input
stringlengths 600
32.7k
| label
stringclasses 3
values |
|---|---|
" Despite several efforts the development of an effective vaccine for COVID19 may take a much longer timeTraditionalnatural medicine already experienced by humans could be an earlier solution Considering the researchteams experience in using nanoclays as highaffinity material for cancer metastasis melanoma treatment andbone regeneration we propose to use these nanoclays for the preventiontreatment of COVID19 Owing to highaffinity nanoclays would capture the viruses before the latter get engaged with human hACE2 In this studymolecularlevel simulations and modeling of the interaction of coronavirus spike and hACE2 proteins wereperformed with and without nanoclays The results showed a very high level of affinitycohesiveness among SARSCoV2 spike and nanoclays as compared to the one between the former and hACE2 We premise that these nanoclays since already being used as drug carriers could also be injected as claysalone medicine Recommendationshave also been provided for future in vitro and in vivo studiesBackgroundThe sudden emergence and rapid spread of novel coronavirus SARSCoV2 have significantly affected thehealth and lives of human beings in addition to criticallyaffecting the world economy SARSCoV2 spike S bindswith high affinity to human angiotensinconverting enzyme hACE2 and uses it as an entry receptor to invade target cells Fig 1a b [] The virussurface spikeprotein mediates coronavirus entry into host cellsSARSCoV2 spike protein contains a receptorbindingdomain RBD that recognizes explicitly as its receptorhACE2 [ ] The surface of hACE2 contains two virusbinding hotspots that are criticalfor SARSCoV2 Sbinding Several naturally selected mutations in SARSCoV2 RBD surround these hotspots and regulate theinfectivity pathogenesis and crossspecies and humantohuman transmissions of SARSCoV2 [ ]At present there are no clinically approved vaccinesor drugs that specifically target SARSCoV2 Followingthe real protocol of developing a vaccine it may takemuch longer time to come up with an effective vaccine Correspondence habibrehmankfupmedusa3Engineering Research International ERI Riyadh Saudi ArabiaFull list of author information is available at the end of the There is a lot of interest in the development of therapeutic antibodies against SARSCoV2 Despite many efthese antibodies have not yet beenforts howeverdiscovered [] exceptin a few trials [] One trialshowed the potent neutralization of SARSCoV2 bybinding to the RBD of its S glycoprotein [] In this trial[] antibody cocktails a mixture of different antibodiesis recommended due to the increased neutralization effect it has on SARSCoV2 However use of antibodiesin the past from convalescent patients of SARSCoV totreat SARSCoV infection has shown adverse reactionsin the patients such as AntibodyDependent Enhancement ADE causing increased viral infectivity and otherharmful immune responses [] Moreover based on theexperience with the vaccine development efforts forSARSCoV and MERS chances of the materialization ofthe efforts being made for SARSCoV2 seems quitethin Therefore naturaltraditional medicines that have ahistory of safe consumptioningestion by humans couldbe considered as one of the treatment options for SARSCoV2 Being a natural material and a history of humanuseconsumption we suggest highly charged nanoclays to be used as coronavirus blockers and inhibitorsof the spikemediated entry into the human cells The Authors Access This is licensed under a Creative Commons Attribution International Licensewhich permits use sharing adaptation distribution and reproduction in any medium or format as long as you giveappropriate credit to the original authors and the source provide a link to the Creative Commons licence and indicate ifchanges were made The images or other third party material in this are included in the 's Creative Commonslicence unless indicated otherwise in a credit line to the material If material is not included in the 's Creative Commonslicence and your intended use is not permitted by statutory regulation or exceeds the permitted use you will need to obtainpermission directly from the copyright holder To view a copy of this licence visit httpcreativecommonslicensesby40 0cAbduljauwad Nanoscale Research Letters Page of Fig Schematics of the SARSCoV2 attack on human hACE2 and the subsequent immune system response a b RBD binding hACE2 withoutan interference c RBD complexed with the antibody at receptor attachment site hence competing with hACE2 d RBD complexed with RBD at asite other than where receptor attaches resulting in the alteration of RBD structure and interruption of lock and key binding of RBD to hACE2Nanoclays nanosized natural materials originatingfrom minerals of the sedimentary rocks have got avery high affinity to bacteria and viruses [] Due toisomorphous substitution in their molecular structurethese nanoclays exhibit charge deficiency on theirsurfaces This charge deficiency on their surfaces isneutralized by the water molecules and the dissolvedcations Fig The charged structure and large surface area of clay nanops give them an affinityfor charged entities as found on bacterial surfacesand bacterial toxins Their distinct biomedical properties include high absorption the ability to engulf microbes and no toxicity Each of the electrically activeclay minerals has its distinct morphology characteristics and interaction behavior The most studied biomedical application of nanoclays includes serving ascarriers and complexes for anticancer drugs such as5fluorouracil and trastuzumab [] They havetherefore been a potential alternate medicine for several diseases [] Clay nanops due to theiradhesive nature have also been used as carriers forsustainedrelease medicine [ ] Nanoclays havealso successfully been used to adsorb and treat bovinerotavirus and bovine coronavirus [] Researchers[] intercalated methotrexate MTX an anticanceragentinto the anionic clay to create a nanohybriddrug They used the coprecipitation and subsequenthydrothermal methodology to prepare this chemicallystructurally and morphologically welldefined twodimensional drugclay nanohybrid The researchers[] discovered that due to the biocompatibility andhigh loading capacity bentonite nanoclay could beused for the preparation of the drugdelivery vehiclesthey prepared doxorubicinbentoniteIn thisto form ananoclay complex DOXBent complexsustainedreleaseintradrugdeliverystudysystem for 0cAbduljauwad Nanoscale Research Letters Page of Fig a SEM image and b the corresponding molecular structure of Namontmorillonite showing the configuration isomorphous substitutioncharge deficiency and interlayer cations from []tumoral chemotherapy of melanoma As montmorillonite clay is recently being studied to be used as anadditive and drug carrier materialthese nanoclaycomposites appeal their use in various dosing formmainly for controlled release of the drug [] The researchers [] also discovered that nanoclays can beused into recent dual functional drug delivery systemsDDSs to have efficiency in the drug delivery and soreduce the toxicity of doxorubicin DOX that is being used for thyroid cancer treatment Using a libraryof singlesingle type photo cleavable amphiphilicJanus dendrimers researchers [] developed a selfassembling lightresponsive dendrimersomes vesicleplatform Similar to the nanoclays surface modifiedbioactive virusmimicking anic nanovesicles fromglycodendrimersomes have structural modificationsthat contribute to manifest SARSCoV2 and hostpathogenic molecular interactions that help the virusto escape from the human immune system []Through considerable previous research we developedbasic characterization and behavior modeling ofthecharged clay minerals [] and their applications in thecontrol of cancer metastasis [] in vitro and in vivo studies on melanoma treatment [] and the calcium depositionbone regeneration studies [] In a previous study bythe authors [] it was demonstrated that clay nanops had got a high affinity to the charged surfaces Thehigh attraction affinity of the nanoclays and the increasednonspecific adhesion attraction of the cancer cells makenanoclays favorable candidates to control cancer metastasis In that study we demonstrated the possible use of twocharged clay minerals to control the metastasis of thecancer cells Namontmorillonite SWy3 and palygorskitePFll Further to the findings of the authors previous research [] on the use of these nanoclays for the control ofcancer metastasis we also through in vitro and in vivostudies established that these nanoclays have inhibitory effects on melanoma cancer cells mainly on cell proliferationand viability [] In these previous studies in addition tolaboratory experiments molecularlevel simulations werealso performed on the nanoclay and cells interactionsThese simulations provided the assessment of the relativelevel of cohesivenessaffinity in the interactions with andwithout clay nanopsperceptionthroughthisestablishingBased on all the above experience of the authors onthe highaffinity potential of nanoclays we propose thatthe nanoclays could be mimicked as antibodies and canthus attract and engulf coronaviruses before they get engaged with human hACE2 This paper is a first steptowardsamolecularlevelsimulation and modeling approachBased on the results of the molecularlevel simulationsan outline of the recommendations for the next phasesof in vitro and in vivo research is also provided As thesenanoclays are also successfully being used as medicinecarriers we also premise that they can also be injectedingested as claysalone medicine and thus we haveproposed a tentative nanoclays administration methodology for this purposeMaterialsMoleculesSelection and Formulation of SARSCoV2 and hACE2Molecules of SARSCoV2 spike S and hACE2 were acquired from the protein data bank website RCSB [] 0cAbduljauwad Nanoscale Research Letters Page of The molecular models of SARSCoV2 spike S andhACE2 formulated in Materials Studio software [] arerespectively shown in Fig 3a b Before being subject tothe simulations these molecules were charged using thecharge equilibration method QEq of the softwareSelection and Formulation of Nanoclay CrystalliteNamontmorillonite one of the most active members ofthe smectite group of clay minerals was selected for thestudy Namontmorillonite is a layered phyllosilicate claysmectite Fig In the colloidal form the space between neighboring layers can contain free sodium calcium or magnesium cations that are electrostaticallyattracted to external negatively charged surfaces [] Inits dry powdered state Namontmorillonite exists asequidimensionalflakessheets with dimensions of approximately à à microns Fig 2a Thesenegative charges on their interlayer surfaces are balancedby the cations As colloids the interlayer cations get dissociated from the clay ps and associate themselveswith the other negatively charged surfaces These ps also have positively charged edges due to the presence of the broken bonds at their ends Morphology andfurther characteristics of these nanoclays are providedin Table while formulation of their crystallites in Materials Studio software are explained belowIn the software Namontmorillonite crystallites wereformulated based on fundamental properties such asCEC exchangeable cations and interlayer charges Table The size of the molecularcrystallite size was selectedbased on the results of the p size analysis usingthe dynamic light scattering DLS technique [] Thefinal form of clay crystallite created in the software istheseshown in Fig 3c Afterthe preparation ofcrystallites in the design mode of the software using theinherent properties these were charged using the chargeequilibration method QEq of the softwareMethodsMolecularLevel SimulationsThis part of the study consisted of the simulation andassessment of the interactions of the SARSCoV2 spikeS with clay crystallites and with hACE2 Although thesemodels may not be the complete replication of the actual in vitro conditions these have been incorporatedwith all the essentialinteractions and are quite wellsuited for the intended relative and comparative studyIn the software the sorption and simulations of theformulated configurations of SARSCoV2 S Namontmorillonite crystallites and hACE2 were carriedout using Monte Carlo MC and molecular mechanicsMM techniques The enhancement of affinity in all thesimulated configurations was assessed in terms of thecalculated cohesive energy density CEDCED beingconsidered as a measurement of the cohesiveness of themolecular system Due to the largesized computationsinvolved in the simulationsthese calculations werecarried out using the highperformance computing facilities HPC at KFUPM KSA The overall methodologyand the choice of particular methods and the simulationparameters were based on authors previous research[] while it is detailed in the subsequent sectionSARSCoV2 Spike S Interactions with hACE2 and ClayCrystallitesTo simulate the interaction of SARSCoV2 S with claycrystallites various numbers of the crystallites of Namontmorillonite clay were sorbed on SARSCoV2 Smodel For these sorption simulations the MetropolisFig Molecularlevel models of a SARSCoV2 spike b hACE2 and c Namontmorillonite crystallite formulated in Materials Studio software 0cAbduljauwad Nanoscale Research Letters Page of lnoitauccoFlnoitcaretnInoitcaretnInoitcaretnIninoisrepsidretawnoisrepsiDygrenelatotygreneWdvygreneBAlraopcilihpordyHaCaNretaWytiniffasγlaitnetopVmPZateZreyalretnIegrahclardeharteTlardehatcOlebaegnahcxEegrahcegrahcsnoitacqemgCECecafruSNaeragmslarenmirehtOliacmehClaumrofacilisOiSgMlAaCaNecruoSytnuoCASUYWkoorC][yWSyacletinolliromtnomaNfonoitaziretcarahcliacmehcdnalacisyhpfoyrammuSelbaT 0cAbduljauwad Nanoscale Research Letters Page of Monte Carlo method was selected in the Sorption module of the software In each sorption step clay crystallitesoccupy spaces around the spike S model to lower theoverall energy of the complex The required number ofcrystallites were sorbed in a maximum of stepsand then the energy of the system was minimized usingthe Forcite module of the software based on the MDprinciples The similar sorption process was repeated forthe interaction modeling of the SARSCoV2 spike molecule with hACE2 In this process hACE2 moleculeswere sorbed around the RBD of the spike S of SARSCoV2 After the completion of the sorption process theenergy of the formulation was minimized using MDbased module of the softwareThe Forcite module ofthe software incorporatingNPT constant number of ps pressure andtemperature ensemble was used for MD simulationswith a modified universal force field [] The simulations were run for to ps with an interval of 05fs ortill a constant volume is obtained A Berendsen thermostat with a decay constant of ps was used to controlthe temperature during the simulation During the MDsimulations the assumed temperature was kept constantat K °C with an atmospheric pressure kPaA Berendsen barostat with a decay constant of pswas used to control the pressure of the system TheBerendsen methodology was considered as the most appropriate for the single crystallites after several trials involving other thermostats and barostats available in thesoftware In the Monte Carlo method the parametersfor the ratios of exchange conformer rotate translateand regrow were selected as and respectively with the corresponding probabilities as and Amplitudes adapted for rotationand translation were ° and respectivelyCohesive Energy Density CED MeasurementIn this study the assessment of the affinitybindinglevelin the SARSCoV2clay crystallites and SARSCoV2hACE2 complexes was measured through thechanges in the CED After the sorption of clay crystallites and the subsequent performance of moleculardynamics of each of the configurations the CED wasdetermined using the cohesive energy density optionof the Forcite module of the software The authorshave experienced that the CED concept consisting ofthe total van der Waals and electrostatic CEDs canquite closely explain the various molecularlevel processes and interactions and simulate the extent of affinitybinding created among the simulated complexes[] Quantitatively CED is defined as the amountof energy needed for the transition of mol of material from the liquid to the gaseous phase It is also ameasureofaffinityattractivenessthe mutualofmolecules and is expressed both as electrostatic andvan der Waalsan NPTensembleaveraged overforcesIn the Forcite module van der Waals energies wereevaluated using atombased cutoffsIn this methodnonbond interactions are simply calculated to a cutoffdistance and interactions beyond this distance are ignored To avoid the discontinuities caused by direct cutoffs most simulations use a switching function to turnoff nonbond interactions over a range of distancessmoothly An effective potential is created by multiplyingthe actual potential by the smoothing function Thechoice of the function in the intermediate range is crucial and should be continuously differentiable in this region so that forces can be calculated In this study acubic spline smoothing function was used with a splinewidth of and a cutoff distance of Results and DiscussionsThe final configuration of the SARSCoV2 ShACE2complex is shown in Fig 4a while the complexes between SARSCoV2 spike and different numbers of clayNamontmorillonite crystallites are respectively shownin Fig 4b c For comparison purposes total CEDs ofvarious proportionsnumbers of the clay crystallites onthe SARSCoV2 spike and the interaction of the laterwith hACE2 are plotted in Fig Based on our experience we have hypothesized thatnanoclays due to their high adhesive properties couldalso act as SARSCoV2 inhibitors They can do it bystrongly associating with the spike S present on SARSCoV2 The results obtained from the molecularlevelsimulations of the interactions indicate that due to veryhigh CED between SARSCoV2 and the nanoclays ascompared to the former and hACE2 Fig they couldinhibit SARSCoV2 from getting engaged with hACE2Moreover it could also be concluded from Fig thatthe extent of inhibition due to nanoclays is increased inquantity dosagedependent wayNanoclay Interactions with SARSCoV2 Spike SAuthors in their earlier research have demonstrated therole of nanoclays in promoting adhesion among thecancer cells and their microenvironment and hence controlling metastasis [] Adhesion measurements of mix of Namontmorillonite and palygorskite showedan increase in adhesion by among cancer cells andthe extracellular matrix proteins Fig 6a A corresponding SEM of the nanoclays binding the Raji cells and thefibronectin proteins is shown in Fig 6b Sample imagingwas performed in SEM mode in an FEI ESEMFEG XL atthe Miller School of Medicine University ofMiami Florida Authors also discovered in their previousresearch that electrostatic van der Waals and ZP 0cAbduljauwad Nanoscale Research Letters Page of Fig Molecularlevel simulation results in Materials Studio Software a SARSCoV2 S and hACE2 CED Jcm3 b SARSCoV2 S modelinteracting with twelve crystallites of Namontmorillonite CED Jcm3 and c SARSCoV2 S model interacting with twentyfour crystallites ofNamontmorillonite CED Jcm3obtained using Sorption technique implemented in the softwareattractions seem to be dominating in the adhesion processes [] We conclude that the same mechanismswould have also facilitated the binding of the adhesivesurfaces of the nanoclays to the spike of SARSCOV2Fig ZP is a measure of the dispersion or flocculationtendency in the colloidal form including the interactions 0cAbduljauwad Nanoscale Research Letters Page of Fig Variation of cohesive energy density CED for SARSCoV2 ShACE2 and the complexes of the former with different numbers ofNamontmorillonite crystalliteswith the other constituents present in the suspensionmedium As a general rule a zeta potential greater than mV either positive or negative indicates dispersiontendency while a zeta potential of less than mV generally results in agglomeration Higher dispersion tendencies ZP of the clay nanops used in the study to mV lead to higher dispersion tendency andhence in the generation of higher surface area amplifyingthe interactions with the SARSCoV2 spike Althoughbased on their ZP Namontmorillonite nanopshave hydrophilic nature they in the presence of saltsalso promote secondary adhesion mechanisms betweenhydrophobic and hydrophilic surfaces [] It should alsobe noted that these clay nanops have high dispersion tendency due to their hydrophilic nature and relatively higher repulsive acidbase AB interactions Table High dispersion in turn results in the generation ofhigh surface area for increasing the attractive interactions Higher surface areas promote larger attractionsdue to the van der Waal attractions and the electrostaticforces among oppositely charged surfaces Besides although of relatively lesser degree positively chargededges of Namontmorillonite ps also get electrically attracted to the spike SThe results of the molecularlevel simulations for theinteraction of SARSCoV2 spike S with the clay crystallites Fig also confirm the above interaction behaviors It has been observed that the sorption of the claynanops results in the formation of closely interacting strong van der Waals attraction fields These van derWaals attraction fields create higher CED of the claySARSCoV2 configuration Substantial increase in totalCED after the addition of clay crystallites Fig is alsoa testimony of a very high affinity of SARSCoV2 withthese ps as compared to the affinity of the formerwith hACE2systemagglutinationNanoclays as PseudoantibodiesBased on all the current and past research by the authors establishing the highaffinity potential of nanoclays we premise that nanoclays could be mimicked asantibodies and can thus attract and engulf coronavirusesbefore they get engaged with human hACE2 Antibodiesare glycoproteins synthesized by plasma cells as part ofthe adaptive immune response to assist in the clearanceof infection from the body Antibodies aid in infectionclearance in multiple ways such as opsonization of pathogens to facilitate phagocytosis activation of the complementandneutralization of viruses and toxins When bound to theviral surface proteins antibodies prevent the entry of theviruses into the cell by preventing the attachment of viruses to their target receptor on the cell Antibody binding can occur at different sites on the surface proteinleading to various mechanisms that cause the same effect In the case of SARSCoV2 two viral neutralizationmechanisms by antibodies have been observed [ ]and shown in Fig 1c d One of the mechanisms involvesdirect binding of antibodies to the attachment site of theSARSCoV2RBD resulting in the antibody competingwith the target receptor hACE2 Another mechanism involves the binding of antibodies to the other sites onRBD without any competition with the target receptorThe latter is shown to be involved in neutralization byof microbes 0cAbduljauwad Nanoscale Research Letters Page of Fig a Summary of adhesion force measurements among RajiRajiFN assembly using AFM before and after treatment with various proportionsof Namontmorillonite and palygorskite clay nanops [] Error bars represent the variations in the trials b SEM image of the binding of Rajicells and Fibronectin proteins produced by nanoclaysthe most potent Monoclonal Antibody mAb discoveredin the study [ ] Analogous to the antibodies interaction with SARSCoV2 RBD inhibiting the latter toengage with hACE2 a similar molecularlevel model isprepared for nanoclays resulting in a similar inhibitionof the coronaviruses and shown in Fig Owing to theirvery high affinity nanoclays would get attracted tospikes of SARSCoV2 and thus restrict engagement ofRBDs of these spikes with hACE2Proposed Nanoclay Administration MethodologyClay use as drug carriers has been tested multiple timesyielding promising results of little to no cytotoxicity tocells of the human body Kaolinite clay mineral wastested for use in a potential drug delivery system andwas shown to have high biocompatibility and very lowas[]negligiblecytotoxicity [] Poly DLlactidecoglycolidemontmorillonite nanop cytotoxicity in vitro was alsodemonstratedPalygorskitepolyethyleneiminefluorescein isothiocyanate nanocomposites also exhibited almost no cytotoxicity in vitro[] Authors have also experienced injecting nanoclayssubcutaneously for the treatment of melanoma duringin vivo studies [] Based on the use of clay as a cancerdrug carrier and in other sustainedrelease medicine[] we propose that nanoclays may be injected asclayalone medicine subject to the verification in vivoand clinical trialsAlthough nanoclays are nonbiodegradable a comprehensive understanding of the design of the similar inanic nanops with their metabolic performancein the body carried out in the study [] could also 0cAbduljauwad Nanoscale Research Letters Page of Fig Three possible mechanisms of interactions of montmorillonite nanoclay with the SARSCoV2 spike S Electrostatic attraction amongpositively charged nanop edges and NaCa ions with negatively charged virus surfaces Van der Waals attractions ZPelectrostatic interactionscategorize these nanoclays as human body clearable inanic agentsConclusions and RecommendationsBased on all the current and past research by the authors establishing the highaffinity potential of nanoclays these could be mimicked as antibodies and canthus attract and engulf coronaviruses before they get engaged with human hACE2The results of the molecularlevel simulations for theinteraction of SARSCoV2 spike S with the clay crystallites result in the formation of closely interacting strongvan der Waals attraction fields These van der Waals attraction fields create higher CED of the claySARSCoV configuration Substantial increase in total CED afterFig Interaction mechanism of nanoclay ps with SARSCoV2 spike S inhibiting the interaction of the later with hACE2 0cAbduljauwad Nanoscale Research Letters Page of addition of clay crystallites is also a testimony of a veryhigh affinity of SARSCoV2 with these ps as compared to the affinity of the former with hACE2We propose to continue the research by carrying outin vitro interaction studies between SARSCoV2 anddifferent percentage of nanoclays Based on theoptimum dose of nanoclay developed in the in vitrophase we suggest to carry out in vivo studies on the animals The animal study should be carried out both withand without nanoclay to finalize the nanoclay dose andshould lay the foundation for the clinical trialsAcknowledgementsThe authors highly acknowledge KFUPM for providing highperformancecomputing research facilitiesAuthors ContributionsAll the authors equally participated at all the research levels The authorsread and approved the final manuscriptFundingNo fundingAvailability of Data and MaterialsAll data generated or analyzed during this study are included in thispublished Ethics Approval and Consent to ParticipateNot applicableConsent for PublicationNot applicableCompeting InterestsThe authors declare that they have no competing interestsAuthor details1Civil Environmental Engineering department King Fahd University ofPetroleum Minerals KFUPM Dhahran Saudi Arabia 2Royal College ofSurgeons in Ireland RCSI Bahrain campus Busaiteen Bahrain 3Engineering Research International ERI Riyadh Saudi ArabiaReceived July Accepted August ReferencesEwen Callaway and Nik Spencer The race for coronavirus vaccines agraphical guide eight ways in which scientists hope to provide immunityto SARSCoV2 News Feature Nature vol April Li F Li W H Farzan M Harrison S C Structure of SARS coronavirusspike receptorbinding domain complexed with receptor Science httpsdoi101126science1116480 Li WH Angiotensinconverting enzyme is a functional receptorfor the SARS coronavirus Nature httpsdoi101038nature02145Li F Structural analysis of major species barriers between humansand palm civets for severe acute respiratory syndrome coronavirusinfections J Virol httpsdoi101128jvi0044208 Wu KL Peng GQ Wilken M Geraghty RJ Li F Mechanisms of hostreceptor adaptation by severe acute respiratory syndrome coronavirus JBiol Chem httpsdoi101074jbcM111325803 Wang C Li W Drabek D Okba NMA van Haperen R Osterhaus ADME A human monoclonal antibody blocking SARSCoV2 infection NatCommun Jiang S Hillyer C Du L Neutralizing antibodies against SARSCoV2and other human coronaviruses Trends Immunol Pinto D Park YJ Beltramello M Walls AC Tortorici MA Bianchi S Crossneutralization of SARSCoV2 by a human monoclonal SARSCoV antibody Nature da Rocha Dias S Salmonson T van ZwietenBoot B Jonsson B Marchetti SSchellens JH Pignatti F The European Medicines Agency review ofvemurafenib Zelboraf® for the treatment of adult patients with BRAF V600mutationpositive unresectable or metastatic melanoma summary of thescientific assessment of the Committee for Medicinal Products for HumanUse Eur J Cancer Sahel N Abduljauwad and HabiburRehman Ahmed Enhancing cancer celladhesion with clay nanops for countering metastasis Nature ScientificReports April httpsdoi101038s4159801942498y Zhang Y Long M Huang P Yang H Chang S Hu Y Mao L Intercalated 2D nanoclay for emerging drug delivery in cancer therapyNano Res Chianelli R R Das S US Patent No Washington DC US Patent and Trademark Office Han S Liu F Wu J Zhang Y Xie Y Wu T Y Targeting of fluorescentpalygorskite polyethyleneimine nanocomposite to cancer cells Appl ClaySci Sun B Ranganathan B Feng SS Multifunctional poly D Llactidecoglycolide montmorillonite PLGAMMT nanops decorated byTrastuzumab for targeted chemotherapy of breast cancer BiomaterialsLin FH Lee YH Jian CH Wong JM Shieh MJ Wang CY A study ofpurified montmorillonite intercalated with 5fluorouracil as drug carrierBiomaterials Bothiraja C Thorat UH Pawar AP Shaikh KS Chitosan coated layeredclay montmorillonite nanocomposites modulate oral delivery of paclitaxel incolonic cancer Mater Technol 29sup3B120B126Kevadiya BD Thumbar RP Rajput MM Rajkumar S Brambhatt H Joshi GVBajaj HC Montmorillonitepolyεcaprolactone composites asversatile layered material reservoirs for anticancer drug and controlledrelease property Eur J Pharm Sci Guo MY Wang AF Muhammad F Qi WX Ren H Guo YJ Zhu GS Halloysite nanotubes a multifunctional nanovehicle for anticancer drugdelivery Chin J Chem MartÃnez C D Cationic clays upon cancer therapy Virtual MultidisciplinaryConference QUAESTI Konta J Clay and man clay raw materials in the service of man ApplClay Sci Murray HH Traditional and new applications for kaolin smectite andpalygorskite a general overview Appl Clay Sci Volzone C Retention of pollutant gases comparison between clayminerals and their modified products Appl Clay Sci Dong Y Feng SS Poly dllactidecoglycolidemontmorillonitenanops for oral delivery of anticancer drugs Biomaterials Clarka KJ Sarrb AB Grantb PG Phillipsb TD Woodea GN In vitrostudies on the use of clay clay minerals and charcoal to adsorb bovinerotavirus and bovine coronavirus Vet Microbiol Choi G Huiyan P Alothman Z Vinu A Yun C Choy J Anionic clay asthe drug delivery vehicle tumor targeting function of layered doublehydroxidemethotrexate nanohybrid in C33A orthotopic cervical cancermodel International Journal of nanomedicine DOI httpsdoi102147IJNS95611 Hosseini F Hosseini F Jafari S M and Taheri A Bentonite nanoclaybaseddrugdelivery systems for treating melanoma Clay Minerals DOI httpsdoi101180clm201842018 Inamuddin Asiri A M and Mohammad Ali Applications of nanocompositematerials in drug delivery DOI httpsdoi101016C20160050751 Avolume in Woodhead Publishing Series in Biomaterials Zhang Y Long M Huang P Yang H Chang S Hu Y Tang A and MaoL Emerging integrated nanoclayfacilitated drug delivery system forpapillary thyroid cancer therapy doi 101038srep33335 Sci Rep Li S Xia B Javed B Hasley W D MelendezDavila A Liu M Kerzner MAgarwal S Xiao Q Torre P Bermudez J G Rahimi K Kostina N YMöller M RodriguezEmmenegger C Klein M Percec V and Good M CDirect visualization of vesicle disassembly and reassembly usingphotocleavable dendrimers elucidates cargo release mechanisms ACS 0cAbduljauwad Nanoscale Resear | Thyroid_Cancer |
Molecular Medicine The role of selenium metabolism andselenoproteins in cartilage homeostasisand arthropathiesDonghyun Kang Jeeyeon Lee Cuiyan Wu3 Xiong Guo3 Byeong Jae Lee24 JangSoo Chun5 andJinHong Kim AbstractAs an essential nutrient and trace element selenium is required for living anisms and its beneï¬cial roles in humanhealth have been well recognized The role of selenium is mainly played through selenoproteins synthesized by theselenium metabolic system Selenoproteins have a wide range of cellular functions including regulation of seleniumtransport thyroid hormones immunity and redox homeostasis Selenium deï¬ciency contributes to various diseasessuch as cardiovascular disease cancer liver disease and arthropathyKashinBeck disease KBD and osteoarthritisOA A skeletal developmental disorder KBD has been reported in lowselenium areas of China North Korea and theSiberian region of Russia and can be alleviated by selenium supplementation OA the most common form of arthritisis a degenerative disease caused by an imbalance in matrix metabolism and is characterized by cartilage destructionOxidative stress serves as a major cause of the initiation of OA pathogenesis Selenium deï¬ciency and dysregulation ofselenoproteins are associated with impairments to redox homeostasis in cartilage We review the recently exploredroles of selenium metabolism and selenoproteins in cartilage with an emphasis on two arthropathies KBD and OAMoreover we discuss the potential of therapeutic strategies targeting the biological functions of selenium andselenoproteins for OA treatmentIntroductionSelenium Se is an essential trace element in humans12Selenium is generally taken up from the diet through foodor other forms of external supplementation Dietaryselenium is obtained in the form of selenomethionineSeMet selenocysteine Sec selenite and selenate Signiï¬cant health beneï¬ts have been attributed to seleniummetabolic systems that play major physiological roles inthyroid hormone metabolism immunity and antioxidantdefense23 Selenium is required for the production ofthyroid hormonemetabolizing enzymes and seleniumCorrespondence JinHong Kim jinhkimsnuackr1Center for RNA Research Institute for Basic Science Seoul South Korea2Department of Biological Sciences College of Natural Sciences Seoul NationalUniversity Seoul South KoreaFull list of author information is available at the end of the These authors contributed equally Donghyun Kang Jeeyeon Leesupplementation is thought to improve the function ofthyrocytes and immune cells4 Selenium supplementationdemonstrated immunostimulant effects such as enhancedproliferation of activated T cells activation of naturalkiller cells and tumor cytotoxicity mediated by cytotoxiclymphocytes56 In contrast selenium deï¬ciency is associated with the occurrence virulence and disease progression of viral infections7Selenium inadequacy can lead to various types ofdiseases most notably cardiovascular disease8 cancer13 hepatopathy1617 and arthropathy Cardiovascular diseases are associated with systemic seleniumlevel with a higher risk at or μgL seleniumconcentration in the blood10 A type of endemic cardiomyopathy Keshan disease is linked to selenium deï¬ciency811 Keshan disease occurs in lowselenium areasin Chinasodium seleniteand is prevented by The Authors Access This is licensed under a Creative Commons Attribution International License which permits use sharing adaptation distribution and reproductionin any medium or format as long as you give appropriate credit to the original authors and the source provide a link to the Creative Commons license and indicate ifchanges were made The images or other third party material in this are included in the s Creative Commons license unless indicated otherwise in a credit line to the material Ifmaterial is not included in the s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use you will need to obtainpermission directly from the copyright holder To view a copy of this license visit httpcreativecommonslicensesby40Ofï¬cial journal of the Korean Society for Biochemistry and Molecular Biology 0cKang Experimental Molecular MedicinePage of studiesEpidemiologicalsupplementation12 Lowselenium status is correlatedwith a significantly increased risk of cancer incidenceand mortality13haveprovided evidence on the cancerpreventing effects ofselenium18 Selenium deï¬ciency is also characterizedby elevated levels of oxidative stress markers in the liver21which significantly contribute to liver injury17 The oxidative stress caused by selenium deï¬ciency further plays adetrimental role in joint development Selenium deï¬ciency is the main cause of endemic KashinBeck diseaseKBD which is mainly reported in lowselenium areas ofChina North Korea and the Siberian region of RussiaMoreover there is a growing body of evidence suggestingthat the pathogenesis of osteoarthritis OA the mostcommon form of arthritis may be associated with selenium deï¬ciency by resulting in oxidative stress22However it is noteworthy that excessive selenium intakecan also cause selenosis2930 which accompanies adversesymptoms including fatigue diarrhea nausea increasedheart rate necrosis in liver and kidney and neurologicaldamage Chroniccompromisesimmune and reproductive systems in humanseventuallyselenosisOA is characterized by progressive loss of cartilageextracellular matrix ECM and pathological changes inother joint tissues such as subchondral bone sclerosisosteophyte formation and synovial ammation31 Cartilage destruction is considered a hallmark of OA and is aresult of increased production of catabolic effectors32and reduced matrix biosynthesis by chondrocytes36 OA isassociated with multiple etiologies involving systemicfactors such as age37 as well as local factors such asmechanical stress38 driven by weightbearing and jointinstability Both OAcausing factors have been found tocause oxidative stress in chondrocytes Oxidative stressresults from the abnormal production of reactive oxygenspecies ROS and the loss of cellular antioxidant capacityMany preclinical and clinical studies have indicated theaccumulation of oxidative burden in chondrocytesundergoing osteoarthritic changes3940 Emerging evidence suggests that oxidative stress is mechanisticallylinked to the initiation of osteoarthritic changes inchondrocytes through the acquisition of senescent phenotypes36 Therefore restoring redox homeostasis canserve as a rational therapeutic strategy to alleviate OAprogression Here we review the role of selenium metabolism in cartilage and bone and the signiï¬cance ofmaintaining its homeostasis in the context of joint diseases such as KBD and OAOverview of the selenium metabolic systemThe selenium metabolic system and the biosynthesis ofselenoproteinsSelenium metabolism is a systemic process that includesandtransformationtransportationabsorptiontheOfï¬cial journal of the Korean Society for Biochemistry and Molecular Biologyexcretion of selenium Fig Selenium is obtained inanic formsSeMet and Secand inanic formsselenite and selenatefrom diet Selenium is taken up bythe liver that synthesizes and exports SELENOP whicheventually circulates through the bloodstream SELENOPwith multiple Sec residues41 transports selenium to othertissues and ans42 and the transported selenium isconverted to selenophosphate by intracellular seleniummetabolic pathways Selenium is excreted through exhalation and urine in the form of smallmolecule metabolites formed by sequential methylation4344Selenium plays biological roles predominantly in theform of selenoproteins synthesized by the seleniummetabolic system Ingested inanic selenium is ï¬rstreduced to hydrogen selenide H2Se via glutathioneGSH and thioredoxin TXN systems Selenide is furtherconverted to Sec amino acids for incorporation intospeciï¬c sites of selenoproteins such as the catalytic sites ofa selenoenzyme Mechanistically selenophosphate synthetase SEPHS2 catalyzes the production of selenophosphate through the reduction of hydrogen selenideThe subsequent reaction with phosphoseryltRNA PSertRNA[Ser]Sec yields SectRNA[Ser]Sec Sec amino acids areincorporated into polypeptidethrough themachinery utilizing the UGA codon Selenocysteineinsertion sequence binding protein SBP2 binds toselenocysteine insertion sequence SECIS element whichis located in the ²untranslated region ²UTR of selenoprotein mRNA and mediates the transfer of SectRNA[Ser]Sec to the Asite of ribosome which recognizesthe UGA codon as the Sec integration codon Collectivelythe selenoprotein translation machinery consists of SECISelement SBP2 Secspeciï¬c eukaryotic elongation factorEEFSEC and aminoacylated SectRNA[Ser]Sec therebyenabling UGA to be recognized as a Sec codon and utilized for translation into the growing polypeptidechainsSelenoproteinssome ofSelenoprotein is deï¬ned as a protein containing Secamino acid residue The biological functions of seleniumare mostly exerted through selenoprotein domains thatcontain Sec residues Twentyï¬ve selenoprotein geneshave been identiï¬ed in the human genome45 In mice atotal of selenoproteins have been characterized46 andtargeted deletion ofthese selenoproteinsdemonstrated their essential roles in developmental processes and in disease pathogenesis Selenoproteins can beclassiï¬ed into subfamilies based on their cellular functionssuch as those implicated in antioxidation GPX1 GPX2GPX3 GPX4 redox regulation TXNRD1 TXNRD2TXNRD3 MSRB1 SELENOH SELENOM SELENOWthyroid hormone metabolism DIO1 DIO2 DIO3 selenium transport and storage SELENOP selenophosphatesynthesis SEPHS2 calcium metabolism SELENOK 0cKang Experimental Molecular MedicinePage of Fig Selenium metabolic system in mammals Selenium is absorbed from the diet undergoes several conversion steps and is incorporated intopolypeptide chains completing selenoprotein synthesis Dietary sources of selenium uptake exist in inanic form such as selenate and selenite andanic form such as Sec and SeMet Inanic forms are reduced by TXNRDTRX or GRXGSH systems and anic forms are cleaved by SCLYforming selenide Selenophosphate is synthesized from selenide by SEPHS2 and the subsequent reaction with PSertRNA[Ser]Sec mediated by SEPSECSyields SectRNA[Ser]Sec SectRNA[Ser]Sec is transferred to the Asite of ribosome mediated by SBP2 which binds to SECIS located in the ²UTR of aselenoprotein mRNA Finally the UGA codon is recognized as the Sec integration codon Abbreviations SeMet selenomethionine Secselenocysteine GRX glutathione reductase TRX thioredoxin TXNRD thioredoxin reductase GSH glutathione MGL methionine gammalyase SCLYselenocysteine lyase SEPHS2 selenophosphate synthetase SARS seryltRNA synthetase PSTK phosphoserylSeptRNA kinase SEPSECS SeptRNASectRNA synthase EEFSEC Secspeciï¬c eukaryotic elongation factor SBP2 SECIS binding protein SELENOT myogenesis SELENON protein foldingSELENOF SELENOI SELENOS and protein AMPylation SELENOO4748 The functions of other selenoproteins such as GPX6 and SELENOV still remain unclearGlutathione peroxidases GPXs such as GPX1 cytosolicGPX GPX2 gastrointestinal GPX and GPX4 phospholipid hydroperoxide GPX catalyze the decompositionof a great variety of peroxides thus protecting cellsagainst oxidative damage4950 Thioredoxin reductasesTXNRDs employ NADPH as an electron donor to revertoxidized TXN to a reduced dithiol the oxidation status ofwhich is critically implicated in regulating various cellbehaviors including proliferation and apoptosis51 Thephysiological signiï¬cance of TXNRDs is further supported by the embryonic lethality of Txnrd1 or Txnrd2knockout mice5253 Deiodinases DIOs regulate thyroidhormone metabolism by catalyzing the conversion ofthyroid hormones from precursor thyroxine T4 to biologically active triiodothyronine T3 or inactive reverseT3 rT354 The expression levels of several selenoproteinsOfï¬cial journal of the Korean Society for Biochemistry and Molecular Biologyare uenced by the extent of selenium uptake Forexample seleniumdeï¬cient animals and human cell linesexhibit reduced transcription of selenoproteins such asGPX1 DIOs SELENOI and SELENOW55 A subset ofselenoproteins such as GPX1 and SELENOW is moresensitive to selenium supplementation or deï¬ciency Thehierarchy of selenoprotein expression is more apparentwhen the intracellular level of selenium is limited1Seleniumresponsive genesgenesareseleniumcontainingSeleniumresponsivethe genes whoseexpression patterns are uenced by supplementationwith selenium orcompoundsTreatment of a cancer cell line with methylseleninic acidin genes58 Theseinduced expression changesresponsive genes were closely associated with annotationsrelated to cell cycle regulation androgenresponsive genesand phase II detoxiï¬cation pathway Selenium supplementation of macrophages diminished the expression oflipopolysaccharide LPSinduced proammatory genes 0cKang Experimental Molecular MedicinePage of such as cyclooxygenase2 COX2 and tumor necrosisfactorα TNFα59 suggesting that selenium has antiammatory effects on the immune system The CTDdatabase httpctdbase reports the effect of environmental chemicals including selenium on gene expression proï¬les in various human tissuesThe role of selenium and selenoproteins incartilage development and KBDSelenium levels and its role in joint tissuesJoints are composed of various types of connective tissues including cartilage bone synovium meniscus andligament Among these tissues cartilage is the maincomponent that absorbs mechanical stress cushioningbones from impacting each other during various weightbearing activities In the human knee joint the seleniumconcentration in cartilage is approximately μgkg dryweight whereas the selenium concentrations in ligamentand meniscus are and μgkg dry weight respectively6061 The requirement of adequate physiologicalselenium levels for maintaining cartilage homeostasis hasbeen recognized Selenium deï¬ciency retards the growthand development of cartilage and bone62 Growthretardation was observed in rats after two generations ofselenium deï¬ciency62 Mice fed a diet deï¬cient in selenium resulted in ï¬brocartilage formation at the articularsurface ultimately showing degeneration of articularcartilage63 Selenium deï¬ciency induced the expression ofthe chondrocyte hypertrophy marker gene type X collagenCOLX in articular cartilage64 The expression of parathyroid hormonerelated protein PTHrP which controlschondrocyte maturation during endochondral ossiï¬cation was enhanced in both articular cartilage andhypertrophic growth plate following selenium deï¬ciencyThese changes were in line with the phenotypic changesobserved in the cartilage of KBD patients64 However itshould be noted that growth retardation caused by selenium deï¬ciency may also be associated with the deregulation of bone metabolism65 In a study by Cao et alselenium deï¬ciency severely compromised bone microarchitecture as a result of increased bone resorption66Abnormalities in selenium metabolism and skeletaldevelopment diseasesSelenium deï¬ciency is regarded as one of the initiatingfactors of KBD which is an endemic osteoarthropathycaused by the premature closure of epiphyseal plate andthe impaired skeletal development Skeletal deformities inhands ï¬ngers knees and elbows and in severe casesdwarï¬sm and movement disorders are the symptoms ofKBD22 The KBD area roughly coincides with lowselenium areas including a geological belt extendingfrom northeast to southwest China North Korea andeastern Siberia22 A metaanalysis showed that seleniumOfï¬cial journal of the Korean Society for Biochemistry and Molecular Biologylevels in the water soil cereal and corn in KBD endemicregions were lower than they were in nonendemicregions supporting the fact that the level of selenium intissue is predominantly affected by dietary intake23 In linewith this ï¬nding selenium levels in the whole bloodserum hair and urine of KBD patients were markedlylower than those of healthy controls24Selenoprotein gene polymorphisms are associated withincreased susceptibility to KBD There were significantdifferences in the allelic frequency of GPX1 Pro198Leurs1050450 between the KBD and control group67 Inaddition the mRNA level of GPX1 and enzyme activity oftotal GPX in blood were lower in the KBD group thanthey were in the control group67 Haplotypes of TCCTTC and TTT of rs1050450 rs3811699 and rs1800668in GPX1 gene also had a significant link to KBD68 Asinglenucleotide polymorphism SNP in the promoterregion of SELENOS rs28665122 105G A was relatedto the increased risk of KBD and upregulation of PI3KAktsignaling in patients with KBD69 In this study tertbutylhydroperoxide tBHPtreatmentinduced chondrocyteapoptosis was mitigated by selenium supplementation viasodium selenitetreatment which suppressed thePI3KAkt pathway The minor Aallele of SELENOFrs5859 was associated with a significantly higher incidenceof KBD70The animals fed a seleniumdeï¬cient diet recapitulatedsome of the pathological manifestations of KBD stronglysupporting the notion that selenium deï¬ciency is criticallyassociated with the development of this endemic arthropathy Selenium deï¬ciency impaired bone and cartilagegrowth with the exhibition of premature chondrocytehypertrophy as evidenced by an increased expression ofCOLX compatible with the phenotypes in KBD cartilage64The lowselenium condition in combination with threemycotoxins deoxynivalenol DON nivalenol NIV and T yielded procatabolic changes and hypertrophic phenotype of chondrocytes as evidenced by the loss of aggrecanand type II collagen COLII and the increase in COLX andmatrix metalloproteinases MMPs expressionrespectively71 In contrast selenium supplementation partiallyalleviated these mycotoxininduced damages in chondrocytes71 In rats dietary selenium deï¬ciency over twogenerations caused the onset of physiological seleniuminsufï¬ciency72 In this condition pathological changes inthe epiphyseal plate were observed with the decreasedexpression of COLII and GPX1 in the chondrocytes suggesting a possible association of reduced chondrocyte anabolism and antioxidant capacity with the epiphyseal platelesions observed in KBD72 The relevance ofimpairedselenium metabolism to the onset of KBD was furthervalidated using a mouse genetic deletion model Targeteddeletion of SectRNA[Ser]Sec Trsp gene in osteochondroprogenitor cells from embryonic stage caused the 0cKang Experimental Molecular MedicinePage of depletion of selenoproteins in skeletal systems causinggrowth retardation abnormalities in the epiphyseal growthplate delayed endochondral ossiï¬cationand chondronecrosis which recapitulated the major pathologicalfeatures of KBD73As a prophylactic treatment selenium supplementationswere given to children living in a KBD area The supplemented group showed elevated physiological seleniumlevels in their hair samples and exhibited a substantiallylower prevalence of KBD74 A metaanalysis including ï¬verandomized controlled trials RCTs and ten prospectivenonRCTs statistically demonstrated the beneï¬ts of selenium supplementation in preventing KBD in children75Selenium metabolism and OAPhysiological signiï¬cance of oxidative stress inchondrocytesOA is the most common form of arthritis and is primarilycharacterized by the loss of cartilagespeciï¬c ECM and otherpathological changes in joints including subchondral bonesclerosis osteophyte formation and synovial ammation31Articular cartilage is composed of abundant proteoglycans inwhich sulfated glycosaminoglycan chains such as chondroitinsulfates are bound to a core protein such as aggrecan Loss ofcartilage matrix during OA progression is a combined resultof increased catabolic process in cartilage and reduced anabolic activity of chondrocytes The molecularlevel understanding of OA pathogenesis has led to the identiï¬cation ofmajor catabolic enzymes ADAMTS576 MMP377 andMMP1378 which mediate the degradation of cartilagematrix Proammatory cytokines drive the expression ofthese catabolic factors in chondrocytes through the activationof transcription factors such as HIF2α32 and NFκB79Abnormalities in various metabolic pathways such as glucose80 or amino acid metabolic system81 in chondrocyteshave been implicated in activating catabolic cascades inosteoarthritic cartilage82 Moreover increased cellular uptakeof Zn2 through the upregulation of zinc transporter ZIP8activates metalregulatory transcription factor1 MTF1which in turn induces the expression of matrixdegradingenzymes in chondrocytes3383 Regulation of catabolism bythefurthershowed the association of metabolic abnormalities with thecatabolic process of OA34cholesterolCH25HCYP7B1RORαaxisMeanwhile the upstream regulatory mechanism eliciting an imbalance in OA matrix homeostasis needs furtherinvestigation OAcausing factorssuch as age andmechanical stress lead to excessive oxidative stress inchondrocytes3738 Consistently clinical and preclinicalOA studies indicated a cumulative oxidative burden inosteoarthritic chondrocytes3940 Emerging evidence suggests that oxidative stress plays a significant role in OAdevelopment and the disease progression can be mitigatedby counteracting oxidative stress3684In generalOfï¬cial journal of the Korean Society for Biochemistry and Molecular Biologyoxidative stress results from the abnormal production ofROS and the loss of cellular antioxidant capacity Synovialï¬uid from patients with latestage OA who were undergoing knee joint replacement had a lower level of oxidoreductases than that from healthy controls87 In partthe increase in oxidative stress is attributable to mitochondrial dysfunction in OA chondrocytes8889 OAchondrocytes displayed reduced mitochondrial DNAcontent mitochondrial dysfunction and diminishedexpression of NRF2 which regulates the transcription ofoxidoreductase genes89 Similarly chondrocytes fromaged individuals exhibited increased ROS burden andmitochondrial and genomic DNA damage90 Therefore the proper maintenance of redox homeostasis canpotentially serve as a rational therapeutic strategy toprotect against OA progressionPotential roles of selenium metabolism in OAThe protective effect of selenium in OA has beenexplored in a large number of epidemiological and geneticstudies Table The concentration of selenium in serumwas significantly lower in OA patients than that of normalcontrols25 Similarly the results from a populationbasedcohort study demonstrated the linkage between lowselenium levels in toenails with OAassociated pain anddisease severity2627 Several studies have indicated thatcartilage matrix homeostasis is impaired in seleniumdeï¬ciency Lowselenium status diminished COLIIexpression level regulated by SOX9 which is known as amaster regulator required for maintaining cartilage matrixIn fact SOX9 was destabilized by thehomeostasisdownregulation ofseleniumresponsive PRMT5 thatsustains SOX9 stability via methylation93 In anotherstudy rats fed a seleniumdeï¬cient diet exhibited lowsulfotransferase activity which resulted in diminishedforcontents ofmechanicalcartilagematrix28 In contrast selenium supplementation ameliorated the spontaneous degeneration of articular cartilagein STR1 N mice by increasing the expression of GPXs94In cultured chondrocytes pretreatment with SeMetmarkedly inhibited nitric oxide NO and prostaglandinE2 PGE2 production in response to proammatorycytokine IL1β95 Expression of SBP2 a factor recognizingSECIS element had a positive correlation with GPX1 andGPX4 expression and antioxidant capacity in chondrocytes96 Oxidation resistance mediated by SBP2 wasdiminished in response to IL1β treatment in vitro and indamaged regions of cartilage in OA patients96 Downregulation of selenoprotein mRNAs including GPX397GPX1 and GPX49698 and Selenop99 was observed inhuman and mouse OA chondrocytessulfated glycosaminoglycan essentialstressabsorbingpropertyofGenetic factors such as SNPs in selenoproteins wereidentiï¬ed to be risk factors for OA development A GAG 0cKang Experimental Molecular MedicinePage of Table List of selenoproteins associated with the pathogenesis of arthropathies KBD and OAGeneGPX1GPX3GPX4DIO2DIO3SELENOFSELENOPSELENOSFunctionExpression in OASNPAntioxidantReduction of hydrogen peroxide and anic peroxidesDownregulatedPlasma antioxidantDetoxiï¬cation of lipid hydroperoxidesMetabolism of lipidsActivation of hormonesDeiodination of T4 to T3Inactivation of hormonesConversion of T4 to rT3Protein foldingStorage and transport of SeAntioxidant propertiesProtein foldingERassociated protein degradationDownregulatedDownregulatedUpregulatedDownregulatedrs1050450 KBDrs3811699 KBDrs1800668 KBDrs225014 OArs12885300 OArs945006 OArs5859 KBDrs28665122 KBDRefhaplotype in SELENOS gene was significantly associatedwith increased levels ofammatory factors in OApatient plasma100 SNPs in DIO2 which converts precursor thyroid hormone T4 to its active form T3 were alsorelated to genetic susceptibility to OA developmentLevels of DIO2 mRNA and protein were markedly upregulated in OA cartilage101 A common DIO2 haplotypecomposed of the minor Callele of SNP rs225014 and thecommon Callele of SNP rs12885300 was significantlyassociated with advanced hip OA as indicated by a higherodds ratio101 Locus rs225014 which confers risk toOA was associated with the differential methylation ofCpG located in the upstream region of DIO2 gene andwas correlated with upregulated DIO2 expression inOA104 Meanwhile DIO3 depletes the resources that canbe utilized for the production of active thyroid moleculesby catalyzing the conversion of T4 and T3 into inactivemetabolites The minor Gallele of the DIO3 variantrs945006 was associated with a protective effect againstOA development105However a few aspects regarding the relationshipbetween selenium and OA remain controversial Firstseveral studies indicate that there are no differences inselenium levels between OA and normal tissues Theselenium concentrations in synovial ï¬uid and plasma of OA patients were not significantly different from thoseof healthy controls106 Similarly no significant difference in selenium concentration was noted between sixdogs with posttraumatic OA and six control dogs107Second the beneï¬cial effect of selenium supplementationin alleviating OA symptoms has been debated The resultsfrom a controlled doubleblind trial of patientsOfï¬cial journal of the Korean Society for Biochemistry and Molecular Biologyrevealed that the supplementation of a formulation containing selenium with vitamins A C and E SeACE didnot have any remarkable curative effect compared to aplacebo108 In a study with an independent cohort theprevalence of radiographic knee OA was not significantlyassociated with dietary selenium intake109Nonethelessit is apparent that selenium deï¬ciencydysregulation of selenoproteins and genetic variations inselenoprotein genes serve as potential risk factors for OAThe vital role of selenium metabolism in maintainingcartilage homeostasis is expected considering its criticalinvolvementin regulating cellular processes such aschondrogenic differentiation of progenitor cells maintenance of redox homeostasis and DNA damage repair inchondrocytes which are covered in the next sectionIntracellular roles of selenium metabolism andselenoproteins in cartilageChondrogenic differentiation programs of progenitor cellsSelenium exerts various beneï¬cial effects to promoteproliferation and differentiation of chondrogenic progenitorcells110111 Selenium supplementation stimulated the proliferation of ATDC5 chondrogenic cells even under serumdeprivation by inducing cyclin D1 expression110 Deï¬ciencyof SELENOO interfered with the chondrogenic differentiation of ATDC5 cells by suppressing the expression ofchondrogenic genes SOX9 COLII and aggrecan anddecreasing the activity of alkaline phosphatase112 Knockdown of Gpx1 reduced the chondrogenic differentiation ofATDC5 cells by modulating intracellular GSHoxidizedGSH GSSG ratio113 Selenop was differentially upregulatedduring the chondrogenic differentiation of micromass 0cKang Experimental Molecular MedicinePage of culture of mesenchymal cells isolated from mouse limbbuds114 In line with the effects of selenium metabolism andselenoproteins in chondrogenic progenitor cells observedin vitro deï¬cient uptake of selenium severely affectedchondrogenic differentiation of mesenchymal lineage cellsin mice64andOsteochondroprogenitorspeciï¬c deletion of Trsp genesignificantly impaired chondrogenic programs causingabnormalities in bone and cartilage development in mice73endochondralossiï¬cationthusAntioxidant defense and redox homeostasisfunction ofattributed to theThe protective effects of selenium on cartilage are primarilyantioxidantdefense115 The metabolism and survival of chondrogenic progenitors and chondrocytes are greatly compromised by ROS including free radicals peroxides andsuperoxide anions118 Recent studies strongly supportthe notion that mitochondrial dysfunction and oxidativestress are the main drivers of OA pathogenesis37Although ROS play essential roles in the maintenance ofbasal cellular activities such as chondrocyte proliferationand matrix remodeling in cartilage excessive oxidativestress causes detrimental events such as cellular senescence36121 dedifferentiation122 and apoptosis123 ROScause oxidative damage to various cellular componentsand disrupt the balance between ECM catabolism andanabolism119 ROS suppress mitochondrial oxidativephosphorylation and ATP production which are essentially required to sustain cartilage matrix synthesis124 Inaddition ROS induce matrix degeneration through theupregulation of matrixdegrading enzyme expressionwhile this effecttreatment123125 The detrimental effects of ROS on cartilagehomeostasis can be effectively alleviated by augmentingcellular antioxidant activity under stress conditions andseveral attempts have been made to treat OA by targetingthe regulators involved in oxidative stress production incartilage84is abolished by antioxidantThe protective role of selenium metabolism is thoughtto be exerted through the neutralization of ROS viaantioxidant activities of selenoproteins including GPXsand TXNRDs Bone marrow stromal cells cultured inmedium supplemented with low selenite concentrationexhibited ROS accumulation along with the reducedexpression of GPXs TXNRDs and other seleniumindependentinmicronuclei generation which is an indication of chromosome damage126 Both GPX1 expression and activitywere substantially lower in mice fed a seleniumdeï¬cientdiet than those in mice fed a normal dietleading todecreased trabecular number reduced femoral trabecularvolumetotal bone volume ratio and trabecular separation66 The rats exposed to a seleniumdeï¬cient diet withT2 toxin showed increased lipid peroxidation level andoxidoreductaseenzymesresultingOfï¬cial journal of the Korean Society for Biochemistry and Molecular Biologydecreased antioxidant GPX activity in their serum andcartilage127 A seleniumdeï¬cient dietinduced theexpression of miR1385p which in turn suppressed theexpression of SELENOM that has antioxidant functionand caused mitochondrial dysfunction and apoptosis ofchondrocytes128 Lead Pbinduced oxidative stress andtoxicity reduced the expression of selenoprotein mRNAsand the effect was mitigated by selenium supplementation129 In summary the antioxidant properties of selenoproteins showed therapeutic potential by counteractingthe accumulation of damage induced by oxidative stress incartilageDNA damage repairIt is well known that DNA damage pathways play substantial roles in the progression of arthropathies119 Theexpression of genes related to DNA damage was changedin the cartilage of KBD patients130131 Chronic DNAdamage induces the initiation of apoptosis or cellularsenescence in chondrocytes36132133 Selenium has apotential to reduce DNA damage and increase DNArepair capacity134 In part the beneï¬cial effect of seleniumon genomic stability is associated with the antioxidationeffect of selenoproteins such as GPXs and TXNRDswhich remove ROS before they cause DNA damage134Cancer cells supplemented with selenium nM sodiumselenite or μM SeMet showed elevated levels of GPX1and TXNRD1 enzyme activity effectively protectingagainst DNA strand breaks induced by ultraviolet A orH2O2induced oxidative stress135 SeMet reduced theextent of DNA damage and enhanced DNA repair capacity by inducing repair complex formation in DNAdamaged cells through U | Thyroid_Cancer |
"MiRNAs play important roles in the development of ovarian cancer activation of primitive folliclesfollicular development oocyte maturation and ovulation In the present study we investigated the specific role ofmiR23a in cov434 cellsResults Downregulation of miR23a was observed in serum of PCOS patients compared with the healthy controlsuggesting the inhibitory effect of miR23a in PCOS MiR23a was positively correlated with Body Mass Index BMI andnegatively correlated with Luteinizing hormone LH Testostrone T Glucose Glu and Insulin INS of PCOS patientsMiR23a mimic inhibited the proliferation and promoted apoptosis of human cov434 cells In addition flow cytometryassay confirmed that miR23a blocked cell cycle on G0G1 phase MiR23a inhibitor showed opposite resultsFurthermore double luciferase reporter assay proved that miR23a could bind to the UTR of FGD4 directly throughsites predicted on Target Scan FGD4 level was significantly suppressed by miR23a mimic but was significantlyenhanced by miR23a inhibitor We further proved that miR23a increased the expression of activated CDC42 GTPbround and pPAK1 suggesting that miR23a induced cell cycle arrest through CDC42PAK1 pathwayConclusions In our study reveals that miR23a participates in the regulation of proliferation and apoptosisof cov434 cells through target FGD4 and may play a role in the pathophysiology of PCOSKeywords miR23a Polycystic ovary syndrome FGD4 Binding site Cell cycleBackgroundPolycystic ovary syndrome PCOS is the most common reproductive endocrine and metabolic disorder disease inwomen characterized by ovulation disorders hyperandrogenism and insulin resistance [ ] PCOS affects about of women of childbearing age accounting for ofanovulatory infertility and usually a lifelong disease Itscommon clinical manifestations include menstrual disorders subfertility acne vulgaris alopecia seborrheia obesity hirsutism and acanthosis [] Women with PCOS havean increased risk of insulin resistance hypertension type Correspondence linjinet163com3Gynaecology Mindong Hospital in Ningde City No Heshan Road FuanFujian ChinaFull list of author information is available at the end of the diabetes oxidative stress dyslipidemia cardiovasculardisease and endometrial cancer [] Therefore understanding the molecular mechanism of metabolic diseases underlying the pathophysiology of PCOS will help to identify newdiagnostic and therapeutic strategies In addition althoughthe exact etiology of PCOS remains to be understood ithas been clear that the survival and proliferation of granulosa cells are closely related to the pathogenesis of PCOS[]In recent years the role of microRNAs miRNAs inovarian physiology and pathology has attracted muchattention Some studies have shown that miRNAs playimportant roles in the development of ovarian canceractivation of primitive follicles follicular developmentoocyte maturation and ovulation [] Several studies The Authors Access This is licensed under a Creative Commons Attribution International Licensewhich permits use sharing adaptation distribution and reproduction in any medium or format as long as you giveappropriate credit to the original authors and the source provide a link to the Creative Commons licence and indicate ifchanges were made The images or other third party material in this are included in the 's Creative Commonslicence unless indicated otherwise in a credit line to the material If material is not included in the 's Creative Commonslicence and your intended use is not permitted by statutory regulation or exceeds the permitted use you will need to obtainpermission directly from the copyright holder To view a copy of this licence visit httpcreativecommonslicensesby40The Creative Commons Public Domain Dedication waiver httpcreativecommonspublicdomainzero10 applies to thedata made available in this unless otherwise stated in a credit line to the data 0cLin Journal of Ovarian Research Page of have found a variety of differentially expressed microRNAs in ovarian granulosa cells of PCOS patients whichare closely related to the proliferation and apoptosis ofovarian granulosa cells and the production of progesterone estradiol and testosterone [ ]responsibleforinducing caspasedependentThe human miR23a gene is located on chromosome of the human genome and transcribed into a part of themiR23a27a242 cluster [] Mi23a27a242 clusterwhich encodes primicroRNA transcripts composed ofthree kinds of miRNAs miR23a miR27a and miR242isandcaspaseindependent apoptosis of embryonic kidney cellsHEK293Tthrough human cJun Nterminal kinasepathway [] In recent years more and more evidencehas shown that miR23a is essential for folliculogenesis Ithas been reported that the expression of circulating miR23a of patients with PCOS was downregulated comparedwith healthy women and proved that miR23a is a betterindicator for evaluation of PCOS than the miR23b []However as far as we know the specific role and mechanism of miR23a in PCOS have not been studiedStudies proved that miR23a issignificantly upregulated in premature ovarian insufficiency POI patients serum and poor ovarian response POR patientsovarian granulosa cells [] Compared with normalwomen miR23a was significantly upregulated in follicular cells of women receiving assisted reproductive technology ART due to oviduct and endometriosis []More critically miR23a can promote the apoptosis byaffecting the expression of multiple targetsincludingXIAP SMAD5 and Sirt1 [ ]Thereforein the present research we hypothesizedthat miR23a is involved in the development of PCOS byregulating downstream pathways related to cell survivalin ovarian cells The objective of this study was to confirm the regulatory effect and mechanism of miR23a onthe growth of cov434 cells We analyzed the expressionof miR23a in serum samples from PCOS patients andhealthy women and the correlation between miR23alevel and PCOS symptoms We focused on a new molecular mechanism by which miR23a induces apoptosisin granular cellsdisease smoking and using alcohol or drugs The serumof healthy women was collected as the control groupThe volunteers in the control group had normal menstruation normal ovaries and no history of reproductivesystem disease or appendicitis The control and PCOSgroup did nottake any medications in the past months including oral contraceptives or other hormonalmedications with no intrauterine devices or smokingPatients with reproductive system disease or appendicitishistory were excluded from the control group All volunteers had understood the purpose and requirements ofthis study and signed a written informed consent beforeparticipating in the study ml of elbow venous bloodfrom each sample was taken and stored in a refrigeratorat °C All the experiments involved in this studyhave obtained the ethical approval of Mindong hospitalin Ningde CityEvaluation of BMI and sex hormoneThe weight and height of the volunteers were measuredto calculate Body mass index BMIBMI weightheight2 Radioimmunoassay RigorBio Scientific andTechnology Co Beijing was used to measure the levelof total testosterone and other sex hormonesCell line and transfectionCell lines KGN derived from a granulosa cell tumorcov434 derived from a granulosa cell tumor and SVOGderived by immortalization of granulosaluteal cellsusing SV40 large T antigen were purchased from cellresource bank of Chinese Academy of Sciences cells were seeded into well plates MiR23a micmic nM miR23a inhibitor nM and negative control NC nM mimic NC and nM inhibitor NCRuibo Biotechnology Co Ltd Guangzhou China weretransfected into cov434 cells by Lipofectamine¢ Normal untreated cov434 cells were cultured as control Thesequence of siRNA used in this study is as follows miR23amimic ²CCTTTAGGGACCGTTACACTA3² mimicNC ²TTCTCCGAACGTGTCACGTTTC3² miR23ainhibitor ²TAGTGTAACGGTCCCTAAAGG3² inhibitor NC ²TTCTCCGAACGTGTCACGTTTC3²Materials and methodsSamplesThe serum of Chinese women with PCOS was collected in Mindong hospital Ningde City Fujian Provincefrom September to December According tothe revised PCOS diagnostic criteria published by theRotterdam consensus [] the PCOS group excluded patients with Cushings syndrome delayed congenital adrenal hyperplasia thyroid dysfunction hyperthyroidismhyperprolactinemia or androgen secreting tumor as wellas patients with diabetes hypertension chronic kidneyReal time fluorescence quantitative PCR qPCRTotal RNA were extract from samples or cells using Trizolreagent Related expression of target gene was calculatedusing 2ÎÎCt method This study involves the followingsequences miR23a3p Reverse transcription ² GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGAAAT3² miR242 Reverse transcription ²GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGTGT3² miR27a3P ²GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCGGAA3² U6 Reverse transcription ²AAAATATG 0cLin Journal of Ovarian Research Page of GAACGCTTCACGAATTTG3² miR23a3p forward primer ²GCGATCACATTGCCAGGG3² and reverse primer²AGTGCAGGGTCCGAGGTATT3² miR242 forwardprimer ²CGCGTGCCTACTGAGCTGAA3² and reverseprimer ²AGTGCAGGGTCCGAGGTATT3² miR27a3Pforward primer ²GCGCGTTCACAGTGGCTAAG3² andreverse primer ²AGTGCAGGGTCCGAGGTATT3² U6forward primer ²CTCGCTTCGGCAGCACATATACT3²and reverse primer ²ACGCTTCACGAATTTGCGTGTC² FGD4 forward primer ²CCTGCCTCTGCTTCTTGTGTCTC3² and reverse primer ²TGGTTGTCAATCCATGCCTTCCTG3²Cell proliferation assayAfter h of transfection cells were seeded into a well plate at the density of cells per well Eachgroup of cells was treated with replicates After incubation for the specified time and h μl of CCK8 reagent was added and incubated at °C for h The absorbance of each pore was measured at nm by an enzyme labeling instrumentFlow cytometry analysis for cell cycleAfter h of transfection the cell cycle was detected byflow cytometry The cells were fixed with ethanolovernight at °C The cells were resuspended with μl of binding buffer μl PI was added to the cellsuspension and incubated at room temperature for min The results were analyzed by ModFit and displayedby FL2w and FL2aFlow cytometry analysis for apoptosisAfter h of transfection the apoptotic cells were detected by flow cytometry μl of PI and FITC annein Vwere added into μl cell suspension and incubated atroom temperature for min Cell apoptosis was detected using a flow cytometerWestern blotThe total protein was extracted with RIPA buffer BCAmethod was used to detect the protein concentrationThe extracted protein was electrophoresis by SDSPAGEand transferred to PVDF membrane PVDF membranewas incubated in skimmed milk at room temperaturefor h and then primary antibody overnight at °Cfollowed by the secondary antibody at room temperaturefor h QUANTITY ONE software is used for resultanalysis The following antibodies were used in this research antiFGD4 Abcam ab97785 87KDaantiCDC42 Abcam ab155940 21KDa antiPAK1 Abcam ab223849 60KDa and βactinTransGen Biotech HC201 42KDaDouble luciferase reporting assayThe plasmids of wild type FDG4WT and mutant typeFDG4MUT luciferase reporter genes were constructedusing pcDNA31as the empty vector MiR23a mimicmimic NC FDG4WT and FDG4MUT plasmids were cotransfected into cov434 cells by LipofectamineTM Cells were divided into four groups FGD4WT ²UTR miR23a mimic NC FGD4Mut ²UTR miR23a mimicNC FGD4WT ²UTR miR23a mimic FGD4Mut ²UTR miR23a mimic After h of transfection FirelyLueiferase F and Renilla Luciferase R were detected byGLOMAX \\fluorescence detector and the relativeluciferase activity F R was calculatedStatistical analysesAll data were analyzed with SPSS SPSS Inc Chicago IL software and represented as mean ± SD Spearman method was used to analyze the relationshipbetween miRNA level and other indicators Independentsample ttest was used to evaluate the difference between two groups and Oneway ANOVA was used toanalyze the difference between three and more groupswith post hoc contrasts by Bonferroni test P wasconsidered statistically significantResultsMiR23a was downregulated in serum of PCOS patientsPeripheral blood was collected from local PCOS patients for the detection of miR23a level with healthywomens peripheral blood as the control Clinical information on age BMI and sex hormone levels of PCOSpatients and normal control samples are alllisted inTable As shown in Fig 1a the serum miR23a level inPCOS patients was significantly lower than that in thecontrol group P Then we detected the level ofmiR27a and miR242 using qPCR As shown in Fig 1amiR27a and miR242 also downregulated in peripheralblood of PCOS patients compared with healthy sampleTable The clinical information of PCOS and control groupsClinical indexPPCOSn ± Controln ± ± ± ± ± ± ± ± ± ± ± AgeE2 pgmLBMI Kgm2LH mIUmLFSH mIUmLPRL mIULT mIUmL ± ± ± Glu nmolmLINS μUmLE2 Estradiol BMI Body Mass Index LH Luteinizing hormone FSH Folliculestimulatinghormone PRL Prolactin T Testostrone Glu Glucose INS Insulin ± ± ± 0cLin Journal of Ovarian Research Page of Fig MiR23a was downregulated in serum of PCOS patients a qPCR was performed to detect the expression of miR23a in PCOS samplePCOS and healthy control Normal b miR27a and miR242 levels were detected using qPCR in PCOS and normal group Correlation betweenmiR23a level and BMI was analyzed in PCOS c and control d group Correlation between miR23a level and LH was analyzed in PCOS econtrol f group Correlation between miR23a and GLU level was analyzed in PCOS g and control h group Correlation between miR23a andINS level was analyzed in PCOS i control j group Correlation between miR23a and T level was analyzed in PCOS k and control l groupP P P The correlation between the expression of miR23a andclinical index of PCOS patientsWe further analyzed the correlation between the expression of miR23a and clinical index As shown in Table the BMI of PCOS patients were significantly higher thanthat of healthy controls P The correlation analysis showed that there was a positive correlation between serum miR23a level and BMI in PCOS patientsFig 1b P r but no correlation wasfound in healthy control group Fig 1c P r As shown in Table the serum LH concentration in PCOS patients was ± mIUmL whichwas significantly higher than that in healthy women ± mIUmL P Furthermore therewas a negative correlation between serum miR23a leveland LH concentration in PCOS patients Fig 1d P r but no correlation was found in healthy controlgroup Fig 1e P r The serum miR23alevel was also negative correlated with GLU Fig 1fP r INS Fig 1h P r and T Fig 1j P r concentration inPCOS patients but not in healthy control group GLUFig 1g P r INS Fig 1i P r and T Fig 1k P r MiR23a inhibits the proliferation of cov434 cellsIn this study the expression of miR23a in three humangranulosa cell lines was detected by qPCR As shown inFig 2a the expression level of miR23a was lowest incov434 cells and highest in KGN cells Therefore wechose cov434 cell line for subsequent experiments Subsequently miR23aspecificsiRNA or mimic was transfected into cov434 cells to explore the role of miR23aAs shown in Fig 2b the expression of miR23a in cells 0cLin Journal of Ovarian Research Page of Fig MiR23a inhibits the proliferation of human ovarian granulosa cells a The expression of miR23a in three human ovarian granulosa celllines KGN cov434 and SVOG was detected by qPCR b MiR23a was overexpressed by the transfection of miR23a mimics c MiR23a was knockeddown by the transfection of miR23a inhibitor d CCK8 was performed to detect the proliferation of cov434 cells P P was significantly increased by the transfection of miR23a mimic P Similarly the expression of miR23a in cells was significantly knocked down by the transfection of miR23a inhibitor Fig 2c P Then CCK8 assay was performed to detect the effectof miR23a on the proliferation of cov434 cells Asshown in Fig 2d compared with the control group thetransfection of miR23a mimic significantly inhibited theproliferation of cov434 cells P on the contrarythe transfection of miR23a inhibitor significantly promoted the proliferation of cov434 cells P Thesedata proved that the expression level of miR23a was involved in the regulation of cov434 cell proliferationMiR23a induced cell cycle arrest on G0G1 phase ofcov434 cellsNext flow cytometry was used to detect the effect ofmiR23a on the cell cycle of cov434 As shown in Fig cells stagnated in G0G1 phase after transfection ofmiR23a mimic P and the proportion of cells inS phaseand G2M phase decreased significantlyP The results were consistent with the inhibition of cell proliferation by overexpression of miR23asuggesting that miR23a induced cell cycle arrest andthus inhibit cell proliferation in cov434 cells On thecontrary the proportion of G2M phase cells increasedsignificantly in the miR23a inhibitor group P while that of G0G1 and S phase cells decreased P The results showed that low expression of miR23a promoted cell cycle progression and thus cell proliferationMiR23a promotes apoptosis of cov434 cellsFlow cytometry was performed to detect the effect of theexpression of miR23a on the apoptosis of cov434 cellsAs shown in Fig apoptotic cells increased significantlyP after the transfection of miR23a mimic anddecreased significantly P after the transfection ofmiR23a inhibitor These results suggested that overexpression of miR23a promoted apoptosis while low expression of miR23a inhibited apoptosisFGD4 is the bind target of miR23a in cov434 cellsThen we predicted six novel potential target of miR23avia the analysis on bioinformatics software Target ScanSubsequently the results of double luciferase reporterassay proved that only FGD4 could bind to miR23a directly through predicted sites The binding sites areshown in Fig 5a Cotransfection of miR23a mimicinhibited the luciferase activity of FGD4WT plasmidP but had no effect on the luciferase activity ofFGD4Mut plasmid Fig 5b The results showed thatmiR23a and FGD4 bind directly through predictive sitesThe effect of miR23a on the expression of FGD4 incov434 cells was investigated using qPCR and westernblot As shown in Fig 6a the expression of FGD4 wassignificantly decreased by the transfection of miR23amimic P whereas the transfection of miR23a 0cLin Journal of Ovarian Research Page of Fig MiR23a induced cell cycle arrest on G0G1 phase of cov434 cells a Flow cytometry was used to detect the effect of miR23a on the cellcycle of cov434 with transfection of miR23a mimics or inhibitor b Column diagram showed the analysis of cell cycle P inhibitor significantly increased the mRNA expression ofFGD4 in cov434 cells P As shown in Fig 6b andc the protein level of FGD4 was significantly decreasedby the transfection of miR23a mimic P whereasthe protein level of FGD4 was significantly increasedby miR23a inhibitor P Combining with thedouble Luciferase Report experiment these results indicated that miR23a physically bind to the ²UTRregion of FGD4 thereby regulating the level of FGD4in cov434 cellsMiR23a induces the activation of CDC42PAK1 signalingpathway in cov434 cellsCDC42 is a member of the Rho GTPase protein familyFGD4 is responsible for activating CDC42 through GTPexchange of GDP PAK1 a serinethreonine kinase wasinitially identified as a protein interacting with CDC42[] CDC42PAK1 signaling pathway involved in theregulation of cell proliferation apoptosis and cell cycle[] As shown in Fig 6d the protein expression of activated CDC42 GTP bround was significantly increasedby the transfection of miR23a mimic P and significantly decreased by the transfection of miR23a inhibitoreffect of miR23a on theexpression of pPAK1 protein was similar to that ofCDC42 protein Fig 6fP TheDiscussionIn this study we explored the differences in serum levelsof miR23a between PCOS patients and normal womenas well as the effects of miR23a on biological behaviorsuch as proliferation and apoptosis of cov434 cells andrelated specific molecular mechanisms in order to provide limited theoretical support and experimental datafor the application of miRNA in PCOS treatmentFirstly we found that compared with healthy womenthe serum level of miR23a in PCOS patients decreasedsignificantly According to previous reports the level ofmiR23a in patients with ovarian disease remains uncertain Yang reported that miR23a was highlyexpressed in the plasma from premature ovarian failure POF patients compared with controls with afold change [] However Dang et alfoundthat miR23a is downregulated in the plasma ofChinese patients with premature ovarian failure []This inconsistency may be caused by individual differences and low sample size MiR23a level in patientswith ovarian disease still needs to be verified in alarge number of samplesMoreover miR23a was positively correlated with BMIand negatively correlated with serum LH T Glu andINS concentration Hyperandrogenism and hyperinsulinemia in PCOS patients are the most important physiological changes exacerbating endocrine disorders [] 0cLin Journal of Ovarian Research Page of Fig MiR23a promotes apoptosis of human ovarian granulosa cells a Flow cytometry was used to detect the effect of miR23a on theapoptosis of cov434 with transfection of miR23a mimics or inhibitor b Column diagram showed the analysis of cell apoptosis P MiR23a is closely related to the changes of hormonelevels suggesting that it may be involved in the progression of PCOS and is a potential clinical treatment targetMurri also reported an inverse relationship betweenBMI and LH concentrations in patients with PCOS []Serum is composed of multiple components from a variety of tissues and ans Therefore the concentration ofmiR23a in serum is regulated by a variety of componentsand factors In addition the results also indicated that thedecrease in miR23a had a negative impact on the occurrence of PCOS and the increase in LHThen we investigated the role of miR23a in cov434cells We have found that miR23a can affect the proliferation of cov434 cells by regulating cell cycle and participate in the regulation of cell apoptosis through aseries of cell functional studies It has been shown thatmiR23a is closely related to apoptosis by inhibiting theexpression of Apaf1 and Bcl2 apoptotic proteins including Noxa Puma and Bax in neurons [] It hasalso been reported that miR23a protects differentiatedembryonic stem cells from apoptosis induced by bonemorphogenetic protein BMP4 by targeting SMAD5[] These data provide strong support for our resultssuggesting that miR23a may be closely related to granulosa cell apoptosis through a variety of pathwaysThese results suggest that miR23a may be closely related to the pathogenesis and development of PCOSTherefore we further study the molecular mechanism ofmiR23a involved in the proliferation and apoptosis ofcov434 cells The biological functions of miRNAs depend mainly on their effects on targets The same microRNAs may have hundreds oftarget proteins thosechange with cell type and cell state MiR23a can promote the apoptosis of cov434 cells by affecting the expression of multiple targets [ ] At presentmany targets have been found including Xlinked inhibitor of apoptosis protein XIAP SMAD5 and Sirt1 [] In this study we found FGD4 as a new target ofmiR23a The direct interaction between the ²UTR region of FGD4 mRNA and the expression of miR23awas demonstrated by double luciferase reporter assayThe results of qPCR and Western blot showed thatoverexpression of miR23a inhibited the expression ofFGD4 at the level of protein and mRNA while low expression of miR23a promoted the expression of FGD4at the level of protein and mRNAFGD4 is a Guanine Nucleotide Exchange Factor GEFspecific to CDC42 Rho GTPase and also an Factinbinding protein which is essential for maintaining myelin formation in Schwann cells [] FGD4 consists of N 0cLin Journal of Ovarian Research Page of Fig FGD4 binds to miR23a via the UTR in cov434 cells a the binding site of miR23a to UTR of FGD4 b Double luciferase reporter assaywas performed to confirm the binding between miR23a and FGD4s UTR P terminal Factin bindingFAB domain Dbl homologyDH domain two pleckstrin homology PH domainand FYVE domain [] FGD4 has many functions including binding to Factin through FAB domain activating Rho GTPasetransduction pathway byincreasing the concentration of CD42 binding to GTPsignalThe structure domain of FGD4 indicates that it acts as acrosslinker between membrane structure and actincytoskeleton therefore the functional deletion mutationof FGD4 coding gene may result in truncated FGD4 expression and lead to motor sensory neuropathy orCharcotMarieToothCMTtype [ ] TheFig MiR23a induces the activation of CDC42PAK1 signaling pathway in cov434 cells a The expression of FGD4 was detected using qPCR incov434 cells with transfection of miR23a mimics or inhibitor b Western blot was performed to detect the levels of CDC42 and pPAK1 incov434 cells with transfection of miR23a mimics or inhibitor c Column diagram showed the expression level of FGD4 d Column diagramshowed the expression level of CDC42 e Column diagram showed the expression level of pPAK1 0cLin Journal of Ovarian Research Page of mutation is mediated by inhibiting guanine nucleotideexchange leading to the decrease of CDC42 activity andthe demyelination of peripheral nerves ultimately However in this study mir23a expression and function wereonly studied by using patients peripheral blood and celllines cultured in vitro The expression and function ofmir23a in vivo and patients ovarian cells still need further verificationIn addition recent studies have shown that FGD4 expression in prostate cancer clinical samples is significantly upregulated compared with the normal groupand downregulation expression of FGD4 in prostatecancer cell lines can cause cell cycle arrest and proliferation reduction [] It seems that FGD4 is also involvedin the tumorigenesis of nasopharyngeal carcinoma dueto its activation of CDC42 [] Studies have shown thatactivated CDC42 regulates downstream signals such asPAK1 WASP and ACK PAK1 as a serinethreoninekinase was originally identified as a protein that interacts with CDC42 and was subsequently found to serveas a downstream node for various oncogenic signalingpathways Studies have shown that the CDC42PAK1signaling pathway involved in cell cycle proliferationand apoptosis regulation [] Our study found thatmiR23a affects the expression of FGD4 as well as theprotein levels of activated CDC42 GTP bround and pPAK1 Therefore we hypothesized that miR23 regulated CDC42PAK1 signaling pathway by targetingFGD4 expression ultimately affecting apoptosis ofcov434 cellsIn our study reveals that the serum level ofmiR23a is significantly downregulated in PCOS patients and that miR23a participates in the regulation ofproliferation and apoptosis of cov434 cells through target FGD4 which may have potential for clinical treatment of PCOS patientsAcknowledgementsNot applicableAuthors contributionsJL and HH mainly performed the experiments and analyzed the data JL was amajor contributor in writing the manuscript LL helped with the data analysisand carried out the experiment design WL and JH helped with theexperiments and analysis All authors read and approved the final manuscriptFundingThis study was supported by Ningde medical technology improvementprojectAvailability of data and materialsAll data generated or analysed during this study are included in thispublished Ethics approval and consent to participateThis research study was approved by the Institutional Review Board of FujianMedical UniversityConsent for publicationNot applicableCompeting interestsThe authors declare that they have no competing interestsAuthor details1Graduate School Fujian Medical University Fuzhou China 2The 900thhospital of the Joint Service Support Force of the Chinese PeoplesLiberation Army Fuzhou China 3Gynaecology Mindong Hospital in NingdeCity No Heshan Road Fuan Fujian ChinaReceived December Accepted July ReferencesUtiger RD Insulin and the polycystic ovary syndrome Diabetes Res ClinPract Polak K Czyzyk A Simoncini T Meczekalski B New markers of insulinresistance in polycystic ovary syndrome J Endocrinol Invest httpsdoi101007s4061801605238Trikudanathan S Polycystic ovarian syndrome Med Clin N Am American College of Obstetricians and Gynecologists' Committee onPractice BulletinsGynecology ACOG Practice Bulletin No PolycysticOvary Syndrome Obstet Gynecol 20181316e157 httpsdoi101097AOG0000000000002656Li X The role of androgen in autophagy of granulosa cells from PCOSGynecol Endocrinol OvidiuLeonard B miRNA expression profiling in formalinfixedparaffinembedded endometriosis and ovarian cancer samples OncoTargets Ther Maalouf SW Liu WS Pate JL MicroRNA in ovarian function Cell Tissue ResKim SH Paeonol inhibits anaphylactic reaction by regulating histamineand TNFα Int Immunopharmacol Naji M Differential Expression of miR93 and miR21 in Granulosa Cellsand Follicular Fluid of Polycystic Ovary Syndrome Associating with DifferentPhenotypes Sci Rep Bindu M miR122 Regulates LHR Expression in Rat Granulosa Cells byTargeting Insig1 mRNA Endocrinology Chhabra R Dubey R Saini N Gene expression profiling indicate role of ERstress in miR23a27a24 cluster induced apoptosis in HEK293T cellsRNA Biol Xiong W Circulatory microRNA 23a and microRNA 23b and polycysticovary syndrome PCOS the effects of body mass index and sex hormonesin an Eastern Han Chinese population J Ovarian Res Guo Y Sun J Lai D Role of microRNAs in premature ovarian insufficiencyReprod Biol Endocrinol Yang X Role of microRNAs in premature ovarian insufficiency ReprodBiol Endocrinol Dang Y MicroRNA223p is downregulated in the plasma of HanChinese patients with premature ovarian failure Fertil Steril 807e1 Nie M Yu S Peng S Fang Y Wang H Yang X miR23a and miR27apromote human granulosa cell apoptosis by targeting SMAD5 Biol Reprod httpsdoi101095biolreprod115130690 Alford C Toloubeydokhti T AlKatanani Y The expression of microRNAmiRNA mir23a and 23b and their target gene CYP19A1 aromatase infollicular cells obtained from women undergoing ART[J] Fertil Steril 88suppS1 Nie M miR23a and miR27a Promote Human Granulosa CellApoptosis by Targeting SMAD5 Biol Reprod S¸rensen AE MicroRNA Species in Follicular Fluid Associating WithPolycystic Ovary Syndrome and Related Intermediary Phenotypes J ClinEndocrinol Metab jc20153588 Wu C Exercise activates the PI3KAKT signal pathway by decreasingthe expression of 5αreductase type in PCOS rats Sci Rep Murri M Effects of polycystic ovary syndrome PCOS sex hormonesand obesity on circulating miRNA21 miRNA27b miRNA103 and miRNA expression J Clin Endocrinol Metab 20139811E1835Sabirzhanov B Downregulation of miR23a and miR27a followingExperimental Traumatic Brain Injury Induces Neuronal Cell Death throughActivation of Proapoptotic Bcl2 Proteins J Neurosci 0cLin Journal of Ovarian Research Page of Musto A miR23a miR24 and miR27a protect differentiating ESCsfrom BMP4induced apoptosis Cell Death Differ Nie MY Yang X Physiological and pathological effects of miR23a and miR27a in ovary Horn M Myelin is dependent on the CharcotMarieTooth Type 4Hdisease culprit protein FRABINFGD4 in Schwann cells Brain Kondo D A novel mutation in FGD4 causes CharcotMarieToothdisease type 4H with cranial nerve involvement Neuromuscul Disord Zis P A novel mutation in the FGD4 gene causing CharcotMarietooth disease J Peripher Nerv Syst Edwards D PRL3 increases the aggressive phenotype of prostatecancer cells inVitro and its expression correlates with highgrade prostatetumors in patients Int J Oncol Liu HP EpsteinBarr VirusEncoded LMP1 Interacts with FGD4 toActivate Cdc42 and Thereby Promote Migration of NasopharyngealCarcinoma Cells PLoS Pathog 201285e1002690Kumar R Gururaj AE Barnes CJ p21activated kinases in cancer Nat RevCancer httpsdoi101038nrc1892Publishers NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliat | Thyroid_Cancer |
Decreased expression of the thyroid hormoneinactivating enzyme type deiodinase is associated with lower survival rates in breast canceriuri Martin Goemann1 Vicente Rodrigues Marczyk15 Mariana RecamondeMendoza23 Simone Magagnin Wajner15 Marcia Silveira Graudenz45 Ana Luiza Maia thyroid hormones tHs are critical regulators of cellular processes while changes in their levels impact all the hallmarks of cancer Disturbed expression of type deiodinase DIO3 the main tHinactivating enzyme occurs in several human neoplasms and has been associated with adverse outcomes Here we investigated the patterns of DIO3 expression and its prognostic significance in breast cancer DIO3 expression was evaluated by immunohistochemistry in a primary cohort of patients with breast cancer and validated in a second cohort using RnA sequencing data from the TCGA database DNA methylation data were obtained from the same database DIO3 expression was present in normal and tumoral breast tissue Low levels of DIO3 expression were associated with increased mortality in the primary cohort Accordingly low DIO3 mRnA levels were associated with an increased risk of death in a multivariate model in the validation cohort DnA methylation analysis revealed that the DIO3 gene promoter is hypermethylated in tumors when compared to normal tissue In DIO3 is expressed in normal and tumoral breast tissue while decreased expression relates to poor overall survival in breast cancer patients Finally loss of DIO3 expression is associated with hypermethylation of the gene promoter and might have therapeutic implicationsBreast cancer is the most common cancer in women worldwide accounting for more than two million new cancer cases and of all cancerrelated deaths in women in Despite remarkable advances in the treatment of breast cancer in recent decades not all patients benefit from current therapeutic options and thus will experience relapse23 Genomic tests improve the clinical prediction of patient outcomes and determine the necessity of adjuvant chemotherapy with endocrine therapy34 However it is a highly heterogeneous disease that is diverse in its behavior and responsiveness to the different modalities of treatment56 Breast cancer is characterized based on receptor and gene expression profiles that together with the classic clinicopathological variables guide the treatment and estimate the risk of recurrence34 Gene expression profiling studies have established at least four molecularly distinct types of breast cancer that can be expanded to the intrinsic subtypes luminal A LumA luminal B LumB HER2enriched basallike and normallike7Numerous studies have established thyroid hormones THs as critical regulators of multiple cellular processes in normal and tumor cells10 They contribute to cellular proliferation and differentiation during development and adulthood and are finetuned for tissuespecific control1011 Clinical studies associate TH levels with breast 1Thyroid Unit Endocrine Division Hospital de Clnicas de Porto Alegre Rua Ramiro Barcelos Porto Alegre RS CEP Brasil 2Institute of Informatics Universidade Federal Do Rio Grande Do Sul Porto Alegre Brazil 3Bioinformatics Core Hospital de Clnicas de Porto Alegre Porto Alegre Brazil 4Department of Pathology Hospital de Clnicas de Porto Alegre Porto Alegre Brazil 5Faculdade de Medicina Universidade Federal Do Rio Grande Do Sul Porto Alegre Brazil email almaiaufrgsbrScientific RepoRtS 101038s41598020708924Vol0123456789wwwnaturecomscientificreports 0cFigure a0 Patterns of expression of DIO3 in breast samples Immunostaining was performed as described in Materials and Methods From left to right A normal glandular breast tissue B breast carcinoma with low expression overall intensity C breast carcinoma with moderate expression overall intensity and D breast cancinoma with high expression overall intensity of DIO3 protein evaluated through immunohistochemistry The staining intensity level is used to calculate the Hscore combined with the percentage of positive cells see Methodscancer risk and mortality1213 while in a0vitro models demonstrate the effect of THs on breast cancer cell proliferation apoptosis and migration14 T4 promotes cell proliferation through the αv3 integrin receptor14 while the proliferative effects of T3 depend at least partially on the presence of estrogen receptors in breast cancer cells1718 Clinically however the effects of THs on specific histopathological and molecular subtypes of breast cancer are still unclear1920Modulation of THs concentrations is orchestrated by a group of selenoproteins called iodothyronine deiodinases which can activate and inactivate thyroid hormones21 Briefly the type deiodinase DIO1 catalyzes both activation and inactivation of thyroxine T4 generating triiodothyronine T3 and reverse triiodothyronine rT3 respectively22 Type deiodinase DIO2 acts locally converting the prohormone T4 into the active T3 Meanwhile type deiodinase DIO3 is the main THinactivating enzyme by degrading T4 and T3 to inactive metabolites rT3 and diiodothyronine respectively21 The DIO3 gene is found in the DLK1DIO3 genomic region which is located on human chromosome 14q3223 DIO3 gene is subject to genomic imprinting an uncommon epigenetic phenomenon that results in the preferential expression of one of the alleles paternal allele in the case2425 DIO3 gene expression is increased in several tissues during embryogenesis but it decreases in most tissues in adulthood2627 Notably DIO3 is expressed in normal and pathological hyperproliferative conditions where it has been implicated in cell proliferation and differentiation20252628 In particular studies have demonstrated that the local control of THs signaling provided by the regulation of DIO3 activity is associated with cancer development progression and recurrence28 We have previously reported that DIO3 mRNA and activity levels are increased in papillary thyroid cancer PTC which are associated with larger tumor size and the presence of lymph node and distant metastasis at diagnosis30 Others have described hyperexpression of this enzyme in basal cell carcinoma BCC where it modulates intracellular T3 concentrations and thus contributes to the cell tumorigenic potential31 DIO3 exerts a similar function in colon cancer which suggests that attenuation of the TH signal is part of the oncogenic process at least in some types of cancer28Considering the implied role of the DIO3 gene in human neoplasms and the potential effect of TH in breast carcinogenesis13 we investigated the expression patterns of DIO3 in normal breast tissue and breast cancer Here we demonstrate that DIO3 is expressed in normal breast tissue and breast cancer tissue In breast cancer reduced DIO3 expression is associated with decreased overall survival Interestingly loss of DIO3 expression might be explained at least partially by gene promoter hypermethylationResultsDIO3 in normal breast and fibroadenoma DIO3 immunohistochemistry staining was detected in all samples of normal breast tissue N at an overall moderate intensity Hscore ± DIO3 staining was predominantly cytoplasmatic and more pronounced in the apical extremity in luminal cells in both ducts and acini of the breast Fig a01A DIO3 was markedly positive in myoepithelial cells Fig a01A bottom Benign fibroadenoma lesions N were also positive for DIO3 staining with an intensity comparable to healthy tissue Hscore ± vs ± P Scientific RepoRtS 101038s41598020708924Vol1234567890wwwnaturecomscientificreports 0cCharacteristicMedian age at diagnosis rangeyearsTumor size in the largest dimensionmmMedian IQRMean ± SDEstrogen receptorno PositiveNegativeMissingProgesterone receptorno PositiveNegativeMissingHER2 statusno PositiveNegativeMissingHistological type of tumorno Invasive Ductal Carcinoma IDCInvasive Lobular Carcinoma ILCDuctal Carcinoma in a0situ DCISClinicalpathological subtypeno Luminal ALuminal BHER2Triple NegativeNon classifiedLymph node metastasisno YesNoDistant metastasisno YesNoTumor stagingno Stage IIIStage IIIIVMissingPretreatment hypothyroidismno Posttreatment hypothyroidismno Followup mean ± SDmonthsAllcause mortalityno Mean survival months CIPrimary cohort N Validation cohort N ± AJCC NANA PAM50 NANA Table Baseline characteristics of patients with breast cancer included in the primary cohort and in the validation cohort NA not available IQR interquatile range SD standard deviation HER2 human epidermal growth factor receptor2 AJCC American Joint Committee on Cancer Classified by the AJCC staging system Classified by PAM50 data available for patientsDIO3 protein in breast cancer the primary cohort To study DIO3 expression in breast cancer we analyzed a cohort of patients who had been seen at our institution primary cohort N and validated the results in the TCGABRCA cohort validation cohort N The clinicopathological characteristics of the patients from both cohorts are summarized in Table a0Patterns of DIO3 staining evaluated through immunohistochemistry in breast cancer samples are shown in Fig a01BD DIO3 staining in FFPE breast cancer tissues was positive in samples of invasive ductal carcinoma IDC with a mean Hscore of ± When evaluating invasive lobular carcinoma ILC only of samples was positive for DIO3 Hscore A sample of ductal carcinoma in a0situ DCIS was also positive for DIO3 expression Hscore A graph comparing the Hscore for DIO3 in nonmalignant tissues and malignant breast cancer types is presented in Fig a02A Mean DIO3 Hscores of primary tumors were similar to the nontumoral tissues with a marginal decrease in DIO3 seen in invasive lobular carcinoma ILC P Scientific RepoRtS 101038s41598020708924Vol0123456789wwwnaturecomscientificreports 0cType of tissuetumorANormalbreastDFibroadenomaIDCILCLymph node statusPNSerocSHerocSHEstrogen receptor statusHER2 statusCPNSpositivenegativeTNM stagingFPNSPNSpositivenegativeDistant metastasisPNSBEerocSHerocSHerocSHerocSHnegativepositiveabsencepresenceIIIIIIIVGLog Rank p0012liavvrusfoytilibaborPDIO3 positiveDIO3 negativePatients at riskDIO3 posDIO3 negMonthsFigure a0 DIO3 staining and clinicopathological characteristics of patients with breast cancer in the primary cohort AF Box plots of DIO3 staining in breast tissue samples evaluated through immunohistochemistry and quantified by HScore Samples were divided according to clinicopathological data as follows A type of tissue analyzed B ER status C HER2 status D lymph node status E distant metastasis and F TNM anatomic staging G KaplanMeier plot of overall survival in patients with the presence gray or absence black of DIO3 staining in breast cancer evaluated through immunohistochemistry ER estrogen receptor HER2 human epidermal growth factor receptor2 IDC invasive ductal carcinoma ILC invasive lobular carcinoma NS not significant P The mean Hscore of invasive ductal carcinoma was similar to that of normal tissue P No differences were observed between the molecular subtypes of breast cancer P data not shown There was no difference in the Hscore between tumors with ERpositive and ERnegative status P Fig a02B or between tumors with HER2positive and HER2negative status P Fig a02C Among the primary tumors there was no significant correlation between Hscore and Ki67 levels P or between Hscore and histological tumor grade P We found no association of DIO3 positivity negative or positive with tumor size P The mean Hscore in primary tumors of patients without nodal metastases was similar to that observed in patients with lymph node metastasis P Similarly Hscores of primary tumors of patients with distant metastasis did no differ from those without distant metastasis P Fig a02DE There were no differences on DIO3 Hscores when comparing patients with stage III vs stage IIIIV disease P Fig a02F We obtained both primary and lymph node tissues from patients In this subset of patients DIO3 staining was comparable between paired primary tumor and lymph node metastasis P Table a0 shows the variables associated with an increased risk of death in the primary cohort univariate analysis We observed that negative DIO3 staining was associated with poor prognosis HR CI to P Therefore additional studies were performed using KaplanMeier analysis and the logrank Scientific RepoRtS 101038s41598020708924Vol1234567890wwwnaturecomscientificreports 0cVariableAge at diagnosis yearsTumor size mmLymph node metastasis pos vs negDistant metastasis pos vs negER status pos vs negP status pos vs negHER2 positivity pos vs negTNM staging IIIIV vs IIIDIO3 status neg vs posHR CI P valueTable Univariate Cox regression analysis of overall survival in breast cancer patients in the primary cohort HR hazard ratio CI confidence interval ER estrogen receptor P progesterone HER2 human epidermal growth factor receptor2test Patients with negative DIO3 staining had a worse overall survival than those with positive DIO3 staining The mean overall survival was a0months CI to in the DIO3negative group and a0months CI to in the DIO3positive group Fig a02G logrank P DIO3 mRNA in breast cancer patients validation cohort It has been previously demonstrated that DIO3 protein levels and activity correlate with DIO3 mRNA levels in different contexts303233 Therefore to validate differences of DIO3 expression among patients with breast cancer we analyzed DIO3 mRNA expression in a second cohort using available gene expression data from the TCGABRCA study In this second population DIO3 expression was found to be reduced in primary solid tumors N compared to that observed in normal breast samples N logFC adjusted P value Fig a03A even when the comparison was made only with matched normal tissues logFC adjusted P value Fig a03B The majority of tumor subtypes with the exception of normallike tumors classified according to PAM50 classification system showed reduced DIO3 expression compared to normal tissue Fig a03C On the other hand DIO3 expression was increased in ERpositive samples compared to that in ERnegative samples logFC P Fig a03D There was no significant difference when comparing DIO3 expression between patients with or without lymph node disease logFC adjusted P value or distant metastasis logFC adjusted P value Fig a03E Decreased DIO3 mRNA expression was observed in all tumor stages compared to that seen in normal tissue P However no differences were found between the different tumor stages Fig a03F Interestingly lower DIO3 expression was associated with greater tumor size P and ER negativity P We then evaluated the prognostic value of DIO3 mRNA expression for patient survival We considered patients as having high DIO3 expression when their logCPM values were above the median and as having low DIO3 expression when their logCPM values were below the median Low DIO3 expression was associated with reduced survival with an HR of CI to P in the univariate model Table a0 Additional analysis using a multivariate model adjusted for all variables with a P in the univariate analysis demonstrated that low DIO3 was an independent prognostic factor for death HR IC to P Table a0 Fig a04A The estimated overall survival rate at five years in the KaplanMeier analysis was CI to in the high DIO3 group and CI to in the low DIO3 group Fig a04AIn the subgroup analysis of patients with advanced disease stage IV those with low DIO3 expression had reduced overall survival compared to patients with high DIO3 expression P Fig a04B Notably low DIO3 expression was associated with worse overall survival among patients with ERpositive tumors P but not among those with ERnegative tumors P Supplementary Fig a0Methylation of DIO3 gene promoter To further investigate possible factors that could lead to decreased DIO3 expression in breast cancer we performed DNA methylation analysis of a subgroup of patients from TCGABRCA database from whom DNA methylation data were available N Our analysis demonstrated that global DNA methylation levels of breast cancer samples were similar to those of healthy breast tissues Fig a05A However the methylation levels of CpG sites in the DIO3 gene region were increased compared to those from healthy tissue Fig a05B P Figure a0 details the CpG sites that are hypermethylated within the DIO3 gene region The first kbp of ² flanking region red are known to be extremely G C rich of the sequence and this region is highly conserved between mouse and human genome34 Promoter region a0bp of the ² flanking region is composed of several promoter elements Fig a05C enhanced including a TATA box two CAAT boxes and CG rich regions35 We observed a significant increase in DNA methylation levels in CpG sites that are located both at the promoter region and in the ² flanking kbp conserved region of the gene Fig a05CDScientific RepoRtS 101038s41598020708924Vol0123456789wwwnaturecomscientificreports 0cFigure a0 The relationship between DIO3 mRNA expression and clinicopathological parameters in breast cancer samples of patients from the TCGABRCA cohort expressed in Log2 counts per million voomtransformed Comparative expression demonstrates that DIO3 mRNA is decreased in tumoral tissue when compared to normal tissue when analyzing A all samples or B only matched samples C All tumor subtypes have decreased expression of DIO3 mRNA when compared to normal tissue with the exception of normallike tumors compared to normal tissue DIO3 mRNA levels were also reduced in basallike tumors when compared to luminal A logFC adjusted P value and in luminal B when compared to luminal A subtypes logFC adjusted P value and D DIO3 expression is increased in ERpositive samples when compared to ERnegative samples E DIO3 expression is similar in patients with or without metastasis F When samples were separated according to tumor staging all tumor stages had decreased DIO3 expression when compared to normal tissue but there was no difference in expression between the stages ER estrogen receptor Adjusted P value in comparison to normal tissueVariablesAge at diagnosis yearsTumor size ¥ a0cm vs ¤ a0cmLymph node pos vs negDistant metastasis pos vs negE2 status pos vs negP status pos vs negHER2 positivity pos vs negTNM staging IIIIV vs IIIDIO3 status low vs highUnivariate analysisHR CI P value Multivariate analysisHR CI P value Table Univariate and multivariate Cox regression and for overall survival in the validation cohort HR hazard ratio CI confidence interval ER estrogen receptor P progesterone HER2 human epidermal growth factor receptor2 All variables with P were included in the multivariate model TNM is not included as it is derived from variables already present in the modelDiscussionDisruption of the iodothyronine deiodinases expression leads to changes in TH concentrations which might contribute to cancer development and progression by impacting virtually all the hallmarks of cancer10 Here we demonstrate that the THinactivating enzyme DIO3 is expressed in normal breast tissue and that its expression is highly prevalent in breast cancer More interestingly our results demonstrated that low DIO3 expression Scientific RepoRtS 101038s41598020708924Vol1234567890wwwnaturecomscientificreports 0cAOverall SurvivalP BOverall Survival Stage IV patientsHighLowDIO3DIO3groupgroupP0011liavvrusfoytilibaborPliavvrusHighLowDIO3DIO3groupgroupHR for death IC to foytilibaborPPatients at riskHigh DIO3Low DIO3MonthsPatients at riskHigh DIO3Low DIO3MonthsFigure a0 KaplanMeier estimates of overall survival in patients of the TCGABRCA cohort according to DIO3 mRNA expression Patients were grouped according to the median of DIO3 expression in the population as presenting high DIO3 expression gray lines or low DIO3 expression black lines Plot A shows the overall survival in the entire cohort Plot B refers only to patients with stage IV disease HR hazard ratio CI confidence intervalwas an independent prognostic factor for reduced overall survival in two different populations of patients with breast cancerData on the expression of iodothyronine deiodinases in human breast tissue are scarce Low levels of DIO1 were reported in normal and lactating tissues but DIO2 and DIO3 have not been analyzed thus far36 Here we show that DIO3 is expressed at both the mRNA and protein levels in normal human breast tissue Expression of DIO3 mRNA has been previously described in breast cancer cell lines MCF7 and MDAMB231 cells DIO3 mRNA was found to be upregulated in MCF7 cells and downregulated in MDAMB231 cells when compared to the nontumoral cell line MCF10A cells DIO3mediated T3 deiodination also occurs in MCF7 cells In these cells DIO3 expression is to regulated by retinoids but not by estradiol37 These findings are consistent with the presence of DIO3 in other tissues of ectodermal origin such as the skin and the nervous system4041The role of thyroid hormone metabolism on human tumorigenesis has been largely debated10 In breast cancer previous studies showed that higher levels of the thyroid hormone receptor alpha were an independent prognostic factor for increased overall survival42 More recently high levels of the thyroid hormone receptor beta in breast tumors were also associated with increased breast cancerspecific survival43In basal cell carcinomas BCC for instance a DIO3mediated decrease in T3 levels relates to increased cell proliferation31 Similarly in colon cancer cells DIO3 knockdown and consequent increases in T3 levels are associated with reduced cell proliferation and induction of differentiation44 High levels of DIO3 expression in primary PTC tumors were associated with advanced disease at the diagnosis30 Some data indeed suggest that T3 can contribute to tumor growth in breast cancer cells in a0vitro17 while a microenvironment with low T3 levels could facilitate invasiveness and dedifferentiation However in agreement with our data in breast cancer similar levels of DIO3 mRNA are observed in glioblastoma and liver carcinomas as compared to respective normal tissues45 These differences could be attributed to the tissue embryological origin since the tissues of ectodermal origin seem to maintain DIO3 expression during adulthood while DIO3 gene is subject to imprinting in other tissues Loss of DIO3 expression was associated with tumor aggressiveness in colon cancer and also in thyroid cancer DIO3 expression is present in papillary and follicular subtypes but not in the most aggressive and dedifferentiated anaplastic subtype30 Taken together these results indicate that although expression of the enzyme is often upregulated in the neoplastic tissue compared to normal tissue loss of DIO3 expression is a common hallmark of dedifferentiation in the neoplastic process which might confer its prognostic significance Alternatively the distinct pattern of expression could be the result of DIO3 regulation or related to the cancertype specific methylation signatureAlthough this was an exploratory study our results point to a prognostic role for DIO3 expression in breast cancer In a primary cohort of patients with breast cancer negative DIO3 staining in the primary tumor was associated with significantly worse prognosis HR CI to P when compared to patients who were DIO3positive More interesting in the second cohort low DIO3 expression was an independent prognostic factor for death in a model adjusted for age tumor size lymph node and distant metastasis estrogen and progesterone status HR IC P The prognostic role of DIO3 expression was particularly relevant in the subgroup of patients with advanced diseaseIntriguingly the difference in survival between groups with distinct DIO3 expression was limited to ERpositive patients Previous studies indicate the existence of a crosstalk between estrogen and THdependent regulatory pathways in breast cancer14174647 which might be a potential explanation T3 regulates cell cycle progression and proliferation in breast cancer cells in a0vitro by a common mechanism involving ER and T3 receptormediated pathways46 Moreover T4 can phosphorylate nuclear ERalpha in MCF7 cells via a MAPKdependent pathway promoting proliferation14 Therefore loss of DIO3 expression and the consequent increase in intracellular T3 levels could be specifically detrimental to tumors that express ER as our results suggest Contributing to this Scientific RepoRtS 101038s41598020708924Vol0123456789wwwnaturecomscientificreports 0cFigure a0 Panel A demonstrates mean global DNA methylation levels values in breast cancer tissue compared to healthy breast tissue Panel B demonstrates that the mean DNA methylation of DIO3 gene region is increased in tumor tissue when compared to normal tissue P Panel C is a schematic representation of the location of DIO3 gene in chromosome and the regions that were evaluated by CpG probes The promoter region is composed by several promoter elements including a TATA box two CAAT boxes and CG rich regions C enhanced Significant hypermethylation in several CpG sites is observed in the promoter region of the gene Panel D presents mean values of CpG sites mapped in DIO3 gene region comparing normal and tumoral tissueinterplay previous studies have demonstrated that estrogen progesterone and their receptors regulate DIO3 activity in rat uteri and decidua4849 Therefore we cannot rule out that in the breast DIO3 expression depends partially on the presence of functional estrogen and progesterone receptorsScientific RepoRtS 101038s41598020708924Vol1234567890wwwnaturecomscientificreports 0cThe DIO3 gene is subject to genomic imprinting an uncommon epigenetic phenomenon that results in the preferential expression of one allele the paternal allele in this case2425 The disturbed expression of genes and miRNAs or altered hypermethylation patterns of the DLK1DIO3 genomic region is involved in the pathogenesis of different types of cancer50 Thus we hypothesized that the loss of DIO3 expression in breast tumors could be a consequence of gene hypermethylation in the tumoral context Indeed our results show that while the mean global methylation in breast tumors is comparable to that of normal tissue the DIO3 genomic region especially its promoter region is significantly hypermethylated in tumors Fig a05C enhanced These findings might explain at least in part the reduced DIO3 expression in breast cancer Of interest the DIO3 gene was also found to be hypermethylated in Bcell Tcell and myeloid malignancies and lung cancer5152Our study has some limitations The absence of data on DIO3 enzymatic activity limits the assumption that the decreases of DIO3 levels cause alterations in intracellular TH homeostasis Alternatively changes in DIO3 expression could simply represent a consequence of broader epigenetic modifications in the tumoral context It is also important to consider that complete clinical data on patient thyroid status was not available which could interfere with deiodinase expression54 Therefore the complex changes on deiodinases and the overall effect on intracellular TH status are still unclear in breast cancer Additionally our analysis is limited to two populations using two different methodology and despite robust supporting data results should be confirmed in other cohortsIn the results of this study demonstrate DIO3 expression in breast tissue and breast cancer Importantly low DIO3 expression is associated with reduced overall survival suggesting that DIO3 might have a prognostic role in this disease Reduced DIO3 expression in breast cancer can be explained at least in part by gene hypermethylation Due to its potential to modulate thyroid hormone intracellular levels and interplay with estrogen metabolism in breast cancer the DIO3 expression might have therapeutic implicationsMethodsPatients and tissues primary cohort Neoplastic tissue from patients diagnosed with breast cancer was retrospectively collected from a consecutive series of unselected patients in the pathology department of Hospital de Clnicas de Porto Alegre Tissue samples of the normal breast N and fibroadenomas N were also obtained Histopathological reports containing information on tumor type grade and immunohistochemistry were retrieved clinical data were retrospectively reviewed in medical records Tumors were histologically classified according to the 8th edition of the American Joint Committee on Cancer AJCC staging system56 All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional andor national research committee The study was reviewed and approved by the Institutional Review Board and Research Ethics Committee from the Hospital de Clnicas de Porto Alegre with a waiver of informed consent Protocol number Immunohistochemistry studies and DIO3 staining assessment DIO3 protein expression was evaluated by immunohistochemical studies on 6mm sections of formalinfixed paraffinembedded FFPE tissue blocks from normal breast tissues fibroadenomas and primary breast cancers The immunohistochemical technique consists of tissue deparaffinization and rehydration antigenic recovery inactivation of endogenous peroxidase and blockage of unspecific reactions Samples were incubated overnight at a temperature of a0°C with an antiDIO3 rabbit polyclonal antibody Abcam Cambridge UK at a dilution of followed by subsequent incubation with a biotinylated secondary antibody a streptavidinHRP conjugate LSAB Dako Carpinteria CA USA and diaminobenzidine tetrahydrochloride Kit DAB Dako The slides were examined using an Olympus BX51 microscope The QCapture Pro software Qimaging Surrey BC Canada was used to capture the images DIO3 staining was evaluated by an experienced pathologist blinded to the molecular profile and TNM staging The immunohistochemical results of DIO3 staining were assessed dichotomously negative or positive and semiquantitatively using the Hscore method as described previously5758 The Hscore combines the percentage of positive cells and staining intensity level weak moderate strong and is calculated using the following formula [ cells cells cells ] with results ranging from to Positive epidermis and placenta and epidermal nevus and negative connective and adipose tissue internal controls were assessed for all the evaluated cases Samples from the primary cohort were classified concerning the presence or absence of these receptors and the level of Ki67 expression into the following groups Luminal A LumA luminal B LumB triple negative and HER2 A Ki67 index cut point of was defined to distinguish HER2 negative lumB from lumA tumors5960Differential gene expression and methylation analysis For the validation cohort RNA sequencing RNASeq RSEM gene expression data from The Cancer Genome Atlas TCGA breast cancer BRCA study were obtained from the Genomic Data Commons GDC Data Portal gdcporta lcninihgov using the TCGAbiolinks RBioconductor package61 Raw expression signals for primary solid tumor samples N and solid normal tissue samples N were normalized and analyzed for differential expression of DIO3 using the limmavoom pipeline from the limma RBioconductor package62 P values were adjusted for multiple comparisons using the false discovery rate FDR procedure of Benjamini and Hochberg63 Clinicopathological information for TCGABRCA samples was downloaded through TCGAbiolinks and the Broad GDAC Firehose gdacbread insti tute merged level clinical data For tumors of the TCGABRCA cohort data retrieved from PAM50 classification were used to define tumor subtype classification64 Overall survival OS was estimated by the KaplanMeier method and compared by the logrank test using functions provided by TCGABiolinks For the methylation analysis we used the TCGAbiolinks RBioconductor package30 to obtain and analyze Illumina a0K methylation and clinical data for samples from the TCGABRCA study includScientific RepoRtS 101038s41598020708924V | Thyroid_Cancer |
Oral squamous cell carcinoma OSCC is a common kind of squamous cell carcinoma of the head and neck which is a threat to public health Long noncoding RNAs lncRNAs are associated with the development of various diseases including cancers LncRNA titin antisense RNA TTNAS1 is known as a crucial regulatory factor in several cancers Nevertheless the specific functions of TTNAS1 in OSCC remains obscureMethods The expression of TTNAS1 in OSCC samples or cells was analyzed through qRTPCR Colony formation assay EdU assay flow cytometry assay TUNEL assay and wound healing assay were conducted to estimate the functions of TTNAS1 in OSCC cells RIP and luciferase reporter assays were utilized to detect the interaction between TTNAS1 and miR3p as well as between miR3p and NFAT5Results TTNAS1 expression was stronger in OSCC cells Knockdown of TTNAS1 effectively restrained cell proliferation and migration but had inductive role in apoptosis Moreover TTNAS1 could function as the miR3p sponge in OSCC and miR3p exerted the inhibitory functions on OSCC cell growth In addition NFAT5 was proven as the target of miR3p Rescue assay indicated that overexpressing NFAT5 could reverse the inhibitory function of TTNAS1 depletion on cell growthConclusion lncRNA TTNAS1 contributed to the progression of OSCC via miR3pNFAT5 axisKeywords TTNAS1 miR3p NFAT5 Oral squamous cell carcinomaBackgroundOral squamous cell carcinoma OSCC is one of the commonest squamous cell carcinomas occurs in the head and neck It ranks sixth in occurrence and had a high mortality rate [ ] According to many years of investigation and research the pathogenesis of OSCC is related to the internal factors such as drinking and smoking but its specific pathogenesis is still unclear [ ] Although the surgery for OSCC is effective the situation for the overall survival of OSCC patients is still unfavorable [ ] Thus Correspondence fusuwei2009163comDepartment of Stomatology Henan Provincial Peoples Hospital Peoples Hospital of Zhengzhou University No7 Weiwu Road Zhengzhou Henan Chinaindepth study of the potential molecular mechanisms of OSCC is of great significance for developing new therapeutic strategiesLong noncoding RNAs lncRNAs are classified as the subgroup member of noncoding RNAs family with over nucleotides in length which are not able to encode proteins [ ] Recently lncRNAs are confirmed to involve in different cell progression such as cell proliferation and cell apoptosis Moreover the crucial functions of lncRNAs in the occurrence and development of assorted cancers have also been reported through a flow of researches [ ] Different kind of lncRNAs exerted different functions in cancers For example PVT1 accelerated esophageal carcinoma cell migration and invasion via sponging miR145 and regulating FSCN1 [] The Authors This is licensed under a Creative Commons Attribution International License which permits use sharing adaptation distribution and reproduction in any medium or format as long as you give appropriate credit to the original authors and the source provide a link to the Creative Commons licence and indicate if changes were made The images or other third party material in this are included in the s Creative Commons licence unless indicated otherwise in a credit line to the material If material is not included in the s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use you will need to obtain permission directly from the copyright holder To view a copy of this licence visit httpcreat iveco mmons licen sesby40 The Creative Commons Public Domain Dedication waiver httpcreat iveco mmons publi cdoma inzero10 applies to the data made available in this unless otherwise stated in a credit line to the data 0cFu a0et a0al Cancer Cell Int Page of SARCC alters he androgen receptormiRNA1433p signals thereby suppresses the progression of renal cell carcinoma [] And GAPLINC facilitated gastric cancer cell growth through serving as a sponge of miR378 to regulate MAPK1 [] Titin antisense RNA TTNAS1 is a novel lncRNA that takes part in the regulation of cancer development in accordance with existing researches For illustration TTNAS1 with high expression in lung adenocarcinoma cells can expedite cellular functions of lung adenocarcinoma through serving as a sponge of miR1425p to regulate CDK5 [] Nevertheless its specific function of TTNAS1 in OSCC remains unclearHere we selected TTNAS1 as the object of our research and investigated the regulatory mechanisms and functions in OSCCMethodsTissues samplesPaired tissues adjacent normal and tumor were collected from patients with OSCC who were diagnosed at Henan Provincial Peoples Hospital Patients participated in this study didnt receive any kind of therapy before surgery All patients enrolled in this study had signed informed consent This study received the approval of the Ethics Committee of Henan Provincial Peoples Hospital Samples were stored at a0 °C until useCell linesHuman normal squamous epithelial cell line NOK obtained from Shanghai Honsun Biological Technology CoLtd Shanghai China human tongue squamous carcinoma cell lines including SCC4 SCC9 CAL27 procured from ATCC Manassas VA USA and BICR cell obtained from European Collection of Authenticated Cell Cultures ECACC UK were used in current study NOK cell was cultured in DMEM Gibco Rockville MD USA with antibiotics and FBS Gibco CAL27 cell was cultured in DMEM containing FBS SCC4 cell was cultured in DMEM F12 Medium containing a0ngml hydrocortisone and FBS SCC9 cell was cultured in DMEM F12 Medium containing a0mM a0lglutamine a0gL sodium bicarbonate a0mM HEPES a0 mM sodium pyruvate supplemented with a0 ngml hydrocortisone and FBS BICR16 cell was cultured in DMEM with 500ugml G418 and FBS Cell culture was conducted under a condition with CO2 and a0°CTotal RNA extraction and a0qRTPCRTRIzol Reagent Invitrogen Carlsbad CA was responsible for total RNA extraction from samples or cells Afterwards RNA samples were converted into cDNA Japan PowerUp¢ SYBR® Green Master Mix Life Techby employing Reverse Transcriptase Kit Takara Shiga nologies Grand Island NY USA was utilized for PCR analysis [] After amplification ÎÎCt method was applied to quantify PCR products U6 snRNA or GAPDH was used as the internal control for lncRNA mRNA or miRNA All primers used in this experiments were provided in Additional file a0 Table a0 S1 Each samples were assayed for more than triplicateTransfectionsThe shRNAs designed for TTNAS1 or NFAT5 and nonspecific shRNAs as well as pcDNA31NFAT5 and empty vector theses transfection plasmids were procured from GenePharma Shanghai China In addition the miR4113p mimicsinhibitor and NC mimicsinhibitor were procured from Genechem Shanghai China SCC4 and SCC9 cells were collected for a0h of plasmid transfections by use of Lipofectamine Invitrogen Sequence for all plasmids used in current study were listed in Additional file a0 Table a0 S1 Each samples were assayed for more than triplicateCCK assayAs previously described [] CCK8 Kit Beyotime Shanghai China was applied to detect cell viability under manufacturers protocols Cells cellswell were planted in 96well plates After and a0h the CCK8 reagents were added into each well Cell viability was detected using a microplate reader to measure the absorbance at the wave length of a0nm Each samples were assayed for more than triplicateColony formation assayAfter indicated transfections SCC4 and SCC9 cells were planted into 6well plates with cells in each well Following 14day of cell culture the resulting colonies were fixed using PFA for a0min stained using crystal violet solution for a0min and finally counted manually [] Each samples were assayed for more than triplicateEdU assayfor cell proliferation detection by use of BeyoClick¢ EdU assay was undertaken in cells of SCC4 and SCC9 EdU Cell Proliferation Kit Beyotime Shanghai China with Alexa Fluor [] The DAPI staining solution was acquired from Beyotime for detecting cell nucleus After washing in PBS cells were studied using inverted microscope Olympus Tokyo Japan Each samples were assayed for more than triplicate 0cFu a0et a0al Cancer Cell Int Page of Flow cytometryCell apoptosis of transfected SCC4 and SCC9 cells was assayed employing the flow cytometer BD Biosciences Franklin Lakes NJ in the presence of Annexin VPI double staining kit Invitrogen Cell samples were collected from 6well plates via centrifugation then stained in Binding Buffer and assayed with flow cytometry [] Each samples were assayed for more than triplicateTUNEL assayThe transfected cell samples of SCC4 and SCC9 were washed employing PBS and fixed using PFS for TUNEL assay [] in the presence of TUNEL assay reagent Merck KGaA Darmstadt Germany Following addition of DAPI staining solution cell samples were analyzed using optical microscopy Olympus Each samples were assayed for more than triplicateWound healingThe transfected cell samples of SCC4 and SCC9 were seeded in 6well plates and cultivated until confluence [] Then the artificial wounds were created with a0μL of pipette tip At and a0h after incubation in serumfree medium the distance of wound healing were imaged under microscope Olympus Each samples were assayed for more than triplicateSubcellular fractionationThe TTNAS1 content in cytoplasmic and nuclear fracPARIS¢ Kit Invitrogen as requested by provider Cell tions of SCC4 and SCC9 cells was studied by use of samples were lysed with cell fractionation buffer and cell disruption buffer then centrifuged for separating cell cytoplasm and cell nucleus [] For quantification GAPDH and U6 served as the cytoplasmic indicator and nuclear indicator respectively Each samples were assayed for more than triplicateFISHThe subcellular location of TTNAS1 in SCC4 and SCC9 cells was also studied with FISH assay using the deigned specifically TTNAS1probe Ribobio Guangzhou China After fixation the digested cells were airdried and cultured with probes in the hybridization buffer then treated in DAPI staining buffer [] Olympus fluorescence microscope was used for imaging Each samples were assayed for more than triplicateApplying the Magna RIP¢ RNABinding Protein Immunoprecipitation Kit [] RIP assay was conducted RNA immunoprecipitation RIPfor RNA interaction in SCC4 and SCC9 cells as guided by provider Millipore Bedford MA RIP lysis buffer Thermo Fisher Scientific Waltham MA USA was applied to obtain the lysates Lysis was incubated with the magnetic beads Invitrogen Carlsbad CA USA conjugated with antiAgo2 antibody or antiIgG antibody at a0 °C overnight Complex was washed and purified according to the protocol of RIP kit used in this experiment The enrichment of RNAs were examined via RTqPCR Each samples were assayed for more than triplicateLuciferase reporter assayTTNAS1 fragment covering wildtype or mutant miR4113p binding sites were employed to construct TTNAS1WT or TTNAS1Mut vectors by use of the pmirGLO dualluciferase vectors Promega Madison WI SCC4 and SCC9 cells were cotransfected with miR4113p mimics or NC mimics and TTNAS1WT or TTNAS1Mut vectors for a0h followed by analysis of dualluciferase reporter assay system Promega [] Renilla luciferase activity was used as the internal control Each samples were assayed for more than triplicateWestern blotCells were lysed via RIPA buffer BCA Protein Assay kit Pierce Biotechnology Rockford IL was used to assess the concentration of protein Separation of equal amount of proteins was conducted via SDSPAGE BioRad Laboratories Hercules CA followed by the transformation to PVDF membranes Millipore Bedford MA The membranes were blocked with skim milk and incubated with primary and secondary antibodies All antibodies were obtained from Abcam Cambridge MA USA Protein bands were detected using a ECL detection kit Pierce Biotechnology Rockford IL Each samples were assayed for more than triplicateAnimal studySix 4weekold BALBc nude mice Shanghai Laboratory Animal Center was subjected to animal study in line with the ethical standards and guidelines of Henan Provincial Peoples Hospital SCC6 cells à stably transfected with shNC or shTTNAS11 were injected into the right dorsal flanks of six mice Tumor sizes and volume were monitored by a caliper every a0days Four weeks later the mice were killed followed with the resection of tumors for measuring tumor weightStatistical analysesData of three or more independent assays were exhibited as the mean ± SD In addition Students ttest or onewaytwoway ANOVA followed by Tukey post hoc test 0cFu a0et a0al Cancer Cell Int Page of use of GraphPad Prism ® GraphPad Software Inc La was employed for comparing the group difference by Jolla CA USA Experimental data were collected when p ResultsKnockdown of a0TTNAS1 restrains the a0proliferation and a0migration of a0OSCC cellsAt first the relative higher level of TTNAS1 was observed in OSCC samples rather than adjacent normal ones Additional file a0 Fig S1A Next we detected the expression of TTNAS1 in OSCC cells through qRTPCR analysis We discovered that TTNAS1 expression was extremely high in OSCC cells in comparison of normal human squamous epithelial cell NOK cell Fig a01a At the same time we also found that TTNAS1 expression in SCC4 and SCC9 cells was highest Thus we knocked down TTNAS1 expression in SCC4 and SCC9 cells and identified that the TTNAS1 expression was exactly declined Fig a0 1b Following functional experiments were implemented to test the influence of inhibiting TTNAS1 on cells proliferation apoptosis and migration CCK8 assay unveiled that TTNAS1 depletion had significantly suppressive effect on cell viability Additional file a0 Fig S1B The number of colonies and EdU positive cells were reduced after silencing TTNAS1 indicating that cell proliferation could be restrained by TTNAS1 depletion Fig a01c d Then it was found by flow cytometry and TUNEL experiments that apoptosis was accelerated when decreased the level of TTNAS1 Fig a01e f Finally wound healing assay revealed that the migrated capability of SCC4 and SCC9 cells was hampered by silencing TTNAS1 Fig a0 1g In a word knockdown of TTNAS1 restrained cell proliferation and migration of OSCCTTNAS1 acts as a0miR3p sponge in a0OSCCThen we tested the distribution of TTNAS1 in SCC4 and SCC9 cells The results indicated that TTNAS1 tended to be located in the cytoplasm of SCC4 and SCC9 cells Fig a0 2a b indicating the potential posttranscriptional regulatory role of TTNAS1 in OSCC A flow of evidence suggested that lncRNA could serve as a ceRNA to regulate mRNAs through sponging miRNAs at posttranscriptional level [ ] Then we utilized starBase website to predict the possible miRNA which could have the binding site of TTNAS1 and one potential miRNA miR4113p was found out Fig a02c Then qRTPCR analysis was implemented to test the expression of miR4113p in OSCC samples and cells And the results indicated that miR4113p expression was lower in OSCC tissues and cells Additional file a0 Fig S1C and Fig a0 2d The lowest level of miR4113p was detected in SCC4 and SCC9 cells After that we discovered the binding site of miR4113p and TTNAS1 from starBase website Fig a02e and conducted Ago2RIP assay to evaluate the binding possibility of them We discovered that miR4113p and TTNAS1 were markedly enriched in antiAgo2 group Fig a02f and Additional file a0 Fig S1D which indicated that they were coexisted in RISC Following we overexpressed miR4113p and conducted the luciferase reporter assay We discovered that miR4113p overexpression caused a notable reduction on the luciferase activity of TTNAS1WT while the luciferase activity of TTNAS1Mut displayed no visible change Fig a02g h indicating that TTNAS1 could bind to miR4113p Overall TTNAS1 sponges miR4113p in OSCCUpregulation of a0miR3p represses OSCC cell growth and a0migrationIn order to search the role of miR4113p in OSCC functional experiments were implemented Firstly colony formation and EdU assays indicated that overexpressing miR4113p suppressed the proliferation of SCC4 and SCC9 cells Fig a0 3a b Moreover apoptosis of SCC4 and SCC9 cells was accelerated by miR4113p mimics through flow cytometry analysis and TUNEL assays Fig a03c d As illustrated in Fig a03e overexpression of miR4113p visibly reduced cell migration Taken together overexpression of miR4113p suppressed growth and migration in OSCCNFAT5 is a0the a0downstream target of a0miR3p in a0OSCCFor the sake of further verifying ceRNA hypothesis we searched the targets of miR4113p Combining the searching results from miRmap microT and PicTar databases candidate target genes were found under the condition Program number programs Fig a0 4a Then qRTPCR assay was applied to detect the influence of miR4113p overexpression and TTNAS1 inhibition on the levels of these mRNAs The results displayed a significant downregulation of mRNAs TLL2 MGAT4A RAB21 and NFAT5 when miR4113p was overexpressed and TTNAS1 was knocked down while other mRNAs were almost unchanged Fig a0 4b Then we tested the expressions of TLL2 MGAT4A RAB21 and NFAT5 in OSCC cells through qRTPCR for further detection We discovered that only NFAT5 displayed a high expression in OSCC cells Fig a04c High level of NFAT5 was further determined in OSCC tissues compared to adjacent normal ones Additional file a0 Fig S2A Thus we selected NFAT5 to conduct the further experiments Following we discovered the binding site of NFAT5 and miR4113p from starBase Fig a04d And RIP assays were implemented to evaluate the relationship of TTNAS1 NFAT5 and miR4113p The results 0cFu a0et a0al Cancer Cell Int Page of Fig Knockdown of TTNAS1 restrains the proliferation and migration of OSCC cells a The expression of TTNAS1 was tested through qRTPCR in OSCC cells b The interference efficiency of TTNAS1 was detected by qRTPCR in SCC and SCC cells c d Cell proliferation ability was measured by colony formation and EdU experiments when TTNAS1 was inhibited e f Cell apoptosis was evaluated through flow cytometry and TUNEL experiments after silencing TTNAS1 g Wound healing assays were utilized to estimate cell migration when TTNAS1 was subjected to knockdown P P 0cFu a0et a0al Cancer Cell Int Page of Fig TTNAS1 acts as the miR3p sponge in OSCC a b The cellular location of TTNAS1 was identified in SCC and SCC through Subcellular fractionation and FISH c StarBsae website was utilized to predict the possible miRNAs that could bind with TTNAS1 d MiR3p expression was detected through qRTPCR in OSCC cells e The binding site of TTNAS1 in miR3p f RIP assay was utilized to evaluate the relationship between miR3p and TTNAS1 g The efficiency of miR3p overexpression was tested through qRTPCR h Luciferase reporter assays were conducted to verify the correlation of miR3p and TTNAS1 P P showed that TTNAS1 NFAT5 and miR4113p were enriched in Ago2 indicating that TTNAS1miR4113pNFAT5 axis combined with RISC Fig a04e and Additional file a0 Fig S2B Then miR4113p was silenced and the interference efficiency was detected We could observe that miR4113p expression exactly declined after inhibition Fig a04f Following we detected the expression of NFAT5 when TTNAS1 and miR4113p were inhibited through qRTPCR Results indicated that NFAT5 expression could be hampered by TTNAS1 depletion but then recovered by miR4113p inhibition Fig a0 4g and Additional file a0 Fig S2C It demonstrated that NFAT5 and TTNAS1 were positively associated while NFAT5 and miR4113p were negatively correlated Then we investigated the function of NFAT5 in OSCC cells Firstly we knocked down the expression of NFAT5 in SCC4 and SCC9 cells and tested the knockdown efficiency Fig a04h and Additional file a0 Fig S2D NFAT5 expression could be hampered effectively after knockdown Then colony formation and EdU assays were carried out and the 0cFu a0et a0al Cancer Cell Int Page of Fig Upregulation of miR3p represses cell proliferation and migration in OSCC a b Cell proliferation was estimated through colony formation and EdU experiments when miR3p was overexpressed c d Flow cytometry and TUNEL experiments were implemented to measure cell apoptosis after overexpressing miR3p e Wound healing assays were adopted to test cell migration ability when miR3p was subjected to upregulation P See figure on next pageFig NFAT5 is a target gene of miR3p in OSCC a mRNAs which had the binding site with miR3p were predicted by starBase b The qRTPCR analysis was utilized to screen out the mRNAs which could be inhibited by NFAT5 depletion and miR3p overexpression c The expressions of TLL2 MGAT4A RAB21 and NFAT5 in SCC and SCC cells through qRTPCR d The binding site of NFAT5 and miR3p e RIP assay was adopted to test the relationship between TTNAS1 miR3p and NFAT5 f The interference efficiency of miR3p was tested by qRTPCR analysis g The expression of NFAT5 was detected when NFAT5 and miR3p was silenced h The interference efficiency of NFAT5 was tested by qRTPCR analysis i j Cell proliferation was evaluated through colony formation and EdU experiments when NFAT5 was knocked down k l Cell apoptosis was measured through flow cytometry and TUNEL experiments after inhibiting NFAT5 m Wound healing assays were carried out for estimating cell migration after NFAT5 was subjected to inhibition P 0cFu a0et a0al Cancer Cell Int Page of result indicated that silencing NFAT5 repressed the proliferation of SCC4 and SCC9 cells Fig a0 4i j Moreover cell apoptosis capability was expedited by NFAT5 depletion in flow cytometry and TUNEL assays Fig a04k l Finally wound healing assays indicated that silencing NFAT5 could hamper cell migration capability Fig a04m 0cFu a0et a0al Cancer Cell Int Page of Collectively NFAT5 was a target gene of miR4113p in OSCC and it accelerated the progression of OSCCTTNAS1 promotes OSCC progression via a0miR3pNFAT5 axisFor the sake of proving whether TTNAS1 could accelerate OSCC progression via miR4113pNFAT5 axis rescue assays were implemented Ahead of rescue assays qRTPCR was adopted to test the overexpression efficiency of NFAT5 in SCC4 and SCC9 cells The results displayed that NFAT5 expression was visibly increased after transfecting with pcDNA31NFAT5 Fig a05a Next we detected the mRNA and protein levels of NFAT5 in SCC4 and SCC9 cells after transfection It was uncovered that NFAT5 levels decreased by TTNAS1 depletion were rescued by the inhibition of miR4113p or the upregulation of NFAT5 Additional file a0 Fig S2E Then colony formation and EdU rescue assays were conducted we discovered that cell proliferation was hampered by TTNAS1 depletion but then it was recovered by NFAT5 overexpression or miR4113p inhibition Fig a0 5b c Through flow cytometry and TUNEL assays we found that knockdown of miR4113p or upregulation NFAT5 could reverse the cell apoptosis ability which was accelerated by TTNAS1 depletion Fig a05d e In the end it was indicated through wound healing assay that the inhibited cell migration caused by knockdown of TTNAS1 was restored by NFAT5 overexpression or miR4113p inhibition Fig a05f Thus we confirmed that TTNAS1 promoted OSCC cell growth and migration by miR4113pNFAT5 axisTTNAS1 promoted OSCC cell growth in a0vivoIn vivo study was conducted to support above in a0 vitro findings We observed that tumor size volume and weight in shNC group were all smaller than those in shTTNAS11 group Fig a06ac Importantly IHC staining indicated that silencing of TTNAS1 caused a reduction in the positivity of Ki67 and PCNA Fig a06d All these experiments unveiled that TTNAS1 promotes OSCC progression via miR4113pNFAT5 axisDiscussionOral squamous cell carcinoma OSCC is a common squamous cell carcinoma of the head and neck It has a relatively high incidence worldwide As the regulatory functions of lncRNA in assorted cancers are constantly being explored lots of lncRNAs have also been confirmed to play a crucial role in promoting the development of OSCC For example PLAC2 could promote cell growth through activating wntβcatenin pathway in OSCC [] CEBPAAS1 was considered to correlate with the bad prognosis and it also could facilitate tumorigenesis through CEBPABcl2 in OSCC [] Moreover P4713 was reported to contribute to the malignant phenotypes of OSCC through activating the JAKSTAT3 pathway [] In our research we investigated the functions of TTNAS1 in OSCC TTNAS1 was a novel lncRNA and it served as the oncogene in lung adenocarcinoma [] In this study TTNAS1 was discovered to be highly expressed in OSCC cells And TTNAS1 depletion impaired cell proliferation and migration but it accelerated cell apoptosis in OSCC Overall TTNAS1 exerted the carcinogenic effect in OSCCMiRNAs are small RNAs with nucleotides in length without ability of coding protein [] In recent years an increasing number of evidences discovered that lncRNA could function as a crucial element of competing endogenous RNA ceRNA network by sponging miRNA to regulate mRNA so as to take part in the regulation of cancer progression [ ] For example lncRNA ATB functioned as a ceRNA to expedite YAP1 through sponging miR5905p in malignant melanoma [] PAGBC acted as a sponge of miR133b and miR and accelerated gallbladder tumorigenesis [] AFAP1AS1 could act as a ceRNA of miR4235p to expedite nasopharyngeal carcinoma progression [] In our research we utilized bioinformatics tools to find the possible miRNA which could bind to TTNAS1 After screening miR4113p was selected With the conduction of RIP and luciferase experiments we proved that TTNAS1 could act as ceRNA to sponge miR4113p in OSCC MiR4113p was verified as the tumor suppressor gene in ovarian cancer and it could restrain cell proliferation migration and invasion of ovarian cancer [] Thus we investigated the functions of miR4113p in OSCC As we expected miR4113p could repress cell proliferation and migration but accelerate cell apoptosis in OSCC In short our research confirmed that TTNAS1 sponged miR4113p and overexpressing miR4113p could repress the progression of OSCCNFAT5 is a mRNA and it has been reported to be associated with several cancers For example NFAT5 was proved to conduce to the glycolytic phenotype rewiring and pancreatic cancer progression through transcription of PGK1 [] Moreover NFAT5 cpuld also promote glioblastoma celldriven angiogenesis through EGFL7 which was mediated via SBF2AS1 and miR3383p [] In our research we discovered that NFAT5 was highly expressed in OSCC cells And based on the mechanism experiments we also proved that NFAT5 was the target of miR4113p and overexpressing it could accelerate the progression of OSCC Rescue experiment indicated that upregulation of NFAT5 could offset TTNAS1 knockdownmediated functions on the progression of OSCC 0cFu a0et a0al Cancer Cell Int Page of Fig TTNAS1 promotes OSCC progression via miR3pNFAT5 axis a The qRTPCR analysis was utilized to examine the overexpression efficiency of NFAT5 in SCC and SCC cells b c Cell proliferation capability in SCC and SCC cells was measured by colony formation and EdU assay in different groups d e Cell apoptosis was tested through flow cytometry and TUNEL assays in different groups f Wound healing assays were implemented to detect the cell migration ability in different groups P 0cFu a0et a0al Cancer Cell Int Page of Fig TTNAS1 promoted OSCC cell growth in vivo a Tumors removed from the mice injected with shNCtransfected cells or shTTNAS11transfected cells b c Volume and weight in different groups were measured d IHC staining of tumor tissues collected from different groups with antiKi and antiPCNA P proving the functions of TTNAS1miR4113pNFAT5 axis in OSCCtransfected with shTTNAS11 was examined by qRTPCR and western blot analyses after cotransfection with miR3p inhibitor or pcDNA31NFAT5 P ConclusionTaken together TTNAS1 could contribute to the progression of OSCC via miR4113pNFAT5 axis which may provide the new idea for the exploration of OSCC treatmentsSupplementary informationSupplementary information accompanies this paper at https doi101186s1293 Additional file a0 Sequence for all plasmids used in current studyAdditional file a0 Figure S1 A TTNAS1 expression in adjacent normal and tumor tissues was examined by qRTPCR analysis B CCK assay was applied to analyze the viability of SCC and SCC cells transfected with shNC shTTNAS11 or shTTNAS12 C The level of miR3p was assessed in pairs of OSCC tissues and adjacent normal tissues D Agarose gel electrophoresis for the Ago2RIP assay in Fig 2F P Additional file a0 Figure S2 A NFAT5 expression in paired tissues obtained from OSCC patients B Agarose gel electrophoresis for the Ago2RIP assay in Fig 4E C Protein level of NFAT5 in cells transfected with shNC shTTNAS11 or cotransfected with shTTNAS11 and miR3p inhibitor D Protein level of NFAT5 in cells transfected with shNC shNFAT51 and shNFAT52 E mRNA and protein level of NFAT5 in cells AbbreviationsOSCC Oral squamous cell carcinoma TTNAS1 Titin antisense RNA lncRNAs Long noncoding RNAs ceRNAs Competing endogenous RNAs miRNAs microRNAs mRNA Messenger RNA ATCC American type culture collection DMEM Dulbeccos modified Eagles medium FBS Fetal bovine serum RIPA Radioimmunoprecipitation assay SDSPAGE Sulphatepolyacrylamide gel electrophoresis PVDF Polyvinylidene fluoride RTqPCR RNA extraction and quantitative realtime polymerase chain reaction HRP Horseradish peroxidase FISH Fluorescence in situ hybridization WT Wildtype Mut Mutant SD Standard deviation ANOVA Analysis of varianceAcknowledgementsWe appreciate all the people involved in this studyAuthors contributionSF project administration study design and review experiments YZ SL and ZS methods investigation data JZ and QH preparation draft manuscript All authors read and approved the final manuscriptFundingNoneAvailability of data and materialsNot applicable 0cFu a0et a0al Cancer Cell Int Page of Ethics approval and consent to participateAll patients enrolled in this study had signed informed consent This study received the approval of the Ethics Committee of Henan Provincial Peoples HospitalConsent for publicationAuthors confirmed that this work can be published The content of this manuscript is original and it has not yet been accepted or published elsewhereCompeting interestsNo competing interest existReceived February Accepted June References Krishna Rao SV Mejia G RobertsThomson K Logan R Epidemiology of oral cancer in Asia in the past decadean update Asian Pac J Cancer Prev APJCP Siegel RL Miller KD Jemal A Cancer statistics CA Cancer J Clin Warnakulasuriya S Global epidemiology of oral and oropharyngeal cancer Oral Oncol Sacco AG Cohen EE Current treatment options for recurrent or metastatic head and neck squa | Thyroid_Cancer |
EFSA for a scientiï¬c opinion on the risks for animal and humanhealth related to the presence of glycoalkaloids GAs in feed and food This risk assessment coversedible parts of potato plants and other food plants containing GAstomato andaubergine In humans acute toxic effects of potato GAs asolanine and achaconine includegastrointestinal symptoms such as nausea vomiting and diarrhoea For these effects the CONTAMPanel identiï¬ed a lowestobservedadverseeffect level of mg total potato GAskg body weight bwper day as a reference point for the risk characterisation following acute exposure In humans noevidence of health problems associated with repeated or longterm intake of GAs via potatoes hasbeen identiï¬ed No reference point for chronic exposure could be identiï¬ed from the experimentalanimal studies Occurrence data were available only for asolanine and achaconine mostly forpotatoes The acute dietary exposure to potato GAs was estimated using a probabilistic approach andapplying processing factors for food Due to the limited data available a margin of exposure MOEapproach was applied The MOEs for the younger age groups indicate a health concern for the foodconsumption surveys with the highest mean exposure as well as for the P95 exposure in all surveysFor adult age groups the MOEs indicate a health concern only for the food consumption surveys withthe highest P95 exposures For tomato and aubergine GAs the risk to human health could not becharacterised due to the lack of occurrence data and the limited toxicity data For horses farm andcompanion animals no risk characterisation for potato GAs could be performed due to insufï¬cient dataon occurrence in feed and on potential adverse effects of GAs in these species European Food Safety Authority EFSA Journal published by John Wiley and Sons Ltd on behalfof European Food Safety AuthorityKeywords glycoalkaloids GAs solanine chaconine potato margin of exposure MOE food feedRequestor European CommissionQuestion number EFSAQ201600811Correspondence contamefsaeuropaeu Leon Brimer was a member of the Working Group on Glycoalkaloids in food and feed until August wwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodPanel members Margherita Bignami Laurent Bodin James Kevin Chipman Jes 13us del Mazo BettinaGraslKraupp Christer Hogstrand Laurentius Ron Hoogenboom JeanCharles Leblanc Carlo StefanoNebbia Elsa Nielsen Evangelia Ntzani Annette Petersen Salomon Sand Dieter Schrenk TanjaSchwerdtle Christiane Vleminckx and Heather WallaceAcknowledgements The Panel wishes to thank the following for the support provided to thisscientiï¬c output Kelly Niermans The Panel wishes to acknowledge all European competentinstitutions Member State bodies and other anisations that provided consumption and occurrencedata for this scientiï¬c outputSuggested citation EFSA CONTAM Panel EFSA Panel on Contaminants in the Food Chain Schrenk DBignami M Bodin L Chipman JK del Mazo J Hogstrand C Hoogenboom LR Leblanc JC Nebbia CSNielsen E Ntzani E Petersen A Sand S Schwerdtle T Vleminckx C Wallace H Brimer L Cottrill BDusemund B Mulder P Vollmer G Binaglia M Ramos Bordajandi L Riolo F Rold 13anTorres R and GraslKraupp B Scientiï¬c Opinion Risk assessment of glycoalkaloids in feed and food in particular inpotatoes and potatoderived products EFSA Journal pp 102903jefsa20206222ISSN European Food Safety Authority EFSA Journal published by John Wiley and Sons Ltd on behalfof European Food Safety AuthorityThis is an access under the terms of the Creative Commons AttributionNoDerivs Licensewhich permits use and distribution in any medium provided the original work is properly cited and nomodiï¬cations or adaptations are madeReproduction of the images listed below is prohibited and permission must be sought directly from thecopyright holderFigure Elsevier Figure Springer Figure American Chemical Society SpringerThe EFSA Journal is a publication of the European FoodSafety Authority an agency of the European UnionwwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodSummaryThe European Commission asked EFSA for a scientiï¬c opinion on the risks for animal and humanhealth related to the presence of glycoalkaloids GAs in feed and food in particular in potatoes andpotatoderived products This risk assessment covers edible parts of potato plants and other foodplants containing GAs in particular tomato and aubergine Nonedible parts of GA containing plantshave not been considered with the exception of potato sprouts The Panel developed the draftscientiï¬c opinion which underwent a public consultation from February to April Thecomments received and how they were taken into account when ï¬nalising the scientiï¬c opinion werepublished in an EFSA Technical Report EFSA GAs are present in many plants of the family of Solanaceae and contribute to plant resistanceagainst pests and pathogens GAs are composed of a steroidal aglycone and an oligosaccharide sidechain In commercial potato cultivars S tuberosum the main GAs are achaconine and asolanineconsisting of the aglycone solanidine and chacotriose and solatriose as oligosaccharide side chainsrespectively The aubergine fruit S melongena contains primarily the GAs asolamargine and asolasonine composed of the aglycone solasodine and chacotriose and solatriose respectively Inlycopersicum atomatine and adehydrotomatine are the major GAs withtomato fruitlycotetraose coupled to the aglycones tomatidine and tomatidenol respectivelySHuman risk assessmentIn experimental animals the potato GAs asolanine and achaconine show a relatively low oralbioavailability with differences between species Hamsters exhibit higher absorption and slowerexcretion rates for both substances when compared to rats Due to the limited information themetabolic proï¬les of potato GAs in experimental animals could not be characterisedIn humans asolanine and achaconine are systemically absorbed following ingestion For bothsubstances relatively long serum halflives were reported suggesting a possible accumulation The bloodclearance of the respective aglycone solanidine appears to be slow Accordingly levels of solanidine wereregularly detected in the blood of human volunteers in several studies suggesting hydrolysis of GAs Nofurther information is available on metabolism and excretion of potato GAs in humansThere are no toxicokinetic data on tomato and aubergine GAs and their aglycones in experimentalanimals and humansIn acute oral toxicity studies no adverse effects of asolanine were observed at doses of mgkgbody weight bw per day in rats and mgkg bw per day in mice Reliable data on other potatoGAs or tomato and aubergine GAs and their aglycones are missingIn repeated oral dose studies on potato GAs rodents showed nonspeciï¬c effects such as reducedbody weight and relative liver weight with indication of similar potencies of asolanine and achaconine Hamsters exhibited these symptoms after a 5day treatment with mg of asolanine ora chaconinekg bw per day while mice showed these effects after one week of daily treatments with mg of asolanine or mg of achaconinekg bw Solanidine however increased the absoluteand relative liver weight at mgkg bw per day in mice suggesting a different effect of theaglycone compared to the GAsThe tomato GA atomatine and its aglycone tomatidine exerted no effects in rats when applied at mgkg bw per day for a period of day At higher doses atomatine reduced the cholesterol uptakeand increased fecal sterol and coprostanol excretion in hamsters and rats In mice a to 2weektreatment with the aubergine GA asolasonine increased the body weight gain at mgkg bw perday while its aglycone solasodine decreased body weight gain and caused gastric gland degenerationand liver toxicity at mgkg bw per dayDevelopmental studies have been performed mainly in hamsters treated with potato GAs and theiraglycones for only one day or for a short very restricted time period during gestation Outcomes weremainly analysed in late gestational embryos and comprised effects in the central nervous systempredominantly exencephaly encephalocele and anophthalmia These malformations occurred at dosesof mgkg bw per day and above for GAs and of mgkg bw per day and above for theaglycones No noobservedadverseeffectlevelLOAEL could be identiï¬ed from these studies Reduced postnatal survival of pups due to insufï¬cientmilk production was reported when pregnant Holtzman rats had been exposed to mg of asolaninekg bw per day Studies on the male fertility in dogs have been performed only with theaubergine aglycone solasodine Decreased epididymal weight and cauda epididymal epithelial heightand also an epididymal lumen depleted of sperm occurred in dogs after mgkg bw per day givenlowestobservedadverseeffectNOAEL orlevelwwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodfor month Similar effects were observed in Rhesus monkeys exposed to mgkg bw per day for monthsFrom the limited number of studies available there was no evidence for genotoxicity of the potatoGAs asolanine and achaconine and the aglycone solanidine as well as for the aubergine GA asolamargine However there is not sufï¬cient information to conclude on the genotoxic potential ofthese GAsNo longterm chronic toxicitycarcinogencity study for potato tomato or aubergine GAs or for therespective aglycones could be identiï¬edIn humans acute toxic effects following ingestion of potato GAs include gastrointestinal symptomsof varying severity such as vomiting diarrhoea and abdominal pain which may occur from a totalpotato GAs potato TGA intake of mgkg bw or more Further symptoms including drowsinessapathy confusion weakness vision disturbances rapid and weak pulse and low blood pressure maybe the consequence of dehydration following vomiting and diarrhoeaIn severe cases paralysis respiratory insufï¬ciency cardiac failure coma and death have beenreported Doses in the range of mg potato TGAskg bw are considered to be potentially lethal forhumans Results from limited volunteer studies suggest possible differences in the human populationwith respect to the individual susceptibility towards adverse effects associated with the intake ofpotato GAsRegarding the mode of action adverse effects of GAs may be due to their ability to complex withmembrane 3bhydroxy sterols thereby causing disruption and loss of integrity of cell membranesAfter oral exposure these effects may affect the mucosa of the gastrointestinal tract and cause thesymptoms observed in intoxicated humans such as nausea vomiting and diarrhoeaGAs inhibit acetylcholinesterase AChE and serum butyrylcholinesterase BuChE by a reversiblecompetitive mode of action The relative potency of inhibition of asolanine and achaconine appearsto be similar The aglycones exert weak or no inhibitory effects The excess of acetylcholine at theneuronal and neuromuscular junctions upon inhibition of the enzymes might also contribute to thesymptoms described for intoxications with GAsAt high doses atomatine may form a nonabsorbable complex with cholesterol and other sterols inthe enteral lumen which may impair the absorption of cholesterol As a consequence blood cholesterollevels were lowered in rodentsThe CONTAM Panel considered that the use of rodent data on acute toxicity was not appropriate toestablish a reference point for acute exposure to potato GAs in humans The CONTAM Panel selectedthe LOAEL of mg potato TGAkg bw per day as the reference point for acute risk characterisationbased on human data from case reports outbreaks and studies in volunteers The available data onacute toxicity were considered insufï¬cient to establish a healthbased guidance value Instead thePanel used the margin of exposure MOE approach to assess a possible health concern from acuteexposure to potato TGAs via foodAssuming the main symptoms to be mainly due to localirritation of the gastrointestinal mucosarather than inhibition of AChE activity the Panel considered that the possible interindividual variabilityin toxicodynamics is more relevant than the interindividual variability in toxicokinetics Accordingly anMOE higher than indicates that there is no health concern This MOE of takes into account theextrapolation from a LOAEL to a NOAEL a factor of and the interindividual variability intoxicodynamics a factor of The experimental data available for repeated dose toxicity are not sufï¬cient to identify a referencepoint for chronic exposure to potato GAs In humans no evidence of health problems associated withrepeated or longterm intake of GAs via potatoes has been identiï¬edRegarding GAs or aglycones occurring in edible parts of food plants other than S tuberosum nosuitable study for determining a reference point for tomato or aubergine GAs or aglycones wasidentiï¬edOccurrence data were only available for asolanine and achaconine and mostly for Maincroppotatoes and New potatoes Few data were available for processed food No data on the occurrenceof tomato and aubergine GAs and their aglycones were submitted to EFSASince the occurrence data on potato GAs did not cover all the food categories containing potatoesin the Consumption Database it was decided that the best approach for the exposure assessmentwould be to use the occurrence data in the raw primary commodities RPC maincrop potatoes andnew potatoes and the RPC Consumption Database The Panel decided to combine the occurrence ofNew potatoes with that of Maincrop potatoes and the mean upper bound UB occurrence sum ofwwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodasolanine and achaconine for these two groups was mgkg and the P95 occurrence was mgkg The minimum and maximum reported concentrations were and mgkg respectivelyThe acute dietary exposure to potato TGAs was estimated using a probabilistic approach includingonly days in which there was consumption of maincrop potatoes As no occurrence data wereavailable for GAs in tomato and aubergine these foods were not included in the exposure assessmentProcessing of potatoes has been reported to reduce the content of GAs in the ï¬nal processedproduct In general and according to the literature the peeling of potatoes reduced the GA contentby boiling in water and blanching of peeled potatoes by and frying in oil of peeledpotatoes by Microwave and oven baking of unpeeled potatoes may cause a reduction in theGA content by and by respectively No information has been found about thechemical nature of the GA degradation products For the exposure assessment processing factors forthe major food processing steps comprising peeling and heat processing boiling frying bakingwere applied to the occurrence data as follows processing factors between and wereattributed to the peeling of potatoes between and for frying and deep frying and between and for all other cooking methodsInformation about the peeling of potatoes was not available in the consumption database but itwas assumed that of the potatoes are consumed as peeled Where information of the cookingmethod was not available a cooking method was randomly attributed to the eating event based onthe relative frequency of cooking methods reportedThe mean UB exposure to potato TGAs across surveys ranged from lgkg bw per day inadults to lgkg bw per day in toddlers The 95th percentile exposure ranged from lgkgbw per day in adults to lgkg bw per day in toddlers up to lgkg bw per day in theupper limit of the conï¬dence intervalComparing the LOAEL for potato TGAs of mgkg bw per day with the acute exposure estimatesthe MOEs for the younger age groups indicate a health concern for the food consumption surveys withthe highest mean exposure as well as for the P95 exposure in all surveys For adult age groups theMOEs indicate a health concern only for the food consumption surveys with the highest P95exposuresThe CONTAM Panel calculated the mean percentage of days with potato consumption acrosssurveys per age group on which the potato TGA intake may be below the MOE of The highestnumber of survey days with intake of potatoes below the MOE of was estimated for toddlers followed by children For the other age groups the estimated TGA intake was below the MOEof in up to of the survey daysFor tomato and aubergine GAs the risk to human health could not be characterised due to the lackof occurrence data in food and the limited information on the adverse effects in experimental animalsand humansThe CONTAM Panel considered that the impact of the uncertainties on the risk assessment of acuteexposure to potato GAs in food is moderate and that overall the identiï¬ed uncertainties may eithercause an over or underestimation of the riskFarm animals horses and companion animals risk assessmentInformation on the toxicokinetics of GAs was limited to ruminants for which the data suggest anextensive conversion of asolanine and achaconine to aglycones in rumen and a low potential ofsolanidine to transfer into cows milkNo data on the potential adverse effects of potato GAs in horses companion animals cats anddogs or fur animals were identiï¬ed Due to an insufï¬cient database on the adverse effects of GAs inruminants pigs poultry rabbits and ï¬sh an acute reference dose could not be derivedPotatoes are not grown speciï¬cally as feed for livestock but when supply exceeds marketrequirements for human consumption whole raw potatoes may be used as feed for ruminants andpigs Some byproducts of potato processing and starch extraction are used as feeds for farmedlivestock principally nonruminants and for companion animalsData on potato GAs in feed were insufï¬cient to perform an exposure assessmentThus no risk characterisation could be performed due to insufï¬cient occurrence data of GAs forfeed and the lack of or limited data on the adverse effects of GAs in farm animals horses orcompanion animalswwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodRecommendationsThe following needs have been identiï¬ed to improve the risk assessment for humans and reducethe uncertaintiescid129Research on the occurrence of GAs and their aglycones and other potentially toxicologicallyrelevant secondary plant metabolites in the potato cultivars available on the market and onnew potato cultivars resulting from breeding experimentscid129 Occurrence data on GAs and their aglycones in potato processed products including foods forinfantscid129 Occurrence data on GAs and their aglycones in tomato and aubergine and products thereofcid129 Data on the toxicokinetics of potato tomato and aubergine GAs and aglycones in experimentalanimals and humanscid129 Data on repeated dose toxicity including reproductive and developmental toxicity of potatotomato and aubergine GAs and aglycones in experimental animalsStudies in humans linking dietary exposure biomarkers of exposure and adverse effectscid129The following needs have been identiï¬ed to improve the risk assessment for farm animals horsesand companion animals and reduce the uncertaintiescid129 Occurrence data on potato GAs and their aglycones in feedcid129Studies on the kinetics and the potential adverse effects from feed material containing GAs ofpotato GAs in farm animals horses and companion animalswwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodTable of contentsAbstractSummaryIntroduction Background and Terms of Reference as provided by the requestor Interpretation of the Terms of Reference Supporting information for the assessment Chemistry Analytical methods Sources Potatoes Tomatoes Aubergine Previous risk assessments Legislation and other standards Data and methodologies Methodology for data collection selection of evidence and study appraisal Food and feed occurrence data submitted to EFSA Data collection and validation Data analysis Food and feed consumption data Food consumption data Feed consumption data Food classiï¬cation Methodology for Exposure assessment Methodology for Risk characterisation Assessment Hazard identiï¬cation and characterisation Toxicokinetics Experimental animals aSolanine aChaconine Humans Mixtures of asolanine and achaconine Solanidine Biomarkers of exposure Farm animals horses and companion animals Summary on toxicokinetics Toxicity in experimental animals Acute toxicity studies GAs from edible parts of S tuberosum GAs from edible parts of food plants other than S tuberosum Summary on acute toxicity studies Repeated dose toxicity studies GAs and aglycones from edible parts of S tuberosum GAs and aglycones from edible parts of food plants other than S tuberosum Developmental and reproductive toxicity studies Developmental effects Reproductive effects Immunotoxicity studies Studies on cardiovascular effects Neurotoxicity studies Genotoxicity GAs from edible parts of S tuberosum GAs from edible parts of food plants other than S tuberosum Carcinogenicity studies Studies on metabolic effects GAs from edible parts of S tuberosum GAs from edible parts of food plants other than S tuberosum Observations in humans wwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and food GAs from S tuberosum Reports on intoxications Studies in human volunteers Epidemiological studies Summary GAs from food plants other than S tuberosum Case Reports Adverse effects in farm animals horses and companion animals Ruminants Pigs Poultry Rabbits Fish Horses Companion animals cats and dogs Fur animals Reports on intoxications Mode of action Membrane effects with implications for the gastrointestinal tract Inhibition of cholinesterases ChEs Comparative determination of inhibition of ChEs in vitro Determination of inhibitory constants Ki for GAs on inhibition of ChEs in vitro Inhibition of ChEs in vivo Developmental and reproductive effects of GAs and their aglycones Inhibition of cholinesterases and effects in the immune system Interference with metabolism Considerations of critical effects and doseresponse analysis for the human risk assessment GAs from edible parts of S tuberosum Considerations of critical effects and doseresponse analysis Derivation of a healthbased guidance value HBGV or margin of exposure MOE approach GAs from edible parts of food plants other than S tuberosum Considerations of critical effects and doseresponse analysis Consideration of critical effects and doseresponse analysis for the farm animal horses andcompanion animals risk assessment Occurrence data Occurrence data submitted to EFSA Previously reported occurrence data in the literature Literature on occurrence data on food Occurrence data on GAs in potatoes Occurrence data on GAs in tomatoes Occurrence data on GAs in aubergines Occurrence data on GAs in other food products Literature occurrence data in feed Inï¬uence of storage and processing on the content of GAs GAs from S tuberosum Storage of potatoes Processing of potatoes for food consumption Processing of potatoes for feed GAs from food plants other than S tuberosum Summary on the inï¬uence of storage and processing on the levels of GAs Exposure assessment Current acute dietary exposure assessment for humans Previously reported dietary exposure assessments Current dietary exposure assessment for farm animals horses and companion animals Risk characterisation Human health risk characterisation GA from edible parts of S tuberosum GAs from edible parts of food plants other than S tuberosum Farm animals horses and companion animal risk characterisation Uncertainty analysis Assessment objectives Exposure scenarioexposure model wwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodHazard identiï¬cation and characterisation Summary of uncertainties Conclusions Hazard identiï¬cation and characterisation Toxicokinetics Toxicity in experimental animals Observations in humans Adverse effects in farm animals horses and companion animals Mode of action Margin of exposure MOE approach Occurrence and exposure Food Feed Risk characterisation Human health risk characterisation Farm animals horses and companion animal health risk characterisation Recommendations Documentation provided to EFSA References Abbreviations Appendix A Major glycoalkaloids and their aglycones present in Solanum species Appendix B Identiï¬cation and selection of evidence relevant for the risk assessment of glycoalkaloids infeed and food Appendix C Details of the study design of the toxicokinetic studies Appendix D Comparison of developmental toxicity of single dose studies Appendix E Inhibition of cholinesterases by GAs Appendix F Rapid Alert System for Food and Feed RASFF reports on the presence of Solanum nigrum infood products Appendix G Studies on the toxicity of Glycoalkaloids not considered in the risk assessment Appendix H Additional scenario for the human risk characterisation Annex A Occurrence data in food and feed submitted to EFSA and dietary exposure assessment forhumans wwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodIntroductionBackground and Terms of Reference as provided by the requestorBackgroundMany plants in the family Solanaceae contain glycoalkaloids and they are considered to be naturaltoxins The plant glycoalkaloids are toxic steroidal glycosides and the commonest types found in foodplants are asolanine and achaconine Their natural function is probably to serve as stress metabolitesor phytoalexins for the protection of the plant when attacked by insects fungi etcAmongst the most widely cultivated food crops aubergines tomatoes and potatoes are in theSolanaceae family but the levels of glycoalkaloids in tomatoes and aubergines are generally quite lowThe glycoalkaloids of most relevance to food safety are those occurring in the potato Thepredominant toxic steroidal glycosides in potato are asolanine and achaconine They occur in potatotubers peel sprouts berries leaves and blossoms and their concentration in tubers depends on anumber offactors Concentrations ofglycoalkaloids are times greater in the peel than in the ï¬esh There is considerable variation inglycoalkaloid content among potato cultivars Storage conditions especially light and temperature aremainly responsible for increases in solanine Although the glycoalkaloid content can increase in thedark the rate of formation is only about the rate of formation in light Increases of solanine inthe potato peel are closely associated with greening synthesis of chlorophyll of the peel Thesebiochemical processes are independent of each other but are both activated by lightsuch as cultivar maturity and environmentalfactorsBitter or burning sensation in the mouth are sensory impressions which may accompanyglycoalkaloid poisoning symptoms from potatoes that include ï¬ulike symptoms such as nauseavomiting stomach and abdominal cramps and diarrhoea More severe cases of glycoalkaloid poisoningmay be accompanied by a variety of neurological effects ie drowsiness apathy restlessnessshaking confusion weakness and disturbed vision There are a few reports of deaths beingattributed to glycoalkaloid exposure from the consumption of potatoes potato leaves and potatoberriesPotatoes and potatoderived products are listed in the Catalogue of feed materials1Terms of ReferenceIn accordance with Art of Regulation EC No the European Commission asks theEuropean Food Safety Authority for a scientiï¬c opinion on the risks for animal and human healthrelated to the presence of glycoalkaloids in feed and food in particular in potatoes and potatoderivedproductsInterpretation of the Terms of ReferenceThe CONTAM Panel considered that the opinion should cover edible parts of potato plants and alsoof other food plants containing glycoalkaloids GAs eg tomato and aubergine Nonedible parts ofGA containing plants have not been considered with the exception of potato sprouts In particular theCONTAM Panel concluded this Opinion should comprise thea evaluation of the toxicity of GAs in feed and food in particular in potatoes and potatoderivedproducts for farm and companion animals and humans considering all relevant toxicologicalend pointsb evaluation of the alkaloid proï¬le ie composition of the alkaloids and their concentration ofthe food and feed samples submitted to EFSAc estimation of the dietary exposure of the European population to GAs in food in particular inpotatoes and potatoderived products including the consumption patterns of speciï¬c groupsof the population if appropriated estimation of the dietary exposure offarm and companion animals to GAs in feedinparticular in potatoes and potatoderived productse assessment of the human health risks for the European population including speciï¬c groupsof the population if appropriate as the consequence of the estimated dietary exposure Commission Regulation EU No of January on the Catalogue of feed materials OJL p wwwefsaeuropaeuefsajournalEFSA Journal 0cGlycoalkaloids in feed and foodf assessment of the farm and companion animal health risks in Europe as the consequence ofthe estimated dietary exposure Exposure to GAs from weeds containing GA is only addressedin this Opinion in the context of accidental intake by farm animalsWhen referring to GAs in potatoes the term total GAs TGA refers to a material comprising asolanineand achaconine as major fraction with no speciï¬cation on the occurrence of minor GAs as well as band cforms of solanine and chaconine Similarly when referring to tomato and aubergine the termTGA refers to the GAs from the corresponding species and forms thereofSupporting information for the assessment ChemistrySolanine is one of the ï¬rst alkaloids that has been isolated from nature by Desfosses in Friedman et al In Zwenger and Kind reported that solanine contains a glycoside sidechain Zwenger and Kind Only in it was shown that solanine extracted from potato is infact a mixture of two glycoalkaloids GAs asolanine and achaconine that share the same solanidineaglycone Kuhn and L¬ow Since then at least different GAs have been isolated and fullystructurally elucidated from over species of the Solanaceae family S 13anchezMata et al AlSinani and Eltayeb The chemical structures and some physical properties of the most importantones are listed in Appendix AGAs are composed of a steroidal aglycone and an oligosaccharide sidechain attached to the 3bhydroxy group of the aglycone see Figure Friedman et al Friedman Milner et al The GAs of relevance can be divided into the i solanidane group with solanidine as thesteroid backbone and the ii spirosolane group with either the solasodine or the tomatidenoltomatidine backbone GAs often contain a double bond between C5 and C6 but the corresponding 5a6hydrogenated forms are also common and in some species eg tomato they constitute the majorcomponents The stereochemistry at carbons C22 and C25 is well deï¬nedtheconï¬guration is 22R 25Stheitconï¬guration is 22S 25S Friedman et al in solanidineis 22R 25R and in tomatidenoltomatidinein solasodineFurther diversiï¬cation is generated by the composition of the glycoside sidechain Most GAscontain either a trisaccharide chacotriose or solatriose or a tetrasaccharide lycotetraose ascarbohydrate In commercial potato cultivars Solanum tuberosum mostly achaconine and asolaninecomposed ofthe solanidine aglycone and chacotriose and solatriose respectively are presentFigure Wild S tuberosum varieties may contain a much wider range of GAs Friedman et al Distl and Wink The aubergine fruit derived from S melongena contains primarily asolamargine and asolasonine composed of the solasodine aglycone and chacotriose and solatrioselycopersicum varieties atomatine and arespectivelydehydrotomatine are the major compounds composed of the aglycones tomatidine and tomatidenolrespectively coupled to lycotetraose Friedman derived from SIn tomato fruitThe preï¬x alpha a refers to the intact glycoside while the preï¬xe | Thyroid_Cancer |
"distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distributi(...TRUNCATED) | Thyroid_Cancer |
"\"attention has been paid to whether snoring frequency is associated with body composition inmenopa(...TRUNCATED) | Thyroid_Cancer |
"Oral squamous cell carcinoma OSCC is a common kind of squamous cell carcinoma of the head and neck (...TRUNCATED) | Thyroid_Cancer |
"Breast cancer is a common malignancy in women Among breast cancer types triplenegative breast can(...TRUNCATED) | Thyroid_Cancer |
End of preview. Expand
in Dataset Viewer.
- Downloads last month
- 38