CTS_user_log.csv

user_query,ref_question,query_score,code_executed,ref_question_2,query_score_2,ref_question_3,query_score_3,similarity_metric,model_used_for_embeddings,lower_threshold,upper_threshold,date,time,response
How many bases are there in the sequence,How many bases are there in the sequence,1.06480165e-20,a2,How many bases does the sequence have,0.032355085,How many bases does the sequence have,0.032355085,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,10:21:36,930
there are cats and two dogs,How many bases are there,1.6690745,a2,What is the number of bases,1.6727788,What is the number of bases,1.6727788,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,10:25:06,Your Query Wasn't Understood. Can You Rephrase The Query
What is the base at position 78,What is the base at position/site 5 and 50,0.48746616,b1,What is the base at position/site 5,0.51927286,What is the base at position/site 5,0.51927286,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,10:31:04,c
What is the base at position 0,What is the base at position/site 5,0.5530416,b1,What are the bases from/between position 10  to/and 20?,0.6031008,What are the bases from/between position 10  to/and 20?,0.6031008,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,10:31:09,Position is out of range. Positions should be 1 - 930
What is the base at position 1000,What is the base at position/site 5 and 50,0.48386246,b1,"What is the base at position/site 5, 50, 515, 1568, 34578",0.49479663,"What is the base at position/site 5, 50, 515, 1568, 34578",0.49479663,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,10:31:38,Position is out of range. Positions should be 1 - 930
What are the bases from position 5 to 90,What are the bases from/between position 10  to/and 20?,0.24776845,b3,how many bases are there from positions 5 to/and 9,0.32962877,how many bases are there from positions 5 to/and 9,0.32962877,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,10:42:59,"ttgaggagaccattgacaccgtcattagcaatgcactacaactgtcacaacctaaa
ccgcagaaacaactcacggcccaatcgac"
How many are there from position 5 to 90,how many bases are there from positions 5 to/and 9,0.81035805,b2,how many bases are there between position 5 to/and 9,0.81407386,how many bases are there between position 5 to/and 9,0.81407386,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,10:43:26,86
what is the base at site 7 8 and 21,What is the base at position/site  34578,0.5133599,b1,What is the base at position/site 15,0.51463896,What is the base at position/site 15,0.51463896,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,10:48:34,g
What is the base at site 789,What is the base at position/site  1568,0.6266778,b1,What is the base at position/site  34578,0.6326653,What is the base at position/site  34578,0.6326653,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:09:15,a
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:10:19,930
How many bases are there,How many bases are there,7.908044e-21,a2,What is the number of bases,0.18966407,What is the number of bases,0.18966407,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:38:25,20
What is the base at site 5,What is the base at position/site 5,0.2645588,b1,What is the base at position/site 515,0.3784331,What is the base at position/site 515,0.3784331,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:46:46,t
What is the base at site 6,What is the base at position/site 5,0.49194798,b1,What is the base at position/site 515,0.53231597,What is the base at position/site 515,0.53231597,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:48:47,t
How many bases are in the sequence,How many bases are there in the sequence,0.0076738065,a2,How many bases does the sequence have,0.03213788,How many bases does the sequence have,0.03213788,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:49:22,15
Is there a pig on the plane,What is the amino acid count in the sequence,1.7117482,a1,What is the number of amino acids in the sequence,1.7167848,What is the number of amino acids in the sequence,1.7167848,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:49:54,Your Query Wasn't Understood. Can You Rephrase The Query
How many thymine,How many thymine t are there?,0.26310813,a6,What is the number of thymine t?,0.34814063,What is the number of thymine t?,0.34814063,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:50:27,5
how many guanines are there,How many guanines g are there?,0.30252665,a3,What is the number of guanines g?,0.41288453,What is the number of guanines g?,0.41288453,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,11:56:27,6
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:19:13,60
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:26:05,60
How many guanines bases are there in the sequence,How many guanines g does the sequence have?,0.3019901,a3,How many guanines g are there in the sequence?,0.3040974,How many guanines g are there in the sequence?,0.3040974,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:26:11,11
What is the base at position 10,What is the base at position/site 5,0.4366287,b1,What is the base at position/site 5 and 50,0.4367645,What is the base at position/site 5 and 50,0.4367645,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:26:20,g
What are the bases from position 2 to 10,What are the bases from/between position 10  to/and 20?,0.1379996,b3,how many bases are there from positions 5 to/and 9,0.28074524,how many bases are there from positions 5 to/and 9,0.28074524,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:26:29,gcattgagg
How many bases are there from position 2 to 10,how many bases are there between position 5 to/and 9,0.1829868,b2,how many bases are there from positions 5 to/and 9,0.18728873,how many bases are there from positions 5 to/and 9,0.18728873,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:26:40,9
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:27:21,60
What is the length,What is the length of the DNA ,0.86588484,a2,What is the length of the sequence,0.8859824,What is the length of the sequence,0.8859824,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:32:32,0
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:35:44,0
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:35:54,0
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:41:09,60
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:46:29,0
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:51:46,0
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:51:57,0
,What is the quantiy of amino acids in the sequence,1.7896336,a1,What is the base at position/site 15,1.8019854,What is the base at position/site 15,1.8019854,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:52:06,Your Query Wasn't Understood. Can You Rephrase The Query
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:53:57,0
,What is the quantiy of amino acids in the sequence,1.7896336,a1,What is the base at position/site 15,1.8019854,What is the base at position/site 15,1.8019854,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,12:54:09,Your Query Wasn't Understood. Can You Rephrase The Query
What is the length of the sequence,What is the length of the sequence,1.974797e-20,a1,How long is the sequence,0.1940434,How long is the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,13:43:27,60
What are the bases from position 2 to 10,What are the bases from/between position 10  to/and 20?,0.1379996,b3,how many bases are there from positions 5 to/and 9,0.28074524,how many bases are there from positions 5 to/and 9,0.28074524,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,13:43:53,gcattgagg
What is the base at position 10,What is the base at position/site 5,0.4366287,b1,What is the base at position/site 5 and 50,0.4367645,What is the base at position/site 5 and 50,0.4367645,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,14:11:51,g
How many bases are there from position 2 to 10,how many bases are there between position 5 to/and 9,0.1829868,b2,how many bases are there from positions 5 to/and 9,0.18728873,how many bases are there from positions 5 to/and 9,0.18728873,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,14:12:54,9
How long is the sequence ,How long is the sequence,2.4214691e-20,a1,What is the length of the sequence,0.1940434,What is the length of the sequence,0.1940434,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,14:13:48,60
Is there an S strand in the DNA sequence ,What is the length of the DNA sequence,0.8219202,a2,How long is the DNA sequence,0.84429514,How long is the DNA sequence,0.84429514,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,14:14:44,60
Do you like syrup waffles? ,How many adenine a are there in the sequence?,1.8768792,a4,How many adenine a does the sequence contain?,1.8772323,How many adenine a does the sequence contain?,1.8772323,k nearest neighbours,all-mpnet-base-v2,1.1,1.4,2023-09-19,14:16:35,Your Query Wasn't Understood. Can You Rephrase The Query