Spaces:
Sleeping
Sleeping
File size: 3,169 Bytes
731bd10 e517d25 de37bdf 731bd10 de37bdf d54db96 731bd10 d295ad0 731bd10 4833747 731bd10 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 |
import gradio as gr
#-------------------------------------------------------------
# first function is taken from lecture notes
#-------------------------------------------------------------
dna2dna = {'A':'T', 'T':'A', 'C':'G', 'G':'C'}
def reverse_comp(dna):
"""Return a string representing the reverse complement of the single dna strand."""
other = '' # start with an empty string
for base in dna:
other = other + dna2dna[base]
return other[ : :-1] # python trick to reverse a string
#-------------------------------------------------------------
# second function is your responsibility to implement
#-------------------------------------------------------------
def mutate(dna, motif):
if motif in dna:
reverse_motif=''
#dna[reverse_comp(motif)]
new_dna=''
if reverse_motif in dna:
#My code
#new_dna=dna[:dna.index(motif)]+dna[dna.index(motif)+len(motif):dna.index(reverse_comp(motif))]+dna[dna.index(reverse_comp(motif))+len(reverse_comp(motif)):]
#reverse_motif.index(reverse_comp)+len()]
new_dna = dna[:dna.index(motif)] + dna[dna.find(reverse_comp(motif), dna.index(motif)) + len(reverse_comp(motif)):]
#correct code ^^^
return new_dna
else:
print('motif not found in sequence: ',end='')
return dna
#def mutate(dna, motif):
#"""Return the result of a mutation based on an inverted repeat of the given motif."""
# your code here!
#### (1) Check if the motif exists in dna sequence. If not, return the original sequence.
#j = dna.find(motif)
#if j == -1:
# return dna
#### (2) If true, check if the reversed complement of the motif exists in dna sequence, if not, return the orignal sequence.
# k = dna.find(reverse_complement(motif), j+len(motif))
# if k == -1:
# return dna
#### (3) If the motif and its reversed complements exist, remove the region starting from the motif and ending with the inverted repeat, return the new sequence.
# """Return the result of a mutation based on an inverted repeat of the given motif."""
#return dna[:j] + dna[k+len(motif): ]
#test_data = """ATCCGAATACGGTTCGGGTA CGAA
#ATCCGAATACGGTTGGGTA CGAA
#ATCCAATACGGTTCGGGTA CGAA
#ATCCGAATACGGTTCGGGTTCGA CGAA
#AGTCACATGATCAGT C"""
#for dna,motif in [line.split() for line in test_data.split('\n')[0:]]:
# print('Executing mutate(%s,%s)...' % (dna,motif))
# print(' returned: %s' % (mutate(dna,motif)))
input_module1 = gr.inputs.Textbox(label = "Enter your DNA sequence in the box:")
input_module2 = gr.inputs.Textbox(label = "Enter your motif of interest in the box:")
output_module = gr.outputs.Textbox(label = 'new dna')
interface = gr.Interface(fn=mutate,
inputs=[input_module1,input_module2],
outputs=output_module,
title="CSCI1020 Demo 3: Web Application for Finding DNA Inverted Repeats",
description= "Click examples below for a quick demo",
theme = 'huggingface',
layout = 'vertical'
)
interface.launch()
|