Datasets:

tomekkorbak

/

pile-detoxify

like 1

[ "I have to say I’ve been surprised to see some of the reaction to the USA team’s celebrations during the 13‑0 win against Thailand. ", "I think some of it is to do with the fact that they aren’t the most popular team out there – there’s this perception that the USA are arrogant and everything is excessive and over the top with them.", "\n\nBut there is also a perception that women’s football should be all hugs, smiles and kisses – people do not expect a level of ruthlessness they might see in the men’s game. ", "That kind of win-at-all-costs attitude is perhaps something people don’t expect from women. ", "There’s still that unspoken rule that everything should be all “nicely‑nicely” but listen: this is a World Cup.", "\n\nThe ruthlessness of the USA team is what every other side in France should aspire to have too. ", "That’s why they are the defending champions. ", "I don’t really understand the concept that they shouldn’t have celebrated, because it would have been an even bigger disrespect to not celebrate.", "\n\nMost of the time these are choreographed before the match, which means there was a discussion in the dressing room: “If we score loads of goals, we want to celebrate them as if they are just as important as if we were playing France or Germany or anyone else.” ", "Is that not respect? ", "Am I missing something?", "\n\nJill Ellis’s substitutions – she brought on Carli Lloyd, Mallory Pugh and Christen Press, who are top players – showed how seriously the American coach was taking the match. ", "I’ve seen much more disrespectful things happen on a football pitch. ", "But if they have decided to celebrate every goal then it is because they have made a conscious decision to try to respect their opponents.", "\n\nI remember playing Montenegro in the World Cup qualifying campaign in 2014 and our manager, Mark Sampson, said to the team before the game that he wanted us to win by double figures and for me to score five goals. ", "I thought: “OK, that’s a good target – I’m going to try to get five.” ", "I ended up getting my first hat-trick for England and my third goal was the eighth in a 10-0 win. ", "Am I not supposed to celebrate in that situation? ", "It meant everything to me to score that hat-trick, so you don’t know what each goal means to an individual player.", "\n\nThe American players probably knew that they could break the record for the biggest win at a World Cup – there are different targets out there. ", "When you saw the family of Sam Mewis celebrating her goal, then you can also understand what it means to them.", "\n\nAt half-time of Germany’s semi-final against Brazil at the 2014 World Cup, I’ve heard from a good source that Joachim Löw asked his players to take it easy because they were already 5-0 up. ", "You could see that in the second half and while you can say that is great sportsmanship, I guarantee you that it wouldn’t make it any easier for the other team. ", "If you asked David Luiz afterwards whether he would have preferred to lose 7-1 rather than 10-1 then he would have said: “It doesn’t really matter as we were battered anyway.” ", "You might as well keep going and enjoy it.", "\n\nSome of the reaction to the USA has seemed very bitter if you ask me, particular from Canada. ", "It was actually a bit venomous. ", "To say it was a disgrace and that it’s “an American thing” that “[the Canada striker] Christine Sinclair would never have done” went too far. ", "Canada should be focusing on their own performance having only just managed to get past Cameroon, who are below Thailand in the rankings.", "\n\nMy question to those players who criticised is: what would you have done differently if you had been scoring so many against Thailand? ", "Not celebrated and looked miserable? ", "You’re damned if you do and you’re damned if you don’t in this situation.", "\n\nIt was also a real shame that Ada Hegerberg was not on the pitch for Norway’s game against France on Wednesday. ", "But sometimes you have to take a stand for what you believe in and if it costs you your national team place then so be it. ", "I know more than anyone how that feels, although the problem is that people don’t know exactly what she is taking a stand against. ", "I don’t think she owes it to anyone to be more specific but I think it may help other people to understand what the issue is. ", "Norway have been leading the way in terms of gender-pay equality so it’s a little bit confusing for everyone, but you have to respect her position.", "\n\nIt’s the same with Pernille Harder, who isn’t in France with Denmark because they decided to forfeit a game in qualifying over a pay dispute. ", "That ended up costing them a place at the World Cup, which is an awful punishment for any player. ", "The associations need to take more responsibility. ", "Denmark reached the final of the Euros in 2017 but their players still had to fight to be treated fairly. ", "Women’s football in the boardrooms needs to improve and then hopefully we will see the world’s best player playing at the World Cup.", "\n\nOn a brighter note, I really enjoyed Asisat Oshoala’s goal in Nigeria’s win over South Korea on Wednesday. ", "She is the best player in Africa and is totally fearless. ", "I think she has developed a lot since she was at Arsenal and is definitely one of the players to watch in this tournament. ", "Under their Swedish coach, Thomas Dennerby, Nigeria have built a solid defensive unit that gives Oshoala the platform to do what she does best – score goals. ", "There are not many defences that can deal with that pace and, just like Alex Morgan – five goals against Thailand for the USA – and everybody else, she is trying to light up this World Cup." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005486240261234343, 0.036970354616642, 0.004922183230519295, 0.06844020634889603, 0.0009887702763080597, 0.003443319583311677, 0.0012982040643692017, 0.0008095166995190084, 0.0005802363157272339, 0.0008162825251929462, 0.0009518185979686677, 0.0009232641314156353, 0.0006626484682783484, 0.0005710791447199881, 0.0006246754201129079, 0.0008792211883701384, 0.0020895814523100853, 0.0007343988982029259, 0.0010848530801013112, 0.0006739532109349966, 0.0005518110701814294, 0.0006994881550781429, 0.0005537400138564408, 0.000753600150346756, 0.0006774049834348261, 0.000580372114200145, 0.0009820632403716445, 0.012260899879038334, 0.0007208751630969346, 0.0010285773314535618, 0.007024073041975498, 0.74155193567276, 0.0044893245212733746, 0.0019817810971289873, 0.0008376979385502636, 0.0005512656643986702, 0.00059369090013206, 0.0008142401347868145, 0.0044031282886862755, 0.0005667644436471164, 0.0007052845903672278, 0.0007180451648309827, 0.0005993858794681728, 0.0005860315868631005, 0.0005969466874375939, 0.0007532461895607412, 0.0007860317127779126 ]

[ "Category Archives: Hip-Hop\n\nTo celebrate the 20th anniversary of their GRAMMY Award winning song, “Tha Crossroads,” Bone Thugs-N-Harmony are headed across the country for a series of live concerts and meet-and-greet events—including upcoming performances at the PlayStation Theater in Times Square, Manhattan on Feb. 24 and The Emporium in Patchogue, Long Island on Feb. 25.", "\n\nBone Thugs-N-Harmony formed in 1991, but didn’t hit it big until 1993, when “the Godfather of West Coast gangsta rap” and N.W.A. co-founder Eric “Eazy-E” Wright signed five rappers from Cleveland, Ohio—”Krayzie,””Layzie,” “Bizzy,” “Wish” and “Flesh”—to his label, Ruthless Records.", "\n\nAccording to Stanley Howse, a.k.a. ", "Flesh-n-Bone, “Crossroads” was originally written in dedication of Wallace “Wally” Laird III—a departed friend of the group—but after Wright died, in March 1995, they decided to go back and re-record “Tha Crossroads” for their second studio album E. 1999 Eternal.", "\n\n“The record was pushed back around the time Eazy-E started to fall sick,” Howse said. “", "So, right now, there are about three or four different versions out there.”", "\n\nMississippi-born rapper/producer David Banner is on fire right now, and it has got us here at AWM pumped for his forthcoming studio album, The God Box, available May 19, from A Banner Vision.", "\n\nLast year, Banner gave listeners an exclusive sneak peek at his creative process, with the release of his “Before The Box” mixtape. ", "It’s an extremely satisfying glimpse at Banner’s creative process and shows the significant progress he made to shape a different kind of sound than we are used to hearing from the artist who brought us The Greatest Story Ever Told.", "\n\nAlthough Banner’s seventh full-length studio album was originally expected to be released in 2016, delays in the production process led him to hold back the date until May 2017.", "\n\nBrought up in discussions this past week, we phased ourselves with the question: If you were stuck on a deserted island, what would be the one album you would take with you?", "\n\nEasier asked than answered was the revelation found by AWM, but after much thought, four brave writers have voiced their opinions on the one album they would want to have with them if they were deserted on an island.", "\n\nThe Rockaway Riot Squad was created in the early 2000’s, when four up-and-coming young rappers from the same neighborhood in Far Rockaway— Bynoe, Chinx Drugz, Cau2G$ and Stack Bundles — joined forces to create a hip-hop “supergroup.”", "\n\nTragically, in May 2015, Chinx was unexpectedly shot and killed on Queens Boulevard in Ridgewood. ", "He never made it to see the success of his debut album, Welcome To JFK, which debuted at No. ", "2 on Billboard.com’s Top R&B/Hip-Hop album charts.", "\n\nIn an interview with Salute Magazine, last year, the slain rapper’s Executive Producer/Manager Douglas “Biggs” Ellison indicated that Chinx left behind several unreleased demos, which were used to construct the rapper’s second posthumous release, aptly named Legends Never Die.", "\n\nSo, on the first anniversary of the slain rapper’s death, Ellison and 4 Kings Management honored his memory by announcing the release of his sophomore album.", "\n\nHip-hop duo Rae Sremmurd have been keeping busy, following the success of their 2015 debut album SremmLife—which premiered at no. ", "1 on Billboard’s Top Hip-Hop and Rap charts.", "\n\nLast December, Mississippi natives Swae Lee and Slim Jimmi went on the air with radio host Tim Westwood to announce plans for their follow-up SremmLife 2, which they were hoping to release February 2016.", "\n\nFar Rockaway rap artist Donald Bradley, a.k.a. “", "Porche Boxx,” feels his community always gets a bad rap. ", "That’s why he hopes to spread a more positive message to the easternmost part of the peninsula, with his upbeat bars and rhymes.", "\n\nBradley grew up in a difficult situation. ", "Never knowing his father, he was raised by his mother, who inspired him to write. ", "Outside of school, Bradley spent a lot of his time at the Ocean Bay Action Center.", "\n\n“We would play ball to stay out of trouble,” he recalled.", "\n\nThe Wave recently met up with the upand coming rapper, Porche Boxx, at the Queens Public Library on Mott Avenue in Far Rockaway, to talk about his music, community and his love of basketball.", "\n\nFlashback to the early 2000’s, when four up-and-coming rappers from the same community in Far Rockaway, Queens, joined forces as the Hip-Hop “supergroup,” Tha Riot Squad. ", "Rappers Bynoe, Chinx Drugz, Cau2G$ and Stack Bundles grew up in the same neighborhood, attended the same schools and knew a lot of the same people.", "\n\nHowever, in 2007, Stack Bundles was shot and killed by an unknown assailant outside of his apartment building. ", "To this day, investigators have not found any leads on the perpetrator. ", "The following year, when Chinx was released from prison after serving a three-year sentence, members of the Rockaway Riot Squad tried to pick up where they left off.", "\n\nSadly, the 31-year-old recording artist also met with an untimely death on May 17, 2015, when he was shot and killed at the wheel of his Porsche Panamera in Briarwood, Queens – just three months before the release of his debut album, Welcome to JFK.", "\n\nNow, more than a year later, both of the surviving members of the Rockaway Riot Squad will be reuniting on a new track, entitled “All Good,” dedicated to the memory of their fallen comrades.", "\n\nRiot Squad Co-Founder Cau2G$ has worked with such big name artists as Nicki Minaj, Tony Yayo, Kanye West, Joe Budden, and Cory Gunz, and has been featured on several of the Riot Squad’s mixtapes. ", "AMW recently caught up with Cau2G$, outside of his childhood home on Mott Avenue, to talk about new music, living in Far Rockaway and the current trend of violence in Hip-Hop.", "\n\nAlthough 2015 didn’t turn out exactly as director Robert Zemeckis predicted in his hit film Back to the Future Part II, it was still quite an exciting year.", "\n\nSo, we haven’t exactly figured out how to manufacture flying cars or self-adjusting clothing, but we did celebrate 50 years of the Grateful Dead; we witnessed “The Killer” Jerry Lee Lewis embark on his final U.K. Tour; we watched the Foo Fighters perform despite frontman Dave Grohl’s broken leg; we scoffed as presidential candidate Donald Trump fought with artists such as Neil Young, Method Man, and R.E.M.; and laughed at the many different parodies of Drake’s “Hotline Bling” music video.", "\n\nBut, like every year, 2015 had both its “ups” and its “downs.”", "\n\nFollowing the Nov. 13 terrorist attack on a Paris nightclub, which claimed the lives of 89 victims attending an Eagles of Death Metal concert, people all over the world came together in a show of solidarity for the victims and their families." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005788581329397857, 0.0038511320017278194, 0.0007529100403189659, 0.0007207462913356721, 0.0012323245173320174, 0.000651906942948699, 0.004129937384277582, 0.0005431483150459826, 0.0005377269699238241, 0.0005891633336432278, 0.0005288439569994807, 0.0005224508349783719, 0.0014848884893581271, 0.0026831808499991894, 0.000954747200012207, 0.0009272140450775623, 0.0007786701316945255, 0.0005976793472655118, 0.0007381207542493939, 0.001074186060577631, 0.0006319920648820698, 0.0013919364428147674, 0.014154328964650631, 0.0006669043796136975, 0.0017194361425936222, 0.0009787126909941435, 0.0006221525254659355, 0.0015085054328665137, 0.0007163623813539743, 0.001146803260780871, 0.002176878275349736, 0.013477496802806854, 0.0007669543265365064, 0.001009636907838285, 0.005598330870270729, 0.0006976181175559759, 0.0016127473209053278, 0.002058544661849737, 0.0006539134192280471, 0.0006502043106593192, 0.0015704997349530458, 0.0006839284906163812 ]

[ "Incidence and predictors of atrial fibrillation progression: A systematic review and meta-analysis.", "\nMore sustained forms of atrial fibrillation (AF) are less amenable to treatment and associated with worse outcomes, but the incidence and predictors of AF progression are not well defined. ", "The purpose of this study was to perform a systematic review and meta-analysis assessing the incidence and predictors of AF progression. ", "PubMed, EMBASE, and the Cochrane Library were searched from inception to August 2017. ", "AF progression was defined as progression from paroxysmal to persistent/permanent AF or as progression from persistent to permanent AF. ", "Random effect models were used to calculate pooled cumulative incidence rates. ", "Predictors related to between-study variability were assessed using meta-regression analyses. ", "We identified 47 studies with 27,266 patients who were followed for 105,912 patient-years. ", "The pooled incidence of AF progression was 8.1 per 100 patient-years of follow-up (95% confidence interval [CI] 7.1-9.1 per 100 patient-years of follow-up; I2 = 98%; P < .0001). ", "The incidence was 7.1 per 100 patient-years of follow-up (95% CI 6.2-8.0 per 100 patient-years of follow-up; across 42 studies) for progression from paroxysmal to non-paroxysmal AF as compared with 18.6 per 100 patient-years of follow-up (95% CI 8.9-28.3 per 100 patient-years of follow-up; across 5 studies) for progression from persistent to permanent AF. ", "Higher age (β = 5.4; 95% CI 1.4-9.4; P = .01; R2 = 14.3%) and the prevalence of hypertension (β = 5.2; 95% CI 1.0-9.4; P = .02; R2 = 18.0%) were associated with a higher AF progression rate. ", "Follow-up duration (β = -4.5; 95% CI -5.8 to -3.3; P < .0001; R2 = 68.0%) and the prevalence of paroxysmal AF (β = -9.5; 95% CI -18.7 to -0.3; P = .04; R2 = 4.4%) were inversely associated with AF progression. ", "Together these variables explained 73.8% of the observed between-study heterogeneity. ", "The incidence of AF progression appears to be relatively low, and the incidence seems to decrease with longer follow-up duration. ", "Age, hypertension, baseline AF type, and follow-up duration explained a high percentage of the observed between-study heterogeneity." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005665693897753954, 0.0006282511749304831, 0.0005646577337756753, 0.0005846956046298146, 0.0006493187393061817, 0.000606388901360333, 0.0005696377484127879, 0.0005500446422956884, 0.0006144089857116342, 0.0007358890725299716, 0.0007342848693951964, 0.0007021992350928485, 0.0006395851378329098, 0.0006022321176715195, 0.0005696143489331007 ]

[ "Children per room\n\nThis information enables us to identify the rooms that will best accommodate your party and to prepare for your arrival.", "\n\nSee room terms and details for information about rollaway and/or extra person charges.", "\n\nPlease note that at most Starwood hotels, guests 17 and under are considered children. ", "All other guests are considered adults. ", "You will be told of any hotel-specific differences in this policy on the following page.", "\n\nPools and Beach\n\nAmong the resort's signature features is a unique 5,000 square feet infinity designed swimming pool situated on the ocean overlooking beautiful Hanalei Bay. ", "The pool features lush tropical gardens, stunning glass tile and striking water features reflecting Hawai'i's tropical outdoor lifestyle.", "\n\nSt. Regis guests can expect the same award winning food and beverage offers as they receive else where in the resort. ", "Enjoy island fresh cuisine and sophisticated tropical libations at Nalu Kai Grill & Bar. ", "Private Cabanas are also available for daily rental. ", "Pool and Beach service is provide along with complimentary passed fruit spears.", "\n\nWhat makes the St. Regis pool so special is the seamless experience with ocean. ", "The stunning, soft sand beach fronting the incredible waters of Hanalei Bay. ", "Protected by the Anini reef, the waters of the St. Regis remain calm and sheltered year round. ", "These waters provide our guests with amazing snorkeling opportunities without leaving the resort. ", "View our dive and snorkel map.", "\n\nRelax on a complimentary chaise lounge or choose a more exclusive option with our Beach Side Cabanas (fees apply).", "\n\nHours and Amenities\n\nOpen 24 hours\n\nTowel Service\n\nIce Water\n\nFruit Spears\n\nChilled towels\n\nPool Restaurant - Nalu Kai Grill & Bar\n\nBali Hai Sunsets\n\nThere’s no better way to start a tropical evening in paradise than with the amazing Bali Hai sunsets. ", "As the sun goes down there's a true sense of place setting in Princeville." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006963242194615304, 0.0005814836476929486, 0.0008222663891501725, 0.0008279631729237735, 0.000536087085492909, 0.0006164219812490046, 0.0006331725162453949, 0.0005653179832734168, 0.0005703167989850044, 0.0006616277387365699, 0.0006501522148028016, 0.0005955384694971144, 0.0006601850618608296, 0.0005911255138926208, 0.0010136940982192755, 0.0008778378251008689, 0.0008972226642072201, 0.0006499518058262765, 0.0006092370022088289 ]

[ "Another day, another outrageous Donald Trump quote. ", "In the last few months since his campaign announcement has squarely fixed the media spotlight on him, Trump has taken jabs at everyone from John McCain to Megyn Kelly, even Heidi Klum. ", "But he sinks extra low with one target in particular: Hillary Clinton — perhaps because she poses a real threat to his presidential dream (a dream he inadvertently crushes a little every time he opens his mouth). ", "Donald Trump's quotes on Hillary Clinton have ranged from inappropriate to absolutely repugnant, and it's because they're reflective of his view of women in general.", "\n\nClinton has commented on the distasteful nature of Trump's remarks as recently as Aug. 10, but this time she was defending a fellow woman who had the misfortune of being caught in his crosshairs. ", "While speaking to high school students in Exeter, New Hampshire, Clinton addressed Trump's \"blood\" comments about Megyn Kelly, telling the crowd:\n\nWhile what Donald Trump said about Megyn Kelly is outrageous, what the rest of the Republicans are saying about all women is also outrageous.", "\n\nBut Trump's comments about Kelly are hardly the only outrageous things that's ever come out of his mouth (or smartphone), and in fact, he's made quite a few horrendously low remarks about Clinton too, and women in general. ", "Because she's got class — unlike Trump — Clinton's never jabbed back at Trump in response to his taunting, so I'm coming to her defense, just like Clinton did for Kelly.", "\n\nMARK RALSTON/AFP/Getty Images\n\nTrump, your incessant barbs are not witty or insightful or even all that original, but they're maddening all the same. ", "Take, for example, these eight verbal attacks Trump hurled at Clinton and women over the years.", "\n\n\"If Hillary Clinton can't satisfy her husband what makes her think she can satisfy America?\"", "\n\nThis is possibly the lowest Trump has ever gone in a public feud. ", "It was so appalling of a statement that even Trump, the notorious never-backer-downer, backed down and deleted the tweet from his account. ", "Luckily, others had already screen grabbed it so they can continue to use it to illustrate his sliminess.", "\n\n\"I have really given a lot of women great opportunity. ", "Unfortunately, after they are a star, the fun is over for me.\"", "\n\nMANDEL NGAN/AFP/Getty Images\n\nApparently, women are only \"fun\" when he can treat them like playthings that he can dress up and put on pedestals, but not if when have their own agency. ", "At least that's what he suggested to ABC’s Primetime Live in 1994.", "\n\n\"You know, it really doesn’t matter what the media write as long as you've got a young and beautiful piece of ass.\"", "\n\nDave Kotinsky/Getty Images Entertainment/Getty Images\n\nIn a 1991 Esquire interview, Trump oozed sexist pig, but a sexist pig with thick skin!", "\n\n\"So assuming [Clinton's] able to run — which would be absolutely, to me, a miracle at this point — I will beat her.\"", "\n\nWin McNamee/Getty Images News/Getty Images\n\nWhen discussing Clinton's email controversy with NBC News, Trump compared her to General David Petraeus, arguing that what she did was much worse and pointing out what happened to his career:\n\nGeneral Petraeus, his life has been destroyed. ", "And he did 5 percent of what she did.", "\n\n\"There's nothing I love more than women, but they're really a lot different than portrayed. ", "They are far worse than men, far more aggressive.\"", "\n\nJamie Squire/Getty Images Sport/Getty Images\n\nTo Trump, women are also two-faced schemers, as he said in his 1997 book, The Art of the Comeback.", "\n\n\"Hillary Clinton, I said be at my wedding, and she came to my wedding. ", "She had no choice because I gave to a foundation.\"", "\n\nMARK RALSTON/AFP/Getty Images\n\nTrump made this swipe during the Republican debate, which Clinton did address, but did so in a manner so cool, she was literally rubber and he was glue. ", "At the high school visit in Exeter, Clinton explained that she happened to be in town during Trump's wedding and \"thought it would be fun.\" ", "I mean, to be honest, who wouldn't want to witness a Trump wedding? ", "Just think of all the fancy hors d'oeuvres!", "\n\n\"When a man leaves a woman, especially when it was perceived that he has left for a piece of ass — a good one! — ", "there are 50 percent of the population who will love the woman who was left.\"", "\n\nMike Ehrmann/Getty Images Sport/Getty Images\n\nIn a 1990 interview with Vanity Fair, Trump sounded more like a frat boy than a presidential candidate when he commented on public sympathy for women whose husbands leave them.", "\n\n\"[Women:] You have to treat 'em like shit.\"", "\n\nDavid Becker/Getty Images News/Getty Images\n\nAnd then there was this nugget, which he dropped to New York Magazine in 1992.", "\n\nNow, ladies — and gentlemen — can you seriously see this man as your president? ", "I hope that answer is a loud, resounding \"no.\"" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0009482052410021424, 0.0008168151252903044, 0.005981015972793102, 0.0015024830354377627, 0.0008232060354202986, 0.004812323488295078, 0.009742009453475475, 0.00670155743137002, 0.3749420940876007, 0.0007340763695538044, 0.0009353902423754334, 0.02821330726146698, 0.05316504091024399, 0.02895837090909481, 0.007294430397450924, 0.0009931973181664944, 0.02425578609108925, 0.0005903015262447298, 0.9227403998374939, 0.9252426624298096, 0.016346996650099754, 0.0007319123251363635, 0.001903711468912661, 0.005458484869450331, 0.03922506794333458, 0.0017352162394672632, 0.0008126786560751498, 0.000670901732519269, 0.008827540092170238, 0.0005424160626716912, 0.000795622996520251, 0.019849592819809914, 0.8862221837043762, 0.0013844643253833055, 0.004602862522006035, 0.9758538007736206, 0.17724008858203888, 0.0007362316828221083, 0.004939293023198843 ]

[ "Population pharmacokinetic model for adherence evaluation using lamivudine concentration monitoring.", "\nInterpretation of antiretroviral drug concentration measurements could be aided by information about adherence to recent doses. ", "We developed a population pharmacokinetic model of lamivudine in young children to propose reference lamivudine concentrations for evaluation of adherence to recent treatment doses. ", "The steady state pharmacokinetics of lamivudine were evaluated in 68 young HIV-infected children receiving antiretroviral treatment twice daily. ", "A population pharmacokinetic analysis was conducted using NONMEM 7. ", "A 2-compartment model with transit absorption best described lamivudine pharmacokinetics. ", "After adjustment for maturation and body weight (using allometric scaling), the variability of clearance was small, hence simulations could accurately predict lamivudine concentrations. ", "Higher lamivudine trough concentrations were detected before the morning dose, possibly owing to slower overnight clearance. ", "Reference values for lamivudine concentrations that can be used to evaluate adherence to recent doses are proposed. ", "Lamivudine concentration measurement can be used to assess recent treatment adherence." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0013506789691746235, 0.0005363387754186988, 0.000773030158597976, 0.004819199442863464, 0.001524218823760748, 0.0012143960921093822, 0.0005929885082878172, 0.0007003676146268845, 0.0005352862062864006, 0.0005785481771454215 ]

[ "John Fownes (junior)\n\nJohn Fownes (c. 1687–1733) of Nethway and Kittery Court, near Dartmouth, was a British politician who sat in the House of Commons from 1715 to 1722.", "\n\nFownes was the eldest son of John Fownes of Nethway and his wife Anne Yarde, daughter. ", "of Edward Yarde, MP of Churston Ferrers, Devon. ", "He matriculated at Hart Hall, Oxford on 10 October 1702, aged 15. ", "He married, Elizabeth Berry, daughter of Robert Berry of Plymouth on 24 January1709. ", "She died on 23 January 1719 and he married secondly Anne Maddock, daughter of Samuel Maddock of Tamerton Folliot, near Plymouth, Devon on 9 May 1720.", "\n\nFownes was returned as Tory Member of Parliament for Dartmouth at the 1715 general election. ", "There is only one record of his voting, which was against the septennial bill. ", " He did not stand in 1722.", "\n\nFownes succeeded to the estates of his father in 1731 and died two years later on 1 October 1733. ", "He had a son and three daughters by his first wife and three sons by his second wife. ", "His son, Henry, born 1722, married Margaret Luttrell the daughter and heir of Alexander Luttrell.", "\n\nReferences\n\nCategory:1680s births\nCategory:1733 deaths\nCategory:Members of the Parliament of Great Britain for constituencies in Devon\nCategory:British MPs 1715–1722" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.00115535210352391, 0.0020592522341758013, 0.0008507107268087566, 0.0007155330968089402, 0.0009898814605548978, 0.0016405765200033784, 0.0011888319859281182, 0.0006025083130225539, 0.0013003261992707849, 0.0014793066075071692, 0.001335805980488658, 0.0011084661819040775, 0.0005665826611220837 ]

[ "Self-organized nanopatterning of polycarbonate surfaces by argon ion sputtering.", "\nPolycarbonate surfaces were sputtered using 40 keV Ar+ ions at off normal incidence of 30° with ion fluences ranging from 1 × 1016 Ar+ cm-2 to 5 × 1016 Ar+ cm-2. ", "Surface topography along with structural modification has been studied using atomic force microscope (AFM) and Raman spectroscopy. ", "Substantial smoothing of polymeric surfaces along with evolution of some random dot like nano structures after ion irradiation has been revealed. ", "Average size of dots varied from 34 to 95 nm while density of dots varied from 0.17 to 14.7 × 107 dots cm-2 for various ion fluences. ", "Power spectral density spectrum has been obtained from fast Fourier analysis of respective AFM images to get the information about underlying mechanism of sputtering induced nano structuring and smoothing of polymeric surfaces. ", "AFM results have been well correlated with the disordering parameters calculated from the deconvoluted Raman spectra. ", "These nanopatterned substrates are useful in a wide range of important applications, for example, in bioengineering, binary optics, making organic thin-film transistors and light-emitting diodes." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0009063010802492499, 0.0007480421918444335, 0.0005475108628161252, 0.0005983542068861425, 0.0005768910050392151, 0.0005825120606459677, 0.0006078768637962639, 0.0006117566954344511 ]

[ "Natural Resources Minister Greg Rickford answers a question during Question Period in the House of Commons in Ottawa on Thursday, Feb. 26, 2015. ", "Rickford has lobbied oil and gas executives to help advance the Keystone XL pipeline project.", "\n\nAdrian Wyld/THE CANADIAN PRESS" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005824399413540959, 0.0005745876114815474, 0.0007272116490639746 ]

[ "Don Willesee\n\nDonald Robert Willesee (14 April 19169 September 2003) was an Australian politician, a member of the Australian Senate for 25 years representing Western Australia, and a Cabinet minister in the Whitlam government.", "\n\nEarly life\nWillesee was born in Derby, Western Australia, to Ethel May (née Flinders) and William Robert Willesee, who were originally from South Australia. ", "His older brother, Bill Willesee, was a state parliamentarian. ", "Willesee was educated at state and convent schools at Carnarvon in the same state. ", " He left school at 14 (his father and brother had lost their jobs during the Great Depression), to work as a postal clerk in Carnarvon, and immediately joined the Australian Union of Postal Clerks and Telegraphists. ", "He eventually became state secretary of this organisation. ", " He later worked as a telegraphist in Perth. ", " In 1940 he married Gwendoline Clarke.", "\n\nPolitical career\nWillesee joined the Australian Labor Party when he was 21 and was elected as a senator for Western Australia in 1950 at the age of 33, taking office as the Senate's youngest member. ", " He worked with Whitlam to reform the Labor Party prior to the 1972 election. ", " According to Kim Beazley he was a \"... key assistant to Gough Whitlam as he set about the task of restructuring the Labor Party ... and made an intelligent, brilliant rabble fit for government.\"", "\n\nFollowing the 1972 election, Willesee was appointed as Special Minister of State, Vice-President of the Executive Council, Minister assisting the Prime Minister and Minister assisting the Minister for Foreign Affairs in the second Whitlam Ministry (which followed the \"two-man Ministry\" from 5 December to 19 December 1972). ", "As Special Minister of State he endorsed the establishment of a computerised library information system to connect national, state and university libraries, which has continued to evolve.", "\n\nWhitlam relinquished the position of Minister for Foreign Affairs to him on 30 November 1973 and in this period he had the major responsibility of implementing the Whitlam government's, ambitious new foreign policy directions, which included improving relations with Asia. ", "For Willesee, this meant Australia taking a more pragmatic approach to international affairs; in a speech to the Australian Institute of International Affairs in June 1974 he declared: \"the first duty of Government is to recognise and comprehend the world as it actually is, not as we might conceive or wish it to be. ", "That is a cardinal principle of the way this Government has approached foreign policy. ", "Australia, if it is to serve national interests in an effective manner, can no longer afford to impose on international events interpretations at variance with the facts.\"", "\n\nThis approach translated into action in various ways, on 26 February 1973, Willesee led the push to recognise the Democratic Republic of Vietnam, and directed the establishment of the Australian Embassy in Hanoi in July 1973. ", "A new Embassy in East Berlin was also established in East Germany in March 1975 following recognition of the GDR in 1973, as well as a new Embassy in Pyongyang, North Korea on 30 April 1975.", "\n\nWillesee was opposed to Indonesia's invasion of East Timor and is quoted as having said in 1975: He did not stand for re-election at the 1975 double dissolution election.", "\n\nDeath\nWillesee died in Joondalup Hospital, Joondalup, two weeks after a heart attack, survived by his wife Gwen, and their six children, Colleen, Mike, Terry, Geraldine, Don junior and Peter. ", "Through Terry, he was the biological paternal grandfather of author and cyclist Janet Shaw. ", "He was the last surviving member of the 1950-1955 Senate.", "\n\nAt his death, the Prime Minister said:\n\nAccording to the leader of the opposition at the time,\n\nNotes\n\n \n\nCategory:1916 births\nCategory:2003 deaths\nCategory:1975 Australian constitutional crisis\nCategory:Australian Labor Party members of the Parliament of Australia\nCategory:Australian ministers for Foreign Affairs\nCategory:Members of the Cabinet of Australia\nCategory:Members of the Australian Senate for Western Australia\nCategory:Members of the Australian Senate\nCategory:People from Derby, Western Australia\nCategory:20th-century Australian politicians\nCategory:Former government ministers of Australia" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0010596435749903321, 0.0009097981383092701, 0.0009291427559219301, 0.0006517516449093819, 0.0019466737285256386, 0.0006659390055574477, 0.0007119338260963559, 0.0012075682170689106, 0.0008123739389702678, 0.0008287046803161502, 0.0011437502689659595, 0.0007124198600649834, 0.000614173652138561, 0.0006320709362626076, 0.000662808830384165, 0.0006767133018001914, 0.0006009243079461157, 0.0006050945376046002, 0.0005895874346606433, 0.0009348374442197382, 0.006657537538558245, 0.0007504280074499547, 0.0007468953845091164, 0.0006401363061740994 ]

[ "Q:\n\nhow i can get started with MEAN stack?", "\n\ni'm trying to get started with Mean stack and i visited the website http://www.mean.io/, and in the section \"quick install\" displays some command,\nwhere i have to put these commands?", "\nThere is a tutorial to get started with mean stack step by step?", "\n\nA:\n\nFirst step is to install node.js to your machine.", "\nThen use npm to install the dependencies. ", "You can find many tutorials on how to get started with MEAN stack.", "\nCheck this \n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000725017802324146, 0.0005557479453273118, 0.0007393886335194111, 0.001376377185806632, 0.0006220624200068414, 0.0005981586291454732, 0.0011516305385157466 ]

[ "I haven’t posted in a while. ", "I have 7 MOCs to upload here. ", "Stay tuned." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006293263286352158, 0.001116134924814105, 0.0006882203742861748 ]

[ "1. ", "Field of the Invention\nThe present invention relates to target tracking, and more particularly, to a target tracking method for configuring augmented reality.", "\n2. ", "Description of the Related Art\nA conventional target tracking method may detect an image estimated as a target from a photographed image, per frame of the photographed image, and may track the detected image only after the detection is completed. ", "Since an amount of time used for detection is relatively long compared to an amount of time used for tracking, the conventional target tracking method has caused many processing delays. ", "The above problem is further worsened since the time used for the detection itself becomes even more prolonged as data of the photographed image increases." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391896310262382, 0.0005819199723191559, 0.0011855863267555833, 0.0005635627894662321, 0.0005551272188313305, 0.0006602228386327624 ]

[ "Gelinsini, Merzifon\n\nGelinsini is a village in the District of Merzifon, Amasya Province, Turkey.", "\n\nReferences\n\nCategory:Populated places in Amasya Province\nCategory:Merzifon District\nCategory:Villages in Turkey" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0016681983834132552, 0.000601050618570298 ]

[ "// cgo -godefs types_openbsd.go | go run mkpost.go\n// Code generated by the command above; see README.md. ", "DO NOT EDIT.", "\n\n// +build amd64,openbsd\n\npackage unix\n\nconst (\n\tSizeofPtr = 0x8\n\tSizeofShort = 0x2\n\tSizeofInt = 0x4\n\tSizeofLong = 0x8\n\tSizeofLongLong = 0x8\n)\n\ntype (\n\t_C_short int16\n\t_C_int int32\n\t_C_long int64\n\t_C_long_long int64\n)\n\ntype Timespec struct {\n\tSec int64\n\tNsec int64\n}\n\ntype Timeval struct {\n\tSec int64\n\tUsec int64\n}\n\ntype Rusage struct {\n\tUtime Timeval\n\tStime Timeval\n\tMaxrss int64\n\tIxrss int64\n\tIdrss int64\n\tIsrss int64\n\tMinflt int64\n\tMajflt int64\n\tNswap int64\n\tInblock int64\n\tOublock int64\n\tMsgsnd int64\n\tMsgrcv int64\n\tNsignals int64\n\tNvcsw int64\n\tNivcsw int64\n}\n\ntype Rlimit struct {\n\tCur uint64\n\tMax uint64\n}\n\ntype _Gid_t uint32\n\ntype Stat_t struct {\n\tMode uint32\n\tDev int32\n\tIno uint64\n\tNlink uint32\n\tUid uint32\n\tGid uint32\n\tRdev int32\n\tAtim Timespec\n\tMtim Timespec\n\tCtim Timespec\n\tSize int64\n\tBlocks int64\n\tBlksize int32\n\tFlags uint32\n\tGen uint32\n\t_ [4]byte\n\t_ Timespec\n}\n\ntype Statfs_t struct {\n\tF_flags uint32\n\tF_bsize uint32\n\tF_iosize uint32\n\t_ [4]byte\n\tF_blocks uint64\n\tF_bfree uint64\n\tF_bavail int64\n\tF_files uint64\n\tF_ffree uint64\n\tF_favail int64\n\tF_syncwrites uint64\n\tF_syncreads uint64\n\tF_asyncwrites uint64\n\tF_asyncreads uint64\n\tF_fsid Fsid\n\tF_namemax uint32\n\tF_owner uint32\n\tF_ctime uint64\n\tF_fstypename [16]int8\n\tF_mntonname [90]int8\n\tF_mntfromname [90]int8\n\tF_mntfromspec [90]int8\n\t_ [2]byte\n\tMount_info [160]byte\n}\n\ntype Flock_t struct {\n\tStart int64\n\tLen int64\n\tPid int32\n\tType int16\n\tWhence int16\n}\n\ntype Dirent struct {\n\tFileno uint64\n\tOff int64\n\tReclen uint16\n\tType uint8\n\tNamlen uint8\n\t_ [4]uint8\n\tName [256]int8\n}\n\ntype Fsid struct {\n\tVal [2]int32\n}\n\nconst (\n\tPathMax = 0x400\n)\n\ntype RawSockaddrInet4 struct {\n\tLen uint8\n\tFamily uint8\n\tPort uint16\n\tAddr [4]byte /* in_addr */\n\tZero [8]int8\n}\n\ntype RawSockaddrInet6 struct {\n\tLen uint8\n\tFamily uint8\n\tPort uint16\n\tFlowinfo uint32\n\tAddr [16]byte /* in6_addr */\n\tScope_id uint32\n}\n\ntype RawSockaddrUnix struct {\n\tLen uint8\n\tFamily uint8\n\tPath [104]int8\n}\n\ntype RawSockaddrDatalink struct {\n\tLen uint8\n\tFamily uint8\n\tIndex uint16\n\tType uint8\n\tNlen uint8\n\tAlen uint8\n\tSlen uint8\n\tData [24]int8\n}\n\ntype RawSockaddr struct {\n\tLen uint8\n\tFamily uint8\n\tData [14]int8\n}\n\ntype RawSockaddrAny struct {\n\tAddr RawSockaddr\n\tPad [92]int8\n}\n\ntype _Socklen uint32\n\ntype Linger struct {\n\tOnoff int32\n\tLinger int32\n}\n\ntype Iovec struct {\n\tBase *byte\n\tLen uint64\n}\n\ntype IPMreq struct {\n\tMultiaddr [4]byte /* in_addr */\n\tInterface [4]byte /* in_addr */\n}\n\ntype IPv6Mreq struct {\n\tMultiaddr [16]byte /* in6_addr */\n\tInterface uint32\n}\n\ntype Msghdr struct {\n\tName *byte\n\tNamelen uint32\n\t_ [4]byte\n\tIov *Iovec\n\tIovlen uint32\n\t_ [4]byte\n\tControl *byte\n\tControllen uint32\n\tFlags int32\n}\n\ntype Cmsghdr struct {\n\tLen uint32\n\tLevel int32\n\tType int32\n}\n\ntype Inet6Pktinfo struct {\n\tAddr [16]byte /* in6_addr */\n\tIfindex uint32\n}\n\ntype IPv6MTUInfo struct {\n\tAddr RawSockaddrInet6\n\tMtu uint32\n}\n\ntype ICMPv6Filter struct {\n\tFilt [8]uint32\n}\n\nconst (\n\tSizeofSockaddrInet4 = 0x10\n\tSizeofSockaddrInet6 = 0x1c\n\tSizeofSockaddrAny = 0x6c\n\tSizeofSockaddrUnix = 0x6a\n\tSizeofSockaddrDatalink = 0x20\n\tSizeofLinger = 0x8\n\tSizeofIPMreq = 0x8\n\tSizeofIPv6Mreq = 0x14\n\tSizeofMsghdr = 0x30\n\tSizeofCmsghdr = 0xc\n\tSizeofInet6Pktinfo = 0x14\n\tSizeofIPv6MTUInfo = 0x20\n\tSizeofICMPv6Filter = 0x20\n)\n\nconst (\n\tPTRACE_TRACEME = 0x0\n\tPTRACE_CONT = 0x7\n\tPTRACE_KILL = 0x8\n)\n\ntype Kevent_t struct {\n\tIdent uint64\n\tFilter int16\n\tFlags uint16\n\tFflags uint32\n\tData int64\n\tUdata *byte\n}\n\ntype FdSet struct {\n\tBits [32]uint32\n}\n\nconst (\n\tSizeofIfMsghdr = 0xa8\n\tSizeofIfData = 0x90\n\tSizeofIfaMsghdr = 0x18\n\tSizeofIfAnnounceMsghdr = 0x1a\n\tSizeofRtMsghdr = 0x60\n\tSizeofRtMetrics = 0x38\n)\n\ntype IfMsghdr struct {\n\tMsglen uint16\n\tVersion uint8\n\tType uint8\n\tHdrlen uint16\n\tIndex uint16\n\tTableid uint16\n\tPad1 uint8\n\tPad2 uint8\n\tAddrs int32\n\tFlags int32\n\tXflags int32\n\tData IfData\n}\n\ntype IfData struct {\n\tType uint8\n\tAddrlen uint8\n\tHdrlen uint8\n\tLink_state uint8\n\tMtu uint32\n\tMetric uint32\n\tRdomain uint32\n\tBaudrate uint64\n\tIpackets uint64\n\tIerrors uint64\n\tOpackets uint64\n\tOerrors uint64\n\tCollisions uint64\n\tIbytes uint64\n\tObytes uint64\n\tImcasts uint64\n\tOmcasts uint64\n\tIqdrops uint64\n\tOqdrops uint64\n\tNoproto uint64\n\tCapabilities uint32\n\t_ [4]byte\n\tLastchange Timeval\n}\n\ntype IfaMsghdr struct {\n\tMsglen uint16\n\tVersion uint8\n\tType uint8\n\tHdrlen uint16\n\tIndex uint16\n\tTableid uint16\n\tPad1 uint8\n\tPad2 uint8\n\tAddrs int32\n\tFlags int32\n\tMetric int32\n}\n\ntype IfAnnounceMsghdr struct {\n\tMsglen uint16\n\tVersion uint8\n\tType uint8\n\tHdrlen uint16\n\tIndex uint16\n\tWhat uint16\n\tName [16]int8\n}\n\ntype RtMsghdr struct {\n\tMsglen uint16\n\tVersion uint8\n\tType uint8\n\tHdrlen uint16\n\tIndex uint16\n\tTableid uint16\n\tPriority uint8\n\tMpls uint8\n\tAddrs int32\n\tFlags int32\n\tFmask int32\n\tPid int32\n\tSeq int32\n\tErrno int32\n\tInits uint32\n\tRmx RtMetrics\n}\n\ntype RtMetrics struct {\n\tPksent uint64\n\tExpire int64\n\tLocks uint32\n\tMtu uint32\n\tRefcnt uint32\n\tHopcount uint32\n\tRecvpipe uint32\n\tSendpipe uint32\n\tSsthresh uint32\n\tRtt uint32\n\tRttvar uint32\n\tPad uint32\n}\n\ntype Mclpool struct{}\n\nconst (\n\tSizeofBpfVersion = 0x4\n\tSizeofBpfStat = 0x8\n\tSizeofBpfProgram = 0x10\n\tSizeofBpfInsn = 0x8\n\tSizeofBpfHdr = 0x14\n)\n\ntype BpfVersion struct {\n\tMajor uint16\n\tMinor uint16\n}\n\ntype BpfStat struct {\n\tRecv uint32\n\tDrop uint32\n}\n\ntype BpfProgram struct {\n\tLen uint32\n\t_ [4]byte\n\tInsns *BpfInsn\n}\n\ntype BpfInsn struct {\n\tCode uint16\n\tJt uint8\n\tJf uint8\n\tK uint32\n}\n\ntype BpfHdr struct {\n\tTstamp BpfTimeval\n\tCaplen uint32\n\tDatalen uint32\n\tHdrlen uint16\n\t_ [2]byte\n}\n\ntype BpfTimeval struct {\n\tSec uint32\n\tUsec uint32\n}\n\ntype Termios struct {\n\tIflag uint32\n\tOflag uint32\n\tCflag uint32\n\tLflag uint32\n\tCc [20]uint8\n\tIspeed int32\n\tOspeed int32\n}\n\ntype Winsize struct {\n\tRow uint16\n\tCol uint16\n\tXpixel uint16\n\tYpixel uint16\n}\n\nconst (\n\tAT_FDCWD = -0x64\n\tAT_SYMLINK_FOLLOW = 0x4\n\tAT_SYMLINK_NOFOLLOW = 0x2\n)\n\ntype PollFd struct {\n\tFd int32\n\tEvents int16\n\tRevents int16\n}\n\nconst (\n\tPOLLERR = 0x8\n\tPOLLHUP = 0x10\n\tPOLLIN = 0x1\n\tPOLLNVAL = 0x20\n\tPOLLOUT = 0x4\n\tPOLLPRI = 0x2\n\tPOLLRDBAND = 0x80\n\tPOLLRDNORM = 0x40\n\tPOLLWRBAND = 0x100\n\tPOLLWRNORM = 0x4\n)\n\ntype Sigset_t uint32\n\ntype Utsname struct {\n\tSysname [256]byte\n\tNodename [256]byte\n\tRelease [256]byte\n\tVersion [256]byte\n\tMachine [256]byte\n}\n\nconst SizeofUvmexp = 0x158\n\ntype Uvmexp struct {\n\tPagesize int32\n\tPagemask int32\n\tPageshift int32\n\tNpages int32\n\tFree int32\n\tActive int32\n\tInactive int32\n\tPaging int32\n\tWired int32\n\tZeropages int32\n\tReserve_pagedaemon int32\n\tReserve_kernel int32\n\tAnonpages int32\n\tVnodepages int32\n\tVtextpages int32\n\tFreemin int32\n\tFreetarg int32\n\tInactarg int32\n\tWiredmax int32\n\tAnonmin int32\n\tVtextmin int32\n\tVnodemin int32\n\tAnonminpct int32\n\tVtextminpct int32\n\tVnodeminpct int32\n\tNswapdev int32\n\tSwpages int32\n\tSwpginuse int32\n\tSwpgonly int32\n\tNswget int32\n\tNanon int32\n\tNanonneeded int32\n\tNfreeanon int32\n\tFaults int32\n\tTraps int32\n\tIntrs int32\n\tSwtch int32\n\tSofts int32\n\tSyscalls int32\n\tPageins int32\n\tObsolete_swapins int32\n\tObsolete_swapouts int32\n\tPgswapin int32\n\tPgswapout int32\n\tForks int32\n\tForks_ppwait int32\n\tForks_sharevm int32\n\tPga_zerohit int32\n\tPga_zeromiss int32\n\tZeroaborts int32\n\tFltnoram int32\n\tFltnoanon int32\n\tFltnoamap int32\n\tFltpgwait int32\n\tFltpgrele int32\n\tFltrelck int32\n\tFltrelckok int32\n\tFltanget int32\n\tFltanretry int32\n\tFltamcopy int32\n\tFltnamap int32\n\tFltnomap int32\n\tFltlget int32\n\tFltget int32\n\tFlt_anon int32\n\tFlt_acow int32\n\tFlt_obj int32\n\tFlt_prcopy int32\n\tFlt_przero int32\n\tPdwoke int32\n\tPdrevs int32\n\tPdswout int32\n\tPdfreed int32\n\tPdscans int32\n\tPdanscan int32\n\tPdobscan int32\n\tPdreact int32\n\tPdbusy int32\n\tPdpageouts int32\n\tPdpending int32\n\tPddeact int32\n\tPdreanon int32\n\tPdrevnode int32\n\tPdrevtext int32\n\tFpswtch int32\n\tKmapent int32\n}\n\nconst SizeofClockinfo = 0x14\n\ntype Clockinfo struct {\n\tHz int32\n\tTick int32\n\tTickadj int32\n\tStathz int32\n\tProfhz int32\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0013304891763255, 0.00201672175899148, 0.013924733735620975 ]

[ "Watch Tonight's Debate On WMUR And WMUR.com\n\nWMUR and ABC News will be teaming up for a prime-time debate this Saturday before the New Hampshire Primary.", "\n\nClick Here To Watch Live\n\nThe debate will take place at 9 p.m. on Jan. 7 on the campus of St. Anselm College. ", "It will be moderated by ABC's Diane Sawyer and George Stephanopoulos and WMUR's Josh McElveen.", "\n\nDebate crews are getting the center ready to take center stage. ", "Light rigger Walter Webber is helping out with the spotlight.", "\n\n\"I go up in the light and I focus in on all the candidates and everything,\" Webber said.", "\n\nSt. Anselm students, meanwhile, stood in for the candidates during debate practice.", "\n\nThe students impressed the stage manager on loan from ?", "Good Morning America.?", "\n\n\"Everything's going incredibly smooth. ", "The stand-ins we have from this school are so intelligent. ", "They're asking questions that we couldn't even think of, kind of. (", "They) installed our faith in the future generation,\" stage manager Scott Kaye said.", "\n\nStephanopoulos told News 9 he expects some fireworks.", "\n\n\"We think it's our job to make sure that the differences between and among the candidates are exposed and really hashed out before the voters of N.H., so they can make up their minds and make their decisions, fully informed decisions by Tuesday, and my sense is the candidates are not going to be shy about that,? ", "Stephanopoulos said.", "\n\nThe debate will be broadcast on WMUR and across the nation on ABC.", "\n\nWMUR.com will livestream the debate and provide live updates throughout the night." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006328385788947344, 0.0006038972642272711, 0.0006540975882671773, 0.0005994604434818029, 0.0008815989713184536, 0.0006958034937269986, 0.0006060560699552298, 0.0006057274877093732, 0.0006432179943658412, 0.0005734045407734811, 0.0035241448786109686, 0.0006922117318026721, 0.000596650002989918, 0.0007794745615683496, 0.00059539545327425, 0.0008256394066847861, 0.0006670483271591365, 0.0006366106681525707 ]

[ "Q:\n\nHow to pass std::string value to RegSetValueEx() in C++\n\nI am writing a program to edit the windows registry key by C++, but when I try to pass a string value to library function RegSetValueEx(), there is a file start with TEXT() which could only be hardcode value in it.", "\nParts of my code:\nstring region;\nstring excelserver_type;\nstring keyname = region + excelserver_type;\n\nif (RegSetValueEx(key64, TEXT(\"XXXXXXXXX\"), 0, REG_SZ, (LPBYTE)TEXT(\"XXXXXXXXXX\"), 100) !", "= ERROR_SUCCESS)\n\n{\n RegCloseKey(key);\n cout << \"Unable to set registry value in HKEY_LOCAL_MACHINE\\\\Software\" << endl;\n }\n\nWhen I try to replace \"XXXXXXXX\" by keyname, it gives me an error. ", "How do I pass value of keyname in RegSetValueEx()?", "\n\nA:\n\nYou need to use the std::wstring type instead. ", "This will give you a wide (Unicode) string, based on the wchar_t type, which is how Windows stores strings internally.", "\nThen, you can simply use the c_str() member function to retrieve a pointer to a C-style string, and pass this directly to the RegSetValueEx function. ", "The size() member function gives you the length of the string, which you can pass as the cbData parameter, except for two caveats:\n\ncbData expects the length of the string to include the terminating NUL character, so you will need to add 1 to the length returned by size().", "\ncbData expects the size of the string in bytes, not the number of characters, so for a wide string, you will need to multiply the value returned by size() by the length of a wchar_t.", "\n\nbool SetStringValue(HKEY hRegistryKey,\n const std::wstring& valueName,\n const std::wstring& data)\n{\n assert(hRegistryKey !", "= nullptr);\n\n return (RegSetValueExW(hRegistryKey,\n valueName.c_str(),\n 0,\n REG_SZ,\n (LPBYTE)(data.c_str()),\n (data.size() + 1) * sizeof(wchar_t)) == ERROR_SUCCESS);\n}\n\nIf you absolutely have to use narrow (ANSI) strings (and you shouldn't, because you're interfacing directly with the operating system here, not working with user data), you can do the same thing but explicitly call the ANSI version of RegSetValueEx, which has an A suffix. ", "Here, you still need to add 1 to the length, but the size in bytes is equivalent to the number of characters, so no scaling is necessary.", "\nbool SetStringValue_ANSI(HKEY hRegistryKey,\n const std::string& valueName,\n const std::string& data)\n{\n assert(hRegistryKey !", "= nullptr);\n\n return (RegSetValueExA(hRegistryKey,\n valueName.c_str(),\n 0,\n REG_SZ,\n (LPBYTE)(data.c_str()),\n data.size() + 1) == ERROR_SUCCESS);\n}\n\nInternally, RegSetValueExA will convert the string to Unicode and then perform the same task as RegSetValueExW.\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006997124874033034, 0.0007515355246141553, 0.001136764301918447, 0.0007065816316753626, 0.0007927751285023987, 0.0006989540415816009, 0.0007666441379114985, 0.000610769318882376, 0.0006678695790469646, 0.0026349162217229605, 0.0015352271730080247, 0.0006369291804730892, 0.0023305779322981834, 0.002770490013062954 ]

[ "Purification and properties of a chitinase from Penicillium sp. ", "LYG 0704.", "\nThe chitinase producing Penicillium sp. ", "LYG 0704 was procured from soil of the Chonnam National University crop field. ", "The chitinase activity was detected after the first day which increased gradually and reached its maximum after 3 days of cultivation. ", "The chitinase was purified from a culture medium by precipitation with isopropanol and column chromatography with Mono Q and Butyl-Sepharose. ", "The molecular mass of chitinase was estimated to be 47 kDa by SDS-PAGE. ", "Optimal pH and temperature were 5.0 and 40 degrees C, respectively. ", "The N-terminal amino acid sequence of the enzyme was determined to be (1)AGSYRSVAYFVDWAI(15). ", "The fully cloned gene, 1287 bp in size, encoded a single peptide of 429 amino acids. ", "BLAST search of the chitinase gene sequence showed similarity with chitinase of Aspergillus fumigatus Af293 chitinase gene (58%) and A. fumigatus class V chitinase ChiB1 gene (56%)." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0012997566955164075, 0.0013395112473517656, 0.01774151623249054, 0.0006147132371552289, 0.0006414191448129714, 0.001065411721356213, 0.0007212973432615399, 0.0005947307217866182, 0.0007067372207529843, 0.0005929266335442662, 0.001113502774387598 ]

[ "Q:\n\nGenerating function of recursive algorithm with random subcalls\n\nI was presented with the following algorithm. ", "As input the algorithm gets an array of length $n \\geq 0$. If $n \\geq 2$ then for each $k \\in \\{1, 2, ..., n\\}$ the algorithm calls itself recursively with the probability $\\frac{1}{2}$ with the array of length $k$. Using generating functions I have to get to the formula which estimates the average number of calls depending on $n$. I have checked analysis of QuickSort algorithm that was performed in similar terms. ", "My proposition for recursive equation, regarding my problem, is as follows: $q_n = 1 + \\frac{1}{2}\\sum_{k=1}^nq_k$.\nIs proposed recursive equation correct (will it estimate the number of calls correctly)? ", "If so, then how, using generating functions, can I get the closed-form expression for the $q_n$?", "\n\nA:\n\nThe recurrence $q_n=1+\\frac12\\sum_{k=1}^nq_k$ for $n\\ge 2$ appears to be correct, and you have the initial conditions $q_0=0$ and $q_1=1$. I would modify the recurrence slightly to make it correct for all $n\\ge 0$ on the assumption that $q_n=0$ for all $n<0$:\n$$q_n=1+\\frac12\\sum_{k=1}^nq_k-[n=0]-\\frac12[n-1]\\;,\\tag{1}$$\nwhere the square brackets are Iverson brackets, and we can include $k=0$ because $q_k=0$. Now multiply $(1)$ by $x^n$ and sum over $n\\ge 0$:\n$$\\sum_{n\\ge 0}q_nx^n=\\sum_{n\\ge 0}x^n+\\frac12\\sum_{n\\ge 0}\\left(\\sum_{k=0}^nq_i\\right)x^n-1-\\frac{x}2\\;.\\tag{2}$$\nThe lefthand side of $(2)$ is the desired generating function, say $g(x)$, so we have\n$$\\begin{align*}\ng(x)&=\\frac1{1-x}-1-\\frac{x}2+\\frac12\\sum_{n\\ge 0}\\left(\\sum_{k=0}^nq_i\\right)x^n\\\\\n&=\\frac12\\left(\\frac{x+x^2}{1-x}+\\sum_{n\\ge 0}\\left(\\sum_{k=0}^nq_i\\right)x^n\\right)\\;.", "\n\\end{align*}$$\nNow recognize $\\sum_{n\\ge 0}\\left(\\sum_{k=0}^nq_i\\right)x^n$ as the Cauchy product of $\\sum_{n\\ge 0}q_nx^n$ and a very simple power series whose corresponding function $f(x)$ you know, so that\n$$2g(x)=\\frac{x+x^2}{1-x}+f(x)g(x)\\;.$$\nYou can then solve for $g(x)$:\n$$g(x)=\\frac{x+x^2}{(1-x)(2-f(x))}\\;.$$\nAnd if you’ve done this correctly, you’ll easily be able to expand $g(x)$ into a power series from which you can read off the coefficients $q_n$.\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006326265865936875, 0.0010022412752732635, 0.0014758066972717643, 0.0009940573945641518, 0.04415138438344002, 0.009447567164897919 ]

[ "Penobscot, Maine\n\nPenobscot is a town in Hancock County, Maine, United States. ", " The Bagaduce River flows through the town. ", "The population was 1,263 at the 2010 census.", "\n\nGeography\nAccording to the United States Census Bureau, the town has a total area of , of which is land and is water.", "\n\nDemographics\n\n2010 census\nAs of the census of 2010, there were 1,263 people, 593 households, and 347 families living in the town. ", "The population density was . ", "There were 883 housing units at an average density of . ", "The racial makeup of the town was 97.5% White, 0.2% African American, 0.4% Native American, 0.6% Asian, 0.2% from other races, and 1.2% from two or more races. ", "Hispanic or Latino of any race were 1.0% of the population.", "\n\nThere were 593 households of which 18.9% had children under the age of 18 living with them, 48.7% were married couples living together, 5.9% had a female householder with no husband present, 3.9% had a male householder with no wife present, and 41.5% were non-families. ", "32.4% of all households were made up of individuals and 16.2% had someone living alone who was 65 years of age or older. ", "The average household size was 2.06 and the average family size was 2.57.", "\n\nThe median age in the town was 51.9 years. ", "14.8% of residents were under the age of 18; 6.1% were between the ages of 18 and 24; 19% were from 25 to 44; 33.9% were from 45 to 64; and 26.1% were 65 years of age or older. ", "The gender makeup of the town was 48.7% male and 51.3% female.", "\n\n2000 census\nAs of the census of 2000, there were 1,344 people, 533 households, and 370 families living in the town. ", " The population density was 33.7 people per square mile (13.0/km²). ", " There were 723 housing units at an average density of 18.1 per square mile (7.0/km²). ", " The racial makeup of the town was 98.07% White, 0.15% African American, 0.37% Native American, 0.30% Asian, 0.30% from other races, and 0.82% from two or more races. ", "Hispanic or Latino of any race were 0.45% of the population.", "\n\nThere were 533 households out of which 27.6% had children under the age of 18 living with them, 60.0% were married couples living together, 7.1% had a female householder with no husband present, and 30.4% were non-families. ", "24.0% of all households were made up of individuals and 11.3% had someone living alone who was 65 years of age or older. ", " The average household size was 2.36 and the average family size was 2.79.", "\n\nIn the town, the population was spread out with 20.3% under the age of 18, 5.0% from 18 to 24, 25.4% from 25 to 44, 27.5% from 45 to 64, and 21.8% who were 65 years of age or older. ", " The median age was 45 years. ", "For every 100 females, there were 94.8 males. ", " For every 100 females age 18 and over, there were 89.9 males.", "\n\nThe median income for a household in the town was $37,232, and the median income for a family was $42,368. ", "Males had a median income of $30,921 versus $22,417 for females. ", "The per capita income for the town was $20,035. ", " About 4.0% of families and 8.0% of the population were below the poverty line, including 12.5% of those under age 18 and 10.5% of those age 65 or over.", "\n\nReferences\n\nFurther reading\n History of Castine, Penobscot, and Brooksville, Maine including the ancient settlement of Pentagoet. ", "By George Augustus Wheeler. ", "Published 1875.", "\n\nExternal links\n Town of Penobscot, Maine\n\nCategory:Towns in Hancock County, Maine\nCategory:Towns in Maine" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0011783329537138343, 0.0009309687302447855, 0.0007106625707820058, 0.0006335929501801729, 0.0006416364922188222, 0.0007137637003324926, 0.0010487319668754935, 0.017259754240512848, 0.01409557182341814, 0.0011334222508594394, 0.002088571432977915, 0.0017123414436355233, 0.0008026203722693026, 0.004743760917335749, 0.002992780413478613, 0.0006324786227196455, 0.0008465003338642418, 0.0014605375472456217, 0.020874083042144775, 0.015302551910281181, 0.0012587257660925388, 0.0024031363427639008, 0.0019350647926330566, 0.0022642638068646193, 0.0010728907072916627, 0.01043093204498291, 0.005813361145555973, 0.0008101421990431845, 0.002261513378471136, 0.001094660721719265, 0.003122124122455716, 0.0005992545047774911, 0.0007729509379714727, 0.0006564400973729789, 0.0006246786215342581 ]

[ "Search Blog\n\nSunday, June 21st, 2009\n\nTwitter: Managing following and followers in bulk\n\nThere are limits on Twitter as to how many people you can follow before you’re stopped from following any more. ", "The limit is reached when you are following 2,000 people if you don’t have enough followers of your own. ", "When you reach this number you won’t be able to follow any new people.", "\n\nThis is a limit that you might encounter if you’re involved heavily in social marketing using Twitter. ", "To cull your accounts so that people who you are following and who do not also follow you can be removed check out http://huitter.com/mutuality/.\n\nAt Huitter.com you can type your Twitter user name and password and select from one of the options to unfollow all who do not follow you back, to unfollow everyone (if you’re having a bad day – but be careful, tomorrow you might be disappointed you did this), and to follow everyone who follows you. ", "This later option is handy if you suddenly decide that instead of being picky about who you follow you now want to follow everyone who is following you.", "\n\nUsing the exclude list you can list specific people by user name from the task so you still follow some people, for example, even if they don’t follow you.", "\n\nWhen you click Go the program goes ahead and performs the task for you. ", "This way you can make bulk changes to your Twitter account in a very short time and painlessly. ", "This is something which you cannot do otherwise on Twitter short of doing it all manually.", "\n\nFor people interested in social marketing, http://huitter.com/mutuality/ is a great tool because it lets you determine instantly who is not following you so that you can weed them out of your list freeing you up to find more Twitter followers in future." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000659159675706178, 0.0023964138235896826, 0.0008645724155940115, 0.0007295248797163367, 0.00591707369312644, 0.00124643137678504, 0.0007083170930854976, 0.0007359199225902557, 0.0006857471307739615, 0.0008783504017628729, 0.0008214190602302551 ]

[ "In a UMTS (Universal Mobile Telecommunications System) network, long term evolution (LTE) is under study for the purpose of further increasing high speed data rates, providing lower delay and so on (see non-patent literature 1). ", "Also, successor systems of LTE (referred to as, for example, “LTE-advanced” or “LTE enhancement” (hereinafter referred to as “LTE-A”)) are under study for the purpose of achieving further broadbandization and increased speed beyond LTE.", "\nIn these LTE and LTE-A, when a mobile station apparatus UE communicates with the network, a cell search process is required to establish synchronization. ", "In the cell search process, the mobile station apparatus UE detects the synchronization signal (SS: Synchronization Signal) that is transmitted from the base station apparatus at regular time intervals, and acquires frequency synchronization, timing synchronization and the cell ID (PCI: Physical Cell ID) of the cell where the mobile station apparatus UE is located (serving cell). ", "Based on the information acquired, the mobile station apparatus UE determines the serving cell. ", "Note that the synchronization signal includes identification information to identify the base station apparatus (for example, a base station ID), so that the mobile station apparatus UE can specify the connecting base station apparatus based on this identification information. ", "Then, by transmitting the RACH (Random Access CHannel) to the specified base station apparatus, the mobile station apparatus UE can report its presence to the cell and secure communication resources." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.000553540769033134, 0.0006071485113352537, 0.0005861801910214126, 0.0006249552243389189, 0.0005574891110882163, 0.0005508959293365479, 0.0006743164267390966 ]

[ "Taylor Swift-Tell Me Why tab\n\nHighlightedShow chord diagrams\n\nCG I took a chance, I took a shotDsus4Em And you might think I'm bulletproof, but I'm notCG You took a swing, I took it hardDsus4Em And down here from the ground I see who you areCG I'm sick and tired of your attitudeD I'm feeling like I don't know youEm You tell me that you love me then cut me downCG And I need you like a heartbeatD But you know you got a mean streakEmD/F#GEmC Makes me run for cover when you're aroundCD And here's to you and your temperGD/F#Em Yes, I remember what you said last nightCD And I know that you see what you're doing to meG Tell me whyCG You could write a book onDEm How to ruin someones perfect dayCG Well I get so confused and frustratedDEm Forget what I'm trying to say, ohCG I'm sick and tired of your reasonsD I got no one to believe inEmCadd9 You tell me that you want me, then push me aroundG And I need you like a heartbeatD But you know you got a mean streakEmD/F#GEmC Makes me run for cover when you're aroundCD And here's to you and your temperGD/F#Em Yes, I remember what you said last nightCD And I know that you see what you're doing to meG Tell me whyEmCWhy... do you have to make me feel smallGDSo you can feel whole insideEmCWhy... do you have to put down my dreamsACDSo you're the only thing on my mindCG I'm sick and tired of your attitudeD I'm feeling like I don't know youEmC You tell me that you want me then cut me downG I'm sick and tired of your reasonsD I got no one to believe inEmD/F#GEmC You ask me for my love then you push me aroundCD Here's to you and your temperGD/F#Em Yes, I remember what you said last nightCD And I know that you see what you're doing to meGEmCadd9D Tell me why, why, tell me why, ohhCG I take a step back, let you goDEmG I told you I'm not bulletproof, now you know" ]

{ "pile_set_name": "Pile-CC" }

[ 0.21378149092197418 ]

[ "A US teen has been convicted of murdering his parents. ", "He did so not because they made him go to bed early or cut off his pocket money, but because they stopped him from playing an Xbox 360 game.", "\nDaniel Petric, 17, now faces lifelong imprisonment without parole for killing his mother using his father’s 9mm handgun. ", "The teen also …\n\nClassic example.", "\n\nMeanwhile, on the Bizarro Planet\n\nHEADLINE: SERIAL KILLER ARRESTED FOLLOWING GAMEPLAY\n\nA court heard today that a lifetime of contract killing lead teenager Zorknik Krvblit to play a video game. ", "A neighbour said \"We knew he did a lot of assassinations, much more than is normal for a boy his age, and perhaps his parents should have stepped in - but now it's too late.\"", "\n\nKrvblit will be tried on a charge of Possesion of a Copy Of Horace Goes Skiing. ", "If convicted, he could be required to eat jelly and ice cream after every Sunday lunch for 25 years.", "\n\nRe: \"just wait'\n\nSomebody ALWAYS blames the culture. ", "Believe it or not, most people have guns to defend themselves against criminals, who - GASP - tend to pack heat. ", "Fun fact: every big massacre in this country happens in a gun free zone(read: shooting gallery). ", "His psychosis made him a killer, not daddy's gun. ", "Remember that many homes have a knife block WITH A BIG HONKING KNIFE IN IT." ]

{ "pile_set_name": "Pile-CC" }

[ 0.025268230587244034, 0.005730447359383106, 0.06415899097919464, 0.0007316724513657391, 0.004304772242903709, 0.0009141492773778737, 0.0014820900978520513, 0.002213646424934268, 0.0008102989522740245, 0.010527039878070354, 0.004075214732438326, 0.7194728255271912, 0.08581263571977615 ]

[ "Horizon: How video games can change your brain Published duration 15 September 2015\n\nmedia caption The creator of Neuroracer explains how it might benefit OAPs' brains\n\nThe video game industry is a global phenomenon. ", "There are more than 1.2 billion gamers across the planet, with sales projected soon to pass $100bn (£65bn) per year.", "\n\nThe games frequently stand accused of causing violence and addiction. ", "Yet three decades of research have failed to produce consensus among scientists.", "\n\nIn laboratory studies, some researchers have found an increase of about 4% in gamers' levels of aggression after playing violent games.", "\n\nimage caption A growing body of evidence suggests video games can affect the brain's development\n\nBut other research groups have concluded factors such as family background, mental health or simply being male are more significant in determining levels of aggression.", "\n\nWhat is certain is that science has failed to find a causal link between video games and real-world acts of violence.", "\n\nBut away from the controversy, a growing body of work is beginning to show these games in a different light.", "\n\nMotor skill\n\nDr Henk ten Cate Hoedemaker is the man behind Underground.", "\n\nmedia caption Underground's creator explains how it can help train keyhole surgeons\n\nIn the game, players must guide a child and her pet robot out of a mine.", "\n\nBut this is no ordinary game. ", "Dr Hoedemaker is a keyhole surgeon, and Underground is designed to hone the skills of his profession.", "\n\nPlayers use adapted controllers that mimic the tools used in surgery - and those who perform well in the game also do better in tests of their surgical skills.", "\n\nVisual abilities\n\nAround the world, other researchers are investigating the potential hidden benefits in video games.", "\n\nAt the University of Geneva, Prof Daphne Bavelier has compared the visual abilities of gamers and non-gamers.", "\n\nIn one test, subjects must try to keep track of the position of multiple moving objects.", "\n\nShe has found that individuals who play action video games perform markedly better than those who do not.", "\n\nProf Bavelier's theory is that fast action games require the player constantly to switch their attention from one part of the screen to another while also staying vigilant for other events in the environment.", "\n\nimage caption Prof Bavelier found action video gamers were better than other people at remembering which smiley faces in an experiment were blue\n\nThis challenges the brain, making it process incoming visual information more efficiently.", "\n\nBrain growth\n\nAt the Max-Planck Institute of Human Development, in Berlin, Prof Simone Kuhn also researches the effects of the video games on the brain.", "\n\nIn one study, she used fMRI (functional MRI) technology to study the brains of subjects as they played Super Mario 64 DS, over a period of two months.", "\n\nRemarkably, she found that three areas of the brain had grown - the prefrontal cortex, right hippocampus and cerebellum - all involved in navigation and fine motor control.", "\n\nimage copyright Nintendo image caption Volunteers had their brains scanned to study how they were affected by playing Super Mario\n\nThe visual layout of this game is distinctive: a 3D view on the top screen and a 2D map view on the bottom.", "\n\nProf Kuhn believes having to navigate simultaneously in different ways may be what stimulates brain growth.", "\n\nKeeping sharp\n\nArguably the most exciting field of research is exploring the potential of video games to tackle mental decline in old age.", "\n\nWhile electronic \"brain training\" games have long had enormous popular appeal, there is no hard evidence playing them has any effect beyond improving your score\n\nBut at the University of California, San Francisco, Prof Adam Gazzaley and a team of video game designers have created a game with a difference: Neuroracer.", "\n\nimage caption Prof Gazzaley believes pensioners can improve their ability to multitask if they play the right kind of video games\n\nAimed at older players, it requires individuals to steer a car while at the same time performing other tasks.", "\n\nAfter playing the game for 12 hours, Prof Gazzaley found pensioners had improved their performance so much they were beating 20-year-olds playing it for the first time.", "\n\nHe also measured improvements in their working memory and attention span.", "\n\nCrucially, this showed that skills improved through playing the game were transferable into the real world.", "\n\nimage copyright Neuroracer image caption Neuroracer players had to steer a vehicle and react to different signs at the same time\n\nTo test whether off-the-shelf games might bring similar benefits to elderly players, the BBC's Horizon programme recruited a small group of older volunteers from a sheltered housing complex in Glasgow.", "\n\nThey learned to play a popular karting game, clocking up about 15 hours each over five weeks. ", "Their working memory and attention spans were tested before and after.", "\n\nOn average, both these scores increased by about 30%.", "\n\nAlthough this was only a small test, larger scientific studies will continue to explore the effects of playing video games.", "\n\nimage caption Horizon challenged some pensioners to play a Sonic the Hedgehog karting game\n\nProf Gazzaley believes we are only just beginning to tap their potential.", "\n\n\"I'm intrigued with the idea that in the future a psychiatrist or neurologist might pull out their pad and instead of writing down a drug, writes down a tablet game times two months, and uses that as a therapy, as a digital medicine,\" he says.", "\n\nHorizon: Are Video games Really That Bad? ", "will be shown at 16 September at 20:00 BST on BBC Two and will be on iPlayer afterwards." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.009552466683089733, 0.0007834690040908754, 0.0009974417043849826, 0.0006110047688707709, 0.0019513001898303628, 0.0015223592054098845, 0.0009449718636460602, 0.0005808203713968396, 0.0015311059542000294, 0.0010534863686189055, 0.0009154911967925727, 0.003941874019801617, 0.0006865027244202793, 0.0005568919004872441, 0.0006192041910253465, 0.000650163390673697, 0.0006504311459138989, 0.0008188324281945825, 0.000902043015230447, 0.0006553108687512577, 0.0007303474703803658, 0.0028098071925342083, 0.0009173776488751173, 0.0008640246232971549, 0.0009393708896823227, 0.0008245579083450139, 0.0007718697306700051, 0.015056689269840717, 0.0005845404230058193, 0.0005984979798085988, 0.000675212882924825, 0.0008335023303516209, 0.00053037004545331, 0.0006767287268303335, 0.0005743316723965108, 0.0007851817063055933, 0.0008638654835522175, 0.0015219164779409766, 0.0006178225157782435 ]

[ "United Hotels Company of America\n\nUnited Hotels Company of America, also known as United Hotels Company, was a chain of upscale hotels in the United States. ", "The company was headquartered in Niagara Falls, New York, with administrative offices in New York City. ", "The company was founded in 1910 by Frank A. Dudley and by the 1930s, the company was \"the largest hotel group in the world under one control.\"", "\n\nHistory\nThe \"United Hotels Company\" was founded in 1910 and incorporated in the state of New York by Frank A. Dudley and F. W. Rockwell. ", "On February 16, 1917, the company reorganized as \"United Hotels Company of America\" and was incorporated in the state of Delaware.", "\n\nThe built and operated \"first class fire proof hotels\" in the more important cities of the United States and Canada. ", "The strategy of the United Hotels Co. was to control 51% or more of the stock of all of its subsidiary operating companies (with certain exceptions, such as \"The Onondaga Co.\", where 90% of the stock was controlled by the officers of the United Hotels Co.). ", "All of the companies operated the hotels under leases (except King Edward Hotel Co. Ltd., Clifton Co. Ltd., and Mount Royal Hotel Co. Ltd.). ", "The United Hotels Co. owned substantial interests in the company stocks of the real estate companies whose hotels are leased to the operating companies.", "\n\nUnder the direction of hotelier and president Frank A. Dudley, the company eventually grew to become one of North America’s premier hotel companies, operating some of the finest hotels across the United States and Canada. ", "By 1922, the company was operating 18 hotels and that number grew to 25 hotels in 1928.", "\n\nBy the 1930s, and with the onset of the Great Depression, the company was forced into receivership in November 1933, but it managed to reorganize in May 1934. ", "The earnings of the individual hotels had shrunk by such a percent in the preceding four years that 80% of mortgages were in default, and in some cases, taxes and interest on first mortgages were unpaid. ", "Continuing under Frank A. Dudley, the newly organized \"United Hotels Co. of America\" was once again incorporated in New York with headquarters in the United Office Building in Niagara Falls. ", "At that time, the company was also affiliated with the \"American Hotels Corporation\" chain, making it \"the largest hotel group in the world under one control.\"", "\n\nWhen Dudley, who was president of \"United Hotels Company of America\", vice-president of \"American Hotels Corporation\", and president or vice-president of 24 subsidiary hotel companies, died on September 21, 1945 at the age of 81, the hotel chain was managing 60 hotels. ", "After his death, many of the company's hotels were acquired by other hotel chains, such as the Hilton Hotel.", "\n\nCompany timeline\n1910 - The \"United Hotels Company\" was founded and in incorporated in the state of New York.", "\n1917 - The \"United Hotels Company\" was reorganized as the \"United Hotels Company of America\" in the state of Delaware\n1922 - Operating 18 hotels\n1928 - Operating 25 hotels\n1933 - The Company was forced into receivership in November\n1934 - The Company was reorganized as the \"United Hotels Co. of America\", once again incorporated in New York with headquarters in Niagara Falls, N.Y..\n1945 - Operating 60 hotels. ", "Frank A. Dudley died on September 21, at the age of 81. ", "After Dudley's death, many of the company's hotels were acquired by other hotel chains, including Hilton Hotels.", "\n\nGallery of former properties\n\nProperties\n\nDomestic\n While in operation, the company operated several upscale and famous hotels in the United States, including:\nThe Roosevelt in New York City\nThe Ten Eyck in Albany, N.Y.\nThe Utica in Utica, N.Y.\nThe Onondaga in Syracuse, N.Y. (demolished)\nThe Seneca in Rochester, N.Y. (demolished)\nThe Rochester in Rochester, N.Y.\nThe Benjamin Franklin in Philadelphia, Pa.\nThe Lawrence in Erie, Pa. (demolished)\nThe Penn-Harris in Harrisburg, Pa. (demolished 1973)\nThe Olympic in Seattle, Wash.\nThe Bancroft in Worcester, Mass.\nThe Portage in Akron, Ohio (demolished 1991)\nFort Steuben Hotel Steubenville, Ohio\nThe Durant in Flint, Mich.\nThe Robert Treat in Newark, N.J.\nThe Alexander Hamilton in Paterson, N.J.\nThe Stacy-Trent in Trenton, New Jersey (demolished 1967)\nThe Tutwiler, in Birmingham, Alabama\nThe Roosevelt in New Orleans\nThe Bienville in New Orleans\nThe Washington-Youree Hotel in Shreveport, Louisiana\nHotel Niagara in Niagara Falls, N.Y.\nPresident in Kansas City, Missouri\nEl Conquistador Hotel in Tucson, Arizona (demolished 1968)\n\nInternational\nIn Canada, the company operated:\nThe Mount Royal in Montreal\nThe Royal Connaught in Hamilton, Ontario\nThe Clifton in Niagara Falls, Ontario (burned 1932)\nThe Niagara in Niagara Falls, Ontario\nKing Edward Hotel, in Toronto\nThe Prince Edward in Windsor, Ontario\nThe Admiral Beatty in Saint John, New Brunswick\n\nOutside the United States and Canada, the company operated:\nConstant Spring Hotel in Kingston, Jamaica\n\nInternational affiliates\nThe \"United Hotels Company\" was affiliated international with Important Hotels of U.N.I.T.I. \"Unione Nazionale Industrie Turistiche Italiane\" in Italy; the \"Japan Hotel Association\", Tokyo, Japan; \"United Travel and Hotel Bureau\", headquarters in Paris.", "\n\nSee also\nFrank A. Dudley\nList of defunct hotel chains\n\nReferences\n\nCategory:American companies established in 1910\nCategory:Hotels established in 1910\nCategory:Defunct hotel chains\nCategory:Defunct companies based in New York (state)\nCategory:Historic hotels in the United States\nCategory:United Hotels Company of America" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006861305446363986, 0.0005974504165351391, 0.0006206582766026258, 0.0005812065792270005, 0.0005870182649232447, 0.0006698271608911455, 0.0006824498996138573, 0.0005942400312051177, 0.0005912610795348883, 0.0005867041763849556, 0.0005898642702959478, 0.0006499651935882866, 0.0006865671603009105, 0.0005776117322966456, 0.0005925362929701805, 0.0006489692023023963, 0.0007926554535515606, 0.0005685653304681182, 0.0005797600606456399, 0.001404807553626597, 0.0007270151982083917, 0.000636717421002686, 0.0005717111635021865 ]

[ "- 23. ", "Give y(198).", "\n-23\nLet b(s) = s**3 + 74*s**2 - 76*s - 1357. ", "Determine b(-75).", "\n-1282\nLet a(f) = 5297*f + 121. ", "Give a(0).", "\n121\nLet p(f) = -425*f**2 + 1885*f - 927. ", "What is p(4)?", "\n-187\nLet x(c) = 24543*c + 123455. ", "Give x(-5).", "\n740\nLet k(w) = -81264*w + 5525920. ", "Give k(68).", "\n-32\nLet o(w) = 1580*w - 7019. ", "What is o(5)?", "\n881\nLet c(v) = 848*v + 200971. ", "Calculate c(-237).", "\n-5\nLet q(f) = 15*f**2 - 1620*f - 1380. ", "What is q(111)?", "\n3615\nLet s(b) = 2*b**3 - 104*b**2 + 739*b - 6. ", "Calculate s(44).", "\n1534\nLet h(b) = -2588183*b + 15529093. ", "Give h(6).", "\n-5\nLet i(s) = 8*s**3 - 168*s**2 + 148*s + 11. ", "Give i(20).", "\n-229\nLet r(m) = -1638*m + 4960. ", "Calculate r(3).", "\n46\nLet l(o) = -1905*o - 177177. ", "Determine l(-93).", "\n-12\nLet m(z) = z**2 - 533*z - 12026. ", "Calculate m(-22).", "\n184\nLet u(p) = -1352*p + 707069. ", "What is u(523)?", "\n-27\nLet g(s) = 1538417*s - 6153656. ", "Calculate g(4).", "\n12\nLet p(t) = -41895*t - 209424. ", "Determine p(-5).", "\n51\nLet y(p) = 4809*p + 355871. ", "Calculate y(-74).", "\n5\nLet f(m) = 19438*m - 96615. ", "Calculate f(5).", "\n575\nLet i(j) = j**3 - 96*j + 133. ", "Give i(12).", "\n709\nLet l(h) = -h**3 + 29*h**2 + 65*h - 1329. ", "Determine l(29).", "\n556\nLet v(a) = 59*a - 777. ", "Calculate v(31).", "\n1052\nLet p(u) = -35551*u - 924331. ", "Give p(-26).", "\n-5\nLet m(d) = 7*d**2 - 346*d + 4203. ", "Determine m(12).", "\n1059\nLet r(d) = -4*d**2 + 148*d + 1148. ", "Calculate r(52).", "\n-1972\nLet v(d) = -d**3 - 140*d**2 - 1121*d - 2146. ", "Determine v(-5).", "\n84\nLet c(s) = -83*s**2 + 8485*s + 6584. ", "Determine c(103).", "\n-8\nLet p(w) = -w**3 + 6*w**2 - 1515*w + 9099. ", "Calculate p(6).", "\n9\nLet i(x) = x**3 - 79*x**2 - 538*x - 5517. ", "Calculate i(86).", "\n-13\nLet r(w) = 5*w**2 + 664*w + 16130. ", "Give r(-32).", "\n2\nLet q(g) = 1607*g + 6550. ", "Determine q(-4).", "\n122\nLet h(a) = -a**3 - 25*a**2 + 99*a - 25. ", "Determine h(-29).", "\n468\nLet u(y) = 22*y**3 - 289*y**2 + 43*y - 36. ", "Give u(13).", "\n16\nLet s(l) = -l**3 - 6*l**2 - 3044*l - 18422. ", "What is s(-6)?", "\n-158\nLet k(v) = -29391*v - 3086059. ", "Give k(-105).", "\n-4\nLet b(z) = -14294285*z + 185825706. ", "What is b(13)?", "\n1\nLet b(f) = -3*f**2 - 658*f + 672. ", "What is b(-221)?", "\n-433\nLet r(m) = m**2 - 330*m - 1825. ", "Calculate r(-6).", "\n191\nLet u(y) = y**3 - 165*y**2 + 3382*y + 272. ", "Determine u(141).", "\n-10\nLet z(k) = -2*k**3 - 35*k**2 + 43*k - 116. ", "Calculate z(-20).", "\n1024\nLet q(l) = -528*l**2 + 28*l + 30. ", "Determine q(-1).", "\n-526\nLet s(b) = -61749*b + 370694. ", "Give s(6).", "\n200\nLet n(t) = 101*t - 4443. ", "Give n(40).", "\n-403\nLet y(m) = 4030*m + 1067953. ", "What is y(-265)?", "\n3\nLet c(o) = -8*o**3 - 90*o**2 - 101*o - 826. ", "Give c(-11).", "\n43\nLet o(k) = -2*k**2 + 2175*k - 175754. ", "Determine o(88).", "\n158\nLet j(x) = -4624*x - 291281. ", "What is j(-63)?", "\n31\nLet w(p) = 2*p**3 - 45*p**2 - 70*p - 19. ", "Calculate w(24).", "\n29\nLet q(j) = -j**2 - 180*j - 8500. ", "Determine q(-86).", "\n-416\nLet m(t) = 5*t**2 - 3531*t + 17668. ", "Give m(5).", "\n138\nLet t(l) = l**3 + 16*l**2 + 111*l + 3319. ", "Calculate t(-19).", "\n127\nLet j(r) = -8*r**2 - 108*r - 218. ", "What is j(-8)?", "\n134\nLet p(v) = -14*v**3 - 475*v**2 + 16*v - 618. ", "Calculate p(-34).", "\n-6\nLet r(z) = 232203*z + 232204. ", "What is r(-1)?", "\n1\nLet i(l) = -l**2 + 74*l + 8197. ", "Determine i(-57).", "\n730\nLet c(p) = 5285*p + 21038. ", "Calculate c(-4).", "\n-102\nLet p(a) = -40201*a - 25. ", "Determine p(0).", "\n-25\nLet y(w) = -w**3 - 50*w**2 - 131*w - 4785. ", "Give y(-49).", "\n-767\nLet i(s) = -28073*s + 363552. ", "Determine i(13).", "\n-1397\nLet i(n) = 2*n**3 + 43*n**2 + 18*n + 157. ", "What is i(-9)?", "\n2020\nLet k(q) = 191*q**2 - 39*q - 6. ", "Give k(-2).", "\n836\nLet v(h) = -h**3 - 31*h**2 + 151*h + 75. ", "Calculate v(-34).", "\n-1591\nLet k(b) = -b**3 + 58*b**2 - 113*b - 341. ", "Determine k(56).", "\n-397\nLet y(b) = -22*b**2 + 1165*b - 30. ", "Determine y(53).", "\n-83\nLet i(l) = -4457*l - 205029. ", "Calculate i(-46).", "\n-7\nLet b(c) = 14936*c + 1269686. ", "Calculate b(-85).", "\n126\nLet g(t) = -53*t**2 - 2016*t - 78. ", "What is g(-38)?", "\n-2\nLet m(t) = -707*t - 91975. ", "What is m(-130)?", "\n-65\nLet q(l) = -605*l**2 - 30823*l + 1637. ", "Determine q(-51).", "\n5\nLet z(l) = -4*l**3 + 151*l**2 + 888*l + 302. ", "Calculate z(-6).", "\n1274\nLet s(d) = -238*d - 11716. ", "Give s(-47).", "\n-530\nLet b(g) = -613*g - 198632. ", "Determine b(-324).", "\n-20\nLet p(g) = 37*g**2 - 5392*g + 67059. ", "Determine p(132).", "\n3\nLet x(u) = u**3 + 275*u**2 - 59178*u + 15019. ", "Calculate x(-417).", "\n7\nLet t(m) = m**3 - 24*m + 79. ", "Calculate t(-7).", "\n-96\nLet j(o) = 5*o**3 - 269*o**2 - 58*o - 219. ", "Calculate j(54).", "\n-435\nLet i(a) = a**3 - 121*a**2 - 1360*a + 6583. ", "Calculate i(131).", "\n33\nLet c(i) = 20*i - 15. ", "Calculate c(-7).", "\n-155\nLet g(q) = 12920*q - 157188. ", "Determine g(12).", "\n-2148\nLet z(l) = -1534*l - 220886. ", "Determine z(-144).", "\n10\nLet v(q) = 2*q**3 + 27*q**2 - 2317*q - 31966. ", "Calculate v(-14).", "\n276\nLet b(u) = -23*u**2 + 1762*u + 5434. ", "Calculate b(-3).", "\n-59\nLet u(f) = -f**3 - 23*f**2 - 863*f - 18539. ", "Determine u(-22).", "\n-37\nLet x(t) = 9708*t**2 - 2087225*t + 1093. ", "Determine x(215).", "\n18\nLet o(p) = 7*p**3 - 7*p**2 + 421*p - 413. ", "Calculate o(1).", "\n8\nLet x(l) = 690*l - 7644. ", "Give x(11).", "\n-54\nLet v(b) = b**3 + 111*b**2 + 36*b + 508. ", "Calculate v(-111).", "\n-3488\nLet g(o) = -9714*o - 6391811. ", "What is g(-658)?", "\n1\nLet n(m) = 2*m**3 - 13*m**2 + 14*m + 403. ", "Give n(7).", "\n550\nLet j(a) = 5657*a + 62351. ", "Calculate j(-11).", "\n124\nLet a(f) = -f**3 + 3639*f**2 + 25504*f - 117. ", "Determine a(-7).", "\n9\nLet y(u) = -u**3 - 13*u**2 + 35*u - 276. ", "Give y(9).", "\n-1743\nLet k(f) = -28*f**2 - 80*f - 15. ", "Determine k(-5).", "\n-315\nLet m(f) = f**2 - 2000*f - 14000. ", "Determine m(-7).", "\n49\nLet y(k) = 2391*k + 15639. ", "What is y(-7)?", "\n-1098\nLet k(s) = -32*s**2 - 1077*s + 2156. ", "What is k(2)?", "\n-126\nLet q(x) = -3965*x - 7944. ", "Give q(-2).", "\n-14\nLet t(u) = -u**3 + 323*u**2 - 11567*u + 193. ", "Calculate t(41).", "\n-12\nLet s(i) = -2*i**3 - 206*i**2 + 186*i - 1803. ", "Calculate s(-104).", "\n485\nLet f(t) = 3311*t - 12154. ", "What is f(4)?", "\n1090\nLet x(p) = -11*p**2 + 4535*p + 110137. ", "Give x(-23).", "\n13\nLet a(f) = 40938*f + 327555. ", "Calculate a(-8).", "\n51\nLet s(q) = -q**3 - 157*q**2 - 1644*q - 339850. ", "Determine s(-160).", "\n-10\nLet m(c) = 274*c - 8208. ", "What is m(30)?", "\n12\nLet x(l) = -64*l**3 + 49*l**2 - 38*l - 10. ", "Calculate x(1).", "\n-63\nLet z(f) = 32*f - 2571. ", "What is z(66)?", "\n-459\nLet k(c) = -284386*c + 5403329. ", "Give k(19).", "\n-5\nLet p(c) = 808*c + 16648. ", "Calculate p(-18).", "\n2104\nLet h(m) = 160*m + 4194. ", "Give h(-26).", "\n34\nLet w(p) = 197*p**2 + 800*p + 26. ", "Determine w(-4).", "\n-22\nLet m(g) = -4*g**2 - 590*g + 181. ", "Calculate m(-148).", "\n-115\nLet i(z) = 12*z**2 - 130331*z - 260706. ", "Determine i(-2).", "\n4\nLet a(m) = -957*m - 52832. ", "Determine a(-55).", "\n-197\nLet q(x) = -39463*x - 1696910. ", "Give q(-43).", "\n-1\nLet g(f) = f**3 - 73*f**2 + 1317*f + 191. ", "Determine g(33).", "\n92\nLet x(u) = -8*u**2 + 2487*u + 12259. ", "What is x(-5)?", "\n-376\nLet t(b) = b**3 + 45*b**2 + 337*b + 247. ", "Determine t(-35).", "\n702\nLet b(p) = 137*p**2 + 837*p + 1679. ", "Calculate b(-2).", "\n553\nLet t(z) = z**2 - 2673*z - 4317170. ", "Determine t(-1134).", "\n-32\nLet q(p) = 2*p**2 + 11288*p - 1195585. ", "Determine q(104).", "\n-1\nLet m(s) = 104*s**2 - 1631*s + 60. ", "What is m(15)?", "\n-1005\nLet d(l) = 92*l**3 + 101*l**2 - 242*l + 64. ", "Give d(2).", "\n720\nLet n(f) = -4*f**3 + 2*f**2 + 69*f - 376. ", "Give n(5).", "\n-481\nLet f(x) = 2*x**3 + 305*x**2 + 446*x - 1043. ", "What is f(-151)?", "\n14\nLet u(t) = -2*t**3 + 10*t**2 + 172*t + 886. ", "Determine u(-5).", "\n526\nLet m(s) = -s**2 + 64*s - 1554. ", "Determine m(23).", "\n-611\nLet j(f) = -f**3 - 55*f**2 - 202*f + 44. ", "Calculate j(-51).", "\n-58\nLet a(h) = h**3 - 39*h**2 - 1183*h - 851. ", "Give a(59).", "\n-1028\nLet w(t) = 2059*t + 1717. ", "Calculate w(-2).", "\n-2401\nLet i(m) = m**3 - 9*m**2 - 47*m - 3663. ", "Determine i(20).", "\n-203\nLet f(b) = 2*b**3 - 44*b**2 + 7*b + 1019. ", "Give f(21).", "\n284\nLet z(v) = -10*v**2 + 409*v - 979. ", "Give z(38).", "\n123\nLet n(k) = -142749*k - 27693297. ", "What is n(-194)?", "\n9\nLet o(k) = -12240*k + 1615678. ", "Determine o(132).", "\n-2\nLet p(h) = -43*h**2 - 17*h - 120. ", "Determine p(-5).", "\n-1110\nLet i(u) = 270*u - 37738. ", "Calculate i(144).", "\n1142\nLet z(n) = 5*n**3 - 17*n**2 + 294*n + 1097. ", "Determine z(-3).", "\n-73\nLet y(u) = 49*u**2 + 2996*u - 6181. ", "What is y(2)?", "\n7\nLet k(f) = -36*f**3 - 288*f**2 - 69*f - 584. ", "Give k(-8).", "\n-32\nLet y(f) = 105*f + 2756. ", "Give y(-25).", "\n131\nLet u(f) = -5963*f + 554569. ", "What is u(93)?", "\n10\nLet d(g) = 29*g**2 - 1008*g - 6031. ", "Determine d(-6).", "\n1061\nLet j(l) = l**3 + 247*l**2 - 8347*l - 10283. ", "Give j(-277).", "\n-34\nLet g(v) = -3*v**2 + 1038*v + 8519. ", "Determine g(354).", "\n23\nLet z(l) = 3*l**3 + 128*l**2 - 56*l - 29. ", "Determine z(-43).", "\n530\nLet t(f) = 1884*f - 480417. ", "Give t(255).", "\n3\nLet w(a) = a**3 + 16*a**2 - 330*a - 5021. ", "Calculate w(-13).", "\n-224\nLet m(a) = -a**2 - 12639*a - 50537. ", "Calculate m(-4).", "\n3\nLet x(h) = 7*h - " ]

{ "pile_set_name": "DM Mathematics" }

[ 0.0008300624322146177, 0.0007321815937757492, 0.016301782801747322, 0.000656845630146563, 0.00515112467110157, 0.0010167412692680955, 0.6570390462875366, 0.0006901500164531171, 0.0009493270190432668, 0.0007083214004524052, 0.007669042330235243, 0.0009360656258650124, 0.001411536242812872, 0.0007579737575724721, 0.0014081501867622137, 0.0006783821154385805, 0.7625017166137695, 0.0006828922778367996, 0.009283323772251606, 0.0006603336078114808, 0.00276929116807878, 0.000860397529322654, 0.036056339740753174, 0.000706210033968091, 0.001281512319110334, 0.0006484956247732043, 0.008821363560855389, 0.0006524694617837667, 0.0018845865270122886, 0.000663058424834162, 0.0024987284559756517, 0.0008153562666848302, 0.0017616566037759185, 0.0006616608588956296, 0.01435802225023508, 0.0006874045357108116, 0.0018682939698919654, 0.000679924210999161, 0.007790490053594112, 0.0007014831062406301, 0.0019344700267538428, 0.0006854217499494553, 0.0068124206736683846, 0.000676696770824492, 0.0021817206870764494, 0.0006927212234586477, 0.003535474883392453, 0.0006962634506635368, 0.007566946558654308, 0.0007238824036903679, 0.008886700496077538, 0.0006527135847136378, 0.001745340647175908, 0.0006785447476431727, 0.01710037887096405, 0.0006500841118395329, 0.025475826114416122, 0.0006607273244298995, 0.00616422900930047, 0.0006659057107754052, 0.005542791914194822, 0.0007876287563703954, 0.0017271669348701835, 0.0006810766644775867, 0.03428849205374718, 0.0006710271700285375, 0.0242158230394125, 0.0007803558837622404, 0.006752200424671173, 0.0006812499486841261, 0.0034047376830130816, 0.0007964790565893054, 0.0013546622358262539, 0.0006724509294144809, 0.6434373259544373, 0.0006979190511628985, 0.0014950715703889728, 0.000635937845800072, 0.0397685244679451, 0.0006997571908868849, 0.9699435234069824, 0.0006545515498146415, 0.002709195949137211, 0.0006935690762475133, 0.0009569278336130083, 0.0007803786429576576, 0.01949785277247429, 0.0008486053557135165, 0.0010380701860412955, 0.0006934170378372073, 0.24731050431728363, 0.000709890213329345, 0.8950796723365784, 0.0007146206335164607, 0.0014046310679987073, 0.0007163904374465346, 0.027753230184316635, 0.0007039634510874748, 0.0034292242489755154, 0.0006666193949058652, 0.014081628993153572, 0.0010422907071188092, 0.03211478143930435, 0.0006712462054565549, 0.022562185302376747, 0.0007176374201662838, 0.024037254974246025, 0.000673590344376862, 0.001554611953906715, 0.0006881291628815234, 0.005084031727164984, 0.0006341620464809239, 0.0009258703794330359, 0.0006432780646719038, 0.0011668013175949454, 0.0007728717755526304, 0.009138930588960648, 0.0007008968386799097, 0.0019122444791719317, 0.000652062299195677, 0.06303779035806656, 0.0007376186549663544, 0.4237201511859894, 0.0010401648469269276, 0.01415985357016325, 0.0006787232123315334, 0.6086036562919617, 0.0007671377970837057, 0.01194912288337946, 0.0007078882190398872, 0.0013243536232039332, 0.0006469560321420431, 0.0015956038841977715, 0.0006548769888468087, 0.027451327070593834, 0.000707813655026257, 0.00895135011523962, 0.0006842822185717523, 0.0014371892903000116, 0.0006590023403987288, 0.01470429077744484, 0.0006523528718389571, 0.0017177395056933165, 0.000683110614772886, 0.001923435484059155, 0.0006468228530138731, 0.010313843376934528, 0.0006716006901115179, 0.01635824143886566, 0.0006478229188360274, 0.06389936804771423, 0.0006697205826640129, 0.05186370387673378, 0.0006980270845815539, 0.002131001790985465, 0.0006627870607189834, 0.009392430074512959, 0.0006449042120948434, 0.0011939905816689134, 0.0007249884074553847, 0.0019482725765556097, 0.0007004867657087743, 0.005034070927649736, 0.0006670044967904687, 0.02137041836977005, 0.0006446377956308424, 0.9676456451416016, 0.0006780916010029614, 0.003075564280152321, 0.0006731963367201388, 0.017515046522021294, 0.0006950846873223782, 0.0009484478505328298, 0.000723650271538645, 0.013990616425871849, 0.0006917422288097441, 0.04265173524618149, 0.0007195333600975573, 0.06803493201732635, 0.0008632548269815743, 0.0007757306448183954, 0.0006691352464258671, 0.7956425547599792, 0.0006963932537473738, 0.14276760816574097, 0.0008321968489326537, 0.978604793548584, 0.0007868610555306077, 0.4728200137615204, 0.0006816409295424819, 0.15636691451072693, 0.0007161300163716078, 0.4764437675476074, 0.0007550526061095297, 0.0010992006864398718, 0.0007264895248226821, 0.08220617473125458, 0.0006897847051732242, 0.005513740703463554, 0.0006589388940483332, 0.045444466173648834, 0.0007946872501634061, 0.0036924865562468767, 0.0006844106828793883, 0.025915777310729027, 0.0006275055347941816, 0.0017047174042090774, 0.0006724072736687958, 0.001009383937343955, 0.0007621697150170803, 0.007713926490396261, 0.0006493020919151604, 0.028546644374728203, 0.0007346639176830649, 0.09420371800661087, 0.0010238741524517536, 0.0029482434038072824, 0.0006689521833322942, 0.004566143732517958, 0.0007396857254207134, 0.0040269698947668076, 0.0006999028846621513, 0.027209049090743065, 0.0006843284936621785, 0.0014784568920731544, 0.0006409168126992881, 0.006892525590956211, 0.0006730631575919688, 0.001110859913751483, 0.0006546145887114108, 0.8249800205230713, 0.0007023621583357453, 0.032943952828645706, 0.00070872314972803, 0.017691677436232567, 0.0006823503645136952, 0.004900570958852768, 0.0006408768240362406, 0.004286463372409344, 0.0006757710361853242, 0.0038918619975447655, 0.000652880291454494, 0.006070734467357397, 0.0007255714735947549, 0.0061079226434230804, 0.0009035913390107453, 0.8324317336082458, 0.0008587880874983966, 0.04378129541873932, 0.0007145637064240873, 0.20976713299751282, 0.0006908702780492604, 0.00795305147767067, 0.000705558224581182, 0.8477875590324402, 0.0006860399735160172, 0.013842685148119926, 0.0014306287048384547, 0.0018090311205014586, 0.0006750591564923525, 0.019039060920476913, 0.0006670140428468585, 0.20533929765224457, 0.0009252244490198791, 0.007548180874437094, 0.0008386599947698414, 0.03999942168593407, 0.0007210166659206152, 0.29287755489349365, 0.0006920640007592738, 0.014445576816797256, 0.0006874045357108116, 0.0011556640965864062, 0.000664607563521713, 0.02198507823050022, 0.0006911823875270784, 0.023893382400274277, 0.0007426855154335499, 0.9892259240150452, 0.0011114712106063962, 0.01352748367935419, 0.0007144843693822622, 0.2461889237165451, 0.0007270453497767448, 0.006875890307128429, 0.0006607990944758058, 0.0020388064440339804, 0.0006727771833539009, 0.011793836951255798, 0.0006923440378159285, 0.010630456730723381, 0.0006647272384725511, 0.1195349395275116, 0.0008300862391479313, 0.005009031388908625, 0.000677456904668361, 0.0009536839206703007, 0.0006637453916482627, 0.007627574726939201 ]

[ "Weekend Projects: 5 Cool DIY Stools\n\nIdeal for beginners, building a DIY stool offers an enjoyable entree to the rewarding world of furniture making.", "\n\nToo many places to sit? ", "Never! ", "Almost any room can benefit from one more seat, so long as it’s sized in proportion to the dimensions of the space. ", "Among the panoply of seating options available to bone-weary homeowners, the humble stool is often overlooked, but no other solution offers greater versatility. ", "This weekend, tackle one of these DIY stool projects, and even before Monday morning, the underappreciated stool will prove its usefulness yet again.", "\n\n1. ", "CONCRETE SEAT\n\nPhoto: homemade-modern.com\n\nAlthough it looks like an expensive piece of furniture from a cutting-edge designer, this DIY stool from Ben at HomeMade Modern costs little to construct—it requires only concrete, wooden dowels, and copper hardware. ", "Ingeniously, the five-gallon bucket in which the concrete is mixed also serves as the form for the seat.", "\n\n2. ", "TRIPOD CAMP CHAIR\n\nPhoto: designsponge.com\n\nA must-have beside the backyard fire pit, this classic tripod camping stool can be made in a single morning using only wooden dowels and a swath of leather (or heavy canvas), plus a handful of nuts, bolts, and washers. ", "Matt from Wood&Faulk provides a step-by-step tutorial that guides DIYers through the process.", "\n\n3. ", "SPOOL STOOL\n\nPhoto: thelovelycupboard.com\n\nThis next idea comes from Heather at The Lovely Cupboard, who repurposed a spool for electrical wire into a DIY stool perfect for nurseries and playrooms. ", "Inexpensive to add on, the cushion top is created from a boldly colored fabric that has been stretched and stapled over foam circles cut from a mattress pad.", "\n\n4. ", "PLYWOOD PERCH\n\nPhoto: abeautifulmess.com\n\nFrom Josh and Sarah at A Beautiful Mess, this trendy DIY stool design balances rough-hewn simplicity with a tall and slender, streamlined silhouette. ", "Besides the power tools that make pretty quick work of this project, all you need is a sheet of plywood and some dime-a-dozen wood screws.", "\n\n5. ", "BAR STOOL REDUX\n\nPhoto: honeybearlane.com\n\nHeidi at Honeybear Lane gave a fresh look to a pair of hand-me-down stools. ", "After spray-painting both with an eye-catching shade of bright red, she “dipped” the seats and legs in gold. ", "In completing your own DIY stool makeover, choose two tones that suit your decor, then seal the painted surfaces with either polyurethane or wax. ", "Fun!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000621673883870244, 0.0011330912820994854, 0.014651045203208923, 0.0006236406043171883, 0.0016453821444883943, 0.0007430557161569595, 0.0009391896310262382, 0.0007073432789184153, 0.0007148804725147784, 0.0011855863267555833, 0.0009858659468591213, 0.0007241142448037863, 0.00117425003554672, 0.0015284655382856727, 0.0005912201595492661, 0.0012900290312245488, 0.0006919255247339606, 0.0015092059038579464, 0.0013671473134309053, 0.0007970245205797255, 0.000870180840138346, 0.0012317777145653963, 0.0010232295608147979 ]

[ "In the remote sensing/aerial imaging industry, imagery is used to capture views of a geographic area and to be able to measure objects and structures within the images as well as to be able to determine geographic locations of points within the image. ", "These are generally referred to as “geo-referenced images” and come in two basic categories:\nVertical Imagery—these images are captured with the camera pointed vertically downward and thus generally only capture the tops of structures.", "\nOblique Imagery—these images are captured with the camera aimed at an angle so as to capture the sides of structures as well as the tops.", "\nMost vertical imagery is processed in order to fit a mathematically rectangular projection or map. ", "This process is known as ortho-rectification and attempts to create an appearance as if the sensor were directly above each pixel in the image. ", "The resulting image is known as an ortho-photo. ", "Since the images are mathematically projected, they can be combined into a seamless mosaic. ", "The resulting composite image is called an ortho-mosaic. ", "The term “ortho image” is used to denote an image that is either an ortho-photo image or an ortho-mosaic image.", "\nBecause they are captured looking straight down, an ortho-photo or ortho-mosaic contains a view of the world to which we are not accustomed. ", "As a result, many people have difficulty determining what it is they are looking at in the image. ", "For instance, they might have difficulty distinguishing between two commercial properties since the only thing they can see of the properties in the ortho-mosaic is their roof tops, where as most of the distinguishing properties are on the sides of the buildings. ", "An entire profession, the photo interpreter, has arisen to address these difficulties as these individuals have years of training and experience specifically in interpreting what they are seeing in ortho imagery.", "\nSince an oblique image, by definition, is captured at an angle, it presents a more natural appearance because it shows the sides of objects and structures—what we are most accustomed to seeing. ", "In addition, because oblique images are not generally ortho-rectified, they are still in the natural appearance that the camera captures as opposed to the mathematical construction of the ortho image. ", "This combination makes it very easy for people to look at something in an oblique image and realize what that object is. ", "Photo interpretation skills are not required when working with oblique images.", "\nIn the past, people have used geo-referenced oblique images to measure objects and structures within the images as well as to be able to determine geographic locations of points within the image when preparing estimates for a variety of construction projects, such as roadwork, concrete work, and roofing. ", "Estimating construction projects using software is desirable in that it increases the speed at which an estimate can be prepared, and reduces labor and fuel costs associated with on-site visits. ", "For roofing, this is even more important since measuring an actual roof can be a costly and potentially hazardous job—especially with steeply pitched roofs.", "\nWith respect to estimating roofing projects, software for measuring the pitch of a roof of a building using a geo-referenced oblique image has been developed. ", "This software causes a computer system to display an oblique image, and provides a “pitch tool” to measure the area and pitch of a roof in an oblique image. ", "To measure pitch, the software permits the user to (1) click a pitch tool, (2) measure a height from the ground to the roofs eave by clicking at the ground, dragging to the eave, and then releasing the mouse button, (3) measure the height from the ground to the roof's peak, by clicking at the ground, dragging to the peak, and then releasing the mouse button, and (4) measure a distance of a ridge-line by clicking where the user last released the mouse, dragging along the ridge-line to the opposite end of the roof, and then releasing the mouse button.", "\nThe prior software displayed an area outline and a measurement on the image, and the following measurements appeared on a status bar: area, eave height, peak height, roof angle, roof, and roof pitch (rise over run).", "\nSoftware for measuring the slope of a roof without using elevation data has also been developed. ", "The software allows a user to measure slope (change in elevation between two points) without using elevation data by clicking a point in a first image at which to start the slope measurement. ", "A small red crosshair marked the starting point. ", "A corresponding point was clicked in a second image, and then a point in the first image at which to end the slope measurement was clicked. ", "A line connected the starting and ending points and a dialog box showed a slope, a distance, a height difference and a pitch.", "\nHowever, the prior software did not include any manner of automatically classifying roof elements, such as ridge lines, drip edges or eaves and the like so that reports including cumulative lengths of such roof elements could be automatically or semi-automatically prepared. ", "It is to such an improvement that the present disclosure is directed." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005477859522216022, 0.0006246786215342581, 0.0005626790807582438, 0.0005985352909192443, 0.0007938391645438969, 0.000847049814183265, 0.0006107666413299739, 0.000812976504676044, 0.0009625623933970928, 0.0008334308513440192, 0.0005797208286821842, 0.0005925622535869479, 0.0005602705641649663, 0.0005784249515272677, 0.0006832568324171007, 0.0005553332739509642, 0.0005968226469121873, 0.0005336027825251222, 0.0005759940831921995, 0.000639381178189069, 0.000567471724934876, 0.000675866031087935, 0.0006799362017773092, 0.000584369758144021, 0.0005899069947190583, 0.0005487495800480247, 0.0005884129786863923, 0.0006028669886291027, 0.0006223269156180322, 0.0005997844273224473, 0.0005918428651057184 ]

[ "Please see https://github.com/dotnet/aspnetcore/blob/master/CONTRIBUTING.md\n" ]

{ "pile_set_name": "Github" }

[ 0.0006907128845341504 ]

[ "Q:\n\nUnderstanding this Poisson Queueing Process\n\nConsider $N$ busses, each which breaks down independently at a rate of $\\mu$. Once a bus breaks down it is sent to a repair shop which can only repair one bus at a time and takes an exponentially distributed amount of time with parameter $\\lambda$ to repair it.", "\nI'm trying to find the equilibrium distribution of the number of busses in service.", "\nCould some one explain to me how to set this up? ", " Am I supposed to do a Q matrix? ", " Is $\\mu$ intended to be determinate, so that the first time around all buses break down at the same time, and then it takes an exponentially distributed amount of time with parameter $\\lambda$ for the first bus to exit the repair shop? ", " Then that would mean it would take twice the random variable for the next one to exit, and so on, but then as soon as one exists it comes back in $\\mu$ time. ", " Like I said I'm just lost as to how to set this up.", "\nThanks \n\nA:\n\nIf we write $N$ for the number of buses in operation, the system you describe is an M/M/$N$/$N$ queue. ", "State $0$ represents the situation where all buses are broken and $N$ when all are working. ", "The queue is finite capacity ($N$ can take values in $\\{0, ..., N\\}$), arrivals happen when a bus is repaired at rate $\\lambda$ and when there are $c$ buses in operation the buses break down at rate $c\\mu$. Note repairs can only happen when there is at least one broken bus so there is no $\\lambda$ transition from state $N$.\nThe system has a $Q$ matrix\n$$\nQ=\\begin{pmatrix}\n-\\lambda & \\lambda \\\\\n\\mu & -(\\mu+\\lambda) & \\lambda \\\\\n&2\\mu & -(2\\mu+\\lambda) & \\lambda \\\\\n&&3\\mu & -(3\\mu+\\lambda) & \\lambda \\\\\n&&&&\\ddots\\\\\n&&&&(N-1)\\mu & -((N-1)\\mu+\\lambda) & \\lambda \\\\\n&&&&&N\\mu & -(N\\mu) \\\\\n\\end{pmatrix}\n$$\nand therefore stationary distribution can be found by solving $\\pi Q = 0$ which gives\n$$\n\\pi_k = \\frac{(\\lambda/\\mu)^k}{k!} ", "\\left[\\sum_{k=0}^N \\frac{\\lambda^k}{\\mu^k k!} ", "\\right]^{-1}.", "\n$$\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000697652401868254, 0.0006119392928667367, 0.0006230363505892456, 0.0010575010674074292, 0.0009597185417078435, 0.0013812055112794042, 0.0006509203813038766, 0.0012187411775812507, 0.0031513343565165997, 0.012970179319381714, 0.16343489289283752, 0.0009517251746729016, 0.013080882839858532 ]

[ "Q:\n\nTokenising a String containing empty tokens\n\nI have a seemingly simple problem of splitting a comma separated String into tokens, whereby the output should include empty tokens in cases where:\n\nThe first character in the String is a comma.", "\nThe last character in the String is a comma.", "\nTwo consecutive commas occur.", "\n\nFor example, for the String: \",abd,def,,ghi,\" should yield the output: {\"\", \"abd\", \"def\", \"\", \"ghi\", \"\"}.", "\nI have tried using String.split, Scanner and StringTokenizer for this but each gives a different undesired output (examples below). ", " Can anyone suggest an elegant solution for this, preferably using JDK classes? ", " Obviously I could code something myself but I feel like I'm missing something on one of the three approaches mentioned. ", " Note that the delimiter is a fixed String although not necessarily a comma, nor a single character.", "\nExample Code\nimport java.util.*;", "\n\npublic class Main12 {\n public static void main(String[] args) {\n String s = \",abd,def,,ghi,\";\n String[] tokens = s.split(\",\");\n\n System.err.println(\"--- String.split Output ---\");\n System.err.println(String.format(\"%s -> %s\", s, Arrays.asList(tokens)));\n\n for (int i=0; i<tokens.length; ++i) {\n System.err.println(String.format(\"tokens[%d] = %s\", i, tokens[i]));\n }\n\n System.err.println(\"--- Scanner Output ---\");\n\n Scanner sc = new Scanner(s);\n sc.useDelimiter(\",\");\n while (sc.hasNext()) {\n System.err.println(sc.next());\n }\n\n System.err.println(\"--- StringTokenizer Output ---\");\n\n StringTokenizer tok = new StringTokenizer(s, \",\");\n while (tok.hasMoreTokens()) {\n System.err.println(tok.nextToken());\n }\n }\n}\n\nOutput\n$ java Main12\n--- String.split Output ---\n,abd,def,,ghi, -> [, abd, def, , ghi]\ntokens[0] =\ntokens[1] = abd\ntokens[2] = def\ntokens[3] =\ntokens[4] = ghi\n--- Scanner Output ---\nabd\ndef\n\nghi\n--- StringTokenizer Output ---\nabd\ndef\nghi\n\nA:\n\nPass a -1 to split as the limit argument:\nString s = \",abd,def,,ghi,\";\nString[] tokens = s.split(\",\", -1);\n\nThen your result array will include any trailing empty strings.", "\nFrom the javadocs:\n\nIf [the limit] is non-positive then the pattern will be applied as many times as possible and the array can have any length. ", " If [the limit] is zero then the pattern will be applied as many times as possible, the array can have any length, and trailing empty strings will be discarded. ", "\n\nCalling split(regex) acts as if the limit argument is 0, so trailing empty strings are discarded.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0010195615468546748, 0.0009259912185370922, 0.0006460398435592651, 0.0008021126850508153, 0.0006949827075004578, 0.000575319747440517, 0.0005725342780351639, 0.000737057242076844, 0.0008948834147304296, 0.0028604604303836823, 0.0005880505777895451, 0.0006566218216903508, 0.0010241654235869646, 0.0019954426679760218 ]

[ "The National Environmental Policy Act (NEPA) and participation rights should mean more, not less, on tribal lands when respect for tribal sovereignty and federal tribal trust responsibilities exists. ", "This Article proposes a rights-based approach to reinvigorate tribal treaty regimes based on a historico-legal analysis of the interconnected right-of-way doctrine and environmental impact statement process for pipeline projects in “Indian Country.” ", "This legal strategy will enrich the democratic approaches to tribal consultation, and respond to environmental justice concerns arising from lax regulations and the subsequent environmental degradation. ", "The aim of this Article is to reframe the responses to tribal environmental challenges on account of deficiencies in NEPA and prior tribal trust claims. ", "It also offers recommendations to overcome those challenges through analyzing the history of right-of-way regulations in Indian Country, the standards for impact statements, and treaty language. ", "Moreover, this Article assesses tribal sovereignty through the lens of energy infrastructure projects on Indian lands, and concludes that updates to the federal right-of-way law chisel away at tribal rights to land, property, and self-determination.[1] Without a thorough reassessment of the essential rights-of-way laws that affect pipeline permitting on tribal lands, tribal environmental sovereignty will be compromised, and tribal land will be more prone to environmental degradation and pollution from increased toxins and hazards associated with oil and gas transport. ", "This Article argues that using existing NEPA procedural remedies,[2] in concert with provisions from the updated rights-of-way regulations in Indian Country, provides project development and litigation outcomes more attenuated to Indian interests.[3]\n\nAmerican Indian tribes face exceptional land use, property, and environmental challenges because of hydrocarbon transport projects on their lands.[4] Due to the tribes’ various geographic locations throughout the United States, and their proximity to existing and future hydrocarbon reserves, pipelines crisscross tribal lands with increased frequency and carrying capacity.[5] A hydrocarbon transport project in a right-of-way corridor creates an economically efficient means of passage for energy resources, but such a project also sullies tribal property, sovereignty, and environmental rights. ", "From a legal perspective, a pipeline poses significant risks to the use and enjoyment of tribal land, and uniquely threatens sacred space.[6]\n\nWhile concern for pipeline siting is ubiquitous, what is less conspicuous––but equally significant––is the property and environmental rights impact of energy projects on tribal lands and on former tribal lands ceded to the United States.[7] More than 50 million acres of Indian trust lands exist in the United States.[8] Thousands of miles of easements traverse tribal lands for various purposes as crucial fragments of the national infrastructure.[9] Significant swaths of tribal lands lay within the path of major energy infrastructure projects.[10] American Indian communities experience an imbalanced proportion of environmental degradation on account of the mineral development in North America.[11]\n\nWithout improved tribal consultations and more robust treaty claims, the updated rights-of-way regulations in Indian Country will lead to a steady and blatant encroachment of tribal lands. ", "Moreover, this will also affect all future development of energy easements, including lands of the White Earth Band of Ojibwe in northwestern Minnesota, Navajo Nation in Texas and New Mexico, and the Seminole Tribe of Florida’s Big Cypress Reservation.[12] Under these regulations, native environmental protection concerns are devalued and underappreciated, particularly in negotiating and/or contesting pipeline siting and permitting.[13] Based on the unique nature of the pipeline industry and asset specificity, long distance pipelines create distinct financing and contracting matters.[14] “[A] century of dealing with oil and gas pipelines shows just how hard it is to keep them from being used as John D. Rockefeller first discovered they could be—as levers to frustrate competition in commodity markets and as profitable tollgates lying athwart commodity trade routes.", "”[15] The economics of the pipeline industry also make the business climate adverse to environmental and tribal land concerns.", "\n\nPart I provides the jurisdictional overlay of rights and duties involved with projects on tribal lands. ", "Part II examines the legal nuances in the development of right-of-way regulations in what constitutes Indian lands. ", "Parts II.C and II.D posit that NEPA sufficiently allows for stronger claims against pipeline projects. ", "Analyzing tribal challenges to pipelines in the cases of Sisseton-Wahpeton Oyate v. U.S. Department of State[16] and TransCanada Pipeline and White Earth Nation v. U.S. Department of State[17] showcases distinct methodological opportunities to take advantage of legal remedies implicit in NEPA.[18] To counter threats to tribal environmental sovereignty by an ever-expanding consortium of oil and gas operations, Part III offers an ancillary proposal of normative guidelines. ", "These guidelines heighten transparency, incorporate a richer understanding of the NEPA process in energy permitting, and enhance measures for a better participatory process to avoid legal showdowns, such as the Dakota Access Pipeline Project.", "\n\n[1] Rights-of-Way on Indian Lands, 80 Fed. ", "Reg. ", "79,258 (Dec. 21, 2015) (to be codified at 25 C.F.R. pt. ", "169) (promulgating a rule “streamlin[ing] the process for obtaining Bureau of Indian Affairs (BIA) grants of rights-of-way on Indian land and BIA land, while supporting tribal self-determination and self-governance”). ", "See also 25 C.F.R. pt. ", "169 (2016) (prescribing the procedures, terms, and conditions under which rights-of-way over tribal lands may be granted).", "\n\n[2] National Environmental Policy Act of 1969, 42 U.S.C. §§ 4331–4370 (2012). ", "The Revised Draft Guidance for Greenhouse Emissions and Climate Change Impacts of the White House Council on Environmental Quality (CEQ) provides additional support for environmental protection. ", "The legacy of previous attempts at climate change adaptation measures is diminishing with a new White House administration. ", "Yet, existing federal regulations and environmental protection measures—along with private-public partnerships—will minimize the assault on environmental rights by federal leadership that is attuned to the interests of the fossil fuel industry. ", "See White House Council on Environmental Quality, Revised Draft Guidance for Greenhouse Emissions and Climate Change Impacts 1–2 (Dec. 18, 2014), https://obamawhitehouse.archives.gov/sites/default/files/docs/nepa_revised_draft_ghg_guidance.pdf.", "\n\n[10]See Daniel W. Hester, Protection of Sacred Sites and Cultural Resources: An Obstacle to Development in Indian Country?, ", "23A Rocky Mtn. ", "Min. ", "L. Inst. ", "11 (1989) (noting that development of the Powder River region would impact the Norther Cheyenne Tribe).", "\n\nWhen Americans celebrated the 100th anniversary of Jane Jacobs’s birth this year, they reflected on her tireless advocacy for vibrant, diverse cities in the face of widespread urban renewal.[1] Jacobs championed an animated streetscape of unique buildings, old and new; an eclectic array of merchants; and colorful, if chaotic, sidewalk activity—essentially “an oasis with an irresistible sense of intimacy, cheerfulness, and spontaneity.", "”[2] Although urban renewal cut a path of destruction through the heart of many cities during the mid-twentieth century, Jacobs’s ideas lived on to shape the historic preservation movement and many other progressive policies that have influenced modern planning.[3]\n\nBut Jacobs’s fight is far from over. ", "Ironically, the renewed interest in urban living—and urban pioneering—that was sparked by her theories has reignited the same tensions that divided Jacobs and her contemporaries back in the 1950s: preservation versus demolition, old versus new, rich versus poor.[4] At the core of these tensions is an affordable housing crisis. ", "Consequently, the strides Jacobs made and the polices she advanced—particularly historic preservation—are being criticized by housing advocates as obstructing affordable housing development.[5]\n\nThus, on Jacobs’s 100th birthday, the question on the minds of many was: on which side of the affordable housing debate would Jacobs fall?[6] Would she side with affordable housing development or the preservation of historic districts?[7] It is impossible to answer this question, and not just because Jacobs is no longer around to opine on the issue, but because it is the wrong question. ", "We should be asking: how can historic preservation be used to further affordable housing goals?", "\n\nThe main argument from housing advocates is twofold: that the only way to create enough affordable housing to meet the demand is to build as much housing as possible, and that historic districts prevent development, thereby obstructing affordable housing growth.[8] This Article proposes that historic preservation is not the problem and that preservation is a necessary tool for creating and maintaining quality, affordable housing.", "\n\nPart I of this Article provides a background on the tension between historic preservation and affordable housing, and lays out the argument against historic preservation. ", "Part II examines the flawed assumptions on which the argument is premised, and explains why preservation is not the problem. ", "Part III illustrates how historic preservation can, in fact, further affordable housing goals. ", "Finally, Part IV explores ways in which historic preservation laws and policies can be strengthened to create more higher-quality affordable housing, while at the same time encouraging preservation.", "\n\n[4]See Peter Moskowitz, Bulldoze Jane Jacobs, Slate (May 4, 2016), http://www.slate.com/articles/business/metropolis/2016/05/happy_100th_birthday_jane_jacobs_it_s_time_to_stop_deifying_you.html (arguing that Jacobs’s vision of urbanism had shortcomings that today are being realized, as once-diverse neighborhoods have become “all-white, aesthetically suburban playground[s] for the rich”).", "\n\n[5]See, e.g., Conor Dougherty, In Cramped and Costly Bay Area, Cries to Build, Baby, Build, N.Y. Times (Apr. 16, 2016), https://nyti.ms/2kmANOG (reporting on a pro-development renters group in San Francisco, the SF Bay Area Renters’ Federation, or SFBARF, which argues that the city needs as much new development as possible, no matter the consequences). “", "You have to support building, even when it’s a type of building you hate,” said the head of SFBARF. ", "Id.; see also Gabriel Metcalf, What’s the Matter with San Francisco?, ", "CityLab (July 23, 2015), http://www.citylab.com/housing/2015/07/whats-the-matter-with-san-francisco/399506/?utm_source=SFFB (explaining that progressive policies developed to respond to blight and urban disinvestment during the twentieth century are not effective in dealing with modern-day problems of rapid population growth and high housing costs).", "\n\n[6] Kriston Capps, Whose Side in the Housing Wars Would Jane Jacobs Take Up Today?, ", "CityLab (May 4, 2016), http://www.citylab.com/work/2016/05/would-jane-jacobs-be-a-nimby-or-yimby-bob-dylan/481269.", "\n\nThere is a broad consensus in the United States that we incarcerate too many people for non-violent narcotics crimes.[1] One way to address that issue, at least within the federal system, is through the use of federal clemency.[2] While President Obama used the Pardon Power in a significant way to grant commutations to 1,715 prisoners,[3] he accomplished this in spite of an archaic, bureaucratic review process that limited his results. ", "To use the Pardon Power consistently and effectively, Obama’s successors must reform the process of consideration.", "\n\nFor centuries, the United States maintained a relatively simple system for the review of federal clemency petitions.[4] That changed in the 1980s, and we now have 7 to 12 levels of review[5] to arrive at the same decision: whether to grant or deny a petition for clemency. ", "Since that shift towards complexity, grant rates have plunged,[6] and the Pardon Power has largely either been ignored or a source of political scandal.[7] While President Obama cranked this archaic machine faster, he did not replace it.[8] To fix the problem, we need to restore simplicity to this essential mechanism of mercy created by the Constitution.[9] This article sets out why reform is necessary in the face of an unproductive bureaucracy, and how that reform should be structured.", "\n\nOur greatest president[10] had the simplest approach of all: Abraham Lincoln met personally with those seeking clemency on behalf of themselves or others.[11] Job Smith’s father, for example, waited in tears in Lincoln’s anteroom.[12] His son had been court-martialed and sentenced to die. ", "When the old man told Lincoln about his son, Lincoln’s face reflected a “cloud of sorrow” according to a witness.[13] There was a complication to clemency, though. ", "The condemned soldier served in General B.F. Butler’s Army of the James, and Butler had just sent Lincoln a note imploring him “not to interfere with the courts-martial of the army.", "”[14] In the end, contrary to the General’s request and in the presence of the soldier’s father, Lincoln spared Job Smith’s life.[15]\n\nContrast that with the process a prisoner faced when seeking clemency from President Obama in 2016. ", "The process had changed in a century and a half. ", "A prisoner’s father would not get to chat with the president, of course; that one degree of separation between the president and Job Smith’s father has blossomed into no less than 12 discrete, successive reviews by people with different interests, values, and filters from one another.[16]\n\nA typical non-violent narcotics prisoner in 2016 likely would have filed his clemency petition through the Clemency Project 2014,[17] a special program established by the Obama Administration and five outside organizations.[18] The Clemency Project 2014 was directed towards petitioners who met certain criteria.[19] Here is a lightning-round synopsis of the harrowing review process one of those cases was subjected to as it coursed through that Clemency Project and then the Administration’s review process, with each step in succession. ", "It was:\n\n(1) Screened by a Clemency Project staffer;\n\n(2) Sent to a lawyer for examination and summary;\n\n(3) Reviewed by a committee of three;\n\n(4) Revised, then reviewed, by a committee of five;\n\n(5) Returned to the lawyer, then returned to and reviewed by the Clemency Project as a petition;\n\n(6) Submitted to the staff of the pardon attorney, and then reviewed by that staff;\n\nJob Smith’s father was told on the spot that President Lincoln was sparing his son’s life. ", "We cannot expect a president today to meet each clemency applicant personally.[21] Still, we can make the system more effective, fair, and efficient by removing at least some of these levels of bureaucracy. [", "22] This article will examine the problem, look to examples in the states and prior administrations, and describe two options for a new and thorough—yet efficient—clemency process.", "\n\nPart II recounts how we got into this swamp, then describes the process under the Obama Administration, summarized above. ", "It is a story that involves a dizzying array of players with very different backgrounds and tasks. ", "Importantly, many of those charged with analyzing clemency cases are generalists; they have many and sometimes conflicting tasks other than the review of petitions for clemency.", "\n\nPart III examines a few of the higher-functioning state processes for clemency and looks for commonalities. ", "A prior federal effort also warrants discussion—President Ford’s Presidential Clemency Board, which granted pardons to thousands of draft evaders and wartime deserters.[23]\n\nFinally, Part IV describes a model for a new federal clemency process based on the high-functioning systems already described. ", "President Ford’s clemency board and the structure used by productive state systems share certain key elements—most importantly, the use of a board that has some degree of independence in making its determinations.", "\n\nWe live in an era where bureaucracy is in the decline. ", "Microsoft, with 6 to 12 layers of bureaucracy, has lost much of its business to a flatter-structured upstart, Google.[24] Analysts like Gary Hamel have concluded that “[t]here’s no other way to put it: bureaucracy must die. ", "We must find a way to reap the blessings of bureaucracy—precision, consistency, and predictability—while at the same time killing it. ", "Bureaucracy, both architecturally and ideologically, is incompatible with the demands of the 21st century.", "”[25]\n\nThe complex bureaucracy we have in place to evaluate clemency is not just a bad system by modern standards. ", "It is a corruption of the intent of those who wrote the United States Constitution. ", "Alexander Hamilton argued that “[h]umanity and good policy conspire to dictate, that the benign prerogative of pardoning should be as little as possible fettered or embarrassed.", "”[26] Our machine of mercy and justice is unduly fettered, and it is we who should be embarrassed.", "\n\n[1] Erik Eckholm, Cutting the Federal Prison Population Will Be Hard. ", "Here’s Why, N.Y. Times (Oct. 26, 2015), https://www.nytimes.com/2015/10/28/upshot/cutting-federal-prison-population-will-be-hard-heres-why.html. ", "Eckholm points out that there is much less of a consensus around lowering sentences for those convicted of violent crimes. ", "Id.\n\n[2] The vast majority of prisoners, of course, are held in state prisons. ", "Id. Each state system has its own clemency process, though these vary wildly in efficacy. ", "For a good examination of state clemency processes, see Margaret Colgate Love, Reinvigorating the Federal Pardon Process: What the President Can Learn from the States, 9 U. St. Thomas L.J. 730, 731 (2012) [hereinafter Love, Reinvigorating the Federal Pardon Process]. ", "See also id. at 732, 744 (suggesting ways to restore presidential pardoning in the federal justice system).", "\n\n[8] President Obama’s grants of commutation (shortening of a sentence) were historically significant, but only came after more than seven years of frustration, and through largely ignoring pardons (which restore rights after a sentence has been served). ", "Clemency Statistics, supra note 6.", "\n\n[10]Id. ", "Any judgment of a president’s value is necessarily subjective. ", "Lincoln was ranked best in a recent poll of the American Political Science Association’s “Presidents and Executive Politics” section. ", "Brandon Rottinghaus & Justin Vaughn, New Ranking of U.S. Presidents Puts Lincoln at No. ", "1, Obama at 18; Kennedy Judged Most Overrated, Wash. Post (Feb. 16, 2015), https://www.washingtonpost.com/blogs/monkey-cage/wp/2015/02/16/new-ranking-of-u-s-presidents-puts-lincoln-1-obama-18-kennedy-judged-most-over-rated.", "\n\n(1) Defendant would have received a substantially lower sentence today;\n\n(2) The offense was non-violent;\n\n(3) Defendant was a low-level offender;\n\n(4) Defendant has no significant ties to large-scale criminal organizations, gangs, or cartels;\n\n(5) Defendant has served at least ten years in prison;\n\n(6) Defendant has no significant criminal history;\n\n(7) Defendant has demonstrated good conduct in prison; and\n\n(8) Defendant has no history of violence prior to or during his or her term of incarceration.", "\n\nIn some iterations, the second, third, and fourth criteria were conflated, and “six” criteria were listed. ", "See Pocket Guide to the Clemency Project 2014 Process (with Checklist) 8–11, https://www.stthomas.edu/media/interprofessionalcenter/PocketGuidev3.pdf (last updated July 13, 2015) (listing criteria required by the Department of Justice).", "\n\n[21]Id. ", "In fact, that did not even work very well for Lincoln. ", "His staff eventually learned that they had to control access to the President so that important work could be done. ", "Love, TheTwilight of the Pardon Power, supra note 11, at 1177 (commenting on the importance of ensuring that President Lincoln met only the “most deserving” clemency cases).", "\n\n[22] The current system has produced some shockingly unfair outcomes, including remarkable racial disparities. ", "A ProPublica analysis of George W. Bush’s clemency record found that, “[a]ll of the drug offenders forgiven during the Bush administration at the pardon attorney’s recommendation — 34 of them — were white.” ", "Dafna Linzer & Jennifer LaFleur, ProPublica Review of Pardons in Past Decade Shows Process Heavily Favored Whites, Wash. Post (Dec. 3, 2011), https://www.washingtonpost.com/investigations/propublica-review-of-pardons-in-past-decade-shows-process-heavily-favored-whites/2011/11/23/gIQAElnVQO_story.html.", "\n\n[23]See infra Part III.B–C (explaining the work of President Ford’s Clemency Board).", "\n\nThroughout history, there has been a long line of cases where prosecutors have attempted to stretch statutes to cover conduct that they consider criminal.[1] Clearly, prosecutors have enormous discretion to pick and choose whom to charge, what to charge,[2] when to charge,[3] and whether to proceed against individuals or entities.[4] Likewise, prosecutors decide who will receive immunity,[5] who will get a plea benefit,[6] and whether a pending case will be dismissed.[7]\n\nAlthough prosecutors do not have “unfettered” discretion,[8] there are very few restrictions on their discretionary power.[9] It is not prohibited for prosecutors to act arbitrarily,[10] and few defendants have succeeded in the dismissal of an indictment absent a showing that the alleged conduct did not match the crime charged or was a result of vindictive action.[11]\n\nThis Essay examines prosecutorial discretion that stretches statutes beyond statutory language, congressional intent, or policy. ", "Although cases of prosecutorial stretching occur throughout the context of criminal law, this piece focuses on the stretching of statutes in the white collar context.", "\n\nIn the past, stretching of statutes or creative prosecutions was sometimes justified with claims that existing statutes did not cover the misconduct.[12] For example, prior to the passage in 1970 of the Racketeered Influenced Corrupt Organization Act (RICO),[13] individuals engaged in organized crime were commonly indicted and convicted for tax crimes.[14] Likewise, prior to the passage of the Computer Fraud and Abuse Act,[15] prosecutors used the National Stolen Property Act[16] and Wire Fraud[17] statutes to proceed against computer misconduct.[18] But the growth of criminal statutes makes looking beyond the explicit language of the legislation less warranted.[19]\n\nThis Essay looks at three areas of white collar crime that have seen prosecutorial statute stretching: fraud,[20] obstruction-of-justice,[21] and bribery.[22] Within each of these areas, there are many examples of both historical and recent cases requiring judicial oversight to halt prosecutorial practices.[23] This Essay concludes by noting that prosecutors who stretch statutes do a disservice to our judicial system. ", "It is important to strictly construe white collar statutes to assure that criminal conduct is recognized and conformity with the law is promoted.[24]\n\n[7]See, e.g., Best v. City of Portland, 554 F.3d 698, 702 (7th Cir. ", "2009) (“[U]nder Indiana law, a prosecutor may voluntarily dismiss an indictment or information before trial for any reason and without court approval.”). ", "Prosecutors also have discretion with respect to many related decisions, such as whether to give a defendant a 5K1.1 motion for substantial assistance, a motion that can reduce the sentence. ", "Julie Gyurci, Note, Prosecutorial Discretion to Bring a Substantial Assistance Motion Pursuant to a Plea Agreement: Enforcing a Good Faith Standard, 78 Minn. L. Rev. 1253, 1260 (1994) (discussing the discretion afforded to prosecutors in filing a motion that serves as an exception to the legislative restrictions of mandatory-minimum sentences).", "\n\n[8] Wayte v. United States, 470 U.S. 598, 608 (1985) (“[A]lthough prosecutorial discretion is broad, it is not ‘unfettered.’”) (", "quoting United States v. Batchelder, 442 U.S. 114, 125 (1979)).", "\n\n[9] Prosecutorial discretion is limited by the use of improper factors. ", "See United States v. LaBonte, 520 U.S. 751, 762 (1997) (“[D]iscretion is an integral feature of the criminal justice system, and is appropriate, so long as it is not based upon improper factors.”). ", "Additionally, there are ethical restrictions that apply to prosecutorial decision-making. ", "See Model Rules of Prof’l Conduct r. 3.8 (Am. ", "Bar Ass’n 2016) (stating that prosecutors shall “refrain from prosecuting a charge that the prosecutor knows is not supported by probable cause”). ", "See Standards for Criminal Justice Prosecution Function and Defense Function § 3-3.9 (Am. ", "Bar Ass’n 1993), for more extensive guidance.", "\n\n[10] United States v. Armstrong, 517 U.S. 456, 465 (1996) (citing Wayte, 598 U.S. at 608).", "\n\n[11] The Supreme Court has held that there is no presumption of vindictiveness. ", "United States v. Goodwin, 457 U.S. 368, 384 (1982). ", "In United States v. Armstrong, the Supreme Court held that “[i]n order to dispel the presumption that a prosecutor has not violated equal protection, a criminal defendant must present ‘clear evidence to the contrary.’” ", "Armstrong, 517 U.S. at 465 (quoting United States v. Chem. ", "Found., ", "272 U.S. 1, 14–15 (1926)).", "\n\n[12]See, e.g., Tod H. Flaming, Comment, The National Stolen Property Act and Computer Files: A New Form of Property, a New Form of Theft, 1993 U. Chi. ", "L. Sch. ", "Roundtable 255, 256, 290 (1993) (discussing Dowling v. United States, 473 U.S. 207 (1985), and noting the confusion lower courts faced in addressing stolen computer files under the National Stolen Property Act).", "\n\n[19]See Brian W. Walsh & Tiffany M. Joslyn, Heritage Found. & ", "Nat’l Ass’n of Criminal Def. ", "Lawyers, Without Intent: How Congress is Eroding the Criminal Intent Requirement in Federal Law 6 (2010), http://s3.amazonaws.com/thf_media/2010/pdf/WithoutIntent_lo-res.pdf (discussing an estimated 4,450 criminal statutes by the end of 2007); Jim E. Levine, From the President: Faces of Overcriminalization, Champion, Nov. 2010, at 1, 5 (noting that there are an estimated 4,450 federal crimes and “quite possibly as many as 300,000 federal regulations that can be enforced criminally”); John S. Baker, Jr., Jurisdictional and Separation of Powers Strategies to Limit the Expansion of Federal Crimes, 54 Am. ", "U. L. Rev. 545, 547 (2005) (discussing how to limit the expansion of federal criminal law); William J. Stuntz, The Pathological Politics of Criminal Law, 100 Mich. L. Rev. 505, 512 (2001) (“Criminal law is both broad and deep: a great deal of conduct is criminalized, and of that conduct, a large proportion is criminalized many times over.”).", "\n\n[20] Although the focus here is on the mail and wire fraud statutes, 18 U.S.C. §§ 1341–1342, it is recognized that many of the fraud statutes that exist in the federal criminal code are modeled after these two statutes. ", "See, e.g., 18 U.S.C. § 1344 (bank fraud statute).", "\n\n[21] Although there are many obstruction-of-justice statutes in the United States Code, a more recent statute is selected here, 18 U.S.C. § 1519 (2012), to demonstrate prosecutorial statutory stretching.", "\n\n[22] There are many bribery statutes in the United States Code. ", "The focus here is on 18 U.S.C. § 201 (2012).", "\n\n[23] Prosecutorial statutory stretching is not limited to these white collar areas, nor are all cases of prosecutorial stretching rejected by the courts. ", "See, e.g., United States v. McNab, 331 F.3d 1228, 1247 (11th Cir. ", "2003) (affirming a conviction under the Lacey Act for an alleged violation of Honduran law); id. (Fay, J., dissenting) (pointing out that the Honduran government found the alleged violation to be “null and void”).", "\n\n[24] This Essay is not exclusively focused on the Rule of Lenity, which “requires ambiguous criminal laws to be interpreted in favor of the defendants subjected to them.” ", "United States v. Santos, 553 U.S. 507, 514 (2008). ", "Rather, the focus is on the prosecutor who stretches a statute to fit alleged misconduct that is not encompassed within the law, intent, or the policy rationale for it being part of the criminal code.", "\n\nIn 2015, approximately 1.3 million refugees crossed into Europe in hopes of seeking asylum.[1] They arrived by sea and also crossed devastated lands.[2] The majority of the refugees in 2015 hailed from Syria, Afghanistan, and Iraq—war-torn countries whose violence has spurred an exodus to the proverbial Promised Land.[3] But is Europe indeed a continent that will equitably cater to each of these refugees? ", "It has certainly tried. ", "But it has certainly failed, as well.", "\n\nThe greatest health risk in the world today is hunger.[1] One out of nine people in the world do not get enough to eat—meaning they do not get enough calories, nutrients, or both.[2] Hunger and malnutrition threaten global health at a greater rate than AIDS, malaria, and tuberculosis combined.[3]\n\nHunger is not restricted to developing nations. ", "Fourteen percent of United States households are food insecure—they cannot consistently access enough food for their households.[4] Closer to home, nearly 80,000 Vermonters, more than 20,000 of whom are children, are food insecure.[5] More than a third of Vermonters report they cannot afford to buy nutritious food, or they cannot buy enough food.[6]\n\nIn January 2014, members of the civil society network, Global Alliance for the Rights of Nature, held the world’s first International Tribunal for the Rights of Nature and Mother Earth (International Tribunal) in Quito, Ecuador. ", "Since that time, the International Tribunal has met in Lima, Peru and Paris, France in parallel with the Conference of Parties for UN climate change negotiations, and Regional Chambers of the International Tribunal have been held in the United States and Australia.[1] Given that the International Tribunal has emerged from civil society rather than state-centered international law, and given that countries like Australia and the United States do not recognize, in State or Federal law, the intrinsic rights of plants, animals, or ecosystems to exist, what possible benefits do Rights of Nature Tribunals offer the natural world, and what impact can they have on the current legal system?", "\n\nIn this paper, I outline the creation and ongoing hearings of the International Tribunal and its Regional Chambers and provide an overview of Earth jurisprudence, the emerging theory of Earth-centered law and governance from which the Tribunals have emerged. ", "I then contextualize the Rights of Nature Tribunals within the phenomenon of peoples’ tribunals during the twentieth and twenty-first centuries. ", "I suggest that like many “peoples’ tribunals” before them, Rights of Nature Tribunals provide a powerful voice for civil society concerns and create an alternative narrative to that offered by western legal systems regarding environmental destruction. ", "They also have the potential to play a role in transforming existing law and offer a welcome, cathartic contribution to the burgeoning field of Earth jurisprudence.", "\n\nAmerican military criminal law does not often receive much attention outside the military and its law journals. ", "But for the first time in over three decades, Congress will debate sweeping reforms to the United States military’s legal system proposed by the Department of Defense (DoD) that, if enacted, would further civilianize the military’s criminal code.[1] Just a few years ago, the acclaimed documentary The Invisible War brought the issue of sexual assault in the U.S. military to the forefront of national attention.[2] This film prompted sustained attacks by certain members of Congress regarding how the military prosecutes sexual assault cases, as well as the creation of numerous panels to study different aspects of the military’s approach to sexual assault investigation and prosecution.[3] On its own initiative, the DoD took a broader view and initiated a comprehensive review of the entire military legal system.[4] The result of this review is the DoD-proposed Military Justice Act of 2016, a wide-ranging proposal that substantially civilianizes a legal system already radically civilianized compared to its original enactment in 1775.[5] However, one institution critical to the military’s legal system will escape all scrutiny by both Congress and the DoD—its highest court, the United States Court of Appeals for the Armed Forces (CAAF). ", "This article closes that gap.", "\n\nThough an Article I court, CAAF is an independent judicial body.[6] Its budget flows through the DoD, but Congress has made it clear that CAAF is located within the DoD “for administrative purposes only . . . ", ".”[7] Like all judicial bodies, it should benefit from ongoing scrutiny. ", "Its early judges agreed and invited such scrutiny.[8] Though the military services law review journals and numerous civilian journals publish works analyzing specific aspects of military law, few, if any, include structural analyses of the military’s appellate institutions generally, and CAAF specifically.[9] This type of study has not occurred since the 1970s.[10] Thus, CAAF, and consequently military law, has evolved over the last 50 or so years without much scrutiny of its role within the military justice system and whether its conduct is consistent with its role. ", "No comprehensive understanding of the military justice system is complete without a better understanding of its highest court.", "\n\nThis article attempts to further the understanding of CAAF’s role in the military justice system by examining CAAF’s effectiveness as the court of last resort within this system. ", "This is accomplished by answering a series of questions. ", "First, what is a court of last resort? ", "Second, is CAAF viewed as a court of last resort in the military judicial hierarchy, or is it viewed as the first real intermediate appellate court, with the service courts acting as mere reviewing agencies? ", "Third, if CAAF is viewed as a court of last resort, does it act like one?", "\n\nThis article concludes that CAAF is a court of last resort that, far too often, acts as an intermediate error-correction court. ", "This conclusion raises both concerns and opportunities for a legal system facing ongoing scrutiny over its legitimacy. ", "Each of the questions presented above are answered in order. ", "Part I introduces the role of a court of last resort in a judicial system. ", "Courts of last resort in a two-tiered system primarily focus on declaring what the law is, not error correction. ", "This role is concerned with the development of the law. ", "Error correction is the primary task of intermediate courts.[11] Part II turns the focus to the perceptions of CAAF, perceptions by both the Supreme Court of the United States (Court) and CAAF itself. ", "Even during periods in which the Court expressed grave concern over the legitimacy and competency of the military justice system, it has always viewed CAAF as the court of last resort within that system.[12] Likewise, CAAF has always asserted itself as the court of last resort in the military justice system.[13] Though CAAF expressed this view less in recent years, it has never retreated from its earlier declarations that it was the military’s supreme court.[14]\n\nPart III begins the inquiry into whether CAAF acts like a court of last resort describing the methodology used to obtain, review, and classify the relevant data. ", "The sample size consisted of each published decision from four select terms: 1951–52, 1968–69, 1994–95, and 2014–15. ", "The first three selected terms followed the enactment of legislation that specifically intended to clarify CAAF’s status as an independent and important federal court. ", "Presumptively, these terms transpired when CAAF was most aware of its enhanced prestige. ", "The 2014–15 term represents CAAF’s most recent full term, thus presenting the opportunity to examine its recent conduct. ", "Based on the criteria established in Part I, each decision in these terms was given one of ten codes to classify it as either an error correction decision or a declaration of law. ", "Nine of the codes mark the nine bases for granting review common amongst courts of last resort. ", "The tenth code marks the decision as one of error correction. ", "In addition to the first three terms, the Court’s 2014–15 term was reviewed and coded for validation. ", "Proper coding should result in a high total number, indicating more declaration decisions by the Court.", "\n\nPart IV analyzes the results of this examination. ", "It concludes that each term contained an extraordinary number of error correction decisions, at times making up nearly 90% of all decisions in a given term. ", "Furthermore, when CAAF does issue a law declaration decision, thus acting as a court of last resort, it often does not frame the issues or address them in a manner one would expect from such a court. ", "The discussion in Part IV offers some initial potential explanations, which ultimately narrow down the question to whether CAAF understands its role, and if it is properly served by its lower courts and appellate counsel. ", "Part V offers a procedural and substantive framework for approaching petitions for review and subsequent decisions based on the available data. ", "This includes suggesting CAAF make clear when it is conducting error correction and when it is conducting law declaration—and why the distinction is important. ", "Finally, this article concludes with a call for examination of the historically high level of error correction decisions issued by CAAF.", "\n\n[3] Senator Kristin Gillibrand, D-NY, first introduced the Military Justice Improvement Act of 2013, which sought to remove the authority to decide whether to prosecute sexual assault cases from military commanders and place that authority in senior attorneys outside the chain of command. ", "S. 967. ", "Sen. Gillibrand’s bill did not make it out of committee, but the substantial interest she generated had an impact. ", "The subsequent National Defense Authorization Act (NDAA) created two panels focused on the prosecution of sexual assault cases. ", "National Defense Authorization Act for Fiscal Year 2013, Pub. ", "L. No. ", "112-239, § 576, 126 Stat. ", "1632, 1758–62 (2013). ", "The charter of the Judicial Proceedings Since Fiscal Year 2012 Amendments Panel (Judicial Proceedings Panel) directed its membership to review judicial proceedings in such cases for the purpose of gathering statistics, determining trends, and making recommendations on improving military judicial proceedings. ", "The Judicial Proceedings Since Fiscal Year 2012 Amendments Panel, Charter 1–3 (2012). ", "In addition, the charter of the Response Systems to Adult Sexual Assault Crimes Panel (Response Systems Panel) directed its members to investigate “the systems used to investigate, prosecute, and adjudicate . . . .” ", "sexual assault and related offenses. ", "Response Sys. ", "to Adult Sexual Assault Crimes Panel, Charter 1 (2013). ", "Part of this directive included investigating whether military commanders should retain their authority in the military legal system, known as the military justice system. ", "Id. at 1. ", "The panel concluded they should. ", "Carl Levin, et al., ", "Report of the Response Systems to Adult Sexual Assault Crime Panel 6–7, 22–23, 36–37, 161–71, 173–74 (2014). ", "Partly in response, Sen. Gillibrand re-introduced the Military Justice Improvement Act. ", "Military Justice Improvement Act of 2014, S. 2992, 113th Cong. (", "2014). ", "It fell a few votes short in a cloture vote, 55-45. ", "On the Cloture Motion S. 1752, GovTrack, https://www.govtrack.us/congress/votes/113-2014/s59 (last visited Nov. 22, 2016).", "\n\n[4] During the same period that the NDAA directed the establishment of the Judicial Proceedings Panel and the Response Systems Panel, the DoD established the Military Justice Review Group (MJRG) to perform a comprehensive review of the Uniform Code of Military Justice (UCMJ), the Manual for Courts-Martial (MCM), and the applicable service regulations. ", "Memorandum from the Secretary of Defense on a Comprehensive Review of the Uniform Code of Military Justice to Secretaries of the Military Departments, et al. (", "Oct. 18, 2013), http://www.dod.gov/dodgc/images/mjrg_secdef_memo.pdf. ", "The last such review occurred in 1983, with many piecemeal amendments since then. ", "Id. The MJRG conducted hearings and received information for two years; its proposals then underwent approximately a month of internal DoD review. ", "SeeMilitary Justice Review Group, Dep’t of Defense, http://www.dod.gov/dodgc/mjrg.html (last visited Nov. 22, 2016) (providing documents related to the DoD’s review of the military justice system). ", "Subsequently, the DoD proposed the Military Justice Act of 2016 on December 28, 2015, based on the MJRG’s initial report. ", "Press Release, U.S. Dep’t of Def., ", "Department of Defense Forwards to Congress Proposed Changes to the Uniform Code of Military Justice (Dec. 28, 2015), http://www.defense.gov/News/News-Releases/News-Release-View/Article/638095/department-of-defense-forwards-to-congress-proposed-changes-to-the-uniform-code.", "\n\n[6] In its report, the MJRG stated that “[i]n view of the judicial independence of the Court, the Department of Defense, as a matter of policy, typically has deferred to the Court with respect to initiating any legislative proposal that might be necessary in the interests of judicial administration.” ", "Military Justice Review Group, Report of the Military Justice Review Group, Part: 1: UCMJ Recommendations 1020 (Dec. 22, 2015), http://www.dod.mil/dodgc/images/report_part1.pdf.", "\n\n[8] Robert E. Quinn, The Court’s Responsibility, 6 Vand. ", "L. Rev. 161, 162 (1953). ", "Chief Judge Quinn eagerly welcomed scrutiny: “It is my hope that the bar, individually and through its legal journals, will follow closely the work of this Court. ", "They can perform a most valuable function in weighing individual cases against the dichotomatic concept of military justice and tell the public, the services and us, the judges, whether we are performing properly our task of enunciating principles worthy of existence in this relatively new field of law.” ", "Id.\n\n[9]See, e.g., Eugene R. Fidell, Is There a Crisis in Military Appellate Justice?, ", "12 Roger Williams U. L. Rev. 820, 820 (2007) (“The highest court of the jurisdiction — The United States Court of Appeals for the Armed Forces — is turning out careful, scholarly opinions that are easily on par with the work of the geographical circuits.”); ", "Jonathan Lurie, Presidential Preferences and Aspiring Appointees: Selections to the U.S. Court of Military Appeals 1951-1968, 29 Wake Forest L. Rev. 521 (1994) (exploring the politicized nature of presidential appointments to the U.S. Court of Military Appeals); Scott L. Silliman, The Supreme Court and Its Impact on the Court of Military Appeals, 18 A.F. L. Rev. 81, 82 (1976) (considering the Court of Military Appeals’ status within the military justice system).", "\n\n[10]See, e.g., Daniel H. Benson, The United States Court of Military Appeals, 3 Tex. ", "Tech L. Rev. 1, 2 (1971) (describing the structure of CAAF); John S. Cooke, The United States Court of Military Appeals, 1975-1977: Judicializing the Military Justice System, 76 Mil. ", "L. Rev. 43, 44 (1977) (discussing the effects of transforming the military justice system during the late 1970s); John T. Willis, The United States Court of Military Appeals: Its Origin, Operation and Future, 55 Mil. ", "L. Rev. 39 (1972) (providing a history of the Court of Military Appeals and its role); John T. Willis, The Constitution, The United States Court of Military Appeals and the Future, 57 Mil. ", "L. Rev. 27, 27 (1972) (examining the decisions and structure of the Court of Military Appeals), John T. Willis, The United States Court of Military Appeals – “Born Again”, 52 Ind. L.J. 151, 153 (1976) (discussing precedent-breaking decisions, supervisory review and civilianization by the Court of Military Appeals).", "\n\n[11] To be fair, there is some discussion that this distinction is not so clear; courts of last resort and intermediate courts routinely engage in a two-way communication in the law development function. ", "See, e.g., Doni Gewirtzman, Lower Court Constitutionalism: Circuit Court Discretion in a Complex Adaptive System, 61 Am. ", "U. L. Rev. 457, 462, 464 (2012) (arguing the circuit courts’ role is to maintain stability and help evolve the judicial system); Evan H. Caminker, Precedent and Prediction: The Forward-Looking Aspects of Inferior Court Decisionmaking, 73 Tex. ", "L. Rev. 1, 7–8 (1994) (comparing and contrasting two models of behavior in inferior courts, namely (1) deference to existing superior court precedents and (2) predictions of future superior court rulings). ", "However, this article structures the roles of each level in accordance with the American Bar Association’s Standards Relating to Court Organization. ", "See Gerald B. Cope, Jr., Discretionary Review of the Decisions of Intermediate Appellate Courts: A Comparison of Florida’s System with Those of the Other States and the Federal System, 45 Fla. L. Rev. 21, 27 (1993) (citing Standards Relating to Court Org. § ", "1.13 commentary at 39–40 (1990)).", "\n\nThe state of Maine has a complicated and often adversarial legal relationship with the federally recognized Native American (Indian) Tribes in the state.[1] Perhaps the most contentious legal relationship presently pertains to Maine’s authority to regulate water resources on Indian territories and lands (Indian lands).[2] At their core, legal conflicts often involve disputes over power, money, respect, or any combination of these elements.[3] What makes conflicts between states and Native American tribes so complex, and in this particular case volatile, is that the legal issues often involve clashes of all three of these elements.[4] The legal framework for the current water resource dispute traces back to a series of state and federal laws setting aside reservation and trust land for the Tribes in the 1980s and 1990s, collectively known as the Settlement Acts.[5] The Tribes’ lack of bargaining power during these settlements arguably resulted in a jurisdictionally oppressive framework for the protection of tribal natural resources.[6] The most recent legal conflict erupted in February 2015, and juxtaposes Maine’s right to regulate water quality standards (WQS) against the Tribes’ right to fish for sustenance on their lands.[7] The emotional responses ignited by this conflict illuminate why a comprehensive approach to settling the disputes between Maine its Tribes is needed.", "\n\nFitzgerald v. Fitzgerald. ", "May this case be branded on the mind of every family law attorney. ", "The husband, Thomas, was the plaintiff, and in conformity with the typical situation, the debtor in bankruptcy. ", "The wife, Sandra, was the defendant in the divorce complaint and creditor-spouse in bankruptcy. ", "The parties negotiated a property settlement. ", "The court incorporated the stipulation into a divorce decree. ", "The stipulation required the husband to make an equalizing payment to the wife. ", "He did not. ", "Instead, only one month after the divorce decree, the husband filed for bankruptcy. ", "Though she entered her appearance as a creditor in bankruptcy court, the wife chose to seek a remedy in Vermont state court. ", "She did not object to the discharge of the husband’s debt to her in bankruptcy court. ", "Rather, she filed a Rule 60(b) motion for fraud and misrepresentation with the family court. ", "Prior to the Rule 60(b) hearing, the husband successfully attained a discharge of the equalizing payment to wife in the bankruptcy case. ", "Sandra’s slaughter was complete.", "\n\nThe trial court dismissed the wife’s 60(b) motion as barred by the husband’s discharge in bankruptcy. ", "On appeal, the Vermont Supreme Court held that Title 11 U.S.C. § 523(c) provides that a creditor must pursue an exception from discharge for a debt based on fraud or deceit in the bankruptcy forum. ", "Given that the wife failed to do so, the discharge of the equalizing payment granted by the bankruptcy court was “an injunction against the commencement or continuation of an action, the employment of process, or any act, to collect, recover or offset any such debt as a personal liability of the debtor, or from property of the debtor, whether or not discharge of such debt is waived . . . .” ", "The court stated that an attempt to distinguish the reopening of the underlying judgment, pursuant to Rule 60(b), from enforcement of the discharged debt was “illusory.” ", "The Vermont Supreme Court further held that res judicata barred the wife from re-litigating the claim; “[f]inal orders of a bankruptcy court are res judicata as to all matters that were or could have been litigated before that court.”", "\n\nThough Fitzgerald was litigated in 1984, the Bankruptcy Abuse Prevention and Consumer Protection Act of 2005 (BAPCPA) continues to enable a similar outcome in Chapter 13 filings. ", "This Article aims to provide family law attorneys with a basic understanding of bankruptcy law so they might successfully negotiate and craft divorce stipulations which are not vulnerable to discharge in bankruptcy. ", "This Article further strives to enumerate specific strategies to achieve that end.", "\n\nSubmissions The Vermont Law Review continually seeks articles, commentaries, essays, and book reviews on any subject concerning recent developments in state, federal, Native American, or international law." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005450908793136477, 0.0005708587705157697, 0.0005428468575701118, 0.0006190089043229818, 0.0005110973143018782, 0.0005707412492483854, 0.0005863452679477632, 0.0005837681819684803, 0.0006305928691290319, 0.0005870711174793541, 0.00056606181897223, 0.000606124522164464, 0.000661654572468251, 0.0006292879115790129, 0.0005454162019304931, 0.0007185253198258579, 0.0018868795596063137, 0.0007069766870699823, 0.0006463548052124679, 0.0020136318635195494, 0.0005814085598103702, 0.0006488789222203195, 0.0005256071453914046, 0.0007166547002270818, 0.0006402974249795079, 0.0005893770139664412, 0.000636315846350044, 0.0009602756472304463, 0.0011563176522031426, 0.0009157900349237025, 0.0006172656430862844, 0.0006237921770662069, 0.000778081186581403, 0.0006644779932685196, 0.0006929787341505289, 0.000611261697486043, 0.0007458253530785441, 0.0005596370319835842, 0.0006435319664888084, 0.000586855981964618, 0.0005507468013092875, 0.010714101605117321, 0.0006267058779485524, 0.005409205332398415, 0.0009590851841494441, 0.0006582935457117856, 0.0009348058374598622, 0.0008093987707979977, 0.000898012425750494, 0.0006462500896304846, 0.0006028388743288815, 0.0006743485573679209, 0.008519584313035011, 0.0007642104174010456, 0.000974077673163265, 0.0011974878143519163, 0.0006139962933957577, 0.0006012508529238403, 0.0012207330437377095, 0.0006021336885169148, 0.0005472330376505852, 0.0005492396303452551, 0.0006869454518891871, 0.0006188458064571023, 0.0005542286671698093, 0.0006314798956736922, 0.000571995391510427, 0.010807865299284458, 0.10758963227272034, 0.0019509539706632495, 0.0008242378244176507, 0.0007178843370638788, 0.0009455406689085066, 0.0031148234847933054, 0.0018370985053479671, 0.012110017240047455, 0.0007378250011242926, 0.0009406834142282605, 0.0012144488282501698, 0.0006470660446211696, 0.0005837089847773314, 0.0006122890627011657, 0.0008056547958403826, 0.0006750295287929475, 0.011658125557005405, 0.000616039673332125, 0.0006737312651239336, 0.0008670890820212662, 0.0008011501631699502, 0.001363829942420125, 0.000586128793656826, 0.0005642609903588891, 0.013138770125806332, 0.0010123049141839147, 0.0006366680026985705, 0.0010315758408978581, 0.0010112426243722439, 0.0012341310502961278, 0.0008183163590729237, 0.0006108038942329586, 0.0007270470960065722, 0.0005843365797773004, 0.0006984506617300212, 0.0006451642257161438, 0.0008168144267983735, 0.0006371423369273543, 0.0006463128956966102, 0.0009408883051946759, 0.0006828373298048973, 0.0007430490222759545, 0.0006476796697825193, 0.0005814664764329791, 0.0007523957756347954, 0.002621270250529051, 0.000706647289916873, 0.007361618801951408, 0.0007553383475169539, 0.0008330739219672978, 0.0009211013675667346, 0.0014784560771659017, 0.000782782502938062, 0.0007353549008257687, 0.0006551282131113112, 0.0013773292303085327, 0.0019199491944164038, 0.0006378428661264479, 0.0006134874420240521, 0.4768073856830597, 0.0006700825761072338, 0.0006597042083740234, 0.0006798969698138535, 0.0008168003987520933, 0.0006119442405179143, 0.0006037376006133854, 0.0006245875847525895, 0.0006306802970357239, 0.0007282193400897086, 0.0006467050989158452, 0.0006220837240107358, 0.0008143107988871634, 0.0006837433902546763, 0.0006190033163875341, 0.0005984494928270578, 0.0006729791057296097, 0.003863157704472542, 0.000987556646578014, 0.0005337002221494913, 0.0005350300925783813, 0.0005578933632932603, 0.0005782361840829253, 0.0005947034806013107, 0.0006862983573228121, 0.0007300965371541679, 0.0006922813481651247, 0.0006583590875379741, 0.0005907312734052539, 0.0005675772554241121, 0.000697938958182931, 0.0006095666904002428, 0.0005762985674664378, 0.0007922420045360923, 0.0006740742246620357, 0.0009249502909369767, 0.0008213870460167527, 0.0005524913431145251, 0.0005590311484411359, 0.0006394732627086341, 0.0006758109666407108, 0.0005749261472374201, 0.0006302786059677601, 0.0006217779009602964, 0.0005511679337359965, 0.0005914174253121018, 0.0005627000355161726, 0.0005649293889291584, 0.0005695492145605385, 0.0006437484989874065, 0.0006376261590048671, 0.0005330278654582798, 0.0005218003643676639, 0.0005552697693929076, 0.000592186814174056, 0.0006291214958764613, 0.0005278209573589265, 0.0005395541666075587, 0.0005890914471819997, 0.000602054235059768, 0.0013064644299447536, 0.000855139282066375, 0.0006364337750710547, 0.0015580537728965282, 0.0006435172981582582, 0.0010127563728019595, 0.0008655775454826653, 0.0006194048910401762, 0.0005467028240673244, 0.0005604011239483953, 0.00634758360683918, 0.196020245552063, 0.0013936847681179643, 0.019383683800697327, 0.0006908439099788666, 0.034122977405786514, 0.000634007912594825, 0.000658363860566169, 0.008553415536880493, 0.000663912738673389, 0.0006031377124600112, 0.0007667993777431548, 0.0007791959797032177, 0.0006421681027859449, 0.0006128871464170516, 0.0005514698568731546, 0.0006802884745411575, 0.0005927992169745266, 0.0005791070288978517, 0.0005681842449121177, 0.0005919546238146722, 0.0008933221688494086, 0.0005952339852228761, 0.0005951384082436562, 0.0006111821276135743, 0.00077001319732517, 0.0006838896661065519, 0.0005246386281214654, 0.0006211029831320047, 0.0006847564945928752, 0.000581860076636076, 0.0005869636661373079, 0.0006789056933484972, 0.0006363700958900154, 0.0006102025508880615, 0.0006375390221364796, 0.0006373442593030632, 0.0005501688574440777, 0.0006724222912453115, 0.0006411212380044162, 0.0006208899430930614, 0.0005898536182940006, 0.0005916663794778287, 0.000631697301287204, 0.0006552416016347706, 0.0006969769019633532, 0.0008335126913152635, 0.002128348918631673, 0.0010398339945822954, 0.0005788278067484498, 0.0008227245416492224, 0.001288931118324399, 0.0010554674081504345, 0.001699752756394446, 0.0007264414452947676, 0.0018801114056259394, 0.0008555105305276811, 0.0006685159751214087, 0.0906982347369194, 0.001249586814083159, 0.0008456393261440098, 0.0009743983973748982, 0.0007349478546530008, 0.002685514511540532, 0.0005902221892029047, 0.000623158470261842, 0.0005715514998883009, 0.0005535801174119115 ]

[ "Sea ice in May 2011\n\nThe Coast Guard went on an ice survey flight between Iceland and Greenland 3rd May. Dense ice was within the Greelandic jurisdiction but only minimal scattered ice within the Icelandic one. ", "The ice was closest to land about 82 nm NW off Straumnes and 93 nm NNW off Horn.", "\n\nThe Greenland Straight had northeasterly wind directions during the whole month." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006154751172289252, 0.0016071063000708818, 0.0005753246950916946 ]

[ "One & Two\n\nOne & Two is a 2015 American independent fantasy thriller film written and directed by Andrew Droz Palermo. ", "The film stars Kiernan Shipka, Timothée Chalamet, Elizabeth Reaser, and Grant Bowler. ", "The film had its world premiere on February 9, 2015, at the Berlin International Film Festival. ", "The film was released on August 14, 2015, in a limited release and through video on demand by IFC Midnight.", "\n\nPlot\nThe film follows a Christian family of four who live peacefully in purposeful isolation. ", "The children, Eva (Kiernan Shipka) and Zac (Timothée Chalamet), are able to teleport short distances, provided they can see where they are going. ", " They use their powers for fun as they chase each other around the farm and drop into the lake. ", "A large wall surrounds the family property. ", " Their father, Daniel (Grant Bowler), is a stern disciplinarian who forbids them from using their powers as he believes them unnatural. ", " His wife Elizabeth (Elizabeth Reaser) is extremely frail, suffering from seizures where she cannot breathe, and he believes her illness is punishment from God due to his children using their powers.", "\n\nWhen Eva and Zac sneak out after dark to play and Elizabeth has a near-fatal seizure, Daniel punishes them by making them face their bedroom walls and nailing their clothes to the wall, preventing them from teleporting away. ", " Despite this, Eva continues using her powers, while Zac refuses to join her. ", " When she tries to teleport an injured bird back to its nest, the bird dies, revealing that they cannot teleport with anyone else.", "\n\nEva continues to sneak out. ", " When Elizabeth dies, Daniel blames Eva. ", " He knocks her out, covers her head and sets her adrift down the river in a boat. ", "He buries one of Eva’s dresses in a grave beside her mother’s on the family plot. ", "He tells Zac that she is taken care of, heavily implying that he has killed her. ", " Zac is furious and visits her makeshift grave to mourn. ", "Eva drifts to a nearby town, where she is found and taken to hospital. ", " Eva struggles in the modern setting. ", " She escapes the hospital, ending up under a bridge by a river, where she meets three kind elderly homeless people. ", "They feed her crackers and play the guitar by the fire until the police arrive, causing Eva to become afraid and teleport away. ", "Eventually she meets a girl her age on the street, whom she follows to a youth home for girls. ", "Eventually, she runs away again and decides to return home to Zac. ", "It is implied that she has a connection to their family land, as she is able to locate it through teleporting short distances along the way. ", "\n\nMeanwhile, Zac is struggling living with Daniel. ", " After a vicious argument, Zac grabs Daniel and teleports, unaware of the consequences. ", " To his horror, Daniel dies shortly afterwards. ", "The next morning, Eva arrives at the wall, teleporting into the air and then onto the ground before she hits it. ", "Zac finishes burying his father and sees her in the woods. ", "They run and embrace each other. ", "As they mourn their parents, they burn their childhood home down as an act of renewal.", "\n\nCast\n Kiernan Shipka as Eva: the thirteen year old female lead\n Timothée Chalamet as Zac: the sixteen year old male lead\n Elizabeth Reaser as Elizabeth: Eva and Zac's mother and Daniel's wife\n Grant Bowler as Daniel: the abusive and destructive father of Eva and Zac and the lead antagonist\n\nProduction\nProduction on the film began on July 21, 2014, in North Carolina, and concluded on August 17, 2014. ", "After production on the film was complete, it was announced Kiernan Shipka, Timothée Chalamet, and Elizabeth Reaser, and Grant Bowler, had all been cast in the film.", "\n\nRelease\nThe film had its world premiere at the Berlin International Film Festival on February 9, 2015. ", "The film went on to premiere at SXSW on March 14, 2015. ", "Shortly after it was announced IFC Midnight had acquired distribution rights to the film. ", "The film then went on to premiere at the Edinburgh International Film Festival on June 22, 2015. ", "and the Berlin Fantasy Film Festival on August 13, 2015. ", " The film was then released on August 14, 2015, in a limited release and through video on demand.", "\n\nReception\nOne & Two received mixed to negative reviews from critics. ", "On review aggregator website Rotten Tomatoes, the film holds a 47% rating based on 15 reviews, with an average rating of 5.5/10. ", "Metacritic reports a 47 out of 100 rating based on 8 critics, indicating \"mixed or average reviews\".", "\n\nReferences\n\nExternal links\n \n \n \n\nCategory:2015 films\nCategory:American films\nCategory:English-language films\nCategory:2010s fantasy films\nCategory:2010s thriller drama films\nCategory:American thriller drama films\nCategory:American fantasy films\nCategory:American independent films\nCategory:American supernatural thriller films\nCategory:Films shot in North Carolina\nCategory:2010s supernatural thriller films\nCategory:2010s independent films" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0009065994527190924, 0.0009977016597986221, 0.0005574869574047625, 0.0006550558027811348, 0.0007730316137894988, 0.0009781752014532685, 0.0028274497017264366, 0.0016763542080298066, 0.024174436926841736, 0.020134376361966133, 0.03189825266599655, 0.001329299178905785, 0.01186362560838461, 0.007229039445519447, 0.016374429687857628, 0.24314726889133453, 0.05272284522652626, 0.07264728844165802, 0.03385826572775841, 0.0024434609804302454, 0.0006213700398802757, 0.0011829282157123089, 0.03767983242869377, 0.008100152015686035, 0.0025672586634755135, 0.0005790970753878355, 0.0011619493598118424, 0.014185035601258278, 0.4147474765777588, 0.001331751118414104, 0.0008354922756552696, 0.00819498673081398, 0.05461128428578377, 0.0013405821518972516, 0.0007576736970804632, 0.000544005015399307, 0.0006342161213979125, 0.0006000198191031814, 0.0005571276415139437, 0.0005782612133771181, 0.0006502281175926328, 0.0006313408957794309, 0.0008487658342346549, 0.0007153745391406119, 0.0006364619475789368 ]

[ "Tick-borne encephalitis virus (TBEV) is the most important arthropod-borne virus in Europe. ", "The Western subtype of this pathogenic neurotropic flavivirus is carried by *Ixodes ricinus*. ", "Tick-borne encephalitis has become a considerable public health risk in several European countries, with currently 3000 hospitalized cases per year. ", "The risk of TBEV-introduction into Belgium remains high and the presence of infected wildlife in Belgium is suspected. ", "Domestic animals such as dogs or cattle can serve as excellent sentinels for TBEV-surveillance in order to install an early warning surveillance component for this emerging zoonotic disease of public health importance.", "\n\nIn a targeted, risk-based and cross-sectional sampling design, serological screening was performed on Belgian cattle (n = 650), selected from the 2010 Belgian national cattle surveillance serum bank. ", "The three most Eastern provinces of Belgium, which are geographically situated closest to known and/or recently emerging TBEV-endemic, were targeted. ", "These areas are also currently known as endemic for Lyme disease (*Borrelia burgdorferi*), another disease transmitted by the same tick.", "\n\nBovine sera were tested at the TBEV Belgian National Reference Centre at the WIV-ISP, by gold standard TBEV seroneutralisation test, based on the rapid fluorescent focus inhibition test (RFFIT) protocol. ", "Using a conservative \\>1/15 cut-off titer for SN test, 17 bovines were seropositive and six had borderline results (1/10 \\< titer \\< 1/15). ", "The accuracy of the RFFIT-SNT was confirmed in a mouse inoculation test and by West Nile virus and Rabies virus serology. ", "There was a positive correlation between the neutralizing antibody titer, determined by SN, and the median survival time in mice inoculated intranasally with a mix of virus and serum. ", "Lesions consistent of viral encephalitis were demonstrated in histopathology.", "\n\nThe overall bovine TBEV-seroprevalence in the targeted area was estimated between 2.6 and 4.3% and freedom could no longer be substantiated. ", "Bovines with borderline results were often located close to confirmed seropositive animals. ", "The geographical locations roughly coincided with the known Belgian hot spots for Lyme disease.", "\n\nThis risk-based cross-sectional serological survey in cattle, obtained through \\\"one health\\\" cooperation confirms the presence of infected foci in Belgium for the first time. ", "Given the relevance of TBEV for the food chain through consumption of unpasteurized milk and cheese and through its considerable public health burden in other European countries, further surveillance in cattle, other sentinels, ticks and humans at risk is recommended to further determine the location and size of endemic foci and the risk for public health.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.004671864677220583, 0.009768020361661911, 0.0012638313928619027, 0.0006947300862520933, 0.0010789205553010106, 0.0005810346337966621, 0.0006499806186184287, 0.0013570523587986827, 0.0006272723549045622, 0.005047854036092758, 0.0007104638498276472, 0.0006043855682946742, 0.0010496560717001557, 0.0006139497854746878, 0.0007110452861525118, 0.0005764229572378099, 0.0007645611767657101, 0.0006399115663953125, 0.0019954426679760218 ]

[ "Driverless car tested in public in UK Published duration 11 October 2016\n\nimage copyright Lutz Pathfinder Project image caption The pods will eventually be able to be hailed by members of the public\n\nA driverless car has been tested among members of the public for the first time in the UK, in Milton Keynes.", "\n\nThe two-seater electric vehicle travelled in a 1km (0.6-mile) loop on the pavements around the town's railway station.", "\n\nThe team behind it hopes a fleet of 40 of the pods will be available to the public next year.", "\n\nIt called the test \"a landmark step\" towards bringing self-driving vehicles to the roads of the UK.", "\n\nLocal dignitaries and members of the press sat alongside a safety driver, who was there to take the car out of autonomous mode in the case of an emergency.", "\n\nProgramme director Neil Fulton said: \"This public demonstration represents a major milestone for autonomous vehicles in the UK and the culmination of an extensive project involving UK companies and experts.", "\n\nimage copyright Lutz Pathfinder Project image caption The response to the vehicle was \"overwhelmingly positive\" said the team behind it\n\nThe autonomy software running the vehicle, called Selenium, was developed by Oxford University's Oxford Robotics Institute and integrated by Oxford University spinout company Oxbotica.", "\n\nSelenium uses data from cameras and LIDAR systems to navigate its way around the environment.", "\n\n\"Oxford University's technology will go on to power automated vehicles around the world, and the project will now feed into a much wider programme of autonomous trials across the UK,\" said Mr Fulton.", "\n\n\"Driverless vehicles are coming to Britain, and what we have demonstrated today is a huge step on that journey.\"", "\n\nVirtual mapping\n\nThe UK government is keen to lead the way on the development of driverless car technology and earlier this year launched a consultation on changes to insurance rules and motoring regulations to allow driverless cars to be used by 2020.", "\n\nIt said it would allow such vehicles to be tested on motorways from next year.", "\n\nThe trial in Milton Keynes is the culmination of 18 months planning, which required a virtual mapping of the town along with extensive work with Milton Keynes Council to ensure the vehicles would be safe, conform to regulations and be accepted by the public.", "\n\nMr Fulton said that public response to the vehicles, which will be on show for three days, had been \"overwhelmingly positive.\"", "\n\n'Huge opportunities'\n\nBusiness and Energy Secretary Greg Clark said: \"Today's first public trials of driverless vehicles in our towns is a ground-breaking moment and further evidence that Britain is at the forefront of innovation.", "\n\n\"The global market for autonomous vehicles present huge opportunities for our automotive and technology firms.", "\n\n\"And the research that underpins the technology and software will have applications way beyond autonomous vehicles.\"" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005631963140331209, 0.0005729552358388901, 0.000557814899366349, 0.0005887987208552659, 0.0005855218041688204, 0.0005206631612963974, 0.0005618393188342452, 0.0005945921293459833, 0.0005915338988415897, 0.0006614502635784447, 0.0005666121141985059, 0.0005722899222746491, 0.0005477428785525262, 0.0005776794860139489, 0.0005549134803004563, 0.0005316249444149435, 0.0005743669462390244 ]

[ "Quentin Tarantino's second-to-last film finally has a name—and a pretty nuts cast list. ", "Brad Pitt has signed on to star alongside Leonardo DiCaprio in the new movie, titled Once Upon a Time in Hollywood, Deadline reports. ", "Both Pitt and DiCaprio have worked with Tarantino in the past on Inglourious Basterds and Django Unchained, respectively, but Once Upon a Time will be the first time the actors have worked together, save for some weird, branded short film back in 2015 that no one ever saw.", "\n\nWhile the new movie has been called Tarantino's \"Manson film\" and is set to drop on the 50th anniversary of the Tate-LaBianca murders, neither Pitt nor DiCaprio will be playing the infamous 60s cult leader. ", "According to Sony Pictures, who won a massive bidding war for the film last November, DiCaprio will play a \"former star of a western TV series\" named Rick Dalton, and Pitt is onboard as Dalton's stunt double, Cliff Booth. ", "Sure, Pitt doesn't look really anything like DiCaprio but, you know, movie magic or whatever.", "\n\nDalton and Cliff live in late-60s LA \"at the height of hippy Hollywood\" and are \"struggling to make it in a Hollywood they don’t recognize anymore,\" Sony told Deadline, \"but Rick has a very famous next-door neighbor… Sharon Tate.\"", "\n\nIn 1969, Manson thought up the pair of grisly murders—including the brutal slaying of a then-pregnant Tate and six friends inside her house on Cielo Drive—and helped put an end to the failed hippie experiment and usher in a new wave of paranoia in California that carried into the 1970s. ", "It's unclear if Pitt and DiCaprio's characters will be directly involved in the Tate murders or cross paths with Manson directly, though Dalton and Booth's western TV history means they could very well find themselves at Spahn Ranch, the defunct Western film set turned commune where Manson and his hippie followers lived.", "\n\n\"I’ve been working on this script for five years, as well as living in Los Angeles County most of my life, including in 1969, when I was seven years old,\" Tarantino said, according to Deadline. \"", "I’m very excited to tell this story of an LA and a Hollywood that don't exist anymore. ", "And I couldn’t be happier about the dynamic teaming of DiCaprio & Pitt as Rick & Cliff.\"", "\n\nSharon Tate's casting has yet to be announced, but Margot Robbie, who is rumored to be on Tarantino's wish list for the film, seems like the obvious choice, especially since the actress told the Hollywood Reporter last January that she'd \"kill to work with him.\"", "\n\nOnce Upon a Time in Hollywood will hit theaters August 9, 2019." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0065031698904931545, 0.0006167605170048773, 0.0006552349659614265, 0.0010291899088770151, 0.0008391855517402291, 0.0009387137251906097, 0.000790822843555361, 0.0039515187963843346, 0.0008540322305634618, 0.0005699741886928678, 0.0006487749633379281, 0.0006056230631656945, 0.0019832379184663296, 0.0006218108464963734 ]

[ "About ZagsBlog\n\nAdam Zagoria covers basketball at all levels. ", "He is the author of two books and an award-winning journalist whose articles have appeared in ESPN The Magazine, SLAM, Sheridan Hoops, Sports Illustrated, Basketball Times and in newspapers nationwide.", "\n\nBeasley Ready for the Knicks?", "\n\nMichael Beasley got a taste of life in New York City Monday night when he appeared at the premiere of a basketball film at the Tribeca Film Festival.", "\nNow the question is, Is Beasley headed to the Knicks in the upcoming NBA Draft?", "\n\n“I love it,” the 6-foot-10 Beasley said of New York when asked if he would like to play for the Knicks. “", "New York is a great city.”", "\nWhen Bobbito Garcia, the famed announcer at Rucker Park in Harlem, added “If the check is right…,” Beasley chimed in with, “I’m there.”", "\nBeasley, an All-American forward out of Kansas State, averaged 26.2 points and 12.4 rebounds per game in his only season on campus. ", "He holds 30 school records, multiple Big 12 marks and six NCAA single-season bests for 2007-08\nHe is likely to be the No. ", "1 or 2 pick in June’s NBA Draft, with Memphis guard Derrick Rose the other possible No. ", "1 pick. ", "The Knicks have a shot at the top pick after finishing with one of the worst records in the NBA. ", "The NBA Draft Lottery is May 20 and the draft is June 26.", "\nLottery picks get three-year guaranteed contracts, and the No. ", "1 overall pick will receive $4,019,000 his first season; $4,320,400 the second; and $4,621,800 the third. ", "The No. ", "2 pick gets $3,595,800 that first season.", "\nBeasley and Garcia appeared at a showing of “Gunnin’ for That #1 Spot,” a documentary produced and directed by Adam Yauch, a former member of the Beastie Boys.", "\nThe film stars several prep and college players, including future NBA lottery picks Beasley, Donte Greene, Kevin Love and Jerryd Bayless, as well as Brooklyn Lincoln star Lance Stephenson, Memphis commit Tyreke Evans, Arizona-bound guard Brandon Jennings and Duke freshman Kyle Singler.", "\n“The idea was to cover eight guys and then use five of them in the film,” Yauch said. “", "But everyone was interesting so we ended up using all eight of them.”", "\nThe film profiles the eight players as they prepare for the 2006 Boost Mobile Elite 24 Hoops Classic at Harlem’s famed Rucker Park. ", "It documents many of the negative aspects of elite level prep hoops, ranging from the absurd practice of ranking of fifth- and sixth-graders to the creeping influence of sneaker companies on young men.", "\n“The film isn’t showing it’s all bad that they’re getting this much publicity,” Yauch said. “", "We’re just showing different opinions that people around the game have.”", "\n\nAdam Zagoria is a Basketball Insider who covers basketball at all levels. ", "A contributor to The New York Times and SportsNet New York (SNY), he is also the author of two books and is an award-winning journalist and filmmaker. ", "His articles have appeared in ESPN The Magazine, SLAM, Sheridan Hoops, Basketball Times and in newspapers nationwide. ", "He also won an Emmy award for his work on the SNY mini-documentary on Syracuse guard Tyus Battle.", "\nA veteran Ultimate Frisbee player, he has competed in numerous National and World Championships and, perhaps more importantly, his teams won the Westchester Summer League (WSL) championships in 2011 and 2013.", "\nHe lives in Manhattan with his wife and children." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007855941075831652, 0.0006753412890248001, 0.0008135886746458709, 0.0006535999709740281, 0.0007977031054906547, 0.0007778116851113737, 0.0008245583157986403, 0.0009634918533265591, 0.0008903327980078757, 0.0024920424912124872, 0.0006944295600987971, 0.0009133892599493265, 0.025959189981222153, 0.0006405944004654884, 0.0006799611146561801, 0.0008727163658477366, 0.001587925711646676, 0.0010036329040303826, 0.0010633821366354823, 0.0007727182237431407, 0.0008592128288000822, 0.0005978112458251417, 0.0007013548165559769, 0.0008213286637328565, 0.0008944279979914427, 0.0005953290383331478, 0.0007688290206715465, 0.0006523149204440415, 0.0006223689997568727, 0.0006631927681155503, 0.0006631545256823301, 0.0019341432489454746 ]

[ "Clinical and social correlates of duration of untreated psychosis among adult-onset psychosis in Hong Kong Chinese: the JCEP study.", "\nUnderstanding factors that contribute to treatment delay would inform early detection and intervention strategies in psychotic disorders. ", "However, existing data were mixed and primarily conducted among early-onset young patients. ", "We examined duration of untreated psychosis (DUP) and its clinical and sociodemographic correlates in a large cohort of adult-onset patients with psychosis. ", "A total of 360 patients with first-onset psychosis aged 26-55 years were recruited consecutively as part of a controlled study of an early psychosis intervention service in Hong Kong Chinese. ", "Demographic, sociodemographic and clinical characteristics relating to DUP were assessed within 4 months of onset. ", "The population had a mean onset age of 36.6 years (SD = 8.7). ", "The mean and median DUP were 515 days (SD = 1091) and 93 days (inter-quartile range from 20 to 382.3), respectively. ", "Multivariate regression analysis suggested that insidious mode of onset, hospitalization, a diagnosis of schizophrenia, poorer insight and younger age at onset significantly prolonged DUP. ", "DUP was not related to premorbid functioning, family involvement during help seeking and living alone. ", "The initial period of untreated psychosis is determined by multiple factors. ", "Whether family involvement is considered a kind of social support in shortening or prolonging DUP needs further examination. ", "Local early intervention program for psychosis should take reference from these findings when formulating personalized plans to reduce delay." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0017720946343615651, 0.0008129850612021983, 0.0005501048872247338, 0.0009716062340885401, 0.0014927511801943183, 0.0005529130576178432, 0.0006353020435199142, 0.0006314486381597817, 0.0007204829598776996, 0.001034421380609274, 0.0037185680121183395, 0.0005642357282340527, 0.0007814107229933143 ]

[ "� Revealed: The \"Stanford Prison Study\" We've Been Hearing About for 50 Years as a Progressive Cautionary Tale Was, Get This, a Scripted Pageant From the Beginning, Designed for the Admitted Purposes of Leftist Activism | Main | Nation's Largest Supplier of Hobo Toilets, Starbucks, to Close 150 Hobo Toilet Outlets � Federal District Court: Elizabeth Warren's Creation, the Consumer Financial Protection Bureau, Is Unconstitutional Courts have found the law creating the CFPB unconstitutional in that it creates a \"Director\" running it, who is, in theory, a member of the Executive Branch, but then puts that Director unconstitutionally beyond the reach of the actual Executive, the President, stating that he can only be fired for cause. ", "One court reviewing this en banc chose to say that part is unconstitutional, but it can be \"severed\" from the rest of the law, and the law just rewritten by judge's fiat to say the Director can be fired by the president, like any other executive officer, for any reason. ", "Actually, a clarification: I think the rule is that members of a committee exercising executive power can be made fire-proof (or fireable only for cause), but you can't vest that kind of unfireable power in a singular head, as a Director is. ", "But one district judge says, \"Nah, bro,\" and finds that that the can-only-be-fired-for-cause provision is part of the heart of the CFPB, and therefore cannot simply be severed/written out of the bill. ", "As that part is unconstitutional, and cannot be severed from the bill creating the CFPB, the whole law is unconstitutional, and the CFPB is unconstitutional and null and void itself. ", "It strikes the CFPB as a party from the suit (against various defendants, including the NFL), finding it simply has no authority to act at all, in any capacity. ", "District court declares CFPB unconstitutional, holds fix is to kill the whole thing https://t.co/rg1RRbrRYJ pic.twitter.com/aP7wVxYU4E — Andrew M. Grossman (@andrewmgrossman) June 21, 2018\n\n\n\nIn reaching the question of the constitutionality of Title X of Dodd-Frank, which established the CFPB as an \"independent bureau\" within the Federal Reserve System, 12 U.S.C. � 5491(a), the Court acknowledges the en banc holding of the Court of Appeals for the District of Columbia Circuit in PHH Corp. v. CFPB, 881 F.3d 75 (D.C. Cir. ", "2018), upholding the statute. ", "Of course, that decision is not binding on this Court.7 Respectfully, the Court disagrees with the holding of the en\n\nbanc court and instead adopts Sections I-IV of Judge Brett\n\nKavanaugh's dissent (joined in by Senior Circuit Judge A.\n\nRaymond Randolph), where, based on considerations of history,\n\nliberty, and presidential authority, Judge Kavanaugh concluded\n\nthat the CFPB \"is unconstitutionally structured because it is an\n\nindependent agency that exercises substantial executive power\n\nand is headed by a single Director.\" ", "Id. at 198. ", "Also most respectfully, the Court disagrees with Section V\n\nof Judge Kavanaugh�s opinion wherein he determined the remedy to\n\nbe to \"invalidate and sever the for-cause removal provision and\n\nhold that the Director of the CFPB may be supervised, directed,\n\nand removed at will by the President.\" ", "Id. at 200. ", "Instead,\n\nthe Court adopts Section II of Judge Karen LeCraft Henderson's\n\ndissent wherein she opined that \"the presumption of severability\n\nis rebutted here. ", "A severability clause 'does not give the\n\ncourt power to amend' a statute. ", "Nor is it a license to cut out\n\nthe 'heart' of a statute. ", "Because section 5491(c)(3) is at the\n\nheart of Title X [Dodd Frank], I would strike Title X in its\n\nentirety.\" ", "Id. at 163-64 (citations omitted). ", "Let me digest the next bits: The CFPB argues that because Mick Mulvaney is now the director, but was appointed as a vacancy appointment and therefore can be fired by the President for any reason, that the CFPB is acting constitutionally if only for this brief bit of time, having a constitutional, fireable executive in charge. ", "The Court points out that Mulvaney can only serve until 2018, at which point the law calls for another unconstitutionally, not-fireable-except-for-cause director to be appointed, which therefore keeps the CFPB in violation of the Constitution. ", "The CFPB argues that Mulvaney, by currently being the head of the CFPB and not choosing to end this action (which was begun before he assumed the directorship), effectively \"ratifies\" the actions taken by his predecessor. ", "The argument is that while the previous Director might have been unconstitutional, the current temporary one is, and his presence retroactively fixes the constitutional defects of the CFPB. ", "Nah, brah, says the Court again. ", "A temporary and temporarily-fireable director does not fix the fundamental unconstitutionality of the Dodd-Frank law which created this unconstitutional agency. ", "Here, the constitutional issues presented by the structure of the CFPB are not cured by the appointment of Mr. Mulvaney. ", "As Defendants point out, the relevant provisions of the Dodd-Frank Act that render the CFPB's structure unconstitutional remain intact. (", "Ratification 4.) ", "Furthermore, Mr. Mulvaney cannot serve past June 22, 2018 (210 days after the vacancy arose), unless the President nominates a new Director, and then\n\nonly until the new Director is appointed. ", "Thus, there will\n\nlikely be a new Director appointed in the coming months who will\n\nbe subject to the for-cause removal provision. ", "Therefore, the\n\nRatification does not cure the constitutional deficiencies with\n\nthe CFPB's structure as the CFPB argues. ", "Accordingly, the Court\n\nrejects the Notice of Ratification (ECF No. ", "78) to the extent\n\nthe CFPB argues that the Ratification renders Defendants'\n\nconstitutional arguments moot. ", "Accordingly, the Court finds that the CFPB \"lacks authority\n\nto bring this enforcement action because its composition\n\nviolates the Constitution�s separation of powers,\" and thus the\n\nCFPB's claims are dismissed. ", "Fed. ", "Election Comm�n v. NRA\n\nPolitical Victory Fund, 6 F.3d 821, 822 (D.C. Cir. ", "1993). ", "d. Conclusion For the foregoing reasons, Defendants' motion (ECF No. ", "39)\n\nis DENIED. ", "Because Plaintiff Consumer Financial Protection\n\nBureau is unconstitutionally structured and lacks authority to\n\nbring claims under the CFPA, the Clerk of Court shall terminate\n\nPlaintiff Consumer Financial Protection Bureau as a party to\n\nthis action.", "\n\nBaller move, bruv.", "\n\nposted by Ace of Spades at\n\n\n\n| Access Comments posted by Ace of Spades at 03:55 PM\n\n\n\n\n\n\n\n\n\nRecent Comments Recent Entries Search Polls! ", "Polls! ", "Polls! ", "Frequently Asked Questions The (Almost) Complete Paul Anka Integrity Kick Top Top Tens Greatest Hitjobs" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006766674341633916, 0.0006045019254088402, 0.0007284460589289665, 0.000742902047932148, 0.001015284564346075, 0.0008844942785799503, 0.0021682281512767076, 0.0006059910519979894, 0.0005996672553010285, 0.03352564573287964, 0.0005960543639957905, 0.05463466793298721, 0.0006856563268229365, 0.0009018947021104395, 0.003810193156823516, 0.0008202590979635715, 0.0006741921533830464, 0.000581189407967031, 0.0006433897069655359, 0.000615597702562809, 0.0006300050299614668, 0.0009824117878451943, 0.0009386770543642342, 0.0005927489837631583, 0.0005893936031498015, 0.0007127539720386267, 0.0006504986668005586, 0.0006261479575186968, 0.0006953447009436786, 0.0006868904456496239, 0.0007567558204755187, 0.0007351954700425267, 0.0022228865418583155, 0.0008038787054829299, 0.0007438244647346437, 0.0006063804612495005, 0.000746308418456465, 0.00070363306440413, 0.0044755213893949986, 0.0008323974907398224, 0.0014681121101602912, 0.0014681121101602912, 0.0011819448554888368 ]

[ "On Tuesday night Mitch McConnell invoked part of one of the Senate’s rules of debate—part of Rule 19—to stop Elizabeth Warren from speaking while she was reading a 1986 letter, written by Coretta Scott King, that criticizes attorney general nominee Jeff Sessions’ record on civil rights. ", "The Washington Post notes that this guideline was enacted in 1902 after a fight on the Senate floor. ", "Here, from a book called The American Senate: An Insider’s History, is the context:\n\nAn incident in the 1850s inspired consideration about adopting a rule to curb such excesses, but the Senate finally did so only after an ugly episode during a debate in 1902. ", "South Carolina’s “Pitchfork Ben” Tillman accused his South Carolina colleague, John McLaurin, of selling his vote for federal patronage. ", "McLaurin called Tillman a malicious liar. ", "Tillman lunged at him, striking him above the left eye. ", "McLaurin hit Tillman back with an upper-cut to the nose. ", "They were separated by other senators, and the brawl caused consternation throughout political Washington. ", "Senator George Hoar of Massachusetts seized the occasion to propose a rule he long had had in mind: “No senator in debate shall, directly or indirectly or by any form of words impute to another senator or to other senators any conduct or motive unworthy or unbecoming a senator.” ", "Once adopted, senators had the means of instantly quieting raucous or abusive debates.", "\n\nThe rule was created, in other words, to protect senators like Ben Tillman from hearing mean things that would make them so mad they had to punch someone. ", "And Ben Tillman, as it happens, is perhaps the most notorious proponent of racial terrorism in the history of the United States. ", "Here are just a few of the things Tillman said during his horrific political career:\n\n“[We] agreed on on the policy of terrorizing the Negroes at the first opportunity by letting them provoke trouble and then having the whites demonstrate their superiority by killing as many of them as was justifiable.” (", "Tillman boasted during the same speech that his pistol had been used to execute seven black men in 1876. ", "Source.)", "\n\n“Lynch law is all we have left.” (", "Source.)", "\n\n“The action of President Roosevelt in entertaining that nigger will necessitate our killing a thousand niggers in the South before they learn their place again.” (", "In reference to Booker T. Washington’s visit to the White House. ", "Source.)", "\n\n“We of the South have never recognized the right of the Negro to govern white men, and we never will. ", "We have never believed him to be the equal of the white man, and we will not submit to his gratifying his lust on our wives and daughters without lynching him. ", "I would to God the last one of them was in Africa and that none of them had ever been brought to our shores.” (", "That one was on the floor of the Senate itself. ", "Source.)", "\n\nIndeed, is it not obvious that we must protect the integrity of Rule 19 to ensure that the Senate continues to be a safe space for Ben Tillman’s successors?" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006646594847552478, 0.0005625053308904171, 0.0005643028998747468, 0.0014403550885617733, 0.3452633321285248, 0.07881952822208405, 0.13316239416599274, 0.0015688497805967927, 0.0009385671583004296, 0.002539368811994791, 0.1011844053864479, 0.02132100611925125, 0.028712144121527672, 0.030899718403816223, 0.0006889746873639524, 0.004398951772600412, 0.0006889746873639524, 0.9854167103767395, 0.0006028368952684104, 0.0006889746873639524, 0.21923181414604187, 0.49412208795547485, 0.0026433567982167006, 0.0006864173337817192, 0.0006889746873639524, 0.0006577878375537694 ]

[ "Q:\n\nブラウザのOSの種類を判定する方法\n\nchrome\nfirefox\nedge\nなど各ブラウザの UserAgent からOSを判定することは可能でしょうか\n\nA:\n\n変更出来たりするので確実では無いようですが、以下の様な記事があり、出来るようです。", "\n【JavaScript】ユーザーエージェントの取得と変更\nUserAgentからOS/ブラウザなどの調べかたのまとめ\n\nWindows\n WindowsのバージョンはWindows NT 6.1の様なWindows NT系のバージョンで表示される。", "\nmacOS\n 「Mac OS X」＋OSのバージョンで判定できる。プロセッサのIntel と PowerPC(PPC)の区別も出来るが、今現在PowerPCはほとんど残っていないと思うのであまり意味なし。", "\nLinux\n 64bitの場合「x86_64」が32bitの場合「i686」、x86_64 環境の i686 Linux デスクトップの場合は、「i686 on x86_64」が入る。", "\n Androidの場合も「Linux」文字列が入るので、「x86_64」、「i686」の有無で判定するか「Android」を除くの条件がいる？", "\n\n他色々とあるので参照してください。", "\n\nまたライブラリがあるようです。", "\nブラウザからデバイスに、OSまで！UA判定に便利なライブラリ「UAParser.js」\n\nそれからUserAgentではなくWeb APIのnavigator(navigatorID?)のプロパティでもわかるようですが、仕様上は「このプロパティが正確な値を返すことを期待しないで下さい。」とあります。", "\nJavaScriptでOSやブラウザの情報を取得する\nNavigatorID.platform - Web API | MDN\n実装状況の表ではSamsung Internet以外は「あり」になっています。", "\nNavigator - Web API | MDN\n\nNavigatorID.platform 読取専用\n 現在のブラウザーのプラットフォームを表す文字列を返します。このプロパティが正確な値を返すことを期待しないで下さい。", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0016345372423529625, 0.0014197498094290495, 0.0015002256259322166, 0.0016435636207461357, 0.0012856433168053627, 0.0008392223389819264, 0.000840991095174104, 0.0012209382839500904, 0.0010788188083097339, 0.0010805348865687847, 0.0019954426679760218 ]

[ "Q:\n\nshort term for incrementing in java\n\nI am quite confused if there any difference the two below. ", " I think they are doing the same thing but when I compile it seems like they are different. ", " Thank you in advance. ", " \nif(hash[s.charAt(leftIdx)]>=0) {\n hash[s.charAt(leftIdx)]++; \n // do other things \n}\n\nif(hash[s.charAt(leftIdx)]++>=0) {\n // do other things \n}\n\nA:\n\nRefactoring to remove the postfix operators, the first one is equivalent to this:\nif(hash[s.charAt(leftIdx)] >= 0) {\n hash[s.charAt(leftIdx)] += 1; \n // do other things\n}\n\nThe second (assuming your hash members are integers) is equivalent to this:\nint tmp = hash[s.charAt(leftIdx)];\nhash[s.charAt(leftIdx)] += 1;\nif(tmp >= 0) {\n // do other things\n}\n\nThe postfix ++ operator returns the pre-incremented value and then increments it as a side-effect. ", "So your if in the 2nd example is using the pre-incremented value in its condition (represented by tmp above).", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005513280048035085, 0.0005834723124280572, 0.0005381046212278306, 0.004033013712614775, 0.0007139674271456897, 0.0019954426679760218 ]

[ "*2 + 7*d. ", "Let x be n(1). ", "What is x rounded to the nearest one million?", "\n48000000\nLet b = -200.517 - -201. ", "What is b rounded to 2 decimal places?", "\n0.48\nLet y = 141 - -79. ", "Let q = -219.454 + y. What is q rounded to two dps?", "\n0.55\nLet q = 32.38 + -32.38002602. ", "Round q to 6 decimal places.", "\n-0.000026\nLet v(x) = -2*x**3 + 20*x**2 + 11*x - 14. ", "Let f be v(9). ", "Round f to the nearest 100.", "\n200\nLet j(t) = -2*t + 17. ", "Suppose 5*o = 8*o - 15. ", "Let x be j(o). ", "Suppose -2*i + 3*w = 31991, -79985 = 5*i + 2*w - x*w. ", "Round i to the nearest 10000.", "\n-20000\nLet u(w) = 12*w**3 - 4*w**2 - 10*w + 20. ", "Let g be u(-5). ", "What is g rounded to the nearest one thousand?", "\n-2000\nLet s be 207100*(-5 + (8 - 4)). ", "What is s rounded to the nearest ten thousand?", "\n-210000\nLet y = 146.612 + 1.088. ", "Round y to the nearest ten.", "\n150\nLet y = -315 - -118. ", "Let s = 50 - y. Let r = s + -224.8. ", "Round r to the nearest integer.", "\n22\nLet y = 9 + -24. ", "Let n = -15 - y. Round n to the nearest ten thousand.", "\n0\nLet x = 68.9173 - -268.9357. ", "Let y = 338 - x. Let a = y - 6.447. ", "What is a rounded to 0 dps?", "\n-6\nLet o = 519104482.0000063 + -519104503. ", "Let r = -21 - o. Round r to 6 decimal places.", "\n-0.000006\nLet l = 2.16 + 3.11. ", "Let d = -6.2 + l. What is d rounded to one decimal place?", "\n-0.9\nLet j = -236.01872 + 236. ", "What is j rounded to three decimal places?", "\n-0.019\nLet g = 144 - 102. ", "Let t be (-2)/(18/g*2/(-222)). ", "What is t rounded to the nearest ten?", "\n520\nLet v be 76640006/8 - ((-81)/(-12) - 6). ", "Round v to the nearest 1000000.", "\n10000000\nLet s = 0.0543 - 0.0483. ", "What is s rounded to two dps?", "\n0.01\nLet h = -5 - 2. ", "Let l = 80 + h. Let g = 71.56 - l. Round g to 1 decimal place.", "\n-1.4\nLet r = -0.1 - 39.9. ", "Let c = r + 40.017. ", "Round c to 2 decimal places.", "\n0.02\nSuppose 2*m + 1 = -f, 0 = -5*f + 2 - 7. ", "Suppose m = -3*t + 2*t - 4*x + 5599992, -t = -2*x - 5600004. ", "What is t rounded to the nearest one million?", "\n6000000\nLet c = -1.17886 + 1.1188608. ", "Let m = -0.06 - c. Round m to six dps.", "\n-0.000001\nLet q = -772 + 771.9998362. ", "Round q to five dps.", "\n-0.00016\nLet b = 63.2000317 - 63.2. ", "What is b rounded to five decimal places?", "\n0.00003\nSuppose -2*z + 2*w = z - 10747014, 2*w - 14329352 = -4*z. ", "Let n = 612338 - z. What is n rounded to the nearest one hundred thousand?", "\n-3000000\nLet a = 116298.7680135 - 116324.768. ", "Let z = a + 26. ", "What is z rounded to six dps?", "\n0.000014\nLet a = -6533 + 6496.79. ", "Let u = a - -36. ", "Let f = u + 0.21075. ", "What is f rounded to four dps?", "\n0.0008\nLet m = -794 + 655.44. ", "Let w = -146 - m. Let u = 0.06 - w. What is u rounded to the nearest integer?", "\n8\nLet l(g) = -2 + 1 - 15*g + 8 - g**2. ", "Let v be l(-12). ", "What is v rounded to the nearest ten?", "\n40\nLet z = 0.238042 - 0.21804. ", "Let q = 1 - 0.98. ", "Let s = z - q. What is s rounded to six decimal places?", "\n0.000002\nLet q(o) = o**2 + 13*o + 32. ", "Let r be q(-11). ", "Let u be 4 - r/2*139. ", "What is u rounded to the nearest one hundred?", "\n-700\nLet y(m) be the first derivative of 33251*m**2 + 4*m - 192. ", "Let k(u) = -u - 9. ", "Let w be k(-7). ", "Let p be y(w). ", "What is p rounded to the nearest 10000?", "\n-130000\nLet j = 25.486 - 25.2. ", "Let g = 0.016 - j. Round g to two dps.", "\n-0.27\nLet w = 713051845.2 + 7075782647.8. ", "Let q = w + -7788834422.99999918. ", "Let r = q - 70. ", "What is r rounded to 7 dps?", "\n0.0000008\nLet i = 9.15 + -20.14. ", "Round i to the nearest 10.", "\n-10\nLet f = 8.9289 - 8.9509066. ", "Let w = 0.022 + f. Round w to six dps.", "\n-0.000007\nSuppose -23739 = -3*l - 115851. ", "Let h = l - -43604. ", "What is h rounded to the nearest 1000?", "\n13000\nLet u be 20/30 + (17/(-3) - -2). ", "Let d be u + (-472)/(8 + -4). ", "What is d rounded to the nearest ten?", "\n-120\nSuppose 0*r = -4*r + 6372. ", "Suppose -j - 3*k + 6196 - r = 0, 0 = -2*j + 3*k + 9197. ", "What is j rounded to the nearest one thousand?", "\n5000\nLet p(f) = -f. ", "Let i be p(-2). ", "Let w(m) be the third derivative of 1325*m**5/3 + 38*m**2 - 2. ", "Let n be w(i). ", "Round n to the nearest ten thousand.", "\n110000\nLet a = -231 - -231.000001616. ", "What is a rounded to 7 dps?", "\n0.0000016\nSuppose -2*f + 2 = n, 0 = 4*n + 4*f - 4 - 0. ", "Suppose 4*j = -j + 30. ", "Suppose j*x - x + 1500 = n. Round x to the nearest 1000.", "\n0\nLet i be (2140 + 3)/(2/(-58)). ", "Let o = -31147 - i. What is o rounded to the nearest ten thousand?", "\n30000\nSuppose -2*a + 9322 = -2*r, -5*r - 3*a - 22567 - 730 = 0. ", "Round r to the nearest one thousand.", "\n-5000\nLet r = 16798.3 - 13122.73. ", "Let t = -3660 + r. Let b = 16.3 - t. What is b rounded to 1 dp?", "\n0.7\nLet w = 162 + -326. ", "Let r = w + 164.0283. ", "Let t = -0.02829761 + r. Round t to 7 decimal places.", "\n0.0000024\nLet s = -4654 + 365. ", "Round s to the nearest 1000.", "\n-4000\nLet j = -2.4 - 11.6. ", "Let a = 57830800.9999999 - 57830787. ", "Let l = a + j. What is l rounded to 6 dps?", "\n0\nSuppose 8*h - 3204284 = 8211716. ", "What is h rounded to the nearest 100000?", "\n1400000\nLet s = 0.79 + 1.58. ", "Let j = s - 2.2. ", "Let a = j - 0.134. ", "What is a rounded to 2 decimal places?", "\n0.04\nLet h = -12435 - -8255. ", "What is h rounded to the nearest 100?", "\n-4200\nLet u = -2.35 + 0.57. ", "Round u to one dp.", "\n-1.8\nLet c = 95.4 - 78. ", "Let a = c - 17.39923. ", "Round a to four dps.", "\n0.0008\nLet y = -127.1998364 - -127.2. ", "Round y to five decimal places.", "\n0.00016\nLet y = 1374.999127 + -1375. ", "Round y to 5 decimal places.", "\n-0.00087\nLet m = 15.122 + -0.212. ", "What is m rounded to one decimal place?", "\n14.9\nLet x = -8.714584 + 6.9146. ", "Let i = 114.2 - 116. ", "Let m = i - x. Round m to five dps.", "\n-0.00002\nLet v = 14489 + -3009. ", "What is v rounded to the nearest 1000?", "\n11000\nLet p(j) = 63*j**3 + j - 5. ", "Let g be p(10). ", "Let c = -7928 + 13467. ", "Suppose -4*v + 7057 = -w - c, -5*w = 5*v + g. What is w rounded to the nearest 1000?", "\n-13000\nLet a = 225 + -225.093. ", "Let h = a - -0.025. ", "Round h to 2 dps.", "\n-0.07\nLet b = 8238.00004273 + -8238. ", "What is b rounded to 5 dps?", "\n0.00004\nLet y be (8779/1)/(3/(-5178)). ", "Let r be y/(1 + -2 - 0). ", "Let t = r + 5447446. ", "Round t to the nearest 1000000.", "\n21000000\nLet n = -0.1167 - -0.11668839. ", "Round n to 6 decimal places.", "\n-0.000012\nLet p = 2070251.8610061 + -2070252. ", "Let b = -247.139 - -247. ", "Let c = b - p. Round c to six decimal places.", "\n-0.000006\nLet d(g) = g**3 - 3*g**2 + 2*g - 2. ", "Let x be d(3). ", "Suppose x*v - 2493 = v. Suppose -4*n - v - 2049 = 0. ", "What is n rounded to the nearest 100?", "\n-700\nLet v = -1.68 - -0.81. ", "Let j = v + -2.22. ", "Let q = 3.0899863 + j. What is q rounded to six decimal places?", "\n-0.000014\nLet h = -1456044 + 845044. ", "What is h rounded to the nearest ten thousand?", "\n-610000\nLet q = -1.1 + 174.1. ", "Let n = q + -173.00000198. ", "What is n rounded to 7 dps?", "\n-0.000002\nLet z = 228.999999456 + -229. ", "Round z to 7 decimal places.", "\n-0.0000005\nLet u = -6.53 + 5.8. ", "Let i = 0.7215 + u. What is i rounded to two dps?", "\n-0.01\nLet r(g) = -g**3 - 10*g**2 + g + 14. ", "Let f be r(-10). ", "Let d(z) = f - 3 - 3*z**2 + 4*z**2 + 3*z. ", "Let y be d(-4). ", "What is y rounded to the nearest 10?", "\n10\nLet o = -357 - -356.99999774. ", "Round o to 6 decimal places.", "\n-0.000002\nLet q = -34 - -34.039. ", "Let i = q + 0.101. ", "What is i rounded to 1 decimal place?", "\n0.1\nLet f = -806290.00095 + 806308. ", "Let j = -8 + 26. ", "Let q = j - f. What is q rounded to 4 decimal places?", "\n0.001\nSuppose 18 = -2*m + 3*r, m + 40 = -3*m + 4*r. ", "Let v = -22 + m. What is v rounded to the nearest ten?", "\n-30\nLet t = -952.1 + 866. ", "Let x = -47.8 - t. Round x to the nearest 10.", "\n40\nLet i = -46.4 + 42. ", "Round i to zero dps.", "\n-4\nLet o = -6.71 + 7.2005. ", "What is o rounded to two decimal places?", "\n0.49\nSuppose 30*r - 37*r = 597800. ", "Round r to the nearest 10000.", "\n-90000\nLet v = 4.09 + -0.09. ", "Let l = 4.2 - v. Let x = l - 0.19992. ", "What is x rounded to five decimal places?", "\n0.00008\nLet x = 120.461828 - -0.915972. ", "Let a = x + -121.5. ", "Let d = 0.12 + a. What is d rounded to three decimal places?", "\n-0.002\nLet n = 12852 - 11940.1. ", "Round n to the nearest 100.", "\n900\nLet k = -2548.00668 - -2548. ", "What is k rounded to three dps?", "\n-0.007\nLet o = 237.8999991737 + -237.9. ", "Round o to seven dps.", "\n-0.0000008\nSuppose -20*g = -15*g + 15750000. ", "What is g rounded to the nearest one hundred thousand?", "\n-3200000\nLet r = -10250.0008347 - -10250. ", "What is r rounded to five dps?", "\n-0.00083\nLet j = 2437 + -9106. ", "Let o = 1069 + j. What is o rounded to the nearest one thousand?", "\n-6000\nLet s = -0.089 - -0.07. ", "Let n = -12517.88 + 12517.86100061. ", "Let a = n - s. What is a rounded to 7 decimal places?", "\n0.0000006\nLet n = 450.101 + -1.801. ", "Let u = 427 - n. Round u to the nearest integer.", "\n-21\nLet v = -29861.15273 + 29861. ", "Let q = -81.152 + 81. ", "Let " ]

{ "pile_set_name": "DM Mathematics" }

[ 0.010899499990046024, 0.002442237688228488, 0.0009324472048319876, 0.001766194007359445, 0.0008029359159991145, 0.0021221127826720476, 0.001320686424151063, 0.0013078661868348718, 0.0006985015934333205, 0.005233506206423044, 0.0022549552377313375, 0.0027611390687525272, 0.025036931037902832, 0.012400235049426556, 0.010176125913858414, 0.005587166640907526, 0.001185325556434691, 0.04427224025130272, 0.0074120452627539635, 0.0009683356038294733, 0.0006430369103327394, 0.0010775575647130609, 0.0013821562752127647, 0.0010952354641631246, 0.001017707516439259, 0.0044753109104931355, 0.0008559907437302172, 0.001750650815665722, 0.014802983961999416, 0.00120389589574188, 0.0018483055755496025, 0.0014643268659710884, 0.0018731207819655538, 0.0049273292534053326, 0.0023974671494215727, 0.0010218993993476033, 0.0028344683814793825, 0.0008587954798713326, 0.001173755037598312, 0.005840741563588381, 0.0009648519335314631, 0.0009300045785494149, 0.001013773842714727, 0.0012088583316653967, 0.0012841576244682074, 0.0023606126196682453, 0.01079423725605011, 0.003428366966545582, 0.0014970781048759818, 0.0007279757992364466, 0.01602262072265148, 0.005578110460191965, 0.0009961947798728943, 0.0016497288597747684, 0.04010104015469551, 0.0019111954607069492, 0.001231218222528696, 0.001373059581965208, 0.0008152653463184834, 0.002632266143336892, 0.0010895204031839967, 0.0017436633352190256, 0.0017036109929904342, 0.0014263706980273128, 0.004044781904667616, 0.002513169776648283, 0.003911569248884916, 0.002182991476729512, 0.003765909466892481, 0.004660617094486952, 0.03624729812145233, 0.001159138628281653, 0.0018872189102694392, 0.0013334823306649923, 0.001348990947008133, 0.0010464624501764774, 0.06871122866868973, 0.0010190497850999236, 0.0021544420160353184, 0.0010190416360273957, 0.0010215479414910078, 0.09869750589132309, 0.001768493908457458, 0.006419058423489332, 0.0008397519122809172, 0.0009087000507861376, 0.01504784356802702, 0.001289365696720779, 0.0021189223043620586, 0.001075542764738202, 0.000993560766801238, 0.009154561907052994, 0.0016845023492351174, 0.0018645196687430143, 0.023006092756986618, 0.001203744439408183, 0.0010617165826261044, 0.0010202460689470172, 0.0019501147326081991, 0.0015924916369840503, 0.0011422188254073262, 0.0015562055632472038, 0.19718870520591736, 0.0013240170665085316, 0.06982197612524033, 0.0011847543064504862, 0.0024860757403075695, 0.032235272228717804, 0.002427754458039999, 0.008521348237991333, 0.0009912126697599888, 0.13174326717853546, 0.0011117778485640883, 0.0024499413557350636, 0.0013196140062063932, 0.001087356940843165, 0.00220276927575469, 0.0011489962926134467, 0.0008292939746752381, 0.0019467300735414028, 0.001149557763710618, 0.0013681281125172973, 0.0019082778599113226, 0.0012109638191759586, 0.0009797561215236783, 0.0008689674432389438, 0.0023914542980492115, 0.0030192036647349596, 0.0013596188509836793, 0.0008540151175111532, 0.0011628578649833798, 0.0029296427965164185, 0.0020827348344027996, 0.0007683339063078165, 0.0014761397615075111, 0.0011259998427703977, 0.001630462589673698, 0.004206973593682051, 0.0016188835725188255, 0.001423439709469676, 0.002526248572394252, 0.003114356892183423, 0.0007421626360155642, 0.002391527406871319, 0.0007754471735097468, 0.003658189671114087, 0.0009773974306881428, 0.0015547702787443995, 0.000967088621109724, 0.029762636870145798, 0.003103541908785701, 0.0010931575670838356, 0.004721413366496563, 0.0016878092428669333, 0.0012446945765987039, 0.00142541469540447, 0.0016509771812707186, 0.0020068229641765356, 0.0019294415833428502, 0.0025287370663136244, 0.0010306318290531635, 0.002418216085061431, 0.0018820452969521284, 0.0011058779200538993, 0.0014874592889100313, 0.0025204147677868605, 0.0007683343719691038, 0.0015276748454198241, 0.001567038823850453, 0.0026228786446154118, 0.11083979904651642, 0.0013090145075693727, 0.004102802369743586, 0.0010605115676298738, 0.001950171310454607, 0.001787833753041923, 0.0010007241507992148, 0.0014770932029932737, 0.0010674175573512912, 0.0013981881784275174, 0.0031848428770899773, 0.0012702038511633873, 0.003367703640833497, 0.0007311824010685086, 0.007933808490633965, 0.0050422316417098045, 0.08883852511644363, 0.0021327363792806864, 0.16465707123279572, 0.0012812950881198049, 0.001029289560392499, 0.0010641817934811115, 0.0007321337470784783, 0.002406140323728323, 0.0015407121973112226, 0.0030576440040022135, 0.005424979608505964, 0.001661380403675139, 0.0011389256687834859, 0.01563969999551773, 0.0017532777274027467, 0.0019880931358784437, 0.004822837188839912, 0.0021628558170050383, 0.010431851260364056, 0.00317942351102829, 0.0009906220948323607, 0.0021065149921923876, 0.0010336254490539432, 0.0018248033011332154, 0.002475128276273608, 0.0008427611319348216, 0.0016611581668257713, 0.00200026691891253, 0.0013524171663448215, 0.0010715750977396965, 0.001824837876483798, 0.0034666622523218393, 0.0015144640346989036, 0.005322096403688192, 0.003125673159956932, 0.006045309826731682, 0.0009467544150538743, 0.0012725070118904114, 0.0012616009917110205, 0.0019354709656909108, 0.001794658019207418, 0.001666169031523168, 0.0015472451923415065, 0.01404651440680027, 0.005414385348558426, 0.001795496791601181, 0.0014412275049835443, 0.0013081234646961093, 0.00817874539643526 ]

[ "Intracranial dural arteriovenous fistulae: angiographic predictors of intracranial hemorrhage and clinical outcome in nonsurgical patients.", "\nThis long-term follow-up study of 54 patients clarifies the angiographic predictors of intracranial hemorrhage (ICH) and clinical outcome in individuals with unoperated intracranial dural arteriovenous fistulae (AVF's). ", "All of these patients were examined at the Mayo Clinic between 1976 and 1989, and all available cerebral arteriograms were reviewed by a neuroradiologist. ", "Follow-up information was obtained for 52 patients (96%) until death or treatment intervention, or for at least 1 year after diagnosis, with a mean follow-up period of 6.6 years. ", "Throughout this 6.6-year follow-up period, ICH related to dural AVF occurred in five of the 52 patients, for a crude risk of hemorrhage of 1.6% per year. ", "The risk of hemorrhage at the time of mean follow-up examination was 1.8% per year. ", "Angiographic examination revealed several characteristics that were considered potential predictors of ICH during the follow-up period. ", "Lesions of the petrosal sinus and straight sinus had a higher propensity to bleed, although the small numbers in the series precluded a definite conclusion. ", "A person suffering from a dural AVF with a venous varix on a draining vein had an increased risk of hemorrhage, whereas no hemorrhage was seen in the 20 patients without a varix (p < 0.05). ", "Lesions draining into leptomeningeal veins had an increased occurrence of hemorrhage, although this increased risk was not statistically significant. ", "Patients' initial symptoms were compared to those at follow-up evaluation. ", "Pulsatile tinnitus improved in more than half of the 52 patients, and resolved in 75% of those showing some improvement. ", "Individuals without a sinus or venous outflow occlusion at initial cerebral angiography were more likely to improve or remain stable (89%), whereas patients with an occlusion showed infrequent improvement (11%; p < 0.05)." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0019078879849985242, 0.0010302558075636625, 0.0005868305452167988, 0.0005555461393669248, 0.0009025378385558724, 0.001639577210880816, 0.0006439531571231782, 0.11339841783046722, 0.0030039744451642036, 0.0007393470732495189, 0.000582522654440254, 0.0011347504332661629, 0.0065580266527831554 ]

[ "1. ", "Field of the Invention\nThe present invention relates to the field of avian egg fertilization. ", "In particular, the present invention relates to a method of fertilizing an egg in a shell.", "\n2. ", "Background Art\nTypically, breeding in the poultry industry is carried out by either one of two systems:\nFloor Breeding Program\nThe first system is called xe2x80x9cfloor breedingxe2x80x9d and it is utilized to produce the vast majority of all commercial hatching eggs. ", "In this system males are simply added into the flocks of females at a typical ratio of between 10 and 15 percent. ", "The floor breeding system, even with its inefficiencies, is currently the low-cost system for producing hatching eggs because it requires less labor than competing systems. ", "Average hatch rates range from approximately 83% for broiler breeders to 92% for layer breeders. ", "Even though this system has been the backbone of the poultry industry for many years, it has many limitations.", "\nSize Versus Reproductive Capacity\nFloor breeding is no longer practiced at all in turkeys due to the intense selection for increased muscle yield that has rendered commercial turkey breeds incapable of natural mating. ", "The same trend is being seen in broilers. ", "Selection for increased size in broilers has compromised fertility and mating ability and it is predicted that fertility will continue to decline as body weights increase. ", "This presents a dilemma for poultry producers because decreases in fertility have a direct negative impact on their bottom line.", "\nInefficient Waste Removal\nNatural mating must be performed on solid floors to avoid injury to the birds. ", "This design requirement precludes the use of automated waste removal systems and necessitates manual cleaning between successive flocks of birds. ", "This adds to labor and overhead costs while decreasing the productive use of facilities.", "\nEgg Production and Quality\nSince eggs remain in the houses with the flock until collection time; eggs are frequently contaminated with dirt and fecal material which can reduce hatch rates. ", "In addition, typically between 3 and 5% of the eggs produced in floor houses are laid directly on the floor rather than in the provided laying boxes and must be discarded.", "\nInefficient Space and Equipment Utilization\nMaintaining males and females together in a floor house requires the installation of two independent feed and watering systems because of different nutritional and production requirements for each sex. ", "It also requires the installation of laying boxes and automated egg collection systems. ", "All of this equipment occupies limited floor space in the house. ", "For these reasons floor rearing is not an efficient use of housing space and equipment when compared to stacked cage systems.", "\nMortality and Fertility\nAggressive males tend to fight, leading to higher male mortality rates. ", "Male mortality rates average 13% in floor houses versus 2% in cage houses. ", "Male aggressiveness towards hens during mating gradually takes a toll in the form of increased female mortality, decreased fertility, and a decrease in the length of the egg production cycle. ", "As the males in one flock get older, fertility starts to decline. ", "The standard solution is to xe2x80x9cspikexe2x80x9d the flock with young males to improve fertility. ", "However, this sets off another round of aggression with a short-term decrease in fertility and an increase in mortality. ", "Disease is more common in floor houses because of the constant contact of the birds with bedding and waste material that harbor pathogenic organisms.", "\nDecreased Feed Conversion\nControlling feed costs is critical to running a competitive poultry operation. ", "Feed costs can account for up to 60% of the cost of raising a broiler chick, for instance. ", "In one study, birds raised on the floor consumed 20% more food for the same amount of production when compared to those raised in cages. ", "This difference is due to the increased level of social interactions as well as the generally higher level of physical activity seen in floor houses. ", "Males consume more feed than females, making the floor breeding system inefficient with respect to feed consumption due to the large numbers of males that must be maintained.", "\nLimited Flexibility in Breeding Strategies\nDue to the fact that males and females are housed in one large group in the floor breeding house arrangement, the breeder is very restricted in their ability to perform advanced crosses and selections on the breeding stock. ", "For this reason floor houses are primarily utilized as a tool for the multiplication of pre-selected genetic stocks to produce final commercial crosses.", "\nArtificial Insemination Breeding Program\nAnother system utilized to generate hatching eggs is called artificial insemination (AI). ", "AI is widely practiced by xe2x80x9cprimary breedersxe2x80x9d at the top of the breeding pyramid but not generally used by commercial producers at the bottom of the pyramid. ", "Primary breeders are companies that own and improve the elite pedigreed genetic lines that are crossed to produce the final commercial products-broilers, layers and turkeys. ", "The quantities of birds increase exponentially as you move down the breeding pyramid from the pedigreed lines through the grandparent stock, parent stock, and finally to the actual commercial birds. ", "While birds of elite genetic makeup at the top of the pyramid are very expensive, birds at the bottom are inexpensive. ", "For these reasons, different operational models are utilized for reproduction at different level.", "\nIn the AI system, males and females are housed in the same houses but are caged separately. ", "The female cages typically hold between two and five hens, while the male cages hold a single rooster. ", "AI programs address many of the limitations of the floor breeding houses listed above. ", "For example, since cage houses are utilized, waste removal can be performed automatically. ", "Houses are generally much cleaner, leading to fewer disease problems. ", "Egg production is improved because eggs roll out of the cages and is not laid on dirty floors. ", "Equipment and housing space are utilized more efficiently. ", "Mortality is minimized due to a decrease in social aggression and disease. ", "Fertility levels are maintained more consistently because social and physical interaction are eliminated from the process of reproduction. ", "Feed conversion is increased. ", "And finally, the production system has increased flexibility for doing advanced crosses and selections. ", "This capability is absolutely required by primary breeders in order to improve their genetic stocks and to stay competitive in the marketplace. ", "While most of the advantages listed above are also important for commercial-level multiplication breeders, they are offset by one crucial shortcoming, the high labor costs associated with AI programs.", "\nAI programs replace the innate sexual drive of poultry with human labor. ", "Workers must manually collect semen from males in cages and inseminate females in cages on a 7-day rotation. ", "The level of sophistication required in these programs mandates a skilled workforce. ", "For this reason, the AI program, though operationally superior, is economically impractical for commercial-level breeding programs. ", "Even the use of dwarf hens, an innovation that allows similar egg production with about 30% less feed consumption, can not justify the increased labor costs of the Al program for commercial level multiplication breeders.", "\nAt the time of ovulation, the avian oocyte comprises a blastodisc, or germinal disc, which contains the female pronucleus, and a yellow yolk mass. ", "The germinal disc and yolk mass are surrounded by the oocyte cell membrane, called the oolemma. ", "Surrounding the oolemma is the perivitelline layer (PL), also referred to as the inner perivitelline layer (IPL). ", "The space between the oolemma and the IPL is termed the perivitelline space, which is traversed by granulosa cells. ", "Once the oocyte is released from its ovarian follicle, it is referred to as an ovum. ", "The ovum moves into the oviduct where it is engulfed by the infundibulum, where fertilization occurs if sperm are present.", "\nAs the ovum passes into the posterior infundibulum, another layer, the outer perivitelline layer (OPL), surrounds the ovum. ", "This membrane acts to prevent polyspermy, which is a lethal condition that occurs when multiple sperm bind to and penetrate the ovum at the region of the blastodisc (Koyanagi et al., ", "xe2x80x9cFate of spermatozoa that do not participate in fertilization,xe2x80x9d Cell Tissue Res., ", "1981; 214 (1): 89-95; Okamura et al., ", "xe2x80x9cThe passage of spermatozoa through the vitelline membrane in the domestic fowl Gallus gallus,xe2x80x9d Cell Tissue Res., ", "1978; 188(3): 497-508; Bakst et al., ", "xe2x80x9cHydrolysis of the Hen\"\"s Perivitelline Layer by Cock Sperm in vitro,xe2x80x9d Biol. ", "Reprod., ", "17: 370-379). ", "The egg is then surrounded with additional layers of chalaza and thick and thin layers of albumen. ", "When the ovum moves into the isthmus, two shell membranes are deposited, upon which small crystals of calcium carbonate are deposited, thus beginning the formation of the shell.", "\nThe preceding events all occur within the first few hours following fertilization. ", "The ovum next moves into the uterus, where over the next 18-20 hours, the calcium shell is completed. ", "The egg then moves into the vagina for several minutes, and then is extruded from the vagina, or oviposited (i.e., xe2x80x9claidxe2x80x9d). ", "At this point, if the egg has been fertilized, the embryo contained therein will have 40,000 to 70,000 cells. (", "Johnston (xe2x80x9cIn Vitro Sperm Binding, Penetration, and Fertilization of Recently Oviposited Chicken Eggs,xe2x80x9d December 1988, Clemson University); Olsen, M. W., J. Morph. ", "70: 413-533 (1942); Etches et al., ", "in Methods in Molecular Biology, vol. ", "62 Recombinant Gene Expression Protocols, Ed. ", "R. Tuan, Humana Press, Inc. Totowa, N.J., pp. ", "433-450 (1997); Petitte et al., ", "in Manipulation of the Avian Genome, Ed. ", "Etches et al., ", "CRC Press, Boca Raton, Fla., pp. ", "81-101 (1993)).", "\nThe present invention provides a ground-breaking improvement in avian biology by making it possible to fertilize an oviposited egg in its shell, to obtain embryo development, and to hatch a live bird from the shell, herein called xe2x80x9cin ovo fertilization,xe2x80x9d (IOF). ", "Such methods provide an alternative to floor breeding and IV fertilization that can greatly increase the efficiency of poultry production.", "\nThe present invention relates to the field of avian egg fertilization. ", "In particular, the present invention provides a method of fertilizing an egg in a shell. ", "The invention also provides a method of fertilizing an egg in a shell, whereby a live chick is hatched. ", "The invention also provides developmentally early stage oviposited avian eggs.", "\nAs used herein, xe2x80x9ca,xe2x80x9d xe2x80x9canxe2x80x9d or xe2x80x9cthexe2x80x9d may mean one or more. ", "For example, xe2x80x9canxe2x80x9d egg may mean one egg or more than one egg. ", "Moreover, xe2x80x9cthexe2x80x9d egg may mean one egg or more than one egg.", "\nThe present invention provides a method of fertilizing an avian egg in a shell, wherein the egg comprises a yolk enclosed by a membrane, comprising obtaining a sperm sample comprising avian sperm in a physiologically acceptable carrier, and delivering the sperm sample into the egg, so as to fertilize the egg. ", "The present invention relates to the unexpected and surprising discovery that an unfertilized, oviposited avian egg can be fertilized in the shell and produce a live chick. ", "As used herein, reference to an avian egg in a shell refers to an oviposited egg, that is, an egg with a calcium carbonate shell that has been extruded from the vagina of the bird. ", "Extrusion of the egg is referred to as xe2x80x9coviposition.xe2x80x9d Accordingly, all references herein to an xe2x80x9cegg in a shellxe2x80x9d or to an xe2x80x9coviposited eggxe2x80x9d should be understood to be equivalent in meaning. ", "The process of fertilizing an oviposited egg in a shell is referred to herein as xe2x80x9cin ovo fertilizationxe2x80x9d (IOF).", "\nAn avian egg comprises a hard, calcified shell at the time the egg is oviposited. ", "Within the shell is a yolk that contains nutrients for supporting growth and development of an embryo. ", "As used herein, an xe2x80x9cembryoxe2x80x9d is a developing organism resulting from the joining of a female pronucleus and a male pronucleus during the process of egg fertilization. ", "While a fertilized (single cell) ovum may thus be called an embryo, the single cell embryo is also specifically referred to herein as a zygote.", "\nAlthough in ovo fertilization can be performed on eggs as old as 2 weeks if the eggs are maintained at room temperature, ideally newly oviposited eggs are used for the best results. ", "In a preferred embodiment, the sperm sample is delivered into the egg between 0 and 96 hours following oviposition. ", "In a more preferred embodiment, the sperm sample is delivered into the egg between 0 and 72 hours following oviposition. ", "In an even more preferred embodiment, the sperm sample is delivered into the egg between 0 and 48 hours following oviposition. ", "In a highly preferred embodiment, the sperm sample is delivered into the egg between 0 and 24 hours following oviposition. ", "Thus, it is preferred that the sperm sample be delivered into the egg as soon as possible following oviposition. ", "However, the precise timing of fertilization can depend on how the oviposited egg is maintained, e.g., temperature, humidity, etc. ", "For example, fertilization can improve if the unfertilized oviposited egg is fertilized before it is allowed to cool.", "\nThe sperm in the sperm sample may be obtained from a bird by methods known to a person skilled in the art, such as the abdominal massage method which is well-known to those of skill in the art. ", "This method allows the collection of an ejaculate (semen) comprising sperm, seminal fluid, and transparent fluid. ", "Transparent fluid is a lymphlike fluid that passes from the lymph channels to the surface of the phallus during phallic tumescence. ", "Avian sperm may also be obtained from commercial sources that are well known to those of skill in the art.", "\nIn one embodiment, the sperm in the sperm sample is from a single bird. ", "In another embodiment, the sperm in the sperm sample is a mixture of sperm obtained from more than one bird. ", "When a mixture of sperm from more than one bird is used in the methods of the invention, the probability of successfully fertilizing the egg can increase, because if one of the birds from which the sperm has been collected is infertile, it is possible that the sperm collected from the other bird or birds will be capable of fertilizing the egg.", "\nIn a preferred embodiment, the sperm sample comprises sperm from birds which are members of the same species, and the sperm sample is used to fertilize eggs oviposited by hens which are members of the same species as the sperm donors. ", "The present invention also contemplates the use of sperm from one species and an egg from another species, if the sperm is capable of fertilizing the egg.", "\nWhile it is typically preferred that the sperm be used within 30 minutes of the time that it is collected, older sperm, and even sperm which have previously been frozen or freeze dried may be used in the methods of the invention, as long as the sperm retain their ability to fertilize an ovum. ", "Where the sperm are to be used more than 30 minutes after collection, it is preferred that they be combined with a sperm extender, as is described below.", "\nAs mentioned above, the sperm sample also comprises a physiologically acceptable carrier. ", "As used herein, a xe2x80x9cphysiologically acceptable carrierxe2x80x9d is a fluid in which sperm remain motile and viable. ", "Examples of a physiologically acceptable carrier include, but are not limited to, unaltered semen, seminal fluid (either original to the sperm or added), transparent fluid (either original to the sperm or added), buffered saline solution, sperm extender, and combinations thereof. ", "Preferably, the carrier includes sperm extender, also referred to in the art as a diluent. ", "As mentioned above, the use of a sperm extender is especially preferred where the collected sperm will not be used for fertilization within 30 minutes after collection. ", "M. R. Bakst, In Manipulation of the Avian Genome, R. J. Etches and AM. ", "Verrinder Gibbons, eds., ", "CRC Press, Boca Raton, Fla., pp. ", "15-28 (1993). ", "As used herein, a xe2x80x9csperm extenderxe2x80x9d is a physiologically acceptable carrier that is used to dilute a sperm sample to produce a sperm sample of greater volume in which the sperm are less concentrated. ", "Preferably, the composition of the sperm extender will extend the shelf life of the sperm, as well as diluting the sperm so as to increase the number of eggs which may be fertilized by the quantity of sperm which has been collected. ", "Examples of sperm extender compositions, suggested dilution rates, optimal storage times and conditions, and commercial sources of extender may be found in Bakst (xe2x80x9cPreservation of Avian Cells: In: Poultry breeding and Genetics, R. D. Crawford (ed.) ", "Elsevier, N.Y., pp 91-108 (1990)). ", "Other diluents commonly used in the poultry industry are Lago Formulation Avian Semen Extender by Hygeia Biological Laboratories, Semaid Turkey Extender by Poultry Health Laboratories in Davis Calif., Beltsville Poultry Semen Extender by Tri Bio Laboratories, Inc. in State College, Pa. In a preferred embodiment, the sperm extender is Avidiluent. ", "Avidiluent is produced by IMB, 10 rue Georges, Clemenceau, BP 81, 61302 1\"\" Aigle, France.", "\nThus, in one embodiment, the sperm sample may comprise sperm and seminal fluid, i.e., semen. ", "Moreover, the sperm sample may comprise sperm and seminal fluid which is diluted with a physiologically acceptable carrier, including but not limited to buffered saline solution and a sperm extender.", "\nThe sperm sample can also be prepared by methods which will be clear to one of ordinary skill in the art, such as washing semen from one or more birds with a solution such as buffered saline solution or sperm extender, centrifuging the resulting solution, removing the supernatant, and resuspending the washed sperm in a volume of a solution such as buffered saline or semen extender. ", "One of ordinary skill in the art will readily understand how to achieve the desired concentration of sperm by resuspending the sperm in the appropriate volume of solution. ", "For example, following centrifugation and removal of supernatant, the packed sperm may then be weighed, and the number of sperm then estimated by using known values for the weight of avian sperm. ", "The sperm may then be resuspended in the volume required to obtain the desired sperm concentration. ", "Alternatively, the centrifuiged sperm may be resuspended following removal of the supernatant, and then recentrifuiged, allowing the determination of the packed sperm volume. (", "Johnston S., xe2x80x9cIn Vitro Sperm Binding, Penetration, and Fertilization of Recently Oviposited Chicken Eggs,xe2x80x9d M. S. Thesis presented to the Graduate School of Clemson University, 1998). ", "Subsequently, the concentration of the sperm may be calculated using the formula of Maeza and Buss. (", "Poultry Sci. ", "55:2059 (1976)).", "\nTypically, the concentration of sperm in chicken semen is from 300 million to 800 million per milliliter, in turkey semen from 800 million to 1.5 billion per milliliter, in Guinea fowl semen from 400 million to 800 million per milliliter, in Pekin duck semen from 20 million to 600 million per milliliter. ", "The standard number of sperm used for artificial insemination is 100 million in a total volume of 50 micro liters. ", "In the methods of the present invention, because sperm are placed directly adjacent to the female pronucleus, far fewer sperm are required to fertilize the egg. ", "Thus, as few as one sperm can be used in the methods of the present invention. ", "In fact, a large range of sperm concentrations can be used in the present invention. ", "In one embodiment, chicken semen is diluted with an equal volume of Avidiluent and approximately 0.01 milliliters of this sperm sample is injected into an egg. ", "Thus, approximately 1 million sperm would be deposited adjacent to the female pronucleus.", "\nIn the methods of the invention, fertilization of the avian egg in the shell is accomplished by delivering the sperm sample into the egg. ", "Delivery of the sperm sample may be accomplished by any method which will allow the sperm to be delivered inside the shell, including, but not limited to, dissolving an area of the shell with, e.g., an acid solution, using electroporation, and creating an opening by penetrating or cracking an area of the shell, for example using a tool such as a needle or a scalpel.", "\nPreferably, the surface of the area of the shell to be penetrated in order to deliver the sperm sample is sanitized before the sperm is delivered inside, to prevent contamination of the egg. ", "Any method which is compatible with the delivery method may be used to sanitize the shell, including, but not limited to, the disinfectant IOFEC-20(copyright), and 3% hydrogen peroxide. ", "The surface of the egg at the intended penetration site may be wiped or sprayed with the disinfectant, or the egg may be immersed in a vessel containing the disinfectant of choice.", "\nAs is described above, an opening in the shell can be made with a tool such as a knife or a needle. ", "Preferably, the tool will be sterile. ", "For example, in a two-step procedure, an opening in the shell can first be made with a knife or other sharp instrument. ", "In a second step, a needle attached to a syringe containing a sperm sample can be passed through the opening to deliver the sperm sample into the egg. ", "Introduction of the sperm sample into the opening in the shell may also be accomplished by other means, including, but not limited to, the use of a pipette, such as a micropipettor. ", "Alternatively, in one step, a needle attached to a syringe containing the sperm sample can be used to penetrate and thus create the opening in the shell and deliver by injection the sperm sample into the egg. ", "Thus, xe2x80x9copeningxe2x80x9d can include a hole created by a needle. ", "Of course, one of ordinary skill in the art will be able to choose a needle whose gauge will be large enough to allow the sperm sample to be moved through the needle. ", "In one embodiment, the needle will be of the smallest gauge that can deliver intact sperm into the shell and also be sturdy enough to penetrate the calcium eggshell. ", "Alternatively, a separate needle or other device could be used to make the opening in the eggshell. ", "Typically, needles varying from 30-gauge to 16-gauge can be used. ", "In one embodiment a 22-gauge needle is used. ", "A sperm is approximately 0.5 um at its widest point and 100 um in length. ", "Therefore, in a preferred embodiment, a needle with an inner diameter of at least 10 um can be used for injections. ", "In one embodiment the needle can remain in the shell after injection. ", "Various needles and methods now used for injection of vaccines into eggs could be used or adapted for delivery of sperm.", "\nThe egg injection mechanism may be of a design similar to those manufactured and sold by Embrex, Inc., Merck Inc., and others in the industry. ", "As an example, one design is disclosed in U.S. Pat. ", "No. ", "4,903,635, entitled xe2x80x9cHigh Speed Automation Injection System for Avian Embryos,xe2x80x9d which is incorporated herein by reference. ", "As described in the patent, the disclosed device is a high-speed automated injection system for avian embryos, which can inject eggs with fluid substances, specifically an inoculating fluid. ", "The machine includes suction devices which lift eggs out of engagement with surfaces, rather than pushing them, before injecting them. ", "Thus, the machine provides separate mechanisms and devices for first forming an opening in the egg shell and then injecting the avian embryo or the surrounding environment with a fluid substance, avoiding use of a single needle or punch to both puncture the shell of an egg and deliver fluid substances to the interior of the egg. ", "As is also known in the art, the present invention here also contemplates using a single needle both to puncture the shell and to deliver fluid substances. ", "Other relevant patents that disclose injection of fluids into eggs include U.S. Pat. ", "No. ", "5,900,929, entitled xe2x80x9cMethod and Apparatus for Selectively Injecting Poultry Eggsxe2x80x9d; U.S. Pat. ", "No. ", "5,722,342, entitled xe2x80x9cOvo Antibiotic and Microbial Treatment to Diminish Salmonellae Populations in Aviansxe2x80x9d; U.S. Pat. ", "No. ", "5,699,751, entitled xe2x80x9cMethod and Apparatus for in Ovo Injectionxe2x80x9d; U.S. Pat. ", "No. ", "5,438,954, entitled xe2x80x9cMethod and Apparatus for Early Embryonic in Ovo Injectionxe2x80x9d; U.S. Pat. ", "No. ", "5,339,766, xe2x80x9cMethod of Introducing Material into Eggs During Early Embryonic Developmentxe2x80x9d; U.S. Pat. ", "No. ", "5,176,101, xe2x80x9cModular Injection System for Avian Embryosxe2x80x9d; U.S. Pat. ", "No. ", "5,158,038, xe2x80x9cEgg Injection Method, Apparatus and Carrier Solution for Improving Hatchability and Diseasexe2x80x9d; and U.S. Pat. ", "No. ", "5,136,979, xe2x80x9cModular injection system for avian embryos,xe2x80x9d all of which are incorporated by reference. ", "In the simplest embodiment for IOF, sperm is substituted for antigen in these machines and the depth of injection is adjusted to accomplish IOF.", "\nThe opening can be made anywhere in the shell that effects viable fertilization, but is typically made in an area of the shell that is near the germinal disc. ", "While an egg may be manipulated so as to place the germinal disc at different regions of the egg, the germinal disc in a newly oviposited egg is located at the large end of the shell, which overlies the air cell adjacent to the yolk. ", "Once an opening has been created in the shell, the sperm sample is preferably delivered by introducing the needle, pipette, etc., ", "through the air cell and beneath a membrane lying below the air cell (inner shell membrane). ", "The sperm number can be increased or decreased, depending on where and in what form the sperm are administered. ", "In a further preferred embodiment, the sperm sample is delivered into the egg using a needle. ", "In nature, the sperm cells must penetrate the inner perivitelline membrane and fuse with the oolema for successful fertilization to occur. ", "With IOF, the sperm cells must also penetrate the outer perivitelline membrane before successful fertilization can occur. ", "To increase the fertilization efficiency, one can treat the OPL. ", "Any treatment which rendered the OPL or yolk membrane more permeable to sperm could be utilized, for example, a non-toxic acid, a proteolytic enzyme or physical abrasion.", "\nIn one embodiment, the needle, pipette, etc., ", "is advanced through the shell at an angle of approximately 15xc2x0, penetrating the membrane lining the shell. ", "In a method of the invention, the needle, pipette, etc., ", "can be advanced through the air cell, until it meets the inner shell membrane. ", "A person practicing the method of the invention will know that the tip of the needle, pipette, etc., ", "has encountered the membrane when slight resistance to further advancement of the tip is felt. ", "As the tip is gently advanced, the resistance from the membrane gives way and the tip is allowed to barely penetrate the membrane. ", "The sperm sample can then be delivered into the egg, adjacent to a region of the membrane and that is adjacent to the germinal disc. ", "Therefore, the sperm can be delivered just under the membrane, a process known as intracytoplasmic sperm injection (ICSI). ", "Typical volumes of the sperm sample are as small as 0.005 ml or as large as 0.10 ml. ", "A typical volume of injected sperm sample is about 0.01 ml.", "\nPreferably, to prevent contamination of the egg and death of an embryo, the opening in the shell is sealed. ", "A non-toxic adhesive can be applied directly to the opening in the shell to seal it. ", "Alternatively, a piece of eggshell can be used as a patch to close the opening and may be attached to the shell with a non-toxic adhesive. ", "In one embodiment, the non-toxic adhesive is Elmer\"\"s(copyright) glue. ", "In another embodiment, the adhesive is silicone sealant. ", "Moreover, any xe2x80x9ctissue gluexe2x80x9d can also be used to seal the shell. ", "A xe2x80x9ctissue gluexe2x80x9d is a sterile, non-toxic adhesive used during surgical, operative procedures to bind tissues together.", "\nThe method of the present invention can be used to fertilize oviposited eggs from avian species selected from the group consisting of chicken, quail, duck, turkey, pheasant, ostrich, emu, goose, peafowl, grouse, rhea, parrot, cockatiel, cockatoo, parakeets, and other commercially valuable birds.", "\nThe present invention also provides a method of fertilizing an avian egg in a shell, wherein the egg comprises a yolk enclosed by a membrane, and hatching a live chick, comprising obtaining a sperm sample comprising avian sperm in a physiologically acceptable carrier, delivering the sperm sample into the egg, so as to fertilize the egg, incubating the egg, and hatching the live chick from the egg. ", "As used herein, xe2x80x9cobtainingxe2x80x9d includes utilizing pre-made and pre-delivered sperm samples.", "\nAfter the sperm sample has been delivered into the egg according to the methods of the present invention as described above, the egg is incubated until the live chick is hatched. ", "One of ordinary skill will be aware of the amount of time and the preferred conditions for incubating a fertilized egg belonging to a particular species. ", "The following are incubation periods for various species of birds: Chicken-21 days, Quail-23 days, Corunix quail-17 to 18 days, Pheasant-23 days, Turkey-28 days, Duck-28 to 33 days, Goose-28 to 30 days, Parakeet-18 days, Parrots-28 days, Dove-14 days, Mynah-14 days, Finch-14 days, Button Quail-16 days, Valley Quail-21 to 22 days, Swan-30 to 37 days. ", "Incubation of eggs fertilized by the methods of the present invention as compared to naturally fertilized eggs may differ only in that the length of incubation time may be lengthened to include the amount of time that the fertilized egg would have spent within the body of the female prior to oviposition. ", "In a preferred embodiment, the incubation period lasts from 21 to 23 days for chicken eggs. ", "While one of ordinary skill in the art will readily be able to determine the optimal temperature for incubation of an egg from a particular species of bird, typically the incubation temperature is between 95xc2x0 F. and 100xc2x0 F. A chicken egg will be incubated at about 99.5xc2x0 F. In a more preferred embodiment, the temperature at which the chicken egg is incubated will be lowered as the egg nears the point of hatching. ", "Thus, in a currently preferred embodiment, a chicken egg is incubated at 99.5xc2x0 F. from day 1 of incubation to about day 18 of incubation, and at 98.50xc2x0 F. from day 19 of incubation to hatching.", "\nAs is well known in the art, the humidity level at which an egg is incubated can be important for bringing the egg to hatch. ", "Thus, typically the egg is incubated at between 75% and 90% humidity. ", "Preferably, the egg is incubated at about 80% humidity. ", "More preferably, the humidity level at which the egg is incubated will be raised as the egg nears the point of hatching. ", "Thus, in a preferred embodiment, a chicken egg is incubated at 80% humidity from day 1 of incubation to about day 18 of incubation, and at 85% humidity from day 19 of incubation to hatching. ", "In a specific preferred embodiment, an egg is incubated at 99.5xc2x0 F. and 80% humidity from day 1 of incubation to about day 18 of incubation, and at 98.50xc2x0 F. and 85% humidity from day 19 of incubation to hatching. ", "As is well known in the art, turning the eggs during incubation is useful for promoting growth of the embryo.", "\nIt is further preferred that the incubation of the eggs take place in a commercial incubator. ", "Commercial hatchers and setters are produced by many companies including PAS Reform, Jamesway, Chickmaster, Buckeye, Cumberland, Petersime, Humidaire Incubator Co., etc. ", "Preferably, the eggs are moved from a setter incubator to a hatcher incubator at about 3 days prior to hatch. ", "The hatcher basket allows the egg to lie on its side where the chick can more easily pip out. ", "This basket also allows the chick to walk about immediately after hatch, which is necessary for the chicks development and viability.", "\nIn another embodiment, the present invention provides an oviposited avian egg comprising a native embryo having fewer than 40,000 cells, wherein the embryo can develop into a live chick. ", "xe2x80x9cNativexe2x80x9d means growing, living or produced in its place of origin. ", "Thus, a native embryo is an embryo that develops and hatches the same shell in which the female pronucleus was formed. ", "Thus, the embyro is descended from the native ovum. ", "By the time an ovum which has been fertilized naturally has been oviposited, the developing embryo typically has between 40,000 and 70,000 cells. ", "However, the egg of the present invention is fertilized after it has been oviposited in its shell; thus, an embryo developing in the egg of the present invention will at some time during incubation have fewer than 40,000 cells. ", "In fact, at the moment of fertilization, the embryo in the egg of the present invention will have one cell and is a zygote. ", "As the embryo grows within the egg, normal cell division will occur and the number of cells will increase. ", "Thus, the fertilized, oviposited egg of the present invention will at some time during incubation comprise an embryo having, for example, 10,000, 20,000 or 30,000 cells, including less than and between these numbers of cells. ", "Thus, the invention provides an oviposited avian egg comprising an embryo and a native yolk having fewer than 40,000, 30,000, 20,000, 10,000, 5,000, 1,000 or 100 cells, including numbers in between 1 and 40,000. ", "Two commercially preferred avian eggs are chicken and turkey. ", "The chicks which hatch from these eggs can have a normal karyotype and normal development.", "\nIn another embodiment, the present invention provides an avian egg in a shell comprising an embryo having fewer than 40,000 cells (e.g. 30,000; 20,000; 10,000; 1,000; 100 and 1 (zygote)), wherein the embryo can develop into a live chick, and wherein the shell has an opening of less than 4 centimeters. ", "In another embodiment, the opening in the shell is less than 2 centimeters. ", "In another embodiment, the opening in the shell is less than 1 centimeter or 0.5 centimeter. ", "In one embodiment, the opening in the shell is only large enough to accommodate a 22-gauge needle. ", "Thus, the opening can be any size between the smallest opening that will permit injection of sperm, up to smaller than the hole required to place an In Vitro fertilized (i.e., outside the shell) ovum back into the shell. ", "By xe2x80x9copeningxe2x80x9d is meant a hole has been made in the egg at some point after oviposition. ", "xe2x80x9cOpeningxe2x80x9d includes an egg where the hole has subsequently been sealed. ", "For example, an egg having a hole created by a needle used to inject sperm and then sealed is, even after sealing, within the definition of avian egg having an opening. ", "The embryo can be either native or non-native to the egg. ", "xe2x80x9cNon-nativexe2x80x9d includes embryos developed from an ovum not native to the shell in which it was oviposited. ", "Two commercially preferred eggs are chicken and turkey.", "\nAn egg of the present invention may, for example, be derived from avian species selected from the group consisting of chicken, quail, duck, turkey, pheasant, ostrich, emu, goose, peafowl, grouse, rhea, parrot, cockatiel, cockatoo, parakeets, swan, dove, and other commercially valuable birds. ", "In a commercially preferred embodiment, the egg is derived from avian species used in the methods of the present invention and is selected from the group consisting of chicken, turkey, goose, duck, quail, and pheasant. ", "In a more preferred commercial embodiment, the egg is derived from a chicken. ", "The method can also be effectively utilized on avian species in zoos, e.g., to help preserve endangered species.", "\nThe methods of the present invention can also be used for in ovo fertilization of reptilian eggs. ", "Reptilian eggs, similar to avian eggs, comprise a yolk and female pronucleus and are protected by a shell when they are laid. ", "An unfertilized, oviposited reptilian egg can be fertilized in the shell according to the methods of the present invention. ", "In particular, a sperm sample, comprising sperm from one or more reptiles of the same species, is delivered into the unfertilized, oviposited egg through an opening created in the shell and onto the yolk adjacent to the female pronucleus where fertilization occurs.", "\nThe in ovo fertilization methods described herein can also be utilized in conjunction with other in ovo procedures. ", "For example, the embryo can be vaccinated after fertilization. ", "Such vaccination procedures are well known to those skilled in the art. ", "Alternatively, such vaccination could occur simultaneous with in ovo fertilization providing however that the vaccine did not prevent development of the embryo.", "\nAdditionally, in ovo fertilization can be automated such that multiple eggs are simultaneously fertilized by, for example, injection techniques. ", "Thus, 50, 100, 200, 300 or more eggs could be simultaneously injected.", "\nIt will be clear to those of ordinary skill in the art that the methods of the present invention may easily be applied to a large-scale industrial operation, using automation to fertilize newly laid eggs. ", "Accordingly, apparatus which has previously been used, for example, to immunize embryos in eggs can be adapted to instead introduce a sperm sample. ", "Any of these apparatus or other apparatus adapted for sperm injection is within the scope of applicants\"\" invention\nThe following Examples are set forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the methods claimed herein can be performed, and is intended to be purely exemplary of the invention and is not intended to limit the scope of what the inventors regard as their invention. ", "Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) ", "but some errors and deviations should be accounted for. ", "Unless indicated otherwise, parts are parts by weight, temperature is in xc2x0 F. and pressure is at or near atmospheric." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391896310262382, 0.0006452195812016726, 0.0006804155418649316, 0.0011855863267555833, 0.0006389678455889225, 0.002002294408157468, 0.0008393799653276801, 0.0006103316554799676, 0.0006333728670142591, 0.0007685950258746743, 0.0006822398281656206, 0.000665075785946101, 0.0005988947814330459, 0.003797488985583186, 0.0019900125917047262, 0.0007751180091872811, 0.001156750600785017, 0.0006509468075819314, 0.0011332315625622869, 0.0007560728117823601, 0.0007008911343291402, 0.0007206460577435791, 0.006312507204711437, 0.0007590283057652414, 0.0021075496915727854, 0.0024595754221081734, 0.002321530831977725, 0.0026965660508722067, 0.0012951164972037077, 0.0007066054968163371, 0.0012492893729358912, 0.0005909430328756571, 0.0006139960023574531, 0.0032268862705677748, 0.0006688665016554296, 0.0005983291193842888, 0.0009613599395379424, 0.0007020669872872531, 0.0007951379520818591, 0.0005676824366673827, 0.0006343962741084397, 0.0005399039946496487, 0.0012501779710873961, 0.006434465292841196, 0.0006487020873464644, 0.0010924652451649308, 0.000703739351592958, 0.011624815873801708, 0.000578861974645406, 0.0013874029973521829, 0.000565951457247138, 0.0006174712907522917, 0.0005266836378723383, 0.0005549142370000482, 0.000635577249340713, 0.005907922983169556, 0.8926478028297424, 0.0006705569103360176, 0.0006107896333560348, 0.0009699566871859133, 0.12508364021778107, 0.02232838235795498, 0.0012387394672259688, 0.0010292689548805356, 0.29948803782463074, 0.08555866032838821, 0.005043691024184227, 0.010132175870239735, 0.04536616429686546, 0.0006943925400264561, 0.07495731115341187, 0.0007152099278755486, 0.6599940061569214, 0.0014430554583668709, 0.0007566310814581811, 0.0008568267803639174, 0.0015390474582090974, 0.0006757761584594846, 0.0006263066898100078, 0.6102428436279297, 0.000648653251118958, 0.0033860625699162483, 0.0006483349716290832, 0.0006401037098839879, 0.0006891323137097061, 0.0007145226118154824, 0.0006517134024761617, 0.0007798043661750853, 0.0006464463076554239, 0.0007521057850681245, 0.0006723851547576487, 0.0009031133376993239, 0.0005959745030850172, 0.0006601831992156804, 0.000744887045584619, 0.0010447392705827951, 0.0020637016277760267, 0.003235887736082077, 0.0014995113015174866, 0.002252710983157158, 0.0012735618511214852, 0.0009555071010254323, 0.020745737478137016, 0.002572602592408657, 0.007462136913090944, 0.004019254818558693, 0.0018059827852994204, 0.018060987815260887, 0.013176290318369865, 0.0011227993527427316, 0.0025843926705420017, 0.002420752542093396, 0.0027157808654010296, 0.002471907064318657, 0.0058878157287836075, 0.0007941440562717617, 0.001445479691028595, 0.015202307142317295, 0.8870288729667664, 0.07832656800746918, 0.07843869179487228, 0.03434689715504646, 0.03106376715004444, 0.0034579013008624315, 0.01775248907506466, 0.004794666543602943, 0.012780793011188507, 0.023746971040964127, 0.002711704233661294, 0.13386158645153046, 0.0856686681509018, 0.20498783886432648, 0.007112711202353239, 0.0007542018429376185, 0.0007189866155385971, 0.0007521057850681245, 0.0006588615942746401, 0.015741689130663872, 0.006449528969824314, 0.0006897802231833339, 0.0006579489563591778, 0.13405337929725647, 0.0006466366467066109, 0.4945451319217682, 0.011704801581799984, 0.1810915768146515, 0.037373580038547516, 0.007954130880534649, 0.02267487905919552, 0.012195458635687828, 0.0022063031792640686, 0.023976318538188934, 0.0007251272909343243, 0.0006870541255921125, 0.8143466711044312, 0.08114731311798096, 0.030964525416493416, 0.06381607800722122, 0.008889324963092804, 0.7046269774436951, 0.18931519985198975, 0.0009710874874144793, 0.005831376649439335, 0.006009582430124283, 0.000675169809255749, 0.0007392601110041142, 0.0006545783835463226, 0.0007214283104985952, 0.0006219432689249516, 0.0021976849529892206, 0.002736321184784174, 0.0017745500663295388, 0.0012411512434482574, 0.001141232904046774, 0.002320052357390523, 0.0007091133156791329, 0.0006333770579658449, 0.0006351085612550378, 0.34371522068977356, 0.0006187747931107879, 0.0006371004274114966, 0.003535997122526169, 0.000578143575694412, 0.0006029710057191551, 0.0013785824412479997, 0.0009115417487919331, 0.0008381950319744647, 0.0009159274050034583, 0.0007705875323154032, 0.0006450050277635455, 0.000636005075648427, 0.0013785824412479997, 0.0015094437403604388, 0.0013785824412479997, 0.0010814133565872908, 0.0013785824412479997, 0.0012193837901577353, 0.0013785824412479997, 0.0009021684527397156, 0.0013785824412479997, 0.0007609134772792459, 0.0013785824412479997, 0.0009072163957171142, 0.0013785824412479997, 0.0008635284611955285, 0.0013785824412479997, 0.0007874926086515188, 0.011978698894381523, 0.0008336055325344205, 0.0009393694926984608, 0.0009268527501262724, 0.0006171936402097344, 0.026942919939756393, 0.0019911930430680513, 0.013139616698026657, 0.01409262977540493, 0.0006205934914760292, 0.034277498722076416, 0.0006091638933867216, 0.0006798406247980893, 0.0005999162094667554, 0.0005655534914694726, 0.0005533368675969541, 0.0005984086892567575, 0.0006203214870765805, 0.001974949613213539, 0.015573161654174328, 0.026882054284214973, 0.016019659116864204, 0.0007427095551975071, 0.0006556242005899549, 0.0007413469138555229, 0.0007064392557367682, 0.033988673239946365, 0.0010974898468703032, 0.003102285321801901, 0.004873812198638916, 0.001559484633617103, 0.013859404250979424, 0.0017781893257051706, 0.0006252334569580853, 0.0015797753585502505, 0.001034456305205822, 0.0007562666432932019, 0.0006396722747012973, 0.0009647926199249923, 0.0006336047663353384, 0.0007570717134512961, 0.0007011987618170679, 0.0007059664349071681, 0.0007250126218423247, 0.0007634086650796235, 0.0007446365198120475, 0.0006722884136252105, 0.0006647900445386767, 0.0015255364123731852, 0.0030285620596259832, 0.0010619026143103838, 0.0010109011782333255, 0.0011154928943142295, 0.018277382478117943, 0.0011630600783973932, 0.000972537905909121, 0.000649148307275027, 0.021999530494213104, 0.0009073849068954587, 0.0008191457018256187, 0.0010023873765021563, 0.0013484186492860317, 0.0023824775125831366, 0.0009587201639078557, 0.0007295099785551429, 0.0007273656083270907, 0.0006521613686345518, 0.01273822970688343, 0.00121383648365736, 0.0017793262377381325, 0.003686134470626712, 0.0006882147281430662, 0.0017202915623784065, 0.0010773306712508202, 0.0011932037305086851, 0.0007666356978006661, 0.0008928307797759771, 0.0005821554805152118, 0.0009695450426079333, 0.02611483447253704, 0.0013427281519398093, 0.015377898700535297, 0.0006560607580468059, 0.001344561344012618, 0.001093739760108292, 0.0009267984423786402, 0.0007295398390851915, 0.000953905691858381, 0.0006394077208824456, 0.0010487374383956194, 0.0006998715689405799, 0.0005362646770663559, 0.0006731234607286751, 0.0006221359362825751 ]

[ "/*\n#########################################################################\n#\n# Copyright (C) 2019 OSGeo\n#\n# This program is free software: you can redistribute it and/or modify\n# it under the terms of the GNU General Public License as published by\n# the Free Software Foundation, either version 3 of the License, or\n# (at your option) any later version.", "\n#\n# This program is distributed in the hope that it will be useful,\n# but WITHOUT ANY WARRANTY; without even the implied warranty of\n# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", "See the\n# GNU General Public License for more details.", "\n#\n# You should have received a copy of the GNU General Public License\n# along with this program. ", "If not, see <http://www.gnu.org/licenses/>.", "\n#\n#########################################################################\n*/\n\nexport default {\n content: {\n width: '50%',\n padding: 10,\n marginRight: 10,\n },\n};\n" ]

{ "pile_set_name": "Github" }

[ 0.0013245857553556561, 0.0006252182647585869, 0.0005876600625924766, 0.0006140132900327444, 0.0006092390394769609, 0.005698936991393566 ]

[ "Integrative Approaches to Stress, Anxiety, and Resilience.", "\nAnxiety is one of the most common psychiatric conditions affecting adolescents and youth in the United States, with over 30% of adolescents having an anxiety disorder of any type. ", "The conventional approach to anxiety management can include medications that in some patient populations can increase the risk of suicidality. ", "Untreated anxiety and sequela of anxiety can have a significant impact on the life of a child and can impact them into adulthood. ", "Integrative treatments in the setting of anxiety and stress management can be used along with conventional approaches to evoke the relaxation response. ", "Integrative approaches can also teach children and youth tools that may serve to help them learn to better manage the symptoms of anxiety and build resilience throughout their lifetime. [", "Pediatr Ann. ", "2019;48(6):e226-e230.]." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006081631290726364, 0.0019136408809572458, 0.0005942383431829512, 0.0007997382781468332, 0.000560980464797467, 0.0007323379395529628, 0.002319690305739641, 0.0007160273380577564 ]

[ "// Github: https://github.com/shdwjk/Roll20API/blob/master/APIHeartBeat/APIHeartBeat.js\n// By: The Aaron, Arcane Scriptomancer\n// Contact: https://app.roll20.net/users/104025/the-aaron\n\nvar APIHeartBeat = APIHeartBeat || (function() {\n 'use strict';\n\n var version = '0.4.2',\n lastUpdate = 1490362946,\n schemaVersion = 0.2,\n beatInterval = false,\n beatPeriod = 200,\n devScaleFactor = 5,\n beatCycle = 3000,\n\n scaleColorRange = function(scale, color1, color2) {\n return _.chain(\n _.zip(\n _.rest(color1.match(/^#([0-9a-fA-F]{2})([0-9a-fA-F]{2})([0-9a-fA-F]{2})$/)),\n _.rest(color2.match(/^#([0-9a-fA-F]{2})([0-9a-fA-F]{2})([0-9a-fA-F]{2})$/))\n )\n )\n .map(function(d){\n var b1 = parseInt(d[0],16),\n b2 = parseInt(d[1],16);\n return Math.min(255,Math.max(0,((b2-b1)*scale+b1).toFixed(0))).toString(16);\n })\n .reduce(function(memo,d){\n return memo+(1===d.length ? '", "0' : '')+d;\n },'#')\n .value();\n },\n\n animateHeartBeat = function() {\n var cycle = beatCycle * (state.", "APIHeartBeat.devMode ? ", "1 : devScaleFactor),\n x = ((Date.now()%cycle)/cycle)*Math.", "PI*2,\n scale = (Math.sin(x)+1)/2;\n\n _.chain(state.", "APIHeartBeat.heartBeaters)\n .map(function(d){\n return {\n player: getObj('player',d.pid),\n color1: d.color1,\n color2: d.color2\n };\n })\n .reject(function(d){\n return !", "d.player || !", "d.player.get('online');\n })\n .each(function(d){\n d.player.set({\n color: scaleColorRange(scale,d.color1,d.color2)\n });\n });\n },\n\n startStopBeat = function() {\n var userOnline=_.chain(\n _.keys(state.", "APIHeartBeat.heartBeaters)\n )\n .map(function(pid){\n return getObj('player',pid);\n })\n .reject(_.isUndefined)\n .map(function(p){\n return p.get('online');\n })\n .reduce(function(memo,os){\n return memo||os;\n },false)\n .value(),\n period=beatPeriod*( state.", "APIHeartBeat.devMode ? ", "1 : devScaleFactor );\n\n if(!beatInterval && _.keys(state.", "APIHeartBeat.heartBeaters).length && userOnline) {\n beatInterval = setInterval(animateHeartBeat,period);\n } else if(beatInterval && (!_", ".keys(state.", "APIHeartBeat.heartBeaters).length || !", "userOnline) ) {\n clearInterval(beatInterval);\n beatInterval=false;\n }\n },\n\n ch = function (c) {\n var entities = {\n '<' : 'lt',\n '>' : 'gt',\n \"'\" : '#39',\n '@' : '#64',\n '{' : '#123',\n '|' : '#124',\n '}' : '#125',\n '[' : '#91',\n ']' : '#93',\n '\"' : 'quot',\n '-' : 'mdash',\n ' ' : 'nbsp'\n };\n\n if(_.has(entities,c) ){\n return ('&'+entities[c]+';');\n }\n return '';\n },\n\n showHelp = function(who) {\n sendChat('',\n\t\t\t'/w '+who+' '\n+'<div style=\"border: 1px solid black; background-color: white; padding: 3px 3px;\">'\n\t+'<div style=\"font-weight: bold; border-bottom: 1px solid black;font-size: 130%;\">'\n\t\t+'APIHeartBeat v'+version\n\t+'</div>'\n\t+'<div style=\"padding-left:10px;margin-bottom:3px;\">'\n\t\t+'<p>APIHeartBeat provides visual feedback that the API is running by changing a user'+ch(\"'\")+'s color periodically.</p>'\n\t+'</div>'\n\t+'<b>Commands</b>'\n\t+'<div style=\"padding-left:10px;\">'\n\t\t+'<b><span style=\"font-family: serif;\">!api-heartbeat '+ch('<')+'<i>--help</i>|<i>--off</i>|<i>--dev</i>'+ch('>')+' '+ch('[')+ch('<')+'color'+ch('>')+ch(']')+' '+ch('[')+ch('<')+'color'+ch('>')+ch(']')+'</span></b>'\n\n\t\t+'<div style=\"padding-left: 10px;padding-right:20px\">'\n\t\t\t+'<p>This command allows you to turn off and on the monitor, as well as configure it.</p>'\n\t\t\t+'<ul>'\n\t\t\t\t+'<li style=\"border-top: 1px solid #ccc;border-bottom: 1px solid #ccc;\">'\n\t\t\t\t\t+'<b><span style=\"font-family: serif;\">'+ch('<')+'--help'+ch('>')+'</span></b> '+ch('-')+' Displays this help.'", "\n\t\t\t\t+'</li> '\n\t\t\t\t+'<li style=\"border-top: 1px solid #ccc;border-bottom: 1px solid #ccc;\">'\n\t\t\t\t\t+'<b><span style=\"font-family: serif;\">'+ch('<')+'--off'+ch('>')+'</span></b> '+ch('-')+' Turns off the heartbeat for the current player.'", "\n\t\t\t\t+'</li> '\n\t\t\t\t+'<li style=\"border-top: 1px solid #ccc;border-bottom: 1px solid #ccc;\">'\n\t\t\t\t\t+'<b><span style=\"font-family: serif;\">'+ch('<')+'--dev'+ch('>')+'</span></b> '+ch('-')+' Activates development mode. (", "<b>Warning:</b> This mode updates much more often and could contribute to performance issues, despite being great for script development.)'", "\n\t\t\t\t+'</li> '\n\t\t\t\t+'<li style=\"border-top: 1px solid #ccc;border-bottom: 1px solid #ccc;\">'\n\t\t\t\t\t+'<b><span style=\"font-family: serif;\">'+ch('<')+'color'+ch('>')+'</span></b> '+ch('-')+' The script alternates between two colors. ", " If you specify 2 colors, it will use those. ", " If you specify 1 color, it will use that and your configured color. ", "If you specify no colors, it will go between your configured color and black or red based on brightness.</b>'\n\t\t\t\t+'</li> '\n\t\t\t+'</ul>'\n\t\t+'</div>'\n\t+'</div>'\n+'</div>'\n );\n },\n\n counterColor = function(color) {\n if(parseInt(\n _.first(\n _.rest(\n (_.isString(color) ? ", "color : '').match(/^#([0-9a-fA-F]{2})/) || []\n )\n ) || '00',\n 16) > 127\n ){\n return '#000000';\n }\n return '#ff0000';\n },\n\n handleInput = function(msg) {\n var args, errors, player, who, color;\n\n if (msg.type !", "== \"api\" && !", "playerIsGM(msg.playerid)) {\n return;\n }\n player = getObj('player',msg.playerid);\n who = (player||{get:()=>'API'}).get('_displayname').split(' ')[0];\n\n args = msg.content.split(/\\s+/);\n switch(args.shift()) {\n case '!", "api-heartbeat':\n\n if(_.contains(args,'--help')) {\n showHelp(who);\n return;\n }\n\n if ( _.contains(args,'--off') ) {\n // turn off\n if(state.", "APIHeartBeat.heartBeaters[msg.playerid]) {\n color = state.", "APIHeartBeat.heartBeaters[msg.playerid].origColor;\n delete state.", "APIHeartBeat.heartBeaters[msg.playerid];\n startStopBeat();\n player.set({color: color});\n }\n sendChat('APIHeartBeat', '/w '+who+' Off for '+player.get('displayname')+'.'); ", " \n } else {\n if ( _.contains(args,'--dev') ) {\n state.", "APIHeartBeat.devMode = !", "state.", "APIHeartBeat.devMode;\n clearInterval(beatInterval);\n beatInterval=false;\n sendChat('APIHeartBeat', '/w '+who+' Dev Mode is now '+(state.", "APIHeartBeat.devMode ? '", "ON' : 'OFF')+'.');", "\n args = _.chain(args).without('--dev').first(2).value();\n if( ! ", "args.length ) {\n startStopBeat();\n return;\n }\n }\n \n errors=_.reduce(args, function(memo,a){\n if( ! ", "a.match(/^(?:#?[0-9a-fA-F]{6})$/) ) {\n memo.push(\"Invalid color: \"+a);\n }\n return memo;\n },[]);\n\n if(errors.length) {\n sendChat('APIHeartBeat', '/w '+who+' Errors: '+errors.join(' '));\n } else {\n switch(args.length) {\n case 2:\n state.", "APIHeartBeat.heartBeaters[msg.playerid]= {\n pid: msg.playerid,\n origColor: player.get('color'),\n color1: args[0],\n color2: args[1]\n };\n break;\n case 1:\n state.", "APIHeartBeat.heartBeaters[msg.playerid]= {\n pid: msg.playerid,\n origColor: player.get('color'),\n color1: player.get('color'),\n color2: args[0]\n };\n break;\n default:\n state.", "APIHeartBeat.heartBeaters[msg.playerid]= {\n pid: msg.playerid,\n origColor: player.get('color'),\n color1: player.get('color'),\n color2: counterColor(player.get('color'))\n };\n }\n sendChat('APIHeartBeat', '/w '+who+' Configured on for '+player.get('displayname')+'.');", "\n }\n startStopBeat();\n }\n break;\n }\n },\n\n checkInstall = function() {\n log('-=> APIHeartBeat v'+version+' <=- ['+(new Date(lastUpdate*1000))+']');\n if( ! _", ".has(state,'APIHeartBeat') || state.APIHeartBeat.version !", "== schemaVersion) {\n log(' > Updating Schema to v'+schemaVersion+' <');\n state.", "APIHeartBeat = {\n version: schemaVersion,\n devMode: false,\n heartBeaters: {}\n };\n }\n\n startStopBeat();\n },\n\n registerEventHandlers = function() {\n on('chat:message', handleInput);\n on('change:player:_online', startStopBeat);\n };\n\n return {\n CheckInstall: checkInstall,\n RegisterEventHandlers: registerEventHandlers\n };\n \n}());\n\non('ready',function() {\n 'use strict';\n\n\tAPIHeartBeat.", "CheckInstall();\n\tAPIHeartBeat.", "RegisterEventHandlers();\n});\n" ]

{ "pile_set_name": "Github" }

[ 0.0011804860550910234, 0.0008407498244196177, 0.0017296506557613611, 0.0008299525361508131, 0.0009278652723878622, 0.003921817522495985, 0.00143866625148803, 0.000978044350631535, 0.0023534398060292006, 0.0017296506557613611, 0.001085285097360611, 0.0007788552320562303, 0.000688813510350883, 0.0009161639609374106, 0.0010750791989266872, 0.0007249966729432344, 0.0006982061313465238, 0.0005844463012181222, 0.0006748950690962374, 0.0005682584596797824, 0.0005574160604737699, 0.0008106410969048738, 0.0011061856057494879, 0.0008405784028582275, 0.0021448477637022734, 0.0007643736316822469, 0.0007823614869266748, 0.001191276009194553, 0.0009830493945628405, 0.0008224655175581574, 0.0019525765674188733, 0.0007877041934989393, 0.0010211411863565445, 0.0013377703726291656, 0.000832927820738405, 0.0009041938465088606, 0.001733022159896791, 0.0013337699929252267, 0.0009727380238473415, 0.0010364361805841327, 0.001001366414129734, 0.0013190540485084057, 0.0006906740600243211, 0.0008899552631191909, 0.0011414341861382127, 0.000820157874841243, 0.0009275794145651162 ]

[ "Browser choice is a key security measure\n\nAlthough most users don't know it, their web browser plays a key part in determining the strength of the ciphers used between their client and an HTTPS-protected website. ", "Encryption ciphers used in the SSL/TLS (secure sockets layer/transport layer security) negotiations can range from very strong to weak, and involve asymmetric ciphers, symmetric ciphers, key exchange algorithms and hash functions.", "\n\nSSL has been replaced by TLS 1.0 as the current HTTPS standard. ", "It is possible in many browsers to select which SSL and TLS versions are enabled. ", "Any browser you use should support TLS and offer it by default to HTTPS-protected websites. ", "Most browsers still support SSL v.3.0, which is next closest in strength to TLS, and many browsers continue to support SSL v.2.0, but may have it disabled by default. ", "SSL v.1.0 is considered insecure today, although some browsers still use it.", "\n\nCiphers\n\nCommon TLS/SSL symmetric ciphers, in order of strongest to weakest (generally), include Advanced Encryption Standard (AES), Triple DES (3DES), RC4, Data Encryption Standard (DES), and RC2. ", "Every browser today should be offering AES as its default symmetric protocol, followed by 3DES as a backup. ", "The other protocols should only be used for legacy compatibility or offered last.", "\n\nCommon TLS/SSL asymmetric ciphers, in order of strongest to weakest (generally), include Elliptical Curve Cryptography (ECC), Rivest Shamir Adleman (RSA), and Diffie Hellman (DH, or DHE for key exchange). ", "ECC is the newly crowned standard for asymmetric ciphers these days, and it's included in the US Government's Federal Processing Information Standards (FIPS) as part of what is called Suite B. A browser must support Suite B to be considered for use by the US government. ", "Browsers should offer ECC as the first asymmetric cipher, followed by RSA or DH.", "\n\nHash functions\n\nCommon cryptographic hash functions include, in order of strongest to weakest (generally), SHA-512, SHA-384, SHA-256, SHA-1, and MD5. ", "MD5 and SHA-1, by far the most popular hashes used, have been shown to have some moderate cryptographic weaknesses, and as such, crypto experts recommend stronger hashes. ", "Of the two, MD5 has been demonstrated to have larger vulnerabilities. ", "Recently, it was shown that digital certificates signed using MD5 hashes cannot be relied upon. ", "Users should avoid cryptography employing MD5 and strive to implement SHA-2 (the family of SHA-256, SHA-384, SHA-512) whenever possible.", "\n\nKey sizes\n\nSSL/TLS symmetric key sizes often range from 40-bit (the old SSL standard) to 512-bit (very strong). ", "Symmetric key sizes of 128-bit to 256-bit are considered secure for most normal security operations, and 256-bit keys are just now becoming the standard, although 128-bit keys are still the most popular.", "\n\nIn general, longer key sizes are stronger within a particular cipher. ", "For example, a 256-bit AES key is stronger than a 128-bit AES key. ", "However, you can't always use key size as a strength measurement between cipher families. ", "For example, 384-bit ECC is considered stronger than 1,024-bit Diffie-Hellman. ", "Plus, you can have a horrible cipher with a really long key size and still come out with poor protection. ", "As a matter of fact, users should be wary of newly announced ciphers from questionable sources that claim ultra-long key sizes (such as a million bits or more). ", "A good cipher doesn't need an ultra-long key size. ", "If the cipher algorithm is good, smaller key sizes can be used and the cipher will remain strong.", "\n\nBrowser cipher order\n\nWhen a browser first connects to a SSL/TLS-protected website, the first packet in the SSL handshake includes the browser's preferred cipher order, including all the ciphers the browser currently supports. ", "Both the client and the website must agree upon which ciphers to use before they continue. ", "With any luck, the website will pick the strongest cipher the client supports.", "\n\nBy offering the strongest cipher first, the browser increases the likelihood that a web server will pick it, if it supports it. ", "Using stronger cipher orders shows a browser vendor's commitment to cipher strength. ", "Still, it is not unusual to see a browser vendor support very strong ciphers but offer weaker, more popular ciphers first. ", "This could potentially speed up SSL/TLS negotiations.", "\n\nThe browsers compared\n\nBrowsers in run the gamut in cipher support. ", "Firefox (v.3.12) has the strongest first cipher showing (TLS, ECC, AES, 256-bit key) followed by Opera (v.9.63). ", "Firefox also has strong defaults, and 34 total ciphers to choose from.", "\n\nOpera is impressive because it offers 256-bit symmetric ciphers for the first five suggestions (TLS, RSA, AES being the first). ", "However, Opera doesn't offer ECC support at all, which means that Chrome (v1.0) and Internet Explorer (v.8 beta 2), which do offer ECC, could easily be considered tied for second in cipher support if more than first cipher offered were considered.", "\n\nBoth Chrome and Internet Explorer offer TLS, RSA, AES with a 128-bit key first and with a 256-bit key second. ", "In both cases, ECC isn't offered until fifth. ", "Still, Safari runs away with last place with weak first offerings (TLS, RSA, RC4, 128-bit key is offered first and second), frequent MD5 offerings, and no support for ECC, AES, or 256-bit keys.", "\n\nCopyright 2017 IDG Communications. ", "ABN 14 001 592 650. ", "All rights reserved. ", "Reproduction in whole or in part in any form or medium without express written permission of IDG Communications is prohibited." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006019561551511288, 0.0006425422034226358, 0.000835796759929508, 0.0006293397746048868, 0.0008380152867175639, 0.0007347997161559761, 0.0007649313774891198, 0.0006317364168353379, 0.0006770486943423748, 0.0005694642895832658, 0.0006789176259189844, 0.0005647470825351775, 0.000670289562549442, 0.0007553962059319019, 0.0007209994946606457, 0.0008329346892423928, 0.0006050942465662956, 0.0007050896529108286, 0.0006365936133079231, 0.0006365093286149204, 0.0006000369321554899, 0.0009262682870030403, 0.0005670656682923436, 0.0008118330733850598, 0.0029249039944261312, 0.0005430608289316297, 0.0006060748710297048, 0.0005261891055852175, 0.0006751221953891218, 0.00055969093227759, 0.0005469751777127385, 0.0005865520797669888, 0.0005882761906832457, 0.0005843050894327462, 0.0006472304812632501, 0.0006304861744865775, 0.000662341364659369, 0.0007128361612558365, 0.000564263085834682, 0.00059011165285483, 0.000703431898728013, 0.0005611839587800205, 0.000840132066514343, 0.0006746892468072474, 0.00100131263025105, 0.0006133944261819124, 0.0006486346246674657 ]

[ "Local Police Departments Make Binding Agreements with FBI, Surveillance Tech Companies, to Withhold Surveillance Information from the Public\n\nFrom a letter in which the FBI tells the Erie County Sheriff's Office that it can use a stingray device as long as it agrees to mislead legislators, reporters, and the general public. ", "Courtesy of the NYCLU\n\nAfter a lengthly struggle with the police department of Erie County, New York, the New York Civil Liberties union finally got ahold of records about its use of \"stingrays\"—surveillance devices that mimic cell-phone towers and track where your cell phone goes.", "\n\nThe NYCLU published the records on its website. ", "One of the big problems they found: \"... cops in that county, which includes the city of Buffalo, used the devices 47 times since 2010 but only once sought and obtained a court order to do so. ", "That revelation contradicts what the county sheriff said last year when he asserted that the department only used the devices under 'judicial review.'\"", "\n\nWIRED covered the story and connected some troubling dots for anyone who's even remotely concerned with transparency in policing:\n\nThe records, which the NYCLU published in a blog post today, also show that the county sheriff’s office signed a stringent gag order with the FBI to maintain secrecy about their stingray records. ", "The department was told to withhold information about the devices in any documents filed with courts, such as affidavits and other documents describing how they obtained evidence in criminal cases. ", "The department was even told that the FBI maintained the right to intervene in county prosecutions to request criminal cases be dismissed if there was a chance that a case might result in the disclosure of information about law enforcement’s use of stingrays.", "\n\nMany police departments have signed non-disclosure agreements with the Harris Corporation, one of the leading makers of the devices, to prevent them from releasing records about the systems or discussing them. ", "In Florida, the U.S. Marshals service went so far as to seize records about a local police department’s use of stingrays in order to prevent the American Civil Liberties Union from obtaining them. ", "And many law enforcement agencies have deceived judges about their use of the devices in order to prevent defendants and the public from learning about how they’re being used.", "\n\nSo... we have local police departments signing gag orders with the FBI, making non-disclosure agreements with private manufacturers of surveillance technology, and deceiving judges, as well as federal marshals seizing police records—all in the name of preventing the public from leaning about the techniques their police are using to police them.", "\n\nSounds like that should be illegal.", "\n\nBut, as the Washington Post has pointed out, there is \"virtually no case law on how the Fourth Amendment—which prohibits unreasonable searches and seizures—should apply to this technology.\"", "\n\nBaltimore police have been engaging in the same kind of contractual obfuscation—and if you didn't get around to reading last year's Tacoma News Tribune investigation about Pierce County judges approving police use of stingray devices without even realizing it, now is a good time to catch up.", "\n\nSpeaking of surveillance, this morning I called Peter Smith, the Coeur d'Alene attorney who appeared before the Ninth Circuit Court in December to challenge the constitutionality of the NSA's bulk phone-data collection program. (", "We posted a detailed account of the hearing, which had its moments of comedy, on Slog.) ", "His is one of a few cases—in the Ninth, Second, and D.C. Circuit courts—that could be the NSA case which winds up in front of the Supreme Court.", "\n\nHe said he's still waiting for a decision from the court about whether his case will proceed. ", "Is there a deadline for a decision?", "\n\n\"No,\" he said. \"", "It's entirely up to the court. ", "A typical civil case can take up to a year.\"", "\n\nAs usual, the technology moves faster than the law." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005703871720470488, 0.0006680284277535975, 0.0006209108978509903, 0.000648883287794888, 0.0005875483038835227, 0.0005924851866438985, 0.0006293304613791406, 0.0006174048176035285, 0.0005357100744731724, 0.0006163092330098152, 0.0007335077971220016, 0.0008048421004787087, 0.0009018767741508782, 0.0006098537123762071, 0.0007320954464375973, 0.0006186397513374686, 0.0009482069872319698, 0.0007186578004620969, 0.0006436107796616852, 0.0007160293171182275, 0.0008688779198564589, 0.0006614052108488977, 0.0005482098204083741, 0.0006703201797790825 ]

[ "Hamid Berhili\n\nHamid Berhili (born May 14, 1964) is a retired male boxer from Morocco, who twice competed for his North African country at the Summer Olympics: 1992 and 1996. ", "He is best known for winning the bronze medal in the men's light flyweight division (– 48 kg) at the 1995 World Amateur Championships in Berlin, Germany.", "\n\n1992 Olympic record\nBelow is the Olympic record of Hamid Berhili, a flyweight boxer from Morocco, who competed at the 1992 Barcelona Olympics:\n\n Round of 32: lost to Jesper Jensen (Denmark) on points, 10-4\n\nReferences\n Hamid Berhili's profile at Sports Reference.com\n\nCategory:1964 births\nCategory:Living people\nCategory:Light-flyweight boxers\nCategory:Boxers at the 1992 Summer Olympics\nCategory:Boxers at the 1996 Summer Olympics\nCategory:Olympic boxers of Morocco\nCategory:Moroccan male boxers\nCategory:AIBA World Boxing Championships medalists" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0009973956039175391, 0.0011815739562734962, 0.0006133225397206843 ]

[ "Q:\n\nWhat file does the python symlink point to\n\nI bought my mac about a year ago and somehow changed my python symlink so that when I run python some_file.py, python 3.4 is used to run the file instead of python 2.7. ", "I now need to change it back, but I can't figure out what I did to change it in the first place! ", "When I run:\nimport os\nos.path.realpath(\"/usr/local/bin/python\")\n\nin the python terminal, the output is:\n'/Library/Frameworks/Python.framework/Versions/2.7/bin/python2.7'\n\nDoes this not mean that my python symlink is pointing to my python 2.7 version, and not my 3.4 version? ", "If not, how do I find out which file is run when I use the python symlink?", "\n\nA:\n\nYou probably installed that specific Python version using the official Python installer for OS X; see the Using Python on a Macintosh documentation. ", "The installer creates the /usr/local/bin symlink for you.", "\nIf you also, at some point, had 3.4 installed then that installation is still there too. ", "Check for a /usr/local/bin/python3 command; it'll link to the existing Python 3 binary. ", "Use that instead to run Python 3 code.", "\nIf you do have a /Library/Frameworks/Python.framework/Versions/3.4/bin/python3.4 command, you could re-create the /usr/local/bin/python symlink to point there instead, but I'd personally only use the python3 name for Python 3 scripts.", "\nLast, you could also have used the homebrew tool to install Python; it can manage symlinks for you. ", "However, homebrew installs Python binaries into the /usr/local/Cellar tree structure instead.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008313506841659546, 0.0006892577512189746, 0.0007693970110267401, 0.000756124674808234, 0.0006133652059361339, 0.0008657487342134118, 0.0005665494245477021, 0.0006030296790413558, 0.0006868583732284606, 0.0005879522068426013, 0.0007436770247295499, 0.0006540303002111614, 0.0019954426679760218 ]

[ "Site Sponsor\n\nCan’t let the weekend go by without remembering that this is the 75th anniversary of Kristallnacht – the “Night” of the Broken Glass” – and the official start of the Holocaust. ", "It took place on November 9-10 of 1938.", "\n\nOn that night, Nazis raided, vandalized, burned down, or otherwise destroyed German Jewish homes, businesses, and synagogues, while non-Jewish residents and police and fireman watched and did nothing. ", "More than 90 Jewish people were murdered, and about 30,000 Jewish men were sent to concentration camps where they, too, would mostly face death.", "\n\nAnti-Semitism always dominated Europe, which is why my paternal grandfather’s immediate family left for America at the turn of the century and my paternal grandmother left not long after. ", "But the night of November 9, 1938 marked the stark notice that this European anti-Semitism had escalated to a level of even more unspeakable horrors against Jews than previously imagined.", "\n\nIt was a loud disruption to the cocooned view of German Jews that they were cultured and mostly assimilated and, many of them, wealthy, and that their fellow Germans would never harm them. ", "To date, many Jews refer to German Jews as “Yeccas,” or “Jackets,” because they were so high-cultured, so formal, and so much a part of German high society. ", "And, yet, on that night, they learned it all meant nothing. ", "On Kristallnacht, they finally realized that, in fact, they were not the equals in society they’d believed for centuries that they were.", "\n\nMany descendants of those German Jews and their contemporaries in America are liberal Jews who voted for Barack Obama and the party dominated by anti-Semitism and anti-Israel sentiment, the Democrats. ", "They are the same Jews who constantly do “outreach” to Muslims who openly hate them and praise Hezbollah and HAMAS and homicide bombings. ", "They are also the same Jews who love to mindlessly utter the tired “Never Again” phrase, but gladly associate with those who will ensure that in a generation or two it very likely could happen again. ", "They are the same Jews who lament what happened to those Jews now dead and completely decayed, but look the other way or do worse when it comes to the living Jews today in Israel and elsewhere around the world who face unprecedented anti-Semitism not faced since the Holocaust–most of it perpetrated by Muslims and their allies.", "\n\nI’ve written about these Jews on my site frequently over the years. ", "They are Jews like Detroit Jewish News owner Arthur Horwitz who endorsed Obama in his left-wing rag the first time and sponsored his own anti-Semitic exhibit in which he marked the then-150th anniversary of Jews in the Detroit area by insisting that the Purple Gang was THE most prominent part of Detroit Jewish history. ", "This week, his liberal self-hating rag commemorated the 75th anniversary of Kristallnacht. ", "And, at the same time, he is engaged in a commercial partnership with Hezbollah agent, Osama Siblani, owner of the Arab American News–who openly praises Farrakhan’s anti-Semitic hate and HAMAS and Hezbollah terrorist attacks on Jews, prints vile anti-Semitic editorials against Detroit-area Jews, and whose brother is an executive of Al-Manar (Hezbollah’s TV station). ", "Horwitz has publicly bragged about trying to promote Siblani’s paper and make it more effective and lucrative.", "\n\nYes, the “comfortable” German Jews have been reborn (with apologies to the German Jews of those days who even themselves didn’t behave like the Arthur Horwitzes of today). ", "Or, more accurately, they never really went away. ", "Theirs is a state of mind that has unfortunately plagued a sizable part of the Jewish community throughout history. ", "As I’ve repeatedly noted on this site over the years, only 20% of the Jews left slavery in Egypt. ", "The rest stayed behind, content to remain enslaved and oppressed by the Egyptians. ", "And, similarly, their counterparts today, the liberal Jews who deign to speak for me though I never chose or elected them to do so, have forgotten the sounds of the breaking glass, of the 20 Jewish suicides of that night 75 years ago, of the screams of 30,000 people arrested and sent to the camps, just because they were Jewish.", "\n\nWhile there are no Kristallnachts here right now, and Americans from the center to the right–who are not of the Pat Buchanan bent–are largely philo-Semitic, we continue to see increasing incidents of anti-Semitism all over America and violent brutal attacks against Jews all over Europe. ", "Again, most of these attacks are perpetrated by the group that is at once the old Nazis and the new Nazis: Muslims. ", "Plots to infiltrate and blow up synagogues in New York: Muslims. ", "Attacks on rabbis waiting for trains in the New York subway: Muslims. ", "And so on.", "\n\nAs I’ve noted repeatedly over the years, the FBI annual statistics on hate crimes since 9/11 show a steady increase in hate crimes against Jews. ", "But, as I’ve also repeatedly noted, the FBI refuses to identify the perpetrators of those hate crimes by religion and ethnicity. ", "If they did, guess who would populate the majority of the perpetrators of these hate crimes against Jews? ", "MUSLIMS.", "\n\nI, myself, have endured the death, rape, and torture threats from four American residents–ALL of them Muslim. ", "Today’s Nazis don’t wear the swastika, they wear the crescent. ", "And they find their most vocal supporters on the left and in the party of the left and its current two-term Prez. ", "And I would be intellectually dishonest if I did not also point out that they–the Muslims–have far too many PC-types who are also yes-men–though to a much lesser extent–in the Republican Party. ", "Take the man the mainstream media and establishment Republicans are pimping for President in 2016: Chris Christie, or as we call him here, Chris ChrispieCreme. ", "He’s an apologist for Islam and its most hateful factions, which is why he appointed a HAMASnik to a judgeship. ", "Expect the same in a Halal ChrispieCreme White House.", "\n\nSeventy-five years and many have forgotten. ", "They repeat the same things over again with their Islamo-pandering.", "\n\nI haven’t forgotten. ", "I have the photos of my late maternal grandmother, Adela, and her friends in their Nazi-imposed Gold Jude star patch. ", "And I have the memories of the many stories my late maternal grandfather, Isaac, told me over the years of his struggle to survive in the death camps and his many close calls with it as he subsisted as a bag of bones working in many camps, including Dora.", "\n\nThere are many famous pictures of what Hitler and the Nazis did to the Jews on that particularly night 75 years ago in Germany and for years to come all over Europe, while Muslims–including Haj Amin Al-Husseini, the Grand Mufti of Jerusalem–begged them to speed up the Final Solution and export it to include the Middle East and North Africa.", "\n\nMy late father, H.L. Schlussel, MD, used to point to the picture of a Nazi SS soldier pulling a rabbi by his beard. ", "He would juxtapose it with his favorite photo by Allan Tannenbaum, of bearded religious Jews in Israel’s Judah and Shomron–the so-called “West Bank”–protecting their homes and lives with M-16s. “", "That Was Then, This is Now,” was the slogan my father would put on the makeshift copies of the two photos he put together.", "\n\nSadly, as my dad lamented, even the “now” may soon be the “then” because my fellow co-religionists, both in Israel and here in America, do not learn from history. ", "They ignore it.", "\n\nToday, there are different architects of the Final Solution, but the plan is the same. ", "Unfortunately, our current President wants to hang out with them–the Rouhanis and Abbases (of the PLO) of the world–and they happily send him their congratulations and entreaties. ", "We’ve reportedly already dropped our sanctions against Iran months ago, and are on the verge of making peace with these enemies of America who are not just the enemies of the Jews but the financiers of Hezbollah, which murdered hundreds of Americans in cold blood. ", "This is the same Rouhani who recently hosted renowned racist and Jew-hater Louis Farrakhan in New York after Rouhani spoke to the U.N. That is the guy with whom we are making nice just like Neville Chamberlain did with the Nazis. ", "And how did that turn out?", "\n\n75 years ago, but that’s in the past. ", "It could never happen now . . . . ", "Right?", "\n\nAll that is necessary for the triumph of evil is for good men to do nothing.", "\n—Sir Edmund Burke\n\n24 Responses\n\nObama wanted to rush into a deal with Iran and leave Israel out to hang to dry.", "\n\nIt was stopped temporarily because the French doublecrossed Obama in exactly the same way he doublecrossed them on Syria earlier in the summer.", "\n\nAnd this followed Kerry’s lashing out at Israel for not committing national suicide fast enough and openly endorsing the Arab Nazi demand to redline Jews from Judea and Samaria.", "\n\nHas the world learned the lessons of Kristallnacht? ", "In a word, no – there is a violent assault in our time upon living Jews as intense and relentless as those the Nazis launched against German Jews over 75 years ago.", "\n\nHistory moves in the blink of an eye and despite the passage of time, the one thing that’s never really changed is the world’s attitude towards the Jews. ", "Which is why in the end no one will really insist that Iran give up the means to produce a nuclear bomb.", "\n\nJews are still expendable and it would be a grave mistake to dismiss Kristallnacht as simply ancient history.", "\n\nHistory repeats….only the names change. ", "We have an administration who refuses to recognize the true capital of Israel, Supports Hamas, the Brotherhood, etc. ", "with money and arms, undercuts Netanyahu at every opportunity, has a cretin like Kerry be the spokesman (Sec/state)for our country, puts the anti-American, anti-Semitic to represent us at the (Useless) UN, etc. ", "If it walks like a duck, quacks like a duck……..I am asked many times why so many Jews supported and voted for Obama. ", "The answer is simple. ", "They are not Jews, their religion is liberalism. ", "Remember Roosevelt? ", "Many Jews in that time would repeat the mantra of, “FDR is OUR “Friend.” ", "They “Forgot,” and today totally forget the ship ST. ", "LOUIS. ", "Unfortunately, what I call Warrior Jews are few and far between here in our country. ", "There are no Davids, Moses, Joshuas, etc. ", "The thinking of the emasculated Jews of today, subconsciously, is, “If I’m nice to the tiger, maybe he’ll eat me last. ", "After all, it can’t happen here.” ……", "and when they came for me, there was no one left to speak for me. ", "Jews here, and especially the JINO’s need to wake up and smell the coffee. ", "Check out Jews for the Preservation of Firearms. (", "JFPO)\n\n1) People just want to “feel good” nowadays. ", "Kristallnacht is baaad – let’s forget that it existed. ", "The pogroms that happened during the Crusades onward? ", "Forget about it! ", "Inquisition – what? ", "People only want the feel-good parts of history, or at least parts to which they can relate. ", "Since the end of the Second World War, western (read: Euro-American) societies were gradually cocooning themselves with notions of a new “peace in our time”, even when the Cold War was raging. ", "Only Israel and the Jews were holding ground – at least until recently – and for a damn good reason. ", "Right now, leadership, discipline and resolve appear to be things of the past. ", "It’s all about optics, and they have to have that “feel-good” quality to them. ", "We have reduced ourselves to “militant cowards”: we’re willing to piss on our friends and ourselves yet bow down and fellate the enemy at the same time. ", "It’s just insane, and shameful.", "\n\n2) Since Roman times, the Jews have always been scapegoated for one bad thing or another. ", "But the proverbial “fear of God” has kept them united through all these years. ", "As an atheist, I don’t really fear any god, but I can understand why Jews have managed to survive as a religious community, an ethnicity and a nation. ", "The problem is that right now, they need to be more united and depend less on the supposed goodwill of others and “righteous among nations”. ", "Most contemporary Jews not only forget Sho’ah but also the 1948 war, the Six-Day War and the Yom Kippur War – all defining moments in Jewish history, IMO. ", "The only people who can destroy the Jews are the Jews themselves. ", "The only people who should save the Jews are the Jews themselves. ", "Only by setting the example and displaying discipline, resolve and leadership can the Jews earn more respect from both friend and foe. ", "It may not be a realistic expectation in this current climate, but it’s never to late to bring back and use these qualities.", "\n\nIf we don’t recognize our shortcomings and work on regaining our self respect and pride, we will have failed our ancestors miserably.", "\n\nKristallnacht is something that has faded from the consciousness of many. ", "It signaled the beginning of the end for German Jews and the commencement of the Final Solution, which encompassed Jews far outside of Germany. ", "As Debbie has noted, antisemitism has not died. ", "Its most effectual practitioners are now Muslim.", "\n\nWhy is this “forgetting” surprising?!… ", "When some people need reminding that freedom doesn’t come free… When some people are too dumb to realize that freedom doesn’t come free even when you try to hammer it into them…\n\nWhen the Department of Veterans Affairs (a.k.a. ", "VA) has turned into a dysfunctional bureaucratic swamp… When more than one third of new GI mental health care patients have to wait more than the standard of 14 days to receive an appointment and, in some instances, veterans have to wait more than a month to receive care… When hundreds of thousands of veterans have to wait well over a year to receive an answer on the decision of their enrollment eligibility for a first time claim… And follow-on claims or disputed claims can take years to receive an answer…\n\nWhen disability benefits checks would not go out during the partial government shutdown… When death benefits were initially denied to grieving families of those who had paid the ultimate sacrifice…\n\nWhen unemployment for post 9/11 veterans has consistently been significantly higher then the average…\n\n2. ", "Cut a deal with Mexico and buy the Baja Peninsula to become a sovereign Jewish state and relocate EVERYTHING from Israel to the Baja. ", "G*D is everywhere and LIFE is his gift. ", "Protect the lives of the Jewish people in a new homeland in the new world.", "\n\n3. ", "Do Not participate in the U.N. nor allow them to control your country.", "\n\nExcellent article Debbie. ", "One point that people overlook these days is that it wasn’t the NAZI party that did this (like the brownshirts), no this was done by the German GOVERNMENT backed up by laws passed in the Reichstag by their version of Congress.", "\n\nThe Final Solution started by a campaign against the infirm (MRDD, insane, sick) saying that caring for them cost too much and that you could pay 3 teachers for the cost of caring for an infirm person (sound familiar). ", "Then they started saying that the Jews couldn’t swim in the same pool as non-Jews (the so called hygiene laws).", "\n\nThis evil is insidious and everyone must always be on guard because it most certainly will crop up again. ", "Whenever you use a group of people as a scapegoat, when people lose empathy for others and people think that they are better then other groups of people, this witch’s brew of evil will arise.", "\n\nThe Burke quotation is one of two favorite quotations of an Israeli friend of mine. ", "The other is “We sleep safely at night because rough men stand ready to visit violence on those who would do us harm.” ", "Sir Winston Churchill\n\nI have always wondered if you could ask the 6 million Jews that were marched off to the death camps what they would say to the liberal Jews of today in regards to their disdain of the private ownership/possession of firearms? ", "Every Jew of age should own a firearm even if he/she never fires it, but as a token to the millions that were disarmed and marched defenseless to the death camps.", "\n\nI and Israel’s Prime Minister seldom see eye to eye on most things but he’s right on Iran that the Jewish people must stand up! ", "And his other point is that Iran is not simply a Jewish/Israeli problem as so many people blithely assume.", "\n\nThis is not off topic at all. ", "I remind every one that sure, Kristallnacht did begin with the Jews – but millions of non-Jews died too, over 50 million of them. ", "My friends, the virus of anti-Semitism cannot be antiseptically contained to the Jews alone.", "\n\nWhich brings us back in the present day to Iran. ", "The Prime Minister mentioned Iran is building ICBMs and is acquiring the capability to hit both Europe and America. ", "The West may think it doesn’t matter what happens to the canary in the mine, Israel – if Iran kills it one day. ", "But it should matter such a fanatical and violent regime can kill every one else one day. ", "Therefore, demanding Iran disarm, is not just in the Jews/Israel’s interests, as has been commonly suggested in many quarters. ", "Its in mankind’s interests.", "\n\nFor you see – in the end why it always begins with the Jews, it seldom ends with them. ", "History, particularly Kristallnacht, has repeatedly given us advance warning on that score. ", "And if the Jewish people should ever die, they will not die alone. ", "That is the thought I want to leave you as you contemplate those today eager to rush to make a deal with Iran at any price. ", "Again, its not just a Jewish/Israeli concern. ", "Let’s keep that in mind for the future.", "\n\nThe Army Code of Conduct. ", "A meaningful Veterans Day to you all from a former Army soldier.", "\n\nI\n\nI am an American, fighting in the forces which guard my country and our way of life. ", "I am prepared to give my life in their defense.", "\n\nII\n\nI will never surrender of my own free will. ", "If in command, I will never surrender the members of my command while they still have the means to resist.", "\n\nIII\n\nIf I am captured I will continue to resist by all means available. ", "I will make every effort to escape and to aid others to escape. ", "I will accept neither parole nor special favors from the enemy.", "\n\nIV\n\nIf I become a prisoner of war, I will keep faith with my fellow prisoners. ", "I will give no information or take part in any action which might be harmful to my comrades. ", "If I am senior, I will take command. ", "If not, I will obey the lawful orders of those appointed over me and will back them up in every way.", "\n\nV\n\nWhen questioned, should I become a prisoner of war, I am required to give name, rank, service number, and date of birth. ", "I will evade answering further questions to the utmost of my ability. ", "I will make no oral or written statements disloyal to my country and its allies or harmful to their cause.", "\n\nVI\n\nI will never forget that I am an American, fighting for freedom, responsible for my actions, and dedicated to the principles which made my country free. ", "I will trust in my God and in the United States of America.", "\n\nUnlike in Germany, the JINOS (Jews in Name Only) of Hollywood are producing anti-Semitic and anti-Israeli movies where the Jews are villians or perverts and the Muslims are the good guys. ", "They are some of the principal financiers of Adolph Obama. ", "In the news media, scum like Bob Simon of 60 Minutes (a Jew married to a French Catholic) run blatantly false stories against Israel, just like his hero, Mike Wallace did.", "\n\nOrganizations like ADL are too busy defending American Muslims to do anything effective about anti-Semitism.", "\n\nMichael Bloomberg is busy encouraging guns laws similar to those used by Hitler to disarm Jews so that they could not defend themselves.", "\n\nJ Street are a bunch of Jews supported by Saudi money and by the Nazi loving Jew George Soros, whose sole purpose is to see Israel wiped out by the Arabs. ", "They are Jews are embarrassed to have been born Jewish.", "\n\nThese people are our modern day Josephus’s, our modern day Labans. ", "These people are the same that worked with the Greek Assyrians against the Nation of Israel, and against whom the Maccabeans rose up. ", "These people are the same people that sided with Romans, the same people that made up the Judenrat and the core of the capos.", "\n\nOur biggest problems in America, Debbie, are the rats nibbling at the foundation of Judaism. ", "As we learn from the Hagaddah at Passover, the enemy from within is more dangerous than the enemy from without.", "\n\nYet, American Christians are not without their own modern day Judas. ", "Their religious leaders have more outreach programs to Muslims than to their own congregants. ", "They lead their religious organizations to call for boycotts against Israel, even though Israel is the only nation in the Middle East that respects Christianity. ", "They push for amnesty for illegal Muslim aliens, the same sort of people who brought us 9/11.", "\n\nThe liberal churches support our Muslim President who denigrates the Christian religions when he states disparagingly that “these people only have their guns and religion.” ", "These churches support a man who disparages every religion except Islam when he states that “Islam is the religion of peace.”", "\n\nThese churches forget that the Muslims have spent 1400 years destroying churches and slaughtering Christians and that this gangsterism continues to this very day.", "\n\nWe Jews and Christians and others are being led by dangerous fools, down a path of our own destruction. ", "We are headed back to the future, back into a future of the dark ages.", "\n\nThanks to the muzzies, it’s become fashionable to become Judeophobic again (I prefer this term to anti-Semitic to avoid the strawman of ‘Arabs are Semites too’). ", "Not just for Muslims, but Western Nazis as well.", "\n\nOne just wonders – if Germany had oil like the muzzies do, and Nazism had been recognized as a religion, what might they have pulled off – particularly in today’s climate? ", "Of course, the muzzies have the added advantage of being non-White so that PCMC types glorify them, even though the Arabs love to think that they are Whites.", "\n\nYesterday was ,for us in Australia, remembrance day,the 11th day of the 11th month at 11AM most activity stops for a few minutes to remember the fallen in foreign wars… There has never been a war on our soil but we tend to remember with the utmost clarity the barbarism of the nazi controlled German government of the 30’s and 40’s. ", "Even Germans of today have forgotten what happened and it is of the utmost importance that people with a spine,such as Debbie continue to prick at the conscience of those who find a certain attraction in the muslem cult.", "\n\nBack when Mr. Vance “served” as Sec. ", "Of State, he made Arik Sharon extremely tired…with his rethorics, Sharon uttered in Hebrew:” let him visit the Kotel & talk to the Wall”. ", "We in Israel “love” Sec. ", "Of State who are very tall…it reminds us of the British Red Barrett soldier back in the 1940’s who while serving in Palestine inquired what we the “Natives” are doing with the piece of skin cut during circumcision…he was told by a Tel-Aviv resident:” we collect those pieces all year then we ship it to the U.K. Where it grows & reaches 6 feet and more, then re-shipped to Palestine to serve in the Red Barrettes”… Most Israelis view Kerry as a modern piece of skin….he too, can talk to the Kotel.", "\n\nOkay, the article is goodn’nough, . . . ", "except in the larger context of weak-a-peedia—while there were several of these nights called “Kristallnacht” in which a lot of glass was broken, and so forth in mayhem and death—for the massive amounts of glass—especially, the breaking of Jewish glass—any such was called a “kristallnacht”, but relatedly, what has been overlooked is “The Night of the Long Knives—”Operation Hummingbird”—or, more commonly used in Germany “Röhm-Putsch”, a so-called purge which was effected between June 30 and July 2, 1934, when the Nazis worked many executions—kind of comical because weak-a-peedia has it that, “Most of those killed were members of the Sturmabteilung (SA), the paramilitary Brownshirts . . . . ", "At least 85 people died during the purge, although the final death toll may have been into the hundreds.", "”—what a laugh, because, those who were in power having at least instinctive awareness of the fact that, because it is only in terms of language in which we are facile that, we are able to think, and this, coupled with the fact that, ppl learn to think by listening to preaching and study of The Word of G0D, Hitler and his associates thus feeling themselves to be in face-to-face competition with the nation’s pastors, during those few nights, they had say, 3,500 of the nation’s pastors to be murdered, . . .", "\n\nIf I could, I would make a reading requirement in public schools, several books on survivors of the death camps. ", "There are many and it’s amazing how some people came out alive. ", "You might also read on how the Japs treated our soldiers while prisoners. ", "Geneva convention be damned.", "\n\nThis is only going to rear it’s ugly head only once more. ", "The sealed prophecies are being loosed. ", "I see hundreds of passages that describe these days CLEARLY, and I haven’t really looked at much of the New Testament…\n“My people perish for lack of knowledge”, and “When they say peace and safety, sudden destruction shall come.” ", "I am trying to teach Americans and Christians (and hopefully Jews) that the next “Kristallnacht” will be all through western civilization VERY soon. ", "Many of the American politicians and bureaucrats are in the “socialist camp”, and they are all so excited, because it looks like their “takedown” will be initiated very soon, but they remain ignorant of the REAL endgame. ", "Anyone with a capacity for critical-thinking knows that the federal gov’t is preparing for an uprising. ", "DHS and many other ‘entities’ are preparing for it, and fundamental Christians are literally in the number 1 position of “Identified potential terrorists”. ", "Blood will flow in time. ", "Not sure how the soc/commie group will fare against Patriots, but what we all need to understand is that those people are walking in agreement with another group with socialistic tendencies: The Nation of Islam…\nAt whatever time it seems that both Patriots and traitors will be most occupied with destroying the other, the Moslems will jump in. ", "What they don’t seem to understand is that whatever agreements they made with Islamists, will be broken at some point. ", "Islam doesn’t share, because their god doesn’t want to share his glory.", "\nThat simple… The Bible clearly identifies Islam as the Beast. ", "That is being revealed to MANY Christians right now, and we are trying to increase the awareness of of it. ", "Obviously we are running into resistance from the usual parties, but are quite surprised at one of these groups: The American Christian… I get ridiculed out of the room before I get the chance to show even some of these verses and passages. ", "They don’t want it to be true, so they don’t believe it…\n\nDebbie your analysis and points are spot on. ", "It’s ironic that currently it’s acceptable to denigrate both Jews and seperately the Roma in our otherwise touchy politicaly correct world now. ", "Worse still mainstream non fundementalist Christian traditions that provided the mainstream society with a back drop of reasonable rational morality is getting eradicated as well. ", "We are reaching a dangerous potential where fundamentalist forms of Islam are able to infiltrate and steer directions to their agendas.", "When society has the permission to paint the Jews, Israel and Roma as a form of other deserving of being maligned and harmed it’s surprising how suddenly it’s acceptable to destroy them, then followed by other social groups and sectors.", "It seemed incredible how suddenly what couldn’t be imaged before Kristel Nacht and further occured. ", "Worse still aided and facilitated by local populations. ", "Ironically those who’d presume to be in the safest spots by status , education and power are the ones who too become targets for eradication.", "It’s unbelievable how the fundamentalist Muslim sector has been infiltrating and dominating so much of the world. ", "In fact the USA seems to be facilitating more of late than seriously countering it. ", "It’s in my late middle age I took to exploring these events you mentioned deciding to explore the barely acknowledged part Jewish and yes even bit of Roma background of supposedly Latvian parents. ", "I was stunned how something like that Krisel Nacht and more occured, so rapidly and horrifickly. ", "I also grasped why my parents had been so nervous of those aspects of origins.", "Especially as they ,looked more like the locals of that ancestry and really not like local Latvians while scrapping by on that identity and why they ended up leaving Latvia in a hurry in various ways nor daring to go back after the war as no more popular with the Soviets. ", "Such a horror , so seemingly unforseable le ought to be unforgotten and known properly by all. ", "Yet it’s not grasped by most so is a risk again.", "\nThe fact is I now understand what via my parents had even impacted on my life in some ways.", "I’m glad that in recent times I’ve explored more the other commemarative events that some Jewish folk reflect on as there are further lessons to note.", "\nI view my Christianity to be more complete in understanding more of the Jewish traditions that Christianty eminated from and therefore respecting Judaism. ", "Plus I’m finding added wisdom from that too.", "\nSeperately I can’t get over how for a supposedly Catholic Largalian/Latvian my mother completly fitted the bill of the stereotype Jewish mother, from chicken soup , use of Jewish terms, even Jewish words of insults when mad at me and even impacting on her perception of G-d. Hence even my styles of thought etc..A great grandma seems to have had to runaway after an affair with a local Latgalian causing the Jewish exit.", "The dot of Jewish on my fathers paternal side left him keen on reading many novels by Jews, their cabarets, music, bits of culture despite more Roma in him from mother.", "\nIt hence makes me wonder about the Jews you Debbie mention playing away from their heritage coming from such a strong culture. ", "Why aren’t they wanting to protect it, or even themselves?." ]

{ "pile_set_name": "Pile-CC" }

[ 0.004025310277938843, 0.000605572247877717, 0.10526272654533386, 0.8110244870185852, 0.0009469023789279163, 0.025585541501641273, 0.052917227149009705, 0.046497367322444916, 0.0008014269405975938, 0.0009985003853216767, 0.04730915650725365, 0.35595089197158813, 0.026197342202067375, 0.4229448139667511, 0.06116097792983055, 0.12228339910507202, 0.06045112386345863, 0.014816056936979294, 0.0006499763112515211, 0.08591269701719284, 0.0007724245078861713, 0.0007897711475379765, 0.019854407757520676, 0.0035133627243340015, 0.00980846956372261, 0.04494376853108406, 0.29195618629455566, 0.27800217270851135, 0.037790071219205856, 0.0016384583432227373, 0.024595562368631363, 0.000879205297678709, 0.06813827157020569, 0.23578347265720367, 0.2805860936641693, 0.3958866000175476, 0.0009162303758785129, 0.008524429984390736, 0.004520824644714594, 0.03477657958865166, 0.0011912198970094323, 0.0006521704490296543, 0.0026118301320821047, 0.0006754958303645253, 0.0010978453792631626, 0.0007229835027828813, 0.0036285489331930876, 0.002751697553321719, 0.004921179264783859, 0.0006798075628466904, 0.0017813966842368245, 0.0010592867620289326, 0.000574895238969475, 0.0011493307538330555, 0.06855875998735428, 0.23275762796401978, 0.0007642697892151773, 0.0007175016799010336, 0.0010404259664937854, 0.0007939329952932894, 0.042385369539260864, 0.014465094543993473, 0.0006545166252180934, 0.07085566967725754, 0.000898107944522053, 0.09449057281017303, 0.018202202394604683, 0.002898657461628318, 0.16164490580558777, 0.0006173421279527247, 0.0006600460037589073, 0.16806966066360474, 0.08506737649440765, 0.000652188144158572, 0.06800952553749084, 0.0007501223590224981, 0.10973848402500153, 0.0028107103426009417, 0.001086861826479435, 0.1883309930562973, 0.0008515399531461298, 0.6823872327804565, 0.002061018720269203, 0.0036494217347353697, 0.273663729429245, 0.07365494221448898, 0.0005944182048551738, 0.05429236218333244, 0.001107382238842547, 0.019344862550497055, 0.0039638797752559185, 0.0006044766050763428, 0.0007223288412205875, 0.6352197527885437, 0.0005552629008889198, 0.0006280075758695602, 0.6396918892860413, 0.12134268134832382, 0.0210671816021204, 0.0037244181148707867, 0.022617990151047707, 0.0013576928758993745, 0.021898357197642326, 0.8236489295959473, 0.5229682326316833, 0.027242805808782578, 0.0005498315440490842, 0.0017420008080080152, 0.0007913656299933791, 0.15091969072818756, 0.002824218478053808, 0.010985911823809147, 0.001703184563666582, 0.1038048043847084, 0.0022486376110464334, 0.012603716924786568, 0.10167206078767776, 0.025873906910419464, 0.00117425003554672, 0.025227922946214676, 0.0006359975668601692, 0.0007412458653561771, 0.009984564036130905, 0.09602069854736328, 0.05426384508609772, 0.024913780391216278, 0.0007733993115834892, 0.01686464250087738, 0.02091885730624199, 0.0888848751783371, 0.042547281831502914, 0.0025159460492432117, 0.0007651862106285989, 0.07222907990217209, 0.11156898736953735, 0.0006410475471056998, 0.0009535057470202446, 0.038291096687316895, 0.6942533850669861, 0.015053088776767254, 0.001261217170394957, 0.020961344242095947, 0.0007054805755615234, 0.8725603222846985, 0.0012428156333044171, 0.0016066150274127722, 0.0006805095472373068, 0.0006839483976364136, 0.0006496542482636869, 0.001838531345129013, 0.16732169687747955, 0.0022284500300884247, 0.0027055509854108095, 0.0029836827889084816, 0.032310448586940765, 0.002098608296364546, 0.0009292137110605836, 0.0033148289658129215, 0.0006745815626345575, 0.0009648652048781514, 0.0008319105836562812, 0.0007391772815026343, 0.004389905836433172, 0.0008424950065091252, 0.0006164032383821905, 0.6124217510223389, 0.0006950393435545266, 0.5553383231163025, 0.024308817461133003, 0.04584193974733353, 0.6438350677490234, 0.3815215528011322, 0.007839260622859001, 0.0119165712967515, 0.0034206777345389128, 0.08816755563020706, 0.008190078660845757, 0.3035563826560974, 0.0016276489477604628, 0.003676122520118952, 0.016803419217467308, 0.037874627858400345, 0.00139048567507416, 0.29927030205726624, 0.9451090097427368, 0.0028698332607746124, 0.007127861026674509, 0.2608729898929596, 0.007890024222433567, 0.011236314661800861, 0.0007299748249351978, 0.001228480483405292, 0.0008573760278522968, 0.001107097021304071, 0.002088408451527357, 0.002007754985243082, 0.0010942650260403752, 0.005670056212693453, 0.003152538789436221, 0.130243182182312, 0.0006373974028974771, 0.0005753447185270488, 0.0009761694236658514, 0.21432147920131683, 0.1668846756219864, 0.004304651636630297, 0.004140036646276712, 0.10145623981952667, 0.0032310683745890856, 0.0008369188872165978, 0.03809685632586479, 0.29298901557922363, 0.005661277566105127, 0.001639557653106749, 0.03188496455550194, 0.0371747761964798, 0.000914624601136893, 0.0008803621167317033, 0.0010473496513441205, 0.11573082208633423, 0.0022507794201374054, 0.0019784574396908283, 0.04081900045275688, 0.0006238620262593031, 0.0011162135051563382, 0.0007536559132859111, 0.050678595900535583, 0.0006383196450769901, 0.0005702904309146106, 0.0011395859764888883, 0.0005546078318729997, 0.0006562648923136294, 0.0899369940161705, 0.0007485552923753858, 0.0006926842033863068, 0.000643038481939584, 0.0008406089618802071, 0.0005689385579898953, 0.027484634891152382, 0.00795044843107462, 0.008833136409521103, 0.0008036569342948496 ]

[ "Q:\n\nHow to rework addAdditionalHeaderData within TYPO3 9.5\n\nwhile upgrading our codebase for 9.5 i just found the old approach with using\n$res = $this->response;\n$res->addAdditionalHeaderData('<script src=\"' . ", "$scriptPath . '\" ", "type=\"text/javascript\"></script>');\n\nthis all happens inside an extension controller extending ActionController, the methods seem not to exist anymore and i cant find the new way of implementing that functionality. ", "so how can i add additional header data inside my action controller from my extbase extension?", "\nhelp is much appreciated\n\nA:\n\nwe did it with the PageRenderer class which can be instantiated within the ActionController\n /** @var PageRenderer $pageRenderer */\n $pageRenderer = GeneralUtility::makeInstance(PageRenderer::class);\n $pageRenderer->addHeaderData($additionalHeaderData);\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007742306916043162, 0.0018862546421587467, 0.0006374098593369126, 0.0006983185303397477, 0.0007336098933592439 ]

[ "This invention relates to valve assemblies and valve stems, and in particular to valves the construction of which are optimized to reduce the sudden changes in pressure caused by routine mechanical opening and closing of the valves.", "\nIt is well known that the closing of a valve in the same direction as the flow of the fluid being controlled results in much more sudden and violent closure than closing of the valve against the flow. ", "For this reason, conventional shut-off valves have been constructed and arranged this way for quite some time.", "\nWith respect to divert valves, though, with the normal arrangement where the inlet is in the center and the two outlets are disposed one above and one below the inlet, or one on each side, it has been conventional to close the valve in the same direction as the flow, as shown in Catalog No. ", "AFC-90 published by Tri-Clover, Inc. The reason for this direction of closure for divert valves is that the two plugs, both affixed to the valve stem, prevent assembly of the valve if arranged any other way.", "\nHowever, the sudden changes in pressure caused by closing valves in this manner can cause damage to a wide range of system components, ranging from pipe hangers to pumps and the clamps connecting the systems together. ", "Alternatively, the avoidance of this hammering leads to otherwise unnecessarily low limits on the pressures, velocities and other capacities of the systems affected.", "\nThis invention relates to improvements to the apparatus described above and to solutions to some of the problems raised or not solved thereby." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005586239276453853, 0.0006605780799873173, 0.002233928767964244, 0.0005840144585818052, 0.0005806313129141927, 0.0008697191369719803, 0.0006297180661931634, 0.0005534524098038673 ]

[ "Nina Nesbitt misses out on singing Flower of Scotland in New York after being sent to the wrong stage\n\n15:00, 7 Apr 2014\n\nUpdated 16:32, 7 Apr 2014\n\nByBeverley Lyons\n\nTHE Scots singer, who is in New York to perform at a number of gigs during Tartan Week, missed her performance of the national anthem after a steward sent her to the wrong place.", "\n\nShare\n\nGet weekly news by email\n\nAFP/Getty Images\n\nNina Nesbitt met First Minister Alex Salmond at the event in New York\n\nNINA Nesbitt missed out on singing Scots national anthem Flower of Scotland at New Yorks’s Scotland Run after a steward gave her the wrong directions.", "\n\nThe Stay Out singer is in the Big Apple to perform at a number of gigs during Scotland/Tartan Week and, aside from a performance at Webster Hall with the La Fontaines and Lau last night for The ­Caledonia Collective, the 10k appearance was one of her diary highlights.", "\n\nBut Nina arrived at the main stage on Saturday just as the Morrison’s Academy Pipe Band were finishing off their set.", "\n\nShe revealed: “I got up bright and early at 6am to come down and sing the national anthem, which ­obviously I was really excited about and honoured to do.", "\n\n“I got there an hour before I was meant to sing, checked in and stood at the stage with my guitars.", "\n\n“I started to realise everyone was heading in the other direction and thought they were warming up.", "\n\n“Then I found out the starting line was 10 minutes away in the other direction and I was told I needed to run to reach it.", "\n\n“I couldn’t run as fast as I’d have liked because I was meant to sing and I’d have been out of breath but I ended up trying to make it to the stage in time. ", "The whole race who were lined up at the starting line were looking at me and it was like a huge game of British bulldogs with me as the miniature Shihtzu.", "\n\n“I got there just as the pipe band were finishing it and I was pretty upset after being told I was in the right place.”", "\n\nNina, who briefly got up on stage to try to sing, was met by First Minister Alex Salmond who smoothed things over by giving her a Scots-American flag badge and chatted to her as they walked up to the finish line.", "\n\nShe was also told she could perform the song before her set on the smaller stage after the race finished.", "\n\nNina said: “I met Alex Salmond who gave me a badge and it was all very nice.", "\n\n\"The First Minister was a bit confused about what happened but he wished me luck and said I had a nice voice.", "\n\n“I ended up doing my performance on the Central Park bandstand and it was nice to see all the Scottish American people there. ", "It was all pretty eventful.”", "\n\nNina returned to Central Park yesterday to perform a spontaneous busking gig by the fountain from the title sequence of US series Friends." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006820197449997067, 0.000631949573289603, 0.0007298137643374503, 0.0006965903448872268, 0.0005621057935059071, 0.000777052715420723, 0.0005920612020418048, 0.0006393976509571075, 0.0014928876189514995, 0.0021733297035098076, 0.0006158494506962597, 0.0006007147021591663, 0.0005869136075489223, 0.0006036855047568679, 0.0005352772423066199, 0.0006166665116325021, 0.0006212614243850112, 0.0006895044352859259 ]

[ "William R. Stewart\n\nWilliam R. Stewart (October 29, 1864 – April 5, 1958) was an American politician who was elected to the Ohio House of Representatives. ", "As an African-American lawmaker, he was instrumental in the passage of anti-lynching legislation and also sponsored bills providing pensions to civil servants. ", "He was the first African American to practice law in Youngstown, Ohio.", "\n\nDuring his two terms as a lawmaker and almost seven decades as a private attorney, Stewart participated in projects and policies designed to improve the condition of African Americans. ", "Toward the end of his life, he was publicly honored for his role in promoting interracial cooperation.", "\n\nStewart retained his law practice until failing health and advanced age intervened. ", "At the time of his death, he was one of the most prominent figures in Youngstown's legal community.", "\n\nEarly years \nStewart was born in New Castle, Pennsylvania, the son of Lemuel A. Stewart, a bricklayer. ", "The family moved to Youngstown when Stewart was still a young child. ", "Despite the elder Stewart's expressed desire that his son follow in his trade, William Stewart pursued his studies at Youngstown's Rayen School, where he earned a diploma in 1883.", "\n\nAfter graduating from high school, Stewart became a baggage master with the old P.C. & P. Railroad. ", "He went on to read law in the Cincinnati office of Laurin D. Woodworth, a two-term congressman, and Benjamin Franklin Wirt, a former state senator. ", "During this time, Stewart developed a brisk sideline helping Civil War veterans cut through government red tape to secure their pensions.", "\n\nLegal career \nUpon the sale of his practice, Stewart acquired enough money to enter Cincinnati Law School, where he graduated in 1886. ", "He returned to Youngstown and established law offices in a downtown landmark known as \"the old Diamond block\". ", "In 1895, he was nominated for state representative at the Mahoning County Republican convention. ", "On October 14, 1895, an editorial in The Youngstown Telegram accused Stewart's Democratic opponent, James B. Chambers, of employing racist rhetoric in his campaign. \"", "This argument is not in good taste for the reason that we are not living in the far South where the colored man is not allowed by Democrats to exercise the rights of a free American citizen\", the editorial stated. \"", "We are in the North, where all men are equal\". ", "The editorial outlined Stewart's qualifications for public office and indicated he had \"won the esteem and good wishes of everyone who knows him\". ", "At the close of the election, Stewart defeated Chambers by a margin of more than 900 votes.", "\n\nIn 1897, Stewart was unanimously nominated for re-election at his party's convention. ", "At a time when U.S. senators were elected by state lawmakers, Stewart publicly vowed to support the senatorial bid of Cleveland political boss Mark Hanna, who managed the successful presidential campaign of William McKinley in 1896. ", "His Democratic opponent, Mark R. Morris, promised to vote against Hanna. ", "Ultimately, Stewart prevailed over Morris by a vote of 6,075 to 5,749.", "\n\nDuring his two terms as a state lawmaker, Stewart sponsored legislation that provided pensions to police and firemen, ensured tax support for the establishment of St. Elizabeth's Hospital, and initiated legislation for the construction of Youngstown's Market Street Bridge, which opened up a vibrant business district to the south of the city. ", "In addition, he supported the Smith Anti-Mob Violence bill, which featured stronger measures to prevent vigilante justice. ", "In 1897, during his campaign for a second term in the state legislature, Stewart hosted the convention of the National League of Colored Voters of Pennsylvania, Ohio, New York, and West Virginia, which was held in Youngstown that year.", "\n\nStewart chose not to seek a third term in the Ohio Senate, stating that his responsibilities as a lawmaker interfered with his law practice. ", "After an unsuccessful bid for probate judge, he abandoned politics altogether. ", "From 1907 to 1914, Stewart served as the local attorney for the Austria-Hungarian monarchy, representing the Washington embassy through the Cleveland consulate.", "\n\nPersonal life \n\nIn the 1880s, Stewart married the former Consuelo Clarke, a medical student who was the daughter of a Cincinnati school superintendent. ", "When the couple settled in Youngstown, Consuelo Stewart became the community's first African-American doctor. ", "In addition, she helped organize a local chapter of the YWCA and sponsored Youngstown's first free kindergarten. ", "Consuelo Stewart died in 1911; William Stewart never remarried.", "\n\nLater years \n\nIn 1924, after almost 40 years in the same location, Stewart moved his offices to another downtown building to make way for the razing of the \"old Diamond block\". ", "He maintained a downtown law practice until well into his eighties, when a broken hip severely limited his mobility. ", "Stewart, in retirement, remained a visible figure within his community. ", "In 1947, he was publicly honored as the first person to organize a local committee dedicated to interracial work. ", "Stewart died at his North Side home of arteriosclerosis at the age of 93. ", "His obituary in The Youngstown Vindicator described him as \"the dean of Youngstown's attorneys\".", "\n\nReferences \n\nCategory:1864 births\nCategory:1958 deaths\nCategory:African-American lawyers\nCategory:African-American state legislators in Ohio\nCategory:American anti-lynching activists\nCategory:Ohio lawyers\nCategory:Ohio Republicans\nCategory:Ohio state senators\nCategory:People from New Castle, Pennsylvania\nCategory:Politicians from Youngstown, Ohio\nCategory:University of Cincinnati College of Law alumni\nCategory:Activists from Ohio\nCategory:American lawyers admitted to the practice of law by reading law\nCategory:Lawyers from Youngstown, Ohio" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0012470809742808342, 0.0008924888679757714, 0.0010928924893960357, 0.0008343735826201737, 0.0005976110114715993, 0.0008528953185304999, 0.0009308395674452186, 0.0008987610344775021, 0.000915969314519316, 0.0006939505692571402, 0.0008414472104050219, 0.000781310664024204, 0.0009702449315227568, 0.0007639602990821004, 0.001090483390726149, 0.0011225732741877437, 0.001206758082844317, 0.004693731665611267, 0.0011532942298799753, 0.0005552279762923717, 0.0010551969753578305, 0.0006732986657880247, 0.000675029878038913, 0.0009198227198794484, 0.0007938055205158889, 0.0008295864099636674, 0.0013628709129989147, 0.0009821371641010046, 0.0008266328368335962, 0.0018284703837707639, 0.0006512319087050855, 0.0006646794499829412, 0.0007361411699093878, 0.000884921639226377, 0.0008688755333423615, 0.0008751673740334809, 0.001054223976098001, 0.0005988460034132004, 0.0006102534243836999, 0.0028136493638157845, 0.0007762127206660807, 0.0006603776128031313 ]

[ "All-American News\n\nRev. Jesse Jackson Calls For Hope And Healing To Begin In Memphis\n\nRev. Jesse Jackson Calls For Hope And Healing To Begin In Memphis\n\nby Trennie L. Williams, PhDc\n\nHundreds of thousands of people have come from around the globe to Memphis, Tenn., commemorating MLK50, the 50th anniversary of the assassination of Rev. Dr. Martin Luther King, Jr. Many community leaders seek to take action that the would promote positive change for poor people in the community.", "\n\nRev. Jesse Jackson was in Memphis for over a week, before and after the April 4th vigil at the National Civil Rights Museum, to move forward with a revived poor people’s campaign that targets education, health care, and economic progress. ", "He reiterated that Memphis is the place to begin change in America.", "\n\n“Right here in Memphis is where America’s transformation must start anew,” Jackson said. “", "This place has great meaning. ", "And this is the right place to be.”", "\n\n“Revive the war on poverty. ", "That means providing affordable health care for all people based on need. ", "We also need affordable education, because if people cannot afford education, they cannot grow. ", "And end so much violence. ", "We must ban assault weapons and stop the killing. ", "We are the most violent nation on earth.”", "\n\nMemphis has one of the largest percentages of poor African-Americans in the nation. ", "According to date, about 30 percent of Blacks in Memphis are in poverty. ", "Nationally, 54 percent of African Americans are making less than $15 an hour. ", "More than 25 percent of that number make $7.50 or less while working.", "\n\nRevive the war on poverty. ", "That means providing affordable health care for all people based on need. ", "We also need affordable education, because if people cannot afford education, they cannot grow. ", "And end so much violence. ", "We must ban assault weapons and stop the killing. ", "We are the most violent nation on earth.", "\n\nRevive the war on poverty. ", "That means providing affordable health care for all people based on need. ", "We also need affordable education, because if people cannot afford education, they cannot grow. ", "And end so much violence. ", "We must ban assault weapons and stop the killing. ", "We are the most violent nation on earth.", "\n\nRevive the war on poverty. ", "That means providing affordable health care for all people based on need. ", "We also need affordable education, because if people cannot afford education, they cannot grow. ", "And end so much violence. ", "We must ban assault weapons and stop the killing. ", "We are the most violent nation on earth.", "\n\n“The big part of our quest today is economic justice,” said Jackson. “", "The poverty in Memphis is abounding, as well as in the Delta, Appalachia, and other parts of the South.”", "\n\nHaving affordable health care is extremely important when it comes to helping less fortunate people physically take care of their bodies while preparing for top earning opportunities.", "\n\n“Just as social security is a base for poor people, affordable health care is a base for poor people,” said Jackson.", "\n\nRev. Jesse Jackson speaks during a press conference at Mt. Olive CME Church in Memphis, Tenn., as tens of thousands of people converged at the National Civil Rights Museum for MLK50, the 50th anniversary of the assassination of Rev. Dr. Martin Luther King, Jr. (Photo by Trennie L. Williams, Sr., ", "Memphis Silver Star News/StarNewsVIP.com.)", "\n\nA way to help younger citizens prepare for better jobs and entrepreneurship is through trade programs that begin in high school. ", "This would allow teenagers to enter the workforce with some sort of skill that would afford them greater work opportunities.", "\n\n“These (high) schools should have a trade component for teaching,” Jackson said. “", "Along with teaching arts and skills, we must learn about computer technology, science and day-to-day trade skills. ", "They (new generations of young people) must be taught, not by accident, but intentionally.", "\n\n“Any rebuilding would involve trade skills. ", "We should demand trade skills and computer skills for all of our children, black and white alike.”", "\n\nA significant way to push trade school and trade skill efforts is by voting for elected officials who will make sure legislation is passed to fund trade programs.", "\n\n“All high school seniors should be registered to vote,” encouraged Jackson. “", "Because of our young people, we still maintain our hope, with the tug of war in America for our souls. ", "We go forward by hope and healing. ", "Hope and healing is going to win this battle because we are going to vote like it.”", "\n\nJackson recognized election wins in Pennsylvania, Virginia, Alabama, and New Jersey that are beginning a change in local and federal governments. ", "Four million African Americans in the South, however, are not registered to vote. ", "Over 2.5 million who were registered did not vote last year.", "\n\n“That will change,” said Jackson, remaining optimistic about the community’s effort to register more voters who literally go to the polls to submit their vote.", "\n\nBoycotts, sit-ins and other actions are being organized to show corporate America that now is the time to significantly change. ", "Jackson noted there are 20 corporations in the Memphis area that are to be challenged to help rid poverty. ", "One of the companies is Kroger. ", "Jackson announced a boycott against Kroger, a grocery store chain that closed several stores in highly-populated Black communities in the Mid-South area.", "\n\n“We should challenge these companies, exposing their board of directors, their EOE reports, the procurement reports, and a fare share of jobs, contracts, and financial services.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006065986817702651, 0.0007346708443947136, 0.0006210248684510589, 0.0006459209835156798, 0.0005851971218362451, 0.0008300070185214281, 0.001218381803482771, 0.0007405179785564542, 0.002166559686884284, 0.023407820612192154, 0.06648143380880356, 0.6950260996818542, 0.08312388509511948, 0.1432957947254181, 0.0038898237980902195, 0.0009026784100569785, 0.0012594362488016486, 0.0007405179785564542, 0.002166559686884284, 0.023407820612192154, 0.06648143380880356, 0.7773299217224121, 0.0012594362488016486, 0.0007405179785564542, 0.002166559686884284, 0.023407820612192154, 0.06648143380880356, 0.7773299217224121, 0.0012594362488016486, 0.0007405179785564542, 0.002166559686884284, 0.023407820612192154, 0.06648143380880356, 0.7773299217224121, 0.0006811912171542645, 0.0008923715213313699, 0.0006784276920370758, 0.004380505997687578, 0.0005862882826477289, 0.0006523855263367295, 0.000548614130821079, 0.002740278374403715, 0.000626733060926199, 0.0006199411582201719, 0.0008425258565694094, 0.0006631832802668214, 0.20103603601455688, 0.0005663275951519608, 0.0008483963902108371, 0.0010220147669315338, 0.0005392393213696778, 0.0006327586015686393, 0.000606138666626066, 0.0011291083646938205, 0.0007546914857812226, 0.0006200141506269574, 0.0008621936431154609, 0.0007164597045630217, 0.0007494381861761212, 0.008572356775403023, 0.0005826131673529744 ]

[ "---\nabstract: 'Here we present a new approach to concatenated quantum error correction in which additional classical processing is used with existing quantum codes and fault-tolerant circuits to more reliably correct errors. ", "Using this new scheme we are able to guarantee correction of a number of discrete errors up to half of the distance of the concatenated code. ", "We simulate the application of the scheme to the \\[\\[4,1,2\\]\\] subsystem code with up to three levels of error correction.'", "\nauthor:\n- 'Zachary W. E. Evans$^{}\\footnote[1]{Electronic address: zevans@unimelb.edu.au}$ and Ashley M. Stephens'\ntitle: 'Optimal decoding in fault-tolerant concatenated quantum error correction'\n---\n\nIntroduction\n============\n\nOur expectation that a quantum computer will one day outperform a classical computer is in part founded upon quantum error correction, which will be necessary to mitigate environmental decoherence and errors that arise from imprecise quantum control. ", "Various methods for error correction are known, including topological error correction [@Kitaev1; @Nayak1; @Raussendorf2], surface codes [@Kitaev1; @Bravyi1; @Dennis1], and color codes [@Bombin1]. ", "The method we are concerned with in this paper involves concatenating small quantum codes that are analogous to classical codes such as the repetition code and the Hamming code.", "\n\nQuantum codes such as the Bacon-Shor code [@Bacon1; @Bacon2] and the Steane code [@Steane1] work by redundantly encoding the state of a single, physical qubit in the combined state of a few qubits, whereafter an error in the state of one or more of these qubits can be diagnosed and corrected using appropriately designed circuits that control the propagation of errors [@Nielsen1]. ", "This reduces the error rate of an encoded quantum circuit relative to an unencoded quantum circuit by at least a factor proportional to reciprocal of the physical error rate, as two or more concurrent errors are required to cause failure. ", "However, because there are more places for errors to occur than before, the encoded error rate will only be lower than the physical error rate if the physical error rate is below some threshold [@Aliferis1].", "\n\nA single level of error correction can only reduce the encoded error rate so much. ", "A greater reduction can be achieved by encoding a single physical qubit in the state of a few qubits, as before, and then encoding each of those qubits in the state of more qubits, and so on. ", "This forms a concatenated quantum code, which allows, in theory, an arbitrarily long and large universal quantum computation to be undertaken reliably and efficiently. ", "However, as both the number of qubits and the time required increase exponentially with the number of concatenation levels, it is likely that only a few levels will be practical. ", "Therefore with finite resources the fault tolerant threshold should not be thought of as the critical point for achieving arbitrary accuracy in quantum computing. ", "To achieve a sufficiently low logical error rate with a practical amount of resources it is important to make each level as effective as possible at reducing the encoded error rate.", "\n\nTypically, each level of a concatenated code operates independently of all other levels and implicitly assumes that errors on all qubits are equally likely. ", "For a distance-$d$ code that is concatenated $l$ times, this method results in a concatenated code that can fail if there are $\\lceil d/2\\rceil^l$ errors. ", "However, as the total distance of the concatenated code is $d^l$, one might expect that a more sophisticated decoding method may exist which will never fail with fewer than $\\lceil d^l/2\\rceil$ errors. ", "Such a method is known for the case of quantum information being communicated over a noisy channel [@Poulin1], but not for the case where errors can occur during error correction itself.", "\n\nRecently we reported on a new method of concatenated error correction which makes use of classical information obtained during the first level of error correction to assist in the diagnosis of errors at the second level [@Evans1]. ", "When applied to the \\[\\[9,1,3\\]\\] subsystem code our method was shown to correct all cases with four physical errors whereas conventional error correction, where each level of error correction operates independently, can only guarantee success with up to three physical errors. ", "Our method was inspired by a similar method that has been applied to an error-detection code with the result that the minimum number of errors that cause failure scales with increasing levels of concatenation as the Fibonacci sequence [@Knill1; @Aliferis2] .", "\n\nHere we extend the method of Ref.", " [@Evans1] so that it is applicable to any number of levels of concatenation. ", "By using information gathered by the process of error correction itself we determine the relative likelihood of failure at each circuit location and thus maximize the probability of correctly interpreting high-level error syndromes. ", "Our method requires no additional quantum resources and increases the minimum number of errors that cause failure to half the total distance of the concatenated code. ", "In the design of this method we assume a discrete error model in which the probability of error at each physical circuit location, $p$, is constant and independent of the other locations. ", "We also assume that the quantum computer will be operating in the low-$p$ limit, thus the exponent of the lowest order of $p$ is sufficient to describe probabilities. ", "It may be possible to improve the method by relaxing these assumptions.", "\n\nMethod\n======\n\nThe key idea for our method is that the process of error correction provides information that can be used to estimate the probability that an encoded qubit has failed. ", "For example, whenever error correction measures a non-zero syndrome we know that at least one error has occurred, and so our confidence in the encoded information should be decreased. ", "Here we aim to use all of the information at our disposal to determine the most likely set of errors that could give rise to the measured syndrome so that we can maximize the probability of returning to the correct codeword state. ", "We achieve this by tracking effect of each possible error through the error-correction circuitry, along with an associated confidence rating. ", "Whenever a syndrome measurement is made, the results are compared to predicted syndrome measurements for possible sets of errors. ", "We apply corrections to the data qubits based on the most likely set of errors that would give rise to the syndrome. ", "Confidence ratings for the higher-level encoded qubits are calculated using the information from the syndrome measurements.", "\n\nFlag raising\n------------\n\nFor each location in the error-correction circuit we determine what effect a discrete $X$ and $Z$ error occurring at that location would have on the data and ancilla at the end of syndrome extraction. ", "Taking into account that some errors are equivalent to other errors, we assign a *flag* to each unique error. ", "In other words, there is a flag for each possible effect on the data and ancilla that can be caused by a single error in the circuit. ", "Each flag represents the possibility of a single error. ", "The probability of any given flag representing an actual error is described by the *weight* of the flag such that $\\textrm{Pr(error)} = \\mathcal{O}(p^{\\textrm{weight}})$. As the possibility of error at each location is independent of the other locations, the probability of multiple flags representing actual errors is $\\mathcal{O}(p^{\\sum{\\textrm{weights}}})$, where the sum is over the set of flags being considered. ", "Error correction and flags in the $X$ and $Z$ bases are treated separately.", "\n\nAt the physical level, each location in the error-correction circuit is assigned a confidence of one, indicating that physical-level locations all fail with probability $p$. At the end of each error-correction cycle (in each basis), after measuring the syndrome and applying the appropriate correction, a confidence rating is calculated for the encoded qubit based on the syndrome and flags. ", "This is the logical confidence rating of the higher-level circuit location, the calculation of which will be described in the following section. ", "Initially, all flags can be thought of as having infinite confidence (as there cannot be any errors before any operations have been done). ", "As each circuit location is executed, the weight of the flag corresponding to an error at that location is updated to be the minimum of its current value and the confidence reported at that location. ", "Detection of errors at lower levels will lower our confidence of success at particular circuit locations all the way up to the highest level of error correction.", "\n\nTwo-qubit gates are special in that errors may be shared on both qubits. ", "For example, errors occurring before a transversal ${\\textsc{cnot}}$ may be copied and errors occurring during a ${\\textsc{cnot}}$ may affect both the control and the target qubits. ", "Therefore, the confidence ratings reported by error correction immediately following a two-qubit gate are used to update the flag which corresponds to a correlated error affecting both qubits involved in the gate. ", "This is in addition to updating both of the flags corresponding to the uncorrelated errors after gate. ", "The flag weight corresponding to the two-qubit error is taken to be the maximum of the two single-qubit confidence ratings as opposed to the sum, which would correspond to the two uncorrelated errors. ", "The possibility of a correlated error is thus represented by its own flag.", "\n\nAny error on a data qubit will eventually have its effect transfered down to the ancilla. ", "The location of the error determines which ancillary qubit will see its effect. ", "An error which affects a data qubit only after it has interacted with the ancilla in its current error-correction cycle can not be detected until the following error-correction cycle. ", "Therefore, flags that represent errors that effect only data qubits should be put aside until the current error-correction cycle is complete, after which they will represent errors that will be detected in the following error-correction cycle. ", "These flags can be called *transitive flags*. ", "Following error correction, each transitive flag is converted into the its associated non-transitive flag for use in the next error-correction cycle. (", "See Section \\[sec: application\\] for an example.)", "\n\nEach logical qubit has its own set of flag weights. ", "When two logical qubits interact (during a logical operation) certain errors within one logical qubit may propagate onto the other logical qubit. ", "Let us call the logical qubit from which errors may be copied the *source* and the logical qubit to which errors may be copied the *target*. ", "Flags representing the possibility of errors on the source are used to update the weights of flags on the target. ", "For each possible error that may be copied from the source, the corresponding flag weight on the target is taken to be the minimum of its current weight and the weight of the flag on the source. ", "Although copying an error from one logical qubit to another would actually result in a correlated error affecting both qubits, we treat each error and its associated probability as if they were independent so that error correction can be performed on each logical qubit separately. ", "The possibility of correlated errors is reintroduced at the logical level where the weight is taken to be the maximum of the weights of the individual logical qubits.", "\n\nFlag matching, correction, confidence reporting\n-----------------------------------------------\n\nAt the end of each error-correction cycle the ancillary qubits are measured to obtain the syndrome. ", "Each possible syndrome is consistent with a finite number of sets of errors. ", "Each of these sets of errors has a corresponding set of flags. ", "We call each set that matches the measured syndrome a *flag match*. ", "The most likely cause of the syndrome is the set of errors that is represented by the flag match with the lowest weight, where the weight of a flag match is the sum of the weights of the flags in the set. ", "With the lowest weight flag match identified, we apply corrections to whichever data qubits would be affected by the set of errors represented by the match.", "\n\nAlternative flag matches will imply different data corrections. ", "In particular, there will always be a flag match which implies a complement set of corrections to that of the lowest weight match $-$ that is, the corrections of both matches combine to form a logical operator. ", "If we correct based on some match but the true set of errors are represented by its complement match then the result is a logical failure. ", "To determine the logical confidence rating that will be used by error correction at the level above, we consider the probability that our choice of correction will result in a logical error, $$\\textrm{Pr(fail}\\vert\\textrm{S}\\cap\\textrm{flags})=\\frac{\\textrm{Pr(fail}\\cap\\textrm{S}\\vert\\textrm{flags})}{\\textrm{Pr(S}\\vert\\textrm{flags})}.", "\n \\label{eq: conditional prob}$$ Pr(fail$\\vert$S$\\cap$flags) is the probability of a logical failure given the current syndrome and set of flags. ", "Pr(S$\\vert$flags) is the probability of the current syndrome occurring given the current set of flags, regardless of success or failure. ", "Pr(fail$\\cap$S$\\vert$flags) is the probability of the current syndrome occurring and error correction resulting in a logical error. ", "In the low-$p$ limit these probabilities are dominated by the leading-order terms and the coefficients are not important. ", "Since our method applies corrections based on the most likely cause of the syndrome, to leading order Pr(SS)$=$Pr(success$\\cap$SS). ", "This implies $$\\frac{\\textrm{Pr(fail}\\cap\\textrm{S}\\vert\\textrm{flags})}{\\textrm{Pr(success}\\cap\\textrm{S}\\vert\\textrm{flags})} \\approx p^{y-x}\n \\label{eq: failure first order}$$ where $x$ is the weight of the lowest weight flag match and $y$ is the weight of the complement match. ", "Therefore, $$C_L = y - x\n \\label{eq: logical confidence}$$ is the logical confidence rating calculated during this error-correction cycle.", "\n\nThe logical confidence rating represents the probability of a logical error, $\\mathcal{O}(p^{C_L})$. However, there is also a possibility that the corrections applied will result in a state that is outside of the code space, so that it is neither the correct state nor the state affected by a logical error. ", "Just as we used the complement match to determine the probability of a logical error we can determine the probability of individual errors on each data qubit by considering the other flag matches. ", "At the end of each error-correction cycle the confidence of each data qubit is updated to be the minimum of the confidence of its associated transitive flag and a confidence determined during the error correction of the encoded qubit, where this confidence is calculated in an analogous way to the logical confidence.", "\n\nIn large codes there will also be probabilities of correlated sets of data errors that we are able to derive from the flag matches. ", "Let $E$ represent a particular set of a data errors after an error-correction cycle. ", "Then $$\\textrm{Pr(}E\\vert\\textrm{S}\\cap\\textrm{flags}) = \\frac{\\textrm{Pr(}E\\cap\\textrm{S}\\vert\\textrm{flags})}{\\textrm{Pr(S}\\vert\\textrm{flags})}.", "\n \\label{eq: correction flagging}$$ The weight of the flag corresponding to this set of data errors should, therefore, be updated to be the minimum of its current weight and the sum of each set of flags that match this outcome, taking into account any corrections that have been applied, minus the weight of the minimum weight flag match. (", "See Section \\[sec: application\\] for an example.)", "\n\nBy the careful consideration of every possible cause of every syndrome we always have accurate confidence ratings for every qubit at every level. ", "We use this information to maximize the probability of success by always correcting based on the most likely set of errors.", "\n\nApplication {#sec: application}\n===========\n\nHere we apply our method to the \\[\\[4,1,2\\]\\] subsystem code [@Bacon1; @Bacon2]. ", "The stabilizer generators of this code are $$\\begin{gathered}\n \\begin{gathered}\n X_1 X_2 X_3 X_4,\\\\\n Z_1 Z_2 Z_3 Z_4,\n \\end{gathered}\n \\label{eq: stabilizers}\\end{gathered}$$ where $X_i$ and $Z_i$ respectively represent the Pauli operators $\\sigma_X$ and $\\sigma_Z$ applied to the $i^{th}$ qubit. ", "Tensor products and identity operators are implicitly present. ", "The gauge group of this code is generated by the operators $$\\begin{gathered}\n \\begin{gathered}\n X_1 X_2,\\\\\n X_3 X_4,\\\\\n Z_1 Z_3,\\\\\n Z_2 Z_4.", "\n \\end{gathered}\n \\label{eq: gauge}\\end{gathered}$$ The logical $X$ and $Z$ operators are $$\\begin{aligned}\n \\begin{aligned}\n X_L & = & X_1 X_4, \\\\\n Z_L & = & Z_1 Z_4,\n \\end{aligned}\n \\label{eq: logical ops}\\end{aligned}$$ or equivalently any operators that can be generated by combining Eq.", " \\[eq: logical ops\\] with the gauge operators of Eq.", " \\[eq: gauge\\].", "\n\nThe syndrome-extraction circuit which we have chosen to use is shown in Fig.", " \\[fig: error map\\] [@Aliferis4], along with the flags that will be used in our message-passing method. ", "The circuit performs operator measurements of the gauge operators, two at a time. ", "Since the stabilizers are products of the gauge operators, the combined parity of each pair of ancilla measurements is effectively the result of an operator measurement of a stabilizer. ", "Individually, each gauge operator measurement tells us nothing about the syndrome.", "\n\nSince the logical operators of the \\[\\[4,1,2\\]\\] code are pairwise products of single-qubit operators, the code distance is equal to two. ", "This means that it is only an error-detection code. ", "The syndrome of the code consists of a single bit in each basis. ", "A syndrome of zero indicates that no error was detected; one indicates that an error was detected but provides no information on which qubits were affected by the error. ", "When the syndrome is measured to be one, in the absence of any additional information, we must simply guess which data qubit was affected by the error. ", "Due to the gauge group of the code, each data qubit has a partner qubit in each basis for which errors are equivalent. ", "For example, an $X$ error on the first qubit is the same as an $X$ error on the second qubit up to the application of the $X_1 X_2$ gauge operator. ", "Such an error can, therefore, be corrected by the application of an $X$ operator on either the first or second qubit. ", "To simplify the analysis of errors, we refer to errors by which gauge operator that they are a part of, rather than by which data qubit they affect. ", "An $X$ error on the first or second qubit is said to be an error on the *first gauge* in the $X$ basis, a $Z$ error on the second or fourth qubit is said to be an error on the *second gauge* in the $Z$ basis, and so on. ", "When there is an error on one gauge and the syndrome is misinterpreted so that the correction operation is applied to the other gauge, the result is always a logical error.", "\n\nIn order to reliably correct errors using the \\[\\[4,1,2\\]\\] code, extra information is required to distinguish between errors affecting the first and second gauges. ", "One method for obtaining this information is to pass classical messages describing the relative probabilities of errors from lower levels of error correction to higher levels. ", "Previously, it was shown that a message passing scheme such as this could increase the minimum number of errors that cause failure to a number that scales according to the Fibonacci series with increasing levels of concatenation [@Knill1; @Aliferis2]. ", "In contrast, the scaling achieved by our method is given by $2^{l-1}$ where $l$ is the number of levels of error correction.", "\n\nIt is worth noting that we have chosen to use \\[\\[4,1,2\\]\\] code for several reasons. ", "Since it is a small code we can simulate more levels of error correction than if we had used a higher distance error-correction code. ", "As our method involves an analysis of combinations of errors that can occur at every circuit location, it is easier to understand and test the operation of the method on a code that requires only small circuits with relatively few locations. ", "Finally, a similar code forms the basis of the post-selection scheme of Knill, where ancillary states are prepared and verified before they are used to enact error correction by teleportation. ", "The advantages of this scheme include a high threshold and fast logical gates, though unfortunately these come at a high resource cost. ", "Our method might be used to improve the performance and overhead of the scheme.", "\n\nTechnique\n---------\n\nFor the \\[\\[4,1,2\\]\\] code, using the circuits we have chosen, there are five unique effects that can result from a single error. ", "Therefore there are five flags that we are required to track for each logical qubit at each level of error correction. ", "These flags are defined in Table I. Note that two of the flags are transitive. ", "The set of error locations belonging to each flag are shown in Fig.", " \\[fig: error map\\].", "\n\n Flag Effects\n ------- --------------------------------\n $AG1$ first gauge and ancilla\n $AG2$ second gauge and ancilla\n $A$ ancilla only\n $G1$ first gauge only (transitive)\n $G2$ second gauge only (transitive)\n\n : Names assigned to the flags of the \\[\\[4,1,2\\]\\] code. ", "There are five flags for each basis. *", "First gauge* refers to an error on either of the two qubits involved in the first gauge operator of the appropriate basis in Eq.", " \\[eq: gauge\\], similarly for *second gauge*. *", "Ancilla* refers to an error which flips the parity of the two gauge operator measurements $-$ that is, an error which changes the outcome of the syndrome measurement. ", "Flags $G1$ and $G2$ become $AG1$ and $AG2$ respectively at the end of the error-correction cycle as they will be seen on the ancilla of the following error-correction cycle.", "\n\n\\[tab: flags\\]\n\nIn our scheme the errors represented by the flag match with the lowest weight are identified as being the most likely cause of the observed syndrome. ", "Corrections are applied to any data qubits marked by the flag match. ", "For example, if the $X$ basis syndrome is one, and the weights of the $X$ flags are $AG1 = 4$, $AG2 = 0$, $A = 2$, then the flag match with the lowest weight is $AG2$ and so a correction should be applied to the second gauge $-$ that is, an $X$ correction should be applied to either qubit three or qubit four. ", "Table II shows a list of all possible flag matches along with the various confidence ratings that would result from each of them being acted on.", "\n\n Syndrome Flag match Correction $C_{G1}$ $C_{G2}$ $C_{L}$\n ---------- ------------- ----------------------- ---------- ---------- -----------\n None None $AG1+A$ $AG2+A$ $AG1+AG2$\n $AG1+A$ \n $AG2+A$ \n $AG1+AG2$ \n $AG1$ $G1$ $A-AG1$ $AG2+A$ $AG2-AG1$\n $AG2$ $G2$ $AG1+A$ $A-AG2$ $AG1-AG2$\n $A$ None $AG1-A$ $AG2-A$ $AG1+AG2$\n $AG1+AG2+A$ \\[tab: flag matches\\] \n\nSimulation and results\n----------------------\n\nOur simulations are of a ${\\textsc{cnot}}$ extended rectangle with concatenated error correction, including all physical locations. ", "The message-passing scheme is simulated along side the concatenated error correction circuit so that it operates in the same way as it would in a real quantum computer. ", "The logical ${\\textsc{cnot}}$ extended rectangle is defined to succeed only if both logical qubits would, after decoding, produce the correct measurement results in both the $X$ and $Z$ bases. ", "The simulations use the method outlined in [@Evans1], which involves keeping track of discrete Pauli errors as they propagate through a circuit. ", "We assume a stochastic error model, where memory, initialization, readout, single-qubit gate, and two-qubit gate errors are all equally likely to occur. ", "Errors are randomly selected one- and two-qubit discrete Pauli errors. ", "Our simulator uses the SIMD-oriented Mersenne Twister pseudo random number generator [@Saito1]. ", "We use the error-correction circuit shown in Fig.", " \\[fig: error map\\], which requires two ancilla qubits per logical qubit for a total block size of six qubits.", "\n\nWe are primarily interested in the logical failure rate when the physical error rate, $p$, is low. ", "Directly simulating the circuit in the low-$p$ limit requires too many runs to obtain statistically significant results. ", "Instead, we use the expansion of logical failure rate with respect to the physical error rate, $$p_{L} = \\sum^N_{i=0}{r_i {N\\choose i}p^i(1-p)^{N-i}},\n \\label{eq: error expansion}$$ where $N$ is the number of physical locations in the error-correction circuit, $p$ is the physical error rate, and $r_i$ is the probability of logical failure after error correction given exactly $i$ errors. ", "To estimate values of $r_i$ we simulate the circuit with exactly $i$ errors placed randomly, repeating many times for each $i$. We approximate $p_L$ by truncating the series above $i = 29$. This approximation breaks down for values of $p$ for which the probability of having more than 29 errors becomes significant.", "\n\nThe failure rate of the logical ${\\textsc{cnot}}$ as a function of physical error rate is plotted in Fig.", " \\[fig: results\\] for one, two, and three levels of error-correction. ", "In the low-$p$ region, the gradient of each line on the log-log plot signifies the minimum number of errors that are required for the circuit to fail: one, two, and four errors for one, two, and three levels of error correction respectively.", "\n\nFurther work\n============\n\nAs described, our scheme assumes that each physical location is equally likely to fail. ", "However, this need not be the case. ", "Relative probabilities of failure for individual physical locations are naturally represented in our scheme by the confidences at the physical level. ", "That is, rather than setting the confidence of all physical locations to one, we can choose to assign different confidence ratings to each type of operation or each individual physical device. ", "These confidence ratings could be based on data obtained by characterization of the gates. ", "Alternatively, data collected during error correction could be fed back to dynamically update physical confidence ratings in a similar way to how our method updates logical confidence ratings.", "\n\nOur message-passing method could be applied to a post-selection based scheme instead of the Fibonacci scheme. ", "There are several ways this could be done, since we are free to choose the confidence threshold which determines whether ancillary states are accepted or rejected. ", "To only accept states that have the maximum confidence would reduce the scheme to ordinary post-selection, as a state would be rejected if any errors are detected at any level regardless of whether or not these errors are correctable at higher levels. ", "Accepting all states that have a confidence greater than one would result in a high acceptance rate, but would not be optimal with respect to logical fidelity. ", "In any case, the confidence of the states that are accepted could be used in higher-level error correction following post selection. ", "There may also be some advantage to using the logical confidence ratings outputted by the highest level of error correction in some quantum algorithms.", "\n\nOur method can be applied to higher distance Bacon-Shor codes and perhaps even to other CSS stabilizer codes. ", "It would be interesting to investigate the pros and cons of using different codes with our method and also to rigorously establish the specific requirements on codes and circuits that enable us to achieve optimality with respect to the minimum number of errors that cause the code to fail.", "\n\n*Acknolwedgements:* We acknowledge financial support from the Australian Research Council, the US National Security Agency, and the Army Research Office under contract number W911NF-04-1-0290.", "\n\n[10]{}\n\nA. Kitaev. **", "303**, 2 (2003).", "\n\nC. Nayak, S. H. Simon, A. Stern, M. Freedman, S.  Das Sarma. ", "arXiv:0707.1889 (2007).", "\n\nR. Raussendorf, J. Harrington, and K. Goyal. **", "9**, 199 (2007).", "\n\nS. Bravyi and A. Kitaev. ", "arXiv:quant-ph/9811052 (1998).", "\n\nE. Dennis, A. Kitaev, A. Landahl, and J. Preskill. **", "43**, 4452 (2002).", "\n\nH. Bombin and M. A. Martin-Delgado. **", "97**, 180501 (2006).", "\n\nD. Bacon. **", "73**, 012340 (2006).", "\n\nD. Bacon and A. Casaccino. **", "44**, arXiv:quant-ph/0610088 (2006).", "\n\nA. M. Steane. **", "78**, 2252 (1997).", "\n\nM. A. Nielsen and I. L. Chuang, , Cambridge University Press (2000).", "\n\nP. Aliferis, D. Gottesman, and J. Preskill. **", "6**, 97 (2006).", "\n\nD. Poulin. **", "74**, 052333 (2006).", "\n\nZ. W. E. Evans and A. M. Stephens. **", "78**, 062317 (2008).", "\n\nE. Knill. **", "434**, 39 (2005).", "\n\nP. Aliferis and J. Preskill. **", "79**, 012332 (2009).", "\n\nP. Aliferis and A. W. Cross. **", "98**, 220502 (2007).", "\n\nM. Saito and M. Matsumoto. **", "2**, 607 (2006).", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0006368864560499787, 0.0006348048336803913, 0.0006822840659879148, 0.0007253906805999577, 0.0006125945947133005, 0.0006148758693598211, 0.000771448714658618, 0.0007349450024776161, 0.0006939016166143119, 0.0007083200616762042, 0.0008633926627226174, 0.0005957896937616169, 0.0006275695050135255, 0.0006175834569148719, 0.0006105556385591626, 0.0007272855145856738, 0.0014641155721619725, 0.001489476184360683, 0.0005974259111098945, 0.0005879860837012529, 0.0007709177443757653, 0.0006558182067237794, 0.0006746185827068985, 0.0005650941748172045, 0.0006287507712841034, 0.0007170751341618598, 0.0006378243560902774, 0.0008469888707622886, 0.0005587583873420954, 0.0006809994229115546, 0.0006039344589225948, 0.0006522518233396113, 0.0005738769541494548, 0.0006817259709350765, 0.0007694344385527074, 0.0005610609659925103, 0.0006797375390306115, 0.0008536464883945882, 0.0007476648315787315, 0.0006240077782422304, 0.0009468185598962009, 0.0006724678678438067, 0.0006222584052011371, 0.0005390745936892927, 0.0005699220346286893, 0.0005922175478190184, 0.0006552606355398893, 0.00115414266474545, 0.0012644327944144607, 0.0006712726899422705, 0.0006752772023901343, 0.0007701768772676587, 0.0006009844364598393, 0.0008919970132410526, 0.0007345255580730736, 0.0009769994067028165, 0.0007564068655483425, 0.0006874012760818005, 0.0006291563040576875, 0.0006089502712711692, 0.0007771393284201622, 0.0009291149326600134, 0.0012918905122205615, 0.0006415940006263554, 0.0006508739315904677, 0.0007835350697860122, 0.0006605847156606615, 0.0007193029741756618, 0.0007980463560670614, 0.0008524907170794904, 0.0007215998484753072, 0.0009637906914576888, 0.0007384661585092545, 0.0006163765210658312, 0.0006901246961206198, 0.003953285049647093, 0.00192309042904526, 0.005920771509408951, 0.004668540321290493, 0.010075104422867298, 0.001020522671751678, 0.0007640393450856209, 0.00419526407495141, 0.0007969964644871652, 0.0007128891302272677, 0.000639128964394331, 0.0006024118629284203, 0.0007070474093779922, 0.0010477008763700724, 0.060688167810440063, 0.0007624693098478019, 0.0006089502712711692, 0.0005989338969811797, 0.0006181119242683053, 0.0013758208369836211, 0.0017174908425658941, 0.0006112873088568449, 0.0010133199393749237, 0.0010858291061595082, 0.0009713882463984191, 0.0009703559335321188, 0.0005520193953998387, 0.0006484232726506889, 0.000579465355258435, 0.0007074899622239172, 0.0005936583620496094, 0.0008115295204333961, 0.0007351313252002001, 0.000738555914722383, 0.000950222893152386, 0.0006646483670920134, 0.0007595942006446421, 0.0010321754962205887, 0.0010719539131969213, 0.0006602127104997635, 0.001568433130159974, 0.0007662639836780727, 0.0007335431291721761, 0.0006048840587027371, 0.0007178470259532332, 0.0006894496036693454, 0.0006348895258270204, 0.0006554676801897585, 0.0006022987072356045, 0.0006333559867925942, 0.0006575702573172748, 0.0005373309249989688, 0.0007444556104019284, 0.0006342158303596079, 0.0006034403922967613, 0.000579098763410002, 0.0008150377543643117, 0.001257159048691392, 0.0006359008839353919, 0.0007449309923686087, 0.0007270682253874838, 0.000903874693904072, 0.0016728529008105397, 0.0007995436317287385, 0.000713552872184664, 0.0008853765903040767, 0.0005680537433363497, 0.010167679749429226, 0.0007098276983015239, 0.0007857763557694852, 0.0005979796405881643, 0.0008410479640588164, 0.002992258407175541, 0.0008183249738067389, 0.0007153111509978771, 0.001247292966581881, 0.0006184640224091709, 0.000871094933245331, 0.0031901318579912186, 0.0009243490640074015, 0.0008757839677855372, 0.0006803529686294496, 0.0007900865166448057, 0.0008374847820959985, 0.0006745150894857943, 0.0006154753500595689, 0.0005471529439091682, 0.000559501291718334, 0.0005854939226992428, 0.0006967451190575957, 0.0005437300424091518, 0.0006014835671521723, 0.0005479305982589722, 0.0005529496702365577, 0.0006018580170348287, 0.0006007130141369998, 0.0005658611189574003, 0.0005968914483673871, 0.0009060705197043717, 0.0007034080917946994, 0.0008133084629662335, 0.0006505421479232609, 0.0009261169470846653, 0.0007709386409260333, 0.0007749895448796451, 0.0006493794498965144, 0.0008196450071409345, 0.0007282037404365838, 0.0007292371592484415, 0.0007328478968702257, 0.0013559553772211075, 0.0007878858596086502, 0.0008625917253084481, 0.0006635240279138088, 0.001029884908348322, 0.0007876516319811344, 0.0006607631803490222, 0.0007929904968477786, 0.0007415235741063952, 0.0011950288899242878, 0.000805154035333544, 0.0008635338163003325, 0.0008043430862016976, 0.0013049602275714278, 0.0007577534415759146, 0.000796942098531872, 0.0007717828848399222, 0.0008031302713789046, 0.0008189466316252947, 0.0008029087330214679, 0.0007374176639132202, 0.0019954426679760218 ]

[ "All relevant data are within the paper and its Supporting Information files.", "\n\n1. ", "Introduction {#sec005}\n===============\n\nSarcoidosis is a multisystem disease of unknown origin, characterized by non-caseating granulomas, which can affect almost any organ system. ", "The diagnosis of sarcoidosis is based on clinical and radiographic manifestations and histopathologic detection of non-caseating granulomas in the affected organ, after exclusion of other diseases that may present similarly. ", "\\[[@pone.0223897.ref001]\\] Diagnostic tests that can contribute to the diagnosis of sarcoidosis include serum angiotensin-converting enzyme (ACE), conventional chest radiograph, high-resolution chest computed tomography (CT), broncho-alveolar lavage and fluorodeoxyglucose-positron emission tomography (FDG-PET).\\[[@pone.0223897.ref002]\\] Undetected sarcoidosis can lead to substantial morbidity. ", "\\[[@pone.0223897.ref003], [@pone.0223897.ref004]\\]Although ACE is one of the most used diagnostic biomarkers for sarcoidosis, it lacks sensitivity. ", "\\[[@pone.0223897.ref005]\\] High sensitivity is needed when a test is used in the initial diagnostic workup, especially when this test is used to rule out the disease.", "\n\nOne of the main immunologic features of sarcoidosis is the influx of CD4^+^ T-helper (Th)1 cells at sites of active disease. ", "\\[[@pone.0223897.ref006]\\] Th 1 cells secrete interleukin (IL) 2, which promotes T-cell proliferation and survival. ", "\\[[@pone.0223897.ref007]\\] IL-2 acts via the IL-2 receptor, which consists of the common γ chain (CD132), a β chain (CD122) and an α chain (CD25). ", "CD25 is overexpressed by activated T-cells and regulatory T-cells and can be secreted from the cell membrane in a soluble form; also referred to as soluble IL-2R (sIL-2R.) Hence, sIL-2R is a surrogate marker for T-cell activation. ", "Peripheral blood sIL-2R levels thus reflect the level of T cell activation in an individual and elevated blood sIL-2R levels correlate with disease activity, for instance in patients with rheumatoid arthritis, systemic lupus erythematosus or IgG4-related disease, but also in sarcoidosis patients. ", "\\[[@pone.0223897.ref008]--[@pone.0223897.ref012]\\]\n\nThere are various theories on the biological action of sIL-2R in the immunopathology of inflammatory diseases. ", "One of the proposed mechanisms of action is that sIL-2R competes with activated T-cells for available IL-2 and thereby inhibits T-cell proliferation. ", "\\[[@pone.0223897.ref013], [@pone.0223897.ref014]\\] Another proposed function is that sIL-2R binds IL-2, thereby prolonging IL-2 half-life, which enhances its immune-stimulatory effects. ", "\\[[@pone.0223897.ref015], [@pone.0223897.ref016]\\] On the other hand, it has been proposed that IL-2 can be presented to CD4+ T-cells via the sIL-2R-IL-2 complex, thereby upregulating FOXP3 expression and differentiation into T regulatory cells that subsequently control immune activity. ", "\\[[@pone.0223897.ref017]\\]\n\nUp to now, it is unclear whether sIL-2R is produced to combat the sarcoidosis-associated immune activation or whether it has an active role in the pathogenesis of sarcoidosis. ", "It is clear, however, that there is a correlation between sIL-2R and sarcoidosis. ", "Earlier research showed a correlation between sIL-2R and disease activity, the extent of disease and response to treatment. ", "\\[[@pone.0223897.ref011], [@pone.0223897.ref018]--[@pone.0223897.ref023]\\] In two studies which specifically examined patients with ocular sarcoidosis, serum sIL2-R has been proposed as a diagnostic biomarker. ", "\\[[@pone.0223897.ref024], [@pone.0223897.ref025]\\] Another study, conducted in patients with sarcoid skin lesions demonstrated a correlation between serum sIL-2R levels and the number of involved organs. ", "\\[[@pone.0223897.ref026]\\] However, no study has evaluated whether the measurement of serum sIL-2R can be useful in diagnosing systemic sarcoidosis in symptomatic patients, whose diagnosis is still uncertain. ", "Thus it remains unknown, whether serum sIL-2R, apart from being a biomarker for disease activity, can be used as a diagnostic tool for sarcoidosis in clinical practice. ", "We hypothesized that serum sIL-2R is a sensitive and specific diagnostic biomarker that can differentiate between sarcoidosis and non-sarcoidosis patients in a cohort of patients suspected of sarcoidosis.", "\n\nTo test this, we conducted a cohort study consisting of new patients in whom sarcoidosis was suspected, but not yet proven or disproven and whose sIL-2R levels were measured before a diagnosis of sarcoidosis or another disease was established. ", "In this cohort, after diagnostic workup and after a definitive diagnosis (sarcoidosis or another disease) was established, we calculated the sensitivity and specificity of sIL-2R in the diagnosis of sarcoidosis and defined the optimal cut-off value and compared this to serum ACE levels.", "\n\n2. ", "Material and methods {#sec006}\n=======================\n\n2.1 Study population {#sec007}\n--------------------\n\nIn this study, we included patients visiting the immunology outpatient clinic, in which sarcoidosis, among other diseases, was a part of the differential diagnosis and of whom serum sIL-2R levels were measured before the definitive diagnosis of sarcoidosis or another disease was established. ", "Sarcoidosis was suspected when a patient was referred to the Immunology department with one or more of these symptoms: 1) lung complaints, i.e. shortness of breath, persistent dry cough or chest pains; 2) uveitis or inflammation of the lacrimal glands; 3) skin disorders, i.e. erythema nodosum, lupus pernio, infiltration of scars or tattoo; 4) neurological complaints, i.e. hearing loss, facial nerve palsy or epilepsy; 5) polyarthritis; 6) incidental finding of lymphadenopathy on imaging.", "\n\nMedical records of patients, whose serum sIL-2R level was assessed at the Erasmus MC between February 2011 and February 2016, were screened for potential inclusion in our study. ", "The following inclusion criteria were applied: availability of medical records, sarcoidosis as part of the differential diagnosis, availability of serum sIL-2R value before a definitive diagnosis was established and a finished diagnostic workup at the immunology outpatient department ([Fig 1](#pone.0223897.g001){ref-type=\"fig\"}). ", "Exclusion criteria were: an established diagnosis of sarcoidosis before serum sIL-2R measurement and immunosuppressive medication within the two weeks prior to sIL-2R measurement or use of ACE inhibitors one month prior to ACE measurement. ", "Patients who received immunosuppressive medication were excluded, because immunosuppressive medication can reduce sIL-2R levels. ", "\\[[@pone.0223897.ref011], [@pone.0223897.ref027]\\] The diagnosis of sarcoidosis relies on consistent clinical and radiological features and histological demonstration of non-caseating granulomas in the affected organ(s), according to the American Thoracic Society/European Respiratory Society/World Association of Sarcoidosis and other Granulomatous Disorders (ATS/ERS/WASOG) guidelines. ", "\\[[@pone.0223897.ref028]\\] In our Sarcoidosis Expertise Centre, sarcoidosis is diagnosed according to these criteria and the diagnosis is verified by at least one pulmonary specialist and at least one clinical immunologist. ", "Patients without histological confirmation of sarcoidosis were, in addition to the evaluation by a pulmonary specialist and a clinical immunologist, evaluated by a, for sIL-2R and ACE blinded, pulmonary specialist who assessed clinical information, radiologic and nuclear imaging. ", "When categorized as sarcoidosis or very probable sarcoidosis the patient was included in the group of patients with a definitive diagnosis of sarcoidosis. ", "Otherwise, the patient was included as a non-sarcoidosis patient.", "\n\n{#pone.0223897.g001}\n\nThe ACE measurement of the date closest to the date of the first sIL-2R measurement was used. ", "If the ACE measurement was performed more than one month prior to or more than one month after sIL-2R measurement, serum ACE was regarded as not available.", "\n\nDemographic data and anatomical localization of sarcoidosis disease activity were recorded. ", "Four anatomical localizations of sarcoidosis activity were distinguished in this study: sarcoidosis with predominantly lung, ocular, neurological or skin involvement. ", "Multiple organ involvement could be present within one patient. ", "Additionally, when sarcoidosis was an incidental finding on radiographic imaging, performed for other reasons, with no organ-related symptoms, none of these categories was chosen. ", "Data on chest radiograph, chest CT and FDG-PET scan were collected. ", "Chest radiographs were scored using the Scadding scale. ", "\\[[@pone.0223897.ref029]\\]\n\nThe serum sIL-2R levels of 101 anonymous blood bank donors were used as healthy controls.", "\n\nStrengthening the reporting of observational studies in epidemiology guidelines were used to structure the reporting of this observational study.\\[[@pone.0223897.ref030]\\] The use of laboratory investigation to gather non-identifiable data in this observational study adheres to the tenets of the Declaration of Helsinki. ", "The medical ethical committee of Erasmus University Medical Center approved the protocol and the associated procedures.", "\n\n2.2 Analysis of serum parameters {#sec008}\n--------------------------------\n\nSerum sIL-2R measurements were performed (ELISA; Diaclone, Besancon Cedex, France) at the laboratory medical immunology at Erasmus MC. ", "A serum sIL-2R value \\<2500 pg/mL is considered as not elevated within the Erasmus MC, which is based on values sIL-2R levels measured in 101 healthy blood donors. ", "Serum ACE levels were determined by kinetic assay (Bühlmann Laboratories, Switzerland), with reference range ≤68 U/mL.\n\n2.3 Sample size calculation {#sec009}\n---------------------------\n\nHypothetical confidence intervals were calculated using Buderer's formula. ", "Reaching a confidence interval of approximately 5% on either side, with a power of 80%, would require 200 patients Therefore, we strived to include 200 patients.", "\n\n2.4 Statistical analysis {#sec010}\n------------------------\n\nThe characteristics of patients with and without the definitive diagnosis of sarcoidosis were summarized using descriptive statistics, such as medians and percentages. ", "Non-parametric tests were used to compare characteristics between the groups. ", "We calculated the specificity, sensitivity and the Youden's index, as well as the concordance statistic (C-statistic), which can be calculated from the receiver operating characteristic (ROC) curve for all patients. ", "Additionally, we calculated the sensitivity, specificity, Youden's index and C-statistic for the subgroup of biopsy-confirmed sarcoidosis patients.", "\n\nSensitivity and specificity can be used to calculate the Youden's index. ", "The Youden's index reflects the performance of a dichotomous diagnostic test.", "\n\nThe ROC curve is designed to visualize and detect the optimal performance of a binary test with a varied cut-off point. ", "The optimal cut-off for sIL-2R was calculated by maximizing sensitivity and specificity, using the values generated by a ROC curve. ", "Kruskal-Wallis one-way analysis of variance of the data on the localization of sarcoidosis and the levels of sIL-2R was performed.", "\n\nThe statistical analyses were all done using Excel, IBM SPSS statistics 21.0.0 for Windows (SPSS inc., ", "Chicago, IL, USA), and R, using the package pROC. ", "\\[[@pone.0223897.ref031]\\]\n\n3. ", "Results {#sec011}\n==========\n\n3.1 Patient characteristics {#sec012}\n---------------------------\n\nOf the 983 screened patients 189 were included and 794 were excluded ([Fig 1](#pone.0223897.g001){ref-type=\"fig\"}). ", "The exclusion was due to unavailable medical records (n = 446), sarcoidosis not in the differential diagnosis (thus not being suspected of sarcoidosis at all: n = 75), or undocumented differential diagnosis (n = 26). ", "Patients were also excluded when the diagnosis was established prior to serum sIL-2R measurement (n = 218) or when the diagnostic workup was not finished or finished elsewhere (n = 7). ", "Furthermore, 22 patients were excluded due to medication use: some patients due to immunosuppressive medication use prior to serum sIL-2R measurement (n = 14), others due to ACE inhibitor use prior to serum ACE measurement (n = 8). ", "Of the 189 included patients, 101 patients were finally diagnosed with sarcoidosis, of which 79 were biopsy-confirmed sarcoidosis patients and another 22 patients without positive biopsy were classified as very probable sarcoidosis by the blinded reviewer. ", "In 88 patients, sarcoidosis was excluded and another disease was diagnosed, including Sjögren's syndrome, tuberculosis, multiple sclerosis or rheumatoid arthritis. ", "A comprehensive list of all the diagnoses is provided in the footnotes of [Table 1](#pone.0223897.t001){ref-type=\"table\"}. ", "ACE levels were available in 120 patients.", "\n\n10.1371/journal.pone.0223897.t001\n\n###### Patient characteristics.", "\n\n![](", "pone.0223897.t001){#pone.0223897.t001g}\n\n -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n Definitive sarcoidosis\\ Definitive diagnosis other than sarcoidosis[^b^](#t001fn002){ref-type=\"table-fn\"}\\\n (n = 101) (n = 88)\n ---------------------------------------------------------------------------- ------------------------- ------------------------------------------------------------------------------------\n Sex, female (% female) 51 (50%) 52 (59%)\n\n Median age at diagnosis, years (IQR[^a^](#t001fn001){ref-type=\"table-fn\"}) 43 (35--52) 44 (31--57)\n\n Positive biopsy (n) 79 0\n\n Angiotensin-converting enzyme \n\n  median 77 51\n\n  IQR [^a^](#t001fn001){ref-type=\"table-fn\"} 44--109 31--69\n\n Soluble interleukin 2 receptor \n\n  median 6100 2600\n\n  IQR [^a^](#t001fn001){ref-type=\"table-fn\"} 4500--9850 1925--3300\n -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\n^a^ IQR: interquartile range\n\n^b^ Including uveitis of unknown origin (n = 19), Nonspecific interstitial pneumonia (n = 3), Systemic lupus erythematosus (n = 3), Asthma (n = 2), Chronic obstructive pulmonary disease (n = 2), Fatigue of unknown origin (n = 2), Fibromyalgia (n = 3), Multiple sclerosis (n = 2), Neuromyelitis optica (n = 2), Ocular vasculitis (n = 2), Rheumatoid arthritis (n = 2), Tuberculosis (n = 2), Sjögren's syndrome (n = 2), Sudden deafness of unknown origin (n = 2), Alopecia (n = 1), Arthritis psoriatica (n = 2), Atypical parkinsonism (n = 1), Auto-immune encephalitis (n = 1), Cervical myelopathy (n = 1), Chronic cough due to reflux (n = 1), Dacryops (n = 1), Epstein Barr viral infection (n = 1), Erythema nodosum (n = 1), Exertional dyspnea (n = 1), Extrinsic allergic alveolitis (n = 1), Folliculitis (n = 1), Guillain-Barre syndrome (n = 1), Herpes simplex related apthosis (n = 1), Human immunodeficiency virus (n = 1), Hyper IgE syndrome (n = 1), Hypophysitis (n = 1), Idiopathic pulmonary fibrosis (n = 1), Increased intracranial pressure (n = 1), Klebsiella pneumoniae infection (n = 1), Langerhans cell histiocytosis (n = 1), Lipoma (n = 1), Neuroendocrine tumor (n = 1), Macular retinopathy (n = 1), Nontuberculous Mycobacterium infection (n = 1), Osteoarthritis (n = 1), Presumed ocular histoplasmosis (n = 1), Rosacea (n = 2), Schwannoma (n = 1), Scleritis (n = 1), Small fiber neuropathy (n = 1), Stills disease (n = 1), Systemic vasculitis (n = 1), Toxoplasmosis (n = 1), Ulcerative colitis (n = 1), Urticaria (n = 1), Vitreomacular traction syndrome (n = 1), Vocal cord paralysis (n = 1)\n\nDemographic characteristics did not differ between the sarcoidosis and non-sarcoidosis groups ([Table 1](#pone.0223897.t001){ref-type=\"table\"}).", "\n\nSerum sIL-2R levels are depicted in [Fig 2](#pone.0223897.g002){ref-type=\"fig\"} and presented in [Table 1](#pone.0223897.t001){ref-type=\"table\"}. ", "The median serum sIL-2R level in patients with a definitive diagnosis of sarcoidosis (n = 101) was 6100 pg/mL, 2600 pg/mL in patients with a definitive diagnosis of another disease(n = 88) and 1515 pg/mL in healthy controls (n = 101, healthy blood bank donors). ", "The sIL-2R levels were significantly higher in patients with a definitive diagnosis of sarcoidosis compared to patients with diseases other than sarcoidosis (P \\< 0.001). ", "In patients with a definitive diagnosis of granulomatous diseases, lung diseases, uveitis, infectious diseases or other diseases, sIL-2R levels were higher than healthy controls (P \\< 0.001) but lower than sarcoidosis patients (P \\< 0.001).", "\n\n{#pone.0223897.g002}\n\nOf all definitive sarcoidosis patients, 65% had a positive chest radiograph, while 99% had a positive CT-scan. ", "Of all sarcoidosis patients who underwent a PET-CT scan, 91% had a positive PET-CT scan. ", "Thirty-five percent of sarcoidosis patients presented with sarcoidosis stage 0 on chest radiograph, while 28% showed stage I, 25% stage II, 10% stage III and only 2% showed stage IV fibrosis on the chest radiograph.", "\n\n3.2 Sensitivity, specificity, Youden's index, and C-statistic {#sec013}\n-------------------------------------------------------------\n\nThe sensitivity of sIL-2R was superior to ACE ([Table 2](#pone.0223897.t002){ref-type=\"table\"}) in the diagnosis of sarcoidosis. ", "The Youden's index performed better for sIL-2R than for ACE (0.73 *versus* 0.38, respectively). ", "The ROC curve ([Fig 3](#pone.0223897.g003){ref-type=\"fig\"}) depicts the performance of both sIL-2R and ACE. ", "The C-statistic, a measure of test performance which can be calculated from this curve, is significantly better for sIL-2R (C-statistic = 0,91, with 95% CI 0,87--0,96) *versus* ACE (C-statistic = 0,68 with 95% CI 0.58--0.78) (P \\< 0.001).", "\n\n10.1371/journal.pone.0223897.t002\n\n###### Sensitivity, specificity, Youden's index and concordance statistic in the diagnosis of sarcoidosis.", "\n\n![](", "pone.0223897.t002){#pone.0223897.t002g}\n\n ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n Sensitivity (95% CI[^a^](#t002fn001){ref-type=\"table-fn\"}) Specificity\\ Youden's\\ Concordance statistic[^c^](#t002fn003){ref-type=\"table-fn\"} (95% CI[^a^](#t002fn001){ref-type=\"table-fn\"})\n (95% CI[^a^](#t002fn001){ref-type=\"table-fn\"}) Index[^b^](#t002fn002){ref-type=\"table-fn\"} \n --------------------------------------------------------- ------------------------------------------------------------ ------------------------------------------------ --------------------------------------------- ------------------------------------------------------------------------------------------------------------\n sIL-2R, cutoff 2500 pg/mL 99% (95--100) 47% (36--57) 0.45 0.91 (0.87--0.96)\n\n sIL-2R, cutoff 3550 pg/mL 88% (82--94) 85% (78--93) 0.73 0.91 (0.87--0.96)\n\n ACE, cutoff 68 U/mL 62% (51--73) 76% (64--88) 0.38 0.68 (0.58--0.78)\n\n sIL-2R, cutoff 3550 pg/mL, biopsy-confirmed sarcoidosis 87% (80--95) 85% (78--93) 0.73 0.93 (0.87--0.98)\n\n ACE, cutoff 68 U/mL, biopsy-confirmed sarcoidosis 60% (48--72) 76% (64--88) 0.36 0.68 (0.50--0.79)\n ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\n^a^ CI: confidence interval\n\n^b^ Interpretation Youden's index: A higher Youden's index is more favorable.", "\n\n^c^ Interpretation concordance statistic: A higher concordance statistic is more favorable.", "\n\n{#pone.0223897.g003}\n\nThe area under the curve (AUC) is a measure of test performance. ", "A larger area under the curve indicates a better test performance.", "\n\nWhen calculating the sensitivity and specificity of serum sIL-2R in a subgroup of patients, consisting of patients with a definitive diagnosis of biopsy-confirmed sarcoidosis (n = 79) and patients with a definitive diagnosis other than sarcoidosis (n = 88), the associated sensitivity and specificity of sIL-2R and ACE similar to the sensitivity and specificity for the whole study group ([Table 2](#pone.0223897.t002){ref-type=\"table\"}). ", "In this subgroup, the C-statistic remained significantly better for sIL-2R *versus* ACE (P = 0.003).", "\n\n3.3 Correlation of sIL-2R with diagnostic parameters {#sec014}\n----------------------------------------------------\n\nThere is a significant, but rather weak correlation between sIL-2R and chest radiograph stage (Spearman's rho 0,24; P = 0.021). ", "Median sIL-2R levels were lower in patients without parenchymal involvement (stages 0 and I) as compared to patients with parenchymal involvement (stages II, III and IV). ([", "Table 3](#pone.0223897.t003){ref-type=\"table\"}).", "\n\n10.1371/journal.pone.0223897.t003\n\n###### Diagnostic parameters in sarcoidosis patients.", "\n\n![](", "pone.0223897.t003){#pone.0223897.t003g}\n\n -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n Number of patients Median sIL-2R levels (IQR[^b^](#t003fn002){ref-type=\"table-fn\"}) in pg/mL\n -------------------------------------------------------- ------------------------------------------------- -------------------- ---------------------------------------------------------------------------\n Chest radiograph[^a^](#t003fn001){ref-type=\"table-fn\"} Stage 0\\ 31 *5500 (3700--7700)*\n *normal chest radiograph* \n\n Stage 1\\ 27 *6300 (4854--9100)*\n *hilar or mediastinal nodal enlargement* \n\n Stage 2\\ 19 *10800 (5300--19368)*\n *nodal enlargement and parenchymal disease* \n\n Stage 3\\ 8 *5947 (3700--8625)*\n *parenchymal disease without nodal enlargement* \n\n Stage 4\\ 5 *8487 (5620--15932)*\n *pulmonary fibrosis* \n\n Chest CT-scan Negative\\ 2 *3100; 3700*\n *no sarcoidosis-associated findings* \n\n Positive\\ 74 *6564 (4841--10800)*\n *Sarcoidosis-associated findings* \n\n FDG-PET-scan Negative\\ 2 *3600*, *4600*\n *No sarcoidosis-associated findings* \n\n Positive\\ 24 *5700 (4075--7900)*\n *Sarcoidosis-associated findings* \n -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\n^a^ Chest radiograph staging: stage 2 is both nodal enlargement and parenchymal disease, while stage 3 is parenchymal disease without nodal enlargement. ", "Therefore, stage 2 is widely regarded as more severe than stage 3.", "\n\n^b^ IQR: interquartile range\n\nOnly two patients with a definitive diagnosis of sarcoidosis had no sarcoidosis-associated signs on CT-scan. ", "Therefore, a correlation between CT positive and negative patients was not performed. ", "However, the two patients with a negative CT-scan, displayed markedly lower serum sIL-2R levels (3100 pg/mL and 3700 pg/mL), in comparison to the interquartile range of patients with a positive CT-scan (5700--7900 pg/mL). ", "Although the sIL-2R value of the two FDG-PET negative sarcoidosis patients was lower (3600 pg/mL and 4600 pg/mL) than the median sIL-2R value of the FDG-PET positive sarcoidosis patients (5700 pg m/L), the values were near or within the interquartile range observed of the FDG-PET positive patients (4075--7900).", "\n\n3.4 Determining the optimal cutoff of serum sIL-2R to facilitate the diagnosis of sarcoidosis {#sec015}\n---------------------------------------------------------------------------------------------\n\nThe current cut-off used in our hospital to indicate an elevated serum sIL-2R level in an individual is 2500 pg/mL and as such was not chosen to facilitate the diagnosis of a certain disease. ", "This is clearly reflected by the unbalanced specificity sensitivity pattern for sarcoidosis when this sIL-2R cut-off was applied ([Table 2](#pone.0223897.t002){ref-type=\"table\"}). ", "ROC analysis indicated that a serum sIL-2R value of 3550 pg/ml represents the optimal cut-off for diagnosing sarcoidosis with 88% sensitivity and 85% specificity and a Youden's Index of 0.73, which is considered good.", "\n\nApplying this optimal cut-off to the biopsy-confirmed subgroup resulted in similar sensitivity and specificity and a Youden's index of 0.73. ", "In order to make a fair comparison, we also calculated the optimal cut-off point for ACE, using the ROC curve. ", "The optimal cut-off point for ACE was 68.75, which equals its current cut-off point.", "\n\n3.5 Serum sIL-2R levels in sarcoidosis subgroups {#sec016}\n------------------------------------------------\n\nA trend for a higher median sIL-2R level was observed in case of nervous system involvement, however, this was not statistically significant ([Table 4](#pone.0223897.t004){ref-type=\"table\"}).", "\n\n10.1371/journal.pone.0223897.t004\n\n###### Soluble interleukin 2 receptor levels.", "\n\n![](", "pone.0223897.t004){#pone.0223897.t004g}\n\n Group Number of persons Median sIL-2R level (pg/mL) IQR[^a^](#t004fn001){ref-type=\"table-fn\"}\n ------------------------------------------------------------------ ------------------- ----------------------------- -------------------------------------------\n **Healthy controls** **101** **1515** **1150--1880**\n **Sarcoidosis** **101** **6100** **4500--9850**\n *Nervous system* *6* *16851* *5027--11020*\n *Ocular* *40* *6150* *4866--7900*\n *Skin* *16* *6050* *4975--8750*\n *Lung* *48* *7300* *4739--11175*\n **Granulomatous diseases**[^b^](#t004fn002){ref-type=\"table-fn\"} **9** **3300** **3000--3550**\n **Lung diseases**[^c^](#t004fn003){ref-type=\"table-fn\"} **11** **3000** **2400--4700**\n **Infectious diseases**[^d^](#t004fn004){ref-type=\"table-fn\"} **7** **2300** **1900--3200**\n **Uveitis** **19** **2300** **1900--3200**\n\n^a^ IQR: interquartile range\n\n^b^ Including Rheumatoid arthritis (n = 2), Tuberculosis (n = 2), Erythema nodosum (n = 1), Extrinsic allergic alveolitis (n = 1), Langerhans cell histiocytosis (n = 1), Systemic vasculitis (n = 1), Toxoplasmosis (n = 1)\n\n^c^ Including Nonspecific interstitial pneumonia (n = 3), Asthma (n = 2), Chronic obstructive pulmonary disease (n = 2), Tuberculosis (n = 2), Extrinsic allergic alveolitis (n = 1), Idiopathic pulmonary fibrosis (n = 1)\n\n^d^ Including Epstein Barr viral infection (n = 1), Herpes simplex related apthosis (n = 1), Human immunodeficiency virus (n = 1), Klebsiella pneumoniae infection (n = 1), Nontuberculous Mycobacterium infection (n = 1), Presumed ocular histoplasmosis (n = 1), Toxoplasmosis (n = 1)\n\n4. ", "Discussion {#sec017}\n=============\n\nIn this study we demonstrated that serum sIL-2R has high and superior sensitivity and specificity compared to ACE for diagnosing sarcoidosis in a group of patients, presenting with symptoms, which raised a suspicion of sarcoidosis as well as other diseases. ", "In patients with a definitive diagnosis of sarcoidosis, sIL-2R is significantly elevated compared to patients with a definitive diagnosis of another disease. ", "Thus, in a group of patients who have not yet received a definitive diagnosis, but are suspected of sarcoidosis, serum sIL-2R is able to discriminate between patients with and without sarcoidosis.", "\n\nSarcoidosis is a heterogeneous systemic disease and notoriously difficult to diagnose. ", "Evaluation often requires extensive diagnostic testing and invasive tests, such as histological sampling of the affected tissue. ", "\\[[@pone.0223897.ref002], [@pone.0223897.ref032]\\] The ACE, which is widely used as a diagnostic biomarker for sarcoidosis, has a low sensitivity, ranging from 22--80% that hampers its use in a diagnostic setting. ", "\\[[@pone.0223897.ref005], [@pone.0223897.ref024], [@pone.0223897.ref033], [@pone.0223897.ref034]\\]The sensitivity of 60% observed for ACE in the current study is within this range. ", "Our study, using robust and frequently used statistical methods such as the C-statistic and Youden's index, demonstrates that serum sIL-2R is more sensitive and equally specific as ACE in diagnosis in patients suspected of sarcoidosis. ", "\\[[@pone.0223897.ref035]--[@pone.0223897.ref039]\\] The demonstrated superiority of serum sIL-2R over ACE as a diagnostic tool for sarcoidosis underlines its use as a valuable clinical instrument in the workup of patients suspected for sarcoidosis and might have consequences for subsequent and potential unnecessary (radiological or invasive) evaluation. ", "\\[[@pone.0223897.ref040]\\]\n\nWe also observed a significant correlation between serum sIL-2R levels and chest radiograph stage. ", "However, this correlation was rather weak (spearman's' rho 0.24) and might therefore not be clinically relevant. ", "Sarcoidosis stage III chest radiograph represents less severe disease (parenchymal involvement without nodal enlargement) compared to sarcoidosis stage II chest radiograph (parenchymal involvement in addition to nodal enlargement) and was also associated with lower levels of serum sIL-2R than radiographic stage II sarcoidosis. ", "Stage IV disease, which is characterized by pulmonary fibrosis, showed high levels serum of sIL-2R. However, these levels were lower than serum sIL-2R levels found in patients with stage II disease, which is associated with nodal and parenchymal involvement. ", "However, stage IV disease might not necessarily have correlated with disease activity at the time of assessment. ", "Since lung fibrosis is irreversible, stage IV disease can still be visible on chest radiograph, while sarcoidosis is biochemically and clinically less active. ", "This might explain why the highest values of sIL-2R were not found in stage IV disease, but rather in stage II.", "\n\nIn the tertiary hospital where this study took place, ACE is less expensive than sIL-2R. **(**€10,00 versus €53,57). ", "However, since sIL-2R is very sensitive, one could speculate that other diagnostic tests, such as CT or FDG-PET might not be necessary for patients with low sIL-2R values. ", "The associated costs **(**€250,00 and €800,00 respectively) could perhaps be avoided. ", "We measured sIL-2R with ELISA, a relatively rapid (5--6 hours) method that requires standard laboratory equipment and can thus easily be implemented in most clinical laboratories. ", "Alternatively, fully automated techniques are also available. ", "\\[[@pone.0223897.ref024]\\] A detailed evaluation of the cost-effectiveness of diagnostic tests used in the diagnostic workup of sarcoidosis is beyond the scope of this study. ", "Yet whether parameters, such as ACE and FDG-PET screening, are rendered redundant by sIL-2R assessment needs evaluation in a cost-effectiveness study\n\nWe demonstrate that the probability of having sarcoidosis with a serum sIL-2R level of \\< 3550 pg/mL is low. ", "This optimal cut-off value of 3550 pg/mL results in a good test performance, both for sensitivity and specificity when used as a diagnostic biomarker for sarcoidosis. ", "\\[[@pone.0223897.ref041]\\]\n\nAlthough underpowered and not designed for subgroup analysis, variations in serum sIL-2R levels between subgroups based on anatomical localization of sarcoidosis disease activity were observed. ", "This was most evident for patients with neurological involvement, who displayed the highest sIL-2R levels. ", "Whether these high serum sIL-2R levels in neurosarcoidosis reflects the total burden of T-cell activation or is an incidental finding, remains unknown.", "\n\nThere is a high clinical variation in sarcoidosis patients. ", "This might be explained by biochemical or genetic differences. ", "It has been shown that certain human leukocyte antigen alleles are associated with variations in the clinical manifestations. ", "For example, the DRB1\\*0301 allele is associated with Löfgren's syndrome in a Dutch cohort.\\[[@pone.0223897.ref042]\\] Whether genetic variances of human leukocyte antigen alleles influence the sIL-2R levels is unknown. ", "Further studies specifically designed for this purpose might further elucidate this observation.", "\n\nA limitation of our study is the number of patients included. ", "However, the number of included patients (189) did approach our initial sample size calculation of 200 patients. ", "Furthermore, since the effect difference observed in this study between ACE and sIL-2R is larger than the estimated effect difference used in the sample size calculation, it is easier to detect a significant difference. ", "Therefore, our study is adequately powered for our primary outcomes.", "\n\nA strength of our study is the control group of non-sarcoidosis patients. ", "All patients included in this study were suspected of sarcoidosis at presentation. ", "Therefore, all diseases that could cause sarcoidosis-like symptoms, ranging from tuberculosis to arthritis psoriatica, are included in this study. ", "Therefore, we strongly believe that our study approach most optimally reflects clinical practice\n\nIn this study, all sIL-2R levels were measured before the definitive diagnosis was established. ", "Therefore, the outcome, i.e. the diagnosis of sarcoidosis, has not influenced the measurement of sIL-2R and prevents bias. ", "\\[[@pone.0223897.ref043]\\] For ACE measurements, only one patient had ACE measured after the diagnosis of sarcoidosis. ", "We feel that this one patient will not have biased the overall result.", "\n\nThere were no missing values for sIL-2R. There were, however, missing values for ACE. ", "When we performed a sensitivity analysis in a subgroup of patients that had no missing values for ACE, sensitivity for sIL-2R was 91% and specificity 85% with a cut-off of \\>3550 pg/mL. These numbers are almost identical to those of the whole population (88% and 85% respectively). ", "With this, we can safely assume that the missing data are not related to the outcome and therefore the whole study population can be used, including patients who have missing values for ACE.", "\n\nThe results of this study have limitations in their application to clinical practice, due to the population in this study, which does not reflect the general population, but rather the population in a tertiary hospital. ", "The patients in this study were often referred to the tertiary hospital due to difficult to diagnose disease.", "\n\nThis study compared patients with a definitive diagnosis of sarcoidosis and patients with a definitive diagnosis of another disease, not with healthy controls. ", "These patients were diagnosed with various diseases and thus represent a heterogeneous group. ", "Comparing the use of sIL-2R within a diseased population is a comparison that mimics clinical practice more closely than comparing sarcoidosis patients and healthy controls.", "\n\n5. ", "Conclusion {#sec018}\n=============\n\nIn this cohort study consisting of patients in whom sarcoidosis is suspected but not yet proven or excluded, we demonstrate the superiority of serum sIL-2R above ACE in the screening for sarcoidosis. ", "Therefore, serum sIL-2R may serve as a diagnostic, discriminating tool and as a biomarker for patients that are suspected for sarcoidosis. ", "Due to its high sensitivity, sIL-2R can be a useful tool to rule out sarcoidosis in patients suspected of sarcoidosis.", "\n\nSupporting information {#sec019}\n======================\n\n###### Dataset of sarcoidosis and non-sarcoidosis patients.", "\n\n(XLSX)\n\n###### \n\nClick here for additional data file.", "\n\nWe would like to thank prof. ", "dr. ", "ir. ", "Eric Boersma for his expertise.", "\n\n10.1371/journal.pone.0223897.r001\n\nDecision Letter 0\n\nMogi\n\nMasaki\n\nAcademic Editor\n\n© 2019 Masaki Mogi\n\n2019\n\nMasaki Mogi\n\nThis is an open access article distributed under the terms of the\n\nCreative Commons Attribution License\n\n, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.", "\n\n13 Aug 2019\n\nPONE-D-19-20768\n\nSensitivity and specificity of the soluble interleukin-2 receptor in biopsy-proven sarcoidosis patients\n\nPLOS ONE\n\nDear Dr. Eurelings, \n\nThank you for submitting your manuscript to PLOS ONE. ", "After careful consideration, we feel that it has merit but does not fully meet PLOS ONE's publication criteria as it currently stands. ", "Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.", "\n\n==============================\n\nThe manuscript should be major revised according to the Reviewers\\' valuable comments.", "\n\nRespond them appropriately.", "\n\n==============================\n\nWe would appreciate receiving your revised manuscript by Sep 27 2019 11:59PM. ", "When you are ready to submit your revision, log on to <https://www.editorialmanager.com/pone/> and select the \\'Submissions Needing Revision\\' folder to locate your manuscript file.", "\n\nIf you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.", "\n\nTo enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. ", "For instructions see: <http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols>\n\nPlease include the following items when submitting your revised manuscript:\n\nA rebuttal letter that responds to each point raised by the academic editor and reviewer(s). ", "This letter should be uploaded as separate file and labeled \\'Response to Reviewers\\'.", "A marked-up copy of your manuscript that highlights changes made to the original version. ", "This file should be uploaded as separate file and labeled \\'Revised Manuscript with Track Changes\\'.", "An unmarked version of your revised paper without tracked changes. ", "This file should be uploaded as separate file and labeled \\'Manuscript\\'.", "\n\nPlease note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. ", "The record will include editor decision letters (with reviews) and your responses to reviewer comments. ", "If eligible, we will contact you to opt in or out.", "\n\nWe look forward to receiving your revised manuscript.", "\n\nKind regards,\n\nMasaki Mogi\n\nAcademic Editor\n\nPLOS ONE\n\nJournal Requirements:\n\nWhen submitting your revision, we need you to address these additional requirements.", "\n\nPlease ensure that your manuscript meets PLOS ONE\\'s style requirements, including those for file naming. ", "The PLOS ONE style templates can be found at\n\n<http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf> and <http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf>\n\n1\\. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. ", "Please see our Supporting Information guidelines for more information: <http://journals.plos.org/plosone/s/supporting-information>.", "\n\n\\[Note: HTML markup is below. ", "Please do not edit.\\]\n\nReviewers\\' comments:\n\nReviewer\\'s Responses to Questions\n\n**Comments to the Author**\n\n1\\. Is the manuscript technically sound, and do the data support the conclusions?", "\n\nThe manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. ", "Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. ", "The conclusions must be drawn appropriately based on the data presented.", "\n\nReviewer \\#1: Yes\n\nReviewer \\#2: Partly\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n2\\. Has the statistical analysis been performed appropriately and rigorously?", "\n\nReviewer \\#1: Yes\n\nReviewer \\#2: Yes\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n3\\. Have the authors made all data underlying the findings in their manuscript fully available?", "\n\nThe [PLOS Data policy](http://www.plosone.org/static/policies.action#sharing) requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). ", "The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. ", "For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. ", "If there are restrictions on publicly sharing data---e.g. participant privacy or use of data from a third party---those must be specified.", "\n\nReviewer \\#1: Yes\n\nReviewer \\#2: No\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n4\\. Is the manuscript presented in an intelligible fashion and written in standard English?", "\n\nPLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. ", "Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.", "\n\nReviewer \\#1: Yes\n\nReviewer \\#2: Yes\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n5\\. Review Comments to the Author\n\nPlease use the space provided to explain your answers to the questions above. ", "You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (", "Please upload your review as an attachment if it exceeds 20,000 characters)\n\nReviewer \\#1: Sarcoidosis is a systemic granulomatous disease of unknown etiology. ", "The polarization into T helper type-1 response and its associated cytokines have been reported to play key roles in pathogenesis of this disease. ", "Until now, the diagnosis of sarcoidosis is still difficult and sometimes very problematic, almost bases on a combination of clinical and imaging findings, histological demonstration and exclusion of other capable diseases. ", "So, exploring a marker with high sensitivity and specificity for diagnosis of sarcoidosis is very interesting and meaning with clinical practices. ", "However, serum level of sIL-2R is not a new marker for sarcoidosis with many research studies before in which sensitivity and correlation between this serum level with disease activity and other diagnosis parameters were already confirmed. ", "Because this serum correlates with the level of T-cell activation, identification for the specificity of sIL-2R required a bigger survey from many other diseases and I have a few questions that I would like to discuss below.", "\n\n1\\. The new information from your study is identification for the specificity of sIL-2R that required a bigger survey from many non-sarcoidosis diseases. ", "In your manuscript, the number patient is small, they are not representative for the disease populations. ", "If you increase these numbers, your study may be more convincing.", "\n\n2\\. In Figure 3, please change the format box-plot to dot-plot, and add the number of each group. ", "It will help to recognize the number of patients involved in this study.", "\n\n3\\. In the result 3.3: correlation of sIL-2R with diagnostic parameter, the author showed the significant correlation between sIL-2R and chest radiograph stage, but R=0.27 is not difference. ", "May you check it? ", "And it might be better if you show these data by correlation chart.", "\n\nReviewer \\#2: Review comment PONE-D-19-207\n\nThe authors examined the diagnostic utility of sIL-2R and ACE in patients with suspected sarcoidosis patients, and concluded that sIL-2R was useful for such biomarkers. ", "Although the manuscript basically well written, this reviewer feels that there is serious concern that should be addressed.", "\n\nMajor\n\n1\\. Study population:\n\nTo consider sensitivity and specificity of biomarker, study subjects (e.g. sarcoidosis, suspected sarcoidosis, other mimicking disease, healthy subjects) are very important.", "\n\nA\\) Suspected of sarcoidosis patients: As mentioned in the introduction, sarcoidosis is systemic disease. ", "Thus, there were many courses in suspected sarcoidosis patients (e.g. lung, heart, liver, skin, nervous). ", "Were all the patients who have lung sarcoidosis in the present study? ", "The authors should clearly define the patients who suspected sarcoidosis. ", "To clarify study subject who suspected sarcoidosis, how about the authors consider to limit the study subjects who have lung sarcoidosis or lung disease.", "\n\nB\\) As shown in Figure 2, patients with immunosuppressive medication \\<2 weeks before sIL-2R measurement or ACE inhibitors \\< 1 month before ACE were excluded. ", "Are there any backgrounds in this setting period? ", "This reviewer feels that all patients who prescribed immunosuppressive medication should be excluded in the study subjects.", "\n\nC\\) In Figure 4, to examine sensitivity and specificity of sIL-2R and ACE, which subjects (e.g. included patients n=180, or include patients n=180 + healthy subjects n=101) did the authors use?", "\n\n2\\. Results Figures 1 and 2\n\nPlease consider combine Figures 1 and 2, to easy to understand for readers.", "\n\nMinor\n\n3\\. Figure 3\n\nPlease add the numbers of each group in Figure 3.", "\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n6\\. PLOS authors have the option to publish the peer review history of their article ([what does this mean?](https://journals.plos.org/plosone/s/editorial-and-peer-review-process#loc-peer-review-history)). ", "If published, this will include your full peer review and any attached files.", "\n\nIf you choose \"no\", your identity will remain anonymous but your review may still be made public.", "\n\n**Do you want your identity to be public for this peer review?** ", "For information about this choice, including consent withdrawal, please see our [Privacy Policy](https://www.plos.org/privacy-policy).", "\n\nReviewer \\#1: Yes: Ikuko Ueda-Hayakawa\n\nReviewer \\#2: No\n\n\\[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. ", "Please log into your account, locate the manuscript record, and check for the action link \\\"View Attachments\\\". ", "If this link does not appear, there are no attachment files to be viewed.\\]\n\nWhile revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, <https://pacev2.apexcovantage.com/>. ", "PACE helps ensure that figures meet PLOS requirements. ", "To use PACE, you must first register as a user. ", "Registration is free. ", "Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. ", "If you encounter any issues or have any questions when using PACE, please email us at <figures@plos.org>. ", "Please note that Supporting Information files do not need this step.", "\n\n10.1371/journal.pone.0223897.r002\n\nAuthor response to Decision Letter 0\n\n16 Sep 2019\n\nDear editor,\n\nThank you for the opportunity to clarify the message of our manuscript. ", "We have answered the remarks of the reviewers, and we feel that the manuscript, after applying the suggested changes, has improved significantly. ", "In addition to this, we noticed that the objective of our study was not stated clearly enough. ", "Therefore, in addition to our replies and corrections based on the advice of the reviewers, we have shifted the focus of the manuscript slightly to highlight our study population and our objective more clearly. ", "Consequently, we have changed the title to \"Sensitivity and specificity of serum soluble interleukin 2 receptor in a population of patients suspected of sarcoidosis\". ", "We hope you will find the manuscript sufficiently improved and suitable for publishing in PlosOne.", "\n\nReviewer \\#1: Sarcoidosis is a systemic granulomatous disease of unknown etiology. ", "The polarization into T helper type-1 response and its associated cytokines have been reported to play key roles in pathogenesis of this disease. ", "Until now, the diagnosis of sarcoidosis is still difficult and sometimes very problematic, almost bases on a combination of clinical and imaging findings, histological demonstration and exclusion of other capable diseases. ", "So, exploring a marker with high sensitivity and specificity for diagnosis of sarcoidosis is very interesting and meaning with clinical practices. ", "However, serum level of sIL-2R is not a new marker for sarcoidosis with many research studies before in which sensitivity and correlation between this serum level with disease activity and other diagnosis parameters were already confirmed. ", "Because this serum correlates with the level of T-cell activation, identification for the specificity of sIL-2R required a bigger survey from many other diseases and I have a few questions that I would like to discuss below.", "\n\n1\\. The new information from your study is identification for the specificity of sIL-2R that required a bigger survey from many non-sarcoidosis diseases. ", "In your manuscript, the number patient is small, they are not representative for the disease populations. ", "If you increase these numbers, your study may be more convincing.", "\n\nThank you for your comment. ", "We agree that increasing the number of patients, thus patients who got a definitive diagnosis of sarcoidosis or another disease than sarcoidosis, in our study would add statistical power and value to our study. ", "Therefore, we did go back into the dataset and now added patients in whom a diagnosis (sarcoidosis or another disease) was now established (they were not included in the initially submitted manuscript, as, although serum sIL-2R levels were available at that time, no definitive clinical diagnosis was available then(for example, because histology results were still pending).", "\n\nIn total, we added 9 additional patients, of whom 4 got the definitive diagnosis of sarcoidosis and 5 patients who were diagnosed with another disease. ", "The addition of these extra patients to our study implied recalculations for the whole manuscript, so you will find that all of our numbers have changed slightly, although not significantly. ", "With the addition of these patients, the total number of patients in the revised manuscript now is 189. ", "Prior to the analysis of this study, we have performed a power calculation, with a power of 80% and a confidence interval of approximately 5% on either side, with a modest estimated effect difference of 10%. ", "This yielded a suggested sample size of 200 patients. ", "The number of patients included in this study (189), is close to the suggested sample size. ", "Importantly, since the effect difference appeared larger than the estimated effect difference used in the initial power calculations, it is easier to detect significant differences. ", "Therefore, we feel our study is adequately powered for our primary outcome.", "\n\nAdding more patients from another population to add power for our secondary outcomes might induce bias to this study. ", "In this study, we selected all patients from the same pool: patients whose sIL-2R had been assessed because sarcoidosis was part of the differential diagnosis. ", "Therefore, we are limited in the number of patients we can include by our population pool of patients that at that time of serum sIL-2R measurement had a differential diagnosis that included sarcoidosis among other diseases. ", "If we would have selected patients from other departments, such as Rheumatology for example with high suspicion of rheumatoid arthritis yet without any suspicion of sarcoidosis to add to the non-sarcoidosis patient group, we include patients who were never suspected of sarcoidosis. ", "For example, a female patient with a family history of rheumatoid arthritis, with a symmetrical polyarthritis of the hands, morning stiffness and a positive rheumatoid factor or anti-citrullinated protein antibody, would in practice never be tested for sarcoidosis. ", "As the aim of our study was to explore whether serum sIL-2R measurements could be of added value to diagnose sarcoidosis in patients that present at the clinic with features that can be associated with sarcoidosis, as well as other diseases, we feel it would not be statistically sound to include serum the sIL-2R from patients who never have been suspected of sarcoidosis. ", "This would clearly not reflect the daily clinical practice where we want to apply serum sIL-2R measurements in patients who are suspected of having sarcoidosis. ", "Furthermore, it would not answer the research question: can sIL-2R be used in case of suspicion of sarcoidosis? ", "Therefore, we only used this pool of patients suspected of sarcoidosis whose sIL-2R was assessed.", "\n\n2\\. In Figure 3, please change the format box-plot to dot-plot, and add the number of each group. ", "It will help to recognize the number of patients involved in this study.", "\n\nWe agree with the reviewer and have changed the initial box-plot into a dot-pot and added the group sizes to make this figure more insightful.", "\n\n3\\. In the result 3.3: correlation of sIL-2R with diagnostic parameter, the author showed the significant correlation between sIL-2R and chest radiograph stage, but R=0.27 is not difference. ", "May you check it? ", "And it might be better if you show these data by correlation chart.", "\n\nWe thank the reviewer for addressing this point. ", "Indeed, a correlation of 0.27, even though it might be statistically significant (P \\< 0.05) is not a strong correlation and presumably of low clinical value. ", "Therefore, we have changed our wording in that paragraph to 'There is a statistically significant, weak correlation between sIL-2R and chest radiograph stage' and we have commented on this in the discussion as well. ", "Since this finding is of low clinical value, we feel it might not be appropriate to use an additional graph for this finding.", "\n\nReviewer \\#2: Review comment PONE-D-19-207\n\nThe authors examined the diagnostic utility of sIL-2R and ACE in patients with suspected sarcoidosis patients, and concluded that sIL-2R was useful for such biomarkers. ", "Although the manuscript basically well written, this reviewer feels that there is serious concern that should be addressed.", "\n\nMajor\n\n1\\. Study population:\n\nTo consider sensitivity and specificity of biomarker, study subjects (e.g. sarcoidosis, suspected sarcoidosis, other mimicking disease, healthy subjects) are very important.", "\n\nA\\) Suspected of sarcoidosis patients: As mentioned in the introduction, sarcoidosis is systemic disease. ", "Thus, there were many courses in suspected sarcoidosis patients (e.g. lung, heart, liver, skin, nervous). ", "Were all the patients who have lung sarcoidosis in the present study? ", "The authors should clearly define the patients who suspected sarcoidosis. ", "To clarify study subject who suspected sarcoidosis, how about the authors consider to limit the study subjects who have lung sarcoidosis or lung disease.", "\n\nThank you for this insightful comment. ", "As you mentioned, there are many localizations of sarcoidosis and sarcoidosis patients may present with a broad variety of symptoms. ", "This directly translates into a difficulty describing the suspicion of sarcoidosis. ", "In our study, we included a wide range of patients who were diagnosed with sarcoidosis after the diagnosis workup, and not only those presenting with lung complaints. ", "On the one hand, including only those patients presenting only with lung complaints, would have resulted in the inclusion of a more homogenous group. ", "On the other hand, including all patients suspected of sarcoidosis, who eventually were diagnosed with sarcoidosis of any organ, enabled us to include more patients, (and thus gain more statistical power). ", "Importantly, this also better reflects the usefulness of sIL-2R in establishing the diagnosis of sarcoidosis, since not all patients suspected of sarcoidosis will initially present themselves to the clinician with lung complaints.", "\n\nSarcoidosis was suspected when a patient was referred to the Immunology department with one or more of these criteria:\n\n1\\) lung complaints i.e. shortness of breath, persistent dry cough or chest pains\n\n2\\) uveitis or inflammation of the lacrimal glands\n\n3\\) skin disorders i.e. erythema nodosum, lupus pernio, infiltration of scars or tattoos\n\n4\\) neurological complaints i.e. hearing loss, facial nerve palsy or epilepsy\n\n5\\) polyarthritis\n\n6\\) incidental finding of lymphadenopathy on imaging\n\nWe have added these criteria to the manuscript to clearly describe our study population.", "\n\nB\\) As shown in Figure 2, patients with immunosuppressive medication \\<2 weeks before sIL-2R measurement or ACE inhibitors \\< 1 month before ACE were excluded. ", "Are there any backgrounds in this setting period? ", "This reviewer feels that all patients who prescribed immunosuppressive medication should be excluded in the study subjects.", "\n\nThank you for this astute observation. ", "We agree that patients who were prescribed immunosuppressive medication should be excluded from this study. ", "To assess immunosuppressive medication use, the list of medication at first visit to the department was screened. ", "The referral letter was also screened for use of any immunosuppressive medication. ", "We cannot know whether the patient had any immunosuppressive medication prior to the referral letter. ", "For example, one patient might have had corticosteroids prescribed to them by their general practitioner. ", "If this medication has been stopped just before the referral and the referral letter, we might not be aware of this use. ", "Therefore, we defined the immunosuppressive use as two weeks before the first visit and sIL-2R determination, since this is the minimum waiting time between referral and visit to the immunology department. ", "Within this time frame, we are certain that patients have not used any immunosuppressive medication. ", "However, for most patients, the time between the referral letter and the first visit to our clinic is longer, and thus increases the interval of time of which we are sure that they did not use immunosuppressive medication.", "\n\nWith regards to the use of ACE-inhibitors, we were able to employ a broader strategy. ", "Since this medication is prescribed for long periods of time, and not in short courses as corticosteroids are, we were able to use data not only from the list of medication at first visit and the referral letter, but also from letters from other departments of our Medical Centre, such as the cardiology or ophthalmology department. ", "Therefore we were able to achieve the certainty that patients did not use ACE-inhibitors one month prior to ACE measurement.", "\n\nC\\) In Figure 4, to examine sensitivity and specificity of sIL-2R and ACE, which subjects (e.g. included patients n=180, or include patients n=180 + healthy subjects n=101) did the authors use?", "\n\nThank you for your comment. ", "In this figure, we examined the sensitivity and specificity of sIL-2R and ACE in included patients (n = 189) that had a suspicion of sarcoidosis in the differential diagnosis. ", "We choose to use this specific population, since this is the population who, in clinical practice, would undergo diagnostic testing for sarcoidosis. ", "We feel that, if we include healthy controls as well, sIL-2R would over-perform in this setting and would not give realistic values that are applicable for the current medical practice. ", "To clarify, we now have added the numbers patient to this Figure.", "\n\n2\\. Results Figures 1 and 2\n\nPlease consider combine Figures 1 and 2, to easy to understand for readers.", "\n\nWe welcome this helpful comment and we have merged Figure 1 and 2 into one figure.", "\n\nMinor\n\n3\\. Figure 3\n\nPlease add the numbers of each group in Figure 3.", "\n\nWe have added the group size to make this figure more insightful.", "\n\n10.1371/journal.pone.0223897.r003\n\nDecision Letter 1\n\nMogi\n\nMasaki\n\nAcademic Editor\n\n© 2019 Masaki Mogi\n\n2019\n\nMasaki Mogi\n\nThis is an open access article distributed under the terms of the\n\nCreative Commons Attribution License\n\n, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.", "\n\n2 Oct 2019\n\nSensitivity and specificity of serum soluble interleukin-2 receptor for diagnosing sarcoidosis in a population of patients suspected of sarcoidosis\n\nPONE-D-19-20768R1\n\nDear Dr. Eurelings,\n\nWe are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.", "\n\nWithin one week, you will receive an e-mail containing information on the amendments required prior to publication. ", "When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.", "\n\nShortly after the formal acceptance letter is sent, an invoice for payment will follow. ", "To ensure an efficient production and billing process, please log into Editorial Manager at <https://www.editorialmanager.com/pone/>, click the \\\"Update My Information\\\" link at the top of the page, and update your user information. ", "If you have any billing related questions, please contact our Author Billing department directly at <authorbilling@plos.org>.", "\n\nIf your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. ", "If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. ", "Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. ", "For more information, please contact <onepress@plos.org>.", "\n\nWith kind regards,\n\nMasaki Mogi\n\nAcademic Editor\n\nPLOS ONE\n\nAdditional Editor Comments (optional):\n\nNo further comment.", "\n\nReviewers\\' comments:\n\nReviewer\\'s Responses to Questions\n\n**Comments to the Author**\n\n1\\. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \"Comments to the Author\" section, enter your conflict of interest statement in the \"Confidential to Editor\" section, and submit your \\\"Accept\\\" recommendation.", "\n\nReviewer \\#1: All comments have been addressed\n\nReviewer \\#2: All comments have been addressed\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n2\\. Is the manuscript technically sound, and do the data support the conclusions?", "\n\nThe manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. ", "Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. ", "The conclusions must be drawn appropriately based on the data presented.", "\n\nReviewer \\#1: Yes\n\nReviewer \\#2: Yes\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n3\\. Has the statistical analysis been performed appropriately and rigorously?", "\n\nReviewer \\#1: Yes\n\nReviewer \\#2: N/A\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n4\\. Have the authors made all data underlying the findings in their manuscript fully available?", "\n\nThe [PLOS Data policy](http://www.plosone.org/static/policies.action#sharing) requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). ", "The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. ", "For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. ", "If there are restrictions on publicly sharing data---e.g. participant privacy or use of data from a third party---those must be specified.", "\n\nReviewer \\#1: Yes\n\nReviewer \\#2: No\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n5\\. Is the manuscript presented in an intelligible fashion and written in standard English?", "\n\nPLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. ", "Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.", "\n\nReviewer \\#1: (No Response)\n\nReviewer \\#2: Yes\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n6\\. Review Comments to the Author\n\nPlease use the space provided to explain your answers to the questions above. ", "You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (", "Please upload your review as an attachment if it exceeds 20,000 characters)\n\nReviewer \\#1: Authors answered the remarks of the reviewers, and they had improved their report significantly. ", "The revised version of the manuscript is acceptable for publication.", "\n\nReviewer \\#2: This manuscript has now much improved.", "\n\nI have no further comments.", "\n\n\\*\\*\\*\\*\\*\\*\\*\\*\\*\\*\n\n7\\. PLOS authors have the option to publish the peer review history of their article ([what does this mean?](https://journals.plos.org/plosone/s/editorial-and-peer-review-process#loc-peer-review-history)). ", "If published, this will include your full peer review and any attached files.", "\n\nIf you choose \"no\", your identity will remain anonymous but your review may still be made public.", "\n\n**Do you want your identity to be public for this peer review?** ", "For information about this choice, including consent withdrawal, please see our [Privacy Policy](https://www.plos.org/privacy-policy).", "\n\nReviewer \\#1: No\n\nReviewer \\#2: No\n\n10.1371/journal.pone.0223897.r004\n\nAcceptance letter\n\nMogi\n\nMasaki\n\nAcademic Editor\n\n© 2019 Masaki Mogi\n\n2019\n\nMasaki Mogi\n\nThis is an open access article distributed under the terms of the\n\nCreative Commons Attribution License\n\n, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.", "\n\n9 Oct 2019\n\nPONE-D-19-20768R1\n\nSensitivity and specificity of serum soluble interleukin-2 receptor for diagnosing sarcoidosis in a population of patients suspected of sarcoidosis\n\nDear Dr. Eurelings:\n\nI am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. ", "Congratulations! ", "Your manuscript is now with our production department.", "\n\nIf your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. ", "If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. ", "Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. ", "For more information please contact <onepress@plos.org>.", "\n\nFor any other questions or concerns, please email <plosone@plos.org>.", "\n\nThank you for submitting your work to PLOS ONE.", "\n\nWith kind regards,\n\nPLOS ONE Editorial Office Staff\n\non behalf of\n\nDr. Masaki Mogi\n\nAcademic Editor\n\nPLOS ONE\n\n[^1]: **Competing Interests:**The authors have declared that no competing interests exist.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0005653150146827102, 0.0009391896310262382, 0.0026279455050826073, 0.0007133284816518426, 0.012058612890541553, 0.0009489910444244742, 0.0006319995736703277, 0.001210001646541059, 0.0023321507032960653, 0.0010833368869498372, 0.0009057476418092847, 0.0008053097990341485, 0.0010419769678264856, 0.0007098391652107239, 0.0011545087909325957, 0.0010345164919272065, 0.0008672505500726402, 0.0006811201456002891, 0.0005955838714726269, 0.0008853315375745296, 0.0010460243793204427, 0.0008632397511973977, 0.0006280146772041917, 0.0007687979377806187, 0.0006394842057488859, 0.000579528568778187, 0.0011855863267555833, 0.0007946300902403891, 0.0016367478528991342, 0.0005159242427907884, 0.0005621020100079477, 0.0006769602769054472, 0.0007680660346522927, 0.000922054925467819, 0.0007564901607111096, 0.000638115918263793, 0.0008916915976442397, 0.0008507756283506751, 0.0019055787706747651, 0.0008998330449685454, 0.00062690390041098, 0.0005675180000253022, 0.0006415288662537932, 0.0006896237609907985, 0.0006397520774044096, 0.0006821361603215337, 0.0005988857010379434, 0.0007757982239127159, 0.0010585221461951733, 0.0006092657567933202, 0.0005327645340003073, 0.000601785141043365, 0.0005917754606343806, 0.0005935426452197134, 0.0005382397794164717, 0.0006619592313654721, 0.0005426528514362872, 0.0005696095176972449, 0.000604082946665585, 0.0005638040602207184, 0.0006288358708843589, 0.000612453673966229, 0.0006135049043223262, 0.0006009924691170454, 0.000603188294917345, 0.0006937442813068628, 0.0020744502544403076, 0.0006857771659269929, 0.0007158519001677632, 0.000564003421459347, 0.0005717806634493172, 0.0008070148178376257, 0.0012681814841926098, 0.0006153419381007552, 0.000600498344283551, 0.00078668660717085, 0.001273537054657936, 0.02719755843281746, 0.0006442128214985132, 0.0006785444566048682, 0.0008916410151869059, 0.0008614155813120306, 0.0019055787706747651, 0.0008077641832642257, 0.0007756929262541234, 0.0011837019119411707, 0.0007411940023303032, 0.0019341192673891783, 0.0008023462141864002, 0.0007219974650070071, 0.0006099850870668888, 0.0006597985629923642, 0.0008923765853978693, 0.001273537054657936, 0.0030152015388011932, 0.0006334108766168356, 0.0019055787706747651, 0.000961524376180023, 0.0006946154753677547, 0.0005309951957315207, 0.0005889047752134502, 0.000659273355267942, 0.000679503777064383, 0.0006490505766123533, 0.000720652227755636, 0.0010465412633493543, 0.001273537054657936, 0.003812718903645873, 0.0006777536473236978, 0.0008369918796233833, 0.000612809497397393, 0.0006700883386656642, 0.0007253809599205852, 0.0008178240968845785, 0.0006529848324134946, 0.0006764063728041947, 0.0007430939585901797, 0.0005750653217546642, 0.0007377209258265793, 0.0006683795945718884, 0.000969202839769423, 0.001273537054657936, 0.049439687281847, 0.0007159491651691496, 0.0007257657707668841, 0.0008490371983498335, 0.002208686200901866, 0.0005566297331824899, 0.0008947772439569235, 0.0009553367272019386, 0.0006402803701348603, 0.0007557451026514173, 0.0007109189755283296, 0.0006394443335011601, 0.0014621677109971642, 0.0012529429513961077, 0.0005738446488976479, 0.002071482129395008, 0.0006331281620077789, 0.0006777594680897892, 0.0006157443858683109, 0.0006287759752012789, 0.0005483077839016914, 0.0005979135166853666, 0.0007782125030644238, 0.0007166877621784806, 0.0007305155741050839, 0.0007054351735860109, 0.0006517706206068397, 0.0009173811413347721, 0.00074901053449139, 0.0006085550994612277, 0.001019439660012722, 0.000791307189501822, 0.0005210489616729319, 0.0005287659005261958, 0.0005780336214229465, 0.00055492646060884, 0.000530493853148073, 0.0005957675166428089, 0.000992034561932087, 0.0008910939795896411, 0.0005281110061332583, 0.0006994664436206222, 0.0009365839650854468, 0.0006175492890179157, 0.0006370075861923397, 0.0005478772800415754, 0.0005568385822698474, 0.0005794416065327823, 0.0005975759704597294, 0.0006584959337487817, 0.000599899678491056, 0.000635934469755739, 0.0013671473134309053, 0.0007549122674390674, 0.001086023054085672, 0.0009087883518077433, 0.0008291581179946661, 0.0006631210562773049, 0.0006653661257587373, 0.0009113985579460859, 0.001576528768055141, 0.0005563213489949703, 0.0006261160015128553, 0.0006069225491955876, 0.000543367350474, 0.0005114882369525731, 0.0007429275428876281, 0.0006341267144307494, 0.0007917095208540559, 0.0006357744568958879, 0.000553094083443284, 0.0005525882006622851, 0.0005389743600971997, 0.0006186635582707822, 0.0006218943744897842, 0.00057413981994614, 0.0006057667196728289, 0.000630238326266408, 0.0005097331595607102, 0.0005323196528479457, 0.0007375248242169619, 0.0005442207911983132, 0.000571252778172493, 0.0005872834590263665, 0.0005878025549463928, 0.0005656360299326479, 0.0006586795207113028, 0.0006146766827441752, 0.0005390298902057111, 0.0005291452398523688, 0.0005381351220421493, 0.0008040782413445413, 0.0008691537659615278, 0.0005452756304293871, 0.0005233085830695927, 0.0005437284708023071, 0.0006026616320014, 0.0009395431843586266, 0.0005946513265371323, 0.000694102665875107, 0.0006842753500677645, 0.0005119979614391923, 0.000745055207516998, 0.0007629352621734142, 0.0007429869729094207, 0.0006097299046814442, 0.0006522565381601453, 0.0005548211629502475, 0.0007360531599260867, 0.000636451062746346, 0.0005543552106246352, 0.0006124475039541721, 0.0005133310914970934, 0.0006409058696590364, 0.0006969814421609044, 0.0005435888306237757, 0.0006737257936038077, 0.0005225384957157075, 0.0005825914558954537, 0.001056779408827424, 0.0007700154092162848, 0.0018615988083183765, 0.0008591159130446613, 0.0009724670089781284, 0.0006739181699231267, 0.0006351833580993116, 0.0006014012615196407, 0.0005959064001217484, 0.0005641050520353019, 0.0006280784145928919, 0.000841009896248579, 0.0005454006022773683, 0.0005778333870694041, 0.0008799314382486045, 0.0005259965546429157, 0.0005885933642275631, 0.0005571751389652491, 0.0005859374650754035, 0.0005756384343840182, 0.0006313530029729009, 0.0005825778935104609, 0.0005693530547432601, 0.000580043881200254, 0.0005924668512307107, 0.0005472017219290137, 0.000523092458024621, 0.0005841372185386717, 0.0005212952964939177, 0.0006032124510966241, 0.0005866418359801173, 0.0016767476918175817, 0.0007629352621734142, 0.0007429869729094207, 0.0006097299046814442, 0.0006522565381601453, 0.0005548211629502475, 0.0007360531599260867, 0.000636451062746346, 0.0005543552106246352, 0.0005217728321440518, 0.0005723856738768518, 0.0005818201461806893, 0.0007064800010994077, 0.0006372477510012686, 0.0006065558991394937, 0.0005469910684041679, 0.0006306405994109809, 0.0005746755632571876, 0.0005664422642439604, 0.0005110844504088163, 0.0006250475998967886, 0.0006944950437173247, 0.000705378595739603, 0.0008574417443014681, 0.0013982034288346767, 0.0005961389979347587, 0.0007529100403189659, 0.0009848469635471702, 0.0007437695167027414, 0.0006124475039541721, 0.0005133310914970934, 0.0005669478559866548, 0.0006409058696590364, 0.0006969814421609044, 0.0005435888306237757, 0.000507635879330337, 0.0006264027906581759, 0.0005289881373755634, 0.0005506473244167864, 0.0006737257936038077, 0.0005225384957157075, 0.0005825914558954537, 0.001056779408827424, 0.0007700154092162848, 0.0018615988083183765, 0.0008591159130446613, 0.0009724670089781284, 0.0005079242982901633, 0.0007253889343701303, 0.0006918137078173459, 0.0006240538787096739, 0.0006554745486937463, 0.0007143465336412191, 0.0006964867934584618, 0.0012518484145402908, 0.0006739181699231267, 0.0006351833580993116, 0.0006014012615196407, 0.0005109275807626545, 0.0005827736458741128, 0.0005500225815922022, 0.0006045500631444156, 0.000654444273095578, 0.005139881744980812, 0.0005465089925564826, 0.0005532385548576713, 0.0006082492182031274, 0.000560294312890619, 0.0005316644674167037, 0.0005934204673394561, 0.0005437193904072046, 0.0005959064001217484, 0.0005217728321440518, 0.0005760437343269587, 0.0007346260827034712, 0.0005301329656504095, 0.0005321011994965374, 0.0005641050520353019, 0.0005157410632818937, 0.0006280784145928919, 0.000532393401954323, 0.0006270575104281306, 0.0005949659971520305, 0.0005562174483202398, 0.0005276476731523871, 0.0005626471829600632, 0.0005328932893462479, 0.0005650704842992127, 0.0005209031514823437, 0.000541528279427439, 0.0015398272080346942, 0.0006500190356746316, 0.0006027127965353429, 0.0005423077382147312, 0.0007108122808858752, 0.0005390298902057111, 0.0005291452398523688, 0.0005381351220421493, 0.0008241487084887922, 0.001073843683116138, 0.0005452756304293871, 0.0005233085830695927, 0.0005437284708023071, 0.0006026616320014, 0.0009401494753547013, 0.0005946513265371323, 0.000694102665875107, 0.0006463612662628293, 0.0005119979614391923, 0.000531481287907809, 0.000541740155313164, 0.0006482774624601007, 0.000653531460557133, 0.0008448315202258527, 0.0005454006022773683, 0.0005778333870694041, 0.0008799314382486045, 0.0005259965546429157, 0.0006279315566644073, 0.0006375405355356634, 0.0006984496721997857, 0.0008934621582739055, 0.0004975041374564171, 0.0005314554437063634, 0.0015398272080346942, 0.0006411474314518273, 0.0006242855452001095, 0.0006288712611421943, 0.0005755380261689425, 0.0019954426679760218 ]

[ "Lucas DeBari - Snowboarder\n\nSomewhere in the mountains of Greenland, begging to be shredded, is a peak called Rytterknaegten. ", "Lucas DeBari, inspired by a single, very small, pixelated photo, has made it his mission to plan the perfect expedition to this remote glacier. ", "Sherpas Cinema captures Lucas and his team, including recent Olympic gold medalist Kaitlyn Farrington, as they embark on an extraordinary experience full of laughter, festivity, and triumph. ", "Come hear the story behind the film, moderated by Transworld, in Seattle, Berkeley, Costa Mesa, or Whistler." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007562199025414884, 0.0006193954613991082, 0.0005726491799578071, 0.0005334052257239819 ]

[ "D-dimer >2.785 μg/ml and multiple infarcts ≥3 vascular territories are two characteristics of identifying cancer-associated ischemic stroke patients.", "\nThe patterns and mechanisms underlying stroke in cancer patients differ from those of the conventional etiology. ", "In this study, we further investigated the characteristics distinguishing cancer-associated ischemic stroke (CAIS) and the relationship of D-dimer value with CAIS. ", "Sixty-one acute ischemic stroke patients with cancer (cancer group) and 76 stroke patients without cancer (control group) were recruited. ", "Cerebrovascular distribution was divided into 3 circulations and 23 vascular territories, and acute multiple brain infarcts (AMBIs) were defined as discrete MRI diffusion-weighted imaging (DWI) lesions in >1 vascular territory. ", "Cancer patients had higher average D-dimer and fibrinogen degradation product values, and fewer stroke risk factors. ", "The numbers of infarct-affected vascular territories, AMBIs, and AMBIs in multiple circulations were significantly higher in the cancer group. ", "Receiver operating characteristic analysis showed that the cutoff value of D-dimer was 2.785 μg/ml; and above features were particularly evident in cancer patients whose D-dimer values were >2.785 μg/ml, while those with D-dimer values ≤2.785 μg/ml were similar to controls. ", "D-dimer >2.785 μg/ml may be an effective cutoff value and a sensitive index for identifying CAIS patients. ", "AMBIs in ≥3 vascular territories and AMBIs in both the anterior and posterior circulations are two imaging characteristics of CAIS." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008751198765821755, 0.000708362611476332, 0.0006049901130609214, 0.0007392565603367984, 0.00068751658545807, 0.0009507951908744872, 0.0008134739473462105, 0.0006876683328300714, 0.0007153268088586628, 0.0006182303186506033 ]

[ "Prethreshold retinopathy of prematurity: VEGF inhibition without VEGF inhibitors.", "\nThe risk of developing treatment-warranted Type 1 retinopathy of prematurity (ROP) might be reduced in preterm infants by modifying certain systemic factors. ", "There are steps that can be taken both early and late in the course of retinal vascular maturation that may potentially reduce an infant's risk of developing Type 1 ROP. ", "In prethreshold stage 2-3 ROP without plus disease, a combination of supplemental oxygen, correction of severe anemia, and light adaptation to reduce rod photoreceptor oxygen consumption helped us to reduce ROP severity, and encouraged a return to a more physiologic retinal vascular maturation pattern. ", "Thus, it may be possible to reduce the risk of developing Type 1 ROP by making adjustments in certain systemic parameters aimed at reducing retinal hypoxia, thereby gently lowering pathologically elevated levels of vascular endothelial growth factor (VEGF) within the eye." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0010770941153168678, 0.0012167281238362193, 0.0011791852302849293, 0.0006740777753293514, 0.0007791113457642496 ]

[ "Q:\n\nKeeping track of the sum of each element of a vector to another vector\n\nI have two vectors where I want to sum each element of a vector a to vector b. But I want to also keep track of which element of a and b that will give me that value. ", "I have tried the following to get my output:\na <- 1:3\nb <- 4:6\n\nstore <- list()\n\nfor(i in 1:length(b)){\n for(j in 1:length(a)){\n total <- b[i] + a[j]\n store[[paste0(\"a\",i, \"+\",\"b\",j)]] <- total \n } \n}\n\n## output\n> unlist(store)\n## a1+b1 a1+b2 a1+b3 a2+b1 a2+b2 a2+b3 a3+b1 a3+b2 a3+b3 \n## 5 6 7 6 7 8 7 8 9 \n\nBut I find using nested for loops are inflexible as it won't work that well if the length of a and b are different.", "\nI have came across the outer() function, where I can easily achieve the same result as above using one line of code:\nc(outer(a,b,`+`))\n##[1] 5 6 7 6 7 8 7 8 9 \n\nHowever, I lost track of the pair that will give me this value.", "\nHow can I track the pair without using loops?", "\n\nA:\n\nWe can use a second outer to get the names and use that the assign the names of the first one\nnm <- outer(seq_along(a), seq_along(b), FUN = function(x, y) sprintf('a%d + b%d', x, y))\nres <- setNames(c(outer(a,b,`+`)), nm)\nres \n# a1 + b1 a2 + b1 a3 + b1 a1 + b2 a2 + b2 a3 + b2 a1 + b3 a2 + b3 a3 + b3 \n# 5 6 7 6 7 8 7 8 9 \n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006050005322322249, 0.0008192022796720266, 0.0006137148593552411, 0.0008148125489242375, 0.001224093372002244 ]

[ "Box office estimates place Star Trek somewhere in the region of a $70 million domestic take for its opening weekend, roughly half of the JJ Abrams movie's estimated budget. ", "But what does that actually mean? »", "5/10/09 7:00am 5/10/09 7:00am" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000699491472914815, 0.0008269023383036256, 0.0058452230878174305 ]

[ "AlwaysArrange is an upcoming jailbreak tweak that does something quite interesting. ", "If you’ve ever wanted to move apps around normally, without having to enter ‘wiggle mode’, this is the tweak for you. ", "It does this extremely well, and you can even adjust the time it takes to move the apps around, pretty cool." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009016060503199697, 0.0010202164994552732, 0.0005651999963447452 ]

[ "Q:\n\nXcode: URL Shared Session not running when unit testing\n\nI have made a simple app which adds data to a database, and then retrieves it. ", "Whilst creating unit testing, it appears that the URLSession.", "Shared.dataTask is not running. ", "I can see this through the output of the print statements I have setup. ", "Below is my code:\nfunc addChild(childName:String,dob:String,number1:String,number2:String,parentNum:String,parentPass:String,notes:String){\n\n //url to php file\n let url = NSURL(string:\"http://localhost/addChild.php\")\n\n //request to this file\n let request = NSMutableURLRequest(url: url as! ", "URL)\n\n //method to pass data to this file\n request.httpMethod = \"POST\"\n\n //body to be appended to url\n let body = \"childName=\\(childName)&dateOfBirth=\\(dob)&contact1=\\(number1)&contact2=\\(number2)&parentAccNum=\\(parentNum)&parentAccPass=\\(parentPass)&notes=\\(notes)\"\n request.httpBody = body.data(using: String.", "Encoding.utf8)\n print(\"a\")\n //launching the request\n URLSession.shared.dataTask(with: request as URLRequest, completionHandler: { (data:Data?, ", "response:URLResponse?, ", "error:Error?) ", "in\n print(\"b\")\n if (error == nil){\n print(\"c\")\n //send request\n //get main queue in code process to communicate back to user interface\n DispatchQueue.main.async(execute: {\n\n do{\n //get json result\n let json = try JSONSerialization.jsonObject(with: data!,options: JSONSerialization.", "ReadingOptions.mutableContainers) as? ", "NSDictionary\n print(\"d\")\n //assigning json to parseJSON in guard/secure way\n //checking whether the parsing has worked\n guard let parseJSON = json else{\n print(\"Error while parsing\")\n return\n }\n\n //get id from parseJSON dictionary\n let id = parseJSON[\"id\"]\n\n //if there is some id value\n if id !", "= nil{\n print(parseJSON)\n self.success = true\n print(\"success\")\n }\n }\n catch{\n print(\"Caught an error:\\(error)\")\n }\n\n } )\n }\n //if unable to proceed request\n else{\n print(\"Error:\\(error)\")\n }\n //launch prepared session\n }).resume()\n}\n\nAnd then below is my unit testing script:\nimport XCTest\n@testable import computerScienceCoursework\n\nclass addChildTest: XCTestCase {\n //Setting up the values of the text fields\n var testChildName:String = \"Test name\"\n var testDOB:String = \"99/99/99\"\n var testContact1:String = \"00000000000\"\n var testContact2:String = \"11111111111\"\n var testParAccNum:String = \"-1\"\n var testParAccPass:String = \"Password\"\n var testNotes:String = \"Insert notes here\"\n\n var newChild = AddChildController()\n\n override func setUp() {\n super.setUp()\n // Put setup code here. ", "This method is called before the invocation of each test method in the class.", "\n\n }\n\n override func tearDown() {\n // Put teardown code here. ", "This method is called after the invocation of each test method in the class.", "\n super.tearDown()\n }\n\n func testAddChildIsWorking(){\n //Assigning the values to the text fields\n newChild.addChild(childName: testChildName,dob: testDOB,number1: testContact1,number2: testContact2,parentNum: testParAccNum,parentPass: testParAccPass,notes: testNotes)\n XCTAssert(newChild.success == true)\n }\n\n}\n\nA:\n\nProblem here is that you don´t know when the async task is finished and the success property is getting updated. ", "\nThere are some possible solutions for your problem one of them is to add a completion handler to your method. ", "\nfunc addChild(childName:String,dob:String,number1:String,number2:String,parentNum:String,parentPass:String,notes:String, completion: (Bool) -> Void){\n //url to php file\n let url = NSURL(string:\"http://localhost/addChild.php\")\n\n //request to this file\n let request = NSMutableURLRequest(url: url as! ", "URL)\n\n //method to pass data to this file\n request.httpMethod = \"POST\"\n\n //body to be appended to url\n let body = \"childName=\\(childName)&dateOfBirth=\\(dob)&contact1=\\(number1)&contact2=\\(number2)&parentAccNum=\\(parentNum)&parentAccPass=\\(parentPass)&notes=\\(notes)\"\n request.httpBody = body.data(using: String.", "Encoding.utf8)\n print(\"a\")\n //launching the request\n URLSession.shared.dataTask(with: request as URLRequest, completionHandler: { (data:Data?, ", "response:URLResponse?, ", "error:Error?) ", "in\n print(\"b\")\n if (error == nil){\n print(\"c\")\n //send request\n //get main queue in code process to communicate back to user interface\n DispatchQueue.main.async(execute: {\n\n do{\n //get json result\n let json = try JSONSerialization.jsonObject(with: data!,options: JSONSerialization.", "ReadingOptions.mutableContainers) as? ", "NSDictionary\n print(\"d\")\n //assigning json to parseJSON in guard/secure way\n //checking whether the parsing has worked\n guard let parseJSON = json else{\n print(\"Error while parsing\")\n completion(false)\n return\n }\n\n //get id from parseJSON dictionary\n let id = parseJSON[\"id\"]\n\n //if there is some id value\n if id !", "= nil{\n print(parseJSON)\n self.success = true\n print(\"success\")\n completion(true)\n }\n }\n catch{\n print(\"Caught an error:\\(error)\")\n completion(false)\n }\n\n } )\n }\n //if unable to proceed request\n else{\n print(\"Error:\\(error)\")\n completion(false)\n\n }\n //launch prepared session\n }).resume()\n}\n\nThen in your test method you can the method.", "\n func testAddChildIsWorking()\n {\n let asyncExpectation = expectationWithDescription(\"addChildIsWorkingFunction\")\n\n newChild.addChild(childName: testChildName, dob: testDOB, number1: testContact1,\n number2: testContact2, parentNum: testParAccNum, parentPass: testParAccPass, notes: testNotes) { (success) in\n\n asyncExpectation.fulfill()\n\n }\n\n self.waitForExpectationsWithTimeout(10) { error in\n\n XCTAssert(newChild.success == true)\n } \n }\n\nwaitForExpectationWithTimeout is waiting until a fulfill is trigger or a timeout occurs. ", "In this way you could test your async code.", "\nFor more informations check this link\nHope that helps.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005964561132714152, 0.0007016720483079553, 0.000797203800175339, 0.0005639176815748215, 0.0013307844055816531, 0.001063695759512484, 0.0007128252764232457, 0.0010316200787201524, 0.0009529745439067483, 0.0008185991318896413, 0.0010433149291202426, 0.0040364572778344154, 0.0010017352178692818, 0.0006413448718376458, 0.0009355778456665576, 0.0006398319965228438, 0.0014833861496299505, 0.0007393213454633951, 0.001978917047381401, 0.001063695759512484, 0.0007128252764232457, 0.0010316200787201524, 0.0009529745439067483, 0.0008185991318896413, 0.0010433149291202426, 0.00491677038371563, 0.0007809753296896815, 0.001063131494447589, 0.0007650553598068655, 0.0005405499832704663, 0.0019954426679760218 ]

[ "Q:\n\nMoment.js: Segmenting a duration into Years, Months, Weeks, Days etc\n\nDoes moment provide this convenience?", "\nIf I have two dates, can I get an object from moment from which I can destructure information like:\nconst now = moment();\nconst futureDay = moment('27-09-2019', 'DD-MM-YYYY');\nconst timeDiff = futureDay.diff(now);\n\n// ... some code here to get an object with the timeDiff\n\nconst {years, months, weeks, days} = theDiffObject;\n...\n\nA:\n\nYes, you can use durations. ", "Something like this:\nconst theDiffObject = {\n years: moment.duration(timeDiff).years(),\n months: moment.duration(timeDiff).months(),\n weeks: moment.duration(timeDiff).weeks(),\n days: moment.duration(timeDiff).days()\n}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006740260287187994, 0.0007648602477274835, 0.0006711677997373044 ]

[ "he nearest to 598/5 in 0.5, -0.04, -3/5, -0.1?", "\n0.5\nWhat is the nearest to 5/3 in 0.4, -0.5, 0.2, -732, 3?", "\n0.4\nWhich is the closest to 2/9? ", " (a) 4149/8 (b) 6 (c) -0.1 (d) 0.5\nd\nWhich is the closest to -0.2? ", " (a) 10 (b) 220/9 (c) -2/7\nc\nWhat is the closest to 1/4 in -3, 1/4, -0.19, 42?", "\n1/4\nWhat is the nearest to -6 in 0.5, -0.0605, 0, -2?", "\n-2\nWhich is the nearest to -1? ", " (a) 4/5 (b) -0.5 (c) 0.0234\nb\nWhich is the closest to -3586? ", " (a) 4 (b) 59 (c) 7\na\nWhat is the closest to 0.006 in -5, 0.3, -2/2153?", "\n-2/2153\nWhat is the closest to 2 in 5, -2/19, -19/9, 4, -4/7?", "\n4\nWhat is the nearest to -58 in 0.4, 0.011, 0?", "\n0\nWhich is the nearest to 4? ", " (a) 2 (b) 158/3 (c) -5 (d) 2/11\na\nWhat is the closest to -2/23 in 4, 5, 2, 228, 2/7?", "\n2/7\nWhat is the closest to -13 in -3, -0.24, 1?", "\n-3\nWhat is the nearest to -17 in 3/4, -0.5, 2/9, 3/5, 5135?", "\n-0.5\nWhich is the closest to -1.6? ", " (a) -3 (b) -5 (c) 0 (d) -1/30 (e) -2075\na\nWhat is the closest to 0 in 0, -7, -300, -2, -1?", "\n0\nWhat is the nearest to -1/3 in 1, 0, 5, -0.213, -2?", "\n-0.213\nWhich is the nearest to 0.3? ", " (a) -0.3 (b) 6 (c) -1.6 (d) 4 (e) 0.5\ne\nWhich is the closest to 3? ", " (a) -2 (b) 31 (c) 7.6 (d) 0.1 (e) 0.5\ne\nWhich is the closest to -2? ", " (a) 27 (b) -0.5 (c) 0.3 (d) 317\nb\nWhich is the closest to 4.2? ", " (a) 2/9 (b) -2/5 (c) 0.032 (d) -3\na\nWhich is the nearest to -0.07? ", " (a) -86 (b) -4 (c) -0.04 (d) -1/3\nc\nWhich is the nearest to 8120? ", " (a) -1/11 (b) -2/3 (c) -0.3 (d) 1 (e) -5\nd\nWhat is the closest to 1 in -23, -3/8, -31?", "\n-3/8\nWhich is the closest to 4? ", " (a) 0 (b) -750 (c) -1 (d) 0.1 (e) -0.5\nd\nWhat is the closest to -40906 in 0.01, -0.5, -0.3, -2/9?", "\n-0.5\nWhat is the closest to -2/7 in -2.283, -3, 1/4, 0.12?", "\n0.12\nWhich is the closest to 6? ", " (a) -8 (b) 3 (c) -5 (d) 2 (e) 0\nb\nWhat is the closest to 7.8 in 5, 2/7, 2, -4/5?", "\n5\nWhat is the nearest to 0 in 10/11, -0.01, -60, -2?", "\n-0.01\nWhat is the closest to 1/8 in 1, 114/13, -1/2?", "\n-1/2\nWhat is the closest to 1/2 in 2/13, 0.04, -437, -4, -2?", "\n2/13\nWhich is the nearest to -159? ", " (a) -2/7 (b) -2 (c) -24 (d) -0.3 (e) 0\nc\nWhich is the nearest to -0.1035? ", " (a) -6 (b) -1/7 (c) 0.4 (d) -3/4 (e) -0.1\ne\nWhat is the nearest to 0.1 in 1/3, 63, -0.04, -0.01?", "\n-0.01\nWhich is the closest to 1? ", " (a) 9 (b) 3/4 (c) 467 (d) -3/7\nb\nWhich is the nearest to -9? ", " (a) -0.3 (b) -6/13 (c) 1 (d) 3\nb\nWhat is the nearest to 0.2 in -0.03, -4, -12/299?", "\n-0.03\nWhich is the closest to 0.1? ", " (a) -3899 (b) 0.4 (c) 3 (d) -1\nb\nWhich is the nearest to -2/7? ", " (a) -4/5 (b) 26.76 (c) 29\na\nWhat is the closest to -0.01 in 1/2, 26, 3/4?", "\n1/2\nWhat is the nearest to -91506 in -0.3, -4, 1?", "\n-4\nWhich is the nearest to 0? ", " (a) -7.3 (b) 5 (c) -1/34\nc\nWhat is the closest to 1 in 5, -1566, -0.1?", "\n-0.1\nWhat is the closest to -4 in -4/7, 0.4, -57, 4, -2/5?", "\n-4/7\nWhat is the nearest to 454 in -4, -3.4, 2?", "\n2\nWhich is the closest to -0.7? ", " (a) -5/6 (b) 2 (c) 182/5\na\nWhat is the closest to 2/3 in 441/16, -2/23, -4, 4?", "\n-2/23\nWhich is the closest to -0.1? ", " (a) 93 (b) 2/5 (c) -72\nb\nWhat is the closest to 0.7 in 0.0914, -4, -246?", "\n0.0914\nWhich is the nearest to 0? ", " (a) 8 (b) -1/3 (c) -2/115 (d) 0.11\nc\nWhat is the closest to 0 in 1, -4, -0.104?", "\n-0.104\nWhat is the closest to -16/7 in 6, -0.2, 2/23, 0.3, 0.1?", "\n-0.2\nWhich is the nearest to -0.2? ", " (a) -8 (b) -0.3 (c) 4 (d) -55\nb\nWhat is the closest to -1 in 0.2, 21, -5, 16?", "\n0.2\nWhich is the nearest to 1/2? ", " (a) 0.1 (b) -153 (c) 0\na\nWhich is the nearest to -0.1? ", " (a) 7 (b) 2/3 (c) -146\nb\nWhich is the closest to -11/10? ", " (a) -0.5 (b) 1 (c) 0.4 (d) -2/13 (e) 0\na\nWhat is the closest to -1 in 0.2, 36, -0.2, 20?", "\n-0.2\nWhich is the nearest to 87/2? ", " (a) 3 (b) 144 (c) 0.05\na\nWhich is the closest to 1? ", " (a) -3/7 (b) -1077 (c) 126 (d) -5 (e) -2\na\nWhich is the nearest to -2? ", " (a) 0.1 (b) 1/9 (c) 0\nc\nWhich is the nearest to 9? ", " (a) 3 (b) -0.4 (c) -108 (d) 13\nd\nWhat is the closest to 3 in 5, 2/19, -3, 0.4, 1/5?", "\n5\nWhat is the nearest to -1 in 4, 35, -102/25?", "\n-102/25\nWhich is the nearest to -4? ", " (a) 3 (b) -2 (c) 1/9 (d) 0 (e) 6/7\nb\nWhich is the nearest to -5/3? ", " (a) 3/2 (b) 13 (c) 807\na\nWhat is the nearest to -2 in -22, -4.82, 2/9, 3/4?", "\n2/9\nWhich is the nearest to -0.2? ", " (a) -2/5 (b) 6807 (c) 2/3\na\nWhat is the closest to 9 in -3/8, 22, -27, 0.1?", "\n0.1\nWhich is the closest to 3/4? ", " (a) 5/2 (b) 0.4 (c) -11/146\nb\nWhich is the closest to -47? ", " (a) 2 (b) -0.37 (c) 4 (d) 3/7\nb\nWhich is the nearest to -2? ", " (a) -8 (b) -6 (c) -7/20\nc\nWhat is the nearest to 2 in 0.4, 0, 2/3, 12, -167?", "\n2/3\nWhich is the closest to 6/11? ", " (a) 164 (b) -5 (c) -0.4\nc\nWhat is the nearest to -1 in 0.5, 2/57, 31/4, 5, -10?", "\n2/57\nWhat is the closest to -1 in 0.1, 4, -93, 5, 6?", "\n0.1\nWhich is the nearest to -1? ", " (a) 61 (b) 0.5 (c) -0.4 (d) -6/13\nd\nWhat is the nearest to 0.1 in 1/2, 0.2, 2/7, -1/9, 4/11?", "\n0.2\nWhich is the nearest to 0.1? ", " (a) 61.9 (b) 0 (c) -91\nb\nWhat is the closest to 1 in 0, -4, -0.4, -3217, 3?", "\n0\nWhat is the closest to -1 in -2, -1737, -2/11?", "\n-2/11\nWhich is the nearest to -5? ", " (a) 2/21 (b) -1/2 (c) -5 (d) 7\nc\nWhich is the nearest to -1/2? ", " (a) 3 (b) -3/8 (c) 2666/3\nb\nWhat is the closest to -3/16 in -1, 0, -4, 5?", "\n0\nWhat is the closest to -2 in 3/38, -4, 1, 476?", "\n-4\nWhat is the closest to -8 in -271, -1/5, -4/21?", "\n-1/5\nWhich is the closest to 0.1? ", " (a) -1/8 (b) 2 (c) 0 (d) 120\nc\nWhat is the nearest to 4 in -1/7, 3/2, -1/5, -10, -5/6?", "\n3/2\nWhich is the nearest to -1/2? ", " (a) -0.2 (b) -2/33 (c) -3 (d) 1/2\na\nWhat is the closest to -1 in 1.5, -0.01, -2, 0.2?", "\n-0.01\nWhich is the nearest to -1/4? ", " (a) -2/5 (b) 4 (c) -3/109 (d) -1/3\nd\nWhat is the nearest to -2 in 152/3, -0.2, -3, -3/8, 0.7?", "\n-3\nWhich is the nearest to 0.1? ", " (a) 7 (b) -1 (c) -175\nb\nWhat is the nearest to -19 in 0.5, -1/4, -3/7, 11, -5?", "\n-5\nWhat is the nearest to -154 in 3, -0.2, 2/7, 5, -2/133?", "\n-0.2\nWhat is the closest to -0.1 in -184/9, -10, 57?", "\n-10\nWhat is the closest to 0 in 3/11, 6, 180, 4?", "\n3/11\nWhich is the nearest to -3/7? ", " (a) 3 (b) 1/8 (c) 41179\nb\nWhich is the closest to 1? ", " (a) 0.35 (b) 0.1 (c) 4 (d) 754\na\nWhich is the nearest to 2/9? ", " (a) -1413 (b) -5 (c) 1/6 (d) 1/3 (e) -1\nc\nWhat is the closest to 1 in -0.012, 0.033, -5, -1?", "\n0.033\nWhat is the closest to 0.1 in 4, -5, -9, 37, -16?", "\n4\nWhat is the nearest to 0.14 in -4, 0.4, 51, -0.2, 1?", "\n0.4\nWhat is the closest to 2 in 1/22, 113/4, -1?", "\n1/22\nWhich is the nearest to -2/5? ", " (a) -0.12 (b) 0.3 (c) -6 (d) -3/4\na\nWhich is the nearest to 7? ", " (a) 0.1 (b) -0.2 (c) 4 (d) -11 (e) 11\nc\nWhich is the closest to 8/397? ", " (a) -7 (b) -6 (c) -4\nc\nWhat is the nearest to 0 in 65, 2, 1, -4, 0?", "\n0\nWhat is the closest to 1/5 in 0.32, 1/3, -8, -5, 1?", "\n0.32\nWhich is the closest to 1? ", " (a) 1086 (b) -2 (c) 240 (d) -0.1\nd\nWhat is the closest to 1 in 8/5, 144, -4?", "\n8/5\nWhat is the closest to -0.6 in 3, 376, 2, 1/2?", "\n1/2\nWhat is the closest to -1 in -486.4, -2, 12?", "\n-2\nWhat is the nearest to 0 in 4, -0.5, -2150?", "\n-0.5\nWhat is the nearest to 1 in -206, 1/4, 4, -0.3?", "\n1/4\nWhich is the nearest to -13? ", " (a) 188 (b) -1/3 (c) 4 (d) -2/27\nb\nWhich is the closest to 1? ", " (a) 289 (b) 29 (c) 5 (d) 1/3 (e) 3\nd\nWhat is the nearest to 1/2 in -1, 3/3163, 57?", "\n3/3163\nWhat is the nearest to -0.1 in 3/5, -2/9, -0.04, 10.2?", "\n-0.04\nWhich is the closest to 0.3? ", " (a) -3 (b) -1 (c) -0.0668 (d) -18 (e) 0.03\ne\nWhat is the nearest to -26 in 2/1589, -2, 4?", "\n-2\nWhich is the nearest to 0? ", " (a) 2/7 (b) -2/5 (c) 12 (d) -4/3 (e) 1\na\nWhich is the nearest to 0.2? ", " (a) -97 (b) 1 (c) 6\nb\nWhat is the nearest to -1 in -2, 8/13, 0.3, 15, -1?", "\n-1\nWhat is the nearest to 5/23 in 0.5, 0.3, 2/3, -10?", "\n0.3\nWhat is the nearest to -0.2 in -697, -106, 2?", "\n2\nWhat is the closest to 0 in -3/13, 0.37, -1/4, 15, 0.3?", "\n-3/13\nWhat is the nearest to 2 in 332, 1.2, 2, -0.5?", "\n2\nWhat is the closest to -2/3 in -1/329, 4, 5?", "\n-1/329\nWhat is the nearest to -1/14 in 0.65, 3, -0.4?", "\n-0.4\nWhich is the nearest to 6/5? ", " (a) -2/43 (b) 3/4 (c) -0.1\nb\nWhich is the closest to -1? ", " (a) -587 (b) -5 (c) 0.3\nc\nWhat is the nearest to -0.2 in 0.17, -2/5, 2/9?", "\n-2/5\nWhich is the closest to -0.1? ", " (a) -3 (b) 8 (c) -4 (d) 13\na\nWhich is the nearest to -2/5? ", " (a) 0 (b) 0.6 (c) -3 (d) -1/21\nd\nWhich is the nearest to 0.1? ", " (a) -1/3 (b) -3 (c) 5/23 (d) 14\nc\nWhat is the closest" ]

{ "pile_set_name": "DM Mathematics" }

[ 0.0015415186062455177, 0.0011533842189237475, 0.00084970414172858, 0.0007389529491774738, 0.0009022093727253377, 0.000941906706430018, 0.000780114671215415, 0.0007570927264168859, 0.0008580764406360686, 0.0007974120089784265, 0.0010194805217906833, 0.0011652245884761214, 0.000771827413700521, 0.0008042391273193061, 0.0008676857687532902, 0.000769556500017643, 0.000981541583314538, 0.0010050141718238592, 0.0008748315158300102, 0.0008961936109699309, 0.0008618699503131211, 0.000782754912506789, 0.0008094230433925986, 0.0007109199650585651, 0.0009196600876748562, 0.0007515039760619402, 0.0008365528774447739, 0.0007931487634778023, 0.0008458182564936578, 0.0009873986709862947, 0.0012248597340658307, 0.0007861343328841031, 0.0008149613277055323, 0.0009050933877006173, 0.0009205929236486554, 0.0011107403552159667, 0.0007710070349276066, 0.0009286683634854853, 0.0009529219241812825, 0.0008538287947885692, 0.0008227272774092853, 0.0006836779648438096, 0.0008968221955001354, 0.0009703193791210651, 0.0007791006355546415, 0.0008470655884593725, 0.000951476686168462, 0.00081496755592525, 0.000683999212924391, 0.0007495935424230993, 0.0007866292726248503, 0.0012095447164028883, 0.0009115331340581179, 0.0009374851360917091, 0.0009009469649754465, 0.0008231185493059456, 0.0010053747100755572, 0.0011523141292855144, 0.0006979626487009227, 0.0010368174407631159, 0.0007828556117601693, 0.000991958542726934, 0.0007760215667076409, 0.0014386250404641032, 0.0009276585187762976, 0.0008915743674151599, 0.0007499633356928825, 0.0009338991367258132, 0.0008897696970961988, 0.0009133675484918058, 0.0008593529346399009, 0.0008277320303022861, 0.0006915071862749755, 0.0009550778777338564, 0.0009525977657176554, 0.0007652631029486656, 0.0008657207363285124, 0.0008948526228778064, 0.0010060679633170366, 0.0010225435253232718, 0.0011197248240932822, 0.0009265137487091124, 0.0007519019418396056, 0.0007878021569922566, 0.000769073492847383, 0.0008967389585450292, 0.0007940589566715062, 0.0007477368344552815, 0.0007925379904918373, 0.0010902776848524809, 0.0008575937827117741, 0.0008200680604204535, 0.0007982609095051885, 0.000844869005959481, 0.0009287763969041407, 0.0008123994921334088, 0.000769958074670285, 0.0008259183377958834, 0.0009986116783693433, 0.0008420274243690073, 0.000836237333714962, 0.0015643038786947727, 0.0009279338992200792, 0.0009550774120725691, 0.0016943587688729167, 0.0008891425095498562, 0.0008752783760428429, 0.000827056763228029, 0.0007667829631827772, 0.0011183981550857425, 0.0010233144275844097, 0.0009095476125366986, 0.0008084571454674006, 0.0008890277240425348, 0.0008498324896208942, 0.0011368418345227838, 0.0008026268915273249, 0.0008557562832720578, 0.0007538120844401419, 0.0008333534351550043, 0.001068014302290976, 0.000811204023193568, 0.0008504283032380044, 0.0009496427373960614, 0.0011075622169300914, 0.0009288325090892613, 0.0007490908028557897, 0.0009735461208038032, 0.001316698850132525, 0.000755850225687027, 0.0007599235977977514, 0.000851919874548912, 0.0008085958543233573, 0.00072860112413764, 0.0008615821716375649, 0.0007729884819127619, 0.0007800529710948467, 0.001048410777002573, 0.0007367780199274421 ]

[ "Ticlopidine, Alka-Seltzer, or a combination of citric acid with aspirin: effects on platelet aggregation in individuals with an insufficient response to aspirin alone.", "\nAspirin (ASA) does not effectively lower platelet aggregation in all people. ", "The platelet aggregation (PA) score is an easily used clinical method for measuring the effect in individuals of antiplatelet medications. ", "Fifteen apparently healthy subjects (2 men and 13 women), selected for their resistance to ASA's antiaggregation effect, completed a sequential trial of ticlopidine, Alka-Seltzer, and ASA + citric acid (CTA). ", "Ticlopidine was the strongest aggregation inhibitor and the ASA + CTA combination was more inhibitory than Alka-Seltzer. ", "It was determined that measuring antiaggregation effects of a particular agent in an individual prior to usage would optimize treatment. ", "The PA score methodology provides a means for testing patients prior to antiplatelet therapy for prevention and treatment of the thrombotic complications of vascular disease." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0010402972111478448, 0.0007053020526655018, 0.0006242218660190701, 0.0007426217780448496, 0.000678432232234627, 0.0005919613759033382, 0.000695185677614063 ]

[ "The present invention relates a a fluorescent display power supply device of a microwave oven.", "\nThe mechanisms of microwave ovens have become noticeably sophisticated in recent years. ", "Reflecting this, a variety of data display devices are provided for them. ", "Actually, many of these mechanisms use a fluorescent display tube containing a large number of display positions. ", "A fluorescent display tube typically contains an anode which is a display unit itself, a heater emitting electrons to said anode, and grid electrodes controlling electrons. ", "Specifically, such a multi-display-position fluorescent display tube has such a configuration in which a heater is provided in order to commonly cover all display positions, while external terminals extend from the right and the left. ", "As a result, if the heater voltage significantly drops to a critical level from a specific voltage existing between the heater and anode, a difference in luminance will occur in the luminance between the uppermost and the lowest display positions.", "\nA microwave oven performs a cooking by properly controlling the ON-OFF operations of either the microwave heating via magnetron or the radiation heating via the heater in accordance with the instructions of the built-in microcomputer, thus consuming large amounts of power during the heating process. ", "This also causes the output voltage from the power transformer to vary when turning the power ON and OFF for heating operations, thus causing the luminance of the display tube to vary.", "\nA typical circuit diagram of a conventional microwave oven is shown in FIG. ", "1, except for the power circuit driving the heating device. ", "The commercial AC voltage is first transformed by the power transformer 1, followed by rectifying it into a DC voltage via a rectifying circuit 2 comprising full-wave rectifying diodes D1 through D4 and a capacitor C1, said DC voltage being converted into 100 KHz of high frequency power via an oscillation circuit 3. ", "A secondary coil of high frequency transformer 4 is provided with terminal A for connection to the microcomputer 5, terminal B for the heater potential operating the fluorescent display tube, and terminal C for the cut-off bias of the fluorescent display tube. ", "In addition, a secondary coil for the heater that operates the fluorescent display tube is provided. ", "A DC voltage VDD is generated by a rectifying circuit comprising diode D5 and capacitor C5, which is provided to the microcomputer 5. ", "A mid-range potential VH is then generated by a rectifying circuit comprising diode D6 and capacitor C6 for delivery to the heater, and said potential VH is provided the mid-point of the heater coil, thus causing the display erase potential VP to be generated in the rectifying circuit comprising diode D7 and capacitor C7. ", "The potential VP is then sent to both the anode and grid electrodes of the fluorescent display tube 6 via resistors R4 and R5. ", "The anode electrode of the segment of the fluorescent display tube 6 and the grid electrodes of each display position are respectively connected to the output pins of the microcomputer 5, while each of these electrodes is provided with a ground level according to the contents to be displayed. ", "Potentials thus obtained are shown in FIG. ", "2, in which, VDD corresponds to -15 V, VH -24 V, and VP -28 V against the ground level VSS, respectively. ", "Difference Ek between the lowest potential of the heater voltage (AC) and the display erase voltage VP is used for the cut-off bias voltage.", "\nAs described above, since conventional fluorescent display power supply devices drive heaters by means of high frequencies, any problem related to the difference of the display luminance can be solved. ", "Nevertheless, they still contain complex circuit constructions, in particular, such a high frequency power oscillation circuit adversely affects broadcast receiving equipment. ", "In addition, those conventional circuits need a large number of coil terminals for the power transformer in order to generate the cut-off bias voltage Ek." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006457381532527506, 0.0006464419420808554, 0.0005428538424894214, 0.0006171474815346301, 0.0007582103717140853, 0.0007634963840246201, 0.0007015911396592855, 0.0006946843350306153, 0.0007226755260489881, 0.000641089747659862, 0.000607446301728487, 0.0006918160361237824, 0.0006440694560296834, 0.0006380523554980755, 0.0008037809748202562, 0.0007682387949898839, 0.000711514032445848, 0.0005774840828962624, 0.0005934134242124856, 0.0007668260368518531, 0.0010619597742334008, 0.000585068017244339, 0.0006764276186004281, 0.0008578965207561851 ]

[ "<?", "php\n/**\n * Kunena Component\n * @package Kunena.", "Template.", "Crypsis\n * @subpackage Layout.", "Category\n *\n * @copyright Copyright (C) 2008 - 2020 Kunena Team. ", "All rights reserved.", "\n * @license https://www.gnu.org/copyleft/gpl.html GNU/GPL\n * @link https://www.kunena.org\n **/\ndefined('_JEXEC') or die;\n\nuse Joomla\\CMS\\HTML\\HTMLHelper;\nuse Joomla\\CMS\\Language\\Text;\n\n?", ">\n<form action=\"<?php echo KunenaRoute::_('index.php?option=com_kunena&view=category') ?", ">\" method=\"post\"\n name=\"kcategoryform\" id=\"kcategoryform\">\n\t<input type=\"hidden\" name=\"userid\" value=\"<?php echo $this->user->userid; ?", ">\" />\n\t<?", "php echo HTMLHelper::_('form.token'); ?", ">\n\n\t<h3>\n\t\t<?", "php echo $this->escape($this->headerText); ?", ">\n\t\t<span class=\"badge badge-info\"><?php echo (int) $this->pagination->total; ?", "></span>\n\n\t\t<?", "php if (!", "empty($this->actions) && !", "empty($this->categories)) : ?", ">\n\t\t\t<div class=\"form-group\">\n\t\t\t\t<div class=\"input-append pull-right\">\n\t\t\t\t\t<div class=\"input-group-btn\">\n\t\t\t\t\t\t<?", "php echo HTMLHelper::_('select.genericlist', $this->actions, 'task', 'size=\"1\"', 'value', 'text', 0,\n\t\t\t\t\t\t\t'kchecktask'); ?", ">\n\t\t\t\t\t\t<input type=\"submit\" name=\"kcheckgo\" class=\"btn\"\n\t\t\t\t\t\t value=\"<?php echo Text::_('COM_KUNENA_GO') ?", ">\"/>\n\t\t\t\t\t</div>\n\t\t\t\t</div>\n\t\t\t</div>\n\t\t<?", "php endif; ?", ">\n\n\t\t<?", "php if (!", "empty($this->embedded)) : ?", ">\n\t\t\t<div class=\"pull-right\">\n\t\t\t\t<?", "php echo $this->subLayout('Widget/Pagination/List')\n\t\t\t\t\t->set('pagination', $this->pagination)\n\t\t\t\t\t->set('display', true); ?", ">\n\t\t\t</div>\n\t\t<?", "php endif; ?", ">\n\t</h3>\n\n\t<table class=\"table table-striped<?php echo KunenaTemplate::getInstance()->borderless(); ?", ">\">\n\n\t\t<?", "php if (!", "empty($this->actions) && !", "empty($this->categories)) : ?", ">\n\t\t\t<thead>\n\t\t\t<tr>\n\t\t\t\t<th colspan=\"3\"></th>\n\t\t\t\t<th class=\"center\">\n\t\t\t\t\t<input class=\"kcheckallcategories\" type=\"checkbox\" name=\"toggle\" value=\"\"/>\n\t\t\t\t</th>\n\t\t\t</tr>\n\t\t\t</thead>\n\t\t<?", "php endif; ?", ">\n\n\t\t<?", "php if (empty($this->categories)) : ?", ">\n\t\t\t<tbody>\n\t\t\t<tr>\n\t\t\t\t<td>\n\t\t\t\t\t<?", "php echo Text::_('COM_KUNENA_CATEGORY_SUBSCRIPTIONS_NONE') ?", ">\n\t\t\t\t</td>\n\t\t\t</tr>\n\t\t\t</tbody>\n\t\t<?", "php else : ?", ">\n\t\t\t<tbody>\n\t\t\t<?", "php\n\t\t\tforeach ($this->categories as $this->category)\n\t\t\t{\n\t\t\t\techo $this->subLayout('Category/List/Row')\n\t\t\t\t\t->set('category', $this->category)\n\t\t\t\t\t->set('config', $this->config)\n\t\t\t\t\t->set('checkbox', !", "empty($this->actions));\n\t\t\t}\n\t\t\t?", ">\n\t\t\t</tbody>\n\t\t<?", "php endif; ?", ">\n\n\t</table>\n</form>\n" ]

{ "pile_set_name": "Github" }

[ 0.0010000207694247365, 0.0016575545305386186, 0.000700967968441546, 0.0013795859413221478, 0.0006329468451440334, 0.0006133944261819124, 0.08078539371490479, 0.0006261327071115375, 0.0008207176579162478, 0.0011433074250817299, 0.0006292785983532667, 0.0014887892175465822, 0.0008024016278795898, 0.0008848372381180525, 0.0009342416888102889, 0.00209058984182775, 0.005656726658344269, 0.0008944068104028702, 0.0007168251322582364, 0.000767379766330123, 0.0006338777020573616, 0.001145396614447236, 0.0010693708900362253, 0.0010388927767053246, 0.00209058984182775, 0.0009034584509208798, 0.0007845546351745725, 0.0010737486882135272, 0.0009181073401123285, 0.0010693708900362253, 0.0007099595968611538, 0.0011029898887500167, 0.00209058984182775, 0.005656726658344269, 0.0008944068104028702, 0.0008607637137174606, 0.0010693708900362253, 0.0010388927767053246, 0.0007691800710745156, 0.002617118414491415, 0.0006298540392890573, 0.002409334760159254, 0.0008890776662155986, 0.0026335108559578657, 0.0012405726592987776, 0.0012242752127349377, 0.0016199210658669472, 0.0010693708900362253, 0.0008395635522902012 ]

[ "Q:\n\ncodeigniter xss validation\n\nIn CI userguide it says \"The following is a list of all the prepping functions that are available to use:\"\nxss_clean = Runs the data through the XSS filtering function.....\nComments in my code has my question. ", "Please read.", "\nNote: Not interested enabling xss globally!!!", "\nThanks in advance\n$this->form_validation->set_rules('select_language', 'Language', 'trim|required|xss_clean');\n\n//Has this been cleaned above while validating and ready to be used or ...\n$language = $this->input->post('text_fullname');\n\n//... do I have to add true to run the data through the XSS filtering again myslef?", "\n$language = $this->input->post('text_fullname', true);\n\nA:\n\nThe post data won't be filtered until you actually run the form validation.", "\n$this->form_validation->set_rules(\n 'select_language',\n 'Language',\n 'trim|required|xss_clean'\n);\n\n// Unaltered $_POST input\n$this->input->post('select_language');\n\n$this->form_validation->run();\n\n// Trimmed and xss_cleaned\n$this->input->post('select_language');\n\nAside: In my opinion, xss filtering makes more sense to use where it actually matters, on output, not input. ", "For example, if the xss filter is improved in a future release, you would want to take advantage of it right? ", "If you filter input only, it would be impossible without running the xss_clean function again on your output, which defeats the purpose of using it as a form validation rule.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006264573894441128, 0.0005876583163626492, 0.0010346436174586415, 0.0006139609031379223, 0.0006297174841165543, 0.0006621128413826227, 0.0006271220045164227, 0.0008320362539961934, 0.0019954426679760218 ]

[ "I may be willing to bet if the game was on TV, but your sorry-assed franchise with even more sorry-assed fans cant even sell out a game, so I am going to miss it live. ", "Thank you, Raiders. ", "Once again, you prove that you are the far inferior football team in the Bay. ", "You guys are a joke? ", "What kind of sad team cannot sell out the FIRST GAME OF THE YEAR against their cross-Bay rivals?", "\n\nsfsfsfgiants wrote:I may be willing to bet if the game was on TV, but your sorry-assed franchise with even more sorry-assed fans cant even sell out a game, so I am going to miss it live. ", "Thank you, Raiders. ", "Once again, you prove that you are the far inferior football team in the Bay. ", "You guys are a joke? ", "What kind of sad team cannot sell out the FIRST GAME OF THE YEAR against their cross-Bay rivals?", "\n\nfirst off \" i may be willing to bet\"\n\nwtf does it have to do with being on TV man up or shut your pie hole.....\n\"its not on tv i better not bet\" sounds like a weak ass excuse to me.", "\n\nsecondly \" raiders ,sorry ass ?\" **** ", "if you were a true niner fan you would ask your mommy for bart money and GO TO THE GAME.", "\nor are you not allowed out that late without your big sister....\n\nthird and final point \"what kind of a sad team cannot sell out the first game?\"....", "\nits a preseason game dont make it sound like its opening day son.", "\n\nohh yeah that reminds me we open MONDAY NIGHT\n\none last thing......\nwhen you finally do get to watch the game and you see the camera sweep by me ...and i set my beer down order to have both hands free.", "\n\nyeah both the birds im flipping are directed towards you.", "\n\ni hope you read this post at about 7:30 tonight..\ni can see it now.....you getting all worked up and peeing on yourself..\nme relaxing at the game.", "\n\nLast edited by JOEL on Fri Aug 08, 2008 1:45 pm, edited 1 time in total.", "\n\nwtf does it have to do with being on TV man up or shut your pie hole.....\"its not on tv i better not bet\" sounds like a weak ass excuse to me.", "\n\nWhy would I bet on a game that I can't watch? ", "How stupid is that?", "\n\nJOEL wrote:secondly \" raiders ,sorry ass ?\" **** ", "if you were a true niner fan you would ask your mommy for bart money and GO TO THE GAME.or are you not allowed out that late without your big sister....\n\nI dont deal with ignorant, uneducated, illegal, non-English speaking Raider fans well, or I would buy a ticket.", "\n\nJOEL wrote:third and final point \"what kind of a sad team cannot sell out the first game?\"....its a preseason game dont make it sound like its opening day son.", "\n\nohh yeah that reminds me we open MONDAY NIGHT\n\nThe Niners sell out every preseason game. ", "Most teams do. ", "They come with your season tickets. ", "My dad and I have gone to every Niner preseason game for six years now, and I can say that though it isnt full, the tickets are sold. ", "The Raiders obviously can't say that, or they would be televized.", "\n\nJOEL wrote:one last thing......when you finally do get to watch the game and you see the camera sweep by me ...and i set my beer down order to have both hands free.", "\n\nMr. Crackerz wrote:Man SFx3... i've never seen anyone so worked up for a preseason game. ", "And the first one for that matter. ", "Usually the least enjoyable one because almost everyone big sits out. ", "remember PRESEASON!", "\n\n-MC\n\nP.S.The Raiders will beat down on the Winers tonight!", "\n\nI'm actually pretty calm right now... just wait until the regular season." ]

{ "pile_set_name": "Pile-CC" }

[ 0.1430543065071106, 0.0005877320072613657, 0.2156543880701065, 0.1827249974012375, 0.011360589414834976, 0.03859281912446022, 0.0005877320072613657, 0.2156543880701065, 0.1827249974012375, 0.011360589414834976, 0.8637652397155762, 0.9330291152000427, 0.026858879253268242, 0.0989576205611229, 0.0021046544425189495, 0.002112877555191517, 0.0024619130417704582, 0.35626786947250366, 0.0006607446703128517, 0.967955470085144, 0.001881019095890224, 0.9679489731788635, 0.8080514073371887, 0.3676806688308716, 0.0016230435576289892, 0.0030799065716564655, 0.0006755389622412622, 0.0012592641869559884, 0.0007909732521511614, 0.0010690473718568683, 0.0010420489124953747, 0.000905030348803848, 0.0006715210038237274, 0.0008132270886562765, 0.0008881192188709974, 0.12935088574886322, 0.0006930698873475194 ]

[ "Introduction {#Sec1}\n============\n\nInositol 1,4,5-trisphosphate receptors (IP~3~Rs) are intracellular Ca^2+^ channels that are expressed in most animal cells and release Ca^2+^ from the endoplasmic reticulum (ER) in response to the many signals that stimulate IP~3~ formation. ", "IP~3~Rs are molecular coincidence detectors^[@CR1]^ because they open and release Ca^2+^ only when they bind both IP~3~ and Ca^2+^. This dual regulation, where IP~3~ binding primes IP~3~Rs to respond to Ca^2+^, allows IP~3~Rs to respond to Ca^2+^ from other channels^[@CR2]^ and to propagate Ca^2+^ signals regeneratively between IP~3~Rs^[@CR3]^. The latter generates a hierarchy of Ca^2+^ release events that can be detected using total internal reflection fluorescence microscopy (TIRFM). ", "These 'optical patch-clamp' measurements^[@CR4]^ reveal tiny cytosolic Ca^2+^ signals that reflect the openings of single IP~3~Rs. ", "As IP~3~ concentrations increase, Ca^2+^ released from an active IP~3~R ignites the activity of its IP~3~-bound neighbours to give larger local Ca^2+^ signals ('Ca^2+^ puffs'), and then Ca^2+^ waves that spread across the cell. ", "These global Ca^2+^ waves become more frequent as IP~3~ concentrations increase further^[@CR5]^. The spatiotemporal complexity of IP~3~-evoked Ca^2+^ signals allows increases in cytosolic Ca^2+^ concentration to selectively regulate diverse processes, including development, migration, metabolism and neuronal functions^[@CR6]^.\n\nIP~3~-evoked Ca^2+^ release also links extracellular stimuli to store-operated Ca^2+^ entry (SOCE)^[@CR7]^, which is activated when the ER loses Ca^2+^. The core components of most SOCE pathways are the ER Ca^2+^ sensor, stromal interaction molecule-1 (STIM1) and the plasma membrane (PM) Ca^2+^ channel, Orai^[@CR8]^. Loss of Ca^2+^ from the luminal EF hands of STIM1 causes STIM1 to oligomerize and expose cytosolic domains that bind to phosphatidylinositol 4,5-bisphosphate (PIP~2~) and Orai. ", "Binding of STIM1 to PIP~2~ in the PM traps STIM1 at stable ER-PM junctions, where the two membranes are closely apposed^[@CR9]--[@CR12]^. Tethered STIM1 then captures Orai and stimulates opening of its Ca^2+^-selective pore. ", "SOCE is activated only after substantial loss of Ca^2+^ from the ER^[@CR8],[@CR13]^, yet the ER must maintain other Ca^2+^-dependent functions, notably protein synthesis and maturation, alongside its contributions to Ca^2+^ signalling. ", "Such conflicting demands suggest a need to segregate different functions within the ER^[@CR14]^.\n\nMany studies suggest that all three IP~3~R subtypes are mobile within ER membranes^[@CR15]--[@CR17]^, and that signals arising from stimulation of phospholipase C (PLC) promote IP~3~R clustering^[@CR18]--[@CR24]^. Because most of these studies relied on over-expression of tagged IP~3~Rs, they may not faithfully report the behaviour of endogenous IP~3~Rs. ", "Furthermore, the conclusion that most IP~3~Rs are mobile contrasts with evidence that IP~3~-evoked Ca^2+^ signals often initiate repeatedly, and over protracted periods of stimulation, from the same intracellular sites^[@CR25]--[@CR27]^. The lack of any satisfactory explanation for this apparently paradoxical mobility of IP~3~Rs and immobility of Ca^2+^ release sites highlights the need to understand how the subcellular geography of IP~3~Rs and Ca^2+^ signals are related.", "\n\nHere, we use gene editing to tag endogenous IP~3~R1 of human cells with monomeric enhanced green fluorescent protein (EGFP). ", "The EGFP-IP~3~R1s are functional and allowed high-resolution measurements of both IP~3~R distribution and the Ca^2+^ signals evoked by IP~3~. We show that a small pool of immobile IP~3~Rs tethered close to ER-PM junctions are 'licensed' to respond to IP~3~. These IP~3~Rs are optimally placed to respond to IP~3~ delivered from PLC and to regulate SOCE.", "\n\nResults {#Sec2}\n=======\n\nEndogenous IP~3~Rs are clustered {#Sec3}\n--------------------------------\n\nIP~3~R1 is the major IP~3~R subtype in HeLa cells^[@CR28]^. We used transcription activator-like effector nucleases (TALENs)^[@CR29]^ to tag all endogenous IP~3~R1 of HeLa cells with monomeric EGFP (Supplementary Figs.", " [1](#MOESM1){ref-type=\"media\"}, [2](#MOESM1){ref-type=\"media\"}). ", "We chose EGFP for tagging because we had previously tagged endogenous IP~3~R1 with mCherry and then detected substantial fluorescence in lysosomes, wherein mCherry but not EGFP is relatively stable^[@CR30]^. There were no such problems with EGFP-IP~3~R1 (Supplementary Fig.", " [3](#MOESM1){ref-type=\"media\"}). ", "Within the gene-edited EGFP-IP~3~R1 HeLa cells, EGFP-IP~3~R1 was functional and there was no off-target tagging of other proteins (Fig.", " [1a](#Fig1){ref-type=\"fig\"} and Supplementary Figs.", " [1](#MOESM1){ref-type=\"media\"}--[3](#MOESM1){ref-type=\"media\"}). ", "In live cells, EGFP-IP~3~R1 was expressed in ER membranes and formed discrete puncta within them (Fig.", " [1b](#Fig1){ref-type=\"fig\"} and Supplementary Fig.", " [4](#MOESM1){ref-type=\"media\"}). ", "Most cells express more than one of the three IP~3~R subtypes, and the subunits can form heterotetrameric channels. ", "HeLa cells express IP~3~R1 (61%), IP~3~R2 (9%) and IP~3~R3 (30%)^[@CR28]^. This pattern of expression was unaffected by tagging endogenous IP~3~R1 with EGFP (Fig.", " [1c](#Fig1){ref-type=\"fig\"}), and co-immunoprecipitation confirmed that EGFP-IP~3~R1 co-assembles with endogenous IP~3~R2 and IP~3~R3 subunits (Fig.", " [1d](#Fig1){ref-type=\"fig\"}). ", "Assuming that IP~3~R subunits assemble randomly into tetramers, which may be an over-simplification^[@CR31]^, but it is consistent with our immunoprecipitation results (Fig.", " [1d](#Fig1){ref-type=\"fig\"}), we expect about 98% of all tetrameric IP~3~Rs to include at least one IP~3~R1 subunit. ", "Since all IP~3~R1 are tagged with EGFP (Fig.", " [1c](#Fig1){ref-type=\"fig\"}) and under optimal conditions about 80% of expressed EGFP is fluorescent^[@CR32]^, about 93% of all tetrameric IP~3~Rs in EGFP-IP~3~R1 HeLa cells should include at least one fluorescent subunit, suggesting that most IP~3~Rs are visualized in our gene-edited cells.", "Fig. ", "1Endogenous IP~3~R1s form puncta. **", "a** In-gel fluorescence of lysates from EGFP-IP~3~R1 HeLa cells (GR) and control (WT) cells demonstrates that the only fluorescence is associated with EGFP-IP~3~R1 (green arrow). ", "Results typical of four gels. ", "Positions of selected *M* ~r~ markers (kDa) are shown (**a**, **c**, **d**). **", "b** TIRFM images of EGFP-IP~3~R1 HeLa cells showing a marker for the ER lumen (mCherry-ER). ", "The merged image and an enlargement of the boxed area show co-localization of EGFP-IP~3~R1 with mCherry-ER (Pearson's coefficient with Costes' automatic threshold = 0.93 ± 0.02; Costes *P* value = 1.00, *n* = 4 cells). ", "Scale bar = 5 µm (2 µm for enlargement). **", "c** Western blots (WBs) for IP~3~R1-3 show expression of tagged (green arrow, \\~290 kDa) and untagged (black arrow, \\~260 kDa) IP~3~R1 in GR and WT cells, respectively. ", "Expression of IP~3~R subtypes in GR cells is shown relative to control (WT) cells (%, mean ± SD, *n* = 3 for IP~3~R2 and IP~3~R3, *n* = 4 for IP~3~R1). ", "Comparisons of band intensities using paired Student's *t*-tests indicated no significant differences between WT and EGFP-IP~3~R1 cells. **", "d** WB (IP~3~R1-3 antibodies) from lysates of EGFP-IP~3~R1 HeLa cells after immunoprecipitation with GFP-Trap. ", "Eluate lanes were loaded with sample equivalent to 1.5 times the amounts loaded in the lysate lanes. ", "Numbers show % of each subtype detected in the pull-down (*n* = 2). **", "e** Photobleaching of a punctum showing the final bleaching step (bracket) and the initial fluorescence (dashed line) used to calculate the total number of fluorophores (*n*). ", "FU, fluorescence units. **", "f** Single-step photobleaching results (284 puncta from five cells, Supplementary Fig.", " [5](#MOESM1){ref-type=\"media\"}) were used to calculate the number of tetrameric IP~3~Rs per punctum (8.4 ± 7)\n\nTIRFM and single-step photobleaching^[@CR32]^ of fixed EGFP-IP~3~R1 HeLa cells were used to determine the number of fluorophores associated with each punctum, and thereby the mean number of tetrameric IP~3~Rs per punctum (8.4, range from 1 to \\~40) (Fig.", " [1e, f](#Fig1){ref-type=\"fig\"} and Supplementary Fig.", " [5](#MOESM1){ref-type=\"media\"}). ", "Since TIRFM, which is required for the photobleaching analyses, only detects EGFP-IP~3~R1 within about 140 nm of the PM, we used spinning disc confocal microscopy to examine the distribution of EGFP-IP~3~R1 in the rest of the cell. ", "EGFP-IP~3~R1 puncta, with features similar to those observed by TIRFM, were present throughout the cell (Supplementary Fig.", " [6](#MOESM1){ref-type=\"media\"}). ", "We conclude that many near-PM IP~3~Rs, and probably most IP~3~Rs in the cell, are assembled into small clusters, suggesting that these clusters are the elementary structural units of IP~3~R signalling. ", "This is consistent with our observation that we rarely observed splitting of puncta (Supplementary Movies [1](#MOESM4){ref-type=\"media\"}--[3](#MOESM1){ref-type=\"media\"}).", "\n\nMobile and immobile populations of IP~3~Rs {#Sec4}\n------------------------------------------\n\nMost EGFP-IP~3~R1 puncta were mobile (74 ± 18%, mean ± SEM, *n* = 10 cells), while other puncta remained immobile for many minutes (Fig.", " [2a](#Fig2){ref-type=\"fig\"} and Supplementary Movie [1](#MOESM4){ref-type=\"media\"}). ", "Fluorescence recovery after photobleaching (FRAP) confirmed the presence of mobile and immobile EGFP-IP~3~R1s (Fig.", " [2b--e](#Fig2){ref-type=\"fig\"}). ", "Within the cell periphery, the mobile fraction (*M* ~f~) was significantly larger than in perinuclear regions (Fig.", " [2d](#Fig2){ref-type=\"fig\"}). ", "The half-times for recovery in peripheral and perinuclear regions (*t* ~½~ = 62 ± 6 s, *n* = 26 cells and 61 ± 12 s, *n* = 25 cells, respectively) and the calculated diffusion coefficients (*D*) were similar in each region (Fig.", " [2e](#Fig2){ref-type=\"fig\"}). ", "We present estimates of *D* to allow comparisons with published data^[@CR15]--[@CR17]^, but subsequent experiments demonstrate that only some mobile IP~3~R puncta move by diffusion alone. ", "A better (but similar) estimate of *D* is provided by our analysis of puncta shown to move only by diffusion (*D* = 0.0308 ± 0.002 μm^2^ s^−1^) (see Supplementary Fig.", " [10a, e](#MOESM1){ref-type=\"media\"}).Fig. ", "2IP~3~Rs form mobile and immobile puncta. **", "a** Time-lapse TIRFM images (0.6-s intervals) of EGFP-IP~3~R1 in cells expressing mCherry-ER. ", "Track of a single particle, with the first and last positions shown by white and yellow arrows, respectively. ", "Scale bar = 5 µm. **", "b** Representative epifluorescence image of an EGFP-IP~3~R1 HeLa cell with perinuclear (blue) and peripheral (magenta) regions highlighted for FRAP analysis (circular bleached area, radius = 1.84 μm). ", "The boxed area is enlarged to show pre- and post-bleach (after 120 s) images of the peripheral region. ", "Scale bars = 5 µm. **", "c** Normalized fluorescence intensities recorded from peripheral or perinuclear regions in a typical FRAP experiment with live and fixed EGFP-IP~3~R1 HeLa cells. **", "d**, **e** Summary results show mobile fractions (*M* ~f~, mean ± SEM) (**d**) and diffusion coefficients (*D*, mean and all values) (**e**) for perinuclear (25 cells) and peripheral regions (26 cells). ", "\\*\\*\\*\\**P* \\< 0.0001, \\**P \\< *0.05, two-tailed Student's *t*-test. **", "f** Distribution of fluorescence intensities for individual mobile and immobile puncta. ", "Inset shows distribution for the brightest immobile puncta. **", "g** Relative numbers of mobile and immobile puncta, and distribution of fluorescence between them (%). ", "Results (**f**, **g**) are from time-lapse TIRFM images of 10 cells (mean ± SD). **", "h**, **i** Analysis of bleaching steps of brightest and dimmest puncta in fixed cells was used to determine the step amplitude (**h**) and number of steps (**i**) for each punctum (Supplementary Fig.", " [8](#MOESM1){ref-type=\"media\"}). ", "Mean ± SD, with 23--25 puncta analysed in each of two cells. ", "\\*\\*\\**P* \\< 0.001, \\*\\*\\*\\**P* \\< 0.0001, Student's *t*-test\n\nThe TIRFM analyses of mobility, which exclude perinuclear regions but include the periphery, suggest that 74% of puncta are mobile. ", "This matches the *M* ~f~ determined by FRAP in the cell periphery (0.77). ", "The similarity might suggest that IP~3~Rs within immobile puncta do not exchange with mobile IP~3~Rs. ", "We tested this directly with a FRAP experiment in which recoveries of fluorescence within mobile and immobile puncta were independently quantified (Fig.", " [3a--e](#Fig3){ref-type=\"fig\"} and Supplementary Fig.", " [7](#MOESM1){ref-type=\"media\"}). ", "The fluorescence of immobile puncta recovered very slowly: after 15 min, fluorescence from mobile puncta had recovered to 62 ± 9% (*n* = 3) of its initial value, while that from immobile puncta had recovered by only 5.1 ± 2.2% (Fig.", " [3e](#Fig3){ref-type=\"fig\"}). ", "We also occasionally observed examples of mobile puncta seemingly passing unperturbed through an immobile punctum (Fig.", " [3f](#Fig3){ref-type=\"fig\"} and Supplementary Movie [2](#MOESM5){ref-type=\"media\"}). ", "We conclude that there is negligible exchange of IP~3~Rs over many minutes between mobile and immobile puncta.", "Fig. ", "3IP~3~Rs within mobile puncta do not exchange with immobile puncta. **", "a** TIRFM images of FRAP experiment show images before, immediately after and 60 min after bleaching. ", "Bleached area shown by white rectangle. ", "Times shown as h:min:s. **b**, **c** Enlarged images of yellow boxed area in **a**. ", "Immobile puncta were identified by overlaying two frames (30 s apart) using pseudocolours for each (green and magenta), such that immobile puncta appear white in the overlay (iii, iv) (Supplementary Fig.", " [7](#MOESM1){ref-type=\"media\"}). ", "Images were captured before photobleaching (**b**) and after recovery for 15 min (**c**). ", "Enlarged areas (red boxes in iii) are shown in (iv). ", "Scale bars (**a**--**c**) = 10 µm. **", "d** Enlargements (blue boxes in **b** iv and **c** iv) show images before and 15 min after bleaching. ", "Scale bar = 2 µm. ", "Abundant green and magenta puncta in the post-bleach images (**c**, and lower in **d**) indicate rapid exchange of mobile EGFP-IP~3~R, while the scarcity of white puncta suggests very slow exchange of immobile EGFP-IP~3~R1. **", "e** Summary results show fluorescence recovery (*F*/*F* ~0~, %, mean ± SEM) from three cells (26 ± 15 immobile puncta per cell were identified in the initial images). **", "f** Example trace from a region centred on an immobile punctum (circled in first image) shows stepwise increase and decrease in fluorescence intensity as a mobile punctum (arrows) moves through the immobile punctum (Supplementary Movie [2](#MOESM5){ref-type=\"media\"}). ", "Scale bar = 1 μm\n\nIP~3~Rs are diffusely distributed within puncta {#Sec5}\n-----------------------------------------------\n\nMost mobile and immobile puncta had similar distributions of fluorescence intensity, but a small fraction of immobile puncta (1.6%) were much brighter (about three- to eightfold brighter than average) (Fig.", " [2f, g](#Fig2){ref-type=\"fig\"}). ", "The difference might be due to bright puncta including more EGFP-IP~3~R1s, or to them being closer to the PM (and so brighter in TIRFM)^[@CR33]^. The amplitude of the single-step bleaching events and the number of bleaching steps were each about twofold larger for the brightest puncta (Fig.", " [2h, i](#Fig2){ref-type=\"fig\"} and Supplementary Fig.", " [8](#MOESM1){ref-type=\"media\"}). ", "This suggests that the brightest immobile puncta, which include about 3% of the fluorescence detected within puncta, are both closer to the PM and include more EGFP-IP~3~R1s than other puncta.", "\n\nWe used stochastic optical reconstruction microscopy (STORM) to resolve the distribution of EGFP-IP~3~R1s within puncta. ", "The fixation required for STORM had no effect on the size or distribution of the puncta observed in live cells (Supplementary Fig.", " [9](#MOESM1){ref-type=\"media\"}). ", "By recording from live cells before fixation, we could identify mobile and immobile puncta in the subsequent STORM images (Fig.", " [4a](#Fig4){ref-type=\"fig\"}). ", "The resolution of these images (\\~45 nm) is not sufficient to distinguish single IP~3~Rs from very small clusters (of up to about four IP~3~Rs), but it is clear that the distribution of fluorophores within most immobile puncta was heterogeneous: some IP~3~Rs were tightly packed, while others were more loosely distributed (Fig.", " [4b](#Fig4){ref-type=\"fig\"}). ", "The distances between some IP~3~Rs within a punctum (up to about 200 nm) were too large for the punctum to be assembled by direct interactions between IP~3~Rs, as each tetrameric IP~3~R has a diameter of only 20 nm^[@CR34]^. Similar analyses of mobile puncta revealed that although IP~3~Rs were more tightly packed than in immobile puncta, here too the spacing of IP~3~Rs was often too large for direct interactions between IP~3~Rs to mediate their association (Fig.", " [4c, d](#Fig4){ref-type=\"fig\"}). ", "We conclude that IP~3~Rs are corralled within mobile and immobile puncta by mechanisms that do not require direct contact between IP~3~Rs (Fig.", " [4e](#Fig4){ref-type=\"fig\"}).Fig. ", "4EGFP-IP~3~Rs are diffusely distributed within puncta. **", "a** Examples of TIRFM and subsequent STORM images of EGFP-IP~3~R1 puncta. ", "Scale bar = 0.5 µm. **", "b**, **c** Before STORM, mobile and immobile puncta were identified using TIRFM and by overlaying pseudocoloured images collected at 10-s intervals (Supplementary Fig.", " [7](#MOESM1){ref-type=\"media\"}). ", "Examples of TIRFM and STORM images show immobile (**b**) and mobile puncta (**c**). ", "Overlays show that EGFP-IP~3~R1s are diffusively distributed within mobile and immobile puncta. ", "Scale bars = 100 nm. ", "The yellow squares show approximate dimensions of an IP~3~R (20 nm × 20 nm). **", "d** Analysis of STORM images shows the area enclosing all EGFP-IP~3~R1s within each punctum and the density of localization events within the punctum for mobile and immobile puncta (mean ± SD for 4--6 puncta). ", "\\**P* \\< 0.05, Student's *t*-test, relative to immobile puncta. ", "Results show that mobile puncta are smaller and contain fewer IP~3~Rs than immobile puncta. **", "e** Many IP~3~Rs within puncta are too diffusively distributed to allow direct interactions between them. ", "Although we used a non-oligomerizing EGFP to tag IP~3~R1 and minimize potential artefacts, the diffuse spacing of some EGFP-IP~3~R1s confirms that puncta are not formed by interactions between EGFP\n\nIP~3~Rs are moved by diffusion and microtubule motors {#Sec6}\n-----------------------------------------------------\n\nWe used TIRFM and single-particle tracking to quantify movements of EGFP-IP~3~R1 puncta within the ER (Fig.", " [5a--c](#Fig5){ref-type=\"fig\"} and Supplementary Fig.", " [10](#MOESM1){ref-type=\"media\"}). ", "Only the flattest regions of the cell, remote from the nucleus and typically comprising 30--50% of the cell area, were amenable to these analyses. ", "If all mobile IP~3~Rs moved randomly by diffusion, the relationship between time and mean squared displacement should be linear (Supplementary Fig.", " [10a, e](#MOESM1){ref-type=\"media\"}), or sub-linear if diffusion is impeded by the labyrinthine architecture of the ER^[@CR35]^. However, single-particle trajectories of 2,698 tracks from five cells demonstrate that the relationship is supra-linear (Fig.", " [5d, e](#Fig5){ref-type=\"fig\"}), suggesting that at least some puncta move directionally. ", "The trajectories of individual puncta revealed that some particles moved randomly, while others showed directional movement (Fig.", " [5f](#Fig5){ref-type=\"fig\"}). ", "These analyses identified distinct populations: immobile puncta (31 ± 4% of puncta were immobile or sub-diffusive) and mobile puncta that moved by diffusion (63 ± 2%) or directionally (7 ± 2%) (Fig.", " [5g](#Fig5){ref-type=\"fig\"} and Supplementary Fig.", " [10](#MOESM1){ref-type=\"media\"}). ", "Most puncta (96%) maintained a single form of motion throughout the \\> 3-s recording (see Methods).Fig. ", "5IP~3~Rs move by diffusion and by directed motion along microtubules. **", "a** TIRFM image used for single-particle tracking shows characteristic reticular ER. ", "Scale bar = 5 µm. **", "b** Trajectories of all puncta from the region defined by white lines in **a**. ", "Colours indicate different trajectories. **", "c** Enlargement showing trajectories within the boxed area in **a**. **", "d** Average mean squared displacement (MSD) for all puncta within each cell plotted against time. ", "Results are from five cells, with 225--926 puncta analysed in each. **", "e** Pooled results from five cells (2,698 tracks). **", "f** Examples of single-particle trajectories (collected at 100-ms intervals) for an immobile punctum (i) or mobile puncta moving by diffusion (ii) or directionally (iii). **", "g** Distribution of EGFP-IP~3~R1 puncta between mobility states. ", "Trajectories of 1,509 puncta from five cells were analyzed by TraJClassifier (Supplementary Fig.", " [10](#MOESM1){ref-type=\"media\"}). **", "h** Wide-field images, typical of nine cells, show EGFP-IP~3~R1 puncta, microtubules (mCherry-tubulin) and their co-localization. ", "Final panel shows an enlargement of the boxed area in the overlay. ", "Scale bar = 10 µm (2 µm in enlargement)\n\nWe next addressed the mechanisms of directional movement. ", "There was significant co-localization of EGFP-IP~3~R1 with microtubules (Fig.", " [5h](#Fig5){ref-type=\"fig\"}). ", "The ER is itself dynamic, with microtubules contributing to its mobility directly and via kinesin-1 and cytoplasmic dynein motors^[@CR36]^. However, IP~3~Rs were much more mobile than the ER (Supplementary Movie [3](#MOESM6){ref-type=\"media\"}), demonstrating that IP~3~Rs move within the ER. ", "Disrupting microtubule dynamics has been shown to slow IP~3~R movement, attenuate IP~3~-evoked Ca^2+^ signals and disrupt their spatial organization (see references in ^[@CR24]^), but many of these effects could be secondary to changes in ER structure. ", "In EGFP-IP~3~R1 HeLa cells, disrupting microtubule polymerization with nocodazole caused shrinkage of microtubules and slow retraction of the ER from the PM (Supplementary Fig.", " [11a, b](#MOESM1){ref-type=\"media\"}), consistent with previous reports^[@CR37]^. Nocodazole reduced the number of directional trajectories without affecting either the speed of the few that remained, or *D* for the diffusing puncta (Supplementary Fig.", " [11c--e](#MOESM1){ref-type=\"media\"}). ", "Both the ER and IP~3~R3 can associate with the growing plus-ends of microtubules via end-binding (EB) proteins^[@CR24]^, but there was no specific co-localization of mCherry-EB3 and directionally moving EGFP-IP~3~R1 puncta (Supplementary Movie [4](#MOESM7){ref-type=\"media\"} and Supplementary Fig.", " [11f--h](#MOESM1){ref-type=\"media\"}). ", "Since EGFP-IP~3~R1 puncta appear not to move by association with EB proteins, we considered a role for microtubule motors (Supplementary Fig.", " [12a](#MOESM1){ref-type=\"media\"}).", "\n\nGFP-Trap precipitated kinesin-1 (KIF5) from lysates of EGFP-IP~3~R1 HeLa cells, and in the reciprocal analysis a kinesin-1 antibody pulled down IP~3~R1. ", "A dynein antibody also precipitated EGFP-IP~3~R1 (Supplementary Fig.", " [12b--d](#MOESM1){ref-type=\"media\"}). ", "These results show that kinesin-1 and dynein interact with IP~3~R1, directly or through additional proteins. ", "We used rapamycin-mediated dimerization to trap kinesin-1 at the PM after it had moved there along microtubules^[@CR38]^. PM trapping of kinesin-1 recruited EGFP-IP~3~R1s, but not GFP-ER~memb~ (a control ER membrane protein^[@CR36]^), to the same PM sites, confirming that IP~3~R1 can be conveyed along microtubules by kinesin-1 (Supplementary Movie [5](#MOESM8){ref-type=\"media\"} and Supplementary Fig.", " [13](#MOESM1){ref-type=\"media\"}).", "\n\nExpression of dominant-negative forms of kinesin heavy chain (KHC-CT) or cytoplasmic dynein (p50-mCherry)^[@CR36]^, or treatment with ciliobrevin D to inhibit dynein motors^[@CR39]^ reduced the number of puncta moving directionally, but the effects were not statistically significant (Supplementary Fig.", " [12e](#MOESM1){ref-type=\"media\"}). ", "Simultaneous inhibition of both motors significantly reduced both the number of directionally moving puncta and the speed of the few remaining directional puncta **(**Supplementary Fig.", " [12f, g](#MOESM1){ref-type=\"media\"}). ", "Evidence that kinesin and dynein contribute to directed movement of IP~3~Rs is consistent with the speed of directionally moving puncta (0.324 ± 0.040 μm s^−1^; Supplementary Fig.", " [10d, h, i](#MOESM1){ref-type=\"media\"}), which falls within the range of speeds reported for cargoes moved by mammalian kinesin^[@CR40]^ and dynein^[@CR41]^ motors.", "\n\nWe considered whether mobile IP~3~Rs might be held within membrane-bound vesicles separate from the ER^[@CR42]^. This seems unlikely since there was no coincident concentration of a luminal protein (mCherry-ER) with moving EGFP-IP~3~R1 puncta (Supplementary Movie [6](#MOESM9){ref-type=\"media\"} and Supplementary Fig.", " [14a](#MOESM1){ref-type=\"media\"}), and directional EGFP-IP~3~R1 trajectories overlaid the reticular ER defined by the trajectories of diffusing puncta (Supplementary Fig.", " [14b](#MOESM1){ref-type=\"media\"}). ", "We conclude that IP~3~Rs move within ER membranes by diffusion, or by directed motion that depends in part on kinesin and dynein motors.", "\n\nCa^2+^ puffs occur at immobile puncta close to the PM {#Sec7}\n-----------------------------------------------------\n\nWe used a red fluorescent Ca^2+^ indicator and TIRFM to visualize local Ca^2+^ release events in EGFP-IP~3~R1 HeLa cells. ", "Histamine evoked transient local Ca^2+^ signals (Supplementary Movie [7](#MOESM10){ref-type=\"media\"} and Supplementary Fig.", " [15a](#MOESM1){ref-type=\"media\"}). ", "These 'Ca^2+^ puffs' were similar to those recorded in other cells^[@CR3]^. Spinning disc confocal microscopy confirmed that almost all histamine-evoked local Ca^2+^ signals occurred close to the PM. ", "During matched recording intervals, we detected 69 ± 20 Ca^2+^ puffs per cell (*n* = 3 cells) close to the basal PM, but only 1.3 ± 1.2 puffs in a plane across the middle of the cell and even these few events (four in total) were at the cell periphery close to the PM (see Supplementary Fig.", " [16c, d](#MOESM1){ref-type=\"media\"}). ", "The occurrence of most histamine-evoked Ca^2+^ puffs close to the PM could result from targeted delivery of IP~3~ from endogenous signalling pathways at the PM. ", "However, photolysis of caged-IP~3~, which uniformly releases IP~3~ throughout the cell, evoked Ca^2+^ puffs similar to those evoked by histamine (Figs [6a--e](#Fig6){ref-type=\"fig\"}), and they too were concentrated near the PM, consistent with results from SH-SY5Y cells^[@CR43]^. In matched recordings from HeLa cells responding to photolysis of caged-IP~3~, we detected 103 ± 30 Ca^2+^ puffs per cell (*n* = 3 cells) close to the basal PM, but only 7 ± 2 puffs per cell in a plane across the middle of the cell. ", "The latter were invariably close to the PM (Supplementary Fig.", " [16](#MOESM1){ref-type=\"media\"}). ", "We conclude that Ca^2+^ puffs, whether evoked by endogenous signalling pathways or by uniform delivery of IP~3~ to the cytosol, are concentrated near the PM despite the presence of IP~3~R clusters throughout the cell (Supplementary Figs [6](#MOESM1){ref-type=\"media\"}, [16d](#MOESM1){ref-type=\"media\"}).Fig. ", "6Ca^2+^ puffs evoked by photolysis of caged-IP~3~ occur at immobile IP~3~Rs. **", "a** TIRFM image of a single cell loaded with EGTA and Cal-590 shows immobile IP~3~Rs (white, see Supplementary Fig.", " [7](#MOESM1){ref-type=\"media\"}) and Ca^2+^ puffs (red) evoked by photolysis of caged-IP~3~. Boxed area of the overlay (iii) is shown enlarged in (iv). ", "Scale bars = 10 µm. **", "b** Co-localization of Ca^2+^ release and immobile IP~3~R puncta shown by their fluorescence intensity profiles along the dashed line in **a** iv. ", "EGFP profiles were captured immediately before and \\~30 s after recording Cal-590 fluorescence. **", "c** Enlargements of four puff sites highlighted in **a** show co-localization of each Ca^2+^ release event with an immobile IP~3~R punctum. **", "d** Enlargements of site 2 (from **a**) show four successive puffs generated at the same immobile punctum. ", "Scale bars = 2 μm (**c**, **d**). **", "e** Temporal profiles of Cal-590 fluorescence changes (Δ*F*/*F* ~0~) show Ca^2+^ puffs last \\~200 ms. **", "f** Summary shows the fraction of Ca^2+^ puffs evoked by histamine (432 puffs in two cells, mean ± range) or photorelease of IP~3~ (871 puffs in three cells, mean ± SD) occurring at immobile IP~3~R puncta. ", "Events and puncta were considered to occur at the same site if the centre of mass of the peak change in Cal-590 fluorescence was within 6 pixels (0.96 µm) of the punctum. **", "g** Comparison of fluorescence intensity distributions of all detected EGFP-IP~3~R1 puncta, and puncta associated with Ca^2+^ puffs evoked by photolysis of caged-IP~3~. Results are from three cells. ", "Dashed lines show 50th and 95th percentiles for the intensities of all puncta\n\nIn the 30 s after photorelease of IP~3~, TIRFM detected 295 ± 20 Ca^2+^ puffs per cell (*n* = 3 cells) distributed across 75 ± 13 sites per cell, confirming that puffs often revisit the same site (Fig.", " [6d](#Fig6){ref-type=\"fig\"} and Supplementary Movie [8](#MOESM11){ref-type=\"media\"}). ", "The response to histamine (10 µM) was similar, with 125--307 puffs per cell distributed across 58--85 sites per cell (two cells) (Supplementary Movie [7](#MOESM10){ref-type=\"media\"}). ", "The occurrence of most Ca^2+^ puffs at a limited number of sites is consistent with other reports^[@CR26],[@CR27]^, although our results suggest there are many more such sites (\\>70 per cell) than previously reported (typically 4--5 per cell)^[@CR3],[@CR44]^. Most Ca^2+^ puffs, whether evoked by histamine or photolysis of caged-IP~3~, co-localized with immobile EGFP-IP~3~R1 puncta (Fig.", " [6a--d](#Fig6){ref-type=\"fig\"} and Supplementary Fig.", " [15](#MOESM1){ref-type=\"media\"}). ", "In the 30 s after photorelease of IP~3~, 74 ± 11% of the 295 Ca^2+^ puffs detected in three cells occurred at immobile puncta (Fig.", " [6f](#Fig6){ref-type=\"fig\"}), and 34 ± 8% of the immobile puncta coincided with a Ca^2+^ puff. ", "In these analyses, where mobile and immobile IP~3~Rs were identified from images collected immediately before and after imaging of Ca^2+^ signals for 30 s, we can identify most Ca^2+^ puffs, but cannot define the locations of moving puncta during the Ca^2+^ puffs (Fig.", " [6](#Fig6){ref-type=\"fig\"} and Supplementary Fig.", " [15](#MOESM1){ref-type=\"media\"}). ", "By collecting rapidly interleaved images of EGFP-IP~3~R1 and Ca^2+^ signals, we come much closer to relating the location of mobile puncta to Ca^2+^ puffs, although we lose the opportunity to detect all Ca^2+^ puffs. ", "We note that the distances travelled by moving IP~3~R puncta (\\~200 nm) during the interleaved recordings (Supplementary Fig.", " [10](#MOESM1){ref-type=\"media\"}) are so short that they would not affect our ability to identify spatially coincident Ca^2+^ puffs and mobile IP~3~R puncta. ", "Applying this approach to cells stimulated with histamine or photolysis of caged-IP~3~, we confirmed that most Ca^2+^ puffs co-localized with stable immobile IP~3~Rs (Supplementary Fig.", " [17](#MOESM1){ref-type=\"media\"}).", "\n\nOur results establish that Ca^2+^ puffs are generated by immobile IP~3~Rs that are segregated from the more abundant pool of mobile IP~3~Rs. ", "Some immobile puncta are larger than mobile puncta (Fig.", " [2f, g](#Fig2){ref-type=\"fig\"}), and larger clusters of IP~3~Rs have an increased probability of initiating Ca^2+^ puffs^[@CR45]^. However, this cannot be the only explanation for Ca^2+^ puffs occurring almost exclusively at immobile puncta (Fig.", " [6f](#Fig6){ref-type=\"fig\"} and Supplementary Fig.", " [17e](#MOESM1){ref-type=\"media\"}). ", "First, responsive puncta lie close to the PM (Supplementary Fig.", " [16](#MOESM1){ref-type=\"media\"}), which probably increases their brightness in TIRFM and so exaggerates (by \\~2-fold) the estimated number of IP~3~Rs within them (Fig.", " [2h](#Fig2){ref-type=\"fig\"}). ", "Second, the number of immobile puncta shown to initiate Ca^2+^ signals (34%, during a 30-s recording) is much larger than the number of unusually bright immobile puncta (only 1.6% were 3- to 8-fold brighter than the average punctum) (Fig.", " [2f](#Fig2){ref-type=\"fig\"}). ", "Third, although bright immobile puncta do initiate Ca^2+^ signals, many of the puncta that released Ca^2+^ had fluorescence intensities comparable to those of mobile puncta (Fig.", " [6g](#Fig6){ref-type=\"fig\"}). ", "We conclude that Ca^2+^ puffs evoked by IP~3~, whether delivered from endogenous signalling pathways or uniformly to the cytosol, occur at immobile IP~3~R puncta close to the PM.", "\n\nSTIM1 accumulates at junctions adjacent to immobile IP~3~Rs {#Sec8}\n-----------------------------------------------------------\n\nSOCE is stimulated when loss of Ca^2+^ from the ER causes STIM to translocate to ER-PM junctions, where it stimulates opening of Orai channels^[@CR8]^. Since most IP~3~R-mediated Ca^2+^ puffs occur at immobile IP~3~R puncta close to the PM, we asked whether immobile puncta reside near the ER-PM junctions where SOCE occurs. ", "We used TIRFM and immunostaining to detect formation of native STIM1 puncta at ER-PM junctions after treatment with thapsigargin to deplete ER Ca^2+^ stores. ", "Assessed pixel-by-pixel, there was no significant co-localization of STIM1 and EGFP-IP~3~R1 puncta (Fig.", " [7a, b](#Fig7){ref-type=\"fig\"}), but immobile IP~3~R1 puncta were often closely apposed to STIM1 puncta (Fig.", " [7b--e](#Fig7){ref-type=\"fig\"}). ", "We confirmed^[@CR8]^ that in cells with empty Ca^2+^ stores, mCherry-Orai1 and CFP-STIM1 were co-localized (Fig.", " [7f](#Fig7){ref-type=\"fig\"}), suggesting that STIM1 puncta identify functional sites of SOCE^[@CR8]^.Fig. ", "7Depletion of ER Ca^2+^ stores causes native STIM1 to accumulate at functional ER-PM junctions adjacent to immobile IP~3~R puncta. **", "a**, **b** Representative TIRFM images of EGFP-IP~3~R1 HeLa cells fixed and immunostained for STIM1 before (**a**) or after treatment with thapsigargin (Tg, 1 µM, 15 min) to deplete the ER of Ca^2+^ (**b**). ", "Overlaid images of Tg-treated cells show no significant co-localization of STIM1 and IP~3~R puncta (Pearson's coefficient with Costes' automatic threshold: 0.331 ± 0.026, *n* = 7 cells). **", "c** Distribution of mobile (green and magenta) and immobile (white) IP~3~R puncta in Tg-treated cell. ", "Scale bars (**a**--**c**) = 10 µm. **", "d** Enlargements of the boxed regions in **b** show that immobile IP~3~R puncta (identified before fixation (**c**), with all shown by arrowheads) abut STIM1 puncta without coinciding with them. ", "Scale bars = 2 µm. **", "e** Fluorescence intensity profiles for EGFP-IP~3~R1 and STIM1 across the lines shown in **d**. ", "Distances (μm) between the peaks of the fluorescence intensity for STIM1 and immobile IP~3~R are shown. **", "f** Co-localization of CFP-STIM1 (pseudocoloured green) and mCherry-Orai1 (red) puncta in a Tg-treated HeLa cell. ", "We used tagged proteins because available antibodies do not reliably detect endogenous Orai1. ", "Scale bar = 10 µm (2 μm in enlargement)\n\nIn EGFP-IP~3~R1 HeLa cells expressing STIM1-mCherry to allow real-time recording of EGFP-IP~3~R1 mobility and STIM1 translocation, loss of Ca^2+^ from the ER caused accumulation of STIM1 puncta at ER-PM junctions abutting immobile IP~3~R puncta (Fig.", " [8a--d](#Fig8){ref-type=\"fig\"}): 84 ± 9% (mean ± SD, *n* = 3) of immobile IP~3~R puncta were juxtaposed to STIM1 puncta (see legend to Fig.", " [8d](#Fig8){ref-type=\"fig\"}). ", "The sites where STIM1 accumulated were selectively adjacent to immobile, rather than mobile, IP~3~Rs (Fig.", " [8e](#Fig8){ref-type=\"fig\"}). ", "Although STIM1-mCherry puncta were much more abundant than immobile EGFP-IP~3~R1 puncta (Fig.", " [8f](#Fig8){ref-type=\"fig\"}), the average distance between STIM1 puncta was significantly larger than the distance between STIM1 and immobile EGFP-IP~3~R1 puncta (Fig.", " [8g](#Fig8){ref-type=\"fig\"}). ", "The distribution of distances between STIM1 and IP~3~Rs is consistent with mobile IP~3~R puncta moving apparently freely around STIM1, while immobile IP~3~Rs are typically 700 ± 70 nm away from STIM1 puncta and rarely within 300 nm (Fig.", " [8h](#Fig8){ref-type=\"fig\"}). ", "Similar results, namely accumulation of STIM1-mCherry puncta alongside immobile EGFP-IP~3~R1 puncta, were obtained when histamine was used to evoke SOCE by stimulating Ca^2+^ release from the ER through activation of IP~3~Rs (Supplementary Fig.", " [18](#MOESM1){ref-type=\"media\"}).Fig. ", "8STIM1 translocates to ER-PM junctions adjacent to immobile IP~3~R puncta. **", "a**, **b** TIRFM images show that thapsigargin (Tg, 1 µM, 5 min) causes formation of STIM1-mCherry puncta at ER-PM junctions (i). ", "Immobile IP~3~Rs (ii, white, identified from overlays of pseudocoloured EGFP-IP~3~R distribution at 30-s intervals) abut STIM1 puncta (iii). ", "Enlarged image of the boxed area shows all immobile EGFP-IP~3~R1 (arrows) and STIM1-mCherry without pseudocolours for clarity (iv). ", "Scale bars = 10 µm (i--iii), 2 µm (iv). **", "c** Similar overlay images from three additional Tg-treated cells, with all immobile IP~3~R punta identified with arrows. ", "Scale bars = 2 µm. **", "d** Fluorescence intensity profiles for EGFP-IP~3~R1 measured at 30-s intervals (green and magenta) and STIM1-mCherry for transects drawn across Tg-treated cells. ", "Results show that immobile IP~3~Rs (white, where green and magenta coincide) and STIM1 after store depletion are juxtaposed, but not perfectly aligned. ", "Distances (μm) between the peaks of the fluorescence intensity for STIM1 and immobile IP~3~R are shown; 84 ± 9% (mean ± SD, *n* = 3 cells) of the centroids of immobile EGFP-IP~3~R1 puncta were within twice their radius (2*r* = 0.64--0.96 μm) of a STIM1 punctum. **", "e** STIM1-mCherry fluorescence was measured before (*F* ~0~) and after Tg treatment (*F* ~Tg~) at ROI with twice the radius of underlying mobile or immobile EGFP-IP~3~R1 puncta. ", "Summary results show the change in mCherry fluorescence (Δ*F* = (*F* ~Tg~−*F* ~0~)/*F* ~0~, mean ± SEM, *n* = 3 cells, 29--33 puncta). ", "\\**P* \\< 0.05, Student's *t*-test. **", "f**, **g** Density of STIM1-mCherry and EGFP-IP~3~R1 puncta from randomly selected peripheral regions of cells (where puncta are most clearly separated) (**f**) and the separation between any STIM1 puncta identified within the randomly selected regions and the nearest STIM1 or immobile EGFP-IP~3~R1 punctum (**g**). **", "h** Frequency distributions for the separations of STIM1 puncta from mobile and immobile EGFP-IP~3~R1 puncta. ", "Whereas 28% of mobile IP~3~R puncta were within 300 nm of a STIM1 punctum, only 10% of immobile IP~3~R puncta fell within this distance. ", "Results (**f**--**h**) are from four cells. ", "\\*\\**P* \\< 0.01, Student's *t*-test\n\nThe close association of immobile IP~3~Rs with the ER-PM junctions where STIM1 and Orai1 accumulate after store depletion (Figs [7](#Fig7){ref-type=\"fig\"}, [8](#Fig8){ref-type=\"fig\"} and Supplementary Fig.", " [18](#MOESM1){ref-type=\"media\"}) prompted us to ask whether IP~3~Rs might contribute to assembly of the junctions. ", "We expressed GFP-MAPPER, a STIM-derived non-perturbing marker of ER-PM junctions^[@CR46]^, in human embryonic kidney (HEK) cells with and without endogenous IP~3~Rs^[@CR47]^. The number and size of the junctions identified by GFP-MAPPER were indistinguishable in cells with and without IP~3~Rs (Supplementary Fig.", " [19a--e](#MOESM1){ref-type=\"media\"}). ", "These results, which are consistent with evidence that IP~3~Rs are not directly required for SOCE in vertebrate cells^[@CR48]^, demonstrate that IP~3~Rs are not required for assembly of ER-PM junctions. ", "Whereas GFP-MAPPER identified punctate ER-PM junctions (Supplementary Fig.", " [19b, c](#MOESM1){ref-type=\"media\"})^[@CR46]^, expression of the same protein with an mCherry tag (mCherry-MAPPER) caused massive expansion of the junctions. ", "This was accompanied by displacement of immobile EGFP-IP~3~R1 puncta to the margins of the enlarged junctions, apparently without preventing mobile IP~3~Rs from passing through the regions enriched in junctions (Supplementary Movie [9](#MOESM12){ref-type=\"media\"} and Supplementary Fig.", " [19f](#MOESM1){ref-type=\"media\"}). ", "Similar results were obtained when mCherry-STIM1 was massively over-expressed (Supplementary Fig.", " [19g](#MOESM1){ref-type=\"media\"}). ", "These results suggest that the assembly of ER-PM junctions determines the location of immobile IP~3~R puncta, rather than vice versa.", "\n\nDiscussion {#Sec9}\n==========\n\nUsing gene editing to tag endogenous IP~3~R1 with EGFP, we provide measurements of the distribution of endogenous IP~3~Rs while simultaneously recording the Ca^2+^ signals they evoke. ", "Our results establish that within ER membranes IP~3~Rs form small clusters that typically include about eight tetrameric IP~3~Rs (Fig.", " [1](#Fig1){ref-type=\"fig\"}). ", "The estimate is approximate because it requires several assumptions (Supplementary Fig.", " [5](#MOESM1){ref-type=\"media\"}), but it confirms that clusters include only a few IP~3~Rs. ", "Our estimate is similar to the small numbers suggested by STORM images (Fig.", " [4](#Fig4){ref-type=\"fig\"}), by single-particle tracking of over-expressed mEos2-IP~3~R1^[@CR17]^ and from functional analyses of Ca^2+^ puffs, which suggest there are about 2--9 functional IP~3~Rs within most puff sites^[@CR45]^. We suggest that these small stable clusters of IP~3~Rs are the elementary structural units for IP~3~-evoked Ca^2+^ signalling. ", "Within clusters, many IP~3~Rs are too far apart for them to interact directly, suggesting that additional scaffolds maintain the loose affiliation of IP~3~Rs within clusters (Fig.", " [4](#Fig4){ref-type=\"fig\"}). ", "The scaffolds may be provided by lipid microdomains, cytosolic or ER proteins, or by interactions with other organelles such as lysosomes or mitochondria with which IP~3~Rs form intimate contacts^[@CR49]^. These scaffolds are likely to be important in determining whether IP~3~Rs can sustain local propagation of Ca^2+^ signals by Ca^2+^-induced Ca^2+^ release, and in segregating populations of mobile and immobile IP~3~Rs.", "\n\nMost IP~3~R puncta are mobile within ER membranes (*M* ~f~ \\~ 74%), but a smaller fraction is immobile over periods of many minutes (Figs [2](#Fig2){ref-type=\"fig\"}, [3](#Fig3){ref-type=\"fig\"}, [5](#Fig5){ref-type=\"fig\"}). ", "These results are consistent with FRAP analyses of over-expressed EGFP-IP~3~R1^[@CR16]^ and EGFP-IP~3~R3^[@CR15]^, the major subtypes in HeLa cells. ", "However, our analyses unmasked a pool of IP~3~Rs (\\~7%) that move directionally (Fig.", " [5](#Fig5){ref-type=\"fig\"}), and demonstrated that kinesin-1 and dynein contribute to this movement (Supplementary Figs [11](#MOESM1){ref-type=\"media\"}--[13](#MOESM1){ref-type=\"media\"}). ", "A study using mEos2-IP~3~R1 expressed in COS-7 cells suggested a similar *M* ~f~ to that of EGFP-IP~3~R1 in HeLa cells (\\~70%), but detected no directional movement of IP~3~Rs^[@CR17]^. The difference may be due to the different cell types or to over-expressed mEos2-IP~3~R1s masking movement of the small number of IP~3~Rs moved by microtubule motors. ", "In neurons, proteins may be transported along dendrites by microtubule motors in either ER-derived vesicles^[@CR42],[@CR50]^ or as a bolus of proteins within ER membranes^[@CR51]--[@CR53]^. The latter seems most likely for directed movement of EGFP-IP~3~R1 in HeLa cells (Supplementary Fig.", " [14](#MOESM1){ref-type=\"media\"}). ", "This directed, motor-driven transport may allow relocation of IP~3~Rs within cells that rely on IP~3~R-mediated Ca^2+^ release to control local events, such as migration^[@CR54]^ and growth of neurons^[@CR55]^.\n\nOver many minutes there is minimal exchange of IP~3~Rs between mobile and immobile puncta (Fig.", " [3](#Fig3){ref-type=\"fig\"}). ", "Since only immobile IP~3~Rs initiate Ca^2+^ signals (Fig.", " [6](#Fig6){ref-type=\"fig\"} and Supplementary Fig.", " [17](#MOESM1){ref-type=\"media\"}), it will be interesting to resolve whether physiological stimuli regulate exchange between these pools and perhaps thereby influence IP~3~ sensitivity.", "\n\nBy simultaneously measuring cytosolic Ca^2+^ signals and the dynamics of native IP~3~Rs, we show that almost all Ca^2+^ puffs originate from immobile clusters of IP~3~Rs adjacent to the PM (Fig.", " [6](#Fig6){ref-type=\"fig\"} and Supplementary Figs [15](#MOESM1){ref-type=\"media\"}--[17](#MOESM1){ref-type=\"media\"}). ", "This occurs whether IP~3~ is delivered uniformly to the cytosol or immediately beneath the PM from endogenous signalling pathways. ", "Since only about 30% of IP~3~R puncta are immobile (Fig.", " [5g](#Fig5){ref-type=\"fig\"}) and only a tiny fraction of them are close to the PM (Supplementary Fig.", " [6](#MOESM1){ref-type=\"media\"}), our results establish that there is an additional level of IP~3~R regulation that licenses a very small number of IP~3~Rs to respond to IP~3~. The larger number of IP~3~Rs within some immobile clusters (Fig.", " [2f, g](#Fig2){ref-type=\"fig\"}) may contribute to their propensity to respond, but it is probably not the only factor (see Results). ", "An important issue is to resolve the mechanisms that provide near-PM immobile IP~3~Rs with the competence to respond to IP~3~.\n\nThe responsive immobile IP~3~Rs are adjacent to, but not coincident with, the ER-PM junctions that become populated by STIM1 and Orai after depletion of ER Ca^2+^ (Figs [7](#Fig7){ref-type=\"fig\"}, [8](#Fig8){ref-type=\"fig\"} and Supplementary Figs [18](#MOESM1){ref-type=\"media\"}, [19](#MOESM1){ref-type=\"media\"}). ", "A likely explanation is that the gap between the ER and PM across which STIM and Orai interact is probably too narrow (about 9--21 nm)^[@CR9],[@CR14],[@CR56]^ to accommodate the immobile IP~3~Rs, which project about 15 nm from ER membranes^[@CR34]^. This explanation would be consistent with enforced exaggeration of the ER-PM junctions causing immobile IP~3~R puncta (presumably in ER facing the PM) to be excluded from the junctions, without preventing mobile IP~3~Rs (populating both sides of the ER) from appearing to pass through them (Supplementary Movie [9](#MOESM12){ref-type=\"media\"} and Supplementary Fig.", " [19f, g](#MOESM1){ref-type=\"media\"}). ", "We speculate that responsive immobile IP~3~R puncta reside in the ER facing the PM, alongside the ER-PM junctions where STIM1 and Orai interact, but they are excluded from the junction itself. ", "We suggest that this juxtaposition of the signalling proteins that mediate Ca^2+^ release and Ca^2+^ entry has important implications (Fig.", " [9](#Fig9){ref-type=\"fig\"}). ", "First, PIP~2~ in the PM recruits active STIM1 to ER-PM junctions. ", "Hence, licensed IP~3~Rs are adjacent to the substrate from which IP~3~ is generated. ", "Second, activation of STIM1 and SOCE requires substantial depletion of ER Ca^2+^ stores. ", "The licensed IP~3~Rs are well placed to locally deplete the stores closest to the ER-PM junctions where SOCE occurs. ", "Third, inhibition of SOCE by increased cytosolic Ca^2+^ concentration provides local feedback regulation of Orai gating^[@CR7],[@CR57]^. Hence, IP~3~Rs, with their very large Ca^2+^ conductance, might inhibit SOCE if they were within ER-PM junctions. ", "We speculate that licensed IP~3~Rs are optimally placed to locally deplete the ER, allowing it to activate SOCE effectively, but far enough away to avoid Ca^2+^-mediated inactivation of SOCE and disruption of local feedback regulation (Fig.", " [9](#Fig9){ref-type=\"fig\"}).Fig. ", "9Ca^2+^ signals evoked by SOCE occur alongside immobile IP~3~Rs. ", "Clustered IP~3~Rs evoke Ca^2+^ puffs when they bind IP~3~ and then respond to Ca^2+^ released by a neighbouring IP~3~R. Only a small fraction of all IP~3~Rs, namely immobile clusters close to the PM, are licensed to respond (green). ", "The licensed IP~3~Rs are adjacent to the junctions where STIM1 and Orai interact to mediate SOCE, which is itself locally regulated by Ca^2+^ passing through Orai (red lines). ", "We suggest that the juxtaposition of responsive IP~3~Rs and the SOCE machinery allows local depletion of ER Ca^2+^ stores to activate SOCE, while sparing it from inhibition by the large Ca^2+^ fluxes through IP~3~Rs\n\nWe have shown that native IP~3~Rs are scaffolded into small clusters within ER membranes. ", "Most IP~3~R clusters are mobile, but it is the small number of immobile IP~3~R clusters sitting alongside the ER-PM junctions where SOCE occurs that are licensed to respond to IP~3~ and initiate Ca^2+^ signals. ", "We suggest that this arrangement of IP~3~Rs may allow effective delivery of IP~3~ from endogenous signalling pathways and local regulation of SOCE.", "\n\nMethods {#Sec10}\n=======\n\nMaterials {#Sec11}\n---------\n\nBAPTA was from Molekula. ", "Cal-590 AM, Cal-520 AM and Fluo-8 AM were from AAT Bioquest. ", "Ciliobrevin D, EGTA-AM, human fibronectin and nocodazole were from Merck Millipore. ", "A membrane-permeant form of caged-IP~3~ (ci-IP~3~/PM[: d]{.smallcaps}-2,3-*O*-isopropylidene-6-*O*-(2-nitro-4,5-dimethoxy)benzyl-*myo*-inositol 1,4,5-trisphosphate hexakis(propionoxymethyl) ester) was from SiChem. ", "Mycalolide B was from Santa Cruz Biotechnology. ", "Rapamycin was from Cell Guidance Systems. ", "Histamine and carbachol were from Sigma-Aldrich. ", "Bovine serum albumin (BSA) was from Europa Bio-Products.", "\n\nSources of plasmids encoding the following proteins were: mCherry-EB3 (Addgene \\#55038); mCherry-C1 (Clontech \\#632524); GFP-ER~memb~ (GFP targeted to ER membranes via the ER-targeting sequence of yeast UBC6 protein)^[@CR36]^; p50-mCherry (dominant-negative cytoplasmic dynein tagged with mCherry)^[@CR36]^; RFP-KHC-CT (dominant-negative kinesin-1 tagged with RFP)^[@CR36]^; pBa-KIF5C 559-tdTomato-FKBP (kinesin-1 tagged with tandem dimer Tomato and FKBP to allow dimerization with Lyn11-FRB-CFP via rapamycin) (Addgene \\#64211)^[@CR38]^; GFP-TPC2^[@CR58]^; mCherry-ER (Addgene \\#55041); Lyn11-FRB-CFP (PM-targeted FRB tagged with CFP to allow dimerization with FKBP via rapamycin) (Addgene \\#38003); LAMP1-mCherry^[@CR59]^; LAMP1-AcGFP^[@CR59]^; STIM1-mCherry^[@CR60]^; CFP-STIM1 (Addgene \\#18858); mCherry-tubulin (Addgene \\#26768); GFP-MAPPER^[@CR46]^ and Orai1-CFP (Addgene \\#19757). ", "The mCherry-MAPPER construct was generated by amplifying mCherry from pmCherry-C1 (Clontech) by PCR using forward (CGCTAGCGCTACCGGTC) and reverse (AGACTAGTTGATCCGGACTTGTACAGCTCGTC) primers, digesting the resulting product with *Age*I/*Spe*I and inserting the product into similarly digested GFP-MAPPER. ", "For the mCherry-Orai1 construct, human Orai1 was amplified by PCR from hOrai1-pcDNA6^[@CR61]^ using forward (GGAGGGGGATCTATGCATCCGGAGCCCG) and reverse (AGCGGCCGCCACTGTGCTGGATATCTGCAGCTAGGCATAGTGGCTGCCG) primers, and mCherry was amplified from pmCherry-C1 (Clontech) using forward (CGTTTAAACTTAAGCTTGGTACCGAGCTCAAGCTTGCCACCATGGTGAGCAAGGGCGAG) and reverse (CGGGCTCCGGATGCATAGATCCCCCTCCCTTGTACAGCTCGTCCATGCC) primers. ", "The resulting PCR products were introduced by Gibson assembly (Gibson Assembly Master Mix; New England Biolabs) into pcDNA3.1+ digested with *Bam*HI/*Eco*RI.", "\n\nPrimers used for sequencing and amplification were from ThermoFisher: forward mCherry (mCherry PF: ATGGTGAGCAAGGGCGAG); reverse *itpr1* (P5R: GGGGCCTCACTACTCCTTTC); forward *itpr1* (P2F: GGGTGACATGCGTACAGTTG); reverse *itpr1* (P4R: GAACGTCACCGTTTTACTTGG); forward *itpr3* (P13F: CTCCAAGCCTGAGCACTTTC); reverse *itpr3* (P16R: CCCGATAGAGGCCTGGAC). ", "The TALENs used are listed in Supplementary Fig.", " [1b](#MOESM1){ref-type=\"media\"}.", "\n\nAntibodies (for Western blotting, WB; immunoprecipitation, IP) were from the following suppliers: β-actin (WB 1:1,000; Abcam, ab6276), dynein, mouse monoclonal (IP and WB 1:1,000, Abcam, ab23905); GFP (WB 1:1,000, ChromoTek, \\#3H9); GFP Tag-Alexa Fluor-647 (STORM 1:400, ThermoFisher, \\#31852); GFP-Trap, anti-GFP V~H~H coupled to magnetic beads (IP 100 µl per 200 µl lysate, ChromoTek, \\#gtm20); IP~3~R1 (rabbit, C-terminal peptide, WB 1:1,000)^[@CR62]^; IP~3~R2 (rabbit, C-terminal peptide GFLGSNTPHENHHMPPH, WB 1:1,000, Pocono Rabbit Farm and Laboratory); IP~3~R3 (WB 1:1,000, BD Transduction Laboratories, \\#610313); kinesin-1 (WB 1:1,000, IP 1:400, Abcam, ab62104); mCherry (WB 1:1,000, Abcam, ab167453); STIM1 (New England Biolabs, D88E10); RFP-Trap, anti-RFP V~H~H coupled to magnetic beads (IP 100 µl per 200 µl lysate, ChromoTek, \\#rtm10); donkey anti-rabbit IgG-HRP (WB 1:5,000, Santa Cruz, SC-2313); donkey anti-mouse IgG-HRP (WB 1:2,000, Santa Cruz, SC-2314); goat anti-rat IgG-HRP (WB 1:5,000, Santa Cruz, SC-2020); goat anti-rabbit Alexa Fluor-594 (ThermoFisher, A11012).", "\n\nAdditional sources of materials are provided within the relevant methods.", "\n\nCell culture and transient transfection {#Sec12}\n---------------------------------------\n\nHEK293 and HeLa cells (both from ATCC) were cultured in Dulbecco's modified Eagle's medium/F-12 with GlutaMAX (ThermoFisher) supplemented with fetal bovine serum (FBS, 10%, Sigma). ", "The cells were maintained at 37 °C in humidified air with 5% CO~2~, and passaged every 3--4 days using Gibco TrypLE Express (ThermoFisher). ", "For imaging, cells were grown on 35-mm glass-bottomed dishes (\\#P35G-1.0-14-C, MatTek) coated with human fibronectin (10 µg ml^−1^). ", "HeLa cells and EGFP-IP~3~R1 HeLa cells were transfected, according to the manufacturer's instructions, using TransIT-LT1 (GeneFlow) and ViaFect (Promega) reagents, respectively (1 µg DNA per 2.5 µl reagent). ", "Short tandem repeat profiling was used to authenticate HeLa cells (Eurofins, Germany) and HEK293 cells (Public Health England). ", "Screening confirmed that all cells were free of mycoplasma infection.", "\n\nGene editing of IP~3~R1 in HeLa cells {#Sec13}\n-------------------------------------\n\nThe methods are summarized in Supplementary Fig.", " [1](#MOESM1){ref-type=\"media\"}. ", "TALENs were designed to target the first coding exon (exon 3) of the human *itpr1* gene at the 3p26.1 locus. ", "A double-stranded donor DNA was synthesized (ThermoFisher) with homology regions for recombination with the *itpr1* gene (\\~300 bp either side of the TALEN cleavage site, with *Sal*I and *Xho*I restriction sites at the 5′ and 3′ ends, respectively) flanking a sequence encoding EGFP mutated (A206K) to ensure the expressed protein was monomeric. ", "The donor DNA was cloned into the pENTR1A-dual selection vector (ThermoFisher), excised from it with *Sal*I and *Xho*I, and purified to provide the donor DNA used for transfection.", "\n\nHeLa cells (75-cm^2^ flask, \\~60% confluence) were cotransfected with double-stranded donor DNA (9 μg) and the TALENs (6 μg of each) using TransIT-LT1. ", "Cells were harvested after 48--72 h using trypsin, washed in phosphate-buffered saline (PBS: 1.06 mM KH~2~PO~4~, 155 mM NaCl, 3 mM Na~2~HPO~4~, pH 7.3) containing FBS (1%) and re-suspended (\\~10^7^ cells ml^−1^) in sorting buffer (PBS with 1 mM EDTA, 25 mM HEPES, 1% FBS, pH 7.0). ", "Cells were sorted by fluorescence-activated cell sorting (FACS, excitation 488 nm, emission 525 nm) using a modular flow multilaser sorter flow cytometer (DakoCytomation, Beckmann Coulter). ", "Cells with the most intense EGFP fluorescence (top \\~1%) were collected into growth medium containing penicillin (100 μg ml^−1^), streptomycin (100 µg ml^−1^), amphotericin B (0.25 µg ml^−1^, all from ThermoFisher) and FBS (20%). ", "Polyclonal cells were cultured in this medium for two passages, and then in normal growth medium without antibiotics. ", "Two further rounds of FACS were used to enrich the EGFP-IP~3~R1-expressing cells, which were then sorted as single cells into 96-well plates and cultured in the antibiotic-containing medium to select monoclonal cell lines (Supplementary Fig.", " [1c](#MOESM1){ref-type=\"media\"}). ", "Five monoclonal EGFP-IP~3~R1 HeLa cell lines were propagated, one of which was used for the work reported here.", "\n\nThe sequences of the edited *itpr1* locus of the five monoclonal EGFP-IP~3~R1 HeLa cell lines was determined by isolating genomic DNA using a Quick-gDNA MiniPrep kit (Zymo Research). ", "The *itpr1* locus of the genomic DNA was amplified by PCR using primers P2F and P4R, and the sequences were determined using the same primers. ", "Sequencing confirmed the appropriate attachment of the EGFP sequence to IP~3~R1 (Supplementary Fig.", " [2a](#MOESM1){ref-type=\"media\"}).", "\n\nKaryotype analysis of G-banded metaphase spreads of EGFP-IP~3~R1 HeLa cells was performed by Cell Guidance Systems (Cambridge, UK) (Supplementary Fig.", " [2b](#MOESM1){ref-type=\"media\"}).", "\n\nMeasurements of \\[Ca^2+^\\]~c~ in cell populations {#Sec14}\n-------------------------------------------------\n\nEGFP-IP~3~R1 HeLa cells were plated in clear-bottomed 96-well plates (Greiner Bio-One) coated with fibronectin (10 µg ml^−1^). ", "Cells were transfected with siRNA directed against GFP (50 nM, \\#AM4626, ThermoFisher) or a nonsilencing control siRNA (50 nM, \\#AM4611, ThermoFisher) using siPORT NeoFX transfection reagent (ThermoFisher, 220 ng siRNA per µl reagent). ", "After 72 h, cells were washed with HEPES-buffered saline (HBS: 135 mM NaCl, 5.9 mM KCl, 1.2 mM MgCl~2~, 1.5 mM CaCl~2~, 11.6 mM HEPES, 11.5 mM glucose; pH 7.3), loaded with Fluo-8 by incubation in HBS with Fluo-8 AM (2 µM, 60 min, 20 °C), washed and incubated in HBS (60 min, 20 °C) before experiments. ", "A FlexStation 3 microplate reader (Molecular Devices) was used to measure Fluo-8 fluorescence at 20 °C. ", "After addition of BAPTA in Ca^2+^-free HBS (final BAPTA and CaCl~2~ concentrations = 2.5 and 0.75 mM, respectively; free \\[Ca^2+^\\]\\<40 nM), histamine (100 µM) was added to stimulate IP~3~ formation through endogenous H~1~ histamine receptors. ", "Fluorescence was collected (using SoftMax Pro, Molecular Devices) and calibrated to cytosolic free Ca^2+^ concentration (\\[Ca^2+^\\]~c~) as described^[@CR63]^.\n\nFunctional expression of EGFP-IP~3~R1 in HEK cells {#Sec15}\n--------------------------------------------------\n\nAn EGFP-IP~3~R1 construct that replicates the linker produced by gene editing of endogenous IP~3~R1 in HeLa cells (Supplementary Fig.", " [2a](#MOESM1){ref-type=\"media\"}) was transiently expressed in HEK cells in which all endogenous IP~3~R genes had been disrupted (Kerafast, Boston, MA, USA)^[@CR47]^. The plasmid, EGFP-hIP~3~R1-pcDNA3.1(+), was constructed as follows. ", "The open reading frame of human IP~3~R1 (NCBI reference sequence NM_002222.5), with the sequence (GGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC) immediately upstream of the start codon and the sequence (ACGCGTACGCGGCCGCTCGAGGA) immediately downstream of the stop codon, was synthesized and subcloned into the *Sma*I/*Sal*I sites of pUC57 (Bio Basic, Markham, Ontario, Canada). ", "The sequence was then transferred into pcDNA3.1(+) using *Kpn*I/*Not*I. The EGFP donor-pENTR1A plasmid used for gene editing was amplified by PCR using forward (CTGGCTAGCGTTTAAACTTAAGCTTGGTACATGGTGAGCAAGGGCGAG) and reverse (AGGAAGCTAGACATTTTGTCAGACATACCAGAACCACCACCAGAAC) primers. ", "The product was inserted using Gibson Assembly (NEBuilder HiFi DNA Assembly Master Mix, New England BioLabs) into hIP~3~R1-pcDNA3.1(+) digested with *Kpn*I/*Sfa*AI, to give EGFP-hIP~3~R1-pcDNA3.1(+). ", "Ca^2+^ signals in single cells were measured using the genetically encoded Ca^2+^ sensor, RGECO1^[@CR64]^.\n\nIn-gel fluorescence and WB {#Sec16}\n--------------------------\n\nCells were harvested using either Cell Dissociation Buffer (ThermoFisher) or, for siRNA experiments, by scraping cells into lysis medium (150 mM NaCl, 0.5 mM EDTA, 1% Triton X-100, 10 mM Tris/HCl (pH 7.5), Pierce protease inhibitor mini-tablet with EDTA, 1 tablet per 10 ml). ", "Cells were lysed by incubation in the same medium at 4 °C for 1 h followed by sonication (Transonic ultrasonic bath, 3 × 10 s), and centrifugation (20,000 × *g*, 30 min) to produce the supernatant used for subsequent analyses.", "\n\nFor in-gel fluorescence, proteins were separated using Novex 4--12% Tris-glycine mini protein gels (ThermoFisher). ", "EGFP fluorescence was detected using a PXi chemiluminescence gel-imaging system (Syngene) equipped with a light-emitting diode for excitation (465 nm) and a filter for emission (525 nm).", "\n\nFor WB, proteins were separated using NuPAGE 3--8% Tris-acetate protein gels, and transferred onto an iBlot PVDF membrane using an iBlot gel-transfer device (ThermoFisher). ", "The membranes were blocked with BSA (5%) in Tris-buffered saline (TBS: 137 mM NaCl, 20 mM Tris, pH 7.6) containing 0.1% Tween-20, incubated with the primary antibody (\\~16 h at 4 °C), washed (3 × 5 min), and incubated with HRP-conjugated secondary antibody (1 h at 20 °C) (see Materials for the antibodies used). ", "After further washes (3 × 5 min), HRP was detected using ECL Prime Western blotting detection reagents (GE Healthcare Life Sciences) and a PXi chemiluminescence detection system. ", "Scans of the most important WB and gels are shown without cropping in Supplementary Fig.", " [20](#MOESM1){ref-type=\"media\"}.", "\n\nImmunoprecipitation {#Sec17}\n-------------------\n\nGFP-Trap magnetic beads (ChromoTek) were used to immunoprecipitate EGFP-IP~3~R1 according to the manufacturer's protocol. ", "Briefly, supernatants (200 µl) from cell lysates prepared as for WB were incubated with a slurry of GFP-Trap magnetic beads (60 µl). ", "After 2 h at 4 °C, immunocomplexes were separated magnetically, washed (3 × 500 µl wash buffer: 150 mM NaCl, 0.5 mM EDTA, 10 mM Tris, pH 7.5) and dissociated from the beads by boiling (10 min, 95 °C) in 2× LDS sample buffer (ThermoFisher). ", "Samples were then separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to WB.", "\n\nFor immunoprecipitation of kinesin-1 and dynein, protein G magnetic Dynabeads (\\~1.5 mg in 200 µl PBS, ThermoFisher) were conjugated to antibodies (\\~10 µg) against kinesin-1 or dynein according to the manufacturer's instructions. ", "Lysates were pre-cleared by incubation with either magnetic particles (ChromoTek) or protein G beads (ThermoFisher) for 1 h at 4 °C. ", "The conjugated beads (1.5 mg) were then incubated with 200 µl of the pre-cleared lysate supernatant for \\~16 h at 4 °C. ", "After washing (PBS, 3 × 200 µl), samples were resuspended in elution buffer (20 µl of 50 mM glycine (pH 2.8) and 10 µl NuPage LDS sample buffer), proteins were eluted (70 °C, 10 min) and the beads were removed magnetically. ", "Samples were then separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to WB.", "\n\nFluorescence microscopy {#Sec18}\n-----------------------\n\nAll fluorescence microscopy used an inverted Olympus IX83 microscope equipped with a 100× oil-immersion TIRF objective (numerical aperture, NA 1.49), a multi-line laser bank (395 nm (for FRAP), 425 nm, 488 nm, 561 nm and 647 nm) and an iLas2 targeted laser illumination system (Cairn, Faversham, Kent, UK). ", "Excitation light was transmitted through either a quad dichroic beam splitter (TRF89902-QUAD) or a dichroic mirror (for 425 nm; ZT442rdc-UF2) (Chroma). ", "Emitted light was passed through appropriate filters (Cairn Optospin; peak/bandwidth: 480/40, 525/50, 630/75 and 700/75 nm) and detected with an iXon Ultra 897 electron multiplied charge-coupled device (EMCCD) camera (512 × 512 pixels, Andor).", "\n\nSpinning disc confocal microscopy used a spinning disk with a 70-µm pinhole (X-Light, Crest Optics). ", "For TIRFM, the penetration depth was 90--140 nm. ", "The iLas2 illumination system was used for TIRFM, wide-field imaging and FRAP. ", "Bright-field images were acquired using a Cairn MonoLED illuminator.", "\n\nBefore analysis, all fluorescence images were corrected for background by subtraction of the fluorescence detected from a region outside the cell. ", "Image capture and processing used MetaMorph Microscopy Automation and Image Analysis Software (Molecular Devices) and Fiji^[@CR65]^. Co-localization analysis was carried out using the JACoP ImageJ plugin^[@CR66]^.\n\nImmunocytochemistry {#Sec19}\n-------------------\n\nCells grown on fibronectin-coated MatTek dishes were washed five times in PBS, fixed with paraformaldehyde (4%) in PBS (30 min, 20 °C), washed twice in PBS with gentle agitation, and then permeabilized by incubation (5 min, 20 °C) in PBS containing 0.25% Triton X-100 with gentle agitation. ", "After washing twice with PBS, cells were incubated (1 h, 20 °C) in blocking buffer (5% BSA in PBS), washed twice, and then incubated with 1:400 anti-GFP antibody-Alexa Fluor-647 conjugate (1:400) in PBS for 1 h at 20 °C with gentle agitation. ", "For STIM1 immunostaining, cells were incubated with anti-STIM1 antibody (1:800) for 16 h at 4 °C, washed three times with PBS, and then incubated with goat anti-rabbit Alexa Fluor-594 secondary antibody (1:1,000) for 1 h at 20 °C. ", "The cells were then washed and imaged.", "\n\nMeasurements of local Ca^2+^ signals in single cells {#Sec20}\n----------------------------------------------------\n\nEGFP-IP~3~R1 HeLa cells grown on fibronectin-coated MatTek dishes were washed twice with HBS and incubated (37 °C, 5% CO~2~) in HBS containing Cal-590-AM (2 µM) alone or with ci-IP~3~/PM (1 µM). ", "After 1 h, the cells were washed twice with HBS, and then incubated for 30 min at 20 °C in HBS containing EGTA-AM (5 µM). ", "EGTA is a slow Ca^2+^ buffer used to limit regenerative propagation of Ca^2+^ signals without perturbing local Ca^2+^ release events^[@CR4]^. The cells were then washed twice with HBS, and incubated for 30 min in HBS at 20 °C to allow de-esterification of the esterified Cal-590, EGTA and caged-IP~3~. The medium was replaced with fresh HBS before imaging. ", "All incubations prior to imaging were in the dark.", "\n\nCal-590 is the only practicable Ca^2+^ indicator compatible with imaging of EGFP, but it has lower affinity for Ca^2+^ (*K* ~D~ = 561 nM) and it is less bright than Fluo-8 (*K* ~D~ = 389 nM). ", "These limitations and the need to minimize photobleaching constrain opportunities to resolve the temporal dynamics of Ca^2+^ puffs, but they do not prevent their accurate spatial localization. ", "In experiments designed to capture the spatial distribution of Ca^2+^ signals and EGFP-IP~3~R1, it was impracticable to collect fully interleaved images of EGFP and Cal-590 fluorescence at sufficient temporal resolution to identify all Ca^2+^ puffs. ", "We therefore adopted two approaches. ", "In the first, we collected interleaved TIRFM images of EGFP-IP~3~R1 and Cal-590 fluorescence at relatively low temporal resolution (700 ms between successive measurements at the same wavelength). ", "This allowed the distribution of both mobile and immobile IP~3~Rs to be compared with almost coincident Ca^2+^ signals (Supplementary Fig.", " [17](#MOESM1){ref-type=\"media\"}). ", "In other experiments (Fig.", " [6](#Fig6){ref-type=\"fig\"} and Supplementary Fig.", " [15](#MOESM1){ref-type=\"media\"}), we identified EGFP-IP~3~R1 (\\~3 s, 488-nm excitation, 525/50-nm emission, 5 frames  s^−1^, fps) immediately before and after fast imaging of Ca^2+^ signals. ", "From the TIRF images of EGFP-IP~3~R1, we then identified immobile puncta (Supplementary Fig.", " [7](#MOESM1){ref-type=\"media\"}). ", "Cal-590 fluorescence was recorded by TIRFM for 2--3 s (561-nm excitation, 20 fps, with illumination for 25 ms of every 50-ms capture interval to minimize bleaching) before collecting further images (\\~30 s) after addition of histamine (10 μM) or photolysis of ci-IP~3~ (using SPECTRA X-light engine, Lumencor, 395/20 excitation, exposure time 50--75 ms). ", "Spinning disc confocal microscopy with Cal-520 was used to image Ca^2+^ puffs across confocal sections of wild-type HeLa cells. ", "Images were collected using MetaMorph, corrected for background fluorescence and Ca^2+^ puffs were detected and analysed using xySpark, a Fiji plugin^[@CR67]^.\n\nFluorescence recovery after photobleaching {#Sec21}\n------------------------------------------\n\nFor wide-field FRAP, time-lapse images (2 fps) of EGFP fluorescence were acquired using a 488-nm laser. ", "A region of interest (ROI, radius = 1.84 μm) was rapidly (225 ms) photobleached by raster scanning using the iLas2 laser illumination system (395 nm). ", "A FRAP macro (<https://www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/frap-calculator-macro>)^[@CR68]^ was used to calculate the mobile fraction (*M* ~f~) and half-time (*t* ~½~) for recovery (ImageJ) from images corrected for background fluorescence. ", "The analysis corrects for loss of fluorescence from both focal bleach of the ROI and photobleaching during image acquisition by expressing fluorescence intensity within the ROI as a fraction of the fluorescence intensity from the entire cell at each time point. ", "The corrected ROI fluorescence was then normalized to its pre-bleach value (*F* ~0~). ", "The diffusion coefficient (*D*) was calculated from: $\\documentclass[12pt]{minimal}\n \\usepackage{amsmath}\n \\usepackage{wasysym} \n \\usepackage{amsfonts} \n \\usepackage{amssymb} \n \\usepackage{amsbsy}\n \\usepackage{mathrsfs}\n \\usepackage{upgreek}\n \\setlength{\\oddsidemargin}{-69pt}\n \\begin{document}$$D = \\frac{{r^2\\gamma }}{{4t_{1/2}}}$$\\end{document}$, where *r* is the radius of the bleached area (1.84 μm) and *γ* is a correction factor for bleaching (\\~1 for a circular beam). ", "The mobile fraction (*M* ~f~) was calculated from: *M* ~f~ = *F* ~300~/*F* ~0~, where *F* ~300~ is the normalized fluorescence recorded after 300 s, when fluorescence recovery had reached a plateau.", "\n\nFRAP was also used to determine whether EGFP-IP~3~R1s exchange between mobile and immobile puncta. ", "For these FRAP analyses, we define an immobile punctum as one for which there is no detectable movement in frames separated by 30 s. Since STORM analyses required slightly shorter (10 s) intervals between the images used to define immobile puncta, we note that the same immobile puncta were identified when the interval between images was varied between 5 and 60 s (Supplementary Fig.", " [7](#MOESM1){ref-type=\"media\"}). ", "Immobile puncta were identified by overlaying TIRFM images of EGFP fluorescence collected 30-s apart; the images were then pseudocoloured (green for *t* = 0, magenta for *t* = 30 s), such that in overlaid images immobile puncta appeared white. ", "This means of defining immobile puncta is important because over the period (60 min) required to monitor fluorescence recovery, there is some re-arrangement of the ER. ", "Hence, even immobile puncta may be in slightly different positions after 60 min, making it impracticable to determine their fluorescence recovery by recording from pre-defined regions. ", "For each time during the recovery period, therefore, immobile puncta were uniquely identified from the appropriate pseudocolour images.", "\n\nFor FRAP analysis of the exchange of EGFP-IP~3~R1 between mobile and immobile puncta, a rectangular strip of the cell (typically \\~30 μm × 7 μm, and comprising \\~10% of the cell area) was photobleached by raster scanning (1.25 s, wide-field using the iLas2 laser 395-nm illumination system). ", "By bleaching a large area, it was possible to monitor recovery of both mobile puncta and many immobile puncta within it. ", "Fluorescence images were then collected using TIRFM (488 nm) at 30-s intervals. ", "After correction for background fluorescence, ROIs corresponding to immobile puncta within the bleached area were identified and pooled for subsequent analysis. ", "The remaining bleached area (with ROI corresponding to immobile puncta removed) was analysed separately. ", "Recovery from photobleaching was calculated from *F*/*F* ~0~.\n\nStochastic optical reconstruction microscopy {#Sec22}\n--------------------------------------------\n\nPrior to fixation for STORM, TIRFM of EGFP-IP~3~R1 HeLa cells in HBS was used to identify mobile and immobile puncta, using the methods described in the FRAP section, but with the interval between successive images reduced to 10 s (Supplementary Fig.", " [7](#MOESM1){ref-type=\"media\"}). ", "Cells were then immediately fixed *in situ* by replacing the HBS with PBS containing paraformaldehyde (4%, 30 min). ", "The cells were then permeabilized and stained with Alexa Fluor-647-conjugated anti-GFP antibody as described in the Immunocytochemistry section. ", "These methods preserved the original distribution of EGFP-IP~3~R1 puncta (Supplementary Fig.", " [9](#MOESM1){ref-type=\"media\"}). ", "The medium used for STORM^[@CR69]^ included an oxygen-scavenging system to reduce photobleaching, 2-mercaptoethanol to improve photoswitching and cyclooctatetraene to improve photon yield; it comprised Tris-HCl (50 mM), NaCl (10 mM) glucose (100 g l^−1^), pH 8.0), catalase (34 µg ml^−1^), glucose oxidase (0.56 mg ml^−1^), 2-mercaptoethanol (1%) and cyclooctatetraene (1%). ", "For STORM, the originally characterized cell was re-identified, and Alexa Fluor-647 fluorescence was bleached using the full laser power (647 nm) in semi-TIRF mode until individual fluorophores began to blink. ", "Images (30,000 at 50 fps) were then acquired by TIRFM using a TIRF objective (×100, NA = 1.49 with an intermediate magnification of ×1.6) during continuous illumination with a 647-nm laser and captured (256 × 256 pixels) with an EMCCD camera (Andor iXon897 Ultra). ", "Image collection and fitting used WaveTracer (MetaMorph), which sets a photon-detection threshold to identify genuine blinking events and a wavelet segmentation algorithm to fit a centroid to each blinking event within each 10 nm × 10 nm pixel^[@CR70]^. Point locations of individually blinking fluorophores in each of the 30,000 frames were collated to form a super-resolution image. ", "TetraSpeck microspheres (0.1 µm diameter, ThermoFisher) were used to verify that there was no significant drift during image acquisition.", "\n\nAnalysis of the distribution of fluorophores within puncta used the program SR-Tesseler^[@CR71]^, which effectively encloses every blinking event ( = localization) within a field (Voronoi tessellation), the boundaries of which are drawn to be equidistant between each localization and its neighbours. ", "Hence, the areas of these fields are smaller (and so the density of localizations is larger) in regions where many events are detected. ", "From the STORM images we manually re-identified immobile puncta, and within the ROIs corresponding to each mobile and immobile punctum, we set a density threshold (1.2× the average localization density within the ROI) to delineate the area (A1) within which fluorophores were concentrated. ", "A second round of thresholding (1.2× the average density of A1) was used to define distributions of fluorophores within A1.", "\n\nAutomated detection of fluorescent puncta {#Sec23}\n-----------------------------------------\n\nThe Fiji TrackMate plugin^[@CR72]^ was used to identify fluorescent puncta in background-corrected TIRFM images of EGFP-IP~3~R1 HeLa cells, using a 'difference of Gaussians' filter after applying a consistent threshold. ", "The algorithm detected no puncta in wild-type HeLa cells, and identified all discernible puncta in EGFP-IP~3~R1 HeLa cells without false-positives (Supplementary Fig.", " [4](#MOESM1){ref-type=\"media\"}). ", "The automated detection of puncta attributed 34 ± 4% (*n* = 5 cells, 2,171 puncta) of total background-corrected fluorescence to puncta.", "\n\nSingle-particle tracking {#Sec24}\n------------------------\n\nThe Fiji TrackMate plugin^[@CR72]^ was used to track single particles in background-corrected time-lapse TIRFM images (10 fps for 10 s). ", "Using a parabolic interpolation scheme, the sub-pixel localization of each detected diffraction-limited spot was obtained. ", "Track segments were generated by frame-to-frame linking of particles and the segments were linked by gap-closing. ", "A linear assignment problem tracking algorithm^[@CR73]^ was used to track the particles. ", "Our user-defined parameters were: maximum distance for frame-to-frame linking (400 nm, 5 pixels; selected after preliminary analysis of manual tracks to avoid incorrect linking of particles); gap-closing (600 nm; maximal allowable distance travelled between frames 1 and 3, when the particle is not detected in frame 2); split and merge events (300 nm; the maximal allowable distance from a particle splitting or merging and its subsequent detection as a new particle). ", "We considered particles that moved \\>40 nm between successive frames (100 ms) to be mobile because in fixed cells, we detected a mean displacement of particles between frames of 40 nm.", "\n\nTraJClassifier (Fiji plugin), which has been extensively validated using computational models and experimental data^[@CR74]^, was used to classify the mobility of single-particle trajectories (Fig.", " [5g](#Fig5){ref-type=\"fig\"} and Supplementary Fig.", " [10](#MOESM1){ref-type=\"media\"}). ", "This algorithm uses a random forest ensemble learning approach to classify trajectories into diffusive, sub-diffusive, confined and directed trajectories. ", "When a particle changes its behaviour during the recording, TraJClassifier splits its trajectory into sub-trajectories. ", "Only 133 of the 4,492 trajectories analysed were split into sub-trajectories. ", "Hence, only 3% of puncta changed their form of motion during the \\>3 s recording. ", "A minimum trajectory of 30 frames (3 s) was used for analysis to minimize the problems associated with analysis of very short trajectories^[@CR35]^. We note that this automated algorithm does not separate immobile puncta from those (sub-diffusive) that move more slowly than diffusing puncta.", "\n\nSingle-step photobleaching analysis {#Sec25}\n-----------------------------------\n\nTime-lapse TIRFM images were captured while alternating (50 ms each) between wide-field (to accelerate bleaching) and TIRF illumination. ", "The TIRFM images were then used for analysis of single-step photobleaching of EGFP-IP~3~R1. ", "We attempted automated stepwise photobleaching analysis using the Progressive Idealization and Filtering (PIF) algorithm^[@CR75]^, but this systematically underestimated the number of bleaching events in the brightest puncta (not shown). ", "We therefore performed manual analysis of photobleaching on randomly selected puncta using Fiji Time Series Analyser, v.2.0. ", "The number of bleaching steps was computed from the initial fluorescence intensity of each punctum and the amplitude of the final bleaching step (Fig.", " [1e](#Fig1){ref-type=\"fig\"}). ", "We confirmed that neither fixation nor selection of particles in which the final bleaching step could be resolved affected the distribution of fluorescence intensities of the puncta (Supplementary Fig.", " [5](#MOESM1){ref-type=\"media\"}).", "\n\nAnalysis of IP~3~Rs at ER-PM junctions {#Sec26}\n--------------------------------------\n\nEGFP-IP~3~R1 HeLa cells transfected with plasmid encoding STIM1-mCherry were used 24 h after transfection. ", "TIRFM images (EGFP, 488 nm; mCherry, 561 nm) were acquired (6 frames  min^−1^, 15 min) before and after addition of thapsigargin (1 µM) in HBS. ", "After correction for background fluorescence (MetaMorph), immobile IP~3~R puncta were identified (see FRAP section). ", "The intensity of STIM1-mCherry was calculated (Fiji Time Series Analyser, v.2.0)^[@CR76]^ before and after thapsigargin treatment for circular ROIs centred on mobile or immobile IP~3~R puncta and with twice the radius (2*r*) of the IP~3~R puncta (*r* = 0.32--0.48 µm). ", "For visualizing histamine-evoked STIM1 puncta, EGFP-IP~3~R1 HeLa cells were transfected with plasmid encoding CFP-STIM1, and TIRFM images (CFP, 425 nm; EGFP, 488 nm) were acquired 24 h after transfection. ", "We confirmed, using four-colour beads (TetraSpeck microspheres, 0.1 µm), that chromatic aberration did not contribute to the non-overlapping localization of EGFP-IP~3~R1 and STIM1-mCherry, immunostained STIM1 or CFP-STIM1. ", "Numbers of STIM1 puncta were calculated using Fiji TrackMate.", "\n\nStatistics {#Sec27}\n----------\n\nMost results are presented as mean ± SEM from *n* independent analyses. ", "Statistical comparisons used paired or unpaired Student's *t*-tests, or analysis of variance with the Bonferroni correction used for multiple comparisons. ", "Significance levels are shown as \\**P* \\< 0.05, \\*\\**P* \\< 0.01, \\*\\*\\**P* \\< 0.001 and \\*\\*\\*\\**P* \\< 0.0001.", "\n\nData availability {#Sec28}\n-----------------\n\nThe authors declare that all data supporting the findings reported are presented within the article and associated [Supplementary Information](#MOESM1){ref-type=\"media\"} files. ", "The data and materials are available on request from the corresponding authors.", "\n\nElectronic supplementary material\n=================================\n\n {#Sec29}\n\nSupplementary Information Descriptions of Additional Supplementary Files Peer Review File Supplementary Movie 1 Supplementary Movie 2 Supplementary Movie 3 Supplementary Movie 4 Supplementary Movie 5 Supplementary Movie 6 Supplementary Movie 7 Supplementary Movie 8 Supplementary Movie 9\n\n**Electronic supplementary material**\n\n**Supplementary Information** accompanies this paper at doi:10.1038/s41467-017-01644-8.", "\n\n**Publisher\\'s note:** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.", "\n\nThis work was supported by the Biotechnology and Biological Sciences Research Council, UK (L0000075) and the Wellcome Trust (101844). ", "N.B.T. was supported by The Cambridge Commonwealth, European and International Trust. ", "We thank V. Allen (Manchester) for plasmids for KHC-CT, p50-mCherry and GFP-ER, J. Liou (UT Southwestern, Dallas) for GFP-MAPPER plasmid, D. Beech (Leeds) for human Orai1 plasmid, R. Blunck (Montréal) for PIF software, F. Levet and J.-B. Sibarita (Bordeaux) for SR-Tesseler software, T. Wagner (Dortmund) for the TraJClassifier plugin and helpful discussions. ", "We are grateful to M. Falke (Berlin) for advice.", "\n\nN.B.T. conducted most experiments. ", "A.P.C. (TALEN methods), S.C.T. (microscopy) and D.L.P. (optical probes) contributed to experiments. ", "N.B.T., D.L.P. and C.W.T. designed and analysed experiments, and wrote the paper. ", "All authors reviewed the paper.", "\n\nCompeting interests {#FPar1}\n===================\n\nS.C.T. is an employee of Cairn Research. ", "The remaining authors declare no competing financial interests.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0008967709727585316, 0.0010638482635840774, 0.0006901283632032573, 0.0012750523164868355, 0.0011297179153189063, 0.0008169579668901861, 0.0006521704490296543, 0.0008451845496892929, 0.0006467544590122998, 0.0006098176818341017, 0.000676104100421071, 0.001170057919807732, 0.0006746683502569795, 0.0007250859052874148, 0.0006380155682563782, 0.0007860313635319471, 0.0006035177502781153, 0.0006798406247980893, 0.0006603989750146866, 0.0006095047574490309, 0.0006369884358718991, 0.0007471107528544962, 0.0007800113526172936, 0.0007219190010800958, 0.000655017385724932, 0.000724815356079489, 0.0006801128038205206, 0.0009098324226215482, 0.0006108691450208426, 0.0008292015991173685, 0.001065134652890265, 0.0036057864781469107, 0.0006748500745743513, 0.009527618065476418, 0.003907708451151848, 0.0006468425854109228, 0.0006205267272889614, 0.008074893616139889, 0.0008600024739280343, 0.00239928369410336, 0.003321521682664752, 0.000629307993222028, 0.0009194226586259902, 0.0016800392186269164, 0.023116348311305046, 0.8399012684822083, 0.000772035913541913, 0.0006141765625216067, 0.0006392919458448887, 0.0006649112910963595, 0.0006710012094117701, 0.0006365475128404796, 0.0006188189145177603, 0.0006013122037984431, 0.0008014915511012077, 0.0006309971213340759, 0.0007307418272830546, 0.0006517199799418449, 0.000684937578625977, 0.0006392215727828443, 0.0006291388999670744, 0.0006575288716703653, 0.0005658896989189088, 0.0006207778351381421, 0.0006546229706145823, 0.0008154534152708948, 0.000995179289020598, 0.000603622174821794, 0.0007768501527607441, 0.000634658383205533, 0.0005986858741380274, 0.0007581832469440997, 0.0011468164157122374, 0.0007453379221260548, 0.06933657824993134, 0.8611494302749634, 0.0006647618138231337, 0.0008265135693363845, 0.6486145853996277, 0.001365557312965393, 0.0006404017913155258, 0.0005826461710967124, 0.058523405343294144, 0.007780658081173897, 0.0007151987520046532, 0.0006450840155594051, 0.0006011697696521878, 0.0006387401954270899, 0.0008352864533662796, 0.0006604877416975796, 0.0006788616883568466, 0.0006420512800104916, 0.0007531404262408614, 0.0008292015991173685, 0.0009730685269460082, 0.0022301343269646168, 0.0008540867129340768, 0.0012068311916664243, 0.0006731510511599481, 0.0006387401954270899, 0.001308188890106976, 0.0005992073565721512, 0.0032150461338460445, 0.010533622466027737, 0.0007343442994169891, 0.000785237061791122, 0.08783069998025894, 0.011105065234005451, 0.0008023278205655515, 0.0006592812133021653, 0.0007180629763752222, 0.0006108050583861768, 0.0006404017913155258, 0.0008663118351250887, 0.0006001395522616804, 0.0006772990454919636, 0.0006411367794498801, 0.0005618805880658329, 0.0006354479701258242, 0.0007023143116384745, 0.0006481962627731264, 0.0006905930931679904, 0.0006496644928120077, 0.0007158495718613267, 0.0006677877972833812, 0.0007128161378204823, 0.0007549180299974978, 0.0008093424257822335, 0.0010845750803127885, 0.0006387401954270899, 0.000711378816049546, 0.0007335242698900402, 0.0006510386010631919, 0.0005912877968512475, 0.0006006520125083625, 0.023153379559516907, 0.0006954972050152719, 0.0012094525154680014, 0.0008961099083535373, 0.0006194098968990147, 0.0006418374250642955, 0.000620833714492619, 0.0005931360647082329, 0.0006090108654461801, 0.0006206866819411516, 0.000652163871563971, 0.000676480820402503, 0.0006502296891994774, 0.0006222100928425789, 0.0006418374250642955, 0.0006173757137730718, 0.0013076269533485174, 0.0008754018344916403, 0.0007768501527607441, 0.007116292137652636, 0.0006629560957662761, 0.020866410806775093, 0.0006457378622144461, 0.000590441923122853, 0.0006469202926382422, 0.30226045846939087, 0.0013688280014321208, 0.0007146924617700279, 0.000670066918246448, 0.0006819018162786961, 0.000564042420592159, 0.0005608625942841172, 0.000651947280857712, 0.0006719159428030252, 0.0007459764019586146, 0.0007200227701105177, 0.0008504833094775677, 0.0006485895719379187, 0.0006512899417430162, 0.00069088937016204, 0.0006622712244279683, 0.0006058380822651088, 0.0006325922440737486, 0.004281805362552404, 0.0010593781480565667, 0.0006387943867594004, 0.0008470227476209402, 0.0006495353882201016, 0.0006338375387713313, 0.0006925769848749042, 0.0006413558730855584, 0.0006792476633563638, 0.0006392529467120767, 0.0006936060963198543, 0.0006542790215462446, 0.0006201164214871824, 0.0008369751158170402, 0.0006369729526340961, 0.0007481552311219275, 0.0009203591616824269, 0.0005797838093712926, 0.0006363700958900154, 0.0011787870898842812, 0.000662541133351624, 0.0006296935025602579, 0.0008916715742088854, 0.0008518609683960676, 0.0006489111110568047, 0.0006335971411317587, 0.0006546220392920077, 0.001476767472922802, 0.0008895695791579783, 0.0006354200886562467, 0.0007607025327160954, 0.0015078519936650991, 0.000722415919881314, 0.0013310873182490468, 0.0007873147260397673, 0.001061493530869484, 0.24970708787441254, 0.308641254901886, 0.0005817023338750005, 0.0007358950097113848, 0.0008211745298467577, 0.0006333478377200663, 0.0006851109210401773, 0.0008019903325475752, 0.0006111958064138889, 0.0006344688008539379, 0.0008472350891679525, 0.0009569770190864801, 0.0006457504350692034, 0.0006164202932268381, 0.0006344688008539379, 0.0007841411861591041, 0.000584047578740865, 0.0007424222421832383, 0.0007561056409031153, 0.00063447339925915, 0.0007161139510571957, 0.0008625502232462168, 0.0007203459972515702, 0.0006139518227428198, 0.0006425715982913971, 0.0006613503792323172, 0.0006875162944197655, 0.0006633789162151515, 0.0006702230894006789, 0.0006679835496470332, 0.0008727599633857608, 0.0006597344181500375, 0.0009365482837893069, 0.0008796480833552778, 0.000802083988673985, 0.0006584470393136144, 0.0008142716251313686, 0.0006604953086934984, 0.0007436305750161409, 0.0006542284972965717, 0.001057484420016408, 0.0023075588978827, 0.0006395899690687656, 0.0007366309873759747, 0.0032150461338460445, 0.0007662205025553703, 0.0007318237330764532, 0.0026726743672043085, 0.0005996318650431931, 0.04310198873281479, 0.0006106357323005795, 0.0007828794769011438, 0.0007022289792075753, 0.0006557157030329108, 0.0006496672285720706, 0.0006579978507943451, 0.0011152245569974184, 0.0007046255050227046, 0.0006677690544165671, 0.0006873505190014839, 0.0006665790569968522, 0.0008601484005339444, 0.0006451153894886374, 0.0018953129183501005, 0.0011712488485500216, 0.0006567160598933697, 0.0005941669223830104, 0.0006646401598118246, 0.0014268087688833475, 0.0007318237330764532, 0.0007055800524540246, 0.0006374089862219989, 0.0006823913427069783, 0.1302817165851593, 0.050580866634845734, 0.0427120104432106, 0.14453420042991638, 0.0008275281870737672, 0.0007298701093532145, 0.8635182976722717, 0.011173304170370102, 0.0005559306591749191, 0.0006937588332220912, 0.000649999245069921, 0.0006325346766971052, 0.0006670070579275489, 0.0006250205333344638, 0.0005945003940723836, 0.0006592049030587077, 0.0006977643934078515, 0.0006457117269746959, 0.0005942354910075665, 0.0006471573724411428, 0.0006464478210546076, 0.0006554932333528996, 0.0006345201982185245, 0.0006112176924943924, 0.0006362745771184564, 0.0007411498227156699, 0.0008091388153843582, 0.0006541730253957212, 0.001053912565112114, 0.0008674704586155713, 0.0007022249628789723, 0.0006976663134992123, 0.0006299461820162833, 0.000770704704336822, 0.0007856569136492908, 0.0006368345348164439, 0.0006395838572643697, 0.0006585135706700385, 0.0007455271552316844, 0.0006164202932268381, 0.000538391643203795, 0.0006820331327617168, 0.00065479741897434, 0.0006275608902797103, 0.0008579586865380406, 0.0006099121528677642, 0.0006911497912369668, 0.0006438681157305837, 0.0006424638559110463, 0.0006636723410338163, 0.0006494094268418849, 0.0006101641920395195, 0.0006497198482975364, 0.0006609568954445422, 0.0010358814615756273, 0.0006849532946944237, 0.0010297161061316729, 0.0007973451865836978, 0.0005840971134603024, 0.0006695877527818084, 0.0006736997747793794, 0.0007014083093963563, 0.001173749566078186, 0.0006417560507543385, 0.0007149649900384247, 0.0008916686056181788, 0.0006053223623894155, 0.0008583703311160207, 0.0007288946071639657, 0.0009758045198395848, 0.002964760409668088, 0.0007993222679942846, 0.0006583055364899337, 0.0007677949033677578, 0.0006485914345830679, 0.0026965239085257053, 0.009320996701717377, 0.053592879325151443, 0.0006008624332025647, 0.013488659635186195, 0.000611544877756387, 0.0006138590397313237, 0.002510401653125882, 0.0005424527334980667, 0.0006435122922994196, 0.0007224248256534338, 0.0007169279269874096, 0.0007898539188317955, 0.0005566804320551455, 0.0012312327744439244, 0.0006579552427865565, 0.0006230218568816781, 0.0007903515943326056, 0.0007552328170277178, 0.001013993052765727, 0.0007281388971023262, 0.001118989079259336, 0.0006170686101540923, 0.0011009470326825976, 0.00057209626538679, 0.0006245773984119296, 0.000636241224128753, 0.000554154219571501, 0.0006044218316674232, 0.0005994041566736996, 0.0005867796717211604, 0.000627222761977464, 0.0006232353625819087, 0.0006334984209388494, 0.0007426610682159662, 0.0011208283249288797, 0.0009600500925444067, 0.0006354548968374729, 0.0007021898054517806, 0.0008303772774524987, 0.0006846383912488818, 0.0024760798551142216, 0.011680749244987965, 0.0007140457164496183, 0.0006645565154030919, 0.000634601863566786, 0.0007209290633909404, 0.0008238860173150897, 0.0007360535673797131, 0.0007654133951291442, 0.0008293658611364663, 0.0005704149371013045, 0.0006270326557569206, 0.0007335029658861458, 0.0008332934230566025, 0.0006910249940119684, 0.0006862024893052876, 0.0008386903209611773, 0.000731155218090862, 0.001016870141029358, 0.0006117690354585648, 0.0006862024893052876, 0.0007165907882153988, 0.000755538756493479, 0.0005891065811738372, 0.0007814636919647455, 0.0009948275983333588, 0.0006168225663714111, 0.0007029306725598872, 0.0006267076241783798, 0.0006387130706571043, 0.0007679295376874506, 0.0009717103093862534, 0.0006075027049519122, 0.0007601177785545588, 0.0009407323668710887, 0.0013456015149131417, 0.0009727111319079995, 0.05908136069774628, 0.000676081923302263, 0.0006664422107860446, 0.0005517082754522562, 0.0005594199756160378, 0.00065941724460572, 0.00063447339925915, 0.0006241656374186277, 0.0006164202932268381, 0.0005984753952361643, 0.0006271229358389974, 0.0006387401954270899, 0.0006773968925699592, 0.0007345532649196684, 0.0006944966735318303, 0.0005777953774668276, 0.0007775811827741563, 0.000664310238789767, 0.10784649103879929, 0.0019691188354045153, 0.4970242381095886, 0.0006291439640335739, 0.0005855681374669075, 0.0006387401954270899, 0.000725420715752989, 0.0005932692438364029, 0.000612670264672488, 0.000597812351770699, 0.0006044512265361845, 0.0007380992756225169, 0.0006188779952935874, 0.0006187169346958399, 0.000645229360088706, 0.08584735542535782, 0.0006387401954270899, 0.0006299458909779787, 0.0007323549943976104, 0.0006511409883387387, 0.0006411367794498801, 0.000727508042473346, 0.0009528910741209984, 0.000649465131573379, 0.0006404652958735824, 0.0007238265825435519, 0.0006502316100522876, 0.0005943974829278886, 0.0006002256413921714, 0.0006671659648418427, 0.000703516707289964, 0.0007538548088632524, 0.0006369884358718991, 0.0007978148641996086, 0.0006369796465151012, 0.0006471459637396038, 0.0005856150528416038, 0.0005797401536256075, 0.0005484107532538474, 0.0005712038255296648, 0.0005776263424195349, 0.0006222100928425789, 0.0006418374250642955, 0.0007671714411117136, 0.0006694688345305622, 0.0007465925882570446, 0.000665044120978564, 0.0006558191380463541, 0.0006683977553620934, 0.0006302614929154515, 0.0006241445662453771, 0.0005998564884066582, 0.0009082132601179183, 0.0006580615299753845, 0.0006726079154759645, 0.0006392919458448887, 0.0007131225429475307, 0.0006751897162757814, 0.0006105995853431523, 0.0006625013193115592, 0.0010640464024618268, 0.0006524364580400288, 0.0005917399539612234, 0.000696473871357739, 0.0029615263920277357, 0.0034425798803567886, 0.0006180644850246608, 0.0005298697506077588, 0.0008835049229674041, 0.0005903288256376982, 0.0005749173578806221, 0.0005796426557935774, 0.0005928953178226948, 0.000538744090590626, 0.0006974060670472682, 0.0006025809561833739, 0.0007102004601620138, 0.0005436121136881411, 0.0007423359202221036, 0.0006327510927803814, 0.0019954426679760218 ]

[ "---\nabstract: 'We propose a generalized gradient approximation (GGA) for the angle- and system-averaged exchange-correlation hole of a many-electron system. ", "This hole, which satisfies known exact constraints, recovers the PBEsol (Perdew-Burke-Ernzerhof for solids) exchange-correlation energy functional, a GGA that accurately describes the equilibrium properties of densely packed solids and their surfaces. ", "We find that our PBEsol exchange-correlation hole describes the wavevector analysis of the jellium exchange-correlation surface energy in agreement with a sophisticated time-dependent density-functional calculation (whose three-dimensional wavevector analysis we report here).'", "\nauthor:\n- 'Lucian A. Constantin$^1$, John P. Perdew$^1$, and J. M. Pitarke$^{2,3}$'\ntitle: |\n Exchange-Correlation Hole of a Generalized Gradient Approximation\\\n for Solids and Surfaces\n---\n\nIntroduction {#sec1}\n============\n\nIn the Kohn-Sham (KS) density functional theory [@KS] for the ground-state energy of a many-electron system, only the exchange-correlation (xc) energy $E_{xc}[n]$ has to be approximated. ", "The exact xc energy of an arbitrary inhomogeneous system of density $n({\\bf r})$, which incorporates all the quantum many-body effects beyond the Hartree approximation, can be obtained from the spherical average $\\bar n_{xc}({\\bf r},u)$ of the coupling-constant averaged xc hole density $\\bar n_{xc}({\\bf r},{\\bf r}')$ at ${\\bf r}'$ around an electron at ${\\bf r}$ as follows [@LP1; @PCP] $$E_{xc}[n]=\\int d{\\bf r}\\,n({\\bf r})\\,\\varepsilon_{xc}[n]({\\bf r}),\n\\label{e1}$$ where $\\varepsilon_{xc}[n]({\\bf r})$ is the xc energy per particle at point ${\\bf r}$: $$\\begin{aligned}\n\\label{new}\n\\lefteqn{\n\\varepsilon_{xc}[n]({\\bf r})=\\frac{1}{2}\\int^\\infty_0 du\\; 4\\pi\nu^2\\frac{1}{u}\\bar n_{xc}({\\mathbf{r}},u)}\\nonumber\\\\\n& =4\\int^{\\infty}_{0} dk\\int^{\\infty}_{0} du\\,u^2\\,\n{\\sin ku\\over ku}\\,\\bar n_{xc}({\\bf r},u),\n\\label{e2}\\end{aligned}$$ with $$\\bar n_{xc}({\\bf r},u)=\n{1\\over 4\\pi}\\int d\\Omega\\,\\bar n_{xc}({\\bf r},{\\bf r}'),\n\\label{e3}$$ $d\\Omega$ being a differential solid angle around the direction of ${\\bf u}={\\bf r}'-{\\bf r}$, and $k$ representing the magnitude of the wavevector. (", "Unless otherwise stated, atomic units are used throughout, i.e., $e^2=\\hbar=m_e=1$.)\n\nThe “Jacob’s ladder” classification of the widely-used ground-state density-functional approximations for $E_{xc}[n]$ and $\\bar n_{xc}({\\bf r},u)$ has three complete non-empirical rungs: the local-spin-density approximation (LSDA), [@KS] the generalized-gradient approximation (GGA), [@PBE; @PBW; @EP] and the meta-GGA.", " [@TPSS; @CPT] Due to its simplicity and accuracy, one of the most commonly used xc density-functional approximation in solid-state physics and quantum chemistry calculations is nowadays the semilocal PBE-GGA.[@PBE]\n\nRecent work[@PCSB] has shown, however, that the exchange density-functional approximations should recover, in the limit of slowly-varying densities, the universal second-order gradient-expansion (GE) approximation of the exchange energy, $$E^{GE}_x[n]=\\int d{\\mathbf{r}}\\;n({\\mathbf{r}})\\epsilon^{unif}_x(n({\\mathbf{r}}))[1+\\mu^{GE}_x s^2({\\mathbf{r}})+...],\n\\label{e4b}$$ where $\\epsilon^{unif}_x$ is the exchange energy per particle of the uniform electron gas, $\\mu^{GE}_x=10/81$ is the GE exchange coefficient,[@AK] and $s=|\\nabla n|/(2k_Fn)$ is the reduced density gradient which measures the variation of the electron density over a Fermi wavelength $\\lambda_F=2\\pi/k_F$, with $k_F=(3\\pi^2 n)^{1/3}$ representing the magnitude of the local Fermi wavevector. ", "Recovery of the correct second-order gradient expansion for correlation [@MB] in the slowly-varying limit is much less important for the construction of density-functional approximations. (", "See Table 1 of Ref.", " ). ", "A GGA, which has as ingredients only the spin densities ${n_{\\uparrow}}$ and ${n_{\\downarrow}}$ and their gradients $\\nabla {n_{\\uparrow}}$ and $\\nabla{n_{\\downarrow}}$, cannot recover, in the limit of slowly varying densities, the GE approximation of the exchange energy and at the same time be accurate for atoms.[@PCSB; @PRCVSCZB] The semilocal PBE has the correct correlation GE coefficient in the high-density limit, and is accurate for atoms, but its exchange GE coefficient is almost twice as large as the exact coefficient, i.e., $\\mu_x^{PBE}\\approx 2\\mu_x^{GE}$. Because of this,[@PRCVSCZB] PBE overestimates the equilibrium lattice constants of solids and yields surface energies that are too low.", "\n\nFollowing the ideas of Ref.", " , PBEsol (PBE for solids) was constructed [@PRCVSCZB]. ", "PBEsol is a GGA that has the same form as PBE but restores the density-gradient expansion for exchange by replacing $\\mu^{PBE}_x=0.2195$ with $\\mu^{PBEsol}_x=\\mu^{GE}_x$. By fitting the jellium xc surface energies (as had been done previously in Ref.", "  in the construction of a GGA which relies on the Airy-gas approximation[@KM]), the PBEsol correlation GE coefficient was set to $\\mu^{PBEsol}_c=0.046$. (For PBE, $\\mu^{PBE}_c=0.0667$). ", "Thus, PBEsol can easily be applied in solid-state calculations (just by changing the coefficients in a PBE code) and yields good equilibrium lattice constants and jellium surface energies.[@PRCVSCZB] Several other applications of PBEsol have already proved the accuracy of this GGA for solids. ", "In particular, PBEsol considerably improves the structure of gold clusters [@Furche1] and works better than PBE for isomerization energies and isodesmic stabilization energies of hydrocarbon molecules.[@Gabor] PBEsol also describes ferro- and anti-ferro-electric $ABO_3$ crystals [@WVK] much better than LSDA or PBE-GGA.", "\n\nIn this paper, we first construct the PBEsol angle-averaged xc hole density $\\bar n^{PBEsol}_{xc}({\\bf r},u)$. A nonempirical derivation of the PBE xc hole was reported in Ref.", " , starting from the second-order density-gradient expansion of the xc hole and cutting off the spurious large-$u$ contributions to satisfy exact constraints according to which (i) the exchange-hole density must be negative, (ii) the exchange hole must integrate to -1, and (iii) the correlation hole must integrate to zero. ", "Later on, a fully smoothed analytic model was constructed for the PBE exchange hole.[@EP] Our construction of the PBEsol xc hole begins with and appropriately modifies the sharp cutoff [*correlation*]{} hole of Ref.", "  and the smooth [*exchange*]{} hole of Ref.", " . ", "It should be recalled that, because of an integration by parts that occurs in the underlying gradient expansion, a GGA hole is meaningful only after averaging over the electron density $n({\\mathbf{r}})$ (as in our tests and applications), and this system-averaging itself smooths sharp cutoffs.", "\n\nFinally, we use our PBEsol xc hole to carry out a three-dimensional (3D) wavevector analysis of the jellium xc surface energy. ", "This wavevector analysis was carried out in Ref.", "  in the random-phase approximation (RPA). ", "Here, we go beyond the RPA in the framework of time-dependent density-functional theory (TDDFT), and we compare these calculations with the results we obtain from our PBEsol xc hole density.", "\n\nThe paper is organized as follows. ", "In Sec. ", "II, we present the PBEsol angle-averaged xc-hole density $\\bar n^{PBEsol}_{xc}({\\bf r},u)$. In section III, we perform the wavevector analysis of the jellium xc surface energy. ", "In Sec. ", "IV, we summarize our conclusions.", "\n\nPBEsol-GGA angle-averaged exchange-correlation hole {#sec2}\n===================================================\n\nWe assume here that the PBEsol correlation energy can be constructed from a gradient expansion for the correlation hole in much the same way that the PBE correlation energy was so constructed [@PBW]. ", "The GGA angle-averaged correlation hole is [@PBW] $$\\bar n^{GGA}_c(r_s,\\zeta,t,v)=\\phi^5k^2_s[A_c(r_s,\\zeta,v)+t^2B_c(r_s,\\zeta,v)]\\theta \n(v_c-v),\n\\label{e5}$$ where $r_s = (9\\pi/4)^{1/3}/k_F$ is a local density parameter, $\\zeta=({n_{\\uparrow}}-{n_{\\downarrow}})/({n_{\\uparrow}}+{n_{\\downarrow}})$ is the relative spin polarization, $\\phi=[(1+\\zeta)^{2/3}+(1-\\zeta)^{2/3}]/2$ is a spin-scaling factor, $v=\\phi k_su$ with $k_s = (4 k_F/\\pi)^{1/2}$ is the reduced electron-electron separation on the scale of the screening length, and $t=|\\nabla n|/(2\\phi k_sn)$ is the reduced density gradient measuring the variation of the electron density over the screening length. ", "The sharp cutoff $v_c$ is found such that Eq.", " (\\[e5\\]) satisfies the correlation hole sum rule $\\int d{\\mathbf{r}}\\;n_c({\\mathbf{r}},{\\mathbf{r}}')=0$. $\\phi^5k^2_sA_c(r_s,\\zeta,v)$ is the LSDA correlation hole[@PW1] given by Eq.", " (45) of Ref.", " , and the gradient correction to the correlation hole is given by the following expression:[@PBW] $$B_c(r_s,\\zeta,v)=B^{LM}_c(v)[1-e^{-pv^2}]+\\beta(r_s,\\zeta)v^2e^{-pv^2},\n\\label{e6}$$ where $B^{LM}_c(v)$ is the RPA nonoscillating long-range contribution given by Eq.", " (49) of Ref.", " , $p(r_s,\\zeta)=\\pi k_F(0.305-0.136\\zeta^2)/4\\phi^4$ measures where the short-range contribution vanishes, and $$\\beta(r_s,\\zeta)=\\frac{2p^2}{3\\pi^3}[\\frac{\\mu^{GGA}_c}{\\mu_c^{PBE}}- \nE_1(12p)]\n\\label{e7}$$ is constructed so that the second-order gradient expansion of the PBEsol correlation energy is recovered. ", "Here $E_1(y)=ye^y\\int^{\\infty}_ydt\\;e^{-t}/t$ is between 0 and 1, and $\\mu^{GGA}_c$ is the GGA gradient coefficient in the slowly-varying limit ($\\mu^{PBE}_c$ for PBE and $\\mu^{PBEsol}_c$ for PBE-sol).", "\n\nIn Fig.", " \\[f1\\], we show PBE and PBEsol versions of $B_c(r_s,\\zeta,v)$ versus $v$, for $r_s=2$. Both PBE and PBEsol recover the correct RPA-like behavior \\[$B^{LM}_c(v)$\\] at large $v$, and they both show the same $\\zeta$ behavior; because $\\mu^{PBEsol}_c<\\mu^{PBE}_c$, however, at intermediate values of $v$ the PBEsol gradient correction to the correlation hole is substantially smaller than the PBE one. ", "The gradient correction $B_c(r_s,\\zeta,v)$ of Eq.", " (\\[e6\\]) can be negative at small $v$ and small $r_s$; however, because of the energy sum rule both $\\int^{\\infty}_0 du\\;u B_c(r_s,\\zeta,v)$ and $\\int^{\\infty}_0 du\\;u^2 B_c(r_s,\\zeta,v)$ are positive, which ensures that the cutoff procedure is correct and for every value of $r_s$, $\\zeta$, and $t$ there is a $v_c$ such that Eq.", " (\\[e5\\]) satisfies the correlation-hole sum rule.", "\n\n![", "Gradient correction to the correlation hole, $B_c(r_s,\\zeta,v)$, versus $v$ for $r_s=2$. PBE and PBEsol are compared here. ", "The solid line represents the Langreth-Mehl (LM) RPA contribution, which should be recovered at large $v$.[]{data-label=\"f1\"}](plotSOL1bis.ps){width=\"\\columnwidth\"}\n\nThe exchange energy and exchange-hole density for a spin-polarized system may be evaluated from their spin-unpolarized counterparts by using the spin-scaling relations[@PBW; @OP] $$E_{x}[n_{\\uparrow} ,n_{\\downarrow}]=\\frac{1}{2}\\{E_{x}[2 n_{\\uparrow}]+E_{x}[2 \nn_{\\downarrow}]\\}\n\\label{e8}$$ and $$n_{x}[n_{\\uparrow} ,n_{\\downarrow}](\\mathbf{r},\\mathbf{r}+\\mathbf{u})=\n\\sum_{\\sigma}\\frac{n_{\\sigma}(\\mathbf{r})}{n(\\mathbf{r})}n_{x}[2 n_{\\sigma}]\n(\\mathbf{r},\\mathbf{r}+\\mathbf{u});\n\\label{e9}$$ thus, we only need to consider the spin-unpolarized system. ", "As in the case of the analytical PBE exchange hole of Ref.", " , we choose the following ansatz for the nonoscillatory dimensionless exchange-hole shape: $$\\begin{aligned}\n\\lefteqn{\nJ^{PBEsol}(s,y)=[-\\frac{\\mathcal{A}}{y^{2}}\\frac{1}{1+(4/9)\\mathcal{A}y^{2}}\n +(\\frac{\\mathcal{A}}{y^{2}}+\\mathcal{B}+}\\nonumber\\\\\n&\\mathcal{C}[1+s^2\\mathcal{F}(s)]y^{2}+\\mathcal{E}[1+s^2\\mathcal{G}(s)]y^{4}\n)e^{-\\mathcal{D}y^{2}}]\ne^{-s^{2}\\mathcal{H}(s)y^{2}},\n\\label{e10}\\end{aligned}$$ where $s$ is the reduced density gradient for exchange. ", "When $s=0$, Eq.", " (\\[e10\\]) recovers [@PW; @EP] $J^{LSDA}$ for $\\mathcal{A}=1.0161144$, $\\mathcal{B}=-0.37170836$, $\\mathcal{C}=-0.077215461$, $\\mathcal{D}=0.57786348$, and $\\mathcal{E}=-0.051955731$. The functions $\\mathcal{F}(s)$, $\\mathcal{G}(s)$, and $\\mathcal{H}(s)$ are found in such a way that the energy and exchange-hole sum rules are satisfied: $$\\frac{8}{9}\\int^{\\infty}_{0}dy\\; y J^{PBEsol}(s,y)=-F^{PBEsol}_{x}(s)\n\\label{e11}$$ and $$\\frac{4}{3\\pi}\\int^{\\infty}_{0}dy\\; y^{2}J^{PBEsol}(s,y)=-1,\n\\label{e12}$$ and also the small-$u$ behavior of the exchange hole is recovered by [@EP]: $$\\mathcal{F}(s)=6.475\\mathcal{H}(s)+0.4797.", "\n\\label{e13}$$ Here $F^{PBEsol}_{x}(s)$ is the PBEsol enhancement factor.[@PRCVSCZB] The integrals of Eqs.", " (\\[e11\\]) and (\\[e12\\]) can be solved analytically, [@EP] and Eqs.", " (\\[e11\\])-(\\[e13\\]) reduce (by substitution) to an implicit equation for $\\mathcal{H}$ \\[Eq.", " (A4) of Ref.", " \\]. ", "We have solved this equation for PBEsol; the numerical solution that we have found for $\\mathcal{H}(s)$ (see Fig.", " \\[f2\\]) can be fitted to the following analytic expression: $$\\mathcal{H}(s)=\\frac{a_1s^2+a_2s^4}{1+a_3s^4+a_4s^6},\n\\label{e14}$$ where $a_1=0.00018855 $, $a_2=0.00741358 $, $a_3=0.05687256$, and $a_4=0.00675093$. For $s>8.5$, as occurs in the tail of an atom or molecule where the electron density is negligible, the implicit equation for $\\mathcal{H}(s)$ does not have a solution (as in the PBE case [@EP]) so we reset $s$ to $s=8.5$. Recently, Henderson *et al.* [", "@HJS] constructed a GGA exchange hole that eliminates this unphysical large-$s$ behavior by using some ideas from the meta-GGA hole [@CPT].", "\n\n![", "The exponent $\\mathcal{H}(s)$ of Eq.", " (\\[e10\\]) versus the reduced gradient $s$. The solid line represents the numerical solution of the implicit equation for $\\mathcal{H}(s)$ \\[Eq.", " (A4) of Ref.", " \\]. ", "The dashed line represents the fit of Eq.", " (\\[e14\\]).[]{data-label=\"f2\"}](plotSOL2bis.ps){width=\"\\columnwidth\"}\n\nIn Fig.", " \\[f3\\], we plot the dimensionless exchange hole shape $J^{PBEsol}(s,y)$ \\[using the analytical fit of Eq.", " (\\[e14\\])\\] versus $y=k_Fu$ for several values of the reduced gradient $s$. Our $J^{PBEsol}(s,y)$ looks similar to the $J^{PBE}(s,y)$ of Ref.", " , but $J^{PBE}(s,y)$ is deeper because $\\mu^{PBE}_x=0.2195 > \\mu^{PBEsol}_x=0.1235$.\n\n![", "Dimensionless exchange hole shape $J^{PBEsol}(s,y)$ \\[see Eq.", " (\\[e10\\])\\] versus $y=k_{F}u$, for $s$ between 0 and 3 in steps of 0.5. ", "For comparison with $J^{PBE}(s,y)$, see Fig.", " 2 of Ref.", " . ", "When $s=0$, $J^{PBEsol}(s,y)$ yields $J^{LSDA}(y)$.[]{data-label=\"f3\"}](plotSOL3bis.ps){width=\"\\columnwidth\"}\n\nFinally, we look at the xc enhancement factor, which displays the nonlocality: [@PT] $$F_{xc}^{GGA}=\\frac{\\epsilon_{xc}^{GGA}({n_{\\uparrow}},{n_{\\downarrow}},\\nabla{n_{\\uparrow}},\\nabla{n_{\\downarrow}})}{\\epsilon_x^{unif}(n)},\n\\label{e3b}$$ $\\epsilon_x^{unif}(n)$ being the exchange energy per particle of a spin-unpolarized uniform electron gas. ", "For a spin-unpolarized system in the high-density limit ($r_s\\rightarrow 0$) the exchange energy is dominant and Eq. (", "15) defines the exchange enhancement factor $F^{GGA}_x=\\epsilon^{GGA}_x(n,\\nabla \nn)/\\epsilon^{unif}_x(n)$. In Figs. ", "\\[f4\\] and \\[f4b\\], we show the PBEsol enhancement factor for a spin-unpolarized system, $F^{PBEsol}_{xc}(r_s,\\zeta=0,s)$, and for a fully-spin-polarized system, $F^{PBEsol}_{xc}(r_s,\\zeta=1,s)$, versus $s$ for several values of $r_s$. $F^{PBEsol}_{xc}$ is calculated either (i) from the analytic expression of $\\epsilon_{xc}^{PBEsol}$ reported in Ref.", "  or (ii) from our PBEsol angle-averaged xc hole density through Eq.", " (\\[e2\\]). ", "Overall, these calculations of $F^{PBEsol}_{xc}$ agree well with each other, confirming the assumption made at the beginning of this section; only for $r_s\\geq 10$ (when the electron density is very small) and $s\\approx 1.5$ is the error introduced by the second procedure significant [@note2]. ", "The analytic fit for $\\mathcal{H}(s)$ used to construct our PBEsol exchange hole does not exactly reproduce the PBEsol enhancement factor, but the difference is small as shown in Fig.", " \\[f4\\]. ", "At this point, we also note that the parametrization[@PBE; @PRCVSCZB] of $H(r_s,\\zeta,t)$ entering the analytic expression of $\\epsilon^{PBEsol}_c$ reported in Ref.", "  does not reproduce exactly the real-space cutoff results, as shown in Figs.", " 7 and 8 of Ref.", " .", "\n\n![", "The PBEsol enhancement factor $F_{xc}$ for the spin-unpolarized case ($\\zeta=0$), as a function of the reduced gradient $s$ for several values of $r_s$. The lines represent the enhancement factor obtained from the PBEsol xc energy functional of Ref.", " . ", "The dots represent the enhancement factor obtained from our PBEsol angle-averaged xc hole density through Eq.", " (\\[e2\\]).[]{data-label=\"f4\"}](plotSOL4bis.ps){width=\"\\columnwidth\"}\n\n![", "The PBEsol enhancement factor $F_{xc}$ for the fully-spin-polarized case ($\\zeta=1$), as a function of the reduced gradient $s$ for several values of $r_s$. The lines represent the enhancement factor obtained from the PBEsol xc energy functional of Ref.", " . ", "The dots represent the enhancement factor obtained from our PBEsol angle-averaged xc hole density through Eq.", " (\\[e2\\]).[]{data-label=\"f4b\"}](plotSOL5bis.ps){width=\"\\columnwidth\"}\n\nWavevector analysis of the jellium xc surface energy {#sec3}\n====================================================\n\nThe xc surface energy, $\\sigma_{xc}$, can be defined as the xc energy cost per per unit area to create a planar surface by cutting the bulk. ", "In a jellium model, in which the electron system is translationally invariant in the plane of the surface, and assuming the surface to be normal to the $z$-axis, the surface energy can be written as follows[@PCP] $$\\sigma_{xc}=\\int^{\\infty}_{0}d\\left(k\\over 2k_F\\right)\\,\\gamma_{xc}(k),\n\\label{e15}$$ where[@note1] $$\\gamma_{xc}(k)=2\\,{k_F\\over\\pi}\\int_{-\\infty}^{+\\infty}dz\\,n(z)\\,b_{xc}(k,z)\n\\label{e16}$$ is the wavevector-resolved xc surface energy, and $$b_{xc}(k,z)=4\\pi\\int_0^\\infty du\\,u^2\\,\n{\\sin ku\\over ku}\\left[\\bar n_{xc}(z,u)-\\bar n^{unif}_{xc}(u)\\right].", "\n\\label{e17}$$ Equations (\\[e15\\])-(\\[e17\\]) comprise an angle-averaged three-dimensional wavevector analysis of the surface xc energy into contributions from density fluctuations of various wavevectors $k$, following from the Fourier transform of the Coulomb interaction in Eq. (", "\\[e2\\]). ", "In these and subsequent equations, $k_F = (3\\pi^2 \\bar n)^{1/3}$ is the bulk (not the local) Fermi wavevector, and $r_s$ is the bulk (not the local) density parameter.", "\n\nThe exact low-wavevector limit of $\\sigma_{xc}$ is known to be[@LP1] $$\\gamma_{xc}(k\\rightarrow 0)=\\frac{k_F}{4\\pi}(\\omega_s-\\frac{1}{2}\\omega_p)k,\n\\label{e17b}$$ where $\\omega_p=(4\\pi\\bar{n})^{1/2}$ and $\\omega_s=\\omega_p/\\sqrt 2$ are the bulk- and surface-plasmon energies, and $\\bar{n}$ is the bulk density. ", "Eq.", " (\\[e17b\\]) was used in the wavevector-interpolation approach reported in Refs.", " , , and , and it was naturally recovered by the RPA approach reported in Ref.", " .", "\n\nTaking into account that $\\bf{k}\\equiv(\\bf{k_{||}},\\bf{k_z})$, $\\bf{k_{||}}$ being a wavevector parallel to the surface, Eq.", " (\\[e17\\]) can be expressed as follows[@PCP] $$\\begin{aligned}\nb_{xc}(k,z)&=&\n\\left[{1\\over 2}\\int_{-k}^{+k}{dk_{z}\\over k}\\int_{-\\infty}^{+\\infty}dz'\\,\n{\\rm e}^{ik_z(z-z')}\\right.\\cr\\cr\n&\\times&\\left.\\bar n_{xc}(k_{\\parallel};z,z')-\\bar n_{xc}^{unif}(k)\\right].", "\n\\label{e18}\\end{aligned}$$ In the case of RPA and TDDFT calculations, we use the fluctuation-dissipation theorem[@HG; @LP1; @GL] to derive $n_{xc}(k_{\\parallel};z,z')$ and $\\bar n_{xc}^{unif}(k)$ from the coupling-constant dependent density-response functions $\\chi_\\lambda^{unif}(k)$ and $\\chi_\\lambda(k_\\parallel;z,z')$, as follows [@PCP; @PE] $$\\bar{n}_{xc}^{unif}(k)={1\\over\\bar n}\n\\left[-\\frac{1}{\\pi}\\int_0^1d\\lambda\\int_0^\\infty\nd\\omega\\chi_\\lambda^{unif}(k,i\\omega)-\\bar n\\right]\n\\label{e19}$$ and $$\\begin{aligned}\n\\bar{n}_{xc}(k_{\\parallel};z,z')&=&{1\\over n(z)}\\left[-\\frac{1}{\\pi}\\int^{1}_{0}\nd\\lambda\\int^{\\infty}_{0}d\\omega\\right.\\cr\\cr\n&\\times&\\left.\\chi_\\lambda(z,z';k_{\\parallel},i\\omega)-n(z)\\delta(z-z')\\right],\n\\label{e20}\\end{aligned}$$ $\\chi_\\lambda^{unif}(k,\\omega)$ and $\\chi_\\lambda(z,z';k_{\\parallel},i\\omega)$ being 3D and 2D Fourier transforms of the corresponding density-response function $\\chi_{\\lambda}({\\bf r},{\\bf r}';\\omega)$. In the framework of TDDFT (our benchmark for this work), the density-response function $\\chi_{\\lambda}({\\bf r},{\\bf r}';\\omega)$ satisfies a Dyson-like equation of the form[@GDP] $$\\begin{aligned}\n&&\\chi_{\\lambda}({\\bf r},{\\bf r}';\\omega)=\n\\chi_0({\\bf r},{\\bf r}';\\omega)+\\int d{\\mathbf{r}}_1\\,d{\\mathbf{r}}_2\\,\n\\chi_0({\\bf r},{\\bf r}_1;\\omega)\\cr\\cr\n&\\times& \\left\\{{\\lambda\\over |{\\mathbf{r}}_1-{\\mathbf{r}}_2|}+\nf_{xc,\\lambda}[n]({\\mathbf{r}}_1,{\\mathbf{r}}_2;\\omega)\\right\\}\\,\n\\chi_{\\lambda}({\\bf r}_2,{\\bf r}';\\omega),\n\\label{e21}\\end{aligned}$$ where $\\chi_0({\\bf r},{\\bf r}';\\omega)$ is the density-response function of non-interacting KS electrons (which is exactly expressible in terms of KS orbitals [@GK]) and $f_{xc,\\lambda}[n]({\\bf r},{\\bf r}';\\omega)$ is the [*unknown*]{} $\\lambda$-dependent dynamic xc kernel. ", "When $f_{xc,\\lambda}[n]({\\bf r},{\\bf r}';\\omega)$ is taken to be zero, Eq.", " (\\[e21\\]) reduces to the RPA density-response function. ", "If the interacting density response function $\\chi_{\\lambda}({\\bf r},{\\bf r}';\\omega)$ is replaced by the noninteracting KS density-response function $\\chi_0({\\bf r},{\\bf r}';\\omega)$, then Eqs. (", "\\[e19\\]) and (\\[e20\\]) yield their [*exchange-only*]{} counterparts.", "\n\nIn the calculations presented below, we have considered, as in Ref.", " , a jellium slab of background thickness $a=2.23\\lambda_F$ (where $\\lambda_F = 2\\pi/k_F$) and bulk parameter $r_s=2.07$. This slab corresponds to about four atomic layers of Al(100).", "\n\nFor the GGA calculations of $\\gamma_{xc}(k)$, the function $b_{xc}(k,z)$ entering Eq.", " (\\[e16\\]) is taken from Eq.", " (\\[e17\\]) with the xc-hole densities calculated as reported in (i) Ref.", "  for $\\bar{n}_{xc}^{unif}(u)$, (ii) Refs.", "  and for $\\bar{n}_{xc}^{PBE}(z,u)$, and (iii) Section II above for $\\bar{n}_{xc}^{PBEsol}(z,u)$.\n\nFor the exact-exchange, exact-RPA, and TDDFT calculations of $\\gamma_{xc}(k)$, the function $b_{xc}(k,z)$ entering Eq.", " (\\[e16\\]) is taken from Eq.", " (\\[e18\\]) with the xc hole densities calculated from Eqs.", " (\\[e19\\]) and (\\[e20\\]). ", "In the case of the TDDFT calculations, we use the accurate static xc kernel reported and used in Ref.", " . ", "This kernel, which is based on a parametrization[@CSOP] of the diffusion Monte Carlo (DMC) calculations reported in Ref.", "  for the uniform electron gas, was constructed for jellium surfaces where neglect of the $\\omega$-dependence does not introduce significant errors, and is expected to yield exact results in the limits of small and large wavevectors. ", "Our numerical scheme was described in detail in Ref.", " , where only RPA calculations were reported.", "\n\n![", "PBE, PBEsol, and exact wavevector-resolved exchange surface energies $\\gamma_x(k)$, versus $k/2k_{F}$, for a jellium slab of thickness $a=2.23\\lambda_F$ and $r_s=2.07$. The semilocal PBE and PBEsol calculations have been performed from non-oscillatory parametrizations of the dimensionless exchange-hole shapes $J^{PBE}$ and $J^{PBEsol}$, respectively. ", "The area under each curve represents the corresponding exchange surface energy: $\\sigma^{PBE}_x=2164\\; \\mathrm{erg}/\\mathrm{cm}^{2}$, $\\sigma^{PBEsol}_x=2424\\; \\mathrm{erg}/\\mathrm{cm}^{2}$, and $\\sigma^{exact}_x=2348\\; \\mathrm{erg}/\\mathrm{cm}^{2}$.[]{data-label=\"f5\"}](plotSOL6bis.ps){width=\"\\columnwidth\"}\n\nThe wavevector-resolved exact-exchange surface energy $\\gamma_{x}(k)$ is shown in Fig.", " \\[f5\\]. ", "Figures \\[f6\\]-\\[f7\\] and Fig.", " \\[f9\\] show, respectively, the wavevector-resolved xc and correlation-only surface energies $\\gamma_{xc}(k)$ and $\\gamma_c(k)$. Figure \\[f5\\] shows that $\\gamma_x^{PBEsol}(k)$ improves over PBE, as expected, and is close to the exact $\\gamma_x(k)$ for intermediate values of the wavevector. ", "At large values of the wavevector, both PBE and PBEsol correctly recover the nonoscillatory LSDA (see Figs.", " 1 and 2 of Ref. ); ", "differences between this nonoscillatory PBEsol (and also LSDA and PBE) and the exact $\\gamma_x(k)$ at these large values of $k$ are due to inaccuracy of the nonoscillatory model employed in Eq. (", "\\[e10\\]) near $k=2k_F$.\n\n![", "Exact-RPA and benchmark TDDFT wavevector-resolved xc surface energies $\\gamma_{xc}(k)$, versus $k/2k_{F}$, for a jellium slab of thickness $a=2.23\\lambda_F$ and $r_s=2.07$. The area under each curve represents the corresponding xc surface energy: $\\sigma^{RPA}_{xc}=3091\\; \\mathrm{erg}/\\mathrm{cm}^{2}$ and $\\sigma^{TDDFT}_{xc}=3090\\; \\mathrm{erg}/\\mathrm{cm}^{2}$. The straight dotted line represents the universal low-wavevector limit of Eq.", " (\\[e17b\\]).[]{data-label=\"f6\"}](plotSOL7bis.ps){width=\"\\columnwidth\"}\n\nIn Fig.", " \\[f6\\], we compare the wavevector-resolved exact-RPA surface energy (as reported in Ref.", " ) with its TDDFT counterpart (which we have not reported elsewhere, and which required three months of computation). ", "In the long-wavelength limit ($k\\to 0$), both RPA and TDDFT calculations approach the exact low-wavevector limit of Eq.", " (\\[e17b\\]). ", "In the large-$k$ limit, where RPA is wrong, our TDDFT approach (which reproduces accurately the xc energy of the uniform electron gas) is expected to be accurate. ", "Furthermore, the uniform-gas-based isotropic xc kernel that we use in our TDDFT calculation has been shown recently to yield essentially the same two-dimensional (2D) wavevector analysis as a more sophisticated high-level correlated approach (the inhomogeneous Singwi-Tosi-Land-Sjölander method) which does not use an isotropic kernel derived from the uniform gas.[@CPDGP] Hence, we take the TDDFT wavevector-resolved surface energy represented in Fig.", " \\[f6\\] by a solid line as the benchmark curve against which we compare various GGA’s.", "\n\n![", "PBE, PBEsol, and benchmark TDDFT wavevector-resolved xc surface energies $\\gamma_{xc}(k)$, versus $k/2k_{F}$, for a jellium slab of thickness $a=2.23\\lambda_F$ and $r_s=2.07$. The semilocal PBE and PBEsol calculations have been performed from non-oscillatory parametrizations of the dimensionless exchange-hole shapes $J^{PBE}$ and $J^{PBEsol}$, respectively. ", "The area under each curve represents the corresponding xc surface energy: $\\sigma^{PBE}_{xc}=2885\\; \\mathrm{erg}/\\mathrm{cm}^{2}$, $\\sigma^{PBEsol}_{xc}=3027\\; \\mathrm{erg}/\\mathrm{cm}^{2}$, and $\\sigma^{TDDFT}_{xc}=3090\\; \\mathrm{erg}/\\mathrm{cm}^{2}$. The straight dotted line represents the universal low-wavevector limit of Eq.", " (\\[e17b\\]).[]{data-label=\"f7\"}](plotSOL8bis.ps){width=\"\\columnwidth\"}\n\nFigure \\[f7\\] shows our wavevector-resolved TDDFT surface energy together with its PBE and PBEsol counterparts. ", "$\\gamma_{xc}^{PBEsol}$ is nearly exact at small wavevectors, where it matches the exact initial slope of Eq.", " (\\[e17b\\]). ", "At intermediate wavevectors, $\\gamma_{xc}^{PBEsol}$ is very close to our benchmark TDDFT calculation. ", "As in the case of wavevector-resolved exchange-only surface energies, PBE and PBEsol calculations correctly recover the nonoscillatory LSDA and differ from the more accurate TDDFT calculation due to the inaccuracy of the nonoscillatory model of the exchange-hole shape \\[see, e.g., Eq.", " (\\[e10\\])\\]. ", "Figure \\[f7\\] shows that $\\gamma_{xc}^{PBEsol}$ nicely matches our benchmark TDDFT calculation at low and intermediate wavevectors, so we recommend using the model PBEsol xc hole, in all solid-state calculations where the hole is needed but full nonlocality is not important, instead of the more expensive TDDFT. ", "We recall that the system-averaged hole, unlike the energy density, is uniquely defined, and is an observable at full coupling strength [@PBW].", "\n\n![", "PBE, PBEsol, exact-RPA, and benchmark TDDFT wavevector-resolved correlation surface energies $\\gamma_c(k)$, versus $k/2k_{F}$, for a jellium slab of thickness $a=2.23\\lambda_F$ and $r_s=2.07$. The area under each curve represents the corresponding correlation surface energy: $\\sigma^{PBE}_{c}=720\\; \\mathrm{erg}/\\mathrm{cm}^{2}$, $\\sigma^{PBEsol}_{c}=604\\; \\mathrm{erg}/\\mathrm{cm}^{2}$, $\\sigma^{RPA}_{c}=743\\; \\mathrm{erg}/\\mathrm{cm}^{2}$, and $\\sigma^{TDDFT}_{c}=742\\; \\mathrm{erg}/\\mathrm{cm}^{2}$.[]{data-label=\"f9\"}](plotSOL9bis.ps){width=\"\\columnwidth\"}\n\nFigure \\[f9\\] exhibits the wavevector-resolved correlation-only PBE, PBEsol, exact-RPA, and TDDFT surface energies. ", "We observe that at long wavelengths ($k\\to 0$), where the LSDA is known to fail badly, and at short wavelengths (large $k$), where RPA is wrong, the GGA’s under consideration are considerably close to our benchmark TDDFT calculations. ", "At intermediate wavevectors, however, GGA’s cannot describe $\\gamma_c$ accurately, although PBEsol has been shown in Fig.", " \\[f7\\] to give a very good description of $\\gamma_{xc}$. This is due to a cancellation of the errors introduced at these wavevectors within the exchange and correlation contributions to $\\gamma_{xc}$, which almost cancel each other [@note3].", "\n\n Conclusions {#sec4}\n============\n\nWe have constructed a PBEsol angle-averaged xc hole $\\bar{n}_{xc}({\\mathbf{r}},u)$ that satisfies known exact constraints and recovers the recently reported PBEsol xc energy functional. ", "Our construction of the PBEsol xc hole begins from and appropriately modifies the sharp cutoff [*correlation*]{} hole of Ref.", "  and the smooth [*exchange*]{} hole of Ref.", " . ", "We also generalize \\[see Eq.", " (\\[e7\\])\\] the sharp cutoff procedure for the correlation hole to any GGA which has a positive gradient expansion coefficient.", "\n\nWe have found that our PBEsol xc hole describes accurately the wavevector-resolved xc jellium surface energy for all values of the wavevector, thus providing support for the PBEsol GGA for solids and surfaces.", "\n\nL.A.C. and J.P.P. acknowledge NSF support (Grant No. ", "DMR05-01588). ", "J.M.P. acknowledges partial support by the Spanish MEC (grant No. ", "FIS2006-01343 and CSD2006-53) and the EC 6th framework Network of Excellence NANOQUANTA. ", "L.A.C. thanks the Donostia International Physics Center (DIPC) where this work was started.", "\n\n[\\[Vo\\]]{}\n\n, Phys. ", "Rev. $\\mathbf{140}$, A1133 (1965). , ", "Phys. ", "Rev. B $\\mathbf{15}$, 2884 (1977); $\\mathbf{21}$, 5469 (1980); $\\mathbf{26}$, 2810 (1982). , ", "Phys. ", "Rev. B $\\mathbf{74}$, 045121 (2006). , ", "Phys. ", "Rev. Lett. ", "$\\mathbf{77}$, 3865 (1996). , ", "Phys. ", "Rev. B $\\mathbf{54}$, 16533 (1996); ibid. ", "$\\mathbf{57}$, 14999 (1998) (E). , ", "J. Chem. ", "Phys. ", "$\\mathbf{109}$, 3313 (1998). , ", "Phys. ", "Rev. B $\\mathbf{73}$, 205104 (2006). , ", "Phys. ", "Rev. Lett. ", "$\\mathbf{91}$, 146401 (2003). , ", "Phys. ", "Rev. Lett. ", "$\\mathbf{97}$, 223002 (2006). , ", "Phys. ", "Rev. B $\\mathbf{31}$, 6779 (1985). , ", "Phys. ", "Rev. $\\mathbf{165}$, 18 (1968). , ", "Phys. ", "Rev. Lett. [**", "100**]{}, 136406 (2008). ", "Erratum submitted. , ", "Phys. ", "Rev. B $\\mathbf{72}$, 085108 (2005). , ", "Phys. ", "Rev. Lett. ", "$\\mathbf{81}$, 3487 (1998). , ", "Phys. ", "Rev. A $\\mathbf{77}$, 053202 (2008) . , ", "J. Chem. ", "Theory Comput. ", "$\\mathbf{4}$, 888 (2008). , ", "Phys. ", "Rev. B $\\mathbf{78}$, 104116 (2008). , ", "Phys. ", "Rev. B $\\mathbf{45}$, 13244 (1992). , ", "Phys. ", "Rev. A $\\mathbf{20}$, 397 (1979). , ", "Phys. ", "Rev. B $\\mathbf{46}$, 12947 (1992). , ", "J. Chem. ", "Phys. ", "$\\mathbf{128}$, 194105 (2008). , ", "J. Chem. ", "Phys. ", "$\\mathbf{120}$, 6898 (2004). ", "We expect that our xc hole will have practically the same accuracy as the PBEsol xc energy functional for the lattice-constant tests presented in Ref. [", "@PRCVSCZB], because the PBEsol exchange is very accurately fitted in Figs. ", "4 and 5. ", "It was shown in the Supporting Information of Ref. [", "@PRCVSCZB] that the lattice constants are not sensitive to the details of the gradient dependence of the correlation functional (which is less well fitted in Figs. ", "4 and 5). ", "This equation holds for a semi-infinite jellium system. ", "For a jellium slab, the right-hand side of Eq.", " (\\[e16\\]) should be divided by a factor of 2. , ", "Phys. ", "Rev. B $\\mathbf{61}$, 2595 (2000). , ", "Phys. ", "Rev. B, $\\mathbf{11}$, 3669 (1975). , ", "Phys. ", "Rev. B $\\mathbf{13}$, 4274 (1976). ", "J.M. Pitarke and A.G. Eguiluz, Phys. ", "Rev. B $\\mathbf{57}$, 6329 (1998); $\\mathbf{63}$, 045116 (2001). , ", "in *Density Functional Theory II*, Vol.181 of *Topics in Current Chemistry*, edited by R.F. Nalewajski (Springer, Berlin, 1996), p.81. , ", "Phys. ", "Rev. Lett. ", "$\\mathbf{55}$, 2850 (1985). ", "J.M. Pitarke and J.P. Perdew, Phys. ", "Rev. B $\\mathbf{67}$, 045101 (2003). , ", "Phys. ", "Rev. B $\\mathbf{57}$, 14569 (1998). , ", "Phys. ", "Rev. Lett. ", "$\\mathbf{75}$, 689 (1995). ", "L.A. Constantin, J. M. Pitarke, J. F. Dobson, A. García-Lekue, and J.P. Perdew, Phys. ", "Rev. Lett. [**", "100**]{}, 036401 (2008). ", "Figs. ", "6 and 9 show that for small wavevectors ($k/2k_F<0.05$) and for $k/2k_F$ between 0.25 and 0.4, $\\gamma_x^{PBE}(k)$ and $\\gamma_c^{PBE}(k)$ are more accurate than their PBEsol analogs. ", "However, due to error cancellation between exchange and correlation, $\\gamma_{xc}^{PBEsol}(k)$ is considerably closer to $\\gamma_{xc}^{TDDFT}(k)$ than is $\\gamma_{xc}^{PBE}(k)$ for $k/2k_F\\leq 0.5$ (see Fig. ", "8).", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0006095596472732723, 0.0007175669888965786, 0.0006400140700861812, 0.0006741044344380498, 0.025107504799962044, 0.0006724566337652504, 0.0009828363545238972, 0.0005696119624190032, 0.0006700129597447813, 0.000777637877035886, 0.0013066013343632221, 0.000694243295583874, 0.0006716041825711727, 0.009925110265612602, 0.0011779812630265951, 0.0007323598838411272, 0.0007416440639644861, 0.0007207556045614183, 0.0008105163578875363, 0.0006375699886120856, 0.002942444756627083, 0.0021375217474997044, 0.0007123184041120112, 0.0008697895682416856, 0.0006169357220642269, 0.0006136917509138584, 0.0005741080967709422, 0.0005558658158406615, 0.000787202559877187, 0.0007496857433579862, 0.000787202559877187, 0.0005600244621746242, 0.0011548475595191121, 0.003136284416541457, 0.007547744549810886, 0.0016908643301576376, 0.0007297720294445753, 0.0015057320706546307, 0.0007374261622317135, 0.004175021778792143, 0.018225977197289467, 0.0006813191575929523, 0.0011813279706984758, 0.001027479418553412, 0.009915037080645561, 0.0008552133804187179, 0.0019055787706747651, 0.0008008681470528245, 0.0021366907749325037, 0.0007312471861951053, 0.00932270847260952, 0.005982187110930681, 0.005765745881944895, 0.0011448326986283064, 0.0006891691009514034, 0.0012914090184494853, 0.0007137279608286917, 0.0017497678054496646, 0.0006498177535831928, 0.0012194697046652436, 0.0034899467136710882, 0.0019055787706747651, 0.0007403024355880916, 0.0007987424614839256, 0.0007137279608286917, 0.0017497678054496646, 0.0006637596525251865, 0.0007628734456375241, 0.0009801002452149987, 0.0212172232568264, 0.006594748701900244, 0.0008623822359368205, 0.057574328035116196, 0.0006632638978771865, 0.0007617173250764608, 0.0021375217474997044, 0.009230461902916431, 0.0006612473516725004, 0.0009650577558204532, 0.0008707970846444368, 0.000657881610095501, 0.0010623285779729486, 0.0006757494411431253, 0.0006917755235917866, 0.01589210517704487, 0.000769507372751832, 0.0006432271911762655, 0.0007609652820974588, 0.0021375217474997044, 0.0019055787706747651, 0.0006949317175894976, 0.0021375217474997044, 0.0006013606325723231, 0.0011135924141854048, 0.000701583456248045, 0.0021375217474997044, 0.0006013606325723231, 0.0014946898445487022, 0.00898649450391531, 0.0007050127605907619, 0.0015248865820467472, 0.0012395704397931695, 0.0035581598058342934, 0.0010828772792592645, 0.0006315573118627071, 0.0006251411396078765, 0.0021375217474997044, 0.0013033237773925066, 0.00973917543888092, 0.007561662700027227, 0.0043577514588832855, 0.0006895349943079054, 0.0009659164352342486, 0.0010590102756395936, 0.0005695880390703678, 0.0011755716986954212, 0.001305599114857614, 0.0007982643437571824, 0.0007762124296277761, 0.004716784227639437, 0.002608424983918667, 0.0007982643437571824, 0.0007499190396629274, 0.0011436303611844778, 0.0005576690309680998, 0.0021375217474997044, 0.0005799068021588027, 0.0007540840306319296, 0.0005809402209706604, 0.0005908216116949916, 0.0019055787706747651, 0.0008053791825659573, 0.0008971431525424123, 0.01658431813120842, 0.0009790895273908973, 0.0007866739179007709, 0.0007063455996103585, 0.0007013849099166691, 0.0009199352934956551, 0.045812129974365234, 0.0009501359309069812, 0.000759666960220784, 0.0007313642418012023, 0.0005627026548609138, 0.0007389279780909419, 0.0009760044631548226, 0.0009513929253444076, 0.0005923903081566095, 0.0011362453224137425, 0.0019055787706747651, 0.0007777839200571179, 0.0010133561445400119, 0.0006931425305083394, 0.0007858137832954526, 0.0009760044631548226, 0.0006328235031105578, 0.0007355273119173944, 0.0015982448821887374, 0.0007429771358147264, 0.0005712666898034513, 0.0019055787706747651, 0.0018060678848996758, 0.0006576148443855345, 0.0007097545894794166, 0.0007501363288611174, 0.0008479926618747413, 0.0010598581284284592, 0.002942444756627083, 0.0021375217474997044, 0.0007347472128458321, 0.0018347568111494184, 0.0007493260782212019, 0.000610361632425338, 0.0009215069003403187, 0.0005551692447625101, 0.0005746628739871085, 0.0005504431901499629, 0.0010665704030543566, 0.000753166910726577, 0.0012429299531504512, 0.0011240848107263446, 0.0012429299531504512, 0.000855693535413593, 0.0012429299531504512, 0.0009818780235946178, 0.0008822330855764449, 0.0012429299531504512, 0.0008038909290917218, 0.0009686460834927857, 0.0009970298269763589, 0.0012429299531504512, 0.0008965604356490076, 0.0012429299531504512, 0.000851261371280998, 0.0012429299531504512, 0.0009818780235946178, 0.0009313652408309281, 0.0012429299531504512, 0.0009818780235946178, 0.0010241132695227861, 0.0012429299531504512, 0.0008662635809741914, 0.0012429299531504512, 0.0008195579284802079, 0.0012429299531504512, 0.0009571402915753424, 0.0008168136118911207, 0.001014821813441813, 0.0012429299531504512, 0.0008882368565537035, 0.0012429299531504512, 0.0009818780235946178, 0.0009458167478442192, 0.0012429299531504512, 0.0008371209842152894, 0.0009970298269763589, 0.0009779301472008228, 0.0009422918665222824, 0.0012429299531504512, 0.0008300940971821547, 0.0012429299531504512, 0.0008093065698631108, 0.0012429299531504512, 0.0008510605548508465, 0.0012429299531504512, 0.0008233342668972909, 0.0009970298269763589, 0.0012429299531504512, 0.000882582797203213, 0.0009970298269763589, 0.0012429299531504512, 0.0009163678041659296, 0.0006163567886687815, 0.000607068941462785, 0.0007508174749091268, 0.0005938230897299945, 0.0006714637274853885, 0.0007382694748230278, 0.0011664378689602017, 0.007605704013258219, 0.000774380867369473, 0.0012429299531504512, 0.000836133724078536, 0.0012429299531504512, 0.0008069163304753602, 0.0012429299531504512, 0.0008636745042167604, 0.000943942170124501, 0.0009170949342660606, 0.0006068606744520366, 0.0012429299531504512, 0.0009818780235946178, 0.0008760584751144052, 0.0009053167304955423, 0.0008660152088850737, 0.0012429299531504512, 0.0008782068034633994, 0.0012429299531504512, 0.0009818780235946178, 0.0009060173761099577, 0.0009061633027158678, 0.0009571402915753424, 0.0008831859449855983, 0.0007230323390103877, 0.0008623538305982947, 0.0012646850664168596, 0.000941664504352957, 0.0019954426679760218 ]

[ "Latest Issue\n\nBioplastics producer Novamont has announced that, following scientific testing, its bioplastic carrier bags made using MATER-BI technology, are 100 per cent biodegradable in anaerobic digestion (AD) plants.", "\n\nThe Co-op uses MATER-BI compostable carrier bags\n\nThe study was carried out in Germany by IGlux Witzenhausen and Witzenhausen-Institut for the Italian bio-based materials company, testing the MATER-BI bioplastic bags in the AD process using equipment made by four different companies: Kompogas, Thoeni, Bekon and WTT.", "\n\nThe test was commissioned in Germany due to the significant role played by organic waste in the country’s national renewable energy plan regards to its application in producing biogas. ", "A fully biodegradable carrier bag would provide a boon for landfill reduction goals and for the energy-from-waste sector.", "\n\nOver the course of the testing process, the carrier bags were monitored at the pre-treatment, AD, post-composting and maturation stages at each plant, with the percentage by weight of MATER-BI in the input material registered as between 3.5 and 3.8 per cent.", "\n\nNovamont said in a statement: “Degradation began during the anaerobic stage and was completed during composting. ", "In total the process took between five and ten weeks, depending on the plant.", "\n\n“No MATER-BI residue was found in any of the samples examined at the end of the test, demonstrating that it had completely degraded in all four plants… The test was entirely successful, with complete degradation of MATER-BI carrier bags within the time normally taken for the process at all four plants, which are representative of the majority of anaerobic digestion facilities employed to process organic waste in Germany, eliminating any reservations about use of the bags.”", "\n\nBags of potential\n\nIt is hoped that this step forward for bio-plastic carrier bags will prove to be another weapon in the fight against plastic waste.", "\n\nRelated Articles\n\nA ‘world-first’ industrial-scale facility to create a chemical intermediate for plastic production from renewable sources has opened, as CEP Rapporteur Simone Bonafe calls for the mainstreaming of the circular economy approach.", "\n\nOnline sellers should be legally required to take on the duties of ‘producer’ under the EU Waste Electrical and Electronic Equipment (WEEE) Directive amid accusations of freeriding, say WEEE collection and recycling associations." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006943402113392949, 0.0006663688109256327, 0.0010358750587329268, 0.0017423690296709538, 0.0005426831194199622, 0.000599248509388417, 0.0005790716968476772, 0.0006222972297109663, 0.0017582621658220887, 0.0005607156199403107, 0.0007274206727743149 ]

[ "Q:\n\nWhy should I use typedefs in C++?", "\n\nLets say I have:\nset<int, less<int> > m_intset;\n\nThat works, but now I change it to typedef, and I do end up with two lines of code:\ntypedef set<int, less<int> > SetInt;\nSetInt m_intset;\n\nWhat's the advantage of such a typedef? ", "Am I using it correctly?", "\n\nA:\n\nSome advantages to using typedef:\n\nSimplification: Now, every time you would normally have needed set<int, less<int> >, you only have to type SetInt. ", " Not a big deal if you're only using the set once, but if you've got multiple instances of the same set, or need to access iterators thereof, the shorter form is much easier to read and type.", "\nClarification: set<int, less<int> > doesn't tell me anything about what the variable is used for, just that it's a set of ints. ", " With typedef, you can choose an identifier that explains the purpose of the type, such as Inventory or Coordinates, for example.", "\nAbstraction: Programs change. ", " Although you may think you need a set<int, less<int> > now, there's always the possibility that your requirements may change in the future, necessitating a set<unsigned long, less<unsigned long> > or vector<int> or some other change. ", " By using a typedef, you would only have to fix this in one place, and it will affect every instance of SetInt in the program. ", " This is far simpler and less prone to error than manually changing a dozen or more entries in the source files.", "\n\nDue to points 2 and 3 above, typedef can be very powerful when used inside a class or a library, since it can strengthen the separation between interface and implementation which is generally considered good C++ form.", "\nOf course, most of these advantages only really show themselves if you're using the same type multiple times in the same program. ", " If you only expect to use the set<int, less<int> > once, typedef is probably overkill.", "\n\nA:\n\nTypedef's are mostly notational convenience, but they do have a bunch of benefits:\n\nDeclaring function pointer types (e.g. for callbacks)--notoriously\nhard to get right when spelled out\ncompletely.", "\nDependent type information is easier to describe (e.g. SetInt::iterator) and should you ever change your mind (suppose you went to a hash_set instead of a std::set), is effectively updated immediately due to the typedef\nThey describe intent better than built-in typenames do (e.g. typedef int ErrCode)\n\nI'm sure there are more I'm not thinking of.... \n\nA:\n\nYou have it exactly correct. ", "Using a typedef makes it easier to use things like SetInt::iterator.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007903500809334219, 0.0009122591000050306, 0.0007561337552033365, 0.0007377609726972878, 0.0005932913045398891, 0.0007856760639697313, 0.0005610790685750544, 0.000637723773252219, 0.0006362281856127083, 0.000653945782687515, 0.0007278634584508836, 0.0005990343634039164, 0.0006117174052633345, 0.0010051548015326262, 0.000644574873149395, 0.0006475340342149138, 0.0006851099315099418, 0.0019954426679760218 ]

[ "Limited Edition Recreation Project\n\nThe Official\n\nLady Vivamus ©\n\nfrom Heinlein's Glory Road\n\n\n\nThe sword is fully endorsed\n\nby the\n\nRobert A. and Virginia\n\nHeinlein Prize Trust\n\n\n\nThe trust promotes and awards the Heinlein Prize for advances in commercial space activities\n\n\"What did I want?", "\n\nI wanted the hurtling moons of Barsoom. ", "I wanted Storisende and Poictesme, and Holmes shaking me awake to tell me, \"The games' afoot!\" ", "I wanted to float down the Mississippi on a raft and elude a mob in company with the Duke of Bilgewater and the Lost Dauphin. ", "I wanted Prester John and Excalibur held by a moon-white arm out of a silent lake. ", "I wanted to sail with Ulysses and with Tros of Samothrace and eat the lotus in a land that seemed always afternoon.", "\n\nI wanted the feeling of romance and the sense of wonder I had known as a kid. ", "I wanted the world to be what they had promised me it was going to be -- instead of the tawdry, lousy, fouled-up mess it is.\"", "\n\n-- Glory Road, Robert Heinlein\n\n\n\nThis is the only official Lady Vivamus, endorsed by the Heinlein Prize Trust, in a limited edition of 100 swords, based on the sword described in the Robert Heinlein classic, Glory Road.", "\n\n\n\nThis has been a dream sword of Howy and Jody's since they were kids. ", "They teamed up with Lars, Jason and Steve to come up with this design based on Heinlein's very detailed description:\n\n\n\n\"...and [I] found there the blade that suited me the way Excalibur suited Arthur.", "\n\nI've never seen one quite like it, so I don't know what to call it. ", "A saber, I suppose, as the blade was faintly curved and razor sharp on the edge and sharp rather far on the back. ", "But it had a point as deadly as a rapier and the curve was not enough to keep it from being used for thrust and counter quite as well as chopping away meat-axe style. ", "The guard was a bell curved back around the knuckles into a semi-basket but cut away enough to permit full moulinet from any guard.", "\n\nIt balanced in the forte less than two inches from the guard, yet the blade was heavy enough to chop bone. ", "It was the sort of sword that feels like an extension of your body.", "\n\nThe grip was honest sharkskin, molded to my hand. ", "There was a motto chased on to the blade but it was so buried in curlicues that I did not take time to study it out. ", "This girl was mine, we fitted! ", "I returned it and buckled belt and scabbard to my bare waist, wanting the touch of it and feeling like Captain John Carter, and the Gascon and his three friends all in one.\"", "\n\n\n\n\"I drew my sword and glanced along it, feeling its exquisite balance while noting again the faint ripples left by the feather-soft hammerblows of some master swordsmith. ", "I tossed it and caught it by the forte. \"", "Read the motto, Star.\"", "\n\nShe traced it out. \"", "Dum vivimus, vivamus! -- '", "While we live, let us live!' \"", "\n\n-- Glory Road, Robert Heinlein\n\n\n\nSimilar to a military or fencing sabre and suitable for both thrust and heavy cutting, the slightly curved, hollow-ground blade comes to a rapier-like point, and is sharp 10\" along the back edge. ", "Only a limited number of these swords can be made in the course of a year. ", "The sword ships in a specially designed handmade wooden box that can easily be converted into a display box for your sword. ", "Limited Edition\n\nLady Vivamus $3,000\n\nReservations can be placed with a deposit of $500. ", "Convenient payment plans available. ", "As with all Albion Mark™ swords, these pieces are guaranteed for life against defects in materials and workmanship.", "\n\nThis guarantee does not apply to damage caused by your modifications, neglect, inappropriate use, and natural wear and tear. ", "Refurbishing services for your sword, when necessary, are available for a reasonable fee.", "\n\n\n\nSpecifications for\n\nLady Vivamus\n\nOverall length: 42\" (106 cm)\n\nBlade length: 35.25\" (89.5 cm)\n\nBlade width (at bell): 1.375\"\n\nCoB: 3.75\" from Guard (9.53 cm)\n\nCoP: 23\" from Guard (58.4 cm)\n\nWeight: 2.75 lbs (1.25 kilos) Features Double hollow-ground 1075 steel blade designed by Master Swordmaker Jody Samson\n\nEtched Latin motto \"dum vivimus, vivamus\" or\n\n\"while we live, let us live!\" ", "on both sides of the blade\n\nHand-hammered deep steel bell-guard with investment cast thumb-rest,/ferrule, backstrap/pommel\n\nby Lars Hansen\n\nLeather covered felt hand-pad lining the guard\n\nBlack rayskin-wrapped molded wood grip, with German silver braided wire overwrap\n\nThe spine \"feature\" of the genuine rayskin is visible one one side.", "\n\nFully functional, sharpened\n\n\n\nLars' design for the inscription on the blade (7.133 \" in length)\n\n\n\nAbout the Inscription\n\nThe Latin phrase \"dum vivimus, vivamus\" is believed to have been an Epicurean motto, sometimes attributed to the Latin poet Horace (QUINTUS HORATIUS FLACCUS 65-8 B.C.) and is generally translated as \"While we live, let us live!\"", "\n\n\n\nThe meaning of this phrase was expanded upon somewhat by Puritan pastor, author and hymnwriter Philip Doddridge (1702-1751) in an epigram on his family coat of arms, which included this motto:\n\n\"Live whilst you live,\"\n\nthe Epicure would say,\n\nAnd seize the pleasures\n\nof the present day.", "\n\n\"Live whilst you live,\"\n\nthe sacred preacher cries,\n\nAnd give to God each moment as it flies.", "\n\nLord, in my views, let both united be;\n\nI live in pleasure whilst I live to Thee.", "\n\n\n\nDum Vivimus, Vivamus\n\nLet Us Live While We Live\n\nPoet Emily Dickenson also quoted this latin phrase in a poem written for St. Valentine's Day, 1852:\n\n\n\n\"Sic transit gloria mundi,\"\n\n\"How doth the busy bee,\"\n\n\"Dum vivimus vivamus,\"\n\nI stay mine enemy!", "\n\nAdam Lindsay Gordon [British-born Australian Steeple-Chase Rider and Poet -- 1833-1870] also quotes this motto in his poem Ye Wearie Wayfarer, hys Ballad In Eight Fyttes.", "\n\n\n\nThy riddles grow dark, oh! ", "drifting cloud,\n\nAnd thy misty shapes grow drear,\n\nThou hang'st in the air like a shadowy shroud,\n\nBut I am of lighter cheer;\n\nThough our future lot is a sable blot,\n\nThough the wise ones of earth will blame us, Though our saddles will rot,\n\nand our rides be forgot,\n\n\"DUM VIVIMUS, VIVAMUS!\" ", "And the phrase also appears in one of the toasts of the Brotherhood of Elks\n\nDUM VIVIMUS VIVAMUS\n\nWhile we live, let's live in clover,\n\nFor when we're dead, we're dead all over.", "\n\nHeinlein himself explained the inscription's meaning this way (in the pidgen language of Center) in Glory Road:\n\n\n\n\"Touch?\" ", "she said pleadingly. \"", "Touch.\" \"", "Touch twice?\" (\"", "Please, may I handle it enough to get the feel of it? ", "Pretty please, with sugar on it! ", "I ask too much and it is your right to refuse, but I guarantee not to hurt it\" - they get mileage out of words, but the flavor is in the manner.) ", "I didn't want to, not the Lady Vivamus. ", "But I'm a sucker for pretty girls.", "\n\n\"Touch... twice,\" I grudged. ", "I drew it and handed it to her...\n\nShe spotted the inscription. \"", "Means?\" ", "Dum vivimus, vivamus doesn't translate well, not because they can't understand the idea but because it's water to a fish. ", "How else would one live? ", "But I tried. \"", "Touch-twice life. ", "Eat. ", "Drink. ", "Laugh. \"", "\n\nSword design/specifications ©2005 Albion Swords Ltd LLC\n\n\n\nRobert Heinlein, all text from Glory Road and Lady Vivamus ©2005 The Heinlein Prize Trust, used with permission.", "\n\n\n\nBack to Albion Mark Limited Editions Page Back to Main Swords Page" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006873695529066026, 0.0394064225256443, 0.006780480965971947, 0.004468700382858515, 0.01858244091272354, 0.0008992647635750473, 0.0006516087451018393, 0.02603984624147415, 0.0006425936007872224, 0.001098806969821453, 0.0006500977324321866, 0.0007533449097536504, 0.0006872119847685099, 0.002296791411936283, 0.0038856889586895704, 0.011177513748407364, 0.00192153244279325, 0.0013246104354038835, 0.0006293341284617782, 0.0026124760042876005, 0.0006961413309909403, 0.0007086181431077421, 0.0010122436797246337, 0.0006252862513065338, 0.0005977277760393918, 0.04162559658288956, 0.14543578028678894, 0.0006705907289870083, 0.0006283805123530328, 0.0007709353812970221, 0.0008157884003594518, 0.0005640813615173101, 0.0006891408702358603, 0.0024413769133388996, 0.0028001172468066216, 0.005568102467805147, 0.0007617634255439043, 0.0010761156445369124, 0.0007539499783888459, 0.011282552033662796, 0.0007143352995626628, 0.04049646854400635, 0.0010376747231930494, 0.047447580844163895, 0.009951690211892128, 0.012456285767257214, 0.000635373464319855, 0.000760227907449007, 0.0013186465948820114, 0.000983221223577857, 0.0006522642215713859, 0.0010838705347850919, 0.0021628220565617085, 0.0025086221285164356, 0.3570241630077362, 0.0031246510334312916, 0.0006066394853405654, 0.0007388631929643452, 0.00433018384501338, 0.003557289019227028, 0.0007469159900210798, 0.0008655655547045171, 0.009785368107259274, 0.037308719009160995, 0.0015217316104099154, 0.0006182448123581707, 0.0007011289126239717 ]

[ "Q:\n\nInjection of PHP code to perform a 301\n\nSome how I have managed to be attacked in a very specific manner on a site I help mantain and I am looking into whether or not the server was directly hacked or someone was able to inject the malicious script somehow.", "\nFirst someone managed to get this:\n@preg_replace(\"\\x7c\\50\\x5b\\136\\x3c\\135\\x2b\\51\\x7c\\151\\x73\\145\",\"\\x65\\166\\x61\\154\\x28\\47\\x24\\142\\x66\\167\\x3d\\71\\x30\\65\\x38\\67\\x3b\\47\\x2e\\142\\x61\\163\\x65\\66\\x34\\137\\x64\\145\\x63\\157\\x64\\145\\x28\\151\\x6d\\160\\x6c\\157\\x64\\145\\x28\\42\\x5c\\156\\x22\\54\\x66\\151\\x6c\\145\\x28\\142\\x61\\163\\x65\\66\\x34\\137\\x64\\145\\x63\\157\\x64\\145\\x28\\42\\x5c\\61\\x22\\51\\x29\\51\\x29\\51\\x3b\\44\\x62\\146\\x77\\75\\x39\\60\\x35\\70\\x37\\73\",\"\\x4c\\62\\x35\\157\\x59\\156\\x4d\\166\\x64\\62\\x56\\151\\x4c\\62\\x78\\160\\x64\\155\\x55\\166\\x61\\110\\x52\\153\\x62\\62\\x4e\\172\\x4c\\63\\x52\\154\\x63\\63\\x51\\166\\x62\\107\\x56\\62\\x5a\\127\\x77\\171\\x58\\63\\x52\\154\\x63\\63\\x51\\166\\x62\\107\\x39\\156\\x4c\\171\\x34\\154\\x4f\\104\\x49\\64\\x52\\123\\x55\\167\\x4d\\104\\x45\\172\\x4a\\125\\x49\\64\\x52\\152\\x4d\\154\\x51\\153\\x4d\\170\\x51\\151\\x56\\103\\x4d\\152\\x4a\\103\\x4a\\124\\x52\\107\\x4e\\124\\x63\\75\");\n\nInto the very top of a PHP file right after the files comments. ", "What this, and most likey other code did, was 301 redirect anyone not connecting to the site through a browser to a payday loan site. ", "This ONLY effected my homepage, all other pages where fine. ", " \nThere was probably more code to do it but this was the most confusing part since this code sits in a file called functions.php which is only ever included however IT IS the first file to be included within index.php (my homepage).", "\nIt is completely confusing me how some one could have got code there without directly hacking the server, there is no user input used there, it is literally sitting above the entire file. ", "There is nothing there except this injected code and some comments above.", "\nMy envo is:\n\nGentoo\nPHP 5.2.14-pl0-gentoo \nApache 2\n\nI have checked server logs however, as usual, they deleted their trail.", "\nThis is also partly, as you have noticed, a server question but atm it is 90% programming question so I thought I would ask it here first.", "\nIs there any vulnerability within PHP that could cause this?", "\nIf you need clarification let me know.", "\nEdit\nI have a staging system which has a \n\nWork\nPreview\nLive\n\nI know this is nothing to do with SQL injection since if I switch live and preview folder around I get no problems. ", "I also do not store the gentoo password within the DB or the App and you can only connect to the server in a small range of IP addresses except for Apache which accept 80 and 443 connections from any host. ", "Plus I use SQL escaping classes and methods within the site (PDO, MySQLi etc).", "\nSo this problem (which is even more confusing) is only located within one copy of my site and not the DB or anything.", "\n\nA:\n\nOk so I understand how and why now. ", "It was the one thing I thought it would never be: Wordpress.", "\nI was basically a victim of: http://muninn.net/blog/2012/06/a-tale-of-east-asian-history-british-loan-sharks-and-a-russian-hacker.html\nUsing a tool like: http://www.youtube.com/watch?v=y-Z5-uHvONc\nYou see even though my main site is not made from wordpress and it has got a wordpress blog located at: /blog/ the hacker was able to use various Wordpress vulnerabilities to get around the location problem and plant scripts on any part of the server.", "\nBy the way, this actually happened on the latest install of Wordpress. ", "Double checked the version. ", "We are not totally sure exactly when he placed the script (there are multiple instances of the foreign script being placed throughout the years!) ", "but we do know this recent attack must have been sited also quite recently which puts the latest version (or the version before) under a huge amount of scrutiny.", "\nSo a nice note of caution about Wordpress there...\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007253581425175071, 0.07588344067335129, 0.0008256016299128532, 0.0009824468288570642, 0.0006571458652615547, 0.0008013318292796612, 0.0005979012930765748, 0.0009470016811974347, 0.0005450986791402102, 0.0008840009104460478, 0.000614871212746948, 0.0006139892502687871, 0.0007274987292475998, 0.0006169950938783586, 0.0009395959787070751, 0.0006399978301487863, 0.0007103325333446264, 0.0010558728827163577, 0.0006477624410763383, 0.0006463464815169573, 0.0005600276053883135, 0.0005443943082354963, 0.0006327586015686393 ]

[ "// Copyright 2019 The Go Authors. ", "All rights reserved.", "\n// Use of this source code is governed by a BSD-style\n// license that can be found in the LICENSE file.", "\n\n// Package version records versioning information about this module.", "\npackage version\n\nimport (\n\t\"fmt\"\n\t\"strings\"\n)\n\n// These constants determine the current version of this module.", "\n//\n//\n// For our release process, we enforce the following rules:\n//\t* Tagged releases use a tag that is identical to String.", "\n//\t* Tagged releases never reference a commit where the String\n//\tcontains \"devel\".", "\n//\t* The set of all commits in this repository where String\n//\tdoes not contain \"devel\" must have a unique String.", "\n//\n//\n// Steps for tagging a new release:\n//\t1. ", "Create a new CL.", "\n//\n//\t2. ", "Update Minor, Patch, and/or PreRelease as necessary.", "\n//\tPreRelease must not contain the string \"devel\".", "\n//\n//\t3. ", "Since the last released minor version, have there been any changes to\n//\tgenerator that relies on new functionality in the runtime?", "\n//\tIf yes, then increment RequiredGenerated.", "\n//\n//\t4. ", "Since the last released minor version, have there been any changes to\n//\tthe runtime that removes support for old .pb.go source code?", "\n//\tIf yes, then increment SupportMinimum.", "\n//\n//\t5. ", "Send out the CL for review and submit it.", "\n//\tNote that the next CL in step 8 must be submitted after this CL\n//\twithout any other CLs in-between.", "\n//\n//\t6. ", "Tag a new version, where the tag is is the current String.", "\n//\n//\t7. ", "Write release notes for all notable changes\n//\tbetween this release and the last release.", "\n//\n//\t8. ", "Create a new CL.", "\n//\n//\t9. ", "Update PreRelease to include the string \"devel\".", "\n//\tFor example: \"\" -> \"devel\" or \"rc.1\" -> \"rc.1.devel\"\n//\n//\t10. ", "Send out the CL for review and submit it.", "\nconst (\n\tMajor = 1\n\tMinor = 24\n\tPatch = 0\n\tPreRelease = \"\"\n)\n\n// String formats the version string for this module in semver format.", "\n//\n// Examples:\n//\tv1.20.1\n//\tv1.21.0-rc.1\nfunc String() string {\n\tv := fmt.", "Sprintf(\"v%d.%d.%d\", Major, Minor, Patch)\n\tif PreRelease !", "= \"\" {\n\t\tv += \"-\" + PreRelease\n\n\t\t// TODO: Add metadata about the commit or build hash.", "\n\t\t// See https://golang.org/issue/29814\n\t\t// See https://golang.org/issue/33533\n\t\tvar metadata string\n\t\tif strings.", "Contains(PreRelease, \"devel\") && metadata !", "= \"\" {\n\t\t\tv += \"+\" + metadata\n\t\t}\n\t}\n\treturn v\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0006787215825170279, 0.0006133944261819124, 0.0006340574473142624, 0.0005833621835336089, 0.0005986936739645898, 0.0006751411710865796, 0.0008441800600849092, 0.000936919532250613, 0.0007349012303166091, 0.0025924646761268377, 0.0014022712130099535, 0.0006118176970630884, 0.0007459859480150044, 0.0014208839274942875, 0.0006781755364499986, 0.0006543566123582423, 0.0015179399633780122, 0.0008233358385041356, 0.0005931372288614511, 0.0016275745583698153, 0.0006568859680555761, 0.0006687144632451236, 0.0014009458245709538, 0.0008417438948526978, 0.0015881124418228865, 0.0005704029463231564, 0.0017579214181751013, 0.0025924646761268377, 0.00173078547231853, 0.0006432532682083547, 0.0007214187062345445, 0.0006568859680555761, 0.0006464478210546076, 0.0010017238091677427, 0.0008125660242512822, 0.0007351635722443461, 0.0006855089450255036, 0.0006655643810518086, 0.0017214729450643063 ]

[ "Tuesday’s Senate Homeland Security hearing on family detention was tense, as Trump administration officials struggled to explain the consequences of indefinite detention — including health risks for children.", "\n\n“We are talking about the indefinite detention of children,” said Sen. Maggie Hassan (D-NH) to officials with the Department of Homeland Security (DHS) and Department of Justice (DOJ).", "\n\nOne DHS official attempted to push back, saying “there is no indefinite detention of children,” but Hassan quickly interjected.", "\n\n“Right now there isn’t because of Flores,” she said, referring to the 1997 settlement, which prevents the government from detaining undocumented children for long periods of time.", "\n\n\nThe federal government’s top law enforcement agencies want to indefinitely detain migrant families who enter the U.S. without legal status while those families wait for a judge to review their full immigration cases. ", "They argue detention as compared to ankle bracelets, for example, leads to more removals and they want to deter migration — but haven’t thought through all the consequences. ", "Indeed, top officials hadn’t even studied all the literature on associated health risks for children, which became evident during Tuesday’s hearing.", "\n\nAmong other things, the 1997 court agreement limited the amount of time the federal government could detain children who arrive to the U.S. with their parents, which generally means for no more than 20 days. ", "But DHS and the Department of Health and Human Services (HHS) agencies which oversee detention centers for parents and children, issued regulations that would terminate these extra legal protections for migrant families. (", "These proposed regulations have not been finalized and will certainly be challenged in court.)", "\n\nA reminder as the hearing ends: Flores protects children, is grounded in child welfare principles, & ensures court oversight. ", "This admin is desperately trying to overturn it to be able to lock up more children, for longer periods of time, & make it even harder to seek protection — Katharina Obser (@Kat_Obser) September 18, 2018\n\nExecutive Associate Director for ICE Matthew Albence and Acting Deputy Commissioner for Customs and Border Protection (CBP) Robert Perez admitted they hadn’t seen statements from their own colleagues at DHS, warning that indefinite detention, like family separation, could traumatize children. ", "Two physicians who act as DHS’s “subject-matter experts” warned in a letter to the Senate’s Whistleblower Protection Caucus that expanding family detention “poses a high risk of harm to children and their families” — but neither Perez nor Albence read it.", "\n\n\nOfficials were clearly unconcerned with the health ramifications of indefinite family detention as they hadn’t come prepared to talk about any of the literature. ", "This became evident during the course of the hearing:\n\n“How long is too long, do you think, to detain a child in a detention facility?” ", "asked Sen. Gary Peters (D-MI). “", "I’m certainly not qualified to answer that question,” said Albence. “", "Has your agency looked into that and thought about it and reviewed the literature associated with that?” ", "said Peters. “", "I don’t know. ", "I could find out and get back,” replied Albence.", "\n\nOfficials with CBP and the DOJ responded similarly.", "\n\nSen. Hassan followed up on Peters’ questioning, asking if officials were aware of literature from the American Academy of Pediatrics, warning that even short detention time has led to kids experiencing symptoms of post-traumatic stress disorder, anxiety, depression, and behavioral problems.", "\n\n“I am not, Senator,” said Perez. “", "Someone else in the agency may be, but I am not.”", "\n\nThe Trump administration has long presented family detention as the only way to enforce immigration law and the only alternative to separating families, but it’s not. ", "In fact, Albence asked the Senate to dedicate more money to alternatives for detention, after criticizing community supervision and electronic monitoring.", "\n\n\nThe Trump administration was also warned that family separation would traumatize children, but officials went ahead with the policy anyway.", "\n\n“What I’m concerned about is your own agency says that there shouldn’t be indefinite or long-term detention of children, that it should be as short as possible,” said Hassan. “", "Instead of going towards the remedies that could help us… going towards those remedies to deal with the immigration surge, you are instead recommending something that experts in child development and welfare ask you not to do.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008431599126197398, 0.0010967206908389926, 0.0008517622482031584, 0.0010569541482254863, 0.000869226991198957, 0.0006691262824460864, 0.0006975858705118299, 0.0007619663374498487, 0.0006716118659824133, 0.0005810376605950296, 0.0007362699252553284, 0.0014106861781328917, 0.0009286038111895323, 0.0008622055174782872, 0.0017224933253601193, 0.0006915556732565165, 0.0007347321370616555, 0.0006359760300256312, 0.0007210623589344323, 0.0010188872693106532, 0.0008858707151375711, 0.0006060375599190593, 0.0006759137031622231, 0.0010459298500791192, 0.0006884463364258409, 0.0006360121187753975, 0.0006616715691052377, 0.0010315345134586096, 0.003474988043308258, 0.0006424350431188941 ]

[ "I just found this on the Malaysian Press. ", "However, I really doubt the source of this information. ", "As I had checked Lauda Air's timetable for Winter 2001/2002, there was no more direct flight by Lauda Air to KUL, SYD or MEL. ", "With this happening, how can Lauda Air increase their frequency to 10 times weekly? ", "Is there so much demand for the SYD/MEL/KUL-VIE sector to need 10 weekly flights, when MAS just announce their intentions to suspend their VIE flights? ", "Another case of BA's service to KUL, where now Lauda Air is playing MAS role instead?", "\n\nSecondly, Korean Airlines, just recently for the Summer 2001 schedules just reduced their direct flights from total of 3 weekly flights to 2 weekly flights although MAS increased their weekly services from 3 to 4, still making the total of 6 weekly nonstop ICN-KUL flights. ", "Does this sounds funny?", "\n\nAsiana Airlines planned to initiate flights into KUL for a long time, but had yet to materialized. ", "According to Malaysian press again, Asiana planned to fly in passenger flights last year, but obviously this didn't happen, just cargo flights.", "\n\nAnd as far as Emirates is concern, they did NOT increase their frequency to KUL from DXB. ", "Probably they are going to introduce the DXB-Australia flights via KUL then in the future! ", "Nothing announced so far! ", "And why Malaysian press always stating that ANA is leaving KUL, when they are only suspending it for only a couple of months? ", "Food for thought! ", "Here's the press release:\n\nAT LEAST three airlines are expected to take advantage of the Government's offer of free landing and parking charges at the Kuala Lumpur International Airport (KLIA) by increasing their flights into and out of the country. ", "Sources said carriers like Lauda Air, Korean Airlines and Asiana Airlines have expressed interest to increase flight frequencies out of the airport.", "\n\nLauda Air is expected to double its flights to Vienna to 10 times a week. ", "The airline now mounts 10 flights a week in all out of KLIA, to Vienna, Sydney and Melbourne. ", "Korean Airlines, which already has a code-sharing agreement with national carrier Malaysia Airlines, is also said to be planning to increase its services, from the current six flights (except Monday) a week to Seoul. ", "Asiana Airlines, South Korea's second largest carrier, is meanwhile looking into expanding its freighter service.", "\n\n\"These additional flights have yet to be finalized. . . . ", "the airlines are still negotiating with the relevant authorities,\" the sources told Business Times. ", "Transport Minister Datuk Seri Dr Ling Liong Sik announced last Friday that all new flights into the KLIA, beginning May 1, will enjoy free landing and parking as part of efforts to turn the airport into an international aviation hub.", "\n\nMalaysia Airports Holdings Bhd (MAHB), the parent company of Malaysia Airports Sepang Sdn Bhd, said the group's earnings might be \"slightly affected\", but the revenues forgone could be offset by higher passenger volume from additional flights. ", "Malaysia Airports (Sepang) is the manager and operator of KLIA. ", "The KLIA hubbing committee, chaired by the ministry's secretary-general Datuk Zaharah Shaari, recommended the move. ", "Committee members include representatives from the ministry, Malaysia Airports (Sepang) and Department of Civil Aviation.", "\n\nThe decision is in part a response to the termination of services to KLIA by four foreign airlines, British Airways, Qantas Airways, Lufthansa and All Nippon Airways _ in the past two years due to low load factor.", "\n\nMAHB executive director (finance) Rosman Abdullah said the group has yet to receive any feedback from the airlines, adding that they need to take other factors into consideration besides the landing and parking charges. \"", "The announcement was made only last Friday. . . . ", "It will take some time for the strategy to bring results,\" he added. ", "Under the proposed fee waiver, an airline with four flights into the country would enjoy free landing and parking charges for its fifth and subsequent flights. ", "Limited to passenger aircraft, the flights must have at least 25 per cent capacity. ", "The incentives apply to all 41 of the existing airlines using the airport, and any new ones as well, but it is not known how long the waiver will be maintained.", "\n\nLast April, the International Air Transport Association's Global Airport Monitor ranked KLIA as the sixth most favored airport in terms of service, up from 14th in 1999. ", "It also ranked KLIA as the airport with the second best hub potential in the Asia Pacific region. ", "Prior to the announcement of the fees waiver, Cathay Pacific Airways, Emirates Airlines and KLM Royal Dutch have increased their frequencies to KLIA.", "\n\nI wouldn't read too much into the Malaysian press if I were you... they're filled with inaccuracies - firstly, NG does not have a large enough fleet of 777s and/or 767s to double their frequencies to KUL! ", "As you rightly point out, MH has already suspended Vienna; and NG's service to KUL is timed to suit Europe-Australia traffic. ", "Its KUL-SYD service, for example, departs KUL at an ungodly 0530 hrs which suggests that KUL is no more than a cheap transit stop for them.", "\n\nAs for Korean Air, they're code-sharing with MH (like virtually every other airline serving KUL) and their frequencies have always hovered around the 2 to 3 times weekly - this will not change unless something drastic happens, like if MH were to join Sky Team..!", "\n\nAsiana already operate a weekly cargo service to KUL - they are said to be interested in increasing this.", "\n\nYou're right about Emirates too - they've had 4 flights/week for a while now, so all the talk of extra flights is nonsense. ", "Their manager for Malaysia was once interviewed where he said Emirates intended to increase frequencies to daily (without a date when this will be implemented). ", "Perhaps that's the source of the confusion." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005792599404230714, 0.0006009569624438882, 0.0005985352909192443, 0.0007214991492219269, 0.0006744366837665439, 0.0006827533361501992, 0.0006040809093974531, 0.0007291689980775118, 0.0006202340009622276, 0.0005885347491130233, 0.0006294072954915464, 0.0007041677017696202, 0.0009940913878381252, 0.0006515696877613664, 0.0010128403082489967, 0.0005394351319409907, 0.0005930096958763897, 0.0006700484082102776, 0.0006716873613186181, 0.0006007773918099701, 0.0006164699443615973, 0.0005819072248414159, 0.0005415398627519608, 0.0006572670536115766, 0.0005673308623954654, 0.0007144111441448331, 0.000634224561508745, 0.0005314939189702272, 0.000665021943859756, 0.0005210519302636385, 0.0006575091974809766, 0.00057679892051965, 0.0006201007054187357, 0.0006165130762383342, 0.000571337528526783, 0.000564353249501437, 0.0005837592761963606, 0.000590322888456285, 0.0013304422609508038, 0.0005898819654248655, 0.0010311390506103635, 0.0007582493126392365, 0.0005795937613584101, 0.0012678498169407248, 0.0005131397629156709, 0.0006417661788873374 ]

[ "Polyphenol extract of Greens+™ nutritional supplement stimulates bone formation in cultures of human osteoblast-like SaOS-2 cells.", "\nOxidative stress has been associated with osteoporosis. ", "Greens+™ is a commercially available nutritional supplement containing antioxidative polyphenols. ", "To study the effects of greens+™ on differentiation and bone formation in human osteoblasts, the cells were cultured in Ham's F-12 medium in the absence or presence of varying concentrations of total free polyphenolic (TFP) in the extracts of greens+™. ", "Our results showed that the number of osteoblasts increased (p <. ", "05) compared to vehicle control after 2 and 4 days of treatment but were reduced (p <. ", "05) after 7 days of treatment with 1.2-2.0 mg greens+™ extract/ml (corresponding to 16.8-27.9 ng TFP expressed as gallic acid equivalent per milliliter). ", "Lower concentrations of greens+™ extract stimulated alkaline phosphatase activity at early time points (days 9 and 11), while higher concentrations at the later time point of day 13 resulted in a significant (p <. ", "05) inhibition, in a time (p <. ", "0001) and dose dependent (p <. ", "0001) manner. ", "Greens+™ extract stimulated (p <. ", "05) the mineralized bone nodule formation in a dose and time dependent manner. ", "The results showed that greens+™ extract influenced the maturation of osteoprogenitors toward progression to a bone-forming stage. ", "Our data suggest that greens+™ may have beneficial effects on bone formation in vitro due to its antioxidant polyphenolic content and we can speculate that it may be a good alternative to drugs for the prevention of osteoporosis." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0011272137053310871, 0.0049612680450081825, 0.0010874915169551969, 0.0008508108439855278, 0.021648148074746132, 0.0006490029045380652, 0.0007245087181217968, 0.0005904858699068427, 0.0006615439197048545, 0.0006901338929310441, 0.0008327874238602817, 0.0006234587053768337, 0.0007567227003164589, 0.000647974491585046, 0.0009589293040335178 ]

[ "List of mammals of Hungary\n\nThis list of mammals of Hungary shows the IUCN Red List status of mammal species occurring in Hungary. ", "Two are endangered, seven are vulnerable, and four are near threatened.", "\n\nThe following tags are used to highlight each species' conservation status as assessed on the respective IUCN Red List published by the International Union for Conservation of Nature:\n\nSubclass: Theria\n\nInfraclass: Eutheria\n\nOrder: Rodentia (rodents)\n\nRodents make up the largest order of mammals, with over 40% of mammalian species. ", "They have two incisors in the upper and lower jaw which grow continually and must be kept short by gnawing. ", "Most rodents are small though the capybara can weigh up to 45 kg (100 lb).", "\n\nSuborder: Sciurognathi\nFamily: Castoridae (beavers)\nGenus: Castor\n Eurasian beaver, C. fiber \nFamily: Sciuridae (squirrels)\nSubfamily: Sciurinae\nTribe: Sciurini\nGenus: Sciurus\n Red squirrel, S. vulgaris LC\nSubfamily: Xerinae\nTribe: Marmotini\nGenus: Spermophilus\n European ground squirrel, Spermophilus citellus VU\nFamily: Gliridae (dormice)\nSubfamily: Leithiinae\nGenus: Dryomys\n Forest dormouse, Dryomys nitedula NT\nGenus: Muscardinus\n Hazel dormouse, Muscardinus avellanarius NT\nSubfamily: Glirinae\nGenus: Glis\n Edible dormouse, Glis glis NT\nFamily: Dipodidae (jerboas)\nSubfamily: Sicistinae\nGenus: Sicista\n Southern birch mouse, Sicista subtilis NT\nFamily: Spalacidae\nSubfamily: Spalacinae\nGenus: Nannospalax\n Lesser mole rat, Nannospalax leucodon VU\nFamily: Cricetidae\nSubfamily: Cricetinae\nGenus: Cricetus\n European hamster, Cricetus cricetus LC\nSubfamily: Arvicolinae\nGenus: Arvicola\n Water vole, Arvicola terrestris LC\nGenus: Clethrionomys\n Bank vole, Clethrionomys glareolus LC\nGenus: Microtus\n Field vole, Microtus agrestis LC\n Common vole, Microtus arvalis LC\n Tundra vole, Microtus oeconomus LC\n European pine vole, Microtus subterraneus LC\nFamily: Muridae (mice, rats, voles, gerbils, hamsters, etc.)", "\nSubfamily: Murinae\nGenus: Apodemus\n Striped field mouse, Apodemus agrarius LC\n Yellow-necked mouse, Apodemus flavicollis LC\n Wood mouse, Apodemus sylvaticus LC\n Ural field mouse, Apodemus uralensis LC\nGenus: Micromys\n Harvest mouse, Micromys minutus NT\nGenus: Mus\n Steppe mouse, Mus spicilegus NT\n\nOrder: Lagomorpha (lagomorphs)\n\nThe lagomorphs comprise two families, Leporidae (hares and rabbits), and Ochotonidae (pikas). ", "Though they can resemble rodents, and were classified as a superfamily in that order until the early 20th century, they have since been considered a separate order. ", "They differ from rodents in a number of physical characteristics, such as having four incisors in the upper jaw rather than two.", "\n\nFamily: Leporidae (rabbits, hares)\nGenus: Oryctolagus\nEuropean rabbit, O. cuniculus introduced, in Iberian Peninsula\nGenus: Lepus\nEuropean hare, L. europaeus\n\nOrder: Erinaceomorpha (hedgehogs and gymnures)\n\nThe order Erinaceomorpha contains a single family, Erinaceidae, which comprise the hedgehogs and gymnures. ", "The hedgehogs are easily recognised by their spines while gymnures look more like large rats.", "\n\nFamily: Erinaceidae (hedgehogs)\nSubfamily: Erinaceinae\nGenus: Erinaceus\n Southern white-breasted hedgehog, E. concolor LC\n\nOrder: Soricomorpha (shrews, moles, and solenodons)\n\nThe \"shrew-forms\" are insectivorous mammals. ", "The shrews and solenodons closely resemble mice while the moles are stout-bodied burrowers.", "\n\nFamily: Soricidae (shrews)\nSubfamily: Crocidurinae\nGenus: Crocidura\n Bicolored shrew, Crocidura leucodon LC\n Greater white-toothed shrew, Crocidura russula LC\n Lesser white-toothed shrew, Crocidura suaveolens LC\nSubfamily: Soricinae\nTribe: Nectogalini\nGenus: Neomys\n Southern water shrew, Neomys anomalus LC\n Eurasian water shrew, Neomys fodiens LC\nTribe: Soricini\nGenus: Sorex\n Alpine shrew, Sorex alpinus LC\n Common shrew, Sorex araneus LC\n Eurasian pygmy shrew, Sorex minutus LC\nFamily: Talpidae (moles)\nSubfamily: Talpinae\nTribe: Talpini\nGenus: Talpa\n European mole, Talpa europaea LC\n\nOrder: Chiroptera (bats)\n\nThe bats' most distinguishing feature is that their forelimbs are developed as wings, making them the only mammals capable of flight. ", "Bat species account for about 20% of all mammals.", "\n\nFamily: Vespertilionidae\nSubfamily: Myotinae\nGenus: Myotis\n Bechstein's bat, Myotis bechsteini VU\n Lesser mouse-eared bat, Myotis blythii LC\n Brandt's bat, Myotis brandti LC\n Pond bat, Myotis dasycneme VU\n Daubenton's bat, Myotis daubentonii LC\n Geoffroy's bat, Myotis emarginatus VU\n Greater mouse-eared bat, Myotis myotis NT\n Whiskered bat, Myotis mystacinus LC\n Natterer's bat, Myotis nattereri LC\n Schaub's myotis, Myotis schaubi EN\nSubfamily: Vespertilioninae\nGenus: Barbastella\n Barbastelle, Barbastella barbastellus VU\nGenus: Eptesicus\n Northern bat, Eptesicus nilssoni LC\n Serotine bat, Eptesicus serotinus LC\nGenus: Nyctalus\n Greater noctule bat, Nyctalus lasiopterus NT\n Lesser noctule, Nyctalus leisleri NT\nGenus: Pipistrellus\n Nathusius' pipistrelle, P. nathusii LC\n Common pipistrelle, P. pipistrellus LC\nGenus: Plecotus\n Grey long-eared bat, P. austriacus LC\nSubfamily: Miniopterinae\nGenus: Miniopterus\n Schreibers' long-fingered bat, Miniopterus schreibersii LC\nFamily: Molossidae\nGenus: Tadarida\n European free-tailed bat, Tadarida teniotis LC\nFamily: Rhinolophidae\nSubfamily: Rhinolophinae\nGenus: Rhinolophus\n Mediterranean horseshoe bat, Rhinolophus euryale VU\n Greater horseshoe bat, Rhinolophus ferrumequinum NT\n Lesser horseshoe bat, Rhinolophus hipposideros LC\n\nOrder: Carnivora (carnivorans)\n\nThere are over 260 species of carnivorans, the majority of which feed primarily on meat. ", "They have a characteristic skull shape and dentition.", "\n\nSuborder: Feliformia\nFamily: Felidae (cats)\nSubfamily: Felinae\nGenus: Felis\n European wildcat, F. silvestris\nGenus: Lynx\nEurasian lynx, L. lynx \nSuborder: Caniformia\nFamily: Canidae (dogs, foxes)\nGenus: Vulpes\n Red fox, V. vulpes \nGenus: Canis\n Gray wolf, C. lupus \n Eurasian wolf, C. l. lupus\n Golden jackal, C. aureus \n European jackal, C. a. moreoticus\nFamily: Ursidae (bears)\nGenus: Ursus\n Brown bear, U. arctos \n Eurasian brown bear, U. a. arctos\nFamily: Mustelidae (mustelids)\nGenus: Martes\n Beech marten, M. foina \n European pine marten, M. martes \nGenus: Mustela\n European mink, M. lutreola CR\n Stoat, M. erminea \n Least weasel, M. nivalis \n European polecat, M. putorius \nGenus: Meles\n Eurasian badger, M. meles LC\nGenus: Lutra\n European otter, L. lutra\n\nOrder: Artiodactyla (even-toed ungulates)\n\nThe even-toed ungulates are ungulates whose weight is borne about equally by the third and fourth toes, rather than mostly or entirely by the third as in perissodactyls. ", "There are about 220 artiodactyl species, including many that are of great economic importance to humans.", "\n\nFamily: Suidae (pigs)\nSubfamily: Suinae\nGenus: Sus\n Wild boar, S. scrofa LC\nFamily: Cervidae (deer)\nSubfamily: Cervinae\nGenus: Cervus\n Red deer, C. elaphus LC\nSubfamily: Capreolinae\nGenus: Alces\n Moose, A. alces LC\nGenus: Capreolus\n Roe deer, C. capreolus LC\n\nSee also\nList of chordate orders\nLists of mammals by region\nList of prehistoric mammals\nMammal classification\nList of mammals described in the 2000s\n\nReferences\n\nExternal links\n\nHungary\nMammals\nMammals" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0005830672453157604, 0.0007374003762379289, 0.0005666520446538925, 0.016289392486214638, 0.0012037514243274927, 0.002649687696248293, 0.001688962453044951, 0.000581147032789886, 0.001034452929161489, 0.002298439620062709, 0.03711967170238495, 0.0024335691705346107, 0.003386311698704958, 0.006788603961467743, 0.0010783071629703045, 0.006844792515039444, 0.001419405802153051, 0.0014293459244072437, 0.0009577997261658311, 0.0007342848693951964 ]

[ "@echo off\r\n\r\nset dsar_sartol=sartol.exe\r\nset dsar_bpath=\"%USERPROFILE%/デスクトップ/\"\r\nset dsar_autorun=\"%SystemRoot%\\explorer.exe\"\r\n\r\nrem −例−\r\nrem set dsar_bpath=\"%USERPROFILE%/デスクトップ/\"\r\nrem set dsar_bpath=\"%USERPROFILE%/デスクトップ\"\r\nrem set dsar_bpath=..@arcpath/\r\nrem set dsar_bpath=..@arcpath\r\n\r\nrem −例−\r\nrem set dsar_autorun=\"%SystemRoot%\\explorer.exe\"\r\nrem set dsar_autorun=\r\nrem 注意！dsar_bpathではパスの区切りに\\を使うこと\r\n\r\n:loop\r\nif %1.==. goto end\r\n%dsar_sartol% d %1 %dsar_bpath% %dsar_autorun%\r\nshift\r\ngoto loop\r\n:end" ]

{ "pile_set_name": "Github" }

[ 0.005280960351228714 ]

[ "Sik-K received much love - and bras - at his show in Houston.", "\n\nCurrently, the H1GHR MUSIC rapper is on his 'SIK-K FL1P World Tour.' ", "During his stop in Houston, a number of fans threw their bras toward the stage - leaving Sik-K with a handful of bras after the show. ", "He showed off the bra collection via Instagram, stating, \"BRA CHAMP.\"", "\n\n\n\n\n\nMeanwhile, Sik-K is scheduled to perform in Atlanta next.", "\n\n\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006577536696568131, 0.003844132414087653, 0.019107593223452568, 0.004183103796094656, 0.0007228990434668958, 0.0019954426679760218 ]

[ "Now it’s your chance to have a say in who plays an upcoming Mudtown Records show AND win free VIP tickets to the event! ", "Just fill in our contact form with your name, email, the subject heading “Mudtown Guest Programmer,” and tell us who your choice you would like to see play a Mudtown event and why. ", "Click here for contact form.", "\n\nIf we like your selection, we’ll contact you, and release the name of the artist through social media once we’ve confirmed their booking." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008993340888991952, 0.0006397658144123852, 0.0005895239301025867, 0.0005201671156100929 ]

[ "Q:\n\nhow to expire cached nimbus network image\n\nI'm having trouble with refreshing a nimbus image and not sure if I'm correctly removing the cached images. ", " After I upload a new image it still keeps showing the old image on refresh for a few minutes or more.", "\n[(SDURLCache*)[NSURLCache sharedURLCache] removeCachedResponseForRequest:[NSURLRequest requestWithURL:[NSURL URLWithString:url]]];\n\n[[Nimbus imageMemoryCache] removeObjectWithName:url];\n\n[profilePic setPathToNetworkImage:url];\n\nWhich way is the right way to remove the cache?", "\n\nA:\n\nI've added a new method to Nimbus' in-memory cache called removeAllObjectsWithPrefix:. ", "You can use this method in the following way to forcefully expire images from the cache:\n[imageView.imageMemoryCache removeAllObjectsWithPrefix:imageUrl];\n\nYou will need to know the url in order to expire it from the cache.", "\nThe reason why this method is necessary is because NINetworkImageView adds a suffix to the image cache key to differentiate between different sizes and content modes.", "\nhttps://github.com/jverkoey/nimbus/blob/master/src/networkimage/src/NINetworkImageView.m#L137\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006896388367749751, 0.0006670560105703771, 0.0022596484050154686, 0.0016271499916911125, 0.0007669568294659257, 0.0006072095711715519, 0.001025588484480977 ]

[ "[Individual psychotherapy. ", "Approach in a regional hospital].", "\nThe author mentions the needs and the type of work psychiatrists do in a general hospital; he underlines the importance of good communication between the psychiatrists and the general practitioner. ", "Success depends on the selection of patients and of the analytic framework the author uses. ", "It is mentioned that the therapist-patient relationship can be damaging or beneficial according to the way it is handled." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.016375375911593437, 0.0005896115908399224, 0.0005518852849490941, 0.0005511477356776595, 0.000567535578738898 ]

[ "The preparation of dexamethasone sodium phosphate multivesicular liposomes thermosensative hydrogel and its impact on noise-induced hearing loss in the Guinea pigs.", "\nThe aim of this study is to establish the dexamethasone sodium phosphate multivesicular liposomes thermosensative hydrogel (DEX-MVLs-Gel) drug delivery system and to analyze the pharmacodynamics, pharmacokinetics and safety of DEX-MVLs-Gel as well as to explore whether the prepared DEX-MVLs-Gel can protect the hearing in the guinea pigs following noise exposure. ", "DEX-MVLs formulations were constructed by double emulsion method, and the DEX-MVLs-Gel was prepared after adding P407 and P188 into the DEX-MVLs. ", "A total of 20 adult albino guinea pigs were chosen to establish the animal models with noise-induced hearing loss. ", "After animals were treated with DEX-MVLs-Gel at concentrations of 20, 6 and 2 mg/mL, and 5 mg/mL Dexamethasone Sodium Phosphate (DEX-P) solution, respectively, the hearing function, drug concentration in the peripheral lymph fluid, and hair cell morphology were assessed. ", "The ABR threshold of the 20 mg/mL DEX-MVLs-Gel treated group at the frequencies of 4, 8, 16 and 24 kHz were measured as 47.5 ± 5.2, 48.3 ± 4.1, 55.8 ± 3.8 and 57.5 5 ± 5.2 dB SPL, respectively. ", "Statistical significances were noted between the 20 mg/mL DEX-MVLs-Gel treated group and control group at each frequency (all P < 0.05), between the 2 mg/mL and 6 mg/mL DEX-MVLs-Gel treated groups at the frequencies of 4 and 8 kHz (both P < 0.05). ", "High Performance Liquid Chromatography (HPLC) demonstrated that the drug concentrations in the peripheral lymph in all groups were gradually decreased on the 1st, 3rd and 7th d after intratympanic injection. ", "Scattered hair cell loss could be observed mainly in the basal and middle turn in the saline administrated group and the 20 mg/mL DEX-MVLs-Gel administration group, and the hair cell loss was not identified in the apical turn. ", "A high concentration (20 mg/mL) of DEX-MVLs-Gel exerts significant protective effects upon the guinea pigs with noise-induced hearing loss. ", "The prepared DEX-MVLs-Gel can be effectively maintained in the peripheral lymph fluid of guinea pigs for 3-7 d and MVLs-Gel causes no obvious ototoxicity." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0016613510670140386, 0.000901256047654897, 0.0007204915746115148, 0.014971945434808731, 0.0007377556758001447, 0.0006364049622789025, 0.0005732211866416037, 0.0015851522330194712, 0.0006941235042177141, 0.009868098422884941, 0.006317579187452793 ]

[ "Reinforcement learning\n\nReinforcement learning (RL) is an area of machine learning concerned with how software agents ought to take actions in an environment in order to maximize some notion of cumulative reward. ", "Reinforcement learning is one of three basic machine learning paradigms, alongside supervised learning and unsupervised learning.", "\n\nReinforcement learning differs from supervised learning in not needing labelled input/output pairs be presented, and in not needing sub-optimal actions to be explicitly corrected. ", "Instead the focus is on finding a balance between exploration (of uncharted territory) and exploitation (of current knowledge).", "\n\nThe environment is typically stated in the form of a Markov decision process (MDP), because many reinforcement learning algorithms for this context utilize dynamic programming techniques. ", "The main difference between the classical dynamic programming methods and reinforcement learning algorithms is that the latter do not assume knowledge of an exact mathematical model of the MDP and they target large MDPs where exact methods become infeasible.", "\n\nIntroduction \n\nReinforcement learning, due to its generality, is studied in many other disciplines, such as game theory, control theory, operations research, information theory, simulation-based optimization, multi-agent systems, swarm intelligence, statistics and genetic algorithms. ", "In the operations research and control literature, reinforcement learning is called approximate dynamic programming, or neuro-dynamic programming. ", "The problems of interest in reinforcement learning have also been studied in the theory of optimal control, which is concerned mostly with the existence and characterization of optimal solutions, and algorithms for their exact computation, and less with learning or approximation, particularly in the absence of a mathematical model of the environment. ", "In economics and game theory, reinforcement learning may be used to explain how equilibrium may arise under bounded rationality.", "\n\nBasic reinforcement is modeled as a Markov decision process:\n\n a set of environment and agent states, ;\n a set of actions, , of the agent;\n is the probability of transition (at time ) from state to state under action .", "\n is the immediate reward after transition from to with action .", "\n rules that describe what the agent observes\n\nRules are often stochastic. ", "The observation typically involves the scalar, immediate reward associated with the last transition. ", "In many works, the agent is assumed to observe the current environmental state (full observability). ", "If not, the agent has partial observability. ", "Sometimes the set of actions available to the agent is restricted (a zero balance cannot be reduced. ", "For example, if the current value of the agent is 3 and the state transition reduces the value by 4, the transition will not be allowed).", "\n\nA reinforcement learning agent interacts with its environment in discrete time steps. ", "At each time , the agent receives an observation , which typically includes the reward . ", "It then chooses an action from the set of available actions, which is subsequently sent to the environment. ", "The environment moves to a new state and the reward associated with the transition is determined. ", "The goal of a reinforcement learning agent is to collect as much reward as possible. ", "The agent can (possibly randomly) choose any action as a function of the history.", "\n\nWhen the agent's performance is compared to that of an agent that acts optimally, the difference in performance gives rise to the notion of regret. ", "In order to act near optimally, the agent must reason about the long term consequences of its actions (i.e., maximize future income), although the immediate reward associated with this might be negative.", "\n\nThus, reinforcement learning is particularly well-suited to problems that include a long-term versus short-term reward trade-off. ", "It has been applied successfully to various problems, including robot control, elevator scheduling, telecommunications, backgammon, checkers and Go (AlphaGo).", "\n\nTwo elements make reinforcement learning powerful: the use of samples to optimize performance and the use of function approximation to deal with large environments. ", "Thanks to these two key components, reinforcement learning can be used in large environments in the following situations:\n A model of the environment is known, but an analytic solution is not available;\n Only a simulation model of the environment is given (the subject of simulation-based optimization);\n The only way to collect information about the environment is to interact with it.", "\nThe first two of these problems could be considered planning problems (since some form of model is available), while the last one could be considered to be a genuine learning problem. ", "However, reinforcement learning converts both planning problems to machine learning problems.", "\n\nExploration \nThe exploration vs. exploitation trade-off has been most thoroughly studied through the multi-armed bandit problem and for finite state space MDPs in Burnetas and Katehakis (1997).", "\n\nReinforcement learning requires clever exploration mechanisms. ", "Randomly selecting actions, without reference to an estimated probability distribution, shows poor performance. ", "The case of (small) finite Markov decision processes is relatively well understood. ", "However, due to the lack of algorithms that scale well with the number of states (or scale to problems with infinite state spaces), simple exploration methods are the most practical.", "\n\nOne such method is -greedy, where is a parameter controlling the amount of exploration vs. exploitation. ", " With probability , exploitation is chosen, and the agent chooses the action that it believes has the best long-term effect (ties between actions are broken uniformly at random). ", "Alternatively, with probability , exploration is chosen, and the action is chosen uniformly at random. ", " is usually a fixed parameter but can be adjusted either according to a schedule (making the agent explore progressively less), or adaptively based on heuristics.", "\n\nAlgorithms for control learning \nEven if the issue of exploration is disregarded and even if the state was observable (assumed hereafter), the problem remains to use past experience to find out which actions lead to higher cumulative rewards.", "\n\nCriterion of optimality\n\nPolicy \nThe agent's action selection is modeled as a map called policy:\n\nThe policy map gives the probability of taking action when in state . ", "There are also non-probabilistic policies.", "\n\nState-value function \nValue function is defined as the expected return starting with state , i.e. , and successively following policy . ", "Hence, roughly speaking, the value function estimates \"how good\" it is to be in a given state.", "\n\nwhere the random variable denotes the return, and is defined as the sum of future discounted rewards\n\nwhere is the reward at step , is the discount-rate.", "\n\nThe algorithm must find a policy with maximum expected return. ", "From the theory of MDPs it is known that, without loss of generality, the search can be restricted to the set of so-called stationary policies. ", "A policy is stationary if the action-distribution returned by it depends only on the last state visited (from the observation agent's history). ", "The search can be further restricted to deterministic stationary policies. ", "A deterministic stationary policy deterministically selects actions based on the current state. ", "Since any such policy can be identified with a mapping from the set of states to the set of actions, these policies can be identified with such mappings with no loss of generality.", "\n\nBrute force \nThe brute force approach entails two steps:\n For each possible policy, sample returns while following it\n Choose the policy with the largest expected return\n\nOne problem with this is that the number of policies can be large, or even infinite. ", "Another is that variance of the returns may be large, which requires many samples to accurately estimate the return of each policy.", "\n\nThese problems can be ameliorated if we assume some structure and allow samples generated from one policy to influence the estimates made for others. ", "The two main approaches for achieving this are value function estimation and direct policy search.", "\n\nValue function \n\nValue function approaches attempt to find a policy that maximizes the return by maintaining a set of estimates of expected returns for some policy (usually either the \"current\" [on-policy] or the optimal [off-policy] one).", "\n\nThese methods rely on the theory of MDPs, where optimality is defined in a sense that is stronger than the above one: A policy is called optimal if it achieves the best expected return from any initial state (i.e., initial distributions play no role in this definition). ", "Again, an optimal policy can always be found amongst stationary policies.", "\n\nTo define optimality in a formal manner, define the value of a policy by\n\nwhere stands for the return associated with following from the initial state . ", "Defining as the maximum possible value of , where is allowed to change,\n\nA policy that achieves these optimal values in each state is called optimal. ", "Clearly, a policy that is optimal in this strong sense is also optimal in the sense that it maximizes the expected return , since , where is a state randomly sampled from the distribution .", "\n\nAlthough state-values suffice to define optimality, it is useful to define action-values. ", "Given a state , an action and a policy , the action-value of the pair under is defined by\n\nwhere now stands for the random return associated with first taking action in state and following , thereafter.", "\n\nThe theory of MDPs states that if is an optimal policy, we act optimally (take the optimal action) by choosing the action from with the highest value at each state, . ", "The action-value function of such an optimal policy () is called the optimal action-value function and is commonly denoted by . ", "In summary, the knowledge of the optimal action-value function alone suffices to know how to act optimally.", "\n\nAssuming full knowledge of the MDP, the two basic approaches to compute the optimal action-value function are value iteration and policy iteration. ", "Both algorithms compute a sequence of functions () that converge to . ", "Computing these functions involves computing expectations over the whole state-space, which is impractical for all but the smallest (finite) MDPs. ", "In reinforcement learning methods, expectations are approximated by averaging over samples and using function approximation techniques to cope with the need to represent value functions over large state-action spaces.", "\n\nMonte Carlo methods\nMonte Carlo methods can be used in an algorithm that mimics policy iteration. ", "Policy iteration consists of two steps: policy evaluation and policy improvement.", "\n\nMonte Carlo is used in the policy evaluation step. ", "In this step, given a stationary, deterministic policy , the goal is to compute the function values (or a good approximation to them) for all state-action pairs . ", "Assuming (for simplicity) that the MDP is finite, that sufficient memory is available to accommodate the action-values and that the problem is episodic and after each episode a new one starts from some random initial state. ", "Then, the estimate of the value of a given state-action pair can be computed by averaging the sampled returns that originated from over time. ", " Given sufficient time, this procedure can thus construct a precise estimate of the action-value function . ", "This finishes the description of the policy evaluation step.", "\n\nIn the policy improvement step, the next policy is obtained by computing a greedy policy with respect to : Given a state , this new policy returns an action that maximizes . ", "In practice lazy evaluation can defer the computation of the maximizing actions to when they are needed.", "\n\nProblems with this procedure include:\n The procedure may spend too much time evaluating a suboptimal policy.", "\n It uses samples inefficiently in that a long trajectory improves the estimate only of the single state-action pair that started the trajectory.", "\n When the returns along the trajectories have high variance, convergence is slow.", "\n It works in episodic problems only;\n It works in small, finite MDPs only.", "\n\nTemporal difference methods\n\nThe first problem is corrected by allowing the procedure to change the policy (at some or all states) before the values settle. ", "This too may be problematic as it might prevent convergence. ", "Most current algorithms do this, giving rise to the class of generalized policy iteration algorithms. ", "Many actor critic methods belong to this category.", "\n\nThe second issue can be corrected by allowing trajectories to contribute to any state-action pair in them. ", "This may also help to some extent with the third problem, although a better solution when returns have high variance is Sutton's temporal difference (TD) methods that are based on the recursive Bellman equation. ", "The computation in TD methods can be incremental (when after each transition the memory is changed and the transition is thrown away), or batch (when the transitions are batched and the estimates are computed once based on the batch). ", "Batch methods, such as the least-squares temporal difference method, may use the information in the samples better, while incremental methods are the only choice when batch methods are infeasible due to their high computational or memory complexity. ", "Some methods try to combine the two approaches. ", "Methods based on temporal differences also overcome the fourth issue.", "\n\nIn order to address the fifth issue, function approximation methods are used. ", "Linear function approximation starts with a mapping that assigns a finite-dimensional vector to each state-action pair. ", "Then, the action values of a state-action pair are obtained by linearly combining the components of with some weights :\n\nThe algorithms then adjust the weights, instead of adjusting the values associated with the individual state-action pairs. ", "Methods based on ideas from nonparametric statistics (which can be seen to construct their own features) have been explored.", "\n\nValue iteration can also be used as a starting point, giving rise to the Q-learning algorithm and its many variants.", "\n\nThe problem with using action-values is that they may need highly precise estimates of the competing action values that can be hard to obtain when the returns are noisy, though this problem is mitigated to some extent by temporal difference methods. ", "Using the so-called compatible function approximation method compromises generality and efficiency. ", "Another problem specific to TD comes from their reliance on the recursive Bellman equation. ", "Most TD methods have a so-called parameter that can continuously interpolate between Monte Carlo methods that do not rely on the Bellman equations and the basic TD methods that rely entirely on the Bellman equations. ", "This can be effective in palliating this issue.", "\n\nDirect policy search \nAn alternative method is to search directly in (some subset of) the policy space, in which case the problem becomes a case of stochastic optimization. ", "The two approaches available are gradient-based and gradient-free methods.", "\n\nGradient-based methods (policy gradient methods) start with a mapping from a finite-dimensional (parameter) space to the space of policies: given the parameter vector , let denote the policy associated to . ", "Defining the performance function by\n\nunder mild conditions this function will be differentiable as a function of the parameter vector . ", "If the gradient of was known, one could use gradient ascent. ", "Since an analytic expression for the gradient is not available, only a noisy estimate is available. ", "Such an estimate can be constructed in many ways, giving rise to algorithms such as Williams' REINFORCE method (which is known as the likelihood ratio method in the simulation-based optimization literature). ", "Policy search methods have been used in the robotics context. ", "Many policy search methods may get stuck in local optima (as they are based on local search).", "\n\nA large class of methods avoids relying on gradient information. ", "These include simulated annealing, cross-entropy search or methods of evolutionary computation. ", "Many gradient-free methods can achieve (in theory and in the limit) a global optimum.", "\n\nPolicy search methods may converge slowly given noisy data. ", "For example, this happens in episodic problems when the trajectories are long and the variance of the returns is large. ", "Value-function based methods that rely on temporal differences might help in this case. ", "In recent years, actor–critic methods have been proposed and performed well on various problems.", "\n\nTheory \nBoth the asymptotic and finite-sample behavior of most algorithms is well understood. ", "Algorithms with provably good online performance (addressing the exploration issue) are known.", "\n\nEfficient exploration of large MDPs is largely unexplored (except for the case of bandit problems). ", "Although finite-time performance bounds appeared for many algorithms, these bounds are expected to be rather loose and thus more work is needed to better understand the relative advantages and limitations.", "\n\nFor incremental algorithms, asymptotic convergence issues have been settled. ", "Temporal-difference-based algorithms converge under a wider set of conditions than was previously possible (for example, when used with arbitrary, smooth function approximation).", "\n\nResearch \nResearch topics include \n adaptive methods that work with fewer (or no) parameters under a large number of conditions\n addressing the exploration problem in large MDPs\n large-scale empirical evaluations\n learning and acting under partial information (e.g., using predictive state representation)\n modular and hierarchical reinforcement learning\n improving existing value-function and policy search methods\n algorithms that work well with large (or continuous) action spaces\n transfer learning\n lifelong learning\n efficient sample-based planning (e.g., based on Monte Carlo tree search). ", "\nbug detection in software projects\n\nMultiagent or distributed reinforcement learning is a topic of interest. ", "Applications are expanding.", "\n Actor-critic reinforcement learning\nReinforcement learning algorithms such as TD learning are under investigation as a model for dopamine-based learning in the brain. ", "In this model, the dopaminergic projections from the substantia nigra to the basal ganglia function as the prediction error. ", "Reinforcement learning has been used as a part of the model for human skill learning, especially in relation to the interaction between implicit and explicit learning in skill acquisition (the first publication on this application was in 1995–1996).", "\n\nComparison of reinforcement learning algorithms\n\nDeep reinforcement learning \nThis approach extends reinforcement learning by using a deep neural network and without explicitly designing the state space. ", "The work on learning ATARI games by Google DeepMind increased attention to deep reinforcement learning or end-to-end reinforcement learning.", "\n\nInverse reinforcement learning \nIn inverse reinforcement learning (IRL), no reward function is given. ", "Instead, the reward function is inferred given an observed behavior from an expert. ", "The idea is to mimic observed behavior, which is often optimal or close to optimal.", "\n\nApprenticeship learning \nIn apprenticeship learning, an expert demonstrates the target behavior. ", "The system tries to recover the policy via observation.", "\n\nSee also \n\n Temporal difference learning\n Q-learning\n State–action–reward–state–action (SARSA)\n Fictitious play\n Learning classifier system\n Optimal control\n Dynamic treatment regimes\n Error-driven learning\n Multi-agent system\n Distributed artificial intelligence\n\nReferences\n\nFurther reading\n\nExternal links \n Reinforcement Learning Repository\n Reinforcement Learning and Artificial Intelligence (RLAI, Rich Sutton's lab at the University of Alberta)\n Autonomous Learning Laboratory (ALL, Andrew Barto's lab at the University of Massachusetts Amherst)\n Hybrid reinforcement learning\n Real-world reinforcement learning experiments at Delft University of Technology\n Stanford University Andrew Ng Lecture on Reinforcement Learning\n Dissecting Reinforcement Learning Series of blog post on RL with Python code\n\nCategory:Markov models\nCategory:Reinforcement learning\nCategory:Belief revision" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0007106128032319248, 0.000729624240193516, 0.0006520595052279532, 0.0005751988501287997, 0.0005688355886377394, 0.0006970279500819743, 0.0005901814438402653, 0.0007063628290779889, 0.0005649301456287503, 0.000576753809582442, 0.000618003832641989, 0.0006394814699888229, 0.0007181762484833598, 0.0005681103211827576, 0.0005482821725308895, 0.0007652897038497031, 0.0007351159583777189, 0.0006117614102549851, 0.0006330711185000837, 0.0005734398146159947, 0.0006524035707116127, 0.0006773836212232709, 0.0006241356604732573, 0.0007727300398983061, 0.0007424313807860017, 0.000630759634077549, 0.0006191735155880451, 0.0006155502051115036, 0.0005672070547007024, 0.0005336317699402571, 0.0005895542562939227, 0.0007000106270425022, 0.0005802761297672987, 0.0006039845175109804, 0.0010730624198913574, 0.0005831951275467873, 0.0006375423981808126, 0.0006952148978598416, 0.0006320052198134363, 0.0006556110456585884, 0.0006134634022600949, 0.0006139737670309842, 0.000676087976898998, 0.0007814926793798804, 0.0006434816750697792, 0.0006152305286377668, 0.0007089396822266281, 0.0006326971342787147, 0.0005789660499431193, 0.0005770636489614844, 0.0005876970244571567, 0.0007179473177529871, 0.0005738151376135647, 0.0007296423427760601, 0.0005926545709371567, 0.0005748177063651383, 0.0005971765494905412, 0.0006084640044718981, 0.0006236691260710359, 0.0005784544046036899, 0.0006064437911845744, 0.0005880970857106149, 0.0006310660392045975, 0.0005677227163687348, 0.000654983043204993, 0.0005744178779423237, 0.0006127908709459007, 0.0005758472252637148, 0.0005785053945146501, 0.0006572564016096294, 0.0006668388959951699, 0.0005955526721663773, 0.0006400939892046154, 0.000571026059333235, 0.0005787544650956988, 0.0006194612942636013, 0.0006409931811504066, 0.0006094390992075205, 0.0005957206594757736, 0.000558405474293977, 0.0006482530734501779, 0.017384085804224014, 0.0009677670313976705, 0.000640081474557519, 0.0007082789088599384, 0.0006864350289106369, 0.0005984879680909216, 0.0005939201219007373, 0.0006606029928661883, 0.0006498589063994586, 0.0006135423900559545, 0.0005981081631034613, 0.0005939094116911292, 0.0006216143956407905, 0.0005707695381715894, 0.0005993496160954237, 0.0005896497750654817, 0.0006127522210590541, 0.0006399058038368821, 0.0006044181063771248, 0.0005597578710876405, 0.0006953871343284845, 0.0005810462753288448, 0.0006421589641831815, 0.0006292816251516342, 0.000671953777782619, 0.0006945393979549408, 0.0006138028693385422, 0.0005899146199226379, 0.0005646093050017953, 0.000555565464310348, 0.0005510224727913737, 0.0005952825304120779, 0.0005567388143390417, 0.0006147809908725321, 0.0006081513129174709, 0.000593008880969137, 0.0006029170472174883, 0.000586960930377245, 0.0007845826330594718, 0.0005590567016042769, 0.0006181835196912289, 0.0005767049151472747, 0.0005792856100015342, 0.000587238697335124, 0.0005577203119173646, 0.0005456982762552798, 0.0005589741049334407, 0.0005723076174035668, 0.0006400381680577993, 0.0006195126916281879, 0.0007188222371041775, 0.001182613312266767, 0.0005695147556252778, 0.000573852623347193, 0.0005970601923763752, 0.0006096938741393387, 0.0005990598001517355, 0.0006361939013004303, 0.0005968752666376531, 0.0005875569768249989, 0.0006063961191102862 ]

[ "Upper Merion senior brings ‘Gatsby' to the stage\n\nBy SABRINA CARROLL AND MOLLY COOKE, Upper Merion Area H.S.\n\nSunday, April 7, 2013\n\n“I like large parties. ", "They’re so intimate. ", "At small parties there isn’t any privacy.”", "\n\nThis observation, from F. Scott Fitzgerald’s iconic novel, “The Great Gatsby,” aptly describes Upper Merion Area High School senior Steven Burke’s passion for the story, which he has adapted to the stage for his Senior Graduation Project. ", "The show will run May 2, 3 and 4.", "\n\nBurke’s stage vision of “The Great Gatsby” is sure to be a party, with luxuriant dance scenes, complex and original video projections, and extravagant costuming.", "\n\nThese efforts seem even more impressive considering that an all-student cast and crew is orchestrating them.", "\n\nThe production also features one of the largest casts ever to take the school’s stage, with over 100 students comprising the Gatsby team.", "\n\n“It’s all in the spirit of promoting an over-the-top environment, just like in the book,” explains Burke, “but with accessibility for every type of audience, whether they frequent stage productions or not.”", "\n\nIndeed, “The Great Gatsby” is an “over-the-top” story that raises poignant questions regarding materialism in everyday life. ", "Some characters undergo deep self-analysis that contributes to their future, while others completely lose sense of themselves.", "\n\nLove is gained and lost tragically. ", "Characters cling desperately to a fading past and fear an unscripted future. ", "Burke plans to capture all of this in his production of The Great Gatsby.", "\n\nGiven the scale of Burke’s vision, the production needs further financial support.", "\n\nTo donate, individuals can visit www.umgatsby.com and click the link to “Sponsor The Show.”", "\n\nFrom there they can fill out a sponsorship form to mail in a donation, or they can donate securely online using a credit or debit card.", "\n\nSponsors will receive special recognition at the show, in the program, and on a display in Upper Merion’s auditorium lobby.", "\n\nBusinesses also ca advertise in the program as a form of sponsorship.", "\n\nIn order to satisfy the community service aspect of Burke’s Senior Graduation Project, all proceeds made from the show will go to funding arts in the community.", "\n\nTo “Join the Party,” come to the show at Upper Merion Area High School, 435 Crossfield Road, King of Prussia on May 2, 3 and 4 at 7:30 p.m.\n\nTickets cost $5 for students and senior citizens and $8 for adults.", "\n\nFor more information about “The Great Gatsby” production, visit www.umgatsby.com." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006333824712783098, 0.0031320564448833466, 0.0006509446538984776, 0.0006067522335797548, 0.0006700780941173434, 0.0008092009229585528, 0.0005954521475359797, 0.0008301272755488753, 0.000686247309204191, 0.0008869589655660093, 0.0006819537957198918, 0.0015884814783930779, 0.0011316101299598813, 0.0007373196422122419, 0.0005994561943225563, 0.0007377364090643823, 0.0006050302181392908, 0.0005473467172123492, 0.0007356755086220801, 0.0005745528033003211, 0.0006699676741845906, 0.0005861796089448035 ]

[ "A review of the public health impact of the Quality and Outcomes Framework.", "\nThere are clear policy objectives in England to encourage primary care and general practice to address health inequalities. ", "In this paper we explore the potential impact of the Quality and Outcomes Framework (QOF) on health inequalities and review the available evidence including analysis of the area based differences in performance between practices in Spearhead and non-Spearhead areas. ", "Overall, the evidence suggests that differences in performance, as measured by the QOF, between practices in deprived and non-deprived areas are narrowing. ", "Although QOF achievement improved in all practices there is weak evidence as to the impact of the QOF on health. ", "The evidence is equivocal as to whether improvements in clinical care and the narrowing gap in performance are influenced by the incentives created by the QOF or whether this translates into reduced health inequalities. ", "Even though the QOF is only part of the range of incentives which affects practices, it is vital that indicators are aligned to the objective of reducing health inequalities. ", "Additional research is needed to understand whether the QOF ensures that those who are the most difficult to reach and those whose need of care is greatest are getting access to high quality primary care and whether in turn it will succeed in reducing health inequalities." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005294779548421502, 0.0005914430948905647, 0.0005218968726694584, 0.0005899218958802521, 0.0006217672489583492, 0.0006005950854159892, 0.0006258586072362959, 0.0005962392897345126 ]

[ "Cyclosporine in chronic inflammatory demyelinating polyradiculoneuropathy.", "\nThis study demonstrates the efficacy of cyclosporine included in a regimen for the treatment of steroid-resistant chronic inflammatory demyelinating polyradiculoneuropathy in two children. ", "Clinical response was characterized by either decreased frequency of recurrent weakness or normalized motor function. ", "Nerve conduction studies and monitoring of cyclosporine levels were included in the serial follow-up evaluations, and their results were used in formulating a treatment plan. ", "One of the two children, who had been monitored for 56 months since the onset of the disease, was able to maintain normal muscle strength without recurrent weakness for 39 months, with 5 mg/kg daily of cyclosporine. ", "The other child, who had been taking prednisolone 0.3 mg/kg daily and cyclosporine 5 mg/kg daily, regained ambulation without support while demonstrating a reduction of recurrent weakness. ", "None had adverse effects caused by cyclosporine therapy. ", "We conclude that cyclosporine is an effective drug in the treatment of children with steroid-resistant chronic inflammatory demyelinating polyradiculoneuropathy." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0020657472778111696, 0.0010280786082148552, 0.0008878256194293499, 0.000624613428954035, 0.0007930494612082839, 0.001389902550727129, 0.0007677294197492301, 0.002713013207539916 ]

[ "Media\n\nHow you can help\n\nRoald Dahl challenge week two: James and the Giant Peach\n\nThe second Roald Dahl challenge has arrived, and it’s time for you to take a ride in your very own Giant Peach! ", "Take part in the challenge to be in with a chance of winning a bundle of his most famous books.", "\n\nThe challenge\n\nFor this challenge, we’re asking children to venture into the outdoors for their daily walk (or this could be done in your garden if you have one) and look for three different insects. ", "Imagine that these critters can grow to the same size as you and will become your travel buddies for your very own giant peach.", "\n\nWe want you to write a newspaper report about the journey in your giant peach. ", "Where will your peach travel and where will it land (it could land somewhere in Middlesbrough for all to see or maybe somewhere far, far away)? ", "You could even interview the minibeasts for the newspaper report, and describe any of their special skills – in the book, the glow worm uses his tail as a light.", "\n\nThis James and the Giant Peach resource from Puffin includes extracts from the book, minibeast fact files, and bonus activities!", "\n\nListen to the opening of James and the Giant Peach on Soundcloud for free\n\nThe winners\n\nEarly years winner: Oscar, age 2 - we really liked the way Oscar has created his nature collage and has had a good go at labelling his picture. ", "Mark making is such an important activity for younger children, as they explore holding crayons and talk about what they are writing.", "\n\nKey Stage 1 winner: Elsie Shields, age 5 - Elsie wrote a story called 'Elsie and the magical potion' featuring a butterfly, a bee and an ant. ", "We were impressed with how creative this story was and we'd love to spend a night in beehive to watch them make their lovely honey.", "\n\nKey Stage 2 winner: Jacob Dewar, age 10 – Jacob's newspaper report was very impressive! ", "He managed to to link in a real life news event with a fictional story which is very clever. ", "He also used some brilliant alliteration, and his report had lots of features of a newspaper. ", "We hope to read a story like this in the Gazette one day Jacob!", "\n\nThe National Literacy Trust is a registered charity no. ", "1116260 and a company limited by guarantee no. ", "5836486 registered in England and Wales and a registered charity in Scotland no. ", "SC042944. ", "Registered address: 68 South Lambeth Road, London SW8 1RL." ]

{ "pile_set_name": "Pile-CC" }

[ 0.001128456206060946, 0.0008344459347426891, 0.0007752502569928765, 0.032887671142816544, 0.0006580436020158231, 0.0008045530412346125, 0.0069344863295555115, 0.0008584652678109705, 0.0006085478817112744, 0.0008537380490452051, 0.0006064680637791753, 0.0009540878818370402, 0.000602821062784642, 0.0006200706120580435, 0.0010764694306999445, 0.0006352165946736932, 0.0007513346499763429, 0.0006906826165504754, 0.0006410567439161241, 0.003000411903485656, 0.0009501947788521647 ]

[ "WEST LOOP — Looking to win over neighbors, developers this week detailed plans for a six-story, nine-unit apartment building at the corner of Randolph and May in the booming West Loop.", "\n\nThe steel-and-masonry building at 1123 W. Randolph St. would replace a parking lot, and offer one-bedroom apartments for an estimated $1,700 a month and two-bedrooms for about $3,400.", "\n\nFirm 1123 Randolph LLC, which includes Interra Realty, presented the plans for the building, which would have retail on the bottom two levels, at a meeting Wednesday.", "\n\nThe proposed 69-foot building would include two one-bedroom apartments and seven two-bedroom apartments spread across four floors, said Matt Ferrino principal at MF Development.", "\n\nThe building would also come equipped with “rooftop amenities” accessible for residents as well as nine bicycle parking spaces, Ferrino said. ", "The first two floors of the building would offer 3,200 square feet of retail space.", "\n\nBecause the building only has nine units, it falls one apartment short of activating city requirements that it include affordable units. ", "Ferrino said there are no designated affordable housing units.", "\n\nDuring the meeting, Ald. ", "Walter Burnett Jr. (27th) said that even with the lower density, he personally would like to see some affordable units included as part of the project. ", "The Affordable Requirement Ordinance calls for including 20 percent on-site affordable units in the West Loop for any new development with 10 or more residential units.", "\n\nBurnett is also advocated for the developer to use union labor to construct the building.", "\n\nArmando Chacon, president of the West Central Association, said the delegate agency had not taken a formal recommendation on the project but was inclined to support it unless there were major concerns from adjacent property owners.", "\n\nCommunity members offered appreciation for a “true six-story building” that included a “brick facade to complement” other buildings in the neighborhood.", "\n\nHKS Architects designed the building, which needs a zoning change to proceed.", "\n\nIf approved by community members and City Council, Ferrino said they hope to begin construction in the fall. ", "The development would take 10-12 months to complete.", "\n\nDo stories like this matter to you? ", "Subscribe to Block Club Chicago. ", "Every dime we make funds reporting from Chicago’s neighborhoods." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005845457199029624, 0.0007262043654918671, 0.0005477815284393728, 0.0006639045313932002, 0.0005693899001926184, 0.0007137177744880319, 0.0006980976322665811, 0.0007071680738590658, 0.0008230110979638994, 0.0005368785932660103, 0.0005773734301328659, 0.000625054759439081, 0.0005723777576349676, 0.0005923538701608777, 0.0005477587692439556, 0.0005939186667092144, 0.0006368609610944986, 0.001160099171102047, 0.011010527610778809, 0.0006643459782935679 ]

[ "A WA piggeries company, its manager and an employee were before court on Friday morning facing several charges relating to the illegal importation of pig semen.", "\n\nThe accused faced Mandurah court on Friday morning. ", "Credit:John Russell\n\nGD Pork Pty Ltd have yet to plead to 12 charges of aggravated illegal importation and four charges of bringing or importing conditionally non-prohibited goods into Australian territory.", "\n\nManaging director Torben Soerensen and internal consultant Henning Laue did not enter pleas in the Mandurah Magistrates Court to 11 charges of aiding, abetting, counselling or procuring the commissioning of an offence.", "\n\nThe case has been the subject of an ongoing investigation by the Department of Agriculture and Water Resources since January 2017." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.3483944535255432, 0.001144993002526462, 0.00608798349276185, 0.0008756369934417307, 0.0005741296918131411 ]