Datasets:

ruliad

/

fineweb_edu_100BT_chunk_14

like 0

Current teaching suggests that many patients are at risk for prolonged bleeding during and following invasive dental procedures, due to an acquired coagulopathy from systemic disease and/or from medications. However, treatment standards for these patients often are the result of long-standing dogma with little or no scientific basis. The medical history is critical for the identification of patients potentially at risk for prolonged bleeding from dental treatment. Some time-honoured laboratory tests have little or no use in community dental practice. Loss of functioning hepatic, renal, or bone marrow tissue predisposes to acquired coagulopathies through different mechanisms, but the relationship to oral haemostasis is poorly understood. Given the lack of established, science-based standards, proper dental management requires an understanding of certain principles of pathophysiology for these medical conditions and a few standard laboratory tests. Making changes in anticoagulant drug regimens are often unwarranted and/or expensive, and can put patients at far greater risk for morbidity and mortality than the unlikely outcome of postoperative bleeding. It should be recognised that prolonged bleeding is a rare event following invasive dental procedures, and therefore the vast majority of patients with suspected acquired coagulopathies are best managed in the community practice setting.

<urn:uuid:5020c5bd-6cec-499b-a91b-6b12d68801ff>

CC-MAIN-2016-50

https://www.mysciencework.com/publication/show/6bb1f12a241451b58235c02419d557c4

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541134.5/warc/CC-MAIN-20161202170901-00437-ip-10-31-129-80.ec2.internal.warc.gz

en

1) Furrel’s Ice Cream Company ships ice cream in bulk from its manufacturing facility to its 25 retail outlets 1) Furrel’s Ice Cream Company ships ice cream in bulk from its manufacturing facility to its 25 retail outlets. Furrel’s has categorized its retail outlets into four types, each of which sells a certain level of ice cream per week, measured in pounds. Furrel’s ships its ice cream in two different size reusable containers: a 6-pound container and a 10-pound container. The company currently has 200 6-pound containers and 25 10-pound containers. The company would like to minimize the amount of excess ice cream shipped to each store while making use of its existing reusable containers. For example, store type 1 needs 25 pounds of ice cream a week. Furrel’s could ship this in one 10-pound container and three 6-pound containers for a total of 28 pounds (3 pounds excess) or in two 10-pound containers and one 6-pound containers (1 pound excess). However, with only 25 10-pound containers available, it is not clear that this is the best choice for this type of store. Pounds of Ice Cream needed Number of Stores a) Given this current store configuration and the number of reusable containers available, how many 6-pound and 10-pound containers should be used to ship to each store in order to minimize the excess ice cream? How much excess ice cream will this lead to each week? b) Should Furrel’s purchase more 6-pound containers or more 10-pound containers? Why? 2) Arizona Semiconductor is trying to determine which R&D projects to fund for the upcoming fiscal year. The company has a limit of $200,000 and 10 researchers available for R&D to be spread between several projects. The table below shows the resources required for each project for the upcoming year and the expected annual profit from each project. Number of Researchers a. Which projects should the company choose to maximize expected annual profit? How much is that profit? Set this up as a spreadsheet using Solver. b. Suppose the company determines that that it must select either project 5 or 6 but not both. Does this change the list of projects the companies should undertake? How? c. If the company wants to increase the amount of R&D it does in the upcoming year, should it allocate more funding or hire more researchers?

<urn:uuid:2b84f716-5a05-4d29-bef1-1740bcf2f225>

CC-MAIN-2016-50

https://www.sophia.org/tutorials/1-furrels-ice-cream-company-ships-ice-cream-in-bulk-from-its-manufacturing

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541134.5/warc/CC-MAIN-20161202170901-00437-ip-10-31-129-80.ec2.internal.warc.gz

en

On energy harvesting from ambient vibration. Journal of Sound and Vibration, 293, (1-2), . (doi:10.1016/j.jsv.2005.10.003). Future MEMS devices will harvest energy from their environment. One can envisage an autonomous condition monitoring vibration sensor being powered by that same vibration, and transmitting data over a wireless link; inaccesible or hostile environments are obvious areas of application. The base excitation of an elastically mounted magnetic seismic mass moving past a coil, considered previously by several authors, is analysed in detail. The amplitude of the seismic mass is limited in any practical device and this, together with the magnitude and frequency of the excitation define the maximum power that can be extracted from the environment. The overall damping coefficient (part of which is mechanical) is associated with the harvesting and dissipation of energy and also the transfer of energy from the vibrating base into the system. Actions (login required)

<urn:uuid:deee6175-a2e0-43bd-b401-35e8854f90d6>

CC-MAIN-2016-50

http://eprints.soton.ac.uk/37842/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

view a plan The Get-Acquainted Rhythm Game illustrates the difference between rhythm and beat 3, 4, 5 Title – Get to Know You Rhythm Game By – Jill Beck Primary Subject – Music Grade Level – 3-5 - At the beginning of a year, or when you have a new group of students, they may be a bit too self-conscious to be musically expressive in front of each other at first. I always like to have them do several icebreaker activities, ones that always have musical merit. - One that they always enjoy is a rhythm name game. - Have the students seated in a circle if possible. Then, establish some 4-beat body percussion patterns. Teacher leads and students echo. Decide as a class on a pattern to continue repeating. - Have them practice the 4-beat pattern on their own. Then stop them and have them repeat after you. “I can KEEP the BEAT, (rest) and I can SAY your NAME.” - Then have them re-establish the body percussion while saying the first part of the chant. Practice until all can do it together. - Second half of the chant involves each individual saying their name alone, then the class repeating it, so each student is encouraged to speak clearly, loudly, and rhythmically. “I can keep the beat, and I can say your name, sitting next to ‘Lisa’ is ‘Allen’, Allen”. Allen says his name then the class says it. Go around the circle in order. - It would continue in that manor. “I can keep the beat, and I can say your name, sitting next to Allen is Jasmine, Jasmine”. - Encourage keeping the steady beat. - I also like to use this as an opportunity to show the difference between beat and rhythm. For example, Allen is a rhythm because it is two fast sounds. Ann is a beat because it is one pulse. The words together make the rhythm, but our bodies are keeping a steady beat. E-Mail Jill Beck !

<urn:uuid:15a6db66-d87d-401f-8362-507ff4e5edd4>

CC-MAIN-2016-50

http://lessonplanspage.com/musicbeginschoolgetacquaintedrhythmandbeatgame35-htm/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

There is no doubt that information is the power of a progressive society. Access to knowledge is the first step in a society’s journey towards becoming empowered. The status quo According to the 2013 INSEAD Global Innovation Index, approximately 14 million people in emerging market country like South Africa have access to the internet. That’s still a relatively small portion of the population, although it’s a much bigger proportion than the 100 or so million internet users India currently has. But while numbers may fluctuate from country to country, there can be no doubting that the internet presents the greatest opportunity for access to knowledge than has ever existed in the world before. The Innovation Index goes on to highlight that knowledge diffusion is a key measure for the level of innovation which can be found in a country. Compare that potential to the current situation in emerging markets. For instance, in 2010 892 936 students (726 882 undergraduates and 138 610 postgraduates) were enrolled in South Africa’s public higher-education institutions. According to that country’s 2011 census, only 12,1% of people 20 years old and older have any tertiary education and this includes short courses and certificates, which is nowhere near the over 10-million unemployed and largely unemployable people in the country. The unavailability of relevant, low-cost, high quality learning content undoubtedly remains a major barrier to growth. Sure, new universities are popping up all the time (Nigeria established nine in 2011). But is opening universities which people still can’t afford really the most impactful and viable way to educate and upskilll people? Is the open source economy the answer? Massive online open courses (MOOCs) have been a key development in recent digital history. These amazing platforms enable users to access university courses. The world is littered with MOOC’s- Open Culture, Coursera and Alison to name a few. Emerging market countries are starting to catch on to the phenomenon too. In fact, nearly nine percent of Coursera’s students are from India, and just over five percent are from Brazil. In South Africa meanwhile, there are a handful of organisations trying their hand at free online learning, the most notable and commendable of which has to be Regenesys Business School’s recently launched Regenesys Foundation which teaches business school classes online at no charge. People from developed nations are starting to pay attention too. A group of Nokia alumni recently set up a MOOC aimed specifically at Nigeria. One of the biggest considerations of MOOCs is their possible impact on the training industry, which is an issue that should come to the fore in the near future. Time for education 2.0 in emerging markets No matter how much money a government can spend on education, the current system has proven that it is not the answer to closing the skills gap which exists in many emerging market countries. It is time for these countries to look at higher education differently and use the Zeitgeist to their advantage. Bureaucracy is not the answer. The real economic difficulties faced by these countries mean many cannot afford to go to school. So what could be an answer? There needs to be a mindset shift in education system for government, institutions, employers and learners. What they can and cannot achieve must be acknowledged, this is a sign of maturity. These countries may not be able to get as many young people through doors of higher learning as we’d like, but we can give them access to the same knowledge and empower them with the same skills. The success of a higher education system depends on all sectors coming to the party in more new ways than before. No longer just dialogues and white papers but in partnering for real impact. What if government working with civil society can create a MOOC and private and civil sector enable the accessibility (through Wi-Fi hotspots, 3G, a MOOC app etc)? Insanity is defined as doing the same thing expecting different results. It’s time to turn tertiary education on its head, and begin to create real value. Education as we know it is gone. The choice is in how we harness the value that comes from the current environment.

<urn:uuid:ab654dbd-04c5-474c-a2d5-cf679effcda1>

CC-MAIN-2016-50

http://memeburn.com/2013/08/could-moocs-help-democratise-education-in-emerging-markets/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

The coal industry in the Hunter Valley could leave taxpayers with annual health bills running into the hundreds of millions of dollars and further mine expansion should be halted, a report released by 28 health groups says. The Coal and Health in the Hunter report by the Climate and Health Alliance estimates that burning coal for electricity in the valley alone produces health damage in the order of $600 million annually from the resulting air pollution, including the release of small particles. The particulate matter from coal, measured in 2.5-10 millionths of a metre in diameter, "lodges into the linings of the blood vessels and causes inflammation and irritation, and leads to long-term cardio-vascular and lung disorders", said Liz Hanna, president of the alliance and a research fellow in epidemiology at the Australian National University. "It's not just people falling ill today, but also the negative impacts [coal is] going to have on their systems so that they end up with cancers in years to come," Dr Hanna said. The release of other chemicals, including from blasts at the region's mostly open-cut coal mines, noise and water pollution also undermine the health of residents. The Hunter Valley produces about 145 million tonnes of coal a year, 126 million tonnes of which is exported, and the remainder burnt in the region's power stations. The report notes that on current projections, coal production will expand to 243 million tonnes by 2022, requiring a 50 per cent increase in coal trains and resulting in a further rise in coal dust problems for residents along the valley and in Newcastle. A 2014 report for the NSW Minerals Council estimated Hunter coal contributes in total $6.3 billion annually to the state's economy, or almost half of the total mining industry's output in the state. The region's coal industry also employed more than 18,000 people. If the climate change costs from burning the coal are taken into account, the damage bill soars into the billions, the CAHA report said. When burnt, the current annual output of Hunter coal converts to about 348 million tonnes of carbon dioxide equivalent. Using US government estimates of a social cost of $US37 ($47) per tonne of carbon dioxide, the cost swells to about $16.4 billion, and would to increase to $26 billion if the 2022 mine expansion goal is reached, the report said. "There's a total disassociation of who gets the benefits and who gets the pain, and we don't think that's particularly moral or just," Dr Hanna said. "There should be a moratorium on any further expansion, and essentially, coal should be phased out." Dr Hanna was also a signatory, along with former NASA scientist James Hansen and former Australian of the Year and research professor Fiona Stanley, to an open letter to be presented on Monday to Premier Mike Baird, calling for an end to coal projects in the Hunter.

<urn:uuid:9d603f6c-ac2b-424c-848d-9900f44f9f7c>

CC-MAIN-2016-50

http://www.brisbanetimes.com.au/environment/climate-change/hunter-valley-coals-annual-health-bill-600-million-doctors-groups-say-20150222-13lfch.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Among American children aged 2 to 18, what percentage of their daily calories come from snacking? According to a study published in Health Affairs magazine, American children between the ages of 2 and 18 derive a full 27% of their daily caloric intake from snacking. The study compared data from Federal diet surveys conducted between 1977 and 2006, and compared to thirty years earlier, snacks have increased calorie counts and snacking itself has become more frequent, with the majority of the nation's children supplementing their three meals a day with nonstop grazing on potato chips, soda and candy bars. "We are at the point where every age group in America is moving towards constant eating," said study co-author Barry Popkin, "and we see no evidence that's going to slow down." SOURCE: Calorie-Heavy Snacks Help Push Childhood Obesity Rate Up | Washington Post

<urn:uuid:74137caa-f89f-4cbd-98db-604cb13b96e6>

CC-MAIN-2016-50

http://www.cnbc.com/id/36073290/page/2

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Shakespeare memorialized the sweet smell of the rose, but obviously he hadn’t so much as sniffed a lilac, the undisputed perfumed queen of the spring. These beautiful, hardy bushes are a great addition to your landscape because they tend to be easy to care for and the problems with lilac bushes are mostly minor. Even so, it’s best to be prepared if you have a run in with lilac pests and diseases, so we made up a list of common lilac problems you may encounter. Common Diseases of Lilacs Although lilacs are a hardy bunch, they can succumb to problems like any other landscape shrub. Be on the lookout for these diseases: Bacterial blight – The bacteria Pseudomonas syringae causes early shoot and branch dieback, distorted leaves and leaf spots that start out olive green, but soon develop water soaked areas. Those spots turn brown with yellow margins and begin to die. Blossoms may become limp or turn brown suddenly. Pruning away the diseased material and thinning the inside of the shrub is the best way to control this disease, but if the infection is widespread, a copper fungicide will help kill it quickly. Powdery mildew – Powdery mildew is probably the most common problem in lilacs. It’s caused by a variety of fungal pathogens that result in leaves with a powered appearance, either in tightly organized spots or spread across the surfaces. Increasing the air circulation around infected leaves is the best treatment, so make sure to thin your plants yearly. Leaf spots – Leaf spots are another fungal problem caused by a variety of pathogens. When you see tan spots appear on your lilac leaves, with or without causing the leaves to fall, you’ve likely got one of the many leaf spot diseases on your hands. As with powdery mildew, this problem is a result of high local humidity, so thin that shrub and clean up all fallen debris to prevent future infections. Common Lilac Pests Scales – Scales can be difficult to detect, many species look like cottony or waxy growths on the stems and branches of landscape shrubs. If you lift their covers though, you’ll find very small, brightly colored insects underneath. Scales are best treated with repeated applications of neem oil, spaced seven to 14 days apart. When they’re clustered together in one section of the plant, pruning them out is an excellent option. Borers – The larvae of the clearwing moth is a boring insect that prefers to feed on lilacs. These tiny caterpillars spend most of their lives inside the stems and branches of your plant, only emerging to mate. Effective management centers around keeping the lilac healthy and happy, since sick plants are much more likely to attract borers. They have a number of natural enemies that will pick them off when the lilac is stronger and less appealing.

<urn:uuid:460cdf54-415b-44a0-bbf2-87cc699e184c>

CC-MAIN-2016-50

http://www.gardeningknowhow.com/ornamental/shrubs/lilac/common-lilac-problems.htm

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Areas deforested in Brazil increased from 152 000 km_ in 1976 to 517 000 km_ in 1996. That figure is the equivalent of the surface area of France. Deforestation is a complex process and involves a host of changing and widely differing situations. The factors behind it are many and varied. They include rising demand for agricultural land, international trade needs for timber and political decisions regarding strategic planning and development. Researchers of the IRD Space Unit conducted an investigation from January 2000 to December 2002, on deforestation in the Amazon Basin. Their overall procedure is based on the use of remote-sensing data obtained from satellites and aircraft. The approach adopted, termed “descending hierarchical”, often used by geographers, was first applied in French Guiana. It consists in analysing the Amazonian forest cover making the most of a full range of remote-sensing tools which provide means of taking into account the different scales involved. These scales are: the regional scale, studied using satellite images of NOAA-AVHRR and Spot 4 VEGETATION sensors which give coverage of terrains of surface area of 2000 km_; the sub-regional scale, with Landsat and Spot images which provide more detailed data on areas of 185 and 60 km_ respectively; local scale (a few tens of kilometres square observed using aerial photography). Together these tools enabled the researchers were therefore able to demonstrate the size diversity of cleared plots in the Amazon forest, from extensive areas of deforestation like the pioneer fronts of Brazil to the small 1-ha plots epitomized by brushwood plots in French Guiana. In parallel, the team processed a mass of field measurements and socio-economic data, for French Guiana in particular, in order to calibrate the available aerial or satellite observations, interpret them and place them in the prevailing context. Such socio-economic data take particular account of the land-ownership situation and strategic planning and redevelopment problems. The untimbered areas in Guiana correspond to spontaneous land-take for agriculture often liable to change rapidly and shift geographically, whereas the pioneer fronts in Brazil mark rather government intentions to enhance agricultural potential, expressed as a plan which indeed prompts the clearances and permanent occupation for pastoral purposes. Marie-Lise Sabrie | alfa Successful calculation of human and natural influence on cloud formation 04.11.2016 | Goethe-Universität Frankfurt am Main Invasive Insects Cost the World Billions Per Year 04.10.2016 | University of Adelaide A multi-institutional research collaboration has created a novel approach for fabricating three-dimensional micro-optics through the shape-defined formation of porous silicon (PSi), with broad impacts in integrated optoelectronics, imaging, and photovoltaics. Working with colleagues at Stanford and The Dow Chemical Company, researchers at the University of Illinois at Urbana-Champaign fabricated 3-D birefringent... In experiments with magnetic atoms conducted at extremely low temperatures, scientists have demonstrated a unique phase of matter: The atoms form a new type of quantum liquid or quantum droplet state. These so called quantum droplets may preserve their form in absence of external confinement because of quantum effects. The joint team of experimental physicists from Innsbruck and theoretical physicists from Hannover report on their findings in the journal Physical Review X. “Our Quantum droplets are in the gas phase but they still drop like a rock,” explains experimental physicist Francesca Ferlaino when talking about the... The Max Planck Institute for Physics (MPP) is opening up a new research field. A workshop from November 21 - 22, 2016 will mark the start of activities for an innovative axion experiment. Axions are still only purely hypothetical particles. Their detection could solve two fundamental problems in particle physics: What dark matter consists of and why it has not yet been possible to directly observe a CP violation for the strong interaction. The “MADMAX” project is the MPP’s commitment to axion research. Axions are so far only a theoretical prediction and are difficult to detect: on the one hand,... Broadband rotational spectroscopy unravels structural reshaping of isolated molecules in the gas phase to accommodate water In two recent publications in the Journal of Chemical Physics and in the Journal of Physical Chemistry Letters, researchers around Melanie Schnell from the Max... The efficiency of power electronic systems is not solely dependent on electrical efficiency but also on weight, for example, in mobile systems. When the weight of relevant components and devices in airplanes, for instance, is reduced, fuel savings can be achieved and correspondingly greenhouse gas emissions decreased. New materials and components based on gallium nitride (GaN) can help to reduce weight and increase the efficiency. With these new materials, power electronic switches can be operated at higher switching frequency, resulting in higher power density and lower material costs. Researchers at the Fraunhofer Institute for Solar Energy Systems ISE together with partners have investigated how these materials can be used to make power... 16.11.2016 | Event News 01.11.2016 | Event News 14.10.2016 | Event News 02.12.2016 | Medical Engineering 02.12.2016 | Agricultural and Forestry Science 02.12.2016 | Physics and Astronomy

<urn:uuid:6cc2759e-d5c3-40aa-b10a-de02bf34d73d>

CC-MAIN-2016-50

http://www.innovations-report.com/html/reports/environment-sciences/report-18089.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Add cancer research to the long list of things that people with a low income have difficulty taking part in, says a new study published Thursday in JAMA Oncology. Following over 1,000 newly diagnosed cancer patients for six months, the study authors found that the lower a person’s income, the less likely they were to sign up for clinical trials of potentially important cancer treatments. Specifically, people who earned less than $50,000 a year were 32 percent less likely to join a trial than their higher income counterparts. This reluctance only became more stark the lower their income level, with the worst participation rates seen among people who earned less than $20,000. Given that cancer “clinical trials provide the best evidence for showing the efficacy of new treatments,” the researchers noted,” limiting income disparities is important for ensuring rapid enrollment and fair access to trials.” It should be pointed out that most cancer patients, rich or poor, don’t take part in clinical trials, for a myriad of reasons, not the least of which includes simply not meeting a study’s eligibility requirements. Even in the sample these researchers observed, only 17 percent of people who earned over $50,000 annually took part in a clinical trial, versus 13 percent of people who earned between $49,999 to $20,000, and 11 percent for those under $20,000. For poorer people, however, it appears that the marginal drawbacks to becoming a study subject impact them more than those with disposable income, from repeated transportation fees to the study site to arranging child care or time off from work. For those reasons, the authors recommend that more researchers should offer to level the playing field for potential volunteers, possibly through offering direct financial compensation to people who need them. Building off an earlier, if limited, study that found similar conclusions, the researchers note that an income gap in clinical cancer research harms both patients and scientists. Cancer researchers are deprived of gathering a more complete picture of how effective a new treatment might be — since low-income people also tend to have worse health — and less able to recruit enough patients quickly enough. Meanwhile, “since clinical trial treatments represent the newest available treatments, access to this vital resource should be available to individuals of all income levels,” the researchers concluded. Source: Unger J, Gralow J, Albain K, et al. Patient Income Level and Cancer Clinical Trial Participation: A Prospective Survey Study. JAMA Oncology. 2015.

<urn:uuid:7c6c3a14-789f-4062-a9a6-e98ec86d9d80>

CC-MAIN-2016-50

http://www.medicaldaily.com/poor-people-arent-signing-cancer-clinical-trials-and-its-bad-science-357258

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

OTTAWA, Nov. 28, 2016 /CNW/ - Canada is a leader in the fight against climate change, both globally and at home. Earlier this month in Marrakech, Canada worked with nations from around the world to implement the Paris Agreement, which aims to keep the global temperature increase to well below 2 °C. In October, Canada played a leadership role in working with countries to negotiate the global phase down of hydrofluorocarbons (HFCs). HFCs are greenhouse gases (GHGs) that are very powerful in trapping heat in the atmosphere. Today, the Minister of Environment and Climate Change, Catherine McKenna, announced the proposed regulations to reduce HFCs domestically. This measure would reduce Canada's annual consumption of HFCs by 85 percent, by 2036. The proposed regulations would apply to the manufacture and import into Canada of HFCs and new products that contain HFCs. Canadians can continue to use appliances and products that they already own, and industries can continue to use up any existing HFC inventories. Canada's HFC regulations would make common products used by all Canadians—such as refrigerators and air-conditioners—more climate-friendly. In addition, replacing HFCs with climate-friendly refrigerants and technologies could improve energy efficiency, leading to cost savings for consumers and businesses. The proposed regulations were published in the Canada Gazette, Part I, on November 26, 2016. Industry stakeholders and interested Canadians are invited to provide input to Environment and Climate Change Canada. "HFCs are among the most potent greenhouse gases emitted around the world. Canada is already a leader, globally, in efforts to phase down damaging HFCs from refrigerators and air conditioners. By working here at home to phase down Canadians' use of products containing HFCs, our government is taking real action to fight climate change. The measures announced today will reduce emissions by the same amount as taking almost two million passenger vehicles off the road per year for 23 years." – Catherine McKenna, Minister of Environment and Climate Change - HFCs are the world's fastest growing source of GHGs, increasing by 10 to 15 percent a year. - Between 2018 and 2040, the proposed regulations are expected to result in a cumulative HFC reductions equivalent to 176 million tonnes of carbon dioxide. This reduction is like taking almost two million passenger vehicles off the road per year for 23 years. - Earlier this year, Canada finalized measures to increase the recovery, recycling, and destruction of HFCs in refrigeration and air‑conditioning equipment and established regulatory provisions for an HFC permitting and reporting system. - The global HFC amendment to the Montreal Protocol adopted last month, in Kigali, Rwanda, is predicted to avoid up to 0.5 °C of global warming by the end of this century. Proposed Regulations Amending the Ozone-depleting Substances and Halocarbon Alternatives Regulations Environment and Climate Change Canada's Twitter page Environment and Natural Resources in Canada's Facebook page SOURCE Environment and Climate Change Canada For further information: Caitlin Workman, Press Secretary, Office of the Minister of Environment and Climate Change, 819-938-9436; Media Relations, Environment and Climate Change Canada, 819-938-3338 or 1-844-836-7799 (toll free)

<urn:uuid:d882f75c-9fc7-4ca9-bfaf-09c0b5d74c2b>

CC-MAIN-2016-50

http://www.newswire.ca/news-releases/canada-proposes-to-phase-down-hfcs--powerful-greenhouse-gases-603430766.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Introduction to the Threatened Species Education Kit This resource has been created to provide specific information on some of Tasmania's threatened species. We have over 600 species currently listed in the schedules of Tasmania's Threatened Species Protection Act 1995. Many more species are in danger of becoming included on these lists. The Federal government promotes the protection of our threatened species with the Environment Protection and Biodiversity Conservation Act 1999 and the National Endangered Species Program which has been operating since 1990. Many Tasmanian species have benefited from this program. Today there are 20 recovery teams in operation on Tasmanian species (both plants and animals). These recovery teams represent a wide cross section of the community. They include researchers, volunteers, landowners and managers. How to use these pages Thirty eight species have been chosen for this educational resource. Each species has its own page of information including a photographic image and Tasmanian distribution map. Information includes current status under the State and Federal Acts, threats and what is being done. All information is correct as of August 2003. Species have been chosen to provide representation of all categories and groups so that teachers and students can access the greatest diversity of material. This resource has been designed to be user-friendly for both individual and class assignments. There is sufficient diversity within any group for students and teachers to make links between: - types of threats (ie. habitat loss, pollution, introduced species) - habitat types (ie freshwater, marine, land, islands) - a group of species (mammals, birds, invertebrates, fish, plants) - threatened categories (extinct, endangered, vulnerable, rare). As far as possible species were also selected from different areas of the State so that most students would be able to identify at least one from their local area. A full listing of all Tasmanian threatened species is available online at the Department of Primary Industries and Water web site.

<urn:uuid:16d8dbf7-c7ea-42c8-a757-400bedb716d4>

CC-MAIN-2016-50

http://www.parks.tas.gov.au/index.aspx?base=938

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

(b) The inmost coating or membrane of a part or organ, especially of a vein or artery. Short for the Latin tunica intima, inmost coating. 1873: “Under the microscope, the cells of the intima and of the middle and external coats are found to be considerably increased in number.” (a) A convex moulding of which the section is a quarter-circle or (approximately) a quarter-ellipse, receding from the vertical downwards. Also called quarter-round or echinus. An adaptation from the Italian, derived from the Latin ovum, and egg. (b) In Jewish cookery, a pancake, especially one made with grated

<urn:uuid:0981139a-0800-43c1-a005-55fb04777ed0>

CC-MAIN-2016-50

http://www.thetimes.co.uk/tto/puzzles/article1710588.ece

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Choosing a Health Profession Allied Health Program How to Prepare Health practitioners diagnose, treat, and strive to prevent illness and disease. While all of them practice the art of healing, they differ in methods of treatment and areas of specialization. Physicians--both allopathic and osteopathic--perform surgery, and prescribe medications, exercise, and proper diet. Optometrists specialize in eye care and Podiatrists treat foot diseases and deformities. Dentists emphasize not only the treatment but the prevention of problems associated with teeth and gums. Veterinarians treat animals and inspect meat, poultry, and other food as part of public health programs. A variety of health professions are briefly described below, all worthy of exploration. 102 Richardson Building, Tulane University, New Orleans, LA 70118 504-865-5798 email@example.com

<urn:uuid:c5023801-6d6d-4bec-a058-1ad7a5ef94bf>

CC-MAIN-2016-50

http://www2.tulane.edu/advising/prehealth/choosing/index.cfm

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Which Joe gave his name to ‘sloppy joes’? We look at five interesting sandwiches and their lexical origins. [mass noun] Severe difficulty in making arithmetical calculations, as a result of brain disorder. - ‘An estimated five per cent of children suffer from dyscalculia - a problem just as serious as dyslexia but still hardly recognised, said Prof Brian Butterworth.’ - ‘Assuming that the word is used in the same way as ‘dyslexia’, I'd deduce that if a person suffers from dyscalculia they could be described as being dyscalculic.’ - ‘Children who have dyscalculia are rarely identified in mainstream schools.’ - ‘I really truly believe that I have dyscalculia, which is a learning disability like dyslexia, only with math instead of language.’ - ‘Irlen Syndrome can be found in combination with dyslexia, dysgraphia, dyspraxia, dyscalculia, dysphasia, or hyperactivity.’ We take a look at several popular, though confusing, punctuation marks. From Afghanistan to Zimbabwe, discover surprising and intriguing language facts from around the globe. The definitions of ‘buddy’ and ‘bro’ in the OED have recently been revised. We explore their history and increase in popularity.

<urn:uuid:2b5938c3-28f6-48f3-aa1b-bf6e5853504a>

CC-MAIN-2016-50

https://en.oxforddictionaries.com/definition/dyscalculia

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Posadowsky Glacier (Bouvet Island) It was first charted and named by the Gauss Expedition under Erich von Drygalski, which visited the island in February 1902. Posadowsky Glacier was named for Count Arthur von Posadowsky-Wehner, Secretary of the Interior of the German Empire, who was instrumental in obtaining a government grant to cover the cost of the Drygalski expedition. |This Bouvet Island location article is a stub. You can help Wikipedia by expanding it.|

<urn:uuid:c416c452-594f-4b70-8928-1aefc2eb269a>

CC-MAIN-2016-50

https://en.wikipedia.org/wiki/Posadowsky_Glacier_(Bouvet_Island)

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Acid blockers may relieve heartburn. But they can’t stop the epidemic of reflux in this country. Try these steps to figure out what may be causing your reflux, and how you may be able to reverse it. Do you have a sweet tooth? Most of us will overindulge at times. But the more sugar we consume, the more we want, says Mark Hyman, MD. However, the good news is that people can break the sugar addiction in 10 days. Here’s how. If you suffer from acid reflux at night, you may one day get relief in an unexpected way: by sleeping on a specially designed pillow. While still in the early stages of study, the pillow — or what the manufacturer calls a sleep positioning device — could eliminate the need for acid-reducing medications or even … Read More The incidence of cancer of the esophagus, or esophageal cancer, is on the upswing in the United States. Some experts theorize that this may be due to the increase in acid reflux (also known as “heartburn”). Acid reflux is a known risk factor for esophageal cancer. Esophageal cancer is a disease in which malignant (cancer) … Read More The esophagus is the muscular tube that connects your throat to your stomach. Achalasia is an uncommon condition in which the esophagus is unable to move food and sometimes liquids into the stomach. When people have this condition, a valve located at the end of the stomach — the lower esophageal sphincter — stays closed … Read More Imagine being a baseball player who gets to see just one pitch. That’s the situation facing most hernia sufferers who require surgery. This is a get-it-right-the-first-time situation (or else). Now, double down on this scenario for seniors who are suffering from a specific type of hernia. Hiatal hernias are most often found in people in their … Read More We call it heartburn, even though it has nothing to do with the heart. It’s gastroesophageal reflux disease (GERD) and one in five Americans have had it at one time or another. Although medications can help to control reflux, lifestyle changes often do the trick, says Scott Gabbard, MD, a gastroenterologist and hepatologist. GERD affects people when … Read More Ugh…heartburn again? If that’s your mantra after meals or as you fall asleep, you may have gastroesophageal reflux disease (GERD). In GERD, the valve between your lower esophagus and stomach weakens. This sometimes lets food and stomach acids to back up into your esophagus. The result is usually a burning sensation behind the breastbone, or … Read More Ladies, we all know the marvels achievable with shapewear – those slimming, stretchy undergarments that can help you go down a dress size and make your body seem smaller and firmer. Unlike Victorian-era corsets, with their tight lacings and metal panels, modern-day shapewear is not going to permanently narrow your ribcage or relocate your organs. … Read More Antacids like Prilosec®, Nexium® and Pepcid® are made to relieve your heartburn, gastroesophageal reflux disease (GERD) and gastric ulcers. But a new study is linking the long-term use of these antacids to deficiencies in vitamin B12. The medications are typically prescribed for short-term use, up to eight weeks, but some people take them for years … Read More

<urn:uuid:04dd9899-6733-48db-9651-6273b5ffebc2>

CC-MAIN-2016-50

https://health.clevelandclinic.org/tag/acid-reflux/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Send the link below via email or IMCopy Present to your audienceStart remote presentation - Invited audience members will follow you as you navigate and present - People invited to a presentation do not need a Prezi account - This link expires 10 minutes after you close the presentation - A maximum of 30 users can follow your presentation - Learn more about this feature in our knowledge base article Do you really want to delete this prezi? Neither you, nor the coeditors you shared it with will be able to recover it again. Make your likes visible on Facebook? You can change this under Settings & Account at any time. Transcript of FLL The Staedtler Allxwrite 292 pencils are completely made from graphite, which means little pencil waste. (The waste comes from erasing, or if you sharpen it, even though you don't have to.) A decent sized tree can make about 300,000 pencils. Before erasers were made, writers & artists used bread crumbs to erase. We could use this method better in the 21st century. Every year more than sixteen billion pencils are sharpened. . 15-20 billion pencils are made each year worldwide. Pencils can write in outer space, and under water. There is no risk of lead poisoning if you stab yourself (or someone else) with a pencil because it contains no lead—just a mixture of clay and graphite. More than half of all pencils come from China. In 2004, factories there turned out 10 billion pencils, enough to circle the earth more than 40 times! The smell of pencil shavings keeps moths away. We are the Nerdy Birds from Betances STEM Magnet School. When our Engineering teacher, Mrs. Delisle, first introduced us to First Lego League, we were all for it. This is our first year participating in FLL. We were very excited, but we got straight to business. First of all, we had to brainstorm to find what we wanted to raise awareness about so that people would know to recycle it to prevent harm to the environment. We are the Nerdy Birds from Betances STEM Magnet School who got chosen to be in the First Lego League Team. This is our school's first year for First Lego League. My name is Benjamin Baby and my group members are Ved Gautam, blank, blank, blank, blank, blank, blank. This our team. Our Feelings About First Lego League: Topic: Pencil Waste Can Be Recycled First Lego League Members: Ansh Desai , Anika Sharma, Viveca Garcia, Shalom Akinwole, Natalie Sherer, Maaria Ahmad, Laxmi Vobbineni, and Ved Gautam How We Decided This machine converts paper into pencils. This machine makes erasers out of pencil shavings. We decided to use pencil waste as our trash type because we voted on which idea would be most presentable, and also which idea we would be able to expand the most on, whether it is by facts, or strong points on why we need to focus on pencil waste as a valuable resource being wasted every year. When we throw it away, and do not replace all the trees that we cut down to make the pencils, it harms our environment. Things You Can Do To Help Put pencil shavings in your recycling bin. Use pencil shavings as mulch for a garden. Use pencil shavings as kindling (fire starters). You can also use them with potpourri. Instead of using wooden pencils, use led pencils with biodegradable shells. Technology That Saves Our Pencil Waste Our presentation is on pencil waste. Many people throw away tons of pencil waste. DON'T INVOLVE IN IT !!! You can use this pencil waste to make beautiful projects and even meet basic needs. Pencil waste is made using the environment. If you do use pencils, you should plant a tree. Make a goal like for every 50 pencils you use plant a tree. No matter what, just do one thing... Help save our environment !!! Make a plan, make a goal, start helping us save our precious Earth. This machine shown below shows a pencil being made into an eraser. The picture below shows a machine that turns waste paper into pencils. Some examples of Pencil Art Pencil waste can have many impacts on not only the environment. It can also harm us as human beings. When trees are formed into pencils, factories prouce smoke. If we breathe this polluted air, we can get sick and maybe even die from diseases or cancer. Half of the pencils used don't even get used or used only for a while. Remember harming the environment is technically harming us! YouTube - Toss it Baby Check This Out !!!

<urn:uuid:8d989f09-805d-4d52-b3f9-408f47ef65a6>

CC-MAIN-2016-50

https://prezi.com/laplo4nlspay/fll/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Spinal cord tumours The spinal cord extends from the base of the brain, to down inside the bones of the backbone, which is also known as the spine or the spinal column. The spinal cord does not extend the full length of the spinal column, but ends in the small of the back (the lumbar area). Intramedullary tumours are located within the nerves of the spinal cord. There are several different types of cancer of the spinal cord, but the most common are astrocytomas and ependymomas and these are most common in children. Intradural extramedullary tumours start inside the coverings of the spinal cord, but outside the cord itself. Meningiomas and nerve-sheath tumours, such as schwannomas, are the most common types of intradural extramedullary spinal tumour and most often are diagnosed in adults. If you or someone you know has been diagnosed and would like support, visit:

<urn:uuid:016da26a-82e3-4c57-9723-debf87d47ad0>

CC-MAIN-2016-50

https://www.braintumourresearch.org/spinal-cord-tumours

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

New hope in the fight against tuberculosis Scientists from the HIPS and the HZI discover a new target for the fight against multi-resistant mycobacteria, from a rejuvenated antibiotic series According to figures of the World Health Organization, some 8.7 million people contracted tuberculosis in 2012 and this disease is fatal for approximately 1.3 million people throughout the world each year. One of the main problems is that the tuberculosis pathogens have become resistant to the antibiotics used to fight them. Scientists from the Helmholtz Institute for Pharmaceutical Research Saarland (HIPS) in Saarbrücken, the Helmholtz Centre for Infection Research (HZI) in Braunschweig and the German Center for Infection Research (DZIF) joined forces with scientists from Sanofi, a global health care company, and identified a new agent, which might potentially remedy these problems. The scientists just described this agent and its unique mechanism of action in the highly renowned scientific journal Science. Mycobacterium tuberculosis is the main cause of tuberculosis. The treatment for drug-susceptible tuberculosis consists of the daily administration of multiple drugs for a minimum of six months. Lack of adherence to this regimen can result in treatment failure and the emergence of drug resistance. "Complexity and duration of the treatment are true issues and the main reasons for the development of resistant pathogens," says Prof Rolf Müller, who is the Executive Director and head of the Microbial Natural Substances department of the HIPS, an institution jointly sponsored by the HZI and Saarland University. Consequently, there is an urgent need for new medications and therapeutic approaches to both fight the resistant pathogens, as well as to shorten the duration for the treatment of drug-susceptible organisms. Based on earlier reports, Müller, in collaboration with Prof Jacques Grosset from the Johns Hopkins University School of Medicine in Baltimore, and his colleagues from the HZI and Sanofi scientists, initially focused on the natural substance called griselimycin. The potential of this natural substance, was discovered in the 1960s. However, due to the success of other tuberculosis medications and its low efficacy in an infection model, the substance was not developed any further at the time. "We resumed the work on this agent and optimised it such that it shows excellent activity in the infection model - even against multi-resistant tuberculosis pathogens," says Müller. In the course of their work, the scientists discovered that cyclohexylgriselimycin, a variant of griselimycin, is particularly effective against Mycobacterium tuberculosis, both in cells and in the animal model. Importantly, cyclohexylgriselimycin was effective when administered orally, which is key in tuberculosis treatment, non-orally available drugs are extremely burdensome to administer daily during the many months of treatment. Moreover, combining this substance with current TB antibiotics increases the efficacy compared to the antibiotic cocktail that is usually administered. The scientists were not only able to demonstrate the efficacy of cyclohexylgriselimycin against tuberculosis, but they also elucidated the underlying mechanism of action. "In the tuberculosis pathogen, the substance binds to the so-called DNA clamp and thus suppresses the activity of the DNA polymerase enzyme, which multiplies the genetic information inside the cell," says Müller. Neither DNA replication nor efficient DNA repair can proceed in the absence of the DNA clamp, which means that the bacterial pathogens are prevented from proliferating in the body. Structural biologists at the HZI successfully elucidated the detailed structure of the DNA clamp in a complex with cyclohexylgriselimycin bound to it. "This allowed us to elucidate the special mode of action of the new antibiotic at high resolution," says Prof Dirk Heinz, Scientific Director of the HZI, who was also involved in the study. Since this mechanism is different from the mechanism of action of the antibiotics used previously against tuberculosis and all other bacterial pathogens, the risk of resistance developing is low for now. In addition, the scientists were able to show that the development of resistance in mycobacteria, which include the tuberculosis pathogen, albeit possible, is associated with a drastic decrease in the growth of the pathogens such that the potential of the development of resistance is estimated to be low. "We hope that cyclohexylgriselimycin will become an agent that can even be used against resistant tuberculosis pathogens in the future and contributes to a more successful fight against this dreadful disease," says Müller. “There is an urgent need for new medicines to fight drug-resistant microbes,” says Gary Nabel, Sanofi’s Chief Scientific Officer. “This elegant study identifies a potential new therapy for tuberculosis and defines its mechanism of action, importantly targeting a genetic synthesis and repair pathway that supports the development of drug resistance. We are pleased to work with our valued academic partners in Germany and the US to harness the collective expertise of academia and industry for the benefit of patients.” Angela Kling, Peer Lukat, Deepak V. Almeida, Armin Bauer, Evelyne Fontaine, Sylvie Sordello, Nestor Zaburannyi, Jennifer Herrmann, Silke C. Wenzel, Claudia König, Nicole C. Ammerman, María Belén Barrio, Kai Borchers, Florence Bordon-Pallier, Mark Brönstrup, Gilles Courtemanche, Martin Gerlitz, Michel Geslin, Peter Hammann, Dirk W. Heinz, Holger Hoffmann, Sylvie Klieber, Markus Kohlmann, Michael Kurz, Christine Lair, Hans Matter, Eric Nuermberger, Sandeep Tyagi, Laurent Fraisse, Jacques H. Grosset, Sophie Lagrange, Rolf Müller. Targeting DnaN for tuberculosis therapy using novel griselimycins. Science 5 June 2015: 348 (6239), 1106-1112. DOI: 10.1126/science.aaa4690.

<urn:uuid:9e251de9-bf6b-4828-84dd-af501019c0f9>

CC-MAIN-2016-50

https://www.helmholtz-hzi.de/en/news_events/news/view/article/complete/new_hope_in_the_fight_against_tuberculosis/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Werewolves aren’t the only thing the moon is supposed to affect (Image: Perry Mastrovito/Corbis) The movement of plant leaves may be partially governed by the gravitational pull of the moon, just like ocean tides. Some plants’ leaves rise and fall during the day-night cycle, mostly in reaction to light in their environment. But plants grown in the dark have similar cycles, which hints that something else – generally accepted to be a form of internal circadian clock – may be at work as well. To investigate further, Peter Barlow of the University of Bristol, UK, looked at data recorded from the 1920s onwards on the leaf movement of beans and other plants. He matched these with computer estimates of the gravitational influence of the moon at the time and location of these experiments. The two data sets don’t match exactly, says Barlow, but generally, when the lunar tide turns, so too do the leaf movements. “You’ve got a zero rate of change in gravity, and that seems to be the trigger for movement in the plant’s cells,” he says. “If you look at enough of these correlations, they all seem to be strong enough to make you believe they might be causal.” Barlow also looked at data from plants on the International Space Station, and found they followed a 90 minute cycle rather than a 24 hour one. Because the ISS orbits Earth every 90 minutes, its position relative to the moon is changing on a faster cycle, so this makes sense, he says. It’s not clear exactly how the moon could influence this change, but Barlow believes it has to do with the movement of water within the plant. Ocean tides are produced by a combination of the sun and moon’s gravity and Earth’s rotation, creating bulges of water on opposite sides of the planet. For plants, Barlow says water movement in the pulvinus, the “joint” where leaf meets stem, could be responsible. Planting by the moon Some gardening folklore suggests that planting crops according to the phases of the moon will give you a better harvest, but there is little scientific evidence to back this up. “It’s not really accepted in mainstream science,” says Barlow, who hopes his paper will encourage people to revisit the idea. Earlier this year, Catarina Rydin of Stockholm University in Sweden did discover a rare plant called Ephedra foeminea whose pollination is governed by the full moon. “Unfortunately, scientific work on lunisolar impact on biological systems has sometimes been almost ridiculed, and the field has probably been hampered by unjustified scepticism,” she says. “Therefore, well-conducted and interesting papers like this are very important.” There is still scepticism, of course. “We definitely cannot exclude that the gravitational effect of the moon and the sun could effect this water-driven movement,” says Christian Fankhauser of the University of Lausanne, Switzerland. But he adds that other forces like temperature would overpower this effect, and there is also genetic evidence for a circadian clock. “I am quite sceptical about the great importance of this phenomenon.” Journal reference: Annals of Botany DOI: 10.1093/aob/mcv096 More on these topics:

<urn:uuid:18155890-e8a8-4114-b774-e4573b3142a3>

CC-MAIN-2016-50

https://www.newscientist.com/article/dn28051-moons-gravity-could-govern-plant-movement-like-the-tides/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

What is a healthcare administrator? A healthcare administrator is a manager who has a healthcare administration degree and oversees all aspects of patient care, while also balancing the demands of compliance with various policies, laws, and regulations. A healthcare administrator works closely with a facility’s governing board and medical staff to address a variety of concerns and activities, including developing and instituting policies and procedures, managing budgets, and obtaining grants for medical research. There are two types of healthcare administrators, the generalist and the specialist. A generalist is responsible for managing an entire facility, while a specialist attends to day-to-day operations, such as budgeting, human resources, and marketing. Specific duties may vary with types of facilities, such as hospitals, medical group practices, and outpatient clinics to health maintenance organizations. What is the job outlook for healthcare administrators? According to the Bureau of Labor Statistics, “Managers in all settings will be needed to improve quality and efficiency of healthcare, while controlling costs, as insurance companies and Medicare demand higher levels of accountability. Managers also will be needed to oversee the computerization of patient records and to ensure their security as required by law. Additional demand for managers will stem from the need to recruit workers and increase employee retention, to comply with changing regulations, to implement new technology, and to help improve the health of their communities by emphasizing preventive care.” Is an online healthcare administration degree right for me? If you enjoy working in the healthcare industry and can handle the demands of managerial responsibilities, an online healthcare administration degree from South University might be the right choice for you.

<urn:uuid:6e76d969-9a76-4c0e-84e5-9feb15791db3>

CC-MAIN-2016-50

https://www.southuniversity.edu/whoweare/newsroom/blog/career-spotlight-healthcare-administrator

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Oceans cover two-thirds of the surface of our planet. The seas, which are vital to survival, have remained an enduring part of our human story. In June 2007 the Oceans team began a series of underwater scientific expeditions to build a global picture of our seas. Their search for answers took them on an voyage of discovery to the Arctic, Southern and Indian Oceans, the Atlantic, the Red Sea, the Sea of Cortez and the Mediterranean. Explorer Paul Rose led the team of intrepid adventurers, including environmentalist Philippe Cousteau (grandson of Captain Jacques-Yves Cousteau), maritime archaeologist Dr Lucy Blue and marine biologist and oceanographer Tooni Mahto. The team ventured into some of the planet's most challenging environments and with the help of scientists and dive teams, they descended beneath frozen Arctic ice-sheets, dived into mysterious black holes in the Bahamas and plunged into the dark water with the fearsome Humboldt squid. The results are shown in this eight part series on BBC Two, which seeks to provide a better understanding of the state of our oceans today, their role in the past, present and future and their significance in global terms. Paul Rose documents just a few of the scientific observations his team made in this BBC News feature. Oceans was filmed over one year, only allowing a few weeks for each film trip, a tight schedule in film terms. Changeable weather, unpredictable nature and strong sea currents presented daily challenges for the team, including a close encounter with a polar bear.

<urn:uuid:7cda28ed-2782-406f-9a35-bb6e880ce2d5>

CC-MAIN-2016-50

https://www.torrentdownloads.me/torrent/1202173/bbc+hd+oceans+plete+series+2008+720p+ac3+5+1+hdbrise

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

Featured The Life and Presidency of Herbert Hoover The 2016 White House Christmas ornament honors the administration of the thirty-first president of the United States Herbert Hoover, who served... By the summer of 1946, President Harry S. Truman needed a vacation. Catapulted into the presidency by the sudden death of Franklin D. Roosevelt in April 1945, the former vice president had presided over the end of World War II that spring and summer and the uneasy peace that followed. During that time, U.S. relations with the Soviet Union deteriorated as the Soviets sought to create a protective zone for themselves by absorbing the countries of Eastern Europe. At the same time, all Europe lay in ruins, its economies devastated, its people starving, and its institutions destroyed. Parts of Asia were equally desolate, particularly the cities of Hiroshima and Nagasaki, obliterated when the United States dropped the first atom bombs in August 1945. Other parts of Asia were in turmoil as British, French, and Dutch colonies agitated for independence. Meanwhile, in China the civil war between the Communist forces of Mao Zedong and the Nationalist troops of Chiang Kai-shek (Jiang Jie-shi) raged as Mao’s guerrillas advanced steadily against Chiang’s larger, better equipped army — a situation Truman described as “very, very bad.” Hovering over all these problems was the threat of nuclear war that seemed to many observers an increasingly likely possibility, especially after newspapers reported Soviet agents in Canada had been caught smuggling atomic secrets to the Soviet Union.1 At home, the United States had swiftly reverted to a peacetime economy while absorbing 10 million returning military personnel. Still, a series of strikes in the steel, coal, and railroad industries had angered the public, as did the 25 percent hike in prices that followed upon Truman’s ending price controls in June. Shortages of meat and housing further aggravated consumers, who blamed the president for their economic woes. Truman’s weak leadership — he was still adjusting to the demands of the presidency — aggravated these problems and fed Republicans’ hopes for winning Congress in the November election.2 Personal concerns also troubled Truman that summer. His mother Martha’s health was failing. “She’s on the way out,” Truman told his wife, Bess, then in Independence, Missouri, caring for her own mother. The president’s health, usually robust, was none too good. He suffered an ear infection as well as recurring stomach pains.3 Eager to put as much distance as possible between himself and his problems, the president initially considered a trip to Alaska. He settled instead for a cruise up the New England coast on the presidential motor yacht, the USS Williamsburg. Truman, a native of landlocked Missouri, loved the yacht though he was not the best of sailors, especially if the seas were choppy. Bill Campbell, a lieutenant on the Williamsburg, recalled that during one difficult voyage from Washington to Key West, Florida, the seasick president told him, “Young man, if you can stop this boat from rolling you can have my job.”4 Seasickness aside, Truman found cruising, particularly on the Potomac River and Chesapeake Bay, a quick, easy escape from the pressures of the presidency. Aboard the Williamsburg, he could work without interruption, entertain friends and members of his staff, or just relax. The yacht offered him “a quiet haven,” recalled one of his naval aides, Commander William M. Rigdon. “He felt free to stroll the deck, work at his desk, sit in the sun, swim, read, . . . do whatever he pleased, without . . . a host of people constantly hovering about him.”5 On this particular New England voyage Truman’s companions included his friend Ted Marks, best man at his 1919 wedding to Bess; presidential press secretary Charlie Ross; Clark M. Clifford, special counsel to the president; George E. Allen, director of the Reconstruction Finance Corporation; Major General Harry H. Vaughan, the president’s military aide; Captain James H. Foskett, Truman’s naval aide; Colonel Wallace H. Graham, the president’s personal physician; and six Secret Service agents. Matt Connelly, Truman’s appointments secretary, accompanied the party as far as Quonset Point, Rhode Island, as did Secretary of the Treasury John W. Snyder.6 Four wire service reporters, eleven print journalists, four radio journalists, three still photographers, and one newsreel pool representative followed about 500 yards behind in the USS Weiss. They kept abreast of Truman’s doings via a daily radio telephone briefing from Charlie Ross. Radio teletype installed aboard the Weiss enabled the reporters to file their stories.7 Truman and his companions embarked from the Washington Navy Yard on the afternoon of August 16 in drizzling rain after posing for photographs on the Williamsburg’s quarterdeck. The first two days of the cruise were uneventful. Truman napped, swam, read (The Life of Grover Cleveland and The Age of Jackson), watched movies, and generally relaxed. Ross told reporters the president “would make no public appearances . . . [or] speeches.” Truman would go ashore “several times,” but the reporters could not report any details until he returned to the yacht. The president also asked that naval ceremonial be kept to a minimum except in the case of the USS Missouri. If the Williamsburg encountered that ship, the Missouri had permission to render full honors to the commander in chief including a presidential gun salute.8 The Williamsburg reached the Naval Air Station at Quonset Point around 4:00 p.m. on Sunday, August 18. After greeting the naval dignitaries and meeting with the Secretary of the Navy James V. Forrestal, who was staying at his summer home in Newport, Rhode Island, Truman held a short press conference for the reporters traveling with him. He told them he was on a vacation cruise and politics had no place on his itinerary.9 He and his guests left in a five-car motorcade for a family “supper” prepared by Captain Foskett’s wife and held at the home of her mother. Truman driving his own car—a Mercury Cabriolet with the top down—led the way. After dining on ham and chicken pie—the president “does not like seafood,” Mrs. Foskett told the press—Truman and his party returned to the Williamsburg.10 The next morning Truman met briefly with Edward H. Foley, assistant secretary of the treasury, and then with U.S. Solicitor General J. Howard McGrath, who was running for the Senate from Rhode Island, and Rhode Island Governor (later Senator) John O. Pastore before leaving for the Naval War College in Newport. Despite poor weather—the New York Times described it as “a driving northeaster”—Truman and his party, which in addition to McGrath and Pastore included General Vaughan, Captain Foskett, and appointments secretary Matt Connelly, toured the college and spoke briefly and extemporaneously to 150 officers attending a War College seminar. He also “looked over” the General Line School at the adjacent Naval Training Station, where he greeted a group of reserve officers. After lunch, the party returned to the Williamsburg, where Truman spent the rest of the day.11 We are just moving around, heading in a general southerly direction with no fixed destination. It’s just a vacation and the President can frolic around in the Atlantic if he wants to. On Tuesday, continued bad weather caused the Williamsburg to change course abruptly. At least that’s what Ross told the traveling press corps. In reality, Truman felt besieged. “Callers, would-be callers, and invitations to come ashore for ceremonies or parties,” to say nothing of the “almost constant gun salutes and other honors,” threatened to turn his vacation into a extension of life in the White House. Truman was having none of it. “Everybody and his brother whom I didn’t want to see tried by every hook or crook to rope me into letting him come aboard or having me seen with him,” he wrote his mother on August 22. “So I just cancelled the trip.”12 Instead of sailing up the Atlantic Coast toward Eastport, Maine—his original destination—Truman told the captain to put out to sea. Reporters aboard the Weiss noticed the change almost immediately and began to speculate on the reasons for the switch. Since the weather report called for “clearing weather with sunshine” in New England, the traveling press corps speculated that Truman perhaps did not want to be too far from Washington in case a diplomatic crisis developed. They also considered the Truman’s tendency to seasickness a factor, although a heavy ground swell in the Atlantic that already caused the Williamsburg to pitch in “an uncomfortable manner” made that conjecture unlikely. Press secretary Ross refused to enlighten the reporters, saying that the Williamsburg was “on a journey into nowhere. We are just moving around, heading in a general southerly direction with no fixed destination. It’s just a vacation and the President can frolic around in the Atlantic if he wants to.”13 More probably, the delay occurred because the State Department and, possibly, the Secret Service and the U.S. Navy were making arrangements for a presidential trip to Bermuda that would be short on ceremony and long on relaxation.14 Five hours later, the diplomatic arrangements completed, Ross told the bewildered reporters that Truman and his party were heading for the island. “The boss decided last night to go into warm waters,” he said by way of explanation. He failed to say how long Truman would stay on the island or where he would go from there.15 In keeping with Truman’s desire for no “fuss or feathers,” the Williamsburg arrived without fanfare at the American naval base in Bermuda at 9:30 a.m. on Thursday, August 22. “This is what we’ve been looking for,” Ross told reporters, “and it’s here we’ll stay till further notice anyway.” He went on to quash reporters’ questions about possible high-level meetings on the island, saying that Truman’s visit was “absolutely without any political significance.” Admiral Sir Ralph Leatham, governor of Bermuda, underlined that point when he spoke to reporters after his formal 15-minute call on Truman. “He [Truman] has told me that he has come to Bermuda because he wants rest and quiet. He [told me] that he would appreciate anything that I could to do to assure that his wishes are respected.” Truman’s activities reinforced that message. After Leatham left the ship, the president and his guests went for a swim. Later in the afternoon Truman and his military and naval aides returned the governor’s call, riding to Government House in the governor’s ceremonial horse-drawn carriage. In Truman’s honor, Bermuda had declared a half holiday. U.S. and British flags decorated the buildings and streets of Hamilton, the capital, but except for a crowd of several hundred at Albouys Point, where Truman debarked, the streets were empty in deference to the president’s desire for privacy. After tea with the governor, Truman and his aides returned to the Williamsburg.16 The next day Truman’s vacation began in earnest with a fishing trip 5 miles off the southern tip of Bermuda. Despite his aversion to fishing (he considered it “a waste of time”) the New York Times reported that the president caught three fish, including the largest one of the day—a 6H pound salmon rockfish. Truman’s account of the expedition was more vivid. “Ted [Marks] caught a big brown fish and Captain Foskett caught four not so large as mine,” he wrote his daughter, Margaret. “The rest caught none.” He further reported, “Clifford almost fell overboard, Vaughan got seasick and Allen told me how good he is with fish but they didn’t take to him.”17 A rain squall cut short the fishing expedition and sent the Truman party back to the Williamsburg, where the president spoke with Secretary of State James F. Byrnes via radio phone from Paris, where Byrnes and other Allied representatives were negotiating peace treaties formally ending World War II with Italy, Romania, Hungary, Bulgaria, and Finland. Thereafter the ship’s log reports that the president and his party “whiled the evening away in their quarters”—perhaps an oblique reference to a poker game, one of Truman’s favorite forms of relaxation.18 On Saturday Truman toured Bermuda by car, stopping at the local Masonic Lodge, where he signed a Bible once signed by George Washington, and visiting other points of interest. The next day, Sunday, he walked to Holy Trinity Cathedral, where he attended services with the governor of Bermuda and heard the bishop of Bermuda pray for the success of the United Nations and for a way to be found to send homeless European Jews to Palestine. After the church service, Truman walked back to the Williamsburg accompanied by a small crowd who followed him back to his launch.19 The next week passed in a leisurely fashion. Truman and his party fished, swam, watched movies, and rested—and probably played more poker.20 After being rained out on a second fishing expedition, Truman and his guests tried again on Thursday, August 29. The group set out in two boats for a spot about 5 miles off the southern tip of Bermuda. Felix Belair Jr. of the New York Times captured the spirit of the outing. Truman, he said, had “agreed to defend his title of champion fisherman of the . . . Williamsburg in a catch-as-catch-can contest” against his friend Ted Marks, an experienced fisherman. Secretary of the Treasury John Snyder, who had flown in from Washington several days earlier, was also involved in the matchup, but “although the smoothest operators in naval intelligence were assigned the job none was able to learn on which side he would be fighting.” Since friendly wagers had been made on the combined catch of each boat, competition was keen. At the last minute Snyder threw in his lot with the president, as did his naval aide Captain Foskett and press secretary Ross. Together the Truman team was credited with forty fish weighing 75H pounds. The Marks team, which in addition to Ted Marks consisted of ace fishermen Allen and Vaughan plus novice Clark Clifford, using a special doughnut bait, came up short, with twenty fish weighing 61G pounds.21 According to the ship’s log, the losers attempted to “increase the weight of their catch by filling a fish with lead sinkers” (weights). However, when they were convinced they had lost, the log went on, “they gallantly acknowledged their perfidy.” Although Truman retained his title, he remarked that he “would never make a great fisherman. I haven’t got the infinite patience required.”22 Truman returned to the Williamsburg where he held a small reception for the governor of Bermuda. Members of the colony’s Parliament and other distinguished officials also attended, along with local citizens, the U.S. consul general in Bermuda, and senior members of the U.S. forces stationed there. According to the log, “the president and his party spent the evening on board in the guests’ quarters” — perhaps playing poker.23 The next day Truman left Bermuda. As he did, he received a farewell message from the island’s governor Sir Ralph Leatham. In his message, Leatham told Truman, “We have deemed it a great honor that you chose Bermuda for your holiday. . . . We shall always remember that you were the first President in office to visit our Colony and hope that you honor us again.” Truman thanked Leatham for his “kind message. Everyone enjoyed our visit to Bermuda and hope to come back. Please express my appreciation to the inhabitants of Bermuda for all their courtesy.” Truman also thanked the U.S. naval personnel stationed in Bermuda for their efforts. “To all hands a well earned ‘Well Done.’”24 Truman’s return voyage to Washington was largely uneventful. Bad weather and rough seas early in the voyage caused many aboard the Williamsburg to keep to their quarters and assume “a horizontal position.” Truman, writing to his mother and his sister Mary, provided a graphic account of his own distress. “I became seasick at the dinner table and rushed to my quarters and to bed. Stayed there most of yesterday. Ate no breakfast or lunch did manage a cup of tea and two sandwiches about eight o’clock last night. Saturday morning it was so rough that furniture, ink bottles, magazines, clothing and pillows got completely mixed up on my floor.”25 By the time the ship reached Hampton Roads, Virginia, on Sunday, September 1, however, the sun shone and so many pleasure craft had crowded around the Williamsburg that a picket boat from the Weiss had to guard the presidential yacht as it lay at anchor.26 Return to U.S. waters also meant the resumption of official business. Postmaster General Robert Hannegan, Reconversion Director John R. Steelman, and Presidential Secretary Bill Hassett came aboard the ship, as did a naval ensign who brought the White House mail.27 Despite the press of public business, a holiday mood prevailed once the Williamsburg headed into the Potomac River. Some of Truman’s guests attired in bathing suits engaged in a spirited game of volleyball using the ship’s last remaining medicine ball. (The other ball had been lost at sea during an earlier contest.) When the last ball also went over, the two sides pinchhit with rope rings or grommets used to secure equipment on board and continued to play. The ship’s log noted tactfully that the grommets “had been made up in quantity and were easily replaceable.”28 The atmosphere turned solemn, however, as the yacht passed Mount Vernon. The presidential party and the ship’s crew assembled on deck and paid traditional honors to George Washington.29 At that point, the Williamsburg and the Weiss were close enough to Washington that the captain of the Weiss asked permission to go ahead so that the reporters aboard could be at the pier when Truman and his party arrived. The press pool greeted the president as he debarked looking tan and rested. Truman’s sudden alteration to Bermuda had been a great success, and he had returned refreshed and ready to face the challenges of the presidency. There would be other seagoing voyages aboard the Williamsburg30 and other presidential vacations, but never again in his presidency would Truman change his travel plans so abruptly or chart a course for “a journey into nowhere.” The 2016 White House Christmas ornament honors the administration of the thirty-first president of the United States Herbert Hoover, who served... Biographies & Portraits Presidents have found different ways to escape the pressures and politics of the position. For early leaders, it was a... Biographies & Portraits The White House Historical Association and the Eleanor Roosevelt Papers Project present this collaboration in an effort to open a... No sport is more closely tied to the American presidency than baseball. One of Washington’s first baseball fields was lo... Every year since 1981, the White House Historical Association has had the privilege of designing the Official White House Christmas Ornament.... In this series of video clips, Historian Lawrence L. Knutson talks about presidential vacations and retreats. He offers anecdotes for... Prior to President and Mrs. Theodore Roosevelt’s visit to Panama in 1906, no American president had set foot outside the co... President Taft, a frequent theater goer, was seated in his box at the National Theatre with his aide Archibald Butt,... The People's House: Thomas Jefferson began the tradition of a public reception to celebrate the Fourth of July in 1801. The... The national parks preceded the National Park Service, but the first great natural park was a state park. California’s Yo...

<urn:uuid:43bcd7bf-e0a7-4cc8-a511-21a7b6525377>

CC-MAIN-2016-50

https://www.whitehousehistory.org/a-journey-into-nowhere

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541525.50/warc/CC-MAIN-20161202170901-00245-ip-10-31-129-80.ec2.internal.warc.gz

en

A new wind turbine by renewable energy firm McCamley UK in Staffordshire, England, may soon be changing the sound and shape of the urban landscape. The firm’s new flatpack wind turbine requires no supporting mast and can be retrofitted to any roof, making it a useful and reliable energy source in urban areas. The turbine incorporates composite materials to overcome issues like size and noise that have long made wind turbines in urban areas a bane instead of a boon. In the late 1980s Andrew McCamley, chief engineer of McCamley Ltd, met Tony Mewburn-Crook, when Mewburn-Crook was performing wind tunnel testing at a local university as part of his PhD on a unique wind turbine design. McCamley was fascinated by the quiet, reliable and efficient wind turbine and the two agreed to work together to make Mewburn-Crook’s concept a reality. Finally, in late 2009 McCamley began development of his first design using his own money, a proof of concept machine known as the Mk1. This machine had its first “flight” in 2010 and flew for a year. A second machine then followed using a different structural philosophy than the Mk1. “The initial design utilized composites for the main (vertical) blades and the rotor (horizontal) blades,” says Mc- Camley. However, there were further improvements needed to make the design work the way the team had imagined. “After the Mk1 first flew, I sat down with a blank piece of paper and completely redesigned the structure of the machine,” he says. “I was determined to create something that was beautiful to look at, structurally stable and aerodynamically clean. Our first machine struggled in all three categories.” The result was the Mk2. McCamley drew heavily from his aerospace design and structural load path knowledge to create the next generation flat-pack. The end result was a lightweight, stiff, multiple load path, curvaceous design. “I went back to some of Tony’s earlier work where the aerodynamic form was important and gave it performance advantages as well,” he explains. Unlike horizontal-axis turbines, which rely on steady wind speed, the flat-pack model is able to cope with turbulent and variable wind speeds often found in urban environments. In fact, its self-starting technology means it doesn’t require power from the grid to restart if wind speed drops below a certain level. And the absence of down-force from sweeping blades significantly decreases noise and ground vibrations making it less likely to impact wildlife.

<urn:uuid:f98a757e-7ff8-4d0d-9189-53e4d10270d0>

CC-MAIN-2016-50

http://compositesmanufacturingmagazine.com/2012/09/flat-pack-turbine-targets-urban-landscape/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

"Ghetto" Rovigo Things to Do Tip by Mikebond Rovigo Things to Do: 38 reviews and 117 photos These pictures show what remains after the demolition of the ghetto, been re-adapted to house flats. The ghetto was built in the heart of the town in 1606 following a wish of Pope Paul V. It was the largest construction in Rovigo at that time. It was (one of) the most characteristic ghetto(s) in Italia. It was a fortress including the synagogue, shops, houses, the market; it was like a mysterious town within the town, with small gardens, narrow streets and gates on the ancient marble gates that were once closed when the night came. Above the main gate, still standing, a stone with a Latin inscription, today illegible (see the second picture), reminds that the authorities of Rovigo wanted the Jews to be forced to live within these walls, so that the Christian religion couldn?t be damaged by their company. The inscription was written in 1627 by podestà Marino Zane. The ghetto was demolished in 1930. Today you can see the church of San Domenico, inserted in the area of the ghetto, maybe built on the same place as the synagogue. Address: Piazza Merlin / via X luglio More Reviews (20) - See All Recreational centre for aged artists - See All The best place for local food - See All Asilo "Principe di Napoli" Mikebond's Related Pages Have you been to Rovigo?Share Your Travels

<urn:uuid:76ef40bc-6f86-4f2d-a587-1f18008e90de>

CC-MAIN-2016-50

http://members.virtualtourist.com/m/p/m/16709c/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

Now, the first idea coming to our minds is related to aliens, but scientists tried to debunk this hypothesis in the lack of further evidence and instead, they chose a more ‘rational’ explanation: the collision between two neutron stars. However, the latest radio burst came as a game changer, as the waves appear to repeat, indicating that whatever is causing this is not being consumed in the impacting process, and it keeps sending these mysterious signals. According to Shami Chatterjee, senior researcher at Cornell, the FRB detected this year did not have an explosive origin. So, either there’s an odd coincidence, or maybe there are different types of FRBs. Either way, it seems we’ve broken this enigmatic phenomenon wide open, Chatterjee stated. These fast radio bursts, or FRBs, were considered an isolated phenomenon until recently, as researchers detected 17 others over the years since 2007, and they were all described as brief radio waves in the sky that only lasted for milliseconds. It became puzzling only last year, when ten blasts originating from the same spot were discovered by Paul Scholz from McGill University in Canada. After he closely investigated the data collected by the Arceibo radio telescope in Puerto Rico, he stumbled upon some peculiar patterns: six FRBs received within 10 minutes of each other, and other four that were more dissipated in time. All of them originated from the same location. I knew immediately that the discovery would be extremely important in the study of FRBs, Scholz said. Although astronomers know these radio signals are coming from distant places in the cosmos, they are having difficulties determining the exact location. The recent discovery of the continuous FRBs, published in Nature last week, was tracked to a galaxy 6 billion light years away from Earth, but the data wasn’t conclusive enough for scientists to determine the exact spot from where it emanated. Knowing that some of the FRBs detected so far repeat their blasting waves, scientists are now trying to shed light into this matter and find the exact emanating source, and are also classifying them into different categories. Cornell professor James Cordes believes that the event is not necessarily caused by a massive cosmic explosion, but neutron stars may still be the cause in his opinion. We’re detecting these FRBs from very far away, which means that they are intrinsically very bright. Only a few astrophysical sources can produce bursts like this, and we think they are most likely neutron stars in other galaxies, Cordes stated. On the other hand, Laura Spitler, a researcher from the Max Planck Institute for radio Astronomy in Germany appeared more enthusiastic of the recent discovery. Not only did these bursts repeat, but their brightness and spectra also differ from those of other FRBs, she said. Although scientists won’t directly admit to an alien-source hypothesis, it’s likely that this new type of FRB is generated by a source other than what scientists have speculated so far. The possibility of a spinning young neutron star or even two stars colliding seem a bit far off, considering that only a few weeks ago, the scientific community was about to conclude about the FRBs once and for all, but now they have a brand new type of FRB signal. If this arrived as a coincidence or rather as a sign, we are yet to find out, but bear in mind that everything happens for a reason.

<urn:uuid:4d5f1643-5520-42a6-8395-b38d15bb6cf8>

CC-MAIN-2016-50

http://mysteriousearth.net/2016/11/19/aliens-are-calling-from-outer-space-scientific-community-still-in-denial/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

Lab-grown eye tissue restores rabbits' vision In what marks important progress toward a future where defective vision could be treated with lab-grown eyeball components, an international team of scientists has used human stem cells to build layers of eye tissue that was then implanted into rabbits to restore vision. With promising early results, the researchers say their findings could usher in trials where such transplantations are put to the test in humans. Stem cells have shown exciting potential in improving the vision of patients with degenerative eye disorders for years. In 2010, scientists reported the creation of the first early-stage retina engineered with human embryonic stem cells. Then in 2012, two legally blind patients experienced improvements to their vision after receiving transplants of retinal cells, also derived from human embryonic stem cells. But what sets this latest achievement apart is that scientists from Osaka and Cardiff University's were able to use human stem cells to reproduce something closer to the complex nature of the entire eyeball. Using induced pluripotent stem cells, or cells derived directly from adult cells, they were able to cultivate multiple cell lineages of the eye, including the lens, cornea and conjunctiva. Transplanting the tissues into rabbits with induced corneal blindness saw the front of the eye repaired and vision restored. The team says that this success could lead to clinical trials of similar transplants to repair damaged vision in humans. "This research shows that various types of human stem cells are able to take on the characteristics of the cornea, lens and retina," says Professor Andrew Quantock, co-author of the study. "Our work not only holds potential for developing cells for treatment of other areas of the eye, but could set the stage for future human clinical trials of anterior eye transplantation to restore visual function." The research was published in the journal Nature. Source: University of Cardiff

<urn:uuid:324e6323-b04a-44bd-bb57-6ceed6f9aae6>

CC-MAIN-2016-50

http://newatlas.com/stem-cells-eyeballs-rabbits/42239/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

In this digital photography and Photoshop tutorial, you will learn how to capture a photo using grids and gels on flashes to get the proper lighting. We will then go into the Adobe Photoshop software program and create the glowing lines and smokey cloud in front of the luminous face. Push the play button on the video player below to start watching the tutorial - I recommend watching it in Full Screen so you can see the text when I am in Adobe Photoshop. If you can't see the video player below, you can watch it directly on YouTube (opens in new tab/window). This is the newest image I've made with abstract glowing lines. This was the first image I created that made use of geometric abstract glowing lines. This image was made after the first one; my friend (the model) got the idea to make the original concept above more three-dimensional by taking the shot at an angle. We spent hours in Photoshop making the lines, perfecting the skin, removing harsh shadows, dodging and burning, and making the colors vivid. There is a before-and-after image here. This one wasn't made with the pen tool to create lines, but instead the rectangular marquee tool was used to create two rectangles filled with white on two separate layers, then I deleted portions of the two rectangles and added a glow to match that of its environment (it was a really foggy morning). The original lighting source in the scene was deleted using layer masks.

<urn:uuid:2ae58a1c-5fd6-491a-883b-0867319dcf60>

CC-MAIN-2016-50

http://photoextremist.com/glowing-lines-photoshop-tutorial

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

A brief MIT Technology news item mentions a solution to the problem of making nanoscale machines that can swim in a fluid. The problem is that at the scale of nanotechnology, the effects of turbulence in water disappear, and any type of swimming robot that relies on traditional reciprocal motion can't move. Iranian researchers Ali Najafi and Ramin Golestanian, have come up with a novel method of propeling nano-sized robots in a fluid. The tiny robots consist of three rigid spheres linked by rods. A non-reciprocal, four-step periodic motion of the spheres moves the nanobot through the fluid. A more detailed explanation of the process can be found in a recent Physical Review Focus article and an animation of the motion is also available. At present only simulations have been done but it should be possible to build practical, molecule-sized swimming robots using this technique within a decade.

<urn:uuid:7bbe18f4-0281-4418-a3fc-ef29e21c7962>

CC-MAIN-2016-50

http://robots.net/article/1259.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

Il Duce Benito Mussolini Using a massive invasion force of eight divisions, well over 200,000 men with full compliments of artillery, armor, and the warplanes of the Regia Aeronautica, which were launched from the Italians made an unexpected move towards war against the greater strategic aims of the Axis powers in October 1940. Most certainly Mussolini and his upper-echelon military generals realized that they must act alone in large scale military operation without the aid of Nazi Germany, so that their Axis allies and the enemies of Italy took them as a serious threat in the coming conflict to come. Below: Regio Esercito, the Italian Royal army, on the march from Albania to Greece October 1940 Albania had been a protectorate kingdom under Italian control 1917-1920, and then again from 1939-1943, following the short decisive invasion and military victory over King Zog I’s (b.1895-1961) royalist forces in April of 1939. Even earlier belligerence worried many of its neighbors including the Greeks, led by their Prime Minister and authoritarian leader Ioannis Metaxas (b.1871-1941). Soviet period political cartoon showing the belligerence of fascist Italy against Albania Even though the Italians had many occupying troops in Albania it was hard to mobilize and deploy all of these forces to both attack Greece and defend the conquered Albanian territory from partisan attacks, all of which tied down much needed manpower and resources. Sporadic but at times intense and bloody skirmishing was common early on, with mountain fighting tactics being deployed by both sides during the conflict. Tactics first deployed during the long bloody campaigns fought between the Italians and Austro-Hungarian/German armies in the Alps, north Italy & southern Austria, 1915-1918 during the Great War. The most significant and bloody battle for the Italian mountain division, 3rd Alpine Division Julia, during this early period being the Battle of Pindus, October-November 1940. 3rd Alpine Division Julia marching through the Balkans to Greece For his greater strategic failures in December, General Pietro Badoglio (b.1871-1956) was fired and replaced by General Ugo Cavallero as commander of forces in the Greek-Albanian theater of operations. Cavallero mounted a better defense in the cold winter months of December-February though he was still no closer to winning a decisive victory over the Greeks. It was clear to the Italians and the rest of the world that without German intervention the war would be lost, or at best become an even longer and costlier stalemate for Mussolini’s Italy who had already overextended itself. One of the final battles between purely the Greeks and the Italians began after the launching of Operation Primavera in March 1941, an operation watched from Albania by Mussolini and the high command very closely because a victory was greatly needed before the British and Germans invaded Greece to turn the campaign in either direction. The battle came to be known as the Battle of Hill 731, for the heroic defense of the Greek positions by the rifleman and machine gunners of the 1st division who inflicted heavy casualties on the Italian attackers, many of whom were experienced assault, ‘arditi’ squads or elite fanatical black shirts divisions. Greek army soldier, fully equipped for battle 1940-1941 Towards the end of the seventeen day battle the Italians captured a portion of the hill before a spirited bayonet charge cut through the attackers yet again, of the 300 Italians who had recently captured half of Hill 731, only four would survive the counter attack. [For more please visit Stavros' blog, My Greek Odyssey] Greeks on the attack The Italo-Greco of 1940-1941 came to end after both the Italians and the Germans intervened in and ultimately after the Germans invaded Albania and Greece, helping to crush organized resistance of and in defense of the . Metaxas had died in January of 1941 and an independent Kingdom of Greece Greece would be crushed until the Allies after in the Invasion of Sicily 1943. Allied & Axis campaigns in the Balkans and Italian War with the 1939-April invasion quickly defeats King Zog I's (b.1895-1961) Royalist army. He abdicates in favor of direct Italian control over Albanian interests as protectorate. Low intensity resistance continued but was insignificant. Albanian Kingdom Siege of Malta-Germans and Italians battle the United Kingdom and its allies for control of Malta, south of Sicily. United Kingdom successfully defends fortress Malta. Greco-Italian War 1940- April 1941-Fought between the Greeks and the Italian military stationed in occupied Albania on the border between both countries. Combat casualties exceeding 150,000 men and vehicles by the time a treaty is signed in April of 1941 following German intervention and withdrawal of the British. Battle for Greece, Operation Marita April 1941-Britain and her allies invade southern Greece hoping to push out the Axis invaders and give a boost to the faltering Greek army lacking in military capabilities and political leadership. Ends in a complete Allied failure, Axis armies occupy most of Greece save for Crete and some other smaller islands. April 1941-German and Italian invasion of Yugoslavia to put pressure on the country to join the growing list of Axis aligned client states in 1940-1942. Quick and brutal victory but a costly occupation splits Yugoslavia into Russian and Italo-German zones where partisan activity is fierce throughout the war. Continued Soviet, Allied, & non-aligned Partisan campaigns fought throughout Albania, Greece, Yugoslavia, and other occupied territories from 1939-1945.

<urn:uuid:2e6f8d3a-67f5-4f88-8b56-c7ee924f2f69>

CC-MAIN-2016-50

http://warfarehistorian.blogspot.fr/2012/10/today-in-history-italy-declares-war-on.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

When is "Create A Great Funeral Day"? October 30 is Create A Great Funeral Day. What is this Holiday for? To remind people of all the many benefits of planning your own end-of-life event. Origin of this holiday Stephanie West Allen Shares Passion for Funeral Planning. She registered it as an official holiday nearly a decade ago to remind people of all the many benefits of planning your own end-of-life event." What a weird holiday!! As you know most holidays are uplifting, exciting and fun. We have to say that this holiday is the first we've ever ran across that was a bit on the depressing and weird side of what we normally know as a holiday. Not everyone welcomes the idea of planning your own funeral. What type of holiday is this? How can I Celebrate this holiday? - Blog with us about it! - We have a blog called "Everyday is a Holiday" so visit our pages and talk with us about the holidays. - Send Free E-Greeting! - If your ready to get together with your friends don't forget to invite them with these fun Internet Invitations. Definition of a funeral A funeral is a ceremony marking a person's death. Funerary customs comprise the complex of beliefs and practices used by a culture to remember the dead, from the funeral itself, to various monuments, prayers, and rituals undertaken in their honor. These customs vary widely between cultures, and between religious affiliations within cultures. In some cultures the dead are venerated; this is commonly called ancestor worship. The word funeral comes from the Latin funus, which had a variety of meanings, including the corpse and the funerary rites themselves. Funeral rites are as old as the human culture itself, predating modern homo sapiens, to at least 300,000 years ago. For example, in the Shanidar cave in Iraq, in Pontnewydd Cave in Wales and other sites across Europe and the Near East, Neanderthal skeletons have been discovered with a characteristic layer of pollen, which suggests that Neanderthals buried the dead with gifts of flowers. This has been interpreted as suggesting that Neanderthals believed in an afterlife. For more information about funeral around the world visit: A Funeral Home in North Syracuse, New York was the first funeral home to offer and broadcast a visitation and funeral "live" on the Internet. A Funeral Director at the Home said "It's not new technology, just a new application." The use of a web-camera allows relatives who could not otherwise attend services to do so from any computer. Family members and friends separated by distance, weather or circumstance can now become part of the support network by being connected electronically to the ceremonies. Other October 30 holidays around the world October 30 is the 303rd day of the year (304th in leap years) in the Gregorian calendar. There are 62 days remaining until the end of the year. - Calendar of Saints - October 30th is the feast day of the following Roman Catholic Saints: Alonso Rodríguez, St. Artemas, St. Herbert, St. Marcellus the Centurion, St. Saturninus, St. Serapion- - International Orthopaedic Nurses Day. - Day of Remembrance of the Victims of Political Repressions in post-Soviet states

<urn:uuid:c5ce2ccd-8e12-4a69-b1cb-5d5e82bdb029>

CC-MAIN-2016-50

http://www.gone-ta-pott.com/create_a_great_funeral_day.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

For beginner and intermediate students of Japanese, encountering a kanji such as 鬱 (utsu, depression) in the wild can be a somewhat traumatic event that, appropriately, induces a deep, introspective depression regarding their language ability. Let’s pull out our electron microscopes and examine that sucker up close: It’s got an upstairs, a downstairs and what appears to be a safety deposit box holding some secret treasure. It has a kakusū (画数, stroke count) of 29 and takes half an hour to write. How the hell would you even determine the bushu (部首, radical) in order to look up the meaning in a kanji dictionary? It looks like it has 10 bushu. Kanji such as 鬱 generally cause students to either think that they’ve made a terrible decision to study this language or that kanji themselves should be abolished and replaced with kana (仮名, syllabary characters) or rōmaji (ローマ字, Latin alphabet letters). They’re mistaken. Kanji may be intricate and complicated and take a significant investment of time to use correctly, but they are an essential part of the Japanese writing system. One that actually makes it easier to read the language. Take, for example, this sentence: まいにちどらやきをさんこたべる. Without any kanji, a reader must look at each individual hiragana (平仮名) character and, after processing the pronunciation, parse out the words that make up the sentence. While this may not seem like much to ask, try looking at the same sentence written with katakana (片仮名) characters: マイニチドラヤキヲサンコタベル. That’s enough to induce a migraine in some newbies who may believe katakana are inherently more difficult. What that tells us, though, is that language is all about familiarity. A written language that only uses hiragana might seem easier at first, but this is because beginners have more exposure to hiragana. Rōmaji requires even less work because they use familiar Latin characters and the spacing helps sort out the words: Mainichi dorayaki wo sanko taberu. But it will be hit or miss. You either know the meanings of the words or you don’t. In other words — and this is key — not knowing the rōmaji is the same as not knowing the kanji. You have to anki (暗記, memorize) something, it’s just a matter of what. It should be clear that writing the sentence with both kanji and kana produces a more readable result: 毎日どら焼きを三個食べる (I eat three dorayaki every day). Even if you’re unfamiliar with the kanji, you can at least discern the pieces involved because most kanji compounds come in sets of two or four. For example, 毎日 (mainichi, every day) is a timing adverb set at the beginning of the sentence. Also, it’s easy to tell where どら焼き (dorayaki, red bean pancake) ends because it’s followed immediately by を, a grammatical particle that marks the direct object of the sentence. Beware: を is pronounced identically to お (o) but gets written “wo” in the world of rōmaji. 三個 (sanko, three items) specifies the number of dorayaki that will presumably be taken care of by the verb at the end of the sentence — ah, there it is: 食べる (taberu, to eat). The first benefit of kanji is that they are so drastically different from kana, they stand out within a sentence, even against each other. Kanji rarely exist in a vacuum, and because readers are familiar with them as compounds (rather than just individual units) and with how kanji become verbs, using kanji helps readers parse the words in a language written without spaces. With kanji there is also a chance that you can extract the meaning visually. For example, you might not know the exact meaning of 軽食 (keishoku), but it’s clear that it involves eating or food because of the second kanji. The first kanji you may recognize from 軽い (karui, light), so it’s simple enough to understand that this compound literally means “light food/meal,” or a snack. The word 早食い might confuse you because 食 isn’t pronounced shoku (しょく) or taberu (たべる), but you can determine the meaning rather quickly from the kanji alone. 早 you may recognize from 早い (hayai, fast) and it’s modifying our lovely kanji 食, which we already know means “eat,” so it must be an adverb-verb relationship: eating quickly or speed eating. 食う can be pronounced kū (くう), which in this case becomes gū, so 早食い, is pronounced hayagui. And finally, kanji make reading more efficient. Our kanji-kana sentence above was only 12 characters as opposed to 15 in the kana-only version. This may sound insignificant, but it’s 20 percent more efficient! The way kanji create verbs is also efficient. This doesn’t save much space with verbs such as 食べる and 飲む (nomu, to drink) where the kanji only takes the place of one kana. Nevertheless, it efficiently communicates the meaning visually and lets the reader focus on how the verb is inflected: Is it past tense 食べた (tabeta, ate) or did someone overeat with 食べ過ぎる (tabesugiru, eat too much)? And there are some verbs that replace several kana, the longest of which is 承る (undertake/take). Hidden within that single kanji are five syllables: うけたまわる (uketamawaru). You might recognize the 承 character from menus: Yoyaku wo uketamawarimasu (予約を承ります, We take reservations). Look at all the space the kanji saves compared to the rōmaji! So the next time someone says they wish that there were more furigana (振り仮名, kana superscript pronunciation guides) or that kanji didn’t exist, tell them that they must help protect the kanji. In the end, you too can gain access to this efficiency with many hours of study and by having soft eyes, as Detective Bunk Moreland recommends in the HBO TV series “The Wire,” as a method for examining crime scenes: “You got soft eyes, you can see the whole thing. You got hard eyes, you staring at the same tree, missing the forest.” Soft eyes let you read compounds and pieces of the sentence together rather than seeing them as individual kanji, kana or rōmaji, and given enough time, even the individual strokes of 鬱 will turn into a familiar forest.

<urn:uuid:b6ca71fe-8fc5-401a-ac98-4181d6a67bf8>

CC-MAIN-2016-50

http://www.japantimes.co.jp/life/2014/08/18/language/complicated-characters-let-us-now-praise-difficult-kanji/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

On a daily basis, cells are subjected to a variety of endogenous and environmental insults. To combat these insults, cells have evolved DNA damage checkpoint signaling as a surveillance mechanism to sense DNA damage and direct cellular responses to DNA damage. There are several groups of proteins called sensors, transducers and effectors involved in DNA damage checkpoint signaling (Figure 1). In this complex signaling pathway, ATR (ATM and Rad3-related) is one of the major kinases that can respond to DNA damage and replication stress. Activated ATR can phosphorylate its downstream substrates such as Chk1 (Checkpoint kinase 1). Consequently, phosphorylated and activated Chk1 leads to many downstream effects in the DNA damage checkpoint including cell cycle arrest, transcription activation, DNA damage repair, and apoptosis or senescence (Figure 1). When DNA is damaged, failing to activate the DNA damage checkpoint results in unrepaired damage and, subsequently, genomic instability. The study of the DNA damage checkpoint will elucidate how cells maintain genomic integrity and provide a better understanding of how human diseases, such as cancer, develop. Xenopus laevis egg extracts are emerging as a powerful cell-free extract model system in DNA damage checkpoint research. Low-speed extract (LSE) was initially described by the Masui group1. The addition of demembranated sperm chromatin to LSE results in nuclei formation where DNA is replicated in a semiconservative fashion once per cell cycle. The ATR/Chk1-mediated checkpoint signaling pathway is triggered by DNA damage or replication stress 2. Two methods are currently used to induce the DNA damage checkpoint: DNA damaging approaches and DNA damage-mimicking structures 3. DNA damage can be induced by ultraviolet (UV) irradiation, γ-irradiation, methyl methanesulfonate (MMS), mitomycin C (MMC), 4-nitroquinoline-1-oxide (4-NQO), or aphidicolin3, 4. MMS is an alkylating agent that inhibits DNA replication and activates the ATR/Chk1-mediated DNA damage checkpoint 4-7. UV irradiation also triggers the ATR/Chk1-dependent DNA damage checkpoint 8. The DNA damage-mimicking structure AT70 is an annealed complex of two oligonucleotides poly-(dA)70 and poly-(dT)70. The AT70 system was developed in Bill Dunphy's laboratory and is widely used to induce ATR/Chk1 checkpoint signaling 9-12. Here, we describe protocols (1) to prepare cell-free egg extracts (LSE), (2) to treat Xenopus sperm chromatin with two different DNA damaging approaches (MMS and UV), (3) to prepare the DNA damage-mimicking structure AT70, and (4) to trigger the ATR/Chk1-mediated DNA damage checkpoint in LSE with damaged sperm chromatin or a DNA damage-mimicking structure. 24 Related JoVE Articles! Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides Institutions: Georgia Institute of Technology. Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo , functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae /. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells. Cellular Biology, Issue 45, RNA-containing oligonucleotides, ribonucleotides, RNA/DNA hybrids, yeast, transformation, gene targeting, genome instability, DNA repair A Manual Small Molecule Screen Approaching High-throughput Using Zebrafish Embryos Institutions: University of Notre Dame. Zebrafish have become a widely used model organism to investigate the mechanisms that underlie developmental biology and to study human disease pathology due to their considerable degree of genetic conservation with humans. Chemical genetics entails testing the effect that small molecules have on a biological process and is becoming a popular translational research method to identify therapeutic compounds. Zebrafish are specifically appealing to use for chemical genetics because of their ability to produce large clutches of transparent embryos, which are externally fertilized. Furthermore, zebrafish embryos can be easily drug treated by the simple addition of a compound to the embryo media. Using whole-mount in situ hybridization (WISH), mRNA expression can be clearly visualized within zebrafish embryos. Together, using chemical genetics and WISH, the zebrafish becomes a potent whole organism context in which to determine the cellular and physiological effects of small molecules. Innovative advances have been made in technologies that utilize machine-based screening procedures, however for many labs such options are not accessible or remain cost-prohibitive. The protocol described here explains how to execute a manual high-throughput chemical genetic screen that requires basic resources and can be accomplished by a single individual or small team in an efficient period of time. Thus, this protocol provides a feasible strategy that can be implemented by research groups to perform chemical genetics in zebrafish, which can be useful for gaining fundamental insights into developmental processes, disease mechanisms, and to identify novel compounds and signaling pathways that have medically relevant applications. Developmental Biology, Issue 93, zebrafish, chemical genetics, chemical screen, in vivo small molecule screen, drug discovery, whole mount in situ hybridization (WISH), high-throughput screening (HTS), high-content screening (HCS) A New Approach for the Comparative Analysis of Multiprotein Complexes Based on 15N Metabolic Labeling and Quantitative Mass Spectrometry Institutions: University of Münster, Carnegie Institution for Science. The introduced protocol provides a tool for the analysis of multiprotein complexes in the thylakoid membrane, by revealing insights into complex composition under different conditions. In this protocol the approach is demonstrated by comparing the composition of the protein complex responsible for cyclic electron flow (CEF) in Chlamydomonas reinhardtii , isolated from genetically different strains. The procedure comprises the isolation of thylakoid membranes, followed by their separation into multiprotein complexes by sucrose density gradient centrifugation, SDS-PAGE, immunodetection and comparative, quantitative mass spectrometry (MS) based on differential metabolic labeling (14 N) of the analyzed strains. Detergent solubilized thylakoid membranes are loaded on sucrose density gradients at equal chlorophyll concentration. After ultracentrifugation, the gradients are separated into fractions, which are analyzed by mass-spectrometry based on equal volume. This approach allows the investigation of the composition within the gradient fractions and moreover to analyze the migration behavior of different proteins, especially focusing on ANR1, CAS, and PGRL1. Furthermore, this method is demonstrated by confirming the results with immunoblotting and additionally by supporting the findings from previous studies (the identification and PSI-dependent migration of proteins that were previously described to be part of the CEF-supercomplex such as PGRL1, FNR, and cyt f ). Notably, this approach is applicable to address a broad range of questions for which this protocol can be adopted and e.g. used for comparative analyses of multiprotein complex composition isolated from distinct environmental conditions. Microbiology, Issue 85, Sucrose density gradients, Chlamydomonas, multiprotein complexes, 15N metabolic labeling, thylakoids Assessing Cell Cycle Progression of Neural Stem and Progenitor Cells in the Mouse Developing Brain after Genotoxic Stress Institutions: CEA DSV iRCM SCSR, INSERM, U967, Université Paris Diderot, Sorbonne Paris Cité, Université Paris Sud, UMR 967. Neurons of the cerebral cortex are generated during brain development from different types of neural stem and progenitor cells (NSPC), which form a pseudostratified epithelium lining the lateral ventricles of the embryonic brain. Genotoxic stresses, such as ionizing radiation, have highly deleterious effects on the developing brain related to the high sensitivity of NSPC. Elucidation of the cellular and molecular mechanisms involved depends on the characterization of the DNA damage response of these particular types of cells, which requires an accurate method to determine NSPC progression through the cell cycle in the damaged tissue. Here is shown a method based on successive intraperitoneal injections of EdU and BrdU in pregnant mice and further detection of these two thymidine analogues in coronal sections of the embryonic brain. EdU and BrdU are both incorporated in DNA of replicating cells during S phase and are detected by two different techniques (azide or a specific antibody, respectively), which facilitate their simultaneous detection. EdU and BrdU staining are then determined for each NSPC nucleus in function of its distance from the ventricular margin in a standard region of the dorsal telencephalon. Thus this dual labeling technique allows distinguishing cells that progressed through the cell cycle from those that have activated a cell cycle checkpoint leading to cell cycle arrest in response to DNA damage. An example of experiment is presented, in which EdU was injected before irradiation and BrdU immediately after and analyzes performed within the 4 hr following irradiation. This protocol provides an accurate analysis of the acute DNA damage response of NSPC in function of the phase of the cell cycle at which they have been irradiated. This method is easily transposable to many other systems in order to determine the impact of a particular treatment on cell cycle progression in living tissues. Neuroscience, Issue 87, EdU, BrdU, in utero irradiation, neural stem and progenitor cells, cell cycle, embryonic cortex, immunostaining, cell cycle checkpoints, apoptosis, genotoxic stress, embronic mouse brain Lignin Down-regulation of Zea mays via dsRNAi and Klason Lignin Analysis Institutions: University of Arizona, Michigan State University, The Institute for Advanced Learning and Research, Michigan State University. To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is needed to open up the structure of the plant cell wall, increasing the accessibility of the cell wall carbohydrates. Lignin, a polyphenolic material present in many cell wall types, is known to be a significant hindrance to enzyme access. Reduction in lignin content to a level that does not interfere with the structural integrity and defense system of the plant might be a valuable step to reduce the costs of bioethanol production. In this study, we have genetically down-regulated one of the lignin biosynthesis-related genes, cinnamoyl-CoA reductase (ZmCCR1 ) via a double stranded RNA interference technique. The ZmCCR1_RNAi construct was integrated into the maize genome using the particle bombardment method. Transgenic maize plants grew normally as compared to the wild-type control plants without interfering with biomass growth or defense mechanisms, with the exception of displaying of brown-coloration in transgenic plants leaf mid-ribs, husks, and stems. The microscopic analyses, in conjunction with the histological assay, revealed that the leaf sclerenchyma fibers were thinned but the structure and size of other major vascular system components was not altered. The lignin content in the transgenic maize was reduced by 7-8.7%, the crystalline cellulose content was increased in response to lignin reduction, and hemicelluloses remained unchanged. The analyses may indicate that carbon flow might have been shifted from lignin biosynthesis to cellulose biosynthesis. This article delineates the procedures used to down-regulate the lignin content in maize via RNAi technology, and the cell wall compositional analyses used to verify the effect of the modifications on the cell wall structure. Bioengineering, Issue 89, Zea mays, cinnamoyl-CoA reductase (CCR), dsRNAi, Klason lignin measurement, cell wall carbohydrate analysis, gas chromatography (GC) Investigating Protein-protein Interactions in Live Cells Using Bioluminescence Resonance Energy Transfer Institutions: Max Planck Institute for Psycholinguistics, Donders Institute for Brain, Cognition and Behaviour. Assays based on Bioluminescence Resonance Energy Transfer (BRET) provide a sensitive and reliable means to monitor protein-protein interactions in live cells. BRET is the non-radiative transfer of energy from a 'donor' luciferase enzyme to an 'acceptor' fluorescent protein. In the most common configuration of this assay, the donor is Renilla reniformis luciferase and the acceptor is Yellow Fluorescent Protein (YFP). Because the efficiency of energy transfer is strongly distance-dependent, observation of the BRET phenomenon requires that the donor and acceptor be in close proximity. To test for an interaction between two proteins of interest in cultured mammalian cells, one protein is expressed as a fusion with luciferase and the second as a fusion with YFP. An interaction between the two proteins of interest may bring the donor and acceptor sufficiently close for energy transfer to occur. Compared to other techniques for investigating protein-protein interactions, the BRET assay is sensitive, requires little hands-on time and few reagents, and is able to detect interactions which are weak, transient, or dependent on the biochemical environment found within a live cell. It is therefore an ideal approach for confirming putative interactions suggested by yeast two-hybrid or mass spectrometry proteomics studies, and in addition it is well-suited for mapping interacting regions, assessing the effect of post-translational modifications on protein-protein interactions, and evaluating the impact of mutations identified in patient DNA. Cellular Biology, Issue 87, Protein-protein interactions, Bioluminescence Resonance Energy Transfer, Live cell, Transfection, Luciferase, Yellow Fluorescent Protein, Mutations A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses Institutions: Emory University, Emory University. The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro . Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline. Infectious Diseases, Issue 90, HIV-1, Gag, viral replication, replication capacity, viral fitness, MJ4, CEM, GXR25 Discovering Protein Interactions and Characterizing Protein Function Using HaloTag Technology Institutions: Promega Corporation, MS Bioworks LLC. Research in proteomics has exploded in recent years with advances in mass spectrometry capabilities that have led to the characterization of numerous proteomes, including those from viruses, bacteria, and yeast. In comparison, analysis of the human proteome lags behind, partially due to the sheer number of proteins which must be studied, but also the complexity of networks and interactions these present. To specifically address the challenges of understanding the human proteome, we have developed HaloTag technology for protein isolation, particularly strong for isolation of multiprotein complexes and allowing more efficient capture of weak or transient interactions and/or proteins in low abundance. HaloTag is a genetically encoded protein fusion tag, designed for covalent, specific, and rapid immobilization or labelling of proteins with various ligands. Leveraging these properties, numerous applications for mammalian cells were developed to characterize protein function and here we present methodologies including: protein pull-downs used for discovery of novel interactions or functional assays, and cellular localization. We find significant advantages in the speed, specificity, and covalent capture of fusion proteins to surfaces for proteomic analysis as compared to other traditional non-covalent approaches. We demonstrate these and the broad utility of the technology using two important epigenetic proteins as examples, the human bromodomain protein BRD4, and histone deacetylase HDAC1. These examples demonstrate the power of this technology in enabling the discovery of novel interactions and characterizing cellular localization in eukaryotes, which will together further understanding of human functional proteomics. Cellular Biology, Issue 89, proteomics, HaloTag, protein interactions, mass spectrometry, bromodomain proteins, BRD4, histone deacetylase (HDAC), HDAC cellular assays, and confocal imaging High-throughput Analysis of Mammalian Olfactory Receptors: Measurement of Receptor Activation via Luciferase Activity Institutions: Monell Chemical Senses Center. Odorants create unique and overlapping patterns of olfactory receptor activation, allowing a family of approximately 1,000 murine and 400 human receptors to recognize thousands of odorants. Odorant ligands have been published for fewer than 6% of human receptors1-11 . This lack of data is due in part to difficulties functionally expressing these receptors in heterologous systems. Here, we describe a method for expressing the majority of the olfactory receptor family in Hana3A cells, followed by high-throughput assessment of olfactory receptor activation using a luciferase reporter assay. This assay can be used to (1) screen panels of odorants against panels of olfactory receptors; (2) confirm odorant/receptor interaction via dose response curves; and (3) compare receptor activation levels among receptor variants. In our sample data, 328 olfactory receptors were screened against 26 odorants. Odorant/receptor pairs with varying response scores were selected and tested in dose response. These data indicate that a screen is an effective method to enrich for odorant/receptor pairs that will pass a dose response experiment, i.e. receptors that have a bona fide response to an odorant. Therefore, this high-throughput luciferase assay is an effective method to characterize olfactory receptors—an essential step toward a model of odor coding in the mammalian olfactory system. Neuroscience, Issue 88, Firefly luciferase, Renilla Luciferase, Dual-Glo Luciferase Assay, olfaction, Olfactory receptor, Odorant, GPCR, High-throughput Generation and Purification of Human INO80 Chromatin Remodeling Complexes and Subcomplexes Institutions: Stowers Institute for Medical Research, Kansas University Medical Center. INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 complexes consist of 14 protein subunits including Ino80, a SNF2-like ATPase, which serves both as the catalytic subunit and the scaffold for assembly of the complexes. Functions of the other subunits and the mechanisms by which they contribute to the INO80 complex's chromatin remodeling activity remain poorly understood, in part due to the challenge of generating INO80 subassemblies in human cells or heterologous expression systems. This JOVE protocol describes a procedure that allows purification of human INO80 chromatin remodeling subcomplexes that are lacking a subunit or a subset of subunits. N-terminally FLAG epitope tagged Ino80 cDNA are stably introduced into human embryonic kidney (HEK) 293 cell lines using Flp-mediated recombination. In the event that a subset of subunits of the INO80 complex is to be deleted, one expresses instead mutant Ino80 proteins that lack the platform needed for assembly of those subunits. In the event an individual subunit is to be depleted, one transfects siRNAs targeting this subunit into an HEK 293 cell line stably expressing FLAG tagged Ino80 ATPase. Nuclear extracts are prepared, and FLAG immunoprecipitation is performed to enrich protein fractions containing Ino80 derivatives. The compositions of purified INO80 subcomplexes can then be analyzed using methods such as immunoblotting, silver staining, and mass spectrometry. The INO80 and INO80 subcomplexes generated according to this protocol can be further analyzed using various biochemical assays, which are described in the accompanying JOVE protocol. The methods described here can be adapted for studies of the structural and functional properties of any mammalian multi-subunit chromatin remodeling and modifying complexes. Biochemistry, Issue 92, chromatin remodeling, INO80, SNF2 family ATPase, structure-function, enzyme purification Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes Institutions: Stowers Institute for Medical Research, Kansas University Medical Center. Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Biochemically dissecting the contributions of individual subunits of such complexes to the multi-step ATP-dependent chromatin remodeling reaction requires the use of assays that monitor the production of reaction products and measure the formation of reaction intermediates. This JOVE protocol describes assays that allow one to measure the biochemical activities of chromatin remodeling complexes or subcomplexes containing various combinations of subunits. Chromatin remodeling is measured using an ATP-dependent nucleosome sliding assay, which monitors the movement of a nucleosome on a DNA molecule using an electrophoretic mobility shift assay (EMSA)-based method. Nucleosome binding activity is measured by monitoring the formation of remodeling complex-bound mononucleosomes using a similar EMSA-based method, and DNA- or nucleosome-dependent ATPase activity is assayed using thin layer chromatography (TLC) to measure the rate of conversion of ATP to ADP and phosphate in the presence of either DNA or nucleosomes. Using these assays, one can examine the functions of subunits of a chromatin remodeling complex by comparing the activities of the complete complex to those lacking one or more subunits. The human INO80 chromatin remodeling complex is used as an example; however, the methods described here can be adapted to the study of other chromatin remodeling complexes. Biochemistry, Issue 92, chromatin remodeling, INO80, SNF2 family ATPase, biochemical assays, ATPase, nucleosome remodeling, nucleosome binding Identifying Protein-protein Interaction in Drosophila Adult Heads by Tandem Affinity Purification (TAP) Institutions: Louisiana State University Health Sciences Center. Genetic screens conducted using Drosophila melanogaster (fruit fly) have made numerous milestone discoveries in the advance of biological sciences. However, the use of biochemical screens aimed at extending the knowledge gained from genetic analysis was explored only recently. Here we describe a method to purify the protein complex that associates with any protein of interest from adult fly heads. This method takes advantage of the Drosophila GAL4/UAS system to express a bait protein fused with a Tandem Affinity Purification (TAP) tag in fly neurons in vivo , and then implements two rounds of purification using a TAP procedure similar to the one originally established in yeast1 to purify the interacting protein complex. At the end of this procedure, a mixture of multiple protein complexes is obtained whose molecular identities can be determined by mass spectrometry. Validation of the candidate proteins will benefit from the resource and ease of performing loss-of-function studies in flies. Similar approaches can be applied to other fly tissues. We believe that the combination of genetic manipulations and this proteomic approach in the fly model system holds tremendous potential for tackling fundamental problems in the field of neurobiology and beyond. Biochemistry, Issue 82, Drosophila, GAL4/UAS system, transgenic, Tandem Affinity Purification, protein-protein interaction, proteomics Functional Interrogation of Adult Hypothalamic Neurogenesis with Focal Radiological Inhibition Institutions: California Institute of Technology, Johns Hopkins University School of Medicine, Johns Hopkins University School of Medicine, University Of Washington Medical Center, Johns Hopkins University School of Medicine. The functional characterization of adult-born neurons remains a significant challenge. Approaches to inhibit adult neurogenesis via invasive viral delivery or transgenic animals have potential confounds that make interpretation of results from these studies difficult. New radiological tools are emerging, however, that allow one to noninvasively investigate the function of select groups of adult-born neurons through accurate and precise anatomical targeting in small animals. Focal ionizing radiation inhibits the birth and differentiation of new neurons, and allows targeting of specific neural progenitor regions. In order to illuminate the potential functional role that adult hypothalamic neurogenesis plays in the regulation of physiological processes, we developed a noninvasive focal irradiation technique to selectively inhibit the birth of adult-born neurons in the hypothalamic median eminence. We describe a method for C omputer tomography-guided f radiation (CFIR) delivery to enable precise and accurate anatomical targeting in small animals. CFIR uses three-dimensional volumetric image guidance for localization and targeting of the radiation dose, minimizes radiation exposure to nontargeted brain regions, and allows for conformal dose distribution with sharp beam boundaries. This protocol allows one to ask questions regarding the function of adult-born neurons, but also opens areas to questions in areas of radiobiology, tumor biology, and immunology. These radiological tools will facilitate the translation of discoveries at the bench to the bedside. Neuroscience, Issue 81, Neural Stem Cells (NSCs), Body Weight, Radiotherapy, Image-Guided, Metabolism, Energy Metabolism, Neurogenesis, Cell Proliferation, Neurosciences, Irradiation, Radiological treatment, Computer-tomography (CT) imaging, Hypothalamus, Hypothalamic Proliferative Zone (HPZ), Median Eminence (ME), Small Animal Radiation Research Platform (SARRP) Genetic Manipulation in Δku80 Strains for Functional Genomic Analysis of Toxoplasma gondii Institutions: The Geisel School of Medicine at Dartmouth. Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene function and phenotype(s). The development of mutant strains with targeted gene deletions, targeted mutations, complemented gene function, and/or tagged genes provides powerful strategies to address gene function, particularly if these genetic manipulations can be efficiently targeted to the gene locus of interest using integration mediated by double cross over homologous recombination. Due to very high rates of nonhomologous recombination, functional genomic analysis of Toxoplasma gondii has been previously limited by the absence of efficient methods for targeting gene deletions and gene replacements to specific genetic loci. Recently, we abolished the major pathway of nonhomologous recombination in type I and type II strains of T. gondii by deleting the gene encoding the KU80 protein1,2 . The Δku80 strains behave normally during tachyzoite (acute) and bradyzoite (chronic) stages in vitro and in vivo and exhibit essentially a 100% frequency of homologous recombination. The Δku80 strains make functional genomic studies feasible on the single gene as well as on the genome scale1-4 Here, we report methods for using type I and type II Δku80Δhxgprt strains to advance gene targeting approaches in T. gondii . We outline efficient methods for generating gene deletions, gene replacements, and tagged genes by targeted insertion or deletion of the hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT ) selectable marker. The described gene targeting protocol can be used in a variety of ways in Δku80 strains to advance functional analysis of the parasite genome and to develop single strains that carry multiple targeted genetic manipulations. The application of this genetic method and subsequent phenotypic assays will reveal fundamental and unique aspects of the biology of T. gondii and related significant human pathogens that cause malaria (Plasmodium sp.) and cryptosporidiosis (Cryptosporidium Infectious Diseases, Issue 77, Genetics, Microbiology, Infection, Medicine, Immunology, Molecular Biology, Cellular Biology, Biomedical Engineering, Bioengineering, Genomics, Parasitology, Pathology, Apicomplexa, Coccidia, Toxoplasma, Genetic Techniques, Gene Targeting, Eukaryota, Toxoplasma gondii, genetic manipulation, gene targeting, gene deletion, gene replacement, gene tagging, homologous recombination, DNA, sequencing Direct Restart of a Replication Fork Stalled by a Head-On RNA Polymerase Institutions: Rockefeller University. studies suggest that replication forks are arrested due to encounters with head-on transcription complexes. Yet, the fate of the replisome and RNA polymerase (RNAP) following a head-on collision is unknown. Here, we find that the E. coli replisome stalls upon collision with a head-on transcription complex, but instead of collapsing, the replication fork remains highly stable and eventually resumes elongation after displacing the RNAP from DNA. We also find that the transcription-repair coupling factor, Mfd, promotes direct restart of the fork following the collision by facilitating displacement of the RNAP. These findings demonstrate the intrinsic stability of the replication apparatus and a novel role for the transcription-coupled repair pathway in promoting replication past a RNAP block. Cellular Biology, Issue 38, replication, transcription, transcription-coupled repair, replisome, RNA polymerase, collision Quantification of γH2AX Foci in Response to Ionising Radiation Institutions: The Alfred Medical Research and Education Precinct, The University of Melbourne, The Alfred Medical Research and Education Precinct. DNA double-strand breaks (DSBs), which are induced by either endogenous metabolic processes or by exogenous sources, are one of the most critical DNA lesions with respect to survival and preservation of genomic integrity. An early response to the induction of DSBs is phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming γH2AX1 . Following induction of DSBs, H2AX is rapidly phosphorylated by the phosphatidyl-inosito 3-kinase (PIKK) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2 . Typically, only a few base-pairs (bp) are implicated in a DSB, however, there is significant signal amplification, given the importance of chromatin modifications in DNA damage signalling and repair. Phosphorylation of H2AX mediated predominantly by ATM spreads to adjacent areas of chromatin, affecting approximately 0.03% of total cellular H2AX per DSB2,3 . This corresponds to phosphorylation of approximately 2000 H2AX molecules spanning ~2 Mbp regions of chromatin surrounding the site of the DSB and results in the formation of discrete γH2AX foci which can be easily visualized and quantitated by immunofluorescence microscopy2 . The loss of γH2AX at DSB reflects repair, however, there is some controversy as to what defines complete repair of DSBs; it has been proposed that rejoining of both strands of DNA is adequate however, it has also been suggested that re-instatement of the original chromatin state of compaction is necessary4-8 . The disappearence of γH2AX involves at least in part, dephosphorylation by phosphatases, phosphatase 2A and phosphatase 4C5,6 . Further, removal of γH2AX by redistribution involving histone exchange with H2A.Z has been implicated7,8 . Importantly, the quantitative analysis of γH2AX foci has led to a wide range of applications in medical and nuclear research. Here, we demonstrate the most commonly used immunofluorescence method for evaluation of initial DNA damage by detection and quantitation of γH2AX foci in γ-irradiated adherent human keratinocytes9 Medicine, Issue 38, H2AX, DNA double-strand break, DNA damage, chromatin modification, repair, ionising radiation Quantitation of γH2AX Foci in Tissue Samples Institutions: The Alfred Medical Research and Education Precinct, The Alfred Medical Research and Education Precinct, The University of Melbourne, Royal Children's Hospital, The University of Melbourne. DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) processes or by exogenous factors, particularly ionizing radiation and radiomimetic compounds. Phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming γH2AX, is an early response to DNA double-strand breaks1 . This phosphorylation event is mediated by the phosphatidyl-inosito 3-kinase (PI3K) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2 . Overall, DSB induction results in the formation of discrete nuclear γH2AX foci which can be easily detected and quantitated by immunofluorescence microscopy2 . Given the unique specificity and sensitivity of this marker, analysis of γH2AX foci has led to a wide range of applications in biomedical research, particularly in radiation biology and nuclear medicine. The quantitation of γH2AX foci has been most widely investigated in cell culture systems in the context of ionizing radiation-induced DSBs. Apart from cellular radiosensitivity, immunofluorescence based assays have also been used to evaluate the efficacy of radiation-modifying compounds. In addition, γH2AX has been used as a molecular marker to examine the efficacy of various DSB-inducing compounds and is recently being heralded as important marker of ageing and disease, particularly cancer3 . Further, immunofluorescence-based methods have been adapted to suit detection and quantitation of γH2AX foci ex vivo and in vivo4,5 . Here, we demonstrate a typical immunofluorescence method for detection and quantitation of γH2AX foci in mouse tissues. Cellular Biology, Issue 40, immunofluorescence, DNA double-strand breaks, histone variant, H2AX, DNA damage, ionising radiation, reactive oxygen species Evaluation of the Spatial Distribution of γH2AX following Ionizing Radiation Institutions: The Alfred Medical Research and Education Precinct, The Alfred Medical Research and Education Precinct, University of Melbourne. An early molecular response to DNA double-strand breaks (DSBs) is phosphorylation of the Ser-139 residue within the terminal SQEY motif of the histone H2AX1,2 . This phosphorylation of H2AX is mediated by the phosphatidyl-inosito 3-kinase (PI3K) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)3 . The phosphorylated form of H2AX, referred to as γH2AX, spreads to adjacent regions of chromatin from the site of the DSB, forming discrete foci, which are easily visualized by immunofluorecence microscopy3 . Analysis and quantitation of γH2AX foci has been widely used to evaluate DSB formation and repair, particularly in response to ionizing radiation and for evaluating the efficacy of various radiation modifying compounds and cytotoxic compounds4 Given the exquisite specificity and sensitivity of this de novo marker of DSBs, it has provided new insights into the processes of DNA damage and repair in the context of chromatin. For example, in radiation biology the central paradigm is that the nuclear DNA is the critical target with respect to radiation sensitivity. Indeed, the general consensus in the field has largely been to view chromatin as a homogeneous template for DNA damage and repair. However, with the use of γH2AX as molecular marker of DSBs, a disparity in γ-irradiation-induced γH2AX foci formation in euchromatin and heterochromatin has been observed5-7 . Recently, we used a panel of antibodies to either mono-, di- or tri- methylated histone H3 at lysine 9 (H3K9me1, H3K9me2, H3K9me3) which are epigenetic imprints of constitutive heterochromatin and transcriptional silencing and lysine 4 (H3K4me1, H3K4me2, H3K4me3), which are tightly correlated actively transcribing euchromatic regions, to investigate the spatial distribution of γH2AX following ionizing radiation8 . In accordance with the prevailing ideas regarding chromatin biology, our findings indicated a close correlation between γH2AX formation and active transcription9 . Here we demonstrate our immunofluorescence method for detection and quantitation of γH2AX foci in non-adherent cells, with a particular focus on co-localization with other epigenetic markers, image analysis and 3D-modeling. Cellular Biology, Issue 42, H2AX, radiation, euchromatin, heterochromatin, immunofluorescence, 3D-modeling Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique Institutions: University of Oxford , University of Warsaw. Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development. Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1 . DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4 . In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope. Molecular Biology, Issue 56, Genetics, DNA fiber analysis, replication speed, fork stalling, origin firing, termination Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies Institutions: University of California, Los Angeles . In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus , consequently the name Taq PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: ● Set up reactions and thermal cycling conditions for a conventional PCR experiment ● Understand the function of various reaction components and their overall effect on a PCR experiment ● Design and optimize a PCR experiment for any DNA template ● Troubleshoot failed PCR experiments Basic Protocols, Issue 63, PCR, optimization, primer design, melting temperature, Tm, troubleshooting, additives, enhancers, template DNA quantification, thermal cycler, molecular biology, genetics Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays Institutions: University of Toronto, University of Toronto, University of Regina. Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1 . While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2 . Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7 , but GI information remains sparse for prokaryotes8 , which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10 Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9 , using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11 ) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13 ) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14 . GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9 . Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2 . Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9 Genetics, Issue 69, Molecular Biology, Medicine, Biochemistry, Microbiology, Aggravating, alleviating, conjugation, double mutant, Escherichia coli, genetic interaction, Gram-negative bacteria, homologous recombination, network, synthetic lethality or sickness, suppression Two- and Three-Dimensional Live Cell Imaging of DNA Damage Response Proteins Institutions: Virginia Commonwealth University, Virginia Commonwealth University, Virginia Commonwealth University, Virginia Commonwealth University. Double-strand breaks (DSBs) are the most deleterious DNA lesions a cell can encounter. If left unrepaired, DSBs harbor great potential to generate mutations and chromosomal aberrations1 . To prevent this trauma from catalyzing genomic instability, it is crucial for cells to detect DSBs, activate the DNA damage response (DDR), and repair the DNA. When stimulated, the DDR works to preserve genomic integrity by triggering cell cycle arrest to allow for repair to take place or force the cell to undergo apoptosis. The predominant mechanisms of DSB repair occur through nonhomologous end-joining (NHEJ) and homologous recombination repair (HRR) (reviewed in2 ). There are many proteins whose activities must be precisely orchestrated for the DDR to function properly. Herein, we describe a method for 2- and 3-dimensional (D) visualization of one of these proteins, 53BP1. The p53-binding protein 1 (53BP1) localizes to areas of DSBs by binding to modified histones3,4 , forming foci within 5-15 minutes5 . The histone modifications and recruitment of 53BP1 and other DDR proteins to DSB sites are believed to facilitate the structural rearrangement of chromatin around areas of damage and contribute to DNA repair6 . Beyond direct participation in repair, additional roles have been described for 53BP1 in the DDR, such as regulating an intra-S checkpoint, a G2/M checkpoint, and activating downstream DDR proteins7-9 . Recently, it was discovered that 53BP1 does not form foci in response to DNA damage induced during mitosis, instead waiting for cells to enter G1 before localizing to the vicinity of DSBs6 . DDR proteins such as 53BP1 have been found to associate with mitotic structures (such as kinetochores) during the progression through mitosis10 In this protocol we describe the use of 2- and 3-D live cell imaging to visualize the formation of 53BP1 foci in response to the DNA damaging agent camptothecin (CPT), as well as 53BP1's behavior during mitosis. Camptothecin is a topoisomerase I inhibitor that primarily causes DSBs during DNA replication. To accomplish this, we used a previously described 53BP1-mCherry fluorescent fusion protein construct consisting of a 53BP1 protein domain able to bind DSBs11 . In addition, we used a histone H2B-GFP fluorescent fusion protein construct able to monitor chromatin dynamics throughout the cell cycle but in particular during mitosis12 . Live cell imaging in multiple dimensions is an excellent tool to deepen our understanding of the function of DDR proteins in eukaryotic cells. Genetics, Issue 67, Molecular Biology, Cellular Biology, Biochemistry, DNA, Double-strand breaks, DNA damage response, proteins, live cell imaging, 3D cell imaging, confocal microscopy Assaying DNA Damage in Hippocampal Neurons Using the Comet Assay Institutions: University of Alabama-Birmingham, The Ohio State University Medical School, University of Alabama at Birmingham School of Medicine, University of Alabama-Birmingham. A number of drugs target the DNA repair pathways and induce cell kill by creating DNA damage. Thus, processes to directly measure DNA damage have been extensively evaluated. Traditional methods are time consuming, expensive, resource intensive and require replicating cells. In contrast, the comet assay, a single cell gel electrophoresis assay, is a faster, non-invasive, inexpensive, direct and sensitive measure of DNA damage and repair. All forms of DNA damage as well as DNA repair can be visualized at the single cell level using this powerful technique. The principle underlying the comet assay is that intact DNA is highly ordered whereas DNA damage disrupts this organization. The damaged DNA seeps into the agarose matrix and when subjected to an electric field, the negatively charged DNA migrates towards the cathode which is positively charged. The large undamaged DNA strands are not able to migrate far from the nucleus. DNA damage creates smaller DNA fragments which travel farther than the intact DNA. Comet Assay, an image analysis software, measures and compares the overall fluorescent intensity of the DNA in the nucleus with DNA that has migrated out of the nucleus. Fluorescent signal from the migrated DNA is proportional to DNA damage. Longer brighter DNA tail signifies increased DNA damage. Some of the parameters that are measured are tail moment which is a measure of both the amount of DNA and distribution of DNA in the tail, tail length and percentage of DNA in the tail. This assay allows to measure DNA repair as well since resolution of DNA damage signifies repair has taken place. The limit of sensitivity is approximately 50 strand breaks per diploid mammalian cell 1,2 . Cells treated with any DNA damaging agents, such as etoposide, may be used as a positive control. Thus the comet assay is a quick and effective procedure to measure DNA damage. Neuroscience, Issue 70, Genetics, Cellular Biology, Molecular Biology, Medicine, Cancer Biology, Anatomy, Physiology, DNA, DNA damage, double strand break, single strand break, repair, neurons, comet assay, cell culture Purifying Plasmid DNA from Bacterial Colonies Using the Qiagen Miniprep Kit Institutions: University of California, Irvine (UCI). Plasmid DNA purification from E. coli is a core technique for molecular cloning. Small scale purification (miniprep) from less than 5 ml of bacterial culture is a quick way for clone verification or DNA isolation, followed by further enzymatic reactions (polymerase chain reaction and restriction enzyme digestion). Here, we video-recorded the general procedures of miniprep through the QIAGEN's QIAprep 8 Miniprep Kit, aiming to introducing this highly efficient technique to the general beginners for molecular biology techniques. The whole procedure is based on alkaline lysis of E. coli cells followed by adsorption of DNA onto silica in the presence of high salt. It consists of three steps: 1) preparation and clearing of a bacterial lysate, 2) adsorption of DNA onto the QIAprep membrane, 3) washing and elution of plasmid DNA. All steps are performed without the use of phenol, chloroform, CsCl, ethidium bromide, and without alcohol precipitation. It usually takes less than 2 hours to finish the entire procedure. Issue 6, Basic Protocols, plasmid, DNA, purification, Qiagen

<urn:uuid:a7056c09-782a-4826-9acb-2dbcaa3d708c>

CC-MAIN-2016-50

http://www.jove.com/visualize/abstract/25375241/a-functional-approach-reveals-genetic-physical-interaction-between

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

Shooting is the show or methodology of releasing guns or other shot weapons, for occurrence, bows or crossbows. Without a doubt, even the completion of gigantic weapons, rockets, and rockets can be called shooting. A man who has some authority in shooting is a marksman. Shooting can happen in a shooting range or in the field in seeking after, in shooting sports, or in battle. Marksmanship has pushed rivalry, and in a few nations rifle clubs began to shape in the nineteenth century.Soon overall shooting occasions made, including shooting at the Summer Olympics (from 1896) and World Championships ( in spite of the route that there is comparably interminable and general shooting sports controlled by unpredictable affiliations. Shooting system contrasts relying on segments like the kind of weapon utilized (from a handgun to an authority sharpshooter rifle); the division to and nature of the objective; the required accuracy; and the accessible time. Breathing and position acknowledge a crucial part when managing a handgun or a rifle. Some shooting diversions, for occasion, IPSC giving, make a session of battle style shooting.The inclined position, stooping position, and standing position offer unmistakable measures of backing for the shooter.

<urn:uuid:a7c96412-77d4-4409-af4a-1eeb99cd9cde>

CC-MAIN-2016-50

http://www.mynepalimusic.com/2016/08/most-viewed-ht-tij-song.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

In a new study, researchers show how a lack of sleep can encourage pre-diabetic conditions in otherwise healthy young men. Specifically, researchers found that a persistent lack of sleep promoted increased fatty acid levels in the blood. Heightened fatty acid levels disrupt fat metabolism and disrupts insulin's ability to properly regulate blood sugar -- thus, diabetes. The levels of fatty acids normally fluctuate throughout the day, but generally follow a pattern of peaking in the evening and receding overnight. But the new study showed a recession of fatty acid levels was mitigated by sleepless nights.

<urn:uuid:e9a672b2-0010-4c58-9eda-30907a3a775d>

CC-MAIN-2016-50

http://www.newshub.org/m/research-explains-insomnia-can-encourage-diabetes-12077845.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

Story: Large companies Large companies have a big investment of capital and many employees. In the 19th century importing was big business, as was banking and finance. By the 2000s many large companies operating in New Zealand were overseas-owned, and many others were previously government-owned companies that had been privatised. Full story by Gary Hawke Main image: Frozen Meat Company share certificate The Short Story A quick, easy summaryRead the Full Story 19th century companies Most companies in the 19th century were owned by individuals or families. The first big company was the New Zealand Company, established in London in 1839. People who had shares in the company were given land. Other large companies developed as importers brought in goods which were not made locally, such as tea, sugar and cloth. Companies making shoes, boots or clothes began to grow. Hallensteins made clothes and by 1900 it had 36 retail stores. From the 1880s exports rose as frozen meat, butter and cheese were produced. Many farmers joined co-operatives to jointly export their produce. Meat-freezing companies were increasingly owned by British meat importing firms. Ross and Glendining was a Dunedin textile manufacturer. By 1900 it employed over 1,000 people, and owned sheep farms, wool-sorting and scouring operations, a coal mine, woollen mills, and hosiery and clothing factories. Other major companies were the New Zealand Sugar Company, Auckland Gas, the New Zealand Frozen Meat Company and the Northern Steamship Company. Access to capital Companies needed capital investment – money – in order to grow. Most of New Zealand’s early companies provided services. There were four overseas banks and two local banks with sizable business in the 19th century. In the late 1800s they each had more than £1 million (around $100 million in 2009 terms). Insurance companies and stock and station agencies were also important for finance. Wright Stephenson was the most important New Zealand-owned agency. Another national agency, Dalgetys, was English-owned. At first transport was difficult between settlements, and businesses like breweries were local. When transport improved, these businesses began to be bought out. By the 1930s there were two large brewers, New Zealand Breweries and Dominion Breweries. Government and investment The government promoted local manufacturing by licensing imports and charging taxes on imported goods. Local firms assembled cars rather than manufacturing the entire product. The government also sponsored overseas investment such as the Tīwai Point aluminium smelter, which was lured with the promise of cheap electricity, and Tasman Pulp and Paper, which was owned partly by Australian newspapers, and partly by the government. Large companies often grew through mergers and by buying other companies. In the early 2000s four companies dominated the petrol industry: Shell, BP, Mobil and Caltex. Two companies controlled supermarkets – Progressive Enterprises and Foodstuffs. Fletchers was a building company that was privately owned by the family until 1940. By the 1980s it was New Zealand’s largest company. But most large companies were owned overseas – such as banks, oil and shipping – or were run by the government – electricity, coal, forestry and railways. In the 1980s the government began reducing taxes on imports and abandoned import licensing. They made it easier for banks to borrow overseas. Aggressive companies like Brierley and Chase bought shares in companies then sold off their assets or restructured them. Ready credit created a finance bubble and there was a crash in 1987. The government sold some state-owned businesses such as Telecom, and turned other government agencies into profit-making state-owned enterprises. The electricity company Contact Energy, sold by the government in 1998, was the largest company on the stock exchange in 2007. Another very large company was the farmers’ co-operative Fonterra, which was owned by its members and not listed on the stock exchange.

<urn:uuid:d0e6f877-1905-45fb-9c75-1a32a9031e92>

CC-MAIN-2016-50

http://www.teara.govt.nz/en/large-companies

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

Bedbugs can come into homes on or inside luggage, furniture, bedding or clothing. Inside homes, bedbugs can hide in small cracks and crevices, such as behind a bed headboard, in the seams and tufts of a mattress, inside a box spring, along the cracks of a wall's baseboard, behind wallpaper and in clutter. Bedbugs do not transmit diseases. While they typically feed on blood every five to 10 days, leaving red, itchy welts, bedbugs can live for a year or more without eating. They also can survive temperatures ranging from almost freezing to almost 113 degrees. Bedbugs leave feces on mattresses, box springs and other furniture. The feces may bleed on fabric like a felt-tip marker. When bedbugs are crushed, they leave rusty or reddish stains on bed sheets or mattresses. Bedbug eggs and eggshells are tiny, about 1 mm, and white. Live bedbugs have flat bodies, antennae and small eyes, and are visible to the naked eye. But many other bugs may look like them, so getting an expert's identification is key. Source: Federal Trade Commission

<urn:uuid:276a4c10-67dc-43c7-8b5c-09f0ebd17a72>

CC-MAIN-2016-50

http://www2.readingeagle.com/article.aspx?id=304401

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

Wild Bird Feeding Strategies - What You Can Do To Support Wild Bird Populations January 12 2009 Best Wild Bird Feeding Strategies The following is a list of the relevant issues that should be considered in all bird feeding strategies.Reevaluate the landscaping of your property. Lawns are very expensive, labor intensive, and ecological deserts. We recommend you minimize the size of your lawn and maximize the natural features of your property by adding plantings of indigenous plants and habitat features that support the local bird populations. Maintain your lawn with ecologically compatible products rather than chemical toxins. Remember we all live downstream.The first step in developing a bird feeding strategy is to become familiar with the local bird species, which species are year-round residents, which ones are seasonal visitors, which species are likely to visit a feeder, and which ones aren't. 1. Manage your property in an ecologically sound manner. 2. Become familiar with the local species and their natural histories. 3. Group them by the type of food that makes up the major portion of their diet. In general, birds can be grouped together by the types of food they eat (trophic levels). This does not necessarily mean that granivores (seed-eaters), for example, eat only seeds. Granivores prefer seeds to other foods and specific types of seeds to others. Since it is rare in nature to find a food that is readily and always available, it is important to remember that most birds select food in order of their preferences. While there are a number of trophic levels, backyard bird feeding usually involves only four. a. Granivores - seed or grain feeders like finches and sparrows. Many seeds and seed mixes are available for granivores. b. Frugivores - fruit feeders like tanagers. There are dehydrated fruit products for frugivores. c. Insectivores - insect feeders like blue birds and woodpeckers. There are a number of live and dehydrated insect products. d. Nectarivores - nectar feeders like hummingbirds. There are several commercial nectar diets available. 4. Evaluate and maximize natural food sources available on your property. Wild birds usually prefer their natural diet to commercial products. There are many sources for information on how to maximize the natural appeal of your property to birds. If you are familiar with the natural history of the species you want to attract, you will know what food supplies and habitat features to maximize for their benefit. 5. Determine what supplemental foods to offer. Not all commercial bird foods are created equal. The vast majority of commercial wild bird diets are formulated and packaged first to attract consumers, second to attract birds to an observation site, and last, as well as least, to provide a nutritional supplement. They are not formulated nor intended to meet all the nutritional needs of birds. Birds meet their nutritional needs by eating a wide variety of foods. Even if you were to offer a variety of seeds to granivores, for example, it would be impossible to meet all the nutritional needs of the birds because they will not eat all of the seeds offered. Feeding preference studies have shown that most granivores prefer by a large margin black oil sunflower and white proso millet seeds. The quality of commercial seed mixes is a function of the proportion of black oil sunflower and white proso millet seeds to other filler seeds that usually end up on the ground. We recommend feeding seeds (preferably only black oil sunflower and white proso millet) for behavioral enrichment only, once a week on a random schedule. We believe that a wild bird food should be formulated first and foremost to meet the nutritional requirements of birds, second to appeal to birds feeding preferences and natural behaviors, and last to attract discriminating consumers/birders/keepers who want to help wild birds thrive. If you want to support bird populations, you need to offer commercial bird foods that are formulated to meet all the nutritional needs of the target species or trophic level. Our products meet all the general nutritional needs of birds and we recommend that they be the only bird food offered free choice at all times. Like all wildlife, birds are instinctively very wary of change. Habitat changes, dietary changes, feeding site or feeder changes and generally anything that is different will cause them to avoid a feeding site until they feel safe enough to resume feeding activity. New foods that are unfamiliar will remain uneaten until birds overcome their natural reticence to try something new. They may never accept it. When offering our products for the first time we recommend offering small amounts. If no feeding has taken place, replace the food after two weeks. If feeding has occurred, manage as usual. There are several important factors to consider in selecting a feeder. The most important consideration is how well the feeder will accommodate the feeding behaviors of the birds it is designed to serve. For example, a group of insectivorous species including woodpeckers hunt insects in the bark of trees. Woodpeckers use their tail for leverage when "hammering" into tree bark by pressing the tail against the bark. Woodpeckers will feed on suet cakes in hanging basket feeders. The cheapest of these feeders is nothing more than a wire mesh basket that accommodates a standard suet cake. This feeder is satisfactory for the smaller woodpeckers, but is awkward for larger woodpeckers that are unable to use their tails for support. The best cake feeders are those that permit maximum air circulation around the cake and have an extension on the bottom of the feeder large enough to accommodate the tails of larger woodpeckers. Another important consideration is how well a feeder preserves and protects the nutritional quality of the food it is designed to accommodate. It is very important that whatever food you offer remains dry and out of the direct sun. If a feeder, regardless of type, allows rain to reach the food, you should use it only with an overhead shelter that protects it from the rain. Wet food including seeds can mold and cause harm to birds. The heat from direct sun exposure can breakdown nutrients. Finally, how easy will it be to clean the feeder? A feeder should be designed for ease of cleaning. That usually means it is easy to disassemble and it is constructed of materials that are nonabsorbent. Recycled plastic is ideal. Wood on the other hand, although widely used is not recommended as it is relatively absorbent, difficult to clean thoroughly, and can promote bacteria and mold. For example, one of the common wood feeders is a hopper type seed feeder with ends that are modified to hold suet or food cakes. Unfortunately, the cakes are usually in direct contact with the wood at some point, which encourages bacteria, and/or mold development 7. Locating feeders. This is very important in terms of effective feeding strategies. Birds are very vulnerable to predation at feeding sites because the focused avian activity will eventually draw the attention of predators. Birds are hunted from above by avian predators like cooper and sharp shin hawks and from below by cats, snakes, and other small predators. If you set up a feeding site you have a responsibility to minimize vulnerability to predation. Have you ever noticed how birds at a covered feeder constantly lean out to check the sky overhead? They are looking for predators. A feeding site should consist of the feeders and a nearby landing site from which the birds can safely search the feeders for predators. The landing site is preferably a tree or shrub sufficiently open that approaching birds can easily determine prior to landing if it harbors any predators, but far enough away from the feeders, typically 10-12 feet, that it does not provide a launching site for an attack on feeding birds. The feeders should be protected from rain and direct sun especially from the south and west The primary predators frequenting feeding sites are hawks and cats. If you own a cat we believe that you have a responsibility to prevent your pet from killing birds by keeping it indoors. The Audubon Society strongly urges cat owners to keep their cats indoors. Please keep in mind that domestic cats are not native to the US. and they number in the millions. They kill millions of birds every year. 8. Feeding strategies. Wild birds will always select food based on their preferences. Wild birds have an instinctive wariness about any change in their habitat. When setting up a new feeding site, be patient. In the beginning, offer foods that the target species cannot resist like black oil sunflower, white proso millet, Niger (thistle), live or dehydrated meal worms or wax worms, currants, or peanuts depending on your target species. Remember that these foods cannot meet all the nutritional needs of birds. After the birds have become accustomed to feeding at the site, we recommend adding a nutritionally complete diet like FNK Nutri-Cakes and Nutri-Dough to the menu. Birds usually are reluctant to accept a new unfamiliar food even when it's better for them. There are feeding strategies like "bait and switch" that can facilitate the acceptance process. Offer the new food alongside the standard fare. Birds will soon overcome their caution and feed on the standard food. They will quickly become conditioned to the presence of the new food. To encourage the birds to eat the new food, gradually reduce the availability of the standard food over a 2 - 4 week period. Remember birds will always select foods according to their preferences. Granivores, for example, will always select seed over a commercial diet. In order to ensure that they are receiving all the nutrients they need, offering seed or any other attractants must be severely limited to a small, occasional, random feeding. 9. Wild birds, like all life forms, compete for limited resources.Their resources are further limited by our actions like habitat destruction or disruption, pollution, and introduction of alien species like the European starling and the house sparrow. Both have contributed to the declines of some native bird populations and should be eliminated from your property by whatever means are ethically acceptable. Squirrels and raccoons are probably the two best-known mammal competitors. There are generally two strategies for dealing with them. Block their access to the food by using one or more of the many exclusionary devices and feeders on the market or offer them their own food. Author: Willis J. Whittaker, 30+ years experience as an animal care professional, BS in Natural Resource Management & BA in Environmental Ethics. Article Source: EzineArticles.com/?expert=Bill_Whittaker

<urn:uuid:f307f460-10aa-4828-afe5-192d8c5a630d>

CC-MAIN-2016-50

https://www.thebirdhousechick.com/blogs/resources/55645571-wild-bird-feeding-strategies-what-you-can-do-to-support-wild-bird-populations

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541907.82/warc/CC-MAIN-20161202170901-00053-ip-10-31-129-80.ec2.internal.warc.gz

en

This activity prepares an infant for rolling over onto their tummy. - A rattle or a squeaky toy. What to do: - When baby is on their back. - Hold the rattle or squeaky toy besides them (either left or right side), slightly out of their reach. - Shake the rattle or press the squeaky toy. - Baby will turn their head towards the sound and try and reach for the toy. - As they begin to reach for the toy, they will bend their knees and bring them towards their chest and roll onto their side (depending on where the direction of sound is coming from). If they are having trouble, place your hand on baby’s back and gently push them onto their side. - To support baby, place your hand behind baby’s back to encourage them to stay on their side. - To roll back, baby will extend their legs and try to push themselves onto their back. You can help them, if they are having trouble doing so. - Practice this regularly so they begin rolling onto their side with ease. - You will need to do this for both the left and right side. Hints and Tips: - You can use any toy however a toy that makes a sound will provide more interest for a baby to want to reach out and grab it. - It’s best to practice this on the floor with a mat. This enables the baby to move easier than doing it on the bed.

<urn:uuid:0f210b73-031f-464b-8c93-773c95ab81d6>

CC-MAIN-2016-50

http://aussiechildcarenetwork.com.au/activities/games-and-activities/rolling-around

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Inhaled corticosteroid is the treatment of choice to control lung inflammation in asthma patients. RESEARCH The problem is that 15% to 20% of patients may be unresponsive to inhaled steroids. There are alternatives like omalizumab (Xolair) or montelukast (Singulair). Hence, advance knowledge of ineffective treatment can prevent patient discomfort as reported in a poster presentation at the American Academy of Allergy, Asthma & Immunology meeting. A study was conducted on 89 patients, 24 of whom were determined to be steroid-resistant. Researchers performed an in vitro experiment on peripheral blood mononuclear cells from 44 asthmatic patients, without regard to whether they were steroid-resistant, to correlate plasma uteroglobin with steroid responsiveness. The latter was measured by the quantity of dexamethasone required to suppress lymphocyte proliferation and tumor necrosis factor production, both of which are associated with inflammatory activity. Researchers found strong correlations – r coefficients of 0.35 and 0.46, respectively, both with P<0.05 – between uteroglobin and steroid responsiveness in these cells. Elena Goleva, PhD, of National Jewish Health in Denver concludes: "It appears that uteroglobin could be a useful biomarker in guiding treatment selection." Read complete 2009 article at MedPageToday.com.

<urn:uuid:afacdda7-21ea-41e6-b862-c3d217f4328d>

CC-MAIN-2016-50

http://clinicalposters.com/news/2010/20100310_biomarker-asthma-steroid.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

[pod-ahyt] /ˈpɒd aɪt/ an arthropod limb. [poh-dee-uh m] /ˈpoʊ di əm/ noun, plural podiums, podia [poh-dee-uh] /ˈpoʊ di ə/ (Show IPA) 1. a small platform for the conductor of an orchestra, for a public speaker, etc. 2. Architecture. 3. . 4. a counter or booth, as one at an airport for handling tickets or dispensing information. 5. Zoology, Anatomy. a foot. […] 1. variant of before a consonant: podotheca. podo- or pod- pref. Foot; foot-shaped: pododynia. [pod-uh-kahr-puh s] /ˌpɒd əˈkɑr pəs/ noun 1. any of various coniferous evergreen trees of the genus Podocarpus, of tropical and semitropical regions, especially P. macrophyllus, which is cultivated as an ornamental. podocyte pod·o·cyte (pŏd’ə-sīt’) n. An epithelial cell of the renal glomerulus, attached to the outer surface of the glomerular capillary basement membrane by cytoplasmic foot processes.

<urn:uuid:c5d7797b-6611-4102-b916-3471debd4cc8>

CC-MAIN-2016-50

http://definithing.com/define-dictionary/podite/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Mining has a rich history and the Bingham Canyon mine has one of the richest histories. Operating since 1906, it is the world’s first open pit mining operation and it showed the world how to mine low-grade minerals profitably. In the late 1800s a man named Daniel Jackling first got the idea that perhaps copper could be mined from the surface if the operation was big enough. Old time miners in the region thought he was crazy to even consider trying to mine such a low grade, which was a mere 2% or about 38 lbs/ton. Today that grade, about $120/ton at today’s prices, would be considered very good by open pit copper mining standards. The original goal was to mine 2000 tons per day, which a quick calculation suggests about a 25 million pound per year when operations started in 1906. It wasn’t long before the Bingham Canyon mine was the only mining operation in the region. In 2006 the grade mined was 0.63% copper, 0.057% molybdenum, with 0.49 g/ton gold and 3.5 g/ton silver. At today’s prices that’s $90/ton metal values. In 2006 Bingham mined concentrates that contained about 580 million pounds of copper, 37 million pounds of molybdenum, 523,000 oz gold, and 4.2 million oz silver, about 17% US copper production. The smelter was shut for 63 days so only about 90% of the concentrate was refined. Bingham Canyon mine claims to be the world’s biggest mine, as does Escondida in Chili. Who’s telling the truth? Escondida currently has the largest production in the world, about 2.8 billion pounds per year, 8.1% of the world’s copper production, and its production is more than 100 times Bingham 1906 initial production. Started in 1990 at 6-700 million pounds per year, Escondida has not produced the most copper in the world, that title belongs to Bingham Canyon. To put into perspective how much mining has happened at Bingham Canyon over the last 100 years when Daniel Jackling first built his mine there was a 9000 ft high mountain and now there is a hole ¾ of a mile deep and 2.5 miles across the top, 500 miles of roads in the pit and it has produced over 17 billion pounds of copper. Bingham Canyon mine uses some of the most equipment today. The shovel weighs 2.5 million pounds and pick up 98 tons with a single scoop. The trucks carry between 255 and 350 tons of rock. The trucks and shovel look small until you look at the tires. The mine has been highly profitable and been described as “the richest hole on the Earth.” It is operated by Kenncott Utah Copper, which is owned by Rio Tinto. Of the $7.4 billion in profits that Rio Tinto had in 2006, about $1.8 billion came from Kenncott Utah Copper. The life of the mine is currently projected until 2017 with reserves of 0.54% copper, 0.043% molybdenum, 0.32 g/ton gold and 2.59 g/ton silver, or about 18% less metal values per ton mined in 2006. The declining reserve grades does mean that profitability will decline and Bingham Canyon Mine’s centennial year (2006) may also go down as its most profitable year in its history. Future considerations after the open pit operations come to an end is to consider the economics of under ground mining for metal resource that can not be reached through open pit operations. To evaluate if Bingham Canyon mine is a good investment, investors need to check out Rio Tinto. It trades in the ADR under the ticker RTP. Rio Tinto has a market cap of $113 billion. Sales in 2006 were $25.4 billion and earnings were $7.338 billion, or about 6.5% of the market cap. Reinvestment for capital projects in 2006 was $3.9 billion, with $1.1 billion of that financed through increasing debt. The copper group made 49% of the 2006 earnings, with Bingham and a 30% ownership of Escondida being the two largest contributors to the copper revenues. Escondida has a life-of-mine that should go 25-30 years. Depending on the grade an economic feasibility to switching to under ground mining, Bingham’s revenue stream may need to be replaced in the next decade and Rio Tinto has interests in 4 world-class undeveloped projects in the works to start in 4-10 years that will meet that objective: - 100% ownership of La Gradja in Peru. - 9.95% increasing to 19.9% interest in Oyu Tolgoi (Turquoise Hill), in Mongolia. - 19.8% interest in Pepple in Alaska. - 55% interest of Resolution Copper, 2 km deep. Since January 2003 strong appreciation against the US dollar has been seen in the Brazilian Real (61%), Australian dollar (37%) and the Canadian dollar (32%). This in turn has increased mining production costs as denominated in US currency. US currency has declined further since that report, further putting upward pressure on production costs as they are reported in US currency. This puts downward pressure on earnings. Furthermore, commodity prices were very strong in 2006, and with strong prices there is more risk for price declines. With a company as big as Rio Tinto mines are constantly coming to the end of their mine life, so there is a constant need for replacement projects to maintain operations, never mind increasing operations. Rio Tinto’s $3.9 billion in capital projects demonstrates that they are focused on ensuring a strong production profile. A problem for Rio Tinto that a small company does not have is that it is so big, any meaningful production growth can be offset by declines in price because relative meaningful increases in production relative to their size affects the supply to the point it can push prices down. For example increasing Rio Tinto’s copper production by 10%, say around 200 million pounds, and that would increase world supply by about 0.5%. A small company’s existing production might only be 100 million pounds, so that increase would triple their production, or increase by 200%. Rio Tinto’s relative increased production is so small, so it gives little protection from downward price risks compared to the small company. The downward prices risks would be enormous if Rio Tinto tried to double their production. There is no question that Rio Tinto is an amazing company with exceptional management that pays attention to not diluting the share count, but with strong commodity prices investors have not properly considered what happens to their investment if commodity prices decline. It simply isn’t wise to price a big commodity company above a P/E of about 12.

<urn:uuid:5bcf032d-9dba-4837-8f88-34921e29cb1d>

CC-MAIN-2016-50

http://makingsenseofmyworld.blogspot.com/2007/06/bingham-canyon-mine-worlds-largest.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

By Ianina Harari – (Translated by Leonardo Kosloff) The theory of imperialism can sometimes be a good excuse to justify ignorance. There have been attempts at explaining the economic problems in countries of late development by imperialist oppression, but which lack the knowledge of how capitalism historically evolved in them. In this way, foreign companies are the agents of this oppression, and their actions would explain all the local shortcomings. The problem of these conceptions is that foreign companies do not always act in the same form in all countries; hence, the outcome is not always the same. One example is the automotive industry in Argentina and Brazil. In both countries this branch has developed at the mercy of the establishment of foreign capitals. But, while in the first case this industry remained attached to the domestic market, in the second case exports shot up. Let us see how, with the exact opposite arguments, the pseudo-Marxist intellectuals have defended the idea that imperialism hinders national development. The Argentine automotive industry exists due to the establishment of foreign terminals in the ‘60’s. A widely spread interpretation of this phenomenon is that the quasi-speculative behavior of these companies caused the meager development of the branch. The author who synthesized this position was Jorge Schvarzer . According to him, transnational companies brought in the least necessary amount of capital to the country and did not adapt machinery to the smaller local scale. Schvarzer does not maintain this line of interpretation coherently: in one page, inefficient industries were generated in this form with high excess capacity. But, contradictorily, in another page, he sets out the argument that great efforts were invested in the adaptation of plants to the domestic market. In turn, he points out that the size of the local plants was smaller than that of their headquarters and that production plans were narrow. In his assessment, the latter would demonstrate that they had short-term mentality and a lack of productive attitude. So…, which one is it then? For Schvarzer, the problem of the plants’ reduced size derived from the denial of foreign companies to embark on exporting ventures, in spite of state policies, to which the terminals were opposed given that the contracts with their headquarters banned them from selling in external markets. Luckily, he saved us the work of refuting this argument, for he does so himself: in the ‘camporist’ epoch exports to Cuba were made, including by terminals such as Ford, which supposedly had it forbidden due to the US blockade on the island. In effect, this possibility was instigated both by terminals as by auto parts makers. The idea that sister companies were opposed to exports is false, since transnational companies like Ford had implemented, beginning in the ‘70s, the policy of promoting exports from their affiliates . Schvarzer reads the process starting from its ulterior results and assumes, even against part of the information he presents, that if exports were not made from Argentina it was because there was no will to do so. In his national-developmentalist dream, the possibility that Argentina was not apt to function as a platform for an exporting automotive industry is absent. As a result, he can only conceive the turn to the domestic market of the affiliate companies as a by-product of speculation and policy of imperialist companies, whose sole desire is to keep underdeveloped countries subjugated. The development of the neighbor country has been analyzed by a famous dependentist, Ruy Mauro Marini , who puts forward that, due to the increase in productivity which is generated with the establishment of foreign companies, there ensues a trend to unemployment which forestalls the creation of a market in line with industrial development. Evidence of this would be afforded by the high levels of excess capacity. Concomitantly, industrialization in Brazil would thereby be centered upon sumptuary goods, beyond the reach of popular consumption. For that reason, these goods would not be part of the value of a super-exploited labor force, since workers would then cease to be part of the market which capitalists are aiming to capture. The author points out that, in the central countries, the tendency to market contraction through the reduction of workers’ consumption is countered by the adaptation of technology to the domestic market, something which he does not demonstrate, and by the expansion to foreign markets . Marini overestimates the capacity of technological adaptation in the central countries without presenting any evidence. On the other hand, he does not formulate the problem in historical terms. Even if, to some degree, this adaptation to smaller scales were possible over a certain period, this situation would not be feasible for an indefinite amount of time. Because, even without excess capacity, the technology adapted to smaller scales implies, in economic terms, larger total productive costs. Therefore, those capitals which fit this description would be the ones which, once the moment of crisis sets in, would perish against large scale capitals. In addition, his hypotheses do not correspond with what effectively happened in Latin American countries, at least in regards to the automotive industry, one of the main recipients of foreign direct investment. It is not true that the technology utilized in countries of the periphery was not, to a certain extent, adapted to the scale of domestic markets. Marini considers that Brazil cannot avoid the impact of the increase in productivity over the domestic market because technology would not be controlled by the local bourgeoisie and because the external markets would be dominated by the imperialist countries. Thus, the Brazilian bourgeoisie was obliged to associate itself with imperialist capital offering it the possibility of extraordinary profits, wholly dependent on cheap labor. On this basis, industry would aim at the external markets. This alternative, contrary to the arguments of Argentine nationalists, does take into account the origins of Brazilian adversities. The neighbor’s always looks better Both in Argentina and in Brazil, capital was not capable of creating an industry at the level of American industry. But while the Argentine nationalists complain about having been prevented from developing like Brazil, it looks as though Brazilians would have preferred being like Argentina and limit themselves to the internal market. In both visions, imperialist capital seems to guide itself on the premise of maintaining underdevelopment, expressed in the smaller scale plants and productivity, although it is not clear why imperialism chooses different paths in each case. However, the explanation is actually simpler once the logic of capital is understood. The factories which were created were, in both cases, smaller in size and had backward machinery compared to that of its countries of origin due to size of the market in which they operated. Even if production had been centralized in the hands of a single capital, that is, a monopoly, the average world-scale productivity could not have been achieved. On the other hand, the fact that companies had excess capacity shows that bringing equipment with higher productive capacity to Argentina or Brazil would have been uneconomical. The search for external markets was an explicit policy of foreign terminals, both in Brazil and Argentina . The countries where this possibility did not prosper were those whose domestic markets were small, as in the Argentinean case, and did not have the necessary productivity to compete even in the Latin American market. Brazil, the then major competitor of Argentina, had a higher productivity given the scale of its factories, which operated in a larger internal market and, therefore, had less costs. The emptiness left by the lack of analysis of concrete data is supplanted with a mystical and religious appeal to imperialism. In these nationalist perspectives of economics, foreign capitals are “evil” and, by mere opposition, national capitals are “good.” As anyone who can add two and two knows, between capitalists there are no good and evil ones, but simply entrepreneurs who seek to maximize profit on the back of workers. Be they national or foreign, in Argentina, Brazil or the USA, the problem is not solved by removing the foreign bourgeoisie, but the whole bourgeoisie. In this point, lies the difference between the nationalist dreamers and the socialist revolutionaries. Notes Schvarzer, Jorge: La industria que supimos conseguir, Ediciones Cooperativas, Bs. As., 2000. Schvarzer, also known as Victor Testa, was a disciple of Milcíades Peña. Peña’s position can be found in ‘Industrialización y clases sociales en la Argentina’, Hyspamerica, Bs.As., 1986. Jenkins, Rhys: “Internationalization of Capital and the Semi-Industrialized Countries: The Case of the Motor Industry”, in Review of Radical Political Economics, Vol. 17, nº 1-2, 1985. Marini, Ruy Mauro: La dialéctica del desarrollo capitalista en Brasil. Subdesarrollo y revolución, Siglo XXI, 1985 y Dialéctica de la dependencia, Ediciones Era, México, 1973. Strictly speaking, this argument is erroneous: the increase in productivity does not necessarily displace workers, as long as total production can increase at a faster rate, as a result of the expansion toward foreign markets or by the expansion of the domestic market. Indeed, the domestic market, in a context of increasing total investment, will expand so that, on one hand, this will generate more demand for the product in question, and on the other, the cheapening of the commodity produced in better technical conditions will make it accessible to new tiers of consumers. This can be seen in the report of the Asociación de Fábricas de Automotores: Los factores que distorsionan la formación de los costos en la industria automotriz, 1969.

<urn:uuid:e561c075-2e9f-45b9-915e-a56f5b05e768>

CC-MAIN-2016-50

http://razonyrevolucion.org/putting-the-blame-on-imperialism-by-ianina-harari/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Presentation on theme: "Introduction to GDP Basic overview: Geographic Data Processing, GIS, what types of data, what applications?"— Presentation transcript: Introduction to GDP Basic overview: Geographic Data Processing, GIS, what types of data, what applications? Topics GDP part of course Basic knowledge geography, cartography GIS data and representation GIS data sources and acquisition GIS data structures GIS analysis Label placement Terrain algorithms Trajectory algorithms Route planning LiDAR data and processing This lecture What is a GIS? Examples of applications of GIS Basic functionality of GIS What is typical about GIS? What software and companies? Role of computer science What is GIS? Definitions A powerful set of tools for collecting, storing, retrieving at will, transforming and displaying spatial data from the real world (Burrough, 1986) A system for capturing, storing checking, manipulating, analysing and displaying data which are spatially referenced to the Earth (Dept. of Environment, 1987) An information technology which stores, analyses, and displays both spatial and non-spatial data (Parker, 1988) Definitions, continued A database system in which most of the data are spatially indexed, and upon which a set of procedures operated in order to answer queries about spatial entities in the database (Smith et al., 1987) A decision support system involving the integration of spatially referenced data in a problem solving environment (Cowen, 1988) Differences Similarities Set of tools System Database system Decision support system Also: A technology Spatial data is essential At the least an aid for input, storage, manipulation, analysis and visualization of data Most common use of GIS Management of geographic data –land use –land ownership –date of origin of features (e.g. buildings) –... with a possibility of querying Important example use Site planning: find locations that satisfy a combination of properties (e.g. for VINEX locations): –not built up –not forest –near a train station –at least 8 km 2 –... What is typical about GIS? Applications are spatial Problems are not well-defined: multiple criteria must be met simultaneously, concepts often not well- defined (e.g. Groene Hart, surroundings of Arnhem) Data is unreliable, expensive to get, sometimes outdated, sometimes only partially relevant, difficult to integrate,... Firsts of data storage, I Geometric and attribute data Geometry: several map layers Attribute: as in normal databases municipality Zierikzee population ….. Firsts of data storage, II Geometry: vector and raster representation (4.234 Lon, Lat) (4.237 Lon, Lat) Output of a GIS Maps - theme choice - stacking order choice - colors, projection, etc. Tables, states Query results: “There is x square meter with the requested properties” Analysis results (e.g., for decision support) Another example use and output More examples Pollution Natural disasters Management (road, water,...) Planning earthquakes and break lines outcome of air pollution analysis GIS in the Netherlands: data Cadastral offices (GBKN) Topographic Service (TOP10vector, raster) Road and Water Management (NWB) Elevation (AHN) Subsurface (TNO) Pollution data, health data (TNO, RIVM) Census bureau: CBS (statistical data) Companies (road networks) Actueel Hoogtebestand Data comes with metadata –Average error 5 cm –Standard deviation 15 cm –Filtering of houses, trees, cars,... Price: 150,000 for the original data points; 75,000 for the 5m grid Actueel Hoogtebestand, from 2012 Second version: data for every 0.5 x 0.5 meters 135 billion data values for the Netherlands Price: 455,000 for the original data points; 227,500 for the 0.5m grid Cadastre/Topographic Service TOP10vectorTOP10roads Subscription, per 1 km 2 : 1.50 For all of NL: 42,500 Cadastre/Topographic Service TOP50rasterTOP250raster TOP10raster without text TOP10raster with text Cadastre/Topographic Service Postal code regions, 6 digit: 13,325 Postal code regions, 5-digit: 1340 Postal code regions, 4-digit: 178 Cadastral map, 1 parcel: 0.66; from 1,000,000 parcels: 0.40 per parcel GBKN raster, per 0.5 km 2 : 1.45 (the Netherlands has 33,800 km 2 ) GIS in the Netherlands: users RIVM Cadastre (including Topografische Dienst Nederland) TNO (defense, security and safety; built environment and geosciences) Alterra (agricultural research) Rijkswaterstaat (ministery of Verkeer en Waterstaat) Companies Universities (research): physical and human geography, cartography, archeology, biology, meteorology, geophysics, geology, …. Application areas: general Socio-economic/ government –Health –Local government –Transport planning –Service planning –Urban management Utilities –Network management –Service provision –Telecommunications –Emergency repairs Commerce & business –Market share analysis –Insurance –Fleet management –Direct marketing –Target marketing –Retail site location Environment –Pollution monitoring –Natural hazard assessment –Resource management –Environmental impact assessment GIS in the Netherlands: research ITC: International Institute for Aerospace Survey and Earth Sciences (Enschede) Universities (e.g., Delft, Utrecht, Wageningen) GIS: types of companies GIS, general software (ESRI, Intergraph, MapInfo, Oracle, Geodan, Logica) Route planners (TomTom, Garmin, Siemens, Magellan) Internet (geographic search engines/geographic IR, Google Maps/Earth, MapQuest,...) Data services, training, consultancy, applications Main GIS company: ESRI (Environmental Systems Research Institute) Since 1969 (!) 70 th largest software company (in 2008) Software of ESRI ArcGis: GIS ArcView: desktop mapping ArcExplorer: GIS data viewer and query tool via map MapObjects: library to add GIS functionality to Windows applications Spatial Database Engine: client/server software to adjoin GIS to existing DBMS (Oracle, Sybase, Microsoft SQL server, …) ArcLogistics, ArcCAD (GIS functionality in AutoCAD), ArcFM (facilities management), NetEngine (network analysis), Maplex (label placement) Software of ESRI for Internet ArcIMS (Internet Mapping Solutions): GIS ArcView IMS (Internet Map Server): desktop mapping on the Internet MapObjects IMS: library to add GIS functionality to Windows applications Software with GIS features Desktop mapping (Freehand, Map Maker, PolyMap) Car Navigation Systems (TomTom, Garmin, Magellan) Landuse Information Systems Software for (geo)statistics, interpolation (SYSTAT) Computer science issues of GIS Databases (Geometric) algorithms Graphics, scientific visualization Knowledge technology, decision support systems Combinatorial optimization Interface design

<urn:uuid:c9f17709-6d8e-410a-b949-7e7f0943b228>

CC-MAIN-2016-50

http://slideplayer.com/slide/2488731/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Presentation on theme: "Comprehension test. STEP 1: Carefully read the following sentences and organized them to build a coherent paragraph. Do not refer to the tale until you."— Presentation transcript: STEP 1: Carefully read the following sentences and organized them to build a coherent paragraph. Do not refer to the tale until you have completed the task so that you can verified your answers and accuracy. Good luck!! 1 st paragraph 1. He was a man of exuberant fancy, and, withal, of an authority so irresistible that, at his will, he turned his varied fancies into facts. 2. When every member of his domestic and political systems moved smoothly in its appointed course, his nature was bland and genial; but whenever there was a little hitch, and some of his orbs got out of their orbits, he was blander and more genial still, for nothing pleased him so much as to make the crooked straight, and crush down uneven places. 3. IN THE very olden time, there lived a semi-barbaric king, whose ideas, though somewhat polished and sharpened by the progressiveness of distant Latin neighbors, were still large, florid, and untrammelled, as became the half of him which was barbaric. 4. He was greatly given to self-communing; and, when he and himself agreed upon any thing, the thing was done. 6th Paragraph 1. He could open either door he pleased: he was subject to no guidance or influence but that of the aforementioned impartial and incorruptible chance. 2. It was the duty and the privilege of the person on trial, to walk directly to these doors and open one of them. 3. When all the people had assembled in the galleries, and the king, surrounded by his court, sat high up on his throne of royal state on one side of the arena, he gave a signal, a door beneath him opened, and the accused subject stepped out into the amphitheatre. Directly opposite him, on the other side of the enclosed space, were two doors, exactly alike and side by side. 4.The moment that the case of the criminal was thus decided, doleful iron bells were clanged, great wails went up from the hired mourners posted on the outer rim of the arena, and the vast audience, with bowed heads and downcast hearts, wended slowly their homeward way, mourning greatly that one so young and fair, or so old and respected, should have merited so dire a fate. 5. If he opened the one, there came out of it a hungry tiger, the fiercest and most cruel that could be procured, which immediately sprang upon him, and tore him to pieces, as a punishment for his guilt. 9 th Paragraph 1. When the people gathered together on one of the great trial days, they never knew whether they were to witness a bloody slaughter or a hilarious wedding. 2. The institution was a very popular one. 3. Thus, the masses were entertained and pleased, and the thinking part of the community could bring no charge of unfairness against this plan; for did not the accused person have the whole matter in his own hands? 4. This element of uncertainty lent an interest to the occasion which it could not otherwise have attained. 14 th Paragraph 1. A door beneath the royal party opened, and the lover of the princess walked into the arena. 2. Tall, beautiful, fair, his appearance was greeted with a low hum of admiration and anxiety. 3. The signal was given. 4. All was ready. 5. Half the audience had not known so grand a youth had lived among them. No wonder the princess loved him! What a terrible thing for him to be there! 16 th Paragraph 1. It was one of tile fairest and lovelies of the damsels of the court who had been selected as the reward of the accused youth, should he be proved innocent of the crime of aspiring to one so far above him; and the princess hated her. 2. And not only did she know in which room stood the lady ready to emerge, all blushing and radiant, should her door be opened, but she knew who the lady was. 3. The girl was lovely, but she had dared to raise her eyes to the loved one of the princess; and, with all the intensity of the savage blood transmitted to her through long lines of wholly barbaric ancestors, she hated the woman who blushed and trembled behind that silent door. 4. Often had she seen, or imagined that she had seen, this fair creature throwing glances of admiration upon the person of her lover, and sometimes she thought these glances were perceived and even returned. 5. Now and then she had seen them talking together; it was but for a moment or two, but much can be said in a brief space; it may have been on most unimportant topics, but how could she know that? 24 th Paragraph 1. when she had seen the priest, with his joyous followers, advance to the couple, and make them man and wife before her very eyes; 2. How her soul had burned in agony when she had seen him rush to meet that woman, with her flushing cheek and sparkling eve of triumph; 3. But how much oftener had she seen him at the other door! 4. How in her grievous reveries had she gnashed her teeth, and torn her hair, when she saw his start of rapturous delight as he opened the door of the lady! 5. when she had seen him lead her forth, his whole frame kindled with the joy of recovered life; when she had heard the glad shouts from the multitude, and the wild ringing of the happy bells; 6. and when she had seen them walk away together upon their path of flowers, followed by the tremendous shouts of the hilarious multitude, in which her one despairing shriek was lost and drowned!

<urn:uuid:3757bc91-992d-47d9-a8b7-6e72bf9e3e3a>

CC-MAIN-2016-50

http://slideplayer.com/slide/3925837/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

The enduring mental health impact of the September 11th terrorist attacks: challenges and lessons learned. Ozbay-F; Auf der Heyde-T; Reissman-D; Sharma-V Psychiatr Clin N Am 2013 Sep; 36(3):417-429 The authors review the existing literature on the mental health impact of the September 11th attacks and the implications for disaster mental health clinicians and policy makers. The authors discuss the demographic characteristics of those affected and the state of mental health needs and existing mental health delivery services; the nature of the disaster and primary impacts on lives, infrastructure, and socioeconomic factors; the acute aftermath in the days and weeks after the attacks; the persistent mental health impact and evolution of services of the postacute aftermath; and the implications for future disaster mental health practitioners and policy makers. Key points:1) Training emergency response staff to carry out potentially traumatizing tasks that normally fall outside their scope of work before a disaster or before their deployment and limiting the length of shifts and total duration of work may reduce psychiatric morbidity in disaster workers. 2) Clinicians who treat disaster survivors must be familiar with the changing needs of a traumatized population over the course of time. 3) Once chronic, posttraumatic stress disorder (PTSD) is a difficult condition to treat and is often comorbid with other major psychiatric disorders. Early interventions administered by well-trained, culturally and linguistically capable clinicians may prevent chronic PTSD and the myriad of comorbid psychiatric conditions that consume a substantial amount of resources in the long-term. 4) In the long-term, resources should be allocated to maintain an infrastructure to continue public outreach and psychoeducation while training clinicians in advanced and evidence-based treatments to address the complex comorbidity associated with chronic PTSD. Emergency-response; Emergency-responders; Rescue-workers; Job-stress; Mental-disorders; Mental-health; Mental-illness; Mental-stress; Psychological-adaptation; Psychological-disorders; Psychological-reactions; Psychological-responses; Psychological-stress; Health-care; Health-programs; Health-services; Medical-care; Medical-monitoring; Stress; Emotional-stress Fatih Ozbay, MD, The WTC Mental Health Program, Icahn School of Medicine at Mount Sinai, New York, NY. Psychiatric Clinics of North America

<urn:uuid:cc8b468f-c2e9-4f26-b531-ace3cad57d86>

CC-MAIN-2016-50

http://www.cdc.gov/niosh/nioshtic-2/20043094.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

In the early hours of Tuesday morning, the world was shocked to discover that one of Hollywood’s most successful and much-loved actors, Robin Williams had died. The 63-year-old was found unresponsive in his home in San Fransisco, U.S., just before midday on Monday and was pronounced dead at the scene. Details have since surfaced that the cause of death seems to have been suicide, and Williams’ publicist confirmed that the actor had in fact been “battling severe depression” over the past few months. Although in the past Williams has openly struggled with alcohol and drug addiction (he was in and out of rehab during his adult life) little did anyone know that the Oscar winner was also contending with one of the most debilitating psychological disorders in the world. According to the Mental Health Foundation, depression affects one in five older people and suicide rates show that men in Britain are three times as likely to die by suicide than women. A complicated illness, depression is characterised by a vast spectrum of troubling emotions and physical issues that many sufferers describe as a ‘prison’. Ultimately, Williams’ unexpected death raises the serious question of why some people – men in particular – continue to suffer in silence and find it difficult to open up about their mental health issues. We spoke to one of our listed counsellors, Myra Eadie who explains how childhood experiences and societal pressures can shape male perspective of depression. “Men are conditioned from an early age to be strong and not show or express certain emotions. Phrases like: ‘Don’t be a cry baby’ and ‘be a big brave soldier’ spring to mind,” Eadie says. “Yet feelings when expressed safely and appropriately actually help solve repetitive problems.” Eadie also highlights that men are more likely to view depression as a weakness rather than a treatable condition. When under stress, they are also prone to anger, irritability, and physical symptoms such as backache, headache and skin conditions – all of which can mask depression. A combination of these factors can make it hard for sufferers to recognise they need help and this may lead them to become trapped in a negative cycle of troubling emotions. Eadie adds: “Women tend to talk to each other and are more inclined to reveal their fears and concerns, and in doing so are supported in finding a solution and to realising they are not alone.” Although it is still not known exactly why Robin Williams sadly decided to end his life, it is quite possible that depression – and the isolation and long-term unhappiness it can bring – played a significant part. If you are worried that you or someone you love may be suffering from depression it is vital that you seek help. Contacting your GP or a counsellor is the first step towards recovery, and from here you will be prescribed medication or offered therapy sessions that will be suited to your specific needs.

<urn:uuid:94211797-300e-4417-8175-8e14f353a98b>

CC-MAIN-2016-50

http://www.counselling-directory.org.uk/blog/2014/08/13/robin-williams-depression

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Just when you might have thought Christmas was getting just that bit too materialistic and commercialised, comes good news from Oxfam. Last week we covered the launch of Oxfam's first ever children's gift range and this week comes some heart-warming research from Oxfam: 71) of parents of young children (5-7 year-olds) believed their children would like to receive a Christmas gift that would actually help other less fortunate children around the world, according to the research carried out by YouGov. Many of these parents also thought that Christmas should be less money-orientated, with four out of five (81) saying that the festive season is a time to think of those less fortunate than us. Leading child expert Jean Gross, author of 'Psychology and Parenthood', commented: "Encouraging empathy and compassion in children from a young age builds their core social and emotional awareness skills, which can not only reduce aggression, depression and anti-social behaviour but develop resilience, optimism and self-worth. "The new Oxfam Unwrapped kids' range is an ideal stepping stone for parents. The gifts are designed to help children feel connected with young people living in poverty and to open their eyes to different social issues, from health and education to the fact that girls in some parts of the world get less chance of an education than boys. Children receiving these gifts feel empowered about the role they can play in helping others and in the long-term can become better-rounded individuals." Rick Lay, Oxfam Unwrapped manager said: "We saw that parents were starting to buy gifts from our Oxfam Unwrapped charity range for their children as well so went about creating a range designed just for them. There are children living in poverty all over the world who benefit hugely from these gifts, something as simple as playtime can help teach them about health through games and songs, while desk and chair sets give them access to an education which can change their lives forever. "Opening presents and stockings is a big part of Christmas day for kids so toys definitely have their place, but hopefully charity gifts can be part of the mix." Do you think children should think more about others less fortunate than themselves? Do you think Christmas has become too materialistic? Or do you think it's the one time in the year you and your family can spend and enjoy? Please give us your comments below. Suggested For You Get top stories and blog posts emailed to me each day. Newsletters may offer personalized content or advertisements. Learn more

<urn:uuid:768c372e-f9c4-4982-b9ee-bad4eb638252>

CC-MAIN-2016-50

http://www.huffingtonpost.co.uk/2010/11/16/christmas-should-be-a-time-to-think-of-others-say-most-parents_n_7393762.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Weight training: Do's and don'ts of proper technique Effective weight training depends on proper technique. Follow these do's and don'ts to maximize your weight training program.By Mayo Clinic Staff You don't have to be a bodybuilder or professional athlete to reap the benefits of weight training. When done correctly, weight training can help you lose fat, increase your strength and muscle tone, and improve your bone density. If done incorrectly, however, weight training won't give you these benefits — and may even lead to injury. Check your technique You might learn weight training techniques by watching friends or others in the gym, but sometimes what you see isn't safe. Incorrect weight training technique can lead to sprains, strains, fractures and other painful injuries that may hamper your weight training efforts. If you're just getting started, work with a knowledgeable weight training specialist — a physical therapist, athletic trainer or other fitness specialist who's familiar with proper weight training technique. If you've been using weights for a while, consider scheduling time with a trainer to double check your technique and identify any changes you may need to make. Aug. 14, 2015 See more In-depth - Resistance training for health and fitness. American College of Sports Medicine. http://www.acsm.org/access-public-information/brochures-fact-sheets/brochures. Accessed June 24, 2015. - AskMayoExpert. What strength training recommendations should be given to patients? Rochester, Minn.: Mayo Foundation for Medical Education and Research; 2015. - AskMayoExpert. What are the components of a strength training program? Rochester, Minn.: Mayo Foundation for Medical Education and Research; 2015. - 2008 Physical Activity Guidelines for Americans. U.S. Department of Health and Human Services. http://www.health.gov/PAGUIDELINES/guidelines/default.aspx. Accessed June 25, 2015. - Garber CE, et al. American College of Sports Medicine position stand. Quantity and quality of exercise for developing and maintaining cardiorespiratory, musculoskeletal, and neuromotor fitness in apparently healthy adults: Guidance for prescribing exercise. Medicine & Science in Sports & Exercise. 2011;43:1334. - Growing stronger — Strength training for older adults. Centers for Disease Control and Prevention. http://www.cdc.gov/physicalactivity/growingstronger/faq/index.html. Accessed July 1, 2015. - Brown LE, et al. Strength Training. Champaign, Ill.: Human Kinetics; 2007:279. - Selecting and effectively using free weights. American College of Sports Medicine. http://www.acsm.org/access-public-information/brochures-fact-sheets/brochures. Accessed June 24, 2015.

<urn:uuid:aa791db3-5775-4a28-8c4d-182e80052913>

CC-MAIN-2016-50

http://www.mayoclinic.org/healthy-lifestyle/fitness/in-depth/weight-training/art-20045842?reDate=30072016

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

|Oregon State Bar Bulletin JANUARY 2007| Perplexing plurals and possessives By Suzanne E. Rowe A few years ago, a British writer named Lynne Truss became famous for a little book subtitled "The Zero Tolerance Approach to Punctuation." On the back flap, she’s seen surreptitiously adding an apostrophe to a movie billboard for "Two Weeks Notice." Ms. Truss knew that the two weeks hadn’t noticed anything, so the plural "weeks" was incorrect. The title should have been "Two Weeks’ Notice," though Ms. Truss and I were surely the only movie-goers who boycotted on grammatical grounds. To avoid having Ms. Truss mark up your documents for faulty plurals and possessives, just review this short column. If you’re an English whiz, skip the next section and pick up with the hard stuff. This column is essentially about nouns in their various forms, some of which need apostrophes and some of which don’t. Folks of my generation remember from "Grammar Rock" that a noun is "a person, place or thing." When a noun refers to one person, place or thing, we call it "singular." When a noun refers to more than one person, place or thing, we call it "plural." So lawyer is singular, and lawyers are plural. The office is singular, and the offices are plural. As shown in the two examples above, English typically forms the plural by adding –s. As another example, the plural of statute is statutes. If the noun ends in a sound that doesn’t readily combine with an s sound, English forms the plural by adding –es. So words that end in s, sh, x, z or ch typically take –es. Examples include boxes and witches. In addition to the many words that follow these simple rules, English is filled with words that have irregular plurals. The plural of "child" is "children." A single "crisis" can become a series of "crises." A dictionary will generally list plurals for nouns that do not follow the basic forms. Nouns are lucky because they get to have stuff. We call that fortunate state of affairs "possession." The lawyer may have a new car. We call it the "lawyer’s car." The possessive form is easy to form in the simplest cases. A singular noun becomes possessive with the addition of –’s. Thus, in the example above, the possessive of lawyer is lawyer’s. Similarly, if a witch has a favorite broom, we would call it the witch’s favorite broom. Note that journalists get away with cutting corners. While the papers announce "Kansas’ primary" and "Congress’ recess" (a pattern, incidentally, adhered to by the Bulletin), the rule followed by curmudgeons like me is still to add an –’s to those singular forms, not just an apostrophe. In formal documents, please use "Kansas’s primary" and "Congress’s recess." The plural noun generally ends in –s already, so we add just an apostrophe. The broom preferred by many witches is the witches’ favorite broom. For irregular plurals that do not end in –s, we add –’s, e.g. a children’s game. Welcome back, English whizzes. This is where things get tricky. Apostrophes and plurals To be safe, avoid using an apostrophe to make a word plural. WRONG: Orange’s — $1.00 each! The rest of the world may assume that oranges are for sale and that each one costs a dollar. A grammar curmudgeon like me wonders what that singular orange possesses that’s worth a dollar. Or maybe the orange has a one-dollar bill? Don’t be tempted to use apostrophes to create plurals, even with less common nouns: The 1980s were difficult years. (No apostrophe needed in 1980s.) Distributions from the IRAs will begin in three years. (No apostrophe needed in IRAs.) The rare situations where apostrophes are used to create plurals include words made of lowercase letters (x’s and y’s) and interior periods (Ph.D.’s). The many x’s and y’s of algebra confused him. The interview room was filled with Ph.D.’s looking for jobs. Difficult family names Devilish details show up with our clients whose names end in –s, especially the Adams family and the Jones clan. Remember the basic rule: don’t try to make a plural with an apostrophe. Everyone is trying to keep up with the Joneses (add –es to form the plural). The form Jones’s (with an apostrophe) refers to something that one of the Jones family members owns. Here’s a quick summary of examples: Ms. Williams has been in practice for 10 years. (singular) Ms. Williams’s practice is flourishing. (singular possessive) The Williamses are going on vacation for two weeks. (plural) The Williamses’ house will be vacant for that period. (plural possessive) Confused? When you’ve asked your secretary and two colleagues and read through a style manual and still do not know what to do with a challenging noun, consider rewriting the sentence to use "of" to show possession. Instead of stressing over "the Davises’ anniversary," just write "the anniversary of Mr. and Mrs. Davis." Its v. it’s One of the most common mistakes in the possessive form concerns the little word "its." The possessive form of the pronoun "it" is "its." For example: The dog hid its bone behind the barn. Or for a more legal example: The court announced its ruling. In contrast, the contraction "it’s" is a substitute for the two words "it is." For example: It’s important to understand the alternate meanings of the statute. Many of us who know these rules well still misuse them in legal documents. One easy way to check is to read every sentence containing "it’s" as though "it is" were written instead. If you don’t mean "it is," take out the apostrophe. (Remember that you can use your word processor’s "find" function to locate every instance of "it’s" in your document.) Here’s another way to check your use of "its" versus "it’s." A contraction always has an apostrophe; the apostrophe indicates that at least one letter has been omitted. Examples of other contractions include "don’t" (for "do not") and "can’t" (for "cannot"). Some possessives have apostrophes (the lawyer’s winning argument), but others don’t (the argument was hers, not his). See if memorizing this jingle helps: Don’t leave out bits of his, hers and its. The contraction at the beginning should remind you that "don’t" is a substitute for "do not," just as "it’s" is a substitute for "it is." The apostrophe takes the place of a bit of those words. The list of possessive words at the end of the jingle should help you remember that "its" is similar to other possessives that don’t use apostrophes, namely "his" and "hers." Note that a combination of those letters ending with an apostrophe — its’ — is not a word, although it is a frequent typo. Generally, do not make the –s or the apostrophe italicized, even when they connect with italicized words like newspaper titles. Look closely at the examples below; those last letters are not italicized. The Register-Guard’s editorial page covered the matter in depth. (singular possessive) Five Oregonians were sitting on the front steps, suggesting the occupants of the apartment were away. (plural) One more hint about nouns, possessives and the importance of the apostrophe. Sometimes nouns share possession; sometimes they don’t. The form "Jay and Sam’s office" contains one apostrophe, which means that the two men share the office. By contrast, the form "Jay’s and Sam’s offices" shows that they each have a different office. Two apostrophes, two offices. This form can be more challenging when the noun possessed is plural in both instances, as in "Lee and Lyn’s letters." This example with one apostrophe refers to the letters Lee and Lyn wrote to each other. If both were possessive (i.e. two apostrophes), as in "Lee’s and Lyn’s letters," we would assume both had letters, not necessarily written to each other. When using a compound term like "attorney general," make the plural with the noun. Thus, more than one "attorney general" is a group of "attorneys general," not "attorney generals" (they’re not in the military) and certainly not "attorney general’s" (no apostrophes in plurals, remember). The possessive of this example is the "attorney general’s opinion." While this seems an exception to the rule above, consider the confusion created by the "attorney’s general opinion." (Is her general opinion different from the A.G.’s specific one?) To make the plural possessive, opt for an alternate form using "of," e.g. the "opinions of several attorneys general." Even if your clients, Mr. and Mrs. Jones, aren’t curmudgeons about other points of grammar, they may expect their name to appear — in plural and possessive forms — the way they’re accustomed to seeing it. As the Chicago Manual of Style admits, "feelings on these matters sometimes run high." Sensitivity to the reader is advised. Sources: Chicago Manual of Style: The Essential Guide for Writers, Editors, and Publishers (15th ed. 2003); Bryan A. Garner, A Dictionary of Modern Legal Usage (2d ed. 2001). ABOUT THE AUTHOR Suzanne E. Rowe is an associate professor at the University of Oregon School of Law, where she directs the Legal Research and Writing Program. She is grateful to Amy Nuetzman of Oregon’s Academic Learning Services for comments on this article. © 2007 Suzanne E. Rowe

<urn:uuid:88cb8bde-5581-4b91-a5b5-a6513fa2f09c>

CC-MAIN-2016-50

http://www.osbar.org/publications/bulletin/07jan/writer.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Japanese railway workers check an overpass, keeping it safe for the "bullet train" below. (Kyodo) Leaving over 100 people dead, the June 3, 1998, derailing of a German Intercity Express (ICE) high-speed passenger train gave quite a shock to railway authorities in Japan. Particularly shaken were Japan Railway (JR) companies, which operate their Shinkansen super-express trains (often called "bullet trains") at speeds of 200 to 300 kilometers (125 to 185 miles) per hour, on schedules timed down to the minute. Emergency inspections are being conducted on all Shinkansen trains and detailed information on the cause of the ICE crash is being compiled by these companies to help ensure future safety. Immediate Inspection of Trains, Crossings The ICE accident occurred when the train was traveling at 200 kph (125 mph). All cars except for the lead engine derailed, smashing into the concrete supports of an overpass and coming to rest in a mangled heap. A broken wheel on the first passenger car has been fingered as the direct cause of the accident. News of the catastrophe was taken very seriously by JR companies, which immediately implemented safety checks on their railways, conducting complete inspections of all Shinkansen cars and elevated crossings. Japan's Shinkansen trains began operation in 1964. In over 30 years of operations, the Shinkansen have recorded no fatal accidents among their more than 3 billion passengers. This legendary safety is supported by a multi-layered inspection and operation system. Regular inspections of the wheels, axles, chassis, and other parts keep trains in good working condition. There are four levels of inspection: those conducted every 2 days, every 30 days or 30,000 kilometers' (18,500 miles') traveling distance, once a year or every 450,000 kilometers (280,000 miles), and every three years or 900,000 kilometers (560,000 miles). Trains are inspected visually and by using ultrasonic and magnetic techniques to check...

<urn:uuid:a60a2909-2ad8-41e6-ab89-3cecc5d1a988>

CC-MAIN-2016-50

http://www.studymode.com/essays/Train-Crash-1333112.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

An article in the Annals of the Association of American Geographers (June 1992) revealed that only 133 of 337 randomly selected residences in Los Angeles County were protected by earthquake insurance. -What are the appropriate null and alternative hypotheses to test the research hypothesis that less than 40% of the residents of Los Angeles County were protected by earthquake insurance? -Do the data provide sufficient evidence to support the research hypothesis, using alpha=0.10 -Calculate the p-value for the test. The solution is attached in Word as a 186 explanation of how to calculate a p-value and decide if evidence sufficiently supports a hypothesis.

<urn:uuid:070e8a5d-7b7c-40f8-9b3e-aff9156f14b8>

CC-MAIN-2016-50

https://brainmass.com/statistics/hypothesis-testing/inferences-based-on-single-sample-45616

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Title: Looking at Lincoln Author & Illustrator: Maira Kalman Check out the interview (Seven Impossible Things Before Breakfast) Publisher: Nancy Paulsen Books, 2012 Book Type: Non-Fiction Themes: Presidents, Civil War, American History Synopsis (from Amazon website): Abraham Lincoln is one of the first giants of history children are introduced to, and now Maira Kalman brings him to life with her trademark style and enthusiasm. Lincoln’s legacy is everywhere – there he is on your penny and five-dollar bill. And we are still the United States because Lincoln helped hold them together. But who was he, really? The little girl in this book wants to find out. Among the many other things, she discovers our sixteenth president was a man who believed in freedom for all, had a dog named Fido, loved Mozart, apples, and his wife’s vanilla cake, and kept his notes in his hat. From his boyhood in a log cabin to his famous presidency and untimely death, Kalman shares Lincoln’s remarkable life with young readers in a fresh and exciting way. This book was based off an on-line tribute that Maira Kalman authored and illustrated for the New York Time in 2009. I highly recommend checking out. ProTeacher! website contains links to for various Abraham Lincoln classroom activities: crossword puzzles, lesson plans, reading list, etc. PBS documentary series “Abraham and Mary Lincoln: A House Divided” may be interesting for older students and adults. I just found out about it, looks interesting. Why I Like This Book: Beautiful tribute with a contemporary voice and bright, bold colored gouche illustrations that will hook any reader young or old. This is not your typical picture book biography. The story reads as if you are listening to a friend tell you about her day “One day, while walking through the park on my way to breakfast I saw a very tall man. He reminded me of someone, but I could not think who … And then I remembered. The man I had seen looked exactly like Abraham Lincoln.” The author doesn’t just spew out a lot of facts but also theorizes about Lincoln’s thoughts, reminding readers that our 16th president was just an ordinary person too. “What was he thinking about? He was thinking about democracy … And maybe he was also thinking about getting a birthday present for his little son. Maybe a whistle. Or pickup sticks.” Text which are the narrator’s thoughts are in a different font from the factual information. The highlights of this book are the illustrations. Especially the final few pages. The spread about the assassination, with the pistol on the left with the empty rocking chair and fallen top hat on the right made me pause for a bit. Equally moving in an uplifting way are the final two spreads letting readers know that Abraham Lincoln will live FOREVER. The book also has Notes and Bibliography sources at the end. I loved this book, except for one topic which really bothered me, regarding the reason the Northern and Southern states went to war. In a picture book format for young kids facts, thoughts, the truth will be bent sometimes as the topic maybe too complicated or not appropriate for young readers. Below is the text that concerns me: It was a difficult time to be president. The Southern states (the Confederacy) wanted their own country where slavery was allowed. Lincoln said no. We must stay one country. The Northern states (the Union) believed that slavery should be abolished. And so they went to war. While the text does reference the Southern states wanting to secede and the North (Lincoln) saying no. The text implies that the issue was slavery, which would be an oversimplification. Wouldn’t it be better to simply state that the Southern states wanted to create their own country without giving a reason, thereby leaving it up to the teacher/parent/librarian to answer the child’s question of why, or that the Southern states wanted state governments to have more power. Neither of these alternate choices are much better, but I still think that would be more accurate than to say the Civil War was fought over humanitarian reasons. What do you think? This review is part of Susanna Leonard Hill’s Perfect Picture Book series. Visit her site to see the other books recommended. PPBF is on hiatus for the summer, however I will still continue to post book reviews. I may try different formats and may try to squeeze in one or two MG novels. As a result I may not have a consistent posting schedule for the summer, but rest assured I am still very interested in telling you about great children’s books. If you would like to stay current with what I am reading, click Goodreads and then click on “follow reviews” button to get my updates.

<urn:uuid:0c5a8165-7b37-4703-9b7b-43039b491462>

CC-MAIN-2016-50

https://floweringminds.wordpress.com/2012/06/15/looking-at-lincoln/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

George Washington Parke Custis inherited the 1100-acre estate from his father, the only surviving son of Martha Washington. Like John Parke Custis, G.W.P. Custis was raised at Mount Vernon, and he dedicated much of his life to perpetuating the memory of George Washington. He commissioned George Hadfield, the second architect of the US Capitol to design Arlington House. It was designed in 1818, and is the third representation of Greek Revival architecture in the United States. In 1803, Custis had constructed two wings, and Hadfield's design was erected between them. The house was constructed of locally made brick and its most prominent feature is the large 16' by 52' portico across the central section. The portico is formed by eight large stuccoed and marbleized brick Doric columns that support a massive central pediment. The house, sited prominently atop the hill, can be seen from many points in the District of Columbia. Robert E. Lee, who was related to Custis's wife, was a frequent visitor to Arlington from childhood until his marriage to Custis's only daughter, Mary. For the next 30 years, the Lees considered Arlington their home. In the Lee bedroom on April 19, 1861, Lee made his fateful decision to resign his US Army commission rather than take up arms against his native state following Virginia's secession from the Union. On April 22, he left Arlington forever. In 1928, following its authorization by Congress as a memorial to Lee, the house began to be restored by the War department. In 1933 the house and immediate grounds were transferred to the National Park Service. By that time, some structural changes made since 1861 had been reversed and many rooms had been partially furnished. Since, then further restoration has been completed. Arlington House is located in Arlington, Va., just across Memorial Bridge from the Lincoln Memorial. Check with your ranger at the door to see if guided tours will be offered during your visit. In lieu of a free guided tour, self-guided tours and audio (cell phone) tours of the house will be available during your visit. Arlington House is open to visitors every day from 9:30 a.m. to 4:30 p.m., with the exception of January 1st and December 25th when the Arlington National Cemetery is also closed. Metro stop: Arlington Cemetery.

<urn:uuid:939ba58b-5442-4946-bb57-626b155dbd42>

CC-MAIN-2016-50

https://www.nps.gov/nr/travel/wash/dc68.htm

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

Case Study 2: Software System Architecture Due Week 8 and worth 100 points Read the case study titled “A Patient Information System for Mental Health Care”, located in Chapter 1 of your textbook. Develop an overall architecture for the system described in the assigned reading. Your architecture should be based on any one of the common architectural patterns (e.g., Pipe and Filter architecture pattern). Your architecture should be documented in text and in UML diagrams (at minimum a class diagram and a sequence diagram). Write a two to four (2-4) page paper in which you: Describe your chosen architecture pattern. Explain why you selected the architecture of this case study. Explain how your chosen pattern could be applied to this case study. Describe any shortcomings associated with your chosen architecture pattern for the case study. Describe how your architecture could be implemented in hardware and software. Develop a UML diagram to document the architecture of the system through the use of Microsoft Visio or its open source alternative, Dia. Note: The graphically depicted solution is not included in the required page length.

<urn:uuid:f36d366d-3e11-48a6-96b5-d2f60fd6a793>

CC-MAIN-2016-50

https://www.sophia.org/tutorials/cis-331-week-8-case-study-2-software-system-architecture

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542412.97/warc/CC-MAIN-20161202170902-00373-ip-10-31-129-80.ec2.internal.warc.gz

en

I was reminded recently that not all the people who read this blog might be familiar with some of the terms, acronyms or abbreviations that I might use in my writing. So, I thought I’d start a list of definitions or explanations that some people might find helpful. The list often includes a link to a more detailed explanation elsewhere on the Internet in case you would like additional information on the subject. If I use a phrase or abbreviation that you are not familiar with, please drop me an email at firstname.lastname@example.org and I’ll do my best to give an explanation and then will add it to this list for future reference. - ACARS : Aircraft Communications Addressing and Reporting System. A datalink system for the transmission of short, simple messages between the aircraft and ground stations. It is used to transmit company position reports, to receive enroute weather, airport weather conditions and forecasts and to pass information to the departure and arrival stations. - ADS : Automatic Dependent Surveillance. A system that automatically sends aircraft position information via datalink to connected ATC centers. System operation is transparent to the flight crew. - AGL : Above Ground Level. An aircraft’s height above the terrain. See also MSL. - AIRMET : A weather advisory for conditions other than convective activity that may be hazardous to single-engine, other light aircraft or VFR pilots. The Airmet is issued for that conditions that are forecast to effect at least a 3000 square mile area. An Airmet Sierra includes Instrument Meteorological Conditions (IMC), Airmet Tango is for turbulence and Airmet Zulu is for icing conditions. [For convective activity see Sigmet.] - ALPA : The Airline Pilot’s Association. A union for professional pilots. - AOM : Aircraft Operating Manual. The airline I work for has this manual in two volumes. Volume I includes expanded explanations of the preflight inspections, checklists, Standard Operating Procedures, Standard Maneuvers and Configurations, International Operations and Aircraft Performance. Volume II includes explanations of the mechanical systems found on the airplane. - APD : Aircrew Program Designee. A pilot working under an airline training program who has been given the FAA’s blessing to conduct type-rating evaluations in the aircraft for which he/she is rated. - APU : Auxiliary Power Unit. A small jet engine usually located in the tail of the aircraft which is capable of providing electrical and pneumatic power to activate the aircraft’s systems. Bleed air from the APU is used to power the air conditioning systems on the ground and to start the main engines. - ATIS : Automatic Terminal Information Service. A means by which aircraft approaching an airport may obtain the latest weather conditions and runway in use at the airport. A recording is available over the appropriate radio frequency or a printed version may be available via datalink. - ASES : Aircraft, Single-Engine Sea. - CAFE Foundation : CAFE is an acronym for Comparative Aircraft Flight Efficiency. The CAFE Foundation is a non-profit, tax-exempt organization which creates and advances the understanding of personal aircraft technologies through research, analysis and education. The CAFE team arose mainly from members of Experimental Aircraft Association Chapter (EAA) 124, where the passion for personal aviation is strong. Volunteers from EAA 124 (Santa Rosa, CA)have formed the backbone of CAFE’s success. CAFE Foundation website. - Cat I/II/II minimums : Instrument approach minimums specifying the minimum weather required to fly the approach. Precision (ILS) approach minimums are usually require only a minimum visibility. Cat I approaches generally require an RVR of 1800′ or a half mile. Cat II approaches, in general, require an RVR of 1200′ or 1/4 mile, while Cat III C approaches have no visibility required for an autopilot/autoland approach (There are incrementally lower visibility requirements for Cat III A, B and C approaches, with C being the lowest). - CBs : Cumulonimbus clouds. Some good examples can be found here at weather pictures. - CBP : U.S. Customs and Border Protection. - COM : Cockpit Operating Manual. A manual carried in the pilot’s book bag which includes the checklists and troubleshooting processes for aircraft systems malfunctions, emergency procedures and supplemental information concerning abnormal operations, such as dispatch without an operating APU. - CPDLC : Controller-Pilot DataLink Communications. Communications between the flight crew and an ATC controller using text messages transmitted by datalink. The messages are largely pre-formatted. - DA(H) : Decision Altitude or Decision Height. The altitude on a precision instrument approach at which the decision must be made to continue the descent to landing or to execute the missed approach procedure. The aircraft will usually descend below this altitude in the transition from descending to executing a climb associated with the missed approach. - DH : deadhead leg. A leg of a trip or rotation during which the crewmember rides as a passenger. Deadhead legs are used to preposition a crew member to a location where they will be part of a working crew. DH legs are found in scheduled trips or are found on trips generated as a result of equipment substitution, weather disruptions or sick calls where the originally scheduled crew member is no longer able to fly the subsequent flight. - DHS : The Department of Homeland Security - DNIF : Duty Not Including Flying. A military term describing the work status of a military pilot who is too ill to fly, but not too sick to work at other jobs he/she may have been assigned. - EAA : Experimental Aircraft Association. An international aviation organization based in Oshkosh, WI. EAA has divisions dedicated to amateur building aircraft, warbirds, light sport aircraft and sport pilots, ultralights, and flight instruction. - EFC : Expect Further Clearance. Information given to an aircraft which has just been given holding instructions. It is a time in the future that the aircraft can reasonably expect to be given instructions to exit the holding pattern and proceed to the destination airport. - EGPWS : Enhanced Ground Proximity Warning System. A system installed on transport-category aircraft that uses a worldwide database of terrain coupled with the aircraft’s gps-derived position to provide a predictive warning of terrain ahead of the aircraft which may become a threat considering the aircraft’s current heading and altitude. - ELT: Emergency Locator Transmitter. A radio transmitter carried on most general aviation aircraft that broadcasts a signal in the event of an aircraft accident. ELT use was mandated by the FAA in 1973, requiring units that broadcast their signal on two emergency frequencies (121.5 and 243.0 MHz). These emergency frequencies were monitored by the international COSPAS-SARSAT satellite system. This type of ELT is prone to false activation and, as a result, has been replaced by a newer digital version broadcasting on 406 MHz. In Feb 2009 the satellite systems stopped monitoring the lower frequencies while retaining surveillance of the 406Mhz signals, however replacement of the older units has not yet been made mandatory in the U.S. - ETOPS : Extended-Range Twin-Engine Operations. An ETOPS rating is obtained for aircraft and aircraft operator by complying with FAA equipment and operation reliability requirements for long-distance flights. Without an ETOPS rating an aircraft with only two engines must always have a suitable landing alternate within 60 minutes of its location if an engine fails in-flight. ETOPS extends this to allow the alternate to be 90 minutes or more, up to a maximum of 180 minutes. Obtaining an ETOPS rating requires certification of the reliability of an airframe/engine combination as well as an airline’s flight operations and maintenance. Usually extra equipment is required as well, such as additional backup systems for electrical power - FMS : Flight Management System. An integration of aircraft sub-systems through Flight Management Computers which aids the pilot in controlling the aircraft by eliminating the need for many routine tasks and computations. It provides automatic navigation, performance optimization and automatic fuel monitoring as well as providing the information for the primary and navigation flight displays. - GPWS : Ground Proximity Warning System. An aircraft system which monitors the aircraft position and flight configuration in order to provide the pilot an aural and visual warning of an unsafe flight condition. Various modes of the GPWS system check for excessive descent rates, altitude loss after a take-off or go-around, glideslope deviations while on an instrument approach and excessive closure rates with terrain. the GPWS system uses inputs from the barometric and radio altimeters as well as landing gear and flap position sensors. An Enhanced version of the system (EGPWS) uses Global Positioning (GPS) and a worldwide terrain database to provide a greater warning time due to it’s “look ahead” ability. - HF : High Frequency communications radio. Used to communicate with air traffic control agencies when out of VHF communications radio range using the frequency range 3 – 30MHz. Newer model aircraft are now using datalink systems for this purpose. See CPDLC. Here is Wikipedia’s discussion of HF. - IA : Inspection Authorization. A designation given to FAA certified aircraft mechanics who have qualified for and successfully passed additional written and practical tests that prove to the FAA that the individual is capable of certifying an aircraft airworthy. All general aviation aircraft (except amateur-built, which have Condition Inspections) must be inspected annually by a mechanic holding an IA who then certifies the aircraft airworthy and in compliance with all applicable regulations. - ICAO : International Civil Aviation Organization. The international version of the US Federal Aviation Administration (FAA). - LOC : Localizer Approach. The non-precision approach associated with the precision ILS approach. This approach is used when the glideslope portion of the ILS is out of service for some reason. The LOC approach provides localizer directional guidance to the runway, but the descent portion of the approach must be accomplished in accordance with non-precision approach procedures. - LSA : Light Sport Aircraft. - MAP : Missed Approach Point. A point on an instrument approach where the aircraft must either transition to a landing or execute a missed approach. - MEF : Maximum Elevation Figure. The VFR sectional Chart is broken up into quadrants bounded by tick-marked lines each 30 minutes of Latitude or Longitude. A bold, Blue two-digit elevation is depicted in each quadrant. This elevation represents the highest elevation, including terrain and other vertical obstacles (natural or man-made) within the quadrant depicted to the nearest 100′ value. 96 would indicate 9600′ MSL - MEL : Minimum Equipment List. A list if items on an aircraft that specifies if the item need be operational for the flight and, if not, how to document the discrepancy. - MDA : Minimum Descent Altitude. Minimum altitude to which and aircraft may descend on an instrument approach without having the ground references necessary to continue to a landing. Usually associated with a non-precision instrument approach. - MMEL : Master Minimum Equipment List. A Master list of aircraft equipment compiled by the aircraft manufacturer and the FAA which may be used to develop a working MEL for a specific make and model of aircraft, tied to that aircraft by it’s serial number and registration. - MSL : Mean Seal Level. The height of an aircraft above mean sea level. Read on the aircraft’s altimeter when the local altimeter setting is placed into the altimeter’s Kohlsman window. - NAT Tracks : North Atlantic Tracks. Organized flight tracks, similar to domestic airways, that stretch from the northeast part of North America to Western Europe. The organized track system provides lateral and vertical separation in the heavily traveled North Atlantic region between FL290 and FL410. The routes are controlled by Gander and Shanwick Oceanic Centers. The specific navigational points change daily and are designed to provide the shortest flight times between the two regions. - NRT : Airline identifier for Tokyo’s Narita International Airport. The ICAO identifier is RJAA. - OE : Operating Experience. Airline pilots receive type ratings in aircraft based solely on simulator training. Operating Experience on actual revenue flights with an instructor finish the aircraft qualification process. - PIREP : Pilot Report. A report given to Air traffic Control or company weather personnel concerning the weather encountered at a navigation reporting point or when unexpected weather phenomenon are encountered, such as turbulence. - PVG : Airline identifier for Shanghai, China’s Pudong International Airport. The ICAO identifier is ZSPD. - RA : Radar Altitude. Refers to a minimum altitude on an instrument approach determined by the indication of the radar altimeter rather than the barometric altimeter. Usually associated with Cat II/III approaches. - RVSM : Reduced Vertical Separation Minimum. Reduced vertical separation (1000 ft) between qualified aircraft flying above FL290. The FAA web site explaining RVSM may be found here. - RVR : Runway Visual Range. A weather term referring to the visibility distance in feet or meters measured by optical instruments (transmissometers) placed next to and aligned with a given runway. One or more measurements are usually provided, such as the touchdown (TD) zone, runway mid-point (MID) and rollout area (RO). If one value is reported it refers to the visibility measured in the touchdown zone. - SATCOM : Satellite Communication. Telephone-type communication between the aircraft and a ground station using a satellite relay system. - SIGMET : A weather advisory containing information applicable to ALL aircraft. There are two types – non-convective and convective. A Non-convective Sigmet will be issued for forecasts covering an area of at least 3000 square miles and containing severe or greater turbulence, severe or greater icing or IMC due to dust, sand or volcanic ash. A Convective SIGMET is issued for an area of thunderstorms affecting an area of at least 3,000 square miles, a line of thunderstorms at least 60 nm long, and/or severe or embedded thunderstorms affecting any area that are expected to last 30 minutes or longer. A Convective SIGMET is valid for 2 hours and they are issued every hour + 55 min. - TCAS : Traffic Collision Avoidance System. An aircraft-based display of other aircraft in the vicinity of yours. Traffic displays are usually restricted to other aircraft within a specified number of miles and a specific number of feet above or below your aircraft, depending upon the installation. More information. When an ‘intruder’ aircraft enters the system’s alert area, TCAS will issue a Traffic Alert (TA) drawing the pilot’s attention to the traffic. If the intruder aircraft continues on a collision course and gets within the aircraft’s protected zone, the TCAS system issues a Resolution Advisory (RA) which directs the pilot to take specific avoidance actions. - TPE : Airline identifier for Taipei, Taiwan. The ICAO identifier is RCTP. - TSA : Transportation Security Administration - UHF: Ultra-High Frequency. A communications radio that uses frequencies in the range 300 – 3000 MHz (3 GHz). these radios are used primarily by U.S. military aircraft. - VHF : Very High Frequency. A communications radio which uses frequencies in the range 118.0 – 137.0 MHz. - VNAV : Vertical Navigation. A function of the autopilot which commands the aircraft to climb, descend or level off as directed by either the pilot through settings made on the autopilot control panel or automatically through the settings inserted into the Flight Management System (FMS).

<urn:uuid:2eef2789-c98d-40a2-aef6-098cd3609b41>

CC-MAIN-2016-50

http://aroundthepattern.com/aviation-terms/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

A History of the Broadway Musical Theater We'll be in touch soon.DONE The definitive history of the Broadway musical: the shows, the stars, the movers, and the shakers. Showtime brings the history of Broadway musicals to life in a narrative as engaging as the subject itself. Beginning with the scandalous Astor Place Opera House riot of 1849, Larry Stempel traces the growth of musicals from minstrel shows and burlesques, through the golden age of Show Boat and Oklahoma!, to such groundbreaking works as Company and Rent. Stempel describes the Broadway stage with vivid accounts of the performers drawn to it, and detailed portraits of the creators who wrote the music, lyrics, and stories for its shows, both beloved and less well known. But Stempel travels outside the theater doors as well, to illuminate the wider world of musical theater as a living genre shaped by the forces of American history and culture. He reveals not only how musicals entertain their audiences but also how they serve as barometers of social concerns and bearers of cultural values. Showtime is the culmination of decades of painstaking research on a genre whose forms have changed over the course of two centuries. In covering the expansive subject before him, Stempel combines original research—including a kaleidoscope of primary sources and archival holdings—with deft and insightful analysis. The result is nothing short of the most comprehensive, authoritative history of the Broadway musical yet published. - September 2010 - 6.5 × 9.6 in / 848 pages - Sales Territory: Worldwide College Edition / Paperback Endorsements & Reviews “Starred Review. Not just a catalog or reference book, but a highly astute, integrative cultural history.” — Kirkus Reviews “Throughout, as Stempel traces the evolution with exhaustive archival research, he offers a penetrating and illuminating analysis of various musical forms and influences. Many of the 105 carefully selected black-and-white illustrations are surprising and revelatory. Theater buffs will be delighted to find that this scholarly, definitive work is also a hugely entertaining read.” — Publishers Weekly

<urn:uuid:367dac71-cd29-45a8-aca5-cd155d8926df>

CC-MAIN-2016-50

http://books.wwnorton.com/books/detail.aspx?ID=17094

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

3.3. DNA detection using southern blots with DIG labelling Southern blotting was invented by Edward M Southern as a means for detecting specific nucleotide sequences in a complex mixture and determining the size of the restriction fragments, which are complementary to a probe. Southern blotting combines transfer of restriction-enzyme-digested and then electrophoresis-separated DNA fragments from a gel to a membrane and subsequent detection by probe hybridization. A variety of non-radioactive methods have been developed to label probes for detection of specific nucleic acids. The Roche Applied Science DIG system is a simple adaptation of enzymatic labelling and offers a non-radioactive approach for the safe and efficient labelling of probes for hybridization reactions.

<urn:uuid:af879c53-beec-4f46-9fc3-dcce89f01d56>

CC-MAIN-2016-50

http://coloss.org/beebook/I/molecular/3/3

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Smaller and Faster: The Cray-2 and 3 Smaller and Faster: The Cray-2 For many supercomputers, swifter meant bigger. But the Cray-2 supercomputer, though smaller than the Cray-1, ran 12 times faster. It computed in one second what would have taken ENIAC several months. The Cray-2 took nine years to develop. Released in 1985, each of the 27 made sold for between $12M and $17M. Rollwagen, an electrical engineer and businessman, became CEO in 1980. He led Cray Research, Inc. through its most successful period, but also through its decline.View Artifact Detail Hitting the Wall: The Cray-3 The Cray-3 was to be 10 times faster than the Cray-2. But Seymour Cray, unwilling to join the trend toward using many slower processors, switched to exotic gallium arsenide chips, packing more than a thousand in each 4-cubic-inch module. This risky path to speed backfired. Cray sold only one partially completed machine.

<urn:uuid:de945bb1-59c9-45c8-8fd2-101b7b1d3855>

CC-MAIN-2016-50

http://computerhistory.org/revolution/supercomputers/10/68

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

[dis-uh n-ter-ee] /ˈdɪs ənˌtɛr i/ Pathology. an infectious disease marked by inflammation and ulceration of the lower part of the bowels, with that becomes mucous and hemorrhagic. infection of the intestine with bacteria or amoebae, marked chiefly by severe diarrhoea with the passage of mucus and blood late 14c., dissenterie, from Old French disentere (13c.), from Latin dysenteria, from Greek dysenteria, coined by Hippocrates, from dys- “bad, abnormal, difficult” (see dys-) + entera “intestines, bowels” (see inter-). Related: Dysenteric. dysentery dys·en·ter·y (dĭs’ən-těr’ē) An inflammatory disorder of the lower intestinal tract, usually caused by a bacterial, parasitic, or protozoan infection and resulting in pain, fever, and severe diarrhea, often accompanied by the passage of blood and mucus. A gastrointestinal disease characterized by severe, often bloody diarrhea, usually caused by infection with bacteria or parasites. A painful disease of the intestines characterized by inflammation and diarrhea. Dysentery may be caused by bacteria or viruses, or may occur as the result of infestation by an amoeba. Note: Dysentery can be transmitted by contact with water or food that has been contaminated by human waste. Public health and sanitation procedures in developed countries, however, have largely eliminated this means of transmission. - Dysencephalia splanchnocystica dysencephalia splanchnocystica dys·en·ce·pha·li·a splanch·no·cys·ti·ca (dĭs-ěn’sə-fā’lē-ə splāngk’nō-sĭs’tĭ-kə, -fāl’yə) n. See Meckel syndrome. dyserethism dys·er·e·thism (dĭs-ěr’ə-thĭz’əm) n. A condition in which a person responds slowly to stimuli. [dih-sur-juh, -jee-uh] /dɪˈsɜr dʒə, -dʒi ə/ noun, Pathology. 1. lack of muscular coordination due to defective nerve conduction. dysergia dys·er·gi·a (dĭ-sûr’jē-ə, -jə) n. The lack of muscular coordination due to a defect in the efferent nerve impulses. [dis-uh s-thee-zhuh, -zhee-uh, -zee-uh] /ˌdɪs əsˈθi ʒə, -ʒi ə, -zi ə/ noun, Pathology. 1. any impairment of the senses, especially of the sense of touch. 2. a condition in which light physical contact of the skin causes pain. dysesthesia dys·es·the·sia (dĭs’ĭs-thē’zhə) n.

<urn:uuid:7eece22d-0404-4c02-89ae-9464f541a6b7>

CC-MAIN-2016-50

http://definithing.com/define-dictionary/dysentery/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Iranian PM Ahmadinijad: “If [the Holocaust] has actually taken place, where did it happen? Why should the Palestinian people become homeless (because of this)? Why should Palestinian children, women and mothers be killed on streets every day for 60 years?” The president said that these innocent people losing their lives had no role in World War II. “All of them had been killed in Europe and Palestinian people were not involved in it,” he added. — MEMRI The assumption is that Israel draws its legitimacy from the Holocaust. But nothing could be farther from the truth. By 1948, the Zionist enterprise in Palestine had been underway for about 60 years. All of the institutions of a state were in place. The League of Nations mandate of 1922 recognized the historic connection of the Jews to the land and the need to create a ‘Jewish National Home’ in Palestine (not in all of Palestine). The Jewish Yishuv in Palestine had built an economy which provided for many more Jews and Arabs than could have lived there if it had not been for Zionism. The Jewish leadership was totally focussed on creating a state, and — as in other areas administered by the colonial powers — it would have happened, Holocaust or no. The Arab leadership, especially the antisemitic Nazi Haj Amin al-Husseini, refused to agree to any Jewish state anywhere in Palestine, even in the area where there was a clear Jewish majority. This leadership denied the Jews their right to self-determination, denied the legitimacy of the League of Nations mandate, and consistently violated the human rights of the Jews by inciting riots and pogroms, such as the one in Hebron in 1928 in which 67 Jews were murdered and the city ethnically cleansed of its 800 Jews. In 1937, the British Peel Commission proposed a partition of Palestine into a (small) Jewish and an Arab state. The Zionists accepted it, but the Arabs did not. All subsequent attempts to provide for both Jewish and Arab self-determination, from 1948 through the Clinton/Barak plan of 2000, were rejected by the Arab nations and the Palestinian leadership, as were all attempts to heal the wounds of 1948 by resettling Arab refugees (the Jews resettled their own refugees). In recent years, Yasser Arafat and his cronies stole literally billions of dollars that were intended to help build the infrastructure of a Palestinian state. So my response to Ahmadinijad is the following: why should the Jewish people continue to suffer from aggressive wars and terrorism because of something that they were not responsible for — the failure of the Arab leadership? The Jews did not refuse any of the partition agreements, the Jews did not prevent a solution to the refugee problem, and the Jews did not impoverish the Palestinian people. The Arabs and their friends like to turn history upside down, but they can’t change reality.

<urn:uuid:e07e4a80-ed35-4179-8637-1f688900054d>

CC-MAIN-2016-50

http://fresnozionism.org/2007/04/who-is-responsible-for-the-palestinian-condition/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Assessment of occupational exposures is a crucial factor in evaluating dose-response relationships and most human population-based studies conducted by the Branch have an extensive exposure assessment component. Major assessment efforts in cohort studies have involved exposures to pesticides, benzene, polycyclic aromatic hydrocarbons, and diesel exhaust fumes, and to a broad range of exposures in a cohort study of women in Shanghai and shipyard workers. Cross-sectional studies are being conducted to study the effect of benzene, diesel exhaust, trichloroethylene, and atrazine on genotoxic, immune, and hormonal parameters. In the case-control design, jobs have been evaluated for a wide variety of exposures, including solvents (including chlorinated hydrocarbons, aromatic, and other solvents), metals (arsenic, chromium, cadmium, lead), electromagnetic fields, polychlorinated biphenyls, dusts (wood dust and other types) , asbestos, formaldehyde, physical activity, nitrosoamines, polycyclic aromatic hydrocarbons, gasoline and diesel exhausts, aromatic amines, and pesticides. These exposures have been evaluated in studies of cancer of the bladder, brain, breast, kidney, lung, larynx, and the lymphatic and hemtopoietic system, and of childhood brain cancer, germ cell tumor cancer, and leukemia Ewings sarcoma and possible associations with parental occupations. Methodologic studies are also conducted to improve exposure assessment techniques and to understand exposure patterns, such as peak exposures. A study has been conducted in Shanghai to evaluate assessments made from detailed occupational questionnaires with air measurements. A report describing the exposure assessment procedures for evaluating EMF exposures in a brain cancer case-control study has been published. Reports describing the occurrences of pesticides, polychlorinated biphenyls, chlorinated and aromatic solvents, wood dust, lead, cadmium, and nitrosoamines are being prepared. Detailed questionnaires have been developed for several case-control studies: a kidney cancer study in the US, a bladder cancer study in New England, a NHL study in the US, and a bladder cancer study in Spain, and the recently launced AsiaLymph Study. A comparison of assessments to pesticides has been compared to pesticide metabolites in the urine. Important determinants of exposure to 2,4-D has been evaluated using urinary levels. Historical benzene and lead exposure estimates have been developed using a novel framework that combines job-exposure matrices with databases of inspection measurements to predict exposure for a population-based cohort of women in Shanghai. Data mining models have been used to extract decision rules from questionnaire responses and previously assessed exposure metrics for occupational diesel exhaust exposure so that the decision rules can be used in subsequent studies. The same data mining approaches will be used for other agents. An algorithm-based approach that efficiently links expert-based exposure decisions to participants responses to exposure-oriented modules was developed to estimate occupational diesel exhaust exposure and was compared to estimates from an expert review of each individual job. Exposure estimates for lead and cadmium exposure are being developed for the kidney cancer study. A study evaluating gender differences in work tasks and exposure within men and women reporting the same job title is underway. |Locke, Sarah J; Colt, Joanne S; Stewart, Patricia A et al. (2014) Identifying gender differences in reported occupational information from three US population-based case-control studies. Occup Environ Med 71:855-64| |Friesen, Melissa C; Park, Dong-Uk; Colt, Joanne S et al. (2014) Developing estimates of frequency and intensity of exposure to three types of metalworking fluids in a population-based case-control study of bladder cancer. Am J Ind Med 57:915-27| |Wheeler, David C; Burstyn, Igor; Vermeulen, Roel et al. (2013) Inside the black box: starting to uncover the underlying decision rules used in a one-by-one expert assessment of occupational exposure in case-control studies. Occup Environ Med 70:203-10|

<urn:uuid:bc9aea96-ed89-4d69-bb67-0bc3a7d76374>

CC-MAIN-2016-50

http://grantome.com/grant/NIH/ZIA-CP010122-18

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Kern Your Enthusiasm (4) August 4, 2014 One of 25 installments in a series of posts analyzing and celebrating a few of our favorite (and least favorite) typefaces. JOHNSTON’S “HAMLET” | EDWARD JOHNSTON | 1929 If you wanted to model a book after the earliest printed books, you might mirror their layout — placing the main text in the middle of the opening, with commentary surrounding it along the margins and illustrations interspersed. You might commission one of the great artists of your age to cut new woodcuts and choose a text that is itself centuries old but still loved today. And you might find a typeface to do the same, straddling the past and the present. When Henry Graf Kessler wanted to print an edition of Hamlet, he did all of these things. The most striking part of the 1929 book is its illustrations — Edward Gordan Craig’s images are stunning and powerful. But what ties the Cranach Press Hamlet most clearly to Kessler’s vision of reworking the past is Edward Johnston’s type. Johnston’s typefaces for the London Underground are decidedly modern sans-serifs. But for Hamlet, at Kessler’s direction, he turned back to some of the earliest fonts, the blackletter types designed by Peter Schoeffer. (The colophon for Hamlet states that the typeface derives from the 1457 Mainz Psalter, but L.M. Newman’s collection of Kessler’s and Craig’s correspondence describes the 1462 Bible and 1472 Decretum as being additional key texts for Johnston’s inspiration.) Schoeffer’s typefaces, like other early fonts, have their origins in scribal writing. Imagine writing with a thick quill, and you might — if you were very talented — come up with the blocky blackletter of medieval religious books. As Schoeffer continued to adapt those letters for the system of punches and matrices that produce metal letters, however, he opened up the white spaces, giving a whole different look to the page. This might have been an aesthetic choice, but it was certainly also a practical one: by introducing more space between the letters, Schoeffer reduced the number of ligatures and the pieces of type that needed to be cast. Just as Schoeffer took the letters of earlier scribes and adjusted them, so Johnston took Schoeffer’s typeface and reworked it for a twentieth-century audience. In Johnston’s hands, the fussiness of the earlier letters is minimized, but if you compare the type of Schoeffer’s 1472 Decretum with Johnston’s 1929 Hamlet, you’ll see the resemblance clearly. Johnston’s ascenders tend to stand straight up, but the curves in the “h” and “g” come straight out of Schoeffer’s. The 12-point type used for the Hamlet commentary is a mixture of sans serif and serif, letting in more air while still suggesting the heaviness of blackletter. But that’s what you see when you look with a knowledgeable eye. What do you see when you look at the book with your heart? What I see is a book that is of both the past and the present, a book that looks back to foundational moments of printing, illustration, and drama and makes them speak to the world even now, nearly a century after its production. 2014: KERN YOUR ENTHUSIASM (typefaces): Matthew Battles on ALDINE ITALIC | Adam McGovern on DATA 70 | Sherri Wasserman on TORONTO SUBWAY | Sarah Werner on JOHNSTON’S “HAMLET” | Douglas Wolk on TODD KLONE | Mark Kingwell on GILL SANS | Joe Alterio on AKZIDENZ-GROTESK | Suzanne Fischer on CALIFORNIA BRAILLE | Gary Panter on SHE’S NOT THERE | Deb Chachra on FAUX DEVANAGARI | Peggy Nelson on FUTURA | Tom Nealon on JENSON’S ROMAN | Rob Walker on SAVANNAH SIGN | Tony Leone on TRADE GOTHIC BOLD CONDENSED NO. 20 | Chika Azuma on KUMON WORKSHEET | Chris Spurgeon on ELECTRONIC DISPLAY | Amanda French on DIPLOMA REGULAR | Steve Price on SCREAM QUEEN | Alissa Walker on CHICAGO | Helene Silverman on CHINESE SHIPPING BOX | Tim Spencer on SHATTER | Jessamyn West on COMIC SANS | Whitney Trettien on WILKINS’S REAL CHARACTER | Cintra Wilson on HERMÈS vs. HOTDOG | Jacob Covey on GOTHAM. 2013: HERC YOUR ENTHUSIASM (old-school hip hop tracks): Luc Sante on “Spoonin’ Rap” | Dallas Penn on “Rapper’s Delight” | Werner Von Wallenrod on “Rappin’ Blow” | DJ Frane on “The Incredible Fulk” | Paul Devlin on “The Adventures of Super Rhyme” | Phil Dyess-Nugent on “That’s the Joint” | Adam McGovern on “Freedom” | David Abrams on “Rapture” | Andrew Hultkrans on “The New Rap Language” | Tim Carmody on “Jazzy Sensation (Bronx Version)” | Drew Huge on “Can I Get a Soul Clap” | Oliver Wang on “The Adventures of Grandmaster Flash on the Wheels of Steel” | Douglas Wolk on “Making Cash Money” | Adrienne Crew on “The Message” | Dart Adams on “Pak Jam” | Alex Belth on “Buffalo Gals” | Joshua Glenn on “Ya Mama” | Phil Freeman on “No Sell Out” | Nate Patrin on “Death Mix Live, Pt. 2” | Brian Berger on “White Lines (Don’t Do It)” | Cosmo Baker on “Here We Go (Live at the Funhouse)” | Colleen Werthmann on “Rockit” | Roy Christopher on “The Coldest Rap” | Dan Reines on “The Dream Team is in the House” | Franklin Bruno on The Lockers. 2012: KIRK YOUR ENTHUSIASM (Captain Kirk scenes): Dafna Pleban: Justice or vengeance? | Mark Kingwell : Kirk teaches his drill thrall to kiss | Nick Abadzis: “KHAAAAAN!” | Stephen Burt: “No kill I” | Greg Rowland: Kirk browbeats NOMAD | Zack Handlen: Kirk’s eulogy for Spock| Peggy Nelson: The joke is on Kirk | Kevin Church: Kirk vs. Decker | Enrique Ramirez: Good Kirk vs. Evil Kirk | Adam McGovern: Captain Camelot | Flourish Klink: Koon-ut-kal-if-fee | David Smay: Federation exceptionalism | Amanda LaPergola: Wizard fight | Steve Schneider: A million things you can’t have | Joshua Glenn: Debating in a vacuum | Kelly Jean Fitzsimmons: Klingon diplomacy | Trav S.D.: “We… the PEOPLE” | Matthew Battles: Brinksmanship on the brink | Annie Nocenti: Captain Smirk | Ian W. Hill: Sisko meets Kirk | Gabby Nicasio: Noninterference policy | Peter Bebergal: Kirk’s countdown | Matt Glaser: Kirk’s ghost | Joe Alterio: Watching Kirk vs. Gorn | Annalee Newitz: How Spock wins 2011: KIRB YOUR ENTHUSIASM (Jack Kirby panels): Douglas Rushkoff on THE ETERNALS | John Hilgart on BLACK MAGIC | Gary Panter on DEMON | Dan Nadel on OMAC | Deb Chachra on CAPTAIN AMERICA | Mark Frauenfelder on KAMANDI | Jason Grote on MACHINE MAN | Ben Greenman on SANDMAN | Annie Nocenti on THE X-MEN | Greg Rowland on THE FANTASTIC FOUR | Joshua Glenn on TALES TO ASTONISH | Lynn Peril on YOUNG LOVE | Jim Shepard on STRANGE TALES | David Smay on MISTER MIRACLE | Joe Alterio on BLACK PANTHER | Sean Howe on THOR | Mark Newgarden on JIMMY OLSEN | Dean Haspiel on DEVIL DINOSAUR | Matthew Specktor on THE AVENGERS | Terese Svoboda on TALES OF SUSPENSE | Matthew Wells on THE NEW GODS | Toni Schlesinger on REAL CLUE | Josh Kramer on THE FOREVER PEOPLE | Glen David Gold on JOURNEY INTO MYSTERY | Douglas Wolk on 2001: A SPACE ODYSSEY | MORE EXEGETICAL COMMENTARIES: Joshua Glenn on Kirby’s Radium Age Sci-Fi Influences | Chris Lanier on Kirby vs. Kubrick | Scott Edelman recalls when the FF walked among us | Adam McGovern is haunted by a panel from THE NEW GODS | Matt Seneca studies the sensuality of Kirby’s women | Btoom! Rob Steibel settles the Jack Kirby vs. Stan Lee question | Galactus Lives! Rob Steibel analyzes a single Kirby panel in six posts | Danny Fingeroth figgers out The Thing | Adam McGovern on four decades (so far) of Kirby’s “Fourth World” mythos | Jack Kirby: Anti-Fascist Pipe Smoker

<urn:uuid:d5e5bffd-c941-471f-b1e0-09741e861395>

CC-MAIN-2016-50

http://hilobrow.com/2014/08/04/kern-your-enthusiasm-4/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

GRE subject test question Here is a sample GRE subject exam question. Let p(x) be the polynomial x^3 + a*x^2 + b*x + c, where a, b, and c are real constants. if p(-3) = p(2) = 0 and p'(3) < 0, which of the following is a possible value of c? I have figured out the solution getting -27 as the answer. My question regards a solution I came across on another forum by someone else that I am having trouble following. Given the information available is it possible to conclude that the third root of the equation must be strictly less than -3?

<urn:uuid:bcf49ec3-1575-42f8-be4c-bea7f891a55d>

CC-MAIN-2016-50

http://mathhelpforum.com/calculus/21432-gre-subject-test-question-print.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

The Used copy of this book is not guaranteed to include any supplemental materials. Typically, only the book itself is included. This is true even if the title states it includes any access cards, study guides, lab manuals, CDs, etc. This popular and classic text chronicles America's roller-coaster journey through the decades since World War II. Considering both the paradoxes and the possibilities of postwar America, William H. Chafe portrays the significant cultural and political themes that have colored our country's past and present, including issues of race, class, gender, foreign policy, and economic and social reform. He examines such subjects as the Vietnam War, the civil rights movement, the origins and the end of the Cold War, the culture of the 1970s, the rise of the New Right, the events of September 11th and their aftermath, and various presidencies. Now thoroughly revised and updated, the seventh edition of The Unfinished Journey combines and reorganizes several chapters. The former Chapter 14, "New Rules, Old Realities," is now divided into two chapters. The new Chapter 14, "An Era of Political Malaise," covers the political history of the 1970s. It is followed by Chapter 15, "A Divided Culture, A Divided Society," which assesses the shifting cultural landscape of the 1970s and the emergence of major fissures in the social system of the nation. The final chapter contains substantial new material on the administration of George W. Bush, the wars in Iraq and Afghanistan, the election of 2008, and the first year of Barack Obama's presidency. Brilliantly written by a prize-winning historian, The Unfinished Journey , Seventh Edition, is an essential text for all students of recent American history. William H. Chafe is Alice Mary Baldwin Professor of History at Duke University. He is the author or coeditor of several books, including Remembering Jim Crow: African Americans Tell About Life in the Segregated South (2008), The Rise and Fall of the American Century: The United States from 1890-2009 (OUP, 2007), A History of Our Time: Readings on Postwar America, Seventh Edition (OUP, 2007), Private Lives/Public Consequences: Personality and Politics in Modern America (2005), and Never Stop Running: Allard K. Lowenstein and the Struggle to Save American Liberalism (1998). He is a former president of the Organization of American Historians and his books have been recognized with the Robert F. Kennedy Book Award (1981), the Sidney Hillman Book Award (1994), and the Lillian Smith Book Award (2003).

<urn:uuid:d0d4eac0-093b-4974-9a17-ea7fdc4d3183>

CC-MAIN-2016-50

http://www.ecampus.com/unfinished-journey-america-since-world-war/bk/9780199760251

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

As we go through the day our blood pressure just naturally raises and lowers depending on a lot of conditions. What most people are most interested in is a regular resting blood pressure as high blood pressure and hypertension are a very strong indicator toward present and future heart problems Daily Fluctuations in Blood Pressure Drugstore machines that require you to sit in a chair and put your arm through a cuff are notorious for being poorly calibrated and fairly inaccurate. These measurements should never be used as an indication that something is wrong, or as reassurance that everything is OK. Changes in blood pressure reflect the body ability to adapt. An increase in blood pressure can be a normal part of daily physiology. Blood pressure can go up in a split second depending on situation. Mere laughter can raise systolic blood pressure even as high as 15 points in people with otherwise normal blood pressure. Talking does the same thing. Now you know why you should not talk or laugh when testing for blood pressure. You may get a false high blood pressure reading. But what if you constantly have a low reading? Changes of 25 to 30% during the day are not abnormal — they reflect the fact the body is a dynamic, changeable organism. Many normal things can have large effects on blood pressure. Walking 20 feet can raise systolic blood pressure by 10 to 15 points. Your stress level, how tight your shoelaces are, what you had for breakfast, and how well you slept last night can all change your blood pressure, too. The Effect Of Sleep on Blood Pressure Sleep causes a fall in blood pressure. The maximum depth occurs about two hours after falling asleep. In sound, untroubled slumber a pressure of 130/80 might dip to 100/70. It once was thought that this drop in pressure was the cause of sleep, the reasoning being that a lower pressure delivers less blood to the brain resulting in mental sluggishness and hence sleep. Now it is known that this blood pressure decline is the result, not the cause, of sleep. As morning approaches, the blood pressure drifts slowly upward as the subject begins the awakening process. Any interference with sound sleep causes the blood pressure to rise. Effect Of Dreaming on Blood Pressure Interestingly enough, dreaming about exercise may evoke a blood pressure response similar to that which would be observed if the individual actually were exercising. A good example is that of a person dreaming he is climbing the Washington Monument. Although sound asleep and involved in no physical activity, except perhaps for involuntary muscular twitches, blood pressure approaches levels that would be “read” if he actually were climbing the monument. Although in deep sleep with a pressure o£ 100/70, the intrusion of a physically active dream raises the pressure to 180/100, when in real life climbing the monument might bring the reading to 200/104. The old teaching was that a dream is completed in a split second, that an event in reality requiring half an hour can be compressed in a dream into a fraction of a second. Doctors recently have discovered that this is erroneous. A dream takes about as long to accomplish as the actual physical act would require. A dream involving prolonged exercise or prolonged anxiety has a prolonged effect on blood pressure. The clinical importance of this observation is only lately being appreciated. If a patient has a known illness or has an incipient illness which is not recognized because he feels well and has not had a physical examination recently, this may explode into a full-blown setback during the blood pressure elevation of a dream. One hears of patients who die in their sleep, or who develop a coronary, stroke, acute breathlessness, or palpitations while sleeping. In the latter group, the patient may be able to tell of an “active” dream, which produced high blood pressure long enough to cause trouble. By affording relaxation and release from tension, physical fitness may decrease the tendency to “active” dreams and promote greater elasticity of the arteries-or at least retard the inevitable “hardening of the arteries” which happens to almost everyone. There is less need to dream about physical exercise for those who are able to achieve this satisfaction while awake. The Effects Of Eating on Blood Pressure For fifteen to forty-five minutes following a meal, blood pressure normally rises. This response is temporary. A pressure of 130/80 may climb 10 to 30 mm. of mercury by virtue of a full stomach. Nationality and Normal Blood Pressure Nationality makes a difference, too. Chinese, for example, are hypertensive at 125/70, while North Americans can get by at 140/90. The British have significantly higher readings than Egyptians. The Effect of the Environment on Blood Pressure People in hot climates average lower pressures than inhabitants of cooler locales. In temperate zones where temperature fluctuates, blood pressures are lower in summer and higher in winter. Moving from one climate to another has an effect. If an Egyptian moves to Britain, his blood pressure rises, but not to the same level as the average Briton. And if a Londoner moves to Cairo, his pressure falls, but it still is slightly higher than that of the average Egyptian. The Posture and Blood Pressure Blood pressure is widest when observed in the reclining subject. It closes slightly on sitting, and is narrowest when standing. A pressure of 130/70 while lying down might become 120/80 on standing. This change varies greatly from person to person and is most exaggerated in obese persons. The Effect of the Bladder on Blood Pressure Curiously enough and for no good reason, the urinary bladder influences blood pressure. Pressure is lowest when the bladder is empty. As the bladder gradually fills, blood pressure rises. Thus a pressure of 130/80 on an empty bladder may reach 160/90 when the bladder is full enough to send messages of “Please empty.” During urination, the blood pressure then precipitously drops back to 130/80. People whose bladders are never quite empty may carry a pressure which is slightly higher. After treatment and with the resumption o£ complete bladder emptying the pressure falls to normal levels. Sitting on a full bladder is not only uncomfortable but bad for the blood pressure.

<urn:uuid:474085eb-6041-479c-bc65-be0d9c8712de>

CC-MAIN-2016-50

http://www.fitnesstipsforlife.com/why-does-blood-pressure-change-throughout-the-day.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Fracking is Revolutionizing the Oil and Gas Industry NCPA Study: The Federal Government Stands in the Way of Greater Supply, Lower Prices, and Increased Employment October 24, 2013 Fracking is currently responsible for more than 30 percent of U.S. domestic oil and natural gas reserves, and the National Petroleum Council estimates that 60 to 80 percent of all U.S. drilling over the next decade will require fracking. In just two short years, oil production from fracking has nearly reversed a 20-year-long oil production decline: - In 1990, the United States produced approximately 7.5 million barrels per day of crude oil. - By 2009, that had dropped to as few as 4 million barrels per day at times. - Since then, production has returned to about 7.5 million barrels a day. - Since summer 2011, U.S. crude production has increased 2 million barrels per day. "Fracking has been a blessing in the oil fields. The oil it has delivered has reduced our trade deficit and our dependence on questionable foreign regimes for oil," said Sterling Burnett, senior fellow at the National Center for Policy Analysis. "We've reduced the billions of dollars we ship overseas each year through the dramatic increase in domestic supplies of oil made possible by fracking." Fracking's role on the natural gas front is just as impressive. Natural gas could not be the energy provider that it is without the vast reserves that fracking opens up every day: - Natural gas has become the fuel of choice for generating base load electricity -- the minimum amount of power needed 24 hours a day. - Gas is still the preferred fuel for peaking power dispatched to the electric grid during times of peak demand. "The energy produced from fracking has been a boon for this country - among the only industries creating jobs during the recent recession," said Burnett. "Absent the massive amount of natural gas unleashed through fracking, our electric bills would be much higher than they are today, and no one would be pushing electric or hybrid electric cars." The United States could increase oil and gas production even more by removing regulatory barriers. Current restrictions on offshore oil production and on public lands across the west and in Alaska prohibit the exploration and production of billions of barrels of oil and trillions of cubic feet of natural gas. Lifting these restrictions would increase supply, reduce prices and imports, and provide high-paying jobs to Americans. "Fracking has not been linked to persistent, widespread, or inherent problems, thus the federal government should accept the mountain of evidence that fracking is safe and should streamline the permitting and leasing process on public lands in order to reap the economic and energy bounty of fracking," Burnett concluded. "If problems arise, regulations can be tailored as narrowly as possible to address issues relevant to specific geographic sites." Source: H. Sterling Burnett, "How Fracking Helps Meet America's Energy Needs," National Center for Policy Analysis, October 2013. Full study: http://www.ncpa.org/pub/ib132

<urn:uuid:f594584e-510f-4c78-a3d2-b30e125a6553>

CC-MAIN-2016-50

http://www.ncpa.org/media/fracking-is-revolutionizing-the-oil-and-gas-industry

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

The famous Geico gecko commercial humanized a gecko by using personification. The gecko was given a cockney British accent and explained how cheap Geico insurance would be. Explain how this ad illustrates allegorical presentation in advertising. Answer to relevant QuestionsWhen discussing exposure as the initial stage of information processing, it was claimed that gaining exposure is a necessary but insufficient condition for success. Explain. There are three general strategies for changing attitudes. Explain each, using, for illustration, consumers’ attitudes toward a fast-food chain of your choice (McDonald’s, Burger King, KFC, etc.). Applying the principles of the Integrated Information Response Model (see Figure 8.3), which response pattern did they use—high involvement, low involvement, or continual switching? Present arguments for and against using advertising agencies. Are there lessons to learn from the experiences of Alex Bogusky (CP+B), featured in the Marcom Insight? Select two advertising campaigns that have been on television for some time. Describe in detail what you think their creative message styles are. Post your question

<urn:uuid:2c98b860-91b0-4522-a219-19a346d3de83>

CC-MAIN-2016-50

http://www.solutioninn.com/the-famous-geico-gecko-commercial-humanized-a-gecko-by-using

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Mobile Device Security Do you know what data your Mobile Device is storing? First, what is a Mobile Device? The Mobile Device Policy (PPM 10-6), defines a Mobile Device as any handheld or portable computing device including, but not limited to, a smartphone, PDA or tablet. Mobile Devices can be used to access email, documents, and other data that may contain sensitive information. Some of this data may reside on your Mobile Device without you being fully aware of it. When you view an email that has an attachment, do you download it to your device? If you are a University employee, make sure you are familiar with the Mobile Device Policy and adhere to the standards and guidelines. Tips to keep your device and data secure - Use a strong passcode to lock your phone. - Install and keep security software current. - Review the rights apps require before installing. - Only share your mobile phone number with those you trust. - Disable the Geotagging feature on your phone. Instructions can be found at http://icanstalku.com/how.php#disable - Practice safe browsing. Just like you do with your computer, be careful what websites you visit. - Be cautious when answering emails. If an email is requesting personal information or providing a link to a site or a download, review it carefully before responding or clicking. - Set up the feature that allows you to remotely wipe your device to allow you to clear your device of any personal or business data in the event it is lost. It is important for everyone to be aware of the increasing security risks of mobile devices, from laptops and tablets, to smartphones and wearable technology, and 24/7 access to your personal data. - Protect Your Device at all times and consider adding a two-Factor authentication (2fa) - Check Your Social Media Settings by reviewing your social media security and privacy settings frequently. Add 2fa. - Educate Yourself by staying informed about the latest technology trends and security issues such as malware and phishing. - Get Trained by contacting your institution’s IT, information security, or privacy office for additional resources or training opportunities. The SANS security group releases a monthly newsletter and the January 2016 OUCH! is about Securing Your New Tablet: https://securingthehuman.sans.org/newsletters/ouch/issues/OUCH-201601_en.pdf

<urn:uuid:592859d0-881e-4fba-a191-243dfcf51279>

CC-MAIN-2016-50

http://www.weber.edu/iso/mobile_device_security.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Use this online American Pioneering History quiz entitled Early American Mountain Men and Gold Seekers Quiz to test your knowledge on the early patterns of exploration for natural resources in America and who the mountain men and gold prospectors were. Use The Mountain Men and Gold Seekers Quiz to test your knowledge of the true mountain men who roamed America's western mountain ranges trapping animals for their valuable pelts; and the adventurous gold seekers, who in 1849 flocked to California and other points west in search of fortune. This quiz will also test your knowledge about the thrill of the yearly rendezvous and the exhilaration of a gold strike. This online quiz contains 25 questions from a pool of over 100 thereby allowing repeat use. We recommend that students study the relevant videos provided on this site on this subject before attempting this quiz.

<urn:uuid:7dd53c19-e65d-460a-9451-42515419fae6>

CC-MAIN-2016-50

http://www.zaneeducation.com/Quizzes/History/American_Pioneering_Experience/Quiz-Mountain_Men_and_Gold_Seekers/The_Mountain_Men_and_Gold_Seekers.php

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Which Joe gave his name to ‘sloppy joes’? We look at five interesting sandwiches and their lexical origins. A man's head covering consisting of a small piece of cloth wrapped around the head, worn especially by Sikh boys or young men. - ‘It was led by a stocky Sikh wearing a bright turban with a yellow patka (the band in the middle).’ - ‘He ran in aggressively, wearing a white patka that was reminiscent of that great flighter of the ball, Bishan Singh Bedi.’ - ‘Bare-bodied tribal member Bagun Sumbrai of the Congress, dressed in a green dhoti and sporting a green patka, also took the oath in Santhali.’ - ‘Mandeep attempted to explain that his patka was not a hat, but rather an article of faith that must remain on his head.’ - ‘The penultimate over before lunch, Harbhajan, shockingly resplendent in white patka, found his bounce.’ Punjabi paṭkā from Sanskrit paṭṭikā turban cloth. We take a look at several popular, though confusing, punctuation marks. From Afghanistan to Zimbabwe, discover surprising and intriguing language facts from around the globe. The definitions of ‘buddy’ and ‘bro’ in the OED have recently been revised. We explore their history and increase in popularity.

<urn:uuid:4cb1cc43-2cfc-484d-9110-fd6c2a02b5b8>

CC-MAIN-2016-50

https://en.oxforddictionaries.com/definition/us/patka

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Botanic of Trees in Outer Space Joint work with Arnaud Hilion I am interested in particular examples of trees with isometric actions of a free group . These are real trees, action is minimal (all orbits are dense), very small (all arc stabilisers are trivial). These represent points of Outer space (case of free actions) and its boundary. 1. Limit set I am interested in a new notion of limit set: is the set of points in the tree at which orbits accumulate in at least two different ways. Definition 1 if there exist distinct points , and sequences , converging respectively to and and such that and tend to . The boundary map , is continuous provided is equipped with the weak observer topology (whose open sets are directions . 1. Start with a once punctured torus. View it as the mapping torus of on . It carries a measured foliation. Lift to universal covering space. There, the space of leaves is a metric tree with an isometric action of . If , orbits are dense and . 2. The Levitt tree. Start with a band complex which is not a surface. E.g. more than two bands can be glued along the same interval. View this as the mapping torus of an interval translation mapping (more general that an interval exchange). Here, is totally disconnected. Indeed, points of are those which belong to bi-infinite leaves. Run Rips’ machine: erase the points which are endpoints of at most one band. Iterate. What remains is the relative limit set . It is a Cantor set. Then has empty interior and is totally disconnected. Theorem 2 (Coulbois, Hilion, Lustig) Every tree in Outer space and its boundary is transverse to the foliation of a band complex built on a compact subtree of . Band complex is constructed as follows. Pick a basis of free group . It restricts to a partial isometry of . Glue a band to . Here is our botanic. Trees split into 4 types, - Surface type trees: . - Levitt type trees: is totally disconnected. - Geometric trees: is a finite tree. - Non geometric trees: see below. To distinguish these types, we introduce numerical invariants. For simplicity, let us assume the action is free. 2.1. Geometric index Definition 3 For , set Then define the geometric index of by Theorem 4 (Gaboriau, Levitt) For all trees in Outer space of and its boundary, the geometric index satisfies with equality iff is geometric. Again, assume the -action is free. Definition 5 For , set Then define the -index of by Theorem 6 (Coulbois, Hilion) For all trees in the boundary of Outer space of , the -index satisfies with equality iff is of surface type. Of surface type does not mean it arises from a surface, it is more general. Example: Let be iwip. Then the action on on the boundary of Outer Space has two fixed points which are trees with actions all of whose orbits are dense. Proposition 7 If is iwip, both fixed points have the same -index. Example 1 (Boshernitzian, Kornfeld) Let map , , . Then the fixed point is our second example (Levitt tree), it is geometric, but . Whereas has , it is surface type. It has a compact heart of Hausdorff dimension ( is incomplete and is contained in the metric completion). Furthermore, so it is non geometric.

<urn:uuid:1f1e7c65-6f79-4a55-85b6-265d078bc1fb>

CC-MAIN-2016-50

https://metric2011.wordpress.com/2011/08/30/notes-of-thierry-coulbois-talk/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Send the link below via email or IMCopy Present to your audienceStart remote presentation - Invited audience members will follow you as you navigate and present - People invited to a presentation do not need a Prezi account - This link expires 10 minutes after you close the presentation - A maximum of 30 users can follow your presentation - Learn more about this feature in our knowledge base article Do you really want to delete this prezi? Neither you, nor the coeditors you shared it with will be able to recover it again. Make your likes visible on Facebook? Connect your Facebook account to Prezi and let your likes appear on your timeline. You can change this under Settings & Account at any time. Transcript of EUROPEAN ZOMBIES by David, Harry & Cara History of Zombies in cinema Zombies have an inability to feel emotion or act on human desires and are described as a non literary monster. Humans have a fascination with the zombie as it is essentially ourself and it is the other. Zombies have been used as a metaphor for many things. They are used to challenge social and political order with their cataclysmic nature. Pre-Medieval folklore in Europe told of the fear that those who died with unfinished business would awake from the dead to finish it or reap revenge on those who have wronged them. "Many of these early stories described the dead that rose as being flesh eating, blood sucking creatures that looked dead. This is where there is a cross over between the zombie and the vampire. Vampires are also seen as the more sexual because they drink the blood rather than the zombies more basic desire to eat the flesh. Both have routes as resentful undead, but the vampire remains a clear 'top' to the zombies 'bottom'" - d elliot smith. noun: zombie; plural noun: zombies a corpse said to be revived by witchcraft, especially in certain African and Caribbean religions. a shambling or running cadaver that spreads infection through bites. zombies have an inability to feel emotion or act on human desires and are described as a non literary monster. Humans have a fascination with the zombie as it is essentially ourselves and it is the other. Zombies have been used as a metaphor for many things. They are used to challenge social and political order with their cataclysmic nature. Unlike the original zombies that originated in Africa that were controlled by a Voodoo shaman, the depiction of European zombies is that they have no master, except hunger. - Although there’s been some debate about if The Returned (2012) is explicitly a 'zombie' TV show, the first thing all of those who returned did was to eat food, and continue eating & one of the characters is stockpiling an armory of weapons which means there could be some kind of undead threat on the horizon. Similarly, 28 Days Later (2002) has been questioned as to whether it is a zombie movie as it involves a virus, however some of the original zombie stories are drawn from real life pandemics of diseases like leprosy so it comes under the same branch in a sense as they share the same destructive tendencies and the disease passes through bites - as does Resident Evil (2002). Dir. Victor Halperin (1932) As the stock market crashed and people fell into debt and out of their homes the zombies symbolized the powerlessness of the American workforce. Their new hell was a vision of unemployment lines full of blank-faced, expendable humans who had lost their individuality and increasingly, their will. Dir. Jacques Tourneur (1943) Dir. George A. Romero (1968) Dir. George A. Romero (1978) Dir. Lucio Fulci (1979) Dir. Edgar Wright (2004) Unlike the original zombies that originated in countries like Africa that were controlled by a Voodoo shaman, the depiction of European zombies is that they have no master, except hunger. They hunt living human flesh which is similar to the depiction of zombies in many Hollywood & European zombie movies. It's been 83 years since the first 'zombie' movie was released, White Zombie (1932), unless you count 1910's Frankenstein, when voodoo and zombie masters played a big role in the zombie movie. George A Romero was the one who changed it all in Night Of The Living Dead (1968), where came about the introduction to the relentless cannibalistic free roaming zombies, who are killed when their brains are removed. These original masterless zombies are said to be a metaphor for the boom in capitalism and consumerism and the zombie has since evolved in meaning and temperament. "The etymological roots of the monstrous imply a boundary space between human and non human...the Zombie transgresses this boundary, giving corporeal shape to all that is not spirit- the remainder of our humanity after the loss of a unique soul...thus the Zombie is an antithesis of our human identity (therefore monstrous)" Kevin Alexandra Boon, ‘The ontological anxiety made flesh: Zombies in literature film and culture' "Given the colonial history, the concept of enslavement implies that the peasant fears, and the zombie suffers, a fate that is literally worse than death – the loss of physical liberty that is slavery, and the sacrifice of personal autonomy implied by the loss of identity." The zombie gives people a common enemy and allows them to come together and work as a commune as they face the threat that is essentially themselves and reinforces people’s humanity. Italian film Zombie flesh eaters (1979) is one that sticks out as it takes the zombie back slightly to its voodoo roots but only touches on it slightly, but like Night Of The Living Dead, it was frowned upon for its extreme violence and one of the trade mark scenes, do to with eyes was removed from the UK cut of film. Before Dawn (2012) In the Flesh (2013) Similarities: In The Flesh, Les Revenants, and other Euro Zombies Themes (In The Flesh) Nature of humanity in the face of threat Depression, sexuality, & suicide Metaphor how society treats mental health HVF: The Human Volunteer Force is very similar to the idea of the Home Guard that came into action in the 2nd world war, only updated in the sense that women are also allowed to join. This has very strong connotations to the way rural communities come together in times of crisis and try to defend their own. The Church: It's not uncommon for towns and villages in rural areas to still have a strong connection with the church - as everyone knows everyone, the church is the ideal meeting ground for socialisation in a sense. The pub: this is common in many British produced film and tv shows, as it is seen as one of the things that make the British, British. It is a social environment and is part of the culture. This is very apparent in ITF as many of the HVF's meetings take place down the local. North/South divide: more than once in ITF the 'bloody Southerners' are mentioned and it is apparent there is a large divide. Isolation: as the town is very rural and out the way it makes it a perfect place for prejudice as there is very little diversity and is also very susceptible to attacks in various forms which makes the inhabitants more wary than most. The Government: No one in ITF has a high opinion of the government and this is echoed in real life. They feel the government has let them down and allowed danger into their lives and there is a hatred there for that - and the way they dealt with the conflict before the rising ended. In The Flesh is based on a real persons battle with depression and feeling like an outcast in a rural area. concern with community & family in the wake of trauma Tragedy changes structure of family Camille’s return forces family to confront loss over again Guilt of survival & difficulty with reconciliation Camille’s presence is disruptive because she is a psychological zombie draining the lives of her family members; Just when her family is almost done with coping with their loss, she comes back like nothing ever happened even though people have moved on and changed. 1920’s flood killed many, and the victims are coming back to life in the forest. (Suggests the town itself returning from the dead?) 1. Who do you perceive to be more inhumane; zombies or people? 2. What similarities can you spot between INF and Les Revenants? Zombies are also seen as sexual objects in many things, in both The Returned and In The Flesh, humans are having sex with the deceased. Russell: ‘Zombification- whether it’s turning men into slaves or women into sex objects- is closely linked with themes of powerlessness. In the 70's the nudity represented in zombie movies was influenced by the popularity of pornography at the time. Religion trying to question and oppose science happens rather frequently - always religious people who turn on the zombies despite the scientific community telling them its fine. Surge in the popularity of zombies being re-integrated into society: Not just in European film, like In The Flesh and Les Revenants but films such as Warm Bodies (2013) and the American cartoon Ugly Americans (2010) which similarly to In the flesh shows regional differences in the acceptance of the partially dead, and how more suburban or rural locations have a stronger opposition to them. Other Zombie Movies to consider: Dead Snow (2009) Shaun of the dead (2004) Dead Set (2008) Rec 2 (2009) 28 Days Later (2002) Rammbock: Berlin Undead (2010) Dellamorte Dellamore (1994)

<urn:uuid:d143e59d-5a37-404a-bb65-5a4c1b2022c2>

CC-MAIN-2016-50

https://prezi.com/ekttvjajbtez/european-zombies/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Geochemical baselines for native soils and biogeochemical baselines for plants in the Piceance basin provide data that can be used to assess geochemical and biogeochemical effects of oil-shale development, monitor changes in the geochemical and biogeochemical environment during development, and assess the degree of success of rehabilitation of native materials after development. Baseline values for 52 properties in native soils, 15 properties in big sagebrush, and 13 properties in western wheatgrass were established. Our Study revealed statistically significant regional variations of the following properties across the basin: in soil&-aluminum, cobalt, copper, iron, manganese, sodium, nickel, phosphorus, lead, scandium, titanium, vanadium, zinc, organic and total carbon, pH, clay, dolomite, sodium feldspar, and DTPA-extractable calcium, cadmium, iron, potassium, manganese, nickel, phosphorus, yttrium, and zinc; in big sagebrush-barium, calcium, copper, magnesium, molybdenum, sodium, strontium, zinc, and ash; and in western wheatgrass-boron, barium, calcium, magnesium, manganese, molybdenum, strontium, zinc, and ash. These variations show up as north-south trends across the basin, or they reflect differences in elevation, hydrology, and soil parent material. Baseline values for properties that do not have statistically significant regional variations can be represented by geometric means and deviations calculated from all values within the basin. Chemical and mineralogical analyses of soil and chemical analyses of western wheatgrass samples from Colorado State University's experimental revegetation plot at Anvil Points provide data useful in assessing potential effects on soil and plant properties when largescale revegetation operations begin. The concentrations of certain properties are related to the presence of topsoil over spent shale in the lysimeters. In soils, calcium, fluorine, lithium, magnesium, sodium, phosphorus, strontium, carbonate and total carbon, and DTPA-extractable boron, copper, iron, magnesium, and nickel have lower concentrations in topsoil than in the spent oil shale; whereas, silicon, titanium, ytterbium, clay, quartz, and DTPA-extractable potassium have greater concentrations in the topsoil than in the spent oil shale. In western wheatgrass, molybdenum has a lower concentration in grasses growing on the topsoil than in grasses on the spent oil shale; whereas, barium, calcium, manganese, strontium, zinc, and ash have greater concentrations in grasses growing on the topsoil than on the spent oil shale. When compared to baseline values, soils in the revegetation plot are significantly higher in concentrations of lead, zinc, organic and total carbon, and DTP A-extractable cadmium, iron, manganese, nickel, phosphorus, and zinc. Whereas, western wheatgrass grown within the revegetation plot has concentrations which fall within the baseline values established in the regional study. The equations used in predicting concentrations of elements in plants from native and altered sites are cumbersome because of the large number of variables required to adequately predict expected concentrations and are of limited use because many explained only a small proportion of the total variation. Additional publication details USGS Numbered Series Geochemical variability of soils and biogeochemical variability of plants in the Piceance Basin, Colorado

<urn:uuid:4e4ccfa3-7a4a-4684-b986-653311692699>

CC-MAIN-2016-50

https://pubs.er.usgs.gov/publication/pp1134E

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

The Pre-Raphaelite Movement began in 1848, and experienced its heyday in the 1860s and 1870s. Influenced by the then little-known Keats and Blake, as well as Wordsworth, Shelley and Coleridge, Pre-Raphaelite poetry "etherialized sensation" (in the words of Antony Harrison), and popularized the notion ofl'art pour l'art—art for art's sake. Where Victorian realist novels explored the grit and grime of the Industrial Revolution, Pre-Raphaelite poems concentrated on more abstract themes of romantic love, artistic inspiration and sexuality. Later they attracted Aesthetes and Decadents like Oscar Wilde, Aubrey Beardsley and Ernest Dowson, not to mention Gerard Manley Hopkins and W.B. Yeats. For more than seventy years, Penguin has been the leading publisher of classic literature in the English-speaking world. With more than 1,700 titles, Penguin Classics represents a global bookshelf of the best works throughout history and across genres and disciplines. Readers trust the series to provide authoritative texts enhanced by introductions and notes by distinguished scholars and contemporary authors, as well as up-to-date translations by award-winning translators.

<urn:uuid:ae4bfa50-9057-494d-a940-93ee5959712f>

CC-MAIN-2016-50

https://www.chapters.indigo.ca/en-ca/books/the-pre-raphaelites-from-rossetti/9780141192406-item.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

PDF (Acrobat) Document File Be sure that you have an application to open this file type before downloading and/or purchasing. 1.31 MB | 11 pages This package includes 12 puzzles for students to explore character traits. Each puzzle has 4 examples (48 scenarios) for students to determine character traits. These 12 puzzles can be printed in black and white or in color (color looks best). To prepare center, simple print puzzles (preferably on cardstock), laminate and cut each 5 piece puzzle out. Store all puzzle pieces in a Ziplock bag.

<urn:uuid:b6c3e7c5-1f28-4daf-a46b-ab6920a51b19>

CC-MAIN-2016-50

https://www.teacherspayteachers.com/Product/Character-Traits-Jigsaw-Puzzles-Grades-3-6-Common-Core-Aligned-1259710

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698542712.49/warc/CC-MAIN-20161202170902-00181-ip-10-31-129-80.ec2.internal.warc.gz

en

Mauritian tomb bats ( (Dengis, 1996)) are found widely distributed throughout the middle to southern regions of Africa, as well as on several offshore islands. Individuals have also been recorded on the islands of Madagascar and Bourbon, as well as a handful of islands in the Indian Ocean. Mauritian tomb bats are distinguishable from other bats by an entirely white ventral surface, combined with mixed-gray dorsal pelage. They have sleek, short hair. Their wings are long and narrow, generally with a pale, parchment-like coloration, and are attached at the ankle. The long, narrow tip of the wing is shortened somewhat to facilitate crawling when the wings are folded. The ears are erect, triangle-shaped, with rounded edges and no papillae on the inner margins. (Dengis, 1996) Mauritian tomb bats do not exhibit sexual dimorphism in coloration or size, although there is evidence of geographic variation in size. In South Africa, the measurements (in mm) of males and females, respectively, are: length of head and body, 101 to 109, 105 to 116; length of forearm, 61 to 63, 61 to 66; and length of tail, 17 to 25, 20 to 23. A typical male body mass (in g) in Southern Africa is 20 to 36, while an average female mass is 27.5 to 31.6. The average wingspan is 181 to 204 mm. (Dengis, 1996) There is little published research dealing specifically with the mating systems of Taphozous species in this regard, with individuals engaging in polygynous relationships during mating seasons. (Bernard and Cumming, 1997; Dengis, 1996). It is likely that they are similar to other Parental investment in (Dengis, 1996)is restricted to the female of any mating pair, and is similiar to the majority of other bat species. The female gives birth to a single young, with remains with the mother at all times until it is able to fly on its own. Although there is little to no research in this particular area, it is possible that this time spent with the mother allows the offspring time to observe hunting behavior and to learn other necessary behaviors for later in life. There is little research information available regarding the lifespan of T. mauritianus in the wild or in captivity. (Dengis, 1996) Day roosts are always chosen so that take-off is unhindered, and may be in the open but out of direct sunlight. When disturbed, Mauritian tomb bats sometimes takes refuge in a tree near their normal roost, or will simply scurry sideways across the roost until they are out of sight of the intruder. Roosts are likely to be recolonized on subsequent years, and these sites generally become stained with a mixture of urine and gular sac secretions over time. (Dengis, 1996) Mauritian tomb bats usually wait for complete darkness to fall before beginning to forage. They detect their prey at long range over open areas, never flying above the tops of nearby trees. When hunting, they make periodic dives of up to 10 meters. With each dive they increase the rate of echolocation calling, possibly to confound moths that would be able to detect the frequencies used by a foraging bat. (Dengis, 1996; Fenton, et al., 1980) It is thought that (Dengis, 1996)individuals rarely travel far from their day roosting site, although little research has been conducted on their movement patterns. Mauritian tomb bats communicate primarily through audible calls, chirruping while at rest but screeching when encountering aggressive situations. Whenever another member of a roosting group approaches, the members of the group already in the roost will emit three-syllable calls at 2-3 second intervals. The reason for these particular social calls is currently unknown. Like most other mammals, they are likely to use chemical cues and touch as well in social communication. (Dengis, 1996; Fenton and Bell, 1981; Fenton, et al., 1980) Mauritian tomb bats perceive their environment in different ways depending on the amount of light available. During daylight hours, they rely primarily on vision to identify intruders or prey that come too close to the roost. Once darkness has completely fallen, they rely on orally emitted echolocation sounds to forage. (Dengis, 1996; Fenton and Bell, 1981; Fenton, et al., 1980) Mauritian tomb bats use vision to pick out potential prey during daylight hours, rather than echolocation. At night, they use orally emitted echolocation sounds to detect prey at long range over open areas. (Dengis, 1996; Fenton, et al., 1980) Snakes as well as nocturnal raptors occasionally prey on Mauritian tomb bats, although specific predators are rarely named in the literature. Mauritian tomb bats occasionally host parasites in the genus Anchitrema. These parasites may be transferred to them by African sheath-tailed bats, Coleura afra, which sometimes roost with Mauritian tomb bats. (Dengis, 1996; Skinner and Chimimba, 2005) Mauritian tomb bats are important in controlling pest populations in the ecosystems they occupy. They consume large numbers of insects nightly. Mauritian tomb bats also host parasites in the genus Anchitrema. (Dengis, 1996; Fenton, et al., 1980) Mauritian tomb bats help humans by controlling pest populations. The insects they consume may carry diseases that harm humans or may simply be considered nuisance species. (Dengis, 1996; Fenton, et al., 1980) There are no known adverse affects of T. mauritianus on humans. Mauritian tomb bats are widespread throughout Africa and neighboring islands. They are not listed as requiring special conservation action under any current programs. Tanya Dewey (editor), Animal Diversity Web. Chris Francis (author), University of Wisconsin-Stevens Point, Chris Yahnke (editor, instructor), University of Wisconsin-Stevens Point. living in sub-Saharan Africa (south of 30 degrees north) and Madagascar. uses sound to communicate having body symmetry such that the animal can be divided in one plane into two mirror-image halves. Animals with bilateral symmetry have dorsal and ventral sides, as well as anterior and posterior ends. Synapomorphy of the Bilateria. an animal that mainly eats meat uses smells or other chemicals to communicate The process by which an animal locates itself with respect to other animals and objects by emitting sound waves and sensing the pattern of the reflected sound waves. animals that use metabolically generated heat to regulate body temperature independently of ambient temperature. Endothermy is a synapomorphy of the Mammalia, although it may have arisen in a (now extinct) synapsid ancestor; the fossil record does not distinguish these possibilities. Convergent in birds. forest biomes are dominated by trees, otherwise forest biomes can vary widely in amount of precipitation and seasonality. An animal that eats mainly insects or spiders. offspring are produced in more than one group (litters, clutches, etc.) and across multiple seasons (or other periods hospitable to reproduction). Iteroparous animals must, by definition, survive over multiple seasons (or periodic condition changes). having the capacity to move from one place to another. the area in which the animal is naturally found, the region in which it is endemic. active during the night having more than one female as a mate at one time rainforests, both temperate and tropical, are dominated by trees often forming a closed canopy with little light reaching the ground. Epiphytes and climbing plants are also abundant. Precipitation is typically not limiting, but may be somewhat seasonal. Referring to something living or located adjacent to a waterbody (usually, but not always, a river or stream). breeding is confined to a particular season remains in the same area reproduction that includes combining the genetic contribution of two individuals, a male and a female associates with others of its species; forms social groups. a wetland area that may be permanently or intermittently covered in water, often dominated by woody vegetation. uses touch to communicate Living on the ground. the region of the earth that surrounds the equator, from 23.5 degrees north to 23.5 degrees south. A terrestrial biome. Savannas are grasslands with scattered individual trees that do not form a closed canopy. Extensive savannas are found in parts of subtropical and tropical Africa and South America, and in Australia. A grassland with scattered trees or scattered clumps of trees, a type of community intermediate between grassland and forest. See also Tropical savanna and grassland biome. A terrestrial biome found in temperate latitudes (>23.5° N or S latitude). Vegetation is made up mostly of grasses, the height and species diversity of which depend largely on the amount of moisture available. Fire and grazing are important in the long-term maintenance of grasslands. uses sight to communicate reproduction in which fertilization and development take place within the female body and the developing embryo derives nourishment from the female. Bernard, R., G. Cumming. 1997. African Bats: Evolution of Reproductive Patterns and Delays. The Quarterly Review of Biology, Vol. 72: 253-274. Dengis, C. 1996. Taphozous mauritianus. Mammalian Species, No. 522: 1-5. Fenton, M., G. Bell. 1981. Recognition of Species of Insectivorous Bats by Their Echolocation Calls. Journal of Mammology, Vol. 62: 233-243. Fenton, M., G. Bell, D. Thomas. 1980. Echolocation and feeding behaviour of Taphozous Mauritianus. Canadian Journal of Zoology, 58: 1774-1777. Skinner, D., C. Chimimba. 2005. The Mammals of the Southern African Subregion. New York, NY: Cambridge University Press.

<urn:uuid:736fd95b-8339-4415-a87d-dab221238694>

CC-MAIN-2016-50

http://animaldiversity.org/accounts/Taphozous_mauritianus/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

ELT proposes to develop an inexpensive printer whose output can be read by touch and sight. The printed output will serve as a bridge to society's graphics rich information - for those who are blind as well as those who have a fair bit of residual vision and would benefit from multimodal print materials. The team of engineers and university researchers will leverage Rapid Prototyping (RP) technology's platform innovations, and modify commercially available off-the- shelf materials to achieve the aims. By leveraging existing technologies with known performance, ELT can keep the costs of the printers and their printed materials low. The team expects that the printer, once fully developed, would be capable of printing raised output that meet Library of Congress standards for tactile text production of braille (and other tactile fonts) as well as solid line drawings (e.g. graphs, charts, drawings, an mathematical and scientific information) in a manner that is robust, provides excellent resolution, and is both easy to feel and easy to see. The research will develop a tactile printer to produce text and graphics that are both tactile and visual. Those who have a visual impairment will use the printer to achieve greater levels of independence, employment and education. Consequently, they are expected to require less health care and enjoy a higher quality of life.

<urn:uuid:37b6e94b-9443-46c5-9c80-ab8fa4969810>

CC-MAIN-2016-50

http://grantome.com/grant/NIH/R43-EY021982-01A1

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

The term "cypress" can mean a few different kinds of plants, including any genus or species in the family Cupressaceae or any member of the cypress genus, Cupressus. The family includes cedars, cypresses, arborvitaes and redwoods, although most of the landscape shrubs are in the genus Chamaecyparis, the false cypresses. Many of the cultivars of Chamaecyparis obtusa are called Hinoki cypresses, and most are shorter shrubs ideal for landscape settings where trees won't fit. The irregularly shaped Golden Dwarf Hinoki cypress (Chamaecyparis obtusa "Nana Lutea") grows to 3 feet tall and offers golden highlights on deep-green foliage in U.S. Department of Agriculture plant hardiness zones 5 through 9. Another Hinoki that offers visual interest due to its irregular shape is Twisted Hinoki cypress (Chamaecyparis obtusa "Torulosa"), which grows in USDA zones 4 through 8. Growing slowly to 9 feet tall and wide, twisted Hinoki has red bark and twisted branches that add to its visual appeal. Other Obtusa Cultivars While many of the cultivars of Chamaecyparis obtusa are commonly called Hinoki cypress, other cultivars are named something other than Hinoki. Fernspray false cypress (Chamaecyparis obtusa "Filicoides") slowly reaches 8 to 10 feet tall. This variety has an irregular pyramidal form with long branches that resemble fern leaves jutting outward and upward. "Tempelhof" (Chamaecyparis obtus "Tempelhof") grows to an 8-foot-tall, 4-foot-wide rounded pyramid and offers the same dense, green foliage of many other false cypresses. Both of these false cypresses grow in USDA zones 4 through 8. Another commonly encountered landscape false cypress species is Chamaecyparis pisifera. Cultivars of this species range from rounded mounds to pyramidal, miniature tree-shaped shrubs. "Baby Blue" sawara cypress (Chamaecyparis pisifera "Baby Blue") has silvery blue foliage that forms densely on twisting branches. This variety reaches 6 feet tall and 4 feet wide and often has a rounded pyramidal shape. For brighter color, consider the golden mop varieties such as Sungold thread-branch cypress (Chamaecyparis pisifera filifera "Sungold"). The dangling branches form a 5-foot-tall and slightly wider mop-headed mound and the new foliage is bright gold. Both varieties grow in USDA zones 4 through 8. While most of the true cypresses are trees, "Wilma Goldcrest" (Cupressus macrocarpa "Wilma Goldcrest"), hardy in USDA zones 7 through 10, is a columnar bright-gold shrub with a defined point that grows to 8 feet tall and up to 2 feet wide. "Drew's Blue" (Microbiota decussata "Condrew"), on the other hand, offers deep, bluish-green foliage on a spreading mound that reaches up to 2 feet tall and 3 feet wide. In the winter, the foliage of "Drew's Blue" gains a maroon tint. "Drew's Blue" is hardy in USDA zones 2 through 8 and is a variety that handles full shade. (Refs 7,8) - Comstock/Comstock/Getty Images

<urn:uuid:fa515dfa-9924-424b-b622-b8354c679c83>

CC-MAIN-2016-50

http://homeguides.sfgate.com/types-evergreen-cypress-shrubs-83044.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

The possibility that people who differ with respect to the A, B, and O blood groups might differ in their susceptibility to such diseases as carcinoma of the stomach, duodenal and gastric ulcer, pernicious anemia, and diabetes mellitus has been much studied of late. A critical analysis of the information so far collected shows, however, that much of it cannot be accepted without serious reservations and that some of it is probably worthless. Since blood groups are inherited, their distribution in small communities is sometimes determined by the predominance of certain family or ethnic units. It is extremely difficult to find a series of healthy people that will be truly comparable to a series of patients with a given disease. The statistical methods used can yield valid results only when sound methodology provides reliable data. Failure to observe this axiomatic principle explains much of the present confusion in research on blood groups and disease. Manuila A. BLOOD GROUPS AND DISEASE-HARD FACTS AND DELUSIONS. JAMA. 1958;167(17):2047-2053. doi:10.1001/jama.1958.02990340007002

<urn:uuid:e7c8ef04-0f1e-49d7-bc96-4e34b1c76d40>

CC-MAIN-2016-50

http://jamanetwork.com/journals/jama/article-abstract/324450

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Legionella pneumophila is a gram-negative bacterial pathogen that replicates in host macrophages and causes a severe pneumonia called Legionnaires' Disease. The innate immune response to L. pneumophila remains poorly understood. Here we focused on identifying host and bacterial factors involved in the production of type I interferons (IFN) in response to L. pneumophila. It was previously suggested that the delivery of L. pneumophila DNA to the host cell cytosol is the primary signal that induces the type I IFN response. However, our data are not easily reconciled with this model. We provide genetic evidence that two RNA-sensing proteins, RIG-I and MDA5, participate in the IFN response to L. pneumophila. Importantly, these sensors do not seem to be required for the IFN response to L. pneumophila DNA, whereas we found that RIG-I was required for the response to L. pneumophila RNA. Thus, we hypothesize that bacterial RNA, or perhaps an induced host RNA, is the primary stimulus inducing the IFN response to L. pneumophila. Our study also identified a secreted effector protein, SdhA, as a key suppressor of the IFN response to L. pneumophila. Although viral suppressors of cytosolic RNA-sensing pathways have been previously identified, analogous bacterial factors have not been described. Thus, our results provide new insights into the molecular mechanisms by which an intracellular bacterial pathogen activates and also represses innate immune responses. Initial detection of invading microorganisms is one of the primary tasks of the innate immune system. However, the molecular mechanisms by which pathogens are recognized remain incompletely understood. Here, we provide evidence that an immunosurveillance pathway (called the RIG-I/MDA5 pathway), thought primarily to detect viruses, is also involved in the innate immune response to an intracellular bacterial pathogen, Legionella pneumophila. In the response to viruses, the RIG-I/MDA5 immunosurveillance pathway has been shown to respond to viral RNA or DNA. We found that the RIG-I pathway was required for the response to L. pneumophila RNA, but was not required for the response to L. pneumophila DNA. Thus, one explanation of our results is that L. pneumophila RNA may access the host cell cytosol, where it triggers the RIG-I/MDA5 pathway. This is unexpected since bacteria have not previously been thought to translocate RNA into host cells. We also found that L. pneumophila encodes a secreted bacterial protein, SdhA, which suppresses the RIG-I/MDA5 pathway. Several viral repressors of the RIG-I/MDA5 pathway have been described, but bacterial repressors of RIG-I/MDA5 are not known. Thus, our study provides novel insights into the molecular mechanisms by which the immune system detects bacterial infection, and conversely, by which bacteria suppress innate immune responses. Citation: Monroe KM, McWhirter SM, Vance RE (2009) Identification of Host Cytosolic Sensors and Bacterial Factors Regulating the Type I Interferon Response to Legionella pneumophila. PLoS Pathog 5(11): e1000665. doi:10.1371/journal.ppat.1000665 Editor: Ralph R. Isberg, Tufts University School of Medicine, United States of America Received: June 8, 2009; Accepted: October 26, 2009; Published: November 20, 2009 Copyright: © 2009 Monroe et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: R.E.V. is supported by a Cancer Research Institute Investigator Award, the Hellman Family Faculty Fund, and NIH grants AI075039 and AI080749. K.M.M is a National Science Foundation Graduate Research Fellow. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. The intracellular bacterium Legionella pneumophila has become a valuable model for the study of immunosurveillance pathways. L. pneumophila is a motile gram-negative bacterium that is the cause of a severe pneumonia called Legionnaires' Disease . In the environment, L. pneumophila is believed to replicate in various species of freshwater amoebae. In humans, L. pneumophila causes disease by replicating within alveolar macrophages in the lung . Replication in macrophages and amoebae requires a type IV secretion system that the bacterium uses to inject effector proteins into the host cell cytosol . These effectors are believed to orchestrate the creation of an intracellular vacuole in which L. pneumophila can replicate. Interestingly, there appears to be considerable redundancy among the effectors, and there are few examples of single effector mutations that have a large effect on intracellular replication of L. pneumophila. One L. pneumophila effector required for intracellular replication is SdhA , but the mechanism by which SdhA acts on host cells remains uncertain . A variety of immunosurveillance pathways that detect L. pneumophila infection have been described ,,,. The best characterized cytosolic immunosurveillance pathway requires the host proteins Naip5 and Ipaf to detect the cytosolic presence of L. pneumophila flagellin, leading to activation of caspase-1, rapid pyroptotic macrophage death, and efficient restriction of bacterial replication ,,,,. L. pneumophila has also been observed to induce transcriptional activation of type I interferon (IFN) genes in macrophages and epithelial-like cell lines by a mechanism that remains incompletely characterized ,. Induction of type I IFNs by L. pneumophila is independent of the flagellin-sensing pathway , but also appears to contribute to restriction of bacterial replication in macrophages , and epithelial-like cell lines . Type I IFNs are an important class of cytokines that orchestrate diverse immune responses to pathogens . Encoded by a single IFNβ gene as well as multiple IFNα and other (e.g., IFNε, κ, δ, ζ) genes, type I IFNs are transcriptionally induced by a number of immunosurveillance pathways, including Toll-like receptors (TLRs) and a variety of cytosolic sensors . For example, cytosolic RNA is recognized by two distinct helicase and CARD-containing sensors, RIG-I and MDA5 , that signal through the adaptor IPS-1 (also called MAVS, CARDIF, or VISA) ,,,,. The cytosolic presence of DNA also induces type I IFNs, but this phenomenon is less well understood ,. Studies with Ips-1-deficient mice have indicated that cytosolic DNA can signal independently of Ips-1 in many cell types, including macrophages . However, cytosolic responses to DNA appear to require IPS-1 in certain cell types, including 293T cells ,. Indeed, two recent reports have described a pathway by which AT-rich DNA can signal via IPS-1 ,. In this pathway, DNA is transcribed by RNA polymerase III to form an RNA intermediate that can be sensed by RIG-I. The RNA Pol III pathway appears to be operational in macrophages, but is redundant with other DNA-sensing pathways in these cells. A couple of reports have proposed that DAI (also called ZBP-1) is a cytosolic DNA-sensor ,, but Zbp1-deficient mice appear to respond normally to cytosolic DNA , consistent with the existence of multiple cytosolic sensors for DNA. Other small molecule compounds, such as cyclic-di-GMP and DMXAA, can also trigger cytosolic immunosurveillance pathways leading to induction of type I IFNs, but these remain to be fully characterized ,,. Type I IFNs are typically considered antiviral cytokines that act locally to induce an antiviral state and systemically to induce cellular innate and adaptive immune responses . Mice deficient in the type I IFN receptor (Ifnar) are unable to respond to type I IFNs, and are highly susceptible to viral infections. Interestingly, most bacterial infections also trigger production of type I IFNs, but the physiological significance of type I IFNs in immune defense against bacteria is complex. Type I IFN appears to protect against infection with group B Streptococcus , but this is not the case for many other bacterial infections. For example, the intracellular gram-positive bacterium Listeria monocytogenes induces a potent type I IFN response ,, but Ifnar-deficient mice are actually more resistant to L. monocytogenes infection than are wildtype mice ,,. Many bacterial pathogens, including Francisella tularensis, Mycobacterium tuberculosis, Brucella abortus, and group B Streptococcus, induce type I IFN production by macrophages via a cytosolic TLR-independent pathway ,,,, but the bacterial ligands and host sensors required for the interferon response of macrophages to these bacteria remain unknown. It was demonstrated that induction of type I IFN by L. pneumophila in macrophages did not require bacterial replication or signaling through the TLR-adaptors MyD88 or Trif, but did require the bacterial Dot/Icm type IV secretion system . Because the IFN response could be recapitulated with transfected DNA , and because Dot/Icm system has been shown to conjugate DNA plasmids to recipient bacteria , it was proposed that perhaps L. pneumophila induced type I IFN via a cytosolic DNA-sensing pathway . Another report used RNA interference to implicate the signaling adaptor IPS-1 (MAVS) in the IFN response to L. pneumophila in human A549 epithelial-like cells . However, the significance of this latter finding is unclear since RNAi-mediated knockdown of RIG-I and MDA5, the two sensor proteins directly upstream of IPS-1, did not have an effect on induction of type I IFN by L. pneumophila . Moreover, the A549 response to L. pneumophila may be distinct from the macrophage or in vivo response. Recently, one report proposed that L. pneumophila DNA was recognized in the cytosol by RNA polymerase III , resulting in the production of an RNA intermediate that triggered IFN production via the IPS-1 pathway. Apparently consistent with this proposal, Ips-1-deficient mouse macrophages did not produce type I IFN in response to L. pneumophila . Moreover, since Pol III acts preferentially on AT-rich substrates, it is plausible that Pol III would recognize the L. pneumophila genome, which has a high proportion (62%) of A:T basepairs. However, the response to L. pneumophila DNA was not investigated . In addition, the same report, as well as others ,, observed that the type I IFN response to AT-rich (or any other) DNA is not Ips-1-dependent in mouse cells. Thus, if L. pneumophila DNA was reaching the cytosol, the simplest prediction would be that the resulting type I IFN response would be independent of Ips-1, instead of Ips-1-dependent, as was shown . Thus, the mechanism of IFN induction by L. pneumophila remains unclear. In the present study, we sought to define bacterial and host factors controlling the macrophage type I IFN response to L. pneumophila. In agreement with previous studies ,, we find that Ips-1 is required for optimal induction of type I IFN in response to L. pneumophila infection in vitro. We extend this observation by demonstrating that Ips-1 also contributes to the type I IFN response in an in vivo model of Legionnaires' Disease. Furthermore, we provide the first evidence that two RNA sensors upstream of Ips-1, Rig-i and Mda5, are involved in the macrophage interferon response to L. pneumophila. Importantly, however, we did not observe a role for the Pol III pathway in the type I IFN response to L. pneumophila. Instead, we found that L. pneumophila genomic DNA stimulates an Ips-1/Mda5/Rig-i-independent IFN response in macrophages, which contrasts with the Ips-1-dependent response to L. pneumophila infection. On the other hand, we found that L. pneumophila RNA stimulated a Rig-i-dependent IFN response. Thus, our data are consistent with a model in which L. pneumophila RNA, or host RNA, rather than L. pneumophila DNA, is the primary ligand that stimulates the host IFN response. We also investigated whether bacterial factors that modulate the host type I IFN response. Although numerous viral proteins that interfere with IFN signaling have been described , similar bacterial proteins have not been documented. It is therefore interesting that we were able to identify a secreted bacterial effector, SdhA, as an inhibitor of the Ips-1-dependent IFN response to L. pneumophila. Taken together, our findings provide surprising evidence that cytosolic RNA-sensing pathways are not specific for viral infections but can also respond to bacterial infections, and moreover, our data provide a specific example of a bacterial factor that suppresses the host IFN response. The cytosolic RNA-sensing pathway is involved in the macrophage response to L. pneumophila We hypothesized that a cytosolic innate immune sensing pathway controls the type I IFN response to L. pneumophila. To test this hypothesis, we determined whether macrophages deficient in known cytosolic RNA and DNA sensing pathway components can induce type I IFNs in response to L. pneumophila. Macrophages were infected with L. pneumophila at a multiplicity of infection (MOI) of 1 and induction of interferon beta (Ifnb) message was analyzed by quantitative RT-PCR after 4 hours (Figure 1A–D). As previously reported , Ips-1−/− macrophages showed a significantly reduced induction of Ifnb in response to infection with wild type L. pneumophila compared to Ips-1+/+ macrophages (p<0.05; Figure 1A). Induction of Ifnb was not completely eliminated in Ips-1−/− macrophages, however, as Irf3−/− macrophages exhibited an even lower induction of Ifnb compared to Ips-1−/− (p<0.05; Figure 1A). Consistent with previous reports , we found that the Dot/Icm type IV secretion system was required to elicit the macrophage type I interferon response since Δdot L. pneumophila did not induce a robust type I interferon response (Figure 1A). These results suggest that L. pneumophila induces type I IFN via a cytosolic RNA immunosurveillance pathway that involves the adaptor Ips-1. (A) Induction of interferon beta (Ifnb) by L. pneumophila is largely dependent on Ips-1. Bone marrow derived Ips-1+/+, Ips-1−/−, and Irf3−/− macrophages were infected with wild type and Δdot L. pneumophila at a multiplicity of infection (MOI) of 1. Ifnb induction was analyzed by quantitative RT-PCR 4 hours post infection. Ifnb message was normalized to ribosomal protein rps17 levels. Differences in Ifnb transcript induction were statistically significant in Ips-1+/+versus Ips-1−/− macrophages (*, p<0.05) and Ips-1−/− versus Irf3−/− (*, p<0.05, Student's t-test) when infected with wild type L. pneumophila. (B) Induction of Ifnb by L. pneumophila is partially dependent on Mda5. Bone marrow derived Mda5+/+ and Mda5−/− macrophages were infected with wild type and Δdot L. pneumophila at a multiplicity of infection (MOI) of 1. Ifnb induction was assessed by quantitative RT-PCR as in (A). Differences in Ifnb induction were statistically significant (*, p<0.05, Student's t-test) between Mda5+/+ and Mda5−/− infected with wild type L. pneumophila. (C) Retroviral transduction of a Rig-i shRNA, but not the control shRNA, knocks down expression of Rig-i in MyD88−/−Trif−/− immortalized macrophages. Stable transduction of MyD88−/−Trif−/− immortalized macrophages was performed with a retroviral vector containing a control and Rig-i shRNA. Level of Rig-i knockdown was determined by quantitative RT-PCR under uninfected, infected, and poly I:C stimulation conditions. Differences in Rig-i transcript levels were statistically significant (*, p<0.05, Students t-test) under resting, infected, and ligand-stimulated conditions. (D) Rig-i is involved in the host type I interferon response to infection with L. pneumophila. Rig-i knockdown leads to reduced Ifnb expression in response to infection with ΔflaA L. pneumophila, as well as stimulation with poly I:C. Quantitative RT-PCR was carried out 4 hours post infection. Control knockdown macrophages induced a statistically significant (*, p<0.05) higher level of Ifnb transcript in response to ΔflaA L. pneumophila and poly I:C. No significant difference was found in uninfected or Δdot L. pneumophila infected macrophages. (E) Induction of Ifnb by L. pneumophila is independent of Zbp-1 (Dai). Bone marrow derived Zbp-1+/+ and Zbp-1−/− macrophages were infected with L. pneumophila strains and analyzed for Ifnb induction as in (A) and (B). Differences in Ifnb transcript levels between Zbp-1+/+ and Zbp-1−/− macrophages infected with L. pneumophila were not statistically significant (ns, p>0.1, Student's t-test). We hypothesized that a cytosolic RNA sensor that functions upstream of Ips-1 could be involved in the type I interferon host response to L. pneumophila. However, knockdown experiments in A549 cells previously failed to reveal a role for the known sensors (MDA5 and RIG-I) upstream of IPS-1 . Therefore, we tested Mda5−/− knockout macrophages (Figure 1B) and found reduced induction of Ifnb message as compared to control Mda5+/+ macrophages. Importantly, however, Dot-dependent induction of type I IFN was not completely abolished in Mda5−/− macrophages, implying that other redundant pathways are also involved. Rig-i knockout mice die as embryos, so we were unable to obtain Rig-i−/− knockout macrophages. To circumvent this problem, we stably transduced immortalized macrophages with a retrovirus expressing an shRNA to knock down Rig-i expression. Quantitative RT-PCR demonstrated that the knockdown was effective, even in infected macrophages (Figure 1C), and that Rig-i knockdown had a significant effect on the induction of type I interferon by L. pneumophila (Figure 1D). In the experiments in Figures 1C and 1D we used the ΔflaA strain of L. pneumophila, but similar results were obtained with wildtype, and it was previously shown that flagellin is not required for the IFN response to L. pneumophila ,. It is unusual, but not unprecedented, that a pathogen would stimulate both the RIG-I and MDA5 RNA-sensing pathways . At present, only one candidate cytosolic DNA sensor involved in the IFN response has been described ,. To determine whether this sensor, called Dai (or Zpb1), is involved in the type I interferon response to L. pneumophila, we tested whether Zbp1−/− macrophages respond to L. pneumophila. We observed similar levels of Ifnb induction in Zbp1+/+ and Zbp1−/− macrophages (Figure 1E). Taken together, these results imply that the RNA sensors Rig-i and Mda5, but not the DNA sensor Zbp1, are involved in sensing L. pneumophila infection. We tested whether loss of signaling through the RNA sensing components Ips-1 or Mda5 could mimic the previously observed permissiveness of Ifnar−/− macrophages . However, neither Ips-1−/− nor Mda5−/− macrophages were permissive to L. pneumophila, suggesting that the low levels of IFNβ produced in the absence of Ips-1 or Mda5 are sufficient to restrict L. pneumophila growth (Figure S1). The type IV secreted effector SdhA suppresses induction of interferon by L. pneumophila To identify bacterial components that modulate the type I interferon response to L. pneumophila, we conducted a transposon mutagenesis screen. The LP02 strain of L. pneumophila was mutagenized with a mariner transposon as described previously . Individual transposon mutants were used to infect MyD88−/−Trif−/− bone marrow-derived macrophages at an MOI of 1, and after approximately 16 hours, supernatants were collected and overlayed on type I IFN reporter cells . Induction of type I IFN was compared to wild type (LP02) and Δdot L. pneumophila controls. We tested approximately 2000 independent mutants and isolated eight mutants that were confirmed to be defective in induction of type I IFN. All these mutants harbored insertions in genes required for the function of the Dot/Icm apparatus (e.g., icmB, icmC, icmD, icmX, icmJ), thereby validating the screen. Interestingly, a single transposon mutant, 11C11, was found that consistently hyperinduced the type I interferon response. The transposon insertion mapped to the 3′ end (nucleotide position 3421 of the open reading frame) of a gene, sdhA, that was previously shown to encode a type IV secreted effector protein of 1429 amino acids (166kDa) (Figure 2A). SdhA has previously been shown to be essential for bacterial replication in macrophages , but a connection to type I IFNs was not previously noted. (A) The 11C11 mutant harbors a transposon insertion in sdhA. The transposon insertion site is in the 3′ end of the open reading frame of the sdhA locus at nucleotide position 3421. (B) A clean deletion mutant of sdhA recapitulates the 11C11 transposon mutant and hyperinduces type I interferon. Bone marrow derived Myd88−/−Trif−/− macrophages were infected with stationary phase L. pneumophila strains at a MOI of 1. Cell supernatants were harvested 8 hours post infection and assayed for type I interferon induction by an L929-ISRE luciferase bioassay. Type I interferon levels were determined by generating a standard curve with recombinant IFNβ An unmarked clean deletion of sdhA was compared to wild type, Δdot, the transposon mutant 11C11, and a triple deletion of sdhA and the two L. pneumophila paralogs, sidH and sdhB. Differences in IFNβ induction were statistically significant between WT L. pneumophila and the transposon mutant 11C11 (***, p<0.0005, Student's t-test). Differences between 11C11, ΔsdhA and ΔsdhAΔsdhBΔsidH were not statistically significant (ns, p>0.05, Student's t-test). (C) A clean deletion mutant of sdhA recapitulates the 11C11 transposon mutant and hyperinduces transcriptional activation of Ifnb. Bone marrow derived Myd88−/−Trif−/− macrophages were infected with wild type, Δdot, ΔsdhA, 11C11, ΔsdhAΔsdhBΔsidH stationary phase L. pneumophila and transcriptional induction of Ifnb was analyzed by quantitative RT-PCR. (D) Complementation of the sdhA mutant results in loss of the Ifnb hyperinduction phenotype. MyD88−/−Trif−/− BMDM were infected at an MOI of 1 with ΔflaA, Δdot, ΔflaAΔsdhA and ΔflaAΔsdhA L. pneumophila carrying vector or a plasmid expressing full length SdhA. Expression of Ifnb message was assessed by quantitative RT-PCR 4 hours post infection. To confirm that the hyperinduction of type I interferon was due to mutation of sdhA, the 11C11 transposon mutant was compared to an unmarked clean deletion of sdhA (Figure 2B). Both the 11C11 mutant and ΔsdhA L. pneumophila showed similar levels of hyperinduction of type I interferon. The L. pneumophila genome contains 2 paralogs of sdhA, called sidH and sdhB. A triple knockout strain, ΔsdhAΔsdhBΔsidH, was compared to single deletion of sdhA to determine if either paralog regulated the induction of type I IFNs. Similar levels of IFNβ were induced ΔsdhAΔsdhBΔsidH and ΔsdhA (Figure 2B). Similar results were obtained when induction of Ifnb was assessed by quantitative RT-PCR (Figure 2C). A role for sdhA in regulating the interferon response was further confirmed by complementing the ΔsdhA mutation with an sdhA expression plasmid . As expected, the complemented strain induced significantly less type I IFN than the control ΔsdhA strain harboring an empty plasmid (Figure 2D). These results indicate that SdhA functions, directly or indirectly, to repress the induction of type I IFN by L. pneumophila. Hyperinduction of type I IFN by the sdhA mutant involves the cytosolic RNA-sensing pathway It was possible that ΔsdhA mutants hyperinduced type I IFN via a pathway distinct from the normal cytosolic RNA-sensing pathway that responds to wildtype L. pneumophila. Therefore, to determine whether hyperinduction of type I interferon by ΔsdhA occurs through the same pathway that responds to wild type L. pneumophila, we infected Ips-1−/− and Mda5−/− macrophages with ΔsdhA L. pneumophila. Induction of Ifnb message was determined by quantitative RT-PCR. The hyperinduction of Ifnb seen in Ips-1+/+ macrophages was almost abolished in Ips-1−/− macrophages (p<0.001; Figure 3A). As a control, induction of Ifnb by poly I:C, a double-stranded synthetic RNA analog, was also Ips-1-dependent as expected. Similarly, the hyperinduction of Ifnb was also reduced in Mda5−/− macrophages (p<0.01; Figure 3B). However, the Mda5−/− macrophages still induced significant amounts of Ifnb, suggesting that the requirement for Mda5 is not complete. We also tested the ΔsdhA mutant in Rig-i knockdown macrophages. Rig-i knockdown appeared to be effective (Figure 3C) and specifically diminished Ifnb expression (Figure 3D). Thus, the residual Ifnb induction in Mda5−/− may be due to Rig-i, or to another uncharacterized pathway. As a control, Theiler's virus (TMEV) induced Ifnb in a completely Mda5-dependent manner, as expected (Figure 3B). (A) Hyperinduction of Ifnb by ΔsdhA L. pneumophila is largely dependent on Ips-1. Bone marrow derived Ips-1+/+ and Ips-1−/− macrophages were infected with wild type, Δdot, and ΔsdhA L. pneumophila at an MOI of 1. Ips-1+/+ and Ips-1−/− macrophages were transfected with 1.0 µg/ml poly I:C. 4 hours post infection and stimulation, macrophages were harvested and assessed for Ifnb induction as in Figure 1. Ips-1+/+ infected with WT L. pneumophila induced statistically significant higher levels of Ifnb transcript than Ips-1−/− (**, p<0.005, Student's t-test). The same phenotype was seen in Ips-1+/+ infected with ΔsdhA L. pneumophila (**, p<0.005) and transfected with poly I:C (*, p<0.05) when compared to Ips-1−/−. (B) Hyperinduction of Ifnb by ΔsdhA L. pneumophila is partially dependent on Mda5. Bone marrow derived Mda5+/+ and Mda5−/− macrophages were infected with ΔflaA, Δdot, and ΔflaAΔsdhA L. pneumophila at an MOI of 1. Theiler's virus (TMEV) was overlaid onto Mda5+/+ and Mda5−/− macrophages. 4 hours post bacterial and viral infection, macrophages were harvested and assessed for Ifnb induction by qRT-PCR as in Figure 1. Ifnb message was induced statistically significantly in Mda5+/+ macrophages infected with ΔflaA L. pneumophila versus Mda5−/− (*, p<0.05, Student's t-test). Mda5+/+ also responded statistically significantly to ΔflaAΔsdhA L. pneumophila over Mda5−/− (*, p<0.05, Student's t-test), while Theiler's virus elicited a robust Ifnb response from Mda5+/+ not seen in Mda5−/− (***, p<0.005, Student's t-test). (C) Retroviral transduction of a Rig-i shRNA, but not the control shRNA, knocks down expression of Rig-i. MyD88−/−Trif−/− immortalized macrophages were stably transduced with retroviral vector containing a control and Rig-i shRNA. Level of Rig-i knockdown was determined by quantitative RT-PCR under uninfected and infected conditions. Differences in Rig-i transcript levels were statistically significant (*, p<0.05, Students t-test) under resting and infected conditions. (D) Rig-i is involved in the hyperinduction of type I interferon by ΔsdhA L. pneumophila. Rig-i knockdown leads to reduced Ifnb expression in response to infection with WT and ΔsdhA L. pneumophila, as well as Sendai virus. Quantitative RT-PCR was carried out 4 hours post infection. Control knockdown macrophages induced a statistically significant (*, p<0.05) higher level of Ifnb transcript in response to WT and ΔsdhA L. pneumophila and Sendai virus. No significant difference was found in uninfected or Δdot L. pneumophila infected macrophages. The effects of the ΔsdhA mutant are independent of caspase-1 activation It was previously shown that ΔsdhA mutants induce a rapid death of infected macrophages that is dependent upon activation of multiple cell death pathways . Consequently, we hypothesized that the hyperinduction of type I IFN by the ΔsdhA mutant might be due to the release of molecules from dying cells, such as DNA, that could induce Ifnb expression. To rule out this explanation, we infected Casp1−/− macrophages, which are resistant to cell death at the early timepoints examined (e.g., 4h post infection), and asked whether type I interferon was still hyperinduced in response to ΔsdhA L. pneumophila. In fact, we found that Casp1−/−macrophages infected with the ΔsdhA mutant hyperinduced Ifnb to levels above that observed in B6 macrophages (Figure 4A). We suspect that the increased Ifnb induction seen in Casp1−/− cells was an indirect consequence of the lower levels of cell death in these cells, and was not due to a specific suppression of type I interferon transcription by Casp1 activation. In any case, our results indicated that the hyperinduction of type I IFN by the ΔsdhA mutant was not due to increased cell death induced by the mutant. As a control, we confirmed that Casp1−/− macrophages were resistant to cell death at the 4h timepoint tested (Figure 4B). (A) Type I interferon receptor signaling and caspase1-dependent pyroptotic cell death are not required for superinduction of Ifnb by the sdhA mutant. Bone marrow derived C57BL/6, Ifnar−/− and Casp1−/− macrophages were infected with wild type, Δdot, and ΔsdhA L. pneumophila at an MOI of 1. Ifnb message was analyzed by qPCR from macrophage RNA harvested 4 hours post infection. (B) Caspase1-dependent pyroptotic cell death occurs independently of the type I interferon receptor. Bone marrow derived C57BL/6, Ifnar−/− and Casp1−/− macrophages were infected with wild type, Δdot, and ΔsdhA L. pneumophila at an MOI of 1 and release of lactate dehydrogenase (LDH) in cell supernatants was measured 4 hours post infection. Specific cell lysis was calculated as a percentage of detergent lysed cells with spontaneous LDH release subtracted. No statistically significant difference was found between B6 and Ifnar−/− macrophages infected with ΔsdhA L. pneumophila (p>0.1, Student's t-test). ND, not detected. SdhA acts independently of the type I IFN receptor Induction of Ifnb is often regulated by a positive feedback loop in which initial production of IFNβ results in signaling through the type I IFN receptor (Ifnar) and synergistically stimulates the production of additional type I IFN. We therefore examined whether the hyperinduction of Ifnb by the ΔsdhA mutant might be due to positive feedback through the type I IFN receptor. To test this possibility we examined induction of Ifnb by the ΔsdhA mutant in Ifnar−/− macrophages. We found that hyperinduction of Ifnb by ΔsdhA L. pneumophila occurs even in the absence of signaling from the type I interferon receptor, since Ifnar−/− macrophages hyperinduce Ifnb in response to infection with ΔsdhA L. pneumophila (Figure 4A). The mechanism by which the ΔsdhA mutant induces cell death remains unclear . Studies with the intracellular bacterial pathogen Francisella tularensis have demonstrated the existence of a type I IFN-inducible caspase-1-dependent cell death pathway . Therefore, we sought to establish if caspase-1-dependent cell death occurred in the absence of Ifnar signaling in response to wild type and ΔsdhA L. pneumophila. Ifnar−/− macrophages were infected at an MOI of 1 and assayed for release of the intracellular enzyme lactate dehydrogenase (LDH) 4 hours post infection. Ifnar−/− macrophages exhibited similar LDH release as B6 macrophages, whether infected with WT or ΔsdhA L. pneumophila, and this LDH release was dependent upon caspase-1 activation (Figure 4B). These data demonstrate that caspase1-dependent pyroptotic death occurs independently of the type I interferon receptor during infection with wild type and ΔsdhA L. pneumophila. Since growth of the ΔsdhA mutant is severely attenuated in macrophages , we hypothesized that hyperinduction of type I interferon might contribute to the restriction of replication of the ΔsdhA mutant. To test this hypothesis, we infected lfnar−/− macrophages with luminescent strains of L. pneumophila at an MOI of 0.01 and monitored bacterial replication over a 72 hour time period. As previously reported , lfnar−/− macrophages were more permissive to WT and ΔflaA L. pneumophila as compared to C57BL/6 macrophages (Figure S2A, C). However, the ΔsdhA or ΔflaAΔsdhA L. pneumophila strains were still significantly restricted in Ifnar−/− macrophages (Figure S2B, D). Thus, SdhA is required for bacterial replication in macrophages primarily via a mechanism independent of its role in suppressing type I IFN. As expected, Δdot L. pneumophila did not replicate in WT or Ifnar−/− macrophages (Figure S2E). Since SdhA is a secreted effector, we hypothesized that SdhA may act in the host cell cytosol, rather than in the bacterium, to repress Ifnb induction. To test this hypothesis, we co-expressed SdhA with MDA5 or RIG-I, by transient transfection of HEK293T cells, and assessed interferon expression with an IFNβ-luciferase reporter. Expression of either MDA5 or RIG-I robustly induced the IFNβ-luc reporter upon stimulation with poly I:C (Figure S3). When SdhA was co-expressed with MDA5, a dose-dependent repression of the IFNβ-luc reporter was observed (Figure S3A). Co-expression of SdhA also resulted in a dose-dependent repression of RIG-I-dependent induction of the IFNβ-luc reporter (Figure S3B). However, SdhA co-expression did not affect TRIF-dependent induction of the IFNβ-luc reporter (Figure S3C), arguing against the possibility that SdhA expression has non-specific effects on IFNβ-luc induction. These results must be interpreted with caution since the 293T IFNβ-luc reporter system is highly artificial; moreover, we have not demonstrated a direct interaction of SdhA with signaling components in the RNA-sensing pathway. In fact, the reported effects of SdhA on mitochondria suggest the effect may be somewhat indirect (see Discussion). Nevertheless, the 293T transfection results suggest that SdhA can act in the host cytosol to specifically repress induction of the RIG-I/MDA5 pathway. L. pneumophila genomic DNA does not appear to stimulate an Ips-1-dependent IFN response Based on our observation that the host type I IFN response requires the L. pneumophila Dot/Icm type IV secretion system and was at least partly Ips-1, Rig-i, and Mda5-dependent, we hypothesized that L. pneumophila nucleic acids (RNA, DNA or both) might gain access to the macrophage cytosol via the type IV secretion system and induce a host type I interferon response. To test if L. pneumophila nucleic acids are sufficient to induce type I interferon, we transfected MyD88−/−Trif−/− macrophages with purified L. pneumophila genomic DNA or total RNA and determined the induction of type I interferons by bioassay. Poly(dA-dT):poly(dA-dT) (abbreviated as pA:T) was used as a non-CpG containing DNA control and poly I:C was used as an RNA control. Nucleic acid preparations were treated with DNase and/or RNase to eliminate contaminating nucleic acids. Both purified L. pneumophila DNA and the crude RNA preparation induced IFNβ (Figure 5A). L. pneumophila RNA treated with RNase also induced IFNβ, presumably due to (contaminating) DNA in the preparation (Figure 5A). However, L. pneumophila RNA treated with DNase induced type I interferon to a level above that induced by L. pneumophila RNA treated with both RNase and DNase, suggesting that L. pneumophila RNA alone can induce type I interferon production (Figure 5A). The induction of type I IFN by L. pneumophila RNA was modest, possibly because bacterial RNA is less stable than DNA. Nevertheless, these results suggest that both L. pneumophila RNA and DNA can induce a type I interferon host response. (A) Purified genomic DNA and RNA from L. pneumophila induces type I interferon independently of MyD88 and Trif. Bone marrow derived Myd88−/−Trif−/− macrophages were stimulated by transfection of 3.3 µg/ml purified L. pneumophila DNA, L. pneumophila RNA, pA:T (DNA), and pI:C (RNA). Nucleic acids were treated with DNase and/or RNase A before transfection. Macrophage supernatants were harvested 8 hours post stimulation and analyzed for IFNβ levels by L929-ISRE luciferase bioassay. IFNβ production by DNase-treated L. pneumophila RNA was statistically significantly higher compared to DNase-treated L. pneumophila DNA (**, p<0.005). In addition, RNase A-treated L. pneumophila RNA produced statistically significant lower levels of IFNβ (***, p<0.0001, Student's t-test) than L. pneumophila RNA and RNase-treated L. pneumophila DNA. (B) Genomic L. pneumophila DNA does not induce type I interferon in a Ips-1-dependent manner. Ips-1−/− and heterozygous littermate bone marrow derived macrophages were stimulated by transfection of 1.0 µg/ml pA:T and purified genomic L. pneumophila DNA. Macrophages were infected with ΔflaA L. pneumophila at an MOI of 1. Sendai virus (SeV) was overlaid onto Ips-1−/− and heterozygous littermate macrophages. Transcriptional activation of Ifnb was determined by quantitative RT-PCR as described in Figure 1. (C) The viral RNA sensor Mda5 is not required for induction of type I interferon by L. pneumophila DNA. WT (C57BL/6) and Mda5−/− bone marrow derived macrophages were stimulated by transfection of 1.0 µg/ml pA:T and purified genomic L. pneumophila DNA. Sendai virus (SeV) and Theiler's virus (TMEV) were overlaid onto WT and Mda5−/− macrophages. Quantitative RT-PCR was used to determine Ifnb gene expression. (D) Non-CpG containing DNA (pA:T) does not induce Ips-1-dependent Ifnb at all concentrations tested. Ips-1−/− and heterozygous littermate bone marrow derived macrophages were stimulated with a titration of pA:T by transfection of 10, 1.0, 0.1, 0.01 µg/ml pA:T. The difference between Ips-1+/− and Ips-1−/− macrophages transfected with pA:T was not statistically significant (ns, p>0.1, Student's t-test). Sendai virus (SeV) was overlaid onto Ips-1−/− and heterozygous littermate macrophages (**, p<0.005). Cell supernatants were collected 8 hours post stimulation/infection. Induction of type I interferon was determined by L929-ISRE luc bioassay. Units are relative light units (RLU). (E) Genomic L. pneumophila DNA induces type I interferon independently of Ips-1 at all concentrations tested. Ips-1−/− and heterozygous littermate bone marrow derived macrophages were stimulated with a titration of purified genomic L. pneumophila DNA by transfection of 10, 1.0, 0.1, 0.01 µg/ml L. pneumophila DNA. No statistically significant difference was found between Ips-1+/− and Ips-1−/− macrophages transfected with genomic L. pneumophila DNA (ns, p>0.1, Student's t-test). Sendai virus (SeV) was overlaid onto Ips-1−/− and heterozygous littermate controls (**, p<0.005). Macrophage supernatants were collected 8 hours post stimulation/infection. Type I interferon levels were determined by L929-ISRE luc bioassay, units are relative light units (RLU). Next, we determined if L. pneumophila nucleic acids could induce type I interferon in an Ips-1-dependent manner in macrophages. In certain cell types, though not mouse macrophages , AT-rich DNA has been shown to induce type I IFN via IPS-1 ,,,. It was important to assess whether L. pneumophila DNA, in particular, might signal in an Ips-1-dependent manner since the L. pneumophila type IV secretion system has previously been shown to translocate DNA . Ips-1+/− and Ips-1−/− macrophages were transfected with pA:T and L. pneumophila DNA, as well as infected with Sendai virus, a virus previously determined to induce an Ips-1-dependent IFN response. Stimulation with pA:T or L. pneumophila DNA failed to induce Ifnb in an Ips-1-dependent manner, whereas Sendai virus induced significantly more Ifnb in Ips-1+/− versus Ips-1−/− macrophages (Figure 5B). Similar results were obtained in Mda5−/− macrophages: induction of type I IFN with pA:T or L. pneumophila genomic DNA showed no requirement for Mda5, whereas a control simulation, Theiler's Virus, showed Mda5-dependent induction of IFNβ, as expected (Figure 5C). It was possible that at high concentrations of DNA, an Ips-1-independent DNA-sensing pathway overwhelmed any putative Ips-1-dependent recognition of DNA. However, induction of Ifnb was independent of Ips-1 even when titrated amounts of pA:T or L. pneumophila genomic DNA were transfected into macrophages (Figure 5D, 5E). Thus, these results suggest that while transfected L. pneumophila DNA robustly induces type I interferon, L. pneumophila genomic DNA does not appear to induce the Ips-1-dependent IFN response that is characteristic of L. pneumophila infection. L. pneumophila RNA stimulates type I interferon via Rig-i To determine whether L. pneumophila RNA could be recognized by Rig-i, we transfected L. pneumophila RNA into macrophages in which Rig-i expression had been stably knocked down. Importantly, the Rig-i knockdown was performed in immortalized bone-marrow-derived macrophages that lack MyD88 and Trif, in order to avoid potential activation of known RNA-sensing TLRs. Knockdown of Rig-i was effective under our transfection conditions, as Rig-i message was significantly lower in macrophages transduced with a Rig-i shRNA compared to a control shRNA (p<0.05; Figure 6A). Crude L. pneumophila RNA (which also contains genomic DNA contaminants) induced Ifnb robustly in both control shRNA and Rig-i shRNA macrophages, even upon treatment with RNase A (Figure 6B). However, transfection of DNase-treated L. pneumophila nucleic acids induced significantly less Ifnb in Rig-i knockdown macrophages as compared to control knockdown macrophages (p<0.05; Figure 6B.) This result suggests that L. pneumophila RNA can induce Rig-i-dependent type I interferon. It was not possible to perform a similar experiment in the Ips-1−/− macrophages because these macrophages were MyD88/Trif+ and exhibited background interferon, presumably due to TLR3 signaling. (A) The efficiency of Rig-i knockdown was determined by quantitative RT-PCR under uninfected, viral and bacterial infected, and transfected conditions. Differences in Rig-i transcript levels were statistically significant (*, p<0.05, Students t-test) under resting, infected, and transfected conditions. (B) Rig-i is involved in the host type I interferon response to L. pneumophila RNA. Rig-i knockdown leads to reduced Ifnb expression upon transfection with DNase-treated L. pneumophila RNA. Quantitative RT-PCR was carried out 4 hours post stimulation. Control knockdown macrophages induced a statistically significant (*, p<0.05) higher level of Ifnb transcript in ΔflaA L. pneumophila and Sendai virus infected macrophages. No significant difference was found in response to untreated and RNase-treated L. pneumophila nucleic acids. RNA polymerase III does not appear to be required for the IFN response to L. pneumophila A recent report found that an inhibitor of RNA polymerase III, ML-60218 , blocked the type I IFN response to L. pneumophila . It was proposed that L. pneumophila DNA is translocated into macrophages and transcribed by Pol III into a ligand that could be recognized by RIG-I . In contrast, we did not see an effect of ML-60218 on induction of type I IFN by L. pneumophila in bone marrow-derived macrophages (Figure 7A). The lack of an effect does not appear to be due to redundant recognition by another DNA sensor in macrophages because the interferon induction was still largely Ips-1-dependent (Figure 7A). Because our results with the Pol III inhibitor were negative, we cannot rule out the possibility that the Pol III inhibitor fails to function in macrophages. However, we also tested 293T cells, which express only the Pol III pathway for cytosolic recognition of DNA ,. As expected, 293T cells responded to pA:T in an ML-60218-inhibitable manner, but did not respond well to L. pneumophila genomic DNA (Figure 7B), again suggesting that L. pneumophila genomic DNA is not an efficient substrate for the Pol III pathway. The Pol III inhibitor also appeared to have little effect on L. pneumophila replication in bone-marrow macrophages (Figure 7C–E). This latter result was expected, since we found that even Ips-1−/− macrophages exhibit normal restriction of L. pneumophila replication (Figure S1), despite significantly reduced IFN induction. (A) Inhibition of Pol III had no effect on Ips-1-dependent Ifnb induction by L. pneumophila. Ips-1+/− and Ips-1−/− macrophages were pretreated (controls were untreated) with 20 µM ML-60218 10 hours before infection with ΔflaA and ΔflaAΔsdhA L. pneumophila at an MOI of 1. Ifnb induction was analyzed by quantitative RT-PCR 4 hours post infection. Ifnb message was normalized to ribosomal protein rps17 levels. (B) L. pneumophila genomic DNA does not induce IFNB in HEK293T cells. HEK293T cells were pretreated, or left untreated, with 20 µM ML-60218 10 hours before transfection with 1.0 µg/ml pA:T, L. pneumophila genomic DNA, or salmon sperm DNA. Ifnb induction was analyzed by quantitative RT-PCR 4 hours post infection. Ifnb message was normalized to S9 levels. (C) WT (C57BL/6) macrophages were infected at an MOI of 0.01 in the presence or absence of 20 µM ML-60218 and growth of luminescent L. pneumophila strains was determined by RLU at 0, 24, 48, and 72 hours post infection. For inhibitor conditions, macrophages were pretreated with 20 µM ML-60218 10 hours before infection. Macrophages were infected with WT (LP02) L. pneumophila or with isogenic Δdot L. pneumophila (D) ΔflaA L. pneumophila (E). In vivo role of Ips-1 in the host type I interferon response to L. pneumophila In order to validate our findings in vivo, we infected Ips-1−/− and littermate Ips-1+/− mice with L. pneumophila (2.5×106 LP01 ΔflaA per mouse, infected intranasally) and assayed type I interferon production in bronchoalveolar lavage fluid 20 hours post infection by bioassay. Ips-1+/− mice induced an IFN response that was statistically significantly greater than the response of Ips-1−/− mice (Student's t-test, p = 0.01; Figure 8A). The difference in IFN production was not explained by a difference in bacterial burden in the Ips-1+/− and Ips-1−/− mice, since both genotypes exhibited similar levels of bacterial colonization (p = 0.76, Student's t-test; Figure 8B). The lack of an effect of Ips-1-deficiency on bacterial replication in vivo was not surprising given that we also failed to observe an effect of Ifnar-deficiency on bacterial replication in vivo (data not shown). We suspect that type II IFN (IFNλ), which is not made by macrophages in vitro, or another in vivo pathway, may compensate for loss of type I IFN in vivo. Nevertheless, our results provided an important validation of our in vitro studies and affirm a role for Ips-1 in the in vivo type I interferon response to L. pneumophila. Since Ips-1-deficient mice still mounted a measurable IFN response in vivo, it appears that additional Ips-1-independent pathways (e.g., TLR-dependent pathways, possibly involving other cell types ) also play a role in vivo. (A) The type I interferon response to L. pneumophila involves Ips-1 in vivo. Ips-1−/− and heterozygous littermate mice were infected intranasally with 2.5×106 LP01ΔflaA. Bronchoalveolar lavage with PBS was performed 20 hours post infection. Type I interferon levels in the bronchoalveolar lavage fluid (BALF) were analyzed by bioassay and recombinant IFNβ was used to determine a standard curve. A two-tailed t-test determined the differences in IFNβ levels were statistically significant (*, p<0.01, Student's t-test) upon comparison of Ips-1+/− and Ips-1−/− mice. (B) L. pneumophila colony forming units are not significantly different in Ips-1+/− and Ips-1−/−. Bronchoalveolar lavage fluid from infected Ips-1+/− and Ips-1−/− mice was centrifuged to isolate cells. Hypotonic lysis of cells was performed and CFU were plated on buffered yeast extract charcoal plates with antibiotic selection for L. pneumophila. A two-tailed t-test determined that CFU in Ips-1+/− and Ips-1−/− mice 20 hours post infection were not statistically significantly different (ns, p>0.5, Student's t-test). Type I interferons (IFNs) have long been appreciated as critical players in antiviral immune defense, and recent work has identified several molecular immunosurveillance pathways that induce type I IFN expression in response to viruses ,. In contrast, the roles of type I IFNs in response to bacteria, and the pathways by which bacteria induce type I IFNs, are considerably less well understood. In this study, we sought to characterize the type I IFN response to the gram-negative bacterial pathogen Legionella pneumophila. Our study focused on the type I IFN response mounted by macrophages, since this is the cell type that is believed to be the primary replicative niche in the pathogenesis of Legionnaires' Disease. In agreement with previous work , we found that L. pneumophila induces type I IFNs in macrophages via a TLR-independent pathway that requires expression of the bacterial type IV secretion system. These results suggested that a cytosolic immunosurveillance pathway controls the IFN response in macrophages. In this report we identify the cytosolic RNA-sensing pathway as a key responder to L. pneumophila infection (Figure 1) and, in agreement with previous results using human A549 cells , we did not observe a role for Dai (Zbp1), a gene implicated in the response to cytosolic DNA ,. A previous study using RNA interference in the human A549 epithelial-like cell line also found a role for IPS-1 in the type I IFN response to L. pneumophila . However, knockdown of RIG-I or MDA5 did not appear to affect the IFN response , so the role of the IPS-1 pathway was unclear. In our study, we used mice harboring targeted gene deletions to establish a role for Mda5 and Ips-1 in the type I IFN response to L. pneumophila in macrophages, and uncovered a role for Rig-i using an shRNA knockdown strategy. We also found that the cytosolic RNA-surveillance pathway regulated the IFN response in vivo in a mouse model of Legionnaires' Disease. After our manuscript was submitted, a report published by Chiu and colleagues also concluded that Ips-1 is required for the macrophage type I IFN response to L. pneumophila . However, the report of Chiu et al differs considerably from our current work by proposing that the type I IFN response to L. pneumophila occurs via a novel and unexpected pathway in which L. pneumophila DNA reaches the host cytosol and is transcribed by RNA polymerase III to generate an RNA intermediate that is sensed by RIG-I. Others have found that the Pol III pathway can be activated by viral and AT-rich DNA in certain cell types . Our data, however, are not easily reconciled with a role for the Pol III pathway in recognition of L. pneumophila. First, and perhaps most important, is the observation that the response to DNA (in contrast to the response to L. pneumophila infection) has never been seen to be Ips-1-dependent in macrophages (; Figure 5). This suggests that the response to L. pneumophila is not simply a response to DNA, regardless of the mechanisms by which potentially translocated DNA might be recognized. We considered the possibility that L. pneumophila DNA exhibits unique properties that cause it to be a particularly efficient substrate for the Pol III pathway. Indeed, the L. pneumophila genome does contain stretches of highly AT-rich DNA, and it has been reported that only highly AT-rich DNA is an efficient substrate for the Pol III pathway ,. Therefore we tested whether L. pneumophila genomic DNA, unlike other DNA, could induce an Ips-1-dependent response in macrophages. Although L. pneumophila DNA induced a robust IFN response, the response was not Ips-1-dependent (Figure 5B, E). Indeed, even the optimal Pol III substrate poly(dA–dT):poly(dA–dT) (abbreviated as pA:T) does not appear to induce an Ips-1-dependent IFN response in macrophages (Figure 5B, D and ). The lack of Ips-1-dependence in the response to pA:T appears to be due to an unidentified Ips-1-independent DNA-sensing pathway that recognizes pA:T and dominates over the Pol III pathway in bone marrow macrophages . Thus, if translocated DNA is the relevant bacterial ligand that stimulates the Ips-1-dependent host type I IFN response, an explanation is required for how the dominant and unidentified DNA-sensing pathway is not activated. While L. pneumophila could selectively inhibit or evade the dominant DNA-sensing pathway, there is at present no evidence to support this mechanism. Moreover, in our hands, the Pol III inhibitor used by Chiu et al (ML-60218) failed to affect IFN induction or bacterial replication in macrophages (Figure 7), in contrast to what would be predicted if the Pol III pathway was selectively activated in response to L. pneumophila infection. Therefore, our data lead us to consider alternative models. Although Chiu et al primarily used the RAW macrophage-like cell line in their experiments with L. pneumophila, we do not believe that cell-type-specific effects can account for the discrepancy in results. Although it is possible that RAW cells express only the Pol III pathway, this would not change the fact that the proposed model of Chiu et al invokes DNA as the primary IFN-inducing ligand produced by L. pneumophila. The simplest prediction of such a model would be that the response of bone marrow macrophages to L. pneumophila would be Ips-1-independent, as is the response of macrophages to all forms of DNA that have been tested. In contrast, as documented here (Figure 1) and by Chiu et al , the response to L. pneumophila is Ips-1-dependent. Moreover, 293T cells, which express only the Pol III DNA-sensing pathway ,, failed to respond significantly to L. pneumophila genomic DNA, despite a robust response to pA:T (Figure 7B). Therefore, our data suggest that recognition of L. pneumophila genomic DNA by Pol III is not responsible for the Ips-1-dependent IFN response to L. pneumophila. We considered two other models to explain how L. pneumophila induces a type I interferon response. The first is that L. pneumophila translocates RNA into host cells. In support of this model, we demonstrate that L. pneumophila RNA, unlike any form of DNA tested, induced a Rig-i-dependent type I IFN response in macrophages (Figures 5A, 6). However, we did not demonstrate that L. pneumophila RNA species are translocated into host cells, and this will be important to examine in future studies. Interestingly, it was recently reported that purified Helicobacter pylori RNA stimulates RIG-I in transfected 293T cells . A second model to explain type I IFN induction by L. pneumophila is that infection induces a host response that indirectly results in signaling via the MDA5/RIG-I/IPS-1 pathways. L. pneumophila secretes a large number of effectors into the host cytosol and these effectors disrupt or alter a large number of host cell processes . Such disruption may either lead to the generation of host-derived RNA ligands for the RIG-I and MDA5 sensors, or may result in signaling through these sensors in the absence of specific ligands. It was previously proposed that a host nuclease, RNaseL, can generate self-RNA ligands for the RIG-I and MDA5 pathways in response to viral infection . Although we could not observe a role for RNaseL in the response to L. pneumophila (K.M. Monroe, unpublished data), it is conceivable that a different host enzyme can fulfill a similar function. Our finding that a secreted bacterial effector, SdhA, previously shown to suppress host cell death, also suppresses the IFN response to L. pneumophila, is consistent with a model in which a host cell stress response leads to direct or indirect activation of the cytosolic RNA-sensing pathway. However, the mechanism by which SdhA acts on host cells remains mysterious. Laguna and colleagues provided evidence that SdhA is critical for prevention of mitochondrial disruption that occurs when host cells are infected with the ΔsdhA mutant . Given that Ips-1 localizes to mitochondria and requires mitochondrial localization for its function , it is tempting to speculate that SdhA acts on mitochondria in a way that both prevents their disruption and interferes with the function of Ips-1. To provide evidence that SdhA acts specifically on the RIG-I/MDA5 pathway, we used transient transfections of 293T cells. SdhA repressed induction of Ifnb when co-expressed with Mda5 or Rig-I but not Trif (Figure S3). Given these results and the evidence that SdhA is translocated into host cells , we favor the idea that SdhA acts within host cells. Mutation of sdhA was reported not to affect translocation of other effectors into host cells ; thus, we tend not to support the alternative possibility that SdhA blocks translocation of the putative IFN-stimulatory ligand through the type IV secretion system. SdhA is a large protein of 1429 amino acids, but does not contain domains of known function, except for a putative coiled coil (a.a. 1037–1068). In future studies it will be important to address whether subdomains of SdhA can be identified that are required for suppression of the IFN response. It will also be important to determine whether these subdomains are distinguishable from any putative subdomains required for suppression of host cell death. In fact, our data have suggested that suppression of cell death and the IFN response may be separable functions of SdhA. We found that cell death was not required for hyperinduction of IFN by the ΔsdhA mutant, and conversely, we also found that hyperinduction of type I IFN does not lead to increased cell death (Figure 4). Our studies demonstrate a partial role for both Mda5 and Rig-i RNA sensors in response to L. pneumophila. Although these sensors are typically thought to respond to distinct classes of viruses, there are indications that they can also function cooperatively in response to certain stimuli, e.g., West Nile Virus . Our results suggest that L. pneumophila produces ligands that can stimulate both Mda5 and Rig-i and that these two sensors cooperatively signal via Ips-1. Fitting with this model, we found that Ips-1-deficiency generally had a more severe impact on type I IFN induction than did Mda5 or Rig-i deficiency. Cytosolic RNA-sensing pathways are believed to respond exclusively to viral infection, and it is therefore surprising that L. pneumophila appears to trigger these pathways. Other bacterial species, such as Listeria monocytogenes and Francisella tularensis, have been shown to induce an Ips-1-independent cytosolic pathway leading to type I IFN induction ,,. The sensor(s) required for the IFN response to Listeria or Francisella have not yet been identified, but are widely assumed to be identical to the (also unknown) sensor(s) that respond to cytosolic DNA ,. Ips-1 or Mda5-deficiency, as well as Rig-i knockdown, did not result in a complete elimination of the type I IFN response (Figure 1, Figure 3). Thus, a cytosolic DNA-sensing pathway may also be stimulated in response to L. pneumophila infection. A minor role for a cytosolic DNA-sensing pathway would be consistent with the observation that the L. pneumophila Dot/Icm type IV secretion system can translocate DNA into recipient cells . However, as discussed above, our results with purified L. pneumophila DNA suggest that cytosolic sensing of L. pneumophila DNA does not account for the Ips-1-dependent induction of IFN that we observe (Figure 5). One last possibility that we cannot eliminate is that a non-DNA, non-RNA ligand is translocated into host cells and stimulates the Ips-1 pathway. In fact, in separate work, we have found that a small bacterial cyclic dinucleotide, c-di-GMP, can trigger a type I IFN response in macrophages, but importantly, this response is entirely independent of the Ips-1 pathway . Nevertheless, there may be other small molecules that can be translocated by the Dot/Icm secretion system and signal in host cells via Ips-1. Taken together, our results lead to new insights into the host immunosurveillance pathways that provide innate defense against bacterial pathogens. We demonstrate an unexpected role for a viral RNA-sensing pathway in the response to L. pneumophila, and identify a secreted bacterial effector, SdhA, that can suppress this response. Our results therefore open new possibilities for immunosurveillance of bacterial pathogens. Materials and Methods Animal experiments were approved by the University of California, Berkeley, Institutional Animal Care and Use Committee. Mice, cell lines and plasmids Bone marrow derived macrophages were derived from the following mouse strains: C57BL/6J (B6), Ips-1−/− , Mda5−/− , Ifnar−/− , Zbp1−/− , MyD88/Trif−/−, and Casp1−/− . C57BL/6J mice were purchased from the Jackson Laboratory. Ips-1−/− mice were from Z. Chen (University of Texas Southwestern Medical Center). Ips-1−/− were obtained on a mixed B6/129 background and Ips-1−/− and Ips-1+/− littermate controls were generated by breeding (Ips-1−/− x B6) F1 mice to Ips-1−/−. Mda5−/− mice were from M. Colonna and S. Gilfillan (Washington University). L929-ISRE IFN reporter cells were from B. Beutler (The Scripps Research Institute). Viruses to immortalize MyD88−/−Trif−/− immortalized bone marrow derived macrophages were the generous gift of K. Fitzgerald, D. Golenbock (U. Mass, Worcester) and D. Kalvakolanu (U. Maryland). The complementation plasmid (pJB908-SdhA) was generously provided by R. Isberg (Tufts). Expression constructs pEF-BOS-RIG-I and pEF-BOS-MDA5 were generously provided by J. Jung (Harvard Medical School). LP02 is a streptomycin-resistant thymidine auxotroph derivative of Legionella pneumophila strain LP01. LP02ΔsdhA and LP02ΔsdhAΔsdhBΔsidH were a generous gift from R. Isberg (Tufts University). The ΔflaAΔsdhA strain was generated by introducing an unmarked deletion of flaA in LP02ΔsdhA using the allelic exchange vector pSR47S-ΔflaA . L929-ISRE and HEK293T cells were cultured in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 100 µM streptomycin, and 100 U/mL penicillin. Macrophages were derived from bone marrow cells cultured for eight days in RPMI supplemented with 10% FBS, 2 mM L-glutamine, 100 µM streptomycin, 100 U/mL penicillin, and 10% supernatant from 3T3-CSF cells, with feeding on the fifth day of growth. MyD88−/−Trif−/− immortalized macrophages were cultured in RPMI supplemented with 10% FBS, 2 mM L-glutamine, 100 µM streptomycin, and 100 U/mL penicillin. Poly I:C was from GE Biosciences, pA:T (poly(dA-dT):poly(dA-dT)) was from Sigma, and Sendai Virus was from Charles River Laboratories. Wildtype Theiler's Virus GDVII was from M. Brahic and E. Freundt (Stanford University). Pol III inhibitor (ML-60218) was from Calbiochem. Isolation of nucleic acids from L. pneumophila Total bacterial RNA was isolated using RNAprotect Bacterial Reagent (Qiagen) and RNeasy kit (Qiagen). Genomic DNA was isolated by guanidinium thiocyanate followed by phenol:chloroform extraction. Nucleic acids were treated with RQ1 RNase-Free DNase (Promega) and/or RNaseA (Sigma). Bone marrow derived macrophages were plated at a density of 2×106 per well in 6 well plates and infected with an MOI of 1. Macrophage RNA was harvested 4 hours post infection and isolated with the RNeasy kit (Qiagen) according to the manufacturer's protocol. RNA was DNase treated with RQ1 RNase-Free DNase (Promega) and reverse transcribed with Superscript III (Invitrogen). Quantitative PCR assays were performed on the Step One Plus RT PCR System (Applied Biosystems) with Platinum Taq DNA polymerase (Invitrogen) and EvaGreen dye (Biotium). Gene expression values were normalized to Rps17 (mouse) or S9 (human) levels for each sample. The following primer sequences were used: mouse Ifnb, F, 5′-ATAAGCAGCTCCAGCTCCAA-3′and R, 5′-CTGTCTGCTGGTGGAGTTCA-3′; mouse Rps17, F, 5′-CGCCATTATCCCCAGCAAG-3′ and R, 5′- TGTCGGGATCCACCTCAATG-3′; mouse Rig-i, F, 5′-ATTGTCGGCGTCCACAAAG-3′ and R, 5′-GTGCATCGTTGTATTTCCGCA-3′, human Ifnb, F, 5′-AAACTCATGAGCAGTCTGCA-3′ and R, 5′- AGGAGATCTTCAGTTTCGGAG G-3′; human S9, F, 5′-ATCCGCCAGCGCCATA-3′ and R, 5′-TCAATGTGCTTCTGGGAATCC-3′. Cell stimulation and transfection Cell stimulants were transfected with Lipofectamine 2000 (LF2000, Invitrogen) according to the manufacturer's protocol. Nucleic acids were mixed with LF2000 in Optimem (Invitrogen) at a ratio of 1.0 µl LF2000/µg nucleic acid and incubated for 20 minutes at room temperature. The ligand-lipid complexes were added to cells at a final concentration of 3.3 µg/ml (96-well plates) and 1.0 µg/ml (6 well plates). For poly I:C, the stock solution (2.5 mg/ml) was heated at 55°C for 10 minutes and cooled to room temperature immediately before mixing with LF2000. Transfection experiments were incubated for 8 hours, unless otherwise stated. RIG-I, MDA5, TRIF and SdhA expression plasmids, along with an IFNβ-firefly luciferase reporter and TK-Renilla luciferase plasmids, were transfected with FuGENE 6 (Roche) according to the manufacturer's protocol. Nucleic acids were mixed with FuGENE 6 in Optimem at 0.5 µl/96 well and incubated for 15 minutes. Total transfected DNA was normalized to 200 ng per well using an empty pcDNA3 plasmid. Cells were stimulated 20 hours after transfection of expression plasmids. Type I IFN bioassay and luciferase reporter assay Cell culture supernatants or bronchoalveolar lavage fluid (BALF) was overlayed on L929-ISRE IFN reporter cells in a 96-well plate format and incubated for 4 hours at 37°C and 5%CO2. L929-ISRE IFN reporter cells and HEK293T cells expressing an IFNβ-firefly luciferase reporter and TK-Renilla luciferase were lysed in Passive Lysis Buffer (Promega) for 5 minutes at room temperature and relative light units were measured upon injection of firefly luciferin substrate (Biosynth) or Renilla substrate with the LmaxII384 luminometer (Molecular Devices). For transient transfection reporter assays, luciferase values were normalized to an internal Renilla control. Cytotoxicity of bacterial strains was determined by measuring lactate dehydrogenase release essentially as previously described . Macrophages were plated at a density of 1×105 in a 96-well plate and infected with stationary phase L. pneumophila at a multiplicity of infection (MOI) of 1. Plates were spun at 400×g for 10 minutes to allow equivalent infectivity of non-motile and motile strains . Plates were re-spun 4 hours post infection and cell culture supernatants were assayed for LDH activity. Specific lysis was calculated as a percentage of detergent lysed cells. Bacterial growth was determined as previously described . Bone marrow derived macrophages were plated at a density of 1×105 per well in white 96-well plates (Nunc) and allowed to adhere overnight. Macrophages were infected with stationary-phase L. pneumophila at a multiplicity of infection (MOI) of 0.01. Growth of luminescent L. pneumophila strains was assessed by RLU with the LmaxII384 luminometer (Molecular Devices). Nonluminescent bacterial strains were analyzed for colony-forming units on buffered charcoal yeast extract plates. Transposon mutagenesis of LP02 was previously described . Briefly, the pSC123 mariner transposon was mated from E.coli SM10 λpir into the L. pneumophila strain LP02. Matings were plated on buffered yeast extract charcoal plates with streptomycin (100 µg/ml) and kanamycin (25 µg/ml). Single colonies were isolated and grown in overnight cultures and used to infect bone marrow derived MyD88−/−Trif−/− macrophages. After overnight incubation, levels of type I interferon in the supernatant was determined by bioassay. The site of transposon insertion was determined by Y-linker PCR . In vivo studies Age and sex-matched Ips-1−/− and littermate Ips-1+/− mice were infected intranasally with 2.5×106 LP01 ΔflaA in 20 µl PBS. Bronchoalveolar lavage was performed 20 hours post infection via the trachea using a catheter (BD Angiocath 18 g, 1.3×48 mm) and 800 µl PBS. Type I interferon induction was determined by bioassay. Type I interferon amounts were calculated using a 4-parameter standard curve determined by dilution of recombinant IFNβ (R&D Systems). CFUs were determined by hypotonic lysis of cells from the brochoalveolar lavage fluid (BALF). In parallel experiments, it was determined that CFU in the BALF was representative of total CFU in the lung. Knockdown constructs were generated with the MSCV/LTRmiR30-PIG (LMP) vector from Open Biosystems. shRNA PCR products were cloned into the LMP vector using XhoI and EcoRI sites. Rig-i sequence: 5′-GCCCATTGAAACCAAGAAATT-3′, control shRNA sequence: 5′-TGACAGTGTCTTCGCTAATGAA-3′. MyD88−/−Trif−/− immortalized bone marrow derived macrophages were transduced with retrovirus as previously described . GFP+ macrophages were sorted with the DAKO-Cytomation MoFlo High Speed Sorter. L. pneumophila replication is restricted in Ips-1−/− and Mda-5−/− macrophages. Ips-1+/−, Ips-1−/−, C57BL/6 (B6) and Mda5−/− macrophages were infected at an MOI of 0.01 and growth of luminescent L. pneumophila strains was determined by RLU at 0, 24, 48, and 72 hours post infection. (A) Ips-1+/− and Ips-1−/− macrophages were infected WT (LP02) L. pneumophila (B) C57BL/6 (B6) and Mda5−/− macrophages were infected as in A (C) Ips-1+/− and Ips-1−/− macrophages were infected with Δdot L. pneumophila (D) C57BL/6 (B6) and Mda5−/− macrophages were infected as in C (E) Ips-1+/− and Ips-1−/− infected with ΔflaA L. pneumophila (F) C57BL/6 (B6) and Mda5−/− macrophages were infected as in E. (0.31 MB PDF) Abrogation of type I interferon receptor signaling alone does not permit growth of ΔsdhA mutant. C57BL/6 (B6) and Ifnar−/− macrophages were infected at an MOI of 0.01 and growth of luminescent L. pneumophila strains was determined by RLU at 0, 24, 48, and 72 hours post infection. (A) C57BL/6 (B6) and Ifnar−/− macrophages were infected WT (LP02) L. pneumophila (B) macrophages were infected as in A but with ΔsdhA L. pneumophila (C) ΔflaA L. pneumophila (D) ΔflaAΔsdhA L. pneumophila (E) Δdot L. pneumophila. (0.29 MB PDF) SdhA represses MDA5 and RIG-I induction of interferon. Overexpression of SdhA in HEK293T cells results in repression of interferon induction mediated by MDA5 or RIG-I but not TRIF. (A) HEK293T cells were transfected with plasmids encoding the IFNβ-firefly luciferase reporter, TK-Renilla luciferase reporter (for normalization), full length MDA5 and/or increasing amounts of full length SdhA. At 20 hours post transfection, cells were transfected with poly I:C and then firefly luciferase and Renilla luciferase levels were determined 8 hours later. (B) Transfection and stimulation were performed as in A, except with a RIG-I expression plasmid and/or increasing amounts of full length SdhA expression plasmid. (C) Transfection and stimulation were performed as in A, except with a Trif expression plasmid and/or SdhA. (0.27 MB PDF) We would like to thank G. Barton, J. Coers and members of the Vance and Barton labs for discussions, G. Lam, K. Sotelo-Troha, and L. Tieu for technical assistance, R. Isberg for sdhA mutants and advice, D. Rookhuizen for help with the mutagenesis screen, K. Fitzgerald, D. Golenbock and D. Kalvakolanu for virus to immortalize macrophages, K. Ishii and S. Akira for Zpb1−/− bone marrow, M. Colonna and S. Gilfillan for Mda5−/− mice, D. Portnoy for Ifnar−/− mice, and Z. Chen for Ips-1−/− mice. Conceived and designed the experiments: KMM SMM REV. Performed the experiments: KMM SMM REV. Analyzed the data: KMM SMM REV. Contributed reagents/materials/analysis tools: KMM SMM. Wrote the paper: KMM SMM REV. - 1. Fields BS, Benson RF, Besser RE (2002) Legionella and Legionnaires' disease: 25 years of investigation. Clin Microbiol Rev 15: 506–526. - 2. Horwitz MA, Silverstein SC (1980) Legionnaires' disease bacterium (Legionella pneumophila) multiples intracellularly in human monocytes. J Clin Invest 66: 441–450. - 3. Isberg RR, O'Connor TJ, Heidtman M (2009) The Legionella pneumophila replication vacuole: making a cosy niche inside host cells. Nat Rev Microbiol 7: 13–24. - 4. Laguna RK, Creasey EA, Li Z, Valtz N, Isberg RR (2006) A Legionella pneumophila-translocated substrate that is required for growth within macrophages and protection from host cell death. Proc Natl Acad Sci U S A 103: 18745–18750. - 5. Archer KA, Roy CR (2006) MyD88-dependent responses involving toll-like receptor 2 are important for protection and clearance of Legionella pneumophila in a mouse model of Legionnaires' disease. Infect Immun 74: 3325–3333. - 6. Hawn TR, Berrington WR, Smith IA, Uematsu S, Akira S, et al. (2007) Altered inflammatory responses in TLR5-deficient mice infected with Legionella pneumophila. J Immunol 179: 6981–6987. - 7. Hawn TR, Smith KD, Aderem A, Skerrett SJ (2006) Myeloid differentiation primary response gene (88)- and toll-like receptor 2-deficient mice are susceptible to infection with aerosolized Legionella pneumophila. J Infect Dis 193: 1693–1702. - 8. Shin S, Case CL, Archer KA, Nogueira CV, Kobayashi KS, et al. (2008) Type IV secretion-dependent activation of host MAP kinases induces an increased proinflammatory cytokine response to Legionella pneumophila. PLoS Pathog 4: e1000220. doi:10.1371/journal.ppat.1000220. - 9. Amer A, Franchi L, Kanneganti TD, Body-Malapel M, Ozoren N, et al. (2006) Regulation of Legionella phagosome maturation and infection through flagellin and host IPAF. J Biol Chem 281: 35217–35223. - 10. Lightfield KL, Persson J, Brubaker SW, Witte CE, von Moltke J, et al. (2008) Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin. Nat Immunol 9: 1171–1178. - 11. Molofsky AB, Byrne BG, Whitfield NN, Madigan CA, Fuse ET, et al. (2006) Cytosolic recognition of flagellin by mouse macrophages restricts Legionella pneumophila infection. J Exp Med 203: 1093–1104. - 12. Ren T, Zamboni DS, Roy CR, Dietrich WF, Vance RE (2006) Flagellin-deficient Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity. PLoS Pathog 2: e18. doi:10.1371/journal.ppat.0020018. - 13. Zamboni DS, Kobayashi KS, Kohlsdorf T, Ogura Y, Long EM, et al. (2006) The Birc1e cytosolic pattern-recognition receptor contributes to the detection and control of Legionella pneumophila infection. Nat Immunol 7: 318–325. - 14. Opitz B, Vinzing M, van Laak V, Schmeck B, Heine G, et al. (2006) Legionella pneumophila induced IFNbeta in lung epithelial cells via IPS-1 and IRF3 which also control bacterial replication. J Biol Chem 281: 36173–36179. - 15. Stetson DB, Medzhitov R (2006) Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity 24: 93–103. - 16. Coers J, Vance RE, Fontana MF, Dietrich WF (2007) Restriction of Legionella pneumophila growth in macrophages requires the concerted action of cytokine and Naip5/Ipaf signalling pathways. Cell Microbiol 9: 2344–2357. - 17. Schiavoni G, Mauri C, Carlei D, Belardelli F, Pastoris MC, et al. (2004) Type I IFN protects permissive macrophages from Legionella pneumophila infection through an IFN-gamma-independent pathway. J Immunol 173: 1266–1275. - 18. Stetson DB, Medzhitov R (2006) Type I interferons in host defense. Immunity 25: 373–381. - 19. Pichlmair A, Reis e Sousa C (2007) Innate recognition of viruses. Immunity 27: 370–383. - 20. Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, et al. (2004) The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5: 730–737. - 21. Seth RB, Sun L, Ea CK, Chen ZJ (2005) Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122: 669–682. - 22. Kawai T, Takahashi K, Sato S, Coban C, Kumar H, et al. (2005) IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat Immunol 6: 981–988. - 23. Xu LG, Wang YY, Han KJ, Li LY, Zhai Z, et al. (2005) VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol Cell 19: 727–740. - 24. Meylan E, Curran J, Hofmann K, Moradpour D, Binder M, et al. (2005) Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437: 1167–1172. - 25. Sun Q, Sun L, Liu HH, Chen X, Seth RB, et al. (2006) The specific and essential role of MAVS in antiviral innate immune responses. Immunity 24: 633–642. - 26. Ishii KJ, Coban C, Kato H, Takahashi K, Torii Y, et al. (2006) A Toll-like receptor-independent antiviral response induced by double-stranded B-form DNA. Nat Immunol 7: 40–48. - 27. Cheng G, Zhong J, Chung J, Chisari FV (2007) Double-stranded DNA and double-stranded RNA induce a common antiviral signaling pathway in human cells. Proc Natl Acad Sci U S A 104: 9035–9040. - 28. Ablasser A, Bauernfeind F, Hartmann G, Latz E, Fitzgerald KA, et al. (2009) RIG-I-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-transcribed RNA intermediate. Nat Immunol. - 29. Chiu YH, Macmillan JB, Chen ZJ (2009) RNA Polymerase III Detects Cytosolic DNA and Induces Type I Interferons through the RIG-I Pathway. Cell 138: 576–591. - 30. Takaoka A, Wang Z, Choi MK, Yanai H, Negishi H, et al. (2007) DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 448: 501–505. - 31. Wang Z, Choi MK, Ban T, Yanai H, Negishi H, et al. (2008) Regulation of innate immune responses by DAI (DLM-1/ZBP1) and other DNA-sensing molecules. Proc Natl Acad Sci U S A 105: 5477–5482. - 32. Ishii KJ, Kawagoe T, Koyama S, Matsui K, Kumar H, et al. (2008) TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature 451: 725–729. - 33. Karaolis DK, Means TK, Yang D, Takahashi M, Yoshimura T, et al. (2007) Bacterial c-di-GMP is an immunostimulatory molecule. J Immunol 178: 2171–2181. - 34. McWhirter SM, Barbalat R, Monroe KM, Fontana MF, Hyodo M, et al. (2009) A host type I interferon response is induced by cytosolic sensing of the bacterial second messenger cyclic-di-GMP. J Exp Med 206: 1899–1911. - 35. Roberts ZJ, Goutagny N, Perera PY, Kato H, Kumar H, et al. (2007) The chemotherapeutic agent DMXAA potently and specifically activates the TBK1-IRF-3 signaling axis. J Exp Med 204: 1559–1569. - 36. Mancuso G, Midiri A, Biondo C, Beninati C, Zummo S, et al. (2007) Type I IFN signaling is crucial for host resistance against different species of pathogenic bacteria. J Immunol 178: 3126–3133. - 37. Leber JH, Crimmins GT, Raghavan S, Meyer-Morse N, Cox JS, et al. (2008) Distinct TLR- and NLR-mediated transcriptional responses to an intracellular pathogen. PLoS Pathog 4: e6. doi:10.1371/journal.ppat.0040006. - 38. O'Riordan M, Yi CH, Gonzales R, Lee KD, Portnoy DA (2002) Innate recognition of bacteria by a macrophage cytosolic surveillance pathway. Proc Natl Acad Sci U S A 99: 13861–13866. - 39. Auerbuch V, Brockstedt DG, Meyer-Morse N, O'Riordan M, Portnoy DA (2004) Mice lacking the type I interferon receptor are resistant to Listeria monocytogenes. J Exp Med 200: 527–533. - 40. Carrero JA, Calderon B, Unanue ER (2004) Type I interferon sensitizes lymphocytes to apoptosis and reduces resistance to Listeria infection. J Exp Med 200: 535–540. - 41. O'Connell RM, Saha SK, Vaidya SA, Bruhn KW, Miranda GA, et al. (2004) Type I interferon production enhances susceptibility to Listeria monocytogenes infection. J Exp Med 200: 437–445. - 42. Charrel-Dennis M, Latz E, Halmen KA, Trieu-Cuot P, Fitzgerald KA, et al. (2008) TLR-independent type I interferon induction in response to an extracellular bacterial pathogen via intracellular recognition of its DNA. Cell Host Microbe 4: 543–554. - 43. Henry T, Brotcke A, Weiss DS, Thompson LJ, Monack DM (2007) Type I interferon signaling is required for activation of the inflammasome during Francisella infection. J Exp Med 204: 987–994. - 44. Roux CM, Rolan HG, Santos RL, Beremand PD, Thomas TL, et al. (2007) Brucella requires a functional Type IV secretion system to elicit innate immune responses in mice. Cell Microbiol 9: 1851–1869. - 45. Stanley SA, Johndrow JE, Manzanillo P, Cox JS (2007) The Type I IFN response to infection with Mycobacterium tuberculosis requires ESX-1-mediated secretion and contributes to pathogenesis. J Immunol 178: 3143–3152. - 46. Vogel JP, Andrews HL, Wong SK, Isberg RR (1998) Conjugative transfer by the virulence system of Legionella pneumophila. Science 279: 873–876. - 47. Fredericksen BL, Keller BC, Fornek J, Katze MG, Gale M Jr (2008) Establishment and maintenance of the innate antiviral response to West Nile Virus involves both RIG-I and MDA5 signaling through IPS-1. J Virol 82: 609–616. - 48. Jiang Z, Georgel P, Du X, Shamel L, Sovath S, et al. (2005) CD14 is required for MyD88-independent LPS signaling. Nat Immunol 6: 565–570. - 49. Wu L, Pan J, Thoroddsen V, Wysong DR, Blackman RK, et al. (2003) Novel small-molecule inhibitors of RNA polymerase III. Eukaryot Cell 2: 256–264. - 50. Mancuso G, Gambuzza M, Midiri A, Biondo C, Papasergi S, et al. (2009) Bacterial recognition by TLR7 in the lysosomes of conventional dendritic cells. Nat Immunol 10: 587–594. - 51. Lippmann J, Rothenburg S, Deigendesch N, Eitel J, Meixenberger K, et al. (2008) IFNbeta responses induced by intracellular bacteria or cytosolic DNA in different human cells do not require ZBP1 (DLM-1/DAI). Cell Microbiol 10: 2579–2588. - 52. Rad R, Ballhorn W, Voland P, Eisenacher K, Mages J, et al. (2009) Extracellular and intracellular pattern recognition receptors cooperate in the recognition of Helicobacter pylori. Gastroenterology 136: 2247–2257. - 53. Ensminger AW, Isberg RR (2009) Legionella pneumophila Dot/Icm translocated substrates: a sum of parts. Curr Opin Microbiol 12: 67–73. - 54. Malathi K, Dong B, Gale M Jr, Silverman RH (2007) Small self-RNA generated by RNase L amplifies antiviral innate immunity. Nature 448: 816–819. - 55. Crimmins GT, Herskovits AA, Rehder K, Sivick KE, Lauer P, et al. (2008) Listeria monocytogenes multidrug resistance transporters activate a cytosolic surveillance pathway of innate immunity. Proc Natl Acad Sci U S A 105: 10191–10196. - 56. Gitlin L, Barchet W, Gilfillan S, Cella M, Beutler B, et al. (2006) Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proc Natl Acad Sci U S A 103: 8459–8464. - 57. Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, et al. (1994) Functional role of type I and type II interferons in antiviral defense. Science 264: 1918–1921. - 58. Li P, Allen H, Banerjee S, Franklin S, Herzog L, et al. (1995) Mice deficient in IL-1 beta-converting enzyme are defective in production of mature IL-1 beta and resistant to endotoxic shock. Cell 80: 401–411. - 59. Decker T, Lohmann-Matthes ML (1988) A quick and simple method for the quantitation of lactate dehydrogenase release in measurements of cellular cytotoxicity and tumor necrosis factor (TNF) activity. J Immunol Methods 115: 61–69. - 60. Kwon YM, Ricke SC (2000) Efficient amplification of multiple transposon-flanking sequences. J Microbiol Methods 41: 195–199.

<urn:uuid:584c6121-d62f-45a0-a176-217df67b49ad>

CC-MAIN-2016-50

http://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1000665

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Discussions about poverty in Albania quickly become discussions about isolation. The interplay between the two fuels a relentless cycle of struggle and deprivation. An insidious enemy that takes shape physically, economically and socially, isolation has disrupted development and progress in the country for years. With over half of Albania's population living in rural communities, physical isolation is a critical problem. Without access to infrastructure, markets and information, poverty is highly concentrated in these regions. Social isolation often rears its head in the form of gender bias and discrimination against the Roma population, and economic isolation casts a wide net everywhere that individuals lack the resources and financial tools to empower themselves. Any type of isolation puts you at risk for the others -- like a cancer it quickly spreads and is hard to control. The upside of these isolated communities is that they foster incredibly strong family bonds. The importance of family is a value that permeates all aspects ofAlbanian culture. Kiva borrower, Halit (above) is a father of seven children. They all work together on the family farm raising animals and growing grains and vegetables. "Farming brings only happiness to me and all of my family together. I get the chance to work along with them every day... I remember more good years than bad ones," Halit told our Field Partner VisionFund Albania. As his children grew, Halit drained his savings sending them to school, paying for their marriages and building basic homes for those who were newly-married. It was a Kiva loan of $925 that helped Halit and his family build an irrigation system to ensure the health and prosperity of their farm for years to come. With 71% of the Albanian population employed in the agriculture sector, providing resources to help strengthen this industry is pivotal to poverty reduction and building economic stability. Another principal issue facing Albania is gender inequality. As Julie Vullnetari from Albania's Sussex Migration Research Centre put it, "The rural woman is the invisible pillar of Albanian Society." However, particularly in these isolated communities, women's participation in decision-making remains low. A European Union External Action Service report frankly stated, "Women face discrimination in a number of areas, which translates into higher unemployment, early school drop-out of girls, limited access to land and property, and lower levels of representation in high-level elected and appointed bodies." Closing the isolation gaps for Albanian women will help promote advancement and empowerment. Inspired by the strength of the Albanian family and the hearty nature of its people, Kiva is proud to support the hardworking entrepreneurs and efforts of our partner as they work toward a brighter future. This is the final post of a three-part series taking a deep-dive look at Albania, its history with microfinance, Kiva's role in expanding opportunities for Albanians, and what it's like to participate in the country's economy as a borrower, lender and field worker.

<urn:uuid:ec6e99c0-0cf6-4894-bdd8-4a863fa3ca9b>

CC-MAIN-2016-50

http://kivanews.blogspot.com/2012/08/passport-series-microfinance-helps.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Pentagon loses contact with unmanned glider moving at Mach 20 The Pentagon tested its hypersonic Falcon HTV-2 vehicle Thursday, losing contact with the craft as it hurtled over the Pacific Ocean. The U.S. military lost contact with an unmanned hypersonic glider shortly after it launched on a test flight today (Aug. 12) as part of a global strike weapons program to develop vehicles capable of flying at Mach 20 and reach any target in the world in an hour. According to DARPA updates, the test flight appeared to go well until the glide phase, when monitoring stations lost contact with the HTV-2 vehicle. [Photos: DARPA Hypersonic Glider's Mach 20 Test] "Range assets have lost telemetry with HTV2," DARPA officials wrote in a Twitter post about 36 minutes after launch. Monitoring stations further down range of the vehicle's flight path over the Pacific Ocean also did not find the hypersonic HTV-2 glider. The vehicle is designed to crash itself into the ocean at the end of its mission. "Downrange assets did not reacquire tracking or telemetry. HTV2 has an autonomous flight termination capability," DARPA officials wrote. Whether the test flight met all of its objecties still remains unclear, but this is the second test flight of the Falcon HTV--2 program that ended prematurely. An April 2010 test flight ended nine minutes into flight, also due to loss of contact. The HTV-2 vehicle was expected to reach suborbital space, then re-enter Earth's atmosphere and glide at hypersonic speed to demonstrate controllable flight at velocities of around Mach 20, which is about 13,000 mph. At that speed, more than 20 times the speed of sound, a vehicle could fly from New York City to Los Angeles in 12 minutes, DARPA officials said. A video animation of the HTV-2 flight test depicts how the the hypersonic vehicle was expected to pop free of its rocket, then soar through Earth's atmosphere for an inevitable, and intentional, plunge into the Pacific Ocean at the end of its mission. A global strike capability The HTV-2 is part of a program called Prompt Global Strike called DARPA (which is short for Defense Advanced Research Projects Agency) to develop advanced weapons systems with extreme range. "The ultimate goal is a capability that can reach anywhere in the world in less than an hour." DARPA officials wrote in a mission description. "The HTV-2 vehicle is a 'data truck' with numerous sensors that collect data in an uncertain operating envelope." [7 Sci-Fi Weapons of Tomorrow Here Today] Hypersonic flight plan for HTV-2 glider For today's hypersonic flight test, the HTV-2 vehicle was expected to launch into suborbital space, separate from its Orbital Sciences Corp.-built Minotaur 4 rocket, then re-enter the atmosphere. During the re-entry phase, the vehicle was expected to use rocket thrusters to help maintain its course, according to a DARPA description. "Assumptions about Mach 20 hypersonic flight were made from physics-based computational models and simulations, wind tunnel testing, and data collected from HTV-2's first test flight — the first real data available in this flight regime at Mach 20," said Air Force Maj. Chris Schulz, HTV-2 program manager, in a statement. "It's time to conduct another flight test to validate our assumptions and gain further insight into extremely high Mach regimes that we cannot fully replicate on the ground." After the re-entry maneuver, the HTV-2 was slated to enter a pull-up phase to control its speed and altitude ahead of the long glide back to Earth. During the glide, the vehicle is programmed to perform maneuvers to test aerodynamic performance, DARPA officials said. The HTV-2 was expected to end its hypersonic test flight by performing a roll maneuver to intentionally crash into the Pacific Ocean. DARPA officials said more than 20 observing stations will monitor the entire flight from space, land, ships and aircraft. Hypersonic tests in wind tunnels on the ground can typically recreate conditions at speeds only up to Mach 15, and only for a few milliseconds at a time, Schulz said. "And even then we wouldn't know exactly what to expect based solely on the snapshots provided in ground testing," Schulz said. "Only flight testing reveals the harsh and uncertain reality."

<urn:uuid:e211670e-065e-4175-ae75-e5440ce78c03>

CC-MAIN-2016-50

http://m.csmonitor.com/Science/2011/0811/Pentagon-loses-contact-with-unmanned-glider-moving-at-Mach-20

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Indexing documents is essential for performant queries. Querying on a key that is not indexed results in a scan of each document in a collection. While this may be fine for small collections, it causes extreme slowness in any collection of substance. It is highly recommended that you read Kyle Banker’s article on The Joy of Indexing if you have any confusion on the subject. Mongo creates a default index on the _id key, but since MongoMapper allows ad hoc queries for more intuitive data access, you need to be aware of how to index those queries as well. Let’s set up an example document on which we will build a few indexes: As we said above, any instance of this class will have _id key automatically indexed. However, if we wanted to search by first name, Mongo would have to search all User documents for all values that match our query. To speed that up, we can set up an index like so: Now, Mongo will index the first_name key for us and make the queries much faster when dealing with a large collection. Creating indexes on single keys will improve query performance for those keys only. If you’re filtering documents using more than one key, you need to create a compound index. The syntax is similar to that of a single key index with the addition of direction to each key being specified in the compound index. Example is as follows: This will create an index that looks up the first name in ascending order and age in the descending order. Important note: the order of keys matters in compound indexes. Using the index above, we could query by first_name or by first_name and age and both would hit the index. If, however, we queried only by age, a full table scan would occur. Unique indexes guarantee that no documents are inserted whose values for the indexed keys match those of an existing document. If the app attempts to insert a document with a duplicate value after the unique index is set, the insert operation will fail. Important note: Notification of this failure in the form of a raised exception will only occur if the document is saved with :safe => true. You can read more about the safe plugin and updates in the driver that allow forcing safe-ness.

<urn:uuid:0b5d15be-fc93-4d0e-af7a-c3701a695743>

CC-MAIN-2016-50

http://mongomapper.com/documentation/plugins/indexes.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Two huge boulders sent tumbling by a landslide narrowly missed a farmhouse in Ronchi di Termeno in northern Italy on January 21, 2014. The above photo, taken two days later, shows one of the boulders after it rumbled down the hill and destroyed the barn before coming to rest in the vineyard—halted within a meter of the house. The second boulder, hidden behind the house, stopped just short of the building. The boulder in the foreground is from an older landslide. Members of the Trebo family, who live on the farm, were reportedly unharmed. These boulders appear to have originated from a large pillar of rock, probably limestone, says Ben Mackey, a geologist at the University of Canterbury in Christchurch, New Zealand. Erosion can cause pillars to slowly detach from the side of a cliff, then collapse, sending boulders tumbling down. It's unclear what triggered this rockfall, geologist Mackey says. But such rockfalls can be caused by storms or earthquakes. "Sometimes, though, rocks will fall with no apparent cause," he says. "Whatever was holding them in place just lets go. This makes predicting when rockfalls will occur quite difficult." While smaller boulders tumble down cliffs often, Mackey says, huge rockfalls like this one are fairly rare. In a given location, boulders of this size would fall maybe once in many thousands of years. Mackey studies the old boulders of Christchurch to try and determine when they toppled over and how often such rockfalls may occur. The fact that another boulder is nearby means that a similar rockfall happened in the past. Geologists usually use such evidence to decide how close to a cliff a building can be located and still be safe. "Generally, it would not be advisable to live under a cliff prone to rockfall like this," Mackey says.

<urn:uuid:f0f96e87-dfcf-4f07-ab8c-cc3e9192b897>

CC-MAIN-2016-50

http://news.nationalgeographic.com/news/2014/02/140204-boulders-italy-pictures-geology-photos-mountains/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Reading academic material With more difficult texts, comprehension can be hindered by any one of these features. Many textbooks and journal articles are written in more formal academic language and subject-specific jargon will be used too. Here is an example - two sentences from a sociological book review that you can only understand if you already know or can deduce what the terms encompass: “The philosophy of praxis,” Gramsci once proclaimed, “is precisely the concrete historicisation of philosophy and its identification with history.” Implicitly, at least, the objective of Jonathan Joseph's Hegemony: A Realist Analysis is to carry forward this assertion by pursuing the philosophical and practical coincidences between critical realism and theories of hegemony within a Marxist-inflected framework. At the beginning of semester, each new paper introduces some jargon that you will have to learn. Help yourself by identifying words new to you in the study guides and texts and work on assimilating them fully into your vocabulary. In particular, learn what certain terms mean. This does require time and effort, but if you do this at the beginning of a course, rather than later (like just before a test or exam), your understanding of your readings will be much greater and readings will take less time. This includes terms that describe schools of thought, such as ‘post-modernism’, ‘Marxism’, ‘epistemological’, ‘positivism’, ‘empiricism’, ‘structuralism’, and ‘ideation’. It may also include more specific terms such as ‘paradigm’, ‘standard deviation’, ‘discursive’, ‘eclectic’, ‘cognitive’, ‘hegemony’, ‘critique’, ‘linguistic’, and many other words that abound more in academic writing than everyday writing. If you cannot understand the definition in your text, go elsewhere - do not give up. Learn new vocabulary by: - constructing a glossary of new terms on the inside of your notebook or study guide folder as you read through material in the first few weeks. Having this list constantly handy means that you can quickly refer to a word, check its meaning and read on with little interruption to the flow of your reading, and therefore to your interpretation of the meaning. - searching the Internet. There are several online thesaurus sites for word meanings and synonyms. Searching for a term such as epistemology reveals a range of sites from which depth of meaning can be gained. - having a list of new terms on a whiteboard - it's a bit like learning vocabulary for a second language. Revising the meaning of each word each time you see the board rehearses the word and helps you remember it for the next time you read it. - seeking and finding associations for new terms. For example, one student learnt the word ‘cognitivism’ by relating it to the word ‘recognise’. - attaching examples to new terms so that the meaning of the word is remembered through the example - talking about the new terms with others and explaining the meaning to someone else - this way you take ownership of the new vocabulary you are meeting - asking for clarification (and maybe examples) through discussion lists or chat sessions for papers with active Stream support facilities - do not be afraid to do this. Take the initiative. If you do not understand, there are bound to be other people who do not understand either, so the posted reply will help others as well as you. - Using tutorials fully - whilst tutors may have tasks they have decided to include in the tutorials, they also like students to raise questions and so this is a good time and place to ask about certain terms that you do not think you fully understand. Some textbooks are definitely more user friendly than others. Titles, subtitles and margin notes all give helpful hints to the author's meaning, but even then some complex sentences need to be carefully and deliberately deconstructed for the full interconnectedness of the message to be clear. For example: For nearly a decade, as the problem of youth unemployment worsened, as race and gender inequalities became more politicised, and as crime and other signs of unrest increased, the education system was subjected to more and more public criticism. Knowing how paragraphs are constructed can help a reader sort out the information and decide which points are the most important. See the section on essay body paragraphs. This may occur because the combination of words is unusual and unexpected. Therefore we worry that the picture we get may not be the interpretation the author intended. Additionally, we need to realise that when an author uses words that belong to a set, they are using a metaphor for their approach to an issue. The metaphor provides us with information on the writer's values and assumptions and gives us a clue to their construct of the concept. For example, literacy campaigns are often described in either medical terms or military terms. That is authors write that millions of people are victims of an epidemic and that the disease of illiteracy must be stamped out; people's learning problems are diagnosed; and they may go to a clinic for assessment and a curative programme. Using the military metaphor, groups will declare war on illiteracy and campaigns will be strategically placed for target populations so that this threat to the country is conquered. Critical reading includes deciphering the inferred meaning of the author's words, as well as understanding the surface meaning. Some disciplines (e.g. law) adhere to writing in a particular style. Because it is difficult, we tend to postpone having to do such reading. However, if you give it a go and read examples then you become familiar with the type of language (e.g. that used in laws and acts) and get used to the structure of the writing too. Use the RAP comprehension strategy where this type of writing is a problem: - For a start read each sentence and decode it by putting its meaning into everyday language. Then move on to the next sentence. - Each time you do this you will find you are getting used to the language and structure and the barrier that the discipline's language posed will disappear. References and further reading Morton, A. D. (2002). Gramsci, realism and revolution. Retrieved from http://www.theglobalsite.ac.uk/review/210morton.htm

<urn:uuid:0724803e-df7b-48bc-8d4d-cf2b1ed21cad>

CC-MAIN-2016-50

http://owll.massey.ac.nz/study-skills/reading-academic-material.php

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Presentation on theme: "What does Scripture say about how we should approach money?"— Presentation transcript: What does Scripture say about how we should approach money? What does the Bible say about poverty and wealth? Give me neither poverty nor riches; feed me with the food that I need, or I shall be full, and deny you, and say, ‘Who is the L ORD ?’ or I shall be poor, and steal, and profane the name of my God. Proverbs 30:8b-9 The Bible has some pretty clear ideas about what our relationship to money should be. Matthew 6:24 Serving Two Masters ‘No one can serve two masters; for a slave will either hate the one and love the other, or be devoted to the one and despise the other. You cannot serve God and wealth. According to the Bible? Yep, because it gets in the way of relationships. There are numerous examples of wealth being an issue in scripture. Here are a few from the Old Testament. Here are a few from the New Testament. Exodus 16 – This is the story of the Manna given by God, no one could have too much, or too little. Deuteronomy 15 – The Sabbath vision of Jubilee when debts will be forgiven and every 50 years all land will be redistributed to avoid certain families or tribes gaining too much wealth. So that all have enough. Luke 16: Poor Man Lazarus, who is neglect by his rich neighbor, who then is neglected in hell. Mark 10: Jesus tells a rich young man to give away his wealth to be closer to God, but he couldn’t, this surprised the disciples, because only God can save, not our efforts. Are we to just give away our wealth to anyone? It is important to contribute. 2 Thessalonians 3:6-15 Warning against Idleness Now we command you, beloved, in the name of our Lord Jesus Christ, to keep away from believers who are living in idleness and not according to the tradition that they received from us. For you yourselves know how you ought to imitate us; we were not idle when we were with you, and we did not eat anyone’s bread without paying for it; but with toil and labor we worked night and day, so that we might not burden any of you. This was not because we do not have that right, but in order to give you an example to imitate. For even when we were with you, we gave you this command: Anyone unwilling to work should not eat. For we hear that some of you are living in idleness, mere busybodies, not doing any work. Now such persons we command and exhort in the Lord Jesus Christ to do their work quietly and to earn their own living. Brothers and sisters, do not be weary in doing what is right. Take note of those who do not obey what we say in this letter; have nothing to do with them, so that they may be ashamed. Do not regard them as enemies, but warn them as believers. Scripture recognizes that systems often take advantage of the poor. Amos 8:5-6- We will make the ephah small and the shekel great, and practice deceit with false balances, 6 buying the poor for silver and the needy for a pair of sandals, and selling the sweepings of the wheat.’ Jesus also fought against a system that took advantage of the meek. Luke 20:45-47 Jesus Denounces the Scribes 45 In the hearing of all the people he said to he disciples, 46 ‘Beware of the scribes, who like to walk around in long robes, and love to be greeted with respect in the market-places, and to have the best seats in the synagogues and places of honor at banquets. 47 They devour widows’ houses and for the sake of appearance say long prayers. They will receive the greater condemnation.’ And he focused on care for the poor. He literally fought the monetizing of forgiveness and access to the community In the cleansing of the temple (John 2:12-22) In the healing of the leper (Luke 17:11-15 In the healing of the blind man (John 9:1-41) He forgives and heals a paralyzed man (Mark 2:1-12) Indeed, the poor were Jesus’ central focus. Luke 4:18-19 ‘The Spirit of the Lord is upon me, because he has anointed me to bring good news to the poor. He has sent me to proclaim release to the captives and recovery of sight to the blind, to let the oppressed go free, to proclaim the year of the Lord’s favor.’ Does this mean Jesus didn’t like the wealthy? Compassion and balance are the goal. 2 Corinthians 8: For if the eagerness is there, the gift is acceptable according to what one has—not according to what one does not have. 13 I do not mean that there should be relief for others and pressure on you, but it is a question of a fair balance between 14 your present abundance and their need, so that their abundance may be for your need, in order that there may be a fair balance. This was all in the hope that all of God’s people might treat each other as fellow children of God. Mark 12:30-31 Because we are still striving against some of the same false theologies that Jesus was. We are dealing with opposing ideas about how God blesses people. Gospel of the Cross Gospel of Prosperity I am loved, therefore I give. Christ died to show his love to all. We are called to be present for and with all God’s people. Bible passage: “For by grace you have been saved through faith, and this is not your own doing; it is the gift of God— not the result of works, so that no one may boast.” Eph 2:8-9 Proponents: Luther, Bonhoeffer, Neibuhr, Barth, MLK, etc. I have, therefore I am loved. “God wants you to be rich!” If you work hard God will bless you with wealth. God shows his favor to the worthy. Bible passage: “I came that they may have life, and have it abundantly.” John 10:10b God helps those that help themselves. Proponents: Oral Roberts, Joel Osteen, Kenneth Copeland, etc. In the Gospel of Prosperity We are blessed by our works with riches. In the Gospel of the Cross We are blessed, and respond by sharing with others. What do they produce? Gospel of Prosperity Gospel of the Cross A false Jesus is Magic idea: If I pray hard enough, Jesus will bless me with wealth An Us vs. Them mentality: I am wealthy therefore God loves me, you are not, so God doesn’t love you A sense of being the Holy Chosen… A desire to give back to God by serving God’s people. A desire to respond to God’s blessings, not just receive them. A sense that all people are God’s children and deserving of love. But I thought God punished us for our sins and blessed us for our faithfulness. Yes, for our faithfulness (especially through people) And no, for our sins (in this life) Mark 10: Peter began to say to him, ‘Look, we have left everything and followed you.’ 29 Jesus said, ‘Truly I tell you, there is no one who has left house or brothers or sisters or mother or father or children or fields, for my sake and for the sake of the good news, 30 who will not receive a hundredfold now in this age—houses, brothers and sisters, mothers and children, and fields, with persecutions— and in the age to come eternal life. 31 But many who are first will be last, and the last will be first.’ Matthew 5:42-48 ‘You have heard that it was said, “You shall love your neighbor and hate your enemy.” But I say to you, Love your enemies and pray for those who persecute you, so that you may be children of your Father in heaven; for he makes his sun rise on the evil and on the good, and sends rain on the righteous and on the unrighteous. For if you love those who love you, what reward do you have? Do not even the tax-collectors do the same? And if you greet only your brothers and sisters, what more are you doing than others? We see similar struggles in the early church. In 1 Corinthians 11,12, and 13 Paul makes it clear, to a church that was struggling with issues of prestige and power, asking themselves who is great, that it is love that is great. By loving one another all are made great. What are the challenges and what are the rewards? Break into small groups and discuss Challenges Rewards Where do you begin? Who can make this happen? How do you live out a life of the cross? What might you have to sacrifice? How does this change how you live in the world? How does the cross change how you approach your neighbor? How would this change the relationships between people that are fighting? How does the cross change your relationships? Come together and discuss What does this view look like from the outside? What is it Jesus seems to want from us? How does this change our relationship to money? How does it change our relationship to each other?

<urn:uuid:d478d8b9-e022-44ad-a87a-a589c1eb32e3>

CC-MAIN-2016-50

http://slideplayer.com/slide/3483065/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

NB Power is investing $2.3 million to study the potential environmental impacts of future options being considered for the aging Mactaquac Dam, officials announced in Fredericton on Tuesday. The utility has hired the University of New Brunswick's Canadian Rivers Institute to provide independent research on the three options — rebuilding it, maintaining the earthen dam and spillway only, or removing it and returning the St. John River to its natural state. NB Power must choose a preferred option by 2016, given the anticipated times required for federal and provincial approvals, design and site work, said president and CEO Gaëtan Thomas. The dam will reach the end of its lifespan by 2030, he said. Stephanie Merrill, of the Conservation Council of New Brunswick, applauds NB Power's move to look ahead. "There's lots of time to weigh the options, to do the science that's needed to understand the impacts of all of the options and the Canadian Rivers Institute is the perfect group of scientists to be undertaking this with," she said. The institute will evaluate key environmental challenges related to the dam, including river health, fish passage and flow management, said project director Allen Curry. "Our goal is to provide objective and transparent science that is accessible and defensible," Curry said in a statement. "The three years will get us to a point where NB Power will be in a position to make an informed decision about which of the options they want to take forward," he said. Meanwhile, the utility will be doing its own research on the economic and social impacts of any changes, seeking advice from experts and meeting with First Nations people who live and work near the dam, as well as other stakeholders. The 660 megawatt plant, which officially opened in 1969, was originally expected to churn out electricity until 2068. But its life expectancy is now 2030 because the concrete used to build the power house and spillways began expanding and causing cracks.

<urn:uuid:ed30d9c8-13bb-4d2e-946e-e319b3ab1c98>

CC-MAIN-2016-50

http://www.cbc.ca/news/canada/new-brunswick/nb-power-invests-2-3m-to-study-mactaquac-dam-1.1930342

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

"A diversified intestinal flora seems to be better at stimulating the immune defense," says Göran Molin, professor of food hygiene at the Faculty of Engineering, Lund University, who co-directed the study with Siv Ahrné, also a professor of food hygiene. The composition of a child's bacterial flora is dependent on the mother's microflora, since she is the primary source for the child's bacteria at the outset. "A healthy vagina is totally dominated by lactobacilli, or lactic acid bacteria. With a vaginal delivery the child will come into close contact with the mother's bacteria. If the mother has a good flora of bacteria, the contact is an important help for the child to be able to be colonized by bacteria in the proper way. It can be assumed that certain hygiene measures, such as antibiotics given in some countries in connection with deliveries, in normal cases may have a deleterious effect, since the mother then is at risk to get a skewed bacteria flora, which she passes on to the child," Göran Molin reasons. But today, many women in the U.S. as many as a third of all women of fertile age have bacterial vaginosis. This is a condition in which other bacteria than lactobacilli dominate in the vagina. Precisely why people have less diversity in their bacteria is not known. But there arespeculations: "Our intestinal system developed to deal with lots of lactobacilli. But today our groceries are often heat-treated, and the food is kept in refrigerators explains Siv Ahrné. Consumption of live lactobacilli included in lactic acid fermented foods has been a regular part of the food intake of humans for a long time. In fact, there are archaeological signs that mankind has used this technique from the beginning of time as it is the simplest and often the safest way to preserve food, and humans have in this way consumed large numbers of live lactobacilli until modern times. Foods that promote the existence of lactobacilli are soured vegetables, such as sauerkraut, marinated olives, capers, and salted pickles, as well as cheese. The industry has discovered that certain living microorganisms are good and therefore add them to certain products under the umbrella term of probiotica. The article in Journal of Allergy and Clinical Immunology is in Vol 121, pp. 129-134. About the study: The children studied were originally included in a study directed by Professor Agnes Wold at Göteborg University, with a total of 300 children whose intestinal flora were examined using traditional methods. From this larger study, 35 children were selected in two categories, those who had been diagnosed with atopical eczema after 18 months and those determined to be free of this disorder after the same period. Only children with clear declarations of good health or eczema diagnosis were selected for the groups studied. The study was performed using genetic methods, which in this connection are more accurate than traditional bacteriological techniques, which are based on growing bacteria in pure cultures in the laboratory, which for some bacterial groups is difficult and sometimes even impossible. The genetic methods more directly target the bacteria's genes in the sample, thus bypassing the culturing stage. More information about lactobacilli: Lactobacilli are bacteria that belong to the genus Lactobacillus, which includes about 90 species. Lactobacilli grow spontaneously in traditional lactic acid fermented foods, knocking out both food-spoiling bacteria and pathogenic bacteria, for example, by forming lactic acid and lowering the pH of the food to 3.5-4. Examples of common species that occur in these foods are Lactobacillus plantarum and Lactobacillus paracasei. Lactobacilli are also present on mucous membranes, both in the mouth and in the intestines. Lactobacilli completely dominate the bacteria flora in a healthy vagina. For more information, please contact Siv Ahrné, professor, Industriell näringslära, (Applied Nutrition), phone: +46 (0)46-222 83 27, Siv.Ahrne@appliednutrition.lth.se or Göran Molin, professor, Industriell näringslära, phone: +46 (0)46-222 83 27 (same phone number as Siv Ahrné), Goran.Molin@appliednutrition.lth.se Kristina Lindgärde | idw Smart Data Transformation – Surfing the Big Wave 02.12.2016 | Fraunhofer-Institut für Angewandte Informationstechnik FIT Climate change could outpace EPA Lake Champlain protections 18.11.2016 | University of Vermont Physicists of the University of Würzburg have made an astonishing discovery in a specific type of topological insulators. The effect is due to the structure of the materials used. The researchers have now published their work in the journal Science. Topological insulators are currently the hot topic in physics according to the newspaper Neue Zürcher Zeitung. Only a few weeks ago, their importance was... In recent years, lasers with ultrashort pulses (USP) down to the femtosecond range have become established on an industrial scale. They could advance some applications with the much-lauded “cold ablation” – if that meant they would then achieve more throughput. A new generation of process engineering that will address this issue in particular will be discussed at the “4th UKP Workshop – Ultrafast Laser Technology” in April 2017. Even back in the 1990s, scientists were comparing materials processing with nanosecond, picosecond and femtosesecond pulses. The result was surprising:... Have you ever wondered how you see the world? Vision is about photons of light, which are packets of energy, interacting with the atoms or molecules in what... A multi-institutional research collaboration has created a novel approach for fabricating three-dimensional micro-optics through the shape-defined formation of porous silicon (PSi), with broad impacts in integrated optoelectronics, imaging, and photovoltaics. Working with colleagues at Stanford and The Dow Chemical Company, researchers at the University of Illinois at Urbana-Champaign fabricated 3-D birefringent... In experiments with magnetic atoms conducted at extremely low temperatures, scientists have demonstrated a unique phase of matter: The atoms form a new type of quantum liquid or quantum droplet state. These so called quantum droplets may preserve their form in absence of external confinement because of quantum effects. The joint team of experimental physicists from Innsbruck and theoretical physicists from Hannover report on their findings in the journal Physical Review X. “Our Quantum droplets are in the gas phase but they still drop like a rock,” explains experimental physicist Francesca Ferlaino when talking about the... 16.11.2016 | Event News 01.11.2016 | Event News 14.10.2016 | Event News 09.12.2016 | Life Sciences 09.12.2016 | Ecology, The Environment and Conservation 09.12.2016 | Health and Medicine

<urn:uuid:4079019b-b7dc-4b60-b67e-0a11c0cd4887>

CC-MAIN-2016-50

http://www.innovations-report.com/hrml/reports/studies/report-101747.html

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Milk & Dairy – Pasteurization by Elizabeth Blessing Pasteurization is a process of heating a food, usually a liquid, to a specific temperature for a predefined length of time and then immediately cooling it after it is removed from the heat. This process slows spoilage due to microbial growth in the food. The process of pasteurization is applied to most milk today. Three types of pasteurization processes are practiced in the U.S. Traditional pasteurization heats the milk to at least 165°F for 15 seconds. This is commonly referred to as “High Temperature, Short Time,” or HTST pasteurization, which is used by dairies like Trader’s Point Creamery and Snowville Creamery. Heating the milk removes 99.9 percent of the bacteria, which gives HTST milk a printed shelf life of 16-21 days from the date it was packaged. Ultra pasteurization—the most widely used pasteurization process in Europe and throughout the world—is a more recently developed process. The process is often referred to as “Ultra High Temperature,” or UHT pasteurization. The UHT process heats the milk to 280°F for only two seconds and eliminates a larger percentage of bacteria than HTST pasteurization. When coupled with sterile packaging, ultra pasteurized milk has a shelf life of 70 days from the date of processing. Low-temperature vat pasteurization is a less conventional (but US FDA-legal) alternative that heats milk at 145°F for 30 minutes and then quickly cools it. This retains a high percentage of the milk’s natural enzymes and bacteria, which add to the flavor and is also believed by consumers to add to the health benefits of the milk. It lasts about as long in your refrigerator as HTST milk. Many people are turning to vat pasteurized as an alternative to unpasteurized milk which can be difficult to get in some areas. Most producers utilize a standard high-temperature pasteurization technique that also destroys enzymes in the process. Without them, milk is very difficult to digest. Many people who have been told they are lactose-intolerant can drink low-temperature vat pasteurized milk, like Green BEAN Delivery’s offering of Hartzler’s, without any problems. This is because Hartzler’s contains the digestive enzyme lactase. Without lactase to help break down the milk sugar lactose, the human body cannot assimilate the milk sugar.

<urn:uuid:1a4d2c9f-0625-4805-8900-67c69ece7b3a>

CC-MAIN-2016-50

http://www.muncievoice.com/6862/milk-dairy-pasteurization/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Peer Mediation a ‘Win-Win’ for Oklahoma Students By Phil Johnson and Jane McConnell It’s a typical day in an Oklahoma public school. In the hallway during the rush to get to class, two students exchange harsh words and a fistfight breaks out — putting other students in physical danger. The two students could be suspended, pushing them behind in their school work and setting up further confrontation in the future, but there might be a better alternative. Enter PROS — Peaceful Resolutions for Oklahoma Students — a peer-based mediation program that equips these students with the skills they need to resolve their conflicts peacefully and effectively, while learning respect for each other in the process. PROS is a collaborative project of the OBA and the Administrative Office of the Courts. The program provides peer mediation training to students in fourth grade and up. Students in turn serve as mediators when conflicts arise, and disputes are not only resolved but prevented. Schools across Oklahoma have utilized this conflict resolution program that inspires their students to communicate more effectively and to bring peace to their school campuses. “It has been a very effective program in our school,” said Shawnee Middle School counselor Angela Lindsay. “Students who go through the training program gain skills in active listening and role playing. When students have a conflict resolved by a peer, we rarely see them twice for the same issue.” Many Oklahoma schools, both large and small, have very diverse student bodies representing different ethnic backgrounds, social statuses and extracurricular interests. There are many positives to diversity, especially the opportunity to interact and learn from one another. Diversity can also present challenges, especially among students who have not yet mastered the skill of respecting those who are different. “The training really opens doors for understanding how to walk in someone else’s shoes,” Ms. Lindsay said. “The program emphasizes understanding and acceptance, and it shows up even in their day-to-day interactions with each other. The students who serve as conflict mediators become positive role models and leaders in the school.” The stages of peer mediation include the opportunity for each student to tell his or her own side of the story, the opportunity to empathize with the other student’s point of view, discussion of how to solve the existing problem and a written agreement. These mediation programs have been shown to decrease violence, fighting, bullying and suspensions while increasing self and mutual respect along with a positive learning climate. As arguments de-crease, learning goes up. Administrators, counselors, teachers and students are trained at no cost in regional trainings held each fall in Oklahoma City and Tulsa. Additional training events are held throughout the year in several inner-city schools. Students who receive the training discover that PROS instills invaluable communication skills benefitting them not only in school but in life beyond. WANT PROS IN YOUR SCHOOL? More information about PROS is available on the bar association’s website at www.okbar.org/public/lre/pros . To find out how to set up a PROS training session in a school in your community, contact the OBA Law-related Education Department at 405-416-7005. Benefits of a School Conflict Mediation Program • Conflict mediators gain confidence in their ability to help themselves • Conflict mediators learn to get along better at home and at school • Conflict mediators’ grades often improve • Other students learn how to get along with each other better from conflict mediators • Conflict mediators often become peer leaders in their school and community • Arguments decrease, so students spend more time learning • Students and teachers are able to work together in a friendlier and relaxed way ABOUT THE AUTHORS Phil Johnson is the peer mediation specialist for the Administrative Office of the Courts. He may be contacted at firstname.lastname@example.org Jane McConnell is Law-related Education coordinator for the Oklahoma Bar Association. She may be contacted at email@example.com Originally published in the Oklahoma Bar Journal, OBJ 85 357 (Feb. 15, 2014)

<urn:uuid:5bbaac56-c7bd-4a3b-92a5-5710954093dc>

CC-MAIN-2016-50

http://www.okbar.org/members/BarJournal/archive2014/FebArchive14/OBJ855JohnsonMcConnell.aspx

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Note: Sample below may appear distorted but all corresponding word document files contain proper formattingExcerpt from Essay: Athens and Sparta -- Was War Inevitable? Between 500 and 350 BC the area now known as Greece was but a collection of separate and unallied city-states. Today, we often view cultures and political conflict in terms of nations, and take the view that since city-states were geographically close, culture was the same. This, however, was untrue, particularly in the case of the two most powerful and well-known city states of Athens and Sparta. That is not to say that these two entities were completely divergent. Both had some cultural similarities in context with their history, and they cooperated -- if distantly, in the years leading up to the Battle of Thermopylae and subsequent defeat of the Persian invaders at Salamis and Plataea, ending Persian aggression for a time. However, understanding Ancient Cultures is often difficult. We have limited resources from which to build a portrait of the culture, and must make a number of assumptions based on interpretation of relics, translation of documents, and the historical record. It does appear that the differences in political culture, supported by different economic and social systems, along with the age-old fear of power dominance once Persia was defeated made war almost inevitable between the two. Athenian historian Thucydides' noted, "The growth of the power of Athens, and the alarm which this inspired in Lacedaemon (Sparta), made war inevitable" (Thucydides, 1.23). In fact, the conflict between the two powers completely reshaped the Ancient Hellenic World. Athens, the strongest city-state of the time, was reduced to almost complete subjugation, its economic and cultural influence dramatically reduced. Sparta rose to become the predominant power in the Greek world. However, the economic costs of the war were disseminated across the entire penninsual, resulting in poverty, disease, and privation, with Athens never really regaining it pre-war dominance. Even more so, the end of the Athenian-Spartan conflict created a different psychological and foreign relations thrust in the Ancient World. The conflict between democracy (Athens) and oligarchy (Sparta) was supported by other factions in other countries and city states; once Sparta triumphed civil war became more of a common occurance in the Greek world, and changed warfare from a more limited and formalized conflict to war that was complete, waged against populations, creating vast devastation and ending the Golden Age of Greece forever (Kagan). General History of Athens Athens is one of the oldest cities in the Ancient World, having been continuously inhabited for at least 7000 years. It was one of the centers of the Mycenaean civilization in 1400 BC. By the 6th century, social unrest led to societal reforms (the Reforms of Solon) which were important building blocks in the eventual introduction of democracy around 508 BC. By this time in its history, Athens had become a significant naval power, helping the Ionian colonial cities rebel against Persian rule, thus instituting the Greco-Persian Conflict. After the defeat of the Persians Athens became the leading city-state of Ancient Greece, both in economic and political power. This including the Deilian League, ostensibly to band together other city-states in a defensive organization against Persia, but really more of an Athenian-based power brokerage designed to help Athens gain more power and influence over all of Greece (Pomeroy). After the defeat by the Spartans in 404 BC, Athens never fully recovered, but became relatively prosperous as a seaport, trading center, and embarkation point during the Crusades, conquered again by the Ottoman Empire in 1458. General History of Sparta Sparta was a prominent city-state in Ancient Greece, loaded far to the south of Athens in the south-easterner Peloponnese. Emerging as a succinct political entity around the 10th century BC, from 650 BC on it was the dominant military land-power in Ancient Greece. Militarily, Sparta was recognized as the leader of the combined Greek forces against the Persians, and while it emerged victorious over Athens in the Peloponnesian Wars, the conflict ruined much of Sparta's economy and power. In fact, Sparta was defeated by the city-state Thebes in 371, ending its role as the predominant power in Greece. Despite this, the unique socio-cultural and political philosophy it engendered changed the course of Greek history. Sparta did, however, manage to remain independent until Rome conquered Greece in 146 BC (Cartledge). Sociology of Athens According to legend, Athens was ruled by kings and then a group of land owners. Prior to the concept of political hegemony, four tribes dominated the area and brought together a series of viewpoints that would define Athens: common religious rights, mutual rights of property and succession, common areas of property, and the right to elect members of the ruling councils. It was this early process that defined the manner in which Athens viewed the world, and despite civil strife, let to Athenian democracy (free man of landed wealth could vote). The combination of this rather unique view, for the Ancient World, geographic location, and a rich seafaring tradition established a form of government that permeated the sociology of the culture (Rhodes). For Athens, the realities of the world, be it peace or war, required a certain mindset in order to be successful. The primary purpose, then, of an Athenian education was to engender well-rounded thinkers. This mean that individuals had to be trained in the arts and sciences just as in the art of warfare and physical education, otherwise, the individual could not serve society in peace and war. Reading was a crucial activity from early age and education was compulsory for merchant and wealthy classes, and suggested for poorer families. By age 14, though, poorer boys began to seek apprenticeships in trades. Those whose families could pay tuition remained in school until age 18. At 18, regardless of social or economic status, Athenian boys were required to attend military school until they reached 20. After about 390 BC there were academies that taught wealthier individuals after military school. Athenian girls did not receive state sanctioned school, but were allowed to learn at home with domestic educators, typically based upon family tradition (Kovacs). Political Culture of Athens Political culture in Ancient Athens revolved around a philosophical idea of logic and human progress and actualization. Both of these concepts were relatively unique in the Ancient World, yet this uniqueness is what drove the political and cultural psychology of Athens. Within this paradigm, though, was built a distrust and intellectual animosity for other viewpoints -- an intolerance of autocracy, if you will. Thucydides notes, "The secret of happiness is freedom, and the secret of freedom, courage" Naval dominance was the trademark of the Athenian military, again due to historical trends and proximity. Their intellectual focus, for instance, aided in the development of naval weaponry and architecture vastly superior to others -- the Athenian trireme. This ship was a galley that allowed for ramming, a maximum speed of 10 knots, and a superior strategic advantage at sea that also contributed to Athenian arrogance (Kovacs). Athens was dependent upon agriculture, both land and sea based, was cosmopolitan, descendent from Ionian culture, and highly dependent upon trade and sea-commerce. They tended to look forward, imagining the human condition as what could be, rather than what was. Because of this, and the philosophical basis for societal thought, Athenian arrogance manifested itself in the view that it alone knew what was best for Greece. The idea of allowing more free-will for educated individuals, and a continual outward search for allies and acquisitions created a belief that the manifest destiny of Athens was to rule Greece based on ideals and power (Pomeroy). Political Culture of Sparta Sparta had no long tradition of seafaring or port contacts with other cultures. From early on, their culture was based on adherence to a military code, to the ruling council, and a philosophical trend towards conservatisms (focusing on the past or present, less concerned about the future). Spartans were descendants of the Dorian invaders, and never really developed the idea of a democratic or open form of power or opportunity. Spartan climate was harsher than that of Athens, and the city was depended upon agriculture, having no easy access to the ocean. Military service was mandated, and almost no lasting works of art or literature came out of Spartan culture. Ironically, though, women in Spartan culture had much more power and authority than that in "democratic" Athens (Pomeroy). Sparta, although militaristic, was primarily defensive based. They considered themselves to be the iconic "protector" of the peninsula. Their push for military power was to gain hegemony for themselves and control over other kingdoms, but not at the expense of northern city-states, in general. Sparta was ruled by a combination of monarchy and oligarchy; usually rulers who ruled for their lifetime. The basic focus was rule by the few for the benefit of the many, as opposed to Athenian views of rule by the many so that inclusion would benefit more (Cartledge). Sociology of Sparta The overall goal of Spartan society was to produce the best warrior possible. Of course, there were other needs for…[continue] "Athens And Sparta -- Was War Inevitable " (2012, April 30) Retrieved December 10, 2016, from http://www.paperdue.com/essay/athens-and-sparta-was-war-inevitable-79619 "Athens And Sparta -- Was War Inevitable " 30 April 2012. Web.10 December. 2016. <http://www.paperdue.com/essay/athens-and-sparta-was-war-inevitable-79619> "Athens And Sparta -- Was War Inevitable ", 30 April 2012, Accessed.10 December. 2016, http://www.paperdue.com/essay/athens-and-sparta-was-war-inevitable-79619

<urn:uuid:5195dbd0-b098-41bc-8feb-6b6ac4aff373>

CC-MAIN-2016-50

http://www.paperdue.com/essay/athens-and-sparta-was-war-inevitable-79619

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

The impact of media is a growing topic of research. And for good reason. In 1970, the average age at which children watched television was four years old. Today, the average age is four months. The typical child before the age of five is watching 4 ½ hours of television per day, 40% of their waking hours! Recent studies on the impact of media have linked television to the over-stimulation of an infant’s brain, leading to the development of Attention-Deficit/Hyperactivity Disorder (ADHD) in young children. Dr. Dimitri Christakis, a Professor of Pediatrics at the University of Washington, says that in the first two years of life, the brain triples in size. Connections that form in the brain, or synapses, are based on early life experiences. Prolonged exposure to rapid image changes during these first years of critical brain development preconditions the mind to expect high levels of stimulation. This, in turn, leads to inattention in later years. Studies on the impact of media have shown that the more kids watch TV before the age of three, the more likely they are to have attention problems in school. Impact of Media: The Good News While studies found exposure to rapid image changes harmful to young children, they also found cognitive stimulation to be helpful. What is cognitive stimulation? When we read to children, sing with them, and take them to museums, we increase their abilities to think and process information. This type of stimulation makes children less likely to develop inattention difficulties later in their school lives. The content of what kids watch is key. Learn how to distinguish what is positive and what may cause inattention. For example, programs that constantly change scenes cause over-stimulation. Those that are slow, real narratives like Mr. Rogers are more calming and cognitively stimulating. An excellent source of guidance for parents concerned about the impact of media on their children can be found in the Technology and Media section at Parent Further, a Search Institute sponsored-website. The Search Institute is a leader in how children develop assets that lead to positive developmental outcomes. Building Blocks vs. Television A study on the impact of media conducted in Seattle by Dr. Dimitri Christakis showed that children who played with building blocks scored significantly higher on language acquisition tests. In fact, a recent New York Times article, With Blocks, Educators Go Back to Basics, describes how parents learn to engage their children in block building! It may end up that blocks, not television, will help build the skills that young people need to be successful in corporate America! According to Christakis and other researchers, early childhood is critical for children’s development. Children need more real time play and less fast-paced media. “If you change the beginning,” Christakis says, “you change the whole story!” Watch the Video In December of 2011, Dr. Dimitri Christakis presented a TEDxTalk on the impact of media on children. It’s a fascinating watch, guaranteed to change the television-watching habits of parents with young children! Image Credit: Kirill Polovnoy Published: February 13, 2012Tags: critical thinking, learning, neuroscience, positive youth development

<urn:uuid:fb458dd9-ccf8-4789-b994-29a35a683422>

CC-MAIN-2016-50

http://www.rootsofaction.com/are-we-over-stimulating-young-children-dimitri-christakis/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Yesterday was National Running Day, and the Atlantic profiled the community of people for whom pounding the pavement is an everyday, necessary occurrence. Known as streakers, these people run daily, for at least one continuous mile, as long as their limbs will hold them. To keep up a streak means running through illness and injury. Of course there are health complications. As the Atlantic explains: Although researchers haven’t examined streak running’s effects on the body, some experts say it’s not healthy. The body needs a day off to recover, says Dr. Lewis G. Maharam, chairman of the International Marathon Medical Directors Association. “When God created the heaven and earth, he gave a day of rest,” Maharam says. “Anybody that runs every day without any rest is not smart.” But there is a surprising number of those not-smart people out there. More than 430 people are registered streakers on the USRSA’s website, with records from five to 15 to 45 years of daily running, the Atlantic reports. Some clinicians suggest that streak running might be a type of addiction. No matter what's motivating these runners, it's hard not to admire these incredible feats of endurance.

<urn:uuid:7d6a3c8d-2f13-41b5-8ace-2c2713bb4214>

CC-MAIN-2016-50

http://www.smithsonianmag.com/smart-news/16447-days-longest-running-streak-record-180951670/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Back in 2010 when I was living in Ithaca, NY I had the opportunity to tour a local grain mill in Trumansburg, Farmer Ground Flour. The region has a long history of grain milling with an old water powered mill at the top of Lucifer Falls/Enfield Falls in what is now Treman State Park. The water-powered gristmill was built in 1839 by Isaac Rumsey and used to mill wheat and corn until 1917. And of course the Haudenosaunee (French name: Iroquois) people were grinding corn in the region for many centuries before that, with Jane Mt. Pleasant dating corn’s arrival to North America at 2,000 years ago. There is a regional project to bring back traditional Haudenosaunee white corn in the areas it was historically grown. If you are an agricultural history nut like I am, you will love Jane Mt. Pleasant’s 2011 paper, The paradox of plows and productivity: an agronomic comparison of cereal grain production under Iroquois hoe culture and European plow culture in the seventeenth and eighteenth centuries. Students in my Land Steward’s course read this paper and it sparked some really fascinating discussions on how traditional ecological knowledge can guide modern sustainable agriculture practices. The corn yields in the traditional no-till system were astounding. During the tour, you’ll see freelance journalist Sharon Tregaskis scribbling notes as we talk with Greg. Shortly after the tour she published a profile of the milling operation in the Cornell Alumni Magazine. I also love her piece on Black Currant production in the Fingerlakes. The winter 2013 issue of Edible Fingerlakes also has a nice profile of Farmer Ground Flour. So as much as I would like to ramble on about this operation, I’ll let Greg Mol, the miller and the professional writers, Sharon Tregaskis and Amy Halloran, take it away… A brief note about this tour: These were the early days of design, construction and operation at the Farmer Ground Flour Mill. They have an updated facility now, but I feel this video is still instructive especially to those who are just starting out in a regional food processing business. An incredible amount of ingenuity, tinkering and research are involved in getting a project like this up and running because the infrastructure and equipment to support similar enterprises assumes a much larger scale of operation. Check out how this business re-invented small-scale regional milling: Updates: Farmer Ground Flour received a USDA grant in 2012 supporting their work to create a sustainable regional food system. You can keep up with their progress on their Facebook site. Farmer Ground Flour Granted Funds by USDA Rural Development to Expand Market (from the NOFA-NY newsletter) “Farmer Ground Flour was awarded $75,000 by the USDA Rural Development Fund under the Value-added Producers grant program. These funds will be matched by $50,000 in working capital contributed to the project by Farmer Ground Flour, and a $25,000 personal loan made to the project by local residents Jon Bosak and Bethany Schroeder. Mr. Bosak and Ms. Schroeder are enthusiastic about participating in reviving local grain growing and milling in Tompkins County, and agreed to have the interest on the loan paid to them in flour and grain on a monthly basis. The two-year, $150,000 marketing expansion project will focus on expanding wholesale sales to bakers and institutions, and retail sales at stores and farmers markets.” A brief note in memory of Bethany Schroeder, her work in the sustainability movement in Tompkins County lives on…

<urn:uuid:6fcbe641-04eb-457a-8f06-eaf1b9686548>

CC-MAIN-2016-50

https://agroecologyaz.wordpress.com/2013/11/19/regional-flour-milling-trumansburg-ny/

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

oa Journal of the Entomological Society of Southern Africa - Studies in African Bombyliidae Although the genus Systoechus is well represented in Africa the vast majority of the species are recorded from Southern Africa. There appear to be only four species recorded from East Africa: exilipes Bezzi, from Kenya and Ethiopia, mixtus Wiedemann from Kenya, somali Oldroyd from Somalia and Kenya, and vulpinus Becker from Ethiopia (and also Aden and Arabia). However, Hesse (1938) has separated no less than seven distinct forms from series determined as mixtus Wied. by various authorities, and has also shown that it is extremely unlikely that palaearctic forms also occur in the ""Ethiopian"" region. Article metrics loading...

<urn:uuid:9b31bf36-1271-45d0-ad32-881556aaae0a>

CC-MAIN-2016-50

https://journals.co.za/content/JESSA/22/2/AJA00128789_3508

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

Hydrogen Production and Utilization of Agricultural Residues by Thermotoga Species MetadataShow full item record Abstract: Hydrogen can be a renewable energy source to replace conventional fossil fuels. Compared to current hydrogen production processes by consuming fossil fuels, biological hydrogen production has the advantage of being environmentally friendly because of the use of renewable and low value biological materials. Some hyperthermophiles, such as Thermotoga species, are capable of producing hydrogen during growth. In this study, Thermotoga maritima, Thermotoga neapolitana DSM 4359 and DSM 5068, were used to investigate their potential in converting selected sugars (glucose and xylose) and complex carbon sources (cellulose, starch, xylan and agricultural residues, such as barley straw, corn stover, soybean straw, wheat straw and corn husk) to hydrogen. In addition, factors which influenced growth and hydrogen production were studied, and optimal conditions for hydrogen production were obtained. All three Thermotoga species could grow in the presence of mono sugars (glucose, xylose) and complex carbohydrates (starch, xylan, milled corn husk). They all could produce hydrogen in the presence of micro-molar level of oxygen without addition of any reducing agents in the growth medium. Compared to the slight inhibition caused by L-lactate accumulation during the growth, gradual pH decreases were the main reasons to inhibit both growth and hydrogen production of T. neapolitana species. Increasing the initial pH of the growth medium to 8.5 and stabilizing the pH by 50 mM Triz buffer resulted in higher growth and hydrogen production of T. neapolitana strains. Adjusting the medium pH at early stationary phase also increased the hydrogen production, and fewer enhancements to the growth. The pH control methods also resulted in higher conversion efficiency (converting glucose to H2) of T. neapolitana strains from 2.2 to 3.6 (H2/glucose), which was approximately 90% of the theoretical efficiency (4 moles H2 produced from 1 mole glucose). The expression of hydrogenases of T. neapolitana strains could also be increased by the pH control methods. Thermotoga species could grow and produce hydrogen using agricultural residues, such as corn husk, achieving 60% growth and hydrogen production as compared to that iii from glucose. With pH control methods, hydrogen production by T. neapolitana strains from corn husk was higher than that from glucose without pH control. These results indicated that the pH was the main factor to affect both hydrogen production and growth of T. neapolitana species, and optimal conditions for hydrogen production could be achieved by using pH control methods. Selected agricultural residues could be utilized for biological hydrogen production by Thermotoga species with minimum pre-treatment, and the pH control methods could result in a higher hydrogen production compared to that from glucose. Further studies on the continuous growth and hydrogenases of Thermotoga species are needed for better understanding of the hydrogen production mechanisms. Cite this work Hongbin Zhu (2007). Hydrogen Production and Utilization of Agricultural Residues by Thermotoga Species. UWSpace. http://hdl.handle.net/10012/3315

<urn:uuid:3f367bcb-4254-4489-ba30-474ab149f184>

CC-MAIN-2016-50

https://uwspace.uwaterloo.ca/handle/10012/3315

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

The early Vasa kings (1523–1611) After Gustav I Vasa was elected to the throne in 1523, he began to restore the power of the Swedish king and to organize a central administration under his own direct leadership. On the one hand, this task was facilitated by the elimination of a great part of the high nobility by the Stockholm Bloodbath. On the other hand, the influence of the king was limited by the economic dependence of Lübeck and the Hanseatic League. In connection with the war against Denmark and the liberation of Stockholm in 1523, Gustav Vasa had been forced to make great concessions to Lübeck, which had given him both economic and military support. In exchange, the merchants of Lübeck and the Hanseatic League were given privileges that created a monopoly of Swedish foreign trade and even had considerable influence on domestic trade and industry. The concessions also included a large payment and left Sweden heavily in debt to Lübeck. Under the mediation of Lübeck, the war with Denmark was brought to an end by a treaty concluded in Malmö in 1524. After the death of the Danish king Frederick I, his son Christian III became king in 1534. When Lübeck attempted at this time to restore the exiled Christian II as king in Denmark, Gustav Vasa gave the young Christian III strong military support in a war against Lübeck. The Hanseatic army was beaten in 1535, and by the terms of a truce in 1536 the Swedish debt to Lübeck was wiped out and the privileges of Lübeck traders were abolished. By this action Hanseatic hegemony was destroyed, other foreign traders were allowed to enter Sweden, and Swedish traders could now move freely beyond the Baltic. Sweden’s relations with Denmark remained peaceful for the rest of Gustav Vasa’s reign. Gustav Vasa devoted the major part of his rule to domestic politics, and he is credited with establishing Sweden as a sovereign state. His initial goal as king was to stabilize the nation’s financial situation. Through stern acts passed by the Diet at Västerås in 1527, he was able to confiscate all the properties of the Roman Catholic Church. The church at that time held 21 percent of Sweden’s land, as opposed to only 6 percent held by the crown. The appropriation of the possessions of the church thus added enormously to the wealth of the state. To some degree the king could justify his actions on the basis of the doctrines of Martin Luther, which were being accepted nationwide with royal encouragement. The Swedish and Roman Catholic churches separated as the Reformation spread, and the Lutheran Swedish church was eventually adopted as the state church. The establishment of the new religious order occurred simultaneously with a reorganization of government, which was accomplished with the assistance of German administrators brought in by Gustav. The new, highly centralized administration attained an unprecedented degree of efficiency. During the latter part of his reign Gustav achieved absolute power and ruled Sweden in accordance with his own precepts. In 1544 the king established a hereditary monarchy in Sweden and accelerated the annexations of land, which finally gave the crown direct possession of about 60 percent of Swedish soil before he died. Gustav Vasa has been compared to a landowner in his behaviour toward the crown properties and the state incomes. He personally took part in developing their administration, and he continuously inspected the crown servants. He nominated county governors himself and reserved the most important charges for members of his own family. Money economy had barely come to Sweden, and many state incomes were therefore paid in kind; some of the goods exchanged were used directly to feed and clothe public servants and soldiers, while others were sold to foreign merchants. Gustav took great pleasure in literally filling the treasury, in which condition it was handed over to his son. The nobility was allowed no part in state affairs, and the Diet was convened only for royal propaganda, of which Gustav was a master. Not surprisingly, Gustav’s new system was not universally accepted. In such regions as Västergötland, Dalarna, and Småland, there was considerable resentment over the imposition of state control. In the 1530s and ’40s the farmers grumbled over taxes, and the clergymen complained about interference in church matters. Gustav met opposition from his former friends—e.g., the farmer-miners of Dalarna—with the same ruthlessness as that from other dissenters. Gustav led a careful foreign policy; nevertheless, a considerable army and a strong navy were created during his reign. Sweden also advanced culturally under Gustav’s rule: among the notable literary accomplishments of the period were a complete translation of the New Testament and the publication of the hymns and theological writings of Olaus Petri, who played an important role in the Swedish Reformation. Following the death of Gustav Vasa, his oldest son, Erik XIV, became king. In his will Gustav had, however, appointed his younger sons dukes and given them part of the realm as duchies with great power in domestic affairs. One of the first steps taken by Erik XIV was to strip his brothers of all power by a treaty that he forced them to sign at Arboga in 1561. The main interest of Erik XIV was, however, devoted to foreign policy. One of his goals was to gain control of Russian trade through the Baltic ports. As a first step he negotiated with the Estonian nobility, which agreed to Swedish rule in 1561 and thereby laid the foundation for a Swedish Baltic empire. His aspirations led to conflicts with Denmark and Lübeck, which, up to the 16th century, had been the leading powers in this region. Control of the Baltic Sea became a central issue. In the 16th and 17th centuries the Baltic region, Europe’s main source of grain, iron, copper, timber, tar, hemp, and furs, was as important as either the Mediterranean or the Atlantic. The Swedish effort to gain control over trade in the Baltic resulted in war with Denmark, Lübeck, and Poland in 1563. After seven bloody years, during which the southern parts of Sweden were ravaged, a peace was signed at Stettin (now Szczecin, Pol.) in 1570, without change to any of the borders. Sweden was forced, however, to pay a large ransom to retrieve the fortress of Älvsborg, its only stronghold in the west. Before the peace was concluded, Erik XIV, accused of lunacy after having murdered some of the leading aristocrats by his own hand, was deposed in 1568 by his brother John, who was supported by the high nobility. Erik later died in prison, probably poisoned on the order of his brother. With the support of the high nobility, John III ascended to the throne in 1568. His reign (1568–92) was characterized by conflict between the king and the high nobility, who asked for a constitutional government and greater influence for the council. At the same time, John tried to reintroduce Roman Catholic customs into the Swedish church, which led to conflict with the clergy. His religious policy was a consequence of his marriage to a Polish princess and the subsequent close political alliance between Sweden and Poland. Their son, Sigismund III Vasa, was elected king of Poland in 1587 before inheriting the throne of Sweden in 1592. Opposition to Sigismund developed because of his Roman Catholicism and his extensive stays in Poland. At a meeting in Uppsala in 1593 the clergy adopted a declaration that became the definitive confirmation of Sweden as a Lutheran country. The strong feelings against Sigismund were also exploited by his uncle Charles, who organized all conceivable Swedish opposition against the recognition of Sigismund. By doing so, Charles made the Diet (and of course the clergy) a political force against the high nobility. The final outcome was the resignation of Sigismund in 1599. Test Your Knowledge Countries of the World Charles IX was an administrator very much like his father. His foreign policy aimed at dominating the Russian trade routes toward the Kola Peninsula and the White Sea and at grasping as much as possible of the territory (Russian and other) south of the Gulf of Finland. Sweden thus was susceptible to Danish attack, which came in 1611 and began the so-called Kalmar War, a conflict that ended with the Peace of Knäred in 1613. By the terms of the peace, Sweden had to renounce its claim on the territories in the far north of Scandinavia and pay a new large ransom for the fortress of Älvsborg, taken by the Danes during the war. Charles IX, however, did not live to experience the defeat.

<urn:uuid:fcd9bb67-5b1f-4223-86dc-4783396e2306>

CC-MAIN-2016-50

https://www.britannica.com/place/Sweden/The-early-Vasa-kings-1523-1611

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en

from Wiktionary, Creative Commons Attribution/Share-Alike License - n. A document issued to a specific person by a government authority, permitting this person to drive one or more classes of motor vehicle on public roads and highways. As the licence generally has a photograph of the licensee, it is generally used as an identification document, and may be required when making credit purchases, cashing checks, applying for employment etc. from WordNet 3.0 Copyright 2006 by Princeton University. All rights reserved. - n. a license authorizing the bearer to drive a motor vehicle Sorry, no etymologies found. Sorry, no example sentences found.

<urn:uuid:e3c06faa-841a-4124-a64c-3c9477c10487>

CC-MAIN-2016-50

https://www.wordnik.com/words/driver's%20license

s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698543567.64/warc/CC-MAIN-20161202170903-00501-ip-10-31-129-80.ec2.internal.warc.gz

en