Datasets:

HoangHa

/

medical-raw

like 0

e529be7c-f360-4dba-b313-7f3fc240697a

Which of the following statements are True/False? 1. Hirsutism, which is defined as androgen-dependent excessive male pattern hair growth, affects approximately 25% of women. 2. Virilization refers to a condition in which androgen levels are sufficiently high to cause additional signs and symptoms. 3. Frequently, patients with growth hormone excess (i.e., acromegaly) present with hirsutism. 4. A simple and commonly used method to grade hair growth is the modified scale of Ferriman and Gallwey. 5. Scores above 8 suggest excess androgen-mediated hair growth.

1, 2, 3 True & 4, 5 false

1, 3, 5 True & 2, 4 false

2, 4, 5 True & 1, 3 false

1, 2, 3, 4 True & 5 false

2c

multi

Here statement 1 & 3 are wrong. It is actually a direct pick from harrison, an impoant topic for entrance examinations hirsutism is seen in 10% of woman. Acromegaly rarely causes hirsutism. Ref: Harrisons Principles of Medicine, 18th Edition, Pages 380-382

Medicine

Which of the following statements are True/False? 1. Hirsutism, which is defined as androgen-dependent excessive male pattern hair growth, affects approximately 25% of women. 2. Virilization refers to a condition in which androgen levels are sufficiently high to cause additional signs and symptoms. 3. Frequently, patients with growth hormone excess (i.e., acromegaly) present with hirsutism. 4. A simple and commonly used method to grade hair growth is the modified scale of Ferriman and Gallwey. 5.

Scores above 8 suggest excess androgen-mediated hair growth.

C. 2, 4, 5 True & 1, 3 false

31868f6c-233a-40ee-880e-9c668509a8b1

An ill 16 days old baby girl is brought to the emergency. On examination pallor and dyspnoea present with a respiratory rate of 85 per minute. Her HR is 200 bpm, hea sounds are distant and a gallop is heard. X-ray showed cardiomegaly. An echocardiogram shows dilated ventricles and dilation of the left atrium. An ECG shows ventricular depolarization complexes that have low voltage. Which of the following is the most likely diagnosis?

CHF

Glycogen storage disease

Pericarditis

Aberrant left coronary aery arising from pulmonary aery

0a

multi

In CHF pallor, dyspnoea, tachypnoea, tachycardia and cardiomegaly are common regardless of the cause.The most common causes of CHF in children include myocarditis caused by adenovirus and coxsackievirus B.The echocardiogram shows ventricular and left atrial dilatation as well as poor ventricular function. With glycogen storage disease of the hea muscle thickening would be expected. With pericarditis- pericardial effusion is seen. On ECG, the voltages of the ventricular complexes seen with aberrant origin of the left coronary aery are not diminished, and a pattern of myocardial infarction can be seen. *

Pediatrics

Impoant Viral Diseases in Children

An ill 16 days old baby girl is brought to the emergency. On examination pallor and dyspnoea present with a respiratory rate of 85 per minute. Her HR is 200 bpm, hea sounds are distant and a gallop is heard. X-ray showed cardiomegaly. An echocardiogram shows dilated ventricles and dilation of the left atrium. An ECG shows ventricular depolarization complexes that have low voltage.

Which of the following is the most likely diagnosis?

A. CHF

090f4f67-eab2-4ffc-a9d0-d03da739bf9f

A 19 year old female presents with pain in the neck for 5 days. She is not able to wear tie for her job because of neck pain. H/O fatigue and lethargy for 10 days. She had flu like symptoms 20 days ago which resolved spontaneously. BP 110/80 mmHg, Pulse 48/min. Extremities are cold and dry. Neck is very tender. ECG normal. TSH is elevated. ESR 30 mm/hr. Next appropriate step

Atropine injection

Levothyroxine administration

Aspirin

Increase iodine intake in food

2c

multi

Answer: c) Aspirin (SCHWARTZ 19TH ED, P-1525; SABISTON 19TH ED, P-895)Granulomatous or Subacute or De Quervain's thyroiditisMost commonly occurs in 30- 40 year-old womenStrong association with the HLA-B35Fever with Sudden or gradual onset of neck painH/o preceding URI; Viral etiologyGland - enlarged, tender, firmClassically progresses through four stages: Hyperthyroid-Euthyroid-Hypothyroid-EuthyroidA few patients develop recurrent diseaseEarly stages: | ESR, Tg, T4, and T3 levels are elevated, TSH decreasedDuring Hypothyroid stage: elevated TSHLow radio-iodine uptakeFNAC - multinucleated giant cells of an epithelioid foreign body type and aggregates of lymphocytes activated macrophages, and plasma cellsSelf-limiting diseaseAspirin and NSAIDs are used for pain reliefPrednisolone for severe casesShort-term thyroid replacement may be needed and may shorten the duration of symptoms

Surgery

Thyroid Gland

A 19 year old female presents with pain in the neck for 5 days. She is not able to wear tie for her job because of neck pain. H/O fatigue and lethargy for 10 days. She had flu like symptoms 20 days ago which resolved spontaneously. BP 110/80 mmHg, Pulse 48/min. Extremities are cold and dry. Neck is very tender. ECG normal. TSH is elevated. ESR 30 mm/hr.

Next appropriate step

C. Aspirin

cbd91783-e901-4672-9ec1-7f58bce041da

A 74-year-old woman develops occipital headache, vomiting, and dizziness. She looks unwell, her blood pressure is 180/100 mm Hg, pulse is 70/min, and respirations are 30/min. She is unable to sit or walk because of unsteadiness. Over the next few hours, she develops a decline in her level of consciousness.For the above patient with altered level of consciousness, select the most likely diagnosis.

basal ganglia hemorrhage

cerebellar hemorrhage

pontine hemorrhage

lobar intracerebral hemorrhage

1b

multi

Cerebellar hemorrhage, when mild, may present with only headache, vomiting, and ataxia of gait. Patients may complain of dizziness or vertigo. The eyes may be deviated to the side opposite the hemorrhage. Nystagmus is not common, but an ipsilateral sixth nerve palsy can occur. This is the only type of intracerebral hemorrhage that commonly benefits from surgical intervention.

Medicine

C.N.S.

A 74-year-old woman develops occipital headache, vomiting, and dizziness. She looks unwell, her blood pressure is 180/100 mm Hg, pulse is 70/min, and respirations are 30/min. She is unable to sit or walk because of unsteadiness.

Over the next few hours, she develops a decline in her level of consciousness.For the above patient with altered level of consciousness, select the most likely diagnosis.

B. cerebellar hemorrhage

d5d03cd8-055b-49bf-9b2d-4b8dc3fd6b4d

A 68-year-old man is admitted to the coronary care unit with an acute myocardial infarction. His postinfarction course is marked by congestive hea failure and intermittent hypotension. On the fouh day in hospital, he develops severe midabdominal pain. On physical examination, blood pressure is 90/60 mm Hg and pulse is 110 beats per minute and regular; the abdomen is soft with mild generalized tenderness and distention. Bowel sounds are hypoactive; stool Hematest is positive. Which of the following is the most appropriate next step in this patient's management?

Barium enema

Upper gastrointestinal series

Angiography

Ultrasonography

2c

multi

In the absence of peritoneal signs, angiography is the diagnostic test of choice for acute mesenteric ischemia. Patients with peritoneal signs should undergo emergent laparotomy. Acute mesenteric ischemia may be difficult to diagnose. The condition should be suspected in patients with either systemic manifestations of aeriosclerotic vascular disease or low cardiac-output states associated with a sudden development of abdominal pain that is out of propoion to the physical findings. Because of the risk of progression to small-bowel infarction, acute mesenteric ischemia is an emergency and timely diagnosis is essential. Although patients may have lactic acidosis or leukocytosis, these are late findings. Abdominal films are generally unhelpful and may show a nonspecific ileus pattern. Since the pathology involves the small bowel, a barium enema is not indicated. Upper gastrointestinal series and ultrasonography are also of limited value. CT scanning is a good initial test, but should still be followed by angiography in a patient with clinically suspected acute mesenteric ischemia, even in the absence of findings on the CT scan. In addition to establishing the diagnosis in this stable patient, angiography may also assist with operative planning and elucidation of the etiology of the acute mesenteric ischemia. The cause may be embolic occlusion or thrombosis of the superior mesenteric aery, primary mesenteric venous occlusion, or nonocclusive mesenteric ischemia secondary to low-cardiac output states. A moality of 50% to 75% is repoed. The majority of affected patients are at high operative risk, but early diagnosis followed by revascularization or resectional surgery or both are the only hope for survival. Celiotomy must be performed once the diagnosis of aerial occlusion or bowel infarction has been made. Initial treatment of nonocclusive mesenteric ischemia includes measures to increase cardiac output and blood pressure. Laparotomy should be performed if peritoneal signs develop

Anaesthesia

Preoperative assessment and monitoring in anaesthesia

A 68-year-old man is admitted to the coronary care unit with an acute myocardial infarction. His postinfarction course is marked by congestive hea failure and intermittent hypotension. On the fouh day in hospital, he develops severe midabdominal pain. On physical examination, blood pressure is 90/60 mm Hg and pulse is 110 beats per minute and regular; the abdomen is soft with mild generalized tenderness and distention. Bowel sounds are hypoactive; stool Hematest is positive.

Which of the following is the most appropriate next step in this patient's management?

C. Angiography

226c17a9-13fe-4496-bc2e-5aabce4fef1c

A 2-week-old baby is irritable and feeding poorly. On physical examination, the infant is irritable, diaphoretic, tachypneic and tachycardic. There is circumoral cyanosis, which is not alleted by nasal oxygen. A systolic thrill and holosystolic murmur are heard along the left sternal border. An echocardiogram reveals a hea defect in which the aoa and pulmonary aery form a single vessel that overrides a ventricular septal defect. What is the appropriate diagnosis?

Atrial septal defect

Coarctation of aoa, preductal

Patent ductus aeriosus

Truncus aeriosus

3d

multi

Truncus aeriosus refers to a common trunk for the origin of the aoa, pulmonary aeries and coronary aeries. It results from absent or incomplete paitioning of the truncus aeriosus by the spiral septum during development. Most infants with persistent truncus aeriosus have torrential pulmonary blood flow, which leads to hea failure. None of the other choices are distinguished by a single vessel that carries blood from the hea.

Pathology

Cardiac disorders

A 2-week-old baby is irritable and feeding poorly. On physical examination, the infant is irritable, diaphoretic, tachypneic and tachycardic. There is circumoral cyanosis, which is not alleted by nasal oxygen. A systolic thrill and holosystolic murmur are heard along the left sternal border. An echocardiogram reveals a hea defect in which the aoa and pulmonary aery form a single vessel that overrides a ventricular septal defect.

What is the appropriate diagnosis?

D. Truncus aeriosus

66cb240a-b8a0-402c-9a9f-1e0a0ffe3551

A 44-year-old businessman presents to a physician because of a markedly inflammed and painful right great toe. He states that he just returned from a convention, and had noticed increasing pain in his right foot during his flight back home. Physical examination is remarkable for swelling and erythema of the right great toe as well as small nodules on the patient's external ear. Aspiration of the metatarsal-phalangeal joint of the affected toe demonstrates needle-shaped negatively birefringent crystals. Which of the following agents would provide the most immediate relief for this patient?

Allopurinol

Aspirin

Colchicine

Probenecid

2c

multi

The patient has gout, which is due to precipitation of monosodium urate crystals in joint spaces (notably the great toe) and soft tissues (causing tophi, which are often found on the external ears). Colchicine reduces the inflammation caused by the urate crystals by inhibiting leukocyte migration and phagocytosis secondary to an effect on microtubule assembly. Allopurinol and its metabolite, oxypurinol, inhibit xanthine oxidase, the enzyme that forms uric acid from hypoxanthine. Therapy with this agent should be begun 1-2 weeks after the acute attack has subsided. Aspirin competes with uric acid for tubular secretion, thereby decreasing urinary urate excretion and raising serum uric acid levels. At high doses (more than 2 gm daily) aspirin is a uricosuric. Probenecid and sulfinpyrazone are uricosuric agents, increasing the urinary excretion of uric acid, hence decreasing serum levels of the substance. Therapy with these agents should be begun 1-2 weeks after the acute attack has subsided.

Pharmacology

A 44-year-old businessman presents to a physician because of a markedly inflammed and painful right great toe. He states that he just returned from a convention, and had noticed increasing pain in his right foot during his flight back home. Physical examination is remarkable for swelling and erythema of the right great toe as well as small nodules on the patient's external ear. Aspiration of the metatarsal-phalangeal joint of the affected toe demonstrates needle-shaped negatively birefringent crystals.

Which of the following agents would provide the most immediate relief for this patient?

C. Colchicine

9ec100e0-c6b0-4164-b3c6-a2685e2a4cd3

A 4-month-old infant has undergone surgical treatment for meningomyeloencephalocele. At bih, an operation was carried out in the posterior cranial fossa to paially replace brain cerebellar contents to an intracranial position. In investigations for progressive hydrocephalus, it is noted that there is herniation of the cerebellar tonsils through the foramen magnum, and a diagnosis of Arnold-Chiari syndrome is established. This syndrome may also include which of the following?

Fusion of the frontal lobes

Fusion of the temporal, parietal, and occipital lobes

Abnormal elongation of the medulla and lower cranial nerves

Paial or complete absence of the pituitary gland

2c

multi

Abnormal elongation of the medulla and lower cranial nerves may be evident in Arnold-Chiari syndrome. Additional features include fusion of the corpora quadrigemina, leading to a "beaked" tectum; paial or complete absence of the corpus callosum; and microgyria.

Surgery

Cerebrovascular Diseases

A 4-month-old infant has undergone surgical treatment for meningomyeloencephalocele. At bih, an operation was carried out in the posterior cranial fossa to paially replace brain cerebellar contents to an intracranial position. In investigations for progressive hydrocephalus, it is noted that there is herniation of the cerebellar tonsils through the foramen magnum, and a diagnosis of Arnold-Chiari syndrome is established.

This syndrome may also include which of the following?

C. Abnormal elongation of the medulla and lower cranial nerves

c2c522e9-595e-4327-a763-7eb93c7fcb88

A 68-year-old male is brought to the outpatient by his wife due to increasing forgetfulness. On taking history in details, wife repoed that for around 6 months patient is having trouble in organising the finances and paying bills, something he has done all his life. He has also become withdrawn and has decreased meeting people. The patient also behaved inappropriately with a female neighbour couple of says back, which is much against his usual nature. The patient denies having any problems and seems indifferent to his wife's concern. He has a medical history of hypeension and type 2 diabetes mellitus There is a family history of Alzheimer disease. On MMSE, score came out to be 23. Which of the following is the most likely diagnosis?

Alzheimer disease

Creutzfeldt-Jakob disease

Dementia with Lewy bodies

Frontotemporal dementia

3d

multi

The history is suggestive of executive dysfunction (trouble in organising the finances and paying bills), apathy and disinhibition (decreased socialisation and inappropriate behaviour with women), lack of insight (denies having any problem) and memory disturbances. This is suggestive of frontotemporal dementia, in which personality changes are prominent, memory disturbances appear later in frontotemporal dementia. In contrast, in alzheimers disease memory disturbances are prominent early in the disorder and personality changes later. Creutzfeldt-Jakob disease which is caused by a prion manifests with rapidly progressive dementia, myoclonus, and cerebellar dysfunction.

Psychiatry

Organic Mental Disorders

A 68-year-old male is brought to the outpatient by his wife due to increasing forgetfulness. On taking history in details, wife repoed that for around 6 months patient is having trouble in organising the finances and paying bills, something he has done all his life. He has also become withdrawn and has decreased meeting people. The patient also behaved inappropriately with a female neighbour couple of says back, which is much against his usual nature. The patient denies having any problems and seems indifferent to his wife's concern. He has a medical history of hypeension and type 2 diabetes mellitus There is a family history of Alzheimer disease. On MMSE, score came out to be 23.

Which of the following is the most likely diagnosis?

D. Frontotemporal dementia

6459cbf2-9cb5-4d04-bfc3-f75278df9306

A 10-year-old male child with sho stature presented to the pediatric OPD with complaints of frequent headaches over the past 6 months along with slowly progressive loss of vision of the right eye. Lately the child has also staed having trouble in walking along with frequent mood changes and excessive thirst. MRI brain showed a tumour in the sellar region which was resected. HPE examination showed reticular epithelial cells that have appearances reminiscent of the enamel pulp of developing teeth along with calcifications and wet keratin nodules. The gene involved in causing the above condition is also involved in causing which other condition: -

Hepatocellular carcinoma

Melanoma

Neuroblastoma

CML

0a

multi

This is a case of Craniopharyngioma. Benign tumour Arise in sellar/suprasellar region Arise from vestigial remnants of Rathke's pouch Bimodal age distribution Presents with headache and visual disturbance May present with sho stature due to GH deficiency (Pituitary hypofunction). Most commonly due to abnormalities in WNT signaling pathway including the activating mutations of the beta-catenin. MRI image shows a mass in the suprasellar region- likely craniopharyngioma OTHER CANCERS DUE TO WNT PATHWAY Mutations in b-catenin are present in: - 50% of hepatoblastomas. 20% of Hepatocellular carcinomas GENES INVOLVED IN: - Melanoma- NRAS, FGF3, HST1 Neuroblastoma- N-MYC, ALK CML- ABL

Unknown

Integrated QBank

A 10-year-old male child with sho stature presented to the pediatric OPD with complaints of frequent headaches over the past 6 months along with slowly progressive loss of vision of the right eye. Lately the child has also staed having trouble in walking along with frequent mood changes and excessive thirst. MRI brain showed a tumour in the sellar region which was resected. HPE examination showed reticular epithelial cells that have appearances reminiscent of the enamel pulp of developing teeth along with calcifications and wet keratin nodules.

The gene involved in causing the above condition is also involved in causing which other condition: -

A. Hepatocellular carcinoma

76c1bec9-32e2-4a59-94e6-bb791855bec6

A 40-year-old intravenous drug user presents to the emergency depament with a 2 days history of right knee pain with associated swelling and erythema. The patient is febrile with a holosystolic murmur at the right lower sternal border. Complete blood count reveals leukocytosis. Blood and synol fluid cultures are sent, and broad-spectrum antibiotics are staed. Synol fluid analysis is pending. What is the most likely pathogen causing these symptoms

Neisseria gonorrhoeae

Pseudomonas aeruginosa

Borrelia burgdorferi

Staphylococcus aureus

3d

single

Gram-positive bacteria remain the most common cause of septic ahritis. Staphylococcus aureus accounts for the majority of culture-positive septic ahritis, especially within ceain patient subgroups such as hemodialysis patients and intravenous drug abusers. The predominance of S. aureus in septic ahritis has remained unchanged for many years.

Orthopaedics

Thigh, Knee,Leg,Foot & Ankle injuries

A 40-year-old intravenous drug user presents to the emergency depament with a 2 days history of right knee pain with associated swelling and erythema. The patient is febrile with a holosystolic murmur at the right lower sternal border. Complete blood count reveals leukocytosis. Blood and synol fluid cultures are sent, and broad-spectrum antibiotics are staed. Synol fluid analysis is pending.

What is the most likely pathogen causing these symptoms

D. Staphylococcus aureus

daf61c69-6951-485c-b98e-5e85aa3c5120

A 25 years old female complains of recurrent rhinitis, nasal discharge and bilateral nasal blockage since one year. She has the history of asthma and allergy. On examination, multiple ethmoidal polyps are noted with mucosal thickening and impacted secretions in both the nasal cavities. A biopsy is taken and the material is cultured which shown the growth of many non pigmented septate hyphae with dichotomous branching typically at 45degrees. Which of the following is the most likely responsible organism

Aspergillus fumigatus

Rhizopus

Mucor

Candida

0a

multi

Aspergillus shows typical dichotomous branching at an angle of approximately 45degrees. Candida shows pseudohyphae. Rhizopus and mucor shows nonseptate hyphae. Reference: Textbook of Microbiology; Baveja; 4th edition

Microbiology

mycology

A 25 years old female complains of recurrent rhinitis, nasal discharge and bilateral nasal blockage since one year. She has the history of asthma and allergy. On examination, multiple ethmoidal polyps are noted with mucosal thickening and impacted secretions in both the nasal cavities. A biopsy is taken and the material is cultured which shown the growth of many non pigmented septate hyphae with dichotomous branching typically at 45degrees.

Which of the following is the most likely responsible organism

A. Aspergillus fumigatus

fb22bfc1-6edc-4099-9d59-5ab1aec761e2

Ten days after an exploratory laparotomy and lysis of adhesions, a patient, who previously underwent a low anterior resection for rectal cancer followed by postoperative chemoradiation, is noted to have succus draining from the wound. She appears to have adequate source control--she is afebrile with a normal white blood count. The output from the fistula is approximately 150 cc per day. Which of the following factors is most likely to prevent closure of the enterocutaneous fistula?

Previous radiation

Previous chemotherapy

Recent surgery

History of malignancy

0a

single

Factors that predispose to fistula formation and may prevent closure include foreign body, radiation, inflammation, epithelialization of the tract, neoplasm, distal obstruction, and steroids.Factors that result in unhealthy or abnormal tissue surrounding the enterocutaneous fistula decrease the likelihood of spontaneous resolution. For example, radiation therapy, such as used for treatment of pelvic gynecologic and rectal malignancies, can result in chronic injury to the small intestine characterized by fibrosis and poor wound healing. High-output fistulas, defined as those with more than 500 cc per day output, are usually proximal and unlikely to close. Treatment consists of source control, nutritional supplementation, wound care, and delayed surgical intervention if the fistula fails to close.

Anaesthesia

Preoperative assessment and monitoring in anaesthesia

Ten days after an exploratory laparotomy and lysis of adhesions, a patient, who previously underwent a low anterior resection for rectal cancer followed by postoperative chemoradiation, is noted to have succus draining from the wound. She appears to have adequate source control--she is afebrile with a normal white blood count. The output from the fistula is approximately 150 cc per day.

Which of the following factors is most likely to prevent closure of the enterocutaneous fistula?

A. Previous radiation

f8d1aab7-88d9-4a6a-982d-8f8ad20ddd8a

A 33-year-old male immigrant from Taiwan presents with increasing right upper quadrant (RUQ) pain. The pain is dull, and it does not radiate or change with eating. On examination the abdomen is soft, there is a mass in the RUQ, and no ascites is clinically detected. He has a prior history of hepatitis B. His laboratory investigations reveal hepatitis B surface antigen (HBsAg) positive, hepatitis B surface antibody (HBsAb) negative, aspartate amino transferase (AST) 60 U/L, alanine amino transferase (ALT) 72 U/L, and an elevated alpha-fetoprotein level. Which of the following is the most likely diagnosis?

hepatoma

hepatocellular carcinoma (HCC)

metastatic cancer

hepatic hemangioma

1b

multi

(b) Source: (Devita, pp. 533-534) Only the chronic carrier state increases HCC risk, not previous infection. The majority, but not all, of HCC associated with HBV occurs in the setting of cirrhosis (60-90%). Because the latency period of HBV infection is 35 years, before HCC supervenes, early-life infection is strongly correlated with HCC. The chronic carrier state of HBsAg in endemic areas, such as Taiwan, is associated with a relative risk of over 100 for the development of HCC. Over half the chronic carriers of HBsAg in such a population will die of cirrhosis or HCC. In Taiwan, where childhood vaccination was introduced in 1984, the death rate from childhood HCC has already declined.

Medicine

Oncology

A 33-year-old male immigrant from Taiwan presents with increasing right upper quadrant (RUQ) pain. The pain is dull, and it does not radiate or change with eating. On examination the abdomen is soft, there is a mass in the RUQ, and no ascites is clinically detected. He has a prior history of hepatitis B. His laboratory investigations reveal hepatitis B surface antigen (HBsAg) positive, hepatitis B surface antibody (HBsAb) negative, aspartate amino transferase (AST) 60 U/L, alanine amino transferase (ALT) 72 U/L, and an elevated alpha-fetoprotein level.

Which of the following is the most likely diagnosis?

B. hepatocellular carcinoma (HCC)

8ac9640d-d878-4003-8341-2eea055157f8

A 60-year-old man presents to the emergency department with chest pain described as retrosternal chest pressure radiating to the jaw. The symptoms started at rest and coming and going, but never lasting more than 15 minutes. He has a prior history of hypertension and smokes 1 pack/day. He is currently chest-pain free and on physical examination the blood pressure is 156/88 mmHg, pulse 88/min, and O2 saturation 98%. The heart and lung examination is normal.His ECG shows ST-segment depression in leads V1 to V4 that is new, and the first set of cardiac enzymes is negative. He is diagnosed with unstable angina pectoris, admitted to a monitored unit, and started on low molecular weight heparin, aspirin, nitroglycerin, and beta- adrenergic blockers. He continues to have ongoing chest pain symptoms. Which of the following is the most appropriate next step in management?

IV streptokinase

coronary angiography

exercise testing

oral aspirin

1b

multi

A period of 24-48 hours is usually allowed to attempt medical therapy. Cardiac catheterization and angiography may be followed by bypass surgery or angioplasty. For those who do settle down, some form of subsequent risk stratification (e.g., exercise ECG) is indicated.

Medicine

C.V.S.

A 60-year-old man presents to the emergency department with chest pain described as retrosternal chest pressure radiating to the jaw. The symptoms started at rest and coming and going, but never lasting more than 15 minutes. He has a prior history of hypertension and smokes 1 pack/day. He is currently chest-pain free and on physical examination the blood pressure is 156/88 mmHg, pulse 88/min, and O2 saturation 98%. The heart and lung examination is normal.His ECG shows ST-segment depression in leads V1 to V4 that is new, and the first set of cardiac enzymes is negative. He is diagnosed with unstable angina pectoris, admitted to a monitored unit, and started on low molecular weight heparin, aspirin, nitroglycerin, and beta- adrenergic blockers. He continues to have ongoing chest pain symptoms.

Which of the following is the most appropriate next step in management?

B. coronary angiography

9dbfe50d-9f1b-40f7-9d22-086482e85b07

A child is taken to a pediatrician because his mother notices that his eyes appear very puffy. The mother said that the boy's eyes appeared normal two days ago, and pa of what caused her concern was that her child seemed to be rapidly becoming ill. On physical examination, the boy is noted to have generalized edema. No hypeension or jaundice is noted. Blood urea nitrogen and serum creatinine are within normal limits. A urine sample is collected, and the nurse notices that the top of the urine has a small amount of foam at the top. Urinalysis is negative for glucose, red cells, white cells, casts, crystals, and bacteria. A 24-hr-urine specimen is collected, which demonstrates proteinuria of 55 mg/h/m2. Which of the following is the most likely diagnosis?

Acute renal failure

Chronic renal failure

Lower urinary tract disease

Nephrotic syndrome

3d

multi

Proteinuria greater than 40 mg/h/m2 in a child or 3.5 g/d/1.73 m2 in an adult produces nephrotic syndrome, which is characterized by generalized edema, often most noticeable in the face. The condition develops when large amounts of protein are spilled through the glomeruli into the duct system of the kidneys. In contrast, nephritic syndrome is accompanied by lower levels of proteinuria, together with microscopic or macroscopic hematuria (red cells and blood in urine). Acute and chronic renal failure are characterized by rising serum levels of BUN and creatinine. The findings seen do not suggest lower urinary tract disease, which is typically due to a lower urinary tract infection (which would show bacteria and white cells), calculi (crystals would likely be present), or tumor (which would show abnormal bladder epithelial cells).

Pediatrics

A child is taken to a pediatrician because his mother notices that his eyes appear very puffy. The mother said that the boy's eyes appeared normal two days ago, and pa of what caused her concern was that her child seemed to be rapidly becoming ill. On physical examination, the boy is noted to have generalized edema. No hypeension or jaundice is noted. Blood urea nitrogen and serum creatinine are within normal limits. A urine sample is collected, and the nurse notices that the top of the urine has a small amount of foam at the top. Urinalysis is negative for glucose, red cells, white cells, casts, crystals, and bacteria. A 24-hr-urine specimen is collected, which demonstrates proteinuria of 55 mg/h/m2.

Which of the following is the most likely diagnosis?

D. Nephrotic syndrome

4db14beb-81b4-4ff3-a091-adf901ae0570

A 44-year-old renal transplant patient develops severe cough and shortness of breath on exertion. On examination, he appears dyspneic, respirations 24/min, pulse 110/min, and oxygen saturation 88%. His lungs are clear on auscultation and heart sounds are normal. CXR shows bilateral diffuse perihilar infiltrates. Bronchoscopy and bronchial brushings show clusters of cysts that stain with methenamine silver. Which of the following is the most appropriate next step in management?

amphotericin B

cephalosporins

trimethoprim-sulfamethoxazole

aminoglycosides

2c

multi

The patient is infected with Pneumocystis organisms invading an immunocompromised host. The treatment of choice is trimethoprim-sulfamethoxazole. Alternate therapies include pentamidine (highly toxic) and trimetrexate plus folinic acid.

Medicine

Infection

A 44-year-old renal transplant patient develops severe cough and shortness of breath on exertion. On examination, he appears dyspneic, respirations 24/min, pulse 110/min, and oxygen saturation 88%. His lungs are clear on auscultation and heart sounds are normal. CXR shows bilateral diffuse perihilar infiltrates. Bronchoscopy and bronchial brushings show clusters of cysts that stain with methenamine silver.

Which of the following is the most appropriate next step in management?

C. trimethoprim-sulfamethoxazole

079d565e-2a47-4500-96af-30bb792d8137

An 8-month-old child presented with reduced appetite, abdominal distension and pain and psychomotor retardation. The child was normal at bih and both parents are normal. O/E: - Hepatosplenomegaly Moderate lymphadenopathy Abnormal posturing of the limbs, trunk, and face Impaired voluntary rapid eye movements Cheery red spot on fundus examination. Bony defects Lymph node-histopathology and electron microscopy. EM findings Which of the following enzymes is most likely deficient in the above disease: -

Hexosaminidase A

Alpha-galactosidase A

Glucocerebrosidase

Sphingomyelinase

3d

multi

This is a case of Niemann-pick disease. 1. Autosomal recessive disease 2. Divided into 2 groups depending on deficiency: - Deficiency of acid sphingomyelinase enzyme- Type A and B Impaired intracellular cholesterol trafficking- Type C and D 3. Normal at bih 4. Presents with hepatosplenomegaly, lymphadenopathy and cherry red spot on fundus examination. 5. HPE image shows Niemann-pick cells- These are foam cells with soap suds appearance (Distention of Lysosomes due to sphingomyelin and cholesterol) 6. Electron microscopy shows Zebra bodies - These are concentric lamellated myelin figures (in engorged secondary lysosomes). OTHER ENZYME DEFICIENCIES: - Hexosaminidase A- Tay-sach's disease Alpha-galactosidase A - Fabry's disease Glucocerebrosidase - Gaucher's disease

Unknown

Integrated QBank

An 8-month-old child presented with reduced appetite, abdominal distension and pain and psychomotor retardation. The child was normal at bih and both parents are normal. O/E: - Hepatosplenomegaly Moderate lymphadenopathy Abnormal posturing of the limbs, trunk, and face Impaired voluntary rapid eye movements Cheery red spot on fundus examination. Bony defects Lymph node-histopathology and electron microscopy.

EM findings Which of the following enzymes is most likely deficient in the above disease: -

D. Sphingomyelinase

a19c7974-94c0-4955-8fd7-fd4117ba4f46

An elderly house wife lost her husband who died suddenly of Myocardial infarction couple of years ago. They had been staying alone for almost a decade with infrequent visits from her son and grandchildren. About a week after the death she heard his voice clearly talking to her as he would in a routine manner from the next room. She went to check but saw nothing. Subsequently she often heard his voice conversing with her and she would also discuss her daily matters with him. This however, provoked anxiety and sadness of mood when she was preoccupied with his thought. She should be treated with:

Clornipramine.

Aiprazolam

Electroconvulsive therapy.

Haloperidol.

3d

single

D i.e. HaloperidolThe diagnosis of this lady is morbid grief When there is an exaggeration of one or more symptoms of normal grief or the duration becomes prolonged beyond 6 months without recovery, it is k/a morbid grief.Preoccupation with the memory of deceased is a characteristic featureQ.Idealization of deceased (ignoring his negative qualities).Sense of presence of deceased in the surroundings & misinterpretation of voices or faces of others as that of lost person. Rarely fleeting hallucinations may occur.Treatment - In morbid & complicated grief, medication depends on presenting clinical features.As this lady is mainly having problem of auditory hallucination (1/t sadness & anxiety) - antipsychotic like haloperidol is needed to treat her.

Psychiatry

An elderly house wife lost her husband who died suddenly of Myocardial infarction couple of years ago. They had been staying alone for almost a decade with infrequent visits from her son and grandchildren. About a week after the death she heard his voice clearly talking to her as he would in a routine manner from the next room. She went to check but saw nothing. Subsequently she often heard his voice conversing with her and she would also discuss her daily matters with him. This however, provoked anxiety and sadness of mood when she was preoccupied with his thought.

She should be treated with:

D. Haloperidol.

cc40d3a2-ae63-4c4f-aa83-32d663267e66

A 50-year-old woman presents with easy fatigability, a smooth sore tongue, numbness and tingling of the feet, and weakness of the legs. A complete blood count shows a megaloblastic anemia that is not reversed by folate therapy. Hemoglobin is 5.6 g/dL, WBC count is 5,100/mL, and platelets are 240,000/mL. This patient most likely has a deficiency of which of the following vitamins?

Vitamin B1 (thiamine)

Vitamin B2 (riboflavin)

Vitamin B12

Vitamin K

2c

single

Except for a few rare situations, vitamin B12 (cyanocobalamin) deficiency is usually a result of pernicious anemia, an autoimmune disease of the stomach. Vitamin B12 is required for DNA synthesis, and its deficiency results in large (megaloblastic) nuclei.Diagnosis: Vitamin B12 deficiency, pernicious anemia

Pathology

Environment & Nutritional Pathology

A 50-year-old woman presents with easy fatigability, a smooth sore tongue, numbness and tingling of the feet, and weakness of the legs. A complete blood count shows a megaloblastic anemia that is not reversed by folate therapy. Hemoglobin is 5.6 g/dL, WBC count is 5,100/mL, and platelets are 240,000/mL.

This patient most likely has a deficiency of which of the following vitamins?

C. Vitamin B12

b226c32d-02b3-4626-92d3-0aada5d3782b

A 25-year-old woman with amenorrhea has never had menarche. On physical examination, she is 145 cm (4 ft 9 in) tall. She has a webbed neck, a broad chest, and widely spaced nipples. Strong pulses are palpable in the upper extremities, but there are only weak pulses in the lower extremities. On abdominal MR imaging, her ovaries are small, elongated, and tubular. Which of the following karyotypes is she most likely to have?

45, X/46, XX

46, X, X (fra)

47, XXY

47, XXX

0a

multi

The features described are those of classic Turner syndrome. Individuals who reach adulthood may have mosaic cell lines, with some 45, X cells and some 46, XX cells. A female carrier of the fragile X syndrome, X(fra), is less likely to manifest the disease than a male, but the number of triple repeat sequences (CGG) increases in her male offspring. The 47, XXY karyotype occurs in Klinefelter syndrome; affected individuals appear as phenotypic males. The "superfemale" karyotype (XXX) leads to mild mental retardation. Trisomy 16 is a cause of fetal loss early in pregnancy.

Pathology

Genetics

A 25-year-old woman with amenorrhea has never had menarche. On physical examination, she is 145 cm (4 ft 9 in) tall. She has a webbed neck, a broad chest, and widely spaced nipples. Strong pulses are palpable in the upper extremities, but there are only weak pulses in the lower extremities. On abdominal MR imaging, her ovaries are small, elongated, and tubular.

Which of the following karyotypes is she most likely to have?

A. 45, X/46, XX

05f44b18-2b84-47dc-8607-869781e0559b

A 78-year-old woman has an acute anterior wall MI with hypotension and pulmonary congestion. Her blood pressure is 90/70 mm Hg, pulse 110/min, JVP at 8 cm, and the heart sounds are normal. The lungs have bibasilar crackles, and her extremities are cool and diaphoretic. What would central hemodynamic monitoring reveal?For the above patient, select the hemodynamic parameters that are most likely to apply.

decreased right atrial pressure (RAP), low cardiac output (CO), and increased systemic vascular resistance (SVR)

increased RAP, decreased CO, increased SVR

increased RAP, decreased CO, decreased SVR

decreased RAP, increased CO, decreased SVR

1b

multi

Cardiogenic shock is characterized by high right atrial pressure (although it can be normal at times), high PA wedge pressure, high systemic vascular resistance, and low cardiac output.

Medicine

C.V.S.

A 78-year-old woman has an acute anterior wall MI with hypotension and pulmonary congestion. Her blood pressure is 90/70 mm Hg, pulse 110/min, JVP at 8 cm, and the heart sounds are normal. The lungs have bibasilar crackles, and her extremities are cool and diaphoretic.

What would central hemodynamic monitoring reveal?For the above patient, select the hemodynamic parameters that are most likely to apply.

B. increased RAP, decreased CO, increased SVR

ddb2fe1c-105e-4ccf-a740-fe383571d102

A 30 year old male was brought for evaluation. The history revealed that the patients 3 year old son died, 5 months back after being hit by a car. At the time of accident, patient was standing nearby and witnessed the accident. For last 5 months, he has been having symptoms of sadness of mood, crying spells, feelings of wohlessness, poor sleep and poor appetite. He has twice thought of killing himself but stopped at the end moment. He has not been attending the office of last 5 months. What is the likely diagnosis:

Post traumatic stress disorder

Normal grief

Major depression

Adjustment disorder

2c

single

Depression: A major depressive disorder occurs without a history of a manic, mixed, or hypomanic episode. A major depressive episode must last at least 2 weeks DIAGNOSIS: Major Depressive Disorder The DSM-5 diagnostic criteria for major depression Sadness of mood Diminished interest in pleasure Significant weight loss or gain more than 5% in a month Crying spells Feeling of wohlessness Poor sleep (Insomnia or hypersomnia) Suicidal thoughts Psychomotor retardation Fatigue or loss of energy. Five or more of these symptoms present for 2 weeks or more or either depressed mood or loss of interest or pleasure.

Psychiatry

Schizophrenia Spectrum and Other Psychotic Disorders

A 30 year old male was brought for evaluation. The history revealed that the patients 3 year old son died, 5 months back after being hit by a car. At the time of accident, patient was standing nearby and witnessed the accident. For last 5 months, he has been having symptoms of sadness of mood, crying spells, feelings of wohlessness, poor sleep and poor appetite. He has twice thought of killing himself but stopped at the end moment. He has not been attending the office of last 5 months.

What is the likely diagnosis:

C. Major depression

071b822d-0b92-4499-bfa3-710331047cae

A 23-year-old female maid was making a bed in a hotel bedroom. As she straightened the sheet by running her right hand over the surface with her fingers extended, she caught the end of the index finger in a fold. She experienced a sudden, severe pain over the base of the terminal phalanx. Several hours later when the pain had diminished, she noted that the end of her right index finger was swollen and she could not completely extend the terminal interphalangeal joint. Which one of the following structures within the digit was most likely injured?

The proper palmar digital branch of the median nerve

The vinculum longa

The insertion of the tendon of the extensor digitorum onto the base of the distal phalanx

The insertion of the flexor digitorum profundus tendon

2c

single

The contraction of the extensor mechanism produces extension of the distal interphalangeal joint. When it is torn from the distal phalanx, the digit is pulled into flexion by the flexor digitorum profundus. The proper palmar digital branches of the median nerve supply lumbrical muscles and carry sensation from their respective digits. Vincula longa are slender, bandlike connections from the deep flexor tendons to the phalanx that can carry blood supply to the tendons. The insertions of the flexor digitorum superficialis and profundus are on the flexor surface of the middle and distal phalanges, respectively, and act to flex the interphalangeal joints.

Anatomy

Upper Extremity

A 23-year-old female maid was making a bed in a hotel bedroom. As she straightened the sheet by running her right hand over the surface with her fingers extended, she caught the end of the index finger in a fold. She experienced a sudden, severe pain over the base of the terminal phalanx. Several hours later when the pain had diminished, she noted that the end of her right index finger was swollen and she could not completely extend the terminal interphalangeal joint.

Which one of the following structures within the digit was most likely injured?

C. The insertion of the tendon of the extensor digitorum onto the base of the distal phalanx

e4ba25b1-2be8-4d30-b095-c3ddc931cc4c

A 26 year old third_gravida mother delivered a male baby weighing 4-2 kg at 37 weeks of gestation through an emergency caesarean section, for obstructed labour. The child developed respiratory distress one hour after bih. He was kept nil per orally (NPO) and given intravenous fluids. He maintained oxygen saturation on room air. No antibiotics were given. Chest radiograph revealed fluid in interlobar fissure. Respiratory distress settled by 24 hours of life. What is the most likely diagnosis ?

Transient tachypnea of the newborn

Meconium aspiration syndrome

Persistent fetal circulation

Hyaline membrane disease

0a

multi

Ans. is 'a' i.e., Transient tachypnea of newborn o Respiratory distress, which resolves within 24 hours without any respiratory suppo and fluid in interlobar fissure on chest X-ray suggest the diagnosis of TTN.

Pediatrics

A 26 year old third_gravida mother delivered a male baby weighing 4-2 kg at 37 weeks of gestation through an emergency caesarean section, for obstructed labour. The child developed respiratory distress one hour after bih. He was kept nil per orally (NPO) and given intravenous fluids. He maintained oxygen saturation on room air. No antibiotics were given. Chest radiograph revealed fluid in interlobar fissure. Respiratory distress settled by 24 hours of life.

What is the most likely diagnosis ?

A. Transient tachypnea of the newborn

d93522e3-8ae1-451e-a688-daec2e5dfe08

A 19-year-old man presents to the clinic complaining of early fatigue and muscle cramps while playing sports. He is fine when walking or doing less intense levels of work. On physical examination, he appears well and the vital signs are normal. Muscle bulk, tone and strength in the proximal muscles are normal. There is no muscle fatigue with repetitive arm grip exercises. After an exercise stress test, his serum creatine kinase (CK) is elevated and lactate level is normal. Which of the following is the most likely diagnosis?

Gaucher disease

Tay-Sachs disease

McArdle disease (glycogen storage disease)

hemochromatosis

2c

single

There are many types of glycogen storage diseases, each caused by a different enzymatic abnormality. The best-known types of glycogen storage disease are those that have hepatic hypoglycemic pathophysiology (eg, von Gierke disease) or those that have muscle energy pathophysiology (McArdle disease). InMcArdle' symptoms usually develop in adulthood, and it is marked by cramps and muscle injury with strenuous exercise, but not with usual activities. Gaucher and Tay-Sachs disease are lysosomal storage diseases.

Medicine

Endocrinology

A 19-year-old man presents to the clinic complaining of early fatigue and muscle cramps while playing sports. He is fine when walking or doing less intense levels of work. On physical examination, he appears well and the vital signs are normal. Muscle bulk, tone and strength in the proximal muscles are normal. There is no muscle fatigue with repetitive arm grip exercises. After an exercise stress test, his serum creatine kinase (CK) is elevated and lactate level is normal.

Which of the following is the most likely diagnosis?

C. McArdle disease (glycogen storage disease)

819a9b25-36f0-41d0-a409-8289d976f067

Kamli Rani, 75-years -old woman present with post myocardial infarction after 6 weeks mild CHF. There was past H/O neck surgery for parathyroid adenoma 5 years ago, ECG shows slow atrial fibrillation. Serum Ca2+ 13.0 mg/L and urinary Ca2+ is 300 mg/24 hr. On examination there is small mass in the Para tracheal position behind the right clavicle. Appropriate management at this time is:

Repeat neck surgery

Treatment with technetium-99

Observation and repeat serum Ca2+ in two months

Ultrasound-guided alcohol injection of the mass

3d

multi

Patient is a case of recurrent hyperparathyroidism, as she was operated previously for parathyroid adenoma. In the setting of recent myocardial infarction, CHF and atrial fibrillation, any operation carries a high risk. Ultrasound-guided alcohol injection in the mass is preferred in this setting.

Surgery

Parathyroid and adrenal glands

Kamli Rani, 75-years -old woman present with post myocardial infarction after 6 weeks mild CHF. There was past H/O neck surgery for parathyroid adenoma 5 years ago, ECG shows slow atrial fibrillation. Serum Ca2+ 13.0 mg/L and urinary Ca2+ is 300 mg/24 hr. On examination there is small mass in the Para tracheal position behind the right clavicle.

Appropriate management at this time is:

D. Ultrasound-guided alcohol injection of the mass

c7adea89-80f3-4715-950a-4b0b133f8e84

A 57-year-old man arrives at the emergency room complaining of weakness, fatigue, and intermittent fever that has recurred for several weeks. The patient had a cardiac valvular prosthesis implanted 5 years ago. Blood cultures grew ceain gram-positive cocci on which catalase and coagulase test were done. The gram-positive organisms failed to ferment mannitol, and their growth was inhibited by novobiocin. CATALASE TEST SLIDE COAGULASE TEST Lesions seen on skin What is the most likely infectious agent?

Staphylococcus aureus

Staphylococcus epidermidis

Staphylococcus saprophyticus

Streptococcus viridans

1b

single

Physical examination reveals petechiae (pinpoint, nonraised, purplish red spots caused by intradermal hemorrhage) on the chest and stomach. Catalase-positive and coagulase negative The patient is probably suffering from bacterial endocarditis caused by S. epidermidis infection of the prosthetic hea valve. S. epidermidis Coagulase-negative organism Unable to ferment mannitol Sensitive to novobiocin Resistant to penicillin. Patients with congenital hea malformations, acquired valvular defects (for example, rheumatic hea disease), prosthetic valves, and previous bacterial endocarditis show an increased incidence of bacterial endocarditis. Intravenous drug users also have a high risk for infection. S. viridans can be ruled out, because streptococci are catalase negative, which is a feature that distinguishes them from catalase-positive staphylococci. S. aureus is coagulase positive so it is ruled out. S. saprophyticus is coagulase negative but resistant to novobiocin, hence also ruled out here

Unknown

Integrated QBank

A 57-year-old man arrives at the emergency room complaining of weakness, fatigue, and intermittent fever that has recurred for several weeks. The patient had a cardiac valvular prosthesis implanted 5 years ago. Blood cultures grew ceain gram-positive cocci on which catalase and coagulase test were done. The gram-positive organisms failed to ferment mannitol, and their growth was inhibited by novobiocin.

CATALASE TEST SLIDE COAGULASE TEST Lesions seen on skin What is the most likely infectious agent?

B. Staphylococcus epidermidis

91d5cae7-c4a1-4d69-b76a-5fd898c29f51

A 4-year-old child presented with palpable purpura and polyahralgia without any frank ahritis along with colicky abdominal pain associated with nausea, vomiting, diarrhea and the passage of blood and mucus per rectum. Urine examination revealed proteinuria and microscopic haematuria. Laboratory studies revealed mild leucocytosis, normal platelet count, normal PT and aPTT, eosinophilia, normal serum complement components and elevated IgA levels. Skin biopsy specimen was taken.

Clotting disorder

Septic emboli

HSP

Uicarial vasculitis

2c

single

Perivascular neutrophils, leukocytoclasis and fibrinoid degeneration involving the small dermal blood vessels with subsequent hemorrhage in a skin biopsy of a patient with HSP. Skin biopsy showing positive immunofluorescence of the small blood vessels for IgA. Henoch-Schonlein purpura (HSP) Acute immunoglobulin A (IgA)-mediated Generalized vasculitis involving the small vessels of the skin, the gastrointestinal (GI) tract, the kidneys, the joints, and, rarely, the lungs and the central nervous system (CNS). It is the most frequent vasculitis in childhood, the incidence decreasing with age. Subsequently, symptoms develop, of which the following are the most common: Rash, especially involving the legs; this is the hallmark of the disease Abdominal pain and vomiting Joint pain especially involving the knees and ankles Subcutaneous edema Scrotal edema Bloody stools

Anatomy

Integrated QBank

A 4-year-old child presented with palpable purpura and polyahralgia without any frank ahritis along with colicky abdominal pain associated with nausea, vomiting, diarrhea and the passage of blood and mucus per rectum. Urine examination revealed proteinuria and microscopic haematuria. Laboratory studies revealed mild leucocytosis, normal platelet count, normal PT and aPTT, eosinophilia, normal serum complement components and elevated IgA levels.

Skin biopsy specimen was taken.

C. HSP

0df537bb-a632-489f-ad81-622b19a6b4c1

A 52-year-old man presents to the eye clinic with painless vision loss of his right eye. He describes the visual loss as a gradual progression from blurry to total blackout over the past two hours. He has no history of prior visual problems. Past medical history is significant for a myocardial infarction three years ago. The patient takes 70mg of aspirin daily. Vital signs are normal. Physical examination reveals 20/20 vision of the left eye but no vision in the right eye. Extraocular muscles are intact. The neurologic examination is normal. The cardiac examination reveals an S4 hea sound. At the molecular level, which of the following components is essential for the first step of the visual cascade?

11-cis-retinal

All-cis-retinal

All-trans-retinal

Meta-rhodopsin ll

0a

multi

The visual cascade: 11-cis-retinal + opsin -> rhodopsin + light -> meta-rhodopsin II. Meta-rhodopsin II dissociates after light exposure to form all-trans-retinal. 11-cis retinal and opsin are essential first steps in generating the photochemical visual cascade. All-cis-retinal is not a pa of the visual cascade. All-trans-retinal, meta-rhodopsin II, rhodopsin is a later pa of the visual cascade: 11-cis-retinal + opsin -> rhodopsin + light -> meta-rhodopsin II. Meta-rhodopsin II dissociates after light exposure to form all-trans-retinal. 11-cis retinal and opsin are essential first steps in generating the photochemical visual cascade.

Ophthalmology

A 52-year-old man presents to the eye clinic with painless vision loss of his right eye. He describes the visual loss as a gradual progression from blurry to total blackout over the past two hours. He has no history of prior visual problems. Past medical history is significant for a myocardial infarction three years ago. The patient takes 70mg of aspirin daily. Vital signs are normal. Physical examination reveals 20/20 vision of the left eye but no vision in the right eye. Extraocular muscles are intact. The neurologic examination is normal. The cardiac examination reveals an S4 hea sound.

At the molecular level, which of the following components is essential for the first step of the visual cascade?

A. 11-cis-retinal

6bce4733-0e59-4afe-baf4-c159a236caca

Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?

A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain

A mutation in the stop codon resulted in elongation of the b-chain

A point mutation resulted in the inseion of a stop codon in the b-chain

A two base pair addition resulted in the elimination of a stop codon in the b-chain

3d

single

Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows: AAG UAU CAC UAA GCU CGC 1 2 3 4 5 6 The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following: AAG AGU AUC ACU AAG CUC GCU UUC UAU UAA 1 2 3 4 5 6 7 8 etc etc The inseion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin. A frameshift mutation resulting in deletion of several amino acids is wrong, since such a mutation would have inseed a stop codon (UAA, UGA or UAG) before position 4. A mutation in the stop codon would have resulted in a longer-than-normal b-globin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin. A point mutation is the result of a single base pair change, which is not the case here. A point mutation resulting in the inseion of a new stop codon is called a nonsense mutation, and it would result in a shoer-than-normal protein. Ref: Weil P. (2011). Chapter 37. Protein Synthesis & the Genetic Code. In D.A. Bender, K.M. Botham, P.A. Weil, P.J. Kennelly, R.K. Murray, V.W. Rodwell (Eds), Harper's Illustrated Biochemistry, 29e.

Biochemistry

Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below.

HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?

D. A two base pair addition resulted in the elimination of a stop codon in the b-chain

2f272bd1-36d2-4982-9bf5-c24136a3552b

A 24-year-old P2+0 woman presents to the emergency department complaining of pain in her right breast. The patient is postpartum day 10 from an uncomplicated spontaneous vaginal delivery at 42 weeks. She reports no difficulty breast-feeding for the first several days postpartum, but states that for the past week her daughter has had difficulty latching on. Three days ago her right nipple became dry and cracked, and since yesterday it has become increasingly swollen and painful. Her temperature is 38.3°C (101°F). Her right nipple and areola are warm, swollen, red, and tender. There is no fluctuance or induration, and no pus can be expressed from the nipple.

Continue breast feeding from both the breasts

Breastfeed from unaffected breast only

Immediately start antibiotics and breastfeed only when antibiotics are discontinued.

Pump and discard breastmilk till infection is over and then continue breatfedding

0a

multi

A postpartum lady coming with H/o pain in breast and fever and nipples being warm, red, swollen, with no induration, fluctuance and no pus extruding from them - leaves no doubt that the patient is having mastitis. As discussed in question 9, mastitis is not a contraindication for breast feeding. She should continue feeding from both the breasts.

Gynaecology & Obstetrics

A 24-year-old P2+0 woman presents to the emergency department complaining of pain in her right breast. The patient is postpartum day 10 from an uncomplicated spontaneous vaginal delivery at 42 weeks. She reports no difficulty breast-feeding for the first several days postpartum, but states that for the past week her daughter has had difficulty latching on. Three days ago her right nipple became dry and cracked, and since yesterday it has become increasingly swollen and painful. Her temperature is 38.3°C (101°F). Her right nipple and areola are warm, swollen, red, and tender.

There is no fluctuance or induration, and no pus can be expressed from the nipple.

A. Continue breast feeding from both the breasts

a21b7844-9dae-4ab5-a61e-ab3da03efa83

A 57-year-old man presents with hemoptysis and generalized weakness. His symptoms began with small-volume hemoptysis 4 weeks ago. Over the past 2 weeks, he has become weak and feels "out of it." His appetite has diminished, and he has lost 10 lb of weight. He has a 45-pack-year history of cigarette smoking. Physical examination is unremarkable. Laboratory studies reveal a mild anemia and a serum sodium value of 118 mEq/L. Chest x-ray shows a 5-cm left, mid-lung field mass with widening of the mediastinum suggesting mediastinal lymphadenopathy. MR scan of the brain is unremarkable. What is the most likely cause of his symptoms?

Bronchial carcinoid

Adenocarcinoma of the lung

Small cell carcinoma of the lung

Lung abscess

2c

multi

Hyponatremia in association with a lung mass usually indicates small cell lung cancer (SCLC) with inappropriate antidiuretic hormone (ADH) production by the tumor. About 10% of lung cancers present with a paraneoplastic syndrome. Tumors producing ADH or adrenocorticotropic hormone (ACTH) are overwhelmingly SCLCs, which arise from hormonally active neuroendocrine cells. SCLC is a rapidly growing neoplasm; early mediastinal involvement, as in this case, is common. Tumor staging for SCLC differs from non-small cell cancers. SCLCs are simply classified as limited (confined to one hemithorax) or extensive. Limited tumors are usually managed with combination radiation and chemotherapy, with approximately 20% cure rate. Extensive tumors are treated with palliative chemotherapy alone; durable remissions are rare. Surgery is not curative in SCLC.Bronchial carcinoids are usually benign. Although they can produce ACTH, mediastinal involvement and hyponatremia would not be expected. Adenocarcinoma of the lung, although common, rarely causes a paraneoplastic syndrome. Localized benign lung infections (especially lung abscess) can cause syndrome of inappropriate antidiuretic hormone (SIADH) but would not account for this patient's mediastinal adenopathy. Lung abscess usually causes fever and fetid sputum. Pulmonary aspergilloma (a fungus ball growing in an old cavitary lesion) can cause hemoptysis but not this patient's hyponatremia or mediastinal lymphadenopathy.

Medicine

Respiratory

A 57-year-old man presents with hemoptysis and generalized weakness. His symptoms began with small-volume hemoptysis 4 weeks ago. Over the past 2 weeks, he has become weak and feels "out of it." His appetite has diminished, and he has lost 10 lb of weight. He has a 45-pack-year history of cigarette smoking. Physical examination is unremarkable. Laboratory studies reveal a mild anemia and a serum sodium value of 118 mEq/L. Chest x-ray shows a 5-cm left, mid-lung field mass with widening of the mediastinum suggesting mediastinal lymphadenopathy. MR scan of the brain is unremarkable.

What is the most likely cause of his symptoms?

C. Small cell carcinoma of the lung

0c5ee077-1330-4d61-9ab9-d9a3b46ac389

A 23-year-old, sexually active man has been treated for Neisseria gonorrhoeae infection 6 times during the past 5 years. He now comes to the physician because of the increasing number and size of warty lesions slowly enlarging on his external genitalia during the past year. On physical examination, there are multiple 1- to 3-mm sessile, nonulcerated, papillary excrescences over the inner surface of the penile prepuce. These lesions are excised, but 2 years later, similar lesions appear. Which of the following conditions most likely predisposed him to the development of these recurrent lesions?

Candida albicans infection

Circumcision

Human papillomavirus infection

Neisseria gonorrhoeae infection

2c

multi

Condyloma acuminatum is a benign, recurrent squamous epithelial proliferation resulting from infection with human papillomavirus (HPV) infection, one of many sexually transmitted diseases that can occur in sexually active individuals. Koilocytosis is particularly characteristic of HPV infection. Candidiasis can be associated with inflammation, such as balanoposthitis, but not condylomata. Recurrent gonococcal infection indicates that the patient is sexually active and at risk for additional infections, but is not the cause for the condylomata. The gonococcal infection causes suppurative lesions in which there may be liquefactive necrosis and a neutrophilic exudate or mixed inflammatory infiltrate. Circumcision generally reduces risks for infections. Phimosis is a nonretractile prepuce, and paraphimosis refers to forcible retraction of the prepuce that produces pain and urinary obstruction.

Pathology

Male Genital Tract

A 23-year-old, sexually active man has been treated for Neisseria gonorrhoeae infection 6 times during the past 5 years. He now comes to the physician because of the increasing number and size of warty lesions slowly enlarging on his external genitalia during the past year. On physical examination, there are multiple 1- to 3-mm sessile, nonulcerated, papillary excrescences over the inner surface of the penile prepuce. These lesions are excised, but 2 years later, similar lesions appear.

Which of the following conditions most likely predisposed him to the development of these recurrent lesions?

C. Human papillomavirus infection

d387c2b9-3e1c-4d75-9155-9424475cb31d

A 23-year-old woman has noticed that she develops a skin rash if she spends prolonged periods outdoors. She has a malar skin rash on physical examination. Laboratory studies include a positive ANA test result with a titer of 1 :1024 and a "rim" pattern. An anti-double-stranded DNA test result also is positive. The hemoglobin concentration is 12.1 g/dL, hematocrit is 35.5%, MCV is 89 mm3, platelet count is 109,000/mm3, and WBC count is 4500/mm3. Which of the following findings is most likely to be shown by a WBC differential count?

Basophilia

Eosinophilia

Monocytosis

Neutrophilia

2c

single

An autoimmune disease, most likely systemic lupus erythematosus (SLE) in this patient, can be accompanied by monocytosis. Cytopenias also can occur in SLE because of autoantibodies against blood elements, a form of type II hypersensitivity. Basophilia occurs infrequently, but also can be seen in chronic myelogenous leukemia (CML). Eosinophilia is a feature more often seen in allergic conditions, tissue parasitic infestations, and CML. Neutrophilia is seen in acute infectious and inflammatory conditions. Thrombocytosis usually occurs in neoplastic disorders of myeloid stem cells, such as the myeloproliferative disorders that include CML and essential thrombocytosis.

Pathology

Blood

A 23-year-old woman has noticed that she develops a skin rash if she spends prolonged periods outdoors. She has a malar skin rash on physical examination. Laboratory studies include a positive ANA test result with a titer of 1 :1024 and a "rim" pattern. An anti-double-stranded DNA test result also is positive. The hemoglobin concentration is 12.1 g/dL, hematocrit is 35.5%, MCV is 89 mm3, platelet count is 109,000/mm3, and WBC count is 4500/mm3.

Which of the following findings is most likely to be shown by a WBC differential count?

C. Monocytosis

f03b37d6-8334-4a73-9007-56327bb663fd

A neonate within 4 hours of bih presented with severe respiratory distress. He appears to be dyspneic, tachypneic, and cyanotic with severe retractions of the chest. On examination, grunting is present along with use of the accessory muscles. Neonate also appears to have scaphoid abdomen and increased chest wall diameter. There is evidence of shift of the point of maximal cardiac impulse from its original location to the right side. Chest x ray of the neonate Defect in development of which pa of the responsible structure is causing this condition of the baby?

PA C

PA A

PA D

PA B

2c

multi

This is a case of congenital diaphragmatic hernia (bochdalek or posterolateral hernia) Chest radiograph shows a stomach, nasogastric tube, and small bowel contents in the thoracic cavity, consistent with a CDH. Development of Diaphragm: PA A: Body wall: Peripheral muscular pa PA B: Oesophageal Mesentery: Crura PA C: Septum Transversum: Central Tendon. PA D: Pleuroperitoneal membrane: Small intermediate muscular pa. More common mechanism for the origin of diaphragmatic hernias occurs when muscle cells fail to populate a region of the pleuroperitoneal membranes. This results in a weakened area and subsequent herniation of abdominal organs into the thoracic cavity. The primary cause for the muscle deficiency appears to reside in fibroblasts in the pleuroperitoneal membranes These fibroblasts fail to provide the appropriate scaffolding and/or guidance cues for migrating myoblasts.

Unknown

Integrated QBank

A neonate within 4 hours of bih presented with severe respiratory distress. He appears to be dyspneic, tachypneic, and cyanotic with severe retractions of the chest. On examination, grunting is present along with use of the accessory muscles. Neonate also appears to have scaphoid abdomen and increased chest wall diameter. There is evidence of shift of the point of maximal cardiac impulse from its original location to the right side.

Chest x ray of the neonate Defect in development of which pa of the responsible structure is causing this condition of the baby?

C. PA D

810f38cb-3f85-42be-a9ba-71610e4fd911

Apgar scores were 3, and 6 at 1 and 5 minutes. At 10 Apgar scores were 3, and 6 at 1 and 5 minutes. At 10 minutes child shows features of breathlessness,on CXR-mediastinal shift was there, possible causes – a) Bilateral choanal atresiab) Pneumothoraxc) Congenital diaphragmatic herniad) Hyaline membrane disease

a

bc

ac

ad

1b

single

Congenital diaphragmatic hernia and pneumothorax cause respiratory distress with mediastinal shift to contralateral side. Bilateral choanal atresia and HMD cause respiratory distress, but no mediastinal shift.

Radiology

Apgar scores were 3, and 6 at 1 and 5 minutes. At 10 Apgar scores were 3, and 6 at 1 and 5 minutes.

At 10 minutes child shows features of breathlessness,on CXR-mediastinal shift was there, possible causes – a) Bilateral choanal atresiab) Pneumothoraxc) Congenital diaphragmatic herniad) Hyaline membrane disease

B. bc

c4d050b6-9c49-4370-9e33-cf93a6c99b95

An epidemiologic study observes increased numbers of respiratory tract infections among children living in a community in which most families are at the poverty level. The infectious agents include Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae. Most of the children have had pneumonitis and rubeola infection. The study documents increased rates of keratomalacia, urinary tract calculi, and generalized papular dermatosis in these children as they reach adulthood. These children are most likely to have a deficiency of which of the following vitamins?

Vitamin A

Vitamin B1

Vitamin E

Vitamin D

0a

single

Vitamin A is important in maintaining epithelial surfaces. Deficiency of this vitamin can lead to squamous metaplasia of respiratory epithelium, predisposing to infection. Increased keratin buildup leads to follicular plugging and papular dermatosis. Desquamated keratinaceous debris in the urinary tract forms the nidus for stones. Ocular complications of vitamin A deficiency include xerophthalmia and corneal scarring, which can lead to blindness. Vitamin B1 (thiamine) deficiency causes problems such as Wernicke disease, neuropathy, and cardiomyopathy. Vitamin D deficiency in children causes rickets, characterized by bone deformities. Vitamin E deficiency occurs rarely; it causes neurologic symptoms related to degeneration of the axons in the posterior columns of the spinal cord. Vitamin K deficiency can result in a bleeding diathesis.

Pathology

Environment & Nutritional Pathology

An epidemiologic study observes increased numbers of respiratory tract infections among children living in a community in which most families are at the poverty level. The infectious agents include Streptococcus pneumoniae, Haemophilus influenzae, and Klebsiella pneumoniae. Most of the children have had pneumonitis and rubeola infection. The study documents increased rates of keratomalacia, urinary tract calculi, and generalized papular dermatosis in these children as they reach adulthood.

These children are most likely to have a deficiency of which of the following vitamins?

A. Vitamin A

44efcde8-dadc-4ad5-9072-142f27d84768

A 30-year-old man has had cramping abdominal pain and bloody diarrhea for the past 4 days. On physical examination, there is diffuse tenderness on palpation of the abdomen. Bowel sounds are present. There are no masses and no organomegaly. A stool culture is positive for Shigella flexneri. The episode resolves spontaneously within 1 week after onset. Six weeks later, he has increasingly severe lower back pain. Physical examination now shows stiffness of the lumbar spine and tenderness of the sacroiliac joints. He is treated with nonsteroidal anti-inflammatory agents. Two months later, the back pain recurs, and he complains of redness of the right eye and blurred vision. Serologic testing for which of the following is most likely to be positive in this patient?

Borrelia burgdorferi

Chlamydia trachomatis

Epstein-Barr virus

HLA-B27

3d

single

This patient developed enteritis-associated arthritis affecting the lumbar and sacroiliac joints several weeks after Shigella dysentery. He subsequently developed conjunctivitis and, most likely, uveitis. This symptom complex is a classic representation of a cluster of related disorders called seronegative spondyloarthropathies. This cluster includes ankylosing spondylitis, reactive arthritis, psoriatic arthritis, and enteropathic arthritis (as in this case). A common feature is a very strong association with the HLA-B27 genotype. Despite some similarities with rheumatoid arthritis, these patients invariably have a negative test result for rheumatoid factor. Urethritis caused by Chlamydia trachomatis can trigger reactive arthritis, another form of seronegative spondyloarthropathy. Such infection precedes the onset of arthritis, however. There is no relationship between infection with Borrelia burgdorferi, the causative agent of Lyme disease, and reactive arthritis in individuals testing positive for HLA-B27. Similarly, Epstein-Barr virus infection is not a trigger for these disorders.

Pathology

Osteology

A 30-year-old man has had cramping abdominal pain and bloody diarrhea for the past 4 days. On physical examination, there is diffuse tenderness on palpation of the abdomen. Bowel sounds are present. There are no masses and no organomegaly. A stool culture is positive for Shigella flexneri. The episode resolves spontaneously within 1 week after onset. Six weeks later, he has increasingly severe lower back pain. Physical examination now shows stiffness of the lumbar spine and tenderness of the sacroiliac joints. He is treated with nonsteroidal anti-inflammatory agents. Two months later, the back pain recurs, and he complains of redness of the right eye and blurred vision.

Serologic testing for which of the following is most likely to be positive in this patient?

D. HLA-B27

eacec070-a402-4eb3-845e-8452e0ee972d

A 40-year-old man without a significant medical history comes to the emergency room with a 3-day history of fever and shaking chills, and a 15-minute episode of rigor. He also reports a cough productive of yellow-green sputum, anorexia, and the development of right-sided pleuritic chest pain. Shortness of breath has been present for the past 12 hours. Chest x-ray reveals a consolidated right middle lobe infiltrate, and CBC shows an elevated neutrophil count with many band forms present. Which feature would most strongly support inpatient admission and IV antibiotic treatment for this patient?

Recent exposure to a family member with influenza

Respiratory rate of 36/min

Recent sexual exposure to an HIV-positive patient

Purulent sputum with gram-positive diplococci on Gram stain

1b

single

Because of the development of effective oral antibiotics (respiratory fluoroquinolones, extended spectrum macrolides), many patients with community-acquired pneumonia (CAP) can be managed as an outpatient as long as compliance and close follow-up are assured. The CURB-65 score is a validated instrument for determining if inpatient admission (either observation or full admission) is indicated. Factors predicting increased severity of infection include confusion, urea above 19 mg/dL, respiratory rate above 30, BP below 90 systolic (or 60 diastolic), and age 65 or above. If more than one of these factors is present, hospitalization should be considered.This patient's presentation (lobar pneumonia, pleuritic pain, purulent sputum) suggests pneumococcal pneumonia. The pneumococcus is the commonest organism isolated from patients with CAP. Fortunately, Spneumoniae is almost always sensitive to oral antibiotics such as clarithromycin/azithromycin and the respiratory fluoroquinolones. A Gram stain suggestive of pneumococci would therefore only confirm the clinical diagnosis. Exposure to influenza is an important historical finding. Patients with influenza often have a prodrome (upper respiratory symptoms, myalgias, prostrating weakness), but influenza would not cause a lobar infiltrate. Staphylococcus aureus pneumonia can sometimes follow influenza. Acute lobar pneumonia, even in an HIV-positive patient, is usually due to the pneumococcus and can often be treated as an outpatient. Pneumocystis jiroveci pneumonia is usually insidious in onset, causes diffuse parenchymal infiltrates, and does not cause pleurisy or pleural effusion. Physical examination signs of consolidation confirm the CXR finding of a lobar pneumonia (as opposed to a patchy bronchopneumonia) and would simply affirm the importance of coverage for classic bacterial pathogens (i.e., pneumococci, H influenzae). Atypical pneumonias (due to Mycoplasma, Chlamydia, or Legionella) are usually patchy and do not usually cause pleural effusion. Currently recommended treatment regimens for CAP cover both typical and atypical pathogens.

Medicine

Respiratory

A 40-year-old man without a significant medical history comes to the emergency room with a 3-day history of fever and shaking chills, and a 15-minute episode of rigor. He also reports a cough productive of yellow-green sputum, anorexia, and the development of right-sided pleuritic chest pain. Shortness of breath has been present for the past 12 hours. Chest x-ray reveals a consolidated right middle lobe infiltrate, and CBC shows an elevated neutrophil count with many band forms present.

Which feature would most strongly support inpatient admission and IV antibiotic treatment for this patient?

B. Respiratory rate of 36/min

c3d09d72-c744-453d-b9a4-675f321fb655

The 27-year-old male triathlon competitor complained that he frequently experienced deep pains in one calf that almost caused him to drop out of a regional track-and-field event. Doppler ultrasound studies indicated, and surgical exposure confirmed, the existence of an accessory portion of the medial head of the gastrocnemius that was constricting the popliteal artery. Above the medial head of the gastrocnemius, the superior medial border of the popliteal fossa could be seen. Which of the following structures forms this border?

Tendon of biceps femoris

Tendons of semitendinosus and semimembranosus

Tendon of plantaris

Tendinous hiatus of adductor magnus

1b

multi

The tendons of the semitendinosus and semimembranosus provide the superior medial border of the popliteal fossa. The semitendinosus inserts with the pes anserinus on the proximal, medial tibia. The semimembranosus inserts on the tibia posteriorly. The biceps femoris forms the superior lateral border of the fossa, as the tendon passes to insertion on the fibula. The plantaris arises from the femur just above the lateral head of the gastrocnemius, passing distally to insert on the calcaneus via the tendo Achilles. The popliteus arises from the tibia and passes superiorly and laterally to insert on the lateral condyle of the femur, with a connection to the lateral meniscus.

Anatomy

Lower Extremity

The 27-year-old male triathlon competitor complained that he frequently experienced deep pains in one calf that almost caused him to drop out of a regional track-and-field event. Doppler ultrasound studies indicated, and surgical exposure confirmed, the existence of an accessory portion of the medial head of the gastrocnemius that was constricting the popliteal artery. Above the medial head of the gastrocnemius, the superior medial border of the popliteal fossa could be seen.

Which of the following structures forms this border?

B. Tendons of semitendinosus and semimembranosus

371ac31c-1a40-4504-9606-186ebb9e2820

A 56 year old man has been having bloody bowel movements on and off for the past several weeks. He repos that the blood is bright red, it coats the outside of the stools, and he can see it in the toilet bowl even before he wipes himself. When he does so, there is also blood on the toilet paper. After fuher questioning, it is asceained that he has been constipated for the past 2 months and that the caliber of the stools has changed. They are now pencil thin, rather the usual diameter of an inch or so that was customary for him. He has no pain. Which of the following is the most likely diagnosis?

Anal fissure

Cancer of the cecum

Cancer of the rectum

External hemorrhoids

2c

single

The combination of red blood coating the stools and a change in bowel habit and stool caliber spells out cancer of the rectum in someone in this age group. Anal fissure is typically seen in young women who have very painful bowel movements with streaks of blood. Pain is the dominant symptom in this condition. Cancer of the cecum leads to anemia and occult blood in the stools, but the blood is rarely seen. If it is, the entire stool is bloody. Fuhermore, there is no change in bowel habit or stool caliber when the tumor is so proximal in the colon. External hemorrhoids hu and itch, but they rarely bleed. Ref: Chang G.J., Shelton A.A., Welton M.L. (2010). Chapter 30. Large Intestine. In G.M. Dohey (Ed), CURRENT Diagnosis & Treatment: Surgery, 13e.

Surgery

A 56 year old man has been having bloody bowel movements on and off for the past several weeks. He repos that the blood is bright red, it coats the outside of the stools, and he can see it in the toilet bowl even before he wipes himself. When he does so, there is also blood on the toilet paper. After fuher questioning, it is asceained that he has been constipated for the past 2 months and that the caliber of the stools has changed. They are now pencil thin, rather the usual diameter of an inch or so that was customary for him. He has no pain.

Which of the following is the most likely diagnosis?

C. Cancer of the rectum

87b19c10-d3b3-4357-af21-51019d1f77a8

A 64-year-old man, who is a chronic alcoholic, presents with fever, chills and increasing shoness of breath. The patient appears in acute respiratory distress and complains of pleuritic chest pain. Physical examination shows crackles and decreased breath sounds over both lung fields. The patient exhibits tachypnea, with flaring of the nares. The sputum is thick, mucoidy and blood-tinged. Which of the following pathogens is the most common cause of this patient's pulmonary infection?

Legionella pneumophila

Klebsiella pneumoniae

Mycoplasma pneumoniae

Streptococcus pneumoniae

1b

multi

Klebsiella pneumoniae is the most frequent cause of gram-negative bacterial pneumonia. It commonly afflicts debilitated and malnourished people, paicularly chronic alcoholics. Thick, mucoid (often blood-tinged) sputum is characteristic because the organism produces an abundant viscid capsular polysac-charide, which the patient may have difficulty expectorating.

Pathology

Infectious Lung Disease: Pneumonia

A 64-year-old man, who is a chronic alcoholic, presents with fever, chills and increasing shoness of breath. The patient appears in acute respiratory distress and complains of pleuritic chest pain. Physical examination shows crackles and decreased breath sounds over both lung fields. The patient exhibits tachypnea, with flaring of the nares. The sputum is thick, mucoidy and blood-tinged.

Which of the following pathogens is the most common cause of this patient's pulmonary infection?

B. Klebsiella pneumoniae

3d38919b-c151-4f05-97e2-8bb90e4ee93d

A 29-year-old woman on oral contraceptives presents with abdominal pain. A computed tomography (CT) scan of the abdomen demonstrates a large hematoma of the right liver with the suggestion of an underlying liver lesion. Her hemoglobin is 6, and she is transfused 2 units of packed red blood cells and 2 units of fresh frozen plasma. Two hours after staing the transfusion, she develops respiratory distress and requires intubation. She is not volume overloaded clinically, but her chest x-ray shows bilateral pulmonary infiltrates. Which of the following is the management strategy of choice?

Continue the transfusion and administer an antihistamine

Stop the transfusion and administer a diuretic

Stop the transfusion, perform bronchoscopy, and sta broad-spectrum empiric antibiotics

Stop the transfusion and continue suppoive respiratory care

3d

multi

The patient has TRALI or transfusion-related acute lung injury which manifests as respiratory distress, hypoxemia, and bilateral pulmonary infiltrates not due to volume overload. The treatment of choice is respiratory suppo, including mechanical ventilation, as needed. The major risk factor for TRALI is transfusion of any plasma-containing blood products from multiparous female donors. Other complications of transfusions and their treatments include: (1) allergic reactions such as rash and fever--mild reactions are treated with an antihistamine; (2) transfusion-associated circulation overload (TACO) which occurs in patients with underlying hea failure who receive large volume transfusions--the treatment is administration of diuretics; and hemolytic reactions--diagnosis is made by a positive Coombs test and treatment is to stop the transfusion and identify the responsible antigen to prevent future reactions. There is no evidence that the patient has pneumonia or any other indication to perform bronchoscopy or to sta antibiotics.

Anaesthesia

Miscellaneous

A 29-year-old woman on oral contraceptives presents with abdominal pain. A computed tomography (CT) scan of the abdomen demonstrates a large hematoma of the right liver with the suggestion of an underlying liver lesion. Her hemoglobin is 6, and she is transfused 2 units of packed red blood cells and 2 units of fresh frozen plasma. Two hours after staing the transfusion, she develops respiratory distress and requires intubation. She is not volume overloaded clinically, but her chest x-ray shows bilateral pulmonary infiltrates.

Which of the following is the management strategy of choice?

D. Stop the transfusion and continue suppoive respiratory care

5585da3c-5132-4b3d-89f5-cd27c8172713

A 67-year-old man with an 18-year history of type 2 diabetes mellitus presents for a routine physical examination. His temperature is 36.9 C (98.5 F), his blood pressure is 158/98 mm Hg and his pulse is 82/minute and regular. On examination, the physician notes a non tender, pulsatile, mass in the mid-abdomen. A plain abdominal x-ray film with the patient in the lateral position reveals spotty calcification of a markedly dilated abdominal aoic walI. Following surgery, the patient is placed on a low-fat diet to reduce the risk of continued progression of his atherosclerotic disease. A bile acid sequestrant is added to interrupt enterohepatic circulation of bile acids. Which of the following agents was MOST likely prescribed?

Atorvastatin

Cholestyramine

Clofibrate

Gemfibrozil

1b

single

Cholestyramine and colestipol are bile acid sequestrants that bind bile acids in the intestine, thereby interrupting enterohepatic circulation of bile acids. This has an indirect effect to enhance LDL clearance and lower lipids in the blood. Atorvastatin and lovastatin are lipid-lowering drugs that competitively inhibit HMG-CoA reductase, an early step in cholesterol biosynthesis. Clofibrate and gemfibrozil are fibric acid derivatives that may increase the activity of lipoprotein lipase. Ref: Bersot T.P. (2011). Chapter 31. Drug Therapy for Hypercholesterolemia and Dyslipidemia. In L.L. Brunton, B.A. Chabner, B.C. Knollmann (Eds), Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12e.

Pharmacology

A 67-year-old man with an 18-year history of type 2 diabetes mellitus presents for a routine physical examination. His temperature is 36.9 C (98.5 F), his blood pressure is 158/98 mm Hg and his pulse is 82/minute and regular. On examination, the physician notes a non tender, pulsatile, mass in the mid-abdomen. A plain abdominal x-ray film with the patient in the lateral position reveals spotty calcification of a markedly dilated abdominal aoic walI. Following surgery, the patient is placed on a low-fat diet to reduce the risk of continued progression of his atherosclerotic disease. A bile acid sequestrant is added to interrupt enterohepatic circulation of bile acids.

Which of the following agents was MOST likely prescribed?

B. Cholestyramine

3a6b4569-defb-49b4-8430-ff9ea210a929

A 69 year old male presents with an episode of slurring of speech which lasted for 12 hours and then resolved.He is heavy smoker having smoked 60 cigarettes per day for 40 years. He had a single episode of haemoptysis 4 weeks previously and has underlying lung cancer with brain metastases and is referred for an urgent CT chest. An ECG was performed which showed new AF. All blood tests including cardiac biomarkers were normal. Chest CT is shown. Which of the following is most probable diagnosis?

Left atrial myxoma

Left atrial thrombus

Infective endocarditis

Rhabdomyoma

1b

multi

The axial image from a contrast enhanced CT scan, in aerial phase, shows a filling defect in the left atrial appendage layered along the anterior wall. Given the clinical history and the CT appearance, the most likely diagnosis is of thrombus in the LA as a consequence of AF. Myxomas generally arise from interatrial septum projecting into the left atrium Vegetation, abscess and new dehiscence of a prosthetic valve are the three major echocardiographic criteria for the diagnosis of infective endocarditis.

Radiology

Cardiovascular Radiology

A 69 year old male presents with an episode of slurring of speech which lasted for 12 hours and then resolved.He is heavy smoker having smoked 60 cigarettes per day for 40 years. He had a single episode of haemoptysis 4 weeks previously and has underlying lung cancer with brain metastases and is referred for an urgent CT chest. An ECG was performed which showed new AF. All blood tests including cardiac biomarkers were normal. Chest CT is shown.

Which of the following is most probable diagnosis?

B. Left atrial thrombus

d2c083fb-c7d7-40a9-8802-59bf29188590

A 30 year old G1P1001 patient comes to see you In office at 37 weeks gestational age for her routine OB visit. Her 1st pregnancy resulted in a vaginal delivery of a 9-lb, 8-02 baby boy after 30 minutes of pushing. On doing Leopold maneuvers during this office visit codetermine ttwt the fetus is breech. Vaginal exam demonstrate that the cervix is 50% effaced and 1-2 cm dilated. The presenting breech is high out of pelvis. The estimated fetal weight, is about 7 lb. yn the patient- for a USG, which confirms a fetus frank breech prestation. There is a normal am &; amniotic fluid present, and the head is well-felt the patient&;s obstetrician, you offer all the following possible mgmt plans except

Allow the patient to undergo a vaginal breech delivery whenever she goes into labor

Send the patient to labor and delivery immediately for an emergen CS

Schedule a CS at or after 39 weeks gestation a

Schedule an ext cephalic version In next few days

1b

multi

definite indications for elective Caesarean section all complicated breech pregnancy Contracted or borderline pelvis Large babies Severe IUGR Hyper extension of fetal head Footling or knee presentation Previous Caesarean section Lack of an obstetrician experienced in assisted breech delivery can also be considered an indication for for elective Caesarean section (refer pgno:378 sheila textbook of obstetrics 2 nd edition)

Gynaecology & Obstetrics

Abnormal labor

A 30 year old G1P1001 patient comes to see you In office at 37 weeks gestational age for her routine OB visit. Her 1st pregnancy resulted in a vaginal delivery of a 9-lb, 8-02 baby boy after 30 minutes of pushing. On doing Leopold maneuvers during this office visit codetermine ttwt the fetus is breech. Vaginal exam demonstrate that the cervix is 50% effaced and 1-2 cm dilated. The presenting breech is high out of pelvis. The estimated fetal weight, is about 7 lb. yn the patient- for a USG, which confirms a fetus frank breech prestation.

There is a normal am &; amniotic fluid present, and the head is well-felt the patient&;s obstetrician, you offer all the following possible mgmt plans except

B. Send the patient to labor and delivery immediately for an emergen CS

b6f6520e-b4a8-4acd-9621-bda51a06f76f

A study was conducted to test if use of herbal tea played any role in prevention of common cold. Data was collected on the number of people who developed cold and those who did not develop cold and this data was tabulated in relation to whether they consumed Herbal tea or not.\r\n\r\n\r\n\r\n Herbal tea \r\nConsumed\r\nNot consumed\r\n\r\n\r\n Had cold \r\n12\r\n 23\r\n\r\n\r\n Did not have a cold \r\n 34\r\n38\r\n\r\n\r\n\r\n In order to study this above given test, which of the following analytical test can be used?

'Z' test

Chi square test

Student -1 test (paired)

Student -1 test (unpaired)

1b

multi

According to the question, the data that has to assessed is the nominal data which has been arranged in qualified categories and thus by using a non-parametric test, the Chi square test is used for the analytical study of the test. The student t-test (unpaired and paired t test) and the 'z' test are parametric tests that are used to test hypothesis for quantitative data (not qualitative data) Ref: Park's Texbook of Preventive and Social Medicine 19th edition; pages 705; High Yield Biostatistics by Anthony N. Glaser 2nd Edition, Pages 46 - 47; Methods in Biostatistics By Mahajan6th Edition, Pages 168 - 185

Social & Preventive Medicine

A study was conducted to test if use of herbal tea played any role in prevention of common cold.

Data was collected on the number of people who developed cold and those who did not develop cold and this data was tabulated in relation to whether they consumed Herbal tea or not.\r\n\r\n\r\n\r\n Herbal tea \r\nConsumed\r\nNot consumed\r\n\r\n\r\n Had cold \r\n12\r\n 23\r\n\r\n\r\n Did not have a cold \r\n 34\r\n38\r\n\r\n\r\n\r\n In order to study this above given test, which of the following analytical test can be used?

B. Chi square test

cd6ef7dd-345d-44f7-8c57-193e747f7bb1

An epidemiologic study evaluates the rate of dental caries and tooth abscesses among children living in communities within a metropolitan area. Investigators discover that the rate is high among children living in an upper-middle-class community but low in children living in a community below the poverty level. The levels of trace elements in the water supplies for those communities are measured. A higher level of which of the following minerals in the water is most likely to be associated with a lower rate of dental decay among the children living in the poor community?

Copper

Fluoride

Iodine

Selenium

1b

single

Water in some areas naturally contains fluoride, and dental problems in children are fewer in these areas because tooth enamel is strengthened. Fluoride can be added to drinking water, but opposition to this practice, from ignorance or fear, is common. Copper deficiency can produce neurologic defects. Iodine deficiency can predispose to thyroid goiter. Selenium is a trace mineral that forms a component of glutathione peroxidase; deficiency may be associated with myopathy and heart disease. Serious illnesses from trace element deficiencies are rare. Zinc is a trace mineral that aids in wound healing; a deficiency state can lead to stunted growth in children and a vesicular, erythematous rash.

Pathology

Environment & Nutritional Pathology

An epidemiologic study evaluates the rate of dental caries and tooth abscesses among children living in communities within a metropolitan area. Investigators discover that the rate is high among children living in an upper-middle-class community but low in children living in a community below the poverty level. The levels of trace elements in the water supplies for those communities are measured.

A higher level of which of the following minerals in the water is most likely to be associated with a lower rate of dental decay among the children living in the poor community?

B. Fluoride

8add0ee7-5f96-4f91-ba5f-fc34ca99d3cd

A 65 year old white male in previously good health sta to notice blood in his urine. He develops pain with urination. He also thinks that the stream of his urine is weakened. He goes to his family doctor because of his symptoms. Laboratory findings show an anemia. His urinalysis is positive for red cells, white cells and gram negative rods are seen. A cystogram is done and shows a tumor. A transurethral biopsy is done and confirms a malignant bladder tumor. Which of the following is true of this patient's tumor?

It is likely to be an adenocarcinoma

More commonly presents with a palpable abdominal mass

Likely to cause an elevated serum acid phosphatase

Is likely to recur after treatment

3d

multi

Is likely to recur after treatment * Even after treatment, transitional cell cancers of the bladder tend to recur. * Choice (a) is incorrect because about 90% of bladder cancers are transitional cell carcinomas. * The classic triad: hematuria, flank pain, and a palpable abdominal mass is associated with renal cell carcinoma, not bladder cancer. * Elevated serum acid phosphatase is seen with prostate cancer, not bladder cancer.

Surgery

A 65 year old white male in previously good health sta to notice blood in his urine. He develops pain with urination. He also thinks that the stream of his urine is weakened. He goes to his family doctor because of his symptoms. Laboratory findings show an anemia. His urinalysis is positive for red cells, white cells and gram negative rods are seen. A cystogram is done and shows a tumor. A transurethral biopsy is done and confirms a malignant bladder tumor.

Which of the following is true of this patient's tumor?

D. Is likely to recur after treatment

b50294a0-bf80-4042-9ed9-87a6ef5e2e10

A 49-year-old woman has experienced increasing weakness and chest pain over the past 6 months. On physical examination, she is afebrile and normotensive. Motor strength is 5/5 in all extremities, but diminishes to 4/5 with repetitive movement. There is no muscle pain or tenderness. Laboratory studies show hemoglobin, 14 g/dL; hematocrit, 42%; platelet count, 246,000/mm3; and WBC count, 6480/mm3. A chest CT scan shows an irregular 10x12 cm anterior mediastinal mass. The surgeon has difficulty removing the mass because it infiltrates surrounding structures. Microscopically, the mass is composed of large, spindled, atypical epithelial cells mixed with lymphoid cells. Which of the following is the most likely cause of this mass lesion?

Extrapulmonary tuberculosis

Hodgkin lymphoma

Lymphoblastic lymphoma

Malignant thymoma

3d

multi

Thymomas are rare neoplasms that can be benign or malignant. In one third to one half of cases, thymomas are associated with myasthenia gravis as an initial presentation (as in this case). Benign thymomas have a mixed population of lymphocytes and epithelial cells and are circumscribed, whereas malignant thymomas are invasive and have atypical cells. Thymic carcinomas resemble squamous cell carcinomas. Granulomas can have epithelioid macrophages and lymphocytes, but the thymus is an unusual location for them. Hodgkin lymphoma involves lymph nodes in the middle or posterior mediastinum, with a component of Reed-Sternberg cells. Lymphoblastic lymphoma of the T-cell variety is seen in the mediastinal region, including thymus, in children, but it has no epithelial component. Metastases to the thymus are quite unusual. An organizing abscess could have granulation tissue at its edge, with a mixture of inflammatory cell types, but not atypical cells.

Pathology

Blood

A 49-year-old woman has experienced increasing weakness and chest pain over the past 6 months. On physical examination, she is afebrile and normotensive. Motor strength is 5/5 in all extremities, but diminishes to 4/5 with repetitive movement. There is no muscle pain or tenderness. Laboratory studies show hemoglobin, 14 g/dL; hematocrit, 42%; platelet count, 246,000/mm3; and WBC count, 6480/mm3. A chest CT scan shows an irregular 10x12 cm anterior mediastinal mass. The surgeon has difficulty removing the mass because it infiltrates surrounding structures. Microscopically, the mass is composed of large, spindled, atypical epithelial cells mixed with lymphoid cells.

Which of the following is the most likely cause of this mass lesion?

D. Malignant thymoma

c07322bc-4b43-4c1a-839e-154aefcc3aa5

A 25-year-old woman rushes to an emergency depament because she is afraid she is dying. She is experiencing chest pain, a sensation of choking, nausea, and tingling sensations up and down her arms. When the screening nurse examines the patient, her face is flushed and sweating. Her pulse is 140/min and respirations are 25/min. When the emergency depament physician examines her 15 minutes later, her symptoms are dissipating; her pulse is 100/min, and respirations are 20/min. The ECG is normal, except for some residual tachycardia. Which of the following is the most likely diagnosis?

Angina

Heaburn

Myocardial infarction

Panic attack

3d

multi

This woman had a panic attack. These are common, affecting more than one third of the general population each year. The etiology appears to be a combination of both biological and psychological dysfunction. The sensations and physiologic changes can be very dramatic and, in addition to the features cited in the question stem, can include dizziness, fear of going crazy, feelings of unreality, chills, abdominal distress, palpitations, shoness of breath, and trembling or shaking. Many patients who experience a panic attack are concerned that they may have a dangerous hea, lung, or brain disorder. Although the diagnosis is fairly straightforward in a younger individual with no known serious disease, the diagnostic dilemma is more difficult in an older patient, who may potentially have a true disease of these organ systems. Whereas isolated panic attacks are common, less than 1% of the population has "panic disorder," characterized by frequent panic attacks, severe anticipation anxiety about recurrent attacks, and avoidance of places in which attacks had previously been experienced. Individuals with isolated panic attacks usually need no more therapy than reassurance; those with panic disorder may be helped with antidepressants, benzodiazepines, and behavior therapy.Angina and myocardial infarction would not be expected in a 25-year-old woman, and the ischemic changes would be apparent on the ECG. Heaburn can produce chest pain, but does not usually produce increased pulse and respiratory rate. Ref: Lee T.H. (2012). Chapter 12. Chest Discomfo. In D.L. Longo, A.S. Fauci, D.L. Kasper, S.L. Hauser, J.L. Jameson, J. Loscalzo (Eds), Harrison's Principles of Internal Medicine, 18e.

Psychiatry

A 25-year-old woman rushes to an emergency depament because she is afraid she is dying. She is experiencing chest pain, a sensation of choking, nausea, and tingling sensations up and down her arms. When the screening nurse examines the patient, her face is flushed and sweating. Her pulse is 140/min and respirations are 25/min. When the emergency depament physician examines her 15 minutes later, her symptoms are dissipating; her pulse is 100/min, and respirations are 20/min. The ECG is normal, except for some residual tachycardia.

Which of the following is the most likely diagnosis?

D. Panic attack

234c6833-b1e3-4452-88bf-cfd490dc5bad

A 69-year-old man comes to the physician because of the gradual onset of pain, tingling and hyperesthesia in the medial aspect of his right arm. Shortly thereafter, he develops erythema and then an outbreak of vesicles on the medial aspect of his right arm extending from his medial epicondyle to the wrist. After several days. the lesions crust over and eventually resolve. However, he is left with a residual “burning” pain in the same distribution as the lesions with occasional episodes of sharp.1O/1O pain that is provoked by touch. He uses ice packs to suppress the pain at night but it has persisted despite this. The infectious agent responsible for this condition resides in which part of the neuraxis?

Brainstem

Dorsal root ganglion

Sensory nerve axon

Sensory nerve root

1b

multi

Medicine

A 69-year-old man comes to the physician because of the gradual onset of pain, tingling and hyperesthesia in the medial aspect of his right arm. Shortly thereafter, he develops erythema and then an outbreak of vesicles on the medial aspect of his right arm extending from his medial epicondyle to the wrist. After several days. the lesions crust over and eventually resolve. However, he is left with a residual “burning” pain in the same distribution as the lesions with occasional episodes of sharp.1O/1O pain that is provoked by touch. He uses ice packs to suppress the pain at night but it has persisted despite this.

The infectious agent responsible for this condition resides in which part of the neuraxis?

B. Dorsal root ganglion

153eb6d2-2430-4054-8c7a-5c0f3da4c493

A 45 year old male presented with palpitations, tachycardia & anxiety. His BP is 158/90 mmHg. The patient also has mild depression and is presently taking citalopram, labetalol & amlodipine to control his blood pressure. 24-hour urine total metanephrines are ordered and show an elevation of 1.5 times the upper limit of normal. What is the next best step?

Hold labetalol for 1 week and repeat testing

Hold citalopram for 1 week and repeat testing

Refer immediately for surgical evaluation

Measure 24-hour urine vanillylmandelic acid level

0a

multi

Investigations done in pheochromocytoma 24 hour urinary fractionated metanephrine 24 hour urinary catecholamines 24 hour urinary vanillylmandelic acid level IOC- Plasma fractionated metanephrine levels 24-hour urine total metanephrines has high sensitivity & value of three times the upper limit of normal is highly suggestive of pheochromocytoma. Borderline elevation- likely to be false positives. Drugs related- include levodopa, sympathomimetics, diuretics, TCA, and a- and b-blockers (Labetalol) Therefore, hold labetalol for 1 week and repeat testing is the best next step

Medicine

Disorders of Adrenal Gland

A 45 year old male presented with palpitations, tachycardia & anxiety. His BP is 158/90 mmHg. The patient also has mild depression and is presently taking citalopram, labetalol & amlodipine to control his blood pressure. 24-hour urine total metanephrines are ordered and show an elevation of 1.5 times the upper limit of normal.

What is the next best step?

A. Hold labetalol for 1 week and repeat testing

5bedaef6-8d34-446e-b094-f42fca1dbd12

A pharmaceutical company develops a new antihypertensive drug. Samples of 24 hypertensive patients, randomly selected from a large population of hypertensive people, are randomly divided into 2 groups of 12. One group is given the new drug over a period of 1 month; the other group is given a placebo according to the same schedule. Neither the patients nor the treating physicians are aware of which patients are in which group. At the end of the month, measurements are made of the patient’s blood pressures. This study

Is a randomized controlled clinical trial

Uses a crossover design

Is a single blind experiment

Is a prospective study

0a

single

Here, a pharmaceutical company develops a new anti-hypertensive drug; samples of 24 hypertensive patients, randomly selected from a large population of hypertensive people, are randomly divided into 2 groups of 12, and one group is given the new drug over a period of 1 month & the other group is given a placebo according to the same schedule, Since a new drug (intervention) is given it is an experimental/ interventional study (not a prospective study which is only observational in design) Also, there are 2 groups, i.e. experimental group (Intervention – new drug is given) and reference group (no intervention is given – only placebo is given) which are compared concurrently, thus it is a ‘Concurrent parallel design of RCT’ (there is no cross-over) Also, neither the patients nor the treating physicians are aware of which patients are in which group, thus it is a ‘double blinded RCT’.

Social & Preventive Medicine

A pharmaceutical company develops a new antihypertensive drug. Samples of 24 hypertensive patients, randomly selected from a large population of hypertensive people, are randomly divided into 2 groups of 12. One group is given the new drug over a period of 1 month; the other group is given a placebo according to the same schedule. Neither the patients nor the treating physicians are aware of which patients are in which group. At the end of the month, measurements are made of the patient’s blood pressures.

This study

A. Is a randomized controlled clinical trial

d9e3512a-cb34-460b-8045-60083ae8387c

A 30 year old person met with a roadside accident. On admision his pulse rate was 120/minute, BP was 100/60 mmHg. Ultrasonagraphy examination revealed laceration of the lower pole of spleen and haemoperitoneum. He was resuscitated with blood and fluid. Two hours later, his pulse was 84/minute and BP was 120/70 mm Hg. The most appropriate course of management in this case would be-

Exploring the patient followed by splenectomy

Exploring the patient followed by excision of the lower pole of spleen

Splenorrhaphy

Continuation of conservative treatment under close monitoring system and subsequent surgery if further indicated

3d

single

Surgery

A 30 year old person met with a roadside accident. On admision his pulse rate was 120/minute, BP was 100/60 mmHg. Ultrasonagraphy examination revealed laceration of the lower pole of spleen and haemoperitoneum. He was resuscitated with blood and fluid. Two hours later, his pulse was 84/minute and BP was 120/70 mm Hg.

The most appropriate course of management in this case would be-

D. Continuation of conservative treatment under close monitoring system and subsequent surgery if further indicated

24e6e46a-91bb-4c8d-9047-170fe6250e05

Several weeks after surgical dissection of her left axilla for the removal of lymph nodes for staging and treatment of her breast cancer, a 32-year-old woman was told by her general physician that she had "winging" of her left scapula when she pushed against resistance during her physical examination. She told the physician that she had also experienced difficulty lately in raising her right arm above her head when she was combing her hair. In a subsequent consult visit with her surgeon, she was told that a nerve was accidentally injured during the diagnostic surgical procedure and that this produced her scapular abnormality and inability to raise her arm normally. What was the origin of this nerve?

The upper trunk of her brachial plexus

The posterior division of the middle trunk

Roots of the brachial plexus

The posterior cord of the brachial plexus

2c

multi

The long thoracic nerve was injured during the axillary dissection, resulting in paralysis of the serratus anterior. The serratus anterior is important in rotation of the scapula in raising the arm above the level of the shoulder. Its loss results in protrusion of the inferior angle ("winging" of the scapula), which is more obvious when one pushes against resistance. The long thoracic nerve arises from brachial plexus roots C5, C6, and C7. The upper trunk (C5,C6) supplies rotator and abductor muscles of the shoulder and elbow flexors. The posterior division of the middle trunk contains C7 fibers for distribution to extensor muscles; likewise, the posterior cord supplies extensors of the arm, forearm, and hand. The lateral cord (C5, C6, and C7) gives origin to the lateral pectoral nerve, the musculocutaneous nerve, and the lateral root of the median nerve. There is no sensory loss in the limb in this patient; injury to any of the other nerve elements listed here would be associated with specific dermatome losses.

Anatomy

Upper Extremity

Several weeks after surgical dissection of her left axilla for the removal of lymph nodes for staging and treatment of her breast cancer, a 32-year-old woman was told by her general physician that she had "winging" of her left scapula when she pushed against resistance during her physical examination. She told the physician that she had also experienced difficulty lately in raising her right arm above her head when she was combing her hair. In a subsequent consult visit with her surgeon, she was told that a nerve was accidentally injured during the diagnostic surgical procedure and that this produced her scapular abnormality and inability to raise her arm normally.

What was the origin of this nerve?

C. Roots of the brachial plexus

f0db5ac0-ee6e-413f-82ab-0ccbff11eab1

A 19-year-old man is brought to the emergency department with a stab wound at the base of the neck (zone I) (Figure below). The most important concern for patients with such injuries is which of the following?For the purpose of evaluating penetrating injuries, the neck is divided into three zones. Zone I is below the clavicles and is also known and the thoracic outlet. Zone II is located between the clavicles and hyoid bone, and Zone III is above the hyoid.

Upper extremity ischemia

Cerebral infarction

Exsanguinating hemorrhage

Mediastinitis

2c

multi

Exsanguinating hemorrhage is the predominant risk, because bleeding may not be easily recognized, given that bleeding into the pleural cavity and mediastinum can occur. The abundant collateral blood supply generally protects against upper extremities or cerebrovascular compromise.

Surgery

Trauma

A 19-year-old man is brought to the emergency department with a stab wound at the base of the neck (zone I) (Figure below). The most important concern for patients with such injuries is which of the following?For the purpose of evaluating penetrating injuries, the neck is divided into three zones. Zone I is below the clavicles and is also known and the thoracic outlet.

Zone II is located between the clavicles and hyoid bone, and Zone III is above the hyoid.

C. Exsanguinating hemorrhage

11fa2143-7c6e-4564-921b-e42ce2eba143

A 40-year-old male patient presented to the dermatology OPD with complaints of a characteristic rash over the face along with fever, ahralgia and moderate chest pain. Patient gave history of using some drug for 3 months. On examination, there was no CNS involvement. Lab findings revealed normal urine r/m studies and normal RFTs. ANA and anti-histone antibody titres were found to be raised. Which of the following mechanisms is most likely implicated in the above disease: -

<img style="max-width: 100%" src=" />

<img style="max-width: 100%" src=" />

<img style="max-width: 100%" src=" />

<img style="max-width: 100%" src=" />

3d

multi

This is a case of Drug induced Lupus. More common in females. Presents with the characteristic malar skin rash. Along with serositis, most commonly pleuritis. Kidney and CNS are rarely involved. Titres of anti-histone Abs are increased. It is a type 3 hypersensitivity reaction. It is associated with HLA-DR2 Image A shows Type 1 hypersensitivity reaction Image B shows Type 2 hypersensitivity reaction Image C shows Type 4 hypersensitivity reaction

Unknown

Integrated QBank

A 40-year-old male patient presented to the dermatology OPD with complaints of a characteristic rash over the face along with fever, ahralgia and moderate chest pain. Patient gave history of using some drug for 3 months. On examination, there was no CNS involvement. Lab findings revealed normal urine r/m studies and normal RFTs. ANA and anti-histone antibody titres were found to be raised.

Which of the following mechanisms is most likely implicated in the above disease: -

D. <img style="max-width: 100%" src=" />

874e45c8-1b40-41c2-9fe5-3e9329a84653

Many rashes and skin lesions can be found first in the newborn period. For each of the descriptions listed below, select the most likely diagnosis. Each lettered option may be used once, more than once, or not at all. An adolescent boy complains of a splotchy red rash on the nape of his neck, discovered when he had his head shaved for football season.The rash seems to become more prominent with exercise or emotion. His mother notes that he has had the rash since infancy, but that it became invisible as hair grew. He had a similar rash on his eyelids that resolved in the newborn period.

Sebaceous nevus

Salmon patch

Neonatal acne

Pustular melanosis

1b

multi

Salmon patches (aka nevus simplex or nevus flammeus) are flat vascular lesions that occur in the listed regions and appear more prominent during crying. The lesions on the face fade over the first few years of life. Lesions found over the nuchal and occipital areas often persist. No therapy is indicated.

Pediatrics

Growth, Development, and Behavior

Many rashes and skin lesions can be found first in the newborn period. For each of the descriptions listed below, select the most likely diagnosis. Each lettered option may be used once, more than once, or not at all. An adolescent boy complains of a splotchy red rash on the nape of his neck, discovered when he had his head shaved for football season.The rash seems to become more prominent with exercise or emotion. His mother notes that he has had the rash since infancy, but that it became invisible as hair grew.

He had a similar rash on his eyelids that resolved in the newborn period.

B. Salmon patch

d12e78d3-6249-49de-8d70-680af7a2e738

A 42-year old female presents with the complaint of bleeding gums for the past 20 days. Intra-oral examination shows thickened and friable gums. Also, she has hepatosplenomegaly with generalized non tender lymphadenopathy. The blood  count reveals: Hemoglobin 11.4 g/dl, Platelet count 90,000/mm3, WBC count 4600/mm3. The bone marrow biopsy shows 100% cellularity, with many large blasts that are peroxidase negative and nonspecific esterase positive. Which of the following is the most likely diagnosis for this patient?

Acute lymphoblastic leukemia

Acute megakaryocytic leukemia

Acute promyelocytic leukemia

Acute monocytic leukemia

3d

single

Patient has an “aleukemic” leukemia in which leukemic blasts fill the marrow, but the peripheral blood count of leukocytes is not high. The staining of the blasts suggests the presence of monoblasts (peroxidase negative and nonspecific esterase positive). So, the likely diagnosis for her is M5 leukemia, which is characterized by increased chances of tissue infiltration and organomegaly. Other options: Acute lymphoblastic leukemia is typically seen in children and young adults. Acute megakaryocytic leukemia is typically accompanied by myelofibrosis and is rare. The blasts react with platelet-specific antibodies. Acute promyelocytic leukemia (M3-AML) has many promyelocytes filled with azurophilic granules, making them strongly peroxidase positive.

Pathology

A 42-year old female presents with the complaint of bleeding gums for the past 20 days. Intra-oral examination shows thickened and friable gums. Also, she has hepatosplenomegaly with generalized non tender lymphadenopathy. The blood  count reveals: Hemoglobin 11.4 g/dl, Platelet count 90,000/mm3, WBC count 4600/mm3. The bone marrow biopsy shows 100% cellularity, with many large blasts that are peroxidase negative and nonspecific esterase positive.

Which of the following is the most likely diagnosis for this patient?

D. Acute monocytic leukemia

c43f4178-abb7-40c6-a1ab-dbb3cc44dd94

An 18 years old male reported with chief complaint of sensitivity and deep, dull, radiating pain during chewing. Intra-oral examination showed sparase plague and dental calculus deposits, distolabial migration of the maxillary incisors with diastema formation, mobility of maxillary and mandibular incisors and first molars. Prescribed radiographs showed an arch shaped loss of alveolar bone extending from the distal surface of the mandibular second premolar to the mesial surface of the second molar. There was vertical bone loss in the maxillary incisor region. The host modulation therapy that may be used as adjunctive therapy for this disease is

Subantimicrobial-dose clindamycin

Subantimicrobial-dose metronidazole

Subantimicrobial-dose doxycycline

Subantimicrobial-dose ciproftoxacin

2c

single

Dental

An 18 years old male reported with chief complaint of sensitivity and deep, dull, radiating pain during chewing. Intra-oral examination showed sparase plague and dental calculus deposits, distolabial migration of the maxillary incisors with diastema formation, mobility of maxillary and mandibular incisors and first molars. Prescribed radiographs showed an arch shaped loss of alveolar bone extending from the distal surface of the mandibular second premolar to the mesial surface of the second molar.

There was vertical bone loss in the maxillary incisor region. The host modulation therapy that may be used as adjunctive therapy for this disease is

C. Subantimicrobial-dose doxycycline