Datasets:

arcee-ai

/

pmc-test-perplexity

like 0

Supplemental Material Seroprevalence of SARS-CoV-2 antibodies among Forcibly Displaced Myanmar Nationals in Cox's Bazar, Bangladesh 2020: a population-based cross-sectional study Mahbubur Rahman Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh Samsad Rabbani Khan Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh A S M Alamgir Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh David S Kennedy Ferdous Hakim Research and Publication World Health OrganizationDhakaBangladesh Egmond Samir Evers Nawroz Afreen Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh Ahmed Nawsher Alam Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh MdSahidul Islam Research and Publication World Health OrganizationDhakaBangladesh Debashish Paul Rijwan Bhuiyan Coordination Center Ministry of Health and Family Welfare Cox's, BazarBangladesh Raisul Islam Adneen Moureen IEDCR Field Laboratory, World Health Organization Cox's, BazarBangladesh M Salimuzzaman Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh Mallick Masum Billah Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh Ahmed Raihan Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh Sharif Mst Khaleda Akter Research and Publication World Health OrganizationDhakaBangladesh Sharmin Sultana Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh Manjur Hossain Khan Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh Kai Von Harbou Mohammad Mostafa Zaman Research and Publication World Health OrganizationDhakaBangladesh Tahmina Shirin Institute of Epidemiology Disease Control and Research (IEDCR) DhakaBangladesh Sabrina Meerjady Flora Directorate General of Health Services (DGHS) DhakaBangladesh Supplemental Material Seroprevalence of SARS-CoV-2 antibodies among Forcibly Displaced Myanmar Nationals in Cox's Bazar, Bangladesh 2020: a population-based cross-sectional study 10.1136/bmjopen-2022-0666532 WHO Emergency Sub-Office, World Health Organization, Cox's Bazar, Bangladesh Weighted and test adjusted prevalence Primarily we used WANTAI total antibody SARS-CoV-2 ELISA kits to estimate the seroprevalence, which has some limitations and could result in false positives and false negatives estimates. In order to validate the test result, we used Kantaro IgG ELISA test kit. We took the following approach to adjust the seroprevalence of WANTAI by KANTARO kits. Let = ( + ) represent the population prevalence of antibodies to SARS-CoV-2 and let = ( + ) be the proportion of participants who test positive in WANTAI. Let, = ( + | + ) be the sensitivity of the test (the probability of testing positive in WANTAI given an individual is positive in KANTARO), and let, = ( − ) be the specificity of the test (the probability of testing negative in WANTAI given an individual is negative in KANTARO). We can write the expected fraction of positive tests, p, as follows: = + (1 − )(1 − ) Therefore, the test adjusted estimated seroprevalence is expressed using following formula [1]- = −(1− ) (1− ) …………………………………………….. (1) Of 3,446 total samples in our study, we found 2,090 positives for WANTAI. Again, we used KANTARO quantitative test to those WANTAI positive samples and we found 290 negatives. Since we didn't test any negative WANTAI samples, and we assumed that all negative samples in WANTAI are also negative in KANTARO. A confusion matrix is displayed below- Bootstrapping for confidence interval We calculated confidence intervals on our weighted sample prevalence estimates based on a non-parametric highest density interval (HDI) bootstrap [2]. Our bootstrap procedure resamples data from our actual datasets for sensitivity, specificity, and prevalence. We use the following steps-▪ First, we draw a single bootstrap sample (i.e. with replacement) from the beta distribution of the sensitivity data. For this sample, we calculate the mean value of sensitivity. Let represent the value for the jth iteration of this procedure. ▪ First, we draw a single bootstrap sample (i.e. with replacement) from the beta distribution of the specificity data. For this sample, we calculate the mean value of specificity. Let represent the value for the jth iteration of this procedure. ▪ For our weighted estimate, we calculate weighted prevalence of WANTAI in the bootstrap sample . Let represent this value for the jth iteration of this procedure. ▪ We then calculate the test adjusted prevalence of antibodies to SARS-CoV-2 for the jth bootstrap sample using the equation (1) ▪ Repeat the steps above for j=1...1,000,000 bootstrap samples. ▪ In our tables, we report the highest density interval (HDI) of the distributions of over the 1,000,000 bootstrap samples as the lower and upper ends of the 95% bootstrap confidence intervals. The confidence intervals for the test-adjusted estimates were derived using bootstrap sampling, with 1,000,000 parametric bootstrap samples for each estimate, using the "adjPrevSensSpecCI" function of the "bootComb" R package. References Figure 2 : 2Test adjusted over weighted seroprevalence among respondent occupation, FDMN population, Bangladesh December 2020 Note: Blue dot represents the prevalence and error bar indicating confidence interval. Table : :Confusion Matrix between WANTAI and KANTARO where 'p' denoting the positive and 'n' denoting the negative test result.Sensitivity, = 1800 1800+0 = 1.00, and specificity, = 1356 290+1356 = 0.8238 Therefore, overall seroprevalence, = 0.574−(1−0.8238) 1−(1−0.8238) = 0.4829 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) BMJ Open doi: 10.1136/bmjopen-2022-066653 :e066653. 1 . 1Chimeddorj B, Mandakh U, Le LV, Bayartsogt B, Deleg Z, Enebish O, Altanbayar O, Magvan B, Gantumur A, Byambaa O, Enebish G. SARS-CoV-2 seroprevalence in Mongolia: Results from a national population survey. The Lancet Regional Health-Western Pacific. 2021 Dec 1;17:100317. 2. Bendavid E, Mulaney B, Sood N, Shah S, Bromley-Dulfano R, Lai C, Weissberg Z, Saavedra-Walker R, Tedrow J, Bogan A, Kupiec T. Covid-19 antibody seroprevalence in santa clara county, Supplemental Table 1. Responses at household, individual and laboratory testing levels, FDMN seroprevalence survey, Bangladesh December 2020 Note: FDMN, Forcibly Displaced Myanmar Nationals *Not included as sample as they do not qualify 1 as sample for the Survey †Household response rate (%)=[RCx100]/[RC+VH+RefI] ‡Individual response rate (%)=[Cx100]/[C+II+U+R+RI] §Laboratory testing response rate (%)=[Cx100]/[C+Rej] ¶ Overall response rate (%)=HRR*IRR*LTRR/(100*100) 1 The American Association for Public Opinion Research. 2016. Standard Definitions: Final Dispositions of Case Codes and Outcome Rates for Surveys. 9th edition. AAPOR. Supplemental Table 2: test adjusted over weighted SARS-CoV-2 antibody prevalence by sex across covariates, FDMN population, Bangladesh 2020 FDMN, Forcibly Displaced Myanmar Nationals *P<0.05 † Among those aged 6 years or more ‡ Among those aged 18 years or more BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Supplemental Figure 1. FDMN camps in Ukhiya and Teknaf of Cox's Bazar district, Bangladesh December 2020 Note: FDMN, Forcibly Displaced Myanmar Nationalscalifornia. International journal of epidemiology. 2021 Apr;50(2):410-9. 3. Henrion MY. bootComb-an R package to derive confidence intervals for combinations of independent parameter estimates. BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) BMJ Open doi: 10.1136/bmjopen-2022-066653 :e066653. Responses All n % At household level Roster completed (RC) 4398 70.9 Vacant house/ No HH respondent available (VH) 152 2.5 House not found* 1112 17.9 Refused interview (RefI) 540 8.7 Total 6202 100 Household response rate (HRR) † 86.4 At individual level Completed (C) 3678 83.6 No one eligible* 181 4.1 Unavailable (U) 297 6.8 Refused (R) 242 5.5 Total 4398 100 Individual response rate (IRR) ‡ 87.2 At laboratory testing level Laboratory testing completed (C) 3446 93.7 Sample rejected by laboratory (Rej) 232 6.3 Total 3678 100 Laboratory testing response rate (LTRR) § 93.7 Overall response rate ¶ 70.6 Available from: https://www.aapor.org/AAPOR_Main/media/publications/Standard- Definitions20169theditionfinal.pdf (Accessed on 3 September 2019) BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) BMJ Open doi: 10.1136/bmjopen-2022-066653 :e066653. Variable Weighted prevalence, % (95% CI) Weighted & kit adjusted prevalence, % (95% CI) Overall Female Male Overall Female Male Age, years All 57.4 (55.1-59.7) 57.4 (54.2-60.6) 57.4 (54.2-60.6) 48.3 (45.3-51.4) 48.3 (44.2-52.3) 48.3 (44.2-52.3) 1-17 49.4 (45.6-53.2) 48.6 (43.0-54.3) 50.2 (45.1-55.2) 38.6 (33.8-43.4) 37.6 (30.7-44.7) 39.5 (33.2-45.8) 18-94 65.5 (63.2-67.8)* 65.4 (62.4-68.2)* 65.7 (62.0-69.3)* 58.1 (55.2-61.1)* 58.0 (54.3-61.6)* 58.4 (53.8-62.9)* 18-49 64.9 (62.3-67.4) 65.1 (61.9-68.1) 64.7 (60.4-68.8) 57.4 (54.1-60.6) 57.6 (53.6-61.4) 57.1 (51.9-62.3) 50-94 68.5 (63.0-73.5)* 67.2 (59.5-74.2)* 69.5 (61.7-76.3)* 61.8 (55.1-68.0)* 60.2 (50.9-68.9)* 63.0 (53.7-71.4)* Education † (n=3,160) No formal education 61.7 (58.8-64.5) 61.4 (57.9-64.8) 62.1 (57.0-67.0) 53.5 (49.8-57.1) 53.1 (48.8-57.4) 54.0 (47.7-60.1) Primary above 61.8 (58.3-65.2) 59.0 (53.0-64.8) 63.8 (59.5-67.9) 53.6 (49.2-57.9) 50.2 (42.9-57.4) 56.1 (50.8-61.1) Camp location Teknaf 54.8 (48.9-60.6) 59.7 (51.0-67.7) 49.4 (41.3-57.6) 45.1 (37.8-52.2) 51.1 (40.6-60.9) 38.6 (28.7-48.7) Ukhiya 58.0 (55.5-60.4) 56.9 (53.5-60.3) 59.1 (55.5-62.5)* 49.0 (45.8-52.2) 47.7 (43.3-51.9) 50.4 (45.8-54.6)* Smoking ‡ (n=2,392) No 67.5 (64.9-70.0) 65.3 (62.2-68.2) 71.8 (67.1-76.1) 60.5 (57.3-63.7) 57.9 (54.0-61.5) 65.8 (60.1-71.2) Yes 59.1 (53.9-64.2)* 66.5 (55.6-75.9) 57.5 (51.6-63.2)* 50.4 (43.9-56.6)* 59.3 (46.5-71.2) 48.4 (41.2-55.5)* BCG vaccination No 58.8 (52.7-64.7) 58.9 (50.0-67.2) 58.7 (50.2-66.7) 50.0 (42.5-57.3) 50.1 (39.4-60.4) 49.9 (39.5-59.7) Yes 57.2 (54.7-59.6) 57.2 (53.8-60.6) 57.2 (53.7-60.6) 48.0 (44.8-51.2) 48.0 (43.8-52.4) 48.0 (43.6-52.3) Any relevant symptoms No symptom 55.3 (52.3-58.2) 53.3 (49.1-57.4) 57.3 (53.2-61.4) 45.7 (41.9-49.5) 43.3 (38.1-48.5) 48.2 (43.1-53.3) Any symptom 61.2 (57.7-64.6)* 64.6 (59.9-69.1)* 57.5 (52.3-62.5) 52.9 (48.5-57.2)* 57.0 (51.2-62.6)* 48.4 (42.0-54.6) Any comorbidity No comorbidity 56.5 (54.0-58.9) 56.1 (52.6-59.5) 56.9 (53.5-60.2) 47.2 (43.9-50.4) 46.7 (42.3-51.0) 47.7 (43.4-51.9) Any comorbidity 65.2 (59.2-70.7)* 67.3 (59.8-74.0)* 62.4 (52.4-71.4) 57.8 (50.4-64.5)* 60.3 (51.4-68.7)* 54.4 (42.4-65.5) Note: BMJ Open doi: 10.1136/bmjopen-2022-066653 :e066653. 12 2022; BMJ Open , et al. Rahman M

Tuberous Sclerosis Complex: Prenatal Diagnosis Using Ultrasound and Magnetic Resonance Imaging-A Report of Two Cases 2023 Eduardo Félix Martins Santana Department of Woman Health Israeli Faculty of Health Sciences Albert Einstein São PauloBrazil Ana Maria Faria Esteves Service of Gynecology and Obstetrics Municipal University Hospital of São Bernardo do Campo São Bernardo do CampoBrazil Daniella Guerra Delorenzo Service of Gynecology and Obstetrics Municipal University Hospital of São Bernardo do Campo São Bernardo do CampoBrazil Celso Hygino Department of Fetal Medicine Clínica de Diagnóstico por Imagem (CDPI) Rio de JaneiroBrazil Heron Werner Department of Fetal Medicine Clínica de Diagnóstico por Imagem (CDPI) Rio de JaneiroBrazil Edward Araujo Júnior Department of Obstetrics School of Medicine Federal University of São Paulo (EPM-UNIFESP) 156 apto. 111 Torre Vitoria05089-030Paulista, São Paulo, São PauloCEPBrazil Indian, Brazil PhDAraujo Júnior araujojred@terra.com.br. Rua Belchior Tuberous Sclerosis Complex: Prenatal Diagnosis Using Ultrasound and Magnetic Resonance Imaging-A Report of Two Cases J Radiol Imaging 33202310.1055/s-0042-1758196Address for correspondence Edward Introduction Prenatal diagnosis of tuberous sclerosis complex (TSC) can show rhabdomyomas, subependymal nodules, cortical tubers, and renal angiomyolipomas, which are the major features of TSC. [1][2][3] Ultrasound, being a noninvasive and repeatable examination, can be used to detect multiple nodules or a hyperechogenic myocardium, usually from the 20th week of pregnancy. 3,4 Currently, fetal magnetic resonance imaging (MRI) can identify brain lesions and sometimes even renal lesions, thus enabling parental counselling and postnatal management with target therapy. 5 Subependymal nodules and cortical tubers are T1-hyperintense and T2-hypointense, the former being more easily identified on fetal imaging. 5,6 However, subcortical lesions are more commonly detected in postnatal MRI. 7 In this article, we present two cases of prenatal diagnosis of TSC using both ultrasound and MRI. Abstract Tuberous sclerosis complex (TSC) is a multiple system neurocutaneous syndrome with a genetic disorder caused by different mutations in TSC1 or TSC2. Usually, TSC causes tumors in the heart, brain, kidneys, eyes, and lungs. However, tumors can also develop in any other organs. The prenatal diagnosis of TCS is based on the identification of fetal cardiac tumors by ultrasound and brain subependymal nodules, usually identified by fetal magnetic resonance imaging (MRI). We present two case reports of the prenatal diagnosis of TCS using both ultrasound and MRI, which were confirmed by clinical and radiological methods in the postnatal period accordingly. showed a typical brain subependymal nodule (►Fig. 2). She underwent a cesarean section due to breech presentation at 39 weeks' gestation and delivered a male newborn weighing 3,250 g. Apgar scores at the 1st and 5th minutes were 9 and 10, respectively. Postnatal clinical and imaging diagnoses confirmed the same findings seen in prenatal examinations. Genetic tests have not been performed to date. Case 2 This case involved a G1-P0 32-year-old pregnant woman, with no family history of TSC. Ultrasound at 32 weeks of gestational age showed an echogenic mass in the fetal heart, consistent with a rhabdomyoma, and hyperechoic lesions in the fetal brain (►Fig. 3). Fetal MRI at 35 weeks of gestational age showed typical brain periventricular and subependymal nodules as well as a cardiac rhabdomyoma (►Fig. 4). She underwent a cesarean section at 38 weeks' gestation due to low placental implantation and delivered a male weighing 3,100 g. Apgar scores at the 1st and 5th minutes were 9 and 10, respectively. Postnatal clinical and prenatal imaging diagnoses confirmed the same findings. Genetic tests have not been performed to date. Discussion After the diagnosis of TSC, a multidisciplinary approach, depending on the most affected systems or organs, is required. Testing for subclinical features with clinical examination, MRI, echocardiogram, electrocardiogram, chest computed tomography (CT), and blood workup needs to be carried out accordingly. 8 Most rhabdomyomas are benign, but they can lead to the obstruction of the cardiac flow depending on the size or location. Sometime this may be the only feature present in the prenatal period, with others developing later in life. They also have a high rate of spontaneous regression up to the age of 5 years. 5 Prenatal diagnosis allows the children to be tested even before the onset of epilepsy symptoms, leading to easier surveillance or targeted treatment. 5 Early findings can make parents aware of the risk of development of autism spectrum disorders and more specifically, of the early signs of the disorder. 9 Some brain lesions that suggest neurodevelopmental diseases can be detected on a third trimester ultrasound, despite this not being a routine exam for low-risk pregnancies in most countries. 10 Signs of renal impairment during the prenatal period are rare, and the reported cases showed cystic formations (unilateral or even diffuse polycystic involvement), accompanied by other findings in the fetal brain or heart. 5 In our case reports, we observed the brain periventricular and subependymal nodules on fetal MRI. Sonigo et al 11 assessed eight fetuses with multiple cardiac tumors, five of which showed hyperintense subependymal and cortical nodules on Tl-weighted images. They concluded that MRI was a valuable tool for diagnosing TSC in fetuses with multiple cardiac tumors. Age does not compromise a good imaging assessment, but it facilitates the diagnosis of TSC by MRI. Most subependymal nodules detected in the fetus and neonate are noncalcified. If TSC is clinically suspected in the first 3 months of life, imaging should not be delayed. TSC nodules in fetus and neonates are hyperintense on T1-weighted images and hypointense on T2-weighted images. The low degree of myelination helps to identify white matter abnormalities, which become less visible as myelination progresses. Since nodules calcify in childhood, they are more easily detected on CT and MRI susceptibility weighted images. 12 Chen et al 13 demonstrated that ultrafast MRI can detect small subependymal nodules in fetuses with cardiac tumors. The accuracy of ultrasound in identifying brain periventricular/ cortical nodules was low. However, we identified a typical brain hyperechogenic cortical nodule on ultrasound in case 2. Conclusion In summary, we presented two case reports of prenatal diagnosis of TSC using both ultrasound and MRI. Ultrasound is the first-line screening method for TSC by the identification of cardiac tumors, and MRI is important for identifying typical brain subependymal nodules accordingly. Fig. 1 1Case 1. Ultrasound image showing a cardiac rhabdomyoma (arrow) in the right atrium (26 weeks). Fig. 2 2Case 1. (A) Axial T2-weighted magnetic resonance image showing a brain subependymal nodule (arrow). (B) Sagittal T2weighted image showing a typical brain subependymal nodule (arrow). Fig. 3 3Case 2. (A) Ultrasound image showing a cardiac rhabdomyoma (arrow) in the interventricular septum (35 weeks). (B) Ultrasound image showing a brain cortical nodule (arrow). This case involved a primiparous (G1-P0) 35-year-old pregnant woman with no family history of TSC. Ultrasound at 24 weeks of gestational age showed an echogenic mass in the left ventricle of the fetal heart, consistent with a rhabdomyoma (►Fig. 1). Fetal MRI at 26 weeks of gestational ageCase Report Case 1 Keywords ► prenatal diagnosis ► tuberous sclerosis complex ► ultrasound ► magnetic resonance imaging 10 Mongrain V, van Doesburg NH, Rypens F, et al. A case report of severe tuberous sclerosis complex detected in utero and linked to a novel duplication in the TSC2 gene. BMC Neurol 2020;20(01): 324 11 Sonigo P, Elmaleh A, Fermont L, Delezoíde AL, Mirlesse V, Brunelle F. Prenatal MRI diagnosis of fetal cerebral tuberous sclerosis. Pediatr Radiol 1996;26(01):1-4 12 Baron Y, Barkovich AJ. MR imaging of tuberous sclerosis in neonates and young infants. AJNR Am J Neuroradiol 1999;20(05): 907-916 13 Chen CP, Liu YP, Huang JK, et al. Contribution of ultrafast magnetic resonance imaging in prenatal diagnosis of sonographically undetected cerebral tuberous sclerosis associated with cardiac rhabdomyomas. Prenat Diagn 2005;25(06):523-524 Indian Journal of Radiology and Imaging Vol. 33 No. 1/2023 © 2022. Indian Radiological Association. All rights reserved. Prenatal Diagnosis of Tuberous Sclerosis Santana et al. Indian Journal of Radiology and Imaging Vol. 33 No. 1/2023 © 2022. Indian Radiological Association. All rights reserved. Prenatal Diagnosis of Tuberous Sclerosis Santana et al. Conflict of InterestNone declared. Prenatal diagnosis of tuberous sclerosis complex using fetal ultrasonography and magnetic resonance imaging and genetic testing. C C Wang, C Y Wang, Y J Lai, T Y Chang, H Y Su, Taiwan J Obstet Gynecol. 5701Wang CC, Wang CY, Lai YJ, Chang TY, Su HY. Prenatal diagnosis of tuberous sclerosis complex using fetal ultrasonography and mag- netic resonance imaging and genetic testing. Taiwan J Obstet Gynecol 2018;57(01):163-165 Maternal and fetal tuberous sclerosis: do we know enough as an obstetrician?. N Sharma, S Sharma, J L Thiek, S S Ahanthem, A Kalita, D Lynser, J Reprod Infertil. 1802Sharma N, Sharma S, Thiek JL, Ahanthem SS, Kalita A, Lynser D. Maternal and fetal tuberous sclerosis: do we know enough as an obstetrician? J Reprod Infertil 2017;18(02):257-260 Maternal and fetal tuberous sclerosis complex: a case report questioning clinical approach. Ö S Onay, A Ç Sağlık, P Köşger, Onay ÖS, Sağlık AÇ, Köşger P, et al. Maternal and fetal tuberous sclerosis complex: a case report questioning clinical approach. . Turk J Pediatr. 6202Turk J Pediatr 2020;62(02):332-337 . G L Cotaina, G E Lázaro, M I Jiménez, C R Savirón, P D Lerma, Diagnosis of cardiac rhabdomyoma in the first trimester of pregnanCotaina GL, Lázaro GE, Jiménez MI, Savirón CR, Lerma PD. [Diag- nosis of cardiac rhabdomyoma in the first trimester of pregnan- . Ginecol Obstet Mex. 8403Ginecol Obstet Mex 2016;84(03):180-185 Diagnosis of tuberous sclerosis complex in the fetus. P Dragoumi, F O&apos;callaghan, D I Zafeiriou, Eur J Paediatr Neurol. 2206Dragoumi P, O'Callaghan F, Zafeiriou DI. Diagnosis of tuberous sclerosis complex in the fetus. Eur J Paediatr Neurol 2018;22(06): 1027-1034 Fetal and maternal manifestations of tuberous sclerosis complex: value of fetal MRI. R Goel, N Aggarwal, M E Lemmon, T Bosemani, Neuroradiol J. 2901Goel R, Aggarwal N, Lemmon ME, Bosemani T. Fetal and maternal manifestations of tuberous sclerosis complex: value of fetal MRI. Neuroradiol J 2016;29(01):57-60 Prenatal and postnatal diagnosis of rhabdomyomas and tuberous sclerosis complex by ultrafast and standard MRI. Y Zhou, S Z Dong, Y M Zhong, A M Sun, Indian J Pediatr. 8509Zhou Y, Dong SZ, Zhong YM, Sun AM. Prenatal and postnatal diagnosis of rhabdomyomas and tuberous sclerosis complex by ultrafast and standard MRI. Indian J Pediatr 2018;85(09): 729-737 Diagnosis of tuberous sclerosis complex in a patient referred for uncontrolled hypertension and renal dysfunction: a case highlighting the importance of proper diagnostic work-up of hypertensive patients. P A Sarafidis, A Bikos, C Loutradis, J Hypertens. 3510Sarafidis PA, Bikos A, Loutradis C, et al. Diagnosis of tuberous sclerosis complex in a patient referred for uncontrolled hyper- tension and renal dysfunction: a case highlighting the importance of proper diagnostic work-up of hypertensive patients. J Hyper- tens 2017;35(10):2109-2114 Genetic syndromes, maternal diseases and antenatal factors associated with autism spectrum disorders (ASD). A Ornoy, L Weinstein-Fudim, Z Ergaz, Front Neurosci. 10316Ornoy A, Weinstein-Fudim L, Ergaz Z. Genetic syndromes, mater- nal diseases and antenatal factors associated with autism spec- trum disorders (ASD). Front Neurosci 2016;10:316 Case 2 (A) Axial T2-weighted magnetic resonance image (half Fourier single-shot turbo spin-echo [HASTE]) at 35 weeks of gestational age showing a brain periventricular low-signal-intensity nodule (arrow). (B) Coronal T2 image (HASTE) at 35 weeks of gestational age showing brain periventricular low-signal-intensity nodules (arrows). (C) Sagittal T2-weighted image (HASTE) at 35 weeks of gestational age showing a brain subependymal low-signal-intensity nodule (arrow). (D) Sagittal T1-weighted image at 35 weeks of gestational age showing a brain subependymal and cortical high-signal-intensity nodule (arrows). (E): Axial T2-weighted image showing a cardiac rhabdomyoma in the interventricular septum. Fig, 435 weeks) (arrowFig. 4 Case 2 (A) Axial T2-weighted magnetic resonance image (half Fourier single-shot turbo spin-echo [HASTE]) at 35 weeks of gestational age showing a brain periventricular low-signal-intensity nodule (arrow). (B) Coronal T2 image (HASTE) at 35 weeks of gestational age showing brain periventricular low-signal-intensity nodules (arrows). (C) Sagittal T2-weighted image (HASTE) at 35 weeks of gestational age showing a brain subependymal low-signal-intensity nodule (arrow). (D) Sagittal T1-weighted image at 35 weeks of gestational age showing a brain subependymal and cortical high-signal-intensity nodule (arrows). (E): Axial T2-weighted image showing a cardiac rhabdomyoma in the interventricular septum (35 weeks) (arrow).

Supplemental material Neutrophils protect against Staphylococcus aureus endocarditis progression independent of extracellular trap release Severien Meyers Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Marleen Lox Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Sirima Kraisin Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Laurens Liesenborghs Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Caroline P Martens Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Liesbeth Frederix Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Stijn Van Bruggen Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Marilena Crescente Department of Life Sciences Manchester Metropolitan University ManchesterUnited Kingdom Dominique Missiakas Department of Microbiology University of Chicago ChicagoILUSA Pieter Baatsen EM-Platform of the VIB Bio Imaging Core and VIB Center for Brain and Disease Research KU Leuven LeuvenBelgium Thomas Vanassche Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Peter Verhamme Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Kimberly Martinod Center for Molecular and Vascular Biology Department of Cardiovascular Sciences KU Leuven LeuvenBelgium Supplemental material Neutrophils protect against Staphylococcus aureus endocarditis progression independent of extracellular trap release Correspondence to: Kimberly Martinod, PhD. Department of Cardiovascular Sciences, KU Leuven. 49 Herestraat, bus 911, 3000 Leuven, Belgium. +32 56 24 62 65 kim.martinod@kuleuven.be Running title: NETs, staphylocoagulase and S. aureus endocarditisStaphylococcus aureusneutrophil extracellular trapsneutrophilsinfective endocarditiscoagulases Persistent ID / URL The following parameters were determined: a = 0.05 b = 0.20 From previous experiments, the MRSA strain of S. aureus (USA300) is expected to give endocarditis in 30% of the mice. A relevant increase to 70% is estimated to be relevant (previously observed in experiment 3). Hence, 58 mice will be needed, based on the Fisher exact test (29 mice in the neutrophil depletion group and 29 in the control group). From previous experiments, the clinical strain of S. aureus is expected to give endocarditis in 50% of the mice. A relevant increase to 90% is estimated to be relevant (previously observed in experiment 3). Hence, 48 mice will be needed, based on the Fisher exact test (24 mice in the neutrophil depletion group and 24 in the control group). From previous experiments, S. epidermidis is expected to give endocarditis in 5% of the mice. A relevant increase to 45% is estimated to be relevant (previously observed in P189/2017). Hence, 42 mice will be needed, based on the Fisher exact test (21 mice in the neutrophil depletion group and 21 in the control group). Significance was reached with a lower number than calculated. Therefore not all animals were used. DOI [to be added] Experiment 2: neutrophil-selective PAD4 knockout mice infected with different bacterial strains and via different delivery models ( Figure 5, Figure S4) Sample Size: Please explain how the sample size was decided Please provide details of any a prior sample size calculation, if done. The following parameters were determined: a = 0.05 b = 0.20 For the experiments with the clinical strain, 48 mice will be needed. From previous experiments, the clinical strain is expected to give endocarditis in 50% of the mice. A relevant increase to 90% is estimated to be relevant (previously observed in P189/2017). Hencef, 48 mice will be needed, based on the Fisher exact test (24 mice in the neutrophil depletion group and 24 in the control group). For the experiments with USA300 (tail vein), 56 mice will be needed. From previous experiments, USA300 is expected to give endocarditis in 20% of the mice. A relevant increase to 60% is estimated to be relevant (previously observed in P189/2017). Hence, 56 mice will be needed, based on the Fisher exact test (28 neutrophil specific PAD4 null mice and 28 PAD4 flowed mice). For the experiment with USA300 (catheter), 40 mice are needed: From pilot studies and P040/2017 the group in which the valves are damaged or inflamed is expected to develop endocarditis in 30% of the cases. A reduction to 5% is estimated to be relevant. Hence, 40 mice are needed, based on the Fisher exact test (20 neutrophil specific PAD4 null mice and 20 control mice) The following parameters were determined: a = 0.05 b = 0.20 From pilot studies and project P040/2017 the group in which the valves are inflamed is expected to develop endocarditis in 30% of the cases. A reduction to 5% is estimated to be relevant. Hence, 20 mice per group are needed (40 mice in total). No possible difference could be observed. Therefore the experiment was ceased earlier. The following parameters were determined: a = 0.05 b = 0.20 From pilot studies and project P040/2017 the group in which the valves are inflamed is expected to develop endocarditis in 30% of the cases. A reduction to 5% is estimated to be relevant. Hence, 20 mice per group are needed (40 mice in total). More mice were needed than initially calculated to have enough endocarditis lesions for quantification analyses. Due to seasonal breeding difficulties the sample size of 18 was not reached in the MRP8Cre + xPAD4 fl/fl group. The following parameters were determined: DOI [to be added] a = 0.05 b = 0.10 The highest proportion observed in other studies is 60% and a reduction of 50% is assumed to be relevant. The smallest relevant effect is D=0.5. Hence, according to the Fisher exact test with 90% power, 21 mice will be needed per group, with 2 genotypes tested, yielding a total of 42 mice. Significance was reached with a lower number than calculated. Therefore not all animals were used. DOI [to be added] Inclusion Criteria Male mice between 8 to 14 weeks old. Exclusion Criteria Mice were excluded from the experiment when they died during the surgical procedure (mostly directly after histamine infusion) or when the aortic valve region was not properly sectioned. Randomization Groups were randomized in different cages. So different groups were housed in the same cage. Blinding Blinding was performed by a third researcher. The researcher that performed the sectioning and analyses was blinded during the whole experiment. After microscopic analyses the researcher was unblinded. Supplemental methods Fluorescence image acquisition and quantitative image analyses Brown-Hopps Gram and MSB staining To determine the proportion of mice that developed endocarditis, we performed a Figure 3B. Figure 3D. Supplemental figures and figure legends Experiment 6 :Sample 6neutrophil isolation from neutrophil-selective PAD4 knockout mice (Figure 5A-Size: Please explain how the sample size was decided Please provide details of any a prior sample size calculation, if done. objective at a constant exposure time for each channel (30ms for DNA, 200ms for AF488 and 200ms for AF555). Using Image J software for analysis, we set the color balance for each image and kept this threshold constant within each experiment. Images were saved as a Tagged image file format for full resolution quantitative analysis.After acquiring the images, we determined the percentage of total fluorescence positive area and the percentage of fluorescence positive area within and outside the thrombus using Image J software (National Institutes of Health, Bethesda, Maryland). To this end, we subtracted the background at a threshold of 100 pixels and excluded folds and the aortic ring to avoid signal due to autofluorescence and background. Using the polygon tool, we selected the thrombus and the total area (within the thrombus and the vasculature surrounding the aortic ring) containing fluorescence signal. Afterwards, the total area was measured, the fluorescence positive area was determined by setting a threshold for each channel and the percentages of fluorescence positive area were calculated. The thresholds were again kept constant within an experiment. To determine the percentage of fluorescence positive area located outside the thrombus, we subtracted the thrombus area from the total area. These quantification analyses were performed on the section with the highest fluorescence signal and largest thrombus area.In addition to quantifying fluorescence stainings, we also quantified the dense infiltration size and thrombus volume on the Brown-Hopps stained sections using the polygon and area measurement tools. The infiltrate size was calculated on the section with the largest infiltrate and the thrombus volume on each section containing a thrombus on one of the 15 consecutive slides. To calculate the thrombus volume, we added up the areas of all the sections containing a thrombus, multiplied them by the thickness of the section and by the number of consecutive slides. Figure S1 : S1Quantitative analyses of components of the coagulation and immunological defense system in IE or sterile thrombi. A-F, Quantifications of thrombus volume (A) and fibrin inside the thrombus (F) on brightfield images, and neutrophil-specific marker Ly6G located outside the thrombus (B), and von Willebrand factor (VWF, C), platelets CD41 (D) and fibrinogen (E) inside the thrombus on fluorescence images of infected vegetations (red, n=11) compared to sterile thrombi (orange, n=7). For the quantification of fibrin on the MSB stained images, 5 sterile thrombi were included. Median and interquartile range are represented, and statistical significance was evaluated by a Mann-Whitney test. Figure S2 : S2Flow cytometry confirms significant neutrophil depletion. A-F, Flow cytometric analysis of blood samples before (day -1) and after antibody injection (day 1) from isotype control IgG2a-injected (n = 21, 20) (A-C) or neutrophil-depleted (anti-Ly6G, n = 24, 20) (D-F) mice after infection with S. aureus USA300 and the endocarditis surgery. The following markers were identified: CD45+ (leukocytes), Ly6G+/Ly6B+ (neutrophils) and Ly6G-/Ly6B+ (neutrophils and monocytes). Each dot represents a single animal. Mann-Whitney tests were performed. Figure S3 : S3Neutrophil depleted mice contain less evidence of infiltrating neutrophils and released neutrophil extracellular traps (NETs). Histological characterization of infected vegetations, injected with S. aureus USA300, from isotype control IgG2a-treated (n = 4, A) and neutrophil depleted (anti-Ly6G) mice (n = 12, B). A-B, Fluorescence staining of citrullinated histone H3 (H3Cit, green) and myeloperoxidase (MPO, red), bacteria (green) and Ly6G (neutrophils, red), CD41 (platelets, red) and fibrinogen (green), and von Willebrand factor (VWF). DNA is identified by Hoechst 33342 staining, depicted in blue. Scale bars equal 200 μm. C-J, Corresponding quantifications of MPO (C), H3Cit (G) and Ly6G (D), and bacteria (H), CD41 (E), fibrinogen (I) and VWF (F) inside the thrombus of isotype control (black, n = 4)and neutrophil depleted mice (gray, n = 12). J, Thrombus volume calculations. Significance was determined by Man-Whitney test (C-J). Figure S4 :Figure S5 : S4S5PAD4-mediated NET formation does not protect against infective endocarditis in additional models of infective endocarditis. A-F, The impact of NETs impairment was evaluated at day one in mice receiving S. aureus USA300 (A-C) via its tail vein; and in a more severe model whereby S. aureus USA300 was infused via the catheter (D-F). Proportion of mice that developed inflammation-induced endocarditis (A, D) or sterile thrombi (B, E) at day one in neutrophil-specific PAD4 knockout mice compared to control mice. Bacteremia levels at endpoint with corresponding median (interquartile range) in one day tail vein (n = 24, 17, C) and one day catheter delivery model ( n = 15, 10, F). Fisher's Exact (A-B, D-E) and Mann-Whitney test (C, F). Infected vegetations in mice with impaired NET formation do not differ from control vegetations. A-D, The following neutrophil-and coagulation-specific markers were visualized in control (PAD4 fl/fl , n = 11) and neutrophil-selective PAD4 knockout mice (MRP8Cre + x PAD4 fl/fl , n = 8) infected with the clinical S. aureus strain at day three: myeloperoxidase (MPO, red) and citrullinated histone H3 (H3Cit, green) (A); S. aureus (green) and neutrophil-specific marker Ly6G (red) (B); platelet CD41 (green) and fibrinogen (red) (C); and von Willebrand factor (VWF, green) (D). DNA was identified by Hoechst 33342 staining, depicted in blue. Scale bars represent 200 μm. E-K, Quantifications of MPO (E), H3Cit (I), S. aureus (F), Ly6G (J) and VWF (H), platelet CD41 (G) and fibrinogen inside the thrombus (K) in control (black, n = 11) and neutrophil-selective PAD4 knockout (gray, n = 8) mice with endocarditis induced by the clinical strain at day three. L, Quantification of the thrombus volume (n = 11, 8). M-N, Quantification of H3Cit in mice with S. aureus USA300-induced endocarditis in the one-day tail vein delivery (n = 5, 2, M) and in the one day catheter delivery model (n = 5, 4, N). O-P, Quantification of the leukocyte infiltration (O) and the TUNEL+ (P) area in the surrounding aortic wall in control (n = 11) and knockout mice (n = 8) with vegetations injected with the clinical S. aureus strain in the tail vein at day three. Q-T, Gram (Q-R) and TUNEL (S-T) staining of a control (PAD4 fl/fl , n=11) and neutrophil-selective PAD4 knockout mouse (MRP8Cre + x PAD4 fl/fl , n = 8) with endocarditis induced by the clinical S. aureus strain. Median and interquartile range are represented, and statistical significance evaluated by Mann-Whitney test (E-P). Figure S6 : S6Correlation analyses between markers of apoptosis and markers of neutrophils or NETs. A-B, Quantifications of fibrin within the thrombus (A) and the size of the thrombus (B) in C57Bl/6J mice with infective endocarditis induced by WT (black, n = 10) or ΔcoaΔvwb S. aureus (dark gray, n = 9). Medians (and interquartile ranges) are represented in A and B, and statistical significance was determined with a Mann-Whitney test (A-B). C-G, Spearman correlations (r = correlation coefficient) between the TUNEL positive area and the leukocyte infiltration area (C), bacteria (D), MPO (E) and Ly6G (F) positive area located outside the thrombus, and the H3Cit positive area inside the thrombus (G). Graphs C and G contain data from endocarditis vegetations in wild-type mice (C57Bl/6J) infected with WT S.aureus (black, n = 10) and in PAD4-expressing wild-type mice (C57Bl/6J and PAD4 fl/fl ) infected with ΔcoaΔvwb S. aureus (dark gray, n = 10). Graph D-F contain data from endocarditis vegetations in wild-type mice (C57Bl/6J) infected with WT S. aureus (black, n = 10), and PAD4-expressing wild-type (C57Bl/6J and PAD4 fl/fl ) (dark gray, n = 10) and neutrophilselective PAD4 knockout (MRP8Cre + x PAD4 fl/fl ) mice infected with ΔcoaΔvwb S. aureus (light gray, n = 4). Figure S7 : S7Absence of staphylocoagulases does not alter endocarditis outcome or bacteremia in mice with impaired NET formation. Proportions of mice that developed inflammation-induced endocarditis (A) or sterile thrombi (B) at day three, bacteremia levels at endpoint (n = 17, 11, C), and survival rates (n = 18, 11, D) of PAD4 fl/fl and MRP8Cre + xPAD4 fl/fl mice infected with ΔcoaΔvwb S. aureus. Median (interquartile range) is represented in C. Fisher's exact (A-B), Mann-Whitney (C) and log-rank (Mantel-Cox) (D) tests were conducted to determine significance. Clinical S. aureus strain and S. epidermidisSample Size: Please explain how the sample size was decided Please provide details of any a prior sample size calculation, if done.Rat InVivoMAb anti-mouse Ly6G Bio X Cell BE0075-1 8 μg/g 673218M1 / InVivoMAb rat IgG2a isotype control Bio X Cell BE0089 8 μg/g 716718O1 654817M2 / InVivoMAb anti- rat Kappa Immunoglobulin Light Chain Bio X Cell BE0122 4 μg/g / / Anti-mouse CD16/CD32 Biolegend 101302 5 μg/ml / / APC/Cyanine7 anti-mouse CD45 (clone 30-F11) Biolegend 103116 1 µg/mL / / PerCP anti-mouse Ly6G (clone 1A8) Biolegend 127654 1 µg/mL B274299 / Rabbit anti- Staphylococcus aureus antibody Abcam ab20920 5 μg/ml GR3361393-1 / Anti-mouse Ly6G antibody (1A8) Biolegend 127602 2.5 μg/ml B265459 / Human/mouse myeloperoxidase antibody R&D systems AF3667 2.5 μg/ml YBZ0421031 / Rabbit anti-Histone H3 (citrulline R2 + R8 + R17) Abcam ab5103 2.5 μg/ml GR3294584-1 (paraffin) GR3362385-1 (cryo) / Recombinant anti- Histone H3 (citrulline R2 + R8 + R17) Abcam ab281584 2.5 μg/ml GR3389586-11 / Anti-mouse CD41 Biolegend 133902 2.5 μg/ml B285959 / Sheep anti- fibrinogen Bio-Rad laboratories 4440-8004 10 μg/ml 151063 / Rabbit anti-human VWF Dako (Agilent) A008202 8.2 μg/ml 20082415 / Goat anti-rat IgG (H+L) AlexaFluor™555 Invitrogen A21434 1.33 μg/ml 1907302 / Donkey anti-goat IgG (H+L) AlexaFluor™555 Invitrogen A32816 1.33 μg/ml UC282069 / Donkey anti-rabbit AlexaFluor™488 (H+L) Invitrogen A21206 1.33 μg/ml 2256732 / Donkey anti-sheep IgG (H+L) AlexaFluor™488 Invitrogen A11015 1.33 μg/ml 1716970 / 10 nm gold- conjugated goat F(ab')2 anti-rabbit IgG (H/L) antibody Abcam ab39601 1/20 (stock concentration not provided) GR3360046-1 / Other Description Source / Repository Persistent ID / URL S. aureus Newman, USA300, DcoaDvwb, Dnuc Dominique Miasakas (University of Chicago) / University hospitals Leuven / Histamine (200 mM) Sigma-Aldrich (H7125-1G) / Rat intrathecal catheter, 32ga (0.8Fr) PU 18cm, stylet, luer. Fits 27-25ga. Instech (C08PU-RIT1301) / Tryptic Soy Broth Merck Millipore (22092) / CountBright absolute counting beads Invitrogen (C36950) / Percoll® PLUS Sigma-Aldrich (GE17-5445-01) / Ionomycin (4 μM) Invitrogen (I24222) / Hoechst 33342 (2,5 μg/ml) Invitrogen (H1399) / MACSxpress Whole Blood Neutrophil Isolation kit Miltenyi Biotec (130-104-434) / Hanks' Balanced Salt Solution (without calcium and magnesium) Invitrogen (14175095) / RPMI 1640 medium (without phenol red) Gibco (11835030) / Fetal calf serum Gibco (A4736401) / Alul restriction enzyme (4 U) Thermo Fisher Scientific (ER0011) / Citrullinated histone H3 (clone 11 D3) ELISA Cayman Chemical (501620-96) / Epoprostenol(2 μg/ml) Tocris Bioscience (2989) / Apyrase from potatoes (0.02 U/ml) Sigma-Aldrich (A7646-200UN) / Donkey serum (10%) Sigma-Aldrich (D9663-10ML) / Sudan Black B (0.05% or 0.1%) Sigma-Aldrich (380B-1KT) / Antigen retrieval reagent basic solution (1X) R&D systems (CTS013) / Click-iT Plus Tunel Assay labeled with AlexaFluor™647 Invitrogen (C10619) / poly-L-lysine coated coverslips VWR (734-1005) / EM grade PFA (1%) Electron Microscopy Sciences (15710) / Normal goat serum (20%) Vector Laboratories (VEC.S-1000) / EM grade glutaraldehyde (2.5%) Sigma-Aldrich (G5882-50ML) / Osmium tetroxide (1%) Electron Microscopy Sciences (19190) / Sodium cacodylate trihydrate (0.2M) Electron Microscopy Sciences (11650) / ARRIVE GUIDELINES The ARRIVE guidelines (https://arriveguidelines.org/) are a checklist of recommendations to improve the reporting of research involving animals. Key elements of the study design should be included below to better enable readers to scrutinize the research adequately, evaluate its methodological rigor, and reproduce the methods or findings. Study Design Experiment 1: neutrophil depletion in WT mice infected with different bacterial strains (Figure 2) Groups Sex Age Number (prior to experiment) Number (after termination) Littermates (Yes/No) Other descripti on Group 1 (Control: isotopy, S. aureus USA300) male 8 to 14 weeks 26 21 N/A C57Bl/6J Group 2 (anti-Ly6G, S. aureus USA300) male 8 to 14 weeks 28 23 N/A C57Bl/6J Group 1 (Control: isotype, Clinical S. aureus) male 8 to 14 weeks 19 19 N/A C57Bl/6J Group 2 (anti-Ly6G, Clinical S. aureus) male 8 to 14 weeks 20 16 N/A C57Bl/6J Group 1 (Control: isotype, S. epidermidis) male 8 to 14 weeks 12 10 N/A C57Bl/6J Group 2 (anti-Ly6G, S. epidermidis) male 8 to 14 weeks 12 10 N/A C57Bl/6J Sample Size: Please explain how the sample size was decided Please provide details of any a prior sample size calculation, if done.Experiment 3: S. aureus deficient in nuclease (Δnuc) in WT mice (Figure 7) Groups Sex Age Number (prior to experiment) Number (after termination) Littermates (Yes/No) Other description Group 1 (Control: S. aureus USA300) male 8 to 14 weeks 14 12 N/A C57Bl/6J Group 2 (S. aureus Δnuc) male 8 to 14 weeks 14 12 N/A C57Bl/6J Experiment 4: S. aureus deficient in Coa and vWbp (ΔcoaΔvwb) in WT mice (Figure 7)Sample Size: Please explain how the sample size was decided Please provide details of any a prior sample size calculation, if done.Groups Sex Age Number (prior to experiment) Number (after termination) Littermates (Yes/No) Other description Group 1 (Control: S. aureus USA300) male 8 to 14 weeks 29 27 N/A C57Bl/6J Group 2 (S. aureus ΔcoaΔvwb) male 8 to 14 weeks 30 26 N/A C57Bl/6J Sample Size: Please explain how the sample size was decided Please provide details of any a prior sample size calculation, if done.From previous experiments, survival rates of 100% are expected for the S. aureus Δcoa/Δvwb strain and 60% for WT S. aureus at endpoint. A relevant decrease in proportion of mice that survive at endpoint of 40% in PAD4 null mice infected with S. aureus Δcoa/Δvwb is estimated to be relevant.Hence, 36 mice will be needed, based on the Fisher exact test (18 mice in the PAD4 null mice group and 18 mice in PAD4 floxed mice group).Experiment 5: S. aureus deficient in Coa and vWbp (ΔcoaΔvwb) in neutrophil-selective PAD4 knockout mice (Figure S7) Groups Sex Age Number (prior to experiment) Number (after termination) Littermates (Yes/No) Other description Group 1 (Control: PAD4 fl/fl , S. aureus ΔcoaΔvwb) male 8 to 14 weeks 21 18 Yes Group 2 (MRP8Cre + xPAD4 fl/fl , S. aureus ΔcoaΔvwb) male 8 to 14 weeks 11 11 Yes The following parameters were determined a = 0.05 b = 0.20 Brown-Hopps Gram stain. To this end, slides were stained with the following solutions: 1 %crystal violet for 2 min, Gram's iodine (1.2 g potassium iodide and 0.6 g iodine in 200 μl MQ) for 5 min, 2-etoxyethanol for 30 s, 0.5 % basic Fuchsin solution for 5 min (Sigma-Aldrich, St. Louis, USA), Gallego's solution (4 ml. 37 % formaldehyde and 2 ml glacial acetic acid in 194 ml deionized water, VWR, Radnor, USA) for 5 min and Tartrazine solution for 3 s (Sigma- the steps and finally, slides were dehydrated and mounted with DPX (Sigma-Aldrich, St. Louis, USA). To detect fibrin, a Martius Scarlet Blue (MSB) staining was conducted. Slides were first fixated overnight in Bouin's solution (Sigma-Aldrich, St. Louis, USA) and incubated with Celestin blue (1 g Celestine blue B, 10 g Ferric ammonium sulphate, 28 ml glycerin in 200 ml deionized water) for 5 min, Harris hematoxylin (100 ml Harris hematoxylin, 2 ml acetic acid in 100 ml deionized water) for 5 min, acid alcohol (1 % HCl in 70 % ethanol) for 10 s and rinsed with 95 % ethanol (Sigma-Aldrich, St. Louis, USA). In between these steps, washing steps were performed with deionized water. After the rinsing step in 95 % ethanol, slides were incubated with Martius yellow (1 g Martius yellow, 4 g phosphotungstic acid in 200 ml 95 % ethanol) for 2 min, Brilliant Scarlet Blue (2 g Crystal Ponceau 6R, 4 ml acetic acid in 200 ml deionized water) for 10 min, 1 % phosphotungstic acid for 5 min, Methyl blue (1 g Methyl blue, 2 ml acetic acid in 200 ml deionized water) for 2 min, rinsed with 1 % acetic acid, dehydrated and mounted with DPX (Sigma-Aldrich, St. Louis, USA). Table S1 : S1Significance testing of Figure 3BP-values from Kruskal-Wallis test with Dunn's multiple comparison test, conducted inS. aureus USA300 S. aureus Newman Clinical S. aureus S. epidermidis S. aureus Δnuc Vehicle 0.402 0.276 <0.001 >0.999 <0.001 S. aureus USA300 / >0.999 0.421 0.239 0.575 S. aureus Newman >0.999 / 0.600 0.160 0.807 Clinical S. aureus 0.421 0.600 / <0.001 >0.999 S. epidermidis 0.239 0.160 <0.001 / <0.001 Table S2 : S2Significance testing ofFigure 3DP-values from Kruskal-Wallis test with Dunn's multiple comparison test, conducted inVehicle + platelets S. aureus USA300 + platelets S. aureus Newman + platelets Clinical S. aureus + platelets S. epidermidis + platelets Vehicle >0.999 0.076 >0.999 0.085 >0.999 Vehicle + platelets / 0.017 >0.999 0.019 >0.999 S. aureus USA300 + platelets 0.017 / >0.999 >0.999 0.230 S. aureus Newman + platelets >0.999 >0.999 / >0.999 >0.999 Clinical S. aureus + platelets 0.019 >0.999 >0.999 / 0.253

Reviewer acknowledgement Contributing reviewers Bong-Kiun Kaang Seoul National University SeoulRepublic of Korea Min Zhuo minzhuo10@gmail.com University of Toronto TorontoCanada Tim Bliss tim.bliss@crick.ac.uk The Francis Crick Institute LondonUK Marisela Agudelo Yoshiki Arakawa Japan Valeria Avdoshina Nagi Ayad Kasum Azim Tudor C Badea Daehyun Baek Angel Barco Spain Arnab Barik Mark Bear Oren Becher Guoqiang Bi China Haruhiko Bito Japan Vadim Bolshakov Victor Borrell Spain Denis Burdakov Timothy Bussey Marco Canossa Shuwen Cao Francesco Cardona Martine Cattarelli France Sebastiano Cavallaro Italy Sunghoe Chang Brian Chen Canada Gong Chen Xuanmao Chen Youjun Chen Zheyu Chen China Kei Cho Dh Cho Youngshik Choe Soo Young Choi Kimberly Christian Steven Clarke Daniel Cohen France Graham Collingridge Jaqueline Crawley United States of America Mian Cao China L Cao United States of America of America, of America, of America, of America, of America Republic of Korea, of America, of America, of America, of America, United Kingdom, United Kingdom, of America, Italy Republic of Korea, of America, of America, of America, United Kingdom Republic of Korea Republic of Korea Republic of Korea, of America, of America, United Kingdom, of America Reviewer acknowledgement Contributing reviewers 10.1186/s13041-016-0208-4R E V I E W E R A C K N O W L E D G E M E N T Open Access The editors of Molecular Brain would like to thank all our reviewers who have contributed to the journal in Volume 8 (2015). Wim Crusio France Eun-Kyoung Kim Republic of Korea Hyong Kyu Kim Republic of Korea Janghwan Kim Republic of Korea Jaesang Kim Republic of Korea Eunjoon Kim Republic of Korea Sang Jeong Kim Republic of Korea Byung Gon Kim Republic of Korea Jin Kim Republic of Korea Jung-Woong Kim Republic of Korea Hye-Sun Kim Republic of KoreaFernando De Castro Spain Jessica Deslauriers Canada Yuqiang Ding China Tr Doeppner Germany Bo Duan United States of America Sebastian Dworkin Australia Marina Emborg United States of America Jose Antonio Esteban Spain Cinthia Farina Italy André Fischer Germany Patrick Fisher Denmark Masayo Fujita Japan Masaki Fukata Japan Tomoyuki Furuyashiki Japan Peter Gass Germany Anamitra Ghosh United States of America Peter Giese United Kingdom Christian Johannes Gloeckner Germany Kerui Gong United States of America Johannes Graeff Swaziland Kamalesh Guliak India Camilla Gustafsen Denmark Hideo Hagihara Japan Jin-Hee Han Canada Kihoon Han Republic of Korea Young-Goo Han United States of America Daniela Hartl Germany Yasunori Hayashi Japan Yasunori Hayashi United States of America Yiping He United States of America Karl Herrup China Hajime Hirase Japan Xiu-Ti Hu United States of America Andrew Huang Taiwan, Republic of China Eunmi Hur Republic of Korea Jeong-Jin Hwang Republic of Korea Sun Wook Hwang Republic of Korea Su-Kyeong Hwang Republic of Korea Kazutaka Ikeda Japan Masashi Ikeda Japan Masai Ishii Japan Anthony Isles United Kingdom Shigeyoshi Itohara Japan Takuji Iwasato Japan Deok-Jin Jang Republic of Korea Ru-Rong Ji United States of America Zhengping Jia Canada Seonmi Jo Republic of Korea Francois Jouret Belgium Yong-Keun Jung Republic of Korea Bong-Kiun Kaang Republic of Korea Wataru Kakegawa Japan Roger Kamm United States of America Fusao Kato Japan Satoshi Kida Japan Ahmad TariqKaang et al. Molecular Brain (2016) 9:25Page 4 of 5 . Kaang, Molecular Brain. 9Kaang et al. Molecular Brain (2016) 9:25 Page 5 of 5

Professor of Ophthalmology and Otology October, 1893 Alvin A Hubbell M D Professor of Ophthalmology and Otology October, 1893 reports a -case of hypopyon keratitis with enucleation of the ball and sub sequent microscopical examination. He attempts to account for the origin and formation of pus in the anterior chamber-a prob lem that has not been satisfactorily solved. His conclusions are '"that the pus in the hypopyon comes, in the majority of cases, from the uveal tract, the iris and the vessels adjacent to Fontana's spaces, while that in the cornea is derived either from the deep 'ciliary vessels or the anterior border-loop vessels. So much is positive. As to the source of the pus-cells, which appear in the exudate on Descemet's membrane very early in most cases, we are still uncertain. The pus in the cornea may be derived from the conjunctival sac, and may originate from the cornea itself. At least it has not been proven that it does not." CROUPOUS IRITIS. Dr. Adolf Alt, of St. Louis, (Journal of Ophthalmology, Novem ber, 1893,) describes a form of iritis which he terms "croupous." It is that form which Knapp has designated as "spongy iritis," and is scarcely mentioned in the text-books. The literature of the subject began with Schmidt, who reported two cases in 1871. Since then it has been noted by Gunning, Gruening, Kipp, Knapp, Alt, and S. M. Burnett. This is an inflammatory disease of the iris, ushered in by severe pain in and about the eye, edema of the lids and conjunctiva, and circumcorneal injection. This inflam mation leads to a peculiar exudation into the anterior chamber, but which is in no way distinguishable from croupous exudation elsewhere. It forms rapidly, and is first seen as a grayish, grayish-yellow, or grayish-green semi-transparent substance (showing sometimes stripes and dots), which, when the patient is seen, usually fills the anterior chamber to its full extent. After a period varying from a day to a week, and even much more, during which time hemorrhages into the anterior chamber not infrequently take place, the exudation becomes transparent in its periphery, and is liquified and gradually absorbed. This change is visible usually at first in the upper part of the anterior chamber,, where a small strip of iris-tissue becomes uncovered, the exudation sinking by gravitation. It then presents a sharp, well-defined, sometimes perfectly round, sometimes jagged edge upward, and has at this stage an appearance much like that of a cataractous lens, dislo cated into the anterior chamber. This resemblance is the more striking, as the anterior chamber is usually very deep. Gradually the absorbing and melting process goes on, till later only a small piece is seen lying at the bottom of the anterior chamber, and finally after ten to twenty-five days it entirely disappears. The eye then quickly recovers, only one or more posterior synechia remaining to mark the disease. In uncomplicated cases not even a synechia may remain. It seems highly probablb that we have to deal with a special form of infection which is worthy of further study. In treat ment the same measures may be used as in plastic iritis. ERRORS OF REFRACTION AND THEIR CORRECTION IN EPILEPTICS. Mr. Work Dodd read a paper on this subject before the Ophthal-'mological Society of the United Kingdom, (Medical ^Veek, Octo ber 27, 1893,) which was the outcome of a study of 100 cases. The refractions were worked out under mydriatics with every care, under the following conditions : (1) The total refraction under a mydriatic was taken; (2) hypermetropia of 0.75 D was reckoned as emmetropia; (3) astigmatism of 0.25 D was not included. The following are the results of his researches : Emmetropia, 7 ; simple hypermetropia, 42 ; simple myopia, 6 ; total astigma tism, 42, of which there were simple hypermetropic astigmatism, 3 ; compound hypermetropic astigmatism, 24 ; compound myopic astigmatism, 2 ; mixed astigmatism, 6 ; marked anisometropic astigmatism, 7 ; other cases of marked anisometropia, 3. If we compare this table with a classification of percentages of refrac tion, obtained from fifty cases of apparently normal eyes, which were worked out under mydriatics in the same manner, we find emmetropia, 6 ; simple hypermetropia, 70 ; simple myopia, 2 ; total astigmatism, 16. It will be seen that the most marked dif ference is in the amounts of the simple hypermetropia and of simple astigmatism, there being twenty-eight cases per cent, less in the epileptic than in the apparently normal class. Of astigma tism of all kinds there are twenty-six cases per cent, more in the epileptic division than in the normal one, chiefly made up by the large amount of compound hypermetropic astigmatism existing in epileptics. Of the 100 consecutive cases of epilepsy, seventy-five were ordered to wear glasses ; of these there were twenty-three who either did not wear them, or failed to report themselves later and could not be found. Of the remaining fifty-two cases there were : (1) Thirteen who had no fits since using the glasses, during periods varying from four months to one year ; (2) three patients whose condition had not apparently altered; and (3) thirty-six patients whose condition had improved since wearing glasses; in the majority of these the improvement had been marked. In all the cases the ordinary treatment was continued for sometime. Several cases in which patients who had ceased to have fits since wearing the glasses, had suffered from them again through some other form of irritation, but in no case had the fits been as severe as before. Mr. Dodd thinks that we may deduce from the foregoing facts that, given a certain condition of instability of the nervous sys tem, errors of refraction may excite epilepsy, and their correction, with other treatment, may relieve and even cure it. THE TREATMENT OF ULCERS AND ABSCESSES OF THE CORNEA BY CURETTING AND IRRIGATION. DeWecker (Annates <?' Oculistique, July, 1893,) has practised curetting and antiseptic irrigation of corneal ulcers and abscesses for some time with surprising results, of which the following are the most marked : 1. The suppression, sometimes instantaneous, of pain and photophobia. 2. The clearing up of the surrounding parts, followed by a cure infinitely more rapid than is obtained by the employment of various antiseptics and particularly the actual cautery. 3. Reparation by a more transparent tissue is better obtained by this method than by any other mode of treatment. He operates by using sharp curettes of small dimensions, and of various forms, of which one differs but little from that of Critchett, except that it is one-third as wide and its edge is sharp. He endeavors as much as possible to remove from the bottom and edges of the ulcer all the adherent whitish parts in such a way that, under the jet of the irrigator (charged with a four per cent, solution of boric acid), the parts of the cornea not attacked by the curette appear feebly opaline, but uniformly transparent. He does not hesitate to affirm that the curetting (raclage), joined with irrigation, should be used by all clinicians until the progress of our therapeutics furnishes something better. FORMIC ALDEHYDE AS AN OCULAR ANTISEPTIC. Valude, of Paris, (Annates eV Oculistique, July, 1893,) has been led to study the antiseptic properties of formic aldehyde, and believes he has found in this a powerful antiseptic, and, being but little irritating, one that is particularly suited to the eye. He recom mends it in cases to be operated upon, in post-operative infection, in purulent affections of the eye, and in the sterilization of collyria, as it does not precipitate the alkaloids (atropine, eserine, cocaine,) as does bichloride of mercury. He uses it in the eye in solutions of 1 to 100 to 1 to 500, and to preserve collyria 1 to 2000. Finally, as it does not attack metals-steel, silver, or aluminum -it may be used for washing and disinfecting instruments, in solution, for example, of 1 to 500. REMOVAL OF THE STAPES IN CHRONIC NON-SUPPURATIVE DISEASE OF THE MIDDLE EAR. Dr. Clarence J. Blake, of Boston, [Archivesof Otology, 1893,) has recorded his experience in the removal of the stapes for chronic, non-suppurative catarrh of the middle ear. His conclusions are so important that they are here presented in full : " In reviewing the cases reported, . . . it is very evident, so far as conclusions can be drawn from a small number of cases, that the operation of the removal of the stapes does not answer the purpose which might be hoped from it in cases of chronic non suppurative disease of the middle ear. This conclusion is one in which the clinical and operative observations are entirely in accord with the pathology of this class of cases as set forth by numerous observers, and lastly and most clearly by Politzer. For all this class of cases, therefore, I should, as the expression of a personal opinion and as the result of experience, advise an exploratory tympanotomy with local and without general anesthesia, as a pre liminary to, or as the first part of, an operation having in view any form of interference with the middle ear, from simple mobiliza tion of the ossicular chain to the removal of the stapes. " The exploratory tympanotomy, especially where the incision is made, as it should be, close to the periphery of the membrana tympani and of sufficient extent, affords an opportunity for a better determination of the condition of the middle ear in chronic non-suppurative disease than can be obtained in any other way, and after the exploratory incision, if it seems advisable not to operate more extensively, the opening in the membrana tympani can be closed by a simple paper dressing, with the prospect of speedy healing. If, however, the exploratory operation and coin cident tests show that it is advisable to perform an operation in the middle ear, whether synectomy, tenotomy, incudectomy, incudostapedectomy, or stapedectomy, the opening suffices for the purpose. "In the great majority of the cases of stapes fixation, conse quent upon chronic non-suppurative disease of the middle ear, the operation . . . was ineffectual, so far as the removel of the stapes was concerned, the fixation of the base-plate at least being such as to result in fracture of the crura instead of the removal of the ossicle entire. In all the cases of non-suppurative disease in which the stapes was extracted entire, the hearing was definitely and practi cally improved in one only ; and of the two other cases in which definite improvement in hearing resulted from the operation, there was one in which the mobilization of the base-plate, incident to the fracture of the crura, gave an improvement for high tones, and for the voice in ordinary conversation only to the extent of about twenty per cent. " When we take into consideration the secondary changes which may have occurred in the internal ear in the course of a non-sup purative disease of the tympanum, and the injury to the delicate structures in the labyrinth, which might result from the force exerted in the extraction of the stapes, coupled with the inadequate results as set forth in the experience tabulated, it may be justly said that stapedectomy does not afford a promising out look for this class of cases." AURAL REFLEX OF UNUSUAL CHARACTER, DUE TO IMPACTED WAX. Theobold (New Yor/c Medical Record, July 29, 1893,) reports the ease of a female, aged 42, who had suffered for six months with an annoying cough and with spells of inability to swallow food. These symptoms were increased on manipulation of the right ear. Examination showed a piece of wax which had been forced against the drum-membrane by attempts at removal. It was removed by syringing, and the difficulty in swallowing and other symptoms disappeared. The hostess who sends a pitcher of ice water to her guest's room should use as large a lump of ice as will fit the pitcher, and not too much water ; then set the pitcher in the center of a large news paper, gathering the ends up at the top and place a strong rubber band around them, to exclude the air. Treated in this way, the water will remain real ice water all night, and a lump of ice as big as one's fist will not be entirely melted by the next morning. -Buffalo Commercial.

Available online 17 February 2023 Available online 17 February 202310.1016/j.abd.2022.12.001Received 27 October 2022; accepted 21 December 2022;Anais Brasileiros de Dermatologia 2023;98(3):426---427 Anais Brasileiros de Dermatologia CORRESPONDENCE * Corresponding author. (H.A. Miot). On the recurrence rate of cutaneous tumors treated exclusively by micrographic surgery ଝ Dear Editor, We read with interest the article by Dr. Otsuka et al., in which they used a peripheral sampling technique with a parallel incision of the lateral and deep surgical margins of cutaneous carcinomas (basal cell and squamous cell carcinomas). Moreover, they validated the concordance of the identification of compromised margins with subsequent analysis of the paraffin-embedded specimens. 1 We would like to congratulate the authors and make comments regarding the method, its validation, and conclusions about the recurrence rate. We encourage the study of operative techniques in micrographic surgery, as well as in the processing of surgical specimens, which may lead to effective and faster procedures, with lower cost and morbidity rates. Initially, for clarifying purposes, it should be noted that the technique used by the authors is identical to the Tübingen method, one of the most employed modalities in Europe. 2 When meta-analytically analyzed, the results of 10,424 basal cell carcinomas operated on by micrographic surgery, the different micrographic surgery techniques do not show overall differences in recurrence rates between them (1% to 3%), although there are no parallel comparative studies that could explore their peculiarities. Primary tumors have a recurrence rate that ranges from 1% to 3%, and relapses, of 2% to 5%. 3,4 Interestingly, false-negative margins can occur in discontinuous tumors (such as multicentric basal cell carcinoma -BCCs), with thin areas (e.g., tumors with perineural invasion), recurrences under flaps/grafts, and because of technical problems during preparation of the slides. On the other hand, false-positive margins can occur due to confusion with cross-sections of follicular bulbs, due to the inflammatory infiltrate, or in the initial spare sectionning ଝ Study conducted at the Department of Dermatology, Faculty of Medicine, Universidade Estadual Paulista, Botucatu, SP, Brazil. of specimens in the cryostat, necessary for preparing the slides. For this reason, validation of the coincidence of surgical margins in paraffin, as used in the work by Otsuka et al., may not be plausible, as it may overestimate the involvement of the margins, since the outermost sections were previously sampled and analyzed intraoperatively, in thicker sections than the ones in paraffin. When analyzing, separately the recurrence rates described by the authors for primary basal cell carcinomas (0.3%) and the recurrent ones (4.3%), we found that there was supplementation of the surgical treatment with radiotherapy in 97% of the cases, which is unusual, especially for basal cell carcinomas (80% of the sample), given the use of a surgical technique that verifies 100% of the surgical margins aiming at complete cure and recurrence prevention. Although the literature has publications that suggest exclusive radiotherapy as a treatment option for BCCs, with good results and local control of up to 96% of cases, studies on the effectiveness of adjuvant radiotherapy in preventing recurrences in micrographic surgeries are still necessary. 5 In the meantime, the recurrence rate found by the authors cannot be attributed only to the surgical technique, but to the combination between micrographic surgery and complementary radiotherapy. Finally, the completion of micrographic surgeries with only one stage in 72% of cases prompts the discussion of indication criteria, aiming to maximize the cost-benefit to the detriment of conventional oncological surgery, since the latter is more accessible, both technically and financially for the health system. Financial support None declared. Authors' contributions Luiz Eduardo Fabrício de Melo Garbers: Design of the study; writing of the manuscript; review and approval of the final version of the manuscript. Ana Carolina Miola: Design of the study; writing of the manuscript; review and approval of the final version of the manuscript. https://doi.org/10.1016/j.abd.2022.12.001 0365-0596/© 2023 Sociedade Brasileira de Dermatologia. Published by Elsevier España, S.L.U. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). Luis Fernando Figueiredo Kopke: Design of the study; writing of the manuscript; review and approval of the final version of the manuscript. Hélio Amante Miot: Design of the study; writing of the manuscript; review and approval of the final version of the manuscript. Conflicts of interest Intraoperative assessment of surgical margins using ''en face'' frozen sections in the management of cutaneous carcinomas. A Otsuka, E Bertolli, M P De Macedo, Cal Pinto, Duprat Neto, J P , An Bras Dermatol. 97Otsuka A, Bertolli E, de Macedo MP, Pinto CAL, Duprat Neto JP. Intraoperative assessment of surgical margins using ''en face'' frozen sections in the management of cutaneous carcinomas. An Bras Dermatol. 2022;97:583---91. Histologic control of excised tissue edges in the operative treatment of basal-cell carcinomas. H Breuninger, J Dermatol Surg Oncol. 10Breuninger H. Histologic control of excised tissue edges in the operative treatment of basal-cell carcinomas. J Dermatol Surg Oncol. 1984;10:724---8. On variations in micrographic surgery and the use of horizontal histological sections in the evaluation of the surgical margin. A C Miola, H A Miot, Lff Kopke, An Bras Dermatol. 95Miola AC, Miot HA, Kopke LFF. On variations in micrographic surgery and the use of horizontal histological sections in the eval- uation of the surgical margin. An Bras Dermatol. 2020;95:545---6. Recurrence rate of basal cell carcinoma among different micrographic surgery techniques: systematic review with metaanalysis. P N Lacerda, E P Lange, N M Luna, H A Miot, Vsn Nogueira, Lpf Abbade, J Eur Acad Dermatol Venereol. 36Lacerda PN, Lange EP, Luna NM, Miot HA, Nogueira VSN, Abbade LPF. Recurrence rate of basal cell carcinoma among different micrographic surgery techniques: systematic review with meta- analysis. J Eur Acad Dermatol Venereol. 2022;36:1178---90. The State of the Art of Radiotherapy for Nonmelanoma Skin Cancer: A Review of the Literature. S Benkhaled, D Van Gestel, Cgs Cauduro, S Palumbo, Del Marmol, V Desmet, A , Front Med (Lausanne). 9913269Benkhaled S, Van Gestel D, Cauduro CGS, Palumbo S, Del Marmol V, Desmet A. The State of the Art of Radiotherapy for Non- melanoma Skin Cancer: A Review of the Literature. Front Med (Lausanne). 2022;9:913269.

Systematic review and meta-analysis of preoperative interventions to support the maturation of arteriovenous fistulae in patients with advanced kidney disease 17 February 2023 Sivaramakrishnan Ramanarayanan s.ramanarayanan@nhs.net 0000-0003-4238-122X Department of Renal Medicine Lister Hospital, East and North Hertfordshire NHS Trust StevenageUK School of Life and Medical Sciences University of Hertfordshire HatfieldHertfordshire, UK Shivani Sharma School of Life and Medical Sciences University of Hertfordshire HatfieldHertfordshire, UK Oscar Swift Department of Renal Medicine Lister Hospital, East and North Hertfordshire NHS Trust StevenageUK Keith R Laws School of Life and Medical Sciences University of Hertfordshire HatfieldHertfordshire, UK Hamza Umar College of Medical and Dental Sciences University of Birmingham BirminghamUK Ken Farrington Department of Renal Medicine Lister Hospital, East and North Hertfordshire NHS Trust StevenageUK School of Life and Medical Sciences University of Hertfordshire HatfieldHertfordshire, UK Systematic review and meta-analysis of preoperative interventions to support the maturation of arteriovenous fistulae in patients with advanced kidney disease 17 February 20234311743089A1FE049667300A8547EC3D10.1093/ndt/gfad040AVF maturationchronic kidney diseasehaemodialysishand exercisepreoperative intervention Background.There is great potential to improve outcomes of arteriovenous fistulas (AVFs) by focusing more on the preoper-ative period of AVF creation.We aim to systematically review the evidence on safety and efficacy of various preoperative interventions that have been tried to improve AVF maturation and success rate. INTRODUCTION Arteriovenous fistulas (AVFs) are the preferred form of vascular access (VA).They have the lowest rate of infection, stenosis and thrombosis among all types of VA [1,2].However, despite the creation of AVFs well before dialysis initiation, a significant proportion fail and patients need to start haemodialysis (HD) through a catheter, putting them at high risk of catheter-related complications.Globally, the rate of primary AVF failure has been estimated at 30-70%, with a 1-year patency rate of 40-70% [3].Variations in the estimates of AVF failure are likely to reflect operational definitions of what constitutes 'failure': e.g.whether the AVF is unsuitable for HD and requires a 'salvage' intervention or failure is defined by other problematic outcomes such as thrombosis alone [4].Bylsma et al. [5], in their systematic review and meta-analysis of AVFs for dialysis, stated that there is ambiguity in how patency is reported across studies, notably that definitions used often do not align to clinical utility. The use of prediction tools to estimate the risk of failure based on a mix of clinical and patient demographic factors [6] as well as preoperative vessel mapping [7] has been suggested to improve AVF maturation, but the rate of primary failure and non-maturation remain at unacceptably high levels.Therefore, interventions aimed at reducing early failure will be advantageous economically, help facilitate patient decision making around VA choices and improve their overall healthrelated quality of life [8]. Most patients with advanced kidney disease are under the care of a nephrologist long before AVF creation is required.This offers a window of opportunity for interventions to improve success rates of AVF maturation.Although there are individual systematic reviews that summarize the outcomes of individual intervention types (hand exercises, pharmacological measures, infrared therapy etc.) on AVF, these have not focused on teasing whether the preoperative period specifically is an important factor in intervention success.For example, Bashar et al. [9] looked at the impact of far infrared therapy in AVF maturation, but the randomized controlled trials (RCTs) included in their review had data from patients who were already receiving HD through an AVF. The aim of this systemic review and meta-analysis is to summarize the types of preoperative interventions that have been implemented to support AVF maturation, to pool data across RCTs specifically to estimate the impact of interventions on outcomes of interest and to undertake subgroup and mediator analyses to understand if the interventions work better for specific patient groups. MATERIALS AND METHODS This review was preregistered in the International Prospective Register of Systematic Reviews (PROSPERO; CRD42020193257). Review process and search strategy The systematic review and meta-analyses were undertaken following the guidelines of the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) [10].The following electronic databases were used to perform searches of published articles without any restrictions and all articles were captured up to 15 May 2022: PubMed, Embase, CINAHL, Cochrane Library and King's Fund Library.The search strategy can be found on https://www.crd.york.ac.uk/PROSPEROFILES/193257_STRATEGY_20200619.pdf. In brief, a combination of terms for advanced kidney disease or end-stage kidney disease (ESKD), haemodialysis, AVF maturation or patency and medical or surgical interventions (including exercises) were combined through the PICO format.Broad terms were used in the search strategy to capture as many studies as possible. The results of searches were then transferred to Endnote citation manager (version X9.3.3;Clarivate, Philadelphia, PA, USA).After removing duplicate publications, titles and abstracts were screened. Study selection criteria S.R. screened the titles and abstracts against the following inclusion criteria: the study involved adult patients with advanced CKD including patients with ESKD; the study explored the efficacy and/or safety of a preoperative intervention aimed at improving the rate of AVF creation or outcome of AVF surgery (using preoperative endpoints such as vein calibre, brachial artery flow etc. or postoperative endpoints such as AVF maturation, primary failure rate); the interventions are confined to the preoperative period of AVF creation; and the study was published in English. We excluded studies that looked at outcomes based on synthetic AV grafts and also studies that were purely investigative, such as aids in vessel selection for AVF creation (e.g.vein mapping) and computational fluid dynamics. The full texts of potentially relevant citations were accessed and assessed using the inclusion/exclusion criteria by two authors (S.R. and O.S.) independently.Any disagreement or discrepancies were discussed and resolved with other members of the study team (K.F. and S.S.). We included RCTs, non-RCTs, case-control studies and cohort studies, including single-arm prospective studies that used baseline values before intervention as a control.We did not include reviews, although they were screened for potentially eligible studies.The primary outcome of interest was maturation of the AVF, assessed by various direct or indirect ways including the proportion of patients achieving the criteria of AVF maturation within a specified time frame in the intervention versus control group; the incidence of primary failure of the AVF in the intervention and control groups; preoperative endpoints such as venous diameter, venous distensibility, arterial diameter or flow and an increase in vessels available for AVF creation, especially in the distal forearm.Additional outcomes of interest included adverse events, dropout rate and adherence. Data extraction The data from eligible studies were extracted by one author (S.R.).The data extracted included author details, country of origin, year published, population studied, eligibility criteria, sample size, study design, baseline demographic and clinical characteristics, intervention characteristics (such as nature, dose and duration, supervised or unsupervised, adherence rate), follow-up time, outcome parameters and adverse events. Where adequate data were not available, attempts were made to contact the principal investigator to obtain the necessary information. Quality and risk of bias assessments The quality and risk of bias assessments were performed by two independent reviewers (S.R. and H.U.).The Cochrane Risk of Bias in Non-randomized Studies of Interventions (ROBINS I) tool [11] was used for risk of bias assessment of non-randomized study designs (Supplemental Table 1) while the Cochrane Risk of Bias 2 (ROB-2) tool [12] was used to determine the quality and risk of bias for randomized study designs (Supplemental Table 2).After independent risk of bias analysis, the two independent reviewers met and discussed their results and discrepancies, if any, were resolved. Statistical analysis The outcome data were grouped according to the type of intervention.For example, studies implementing hand exercise as the intervention were grouped together in order to pool the outcome data.Where it was not possible to pool the data due to significant heterogeneity, the data were summarized narratively.Binary outcomes were expressed as odds ratios (ORs) and 95% confidence intervals (CIs).Only one type of intervention, namely hand exercise, was suitable for meta-analysis, as the relevant studies had common outcome variables, namely vessel diameter.As all hand exercise studies consistently reported cephalic vein diameter in the distal forearm at baseline and end of follow-up (6-8 weeks), this parameter was pooled and meta-analysis was performed using ReviewManager version 5.4 software (https://training.cochrane.org/online-learning/core-software/revman) [13].The effect size was expressed as the weighted mean difference in the final diameter between the intervention and the control arm.A random effects model was applied for meta-analysis of the effect size for hand exercise on vessel diameters.Heterogeneity was assessed using the I 2 statistic, and for interpretation we followed Cochrane guidance [14], where I 2 values of 0-40% identified as might not be important, 30-60% as moderate heterogeneity, 50-90% as substantial heterogeneity and 75-100% as considerable heterogeneity.The presence of any significant publication bias was assessed by examining funnel plots for asymmetry and through the Egger's test. RESULT S Study and participant characteristics The steps of study selection and exclusion are summarized in the PRISMA diagram (Fig. 1).The reason for study exclusion at each step was recorded. Eight studies, conducted between 2003 and 2021, were eligible for inclusion in the systematic review (for study characteristics, see Table 1).The number of participants ranged from 5 patients to a maximum of 138 patients, with total participants across the eight studies being 323. Of the eight included studies, four were RCTs, with three of them involving hand exercise [15][16][17] as the test intervention and one involved a drug, namely cholecalciferol, as the test intervention compared with placebo [18]. Three eligible non-randomized studies tested the efficacy of different regimens of hand exercises on vascular structural and functional parameters.These three studies were single-arm prospective studies in which the intervention was performed on a cohort of patients with advanced CKD or ESKD [19][20][21].However, in the studies by Leaf et al. [20] and Uy et al. [21], the pre-and post-intervention variables were compared between the exercise limb and the non-exercise limb (split-body trial design).This was not possible in the study conducted by Rus et al. [19], as the patients included were HD patients with an AVF in one arm.Yet another non-randomized study involved testing the efficacy of intermittent pneumatic compression of the arm with the Fist Assist device [22]. As hand exercise was the most common type of intervention studied in the preoperative period, these studies are summarized in Table 2. In summary, isometric hand grip exercise was the most common type of exercise advocated and was part of an exercise regime in all the included studies.Additional isotonic exercises were included in studies by Leaf et al. [20] and Barbosa et al. [16].Important additional co-interventions included blood flow restriction using a tensiometer applied to the exercise arm, where the tensiometer was inflated to 50 mmHg of Preoperative interventions to support the maturation of AVFs systolic blood pressure in the study by Barbosa et al. [16], and temperature control during exercise in the study by Leaf et al. [20] to standardize the effect of temperature on venous and arterial calibre. Risk of bias The risk of bias was assessed by the above-mentioned tools and the results are summarized in Table 3.Of the four RCTs, one had a high risk of bias [15], two had some concerns [16,17] and only one had a low risk of bias [18].All four non-RCTs had serious risk of bias due to the small number of participants [20,22] or the split-body trial design [19,21], as the systemic effect of exercise is likely to affect vessel parameters in both upper limbs. Primary and secondary outcomes The outcome measures used for all the exercise studies were predominantly related to a change in vessel calibre or flow at the end of the exercise period.Only the RCT by Aragoncillo Sauco et al. [15] followed patients beyond AVF creation until 12 weeks post-surgery to look at more hard outcomes such as percentage primary failure at 12 weeks as the primary outcome.The cholecalciferol study by Wasse et al. [18] was another RCT that looked at the percentage or proportion of AVF maturation at 6-months after AVF creation using a standard definition of AVF maturation.Neither hand exercise nor cholecaliferol was found to improve the rate of AVF maturation or primary failure. As summarized in Table 2, hand exercise was generally found to have a positive effect on vein calibre.with most of the studies demonstrating a significant increase as compared with no intervention.Effect size was lower in those studies that used the opposite limb of the same patients as a control, possibly because of the systemic effect of exercise affecting the non-exercise arm as well. Meta-analysis of effect in four hand exercise studies was undertaken [15,17,20,21] and the results are summarized in Fig. 2. Two studies were not included due to the lack of a comparative arm or addition of a co-intervention, namely blood flow restriction, to hand exercise.The overall effect size of hand exercise on distal cephalic vein calibre without a tourniquet is ≈0.24 mm (95% CI 0.03-0.45).The heterogeneity is minimal at ≈16%.As can be seen in the forest plot in Fig. 3, the effect size from the RCTs was significantly higher with narrow CIs as compared with non-RCTs, possibly because the non-RCTs used the non-exercise arm of the same patients as a control and hence the systemic influence of exercise on the non-exercise arm underestimated the effect size of hand exercise on the cephalic vein in the exercise arm. The study by Rus et al. [19] also looked at the effect of hand exercise on endothelium-dependent vasodilation, but no significant effect was found. The only single-arm prospective cohort study on intermittent pneumatic compression using a Fist Assist device found a significant improvement in baseline cephalic vein diameter on fixed landmarks of the forearm and upper arm with or Not tested Only one RCT [15] tested this outcome and found no difference between the control and intervention arms (50% lower primary failure in exercise arm, although not statistically significant) One RCT [15] demonstrated significantly high rate of distal AVF creation in the exercise arm versus the control arm: 75% versus 51% (P = .008).In another study [21], potential access sites increased from 12 at baseline to 33 (P < .001) and 23 (P = .047),after 4 and 8 weeks of exercise, respectively Intermittent pneumatic compression (Fist Assist device) Single-arm prospective study [22] Mean increase in forearm cephalic vein diameter by 0.41 mm (CI 0.12-0.without blood pressure cuff application and also increased the proportion of cephalic veins that is suitable for AVF creation [22]. Adverse events of the intervention A common finding seen with hand exercise regimens in all the studies is that, according to logbooks, the adherence rate decreases after 4 weeks, as well as grip strength measurements.In the study by Aragoncillo Sauco et al. [15], 5 of 68 patients dropped out of the elastic band exercise due to shoulder pain and only 60% followed the suggested exercise regimen.Otherwise, overall engagement with exercise was good in all studies, especially in the first 4 weeks.Adherence to the Fist Assist device was also reasonable, with at least 300 recorded sessions in a 3-month period and no adverse events. Publication bias and moderator analyses The funnel plot of the four studies (see Fig. 4) did not indicate any asymmetry; however, the number of studies is small.Similarly, owing to the small number of studies, moderator analysis were not possible. DISCUSSION This systematic review and meta-analysis assessed the efficacy of various forms of preoperative interventions aimed at improving AVF outcomes.The striking finding was the paucity of intervention studies applied to this cohort of patients.Hand exercise was the predominant form of intervention and was used with varying combinations of isometric or isotonic exercise with or without the addition of blood flow restriction.Although the exercise regimens were variable, they were usually applied for ≈6-8 weeks, but peak engagement occurred in the first 4 weeks, after which it appeared to decrease.Most of the exercise regimen seemed to be well tolerated, apart from slow arm contractions using the elastic band, which is associated with shoulder pain, leading to discontinuation of exercise. Although the effect size of hand exercise on cephalic vein size seems to be quite small in terms of an increase in diameter, this might translate to a better outcome, as flow in a vessel is inversely related to the fourth power of its radius.Unfortunately, only one exercise study, by Aragoncillo Sauco et al. [15], followed patients until AVF maturation to assess the effect on primary failure and AVF maturation, which is the hard and desirable outcome measure.Although the study demonstrated a decrease in primary failure in the exercise arm compared with the non-exercise arm, it did not reach statistical significance, due to the overall low rate of primary failure. Two studies employed a split-body trial design, where the non-exercise arm was used as the control.There have been studies [23] that have shown that exercise with one limb leads to systemic vasodilation and changes in vessel calibre in the opposite limb.As typically the dominant arm was the nonexercise arm in these studies (as AVFs are usually created in the dominant arm), exercise with the non-dominant arm may have more influence on the dominant arm.This can lead to underestimation of the effect size of hand exercise. The latest Kidney Disease Outcomes Quality Initiative guidelines [24] suggest not relying on vessel diameter but to test vessel function, as recent studies on AVF maturation have revealed that vessel function parameters are good predictors of AVF maturation [25].Only one study in this analysis tried to study the effect of hand exercise on endothelial-dependent vasodilation [19], but it was undertaken among patients who were already on HD and hence known to have severely impaired endothelial function. There were not enough studies to do a moderator analysis to see which subgroup of patients might benefit more from exercise. The other preoperative intervention that was tested was cholecaciferol supplementation, which was tested in a well-conducted double-blind RCT and was not found to be effective in improving the rate of AVF maturation. Finally, the Fist Assist device [22] demonstrated reasonable safety and efficacy in improving upper arm and forearm cephalic vein calibre and also in increasing the proportion of veins suitable for AVF creation.This is one example where a proven intervention after AVF creation [27] has been tested and proven to be effective in the preoperative period [22]. Several interventions, including infrared radiation [26], that have been employed after AVF creation to assist with the maturation could also be potentially tried in the preoperative period, which is the window of opportunity available to improve AVF outcomes. The limitations of our review are restriction of studies to those in English, inability to do moderator analysis due to the paucity of studies, the paucity of hard outcome data and an inability to account for error in diameter measurements by ultrasound, which is influenced by operator experience, body temperature, environmental temperature, medications etc.However, the strength of the review is identification of gaps in knowledge in the preoperative interventions and the positive effect of exercise on vein calibre that might be enhanced with other co-interventions, thereby improving AVF outcome. C ONCLUSION There is a pressing need to do large-scale RCTs with hard endpoints of preoperative interventions that can improve the structure and function of upper arm vessels prior to AVF creation in order to facilitate favourable remodelling after AVF creation.Multiple co-interventions employing innovative trial designs will help in identifying the synergistic effects of such interventions and filling the current gaps in knowledge. Figure 1 : 1 Figure 1: PRISMA flow diagram. Figure 3 : 3 Figure 3: Forest plot of the effect of hand exercise on end-of-follow-up distal cephalic vein calibre (in mm) without a tourniquet, categorised according to study design. Figure 4 : 4 Figure 4: Funnel plot of eligible studies indicating symmetry and hence absence of publication bias. Table 1 : Summary of included studies with baseline characteristics. 1Outcome measurePrimary: percentage PF by 12 weeks;secondary: mean increase in venouscalibre, mean increase in PSV, %increase in distal AVF creationPrimary outcome: increased CVdiameter (mm) of at least 0.22 mm;secondary: increased CV distensibility(mm), increased RA diameter,increased PSV (cm/s) and meanvelocity (cm/s) in the upper limbs,increased forearm circumference (cm)and increased HGSPrimary: mean change in the distalforearm CV diameter between theintervention and control group atweeks 4 and 8; secondary: HGSPrimary: mean change in venousdiameter between the control and studyarm at weeks 4 and 8; secondary:proportion of subjects that achieved atleast one CV diameter >2.5 mm,proportion of subjects who had asuccessful AVF placementChange/increase in forearmcircumference, venous diameter withand without tourniquet, arterialdiameter and flow, HGS, EDV at8 weeksChange/increase in distal CVcapacitance as measured by CSA withand without a tourniquet, increase inHGSAVF maturation, defined as the abilityto cannulate the AVF with twolarge-bore needles at ≥6 consecutivedialysis sessions and achievement of anAVF blood flow >300 ml/min assessedat 6 months after AVF creationIncrease in upper arm and forearmcephalic vein diameter with andwithout blood pressure cuff, proportionof veins achieving threshold forsuitability for AVFDiabetics(%)IA: 52.8%CA: 55.7%IA: 75%CA: 21.4%IA: 18.8%CA: 16.7%20%35.7%60%IA: 45%CA: 50%59.5%Gender (%Males)IA: 79.2%CA:72.1%IA: 66.7%CA: 71.4%IA:75%CA: 77.8%46%50%100%IA: 75%CA: 62.5%56.8%Mean ageIA: 64.7(21.1) CA:67.9 (55.3)IA:61.33 ± 7.82CA:60.14 ± 10.67IA:48.6 ± 3.4CA:43.4 ± 3.768.7 ± 4.249 ± 1157 ± 9IA:49.9 ± 10.9CA:52.1 ± 14.962.1 ± 12.61Study size167 screened,138randomized, 68 inintervention and 70in control35 screened, 26randomized, 12 inBFR and 14 in CA36 patients, 18intervention, 18control. 2 inexercise arm lost toFU15 patients (28limbs examined, asno detectable distalveins in 2non-exercise limbs)14 patients, 7 maleand 7 female5 patients52 randomized, 25to cholecalciferol,27 to placebo. Finalanalysis: 44: 20cholecalciferol and24 placebo37 patients (46enrolled)Population source4 centres inMadrid, Spain,CKD stage 4/5Nephrologyoutpatients, CKD4/5Nephrologyoutpatients, CKD4/5Nephrologyoutpatients, CKD4/5HD patientsNephrologyoutpatient, CKDwith SCr >1.5Adult ESRDpatients receivingin-centre MHDand planned forAVF creationCKD stage 4 and 5patients anticipatedto start HDMean follow-upAVF surgery after8 weeks of exerciseand follow-up until3 months after AVFcreation8 weeks fromrecruitment8 weeks8 weeks8 weeks6 weeks6 months after AVFcreation84 hours/day for3 monthsStudy designRCT, open labelRCT, double blindRCT, open labelSplit-body trialSingle-armprospective studySplit-body trialRCT, double blindSingle-armprospective studyStudy and year InterventionSauco et al., 2019 IA: isometric[15] exercise, hand gripcontractions; elasticband, arm flexionand extensionCA: no exerciseBarbosa et al., 2017 IA: exercise[16] (isometric andisotonic) BFRtrainingCA: exercisewithout BFRKumar et al., 2020 IA: isometric hand[17] grip exerciseCA: no exerciseUy et al., 2012 [21] IA:isometrichandgrip exercise in onearmCA: opposite limbof same patientRus et al., 2003 [19] Isometrichandgrip exercise innon-AVF armLeaf et al., 2003 IA: isometric hand[20] grip exercise in onearmCA: opposite limbof the same patientWasse et al., 2011 IA: high-dose[18] cholecalciferol200 000 U onceweekly for 3 weeksCA: placeboHammes et al., Intermittent2021 [22] pneumaticcompression of thearm using FistAssist device BFR: blood flow restriction; CA: control arm; CSA: cross-sectional area; CV: cephalic vein; HGS: hand grip strength; IA: intervention arm; MHD: maintenance haemodialysis; PSV: peak systolic velocity; RA: radial artery.2334S. Ramanarayanan et al Table 2 : Summary of exercise regimens and effect on various vessel structure and function parameters across selected studies. 2Artery parametersIncrease in calibre by 0.12 mm(SD 0.31; P = .008) in IADecrease in calibre by 0.02 mm(SD 0.32; P = .55) in CANo significant changes in meanvelocity at all segments acrossboth groups (P = .279, .150and .341 at 2, 10 and 20 cm)Not measuredNot assessedNo significant change inendothelium-dependentvasodilationNot assessedEffect size on vein calibre incontrol armMean decrease of 0.112 mm(SD 0.48; P = .121) at 8 weeksMean increase in CVdiameter of 0.24, 0.39 and0.17 mm for the segments 2,10 and 20 cm (P = .008, .001and .237at these segments)No significant change with orwithout tourniquetMean changes in distal sites:0.81 ± 0.20 at 4 weeks and0.65 ± 0.15 at 8 weeks; inproximal sites:0.71 ± 0.20 mm at 4 weeksand 0.43 ± 0.20 at 8 weeks.No significant difference inproximal or distal sites, asdiameter increased in botharms (inter P = .209, .217,.726 and .826)No control armCephalic vein size increasewas ≈0.4 mm in non-exercisearm (P = non-significant)Effect size on vein calibre inintervention armMean increase of 0.71 mm(SD 0.49; P < .001) at 8 weeksMean increase of 0.20, 0.16and 0.15 mm for thesegments 2, 10 and 20 cm inCV (P = .16, .20 and .33 atthese segments)Mean change 0.31 ± 0.04 at4 weeks (P < .05) withouttourniquet and 0.40 ± 0.06with tourniquet (P < .05)Mean changes in distal sites:0.48 ± 0.16 at 4 weeks and0.32 ± 0.20 at 8 weeks; inproximal sites:0.59 ± 0.25 mm at 4 weeksand 0.52 ± 0.32 at 8 weeksAverage vein diameterwithout tourniquet remainedunchanged for 4 weeks butsignificantly increased after8 weeks (P = .015). Averagevein diameter after tourniquetsignificantly greater after4 weeks (P = .007) and even.001). greater at 8 weeks (P <However, distensibilityremained unchanged2-fold increase in CVdiameter noted in mostpatients (P < .05)Grip strengthSignificant increase of 4.33 kg(SD 4.5) in IA (P < .001);non-significant increase of3.4 kg (SD 2.5) in the CA(P = .46)Significant increase indynamometry: in CA, 2.36 kgincrease (P = .003); in IA,2.25 kg increase (P = .06). Nosignificant difference inincrease in strength betweenarms, inter P = .302Increased by median of 4 kgon exercise arm; nosignificant increase in controlarmIncrease in the exercised armfrom 0 to 8 weeks:24.50 ± 2.05 kg to27.04 ± 2.20 kg (P = .025).No change in control arm:26.68 ± 2.60 kg to26.82 ± 2.40 kg P = .929Maximal hand grip strengthmeasured with dynamometerincreased significantly from24.1 ± 2.95 mm to26.2 ± 3.06 mm after 4 weeksand to 28.5 ± 3.17 mm after8 weeks (P < .001)Paradoxically, the increase invenous size wasunaccompanied by anincrease in hand grip strengthIntervention, co-interventions and controlsTwo sets of 30 ISM hand grip contractionstwice a day. At noon: slow contractionsession using elastic band with arm in flexionand extension. Comparator: no exercise.Duration 8 weeksISM + IST with tensiometer for BFR inintervention arm. Exercise only without BFRin control. Duration 8 weeksISM handgrip exercise: 20 repetitions/min,30 min/day. Comparator: no exercise.Duration 8 weeksISM forearm strengthening exercises inpreferred access arm: 10 sets of 20repetitions/min. Comparator: non-exercisearm. Duration 8 weeksISM hand grip exercise using a rubber ring:4.5 cm inner and 7.5 cm outer diameter,maximal compression force 50 N. Frequencyand intensity: trained and supervised bydialysis staff on HD days6 weeks of ISM exercise at 30-40% MVC for80-360 sec with increased frequency overtime and repetitive isotonic squeezing of asquash ball or racquet ball. Non-exercise armwas comparator. Duration and frequency: 4times per week for 6 weeks. Controlledheating employedAuthor andyearSauco et al.,2021 [15]Barbosa et al.,2018 [16]Kumar et al.,2020 [17]Uy et al., 2012[21]Rus et al., 2003[19]Leaf et al.,2003 [20] CA: control arm; CV: cephalic vein; IA: intervention arm; ISM: isometric; IST: isotonic; MVC: maximal voluntary contraction; RA: radial artery. Table 3 : Comparison of effect size of various preoperative interventions on AVF outcomes and some salient outcome measures tested by these interventions. 3Proportion of veins achieving thethreshold for AVF creationNot testedEffect on primary failure/thrombosis/re-interventions/re-anastomosis/plastiesNot testedEffect on AVF maturationAVF maturation at 6 months:45% in cholecalciferol groupand 54% in the placebo group(P = .8)Effect size on forearm cephalic veindiameterNot testedMean increase in vein diameter of0.24 mm (CI 0.03-0.45). If only RCTsare included, the mean increase is0.29 mm (CI 0.11-0.47)Source of data1 RCT [17]Meta-analysis of 4 trialsconducted by us (2 RCT and2 non-RCT) [15, 17, 20, 21]Intervention typeCholecalciferolsupplementationHand exercise Forest plot of the effect of hand exercise on end-of-follow-up distal cephalic vein calibre (in mm) without a torniquet. ExerciseControlMean differenceMean differenceStudy or subgroup Aragoncillo et al. Kumar Leaf Uy Total (95% CI) Heterogeneity: τ 2 = 0.01, χ 2 = 3.59, df = 3 (P = 0.31), I 2 = 16% Mean (mm) 3.52 2.15 SD (mm) 0.93 0.4 Total 68 16 Mean (mm) 3.21 1.87 SD (mm) 0.98 0.21 2.47 1.98 1.42 0.73 5 15 1.51 2.2 1.18 0.79 Test for overall effect: Z = 2.25 (P = 0.02) 104 Exercise Control Figure 2: Study or subgroup Mean SD Total Mean SDTotal 70 16 5 13 104 TotalWeight 32.5% 53.5% 1.6% 12.3% 100.0% WeightIV, Random, 95% CI 0.31 [-0.01, 0.63] 0.28 [0.06, 0.50] 0.96 [-0.66, 2.58] -0.22 [-0.79, 0.35] 0.24 [0.03, 0.45] Mean difference IV, Random, 95% CI-430% of forearm and 43% of upper Increase in vein calibre arm veins crossed the threshold IV, Random, 95% CI needed for AVF creation from being 0 Decrease in vein calibre -2 2 Mean difference IV, Random, 95% CI4 under the threshold(mm)(mm)(mm)(mm)2.1.1 RCTAragoncillo et al.3.520.93683.210.987032.5%0.31 [-0.01, 0.63]Kumar2.150.4161.870.211653.5%0.28 [0.06, 0.50]Subtotal (95% CI)848686.0%0.29 [0.11, 0.47]Heterogeneity: τ 2 = 0.00, χ 2 = 0.02, df = 1 (P = 0.88), I 2 = 0% Test for overall effect: Z = 3.12 (P = 0.002) 2.1.2 Non-RCTNot testedLeaf2.471.4251.511.1851.6%0.96 [-0.66, 2.58]Uy1.980.73152.20.791312.3%-0.22 [-0.79, 0.35]Subtotal (95% CI)Heterogeneity:Not tested.006)7; P =2336S. Ramanarayanan et al Preoperative interventions to support the maturation of AVFs S. Ramanarayanan et al SUPPLEMENTARY DATASupplementary data are available at ndt online.FUNDINGNone.AU THORS' C ONTRIBU TIONS S.R. was responsible for the design, analysis and interpretation of data and drafting of the manuscript.O.S. was responsible for analysis of data and study selection.S.S. was responsible for the design, analysis and interpretation of data and critical review of the manuscript.K.L. was responsible for statistical analysis, interpretation of data and critical review of the manuscript.H.U. was responsible for analysis and interpretation of data and the risk of bias analysis.K.F. was responsible for the concept, design, analysis and interpretation of data, critical review of the manuscript and final approval of the manuscript submitted.DATA AVAIL ABILIT Y STATEMENTThe data underlying this article will be shared upon reasonable request to the corresponding author.C ONFLICT OF INTEREST STATEMENTNone declared.The results presented in this article have not been published previously in whole or part. Increasing arteriovenous fistulas in hemodialysis patients: problems and solutions. M Allon, M L Robbin, 10.1111/j.1523-1755.2002.kid551.xKidney Int. 622002 Superiority of autogenous arteriovenous hemodialysis access: maintenance of function with fewer secondary interventions. G B Perera, M P Mueller, S M Kubaska, 10.1007/s10016-003-0094-yAnn Vasc Surg. 182004 Moving beyond the assumed: improving fistula success rates. J B Wish, S M Moe, 10.1681/ASN.2017060663J Am Soc Nephrol. 282017 Standardized definitions for hemodialysis vascular access. T Lee, M Mokrzycki, L Moist, 10.1111/j.1525-139X.2011.00969Semin Dial. 242011 Arteriovenous fistulae for haemodialysis: a systematic review and meta-analysis of efficacy and safety outcomes. L C Bylsma, S Gage, H Reichert, 10.1016/j.ejvs.2017.06.024Eur J Vasc Endovasc Surg. 542017 Risk equation determining unsuccessful cannulation events and failure to maturation in arteriovenous fistulas (REDUCE FTM I). C E Lok, M Allon, L Moist, 10.1681/ASN.2006030190J Am Soc Nephrol. 172006 The necessity for routine pre-operative ultrasound mapping before arteriovenous fistula creation : a meta-analysis. G S Georgiadis, D G Charalampidis, C Argyriou, 10.1016/j.ejvs.2015.01.012Eur J Vasc Endovasc Surg. 492015 Patient attitudes towards the arteriovenous fistula: a qualitative study on vascular access decision making. W Xi, L Harwood, M J Diamant, 10.1093/ndt/gfr055Nephrol Dial Transplant. 262011 Role of far infra-red therapy in dialysis arterio-venous fistula maturation and survival: systematic review and meta-analysis. K Bashar, D Healy, L D Browne, 10.1371/journal.pone.0104931PLoS One. 9e1049312014 The PRISMA 2020 statement: an updated guideline for reporting systematic reviews. M J Page, J E Mckenzie, P M Bossuyt, 10.1136/bmj.n71BMJ. 372712021 ROBINS-I: a tool for assessing risk of bias in non-randomized studies of interventions. Jac Sterne, M A Hernán, B C Reeves, 10.1136/bmj.i4919BMJ. 35549192016 RoB 2: a revised tool for assessing risk of bias in randomised trials. Jac Sterne, J Savović, M J Page, 10.1136/bmj.l4898BMJ. 36648982019 Version 5.4. London: Cochrane Collaboration. 2020Review Manager (RevMan) Cochrane Handbook for Systematic Reviews of Interventions version. J J Deeks, Jpt Higgins, D G Altman, Higgins JPT, Thomas J Chandler J et al.February 2022. 2022Cochrane Collaboration6LondonChapter 10: analysing data and undertaking meta-analyses Effect of preoperative exercise on vascular caliber and maturation of arteriovenous fistula: the PHYSICAL-FAV trial, a randomized controlled study. I A Sauco, C Hevia, S M Grossi, 10.1007/s40620-020-00907-wJ Nephrol. 342021 Does blood flow restriction training increase the diameter of forearm vessels in chronic kidney disease patients? A randomized clinical trial. J B Barbosa, T O Maia, P S Alves, 10.1177/1129729818768179J Vasc Access. 192018 Effect of isometric handgrip exercise on the size of cephalic veins in patients with stage 3 and 4 chronic kidney disease: a randomized controlled trial. A/L S Kumar, K Katheraveloo, Suryani Safri, L , Guo Hou, L , 10.1177/1129729819879314J Vasc Access. 212020 Very high-dose cholecalciferol and arteriovenous fistula maturation in ESRD: a randomized, double-blind, placebo-controlled pilot study. H Wasse, R Huang, Q Long, 10.5301/jva.5000187J Vasc Access. 152014 Effect of local physical training on the forearm arteries and veins in patients with end-stage renal disease. R Rus, R Ponikvar, Kenda R , 10.1159/000073441Blood Purif. 212003 Isometric exercise increases the size of forearm veins in patients with chronic renal failure. D A Leaf, H S-H Macrae, Grant E , 10.1097/00000441-200303000-00003Am J Med Sci. 3252003 Impact of isometric handgrip exercises on cephalic vein diameter in non-AVF candidates, a pilot study. A L Uy, R M Jindal, T W Herndon, 10.5301/jva.5000116J Vasc Access. 142013 The FACT: use of a novel intermittent pneumatic compression device to promote pre-surgery arm vein dilation in patients with chronic renal failure. M Hammes, S Desai, J F Lucas, 10.1177/11297298211057378J Vasc Access. 2021 Cross transfer effects of muscular training on blood flow in the ipsilateral and contralateral forearms. Y Yasuda, M Miyamura, 10.1007/BF00429068Eur J Appl Physiol Occup Physiol. 511983 KDOQI clinical practice guideline for vascular access: 2019 update. C E Lok, T S Huber, T Lee, 10.1053/j.ajkd.2019.12.001Am J Kidney Dis. 7542020Suppl Association between preoperative vascular function and postoperative arteriovenous fistula development. M Allon, T Greene, L M Dember, 10.1681/ASN.2015020141J Am Soc Nephrol. 272016 Effects of far infrared therapy on arteriovenous fistulas in hemodialysis patients: a meta-analysis. Q Wan, S Yang, L Li, 10.1080/0886022X.2017.1361835Ren Fail. 392017 Early application of an intermittent pneumatic compression device is safe and results in proximal arteriovenous fistula enlargement. S Desai, Mitra A Arkans, E , 10.1177/1129729818773295J Vasc Access. 202019 Preoperative interventions to support the maturation of AVFs.

SUPPLEMENTARY DATA for 5-methyl-cytosine stabilizes DNA but hinders DNA hybridization revealed by magnetic tweezers and simulations Xiao-Cong Zhao Institute for Advanced Studies College of Life Sciences State Key Laboratory of Virology, Hubei Key Laboratory of Cell Homeostasis Wuhan University 430072WuhanChina Hai-Long Dong Department of Physics School of Physics and Technology Key Laboratory of Artificial Micro & Nano-structures of Ministry of Education Wuhan University 430072WuhanChina Xiao-Lu Li Institute for Advanced Studies College of Life Sciences State Key Laboratory of Virology, Hubei Key Laboratory of Cell Homeostasis Wuhan University 430072WuhanChina Hong-Yu Yang Institute for Advanced Studies College of Life Sciences State Key Laboratory of Virology, Hubei Key Laboratory of Cell Homeostasis Wuhan University 430072WuhanChina Xue-Feng Chen Institute for Advanced Studies College of Life Sciences State Key Laboratory of Virology, Hubei Key Laboratory of Cell Homeostasis Wuhan University 430072WuhanChina Liang Dai Department of Physics City University of Hong Kong 999077Hong KongChina Wen-Qiang Wu School of Life Sciences State Key Laboratory of Crop Stress Adaptation and Improvement, Key Laboratory of Plant Stress Biology Henan University 475001KaifengChina Zhi-Jie Tan zjtan@whu.edu.cn Department of Physics School of Physics and Technology Key Laboratory of Artificial Micro & Nano-structures of Ministry of Education Wuhan University 430072WuhanChina Xing-Hua Zhang Institute for Advanced Studies College of Life Sciences State Key Laboratory of Virology, Hubei Key Laboratory of Cell Homeostasis Wuhan University 430072WuhanChina SUPPLEMENTARY DATA for 5-methyl-cytosine stabilizes DNA but hinders DNA hybridization revealed by magnetic tweezers and simulations S1 # These authors contributed equally to this work. *Corresponding authors S2 Section1. Preparation of DNA for MT experiments. As shown in Figure 1 in the main text, we prepared the DNA hairpin sample by following steps. (i) We amplified the 209-bp dsDNA (5206-5415 bp of λ-DNA) and the 211-bp dsDNA (11075-11286 bp of λ-DNA) as hairpin handles through PCR using hairpinF1-Thiol/hairpinR1_BsaI and hairpinF4_BsaI/hairpinR4 as primers, respectively. For the DNA sample used in Figures 1B-C, 2-3 and Figures S2-S8, S12A, we amplified the head-to-head two 502-bp dsDNA segments (3315-3817 bp of λ-DNA) as the hairpin stem through PCR using hairpinF2-BsaI/hairpinR2_BsaI and hairpinF3_BsaI/hairpinR3_BsaI as primers, respectively. We used Taq DNA polymerase (Thermo Scientific) to generate dsDNA. We used 5-methyl-dCTP to replace dCTP (New England Biolabs) in PCR to add methyl groups to cytosine of the dsDNA. (ii) We digested the four dsDNA segments to generate the 4-nt sticky ends using BsaI-HF (New England Biolabs). (iii) We ligated the four dsDNA segments to generate a 1424-bp combined dsDNA using T4 DNA ligase (New England Biolabs). (iv) We added biotin groups to 3' ends of the dsDNA using Terminal transferase (New England Biolabs) and biotin-11-dUTP (Roche). (v) We anchored the thiol-labelled end of dsDNA to the sulfo-SMCC (Thermo Fisher) coated glass surface. Then, we tethered a streptavidin-coated superparamagnetic microbead Dynabeads) to the other end of dsDNA through the biotin-streptavidin bond. We exerted a stretching force of ~40 pN on the dsDNA using magnetic tweezers. (vi) We peeled off the untethered ssDNA strand in the dsDNA at 100 mM NaOH and left the tethered ssDNA stretched at ~40 pN. (vii) Because the two hairpin stems contained complementary sequences, the long DNA hairpin zipped at 8 pN when we changed the buffer into 1 mM Tris-HCl pH7.5 and 150 mM NaCl. For the other DNA sample used in Figure S9, S10 and S12B, we amplified the head-to-head two 502-bp dsDNA segments (40701-41202 bp of λ-DNA) as the new hairpin stem through PCR using 2_hairpinF2-BsaI/2_hairpinR2_BsaI and 2_hairpinF3_BsaI/2_hairpinR3_BsaI as primers, respectively. We prepared this DNA sample by above steps except changed the sequence of the long hairpin. We synthesized all the oligos with the following sequences (Sangon Biotech). Figure S1. Home-built MT and flow cell. We built the MT using an inverted microscope equipped with an oil objective, on the top of which a flow cell was placed. We controlled the temperature with an objective heater. To assemble one flow cell, we stuck together two cover slides with doubles-side taps and draw the inlet and outlet with silicone rubber. Figure S13. The effects of 5mC on the unzipping and rezipping forces obtained at 150 mM NaCl using MD simulations. We stretched the 2-bp DNA hairpin through a force-cycle containing a force-increasing scan through a set of constant forces where the hairpin unzipped, followed by a force-decreasing scan through the same set of constant forces where the hairpin rezipped. At each constant force, we held the DNA for 150 ns during which we calculated the average in the extension of DNA in the last 50 ns. The force-cycle yielded an unzipping force-extension curve (filled symbols) and a rezipping force-extension curve (empty squares symbols). We determined the unzipping force to be the lowest force where an abrupt increase in extension occurred in the unzipping force-extension curve (upward arrow). Similarly, we determined the rezipping force to be the highest force where an abrupt decrease in extension occurred in the rezipping force-extension curve (downward arrow). Figure S2 . S5 Figure S3 .Figure S4 . S2S5S3S4The effects of 5mC on the unzipping-rezipping cycle of long DNA hairpin at various NaCl concentrations (A-D), MgCl2 concentrations (E-H) and temperatures (I-L) using a constant loading rate of 0.2 pN/s. (A-B), (E-F) and (I-J) Representative unzipping (filled squares) and rezipping (empty squares) forceextension curves. The determined unzipping and rezipping forces were marked as upward and downward arrows, respectively. (C), (G) and (K) The effects of 5mC on unzipping (filled squares) and rezipping (empty S4 squares) forces. The error bars were the standard deviations obtained from four molecules. We fitted the forces as linear functions of log([NaCl]/1 M), log([MgCl2]/1 M or temperature, respectively. We obtained the slopes donated them in the figures. (D), (H) and (L) The effects of 5mC on hysteresis in the unzipping-rezipping cycle. The error bars were the standard deviations obtained from four molecules. We fitted the hysteresis as linear functions of log([NaCl]/1 M), log([MgCl2]/1 M or temperature, respectively. We obtained the slopes donated them in the figures. The obtained slopes were: Non-Me DNA, unzipping force versus log([NaCl]/1 M), 4.7 pN (Figure S2C) 5mC DNA, unzipping force versus log([NaCl]/1 M), 4.7 pN (Figure S2C) Non-Me DNA, rezipping force versus log([NaCl]/1 M), 4.7 pN (Figure S2C) 5mC DNA, rezipping force versus log([NaCl]/1 M), 4.8 pN (Figure S2C) Non-Me DNA, unzipping force versus log([MgCl2]/1 M), 1.3 pN (Figure S2G) 5mC DNA, unzipping force versus log([MgCl2]/1 M), 1.2 pN (Figure S2G) Non-Me DNA, rezipping force versus log([MgCl2]/1 M), 1.3 pN (Figure S2G) 5mC DNA, rezipping force versus log([MgCl2]/1 M), 1.6 pN (Figure S2G) Non-Me DNA, unzipping force versus temperature, -0.22 pN/ o C (Figure S2K) 5mC DNA, unzipping force versus temperature, -0.21 pN/ o C (Figure S2K) Non-Me DNA, rezipping force versus temperature, -0.20 pN/ o C (Figure S2K) 5mC DNA, rezipping force versus temperature, -0.04 pN/ o C (Figure S2K) Non-Me DNA, hysteresis versus log([NaCl]/1 M), -57.8 pN· nm (Figure S2D) 5mC DNA, hysteresis versus log([NaCl]/1 M), -114.6 pN· nm (Figure S2D) Non-Me DNA, hysteresis versus log([MgCl2]/1 M), -43.3 pN· nm (Figure S2H) 5mC DNA, hysteresis versus log([MgCl2]/1 M), -305.8 pN· nm (Figure S2H) Non-Me DNA, hysteresis versus temperature, -7.8 pN· nm/ o C (Figure S2L) 5mC DNA, hysteresis versus temperature, -64.3 pN· nm/ o C (Figure S2L) The effects of 5mC on the unzipping-rezipping cycle of long DNA hairpin at various NaCl concentrations (A-D), MgCl2 concentrations (E-H) and temperatures (I-L) using a constant loading rate of 1 pN/s. (A-B), (E-F) and (I-J) Representative unzipping (filled squares) and rezipping (empty squares) forceextension curves. The determined unzipping and rezipping forces were marked as upward and downward arrows, respectively. (C), (G) and (K) The effects of 5mC on unzipping (filled squares) and rezipping (empty squares) forces. The error bars were the standard deviations obtained from four molecules. We fitted the forces as linear functions of log([NaCl]/1 M), log([MgCl2]/1 M or temperature, respectively. We obtained the slopes donated them in the figures. (D), (H) and (L) The effects of 5mC on hysteresis in the unzipping-rezipping cycle. The error bars were the standard deviations obtained from four molecules. We fitted the hysteresis as linear functions of log([NaCl]/1 M), log([MgCl2]/1 M or temperature, respectively. We obtained the slopes donated them in the figures. The obtained slopes were: Non-Me DNA, unzipping force versus log([NaCl]/1 M), 4.5 pN (Figure S3C) 5mC DNA, unzipping force versus log([NaCl]/1 M), 4.6 pN (Figure S3C) Non-Me DNA, rezipping force versus log([NaCl]/1 M), 4.8 pN (Figure S3C) 5mC DNA, rezipping force versus log([NaCl]/1 M), 4.9 pN (Figure S3C) Non-Me DNA, unzipping force versus log([MgCl2]/1 M), 1.4 pN (Figure S3G) 5mC DNA, unzipping force versus log([MgCl2]/1 M), 1.2 pN (Figure S3G) Non-Me DNA, rezipping force versus log([MgCl2]/1 M), 1.4 pN (Figure S3G) 5mC DNA, rezipping force versus log([MgCl2]/1 M), 1.7 pN (Figure S3G) S6 Non-Me DNA, unzipping force versus temperature, Comparison of the extension histograms with free energy landscape at 150 mM NaCl 22 o C under a constant force of 18.0 pN. (A) The free energy landscape as a function of the location of the unzipping fork (proportional to extension) was calculated using the 10 nearest-neighbor base-pair energies obtained in forceinduced DNA unzipping experiments by optical tweezers. (B) The extension histograms obtained from four molecules. Figure S5 .Figure S6 . S5S6The repetitive constant-force DNA unzipping experiments at 150 mM NaCl and 22 o C. The extensions of fully zipped and unzipped DNA are marked as dashed horizontal lines. The beginning and end of unzipping are enlarged for clarity. (A) Unzipping of non-Me DNA using other three independent DNA molecules. (B) Unzipping of 5mC DNA using other three independent DNA molecules. The repetitive constant-force DNA rezipping experiments at 150 mM NaCl and 22 o C. The extensions of fully zipped and unzipped DNA are marked as dashed horizontal lines. The beginning and end of DNA rezipping are enlarged for clarity. (A) Rezipping of non-Me DNA using other three independent DNA molecules.(B) Rezipping of 5mC DNA using other three independent DNA molecules. Figure S7 .Figure S8 . S7S8The effects of 5mC on the unzipping-rezipping cycle of long DNA hairpin at 150 mM NaCl, 100 mM MgCl2 and 36 o C. The unzipping (filled squares) and rezipping (empty squares) force-extension curves of 5mC DNA (magenta) and non-Me DNA (olive) in one unzipping-rezipping cycle are plotted. For each molecule at each salt and temperature condition, we repeated the force-cycles three times and used at least four molecules to obtain the averages and standard deviations of the unzipping force, rezipping force and hysteresis. The effects of 5mC on the time-courses of DNA unzipping and rezipping at constant force at 100 mM MgCl2, 150 mM NaCl and 36 o C. The beginning and end of unzipping or rezipping are enlarged for clarity. (A) Unzipping of non-Me DNA. (B) Unzipping 5mC DNA. (C) Rezipping of non-Me DNA. (D) Rezipping 5mC DNA. (E) The probability of rezipping for 5mC DNA as a function of applied force obtained by 25 repetitive measurements at each constant force for each molecule. The error bars were the standard deviations obtained from four molecules. Figure S9 . S10 Figure S10 . S9S10S10The effects of 5mC on the time-courses of DNA unzipping and rezipping at constant force using the other 502-bp DNA sequence at 150 mM NaCl and 22 o C. The beginning and end of unzipping or rezipping are enlarged for clarity. (A) Unzipping of non-Me DNA. (B) Unzipping 5mC DNA. (C) Rezipping of non-Me DNA. (D) Rezipping 5mC DNA. (E) The probability of rezipping for 5mC DNA as a function of applied force obtained by 25 repetitive measurements at each constant force. The error bars were the standard deviations obtained from four molecules. The effects of 5mC on the time-courses of DNA unzipping and rezipping at constant force using another 502-bp DNA sequence at 150 mM NaCl, 100 mM MgCl2 and 36 o C. The beginning and end of unzipping or rezipping are enlarged for clarity. (A) Unzipping of non-Me DNA. (B) Unzipping 5mC DNA. (C) Rezipping of non-Me DNA. (D) Rezipping 5mC DNA. (E) The probability of rezipping for 5mC DNA as a function of applied force obtained by 25 repetitive measurements at each constant force for each molecule. The error bars were the standard deviations obtained from four molecules. Figure S11 . S11 Figure S12 . S11S11S12The 5mC slowed down DNA hybridization at 150 mM NaCl and 100 mM MgCl2 revealed by MD simulations. (A) The average H-bond distance as a function of the MD simulation time from three independent MD trajectories. The dash lines donated the H-bond distance of the folded state. The average and standard deviation of the time to fold () obtained from three independent MD trajectories were donated. (B) The hybridization time for non-Me DNA, and 5mC DNA at different salt conditions. The error bars denoted the standard deviations obtained from different MD trajectories. The beginning of non-Me DNA rezipping at 150 mM NaCl and 22 o C using the 502-bp DNA hairpin. (A) The DNA hairpin used in Figures 1B-C, 2-3 and Figures S2-S8. (B) The DNA hairpin used in Figures S9-S10. hairpinF1 - hairpinF1Thiol: thiol/TACCGAGGCTGCAGTGTAChairpinR1_BsaI: CGATCGGTCTCGCTGGCACCACGTC hairpinF2-BsaI: CGATCGGTCTCACCAGTTCGTCGCGGCTTTTCCG hairpinR2_BsaI: CGATCGGTCTCAAAAACGCCTCCCAGCCGGACCGG hairpinF3_BsaI: CGATCGGTCTCTTTTTCGCCTCCCAGCCGGACCGG hairpinR3_BsaI: CGATCGGTCTCATCAGTTCGTCGCGGCTTTTCCG hairpinF4_BsaI: CGATCGGTCTCGCTGACGTTTAACCAGACCAGCG hairpinR4: ACACGTTATGGAACTGGCGAGCCATC 2_hairpinF2-BsaI: CGATCGGTCTCACCAGTGTTCACAACCTGTATCCA 2_hairpinR2_BsaI: CGATCGGTCTCAAAAAGCAGTACAGCAAATCCTT 2_hairpinF3_BsaI: CGATCGGTCTCTTTTTGCAGTACAGCAAATCCTT 2_hairpinR3_BsaI: CGATCGGTCTCATCAGTGTTCACAACCTGTATCCA S3

Virtual fashion experiences in virtual reality fashion show spaces 17 November 2023 SeJin Kim sejinkim@changwon.ac.kr Osvaldo Gervasi Annamaria Recupero Se Jin Kim Department of Clothing and Textiles Changwon National University ChangwonRepublic of Korea University of Perugia Italy University of Siena Italy Junwei Cao Yangzhou University China Virtual fashion experiences in virtual reality fashion show spaces 17 November 2023F819B4FEBB3D71057C6C95ACBE10435710.3389/fpsyg.2023.1276856RECEIVED 13 August 2023 ACCEPTED 07 November 2023virtual fashion experiencefashion showvirtual fashion spacecognitive presencesensible immersionemotional immersionaesthetic interaction Introduction: Virtual reality (VR) provides a new fashion space and fashion experience.This study focuses on immersive VR and fashion shows to empirically explore the VR fashion space and fashion experience.Insights specific to fashion have not been presented in as much depth in the literature; thus, the current findings are particularly valuable and insightful.Methods: This study employed three immersive VR (IVR) fashion show stimuli and in-depth interviews according to a semi-structured questionnaire.Collected data were analyzed based on the concept of VR space and VR experience derived through literature research.Results: The VR fashion space was divided into three types and VR experiences of cognitive presence, sensible immersion, emotional immersion, and aesthetic interaction were derived accordingly.First, the physical representation of a fashion show induced a cognitive and emotional sense of presence, in which users felt as though they had moved to the same time and place as those at the fashion show.Second, participants experienced cognitive confusion owing to the differences with a priori experiences in the fashion show space (i.e., reality and imagination coexist).Third, participants transcended the limitations of physical reality while in the fashion show space of pataphysics (which was realized with human imagination), and they moved beyond the stage of confusion that is experienced while facing realistic objects to connect to creative inspiration.Discussion: The difference in the properties of VR space may be associated with distinct VR fashion experiences.The findings suggest that (1) a priori elements such as sociocultural contexts and personal experiences differ in the experiential dimension of virtual space, (2) the VR fashion show space induces a psychological experience between brand and consumer, and (3) creative inspiration and exploratory play can be greatly induced in a user if the immersive fashion space is further from the original source. Introduction Humans accumulate experience when interacting with space, which is a medium through which the world is perceived (Tuan, 2011).Space is signified through dynamic interrelationships between itself and the various elements that constitute it (Lefebvre, 1991).As space is not just a static, physical background, attention needs to be paid to its active aspects. Virtual reality (VR) spaces provide humans with virtual spaces, with social functions that are similar to space in reality (Barreda-Ángeles and Hartmann, 2022).For example, VR can facilitate social interactions between people who are geographically distant, enabling collaboration.Humans accumulate novel experiences in this new space.A VR space can provide an environment that is either similar to reality or one that is completely new.The space allows users to feel an immediate sense of immersion, even more so than the sense of presence in the real world and physical reality, and this virtual human experience is real (Pelet et al., 2017).Therefore, the experiential impact that the new digital environment has on humans needs to be determined. VR affects fashion shows, which are a site for the presentation of fashion and serve as a means of communication between fashion brands and audiences.Space has not been given the same consideration as clothes vis-à-vis fashion shows.Yet, fashion shows cannot be held without space.It is an important component in developing and conveying the concept and image of a fashion collection (Mendes, 2019).Various places have been used effectively to convey the fashion show's image and concept (Strömberg, 2019).VR technology allows users to access fashion shows at any time and from any place.Advances in communication infrastructure such as the Internet of Things and 5G technology support this, and a Metaverse world that can be accessed from anywhere in the world is opening up.VR spaces based on the properties of digital media share the characteristics of imagined and physical images (Wideström, 2019).They transcend regional, cultural, and temporal boundaries and have unique spatial characteristics that cannot be experienced in a physical space.Thus, VR fashion show spaces can affect the fashion experiences of users. Fashion studies have focused on topics such as the use of virtual environment technology in the development of fashion stores and designs and the effect they have on user experience.Park et al. (2018) showed that VR fashion stores have a positive impact on users' shopping behavior vis-à-vis enjoyment and purchase intention.Sina and Wu (2023) revealed that the appropriate use of design elements in VR fashion stores leads to high results regarding consumers' emotions, perceptions, and satisfaction levels.Lighting color and color temperature in a 360-degree VR space are also related to consumers' shopping motivation.Jung et al. (2021) noted that expanding the experience of a luxury fashion show (which had been allowed to a small, limited audience previously) to the public would popularize luxury items. These findings are significant as they suggest that human perception and experience of the fashion industry can be affected by the relevant VR technology.However, a fashion show differs from a fashion store with regards to purpose, content, and experience.Fashion shows provide fashion images, communication, and entertainment.VR fashion show spaces allow various interactions between brands, designers, and users to create new meaning for fashion shows and novel fashion experiences.Therefore, investigating such content is meaningful as it will expand on previous studies to present a new perspective. This study focused on immersive VR environments and students majoring in fashion.Immersive VR (IVR) uses wearable devices such as head-mounted displays (HMDs;Shahrbanian et al., 2012).Ricci et al. (2023) noted that IVR was associated with higher hedonic and utilitarian values, and better user experience when compared to general VR.IVR provides higher levels of sense of presence, immersion, and emotion than does general VR (Kerrebroeck et al., 2017).The experiential dimension could differ based on user characteristics; users with higher levels of openness to experience (Costa and McCrae, 1997; which is a prominent characteristic of artists) experience a deeper aesthetic experience through the sense of presence in VR (Starkey et al., 2021).Therefore, fashion students are required to have emotional and sensory experiences that will enhance their IVR experiences compared to general students. This study investigated users' fashion experiences in IVR fashion show spaces, in which VR and an HMD are used.VR fashion show spaces refer to the virtual realm in which fashion shows are conducted using IVR technology.This study explored the following research questions: First, how are VR spaces and experiences defined?Second, what kind of fashion experiences do users have in VR fashion shows?A framework of analysis was prepared through a literature review for research question 1.For research question 2, in-depth interviews were conducted with undergraduate fashion students with higher levels of immersion to analyze users' virtual fashion experiences through VR fashion shows. 2 Literature review 2.1 The VR space as an experience-creating medium Perspectives and characteristics of space Space is the realm or world in which certain substances and objects can exist or events can occur and is simultaneously universal and abstract.It is a medium that defines human thoughts and forms individuals' unique experiences (Buttimer and Seamon, 2015).Space is formed in the relationship between an object and the human who perceives and recognizes it (Ashihara, 1981). Experiences are formed during a human's interactions with a given space.This sociological approach to space explains the interactions between people, space, and human behavior rather than focusing on the meaning of physical backgrounds.This approach is useful in establishing a conceptual framework to unpack human experiences in VR space. There are many discussions on space from a sociological perspective.The first is the space of physical interactivity.Space is not an abstract entity that is distinct from the objects existing within it; it can only be understood through concrete events or objects (Choi, 2016).Löw and Weidenhaus (2017) defined space as a relational arrangement of social goods and living beings existing in places.Space does not exist independently.It is formed by exchanges that take place among the sociocultural background, and the actors and products within it.Therefore, space is created by social institutions and actors and cannot exist independently from these elements.Simmel (2005) paid attention to the kinds of spatial experiences that people undergo in a city, and the cognitive functions that take place, and found that the meaning of space is created, and interactions are amplified through human engagement.Space is nothing in itself but becomes full through interactions and gains meaning vis-à-vis individuals and social groups (Schroer, 2010). The second is the space of fluidity and dynamism.Modern society is flexible and fluid because of its fast pace and advancements in information technology.Bauman (2005) distinguished this from the solidity of the modern era and described the spatial characteristics of modern society as being liquid.He considered a city an intensely liquid space that is not fixed in one space and is consistently moving owing to the loose solidarity between the individualized elements constituting the liquid.Advancements in information technology cause changes in social patterns and create new spatial logics called the Space of Flow (space-time created by the fluidity of changes among social institutions, cultures, and members; Castells, 2010).Therefore, space is not fixed and eternal, but rather expands, integrates, and fractures in its relationship with changing social institutions, cultural contexts, and members. The third is the space of symbolism.Foucault presented the concept of heterotopia; for example, everyday spaces such as public baths, prisons, and colonies embody either deviant ideals within the institutions of modern society or incompatible utopian concepts (Foucault, 1967).This interpretation disproves the idea that space has a symbolic meaning.Lefebvre (1991) considered space a social product and stated that it can control or influence human consciousness and behavior.The framework of social space was based on trialectics, which includes representations of space as perceived through human activities, cognitive space such as lifestyles, and space of representations that is experienced with a combination of symbols and images (Lefebvre, 1991).It is a view of space as a social product and its representation differs from the second perspective in terms of the formative identity of space.Soja (1989) stated that space is formed as material spatial practices that reproduce the actual form and concrete patterns of lifestyles, which are transformed into an imaginary conceived space that becomes conceptual and is expressed symbolically, changing into a lived space that is structured by the experiences of individuals or groups.These discussions suggest that space is created by humans, the agents of action, and can be symbolically realized through interactions with social institutions.Thus, space is a result of human interaction and a social construct. Accordingly, this study approaches the spatial characteristics of VR space by considering the properties of digital space in the next chapter based on the three perspectives regarding the concept of space. Approach to fashion shows and VR spaces By reviewing previous studies on digital media spaces (Choi and Park, 2019;Suh, 2020) to determine their characteristics, this study identified the following: ambiguity and extensibility of space-time boundaries; complexity and flexibility of information; virtuality of reality; interactions that enable two-way communication between information providers and users; and ease of access to information.These characteristics are classified as follows by comprehensively considering the properties of space examined earlier (Table 1). First, the space of physical representation is the space in which the real world's physical appearance is projected and reconstructed.Although VR space is artificial, it is reproduced by reflecting reality (Lombard et al., 2006;Deng et al., 2019).New media interacts with old media (Bolter and Grusin, 2000).Second, the mixed space of reality and imagination is the space in which reality and virtuality coexist, which is characterized by the flexibility and dynamism of information, and in which space and time are not clearly separated.Modern space has a complex and fluid character and breaks away from the existing fixed concept of space and time owing to the rapid exchange of information and advances in the media (Bauman, 2005).Digital media spaces are characterized by a property of variability that differs from physical space and old media (Manovich, 2001).Therefore, the VR space has a mixed character that encompasses all these properties, in which reality and virtuality coexist owing to the variability and fluidity of digital images.For example, while components of the traditional fashion show reproduce the space-time of reality in the VR space, they construct a new fashion show space by creating an ideal object or by transforming the existing appearance.Third, the space of pataphysics is based on symbolic creation.The term pataphysics was proposed by Alfred Jarry and refers to an area of study that extends beyond metaphysics, and to the virtual nature of things based on imagination (Bok, 2002).Space in pataphysics cannot exist in reality but is realistically created by human imagination.Modern society is a world of simulacra in which reality has been replaced by symbols (Baudrillard, 1994).This VR space is the space of symbolic ideals in which symbolic objects are realized without material substance.The spatial characteristics of pataphysics are significant in the image-oriented fashion industry as they can express images that designers want to convey without limitations and communicate with users. VR experience Humans accumulate new experiences by interacting with various elements surrounding digital media.For example, digital images have a color range different with nature, which means it gives humans supernormal stimulation.VR technology also provides opportunities to travel to outer space and other places.As an example of VR fashion show, the 21FW Balenciaga collection-set in universe and in the form of a 3D virtual video game-was presented and audiences could easily access it anytime, anywhere. The VR resulting from digital media is a 3D environment that is reproduced to enable physical experiences as in the real world.In the VR space, users can navigate the space as they do in real life, interact with objects, and experience one or more of their five senses being stimulated in real time (Burdea and Coiffet, 2003).While more recent studies (Freeman et al., 2019;Rathinam et al., 2019) have focused on the possibility of VR technology to help human psychological treatment and physical rehabilitation, there is a lack of research that identifies emotional and aesthetic experiences, especially in fashion Thus, this study explored the virtual fashion experience through the concept of space and virtual experience.For this, a framework was built through a literature review about the concept of space as its focus, previous studies on the relationship between brands and users, and relevant studies on VR experiences, summarizing the results (Table 2). Cognitive presence The sense of presence refers to the psychological experience of feeling as though you are in a specific space in the virtual world or perceiving created objects, people, and events as being real (Lombard et al., 2006).The sense of presence can be divided according to the degree of interaction between the user and virtual space and media.Among the subdivisions, the cognitive sense of presence refers to the experience of perceptual illusion, in which the user mistakenly feels as though it is a real physical environment or object owing to the physical stimulations provided by digital media.This is a cognitive experience in which the user feels they are physically present in a specific space and perceives various information through sensory stimulations (Biocca and Levy, 2000); the cognitive sense of presence causes a user to experience place illusion, in which they feel as though they are in a specific place by experiencing the virtual space even though they are not actually present (Slater, 2009). As a sense of presence is based on sensory information, it increases when the media provides more detailed and elaborate information as if in real life (Lombard and Ditton, 1997).It is classified as the characteristics of media systems that generate a sense of presence concerning vividness and interactivity (Steuer, 1992).If high and intense levels of sensory information are acquired in the VR space, it causes high levels of vividness (Li et al., 2002).Interactivity refers to the degree to which a user can affect the content and form of a mediated environment in real time, and it is determined by the speed at which user inputs are reflected, as well as their range, and how natural the mapping is (Steuer, 1992).For example, naturalness in a VR environment is related to high fidelity and it enhances the sense of presence (McMahan et al., 2012).Therefore, interactivity can be increased by high levels of fidelity in the VR space, in which elaborate, realistic, and sensory expressions are possible. Although not much research on the effect of interaction in the VR space exists, there have been some studies on VR related to sports (Sigrist et al., 2015;Vogt et al., 2015).According to them, the sense of presence is related to the electroencephalogram and was highest in the interactive VR condition, showing that interactive VR produces physical performance in a highly competitive spirit.However, the impact of the high fidelity of VR fashion presentation and user experience has not been proven yet. Sensible immersion Immersion refers to the state in which the user's perceptual and psychological awareness are almost completely cut off from the outside world while participating in VR, and the pleasurable experience of being transported to an elaborately simulated place, alongside the sensory, emotional experience of being surrounded by a completely different reality that takes over their attention and sense organs (Murray, 1997).It is the flow that is experienced owing to external stimuli, and it is primarily used to describe the experience of using VR devices (Cheng et al., 2017).This study examined the characteristics of immersion by distinguishing between sensory and emotional immersion.Sensory immersion refers to the range of sensory channels involved in virtual simulation (Kim and Biocca, 2018).Using purely sensory receptors such as one's sight and hearing to acquire information also increases the immersion effect when compared to using one type of sensory channel.It can further focus on the sensory properties of the garment as an object.Thus, this study aimed to determine whether users obtain tactile effects in non-contact situations of VR. Emotional immersion Emotion is a personal response to internal or external stimuli that is caused by a somewhat specific cause or event; it provides information on a specific object or situation (Payne and Cooper, 2001).Sensory organs sense external stimuli and the sensed information is transmitted to the brain, which undergoes mental processes called emotions and reactions.The implicit memories of a person, psychological experiences, feelings that are expressed as emotions through external physical stimuli, and the resulting highlevel emotional responses are sensibilities (Han and Choi, 2020).A user can experience human senses and emotions through the VR space, without directly induced stimuli and events, which is the plausibility illusion (Slater, 2009).Although sensibilities and emotions can be discussed separately, this study uses the term emotion to collectively define psychological responses that are distinct from perception.Users of the VR space experience emotional immersion through objects and emotions such as joy and sadness (Han and Choi, 2020). Emotional immersion is closely related to sensory experience.The sense of space and distance are related to creating emotional experiences in themselves (Diemer et al., 2015;Peperkorn et al., 2015).Facial expressions are effective in inducing emotions (Han, 2018), and the hyper-realistic expression of digital humans in virtual space induces interest and pleasure; through this satisfaction, the level of immersion increases owing to intrinsic rewards and the sense of selfachievement, even if there are no special goals or extrinsic rewards (Kim and Seo, 2017).Thus, visual expressions bring about emotional immersion.In fashion presentations, emotional communication such as fashion images is important.This study revealed how users gain virtual fashion experiences through the emotional immersion provided by the IVR environment. Aesthetic interaction The aesthetic experience refers to an attitude, perception, experience, or interest related to art appreciation (Wanzer et al., 2020)."Aesthetic" refers to a sensory experience that is related to the visual form, texture, harmony, order, and beauty of an artifact (Venkatesh and Meamber, 2008), and is an ideal experience characterized by an aesthetic quality that is distinct from everyday experiences (Marković, 2012).This experience arises from the dynamic interactions between the perceptions of objects and processing of perceived information and is formed with the addition of judgment and evaluation (Venkatesh et al., 2010).It is influenced by culture, reference groups, and personal taste (McCracken, 2005). Aesthetic experience is not only limited to exhibitions and works of art; it is also found in various areas of activity such as in sports, games, and exploration (Csikszentmihalyi and Robinson, 1990).It refers to the element of pleasure that is based on the understanding of the object.Norman (2002) stated that the aesthetic experience in the goods and services system includes the immediate sense of the object and the joy and pleasure that are experienced in the process of comparing the characteristics to the information saved in one's memory. An aesthetic interaction refers to the dynamic exchange of information, such as product characteristics and sensory and cognitive experiences that include user behavior between the person and artifact contexts (Locher et al., 2010).Instead of being seen as a unilateral experience, an aesthetic interaction should be considered an active and agentic concept in which information is shared between humans and objects.Kang (2023) analyzed the aesthetic experience of the VR exhibition and showed that the IVR exhibition was highly evaluated in the emotional and intellectual factors than the VR exhibition.Ma et al. (2023) showed that education using VR technology can foster children's aesthetic creativity.These provide important grounds suggesting that IVR can affect aesthetic experience and creativity.Nevertheless, the aesthetic experience of fashion presentation in an IVR environment has not been considered so far. The experience of aesthetic interactions is appropriate to define this complex experience as a separate characteristic for examining the user's experience of VR fashion show spaces.This is because each experiential element in the VR space can appear in a complex manner unlike in real spaces, and because the nature of fashion, unlike other fields, has aesthetics that reflect the internal experience of external objects.This study examined the experience of aesthetic interactions in the VR space separately concerning experiences such as the sensory and emotional pleasure regarding objects, and the psychological state of satisfaction with fashion collections and brands as consumer goods. 3 Materials and methods Participants Interviews were conducted in a controlled laboratory on campus.Denzin and Lincoln (2003) argued that content was more important than the number of cases and suggested no more than 10 cases.Consequently, this study selected 21 participants, with 7 per stimulus (Table 3).Participants were recruited through purposive and snowball sampling.Recruitment notices were distributed through social media and in-depth interviews were conducted with respondents.According to Lee and Park (2018), those who prefer communicating with new communication technologies are in their 20s and 30s.Thus, this study selected male and female participants in South Korea who were in their 20s, majoring in fashion/clothing, and had experience watching fashion shows or videos, but had no experience with VR.Those who satisfied the necessary conditions and expressed their intention to participate were selected (Table 3).This study received ethics approval from an institutional review board (no.7001066-202301-HR-003). Stimuli and devices Of the case selection methods suggested by Jason and John (2008), a typical method was used to select the most representative cases, which were 360-degree VR fashion shows that had the three types of characteristics vis-à-vis virtual space.The following method was used to select the stimuli: In January 2023, keywords combining "360, " "VR, " and "fashion show" were entered on YouTube VR to search for fashion shows of different brands that had the highest number of likes and that clearly showed each of the three characteristics of virtual space.Accordingly, three videos were selected.Fashion show spaces comprise models, runway clothes, music, lighting, stage, venue, and the audience (Kim and Ahn, 2016;Kim, 2018).Accordingly, stimuli were selected by considering whether the elements of the traditional fashion show were reproduced, transformed, and maintained; these stimuli were created according to the characteristics of a VR space when the above material elements of the fashion show were converted to digital images.Stimulus 1, Dior's 2017 Spring/Summer Haute Couture Show, was produced by recording the live fashion show so that participants could watch the show as a 360-degree video from an audience perspective.The concept of this show was a labyrinth, and the space was constructed using grass and trees inside a tent that was set up in the Musée Rodin Garden (Mower, 2017).It was a fashion show space that reproduced the appearance of physical reality.Stimulus 2, Prada's 2021 Spring/Summer Womenswear Show, was held without an audience and comprised a stage that was blocked off on all sides by digital screens and curtains.As with Stimulus 1, this space had a variable and flexible appearance as the viewer's perspective was not fixed in place and the background moved at different stages.Digital screens were set up on the walls of the space to create another fashion show scene.It was a mixed space comprising a blend of reality and virtuality.Stimulus 3, TTSWTRS's Technological Singularity Show, was produced in 2020.This fashion show displayed the transformation of objects, animals, and human figures into virtual objects and backgrounds that were made using digital images.A space of manufactured objects is one of pataphysics, which is expressed beyond the limitations of reality through interactions between the human imagination and VR technologies. Although there are several types of IVR display devices, Oculus Quest 2 was used from among the wireless HMD devices that allow a wearer to move freely.This device was selected because it had a reduced weight and more comfortable, ergonomic design when compared to previous devices that could be attached to the wearer's head.Released in 2020 by Meta, the Oculus Quest 2 comprises a VR headset and controller, and the screen can be moved while wearing the VR headset, by using the controller and neck movements. Detailed interview questions For feelings such as the sense of presence that users experience in VR, many consider that subjective statements are the standard method of measurement (Ijsselsteijn et al., 2000).Therefore, this study conducted in-depth interviews and used the participants' statements for data analysis.Semi-structured questionnaires were used to facilitate detailed conversations in an open environment without any constraints (Karanika and Hogg, 2010).The questionnaire comprised items that could determine the characteristics of the VR experience.Items were referenced from previous studies on experience (Pinker, 1997;Shedroff, 2001;Mascarenhas et al., 2006), VR experience and space (Ji et al., 2022), and the sense of presence and immersion in VR environments (Steuer, 1992;Narciso et al., 2019;Kim and Choo, 2023) (Table 4). In-depth interview and methods of data collection and analysis In a qualitative study, it is important to create a favorable atmosphere by building rapport with participants so that they can express themselves freely (Boyce and Neale, 2006).Two moderators who were students majoring in clothing and textiles helped build rapport with participants to create a relaxed atmosphere and encourage them to speak so that they would voluntarily share and interact with each other.In-depth interviews were conducted in the following manner: (1) Before watching the stimuli, participants were asked simple questions about themselves; (2) Participants who were going to experience VR were given an explanation on using the HMD, and a simple simulation was conducted to help them understand the device and learn how to operate it; and (3) After watching the stimuli (for approximately 3 to 4 min), participants were interviewed for 30 min using the prepared questionnaire.Their responses were recorded and transcribed using Naver CLOVA NOTE, an automatic recording program.The responses were moved to Microsoft Word for refinement and preparation of the data.Data were analyzed using qualitative methods.Participants' responses were recorded in writing and compared with the key concepts and characteristics that were derived through the literature review.Data analysis was conducted in line with Giorgi (2004), where: (1) the content of the descriptions was understood in full, (2) the content of participants' descriptions were organized into meaningful units, (3) the organized words were transformed into academic expressions and the themes and central meanings were determined, and (4) the central meanings were identified and categorized into groups. Results Virtual fashion experience representing space-time Cognitive sense of the place In Stimulus 1, which comprised a 360-degree video of a real-life show, participants described experiencing place illusion, in which they felt as though they were with the audience in a specific place in which the fashion show was being held. "The background was green and felt like a field.It felt like the spectators were sitting on a path in the field, and it was so realistic that I felt I was there" (Participant 7). "If I turned my head just a little, I could see people right next to me talking to and looking at each other, so it felt like I was with the audience…It felt like I was in Paris so it somehow felt like I was dreaming!"(Participant 4). These responses demonstrate that with the reproduction of the stage, background, and audience in the VR fashion show space, participants were fully aware that it was a fashion show.Rather than focusing on the details of elements such as the runway outfits and models, they were fascinated by the atmosphere in the space, and experienced the cognitive sense of presence, wherein they felt as though they were in the venue, which was actually in another region. Assimilation into the fashion show In the space of Stimulus 1, participants were reminded of brands or images they had seen on other visual media, and fashion images were formed in addition to the atmosphere of the fashion show that was provided by the VR space. "The location of the fashion show felt like a spring garden, and the floral atmosphere felt a lot like old-fashioned dresses" (Participant 6)."There were a lot of dresses, and I thought of the image of a spring picnic" (Participant 4). "The brand generally had a luxurious and elegant image" (Participant 7). Participant 7 linked the fashion image to that of the brand.The VR fashion show space is a container in which fashion images are created through the interactions of each component and the user's overall a priori experience, perception, and emotional response.As the space of a reproduced fashion show captures the appearance of a specific reality, participants had the emotional experience of forming fashion images based on previous experiences and then relating them to the brand identity.Participants said that they felt a sense of belonging to the brand as it felt as though they had attended a fashion show that was only open to a few people. "I looked around a lot because it felt like I was experiencing a fascinating fashion show in the forest.I was surprised to see that famous actors were there, too!" (Participant 3). "It felt novel and exclusive.I felt like I was watching the fashion show after getting a VIP seat invitation from the director" (Participant 1).Experiencing a fashion show in which a specific time and place was reproduced created a sense of closeness among all the elements that shared the same space and time.This is a state of brand attachment □ What had you known about the brand and design previously? □ How does it compare to watching a fashion show on social media? Sense □ Did the models and objects in the video feel three-dimensional?Why do you think so? □ How was the visual texture of the runway outfits, models, audience, etc.? □ How was the music in the fashion show space? □ How were the form and visual texture of the stage, background, and props?Please describe them in detail. Emotion □ How did you feel after watching the fashion show? □ Did any images come to mind?Why is that? □ What was the most memorable thing after watching the video and how did it make you feel?Why is that? Behavior □ How was the process of putting on the head-mounted display? that was formed in the fashion show space, wherein one created an emotional bond in the way they would with someone close to them (Thomson et al., 2005).It represented an emotional experience. □ Contextual understanding of runway outfits During the fashion show, participants could see three-dimensional runway outfits and perceive their form, color, and texture.However, instead of remembering the outfits in detail, they appeared to try to understand the outfits in the context of the fashion show space. "I saw a female model, and I was impressed because the stage and outfit that the model was wearing matched so well!" (Participant 7). "It was nice to be able to see environmentally friendly outfits that fit the atmosphere of the fashion show" (Participant 3). "It was different from the style of the brands I know, but it was good in that it showed various sides and reflected the changes by the trend" (Participant 1). These responses contrasted the purpose of watching a fashion show, as participants had articulated in the beginning of the interview.Participants who were majoring in clothing and textiles stated that they occasionally watched fashion shows to gain information on outfits.However, in the reproduced VR space, participants were more immersed in the space and atmosphere than in the clothes and demonstrated the aesthetic experience of trying to understand the outfits in the context of the space. The VR fashion show space, which is a physical representation of the original in real life, allows users to experience a representation of reality.Through this representational space, the user shows that they are forming an emotional bond by observing the fashion show in the context of brand identity and the sociocultural context that they perceive in reality and being immersed rather than focusing on fashion information. Virtual fashion experience of mixed reality and virtuality Cognitive confusion Participants experienced cognitive confusion, in which all the objects constituting this mixed space were considered artificially created virtual objects. "I was mistaken about whether seeing real three-dimensional models was virtual reality or reality.I looked into the model's eyes, and even though they were a fake person, I got goosebumps because they looked real" (Participant 10). In Stimulus 2, some objects that comprised the digital screens and stage were created virtually.However, the models, runway outfits, and stage were real.Participants could not tell the difference.These responses suggest that although an enclosed virtual space that is blocked from the outside world can increase the psychological experience of immersion for users, it can cause them to experience cognitive confusion (where reality is considered virtual) if users are not given sufficient clues that relate to the physical reality. Sensory and emotional immersion of closeness As with perception, the process of judging a situation begins with the senses (Lokesh et al., 2022).In the VR fashion show space, the movements of models and perspectives caused sensory experiences such as the three-dimensional effect and sense of distance.The elements of a fashion show, such as a model's walk, differ from other mediums of fashion presentation as dynamism is emphasized.In the case of VR fashion shows, the dynamism provides a three-dimensional effect and a sense of space. "I felt a strong sense of three-dimensionality.When the model came back, I felt like I could touch them if I reached out, and I felt like I was in the fashion show space with them" (Participant 9)."The models made eye contact with me as they walked by, and it seemed like they were really looking at me and that the model was aware of me" (Participant 10). Visual elements that are presented can have an effect on inducing emotions (Diemer et al., 2015;Peperkorn et al., 2015).An approach that reflects the sense of space and distance concerning visual perception acts to induce emotions; facial expressions also induce emotions (Han, 2018).As they felt that the models were walking by them, participants said that they experienced a sense of threedimensional space and presence.Some said that they felt scared or a sense of familiarity because of the models' eyes or expressions. "The models' eyes and expressions seemed a bit threedimensional, and they felt real as they came closer.I was overwhelmed when I saw the models' eyes and the fashion together" (Participant 10). "When they approached me, I could feel it so vividly, like they were going to reach me right away, and it felt like having a friend right in front of me!" (Participant 8). Regarding the eyes of digital humans, the addition of mutual interactivity, emotional expressions, visual processing technology, and biological characteristics can increase levels of immersion in visual immersion, self-purposefulness, concentration, and external insensitivity (Yun et al., 2020).Participants' responses demonstrate that when the model's eyes faced them and they came closer, this induced emotional experiences such as a sense of fear or familiarity.Although Stimuli 1 and 3 had dynamism, which is a component of fashion shows, when there is not enough information on the space (that is, when it is difficult to understand the space in the sociocultural context of reality), this suggests that there could be higher levels of emotional experience concerning the fashion objects. Authenticity of a fashion image The new information and emotional experiences that are acquired in the VR fashion show space have an impact on the perceived image of the fashion brand.Participants recalled the fashion image of the brand they had known and explained that experiencing a VR fashion show that mixed reality and imagination either renewed their brand image or strengthened the existing one. "I think the feeling of models walking up and making eye contact with me made me focus on the show more, and made me feel good because it felt like they were holding the show just for me" (Participant 8). "It did not have that feeling that was characteristic to the brand.It had a very bright feeling…The show rather felt friendlier and a little different" (Participant 10). Participants did not stop with these emotional experiences.They went on to connect them with their evaluation of the fashion brand.This is connected to fidelity, which is a measure of how well virtual environments represent the real world (Meyer et al., 2012), and is also strongly related to realism (Bowman and McMahan, 2007).In the VR fashion show space, in which reality and virtuality are mixed, participants said that low levels of fidelity increased virtuality and created doubts regarding brand originality. "The overall quality of the fashion show I watched on YouTube was very high…but this somehow did not feel like Prada" (Participant 14). It appears that participants felt more confused about the brand identity when they were not sufficiently provided with information that is generally well-known. "As there wasn't a logo or anything to symbolize the brand, I did not think anyone would know that they were that brand's clothing" (Participant 10)."I do not think I ever felt like it was a real stage…so I really did not think it was that brand" (Participant 11). The VR fashion show space (in which there is a mix of reality and imagination) creates a new space-time that has fluidity and dynamism, and is a mix of the real and virtual.This fashion show space makes it difficult to understand objects based on the user's past experiences, which is the sociocultural context of reality.Therefore, participants experienced immersion that was dependent on sensory elements, and as a result, the technology of graphics such as fidelity affected the authenticity of objects.This way, a fluid space can become an obstacle for users who are trying to immerse themselves in a brand (that is, trying to maintain the relationship between a brand and consumer; Gundlach et al., 1995), which is because the solidarity with the history, tradition, and identity that the brand built in reality weakens in this space.However, it is meaningful as it creates aesthetic experiences in which fashion images (that are strengthened or decreased) can be perceived or experienced through individual subjective insight and new spaces. Virtual fashion experience of pataphysics 4.3.1 Connection to creative inspiration Although participants experienced a sense of presence as though they were in the same fashion show space as others, they considered the objects they observed unrealistic because they had neither seen nor touched them and could not touch them outside of the show.As a result of this "unreality, " participants said that they became curious about how the elements of an ideal fashion show space are created, and said that they felt inspired. "As the video moved with me when I turned my head and moved my gaze, it really felt like I was in a fashion show…First, I felt it was a little unrealistic because the video's composition and flow were unrealistic, and I had never experienced it and could not touch it" (Participant 21). "I wonder how the graphics were implemented so well…It makes me wonder how long it must have taken to make this great video with the designs…I thought that it could be expressed in a more fun way if it was done this way" (Participant 16). Before watching, participants majoring in the field of fashion stated that they ordinarily acquired new ideas and information through fashion shows.These responses demonstrate that unfamiliar images can provide new visual stimulation and cognitive experiences to a greater degree than when compared to other stimuli; this shows that they could provide material for creative inspiration concerning academic and work-related activities. Aesthetic exploratory play Exploratory behavior obtains information on stimuli.Exploration is divided into specific exploration, in which a new object is manipulated and tested using one's senses, and diverse exploration, which is a long-term and continuous exploration that takes place internally after an object's characteristics have been identified (Hutt, 1971).Unlike exploratory behaviors, which are driven by external stimuli, playing is a multifaceted behavior that is driven by intrinsic motivation.It takes place after the information has been acquired and feelings of pleasure are induced in the process, and not in the results.With exploratory play, a combination of exploration and play takes place.It refers to the behavioral pattern that appears after a new object is observed based on an a priori experience related to the said object.The unfamiliar emotions that participants experienced in Stimulus 3 resulted in the behavior of collecting information by moving the field of view to various angles.Through this experience, participants explained that they became more curious about the brand's concept and level of completeness of the content.This is similar to the exploratory play that young children engage in while exploring a new world."It was the first time I had seen a model or clothes threedimensionally, so it felt like I was on a new amusement park ride" (Participant 21).Participants' physical activity in the VR fashion show space was limited to their eye movements.However, they were seen to acquire audiovisual information with virtual objects regardless of material achievements and physical behaviors.Even if participants could not use their will to control the situation directly, they used the information they acquired by guessing the connectivity between the fashion show's components to see the fashion show as a work of art and understand its concept, which was an aesthetic exploratory experience. The fashion show space of pataphysics, which was realized with human imagination, is an imaginary space that comprises a combination of images that are somewhat far from the experiential symbolism of lifestyles and social groups.This space (where the relationship between the social signifiers and the signified are disconnected) provides aesthetic experiences in which users engage in new exploratory play and dynamic interactions take place between fashion images and the users' aesthetic exploration. Conclusion Summary and discussion This study approached the VR space with three characteristics based on the perspective of social space and proposed that differences in spatial character led to differences in the fashion experiences of users. First, the fashion show space, which is a physical representation, induced a cognitive and emotional sense of presence, in which users felt as though they had moved to the same time and place as those of the fashion show.Through this fashion show space, users experienced aesthetic interactions in the cultural context, in which runway outfits were interpreted by connecting them to the atmosphere of the representational space.Jung and Ko (2023) explored the experiences of luxury fashion brands and determined that the components of the virtual fashion space are related to virtual experiences such as immersion, presence, and interaction.A priori elements such as sociocultural contexts and personal experiences differ in the experiential dimension of virtual space.Stimulus 1 was the reproduction of a real luxury brand fashion show, and it was determined that the user became immersed by connecting the fashion images that were accumulated in reality to the virtual space.This immersion played a large role in forming the emotional bond that is referred to as a sense of belonging. Second, in the mixed fashion show space (in which reality and imagination coexist), participants experienced cognitive confusion owing to the differences with a priori experiences.Participants' sensory experience was connected to the formation of the brand's image and emotional experiences.The three-dimensionality and a sense of space that occurs in enclosed spaces provided by VR technology induce a psychological experience in which the user feels as though they have a special and intimate relationship with the brand.Given that the stimuli are fashion shows of luxury brands, it is unusual that an emotional experience of intimacy is induced concerning a private relationship, which is unlike the sense of belonging in a representational space.Jung et al. (2021) argued that VR technology reflects a utopia in which traditional luxury fashion shows (that had been characterized by privilege and status in the past) can be experienced equally.This could lead to different consequences based on the properties of the space. Third, participants transcend the limitations of physical reality while in the fashion show space of pataphysics (which was realized with human imagination) and that they move beyond the stage of confusion that is experienced while facing realistic objects to connect to creative inspiration.Unlike other spaces, the fashion show space of pataphysics is far from social symbolic meanings and is a space that results from the creator's imagination.In virtual space, which is difficult to understand in the sociocultural context of reality, the user engaged in active exploratory behavior to acquire new information and underwent aesthetic experiences concerning aesthetic exploration.This confirmed the results of Kim and Choo (2023), who found that experiences of shopping in VR increased levels of perceptual curiosity and creativity in consumers.Research findings suggest that creative inspiration and exploratory play can be induced in a user to a greater degree if the immersive fashion space is further from the original source and if the relationship between the signifiers and the signified is further disconnected. Implications and limitations Studies in the field of fashion that have dealt with fashion experiences through IVR technology have primarily focused on fashion stores or consumer experiences.This study presented the characteristics of new virtual spaces created by media technology, and empirically determined the differences in fashion experiences in each virtual space.It followed a more detailed approach to the virtual experience and subdivided it.This study provides a basic framework for research on fashion content production and interactions with users in the Metaverse, which has been used increasingly in recent years.Therefore, this study makes an academic contribution by expanding the field of digital fashion design, which is still in its early stages, by narrowing the research gap. The VR fashion show spaces of pataphysics provide creative motivation and aesthetic experiences of exploratory play.Unlike previous studies that focused on the environment of fashion stores (whose primary purpose is sales), and consumption behavior and intention, this study focused on fashion show environments.Current fashion shows are significant as they are communication channels that convey brand concepts and designers' creativity.Experience is an important mechanism for improving professionalism (Dreyfus and Dreyfus, 1986), and the VR space can create a variety of experiences.Therefore, the current findings suggest that IVR fashion shows, and the spatial experience of pataphysics, could have an educational effect and help enhance the professionalism of students majoring in fashion, who are required to have abundant creative sensibilities.Future research should focus on its educational effects. IVR technology changes the way that traditional fashion shows communicate.This study demonstrated that VR fashion shows play a positive role in fashion media by interacting with users, building a sense of closeness, and creating new fashion images.This is unlike previous fashion shows, which used a few unilateral methods of delivery.Unlike in the real world, in which new designers can be placed at a disadvantage when compared to luxury fashion brands that have a long history and tradition, VR fashion show spaces can give them the opportunity to effectively expand into new markets.Although physical fashion shows only last for about 20 min, there are concerns about the negative environmental effects they have, such as the vast amount of energy that is used and their heavy carbon footprint (Webb, 2022).Holding VR fashion shows can minimize their impact on the physical environment, and contribute to the development of a sustainable fashion industry by enhancing diversity in the industry, which is centered on mainstream fashion companies.This study has some limitations.First, it did not adequately examine how technical problems in the devices used to experience VR fashion shows can affect a user's fashion experience.Pallavicini et al. (2020) found that the images, sounds, and interactions of VR experience devices induced positive or negative reactions.Marsh et al. (2001) explained that the effect of sense of presence decreased and emotions such as discomfort and fear could be induced if interactions with the user were not smooth and the images on the device or screen were difficult to discern owing to issues such as slow buffering speeds.Some experienced problems with image quality owing to the Wi-Fi connection during the experiment, whereas some complained of discomfort owing to the weight of the device.Therefore, future research should exclude the technical limitations of the experience devices.Second, there could be differences in perception and cognition by sex (Rosa et al., 2014).Future research can evaluate differences based on sex and individual perceptions.Third, the experiment was conducted with fashion students; thus, there could be individual differences in students' personalities and the results may not be generalizable to students in other fields.According to Dewey (2007), experience is formed by the interaction between the reciprocity of external conditions and subjective internal conditions.Thus, different dimensions of VR experience could be derived if other populations were targeted (e.g., consumers, other fashion professionals, or tourists). TABLE 1 1 The characteristics of VR space. Social spaceDigital media spaceVR spacePhysical interaction-InteractionSpace of physical representation-Ease of accessFluidity and dynamism-Complexity and flexibility of informationMixed space of reality and idea-Ambiguity and extensibility of space-time boundariesSymbolismVirtualitySpace of pataphysics TABLE 2 2 The dimension of VR experience in VR space. Brand experienceVR experienceVR experience in VR spacePerceptionPresenceAuthenticityCognitive presenceSenseSensible immersionEmotionImmersionEmotional immersionBehaviorEmotion SimulationInteractionAesthetic interaction TABLE 3 3 Participants. No.Age (years)SexStimuli126MS1221MS1324MS1426MS1521FS1627FS1723FS1822FS2923FS21022FS21125FS21225FS21325MS21424FS21523FS31624FS31722FS31827MS31922FS32023FS32123FS3 All were undergraduates majoring in clothing and textiles except for no.6 (postgraduate in fashion design).No one had any VR experience. TABLE 4 4 Detailed interview questions.Age, occupation, education level, residence, use of social and digital media, and experience watching fashion shows □ Reason for watching fashion shows and what is expected of them Item AcknowledgmentsI thank all participants and Donghyun Lee, Woogyun Kim, and Minseo Gwon for collecting survey data.Data availability statementThe original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.Ethics statementThe studies involving humans were approved by the Institutional Review Board in Changwon National University(no. 7001066-202301-HR-003).The studies were conducted in accordance with the local legislation and institutional requirements.The participants provided their written informed consent to participate in this study.Author contributionsConflict of interestThe author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.Publisher's noteAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers.Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. Psychological benefits of using social virtual reality platforms during the Covid-19 pandemic: the role of social and spatial presence. Y Ashihara, M Hartmann, T , 10.1016/j.chb.2021.107047Comput. Human Behav. 1271070471981. 2022Nostrand Reinhold. Barreda-ÁngelesExterior design in architecture Communication in the age of virtual reality. J Baudrillard, Z Bauman, Work, consumerism and the new poor. F Biocca, M R Levy, Ann Arbor; New York; New YorkRoutledge1994. 2005. 2000Simulacra and simulation Pataphysics: the poetics of an imaginary science. C Bok, J D Bolter, R Grusin, D A Bowman, R P Mcmahan, 10.1109/MC.2007.257Computer. 402002. 2000. 2007The MIT PressVirtual reality: how much immersion is enough? Conducting in-depth interviews: a guide for designing and conducting in-depth interviews for evaluation input. C Boyce, Neale , P , Virtual reality technology. G C Burdea, P Coiffet, HobokenWiley-Interscience2006. 200312Watertown: Pathfinder international The human experience of space and place. A Buttimer, D Seamon, The rise of network society. New York; ChichesterWiley-Blackwell2015. 2010 . Kim, 10.3389/fpsyg.2023.1276856 . Frontiers in Psychology. 12 Is immersion of any value? Whether, and to what extent, game immersion experience during serious gaming affects science learning. M T Cheng, Y W Lin, H C She, P C Kuo, B D Choi, 10.47294/KSBDA.20.6.38doi: 10.47294/ KSBDA.20.6.38Research of space conceptual characteristics in digital technology environment. Y S Choi, T W Park, ArtKorean Soc. Basic Des2017. 2016. 201948 Longitudinal stability of adult personality" in Handbook of personality psychology. P T CostaJr, R R Mccrae, R. Hogan, J. A. Johnson and S. R. Briggs1997Academic PressSan Diego Too true to be good?" when virtual reality decreases interest in actual reality. M Csikszentmihalyi, R E Robinson, X Deng, H R Unnava, H Lee, 10.1016/j.jbusres.2018.11.008California: J. Paul Getty Museum and Getty Center for Education in the Arts. 1990. 2019100The art of seeing: an interpretation of an aesthetic encounter Introduction: the discipline and practice of qualitative research. N K Denzin, Y S Lincoln, Strategies of qualitative inquiry. N K Denzin, Y S Lincoln, Thousand OaksSage Publications2003 Experience and education. J Dewey, 2007Free PressNew York . J Diemer, G W Alpers, H M Peperkorn, Y Shiban, A Mühlberger, 2015 The impact of perception and presence on emotional reactions: a review of research in virtual reality. 10.3389/fpsyg.2015.00026Front. Psychol. 6 Mind over machine: the power of human intuition and expertise in the era of the computer. H L Dreyfus, S E Dreyfus, M. Dehaene and L. D. Cauter1986. 1967RoutledgeNew York; LondonOf other spaces" in Heterotopia and the city . D Freeman, R Lister, F Waite, L.-M Yu, M Slater, G Dunn, 2019 Automated psychological therapy using virtual reality (VR) for patients with persecutory delusions: study protocol for a single-blind parallel-group randomized controlled trial (thrive). 10.1186/s13063-019-3198-6Trials. 2087 A Giorgi, Qualitative research methodology. Thousands Oak: Sage. 2004 The structure of commitment in exchange. G T Gundlach, R S Achrol, J T Mentzer, 10.1177/002224299505900107J. Mark. 591995 The study of the analysis of a user's perception of screen component for inducing emotion in the 3D virtual reality environment. H J Han, 10.5392/JKCA.2018.18.07.165J. Korea Contents Assoc. 182018 The effect of presence and flow of augmented reality advertising on the advertising toward attitude and recall. K.-S Han, J Choi, 10.14400/JDC.2020.18.8.029J. Digit. Converg. 182020 Presence: concept, determinants and measurement. C Hutt, W A Ijsselsteijn, H De Ridder, J Freeman, S E Avons, 10.1117/12.387188from Symposium of the Zoological Society of London. R E Herron, B Sutton-Smith, New YorkWiley1971. 200018Exploration and play in children Case selection techniques in case study research. S Jason, G John, 10.1177/1065912907313077Polit. Res. Q. 612008 The attributes of virtual reality (VR) experiences and spatial cognition among tourists: focusing on a behavioral geographic perspective. S Ji, H J Hwang, C S Hwang, C Koo, E Lee, 10.17086/JTS.2022.46.4.153.176J. Tour. Sci. 462022 An exploratory study on experience of luxury brand virtual fashion show. H Jung, E Ko, 10.12940/jfb.2023.27.2.70J. Fash. Bus. 272023 Consumer experiences of virtual reality: insights from VR luxury brand fashion shows. J Jung, J Yu, Y Seo, E Ko, 10.1016/j.jbusres.2019.10.038J. Bus. Res. 1302021 A study on the aesthetic experience of exhibition visitors by virtual reality type, focusing on Nam June Paik's exhibition "exposition of music. J Y Kang, 10.9728/dcs.2023.24.6.1183J. Digit. Contents Soc. 242023 The interrelationship between desired and undesired selves and consumption: the case of Greek female consumers' experiences. K Karanika, M Hogg, 10.1080/0267257X.2010.508979J. Mark. Manag. 262010 Escaping the crowd: an experimental study on the impact of a virtual reality experience in a shopping mall. H V Kerrebroeck, M Brengan, K Willems, 10.1016/j.chb.2017.07.019Comput. Hum. Behav. 772017 A study on fashion experience of fashion street in social mediafocused on Myeong-dong street in Seoul. S J Kim, 10.18652/2018.18.4.3J. Korea Soc. Fash. Des. 182018 Analysis of substantial visual elements in 3D digital fashion show. S Kim, D Ahn, J. Commun. Des. 572016 Immersion in virtual reality can increase exercise motivation and physical performance" in Virtual, augmented and mixed reality: applications in health, cultural heritage, and industry. G Kim, F Biocca, J. Chen and G. Fragomeni2018SpringerCham How virtual reality shopping experience enhances consumer creativity: the mediating role of perceptual curiosity. W B Kim, H J Choo, 10.1016/j.jbusres.2022.113378J. Bus. Res. 1541133782023 A study on immersion and presence of VR karaoke room implementations in mobile HMD environments. K Kim, B Seo, 10.7583/JKGS.2017.17.6.28J. Korea Game Soc. 172017 The influence of SNS use motivation on SNS addiction. G Lee, J Park, 2018 Public Relat. J Korean, Advert, 10.16914/kjapr.2018.20.3.30120 The production of space. H Lefebvre, 1991BlackwellOxford Impact of 3-D advertising on product knowledge, brand attitude, and purchase intention: the mediating role of presence. H Li, T Daugherty, F Biocca, 10.1080/00913367.2002.10673675J. Advert. 312002 Aesthetic interaction: a framework. P Locher, K Overbeeke, S Wensveen, 10.1162/DESI_a_00017Des. Issues. 262010 . R Lokesh, S Sullivan, J A Calalo, A Roth, B Swanik, M J Carter, 2022 Humans utilize sensory evidence of others' intended action to make online decisions. M Lombard, T Ditton, M Lombard, R D Reich, M E Grabe, C C Bracken, T B Ditton, 10.1111/j.1083-6101.1997.tb00072.xdoi: 10.1111/j.1083-6101.1997.tb00072J. Comput. Med. Commun. 12C3211997. 2006Sci. Rep. Borders that relate: conceptualizing boundaries in relational space. M Löw, G Weidenhaus, 10.1177/0011392117694804doi: 10.1177/0011392117694804Hum. Commun. Res. 262017Curr. Soc. Virtual reality products that foster aesthetic creativity. IEEE 6th information technology, networking, electronic and automation control conference (ITNEC). S Ma, J Fu, J Yang, L Manovich, 10.1068/i0450aapThe language of new media. S Marković, Chongqing, China; CambridgeThe MIT Press2023. 2001. 201227Components of aesthetic experience: aesthetic fascination, aesthetic appraisal, and aesthetic emotion. i-Percept Evaluation for the design of experience in virtual environments: modeling breakdown of interaction and illusion. T Marsh, P Wright, S Smith, 10.1089/109493101300117910Cyberpsychol. Behav. 42001 Lasting customer loyalty: a total customer experience approach. O A Mascarenhas, R Kesavan, M Bernacchi, 10.1108/07363760610712939J. Consum. Mark. 232006 Culture of consumption II. G Mccracken, 2005Indiana University PressBloomington Evaluating display fidelity and interaction fidelity in a virtual reality game. R P Mcmahan, D A Bowman, D J Zielinski, R B Brandy, 10.1109/TVCG.2012.43IEEE Trans. Vis. Comput. Graph. 182012 The instagrammability of the runway: architecture, scenography, and the spatial turn in fashion communications. S Mendes, 10.1080/1362704X.2019.1629758Fash. Theory. 252019 Objective fidelity evaluation in multisensory virtual environments: Auditory cue fidelity in flight simulation. G F Meyer, L T Wong, E Timson, P Perfect, M D White, 10.1371/journal.pone.0044381PLOS ONE. 7e443812012 Hamlet on the holodeck. S Mower, J. 2017. 2017. 1997MIT PressChristian Dior spring . D Narciso, M Bessa, M Melo, A Coelho, J Vasconcelos-Raposo, 2019 Immersive 360° video user experience: impact of different variables in the sense of presence and cybersickness. 10.1007/s10209-017-0581-5Univers. Access Inf. Soc. 18 Emotion and design: attractive things work better. D A Norman, 10.1145/543434.543435Interactions. 92002 . F Pallavicini, A Pepe, A Ferrari, G Garcea, A Zanacchi, F Mantovani, 2020 What is the relationship among positive emotions, sense of presence, and ease of interaction in virtual reality systems? An on-site evaluation of a commercial virtual experience. 10.1162/pres_a_00325Presence. 27 Feasibility and user experience of virtual reality fashion stores. M Park, H Im, D Y Kim, R Payne, C L Cooper, 10.1186/s40691-018-0149-xEmotions at work: theory, research and applications for management. ChichesterWiley2018. 2001532 Optimal experience of flow enhanced by telepresence: evidence from social media use. J.-E Pelet, S Ettis, K Cowart, 10.1016/j.im.2016.05.001Inf. Manag. 542017 Temporal dynamics in the relation between presence and fear in virtual reality. H M Peperkorn, J Diemer, A Mühlberger, 10.1016/j.chb.2015.02.028Comput. Hum. Behav. 482015 How the mind works. London: Penguin Books. S Pinker, 10.3389/fpsyg.2023.12768561997 . Frontiers in Psychology. 13 Effectiveness of virtual reality in the treatment of hand function in children with cerebral palsy: a systematic review. C Rathinam, V Mohan, J Peirson, J Skinner, K S Nethaji, I Kuhn, 10.1016/j.jht.2018.01.006J. Hand Ther. 32e12019 Immersive and desktop virtual reality in virtual fashion stores: a comparison between shopping experiences. Virtual Real. M Ricci, A Evangelista, A Di Roma, Michele , F Rosa, J A Qualls, W J Ruth, J , 10.1016/j.jbusres.2012.12.023doi: 10.1016/j.jbusres.2012.12.023J. Bus. Res. 272023. 2014Consumer creativity: effects of gender and variation in the richness of vision and touch inputs Auf dem Weg zu einer Soziologie des Raums. M Schroer, Raume, Orte, S Grenzen, X Ma, N Aghaei, N Korner-Bitensky, K Moshiri, Seoul: Ecolivres Shahrbanian. 2010 Use of virtual reality (immersive vs. non immersive) for pain management in children and adults: a systematic review of evidence from randomized controlled trials. M J Simmonds, R Sigrist, G Rauter, L Marchal-Crespo, R Riener, P Wolf, Eur. J. Exp. Biol. 22012. 2001. 2015Experience design. Indianapolis: New Riders Sonification and haptic feedback in addition to visual feedback enhances complex motor task learning. Exp. 10.1007/s00221-014-4167-7Brain Res. 233 . G Simmel, Modernity. Seoul: Saemulgyeol. 2005 The effects of retail environmental design elements in virtual reality (VR) fashion stores. A S Sina, J Wu, 10.1080/09593969.2022.2049852Int. Rev. Retail Distrib. Consum. Res. 332023 Place illusion and plausibility can lead to realistic behaviour in immersive virtual environments. M Slater, 10.1098/rstb.2009.0138Philos. Trans. R. Soc. B. 3642009 Fashion inspiration and technology: virtual reality in an experimental apparel design classroom. E W Soja, Verso, S Starkey, S Alotaibi, H Striebel, J Tejeda, K Francisco, N Rudolph, 10.1080/17543266.2020.1844807Postmodern geographies: the reassertion of space in critical social theory. London1989. 202114 Defining virtual reality: dimensions determining telepresence. J Steuer, P Strömberg, 10.1080/1362704X.2017.1386503doi: 10.1080/1362704X.2017.1386503Fash. Theory. 421992. 2019J. Commun. Non-boundaries of style represented in fashion Instagram: a social media platform as a digital space-time. S Suh, 10.1186/s40691-020-00222-9Fash. Text. 7332020 The ties that bind: measuring the strength of consumer's emotional attachment to brand. M Thomson, D Maclnnis, C W Park, 10.1207/s15327663jcp1501_10J. Consum. Psychol. 152005 The aesthetics of luxury fashion, body and identify formation. Y Tuan, A Joy, A Sherry, J F DeschenesJr, J , 10.1016/j.jcps.2010.06.011J. Consum. Psychol. 202011. 2010University of Minnesota Press VenkateshSpace and place: the perspective of experience The aesthetics of consumption and the consumer as an aesthetic subject. A Venkatesh, L Meamber, 10.1080/10253860701799983Consum. Mark. Cult. 112008 . T Vogt, R Herpers, D Scherfgen, H K Struder, S Schneider, 2015 Neuroelectric adaptations to cognitive processing in virtual environments: an exerciserelated approach. D L Wanzer, K P Finley, S Zarian, N Cortez, 10.1037/aca0000203doi: 10.1037/aca0000203Psychol. Aesthet. Creat. Arts. 2332020Exp. Brain Res. The transdisciplinary nature of virtual space" in Augmented reality, virtual reality, and computer graphics. B Webb, Can fashion shows ever be sustainable? VOGUE. L T D Paolis, P Bourdot, ChamSpringer2022. 2019sustainability/can-fashion-shows-ever-be-sustainable-kering-lvmhrichemont Wideström A study on characteristics of digital human eye implementation for improvement of immersion in VR environment. G R Yun, J E Moon, K H Lee, J Y Han, 10.35216/kisd.2020.15.8.325J. Korean Inst. Spatial Des. 152020

"Detailed Seed Cone Morpho-Anatomy Provides New Insights into Seed Cone Origin and Evolution of Podo(...TRUNCATED)