731186, 0.0006647633854299784, 0.0007034442969597876 ]

[ "Q:\n\nSquid reverse proxy with optional SSL\n\nI'm trying to set up squid as a load-balancing reverse-proxy, and I'm having a bit of trouble with the SSL. ", "One of the site's applications checks to see if a site is loaded over SSL, and behaves differently if that is the case, so I need SSL connections to be proxied over SSL, and non-SSL connections to be proxied without it.", "\nRight now, the squid server accepts connections over HTTP and HTTPS, but it only makes connections over HTTP to the upstream servers.", "\nThe interesting part of my squid configuration looks like this:\nhttp_port 80 vhost vport\nhttps_port 443 vhost vport cert=/etc/cert.pem key=/etc/cert.key\ncache_peer 10.0.0.10 parent 80 0 originserver round-robin\ncache_peer 10.0.0.11 parent 80 0 originserver round-robin\n\nIs there a simple way to tell it to proxy the SSL connections upstream over SSL, while leaving the others alone?", "\n\nA:\n\nUPDATE (actually tried this from my squid...):\nacl is_ssl port 443\nhttps_port 443 cert=<yourcert> key=<yourkey> accel name=site_ssl defaultsite=<y\\\nour_external_site>\ncache_peer <your_internal_ssl> parent 443 0 no-query originserver ssl sslflags=\\\nDONT_VERIFY_PEER name=site_ssl\ncache_peer_access site_ssl allow is_ssl\ncache_peer_access site_ssl deny !", "is_ssl\n\nacl nonssl port 80\nhttp_port 80 accel defaultsite=<your_external_site> name=site_nonssl\ncache_peer <your_internal_nonssl> parent 80 0 no-query name=site_nonssl origins\\\nerver\ncache_peer_access site_nonssl allow nonssl\ncache_peer_access site_nonssl deny !", "is_nonssl\n\nORIGINAL ANSWER BELOW HERE:\nyou want something like \ncache_peer 10.0.0.11 parent 443 0 no-query originserver ssl sslflags=DONT_VERIFY_PEER name=site_ssl\nacl sites_server_3 dstdomain site_ssl\ncache_peer_access site_ssl allow ssl_servers\nhttp_access allow ssl_servers\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0009455487597733736, 0.0006038566934876144, 0.0006806636229157448, 0.0009910997468978167, 0.01396208256483078, 0.011904271319508553, 0.0034604358952492476 ]

[ "[Decanoic acid, new precursor for in vitro biosynthesis of oleic acid by a plant subcellular fraction].", "\nVarious membraneous fractions prepared from a cauliflower homogenate synthesize radioactive oleic acid when they are incubated in a 14C-decanolate solution. ", "The more active fraction is formed of vesicles sedimenting at 30,000 g x 20 mn (heavy microsomes). ", "The labelled precursor is transformed by this fraction mainly into oleic acid and hydroxyacids. ", "ATP, NADPH, CoA and oxygen are required for these reactions. ", "Labelled fatty acids, longer than lauric and (i.e. 14C-myristic, 14C-palmitic and 14C-stearic acids) are not transformed into oleic acid by the subcellular fraction studied in this paper." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007726195617578924, 0.0011323963990435004, 0.0007007421809248626, 0.0015637492761015892, 0.0006118602468632162, 0.0008242688491009176 ]

[ "Check out our new site Makeup Addiction\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nFULL OF PEOPLE DEMANDING CHEAP GOODS FULL OF PEOPLE WHO COMPLAIN ABOUT CHEAP GOODS" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.06160628795623779 ]

[ "Q:\n\nIs it possible to update multiple columns using different criteria in one statement?", "\n\nI need to set all columns to 0 if they are negative. ", " Currently I do it one column at a time:\nUPDATE #ListingRank SET Distance = 0 WHERE Distance < 0\nUPDATE #ListingRank SET ActionDays = 0 WHERE ActionDays < 0\nUPDATE #ListingRank SET Price = 0 WHERE Price < 0\nUPDATE #ListingRank SET Beds = 0 WHERE Beds < 0\nUPDATE #ListingRank SET Baths = 0 WHERE Baths < 0\nUPDATE #ListingRank SET SqFt = 0 WHERE SqFt < 0\n\nIs it possible to do the same in a single statement?", "\n\nA:\n\nYou can try to use CASE WHEN\nUPDATE #ListingRank\nSET Distance = (CASE WHEN Distance < 0 THEN 0 ELSE Distance END),\n ActionDays = (CASE WHEN ActionDays < 0 THEN 0 ELSE ActionDays END),\n Price = (CASE WHEN Price < 0 THEN 0 ELSE Price END),\n Beds = (CASE WHEN Beds < 0 THEN 0 ELSE Beds END),\n Baths = (CASE WHEN Baths < 0 THEN 0 ELSE Baths END),\n SqFt = (CASE WHEN SqFt < 0 THEN 0 ELSE SqFt END)\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006836430984549224, 0.000908467685803771, 0.0012003736337646842, 0.001140735694207251 ]

[ "Lars Bender RSS feedhttp://www.fourfourtwo.com/lars-bender\nenBayers Bender fit to face Atletico MadridBayer Leverkusen midfielder Lars Bender is fit to face Atletico Madrid in their UEFA Champions League last 16 second leg on Tuesday.http://www.fourfourtwo.com/news/bender-fit-face-atletico\nBattling an ankle injury, the Germany international is back in training and a chance to start against the La Liga giants.", "\nLeverkusen coach Roger Schmidt, whose team lead the tie 1-0 heading to the Vicente Calderon, was unwilling to give too much away.", "\n\"He is doing well. ", "He could train the last two days without pain,\" he said on Monday.", "\n\"I will not announce the line-up today, but he is fit to play.\"", "\nA goal from Hakan Calhanoglu in the second lifted helped Leverkusen to their victory at home.", "\nAtletico are winless in their past four games in all competitions, but Schmidt is still wary of Diego Simeone's men.", "\n\"Of course we know that Atletico [are] different at home and that they are very strong,\" he said.", "\n\"One-nil is a good result, but tomorrow we must outdo ourselves to reach the next round.\"", "\nnews_articleTue, 17 Mar 2015 01:28:11 +0000Anonymous361779 at http://www.fourfourtwo.comSchmidt hopes Bayern effect will help injuriesBayer Leverkusen coach Roger Schmidt hopes a trip to Bayern Munich on Saturday will help speed up the recovery of his injured players.http://www.fourfourtwo.com/news/schmidt-hopes-bayern-effect\nSchmidt has fitnessconcerns over key players includingOmer Toprak, Lars Bender andStefan Kiessling ahead of Saturday's meeting with the championsatthe Allianz Arena.", "\nLeverkusen sit third going into the weekend's clash, 10 points behind Pep Guardiola's leaders, having seen off rivals Cologne 5-1 at the weekend.", "\nAs they seek to end Bayern's winning start to the Bundesliga season, Schmidt expectsthe prospect of taking on the Bavarian giants to leave the treatment room less congested.", "\nAsked whether a trip to face Bayern could motivate recoveries, Schmidt is quoted by Kicker as saying:\"It would appear so.", "\n\"This is a game that all will wantto play in.\"", "\nSchmidt also expressed the need for his side to be on top of their game if they are to get anything from their trip to Munich.", "\n\"Against Bayern it's all about unity,\" he added.", "\n\"We must never be alone on the pitch aswe need to go to our limits.", "\n\"We must do what we always do, and look for perfection.\"", "\nnews_articleWed, 03 Dec 2014 17:12:42 +0000Anonymous298820 at http://www.fourfourtwo.comBender pleased with Leverkusen effortStand-in Bayer Leverkusen captain Lars Bender felt his side were worth all three points in their 2-0 win over Zenit on Wednesday.http://www.fourfourtwo.com/news/bender-pleased-leverkusen-effort\nLeverkusen moved to the top of UEFA Champions League Group C with a routine success at BayArena that came thanks to second-half goals from Giulio Donati and Kyriakos Papadopoulos.", "\nBrazilian full-back Wendell was sent off with 11 minutes to play in a fractious affair but Leverkusen avoided a late scare to secure maximum points.", "\nAnd Bender - deputising as captain for the injured Simon Rolfes - was pleased with his team's display.", "\n\"Today we have been very disciplined right from the start,\" he said.", "\n\"It was a very tough game. ", "But in the end, we really deserved the win.\"", "\nLeverkusen visit Zenit in two weeks' time for their next fixture in Europe's premier club competition.", "\nnews_articleWed, 22 Oct 2014 22:09:06 +0000Anonymous273290 at http://www.fourfourtwo.comBender thrilled with backs to the wall winBayer Leverkusen midfielder Lars Bender praised the spirit of his side after their comfortable 3-1 UEFA Champions League win over Benfica.http://www.fourfourtwo.com/news/bender-thrilled-backs-wall-win\nFirst-half strikes from Stefan Kiessling and Son Heung-min, as well as a Hakan Calhanoglu penalty, were enough to see off the visitors on Wednesday.", "\nThe win leaves Leverkusen one point off the top of Group C, giving them a good chance of progressing to the last 16 despite going down 1-0 to Monaco in their opening game.", "\nIt represented a fine return to Leverkusen's early-season form, which saw them score 22 goals in their first six games during a blistering start to the season.", "\nAnd Bender could not hide his delight after his team got their European campaign back on track.", "\nHe told UEFA.com: \"We were very ambitious, because our start in this Champions League was a little bit unsuccessful.", "\n\"We showed a very good reaction and a fantastic match. ", "This win was extremely important, because we were standing with our backs to the wall. ", "In groups like this you have to win your home matches.\"", "\nThe German outfit are yet to taste defeat at home this season and will hope to continue their favourable record when they welcome Zenit, who drew 0-0 at home to Monaco in the group's other game,to the BayArena on October 22.", "\nnews_articleWed, 01 Oct 2014 22:07:10 +0000Anonymous261937 at http://www.fourfourtwo.comBender close to Leverkusen returnLars Bender could return for Bayer Leverkusens opening Bundesliga clash with Borussia Dortmund after recovering from a thigh problem.http://www.fourfourtwo.com/news/bender-close-leverkusen-return\nThe midfielder has been absent since suffering the injury during a training session with Germany ahead of the World Cup in May.\nBender was omitted from Joachim Low's final 23-man squad and had to watch from home as his team-mates were crowned world champions for a fourth time.", "\nThe 25-year-old missed all of Leverkusen's pre-season as he recoveredfrom the injury, but head coach Roger Schmidt revealed he has now returned to full training.", "\nAlong with new signing Kyriakos Papadopoulos,Bender could feature at Signal Iduna Park on Saturday.", "\n\"Both players took part in full training,\" Schmidt told a media conference on Thursday.", "\n\"We've still got two days to go and we'll see what happens in training and decidewhether or not they make it to the squad.\"", "\nBender made 29 appearances for Leverkusen last season as they finished fourth and qualified for the UEFA Champions League play-off round.", "\nnews_articleThu, 21 Aug 2014 16:23:35 +0000Anonymous235973 at http://www.fourfourtwo.comIf not Vidal then who? ", "Six alternatives for Manchester United to considerConflicting reports claim the Chileans move to Old Trafford isnt so certain. ", "Greg Johnson suggests the other stars who could fill the void for Louis van Gaal...Greg Johnsonhttp://www.fourfourtwo.com/features/if-not-vidal-then-who-six-alternatives-manchester-united-consider\nDepending on who you talk to, Arturo Vidal's arrival at Manchester United would galvanise the club into becoming instant favourites for the Premier League title, unstoppable through the middle regardless of their opposition or as strong a team as they have ever been.", "\nIn fairness the Chilean certainly looks the part; for both Juventus and Chile he is a one-man conveyer belt of goals, chances, tackles, turnovers and surging runs that are genuinely box-to-box in their nature. ", "He made 96 tackles last season in Serie A, took 56 shots, scored 11 goals and was named man of the match on five occasions.", "\nAt a time when players like Aaron Ramsey and Jordan Henderson are emerging as key players, Vidal looks a perfect fit. ", "Yet while many continue to hail him as the perfect man to complete Louis van Gaal’s squad, it feels as though they have jumped the gun slightly. ", "Regardless of what the gossip columns may be saying in Italy, Vidal to United is not a done deal: far from it, according to the English journalists who remain adamant that no move has been made yet.", "\nSo just in case the 27-year-old pitbull doesn't hot-foot it to Manchester, here are six alternatives who could grace the United shirt instead...\nKevin Strootman\nStrootman’s injury before the World Cup forced Van Gaal to switch to a 3-5-2 in Brazil, such was the Roma midfielder’s importance to the 4-3-3 system that had served the Dutch so well during qualifying.", "\nThough not blessed with pace, like Vidal he can be regarded as a complete midfielder, offering plenty of comparable defensive coverage with tackles and ball recoveries, if not the lung-busting acceleration of the Chilean. ", "With 55 tackles in 25 Serie A appearances, along with 5 goals and 6 assists in his first season in Italy, he certainly hasn’t lacked end product.", "\nHowever, he is yet to return to full fitness and will be able to count on Champions League football for the time being with Roma, so a move before January seems unlikely. ", "If Van Gaal feels he can wait until then, he could be an even more suitable capture given his existing understanding of the new manager’s ideas and methods.", "\nMorgan Schneiderlin\nSouthampton’s defensive midfielder may not be a like-for-like substitute for Juve’s box-to-box general, but during his two seasons of Premier League football, Schneiderlin has certainly shown flashes of being capable of far more than intercepting and neat distribution.", "\nHe is a less active player– more of a passer than a runner– but few players compare to Vidal’s mixture of athleticism, attacking prowess and defensive power. ", "With Ander Herrera providing combativeness and creativity higher up the field, Schneiderlin wouldn’t need to be the sole dynamic presence in midfield anyway.", "\nSaints won’t let another one of their young stars leave without a fight– or an offer too big to turn down– especially now Ronald Koeman is in charge at St Mary's. ", "The former Feyenoord boss enjoys an adversarial relationship with Van Gaal that would hardly stir any genuine interest.", "\nWilliam Carvalho\nAfter a promising campaign last season with Sporting, Carvalho made his World Cup debut this summer for Portugal against the USA as a substitute, and impressed with his composure on the ball.", "\nLike Schneiderlin, the defensive midfielder would be a less dynamic option than Vidal, but as shown by his occasional forays forward from deep last season, he can be a more mobile threat when not on defensive duty.", "\nSEE ALSOEverything you need to know about... William Carvalho\nLars Bender\nThough regularly linked with a move to the Premier League, Bender is reportedly content with life at Bayer Leverkusen. ", "Yet if the Vidal deal did fall through, he would be an intriguing option. ", "The Arsenal-linked German is more mobile than he is often given credit for, and while he may be a far more defensively focused player than Vidal –he made 87 tackles last season in the Bundeliga but created only 1 goal, scoring 4 –he is far from limited.", "\nLeverkusen was Vidal’s club prior to Juventus, and a move away helped him to flourish in a more rounded role. ", "Perhaps a similar opportunity could unleash Bender’s true potential.", "\nLeon Goretzka\nStaying in the Bundesliga, Schalke’s 19-year-old midfielder Goretzka could be a left-field, yet well-suited option for Van Gaal. ", "The young German is also capable of playing wide on the right but looked surprisingly mature when called upon to play in central midfield last season.", "\nAlthough still young and largely inexperienced, he did not seem fazed getting involved all over the pitch against Werder Bremen and Hertha Berlin (see below). ", "His age might worry United fans who crave Vidal's more refined abilities, but Van Gaal has never been afraid to trust youngsters with big responsibilities.", "\nSEE ALSOEverything you need to know about... Leon Goretzka\nRoberto Firmino\nHoffenheim’s No.10 may not seem like an obvious candidate to replace Vidal as a transfer target, but the midfielder-cum-striker is an exceptionally hard-working player who made 82 tackles in just 33 Bundesliga appearances last season.", "\nEven if the Brazilianisn’t already a true box-to-box midfielder, at just 22 he could still become one. ", "Van Gaal’s ability to redeploy players in roles that suit their abilities saw him turn wingers into full-backs and defenders at Ajax, and although buying big on a young star to play them out of position may be a step further, Firmino could be a player who could thrive if played deeper.", "\nSEE ALSOFive Bundesliga youngsters fit for Premier League stardom\nfeatureThu, 24 Jul 2014 10:00:00 +0000Joe Brewin217909 at http://www.fourfourtwo.comThigh injury rules Bender out of World CupLars Bender will miss the FIFA World Cup after suffering a thigh injury during Germanys pre-tournament training camp on Thursday.http://www.fourfourtwo.com/news/thigh-injury-rules-bender-out-world-cup\nThe Bayer Leverkusen midfielder was named in Joachim Low's provisional squad for the finals in Brazil after impressing during the Bundesliga season.", "\nGermany are currently in northern Italy before heading to South America next month, but Bender will not be on the plane after the German Football Association confirmed he damaged a muscle in his right thigh during a training session.", "\n\"If just before a tournament injury fails a player then that's disappointing,\" said Low.", "\n\"For Lars, I'm personally very sorry.", "\n\"I know he wanted to be in Brazil, he is an absolute role model.\"", "\nBender has made 17 appearances for Germany since his debut in September 2011 and was part of Low's squad during the World Cup qualifying campaign.", "\nThe 25-year-old's withdrawal may see Low opt for Sami Khedira as part of his midfield options in Brazil, even though the Real Madrid player has been absent with a long-term knee injury this season.", "\nnews_articleFri, 23 May 2014 08:31:21 +0000Anonymous178400 at http://www.fourfourtwo.comBender extends Leverkusen contractLars Bender has agreed a two-year extension to his Bayer Leverkusen contract and will remain with the club until 2019.http://www.fourfourtwo.com/news/bender-extends-leverkusen-contract\nThe midfielder arrived at the BayArena in 2009 and has since made 151 appearances in all competitions, while also having his form recognised with a call-up to the Germany national team.", "\nThe 24-year-old has started seven Bundesliga matches this season under Sami Hyypia, helpingLeverkusen into third place in the table, just a point behind leaders Bayern Munich.", "\nHis deal was due to expire at the end of the 2016-17 season, but he has committed his long-term future to the club after being impressed with the improvements they have made.", "\n\"Bayer Leverkusen has evolved in recent years into something very positive,\" he told the club's official website.", "\n\"Our team is strong and has the potential to be even better. ", "I want to be part of this story and make my contribution as we try and permanently establish ourselves in the top group.", "\n\"Bayer has become for me a great passion. ", "I feel part of this club and just feeling that gives me great pleasure to play here.\"", "\nBender has picked up 15 caps under Joachim Low and scored four goals, while his last appearance for the national team came in their 3-3 draw with Paraguay in August.", "\nnews_articleThu, 31 Oct 2013 15:03:26 +0000Anonymous79227 at http://www.fourfourtwo.comBender returns to Leverkusen trainingBayer Leverkusen midfielder Lars Bender returned to full training on Tuesday after three weeks out of action with a thigh injury.http://www.fourfourtwo.com/news/bender-returns-leverkusen-training\nThe 24-year-old suffered a torn quadriceps muscle in the closing stages of Leverkusen's 1-1 draw with Bundesliga leaders Bayern Munich on October 5.", "\nBender missed three games for his club, as well as Germany's final FIFA World Cup qualifiers, as a result.", "\nBut he could now be back in contention for Saturday's trip to the Bundesliga's bottom club, Eintracht Braunschweig.", "\n\"I have worked a lot with (fitness coach) Holger Broich individually,\" Bender told the club's official website.", "\n\"But I have put my return off long enough and I'm ready to play again.\"", "\nLeverkusen coach Sami Hyypia will be buoyed by the midfielder's recovery, but he still has concerns elsewhere in his squad.", "\nStar striker Stefan Kiessling did not participate on Tuesday's session, due to a cut on his foot sustained in the weekend's 2-1 win over Augsburg that required five stitches.", "\nDefensive duo Stefan Reinartz (heel) and Sebastian Boenisch (ankle) were also absent.", "\nLeverkusen are part of a trio of clubs currently clear at the top of the Bundesliga after nine rounds. ", "They sit third, level on points with Borussia Dortmund, and just one behind league leaders Bayern Munich.", "\nHowever, Leverkusen already hold a nine-point advantage over fourth-placed Borussia Monchengladbach.", "\nnews_articleTue, 29 Oct 2013 16:31:52 +0000Anonymous78491 at http://www.fourfourtwo.comLeverkusen sweating on Bender fitnessBayer Leverkusen midfielder Lars Bender is fighting to be fit for Wednesdays UEFA Champions League clash with Real Sociedad.http://www.fourfourtwo.com/news/leverkusen-sweating-bender-fitness\nThe Bundesliga side will take on Real Sociedad in their second group game of the competition, having lost 4-2 to Premier League champions Manchester United in their opener.", "\nBut as they prepare to fight for the essential points in a tough group that also includes Shakhtar Donetsk, they may have to do so without star midfielder Bender.", "\nThe 24-year-old picked up a knock on his ankle in Saturday's 2-0 win over Hannover, but boss Sami Hyypia is hopeful that he may recover in time.", "\n\"We will wait until tomorrow's warm-up (in the morning) to see if Lars is good to play,\" he said.", "\n\"Today he did not train with the team but did an individual session. ", "We have to see how his injury reacts to know where we stand.", "\n\"Now we have a home game which we have to win if we are to have any chance of advancing.\"", "\nThe former Finland international sees his men come into the fixture in good form, having won their last five home matches in all competitions.", "\nnews_articleTue, 01 Oct 2013 16:30:18 +0000Anonymous68498 at http://www.fourfourtwo.comThe Leverkusen stars Man United should fearMichael Cox names the Bundesliga sides biggest threats ahead of Tuesday evenings Champions League clash at Old Trafford.", "Michael Coxhttp://www.fourfourtwo.com/features/leverkusen-stars-man-united-should-fear\nBayer Leverkusen were the forgotten side in last year’s Bundesliga – while Bayern Munich and Borussia Dortmund stormed Europe and competed in a fast-paced, intense final, few were talking about third-placed Leverkusen.", "\nBut they were one of the most interesting sides in Europe last season, eschewing the dominant modern obsession with possession and instead playing a pure counter-attacking game. ", "Therefore, they’re suited to this away contest against Manchester United, where they’ll surely start as underdogs and see relatively little of the ball.", "\nThere have been changes over the summer, chiefly because Sami Hyypia is now in sole charge following a period as joint-manager with Sascha Lewandoswki. ", "His more experienced colleague’s tactical knowledge will certainly be missed, although the former Liverpool centre-back is showing signs of becoming an excellent coach.", "\nThere were also three major departures in the starting XI. ", "Andre Schurrle, who was the star man in his advanced left-sided role and was the instigator of the majority of counter-attacks, has left for Chelsea. ", "On the opposite side, attacking right-back Daniel Carvajal impressed so much that Real Madrid wasted no time in activating their buy-back clause after just one season. ", "Meanwhile, in the centre of defence, Michal Kadlec departed to Fenerbahce.", "\nNonetheless, there are three players David Moyes will need to keep a close eye on. ", "The first is centre-forward Stefan Kiessling. ", "Last year’s Bundesliga top goalscorer with 25 goals, one ahead of Dortmund’s in-demand Robert Lewandoswki, there’s something old-fashioned about him. ", "In the age of false No.9s and strikers who drift wide, Kiessling is an old-fashioned target man who stays inside the penalty box.", "\nNo player in last season’s Bundesliga had as many shots as Kiessling, and none won as many aerial duels – although Kiessling insists he doesn’t score a particularly high number of goals with his head. ", "Still, Nemanja Vidic’s aerial ability will be needed against the strong, 6ft 3in striker. ", "Competing in aerial battles is essentially all Kiessling does outside the penalty box.", "\nThe second dangerman is right-sided Sidney Sam, a pacey direct forward who was often used from the bench last year, but who has thrived in Schurrle’s absence – combining excellently with Kiessling so far this season. ", "Both have recorded four goals in the first five Bundesliga matches.", "\nSam specialises on the counter-attack, breaking directly into space. ", "He’s capable of beating oppnents with mazy dribbles when he picks up full speed, and provides a consistent goal threat. ", "In the 4-2 win over Borussia Monchengladbach, Schurrle set up Sam for two fine goals.", "\nFinally, there’s central midfielder Lars Bender. ", "Twin brother of Sven, who reached the final with Dortmund last season, Lars is arguably more of a complete footballer, although is most notable for his tenacious defensive work – putting in plenty of tackles in the central midfield zone.", "\nLeverkusen’s 4-3-3 system means they pack the centre of the pitch, with Bender the most dominant force to the right of the pitch – he might attempt to stop Patrice Evra’s forward bursts, a notable feature of United’s play so far this campaign.", "\nfeatureTue, 17 Sep 2013 10:07:33 +0000James Maw60009 at http://www.fourfourtwo.comInternational Friendly: Germany 3 Paraguay 3An absorbing encounter at the Fritz-Walter-Stadion in Kaiserslautern saw Germany and Paraguay draw 3-3 on Wednesday.http://www.fourfourtwo.com/news/international-friendly-germany-3-paraguay-3\nBoth sides named strong sides ahead of their final FIFA World Cup qualifiers, with two goals in four first-half minutes from Jose Nunez and Wilson Pittoni putting Paraguay ahead before\nIlkay Gundogan and Thomas Mueller drew Germany level.", "\nMiguel Samudio put the visitors back in front on the stroke of half-time before a second-half Lars Bender strike ensured the hosts avoided consecutive friendly defeats.", "\nGermany manager Joachim Loew was without injured trio Mario Goetze, Julian Draxler and Bastian Schweinsteiger, but Ilkay Gundogan and Marco Reus were among the returning contingent, despite fitness doubts before the game.", "\nParaguays record goalscorer Roque Santa Cruz was recalled to Victor Genes starting line-up, while Justo Villar made his 100th appearance for Paraguay in goal.", "\nThe strength of Germanys line-up, going into the final round of World Cup qualifiers which start in September, showed how serious Loew was taking the friendly and he will have been pleased with his sides start to the game.", "\nA Reus free-kick forced an early save from Villar before Gundogan and Klose both had efforts from inside the area.", "\nHowever, Nunez gave his side the lead against the run of play after nine minutes when he dispatched a long ball past Manuel Neuer.", "\nKlose should have equalised for Germany shortly after when he was played through by Gundogan, but, while his dink beat Villar, it also went over the crossbar.", "\nPittoni then doubled Paraguays lead after 13 minutes, following poor German defending.", "\nThe Olimpia midfielder struck a half-volley after a bad clearance which deflected off Sami Khedira and past Neuer to put Paraguay in control.", "\nThe goals kept coming, although it was the hosts finally making headway. ", "Gundogan clawed one back after 18 minutes, hitting a deft curling strike which evaded Villar, who could only get a hand to the ball.", "\nThe Borussia Dortmund midfielder showed his value at the other end, clearing a corner off the line before being forced off with a back problem to be replaced by Bender.", "\nGermany restored parity 31 minutes in as Mueller stayed onside and controlled a lofted ball under pressure from the onrushing Villar before calmly rolling the ball past the goalkeeper.", "\nHowever, Paraguay ensured they went in ahead at the break, when Santa Cruz squared for Samudio to score from close range on the stroke of half-time.", "\nMario Gomez replaced Klose early in the second half and he had a quick impact, forcing a good save from Villar after 57 minutes.", "\nFellow substitute Jerome Boateng then rifled a shot over the bar after 71 minutes before Mueller fired across goal shortly after.", "\nHowever, Germanys search for an equaliser ended three minutes later when Bender latched on to a loose clearance and fired home to make it 3-3.", "\nAndre Schurrle had a late chance but could only blaze over from close range after waves of Germany pressure.", "\nNext up for both sides are final batches of World Cup qualifiers, with UEFA Group C leaders Germany hosting Austria in September while Paraguay, who sit bottom of CONMEBOL qualifying, host Bolivia in the same month.", "\nnews_articleWed, 14 Aug 2013 21:47:42 +0000Anonymous39152 at http://www.fourfourtwo.com" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0011708623496815562, 0.0007931700092740357, 0.0006365287117660046, 0.001078195171430707, 0.0006410267669707537, 0.0010729734785854816, 0.0007527220877818763, 0.0005741097265854478, 0.0008130907663144171, 0.0007367205107584596, 0.0010418881429359317, 0.0008040062384679914, 0.0010181362740695477, 0.0008296204614453018, 0.0007392392726615071, 0.0008054586360231042, 0.0013927228283137083, 0.0005941245472058654, 0.0008317064493894577, 0.0027692161966115236, 0.0006977291777729988, 0.0005738244508393109, 0.0007081665098667145, 0.0006614531157538295, 0.0006285775452852249, 0.0008053799392655492, 0.0009491225355304778, 0.002157180802896619, 0.0008238946902565658, 0.0006198117625899613, 0.0005256459699012339, 0.016591280698776245, 0.0009720783564262092, 0.0010594296036288142, 0.0007903892546892166, 0.0014156833058223128, 0.0007870889967307448, 0.0006077607395127416, 0.0009194726007990539, 0.0011116804089397192, 0.000853000907227397, 0.0008208940853364766, 0.0006931798416189849, 0.0008945725858211517, 0.0008170623332262039, 0.0006209414568729699, 0.0009825910674408078, 0.0005520188715308905, 0.0016346408519893885, 0.0011067743180319667, 0.0006339943502098322, 0.0007780759478919208, 0.000560905085876584, 0.0011651352979242802, 0.007217720616608858, 0.0006001521251164377, 0.0024512142408639193, 0.0008920637774281204, 0.0007538174977526069, 0.0008879365050233901, 0.0009467133786529303, 0.0005888377199880779, 0.0008202396566048265, 0.0007715358515270054, 0.0018498527351766825, 0.0010275847744196653, 0.0006538850720971823, 0.0010756211122497916, 0.001004040357656777, 0.0008228440419770777, 0.0007568232831545174, 0.0010113692842423916, 0.0010072182631120086, 0.0016628814628347754, 0.0008434017654508352, 0.0005221272585913539, 0.0005507601308636367, 0.0007923918892629445, 0.0013697167159989476, 0.0006589693366549909, 0.0014101510168984532, 0.000577450729906559, 0.000611630268394947, 0.0005222798208706081, 0.0006101588951423764, 0.0005898685194551945, 0.0006535386200994253, 0.0007486540707759559, 0.0009255268378183246, 0.0012573435669764876, 0.001040695235133171, 0.0005929704639129341, 0.0009215433965437114, 0.0007866394007578492, 0.0007682172581553459, 0.0009452254162169993, 0.0009994892170652747, 0.0009764842689037323, 0.0011125385062769055, 0.001012583146803081, 0.0007707524346187711, 0.004663185682147741, 0.00056452676653862, 0.000595182937104255, 0.0006619191262871027, 0.0006777407834306359, 0.0007691921200603247, 0.0009151902631856501, 0.000979189295321703, 0.0012515437556430697, 0.0021496510598808527, 0.0007212025229819119, 0.0005923731368966401, 0.0006346430163830519, 0.0016708527691662312, 0.0010519855422899127, 0.0011673844419419765, 0.0005680975737050176, 0.0007237506797537208, 0.001348181045614183, 0.0026947367005050182, 0.005009036045521498, 0.004347586538642645, 0.0007401387556456029, 0.0011391866719350219, 0.0007433539140038192, 0.0007735805702395737, 0.007346858736127615, 0.000969799468293786, 0.0013653686037287116, 0.0009520311723463237, 0.0015751055907458067, 0.0007582193939015269, 0.001470940187573433, 0.000765467353630811, 0.0006211696309037507, 0.0006305297138169408, 0.0019736276008188725, 0.0010435445001348853, 0.005916159134358168, 0.004058512393385172, 0.001400421024300158, 0.0007905678357928991, 0.0028503960929811, 0.0012046409538015723, 0.0013896258315071464, 0.0009327994775958359, 0.0009500790038146079, 0.001404143520630896, 0.006910788360983133, 0.0009410649072378874, 0.0005943785072304308, 0.0007430047262459993 ]

[ "Q:\n\nAngular 5 Service Worker not working\n\nI try to add service worker to my project after updating to angular 5 and have some problems. ", "I add imports to app.module.ts: \nimport {ServiceWorkerModule} from '@angular/service-worker';\nimport {environment} from '../environments/environment';\n...\nenvironment.production ? ", "ServiceWorkerModule.register('/ngsw-worker.js') : [],\n\nexecute $ ng set apps.0.serviceWorker=true to allow service workers in project\ngenerate config: \n{\n \"index\": \"/index.html\",\n \"assetGroups\": [\n {\n \"name\": \"app\",\n \"installMode\": \"prefetch\",\n \"resources\": {\n \"files\": [\n \"/index.html\"\n ],\n \"versionedFiles\": [\n \"/*.bundle.css\",\n \"/*.bundle.js\",\n \"/*.chunk.js\"\n ]\n }\n },\n {\n \"name\": \"assets\",\n \"installMode\": \"lazy\",\n \"updateMode\": \"prefetch\",\n \"resources\": {\n \"files\": [\n \"/assets/**\"\n ]\n }\n }\n ],\n \"dataGroups\": [\n {\n \"name\": \"api-performance\",\n \"urls\": [\n \"/\",\n \"/main\",\n \"/login\",\n \"/select-content\"\n ],\n \"cacheConfig\": {\n \"strategy\": \"performance\",\n \"maxSize\": 100,\n \"maxAge\": \"3d\"\n }\n }\n ]\n}\n\nAnd manifest: \n{\n \"name\": \"App\",\n \"short_name\": \"App\",\n \"start_url\": \"/login\",\n \"theme_color\": \"#00a2e8\",\n \"background_color\": \"#00a2e8\",\n \"display\": \"standalone\",\n \"icons\": [\n {\n \"src\": \"assets\\/icons\\/android-icon-36x36.png\",\n \"sizes\": \"36x36\",\n \"type\": \"image\\/png\",\n \"density\": \"0.75\"\n },\n {\n \"src\": \"assets\\/icons\\/android-icon-48x48.png\",\n \"sizes\": \"48x48\",\n \"type\": \"image\\/png\",\n \"density\": \"1.0\"\n },\n {\n \"src\": \"assets\\/icons\\/android-icon-72x72.png\",\n \"sizes\": \"72x72\",\n \"type\": \"image\\/png\",\n \"density\": \"1.5\"\n },\n {\n \"src\": \"assets\\/icons\\/android-icon-96x96.png\",\n \"sizes\": \"96x96\",\n \"type\": \"image\\/png\",\n \"density\": \"2.0\"\n },\n {\n \"src\": \"assets\\/icons\\/android-icon-144x144.png\",\n \"sizes\": \"144x144\",\n \"type\": \"image\\/png\",\n \"density\": \"3.0\"\n },\n {\n \"src\": \"assets\\/icons\\/android-icon-192x192.png\",\n \"sizes\": \"192x192\",\n \"type\": \"image\\/png\",\n \"density\": \"4.0\"\n }\n ]\n}\n\nThen build it in production: \nng build --prod --aot=false --build-optimizer=false\n\nHttp-server run in SSL mode, but lsit of service workers in chrome dev-tools is clear. ", "What's wrong? ", "May be this flags broke it --aot=false --build-optimizer=false?", "\n\nA:\n\nSeems to be a problem in registering service worker in module where also importing AngularFire2. ", "I found solution how to register SW in main.ts, that's work:\nplatformBrowserDynamic().bootstrapModule(AppModule).then(() => {\n if ('serviceWorker' in navigator && environment.production) {\n navigator.serviceWorker.register('ngsw-worker.js');\n }\n}).catch(err => console.log(err));\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006815412198193371, 0.000641089747659862, 0.0017141763819381595, 0.0007939144852571189, 0.0012416739482432604, 0.000647703476715833, 0.0007403634372167289 ]

[ "Q:\n\nOneDrive SDK - IOS Get Special Folder\n\nI am confused to the correct usage of the OneDriveSDK for IOS on the correct way to create a query in order to get all items in the special folder. ", "\nI want to get the music items but once I create the request how should it be executed ?", "\nThere is no relevant example I can find anywhere. ", "Other types of requests have implementation methods, but not special folders \nThe url I want to construct is simple enough\nhttps://api.onedrive.com/v1.0/drive/special/music/children\n\nBut I am confused on how to use the SDK to create and execute it\n@class ODItemRequest, ODURLSessionDataTask;\n\nThe furthest I got was\nODSpecialCollectionRequest *musicCollectionRequest = self.client.drive.special.request; \n\nWhat would I do next ? ", "\ndocumentation is at \nhttps://github.com/OneDrive/onedrive-sdk-ios/blob/master/docs/overview.md\nand the sdk is at\nhttps://github.com/OneDrive/onedrive-sdk-i\nODSpecialCollectionRequest.h\n\n#import \"ODModels.h\"\n#import \"ODCollectionRequest.h\"\n\ntypedef void (^ODItemCompletionHandler)(ODItem *response, NSError *error);\n\ntypedef void (^ODSpecialCompletionHandler)(ODCollection *response, ODSpecialCollectionRequest *nextRequest, NSError *error);\n\n/**\n* The header for type ODSpecialCollectionRequestBuilder.", "\n*/\n\n@interface ODSpecialCollectionRequest : ODCollectionRequest\n@end\n\nA:\n\nFirst notice that the request you are generating isn't quite right. ", " You want an ODChildrenCollectionRequest, generated from the \"Music\" folder. ", " To do this you will need to construct the correct URL using method calls (not properties like you have above). ", " This looks like:\nODChildrenCollectionRequest *request = [[self.client drive] special:@\"Music\"] children] request];\n\nYou then want to execute a get on the children request. ", " This looks like :\n[request getWithCompletion:^(ODCollection *response, ODChildrenCollectionRequest *nextRequest, NSError *error){\n if(!error){\n // Do Stuff with children\n }\n}];\n\nThe completion handler takes three parameters\n\nthe ODCollection which contains a NSArray of ODItem called\nvalues these are the children of the music folder. ", "\nAnother ODChildrenCollectionRequest, By default we only return the first\n 200 items in a collection, this is another request you can issue\n that will return the next page of items.", "\nAn NSError object, this will be nil unless there was an error\n somewhere along the request.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006947379442863166, 0.0005879029049538076, 0.0005857708165422082, 0.0007780218729749322, 0.0008645369089208543, 0.0007352049578912556, 0.0007980794762261212, 0.0006970136892050505, 0.0008769846754148602, 0.0015162042109295726, 0.0007200093241408467, 0.003499615238979459, 0.001995444530621171 ]

[ "Q:\n\nIt is as simple as ABC\n\nFind three different digits $ A, B, C $ that satisfies the equation $ \\overline{ABC} \\times \\overline{AA} \\times \\overline{AB} \\times C = \\overline{ABCABC}. ", "$\n\nA:\n\n $ABCABC=1001\\times ABC$. $1001=7\\times11\\times13$. So $A=1, B=3, C=7$ is the soution.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0012964513152837753, 0.057230547070503235, 0.001995444530621171 ]

[ "Q:\n\nSharePoint Online Permissions Not Updating\n\nSome of our SharePoint sites have permissions maintained in AD. ", " I added a person to a group in question, but he can not yet access the site. ", " The change was made two days ago. ", " If I pull up the Microsoft 365 admin center I can see that the AD group has synced and he is a member of it, yet he still does not have access to the site. ", " If I look at permissions of other members of the AD group on the site I do see them as having access through that group. ", " Am I missing a step, or is there an automated process that takes place that refreshes SharePoint permissions? ", " If so, can that be adjusted?", "\n\nA:\n\nThis is knowing isssue with Active Directory groups... It takes some time to apply new permissions... Sometimes it is few hours, sometimes few days (we already faced this issue)\n\nIf you sync AD to AAD, check if there are errors in synchronization > do full sync to AAD\nVerify that user in Office 365 portal in Users has right groups\nAAD and SP User Service have own jobs for synchronization and it run automatically, you must wait. ", "If you need permissions now, set account to SharePoint group\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007099162903614342, 0.0005544400191865861, 0.0005885299178771675, 0.0006376167293637991, 0.0005563555168919265, 0.0006847711629234254, 0.0008013861370272934, 0.0006687485729344189, 0.0007098435307852924 ]

[ "Raklet News\n\nFollowing the investment of Techstars, Raklet continues to widen its activity area as a global community management platform. ", "As part of this, we were at the Websummit Lisbon with internet technology leaders between the 7th and 10th of November.", "\n\nFocusing on promising startups or first-time entrepreneurs, the Accelerator is an immersive program designed to build great startups. ", "During the 4-month program, startups will have access to top-notch mentorship, technical training and support, and the opportunity to network with angel investors, venture capitalists, Microsoft executives, local media, and industry experts.", "\n\nJust in time for the spring start, eight start-ups from Germany, Switzerland, Turkey and Spain have moved into the Microsoft Accelerator in the heart of Berlin. ", "The participants of the fifth grade have been selected from over 400 applications and will work intensively on their ideas, products, technology and business models for four months. ", "They are supported by an on-the-ground team and a network of external mentors, partners, and experts." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005892127519473433, 0.0005556856631301343, 0.0005588214844465256, 0.0005306319217197597, 0.0005470025353133678, 0.0005513121723197401, 0.0005719943437725306 ]

[ "The Economist Ranks The Birmingham MBA Within Top 10 UK Schools\n\nPosted on Monday 17th October 2011\n\nThe Birmingham MBA are delighted to announce that we have been ranked 9th in the UK by The 2011 Economist Rankings, moving up three places from 12th. ", "We have now achieved one of our targets to be in the top 10 of UK Business Schools.", "\n\nWith ever increasing and fierce international competition, we are also pleased to report that we have mostly maintained our global position in the rankings – a slight movement from 68th to 70th The impact of such competition does make our other target more challenging – to be ranked in the world top 50. ", "Nevertheless we strive towards this achievement and seek to consolidate our UK top ten standing.", "\n\nProfessor Steve Kempster, Director of MBA Programmes “We are delighted with our improved ranking position in the UK. ", "We are committed to continue to build on the quality of our MBA and for it to remain a leading global MBA programme. ", "Significant investments we have made in developing the programme should put us in a great position in terms of enabling our graduates to achieve their career ambitions.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005640547606162727, 0.0006812304491177201, 0.000551858451217413, 0.0005344228120520711, 0.0005390260485000908, 0.0004963739193044603, 0.0005303391953930259 ]

[ "Alun Ffred Jones\n\nAlun Ffred Jones (born 29 October 1949) is a Welsh politician and member of Plaid Cymru and former television producer, writer and director. ", "Jones was the National Assembly for Wales Member for Caernarfon 2003–07 and for the newly created Arfon constituency since the 2007 National Assembly for Wales election. ", "He is now the current Chair of Plaid Cymru.", "\n\nBackground\nJones was born in Brynamman and is the brother of former Plaid Cymru President Dafydd Iwan. ", " He was educated at the University of Wales, Bangor. ", "Before his election, he was a television director and producer for Ffilmiau'r Nant and a BAFTA Cymru winner as co-writer of the S4C Welsh language comedy series, C’mon Midffild!. ", "Before that he was a Welsh teacher and Head of Department and then a journalist with HTV. ", "Jones speaks Welsh, English and French.", "\n\nPolitical career\nJones is the former Leader of Gwynedd County Council, is Chair of Antur Nantlle and chair of Nantlle Vale Football Club. ", " His main political interests are in broadcasting, community development and the economy. ", "On 22 July 2008 he was appointed Minister for Heritage in the Welsh Labour/Plaid Cymru coalition Welsh Assembly Government.", "\n\nOn 20 November 2008, Jones became the first person to use the Welsh language as a representative of the UK government at a European Union meeting in Brussels.", "\n\nReferences\n\nExternal links\nAlun Ffred Jones AM website\nPlaid Cymru Website\n\nOffices held\n\nCategory:1949 births\nCategory:Living people\nCategory:Councillors in Wales\nCategory:Plaid Cymru politicians\nCategory:Alumni of Bangor University\nCategory:Plaid Cymru Members of the National Assembly for Wales\nCategory:Members of the Welsh Assembly Government\nCategory:Wales AMs 2003–2007\nCategory:Wales AMs 2007–2011\nCategory:Wales AMs 2011–2016\nCategory:Welsh-speaking politicians\nCategory:People from Brynamman" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0012978739105165005, 0.001024521072395146, 0.0010121993254870176, 0.0009924637852236629, 0.0006295074126683176, 0.0019237286178395152, 0.0008277414599433541, 0.000677442760206759, 0.0008475164650008082, 0.0006003729649819434, 0.0006960664177313447, 0.0005752326105721295, 0.000710330146830529 ]

[ "Q:\n\nAudioSet and Tensorflow Understanding\n\nWith AudioSet released and providing a brand new area of research for those who do sound analysis for research, I've been really trying to dig deep these last few days on how to analyze and decode such data. ", " \nThe data is given in .tfrecord files, heres a small snippet.", "\n�^E^@^@^@^@^@^@C�bd\nu\n^[\n^Hvideo_id^R^O\n\n^KZZcwENgmOL0\n^^\n^Rstart_time_seconds^R^H^R^F\n^D^@^@�C\n^X\n^Flabels^R^N^Z^L\n\n�^B�^B�^B�^B�^B\n^\\\n^Pend_time_seconds^R^H^R^F\n^D^@^@�C^R�\n\n�\n\n^Oaudio_embedding^R�\n\n�^A\n�^A\n�^A3�^] q^@�Z�r�����w���Q����.", "���^@�b�{m�^@P^@^S����,^]�x�����:^@����^@^@^Z0��^@]^Gr?v(^@^U^@��^EZ6�$\n�^A\n\nThe example proto given is:\ncontext: {\n feature: {\n key : \"video_id\"\n value: {\n bytes_list: {\n value: [YouTube video id string]\n }\n }\n }\n feature: {\n key : \"start_time_seconds\"\n value: {\n float_list: {\n value: 6.0\n }\n }\n }\n feature: {\n key : \"end_time_seconds\"\n value: {\n float_list: {\n value: 16.0\n }\n }\n }\n feature: {\n key : \"labels\"\n value: {\n int64_list: {\n value: [1, 522, 11, 172] # The meaning of the labels can be found here.", "\n }\n }\n }\n}\nfeature_lists: {\n feature_list: {\n key : \"audio_embedding\"\n value: {\n feature: {\n bytes_list: {\n value: [128 8bit quantized features]\n }\n }\n feature: {\n bytes_list: {\n value: [128 8bit quantized features]\n }\n }\n }\n ... # Repeated for every second of the segment\n }\n\n}\n\nMy very direct question here - something that I can't seem to find good information on is - how do I convert cleanly between the two?", "\nIf I have a machine readable file, how to make it human readable, as well as the other way around.", "\nI have found this which takes a tfrecord of a picture and converts it to a readable format... but I can't seem to get it to a form that works with AudioSet\n\nA:\n\nthis worked for me, storing the features in feat_audio. ", " to plot them, convert them to an ndarray and reshape them accordingly.", "\naudio_record = '/audioset_v1_embeddings/eval/_1.tfrecord'\nvid_ids = []\nlabels = []\nstart_time_seconds = [] # in secondes\nend_time_seconds = []\nfeat_audio = []\ncount = 0\nfor example in tf.python_io.tf_record_iterator(audio_record):\n tf_example = tf.train.", "Example.", "FromString(example)\n #print(tf_example)\n vid_ids.append(tf_example.features.feature['video_id'].bytes_list.value[0].decode(encoding='UTF-8'))\n labels.append(tf_example.features.feature['labels'].int64_list.value)\n start_time_seconds.append(tf_example.features.feature['start_time_seconds'].float_list.value)\n end_time_seconds.append(tf_example.features.feature['end_time_seconds'].float_list.value)\n\n tf_seq_example = tf.train.", "SequenceExample.", "FromString(example)\n n_frames = len(tf_seq_example.feature_lists.feature_list['audio_embedding'].feature)\n\n sess = tf.", "InteractiveSession()\n rgb_frame = []\n audio_frame = []\n # iterate through frames\n for i in range(n_frames):\n audio_frame.append(tf.cast(tf.decode_raw(\n tf_seq_example.feature_lists.feature_list['audio_embedding'].feature[i].bytes_list.value[0],tf.uint8)\n ,tf.float32).eval())\n\n sess.close()\n feat_audio.append([])\n\n feat_audio[count].append(audio_frame)\n count+=1\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005328910192474723, 0.0012593247229233384, 0.24488602578639984, 0.0007770326919853687, 0.000759318470954895, 0.0006051859236322343, 0.0006684860563836992, 0.004044828005135059, 0.0008225442143157125, 0.0007099463837221265, 0.0008884667186066508, 0.0006998255266807973, 0.000820153160020709, 0.0008039557142183185 ]

[ " \nIf you've been living under a rock will smith has become a revived meme after the catastrophe that was called youtube rewind in 2018\nand the reason why this happened is because of a little\nEntanglement that jada had with august alsina. ", "I'm also working on an album and i'll give you a snippet\nSo jada pinkett and will smith went on red table talk to talk about some scandals about their persona and\nI mean scandalous persona on the media will claimed this would be a healing moment as they needed to \"clear their heads\"\nBut why do why do in the public public in the public eye that's my question(Repetition, I know lmao)\nThis is just going to be another controversial take on two of you two of you. ", "That's and\nIt's also claimed that they are they're in an open marriage relationship, but it's explained as if it's wrong\nthe problem is\nThey spoke on national tv about jada's relationship with august alsina and how she was dating him the most famous line\nShe said was she had an entanglement with\nFreaking august things like this are supposed to be kept behind closed doors\nBut they decided to bring stuff up hence i'm talking about it today\nI don't know how open marriages and different families work and i'm just talking about this generally\nGenerally speaking. ", "Will smith got played devastated\nJada became a meme and august is taking the piss out of will he literally made a whole song about the situation?", "\nIt's literally named entanglements for crying out loud. ", "All three of these lads need to be sent to the gulag like honestly\nSo that's a stephen move\nwhen harriet tubman\nWell harriet tubman never actually freed the slaves jesus had the slaves go work for other white people y'all we leaving right now\non the os has also been the news shock like he's been talking about uh, you know,\num, he also said that he was bipolar and the issue was he you know,\nHe'll say he wants to do stuff above and beyond expectation and then suddenly just turn it down\nHe said he he decided to become a president. ", "He wanted to be president\nSo he, you know, obviously everyone's going to talk about it\nHe just turns it off and then comes and then comes back to make a campaign\nAnd he was mostly talking about abortion and you know talking about how his dad almost supported him when he was\nwhen he was a child or he was almost born unborn and\nYeah and stuff like that. ", "It was really touching but then he started to talk about this. ", "So that's a stephen move\nwhen harriet tubman\nWill harry and tutman never actually freed the slaves. ", "Jesus had the slaves don't work for all the white people y'all we leaving right now\nNo, i'm not sure about that one, I don't know if that checks out kanye kanye, mr. ", "West listen listen\nlook\nYou're a black man living in a country that in the past has had a racial past about oppressing minors\nYou should know about this freaking history mate. ", "Like why would you make these claims? ", "And yeah, I could say\nYou guys could say mental health and all of that bullshit, but this guy is just making\nUnexplainable claims that just make don't make sense. ", "There's no facts. ", "He doesn't have a professor to back him up\nHe just has a bulletproof vest which he knows if you say stuff like this\nHe might get divorced by kim or get shots might get killed\nSo he got the bull professor on him like this is not world war ii or freaking call of duty\nOf course, he wants to be sent to the gulag so he could redeem himself. ", "He can't redeem himself anymore\nHe said stuff like that like two years ago many people forgot about it. ", "But now he he brings us up another thing\nThis is not going to be forgotten. ", "He's literally taking a piss out of harriet tubman\nYou don't know how um what she's been through her whole life\nShe literally\nShe was literally born in slavery her family members were taken away from her where she was very little she doesn't remember\nmost of her family members when she was young and then now she\nAnd made american history by making the underground railroad and then helping other lads\nWhy would you why would you say that if you have no proof if you have no\nYou know\nConspiracy thinking you just say stuff just saying and it's like a common trend for politicians to just take the piss out of any historical\nyou know historical events, like people like donald trump have have said\ndumb stuff, um kanye west, you know\nmany others even joe biden said controversial stuff and he's in the presidency many politicians have said\ncontroversial stuff\nYou know\nAnd they they don't back it up with with with false claims, especially donald trump. ", "He loves to do that\nIt's like that's what he's known for\nHe just likes to you know, make false claims and stereotype and that's why people call him racist because that's what he does\nAnd yeah, you know, I don't i'm not trying to talk about politics\nBut uh kanye this was just this was uncalled for me\nYou didn't really need to say that you would have said anything, but that and now your reputation is ruined\nYou're not going to become the president\nOkay, so I stubbed myself\nEither joe biden lord have mercy donald trump. ", "I have freedom of speech. ", "I don't don't come at me, but\nKanye west no, it can't happen\nHonestly months before I uh, I was saying kanye west 2020 is a joke, and now kanye west actually wants to become president\nHe can't because one he has no\npresidential you know\nPolitical standing he hasn't been politics that much. ", "Yes. ", "He has politic, uh, political friends like barack obama\nUm, donald trump. ", "I think he's not friends with donald trump anymore because he claims you know his\nhis ways even though he literally just took the piss out of harriet tubman, but you know\nAnd he he's made friends with uh, uh politicians. ", "Those are the ones I could name\nUm, and yeah, but he's not a politician himself. ", "He's a musician. ", "He's an artist. ", "He's an entrepreneur\nHe literally he literally made shoes easy obviously and you know, he's been friendly artists that is his job\nWhy would you go to politics if you have no, you know?", "\nNo political political thinking I mean, there are some people that could move from what they're doing to politics\nOut of it. ", "I'm not refusing now. ", "I'm just saying it's too early in it, like i'm not saying artists can be\nPoliticians but you you should try and learn\nActually, you should learn the way of politician. ", "You can't just oh because I was friends with donald trump automatic automatically\nYou know makes me candidate for president. ", "That's not how it works. ", "You need to be a politician\nYou need to know the political ways, you know\nlearn from all the politicians\nLearn how to debate because if this guy goes to the bay\nHe's going to get demolished by any politician that comes at him because he does he doesn't know the facts. ", "He doesn't research\nHe he just took the piss out of harriet tubman. ", "Yes i'm using i'm using her and he's he said\nThat we decided to be slaves a black man saying that we decided to be slaves\nwhat the like this does not make any sense and I think um\nKanye west should come back think what he says and make a speech because he's just saying anything out of his head\nYes, the abortion part was totally saddened. ", "Um, I feel bad for him\nIf it's true, I don't know. ", "But if it's true I feel bad for him\nBut what he said after that was just uncalled for shout out to the person\nWho said we're leaving like that was that was the funniest part like this guy just says anything out of his head\nif you want to say his mental illness you can but\nFrom my perspective you could have you could have just written a speech if you know you have a mental illness\nsomething as you know serious as\nBeing bipolar you should have just written a speech and read you know or read\nIt's not like you're disabled from reading and writing\nIt's just like, you know, it's just it's just a thought just just speak out of your mind\nBut you can just read uh, read it right you just write a speech\nI read it. ", "That's what most politicians do but he's not politician\nSo, you know\nhe just set anything out of his mind and expected that he just come out right but now he's he's scared and he's saying\noh kim might\nDivorced me, you know from what I said\nKanye I want a divorce\nyou and I\ndecided we were gonna\nTake our space and what happened? ", "Yeah, and then I got into an entanglement with\nAugust an entanglement with august an entanglement with august an entanglement an entanglement an entanglement with american\nEntanglement. ", "I swear man. ", "The internet is so fast\nmoral of the story is\nDon't say stupid shxt kids and uh, yeah, thank you for watching. ", "Um, like if you liked the video\nComments what you think about the situation? ", "Um, you know, you can comment anything. ", "Um,\nYeah, even make it even make friendships in the comment section. ", "It doesn't really matter\nUm, yeah subscribe if you like the content that I make\nIf because I don't want that demotivating stuff\nAnd uh, yeah\nPlease sub to ryan\n" ]

{ "pile_set_name": "YoutubeSubtitles" }

[ 0.000960199220571667, 0.0015463982708752155, 0.0007574398186989129, 0.11739490926265717, 0.0008681604522280395, 0.021067064255475998, 0.001575749134644866, 0.0005376944318413734, 0.005722560454159975, 0.07278624922037125, 0.9558206796646118, 0.0008398711797781289, 0.8731710910797119, 0.0008262029150500894, 0.5087912082672119, 0.0008284930954687297, 0.0006875077378936112, 0.32002267241477966, 0.03746190294623375, 0.0010737598640844226, 0.0008517347159795463, 0.0008940021507441998, 0.0006753510097041726, 0.010264343582093716, 0.0016721785068511963, 0.0027809315361082554, 0.0031303123105317354, 0.00238038063980639, 0.0006582610076293349, 0.0010313699021935463, 0.0018159335013478994, 0.0006948753725737333, 0.0010106305126100779, 0.0010644459398463368, 0.2679247558116913, 0.016897082328796387, 0.0009216158650815487, 0.1088733822107315, 0.017489152029156685, 0.0017802929505705833, 0.029586540535092354, 0.673846423625946, 0.0005782085936516523, 0.0007245394517667592, 0.0006412715301848948, 0.001113129430450499 ]

[ "1. ", "Introduction\n===============\n\nKaposi's sarcoma-associated herpesvirus (KSHV), also known as Human Herpesvirus 8 (HHV-8), is a DNA tumor virus that infects endothelial cells *in vivo* and is the etiological agent of Kaposi's sarcoma (KS) \\[[@B1-viruses-06-04005]\\]. ", "KSHV has been linked to two B cell lymphoproliferative disorders, primary effusion lymphoma (PEL) and a subset of multicentric Castleman's disease (MCD) \\[[@B2-viruses-06-04005],[@B3-viruses-06-04005]\\]. ", "As with all herpesviruses, KSHV has both lytic and latent modes of replication. ", "During lytic replication and reactivation, genome-wide expression occurs in a temporally regulated cascade of immediate early, early, and late genes, which results in lysis of the host cell and release of progeny virus. ", "During latency most tumor cells express only a limited number of genes, the majority residing in the latency-associated region, which encodes the latency-associated nuclear antigen (LANA), v-FLIP, v-cyclin, kaposin, and 12 miRNA genes. ", "A subset of cells also express vIRF3, vIL-6, and K1 during latency \\[[@B4-viruses-06-04005],[@B5-viruses-06-04005],[@B6-viruses-06-04005],[@B7-viruses-06-04005],[@B8-viruses-06-04005],[@B9-viruses-06-04005],[@B10-viruses-06-04005],[@B11-viruses-06-04005],[@B12-viruses-06-04005]\\].", "\n\nMicroRNAs (miRNAs) are non-coding RNAs 19--23 nucleotides in length that regulate gene expression post-transcriptionally by targeting 3\\' untranslated regions (UTRs) of messenger RNAs (for review see \\[[@B13-viruses-06-04005]\\]). ", "Since the discovery of highly expressed KSHV-encoded miRNAs in all KSHV-associated tumors \\[[@B14-viruses-06-04005],[@B15-viruses-06-04005]\\], several cellular targets of KSHV-encoded miRNAs have been identified. ", "Roles for KSHV miRNAs include promotion of angiogenesis, cell cycle regulation, inhibition of apoptosis and recently transformation \\[[@B16-viruses-06-04005]\\] (for reviews see \\[[@B17-viruses-06-04005],[@B18-viruses-06-04005],[@B19-viruses-06-04005]\\]). ", "Early after the discovery of herpesvirus-encoded miRNAs it was hypothesized that these novel viral post‑transcriptional regulators may promote latency by targeting lytic genes \\[[@B20-viruses-06-04005]\\]. ", "Indeed, one EBV microRNA, miR-BART2, is encoded antisense to BALF5, the EBV DNA polymerase, and targeting and cleavage of the BALF5 mRNA has been experimentally confirmed \\[[@B21-viruses-06-04005],[@B22-viruses-06-04005]\\]. ", "For KSHV, elegant work from the Ganem lab utilizing miRNA mimic- and antagomir-based screens provided evidence that KSHV miRNAs can modulate the latent/lytic transition through direct targeting of RTA by miR-K12-9 \\* \\[[@B23-viruses-06-04005]\\]. ", "RTA, the product of the immediate early lytic gene ORF50, is the KSHV replication and transcriptional activator that is expressed first during reactivation and initiates the cascade of lytic gene expression by activating several early lytic gene promoters \\[[@B24-viruses-06-04005],[@B25-viruses-06-04005]\\]. ", "Direct miRNA targeting of RTA was also demonstrated for miR-K12-5 and miR-K12-7 based on *in vitro* luciferase assays \\[[@B26-viruses-06-04005],[@B27-viruses-06-04005]\\], consistent with *in silico* prediction of targets within the RTA 3\\'UTR. ", "Hence, direct targeting of RTA by miRNAs may act as a gate keeper of latency by preventing reactivation.", "\n\nConceptually, miRNAs can also contribute to latency by targeting host factors that normally tip the balance toward reactivation. ", "We present evidence here that KSHV miRNAs contribute to the maintenance of latency by targeting cellular transcription factors. ", "Our data demonstrate that miR-K12-11 and miR-K12-3 prevent lytic reactivation by modulating expression of the transcription factors MYB, C/EBPα and Ets-1, which have previously been reported as activators of the RTA promoter \\[[@B28-viruses-06-04005],[@B29-viruses-06-04005],[@B30-viruses-06-04005]\\].", "\n\n2. ", "Materials and Methods\n========================\n\n2.1. ", "Cell Lines\n---------------\n\nBC-3-G cells containing a PAN-GFP expression cassette were provided by Ren Sun (UCLA) \\[[@B28-viruses-06-04005]\\]. ", "BC-3-G, BC-3 and BCBL-1 primary effusion lymphoma (PEL) cells are latently infected with KSHV, and were cultured in RMPI supplemented with 10% FBS, 1% penicillin/streptomycin, and 1% sodium pyruvate. ", "Human embryonic kidney 293 and 293T cells were cultured in DMEM with 10% FBS and 1% P/S. iSLK cells were kindly provided by Don Ganem (UCSF) \\[[@B31-viruses-06-04005]\\] and were cultured under the same conditions as 293 cells. ", "TIVE ([T]{.ul}elomerase [I]{.ul}mmortalized [V]{.ul}ein [E]{.ul}ndothelial) cells were cultured as previously described \\[[@B32-viruses-06-04005]\\].", "\n\n2.2. ", "Antagomir Derepression Assays and Quantitative Reverse Transcription-PCR (RT-qPCR) Analysis\n------------------------------------------------------------------------------------------------\n\nFor inhibition of KSHV miRNAs, 2\\'OMe RNA antagomirs were used as previously described \\[[@B33-viruses-06-04005]\\]. ", "PEL cells (1 × 10^6^) were transfected with 50--400 nM of antagomir using TransIT-TKO transfection reagent (Mirus) as described \\[[@B34-viruses-06-04005]\\]. ", "At 48 h post transfection (hpt), cells were harvested using RNA-Bee (Tel-Test) according to the manufacturer's instructions. ", "1 μg of DNase treated RNA was reverse transcribed using SuperScript III (Invitrogen, Grand Island, NY, USA) according to the manufacturer's instructions. ", "Quantitative PCR (qPCR) analysis was carried out using an ABI StepOne Plus system along with ABI Fast SYBR reagent (Applied Biosystems, Carlsbad, CA, USA). ", "Expression of all genes was normalized to β-actin expression, and Student's t-tests were performed to determine statistical significance compared to the mock control. ", "The sequences of PCR primers can be found in [Table 1](#viruses-06-04005-t001){ref-type=\"table\"}.", "\n\nviruses-06-04005-t001_Table 1\n\n###### \n\nPrimers used in this study.", "\n\n --------------------------------------------------------------------------------\n Gene Primer Sequence 5\\'-3\\' Reference\n --------------- ---------------------------------- -----------------------------\n MYB 3\\'UTR FWD- GATGGAGGAGCAGATGACATC\\ \n REV- AGGTAAAATAAGGGCAC \n\n Ets-1 3\\'UTR FWD- CGTGTTGGTTGGACTCTGAA\\ \n REV- TCTCCAGCAAAATGATGTGC \n\n C/EBPα 3\\'UTR FWD-CTTGTGCCTTGGAAATGCAAACTCACC\\ \n REV- AAGAAGAGAACCAAGCCGTCCTTC \n\n MYB FWD- TCAGGAAACTTCTTCTGCTCACA\\ \n REV- AGGTTCCCAGGTACTGCT \n\n Ets-1 FWD- AAGGGAGATCGAAGGAGGAA\\ \n REV- TCTGCTATAGGAACTGCAGGAG \n\n C/EBPα FWD- TGTATACCCCTGGTGGGAGA\\ \n REV- TCATAACTCCGGTCCCTCTG \n\n RTA FWD- CACAAAAATGGCGCAAGATGA\\ \\[[@B35-viruses-06-04005]\\]\n REV- TGGTAGAGTTGGGCCTTCAGTT \n\n ORF59 FWD- TTAGAAGTGGAAGGTGTGCC\\ \\[[@B36-viruses-06-04005]\\]\n REV- TCCTGGAGTCCGGTATAGAATC \n\n ORF19 FWD- GGCGAAAAAGTCAGCGGTGGT\\ \\[[@B37-viruses-06-04005]\\]\n REV- CGGCGCGTCTTCCCTAAAGA \n\n LANA\\ FWD- GCGCCCTTAACGAGAGGAAGTT\\ \n N-Terminus REV- TTCCTTCGCGGTTGTAGATG \n\n β-actin FWD- CATGTACGTTGCTATCCAGGC\\ Primerbank\\\n REV- CTCCTTAATGTCACGCACGAT ID 4501885a1\n --------------------------------------------------------------------------------\n\n2.3. ", "Virus Isolation and Quantitation\n-------------------------------------\n\nVirus particles were harvested from PEL cells 6 days post transfection (dpt) with antagomirs. ", "Cells were pelleted at 1100 RPM for 5 min and media supernatant was passed through a 0.45 μM filter. ", "Virus particles were pelleted by ultra-centrifugation using a Beckman SW-40 rotor at 100,000 g for 1 h on a 25% sucrose cushion. ", "Virus pellets were resuspended in 1% of the original medium volume using serum-free RPMI. ", "DNA was extracted from 25 μL of virus stocks using DNAzol (Molecular Research Center, Inc., Cincinnati, OH, USA) and resuspended in 25 μL of ddH~2~O. Viral genome copy number was determined by qPCR assay using a standard curve based on serially diluted LANA expression plasmid.", "\n\n2.4. ", "Recombineering of miRNA Deletion Mutants in KSHV BAC16\n-----------------------------------------------------------\n\nKSHV BAC16 \\[[@B38-viruses-06-04005],[@B39-viruses-06-04005]\\] was kindly provided by the Jung lab (USC). ", "A modified version of the protocol by Tischer *et al.* ", "\\[[@B40-viruses-06-04005]\\] was used to generate mutant bacmids. ", "BAC DNA was isolated from bacteria using the Large-Construct Kit (Qiagen) according to the manufacturer's recommendations. ", "293T cells were transfected with 2 μg of DNA using TransIT-293 reagent (Mirus) according to the manufacturer's instructions. ", "Cells were selected with 100 μg/mL hygromycin B and expanded for 10--15 days. ", "Transfected cells, which express GFP, were monitored under a fluorescence microscope. ", "Once the expanded cell population was 100% GFP positive, cells were induced with 20 pg/mL of TPA and 1 mM valproic acid and co-cultured with iSLK cells \\[[@B41-viruses-06-04005]\\]. ", "Infected iSLK cells were selected using 1 μg/mL puromycin, 250 μg/mL G418, and 1.2 mg/mL hygromycin B. Stable KSHV∆miRNA BAC16 iSLK cells were induced using 1 μg/mL doxycycline (DOX) and 1 mM sodium butyrate. ", "Virus was collected and quantified at 4 days as described above.", "\n\n2.5. ", "Reporter Construction and Luciferase Assays\n------------------------------------------------\n\nMYB, C/EBPα, and Ets-1 full length 3\\'UTR sequences were cloned downstream of the luciferase gene in pGL3 promoter (Promega) using pCRII-TOPO (Invitrogen) for MYB and GeneArt Seamless Cloning (Invitrogen) for C/EBPα and Ets-1. ", "Primers for 3\\'UTR cloning can be found in [Table 1](#viruses-06-04005-t001){ref-type=\"table\"}. ", "293 cells were transfected using TransIT-293 reagent (Mirus) in 24-well cell culture dishes according to the manufacturer's protocol. ", "Each transfection reaction contained 2 ng pCMV-Renilla (Promega) control vector, 20 ng pGL3 promoter-3\\'UTR reporter construct and 0, 400 or 800 ng pcDNA3.1 miRNA expression vector complemented with 800, 400, or 0 ng of empty pcDNA3.1 vector as filler to reach 800 ng total pcDNA3.1 in each transfection \\[[@B42-viruses-06-04005]\\]. ", "Cells were harvested 72 h post transfection and luciferase activity was quantified using the Dual Luciferase Reporter kit (Promega) according to the manufacturer's protocol. ", "Each lysate was assayed for firefly luciferase activity using a FLUOstar OPTIMA reader (BMG Labtech, Cary, NC, USA). ", "Firefly luciferase activity for each sample was normalized to Renilla expression and samples were compared to the miRNA mock transfection control. ", "Transfection assays were performed in triplicate and repeated at least 3 times. ", "Standard deviation was calculated for triplicates and displayed as error bars in the figures. ", "Significance of the repression of the reporter construct relative to the 0 ng miRNA expression vector was tested by one-tailed, unpaired t-test.", "\n\n3. ", "Results\n==========\n\n3.1. ", "Screening for Effects of KSHV miRNA Knockdown on Reactivation in BC-3-G Cells\n----------------------------------------------------------------------------------\n\nIn order to determine which KSHV-encoded miRNAs may affect lytic reactivation, miRNA knockdown studies were performed in BC-3-G \\[[@B28-viruses-06-04005]\\], a PEL-derived indicator cell line. ", "BC-3-G cells contain a GFP cassette under the control of the KSHV PAN promoter, which is highly transactivated by RTA. ", "Upon lytic reactivation, RTA is the first protein expressed, activates the PAN promoter and as a result switches on GFP expression \\[[@B28-viruses-06-04005]\\].", "\n\nTo validate efficiency and specificity of 2\\'OMe antagomirs against KSHV miRNAs, knock-down was assessed by stem-loop TaqMan qPCR which measures the amount of mature miRNA. ", "These experiments were done in BCBL-1 cells with antagomirs against miR-K12-3 and miR-K12-11. ", "Transfection of antagomirs against miR-K12-3 yielded reduced levels of miR-K12-3, with the greatest effect at the highest concentration (400 nM) of antagomir ([Figure 1](#viruses-06-04005-f001){ref-type=\"fig\"}A). ", "Antagomirs against miR-K12-3 did not reduce the level of miR-K12-11. ", "Similarly, miR-K12-11 antagomirs gave progressively reduced levels of miR-K12-11 with increasing antagomir concentration, but had no effect on the level of mature miR-K12-3 ([Figure 1](#viruses-06-04005-f001){ref-type=\"fig\"}A). ", "When antagomirs against miR-K12-3 and miR-K12-11 were co‑transfected, strong inhibition of both miRs was observed.", "\n\nBC-3-G cells were transfected with antagomirs for each of the 12 KSHV-encoded miRNAs. ", "Cells were monitored for GFP expression by fluorescence microscopy at 72 h after transfection. ", "Mock transfected control cells displayed a small number of GFP-expressing cells arising from spontaneous reactivation. ", "Screening was performed with inhibition of all 12 KSHV-encoded miRNAs individually or in combinations. ", "The greatest increase in GFP expression was observed when either miR-K12-3 or miR-K12-3 in combination with miR-K12-11 were knocked down (data not shown). ", "MiR-K12-3 is the most abundant miRNA within RISC complexes in BC-3 cells but is only moderately expressed in BCBL-1 cells; miRK-12-11 is moderately expressed in both PEL lines. ", "\\[[@B43-viruses-06-04005],[@B44-viruses-06-04005]\\]. ", "Interestingly, miR-K12-11 is a mimic of hsa-miR-155 and has been shown to play an important role in B cell proliferation \\[[@B33-viruses-06-04005],[@B34-viruses-06-04005],[@B35-viruses-06-04005],[@B36-viruses-06-04005],[@B37-viruses-06-04005],[@B38-viruses-06-04005],[@B39-viruses-06-04005],[@B40-viruses-06-04005],[@B41-viruses-06-04005],[@B42-viruses-06-04005],[@B43-viruses-06-04005],[@B44-viruses-06-04005],[@B45-viruses-06-04005]\\]. ", "To take into account miRNA expression differences between PEL lines, we tested the effects of antagomirs against miR K12-3 and miR-K12-11 in both BCBL-1 and BC-3 cells.", "\n\n3.2. ", "Lytic Gene Expression and Virus Production Increase upon miR-K12-3 and miR-K12-11 Knockdown in PEL Cells\n-------------------------------------------------------------------------------------------------------------\n\nBased on the preliminary results indicating that knockdown of miR-K12-3 and miR-K12-11 in BC-3-G cells increased RTA expression, we tested for effects on virus lytic gene expression downstream from RTA and on virus production. ", "BC-3 cells, the parent of BC-3-G cells, were transfected with miR‑K12-3 antagomir, or a combination of miR-K12-3 and miR-K12-11. ", "RT-qPCR was performed at 48 h to monitor expression of RTA (immediate early gene), ORF59 (early) and ORF19 (late glycoprotein). ", "Significant increases in the levels of RTA, ORF59 and ORF19 transcripts were observed upon addition of 400 nM antagomir against miR-K12-3 ([Figure 1](#viruses-06-04005-f001){ref-type=\"fig\"}B--D). ", "Moreover, expression of these lytic genes was induced more efficiently when both miR-K12-3 and miR-K12-11 were knocked down simultaneously (200 nM miR-K12-3 antagomir plus 200 nM miR-K12-11 antagomir ([Figure 1](#viruses-06-04005-f001){ref-type=\"fig\"}B--D).", "\n\n{#viruses-06-04005-f001}\n\nWe asked if the increase in lytic gene expression translates into production of progeny virus. ", "Latently infected BCBL-1 cells were used for these experiments. ", "Cell-free virus was isolated from BCBL-1 supernatants 6 days post antagomir transfection, viral DNA was extracted, and viral genome copy number determined by qPCR. [", "Figure 1](#viruses-06-04005-f001){ref-type=\"fig\"}E shows that virus production increased in a dose dependent manner with 100, 200 and 400 nM antagomir when either miR-K12-3 or miR-K12-11 was knocked down. ", "These results indicate that knockdown of miR-K12-3 alone or of miR-K12-3 and miR-K12-11 together increases expression of lytic genes belonging to the immediate early, early and late classes. ", "Knockdown of miR-K12-3 or of miR-K12-11 alone was sufficient to increase production of progeny virus.", "\n\n3.3. ", "Generation of KSHV miRNA Deletion Mutants and Latently Infected iSLK Cells\n-------------------------------------------------------------------------------\n\nIn order to investigate the role of miR-K12-3 and miR-K12-11 in the context of viral infection, we generated two miRNA deletion mutants using the KSHV bacmid BAC16, which was derived from the PEL cell line JSC-1 \\[[@B38-viruses-06-04005],[@B39-viruses-06-04005]\\]. ", "20 to 25 bp regions were deleted from one arm of each pre-miRNA, destroying pre-miRNA hairpin formation without affecting neighboring miRNA expression. ", "A modified version of the protocol of Tischer *et al.* ", "was used to create markerless microRNA deletions within BAC16 \\[[@B40-viruses-06-04005],[@B46-viruses-06-04005]\\]. ", "Recombinant bacmids were validated by PCR and pulsed field gel electrophoresis to monitor for intact terminal repeats. ", "Detailed experimental procedures to recover recombinant bacmids in iSLK cells will be reported elsewhere \\[[@B47-viruses-06-04005]\\]. ", "miRNA deletion mutant and wild-type (WT) bacmids were transfected into 293T cells. ", "After selection, BAC16-containing 293T cells were induced with TPA and valproic acid, and co-cultured with iSLK cells, which harbor a doxycycline-inducible RTA gene and produce high levels of progeny virions \\[[@B31-viruses-06-04005],[@B41-viruses-06-04005]\\]. ", "WT BAC16-, KSHV∆miRK-12-3-, or KSHV∆miRK-12-11-containing iSLK cells produce high titer progeny virus after doxycycline induction (up to 1.14 × 10^7^ genome copies/mL). ", "As a final quality control, episomal DNAs isolated from latently infected iSLK cells containing miRNA deletion mutants or WT BAC16 were analyzed by Illumina-based genome-wide sequencing, which confirmed the presence of the appropriate deletion without detecting any mutations outside the miRNA region.", "\n\nTo test whether deletion of miR-K12-3 or miR-K12-11 had an effect on the maintenance of latency in iSLK cells, we analyzed spontaneous lytic gene expression during latent infection, and reactivation upon induction with sodium butyrate at a sub-optimal concentration. ", "The expression levels of LANA determined by RT-qPCR in wild type- and mutant-infected iSLK cells were very similar ([Figure 2](#viruses-06-04005-f002){ref-type=\"fig\"}A). ", "However, iSLK cells latently infected with KSHV∆miR-K12-11 displayed higher expression levels of RTA and ORF19 than iSLK cells infected with either WT virus or KSHV∆miR-K12-3 ([Figure 2](#viruses-06-04005-f002){ref-type=\"fig\"}A). ", "Upon sub-optimal induction with 2 mM sodium butyrate, both KSHV∆miR-K12-3- and KSHV∆miR‑K12-11-infected iSLK cells displayed ≥4-fold higher levels of RTA expression compared to KSHV wild type infected iSLK cells, and ≥6-fold higher levels of ORF19 expression ([Figure 2](#viruses-06-04005-f002){ref-type=\"fig\"}B). ", "Recently it has been shown that SLK cells, which are commonly used for KS-derived endothelial tumor biology studies, are not of endothelial origin, but are of epithelial cell origin instead \\[[@B48-viruses-06-04005]\\]. ", "To test for lytic gene expression levels in endothelial cells infected with KSHV miRNA-deletion mutants, we repeated experiments in [t]{.ul}elomerase-[i]{.ul}mmortalized [v]{.ul}ascular [e]{.ul}ndothelial (TIVE) cells \\[[@B32-viruses-06-04005]\\]. ", "Sub-optimal induction of infected TIVE cells gave a significant increase in expression of RTA and ORF19 lytic genes on infection with either KSHV∆miR-K12-3 or KSHV∆miR-K12-11 compared with WT ([Figure 2](#viruses-06-04005-f002){ref-type=\"fig\"}C), as was seen for iSLK cells ([Figure 2](#viruses-06-04005-f002){ref-type=\"fig\"}B). ", "These results suggest that expression of miR‑K12-3 and miR-K12-11 both contribute to the maintenance of latency in endothelial cells, and are consistent with the antagomir inhibition experiments in PEL cells which measured expression of RTA, ORF59, ORF19 and virus production during latent infection ([Figure 1](#viruses-06-04005-f001){ref-type=\"fig\"}).", "\n\n3.4. ", "In Silico Seed Sequence Prediction for miR-K12-3 and miR-K12-11 Identified MYB, C/EBPα, and Ets-1 as Potential Targets\n---------------------------------------------------------------------------------------------------------------------------\n\nScanning the 3\\'UTR of RTA revealed no seed sequence matches for miR-K12-3 or miR-K12-11. ", "We therefore focused on transcription factors known to activate the viral RTA promoter \\[[@B28-viruses-06-04005],[@B29-viruses-06-04005],[@B30-viruses-06-04005]\\], and searched for seed sequence matches of at least 6 nts \\[[@B49-viruses-06-04005]\\]. ", "The 3\\'UTR of the proto-oncogene MYB contained two potential 8 base binding sites for miR-K12-11 ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}A). ", "MYB is a transcriptional activator with a central role in hematopoiesis, and cooperates with transcription factors including members of the CEBP and Ets families. ", "Targets of the MYB transcription factor include genes involved in development, cell survival, proliferation, and homeostasis \\[[@B50-viruses-06-04005]\\]. ", "C/EBPα is a member of the CCAAT/Enhancer-Binding Protein family, which are bZIP nuclear transcription factors. ", "The 3\\'UTR of C/EBPα has two potential sites for miR-K12-3, each with a 7 base match ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}B). ", "C/EBPα is an important transcription factor involved in controlling tissue-specific gene expression in myeloid tissues and growth arrest \\[[@B51-viruses-06-04005]\\].", "\n\nInterestingly, we found 3 putative binding sites for miR-K12-3 and 3 for miR-K12-11 within the 3\\'UTR of Ets-1 ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}C) ranging from 6 to 9 base matches. ", "Ets-1 is a member of the Ets family of transcription factors, which are downstream effectors of the Ras-MAPK signaling cascades \\[[@B52-viruses-06-04005]\\]. ", "The Ets family binds to a specific DNA consensus sequence and activates genes involved in cell proliferation, differentiation, and survival \\[[@B53-viruses-06-04005]\\].", "\n\n{#viruses-06-04005-f002}\n\nThe 3\\'UTRs of MYB, Ets-1, and C/EBPα were separately cloned downstream of the firefly luciferase reporter, and assays performed to test directly for miR-K12-3 and/or miR-K12-11 targeting of the resulting transcripts. ", "The luciferase reporter plasmid DNAs were transfected with either a miR‑K12-3 or miR-K12-11 expression vector into 293 cells. ", "Transfection with increasing amounts of miR-K12-11 expression vector gave progressively reduced luciferase activity from the luciferase‑MYB 3\\'UTR construct ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}D), indicating that miR-K12-11 targets the MYB 3\\'UTR. ", "Despite the presence of two predicted binding sites in the C/EBPα 3\\'UTR for miR-K12-3, miR-K12-3 expression alone did not cause significant reduction in luciferase expression from the C/EBPα 3\\'UTR construct ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}E). ", "The pcDNA3.1/cluster expression plasmid, which expresses 10 KSHV miRNAs \\[[@B42-viruses-06-04005]\\], was also tested for effects on the C/EBPα 3\\'UTR, and significantly reduced luciferase expression ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}E). ", "Bioinformatic prediction revealed that the C/EBPα 3\\'UTR contains additional seed sequence matches for miR-K12-8 and -9 (data not shown). ", "The 3.6 kb long 3\\'UTR of Ets-1 has a number of putative binding sites for KSHV miRNAs (miR-K12-1, -6, and -7) in addition to the sites for miR-K12-3 and miR-K12-11. ", "The luciferase-Ets-1 3\\'UTR construct was cotransfected with plasmids expressing miR-K12-3 and miR-K12-11 alone and in combination, and with pcDNA3.1/cluster. ", "Expression of miR-K12-3 alone had no significant effect, but miR-K12-11 alone and miR-K12-11 in combination with miR-K12-3 led to significant repression ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}F). ", "Expression of the 10 cluster miRNAs also gave reduced luciferase expression. ", "These results suggest that Ets-1 is targeted by multiple KSHV miRNAs. ", "In summary, these *in vitro* data show that all three transcription factors can be targeted by KSHV miRNAs.", "\n\n{#viruses-06-04005-f003}\n\n3.5. ", "MYB, C/EBPα and Ets-1 Expression Is Increased upon miRNA Knockdown in PEL Cells\n------------------------------------------------------------------------------------\n\nTo investigate whether MYB, C/EBPα, and Ets-1 are regulated by KSHV miRNAs in latently infected PEL cells, BCBL-1 and BC-3 cells were transfected with miR-K12-11 or miR-K12-3 antagomirs. ", "RT-qPCR performed 48 h after antagomir transfection revealed increased levels of MYB transcript upon miR-K12-11 knockdown with dose dependence ([Figure 4](#viruses-06-04005-f004){ref-type=\"fig\"}A). ", "MYB transcript was increased 1.5-fold in BCBL-1 cells compared to mock-transfected control in the presence of 200 nM miR-K12-11 antagomir. ", "For C/EBPα, transcript levels were increased approximately two-fold in BCBL-1 cells on addition of miR-K12-3 antagomir ([Figure 4](#viruses-06-04005-f004){ref-type=\"fig\"}B). ", "In BC-3 cells, where miR-K12-3 is the most highly expressed KSHV miRNA \\[[@B44-viruses-06-04005],[@B54-viruses-06-04005]\\], knockdown of miR-K12-3 gave increases of up to 2-fold in Ets-1 transcript levels in a dose-dependent fashion ([Figure 4](#viruses-06-04005-f004){ref-type=\"fig\"}C). ", "Addition of 200 nM miR‑K12-3 and 200 nM miR-K12-11 antagomirs together gave a higher Ets-1 level than 200 nM miR‑K12-3 antagomir alone.", "\n\nThese data suggest that expression of KSHV miR-K12-11 in latent infection normally reduces the level of MYB transcript, and miR-K12-3 behaves similarly against C/EBPα and Ets-1. ", "Our results point to a mechanism in which miR-K12-3 and miR-K12-11 down-regulate RTA expression by modulating cellular transcription factors in cells of both endothelial and lymphoid origin.", "\n\n4. ", "Discussion\n=============\n\nWe used BC-3-G cells containing GFP driven by the RTA-responsive PAN promoter to ask whether antagomir-based inhibition of KSHV miRNAs activates RTA. ", "Inhibition of single or multiple miRNAs revealed that in this experimental system only antagomirs against miR-K12-3 and mir-K12-11 led to significantly increased RTA expression levels. ", "We note that miR-K12-3 and miR-K12-11 expression levels are higher in BC-3 cells compared to BCBL-1 cells used in previous screens \\[[@B43-viruses-06-04005],[@B44-viruses-06-04005]\\]. ", "Antagomir inhibition of miR-K12-7 and miR-K12-5 did not activate RTA expression in BC-3-G cells, as was observed in 293 cells infected with Bac36-derived KSHV \\[[@B26-viruses-06-04005],[@B27-viruses-06-04005]\\]. ", "Additionally, miR-K12-9 \\* is not expressed at all in BC-3 cells due to the presence of a highly polymorphic miR-K12-9 pre-miRNA \\[[@B55-viruses-06-04005],[@B56-viruses-06-04005]\\], and therefore RTA inhibition by miR-K12-9 \\* \\[[@B57-viruses-06-04005]\\] would not be expected in this cell line. ", "We note that recent ribonomics reports on KSHV miRNA targetomes using PAR-CLIP and HITS-CLIP \\[[@B43-viruses-06-04005],[@B44-viruses-06-04005]\\] did not reveal direct targeting of RTA by KSHV miRNAs in two different PEL cell lines including BC-3 during latency. ", "In contrast, targeting of host BCLAF1 by mIR-K12-5 has been reported to sensitize cells for reactivation \\[[@B23-viruses-06-04005]\\], and BCLAF1 was validated as a viral miRNA target in BCBL-1 cells by PAR-CLIP and HITS-CLIP \\[[@B43-viruses-06-04005],[@B44-viruses-06-04005]\\].", "\n\n{#viruses-06-04005-f004}\n\nSince neither the 3\\'UTR of RTA nor its coding region contains any mir-K12-3 or miR-K12-11 seed sequence matches, mir-K12-3 and miR-K12-11 apparently regulate RTA indirectly by targeting cellular genes that positively regulate RTA. ", "A number of cellular transcription factors have been identified to activate the RTA promoter including MYB, Ets-1, and C/EBPα \\[[@B28-viruses-06-04005],[@B29-viruses-06-04005],[@B30-viruses-06-04005]\\]. ", "Lacoste and colleagues demonstrated that MYB transactivates the RTA promoter in the absence of any KSHV protein expression and furthermore that v-FLIP and v-GPCR induction of NF-κB leads to downregulation of MYB expression in PEL cells \\[[@B29-viruses-06-04005]\\]. ", "Our data indicate that miR-K12-11 directly targets the MYB 3\\'UTR ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}) and that knockdown of miR-K12-11 increases MYB transcript level ([Figure 4](#viruses-06-04005-f004){ref-type=\"fig\"}). ", "Thus, miR-K12-11 fine tunes MYB expression post-transcriptionally in conjunction with virally encoded proteins that regulate MYB through NF-κB signaling. ", "Interestingly, the NF-κB pathway or more specifically the IκBα super repressor, was shown to be regulated by miR-K12-1, thereby also inhibiting lytic growth \\[[@B35-viruses-06-04005]\\].", "\n\nWang and colleagues observed that C/EBPα activates RTA directly and mapped three C/EBPα binding sites within the RTA promoter \\[[@B30-viruses-06-04005]\\]. ", "In addition, C/EBPα functions during lytic reactivation by interacting with RTA to bind and activate the K8 promoter, an early replication-associated protein. ", "K8 then interacts with and stabilizes C/EBPα leading to upregulation of C/EBPα, in turn leading to further activation of RTA and K8 gene expression. ", "It was also shown that C/EBPα activates additional early lytic genes PAN and ORF57 \\[[@B30-viruses-06-04005]\\]. ", "Even though miR-K12-3 does not appear to target C/EBPα directly by itself in 293 cells ([Figure 3](#viruses-06-04005-f003){ref-type=\"fig\"}E), antagomir knockdown of miR-K12-3 in BCBL-1 cells does increase C/EBPα mRNA ([Figure 4](#viruses-06-04005-f004){ref-type=\"fig\"}). ", "Therefore, miR-K12-3 contributing to downregulation of C/EBPα represents targeting a central regulatory node to negatively modulate several immediate early and early genes.", "\n\nEts-1 was originally identified as an activator of RTA by utilizing BC-3-G cells in a genome-wide screen to identify cellular proteins and pathways that reactivate KSHV \\[[@B28-viruses-06-04005]\\]. ", "The Raf/MEK/ERK pathway was demonstrated to mediate KSHV reactivation and Ets-1, which is a downstream effector of this pathway, directly activates the RTA promoter. ", "Ets-1 contains five putative KSHV miRNA binding sites in addition to a total of six seed sequence matches for miR-K12-3 and miR-K12-11. ", "KSHV miRNA targeting of Ets-1 presumably contributes to maintenance of latency by inhibiting Raf/MEK/ERK induced activation of RTA. ", "Ets-1 targeting by miRK-12-3 and -11 might be cell type specific since KSHV v-FLIP upregulates Ets-1 in a NF-κB-dependent fashion and moreover this is required for KSHV-dependent induction of lymphatic reprogramming of endothelial cells \\[[@B58-viruses-06-04005]\\]. ", "Hence, fine tuning of Ets-1 may be important to balance differentiation and reactivation. ", "We recently demonstrated Ets-1 targeting in TIVE cells engineered to express miR-K12-11 in the absence of KSHV \\[[@B59-viruses-06-04005]\\].", "\n\nA common feature of these three transcription factors is their involvement in signaling pathways as part of cellular stress responses. ", "The RTA promoter of γ-herpesviruses contains an array of transcription factor binding sites thereby sensing environmental changes and linking cell stress including innate and adapted immune responses against other pathogens to lytic reactivation \\[[@B60-viruses-06-04005],[@B61-viruses-06-04005]\\]. ", "Our data suggest a model where viral miRNAs contribute to the regulation of the latent to lytic transition by post‑transcriptionally modulating multiple signaling pathways. ", "We believe that KSHV miRNAs fine‑tune the regulation of MYB, C/EBPα, and Ets-1, which increases the signaling threshold that has to be overcome before the lytic cascade can be initiated. ", "Some of these cellular targets are regulated by other latency-associated genes, as in the case of MYB and NF-κB in lymphoid cells \\[[@B29-viruses-06-04005]\\] and Ets-1 and NF-κB in endothelial cells \\[[@B58-viruses-06-04005],[@B59-viruses-06-04005]\\]. ", "Rather than acting like an on/off switch, viral miRNAs serve as gatekeepers of latency by manipulating multiple host cellular pathways that when activated would otherwise lead to RTA expression. ", "In contrast to directly regulating RTA, targeting multiple cellular genes allows for greater flexibility in regulation of latency in different tissues and cell types where both the viral miRNAs and their cognate targets are expressed differentially \\[[@B14-viruses-06-04005],[@B15-viruses-06-04005],[@B32-viruses-06-04005],[@B62-viruses-06-04005]\\]. ", "For example, Ets‑1 levels are higher in endothelial cells while MYB is a master regulator of hematopoietic cells.", "\n\nWe propose that the regulation of host transcription factors by KSHV miRNAs contributes to the ability to quickly respond to environmental stimuli, which can overcome the intricate balance between miRNA copy number and their cognate targets \\[[@B63-viruses-06-04005],[@B64-viruses-06-04005]\\]. ", "A similar miRNA-based \"spring-loaded\" regulatory model was first proposed for OCT and SOX transcription factors that regulate pluripotency during differentiation \\[[@B65-viruses-06-04005]\\]. ", "In conclusion, our results suggest that miR-K12-3 and miR-K12-11 contribute to regulation of latency in cells of endothelial and lymphoid origin by targeting the host cellular transcription factors MYB, C/EBPα and Ets-1, thereby indirectly manipulating RTA expression.", "\n\nThis work was supported by grants from National Institutes of Health (CA88763, CA 119917 and RC2 CA148407) to RR. ", "KP-B was supported by T32 CA009126 and IWB was supported by T32AI060527 and T32AI007110. ", "We thank Jae Jung, Don Ganem, and J. Myoung for their generosity in providing BAC16 and iSLK cells, and Ren Sun for kindly providing BC-3-G cells. ", "Finally, we thank Peter Turner for carefully editing the manuscript.", "\n\nR.R. designed the experiments; K.P.-H., H.S.C., T.B., I.W.B., and L.A.G. performed the experiments. ", "B.J.K. constructed the KSHV recombinants and optimized virus recovery in iSLK cells. ", "I.H. provided bioinformatic support. ", "K.P.-H., R.R., and H.S.C. wrote the manuscript.", "\n\nThe authors declare no conflict of interest.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0009391900966875255, 0.009968598373234272, 0.0027702422812581062, 0.07775996625423431, 0.0005954090738669038, 0.0006946420180611312, 0.0013559890212491155, 0.0008134545641951263, 0.0006496960413642228, 0.0006743129342794418, 0.0007190408068709075, 0.0007311865338124335, 0.0006592513527721167, 0.0007500705542042851, 0.0007017225143499672, 0.0006835681269876659, 0.0005822312086820602, 0.0006304233684204519, 0.0006782680284231901, 0.001185585861094296, 0.0010115510085597634, 0.0006717824726365507, 0.0030375057831406593, 0.0006850015488453209, 0.0010447392705827951, 0.0013893843861296773, 0.0009031184017658234, 0.0007654911023564637, 0.0006132003618404269, 0.0005779906641691923, 0.0005597386625595391, 0.0006066765054129064, 0.0006041721790097654, 0.0007489958661608398, 0.4024614095687866, 0.0007214706274680793, 0.0008839819929562509, 0.0010045733070001006, 0.0008777813636697829, 0.0006315512582659721, 0.001303607365116477, 0.0013002688065171242, 0.0005979132256470621, 0.001150454510934651, 0.0005893924389965832, 0.0007059210329316556, 0.0006253640167415142, 0.0007651526248082519, 0.0008615169208496809, 0.0010516910115256906, 0.0006777539383620024, 0.0012572675477713346, 0.0007796133868396282, 0.000654586881864816, 0.0006198522169142962, 0.0007515616598539054, 0.000694140384439379, 0.000807402073405683, 0.0006646683323197067, 0.0007774297264404595, 0.0006023593014106154, 0.0005839755176566541, 0.00117425003554672, 0.0009360397816635668, 0.0007865441730245948, 0.0007839137688279152, 0.0006618860061280429, 0.0006470127846114337, 0.0006235187174752355, 0.000645176914986223, 0.0008064655121415854, 0.0006450105574913323, 0.0006380763370543718, 0.0008424741099588573, 0.0005932005005888641, 0.0006169942207634449, 0.0006478358409367502, 0.0006114108837209642, 0.0007261811988428235, 0.0011846957495436072, 0.001324291224591434, 0.0005843112012371421, 0.0013830555835738778, 0.000937495962716639, 0.0008399651851505041, 0.0007118769572116435, 0.0005890675820410252, 0.0005910277832299471, 0.0019055769080296159, 0.0006837525870651007, 0.0020237849093973637, 0.0006724389968439937, 0.0006143733044154942, 0.000656053249258548, 0.0007032723515294492, 0.0005793071468360722, 0.002479933900758624, 0.0008239519665949047, 0.0006600805791094899, 0.0006347873131744564, 0.0006172342109493911, 0.0009224701789207757, 0.0013750585494562984, 0.0014440494123846292, 0.000758306821808219, 0.0006108449306339025, 0.0010765478946268559, 0.0006686807028017938, 0.0007029989501461387, 0.0013009872054681182, 0.000880687206517905, 0.001115039805881679, 0.0006769435713067651, 0.0006935197743587196, 0.0006086714565753937, 0.0008108051843009889, 0.0007777627906762064, 0.0006652630981989205, 0.0008135239477269351, 0.0006929839728400111, 0.0006170254200696945, 0.0013624530984088778, 0.0009388027247041464, 0.0006485861376859248, 0.000677027041092515, 0.0012201005592942238, 0.0006557713495567441, 0.0011675795540213585, 0.0006568818935193121, 0.0008175186812877655, 0.0005989929777570069, 0.00095384381711483, 0.0006336155929602683, 0.0019055769080296159, 0.0007875841693021357, 0.001271979883313179, 0.0007552555180154741, 0.0007058685296215117, 0.0005852952599525452, 0.0005895871436223388, 0.0023822824005037546, 0.000810651108622551, 0.0008284070645458996, 0.0006686552078463137, 0.0008395650656893849, 0.0006031758966855705, 0.0006983374478295445, 0.0007602741825394332, 0.0006177844479680061, 0.0007602495606988668, 0.0008104422013275325, 0.0005990580539219081, 0.0019055769080296159, 0.0007215184159576893, 0.060396306216716766, 0.0008100603590719402, 0.0008845886331982911, 0.0007346859201788902, 0.0010277271503582597, 0.0006722269463352859, 0.0006483070901595056, 0.0005930035258643329, 0.0006819733534939587, 0.0007007124368101358, 0.0007083791424520314, 0.0007832577684894204, 0.0012900278670713305, 0.0007913449080660939, 0.0005961188580840826, 0.0007065816316753626, 0.0008227598154917359, 0.0007476406171917915, 0.0007315518450923264, 0.0008924761204980314, 0.0019055769080296159, 0.0008207008359022439, 0.0007317487616091967, 0.0006348617025651038, 0.0006064582848921418, 0.003812439739704132, 0.0006547552766278386, 0.0008171405643224716, 0.000715340836904943, 0.0006273282342590392, 0.0006697326898574829, 0.0007103768875822425, 0.0007418125751428306, 0.0015325411222875118, 0.0007418564055114985, 0.0006859377608634531, 0.0006960206665098667, 0.0006839956622570753, 0.0006655110628344119, 0.0006557109882123768, 0.000764237716794014, 0.0008308059186674654, 0.0005318920593708754, 0.0006710760062560439, 0.0005849439185112715, 0.0007793059339746833, 0.0006611181888729334, 0.0005591920926235616, 0.0008987109176814556, 0.0009574174764566123, 0.0007966745179146528, 0.0013621754478663206, 0.0006212252774275839, 0.0006801208364777267, 0.000806860625743866, 0.0005918476963415742, 0.0011450317688286304, 0.0006080092862248421, 0.0005447303992696106, 0.0007798753795213997, 0.0009694988839328289, 0.0006207757396623492, 0.0007175741484388709, 0.0006131045520305634, 0.001995444530621171 ]

[ "Bause\n\nBause () is a German surname. ", "Notable people with this surname include:\n\n Arndt Bause (1936–2003), German composer of popular songs\n Inka Bause (born 1968), German singer, TV presenter and actress\n Johann Friedrich Bause (1738–1814), German engraver" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.001292204367928207, 0.0006423686281777918 ]

[ "The present invention relates to consumable electrode type arc welding apparatuses. ", "More particularly, the invention relates to electrode type arc welding apparatuses in which, while a wire electrode is being fed towards a workpiece to be welded, an arc is generated between the wire electrode and the workpiece to weld the latter.", "\nHeretofore, a consumable electrode type arc welding apparatus of this type is started as follows:\nA DC voltage is applied between a wire electrode wound on a reel and a workpiece to be welded, and the wire electrode is fed towards the workpiece by a wire electrode feeding device at a constant speed. ", "When the wire electrode 10 is brought into contact with the surface of the workpiece 12 as shown in FIG. ", "1(A), a start current flows to the workpiece 12 from the electrode 10. ", "The reason why the start current is caused to flow at the start of the welding operation is that it is necessary to generate a small arc between the end of the wire electrode 10 and the workpiece 12 to melt a certain length of the end portion of the wire electrode and to thereby generate an arc having a desired arc length from the entire end face of the wire electrode 10.", "\nIn the conventional arc welding apparatus, the start current rises at a predetermined rate irrespective of welding conditions such as wire diameter and welding current, and therefore the start current is so controlled that a predetermined amount of current is allowed to flow in a predetermined period of time. ", "For instance, as shown in FIG. ", "2, the current rise curve is so determined that a start current I.sub.1 flows at a time instant T.sub.1 which occurs a predetermined period of time after the time instant T.sub.0 at which the wire electrode 10 is brought into contact with the surface of the workpiece 12. ", "The case where the arc is generated in a relatively short period of time is indicated by the broken line in FIG. ", "2. ", "In this case, at the time instant T.sub.5 a small arc is generated between the end of the wire electrode 10 and the workpiece 12. ", "As the short-circuited state becomes the arcing state, the current decreases gradually. ", "When the current decreases to a value I.sub.2 at the time instant T.sub.6, the flow of current becomes steady; that is, a welding current I.sub.2 having a predetermined value flows. ", "In the case when the arc is generated in an extremely short time as described above, the arc generating current I.sub.3 is small and therefore very little sputtering occurs at the start of the welding operation.", "\nA specific example of a conventional arc welding apparatus is shown in FIG. ", "3. ", "In this apparatus, the three-phase alternating current input is subjected to voltage drop by a step-down transformer T.sub.1, the three-phase alternating current output of which is subjected to rectification and phase control by a main circuit thyristor unit to provide a DC output. ", "The DC output thus provided is coupled out of the welding power source through a DC reactor L.sub.2 ; that is, it is supplied between the wire electrode of a welding torch and a workpiece to be welded through a wire feeding device. ", "In this case, the phase control angle (i.e., the DC output value) of the main circuit thyristor unit is determined by a voltage adjustment value set by an operating control head, and the speed of feeding of the wire electrode is determined by a current adjustment value set by the operating control head. ", "The rate of rise of the welding current is determined by the output voltage preset and the inductance of the DC reactor L.sub.2 ; however, only for the start, is the welding control circuit operated to separately determine the output voltage so that it is higher than the ordinary welding voltage. ", "A predetermined period of time after the arc has been generated, an instruction is issued to return the output voltage to the voltage adjustment value set by the operating control head. ", "Thus, at the start of the welding operation, the gradient of rise of the current is completely determined by the output voltage set at the start and the inductance of the DC reactor L.sub.2. ", "The falling waveform of the current is fully determined by the value of the welding current provided when the arc is generated after the wire electrode has contacted the workpiece and by the inductance of the DC reactor L.sub.2, as shown in FIG. ", "4.", "\nIn the conventional apparatus, in order to positively generate an arc, control is so made that a sufficiently long period of time is provided for the initial generation of the arc; that is, an excessively large short-circuiting current flows for the period of time between the time instants T.sub.0 and T.sub.1. ", "Therefore, even when the end of the wire electrode 10 is brought into contact with the surface of the workpiece 12 as shown in FIG. ", "1(A), the arc will not generate immediately, and instead is generated at the time instant T.sub.1. ", "In this case, the arc is not produced between the workpiece 12 and the end of the wire electrode 10. ", "That is, the current has a considerably large value I.sub.1, as a result of which the wire electrode can be fragmented by a fusing action while producing arcs as shown in FIG. ", "1(B). ", "In such a case, the wire electrode 10 is burnt away. ", "That is, the conventional apparatus is disadvantageous in that the arcing is not positively started.", "\nFurthermore, in the conventional apparatus, a predetermined amount of short-circuiting current is allowed to flow irrespective of the welding conditions. ", "Therefore, the conventional apparatus suffers from a problem that, when a wire electrode of a different diameter from the one previously employed is used or the welding current value is changed, the arcing will not be positively started. ", "That is, the optimum value of the short-circuiting current is determined by the diameter of the wire electrode, and the start current should be increased with the wire diameter. ", "Similarly, when the welding current is increased, it is necessary to increase the start current. ", "Thus, when generation of the arc is delayed, an excessively large start current increasingly causes sputtering at the start, accelerates the creeping of the arc, and causes a burn back phenomenon frequently whereby the electrode wire 10 is welded to a tip (not shown) used for feeding the electrode wire. ", "In this case also, the arcing cannot be positively started.", "\nIn order to overcome this difficulty, a method of controlling the start current according to the welding conditions has been proposed in the art. ", "However, the method is still disadvantageous in that, in a conventional thyristor control system, the start current varies as shown by the characteristic curve of FIG. ", "2. ", "Therefore, if the peak value of the start current is set to be small, the arc is generated from only a part of the end of the wire electrode. ", "In other words, the arc is not produced from the entire end face of the wire electrode 10. ", "Thus, the produced arc is unstable and is therefore liable to extinction." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005672835395671427, 0.0005732318386435509, 0.0006011245422996581, 0.000664879335090518, 0.0005703254719264805, 0.0006807648460380733, 0.0005929800681769848, 0.0006122117047198117, 0.0006824221927672625, 0.0005643072654493153, 0.001185585861094296, 0.0006448639323934913, 0.000710595864802599, 0.000671357789542526, 0.0006237449706532061, 0.0005528679466806352, 0.00117425003554672, 0.000778982590418309, 0.0006277657812461257, 0.0006659408682025969, 0.0006284209666773677, 0.0006258228095248342, 0.000607335998211056, 0.0006139298784546554, 0.0012900278670713305, 0.0006348771275952458, 0.0006536840810440481, 0.0006992268608883023, 0.0006433397065848112, 0.000631284958217293, 0.0007256295066326857, 0.0007474824087694287, 0.0006416827091015875, 0.0006160208722576499, 0.0007302475278265774, 0.0005939710536040366, 0.000580635154619813, 0.0008215763955377042, 0.0006220861687324941, 0.0005413373000919819, 0.0005990512436255813, 0.001185585861094296, 0.0006345371366478503, 0.0006936361896805465, 0.000665110710542649 ]

[ "President George W. Bush and Mrs. Laura Bush stand in silence after laying flowers at the eternal flame of the 1956 Memorial Monument outside the Hungarian Parliament in Budapest, Hungary, Thursday, June 22, 2006. ", "The monument honors victims of the 1956 Hungarian uprising against Soviet rule. ", "White House photo by Eric Draper" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006138927419669926, 0.0007623883429914713, 0.0006281796377152205 ]

[ "A comparison of the effects of quinolinate and N-methyl-aspartate on neurons in rat piriform cortex.", "\nQuinolinate has been proposed to be the endogenous ligand of the N-methyl-aspartate (NMA) receptor in the mammalian central nervous system. ", "We have compared the relative potency and pharmacologic sensitivity of quinolinate- and NMA-induced excitation on pyramidal cells in the rat piriform cortex. ", "Quinolinate was considerably less potent than NMA, but the NMA responses were more sensitive to antagonism by NMA-receptor antagonists. ", "These results suggest that, at least in this preparation, quinolinate and NMA are pharmacologically distinguishable and may act at different receptor sites." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007658094982616603, 0.0008169038337655365, 0.0006856756517663598, 0.0008724919171072543, 0.0006753107882104814 ]

[ "WHEN Bill Clinton called the first Summit of the Americas in Miami in 1994 he wanted to celebrate the shared commitment of all 34 countries in the hemisphere to democracy and free trade—all, that is, except Cuba, the 35th, which was not invited. ", "At the seventh summit in Panama in 2015, regional solidarity prevailed. ", "At Latin America’s insistence, Cuba was invited and Raúl Castro sat down with Barack Obama, setting the seal on their diplomatic détente.", "\n\nSo it was a big diplomatic step when last month Peru’s government, the host of the eighth summit, scheduled for April 13th-14th, announced that it was withdrawing Venezuela’s invitation and that Nicolás Maduro, its president, would be denied entry. ", "Peru acted for the 14-nation ad hoc “Lima group”, which includes most Latin American countries. ", "They rejected Mr Maduro’s decision to hold a sham presidential election on April 22nd. ", "Latin America is once again giving priority to the defence of democracy. ", "Can it do so consistently and effectively?", "\n\nIf democracy is to be the criterion for participation (as agreed at the meeting in Quebec in 2001), why not exclude others? ", "Neither Cuba nor Nicaragua should qualify. ", "Nor, arguably, does Honduras. ", "Having ended term limits in dubious fashion, Juan Orlando Hernández, a pro-American conservative, won a second term as president in November in an election that the opposition and outside observers claim was rigged. ", "His party’s legislators have given themselves carte blanche to steal public money, eviscerating an anti-corruption mission under the aegis of the Organisation of American States (OAS).", "\n\nBut the electoral fraud in Honduras was not clear-cut. ", "Mr Hernández should be warned but not excluded. ", "Venezuela remains the most dramatic case of democratic regress in Latin America. ", "Its descent into economic chaos, human misery and dictatorship is of unprecedented gravity.", "\n\nMr Maduro’s regime has stopped publishing many statistics. ", "A survey by three universities published last month found widespread malnutrition; 87% of respondents were poor and 61% were extremely so. ", "That is far above the Latin American averages of 31% and 10% respectively, and should shame all those who hailed Hugo Chávez, Mr Maduro’s late mentor, as an anti-capitalist paragon. ", "The survey estimates that 815,000 Venezuelans have emigrated since 2012, most in the past two years. ", "Their arrival in other South American countries is pushing the region to act.", "\n\nHaving weakened the opposition through the imprisonment or banning of its leaders and the intimidation (including torture) of its activists, Mr Maduro is trying to seal his dictatorship by bringing forward the presidential election due later this year. ", "Since the government refuses the conditions for a free and fair contest, the opposition coalition says that it will boycott the poll next month. ", "In those circumstances, “a lot of Latin American countries will not recognise the result as legitimate,” says Juan Carlos Varela, Panama’s president.", "\n\nOn February 23rd the OAS, which brings together all countries except Cuba, approved a resolution similar to the Lima group’s. ", "But it did so only by a bare majority. ", "Venezuela’s regime still has a few allies (and clients among Caribbean island-states that receive cheap oil). ", "Some may boycott the Lima summit in solidarity.", "\n\nWhat chance is there that action by Venezuela’s neighbours can achieve results? “", "This is the moment for mediation [in Venezuela], but it has to be by everyone, by Latin America, the United States and Europe,” says César Gaviria, a former secretary-general of the OAS. ", "The priority must be a free and fair election. ", "Failing that, the region will have to ramp up the pressure.", "\n\nOstracism is a start. ", "That it hurts the regime’s pride was clear in 2016 when the foreign minister tried to gatecrash a meeting of the Mercosur trade group, from which her country has been suspended. ", "Latin American countries should follow the United States and the EU in barring the regime’s leaders from visiting, and in seizing their looted assets. ", "It should also demand that the faction-ridden opposition unite behind a single leadership.", "\n\nLatin America has plenty of disagreements with Donald Trump, but anti-imperialism should not, as Venezuela argues, override the defence of democracy and human rights. ", "Neither should the tradition of non-intervention, nor an insistence on unattainable regional unanimity. ", "That means the OAS might not be the right diplomatic vehicle. ", "Rather, the Group of Lima should turn itself into an open-ended coalition of the willing to take whatever political action is necessary to return Venezuela to democracy and stave off a humanitarian disaster." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005314063164405525, 0.0005274148425087333, 0.0007000974146649241, 0.0005632221000269055, 0.0005982281873002648, 0.0009441804140806198, 0.0009277291828766465, 0.0006602470530197024, 0.0005652199033647776, 0.0009326107101514935, 0.0007170235621742904, 0.000988415558822453, 0.0016752395313233137, 0.0008413097239099443, 0.0005721058114431798, 0.000666652456857264, 0.019024673849344254, 0.0008211341919377446, 0.002089984016492963, 0.05103094130754471, 0.0006014047539792955, 0.000638881407212466, 0.0023122455459088087, 0.0008633675752207637, 0.0005702806520275772, 0.0005689930403605103, 0.0007655125227756798, 0.000604774511884898, 0.0006021583685651422, 0.0007105311378836632, 0.0005431504105217755, 0.0007231163908727467, 0.0007871155976317823, 0.0024137694854289293, 0.0009294389747083187, 0.0018857689574360847, 0.001521415775641799, 0.0007024705992080271, 0.0011852566385641694, 0.0007294320967048407, 0.0008085373556241393 ]

[ "OSBPL1A\n\nOxysterol-binding protein-related protein 1 is a protein that in humans is encoded by the OSBPL1A gene.", "\n\nThis gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. ", "Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. ", "Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms.", "\n\nReferences\n\nFurther reading" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0009746681316755712, 0.0009262832463718951, 0.0010699847480282187, 0.0005645673372782767, 0.0006112628034316003 ]

[ "The above map is for quick reference purposes only and may not be to scale.", "\nFor a copy of the full scale map, please see the attached PDF - 1108401 .pdf\n\nThe PDF will be generated from our live systems and may take a few minutes to download depending on how busy our servers are. ", "We apologise for this delay.", "\n\nThis copy shows the entry on 19-Nov-2018 at 22:35:27.", "\n\nLocation\n\nStatutory Address: STEPS COTTAGE\n\nThe building or site itself may lie within the boundary of more than one authority.", "\n\nCounty: Devon\n\nDistrict: South Hams (District Authority)\n\nParish: Ashprington\n\nNational Grid Reference: SX 81387 56511\n\nSummary\n\nLegacy Record - This information may be included in the List Entry Details.", "\n\nReasons for Designation\n\nLegacy Record - This information may be included in the List Entry Details.", "\n\nHistory\n\nLegacy Record - This information may be included in the List Entry Details.", "\n\nDetails\n\nASHPRINGTON\nSX85Nll Bow\n6/39 Steps Cottage\n\nII\n\nHouse, extended and converted into 3 cottages and reverted to 1 house.", "\nProbably late C17 or early C18, possibly with earlier origins; extended and\nconverted to cottages in circa early to mid C19 reunited and extended again\nin the C20. ", "Rendered cob and stone rubble. ", "Thatched roof with gabled ends.", "\nStacks with rendered shafts at the gable end of the original house, the left\nhad stack is now an axial stack.", "\nPlan: 3-room single depth plan; the 2 right hand rooms are probably the\nextent of the original house. ", "In circa early to mid C19 the house was\nconverted into a row of three 1-room plan cottages by the extension at the\nleft end of a 1-room plan addition. ", "In the C20 it was reunited as one house\nagain and a small extension was added at the left end.", "\nExterior: 2 storeys. ", "Asymmetrical 1:2 window range. ", "C18 or early C19 wooden\ncasement to first floor left. ", "To the left and right of centre late C19 or C20\nglazed doors with late C19 or C20 wooden lattice porches.", "\nAt the left hand end a 1-room plan addition, stone rubble with a grouted\nscantle slate roof,1 storey and attic, late C19 2-light casement with glazing\nbars and gabled dormer with timber casement and C20 glazed door. ", "Small late\nC20 addition at extreme left hand end. ", "Interior: Interior much altered but\nsome C19 joinery survives. ", "The straight feet of the roof principals can be\nseen on the first floor. ", "The trusses are mostly soft wood but one truss at\nthe left hand end has much heavier oak principals. ", "At the right hand end\nthere are said to be blackened roof timbers associated with the curing of\nfish. ", "Steps Cottage is on the site of a salting recorded in the Domesday\nBook.", "\nSource: Information provided by the owner, Mr Chadwick.", "\n\nListing NGR: SX8138756511\n\nLegacy\n\nThe contents of this record have been generated from a legacy data system.", "\n\nLegacy System number: 100948\n\nLegacy System: LBS\n\nLegal\n\nThis building is listed under the Planning (Listed Buildings and Conservation Areas) Act 1990 as amended for its special architectural or historic interest.", "\n\nThe information and images below are the opinion of the contributor, are not part of the official entry and do not represent the official position of Historic England. ", "We have not checked that the contributions below are factually accurate. ", "Please see our terms and conditions. ", "If you wish to report an issue with a contribution or have a question please email [email protected]." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005760220810770988, 0.0005621850723400712, 0.0005609486834146082, 0.0005981962895020843, 0.000574473466258496, 0.0006054429686628282, 0.0005309152184054255, 0.0005409239674918354, 0.0007750035729259253, 0.0006232534651644528, 0.0006675355252809823, 0.0026245920453220606, 0.0006161744240671396, 0.0006790243787690997, 0.0007189674652181566, 0.0006375873344950378, 0.0007061820942908525, 0.000691804161760956, 0.0008211612002924085, 0.0006591025157831609, 0.0009780775289982557, 0.0006842815782874823, 0.0005987792392261326, 0.0006067955982871354, 0.0006058651488274336, 0.000817882944829762, 0.0006652532611042261, 0.0005870609893463552, 0.0006080848979763687, 0.0006197663024067879, 0.0006417138502001762, 0.0005981067661195993, 0.0005158886197023094, 0.0005796598270535469 ]

[ "My name is David Hargraves\nand I started this site.", "This site was created using MyHeritage.com. ", "This is a great system that allows anyone like you and me to create a private site for their family, build their family tree and share family photos. ", "If you have any comments or feedback about this site, please click here to contact me.", "Our family tree is posted online on this site! ", "There are 286 names in our family site.", "The site was last updated on Feb 17 2015, and it currently has 27 registered member(s). ", "If you wish to become a member too, please click here. ", "Enjoy!", "\n\nI know he loved my cousin Pat and their two son's. ", "When he was younger my parents spent many vacations with my Aunt and Uncle and their two children. ", "When David was born she sent me boxes of clothes that he could wear. ", "He was the best dressed Okie child. ", "Will miss another of the good guys. ", "Glenda" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000930673792026937, 0.0007137001375667751, 0.000826879870146513, 0.0005464782589115202, 0.0008184310281649232, 0.0005876345676369965, 0.0005984503077343106, 0.0005677698063664138, 0.0010163075057789683, 0.0007921906653791666, 0.0007024672231636941, 0.001219382626004517, 0.002738005481660366, 0.0006175448652356863, 0.010452128015458584 ]

[ "A Washington state man who received a heart transplant last year said surveillance cameras captured the moment a stranger stole life-saving medication from his doorstep last week.", "\n\n'PORCH PIRATES' RETURN STOLEN WRESTLING BELTS TO BOY WITH AUTISM AHEAD OF BRAIN SURGERY\n\nRon Kraft, of Pierce County, said he needs to take medication every 12 hours since receiving a transplant in 2018 after his heart failed, Seattle’s KIRO-TV reported.", "\n\n“If I don’t, my body starts rejecting my heart and things just start going all wrong,” Kraft said. “", "It’s life or death.”", "\n\nKraft called the pharmacy last Tuesday when he did not see the package that he expected to be delivered to his home. ", "When the pharmacy confirmed the medication had been delivered, Kraft said he checked his home security cameras. ", "The surveillance video shows a man approach Kraft’s home with his dog, snag the package from his back doorstep and then walk away.", "\n\nCLICK HERE TO GET THE FOX NEWS APP\n\nKraft was able to get an emergency supply of medication from the pharmacy directly. ", "He's asking the porch pirate to come forward with the stolen package. ", "It was unclear from reporting if a police report had been filed." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000569512601941824, 0.002145555103197694, 0.002086839871481061, 0.042489439249038696, 0.0006872077356092632, 0.0006306676659733057, 0.001522091799415648, 0.0006604645168408751, 0.013788159005343914, 0.0006151525303721428 ]

[ "Learning a Phonological Contrast Modulates the Auditory Grouping of Rhythm.", "\nPerceptual grouping is fundamental to many auditory processes. ", "The Iambic-Trochaic Law (ITL) is a default grouping strategy, where rhythmic alternations of duration are perceived iambically (weak-strong), while alternations of intensity are perceived trochaically (strong-weak). ", "Some argue that the ITL is experience dependent. ", "For instance, French speakers follow the ITL, but not as consistently as German speakers. ", "We hypothesized that learning about prosodic patterns, like word stress, modulates this rhythmic grouping. ", "We tested this idea by training French adults on a German-like stress contrast. ", "Individuals who showed better phonological learning had more ITL-like grouping, particularly over duration cues. ", "In a non-phonological condition, French adults were trained using identical stimuli, but they learned to attend to acoustic variation that was not linguistic. ", "Here, no learning effects were observed. ", "Results thus suggest that phonological learning can modulate low-level auditory grouping phenomena, but it is constrained by the ability of individuals to learn from short-term training." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006743035628460348, 0.000626196910161525, 0.0007731941295787692, 0.0006013434613123536, 0.0007597798830829561, 0.0006616527098231018, 0.0006282778340391815, 0.00066889583831653, 0.0006565726944245398, 0.0006643785745836794, 0.0006144722574390471 ]

[ "Wearable near-to-eye display system for workers have long seemed to be on the verge of commercial success, but to date, acceptance has been limited. ", "The main reason is that the images presented to the human brain through the eyes are not as natural as the images sensed by the eye causing eye strain and/or nausea. ", "Several factors contribute to this unnatural sensation.", "\nFirst factor is tunnel vision. ", "Human eyes cover a wide field of view, a total binocular field of view (FOV) of about 120 degrees horizontal (180 degrees forward facing horizontal) by 130 degrees vertical. ", "Normal camera covers up to 60 degrees FOV. ", "Optical design to replicate human visual FOV is possible but creates a very bulky and heavy system which is not suitable for a wearable display. ", "Therefore existing commercial off the shelf (COTS) wearable, one-camera, near-the-eye display systems offer a narrower FOV and the user suffers with tunnel vision.", "\nAnother factor causing unnatural sensation includes incorrect focus of the scene. ", "Human eyes are capable of instantaneously switching focus on objects in the scene from far field to near field. ", "Autofocus camera exists which provide a solution. ", "Such cameras, however, have complex lens systems and drivers. ", "Again the requirements on size, weight and power make the autofocus feature not-suitable for a wearable display. ", "Fixed focus cameras yield blurry images when the subject of interest is beyond the depth of field of the current focus distance.", "\nAnother factor that influences the acceptance of a wearable display system is incorrect viewing perspective. ", "The inter-pupillary distance (IPD) of adults ranges from 5.5 to 7.0 cm. ", "If the cameras are placed at locations other than the center of the pupils, the acquired images will have a different perspective than that of the eyes. ", "This different perspective creates an impression/sensation that the eyes are stretching or squinting all the time." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005847056745551527, 0.0012971892720088363, 0.0005861929967068136, 0.0006461244774982333, 0.00096037209732458, 0.001079739537090063, 0.0006864516763016582, 0.001030223909765482, 0.0006523600313812494, 0.0007486815447919071, 0.0006487169302999973, 0.00063708407105878, 0.0007562137325294316, 0.0006407076143659651, 0.0005828553112223744, 0.000696424744091928, 0.0005658312002196908, 0.0006454065442085266 ]

[ "Q:\n\npython regex search for elimitation\n\ni have the following case\nimport re\n\ntarget_regex = '^(?!P\\-[5678]).*'", "\npattern = re.compile(target_regex, re.", "IGNORECASE)\n\nmylists=['p-1.1', 'P-5']\n\ntarget_object_is_found = pattern.findall(''.join(mylists))\n\nprint \"target_object_is_found:\", target_object_is_found\n\nthis will give \ntarget_object_is_found: ['P-1.1P-5']\n\nbut from my regex what i need is P-1.1 alone eliminating P-5\n\nA:\n\nYou joined the items in mylist and P-5 is no longer at the start of the string.", "\nYou may use\nimport re\n\ntarget_regex = 'P-[5-8]'\npattern = re.compile(target_regex, re.", "IGNORECASE)\nmylists=['p-1.1', 'P-5']\ntarget_object_is_found = [x for x in mylists if not pattern.match(x)]\nprint(\"target_object_is_found: {}\".format(target_object_is_found))\n# => target_object_is_found: ['p-1.1']\n\nSee the Python demo.", "\nHere, the P-[5-8] pattern is compiled with re.", "IGNORECASE flag and is used to check each item inside mylist (see the [...] list comprehension) with the regex_objext.match method that looks for a match at the start of string only. ", "The match result is reversed, see not after if.", "\nSo, all items are returned that do not start with (?", "i)P-[5-8] pattern.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007100435323081911, 0.0007693864754401147, 0.0008182137971743941, 0.0007280525169335306, 0.0007160836248658597, 0.0007118338253349066, 0.0007613214547745883, 0.0006383107975125313, 0.0008054579375311732, 0.0007042022189125419, 0.001995444530621171 ]

[ "311’s Universal Pulse\n\nby terri sapp\n\nEvery time that my favorite band comes out with a new album, I get all nervous and excited all at the same time! ", "I can’t wait to sit alone with the lyrics, read along as I listen, and just enjoy. ", "The nerves come from the same anticipation that I get when I am about to shoot photos of them at their concerts. ", "Butterflies and all! ", "Nick Hexum (vocals and guitar), SA Martinez (vocals and special effects), Chad Sexton (drums), P-Nut (bass), and Tim Mahoney (guitar) have not made an album yet that I did not like, and their 2011 release, Universal Pulse is no different. ", "I knew from the first song, “Time Bomb” that I would love Universal Pulse. ", "This time, unlike in the past, I ordered my copy (CD and vinyl) on a pre-sale set up by the band. ", "However, once the actual day came for the album to ‘drop,’ I didn’t feel right not picking a copy up from one of my favorite local record stores, so I went there, too! ", "311 usually offers a special keepsake with their records that are bought the day they go on sale, and this year it was a free limited edition lenticular hologram of the album cover. ", "Of course, I couldn’t resist!", "\n\n“Time Bomb” is a classic 311 dancehall rock jam. ", "Seems like another awesome message and sort of another ode to their fans… “Let me introduce you to the excitable crew! ", "This is just how we do. ", "Tickin’ like a time bomb…watch, we go off!” ", "SA and Nick’s harmonies are on point throughout Universal Pulse, which always gets a crowd going. ", "Read More »\n\n!!! (", "chk chk chk)’s Strange Weather, Isn’t It?", "\n\nby terri sapp\n\nOne of my favorite bands, !!! (", "chk chk chk) made us all happy in the Fall of 2010 when they released their latest album called Strange Weather, Isn’t It? ", "just in time for my birthday!! ! ", "Since their debut self-titled studio album in 2001, !!! ", "has produced nothing but quality work. ", "After the 2007 release of the awesome Myth Takes record, I was not surprised to hear that their sound just keeps getting tighter and tighter! ", "It is hard to imagine an album that can stand up next to Myth Takes, because it is such a fantastic collection of songs, but Strange Weather, Isn’t It? ", "holds its own in a major way. ", "I knew I loved this new release within the first few measures." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005853960174135864, 0.0006556322914548218, 0.0012608171673491597, 0.0024313221219927073, 0.0009267471614293754, 0.000615347467828542, 0.0006336454534903169, 0.0006921833846718073, 0.0005542233702726662, 0.0011423630639910698, 0.007489412557333708, 0.0010131457820534706, 0.0007451152778230608, 0.2702533006668091, 0.0006185323582030833, 0.0010106845293194056, 0.0012626564130187035, 0.0006772555061616004, 0.0008581994916312397, 0.003392308484762907, 0.0006671806331723928, 0.0008143414743244648, 0.000617023091763258, 0.0006895698606967926, 0.0007825517095625401, 0.0006352299824357033 ]

[ "Is age becoming irrelevant? ", "An exploratory study of perceived age norms.", "\nTo check on impressionistic assertions that the United States is becoming an \"age-irrelevant society,\" a quota sample of white-collar and blue-collar men and women (ages eighteen to seventy; N = 462) was studied with a questionnaire that asked for designation of the most suitable ages for various role transitions and age-related attributes. ", "The findings converged with pertinent recent reports from more representative samples. ", "Comparisons with findings in the 1950s indicated loosening of the norms, but with continuing adherence to a prescriptive timetable and with persistent socio-economic differences. ", "These results challenge the notion of age-irrelevance." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0011022204998880625, 0.0005781385698355734, 0.0006546105141751468, 0.0005606552003882825, 0.0005601896555162966, 0.0006506072240881622 ]

[ "Khartoum massacre investigation\n\nThe Khartoum massacre investigation is an official investigation of the 3 June 2019 Khartoum massacre and other human rights violations of the Sudanese Revolution, mandated under Article 7.(16) of the Sudanese August 2019 Draft Constitutional Declaration, to cover \"violations committed on 3 June 2019, and events and incidents where violations of the rights and dignity of civilian and military citizens were committed.\" ", "The men-only investigation committee of the massacre, rapes and other human rights violations is headed by human rights lawyer Nabil Adib. ", "The No to Oppression against Women Initiative protested against the men-only composition of the commission.", "\n\nBackground\n\nThe Khartoum massacre took place on 3 June 2019 in the context of the Sudanese Revolution against a protestors' sit-in in Khartoum. ", "The massacre of 118 civilians and the rape of 70 women and men is generally attributed to the Rapid Support Forces (RSF), under the leadership of Mohamed Hamdan Dagalo (\"Hemetti\"). ", "The rapes were documented as a deliberate campaign to \"break the girls\" according to France 24.", "\n\nThe results of three different enquiries were released in late July 2019. ", "On 27 July, Fathelrahman Saeed, the head of a committee appointed by the Attorney-General at the request of the Transitional Military Council (TMC) to investigate the massacre, stated that 87 people had been killed, 168 injured, no rapes had occurred and no tents had been burnt. ", "Saeed stated that legal cases for crimes against humanity had been launched against eight unnamed high-ranking security officers. ", "The report was considered \"poor and defective\" by citizens' groups.", "\n\nThe Darfur Bar Association (DBA) released its own report on 30 July, stating that eight rape victims were receiving psychological therapy; one in Omdurman had committed suicide as a result of the rape; one rape victim had been forced by social stigma to search for another home for her and her family. ", "The DBA claimed that it had \"ample evidence\" of responsibility of the TMC for the massacre and that the \"decision to disband the sit-in\" took place at a meeting including all TMC members, the Attorney-General, police chiefs and security directors.", "\n\nThe third report was that of a committee created by the National Umma Party and led by Yousef El Amin. ", "On 30 July, El Amin stated that the sit-in was disbanded by \"a large military force wearing RSF uniforms and riot police\" and that the massacre had been \"premeditated and planned\". ", "He stated that 47 victims of the massacre died on 3 June, with a total of 124 dying from 3 to 20 June. ", "He confirmed rapes, throwing of bodies into the Nile, and burning of tents.", "\n\nLegal constraints\nThe 4 August Draft Constitutional Declaration refers to the investigation in Article 7.(16) as an element of the \"Mandate of the Transitional Period\", defining the scope as \"violations committed on 3 June 2019, and events and incidents where violations of the rights and dignity of civilian and military citizens were committed.\" ", "The investigation committee is to be created under an \"order\" that \"guarantees that it will be independent and possess full powers to investigate and determine the timeframe for its activities\".", "\n\nArticle 21 of the Draft Constitutional Declaration gives \"procedural\" immunity to members of the Sovereignty Council, the Cabinet, the Transitional Legislative Council, governors of provinces and heads of regions, with Article 21.(2) giving the Transitional Legislative Council the right to lift that immunity by a simple majority.", "\n\nCommission\nOn 21 September 2019, Prime Minister Abdalla Hamdok issued a decision to create the primary investigation commission of seven lawyers, including a Supreme Court judge, representatives of the Ministries of Justice, Defence and Interior, a \"national figure\" and two independent lawyers. ", "The decision guaranteed that the committee would operate independently of any other governmental, judicial or legal body. ", "The commission will be required to release a report with its findings within three months and can extend its mandate for another three months.", "\n\nHamdok named the members of the commission on 20 October, with Nabil Adib as the head of the commission. ", "The other commission members are Osman Mohamed Osman as rapporteur, Sohaib Abdullatif as deputy rapporteur, colonel Ismat Abdalla Mohamed Taha and Ahmed El Taher El Nur and two unnamed members.", "\n\nMen-only commission\nIhsan Fagiri of the No to Oppression against Women Initiative protested on 22 October 2019 against the men-only nature of the commission. ", "She stated that women should participate as commission members, since many women had been killed, raped or thrown dead into the Nile and three women rape victims had committed suicide after the massacre.", "\n\nMissing persons committee\nOn 23 September, the Attorney-General Abdallah Ahmed Abdallah created a committee of prosecutors and \"representatives of the Bar Association, the police, the Human Rights Department of the Ministry of Justice, and the Unit to combat violence against women\" to investigate the disappearances of the people who remained missing after the Khartoum massacre and provide a report within two months. ", "On 14 September, the citizens' group \"Missing\" listed 21 people missing.", "\n\nReferences\n\nCategory:Criminal investigation\nCategory:Sudanese Revolution" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006672528106719255, 0.0009987554512917995, 0.002058658516034484, 0.0007121679955162108, 0.01652158983051777, 0.011185669340193272, 0.0005474654026329517, 0.0012546535581350327, 0.0007553861360065639, 0.013637489639222622, 0.001844570622779429, 0.0006557134911417961, 0.0007338860887102783, 0.0009974217973649502, 0.0012967514339834452, 0.0908849686384201, 0.0005497736274264753, 0.0005833816831000149, 0.0005615437985397875, 0.0005606714985333383, 0.0005915735964663327, 0.0005368021666072309, 0.0006388466572389007, 0.0006700736121274531, 0.0012231504078954458, 0.03884361311793327, 0.0008774347370490432, 0.000636915909126401, 0.0006087642395868897 ]

[ "\n247 P.3d 436 (2011)\nDerek E. GRONQUIST and Byron A. Mustard, Appellants,\nv.\nDEPARTMENT OF CORRECTIONS, Respondent.", "\nNo. ", "39651-3-II.", "\nCourt of Appeals of Washington, Division 2.", "\nJanuary 19, 2011.", "\nAs Corrected March 4, 2011.", "\n*438 Derek E. Gronquist, Walla Walla, WA, pro se.", "\nByron A. Mustard, Wenatchee, WA, pro se.", "\nAndrea Vingo, Attorney General-Corrections Div., ", "Olympia, WA, for Respondent.", "\nBRIDGEWATER, J.\n¶ 1 Derek E. Gronquist and Byron A. Mustard (collectively inmates) appeal from a trial court's orders granting the Department of Correction's (DOC) motion for summary judgment and dismissing their show cause motion. ", "We hold that the DOC's Policy 280.510 (policy) does not violate the Public Records Act (PRA),[1] separation of powers, or collateral estoppel. ", "In addition, because the inmates preemptively took the position that they would not pay for any copies of documents, the DOC did not need to perform a search for responsive records. ", "We affirm the orders granting partial summary judgment and dismissing the inmates' show cause motion.", "\n\nFACTS\n¶ 2 On October 27, 2001, Derek Gronquist mailed a Public Disclosure Act (PDA)[2] request to the Airway Heights Corrections Center (AHCC) public disclosure officer asking for all documents alleging retaliatory action by AHCC staff since the facility's inception. ", "Gronquist insisted on inspecting the records in person and did not want to pay for copies. ", "Under DOC Policy 280.510, the DOC does not permit an offender to inspect public records in person except for information contained in the offender's central file or medical file. \"", "Inspection\" appears to mean an in-person viewing of public records without cost to the requester. ", "See Clerk's Papers (CP) at 283 (explaining procedures for in-person inspection). ", "For all other records, the DOC mails an inmate copies for a fee of $0.20 per page, plus postage. ", "WAC 137-08-110(2).", "\n¶ 3 The DOC notified Gronquist that, due to the facility's document retention policy, it could not provide complete documentation of every retaliatory act alleged at the AHCC. ", "The DOC later notified Gronquist that it had *439 identified 70 pages of documents and requested $16.95 for copies and postage.", "\n¶ 4 On January 18, 2005, Gronquist filed another PDA request and sought inspection of 14 different categories of information, including written materials regarding himself, materials concerning a job that Gronquist appears to have wanted, the complete employment files of two corrections officers, and records and/or training materials that appraise staff.[3] On January 26, the DOC again notified Gronquist of its policy and that he needed to submit DOC form 05-066 to inspect his central file without cost. ", "The DOC did not provide a page count of responsive documents it found.", "\n¶ 5 On February 16, Byron Mustard filed a PDA request, asking to inspect information regarding his banking records and personnel in charge of managing his account and court-obligated deductions. ", "Mustard stated that he did not want copies; but rather he wanted to inspect the documents. ", "The DOC notified Mustard of DOC Policy 280.510 and stated that it would search existing records and compile the information he sought. ", "On March 4, 2005, the DOC notified Mustard that it had compiled 93 pages of documentation and that it would forward the documents upon receipt of $22.45.", "\n¶ 6 The inmates have not paid for copies and thus the DOC has not sent the requested documents. ", "On October 5, 2006, the inmates sued the DOC, seeking an injunction enjoining the DOC from enforcing its policy and to declare the policy contrary to statutory and constitutional law. ", "The inmates also sought to compel inspection of the records they requested in 2001 and 2005.[4] They also claimed that the DOC was collaterally estopped from enforcing the policy because of a previous judicial determination in a case brought by Gronquist.", "\n¶ 7 On August 8, 2008, the DOC moved for summary judgment, arguing that, under Sappenfield v. Department of Corrections,[5] its policy was proper. ", "On August 22, the inmates filed a motion to show cause why inspection of the records should not be compelled and the policy should not be enjoined. ", "They alleged that the DOC failed to (1) perform an adequate search for the records requested, (2) identify withheld records, and (3) preserve records subject to PRA requests.", "\n¶ 8 The trial court granted a partial summary judgment motion in the DOC's favor, finding Sappenfield persuasive. ", "In a separate hearing, the trial court denied the inmates' show cause motion and dismissed their complaint with prejudice. ", "The inmates appeal both orders.", "\n\nANALYSIS\n\nI. DOC POLICY 280.510\n\nA. Summary Judgment\n¶ 9 First, the inmates argue that under the PRA, the DOC must permit them to inspect public records in person and that denying them that right amounts to a denial of their PRA requests. ", "The inmates contend that the DOC may only charge for copies if they request that the copies be mailed to them.", "\n¶ 10 We review de novo a challenge to an agency action under the PRA. ", "Sappenfield v. Dep't of Corr., ", "127 Wash.App. ", "83, 88, 110 P.3d 808 (2005), review denied, 156 Wash.2d 1013, 132 P.3d 146 (2006). ", "When reviewing an order granting summary judgment, we engage in the same inquiry as the trial court. ", "Kahn v. Salerno, 90 Wash.App. ", "110, 117, 951 P.2d 321, review denied, 136 Wash.2d 1016, 966 P.2d 1277 (1998). ", "Summary judgment is appropriate if the pleadings, depositions, answers *440 to interrogatories, and admissions on file, together with the affidavits, if any, show that no genuine issue as to any material fact exists and that the moving party is entitled to a judgment as a matter of law. ", "CR 56(c). ", "A material fact is one on which the outcome of the litigation depends, in whole or in part. ", "Morris v. McNicol, 83 Wash.2d 491, 494, 519 P.2d 7 (1974). ", "We consider all reasonable inferences in the light most favorable to the nonmoving party. ", "Clements v. Travelers Indem. ", "Co., 121 Wash.2d 243, 249, 850 P.2d 1298 (1993). ", "The parties do not dispute any issues of fact as to the summary judgment motion.[6]\n¶ 11 Public records shall be available for inspection and copying, and agencies shall, upon request for identifiable public records, make them promptly available to any person. ", "RCW 42.56.080. ", "Agencies shall not distinguish among persons requesting records. ", "RCW 42.56.080. ", "Agency facilities shall be made available to any person for the copying of public records except when and to the extent this would unreasonably disrupt the agency's operations. ", "RCW 42.56.080. ", "Agencies shall adopt and enforce reasonable rules and regulations consonant with the intent of chapter 42.56 RCW to provide full public access to public records, to protect public records from damage or disorganization, and to prevent excessive interference with other essential agency functions. ", "RCW 42.56.100.", "\n¶ 12 An agency shall not charge a fee for inspecting public records or for locating public documents and making them available for copying. ", "RCW 42.56.120. ", "But an agency may impose a reasonable charge for providing copies of public records, so long as the charges do not exceed the amount necessary to reimburse the agency for its actual costs incident to such copying. ", "RCW 42.56.120.", "\n¶ 13 In enforcing DOC Policy 280.510, the DOC appropriately balances the PRA's mandates with its duty to manage prison inmates. ", "Sappenfield, 127 Wash.App. ", "at 84, 110 P.3d 808. ", "Sappenfield, an incarcerated inmate at the AHCC, filed a PDA request to inspect information not contained in his central file. ", "Sappenfield, 127 Wash.App. ", "at 84, 110 P.3d 808. ", "The DOC informed him of DOC Policy 280.510, that it had compiled 187 pages of documents, and that it would mail the documents upon receipt of payment. ", "Sappenfield, 127 Wash.App. ", "at 85, 110 P.3d 808. ", "Sappenfield treated this as a denial and sued for an order for DOC to show cause why the records should not be made available for personal inspection. ", "Sappenfield, 127 Wash. App. ", "at 85-86, 110 P.3d 808.", "\n¶ 14 The trial court upheld the DOC's policy and Division Three of this court affirmed. ", "Sappenfield, 127 Wash.App. ", "at 87, 110 P.3d 808. ", "First, the court acknowledged that the choice whether to copy or inspect on site is usually up to the requester, not the agency. ", "Sappenfield, 127 Wash.App. ", "at 88, 110 P.3d 808. ", "But the court then noted that prisoner requests \"are not the usual case.\" ", "Sappenfield, 127 Wash.App. ", "at 88, 110 P.3d 808. ", "The court acknowledged that prison administrators generally control matters affecting the prison's internal security and that inmates do not enjoy all the privileges of the public community. ", "Sappenfield, 127 Wash. App. ", "at 88, 110 P.3d 808. ", "Further, the court noted that the PDA commands each agency to set its own disclosure rules. ", "Sappenfield, 127 Wash.App. ", "at 89, 110 P.3d 808 (citing former RCW 42.17.290 (1995), recodified as RCW 42.56.100 by Laws of 2005, ch. ", "274, § 103). ", "The court concluded that \"disclosure by promptly mailing copies at a reasonable charge satisfies this statutory obligation.\" ", "Sappenfield, 127 Wash.App. ", "at 89, 110 P.3d 808.", "\n¶ 15 In addition, the court noted that the DOC's policy complied with its duty to adopt and enforce reasonable rules and regulations to protect the public records and prevent excessive interference with its essential function to securely restrain criminal offenders. ", "Sappenfield, 127 Wash.App. ", "at 89, 110 P.3d 808 (citing former RCW 42.17.290). ", "In addition, while the PRA specifically prohibits agencies from denying a requester copies of identifiable public records, the statute did not *441 preclude denying requests for direct inspection when necessary to preserve the records and the agency's own essential functions. ", "Sappenfield, 127 Wash.App. ", "at 89, 110 P.3d 808 (citing former RCW 42.17.290). ", "Thus, the Sappenfield court concluded that the DOC's policy was reasonable. ", "Sappenfield, 127 Wash.App. ", "at 90, 110 P.3d 808.", "\n¶ 16 The inmates argue that Sappenfield is erroneous and should not be followed. ", "They argue that the PRA permits inspection by any person and does not permit an agency to consider the requester's identity. ", "But our Supreme Court recently favorably cited Sappenfield and acknowledged the unique nature of prisoner requests for PRA disclosures. ", "Livingston v. Cedeno, 164 Wash.2d 46, 53-54, 186 P.3d 1055 (2008).", "\n¶ 17 Livingston, an incarcerated offender, challenged a DOC policy in which his mail, which contained records the DOC produced in response to a PRA request, was intercepted as contraband under the prison's mail policy. ", "Livingston, 164 Wash.2d at 48-49, 186 P.3d 1055. ", "The court held that the DOC's application of the mail policy to its own public records did not violate the PRA. ", "Livingston, 164 Wash.2d at 49, 186 P.3d 1055. ", "The court reasoned that \"[a]cting in its custodial capacity to ensure the safety of inmates, staff, and the public, the [DOC] may prohibit the entry into an institution of materials otherwise subject to disclosure under the [PRA].\" ", "Livingston, 164 Wash.2d at 53, 186 P.3d 1055. ", "The court acknowledged that, as it and the United States Supreme Court has recognized, prisoners have, in many respects, more limited rights and privileges because of paramount institutional goals and policies. ", "Livingston, 164 Wash.2d at 53, 186 P.3d 1055. ", "Importantly to this case, the court acknowledged that it had to give \"considerable deference . . . ", "to prison administrators to regulate communications between prisoners and the outside world.\" ", "Livingston, 164 Wash.2d at 53-54, 186 P.3d 1055 (favorably citing Sappenfield as recognizing the unique circumstances of incarceration in the context of PRA requests).", "\n¶ 18 We agree with Division Three and adopt the Sappenfield court's holding. ", "The DOC's need to securely restrain incarcerated offenders and to protect public records has not changed in the years since Sappenfield was decided. ", "Gronquist and Mustard were incarcerated offenders at the time of their disclosure requests. ", "Their incarceration presents unique concerns in the context of PRA requests. ", "The DOC is entitled to adopt reasonable rules to protect both the records and its essential agency functions.[7] Furthermore, because the policy is valid, the DOC did not, in applying the policy, deny the inmates' requests or fail to identify withheld documents. ", "In fact, the DOC did not withhold documents; the inmates simply refused to avail themselves of the policy and pay for copies. ", "DOC Policy 280.510 is a reasonable way of addressing these concerns.[8] The DOC was therefore entitled to judgment as a matter of law. ", "We hold that the trial court did not err in granting the DOC partial summary judgment.", "\n\nB. Separation of Powers\n¶ 19 Next, the inmates argue that separation of powers enjoins us from following Sappenfield or affirming the DOC's policy. ", "We disagree.", "\n¶ 20 The separation of powers doctrine recognizes that each branch of government has its own appropriate sphere of activity. ", "Hale v. Wellpinit Sch. ", "Dist. ", "No. ", "49, 165 Wash.2d 494, 504, 198 P.3d 1021 (2009). ", "To determine whether an action violates separation of powers, we must determine whether the activity of one branch threatens the independence *442 or integrity or invades the prerogatives of another. ", "Hale, 165 Wash.2d at 507, 198 P.3d 1021. ", "It is the judicial branch's function to interpret the law. ", "Hale, 165 Wash.2d at 505, 198 P.3d 1021. ", "It is within our appropriate sphere of activity to determine what a particular statute means and that determination relates back to the time of the statute's enactment. ", "Hale, 165 Wash.2d at 506, 198 P.3d 1021. ", "The legislature's role is to set policy and to draft and enact laws. ", "Hale, 165 Wash.2d at 506, 198 P.3d 1021.", "\n¶ 21 Sappenfield does not violate separation of powers. ", "In Sappenfield, Division Three interpreted the PRA's requirement that each agency set its own disclosure rules. ", "127 Wash.App. ", "at 89, 110 P.3d 808 (citing former RCW 42.17.290). ", "It did not alter the PRA nor invade the legislature's independence, integrity, or prerogatives.", "\n¶ 22 The inmates cite Fritz v. Gorton, 83 Wash.2d 275, 287, 300, 309-10, 517 P.2d 911 (1974), for the proposition that the judiciary may not alter PRA's statutory scheme under separation of powers doctrine. ", "But, as we already stated, Sappenfield does not alter the statutory scheme or enact new legislation. ", "It interprets an agency's implementation of the PRA's mandate to set disclosure rules that do not interfere with the agency's essential functions or place public records in danger. ", "Sappenfield does not violate the separation of powers doctrine.", "\n\nC. Collateral Estoppel\n¶ 23 In addition, the inmates argue that collateral estoppel prohibits application of Sappenfield because Gronquist previously successfully litigated this issue before the superior court and the DOC did not appeal that order. ", "We disagree.", "\n¶ 24 On October 21, 2001, Gronquist sent the DOC a PDA request seeking inspection of disciplinary minutes, recordings, and findings regarding serious infractions against all AHCC inmates, including himself, in the prior 24 months. ", "He also sought DOC guidelines regarding serious infractions and information regarding the DOC's relationship with and complaints against Omega Pacific, Inc. The DOC requested additional time to process the request, and it informed Gronquist that once the compilation was complete, it would provide copies for $0.20 per page.", "\n¶ 25 Eventually, the DOC informed Gronquist that due to the large number of documents retrieved, the cost of copies would exceed $300. ", "The DOC requested prepayment of $300 before going further with Gronquist's request as well as additional time to assemble the requested records. ", "Gronquist filed a show cause motion to compel inspection of the documents. ", "Gronquist asked the trial court to compel the DOC to make the records available for in-person inspection, not just to provide copies. ", "The trial court found that the DOC had not provided justification for the $300 fee because it had not assembled the records before calculating the fee. ", "The trial court appears to have been concerned with the DOC's demand for a fee based on an estimated cost. ", "The trial court found that while the statutory scheme permits a charge for copies when requested, Gronquist did not request copies. ", "The trial court stated, \"I don't know if it's a fact that prisoners are routinely required to pay a fee when they request a public disclosure, but that's not before me right now. ", "I just don't see a justification for the $300 fee.\" ", "CP at 202.", "\n¶ 26 Collateral estoppel applies when: (1) the issue decided previously is identical with the one presented in the second proceeding; (2) the prior adjudication ended with a final judgment on the merits; (3) the party against whom the doctrine is asserted was a party or in privity with a party to the prior adjudication; and (4) application of the doctrine will not work an injustice. ", "Hanson v. City of Snohomish, 121 Wash.2d 552, 562, 852 P.2d 295 (1993). ", "The burden of proof is on the party asserting the doctrine as a bar. ", "Dep't of Ecology v. Yakima Reservation Irrigation Dist., ", "121 Wash.2d 257, 296, 850 P.2d 1306 (1993).", "\n¶ 27 The inmates have not carried their burden of proving that the 2001 ruling decided an identical issue of fact as that presented in this case.[9] The trial court in 2001 appeared *443 unclear about whether it was ruling on the policy and its ruling did not clearly bar application of the DOC's policy. ", "Instead, the 2001 trial court found that the DOC had not justified its demand that Gronquist pay a $300 advance fee. ", "While the trial court did note that Gronquist did not want copies, it also stated that it was not ruling on the DOC's policy. ", "See Davis v. Nielson, 9 Wash. App. ", "864, 875, 515 P.2d 995 (1973) (when, because of ambiguity or indefiniteness, the appellate court cannot say that the issue was determined in the prior action, collateral estoppel will not be applied as to that issue). ", "Here, the policy's validity is at issue, not whether the copy fees were justified. ", "Accordingly, the inmates failed to show that this case presents an identical issue to Gronquist's 2001 lawsuit.", "\n\nII. ", "SHOW CAUSE MOTION — ADEQUACY OF SEARCH AND RECORDS RETENTION\n¶ 28 Gronquist[10] next argues that the trial court erred by denying his show cause motion as to his October 27, 2001, and January 18, 2005, requests. ", "We disagree.", "\n¶29 Upon the motion of any person having been denied an opportunity to inspect or copy a public record, the superior court may require the agency to show cause why it has refused to allow inspection or copying of a specific public record or class of records. ", "RCW 42.56.550(1). ", "The burden of proof shall be on the agency to establish that the refusal is in accordance with a statute that exempts or prohibits disclosure. ", "RCW 42.56.550(1). ", "Where the record on a show cause motion consists entirely of written materials and the trial court has not seen nor heard testimony requiring it to assess the credibility or competency of a witness, weigh evidence, nor reconcile conflicting evidence, then an appellate court stands in the same position as the trial court in looking at the facts of the case and should review the record de novo. ", "Progressive Animal Welfare Soc'y v. Univ. ", "of Wash., 125 Wash.2d 243, 252, 884 P.2d 592 (1994) (PAWS); Zink v. City of Mesa, 140 Wash.App. ", "328, 336, 166 P.3d 738 (2007). ", "Under such circumstances, the reviewing court is not bound by the trial court's findings on disputed factual issues. ", "PAWS, 125 Wash.2d at 253, 884 P.2d 592. ", "Here, the trial court did not consider any live testimony (nor make factual findings), so we review both facts and law de novo.", "\n¶ 30 Gronquist argues that even if the DOC's policy is reasonable, the DOC erred by refusing to search for, identify, and safeguard the records he requested.[11] He asserts that the DOC refused to search for records in response to his October 27, 2001, and January 18, 2005, requests. ", "At the trial court, the DOC contended that it had no duty to search for records when it knew that the inmates did not intend to pay for copies. ", "We agree with the DOC.", "\n¶ 31 When inmates make it known to the DOC that they will not pay for copies of records the DOC identifies as responsive to the inmates' PRA requests, searching for, collecting, and identifying the documents would be a futile and useless waste of staff time. ", "We have held that the policy of charging inmates for copies is reasonable, but Gronquist adamantly refuses to pay for the copies. ", "The law does not demand compliance when such compliance results in a vain and useless act. ", "Vashon Island Comm. ", "for Self-Gov't v. Wash. State Boundary Review Bd. *", "444 for King Cnty., ", "127 Wash.2d 759, 765, 903 P.2d 953 (1995).[12] The uselessness of requiring the DOC to search for and identify more records for Gronquist is illustrated by Gronquist's refusal to pay for copies of the 70 pages the DOC identified in 2001.", "\n¶ 32 Finally, there is no evidence that any of the records that DOC destroyed were the subject of Gronquist's request because Gronquist failed to show that the destroyed documents contained information relevant to his requests. ", "In addition, there is no evidence that the majority of the records Gronquist requested are contained in his central file, nor is there evidence of what a central file might contain. ", "Furthermore, there is no evidence that Gronquist completed DOC form 05-066 requesting access to his central file without charge.", "\n¶ 33 Affirmed.", "\nWe concur: QUINN-BRINTNALL, J., and PENOYAR, C.J.\nNOTES\n[1] Ch. ", "42.56 RCW.", "\n[2] At the time of Gronquist's request, the PRA was called the Public Disclosure Act and was codified at chapter 42.17 RCW. ", "Former ch. ", "42.17 RCW (2000). ", "Effective July 1, 2006, the act was renamed and recodified as chapter 42.56 RCW. ", "LAWS OF 2005, ch. ", "274, §§ 102-03. ", "The relevant portions of the current and former statute appear identical as to the issues involved in this case.", "\n[3] Gronquist also requested a photocopy of a job opening posted in a day room and transferred $0.20 for the single photocopy. ", "The DOC made this document available for mailing upon receipt of $0.57 (copy fee plus actual postage).", "\n[4] Effective July 24, 2005, a PRA requester had to file an action under chapter 42.56 RCW within one year of the agency's claim of exemption or the last production of a record. ", "RCW. ", "42.56.550(6). ", "But prior to that date, the requester had five years to file an action. ", "Former RCW 42.17.410 (1982). ", "The inmates sent all three disclosure requests before the new statute of limitations became effective and within five years of any alleged exemption or production. ", "As such, we regard their suit as timely.", "\n[5] 127 Wash.App. ", "83, 110 P.3d 808 (2005), review denied, 156 Wash.2d 1013, 132 P.3d 146 (2006).", "\n[6] The inmates argue that the records they requested are not exempt from disclosure under the PRA. ", "They also contend that the DOC should have identified each record withheld from inspection. ", "But the DOC does not dispute that the records were subject to disclosure.", "\n[7] The inmates argue that the DOC must permit inspection because RCW 42.56.090 requires inspection on an agency's premises during normal business hours. ", "But the policy is necessary to protect the DOC's essential functions. ", "In addition, although an agency has a duty to permit inspection on its premises during normal business hours, there is no requirement that an agency transmit the records to the requester who is unable to come to the agency's premises.", "\n[8] Contrary to the inmates' argument, the DOC does not charge for inspection. ", "The DOC charges for copies and does not permit inmate inspection of documents outside their central or medical files. ", "There is no evidence to suggest that the DOC charges for inspecting one's central or medical files.", "\n[9] The DOC was a party to the prior lawsuit and the parties do not dispute that Gronquist's prior lawsuit ended with a final judgment. ", "Contrary to the DOC's assertion, Mustard did not have to be a party to Gronquist's prior action. ", "Collateral estoppel's third requirement mandates that the DOC or a party in privity to it was a party to the prior action. ", "Hanson, 121 Wash.2d at 562, 852 P.2d 295.", "\n[10] As Mustard has presented no argument on the adequacy of the DOC's search in regards to his request he has waived this issue. ", "RAP 10.3(a)(6); State v. Thomas, 150 Wash.2d 821, 874, 83 P.3d 970 (2004) (without argument or authority to support it, an assignment of error is waived); In re Pers. ", "Restraint of Connick, 144 Wash.2d 442, 455, 28 P.3d 729 (2001) (a pro se appellant held to the same responsibility as a lawyer and is required to follow applicable statutes and rules; failure to do so will preclude review of the asserted claim). ", "Therefore, we assign these arguments to Gronquist and not the joint inmates.", "\n[11] The DOC argues that Gronquist never raised these arguments below and, thus, we should not consider them. ", "This is incorrect. ", "Gronquist raised these arguments in his show cause motion, which the DOC acknowledged below.", "\n[12] Although this is not a mandamus action, Gronquist is essentially asking us to force the DOC to perform a search. ", "As such, the \"vain and useless\" standard is relevant here.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0006958664744161069, 0.0013785817427560687, 0.0009826073655858636, 0.0007135572959668934, 0.0007161910180002451, 0.0006139272591099143, 0.0007610686589032412, 0.000987439532764256, 0.000777554465457797, 0.000612949428614229, 0.0006953172269277275, 0.0006535728462040424, 0.0007081216317601502, 0.0007506458205170929, 0.0005705242510885, 0.00065807462669909, 0.0006078496226109564, 0.0006107017979957163, 0.0005438124644570053, 0.0006104957428760827, 0.0007588732405565679, 0.0006353104836307466, 0.0006105920183472335, 0.0006037329440005124, 0.0006047350470907986, 0.0005829266738146544, 0.0006337729282677174, 0.0006630347343161702, 0.0006174371810629964, 0.0007887136889621615, 0.0013028552057221532, 0.0006333034834824502, 0.0006475488189607859, 0.0008643182809464633, 0.0007456664461642504, 0.0007548651774413884, 0.0009435837855562568, 0.0014423232059925795, 0.0007137894863262773, 0.0007091092993505299, 0.0005723204812966287, 0.0015180556802079082, 0.0012096985010430217, 0.0007152794278226793, 0.0005754568264819682, 0.000892561103682965, 0.0006949075032025576, 0.0005664282361976802, 0.0007563993567600846, 0.0006353719509206712, 0.0008279730100184679, 0.0006036472041159868, 0.0008354285382665694, 0.0007313855458050966, 0.0005702202906832099, 0.001130632939748466, 0.0005995715619064867, 0.001130632939748466, 0.0006092204712331295, 0.001130632939748466, 0.0007087417761795223, 0.0010882583446800709, 0.0006691556191071868, 0.0011068085441365838, 0.0006462695309892297, 0.0011068085441365838, 0.000625519547611475, 0.0012015255633741617, 0.0006768754101358354, 0.0006259322981350124, 0.0012015255633741617, 0.0006768754101358354, 0.0005539397825486958, 0.0012015255633741617, 0.0006760354735888541, 0.0011960697593167424, 0.0012015255633741617, 0.0006825461168773472, 0.0006014290847815573, 0.0012015255633741617, 0.0006830920465290546, 0.0005757163162343204, 0.0012015255633741617, 0.0006852101651020348, 0.0006725486018694937, 0.0012015255633741617, 0.0006852101651020348, 0.0006923545734025538, 0.0012015255633741617, 0.0006852101651020348, 0.0005937580135650933, 0.0012015255633741617, 0.0006275399355217814, 0.0007167758885771036, 0.0006046211929060519, 0.0012015255633741617, 0.0006786012672819197, 0.00069747882662341, 0.0012015255633741617, 0.000595797086134553, 0.000671457324642688, 0.0012015255633741617, 0.000595797086134553, 0.0006800891133025289, 0.0012015255633741617, 0.000673274218570441, 0.001306798541918397, 0.0006435282411985099, 0.0005900762043893337, 0.0007749408250674605, 0.0007005425286479294, 0.0007633617497049272, 0.0008178778807632625, 0.000777816865593195, 0.0008407463319599628, 0.0007783907349221408, 0.0005875880597159266, 0.0007783907349221408, 0.0005593709647655487, 0.0008278534514829516, 0.0007011921261437237, 0.0006283592665567994, 0.0007906559621915221, 0.0008359811617992818, 0.0006110522663220763, 0.0005965809104964137, 0.0008346209651790559, 0.0005465165595524013, 0.0007111429003998637, 0.0008692505653016269, 0.0006458114366978407, 0.0005889643216505647, 0.0022518064361065626, 0.0011276830919086933, 0.0013785817427560687, 0.0007811911636963487, 0.0007045079837553203, 0.0007920472999103367, 0.0006621611537411809, 0.0007312357192859054, 0.0005586385959759355, 0.000797651766333729, 0.0007944169919937849, 0.000797651766333729, 0.0008670142851769924, 0.0006650894065387547, 0.0012096985010430217, 0.000595797086134553, 0.0008438323275186121, 0.0006945370696485043, 0.0007299132994376123, 0.0006389195332303643, 0.0009236464975401759, 0.0007466477109119296, 0.0006458114366978407, 0.0006473387475125492, 0.0005620958399958909, 0.0006163204088807106, 0.0005694768042303622, 0.0007107926066964865, 0.000626278342679143, 0.0008383675012737513, 0.0006043461035005748, 0.0006590848788619041, 0.0005870159948244691, 0.0007786693749949336, 0.000644391227979213, 0.0007003318751230836, 0.0008016164065338671, 0.0008319657063111663, 0.000782156886998564, 0.0006694021285511553, 0.0006653435993939638, 0.0007478561601601541, 0.0006293263286352158, 0.0007383472984656692, 0.0006282005924731493, 0.0006397051620297134, 0.0008579922141507268, 0.0011519683757796884, 0.0006636400357820094, 0.0006458114366978407, 0.0006588123505935073, 0.0006859576678834856, 0.0007811178220435977, 0.0006859576678834856, 0.0006290798191912472, 0.0011476441286504269, 0.0008793489541858435, 0.0006326190778054297, 0.0006299417000263929, 0.000770580256357789, 0.0006014637765474617, 0.0006168005056679249, 0.0007484371890313923, 0.0005929560866206884, 0.013560778461396694, 0.000900542363524437, 0.01878189481794834, 0.001050329301506281, 0.0007013277499936521, 0.0008132437360472977, 0.0016088049160316586, 0.0006560483016073704, 0.0006639016792178154, 0.0006406866014003754, 0.0006937673897482455, 0.0005860148230567575, 0.002113621449097991, 0.0005915178335271776, 0.0007568106520920992, 0.0007126167765818536, 0.0006765946163795888, 0.0006491841631941497, 0.0007339742733165622, 0.0005481256521306932, 0.0006009199423715472, 0.0005488769966177642, 0.000611320196185261, 0.0015350482426583767, 0.0006937075522728264, 0.0006861158763058484, 0.0006702386890538037, 0.0006365244626067579, 0.0005384444957599044, 0.0012716855853796005, 0.000727096339687705, 0.0007300088764168322, 0.0005297319148667157, 0.0006123611237853765, 0.0007972077000886202, 0.0006211047875694931, 0.0006321630789898336, 0.000983256264589727, 0.0006470484659075737, 0.0006366724846884608, 0.0007785306661389768, 0.0014583986485376954, 0.000677772331982851, 0.000739426352083683, 0.0007361836615018547, 0.001834196038544178, 0.0006583905196748674, 0.0006830022903159261, 0.0006061075255274773, 0.0008244444616138935, 0.0005766235990449786, 0.004724506754428148, 0.021885618567466736, 0.001995444530621171 ]

[ "Traffic fatalities in the US, for the first nine months of 2015, rose 9.3 percent from the year prior. ", "It's an increase of roughly 2,200 though these are still statistical projections and the numbers could change.", "\n\nMore traffic deaths are definitely bad, but the total number of fatalities is only one part of the story. ", "The important number is the amount of traffic deaths per mile driven. ", "If people are driving more miles, it's natural that traffic accidents (and then fatalities) would increase as well, as long as technology and behavior remain the same.", "\n\nAnd, unsurprisingly, traffic deaths per vehicle mile rose as well, from 1.05 per 100 million vehicle miles for the first nine months of 2014 up to 1.10 for the first nine months of 2015, according to data from the National Highway Traffic Safety Administration (NHTSA). ", "That's about a 5 percent increase — still bad, but not nearly as bad as the 9.3 percent rise in total fatalities.", "\n\nWith the rise in fatalities this year, government highway agencies and safety organizations are holding conferences to figure out what must be done. ", "But here's the cynical view: DOT, like other government agencies, needs to make the case for bigger budgets — and a safety concern can play into that. ", "So while a rise in fatalities is never a good thing, overall the situation looks pretty good, regardless of the doom-and-gloom that you might see from your local highway department.", "\n\nCars are much safer these days than they have been in years. ", "Total traffic fatalities are down significantly from 10 years ago, and the decline gets even more significant if you go back further. ", "In 2005, we saw traffic fatalities reach 1.43 per 100 million vehicle miles, well above what we're seeing these days. ", "By any measure, cars — and the people who ride in them — are safer than they've ever been, even with this slight uptick in fatalities.", "\n\nno obvious cause for the jump\n\nThere's no single obvious cause for the rise in fatalities in 2015 — though this is still preliminary data, there hasn't been a significant jump in drunk driving or a drop in seat belt use. ", "There are lots of theories, mostly related to distracted driving, including talking on phones or texting while driving, as well as more motorcyclists choosing to ride sans helmet.", "\n\nRiding in cars has gotten significantly safer over the past 20 years, and, even with a slight uptick last year, we can see on the chart above that the overall trend is drifting lower. ", "Still, if you don’t want to die, use some common sense: wear your seat belt, don't drink and drive, or text and drive." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006276990752667189, 0.0005995967076160014, 0.0008102977299131453, 0.0010197942610830069, 0.0006739001255482435, 0.000649098539724946, 0.0009351599146611989, 0.000613361713476479, 0.0006421200814656913, 0.0005902221892029047, 0.0009516004356555641, 0.0007665192242711782, 0.000648518733214587, 0.0008673901902511716, 0.0008311721030622721, 0.0005991705693304539, 0.0005776690086349845, 0.6623483896255493 ]

[ "I'm generating a PDF document with pdflatex (more precisely, latexmk invoked from TexMaker 3.4. ", "My LaTeX install is TeXLive 20120719). ", "I can read the document fine in Okular and Gmail's attachment preview, but a colleague that runs Acrobat Reader on Windows reports: \"There was a problem reading this document (131)\".", "\n\nEDIT: The error disappears when using \\usepackage[demo]{graphicx}, which puts black boxes instead of the real images. ", "They are all PDFs, PNGs and JPGs. ", "Instead of using demo, I added the code for a \\demoincludegraphics command, which makes the file work in Reader when using it to replace the logo in the headers, as shown below. ", "But enabling it (using \\includegraphics instead of \\demoincludegraphics) and removing everything else also works in Reader! ", "There is some strange global interaction that makes the file appear broken to Reader when enabling all the graphics...\n\nMy code compiles fine, reason why I only attach the preamble and a simple text for a Minimal Working Example:\n\nYes I saw that page before, not particularly illuminating, as it points to some \"LiveCycle\" software that I'm obviously not using. ", "It tells about some \"usage rights\", and having looked for how to set that with LaTeX commands, I came out empty...\n–\nLuis E.Jul 24 '12 at 12:33\n\nI don't really know how to go about the MWE, as I would need to attach the images that go along the document. ", "I understand your reasons, and that's precisely why I put the workaround as an edit. ", "However, not being a LaTeX guru, I don't have much more control over the pdf generation process. ", "The workaround also shrunk the file size, from 5.2 Mb to 1.4 Mb with no quality loss whatsoever, so it is a plus...\n–\nLuis E.Jul 24 '12 at 16:13\n\nDid you check if each of your pdf included images are OK for Adobe Acrobat?", "\n–\nJLDiazJul 24 '12 at 17:55\n\n4 Answers\n4\n\nI solved a similar problem by generating a PDF 1.4 only with pdflatex using \\pdfminorversion=4. ", "I'm also only using png's and 1.4 pdf images in my latex document. ", "It worked before with evince but now acroread also reads the file just fine and I preserve the same quality level. ", "The ghostscript workaround resampled my images to jpeg which derogated the quality.", "\n\nThanks for the answer. ", "I had to place \\pdfminorversion=4 before \\documentclass{beamer}.", "\n–\nstaliDec 1 '12 at 3:25\n\n9\n\nIf you don't want to decrease the pdf version setting \\pdfobjcompresslevel=0 or \\pdfobjcompresslevel=1 also solves the problem\n–\nergoenJun 3 '13 at 12:47\n\nFYI, it turns out this is related to the problem \"Warning: File(s) failed to convert\" when submitting a paper to an IEEE journal over the ScholarOne Manuscript Central. ", "Accidentally and luckily, I found out this also causes the error 131 in Acrobat Reader. ", "The above \\pdfminorversion=4 fixes it.", "\n–\nhenrikzAug 1 '13 at 10:46\n\nThis answer should be the accepted one, it worked for me too\n–\nlauhubMay 13 '14 at 18:31\n\nAwesome, adobe was giving me a different error about a damaged file. ", "Setting pdfobjcompresslevel fixed the problem.", "\n–\nMaximeJun 10 '14 at 13:10\n\nHow did you find out which png file was the cause?", "\n–\nbluenote10Apr 21 at 10:25\n\nIt was the only file not being generated by pdflatex. ", "Unfortunately I cannot provide a methodology or what was the problem in the png file.", "\n–\nzakkakApr 22 at 11:37\n\n2\n\nIn my case it was also a faulty file, however, for me it was a PDF file that was the cause. ", "The PDF in question was a plot from matplotlib that had been cropped using the boundingbox option in pyplot.savefig\n–\nregdougMay 15 at 23:42\n\n@regdoug, do you have a solution to this problem with matplotlib? ", "I have the same issue when using boundingbox with pyplot.savefig. ", "Did you just output png instead of pdf and lose the vector graphic? ", "Or did you do something else?", "\n–\nScott BMay 27 at 2:48\n\nI output eps instead of pdf. ", "That way it is still vector graphics\n–\nregdougMay 28 at 4:55" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005797144840471447, 0.0012302253162488341, 0.0006402095896191895, 0.0007793849799782038, 0.0008537462563253939, 0.0006307136500254273, 0.0009125146898441017, 0.0005743603687733412, 0.0005839443765580654, 0.0005781382787972689, 0.000801547197625041, 0.0006776216323487461, 0.0008507212623953819, 0.0007589517044834793, 0.0005761236534453928, 0.0006318210507743061, 0.0005977502441965044, 0.0008064016583375633, 0.0009763076086528599, 0.0011586392065510154, 0.000851076387334615, 0.0010485821403563023, 0.0007418702589347959, 0.0008233092376030982, 0.0007520090439356863, 0.00071857706643641, 0.0006656572222709656, 0.001361211878247559, 0.007250260096043348, 0.0008954748627729714, 0.0010439398465678096, 0.000615251949056983, 0.0006729317246936262 ]

[ "int i;\n\nint bar(void)\n{\n return 0x1234;\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.003600463969632983 ]

[ "Launch of the Acteal Campaign: Roots, Memory and Hope. ", "Photo@: Sipaz\n\nOn 23 March, the Acteal Campaign: Roots, Memory and Hope was launched from the offices of the Fray Bartolome de las Casas Human Rights Center (CDHFBC) in San Cristobal de Las Casas. ", "The campaign will take place within the framework of the XX anniversary of the Acteal Massacre and the 25th anniversary of the founding of Las Abejas Civil Society to “highlight our path as survivors and victims of the Acteal Massacre and as members of Las Abejas Civil Society of Acteal, […] exchange and share experiences with men and women from towns and cities who also fight for the same cause as us” and to “point out the material and intellectual authors of the Acteal Massacre so that the Mexican State recognizes its responsibility that Acteal is a state crime, a crime against humanity. ", "And denounce that the Mexican State has so far been unable to ensure the non-repetition of events such as that of Acteal” (sic). ", "They affirmed that, “it is the path of the search for truth and true justice. ", "But, it is also memory, because we will be remembering, reporting and denouncing.”", "\n\nThe campaign will last nine months with cultural, political and religious activities. ", "It will culminate with the commemoration of the 20th anniversary of the massacre on December 20th, 21st and 22nd, 2017, in Acteal, House of Memory and Hope.", "\n\nDuring the launch, Gonzalo Ituarte, Secretary of the Board of Directors of CDHFBC and Vicar of Justice and Peace of the Diocese of San Cristobal de Las Casas, shared his testimony. ", "On the day of the massacre he reported receiving two calls from Chenalho informing him of the approach of an armed group shooting. ", "He indicated that he had twice called the government secretary to address this situation. ", "However, no aid was sent for which Gonzalo Ituarte denounced “the way the government had deceived us and how it had allowed, that is to say, how it had caused that massacre. ", "The government that could stop all this did not do it and I am convinced that it did not because it was part of their plan, they wanted to kill, they wanted to destroy the heart of civil society, which sought just causes and a solution to the problem. ", "They wanted to kill and they killed them consciously and this causes indignation and this is a crime unpunished today.”", "\n\nFor more information in Spanish:\n\nEn el marco de los XX años de la Masacre, realizaremos una campaña llamada, Acteal: Raíz, Memoria y Esperanza (Las abejas de Acteal, 23 de marzo 2017)\n\nAbejas de Acteal y Frayba lanzan campaña para romper los muros de la impunidad y contra el olvido (Centro de Derechos Humanos fray Bartolomé de Las Casas, 24 de marzo de 2017) Comunicado de Las Abejas de Acteal en el lanzamiento de la Campaña Acteal: Raíz, Memoria y Esperanza (Chiapas Denuncia Pública, 23 de Marzo de 2017)" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000548925600014627, 0.0005931629566475749, 0.0008067956077866256, 0.0010281662689521909, 0.0006198519258759916, 0.0007850559777580202, 0.0006608775584027171, 0.000674721144605428, 0.0005732335266657174, 0.001278139534406364, 0.0005493126227520406, 0.0013967967825010419, 0.03955449163913727, 0.7020829916000366, 0.0007839847239665687 ]