Datasets:

nayohan

/

aihub-en-ko-translation-1.2m

like 1

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

이미다졸리디논 화합물종양괴사인자의 생성을 억제시키고 TNF생성에 의해 중재되었거나 악화된 질병상태를 치료하는데 유용한 신규의 이미다졸리디논 유도체가 기술된다. 본 발명의 화합물은, 또한, PDE IV의 억제인자로서 유용하며, 따라서, PDE IV의 중재 또는 억제가 필요한 질병상태를 치료하는데 유용하다.하기 일반식(Ⅰ)의 화합물 또는 이의 약제학적으로 허용되는 염: 상기식에서, R1은 -(CR9R10)n-(C(O)O)r-(CR9R10)m-R8, -(CR9R10)n-(C(O)NR6)r-(CR9R10)m-R8, 또는 -(CR9R10)n-(C)s-(CR9R10)m-R8이고, 여기서, 알킬잔기는 하나이상의 할로겐에 의해 임의로 치환될 수 있고, n은 0내지 4의 수이고, m은 0내지 2의 수이고, r은 0또는 1의 수이고, s는 0또는 1의 수이고, R9 및 R10은 수소 또는 C1-2알킬중에서 독립적으로 선택되고, R8은 수소, 메틸, 하이드록실, 테트라하이드로푸란, 테트라하이드로피란, 테트라하이드로티오펜, 테트라하이드로티오피란, C3-6사이클로알킬, 또는 한개 또는 두개의 불포화결합을 함유한 C4-6사이클로알킬이고, 여기서, 사이클로알킬 및 헤테로사이클잔기는 1내지 3개의 메틸그룹 또는 한개의 에틸그룹에 의해 임의로 치환될 수 있고, 단, a) r이 1일때, n은 1내지 4이거나, b) s가 1일때, n은 2내지 4이거나, c) R8이 하이드록실이고, r이 1이고, n이 1내지 4일때, m은 2이거나, d) R8이 하이드록실이고, r또는 s가 0일때, n+m의 합이 2내지 6이거나, e) -(CR9R10)n-(C(O)O)r-(CR9R10)m-R8에서 m이 0이고, r이 1일때, n은 1내지 4이거나, f) R5이 2-테트라하이드로피란 또는 2-테트라하이드로티오피란, 2-테트라하이드로푸란 또는 2-테트라하이드로티오펜이고, r또는 s가 0일때, n+m의 합이 1내지 6이거나, g)R8이 2-테트라하이드로피란, 2-테트라하이드로티오피란, 2-테트라하이드로푸란 또는 2-테트라하이드로티오펜이고, n이 1내지 4이고, r이 1일때, m은 1내지 2이어야하거나, h) R8이 2-테트라하이드로피란, 2-테트라하이드로티오피란, 2-테트라하이드로푸란 또는 2-테트라하이드로티오펜이고, n은 2내지 4이고, s는 1일때, m은 1내지 2이어야하고, X는 YR2, 할로겐, 니트로, NR6R7또는 포르밀아민이고, 여기서, Y는 0또는 S(O)m′이고, m′은 0내지 2의 수이고, R6 및 R7은 하기정의한 바와같고, R2는 1개이상의 할로겐에 의해 임의로 치환된 -CH3 또는 -CH2CH3이고, R3은 H, CH3, CN, CH2F, CHF2, 또는 CF3이고, R4는 H, C1-C4알킬, OH, OCH3, OCH2CH3, 또는 OAc이고, R5는 H, OH, (CH2)qAr, 또는 C1-6알킬이고, 여기서, -(CH2)qAr, 또는 C1-6알킬그룹은 F, Br, Cl, -NO2, -NR6R7, -CO2R6, -OR6, -OC(O)R6, C(O)R6, CN, -C(O)-NR6R7, -C(S)-NR6R7, -NR6-C(O)-NR6R7, -NR6-C(S)-NR6R7, -NR6-C(O)-R6, -NR6-C(S)-R6, -NR6-C(O)-OR6 , C(=-NR6)--NR6R4, -C(=NCN)-NR6R7, -C(=NCN)-SR6, -NR6-C(=NCN)-SR6, -NR6-C(=NCN)-NR6R7, -C(=NR6R7)SR6, -NR6-S(O)2-R6, -S(O)m'-R6, -NR6SO2-CF3, -NR6C(O)-C(O)-NR6R7, -NR6-C(O)-C(O)-OR6, 1-이미다졸릴 또는 1-(NR6)-2-이미다졸릴에 의해 한번이상 임으로 치환되고, Ar은 2-,3- 또는 4-피리딜, 피리미딜, 피라질, 이미다졸릴, 모르폴리노, 4- 또는 5-티아졸릴, 트리아졸릴, 2-또는 3-티에닐, 2-티아펜 또는 페닐이고, R6및 R7은 독립적으로 수소이거나, 한개 이상의 할로겐에 의해 임의로 치환된 C1-4알킬이고, q는 0내지 2의 수이다.

IMIDAZOLIDINONE COMPOUNDSNovel imidazolidinone derivatives are described which inhibit the production of Tumor Necrosis Factor and are useful in the treatment of disease stated mediated or exacerbated by TNF production. The compounds of the present invention are also useful as inhibitors of PDE IV and are therefore useful in the treatment of disease states in need of mediation or inhibition thereof.A compound of the formula: wherein:Ri is - (CR9RlO)n- (C(0)0)r -(CR9Rιo)m-R8--(CR9Rl0)n-(C(O)NR6)r(CR9Rl0)m-R8, or - (CR9Rlθ)n- (0)s -(CR9Rl0)m-R8 wherein the alkyl moieties may be optionally substituted with one or more halogens; n is a number having a value of 0 to 4; m is a number having a value of 0 to 2; r is a number having a value of 0 or 1; s is a number having a value of 0 or 1;R9 and Rio are independently selected from hydrogen or a Cl-2 alkyl; Rg is hydrogen, methyl, hydroxyl, tetrahydrofuran, tetrahydropyran, tetrahydrothiophene, tetrahydrothiopyran, C3-6 cycloalkyl, or a C4-6 cycloalkyl containing one or two unsaturated bonds, wherein the cycloalkyl and heterocyclic moieties may be optionally substituted by 1 to 3 methyl groups or one ethyl group; provided that a) when r is 1, n is 1 to 4; or b) when s is 1, n is 2 to 4; or c) when Rg is hydroxyl, r is 1, and n is 1 to 4, then m is 2; or d) when Rg is hydroxyl, and r or s is 0, then the sum of n + m is 2 to 6; or e) when m is 0, r is 1 in -(CR9Riθ)n- (C(0)0)r -(CR9Riθ)m-R8- then n is 1 to 4; or f) when Rg is a 2-tetrahydropyran or 2-tetrahydrothiopyran, 2-tetrahydrofuran or2-tetrahydrothiophene, and r or s is 0, then the sum of n + m is 1 to 6; or g) when Rg is a 2-tetrahydropyran, 2-tetrahydrothiopyran, 2-tetrahydrofuran or 2-tetrahydrothiophene, n is 1 to 4, and r is 1, then m must be 1 to 2; or h) when Rg is a 2-tetrahydropyran, 2-tetrahydrothiopyran, 2-tetrahydrofuran or 2-tetrahydrothiophene, n is 2 to 4, and s is 1, then m must be 1 to 2; X is YR2, halogen, nitro, NR6R7, or formyl amine; Y is O or S(0)m'; m' is a number having a value of 0 to 2;HEET R2 is -CH3 or -CH2CH3 optionally substituted by 1 or more halogens; R3 is H, CH3, CN, CH2F, CHF2, or CF3; R4 is H, C1-C4 alkyl, OH, OCH3, OCH2CH3, or OAc; R5 is H, OH, -(CH2)qAr, or C . alkyl wherein the (CH2)qAr or Cι_6 alkyl group is optionally substituted one or more times by F, Br, Cl, -NO2, -NR R-j, -CO2R6- -OR6, -OC(0)R6, C(0)R6, CN, -C(0)-NR6R7, -C(S)-NR6R7, -NR6-C(0)-NR6R7, -NR6-C(S)-NR6R7- - NR6-C(0)-R6, - NR6-C(S)-R6, -NR6-C(0)-OR6, C(=NR6)-NR6R7, -C(=NCN)-NR6R7- -C(=NCN)-SR6, -NR6-C(=NCN)-SR6 , -NR6-C(=NCN)-NR6R7. -C(=NR6R7)SR6, -NR6-S(0)2-R6, -S(0)m--R6, -NR6SO2-CF3, - NR6C(0)-C(0)-NR6R7- -NR6-C(0)-C(0)-OR6, 1-imidazolyl, or l-(NR6)-2-imidazolyl ;Ar is 2-, 3- or 4-pyridyl, pyrimidyl, pyrazyl, imidazolyl, morpholino, 4- or 5- thiazolyl, triazolyl, 2- or 3- thienyl, 2-thiaphene, or phenyl;Rg and R7 are independently hydrogen, or Cι_4 alkyl optionally substituted by one or more halogens; q is a number having a value of 0 to 2; and the pharmaceutically acceptable salts thereof.

26129

기타 반도체 소자 제조업

특허

ko

en

다색 전자 소자 및 이를 인쇄에 의해 형성하는 방법작업물 상에 서브픽셀들의 행들의 규칙적인 어레이를 형성하는 방법이 제공된다. 서브픽셀들은 네 가지의 상이한 색상 및 서브픽셀 피치 s를 갖는다. 네 가지 색상 중에서, q개의 색상은 인쇄에 의해 형성되고 r개의 색상은 비인쇄 방법에 의해 형성된다. 본 방법은 (1) 노즐들 사이의 간격이 p인 상태로 일렬로 배열된 z개의 노즐을 갖고, 작업물에 대해서 제1 위치에 있는 인쇄 헤드를 제공하는 단계 - 여기서, z = 4n1이고 p = 3s임 - ; (2) q개의 인쇄 색상의 각각에 대해 하나씩, q개의 상이한 인쇄 잉크를 제공하는 단계; (3) 규칙적으로 교번하는 패턴으로 노즐에 각각의 인쇄 잉크를 공급하는 단계; (4) 인쇄 헤드를 이용하여 서브픽셀들의 z개의 행으로 된 제1 세트를 인쇄하는 단계; (5) (a) 작업물을 인쇄 헤드에 대해서 측방향으로 거리 d1만큼 이동시키는 단계 - 여기서, d1 = 4n2s임 - 와, (b) 인쇄 헤드를 이용하여 서브픽셀들의 z개의 행으로 된 세트를 인쇄하는 단계에 의한, 이동 및 제1 인쇄 패턴으로 인쇄하는 단계; (6) (c) 작업물을 인쇄 헤드에 대해서 측방향으로 거리 d2만큼 이동시키는 단계 - 여기서, d2 = d1임 - 와, (d) 인쇄 헤드를 이용하여 서브픽셀들의 z개의 행으로 된 세트를 인쇄하는 단계에 의한, 이동 및 제2 인쇄 패턴으로 인쇄하는 단계; (7) (e) 작업물을 인쇄 헤드에 대해서 측방향으로 거리 d3만큼 이동시키는 단계 - 여기서, d3 = 4n3s여서, d1 + d2 + d3 = pz가 되게 함 - 와, (f) 인쇄 헤드를 이용하여 서브픽셀들의 z개의 행으로 된 세트를 인쇄하는 단계에 의한, 이동 및 제3 인쇄 패턴으로 인쇄하는 단계; (8) 단계 (5) 내지 단계 (7)을 동일한 순서로 다수회 반복하는 단계; 및 (9) 비인쇄 방법에 의해 r개의 색상을 적용하는 단계를 포함하며, 여기서, n1은 0보다 큰 정수이고; n2는 3의 배수가 아니고 n2 ≤ n1이 되게 하는, 0보다 큰 정수이며; n3는 2n2+ n3= 3n1이 되게 하는 정수이고; q는 1 내지 4의 정수이며; r은 q + r = 4가 되게 하는 정수이다.네 가지의 상이한 색상 및 서브픽셀 피치 s를 갖는 서브픽셀(subpixel)들의 행(row)들의 규칙적인 어레이를 작업물 상에 형성하며, q개의 색상은 인쇄에 의해 형성되고 r개의 색상은 비인쇄 방법에 의해 형성되는, 방법으로서,(1) 노즐들 사이의 간격이 p인 상태로 일렬로 배열된 z개의 노즐을 갖고, 작업물에 대해서 제1 위치에 있는 인쇄 헤드를 제공하는 단계 - 여기서, z = 4n1이고 p = 3s임 - ;(2) q개의 인쇄 색상의 각각에 대해 하나씩, q개의 상이한 인쇄 잉크를 제공하는 단계;(3) 규칙적으로 교번하는 패턴으로 노즐에 각각의 인쇄 잉크를 공급하는 단계;(4) 인쇄 헤드를 이용하여 서브픽셀들의 z개의 행으로 된 제1 세트를 인쇄하는 단계;(5) (a) 작업물을 인쇄 헤드에 대해서 측방향으로 거리 d1만큼 이동시키는 단계 - 여기서, d1 = 4n2s임 - 와, (b) 인쇄 헤드를 이용하여 서브픽셀들의 z개의 행으로 된 세트를 인쇄하는 단계를 포함하는, 이동 및 제1 인쇄 패턴으로 인쇄하는 단계;(6) (c) 작업물을 인쇄 헤드에 대해서 측방향으로 거리 d2만큼 이동시키는 단계 - 여기서, d2 = d1임 - 와, (d) 인쇄 헤드를 이용하여 서브픽셀들의 z개의 행으로 된 세트를 인쇄하는 단계를 포함하는, 이동 및 제2 인쇄 패턴으로 인쇄하는 단계;(7) (e) 작업물을 인쇄 헤드에 대해서 측방향으로 거리 d3만큼 이동시키는 단계 - 여기서, d3 = 4n3s여서, d1 + d2 + d3= pz가 되게 함 - 와, (f) 인쇄 헤드를 이용하여 서브픽셀들의 z개의 행으로 된 세트를 인쇄하는 단계를 포함하는, 이동 및 제3 인쇄 패턴으로 인쇄하는 단계;(8) 단계 (5) 내지 단계 (7)을 동일한 순서로 다수회 반복하는 단계; 및(9) 비인쇄 방법에 의해 r개의 색상을 적용하는 단계를 포함하며,여기서,n1은 0보다 큰 정수이고;n2는 3의 배수가 아니고 n2 ≤ n1이 되게 하는, 0보다 큰 정수이며;n3는 2n2+ n3= 3n1이 되게 하는 정수이고;q는 1 내지 4의 정수이며;r은 q + r = 4가 되게 하는 정수이고;패턴들은 순서 (i) 제1 인쇄 패턴, 이어서 제2 인쇄 패턴, 이어서 제3 인쇄 패턴, 또는 순서 (ii) 제3 인쇄 패턴, 이어서 제1 인쇄 패턴, 이어서 제2 인쇄 패턴으로 수행되는 방법.

MULTICOLOR ELECTRONIC DEVICES AND PROCESSES OF FORMING THE SAME BY PRINTINGThere is provided a process of forming a regular array of rows of subpixels on a workpiece. The subpixels having four different colors, and a subpixel pitch s. Of the four colors, q colors are formed by printing and r colors are formed by a non-printing method. The process includes the steps: (1) providing a printing head having z nozzles arranged in a row with a spacing between the nozzles of p, where z = 4n1 and p = 3s, the printhead being at a first position relative to the workpiece; (2) providing q different printing inks, one for each of the q printed colors; (3) supplying each of the printing inks to the nozzles in a regular alternating pattern; (4) printing a first set of z rows of subpixels with the printing head; (5) moving and printing in a first printing pattern by: (a) moving the workpiece laterally relative to the printing head by a distance d1, where d1 = 4n2s; (b) printing a set of z rows of subpixels with the printing head; (6) moving and printing in a second printing pattern by: (c) moving the workpiece laterally relative to the printing head by a distance d2, where d2 = d1; (d) printing a set of z rows of subpixels with the printing head; (7) moving and printing in a third printing pattern by: (e) moving the workpiece laterally relative to the printing head by a distance d3, where d3 = 4n3s, such that d1 + d2 + d3 = pz; and (f) printing a set of z rows of subpixels with the printing head; (8) repeating steps (5) through (7) multiple times in the same order; and (9) applying r colors by a non-printing method; where: n1 is an integer greater than 0; n2 is an integer greater than 0, such that the integer is not a multiple of three and n2 ≤ n1; n3 is an integer such that 2n2 + n3 = 3n1; q is an integer from 1-4; and r is an integer, such that q + r = 4.A process of forming a regular array of rows of subpixels on a workpiece, the subpixels having four different colors, and having a subpixel pitch s, and wherein q colors are formed by printing and r colors are formed by a non-printing method, said process comprising:(1 ) providing a printing head having z nozzles arranged in a row with a spacing between the nozzles of p, where z = 4ni and p = 3s, the printhead being at a first position relative to the workpiece;(2) providing q different printing inks, one for each of the q printed colors;(3) supplying each of the printing inks to the nozzles in a regular alternating pattern; (4) printing a first set of z rows of subpixels with the printing head;(5) moving and printing in a first printing pattern comprising:(a) moving the workpiece laterally relative to the printing head by a distance di, where di = 4n2s;(b) printing a set of z rows of subpixels with the printing head; (6) moving and printing in a second printing pattern comprising:(c) moving the workpiece laterally relative to the printing head by a distance O2, where d2 = di;(d) printing a set of z rows of subpixels with the printing head;(7) moving and printing in a third printing pattern comprising: (e) moving the workpiece laterally relative to the printing head by a distance d3, where d3 = 4n3s, such that di + d2 + d3 = pz; and (f) printing a set of z rows of subpixels with the printing head;(8) repeating steps (5) through (7) multiple times in the same order; and(9) applying r colors by a non-printing method; where: ni is an integer greater than 0; n2 is an integer greater than 0, such that the integer is not a multiple of three and n2 ≤ ni; n3 is an integer such that 2n2 + n3 = 3ni; q is an integer from 1-4; and r is an integer, such that q + r = 4; and wherein the patterns are carried out in the order (i) first printing pattern, followed by second printing pattern, followed by third printing pattern, or (ii) third printing pattern, followed by first printing pattern, followed by second printing pattern.

20499

그 외 기타 분류 안된 화학제품 제조업

특허

ko

en

신규의 이원 화합물 및 그 약학적 용도, 그 제조방법 및이들을 포함하는 약제학적 조성물본 발명은 신규의 비만치료제, 고콜레스테롤증 치료에 유용한 화합물, 이들의 유도체, 이들의 유사체, 이들의 호변이체, 이들의 입체이성질체, 이들의 동질이상체, 이들의 약제학적으로 수용가능한 염, 이들의 약제학적으로 수용가능한 용매화합물에 관한 것이다. 보다 상세하게는 식 (I)의 β-아릴-α-옥시치환된 알킬카르복실산, 이들의 유도체, 이들의 유사체, 이들의 호변이체, 이들의 입체이성질체, 이들의 동질이상체, 이들의 약제학적으로 수용가능한 염, 이들의 약제학적으로 수용가능한 용매화합물에 관한 것이다. 하기 식(I)의 화합물, 이들의 유도체, 이들의 유사체, 이들의 호변이체, 이들의 입체이성질체, 이들의 동질이상체, 이들의 약제학적으로 수용가능한 염, 이들의 약제학적으로 수용가능한 용매화합물, 및 이들을 포함하는 약제학적 조성물: 상기 식에서, R1, R2, R3 , R4, 및 탄소원자에 부착되는 경우의 R6와 R5는 같거나 다르고, 수소, 할로겐, 히드록시, 니트로, 시아노, 포르밀, 또는 임의로 치환된 알킬, 시클로알킬, 알콕시, 시클로알콕시, 아릴, 아릴옥시, 아르알킬, 아르알콕시, 헤테로사이클일, 헤테로아릴, 헤테로아르알킬, 헤테로아릴옥시, 헤테로아르알콕시, 아실, 아실옥시, 히드록시알킬, 아미노, 아실아미노, 알킬아미노, 아릴아미노, 아르알킬아미노, 아미노알킬, 알콕시카르보닐, 아릴옥시카르보닐, 아르알콕시카르보닐, 알콕시알킬, 아릴옥시알킬, 아르알콕시알킬, 알킬티오, 티오알킬, 알콕시카르보닐아미노, 아릴옥시카르보닐아미노, 아르알콕시카르보닐아미노, 카르복실산 또는 그 유도체, 술폰산 또는 그 유도체이고; R6와 R5이 탄소에 부착되는 경우 그 중 하나 또는 둘이 옥소그룹을 나타낼 수 있고; R6와 R5이 질소에 부착되는 경우 수소, 히드록시, 포르밀, 또는 임의로 치환된 알킬, 시클로알킬, 알콕시, 시클로알콕시, 아릴, 아르알킬, 헤테로사이클일, 헤테로아릴, 헤테로아르알킬, 아실, 아실옥시, 히드록시알킬, 아미노, 아실아미노, 알킬아미노, 아릴아미노, 아르알킬아미노, 아미노알킬, 아릴옥시, 아르알콕시, 헤테로아릴옥시, 헤테로아르알콕시, 알콕시카르보닐, 아릴옥시카르보닐, 아르알콕시카르보닐, 알콕시알킬, 아릴옥시알킬, 아르알콕시알킬, 알킬티오, 티오알킬, 카르복실산 유도체, 술폰산 유도체이고; X는 산소, 황 또는 NR11으로부터 선택된 헤테로 원자를 나타내는데, 여기서 R11는 수소 또는 임의로 치환된 알킬, 아릴, 아르알킬, 아실, 알콕시카르보닐, 아릴옥시카르보닐, 아르알콕시카르보닐이며; Ar은 임의로 치환된 이가의 단일 또는 축합된 방향족 또는 헤테로사이클 그룹이고; R7는 수소, 히드록시, 알콕시, 할로겐, 저급 알킬, 임의로 치환된 아르알킬 또는 R7는 R8와 결합을 형성하며; R8는 수소, 히드록시, 알콕시, 할로겐, 저급 알킬, 아실, 임의로 치환된 아르알킬 또는 R8는 R7와 결합을 형성하며; R9는 수소 또는 임의로 치환된 알킬, 시클로알킬, 아릴, 아르알킬, 알콕시알킬, 알콕시카르보닐, 아릴옥시카르보닐, 알킬아미노카르보닐, 아릴아미노카르보닐, 아실, 헤테로사이클일, 헤테로아릴, 또는 헤테로아르알킬 그룹이고; R10는 수소, 알킬, 시클로알킬, 아릴, 아르알킬, 헤테로사이클일, 헤테로아릴, 또는 헤테로아르알킬 그룹이며; Y는 산소 또는 NR12인데, 여기서 R12는 수소, 알킬, 아릴, 히드록시알킬, 아르알킬, 헤테로사이클일, 헤테로아릴, 또는 헤테로아르알킬 그룹이고; R10와 R12는 함께 탄소를 포함하는 5원 또는 6원 고리 구조를 형성할 수 있고, 임의로 산소, 황 또는 질소로부터 선택된 헤테로 원자를 포함할 수 있으며; -(CH2)n-(O)m-으로 나타낸 연결기는 질소나 탄소에 부착될 수 있고; n은 1-4의 정수이고 m은 0 또는 1이다.

BICYCLIC COMPOUNDS, PROCESS FOR THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEMThe present invention relates to novel antiobesity and hypocholesterolemic compounds, their derivatives, their analogs, their tautomeric forms, their stereoisomers, their polymorphs, their pharmaceutically acceptable salts, their pharmaceutically acceptable solvates and pharmaceutically acceptable compositions containing them. More particularly, the present invention relates to novel β-aryl-α-oxysubstituted alkylcarboxylic acids of general formula (I), their derivatives, their analogs, their tautomeric forms, their stereoisomers, their polymorphs, their pharmaceutically acceptable salts, their pharmaceutically acceptable solvates and pharmaceutically acceptable compositions containing them.A compound of formula (I) its derivatives, its analogs, its tautomeric forms, its stereoisomers, its polymoφhs, its pharmaceutically acceptable salts, its pharmaceutically acceptable solvates, wherein the groups R1, R2, R3, R4, and the groups R5 and R6 when attached to a carbon atom, may be same or different and represent hydrogen, halogen, hydroxy, nitro, cyano, formyl or optionally substituted groups selected from alkyl, cycloalkyl, alkoxy, cycloalkoxy, aryl, aryloxy, aralkyl. aralkoxy, heterocyclyl, heteroaryl, heteroaralkyl, heteroaryloxy, heteroaralkoxy, acyl, acyloxy, hydroxyalkyl, amino, acylamino, alkylamino, arylamino, aralkylamino, aminoalkyl, alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl, alkoxyalkyl, aryloxyalkyl, aralkoxyalkyl, alkylthio, thioalkyl, alkoxycarbonylamino, aryloxycarbonylamino, aralkoxycarbonylamino, carboxylic acid or its derivatives, or sulfonic acid or its derivatives; one or both of R and R may represent an oxo group when attached to a carbon atom; R5 and R6 when attached to a nitrogen atom represents hydrogen, hydroxy, formyl or optionally substituted groups selected from alkyl, cycloalkyl, alkoxy, cycloalkoxy, aryl, aralkyl, heterocyclyl, heteroaryl, heteroaralkyl, acyl, acyloxy, hydroxyalkyl, amino, acylamino, alkylamino, arylamino, aralkylamino. aminoalkyl, aryloxy, aralkoxy, heteroaryloxy, heteroaralkoxy, alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl, alkoxyalkyl, aryloxyalkyl, aralkoxyalkyl, alkylthio, thioalkyl groups, carboxylic acid derivatives, or sulfonic acid derivatives; X represents a heteroatom selected from oxygen, sulfur or NR1 ' where R1 ' is selected from hydrogen, or optionally substituted alkyl, cycloalkyl, aryl, aralkyl, acyl, alkoxycarbonyl, aryloxycarbonyl, or aralkoxycarbonyl group; Ar represents an optionally substituted divalent single or fused aromatic or heterocyclic group; R7 represents hydrogen atom, hydroxy, alkoxy, halogen, lower alkyl, optionally substituted aralkyl group or forms a bond together with adjacent group R8; R8 represents hydrogen, hydroxy, alkoxy, halogen, lower alkyl group, acyl, or optionally substituted aralkyl or R8 forms a bond together with R7; R9 represents hydrogen, or optionally substituted groups selected from alkyl, cycloalkyl, aryl, aralkyl, alkoxyalkyl, alkoxycarbonyl, aryloxycarbonyl, alkylaminocarbonyl, arylaminocarbonyl, acyl, heterocyclyl, heteroaryl, or heteroaralkyl groups; R10 represents hydrogen or optionally substituted groups selected from alkyl, cycloalkyl, aryl, aralkyl, heterocyclyl, heteroaryl, or heteroaralkyl groups; Y represents oxygen or NR12, where R12 represents hydrogen, alkyl, aryl, hydroxyalkyl, aralkyl, heterocyclyl, heteroaryl, or heteroaralkyl groups; R10 and R12 together may form a 5 or 6 membered cyclic structure containing carbon atoms, which may optionally contain one or more heteroatoms selected from oxygen, sulfur or nitrogen; the linking group represented by -(CH2)n-(O)m- may be attached either through a nitrogen atom or a carbon atom; n is an integer ranging from 1-4 and m is an integer 0 or 1.

20119

석탄화학계 화합물 및 기타 기초 유기화학 물질 제조업

특허

ko

en

전자 소자용 물질본 출원은 화학식 (I) 또는 (II) 의 치환 벤즈안트라센 화합물에 관한 것이다. 본 출원은 또한 상기 벤즈안트라센 화합물을 포함하는 전자 소자에 관한 것이다.하기 화학식 (I) 또는 (II) 의 화합물:[이미지][식 중, 하기가 나타낸 기호에 적용됨:Ar1 은 6 내지 40 개의 방향족 고리 원자를 갖는 방향족 고리계 (이는 하나 이상의 라디칼 R2 에 의해 치환될 수 있음), 또는 5 내지 40 개의 방향족 고리 원자를 갖는 헤테로방향족 고리계 (이는 하나 이상의 라디칼 R2 에 의해 치환될 수 있음) 로부터 선택되고;R0 은 C(=O)R3, CN, Si(R3)3, P(=O)(R3)2, OR3, S(=O)R3, S(=O)2R3, 탄소수 1 내지 20 의 직쇄 알킬 또는 알콕시 기 또는 탄소수 3 내지 20 의 분지형 또는 시클릭 알킬 또는 알콕시 기 또는 탄소수 2 내지 20 의 알케닐 또는 알키닐 기 (여기서, 상기 언급된 기는 각각 하나 이상의 라디칼 R3 에 의해 치환될 수 있고, 상기 언급된 기에서 하나 이상의 CH2 기는 -R3C=CR3-, -C≡C-, Si(R3)2, C=O, C=NR3, -C(=O)O-, -C(=O)NR3-, NR3, P(=O)(R3), -O-, -S-, SO 또는 SO2 로 대체될 수 있음) 이고; 라디칼 R0 은 라디칼 R1 에 연결될 수 있고 고리를 형성할 수 있고;L 은 6 내지 40 개의 방향족 고리 원자를 갖는 방향족 고리계 (이는 하나 이상의 리다칼 R2 에 의해 치환될 수 있음), 또는 5 내지 40 개의 방향족 고리 원자를 갖는 헤테로방향족 고리계 (이는 하나 이상의 라디칼 R2 에 의해 치환될 수 있음) 로부터 선택되는 n-가 기이거나; L 은 화학 결합이고, 여기서 n 은 이때 2 이고;R1, R2 은 각 경우에 동일 또는 상이하게, H, D, F, C(=O)R3, CN, Si(R3)3, N(R3)2, P(=O)(R3)2, OR3, S(=O)R3, S(=O)2R3, 탄소수 1 내지 20 의 직쇄 알킬 또는 알콕시 기 또는 탄소수 3 내지 20 의 분지형 또는 시클릭 알킬 또는 알콕시 기 또는 탄소수 2 내지 20 의 알케닐 또는 알키닐 기 (여기서 상기 언급된 기는 각각 하나 이상의 라디칼 R3 에 의해 치환될 수 있고, 상기 언급된 기에서 하나 이상의 CH2 기는 -R3C=CR3-, -C≡C-, Si(R3)2, C=O, C=NR3, -C(=O)O-, -C(=O)NR3-, NR3, P(=O)(R3), -O-, -S-, SO 또는 SO2 로 대체될 수 있음), 또는 6 내지 40 개의 방향족 고리 원자를 갖는 방향족 고리계 (이는 하나 이상의 라디칼 R3 에 의해 치환될 수 있음), 또는 5 내지 40 개의 방향족 고리 원자를 갖는 헤테로방향족 고리계 (이는 하나 이상의 라디칼 R3 에 의해 치환될 수 있음) 이고; 둘 이상의 라디칼 R1 또는 R2 는 서로 연결될 수 있고 고리를 형성할 수 있고;R3 은 각 경우에 동일 또는 상이하게, H, D, F, C(=O)R4, CN, Si(R4)3, N(R4)2, P(=O)(R4)2, OR4, S(=O)R4, S(=O)2R4, 탄소수 1 내지 20 의 직쇄 알킬 또는 알콕시 기 또는 탄소수 3 내지 20 의 분지형 또는 시클릭 알킬 또는 알콕시 기 또는 탄소수 2 내지 20 의 알케닐 또는 알키닐 기 (여기서, 상기 언급된 기는 각각 하나 이상의 라디칼 R4 로 치환될 수 있고, 상기 언급된 기에서 하나 이상의 CH2 기는 -R4C=CR4-, -C≡C-, Si(R4)2, C=O, C=NR4, -C(=O)O-, -C(=O)NR4-, NR4, P(=O)(R4), -O-, -S-, SO 또는 SO2 로 대체될 수 있음), 또는 6 내지 40 개의 방향족 고리 원자를 갖는 방향족 고리계 (이는 하나 이상의 라디칼 R4 로 치환될 수 있음), 또는 5 내지 40 개의 방향족 고리 원자를 갖는 헤테로방향족 고리계 (이는 하나 이상의 라디칼 R4 에 의해 치환될 수 있음) 이고; 둘 이상의 라디칼 R3 은 서로 연결될 수 있고 고리를 형성할 수 있고;R4 는 각 경우에 동일 또는 상이하게, H, D, F, CN 또는 탄소수 1 내지 20 의 지방족, 방향족 또는 헤테로방향족 유기 라디칼 (여기서 또한 하나 이상의 H 원자는 D, F 또는 CN 로 대체될 수 있음) 이고; 둘 이상의 치환기 R4 는 서로 연결될 수 있고 고리를 형성할 수 있고;n 은 2, 3, 4, 5 또는 6 임];여기서 화학식 (I) 또는 (II) 의 화합물은 비치환으로 나타낸 위치 각각에 라디칼 R1 을 함유할 수 있고;하기 화합물은 배제됨:[이미지][이미지].

Materials for electronic devicesThe present invention relates to a substituted benzanthracene compound according to a formula (I) or (II). The application further relates to an electronic device containing said benzanthracene compound.Formula (i) or the compound of (ii),wherein following it is applicable to occurred symbol:ar1being selected from the aromatics ring system with 6～40 aromatic ring atom, described aromatics ring system can be by one or more group r2take generation, or there is the heteroaromatic ring system of 5～40 aromatic ring atom, described heteroaromatic ring system can be by one or more group r2take generation；r0for c (=o) r3、cn、si(r3)3, p (=o) (r3)2、or3, s (=o) r3, s (=o)2r3, there is 1～20 c atom the alkyl of straight chain or alkoxy base or there is side chain or ring-type alkyl or the alkoxy base of 3～20 c atoms or have 2 ～the alkenyl or alkynyl group of 20 c atoms, group the most mentioned above can be each by one or more group r3replace and the wherein one or more ch in group mentioned above2group can be by-r3c=cr3-、-c≡c-、si(r3)2, c=o, c= nr3,-c (=o) o-,-c (=o) nr3-、nr3, p (=o) (r3) ,-o-,-s-, so or so2replace；group r0may be connected to group r1and ring can be formed；l can be by one or more group r for being selected from2the substituted aromatics ring system with 6～40 aromatic ring atom or can be by one or multiple group r2the n valency group of the substituted heteroaromatic ring system with 5～40 aromatic ring atom；or l is chemical bond, wherein n is then equal to 2；r1、r2when occurring every time identical or differently for h, d, f, c (=o) r3, cn, si (r3)3, n (r3)2, p (=o) (r3)2, or3, s (=o) r3, s (=o)2r3, there is alkyl or the alkoxy base of the straight chain of 1～20 c atom or there are 3～20 c the side chain of atom or ring-type alkyl or alkoxy base or there is the alkenyl or alkynyl group of 2～20 c atoms, the most above the group mentioned can be each by one or more group r3replacement and the wherein one or more ch in group mentioned above2 group can be by-r3c=cr3-、-c≡c-、si(r3)2, c=o, c=nr3,-c (=o) o-,-c (=o) nr3-、nr3, p (=o) (r3) ,-o-,-s-, so or so2replacing, or have the aromatics ring system of 6～40 aromatic ring atom, described aromatics ring system can be by one individual or multiple group r3replacing, or have the heteroaromatic ring system of 5～40 aromatic ring atom, described heteroaromatic ring system can be by one or multiple group r3replace；two or more groups r1or r2can be connected to each other and ring can be formed；r3when occurring every time identical or differently for h, d, f, c (=o) r4, cn, si (r4)3, n (r4)2, p (=o) (r4)2, or4, s (=o) r4, s (=o)2r4, there is alkyl or the alkoxy base of the straight chain of 1～20 c atom or there are 3～20 c the side chain of atom or ring-type alkyl or alkoxy base or there is the alkenyl or alkynyl group of 2～20 c atoms, the most above the group mentioned can be each by one or more group r4replacement and the wherein one or more ch in group mentioned above2 group can be by-r4c=cr4-、-c≡c-、si(r4)2, c=o, c=nr4,-c (=o) o-,-c (=o) nr4-、nr4, p (=o) (r4) ,-o-,-s-, so or so2replacing, or have the aromatics ring system of 6～40 aromatic ring atom, described aromatics ring system can be by one individual or multiple group r4replacing, or have the heteroaromatic ring system of 5～40 aromatic ring atom, described heteroaromatic ring system can be by one or multiple group r4replace；two or more groups r3can be connected to each other and ring can be formed；r4when occurring every time identical or differently for h, d, f, cn or there is the aliphatic series of 1～20 c atom, aromatics or heteroaromatic organic group, wherein, one or more h atom also can be replaced by d, f or cn；two or more substituent r4can be connected to each other and ring can be formed；n is equal to 2,3,4,5 or 6；the compound of wherein said formula (i) or (ii) can contain group r at each in being designated as unsubstituted position1；andwherein get rid of following compounds:

21102

생물학적 제제 제조업

특허

ko

en

테트라하이드로티오피라노 피라졸 카나비노이드 모듈레이터본 발명은 일반식 (I)의 CB 모듈레이터 화합물 또는 이의 약제학적으로 허용가능한 형태, 및 CB 수용체 매개 증후군, 장애 또는 질환을 치료, 개선 또는 예방하는데 이를 사용하는 방법에 관한 것이다. (I)일반식 (I)의 화합물, 또는 이의 약제학적으로 허용가능한 염, 이성질체, 프로드러그, 대사산물 또는 다형체: [이미지] 상기식에서, 일반식 (I)의 위치 2-3과 위치 3a-7a 사이의 점선은 X1R1이 존재하는 경우에 각각 이중결합에 대한 위치를 나타내고; 일반식 (I)의 위치 3-3a와 위치 7a-1 사이의 점선은 X2R2가 존재하는 경우에 각각 이중결합에 대한 위치를 나타내며; 일반식 (I)의 위치 7과 X4R4 사이의 점선은 이중결합에 대한 위치를 나타내고; X는 황, 술폭소 또는 술포닐이며; X1은 존재하지 않거나, 저급 알킬렌이고; X2는 존재하지 않거나, 저급 알킬렌이며; X1R1과 X2R2 중 하나만 존재하고; X3는 존재하지 않거나, 저급 알킬렌 또는 저급 알킬리덴이며; 위치 7과 X4R4 사이의 점선이 존재하지 않는 경우에는, X4는 존재하지 않거나, 저급 알킬렌이고; 위치 7과 X4R4 사이의 점선이 존재하는 경우에는, X4는 존재하지 않으며; R1은 수소, 아릴, C3-C12 사이클로알킬 또는 헤테로사이클릴이고, 아릴, C3-C12 사이클로알킬 또는 헤테로사이클릴은 각각 하나 이상의 위치에서 할로겐, 저급 알킬, 하이드록시 또는 저급 알콕시로 임의로 치환되며; R2는 수소, 아릴, C3-C12 사이클로알킬 또는 헤테로사이클릴이고, 아릴, C3-C12 사이클로알킬 또는 헤테로사이클릴은 각각 하나 이상의 위치에서 할로겐, 저급 알킬, 하이드록시 또는 저급 알콕시로 임의로 치환되며; R3는 -C(O)-헤테로사이클릴 또는 -Z-N(R6)-Z1R7- (헤테로사이클릴이 하나 이상의 하이드록시, 할로겐, 아미노, 저급 알킬, 카복시, 알콕시카보닐, 저급 알콕시, 저급 알콕시-저급 알킬렌-, 하이드록시-알킬렌-, 아릴옥시 또는 아릴알콕시로 임의로 치환됨)이고; 위치 7과 X4R4 사이의 점선이 존재하지 않는 경우에는, R4는 수소, 하이드록시, 저급 알킬, 저급 알콕시, 할로겐, 아릴 (아릴이 하나 이상의 위치에서 하이드록시, 저급 알킬, 저급 알콕시 또는 할로겐으로 임의로 치환됨), 헤테로사이클릴 (헤테로사이클릴이 하나 이상의 위치에서 하이드록시, 저급 알킬, 저급 알콕시 또는 할로겐으로 임의로 치환됨) 또는 C3-C12 사이클로알킬 (C3-C12 사이클로알킬이 하나 이상의 위치에서 하이드록시, 저급 알킬, 저급 알콕시 또는 할로겐으로 임의로 치환됨)이며; 위치 7과 X4R4 사이의 점선이 존재하는 경우에는, R4는 CH-아릴 (아릴이 하나 이상의 위치에서 하이드록시, 저급 알킬, 저급 알콕시 또는 할로겐으로 임의로 치환됨) 또는 CH-헤테로사이클릴 (헤테로사이클릴이 하나 이상의 위치에서 하이드록시, 저급 알킬, 저급 알콕시 또는 할로겐으로 임의로 치환됨)이고; R6 및 R7은 각각 독립적으로 수소, 저급 알킬, -NR8N9, 아릴 (아릴이 하나 이상의 하이드록시, 할로겐, 저급 알킬, 카복시, 알콕시카보닐, 저급 알콕시, 하이드록시-알킬렌-, 아릴옥시 또는 아릴알콕시로 임의로 치환됨), C3-C12 사이클로알킬 (C3-C12 사이클로알킬이 하나 이상의 하이드록시, 할로겐, 아미노, 저급 알킬, 카복시, 알콕시카보닐, 저급 알콕시, 하이드록시-알킬렌-, 아릴옥시, 아릴알콕시 또는 저급 알킬렌으로 임의로 치환됨) 또는 헤테로사이클릴 (헤테로사이클릴이 하나 이상의 하이드록시, 할로겐, 아미노, 저급 알킬, 카복시, 알콕시카보닐, 저급 알콕시, 저급 알콕시-저급 알킬렌-, 하이드록시-알킬렌-, 아릴옥시 또는 아릴알콕시로 임의로 치환됨)이며; R8 및 R9는 각각 독립적으로 수소, 알킬, 헤테로사이클릴, C3-C12 사이클로알킬, 또는 아릴 (아릴이 하나 이상의 저급 알킬, 하이드록시, 알콕시, 할로겐, 헤테로사이클릴 또는 아릴-저급 알킬렌-으로 임의로 치환됨)이고; Z는 카보닐 또는 술포닐이며; Z1은 존재하지 않거나, 하나 이상의 위치에서 할로겐, 하이드록시, 저급 알콕시, 카복시 또는 저급 알콕시카보닐로 임의로 치환되는 저급 알킬렌이다.

Tetrahydrothiopyrano pyrazole cannabinoid modulatorsThe invention relates to a CB modulator compound of Formula (I) or a pharmaceutically acceptable form thereof and a method for use in treating, ameliorating or preventing a CB receptor mediated syndrome, disorder or disease.The chemical compound of a formula (i)whereindotted line in the formula (i) between 2-3 position and the 3a-7a position is represented separately when there being x 1r 1the position of shi shuanjian; dotted line in the formula (i) between 3-3a position and the 7a-1 position is represented separately when there being x 2r 2the position of shi shuanjian; 7 and x in the formula (i) 4r 4between the position of the two keys of dotted line representative; x is sulfur, sulfoxide group or sulfonyl;x 1do not exist, or low-grade alkylidene; x 2do not exist, or low-grade alkylidene; x wherein 1r 1and x 2r 2only there is one; x 3do not exist, or low-grade alkylidene or rudimentary alkylidene radical; as 7 and x 4r 4between dotted line when not existing, x then 4do not exist or low-grade alkylidene; as 7 and x 4r 4between dotted line when existing, x then 4do not exist; r 1be hydrogen, aryl, c 3-c 12cycloalkyl or heterocyclic radical, wherein each aryl, c 3-c 12cycloalkyl or heterocyclic radical are randomly replaced by halogen, low alkyl group, hydroxyl or lower alkoxy on one or more position; r 2be hydrogen, aryl, c 3-c 12cycloalkyl or heterocyclic radical, wherein each aryl, c 3-c 12cycloalkyl or heterocyclic radical are randomly replaced by halogen, low alkyl group, hydroxyl or lower alkoxy on one or more position; r 3be-c (o)-heterocyclic radical or-z-n (r 6)-z 1r 7(on the heterocyclic radical randomly by one or more hydroxyl, halogen, amino, low alkyl group, carboxyl, alkoxy carbonyl group, lower alkoxy, lower alkoxy-low-grade alkylidene-, hydroxyl-alkylidene-, aryloxy group or aralkoxy replace); as 7 and x 4r 4between dotted line when not existing, r then 4be hydrogen, hydroxyl, low alkyl group, lower alkoxy, halogen, aryl (aryl is randomly being replaced by hydroxyl, low alkyl group, lower alkoxy or halogen on one or more position), heterocyclic radical (heterocyclic radical is randomly replaced by hydroxyl, low alkyl group, lower alkoxy or halogen on one or more position) or c 3-c 12cycloalkyl (c 3-c 12cycloalkyl is randomly replaced by hydroxyl, low alkyl group, lower alkoxy or halogen on one or more position); as 7 and x 4r 4between dotted line when existing, r then 4be ch-aryl (aryl is randomly being replaced by hydroxyl, low alkyl group, lower alkoxy or halogen on one or more position) or ch-heterocyclic radical (heterocyclic radical is optional on one or more position to be replaced by hydroxyl, low alkyl group, lower alkoxy or halogen); r 6and r 7be individually separately hydrogen, low alkyl group ,-nr 8r 9, aryl (on the aryl randomly by one or more hydroxyl, halogen, low alkyl group, carboxyl, alkoxy carbonyl group, lower alkoxy, hydroxyl-alkylidene-, aryloxy group or aralkoxy replace), c 3-c 12cycloalkyl (c 3-c 12on the cycloalkyl randomly by one or more hydroxyl, halogen, amino, low alkyl group, carboxyl, alkoxy carbonyl group, lower alkoxy, hydroxyl-alkylidene-, aryloxy group, aralkoxy or low-grade alkylidene replace) or heterocyclic radical (on the heterocyclic radical randomly by one or more hydroxyl, halogen, amino, low alkyl group, carboxyl, alkoxy carbonyl group, lower alkoxy, lower alkoxy-low-grade alkylidene-, hydroxyl-alkylidene-, aryloxy group or aralkoxy replace); r 8and r 9be hydrogen, alkyl, heterocyclic radical, c separately individually 3-c 12cycloalkyl or aryl (on the aryl randomly by one or more low alkyl group, hydroxyl, alkoxyl, halogen, heterocyclic radical or aryl-low-grade alkylidene-replacement); z is carbonyl or sulfonyl;z 1do not exist, or the low-grade alkylidene that on one or more position, is randomly replaced by halogen, hydroxyl, lower alkoxy, carboxyl or lower alkoxycarbonyl; perhaps its pharmaceutically acceptable salt, isomer, prodrug, metabolite or polymorph.

29120

유압 기기 제조업

특허

ko

en

건설기계의 유압펌프제어장치건설 기계가 엔진에 의해 구동되도록 조정된 첫 번째와 두 번째 유압 펌프를 포함하는 건설 기계의 유압 펌프 제어 장치는 첫 번째와 두 번째 작동 밸브를 통해 첫 번째와 두 번째 유압 펌프에 유압적으로 연결되어 있다. 제어 구간은 1, 2차 유압 펌프와 1, 2차 유압 펌프에서 파생된 실제 흡수식 마력(HP01) 및 (HP02)에 대해 설정된 기준 허용 흡수식 마력을 기반으로 추가 마력 ΔHP1 및 ΔHP2를 계산한다. 또한 제어 구간은 엔진 회전수(N), 1차 및 2차 유압 펌프에서 배출되는 유압 오일 압력(P1) 및 (P2)과 추가 마력 ΔHP1 및 ΔHP2 및 허용 방출 용량(V1)을 기준으로 V1P 및 (V2P)를 계산한다. 관리부문에서는 대상방출능력 및 허용방출능력(V1P) 중 작은 것을 선정하고, 다른 대상방출능력 및 허용방출능력(V2P) 중 작은 것을 최소대상방출능력(V1) 및 (V2)으로 선정한다. 그 후 제어 구간은 첫 번째와 두 번째 유압 펌프의 스와시 플레이트 각도를 제어하여 최소 목표 방전 용량(V1)과 (V2)이 첫 번째와 두 번째 유압 펌프에 따라 올바르게 설정되도록 한다. 따라서 1차 및 2차 유압 펌프에서 도출되는 흡수 마력은 기준 허용 흡수 마력의 합이 일정하게 유지되는 동안 적절히 제어될 수 있다.건설 기계가 엔진에 의해 구동되도록 조정된 첫 번째와 두 번째 유압 펌프를 포함하는 건설 기계의 유압 펌프 제어 장치는 첫 번째와 두 번째 작동 밸브를 통해 첫 번째와 두 번째 유압 펌프에 유압적으로 연결되어 있다. 제어 구간은 1, 2차 유압 펌프와 1, 2차 유압 펌프에서 파생된 실제 흡수식 마력(HP01) 및 (HP02)에 대해 설정된 기준 허용 흡수식 마력을 기반으로 추가 마력 ΔHP1 및 ΔHP2를 계산한다. 또한 제어 구간은 엔진 회전수(N), 1차 및 2차 유압 펌프에서 배출되는 유압 오일 압력(P1) 및 (P2)과 추가 마력 ΔHP1 및 ΔHP2 및 허용 방출 용량(V1)을 기준으로 V1P 및 (V2P)를 계산한다. 관리부문에서는 대상방출능력 및 허용방출능력(V1P) 중 작은 것을 선정하고, 다른 대상방출능력 및 허용방출능력(V2P) 중 작은 것을 최소대상방출능력(V1) 및 (V2)으로 선정한다. 그 후 제어 구간은 첫 번째와 두 번째 유압 펌프의 스와시 플레이트 각도를 제어하여 최소 목표 방전 용량(V1)과 (V2)이 첫 번째와 두 번째 유압 펌프에 따라 올바르게 설정되도록 한다. 따라서 1차 및 2차 유압 펌프에서 도출되는 흡수 마력은 기준 허용 흡수 마력의 합이 일정하게 유지되는 동안 적절히 제어될 수 있다.건설 기계용 유압 펌프 제어 장치로서, 상기 건설 기계는 엔진에 의해 구동되도록 구성된 제1 및 제2 유압 펌프, 및 제1 및 제2 작동 밸브를 통해 상기 제1 및 제2 유압 펌프에 유압적으로 연결된 유압 액추에이터를 포함하고, 상기 장치는 ; 상기 엔진의 회전수(N)를 검출하는 엔진 회전수 검출 수단, 상기 제1 및 제2 유압 펌프로부터 토출되는 작동유의 압력(P1) 및 (P2)를 검출하는 압력 검출 수단, 기준을 미리 설정하는 마력 설정 수단 상기 제1 및 제2 유압 펌프에 대한 허용 흡수 마력, 상기 제1 및 제2 작동 밸브의 작동량에 상응하는 목표 토출량(V1L) 및 (V2L)을 명령하는 목표 토출량 명령 수단, 계산을 위한 흡수 마력 계산 수단 상기 제1 및 제2 유압펌프로부터 도출된 실흡수마력(HP01) 및 (HP02), 상기 기준 허용흡수마력 및 상기 실흡수마력에 기초하여 여분마력(ΔHP1) 및 (ΔHP2)를 계산하는 여분마력 계산수단 힘 (HP01) 및 (HP02), 상기 추가 마력 (ΔHP1) 및 (ΔHP2)는 상기 첫 번째에 의해 흡수되지 않고 d 제2 유압 펌프, 상기 엔진 회전수(N), 상기 토출 압력(P1) 및 (P2), 상기 추가 마력(ΔHP1) 및 (ΔHP2)에 기초하여 허용 가능한 토출 용량(V1P) 및 (V2P)를 계산하는 수단 및 상기 제1 및 제2 유압 펌프에 대한 상기 기준 허용 마력수, 상기 목표 토출 용량(V1L) 및 상기 허용 토출 용량(V1P) 중 작은 것과 상기 목표 토출 용량(V2L) 중 작은 것을 선택하는 수단, 및 상기 허용 토출 용량(V2P)을 최소 목표 토출 용량(V1) 및 (V2)로 하고, 상기 제1 및 제2 유압 펌프에서 토출되는 작동유의 용량이 되도록 상기 제1 및 제2 유압 펌프의 사판 각도를 제어하는 ​​사판 제어 수단 펌프는 상기 최소 목표 배출 용량 (V1) 및 (V2)와 일치하는 것을 특징으로 하는 건설기계의 유압펌프제어장치.

Apparatus for controlling hydraulic pumps for construction machineAn apparatus for controlling hydraulic pumps for a construction machine wherein the construction machine includes first and second hydraulic pumps adapted to be driven by an engine and hydraulic actuators hydraulically connected to the first and second hydraulic pumps via first and second actuating valves is disclosed. A controlling section calculates extra horse powers ΔHP1and ΔHP2based on reference allowable absorptive horse powers set relative to the first and second hydraulic pumps and actual absorptive horse powers (HP01) and (HP02) derived from the first and second hydraulic pumps. In addition, the controlling section calculates allowable discharge capacities (V1P) and (V2P) based on the number (N) of revolutions of the engines, pressures (P1) and (P2) of hydraulic oils discharged from the first and second hydraulic pumps, the extra horse powers ΔHP1and ΔHP2and allowable discharge capacities (V1P) and (V2P). Then, the controlling section selects a smaller one of a target discharge capacity and the allowable discharge capacity (V1P) and a smaller one of another target discharge capacity and the allowable discharge capacity (V2P) as minimum target discharge capacities (V1) and (V2). Thereafter, the controlling section controls swash plate angles of the first and second hydraulic pumps such that the minimum target discharge capacities (V1) and (V2) are correctly set corresponding to the first and second hydraulic pumps. Consequently, absorptive horse powers to be derived from the first and second hydraulic pumps can properly be controlled while a sum of the reference allowable absorptive horse powers is kept constant.An apparatus for controlling hydraulic pumps for a construction machines wherein said construction machine includes first and second hydraulic pumps adapted to be driven by an engine and hydraulic actuators hydraulically connected to said first and second hydraulic pumps via first and second actuating valves, wherein said apparatus comprises; engine revolution number detecting means for detecting the number (N) of revolutions of said engine,pressure detecting means for detecting pressures (P1) and (P2) of hydraulic oils discharged from said first and second hydraulic pumps,horse power setting means for presetting reference allowable absorptive horse powers relative to said first and second hydraulic pumps,target discharge capacity commanding means for commanding target discharge quantities (V1L) and (V2L) corresponding to quantities of actuations of said first and second actuating valves,absorptive horse power calculating means for calculating actual absorptive horse powers (HP01) and (HP02) derived from said first and second hydraulic pumps,extra horse power calculating means for calculating extra horse powers (ΔHP1) and (ΔHP2) based on said reference allowable absorptive horse powers and said actual absorptive horse powers (HP01) and (HP02), said extra horse powers (ΔHP1) and (ΔHP2) failing to be absorbed by said first and second hydraulic pumps,means for calculating allowable discharge capacities (V1P) and (V2P) based on said engine revolution number (N), said discharge pressure (P1) and (P2), said extra horse powers (ΔHP1) and (ΔHP2) and said reference allowable horse powers relative to said first and second hydraulic pumps,means for selecting a smaller one of said target discharge capacity (V1L) and said allowable discharge capacity (V1P) and a smaller one of said target discharge capacity (V2L) and said allowable discharge capacity (V2P) as minimum target discharge capacities (V1) and (V2), andswash plate controlling means for controlling swash plate angles of said first and second hydraulic pumps such that the capacities of hydraulic oils discharged from said first and second hydraulic pumps coincide with said minimum target discharge capacities (V1) and (V2).

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

도파민 Ｄ₃ 수용체의 조정에 반응하는 장애의 치료에적합한 트리아졸 화합물 본 발명은 화학식 I의 화합물 및 생리학적으로 허용되는 이의 산 부가염에 관한 것이다. 화학식 I 위의 화학식 I에서, n은 1 또는 2이고, Ar은 잔류 탄소원자에 R1 라디칼을 갖고 질소원자들 중의 하나에 R1a 라디칼을 갖는 C-결합 1,2,4-트리아졸이고, R1은 수소, C1-C6 알킬, C3-C6 사이클로알킬, C1-C4 알콕시메틸, 불소화 C1-C6 알킬, 불소화 C3-C6 사이클로알킬, 불소화 C1-C4 알콕시메틸, 또는 임의로 치환된 페닐 또는 5원 또는 6원 헤테로아릴이고, R1a는 수소 또는 C1-C4-알킬이고, R2는 C1-C6 알킬, C3-C6 사이클로알킬, 불소화 C1-C6 알킬 또는 불소화 C3-C6 사이클로알킬이다. 본 발명은 또한 화학식 I의 하나 이상의 트리아졸 화합물 및/또는 하나 이상의 생리학적으로 허용되는 이의 산 부가염을 포함하는 약제학적 조성물, 및 추가로 하나 이상의 화학식 I의 트리아졸 화합물 또는 생리학적으로 허용되는 이의 산 부가염을 도파민 D3 수용체 길항제 또는 도파민 D3 효능제에 유리하게 반응하는 장애의 치료를 요하는 환자에게 투여함을 포함하는, 도파민 D3 수용체 길항제 또는 도파민 D3 효능제에 유리하게 반응하는 장애를 치료하는 방법에 관한 것이다. 화학식 I의 트리아졸 화합물 및 생리학적으로 허용되는 이의 산 부가염. 화학식 I [이미지] 위의 화학식 I에서, n은 1 또는 2이고, Ar은 잔류 탄소원자에 R1 라디칼을 갖고 질소원자들 중의 하나에 R1a 라디칼을 갖는 C-결합 1,2,4-트리아졸 라디칼이고, R1은 수소, C1-C6 알킬, C3-C6 사이클로알킬, C1-C4 알콕시메틸, 불소화 C1-C6 알킬, 불소화 C3-C6 사이클로알킬, 불소화 C1-C4 알콕시메틸, 페닐 또는 5원 또는 6원 헤테로아릴[여기서, 페닐 및 헤테로아릴은 치환되지 않거나 독립적으로 각각 할로겐, C1-C6 알킬, C3-C6 사이클로알킬, C1-C4 알콕시-C1-C4-알킬, 불소화 C1-C4 알킬, CN, NO2, OR3, NR3R4, C(O)NR3R4, O-C(O)NR3R4, SO2NR3R4, COOR5, SR6, SOR6, SO2R6, O-C(O)R7, COR7 및 C3-C5 사이클로알킬메틸로부터 선택된 1, 2, 3 또는 4개의 Ra 라디칼에 의해 치환될 수 있고, 또한 환 구성원으로서의 1개의 질소원자와 각각 독립적으로 O, S 및 N으로부터 선택된 0, 1, 2 또는 3개의 추가의 헤테로원자를 포함하는 페닐 그룹 또는 방향족 5원 또는 6원 C-결합 헤테로방향족 라디칼을 가질 수 있고, 언급한 마지막 2개의 라디칼은 1, 2, 3 또는 4개의 위에서 언급한 Ra 라디칼을 가질 수 있다]이고, R1a는 수소 또는 C1-C4 알킬이고, R2는 C1-C6 알킬, C3-C6 사이클로알킬, 불소화 C1-C6 알킬 또는 불소화 C3-C6 사이클로알킬이고, R3, R4, R5, R6 및 R7은 각각 독립적으로 H; OH, C1-C4 알콕시 또는 페닐로 임의로 치환된 C1-C6 알킬; C1-C6 알킬, C1-C6 알콕시, NR3aR4a, CN, C1-C2 플루오로알킬 및 할로겐으로 이루어진 그룹으로부터 선택된 1, 2 또는 3개의 라디칼을 가질 수 있는 C1-C4 할로알킬 또는 페닐이고, R3a 및 R4a는 각각 독립적으로 H; OH, C1-C4 알콕시 또는 페닐로 임의로 치환된 C1-C6 알킬; C1-C6 알킬, C1-C6 알콕시, 아미노, NH(C1-C4 알킬) 및 N(C1-C4 알킬)2로 이루어진 그룹으로부터 선택된 1, 2 또는 3개의 라디칼을 가질 수 있는 C1-C4 할로알킬 또는 페닐이고, R4는 또한 COR8 라디칼[여기서, R8은 수소; C1-C6 알킬, C1-C6 알콕시, NR3R4, CN, C1-C2 플루오로알킬 및 할로겐으로 이루어진 그룹으로부터 선택된 1, 2 또는 3개의 라디칼을 가질 수 있는 C1-C6 알킬, C1-C6 알콕시 또는 페닐이다]일 수 있고, R3과 R4는, 이들이 결합한 질소원자와 함께, 환 구성원으로서 산소원자 또는 추가의 질소원자를 포함할 수 있고 1, 2, 3 또는 4개의 C1-C6 알킬 그룹을 가질 수 있는 N-결합 5원 또는 6원 포화 헤테로사이클을 형성할 수 있다.

Triazole compounds suitable for treating disorders that respond to modulaiont of the dopamine d3 receptorThe invention relates to compounds of formula (I), wherein n is 1 or 2, Ar is a C-bound 1,2,4-triazol radical which carries a radical R on the remaining carbon atom and a radical R on one of the nitrogen atoms; R is hydrogen, C1-C6 alkyl, C3-C6 cycloalkyl, C1-C4 alkoxymethyl, fluorinated C1-C6 alkyl, fluorinated C3-C6 cycloalkyl, fluorinated C1-C4 alkoxymethyl, or optionally substituted phenyl or 5- or 6-membered heteroaryl; R is hydrogen or C1-C4 alkyl; and R is C1-C6 alkyl, C3-C6 cycloalkyl, fluorinated C1-C6 alkyl or fluorinated C3-C6 cycloalkyl; and to the physiologically tolerated acid addition salts of there compounds. The invention also relates to a pharmaceuticaly composition that comprises at least one triazole compound of the formula (I) and/or at least one physiologically tolerated acid addition salt thereof, and further to a method for treating disorders that respond beneficially to dopamine D3 receptor antagonists or dopamine D3 agonists, said method comprising administering an effective amount of at least one traizole compound or physiologically tolerated acid addition salt of the formula (I) to a subject in need thereof.Have the acid-addition salts that can tolerate on the triazole compounds of following formula i and the physiology thereof,whereinn is 1 or 2;ar is 1,2 of c connection, the 4-triazolyl, and on remaining carbon atom, have radicals r 1, have radicals r on a nitrogen-atoms therein 1ar 1be hydrogen, c 1-c 6alkyl, c 3-c 6cycloalkyl, c 1-c 4alkoxy methyl, fluoro c 1-c 6alkyl, fluoro c 3-c 6cycloalkyl, fluoro c 1-c 4alkoxy methyl, phenyl or 5 yuan or 6 yuan of heteroaryls, wherein phenyl and heteroaryl can not be substituted or be selected from following r independently of one another by 1,2,3 or 4 areplace: halogen, c 1-c 6alkyl, c 3-c 6cycloalkyl, c 1-c 4alkoxy-c 1-c 4-alkyl, fluoro c 1-c 4alkyl, cn, no 2, or 3, nr 3r 4, c (o) nr 3r 4, o-c (o) nr 3r 4, so 2nr 3r 4, coor 5, sr 6, sor 6, so 2r 6, o-c (o) r 7, cor 7or c 3-c 5methyl cycloalkyl, wherein phenyl can also have phenyl or 5 yuan or 6 yuan heteroaromatic group that c is connected of aromatics with heteroaryl, described heteroaromatic group comprises 1 as the nitrogen-atoms of annular atoms and 0,1,2 or 3 other hetero atom that is selected from o, s and n independently of one another, and wherein last 2 groups of mentioning can have 1,2,3 or 4 above-mentioned radicals r ar 1abe hydrogen or c 1-c 4-alkyl; r 2be c 1-c 6alkyl, c 3-c 6cycloalkyl, fluoro c 1-c 6alkyl or fluoro c 3-c 6cycloalkyl; r 3, r 4, r 5, r 6and r 7be h independently of one another, optional by oh, c 1-c 4the c that alkoxyl or phenyl replace 1-c 6alkyl, c 1-c 4haloalkyl or phenyl, it can have 1,2 or 3 and be selected from following group: c 1-c 6alkyl, c 1-c 6alkoxyl, nr 3ar 4a, cn, c 1-c 2fluoroalkyl and halogen, wherein r 3aand r 4abe h independently of one another, optional by oh, c 1-c 4the c that alkoxyl or phenyl replace 1-c 6alkyl, c 1-c 4haloalkyl or phenyl, it can have 1,2 or 3 and be selected from following group: c 1-c 6alkyl, c 1-c 6alkoxyl, amino, nh (c 1-c 4alkyl) and n (c 1-c 4alkyl) 2, r 4also can be group cor 8, r wherein 8be hydrogen, c 1-c 6alkyl, c 1-c 6alkoxyl or phenyl, it can have 1,2 or 3 and be selected from following group: c 1-c 6alkyl, c 1-c 6alkoxyl, nr 3r 4, cn, c 1-c 2fluoroalkyl and halogen, r 3and r 4can form 5 yuan or 6 yuan of saturated heterocyclics that n connects with the nitrogen-atoms that they connected, this heterocycle can comprise 1 oxygen atom or other 1 nitrogen-atoms as annular atoms, and can have 1,2,3 or 4 c 1-c 6alkyl.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

B형 간염 바이러스 (HBV)에 대해 활성인 6,7-디히드로-4H-피라졸로[1,5-A]피라진 인돌-2-카르복스아미드본 발명은 일반적으로 항바이러스제에 관한 것이다. 특히, 본 발명은 B형 간염 바이러스 (HBV)에 의해 코딩된 단백질(들)을 억제하거나 HBV 복제 주기의 기능을 방해할 수 있는 화학식 I의 화합물, 이러한 화합물을 포함하는 조성물, HBV 바이러스 복제를 억제하는 방법, HBV 감염을 치료 또는 예방하는 방법, 및 상기 화합물을 제조하는 방법 및 중간체에 관한 것이다.[이미지]화학식 I의 화합물 또는 그의 제약상 허용되는 염, 또는 화학식 I의 화합물 또는 그의 제약상 허용되는 염의 용매화물 또는 수화물, 또는 화학식 I의 화합물 또는 그의 제약상 허용되는 염 또는 용매화물 또는 수화물의 전구약물:[이미지]여기서- R1, R2, R3 및 R4는 각각의 위치에 대하여 H, CF2H, CF3, CF2CH3, F, Cl, Br, CH3, Et, i-Pr, c-Pr, D, CH2OH, CH(CH3)OH, CH2F, CH(F)CH3, I, C=C, C≡C, C≡N, C(CH3)2OH, SCH3, OH, 및 OCH3을 포함하는 군으로부터 독립적으로 선택되고,- R5는 H 또는 메틸이고,- R6은 H, D, SO2-C1-C6-알킬, SO2-C3-C7-시클로알킬, SO2-C3-C7-헤테로시클로알킬, SO2-C2-C6-히드록시알킬, SO2-C2-C6-알킬-O-C1-C6-알킬, SO2-C1-C4-카르복시알킬, SO2-아릴, SO2-헤테로아릴, SO2-N(R12)(R13), C(=O)R8, C(=O)N(R12)(R13), C(=O)C(=O)N(R12)(R13), C1-C6-알킬, C3-C6-시클로알킬, C1-C4-카르복시알킬, C1-C4-아실술폰아미도-알킬, C1-C4-카르복스아미도알킬, C3-C7-헤테로시클로알킬, C2-C6-아미노알킬, C1-C6-알킬-O-C1-C6-알킬, C2-C6-히드록시알킬, 및 아실을 포함하는 군으로부터 선택되고, 이는 OH, 할로, NH2, 아실, SO2CH3, SO3H, 카르복시, 카르복실 에스테르, 카르바모일, 치환된 카르바모일, C6-아릴, 헤테로아릴, C1-C6-알킬, C3-C7-시클로알킬, C3-C7-헤테로시클로알킬, C1-C6-할로알킬, C1-C6-알콕시, C1-C6-알킬-O-C1-C6-알킬, C1-C6-히드록시알킬, 및 C2-C6 알케닐옥시로부터 각각 독립적으로 선택된 1, 2, 또는 3개의 기로 임의로 치환되고, 여기서 C3-C7-헤테로시클로알킬은 C1-C6-알킬 또는 C1-C6-알콕시로부터 각각 독립적으로 선택된 1, 2, 또는 3개의 기로 임의로 치환되고,- R8은 C1-C6-알킬, C1-C6-히드록시알킬, C1-C6-알킬-O-C1-C6-알킬, C3-C7-시클로알킬, C1-C4-카르복시알킬, C3-C7-헤테로시클로알킬, C6-아릴, 및 헤테로아릴을 포함하는 군으로부터 선택되고, 이는 OH, 할로, NH2, 아실, SO2CH3, SO3H, 카르복시, 카르복실 에스테르, 카르바모일, 치환된 카르바모일, C6-아릴, 헤테로아릴, C1-C6-알킬, C3-C6-시클로알킬, C3-C7-헤테로시클로알킬, C1-C6-할로알킬, C1-C6-알콕시, C1-C6-히드록시알킬, 및 C2-C6-알케닐옥시로부터 각각 독립적으로 선택된 1, 2, 또는 3개의 기로 임의로 치환되고,- R12 및 R13은 H, C1-C6-알킬, C3-C7-시클로알킬, C1-C4-카르복시알킬, C3-C7-헤테로시클로알킬, C6-아릴, 및 헤테로아릴을 포함하는 군으로부터 독립적으로 선택되고, 이는 OH, 할로, NH2, 아실, SO2CH3, SO3H, 카르복시, 카르복실 에스테르, 카르바모일, 치환된 카르바모일, C6-아릴, 헤테로아릴, C1-C6-알킬, C3-C6-시클로알킬, C3-C7-헤테로시클로알킬, C1-C6-할로알킬, C1-C6-알콕시, C1-C6-히드록시알킬, 및 C2-C6 알케닐옥시로부터 각각 독립적으로 선택된 1, 2, 또는 3개의 기로 임의로 치환되고,- R12 및 R13은 임의로 연결되어 C3-C7 시클로알킬 고리, 또는 1 또는 2개의 질소, 황 또는 산소 원자를 함유하는 C4-C7-헤테로시클로알킬 고리를 형성한다.

6, 7-dihydro-4H-pyrazolo [1,5-a ] pyrazindole-2-carboxamide active agents against hepatitis b virus HBVThe present invention relates generally to novel antiviral agents. In particular, the present invention relates to compounds of formula I that can inhibit proteins encoded by Hepatitis B Virus (HBV) or interfere with the function of the HBV replication cycle, compositions comprising such compounds, methods of inhibiting HBV viral replication, methods of treating or preventing HBV infection, and methods and intermediates for making the compounds.A compound of the formula i, wherein,wherein-r1, r2, r3 and r4 are independently selected for each position from h, cf2h、cf3、cf2ch3、f、cl、br、ch3、et、i-pr、c-pr、d、ch2oh、ch(ch3)oh、ch2f、ch(f)ch3、i、c＝c、c≡c、c≡n、c(ch3)2oh、sch3oh and och3；-r5 is h or methyl;-r6 is selected from h, d, so2-c1-c6-alkyl, so2-c3-c7-cycloalkyl, so2-c3-c7-heterocycloalkyl, so2-c2-c6-hydroxyalkyl, so2-c2-c6-alkyl-o-c1-c6-alkyl, so2-c1-c4-carboxyalkyl, so2aryl, so2heteroaryl, so2-n (r12) (r13), c (═ o) r8, c (═ o) n (r12) (r13), c (═ o) n (r12) (r13), c1-c6-alkyl, c3-c6-cycloalkyl, c1-c4-carboxyalkyl, c1-c4-acylsulfonamide-alkyl, c1-c4-carboxamidoalkyl, c3-c7-heterocycloalkyl, c2-c6-aminoalkyl, c1-c6-alkyl-o-c1-c6-alkyl, c2-c6-hydroxyalkyl and acyl, each of which is optionally independently selected from oh, halogen, nh2acyl, so2ch3、so3h. carboxy, carboxylate, carbamoyl, substituted carbamoyl, c6-aryl, heteroaryl, c1-c6-alkyl, c3-c7-cycloalkyl, c3-c7-heterocycloalkyl, c1-c6-haloalkyl,c1-c6-alkoxy, c1-c6-alkyl-o-c1-c6-alkyl, c1-c6-hydroxyalkyl, and c2-c6 alkenyloxy, wherein c3-c7-heterocycloalkyl is optionally substituted with 1,2, or 3 groups each independently selected from c1-c6-alkyl or c1-c6-alkoxy;-r8 is selected from the group consisting of c1-c6-alkyl, c1-c6-hydroxyalkyl, c1-c6-alkyl-o-c1-c6-alkyl, c3-c7-cycloalkyl, c1-c4-carboxyalkyl, c3-c7-heterocycloalkyl, c6-aryl and heteroaryl, optionally each independently selected from the group consisting of oh, halogen, nh2acyl, so2ch3、so3h. carboxy, carboxylate, carbamoyl, substituted carbamoyl, c6-aryl, heteroaryl, c1-c6-alkyl, c3-c6-cycloalkyl, c3-c7-heterocycloalkyl, c1-c6-haloalkyl, c1-c6-alkoxy, c1-c6-hydroxyalkyl and c2-c6-alkenyloxy are substituted by 1,2 or 3 groups;-r12 and r13 are independently selected from h, c1-c6-alkyl, c3-c7-cycloalkyl, c1-c4-carboxyalkyl, c3-c7-heterocycloalkyl, c6-aryl and heteroaryl, optionally each independently selected from oh, halogen, nh2acyl, so2ch3、so3h. carboxy, carboxylate, carbamoyl, substituted carbamoyl, c6-aryl, heteroaryl, c1-c6-alkyl, c3-c6-cycloalkyl, c3-c7-heterocycloalkyl, c1-c6-haloalkyl, c1-c6-alkoxy, c1-c6-hydroxyalkyl and c2-c6 alkenyloxy are substituted with 1,2 or 3 groups;-r12 and r13 are optionally linked to form a c3-c7 cycloalkyl ring or a c4-c7-heterocycloalkyl ring containing 1 or 2 nitrogen, sulfur or oxygen atoms;or a pharmaceutically acceptable salt thereof, or a solvate or hydrate of a compound of formula i or a pharmaceutically acceptable salt thereof, or a prodrug of a compound of formula i or a pharmaceutically acceptable salt or solvate or hydrate thereof.

21102

생물학적 제제 제조업

특허

ko

en

항-CD38 항체, 이의 항원 결합 단편, 및 제약 용도본 출원은 항-CD38 항체, 이의 항원 결합 단편, 및 제약 용도를 제공한다. 구체적으로, 본 출원은 항-CD38 항체의 CDR 영역을 포함하는 뮤린 유래 항체, 키메라 항체 또는 인간화 항체, 항-CD38 항체 또는 이의 항원 결합 단편을 포함하는 제약 조성물, 및 약물로서 이의 적용을 제공한다. 특히, 본 출원은 CD38 양성 질환 또는 장애를 치료하기 위한 약물을 제조하는 데 있어서 인간화 항-CD38 항체의 적용을 제공한다.항-CD38 항체 또는 이의 항원 결합 단편으로서, 항-CD38 항체 또는 항원 결합 단편은 인간 CD38에 특이적으로 결합하고, 항체 또는 이의 항원 결합 단편은 다음을 포함하는 것인, 항-CD38 항체 또는 이의 항원 결합 단편:(i) 중쇄 HCDR1로서, 이의 아미노산 서열은 서열번호 9에 제시된 바와 같거나, 또는 서열번호 9와 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR1, 중쇄 HCDR2로서, 이의 아미노산 서열은 서열번호 10에 제시된 바와 같거나, 또는 서열번호 10과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR2,중쇄 HCDR3으로서, 이의 아미노산 서열은 서열번호 11에 제시된 바와 같거나, 또는 서열번호 11과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR3,경쇄 LCDR1로서, 이의 아미노산 서열은 서열번호 12에 제시된 바와 같거나, 또는 서열번호 12와 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR1,경쇄 LCDR2로서, 이의 아미노산 서열은 서열번호 13에 제시된 바와 같거나, 또는 서열번호 13과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR2, 및 경쇄 LCDR3으로서, 이의 아미노산 서열은 서열번호 14에 제시된 바와 같거나, 또는 서열번호 14와 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR3; 또는(ii) 중쇄 HCDR1로서, 이의 아미노산 서열은 서열번호 15에 제시된 바와 같거나, 또는 서열번호 15와 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR1,중쇄 HCDR2로서, 이의 아미노산 서열은 서열번호 16에 제시된 바와 같거나, 또는 서열번호 16과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR2,중쇄 HCDR3으로서, 이의 아미노산 서열은 서열번호 17에 제시된 바와 같거나, 또는 서열번호 17과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR3,경쇄 LCDR1로서, 이의 아미노산 서열은 서열번호 18에 제시된 바와 같거나, 또는 서열번호 18과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR1,경쇄 LCDR2로서, 이의 아미노산 서열은 서열번호 19에 제시된 바와 같거나, 또는 서열번호 19와 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR2, 및 경쇄 LCDR3으로서, 이의 아미노산 서열은 서열번호 20에 제시된 바와 같거나, 또는 서열번호 20과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR3; 또는(iii) 중쇄 HCDR1로서, 이의 아미노산 서열은 서열번호 15에 제시된 바와 같거나, 또는 서열번호 15와 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR1, 중쇄 HCDR2로서, 이의 아미노산 서열은 서열번호 21에 제시된 바와 같거나, 또는 서열번호 21과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR2, 중쇄 HCDR3으로서, 이의 아미노산 서열은 서열번호 17에 제시된 바와 같거나, 또는 서열번호 17과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 중쇄 HCDR3, 경쇄 LCDR1로서, 이의 아미노산 서열은 서열번호 22에 제시된 바와 같거나, 또는 서열번호 22와 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR1,경쇄 LCDR2로서, 이의 아미노산 서열은 서열번호 19에 제시된 바와 같거나, 또는 서열번호 19와 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR2, 및 경쇄 LCDR3으로서, 이의 아미노산 서열은 서열번호 23에 제시된 바와 같거나, 또는 서열번호 23과 비교할 때 3, 2 또는 1개의 아미노산 차이가 있는 것인, 경쇄 LCDR3.

ANTI-CD38 ANTIBODY, ANTIGEN-BINDING FRAGMENT THEREOF, AND PHARMACEUTICAL USEThe present application provides an anti-CD38 antibody, an antigen-binding fragment thereof, and pharmaceutical use. Specifically, the present application provides a murine-derived antibody, a chimeric antibody or a humanized antibody comprising a CDR region of the anti-CD38 antibdoy, a pharmaceutical composition comprising the anti-CD38 antibody or the antigen-binding fragment thereof, and an application thereof as a drug. In particular, the present application provides an application of a humanized anti-CD38 antibody in preparing a drug for treating a CD38 positive disease or disorder.An anti-CD3 8 antibody or an antigen-binding fragment thereof, wherein the anti-CD38 antibody or the antigen-binding fragment specifically binds to human CD38, the antibody or the antigen-binding fragment thereof comprising: (i) a heavy chain HCDR1, the amino acid sequence thereof is as shown in SEQ ID No: 9 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 9, a heavy chain HCDR2, the amino acid sequence thereof is as shown in SEQ ID No: 10 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 10, a heavy chain HCDR3, the amino acid sequence thereof is as shown in SEQ ID No: 11 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 11, a light chain LCDR1, the amino acid sequence thereof is as shown in SEQ ID No: 12 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 12, a light chain LCDR2, the amino acid sequence thereof is as shown in SEQ ID No: 13 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 13, and a light chain LCDR3, the amino acid sequence thereof is as shown in SEQ ID No: 14 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 14; or (ii) a heavy chain HCDR1, the amino acid sequence thereof is as shown in SEQ ID No: 15 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 15, a heavy chain HCDR2, the amino acid sequence thereof is as shown in SEQ ID No: 16 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 16, a heavy chain HCDR3, the amino acid sequence thereof is as shown in SEQ ID No: 17 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 17, a light chain LCDR1, the amino acid sequence thereof is as shown in SEQ ID No: 18 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 18, a light chain LCDR2, the amino acid sequence thereof is as shown in SEQ ID No: 19 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 19, and a light chain LCDR3, the amino acid sequence thereof is as shown in SEQ ID No: 20 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 20; or (iii) a heavy chain HCDR1, the amino acid sequence thereof is as shown in SEQ ID No: 15 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 15, a heavy chain HCDR2, the amino acid sequence thereof is as shown in SEQ ID No: 21 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 21, a heavy chain HCDR3, the amino acid sequence thereof is as shown in SEQ ID No: 17 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 17, a light chain LCDR1, the amino acid sequence thereof is as shown in SEQ ID No: 22 orhas 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 22, a light chain LCDR2, the amino acid sequence thereof is as shown in SEQ ID No: 19 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 19, and a light chain LCDR3, the amino acid sequence thereof is as shown in SEQ ID No: 23 or has 3, 2 or 1 amino acid(s) difference(s) when compared with SEQ ID No: 23.

20119

석탄화학계 화합물 및 기타 기초 유기화학 물질 제조업

특허

ko

en

B형 간염 바이러스 (HBV)에 대해 활성인 신규 우레아 6,7-디히드로-4H-피라졸로[1,5-A]피라진본 발명은 일반적으로 신규 항바이러스제에 관한 것이다. 특히, 본 발명은 B형 간염 바이러스 (HBV)에 의해 코딩된 단백질(들)을 억제하거나 HBV 복제 주기의 기능을 방해할 수 있는 화합물, 이러한 화합물을 포함하는 조성물, HBV 바이러스 복제를 억제하는 방법, HBV 감염을 치료 또는 예방하는 방법, 및 상기 화합물을 제조하는 방법 및 중간체에 관한 것이다.화학식 I의 화합물 또는 그의 제약상 허용되는 염, 또는 화학식 I의 화합물 또는 그의 제약상 허용되는 염의 용매화물 또는 수화물, 또는 화학식 I의 화합물 또는 그의 제약상 허용되는 염 또는 용매화물 또는 수화물의 전구약물:[이미지]여기서- R1은 페닐 또는 피리딜이며, 이는 H, CF2H, CF3, CF2CH3, F, Cl, Br, CH3, Et, i-Pr, c-Pr, D, CH2OH, CH(CH3)OH, CH2F, CH(F)CH3, I, C=C, C≡C, C≡N, C(CH3)2OH, SCH3, OH 또는 OCH3으로 1, 2 또는 3회 임의로 치환되고,- R2는 H 또는 메틸이고,- R3은 H, D, SO2-C1-C6-알킬, SO2-C3-C7-시클로알킬, SO2-C3-C7-헤테로시클로알킬, SO2-C2-C6-히드록시알킬, SO2-C2-C6-알킬-O-C1-C6-알킬, SO2-C1-C4-카르복시알킬, SO2-아릴, SO2-헤테로아릴, SO2-N(R12)(R13), C(=O)R5, C(=O)N(R12)(R13), C(=O)C(=O)N(R12)(R13), C1-C6-알킬, C3-C6-시클로알킬, C1-C6-알킬-O-C1-C6-알킬, C1-C4-카르복시알킬, C1-C4-아실술폰아미도-알킬, C1-C4-카르복스아미도알킬, C3-C7-헤테로시클로알킬, C2-C6-아미노알킬, C2-C6-히드록시알킬 및 아실을 포함하는 군으로부터 선택되며, 이는 OH, 할로, NH2, 아실, SO2CH3, SO3H, 카르복시, 카르복실 에스테르, 카르바모일, 치환된 카르바모일, C6-아릴, 헤테로아릴, C1-C6-알킬, C3-C7-시클로알킬, C1-C6-알킬-O-C1-C6-알킬, C3-C7-헤테로시클로알킬, C1-C6-할로알킬, C1-C6-알콕시, C1-C6-히드록시알킬 및 C2-C6 알케닐옥시로부터 각각 독립적으로 선택된 1, 2 또는 3개의 기로 임의로 치환되고, 여기서 C3-C7-헤테로시클로알킬은 C1-C6-알킬 또는 C1-C6-알콕시로부터 각각 독립적으로 선택된 1, 2 또는 3개의 기로 임의로 치환되고,- R5는 C1-C6-알킬, C1-C6-히드록시알킬, C1-C6-알킬-O-C1-C6-알킬, C3-C7-시클로알킬, C1-C4-카르복시알킬, C3-C7-헤테로시클로알킬, C6-아릴 및 헤테로아릴을 포함하는 군으로부터 선택되며, 이는 OH, 할로, NH2, 아실, SO2CH3, SO3H, 카르복시, 카르복실 에스테르, 카르바모일, 치환된 카르바모일, C6-아릴, 헤테로아릴, C1-C6-알킬, C3-C6-시클로알킬, C3-C7-헤테로시클로알킬, C1-C6-할로알킬, C1-C6-알콕시, C1-C6-히드록시알킬 및 C2-C6 알케닐옥시로부터 각각 독립적으로 선택된 1, 2 또는 3개의 기로 임의로 치환되고,- R12 및 R13은 H, C1-C6-알킬, C2-C6-히드록시알킬, C2-C6-알킬-O-C1-C6-알킬, C3-C7-시클로알킬, C1-C4-카르복시알킬, C3-C7-헤테로시클로알킬, C6-아릴, 헤테로아릴을 포함하는 군으로부터 독립적으로 선택되며, 이는 OH, 할로, NH2, 아실, SO2CH3, SO3H, 카르복시, 카르복실 에스테르, 카르바모일, 치환된 카르바모일, C6-아릴, 헤테로아릴, C1-C6-알킬, C3-C6-시클로알킬, C3-C7-헤테로시클로알킬, C1-C6-할로알킬, C1-C6-알콕시, C1-C6-히드록시알킬 및 C2-C6 알케닐옥시로부터 각각 독립적으로 선택된 1, 2 또는 3개의 기로 임의로 치환되고,- R12 및 R13은 임의로 연결되어 C3-C7 시클로알킬 고리, 또는 1 또는 2개의 질소, 황 또는 산소 원자를 함유하는 C4-C7-헤테로시클로알킬 고리를 형성한다.

Urea 6, 7-dihydro-4H-pyrazolo [1,5-a ] pyrazine active agents against hepatitis b virus HBVThe present invention relates generally to novel antiviral agents. In particular, the present invention relates to compounds that can inhibit the protein encoded by the Hepatitis B Virus (HBV) or interfere with the function of the HBV replication cycle, compositions comprising such compounds, methods of inhibiting HBV viral replication, methods of treating or preventing HBV infection, and methods and intermediates for making the compounds.A compound of the formula i, wherein,wherein-r1 is phenyl or pyridyl, optionally substituted with h, cf2h、cf3、cf2ch3、f、cl、br、ch3、et、i-pr、c-pr、d、ch2oh、ch(ch3)oh、ch2f、ch(f)ch3、i、c＝c、c≡c、c≡n、c(ch3)2oh、sch3oh or och3once, twice or three times;-r2 is h or methyl;-r3 is selected from h, d, so2-c1-c6-alkyl, so2-c3-c7-cycloalkyl, so2-c3-c7-heterocycloalkyl, so2-c2-c6-hydroxyalkyl, so2-c2-c6-alkyl-o-c1-c6-alkyl, so2-c1-c4-carboxyalkyl, so2aryl, so2heteroaryl, so2-n (r12) (r13), c (═ o) r5, c (═ o) n (r12) (r13), c (═ o) n (r12) (r13), c1-c6-alkyl, c3-c6-cycloalkyl, c1-c6-alkyl-o-c1-c6-alkyl, c1-c4-carboxyalkyl, c1-c4-acylsulfonamido-alkyl, c1-c4-carboxamidoalkyl, c3-c7-heterocycloalkyl, c2-c6-aminoalkyl, c2-c6-hydroxyalkyl and acyl, optionally each independently selected from oh, halogen, nh2acyl, so2ch3、so3h. carboxy, a carboxylic acid ester, carbamoyl, substituted carbamoyl, c6-aryl, heteroaryl, c1-c6-alkyl, c3-c7-cycloalkyl, c1-c6-alkyl-o-c1-c6-alkyl, c3-c7-heterocycloalkyl, c1-c6-haloalkyl, c1-c6-alkoxy, c1-c6-hydroxyalkyl and c2-c6 alkenyloxy, wherein c3-c7-heterocycloalkyl is optionally substituted with 1,2 or 3 groups each independently selected from c1-c6-alkyl or c1-c6-alkoxy;-r5 is selected from the group consisting of c1-c6-alkyl, c1-c6-hydroxyalkyl, c1-c6-alkyl-o-c1-c6-alkyl, c3-c7-cycloalkyl, c1-c4-carboxyalkyl, c3-c7-heterocycloalkyl, c6-aryl and heteroaryl, optionally each independently selected from the group consisting of oh, halogen, nh2acyl, so2ch3、so3h. carboxy, carboxylate, carbamoyl, substituted carbamoyl, c6-aryl, heteroaryl, c1-c6-alkyl, c3-c6-cycloalkyl, c3-c7-heterocycloalkyl, c1-c6-haloalkyl, c1-c6-alkoxy, c1-c6-hydroxyalkyl and c2-c6 alkenyloxy are substituted by 1,2 or 3 radicals;-r12 and r13 are independently selected from h, c1-c6-alkyl, c2-c6-hydroxyarylalkyl, c2-c6-alkyl-o-c1-c6-alkyl, c3-c7-cycloalkyl, c1-c4-carboxyalkyl, c3-c7-heterocycloalkyl, c6-aryl, heteroaryl, optionally each independently selected from oh, halogen, nh2acyl, so2ch3、so3h. carboxy, carboxylate, carbamoyl, substituted carbamoyl, c6-aryl, heteroaryl, c1-c6-alkyl, c3-c6-cycloalkyl, c3-c7-heterocycloalkyl, c1-c6-haloalkyl, c1-c6-alkoxy, c1-c6-hydroxyalkyl and c2-c6 alkenyloxy are substituted by 1,2 or 3 radicals;-r12 and r13 are optionally linked to form a c3-c7 cycloalkyl ring or a c4-c7-heterocycloalkyl ring containing 1 or 2 nitrogen, sulfur or oxygen atoms;or a pharmaceutically acceptable salt thereof, or a solvate or hydrate of a compound of formula i or a pharmaceutically acceptable salt thereof, or a prodrug of a compound of formula i or a pharmaceutically acceptable salt or solvate or hydrate thereof.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

항-종양 요법에서 사용하기 위한 이중 ATM 및 DNA-PK 억제제본원에는 화학식 (I), (II) 및 (III)의 화합물뿐만 아니라 이의 약제학적으로 허용되는 염이 제공되며, 여기에서, 치환기는 명세서에 개시된 것들이다. 이들 화합물 및 이를 함유하는 약제학적 조성물은 종양 질환의 치료에 유용하다.화학식 (I)의 화합물 또는 이의 입체 이성질체, 거울상 이성질체, 토토머(tautomer) 또는 이의 혼합물, 또는 이의 약제학적으로 허용되는 염:상기 식에서,m 및 n은 각각 독립적으로 0, 1, 2, 3, 또는 4이고;p 및 q는 각각 독립적으로 0, 1, 2, 또는 3이고;는 융합된 사이클릴, 융합된 헤테로사이클릴, 융합된 아릴 또는 융합된 헤테로아릴이고;는 모노-사이클릭 또는 바이-사이클릭 고리, 모노-헤테로사이클릭 또는 바이-헤테로사이클릭 고리, 아릴 또는 헤테로아릴이고;Y는 -(C(R1a)H-, -C(O)-, -O-, -N(R5)-, -S(O)r- (여기서, r은 0, 1 또는 2이다), -S(O)t(NR5)- (여기서, t는 1 또는 2이다), -P(O)(R3)-O-, -O-P(O)(R3)-, P(O)(R3)-N(R5)-, -N(R5)-P(O)(R3)-, -CHF-, -CF2-, -OC(O)-, -C(O)O-, -C(O)N(R5)- 또는 -N(R5)C(O)-이고,M은 O, S, 또는 NR5이고;U는 수소 또는 알킬이고;V, W, 및 X는 각각 독립적으로 수소, 임의로 치환된 알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 할로, 임의로 치환된 할로알킬, 임의로 치환된 할로알케닐, 임의로 치환된 할로알콕시, 임의로 치환된 사이클로알킬, 임의로 치환된 아릴, 임의로 치환된 헤테로사이클릴, 임의로 치환된 헤테로아릴, -R6-CN, -R6-NO2, -R6-OR5, -R6-N(R4)R5, -O-R6-N(R4)R5, -N=C(R4)R5, -S(O)rR4, -OS(O)2CF3, -R6-C(O)R4, -C(S)R4, -R6-C(O)OR4, -C(S)OR4, -R6-C(O)N(R4)R5, -C(S)N(R4)R5, -N(R5)C(O)R4, -N(R5)C(S)R4, -N(R5)C(O)OR4, -N(R5)C(S)OR4, -N(R5)C(O)N(R4)R5, -N(R5)C(S)N(R4)R5, -N(R5)S(O)tR4, -N(R5)S(O)tN(R4)R5, -R6-S(O)tN(R4)R5, -O-P(O)(R4)R5, -O-P(O)R4O(R4), -O-P(O)R4N(R4)R5, -N(R5)-P(O)(R4)R5, -N(R5)-P(O)R4O(R4), -N(R5)-P(O)R4N(R4)R5, -N(R5)-P(O)O(R4)N(R4)R5, -N(R5)-P(O)N(R4)R5N(R4)R5, -N(R5)C(=NR5)R4, -N(R5)C(=NR5)N(R4)R5, 및 -N(R5)C(=N-CN)N(R4)R5로 이루어진 군으로부터 선택되고, 여기서, 각각의 r은 독립적으로 0, 1, 또는 2이고, 각각의 t는 독립적으로 1 또는 2이거나; 또는2개의 인접한 V, 또는 W, 또는 X는 이들이 직접 부착된 탄소 고리 원자와 함께, 임의로 치환된 사이클로알킬, 임의로 치환된 아릴, 임의로 치환된 헤테로사이클릴, 및 임의로 치환된 헤테로아릴로부터 선택되는 융합된 고리를 형성하고; Z는 C(R1a) 또는 N이고;R1a는 수소, 임의로 치환된 알킬, 할로, CN, NO2, 또는 -OR5이고;R3은 임의로 치환된 알킬, -OR5, 또는 -N(R4)R5이고;각각의 R4 및 R5는 독립적으로 수소, 임의로 치환된 알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 임의로 치환된 할로알킬, 임의로 치환된 알콕시알킬, 임의로 치환된 사이클로알킬, 임의로 치환된 아릴, 임의로 치환된 헤테로사이클릴, 및 임의로 치환된 헤테로아릴로 이루어진 군으로부터 선택되거나; 또는R4 및 R5가 각각 동일한 질소 원자에 부착되는 경우, R4 및 R5는 이들이 부착된 질소 원자와 함께, 임의로 치환된 헤테로사이클릴 또는 임의로 치환된 헤테로아릴을 형성하고; 그리고각각의 R6은 직접 결합 또는 선형 또는 분지형의 임의로 치환된 알킬렌 사슬, 선형 또는 분지형의 임의로 치환된 알케닐렌 사슬, 선형 또는 분지형의 임의로 치환된 알키닐렌 사슬, 또는 임의로 치환된 헤테로사이클릴렌이다.

DUAL ATM AND DNA-PK INHIBITORS FOR USE IN ANTI-TUMOR THERAPYProvided herein are compounds of the Formula (I), (II), and (III), as well as pharmaceutically acceptable salts thereof, wherein the substituents are those disclosed in the specification. These compounds, and the pharmaceutical compositions containing them, are useful for the treatment of oncologic diseases.A compound of Formula (I) :or a stereoisomer, enantiomer, tautomer thereof or a mixture thereof;or a pharmaceutically acceptable salt thereof;whereinm and n are each independently 0, 1, 2, 3, or 4;p and q are each independently 0, 1, 2, or 3;is a fused cyclyl, a fused heterocyclyl, a fused aryl or a fused heteroaryl;is a mono-cyclic or bi-cyclic ring, a mono-heterocyclic or bi-heterocyclic ring, an aryl or heteroaryl;Y is- (C (R 1a) H-, -C (O) -, -O-, -N (R 5) -, -S (O) r- (where r is 0, 1 or 2) , -S (O) t (NR 5) - (where t is 1 or 2) , -P (O) (R 3) -O-, -O-P (O) (R 3) -, P (O) (R 3) -N (R 5) -, -N (R 5) -P (O) (R 3) -, -CHF-, -CF 2-, -OC (O) -, -C (O) O-, -C (O) N (R 5) -or -N (R 5) C (O) -,M is O, S, or NR 5;U is hydrogen or alkyl;V, W, and X are each independently selected from the group consisting of hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, halo, optionally substituted haloalkyl, optionally substituted haloalkenyl, optionally substituted haloalkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl, optionally substitutedheteroaryl, -R 6-CN, -R 6-NO 2, -R 6-OR 5, -R 6-N (R 4) R 5, -O-R 6-N (R 4) R 5, -N=C (R 4) R 5, -S (O) rR 4, -OS (O) 2CF 3, -R 6-C (O) R 4, -C (S) R 4, -R 6-C (O) OR 4, -C (S) OR 4, -R 6-C (O) N (R 4) R 5, -C (S) N (R 4) R 5, -N (R 5) C (O) R 4, -N (R 5) C (S) R 4, -N (R 5) C (O) OR 4, -N (R 5) C (S) OR 4, -N (R 5) C (O) N (R 4) R 5, -N (R 5) C (S) N (R 4) R 5, -N (R 5) S (O) tR 4, -N (R 5) S (O) tN (R 4) R 5, -R 6-S (O) tN (R 4) R 5, -O-P (O) (R 4) R 5, -O-P (O) R 4O (R 4) , -O-P (O) R 4N (R 4) R 5, -N (R 5) -P (O) (R 4) R 5, -N (R 5) -P (O) R 4O (R 4) , -N (R 5) -P (O) R 4N (R 4) R 5, -N (R 5) -P (O) O (R 4) N (R 4) R 5, -N (R 5) -P (O) N (R 4) R 5N (R 4) R 5, -N (R 5) C (=NR 5) R 4, -N (R 5) C (=NR 5) N (R 4) R 5, and-N (R 5) C (=N-CN) N (R 4) R 5, wherein each r is independently 0, 1, or 2 and each t is independently 1 or 2;or two adjacent V, or W, or X together with the carbon ring atoms to which they are directly attached, form a fused ring selected from optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl, and optionally substituted heteroaryl;Z is C (R 1a) or N;R 1a is a hydrogen, optionally substituted alkyl, halo, CN, NO 2, or-OR 5;R 3 is an optionally substituted alkyl, -OR 5, or-N (R 4) R 5;each R 4 and R 5 is independently selected from group consisting of hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted haloalkyl, optionally substituted alkoxyalkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl, and optionally substituted heteroaryl;or when R 4 and R 5 are each attached to the same nitrogen atom, R 4 and R 5, together with the nitrogen atom to which they are attached, form a optionally substituted heterocyclyl or optionally substituted heteroaryl; andeach R 6 is a direct bond or a linear or branched optionally substituted alkylene chain, a linear or branched optionally substituted alkenylene chain, a linear or branched optionally substituted alkynylene chain, or optionally substituted heterocyclylene.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

질환을 제거하기 위한 체크포인트-억제 항체와 상승작용하는 TLR1/2 작용제 디프로보심의 애쥬번트 효과잠재적 사람 및 마우스 Toll-유사 수용체 (TLR)1/TLR2 작용제는 확인되고 최적화하된 디프로보심이고, 이는 사람 THP-1 세포에서 110 pM 및 일차 마우스 복막 마크로파지에서 1.3 nM의 EC50을 나타내었다. 마우스에서, 디프로보심-보강된 오브알부민 면역접종은 항원-특이적 체액 및 CTL 반응을 촉진하고, 항-PD-L1 치료제와 상승작용하여 종양 성장을 억제하고, 장기간 항-종양 기억을 생성하고, 뮤린 흑색종 B16-OVA와 생착된 마우스의 생존을 치유 또는 연장시켰다. 디프로보심은 명반보다 더 높은 빈도의 종양 침윤성 백혈구를 유발하고, 이의 CD8 T 세포는 면역접종 플러스 항-PD-L1 치료제의 항종양 효과에 필수적이다.포유동물에서 질환에 걸린 세포의 성장을 억제하는 방법으로서, 상기 질환에 걸린 세포는, 상기 질환이 없는 동일한 유형의 세포에는 부재하거나, 상기 질환에 걸린 세포와 비교하여, 무-질환(disease-free) 세포에서 상당히 감소된 수로 존재하는 마커 분자를 나타내고, 상기 방법은: a) 상기 포유동물에게 (i) 애쥬번트(adjuvant)-충분량의 디프로보심(Diprovocim) 화합물, (ii) T 세포-자극량의 면역 체크포인트(checkpoint) 억제제, 및 (iii) 면역량 (immunizing amount)의 상기 마커 분자 또는 이의 부분을 투여하는 단계; b) 상기 면역접종된(immunized) 포유동물을 상기 포유동물이 상기 면역접종에 대한 면역 반응을 일으키기 위해 충분한 시간 동안 유지시키는 단계를 포함하고; 여기서, 상기 디프로보심 화합물은 구조식 V의 구조에 상응하는, 방법:화학식 V상기 화학식 V에서, -A는 -H (하이드라이도(hydrido)) 또는 -C(O)NH-R4이고;R1, R2, R3 및 R4는 동일하거나 상이하고, 2-(4-플루오로페닐)에틸, 트랜스-2-페닐사이클로프로필, 트랜스-2-(4-플루오로페닐)-사이클로프로필 또는 C2-C18 하이드로카빌 그룹이고, 단: 1) R1, R2, R3 및 R4 (R1-4) 중 적어도 2개 또는 R1, R2, 및 R3 (R1-3) 중 적어도 2개는 트랜스-2-페닐사이클로프로필, 트랜스-2-(4-플루오로페닐)-사이클로프로필 그룹 또는 이의 혼합물이거나, R1-4 각각은 2-(4-플루오로페닐)에틸 그룹이고, 2) R1-4 각각이 2-(4-플루오로페닐)에틸이 아닌 경우, 적어도 하나의 도시된 피롤리디닐디카복스아미도 그룹은 (S,S) 배치를 갖고, C2-C18 하이드로카빌 그룹 이외의 도시된 R 치환체 각각은 트랜스-2-페닐사이클로프로필, 트랜스-2-(4-플루오로페닐)-사이클로프로필 그룹 또는 이의 혼합물이고, 3) -A가 -C(O)NH-R4인 경우, R1-4 중 2개 이하는 C2-C18 하이드로카빌 그룹이고, 4) A가 하이드라이도인 경우, R1-3 중 하나는 C2-C18 하이드로카빌 그룹일 수 있고, 도시된 R3-함유 피롤리디닐카복스아미도 그룹은 R 또는 S 배치 중 어느 하나, 또는 둘 다의 배치의 혼합을 가질 수 있고;-Z는 할로겐, -H, -NH2, -OH, -OCH3, -NO2, -OCH2CO2H, -O(CH2CH20)nCH2CH2CO2H, -OCH2CONH(CH2CH2O)nCH2CH2CO2H, -NHCOCH2O-(CH2CH2O)nCH2CO2H, -OCH2CONHCH2CONHCH(CHOH)CO2H, -OCH2CONHCH2CONHCHCO2H(CH2CO2H), -OCH2CONHCH2CONHCH(CHOH)(CH2CH2O)nCH2CH2CO2H, -OCH2CONHCH2CONHCH(CHOH)(CH2CH2O)nCH2CH2CO2H, -OCH2CONHCH2CONHCH[(CH2)4NH2]CO2H, -OCH2CONHCH2CONHCH(CH2OH)CO{NHCH[(CH2)4NH2]CO}mNHCH-[(CH2)4NH2]CO2H (서열번호: 3-8), -OCH2CONHCH2CO{NHCH[(CH2)4NH2]CO}pNHCH[(CH2)4NH]CO2H (서열번호: 9-13) 및 -OCH2CONHCH2CO{NHCH(CH2OH)CO}qNHCH(CH2OH)CO2H (서열번호: 14-18) 중 하나 이상이고;W는 질소 (N) 또는 CH이고; "n"은 평균 값이 1 내지 약 8인 수이고; "m"은 이의 값이 1 내지 약 6인 수이고; "p"는 이의 값이 1 내지 약 6인 수이고;"q"는 이의 값이 1 내지 약 6인 수이다.

ADJUVANT EFFECT OF THE TLR1/2 AGONIST DIPROVOCIM SYNERGIZES WITH CHECKPOINT-INHIBITING ANTIBODIES TO ELIMINATE DISEASEA potent human and mouse Toll-like receptor (TLR)1/TLR2 agonist was identified and optimized, Diprovocim, which exhibited an EC50 of 110 pM in human THP-1 cells and 1.3 nM in primary mouse peritoneal macrophages. In mice, Diprovocim-adjuvanted ovalbumin immunization promoted antigen-specific humoral and CTL responses, and synergized with anti- PD-L1 treatment to inhibit tumor growth, generating long-term anti-tumor memory, curing or prolonging survival of mice engrafted with the murine melanoma B16-OVA. Diprovocim induced greater frequencies of tumor infiltrating leukocytes than alum, of which CD8 T cells were necessary for the antitumor effect of immunization plus anti-PD-L1 treatment.A method of inhibiting the growth of diseased cells in a mammal, which diseased cells exhibit a marker molecule that is absent on cells of the same type that are free of said disease or is present on the disease-free cells in significantly reduced numbers compared to said diseased cells, that comprises the steps of:a) administering to said mammal (i) an adjuvant-sufficient amount of a Diprovocim compound, (ii) a T cell-stimulating amount of an immune checkpoint inhibitor, and (iii) an immunizing amount of said marker molecule or portion thereof;b) maintaining said immunized mammal for a time period sufficient for said mammal to mount an immune response to said immunization; andwherein said Diprovocim compound corresponds in structure to structural Formula V, wherein-A is -H (hydrido) or -C(0)NH-R4;R1, R2, R3 and R4 are the same or difterent and are a 2- (4-fluorophenyl) ethyl, a trans-2- phenylcyclopropyl , a trans-2- ( 4-fluorophenyl) - cyclopropyl or a C2-C]_g hydrocarbyl group with the provisos that:1) at least two of r , R^, R-3 (r -^) or at least two of R-'-, R^, and R^ (Ri-3) are a trans- 2-phenylcyclopropyl, a trans-2- (4-fluorophenyl) - cyclopropyl group or a mixture thereof, or each of ys a 2- ( 4-fluorophenyl) ethyl group,2) at least one depictedpyrrolidinyldicarboxamido group has the (S,S) configuration, and each depicted R substituent other than a Cg-Cpg hydrocarbyl group is a trans-2- phenylcyclopropyl , a trans-2- (4-fluorophenyl) - cyclopropyl group or a mixture thereof 'when each of P.l- 13 other than 2- ( 4-fluorophenyl ) ethyl,3) no more than two of Ri_ are C2_C]_3 hydrocarbyl groups when -A is -C(0)NH-R^, and4) when A is hydrido, one of R^-^ can j-,e a Cf-Cig hydrocarbyl group and the depicted R^- containing pyrrolidinylcarboxamido group can have either the R or S configurations, or a mixture of both configurations;-Z is one or more of halogen -H, -NH2 , -OH, -OCH3, -N02, -0CH2C02H, -0 (CH2CH20) nCH2CH2C02H, -0CH2C0NH (CH2CH20) nCH2CH2C02H, -NHC0CH20- (CH2CH20) nCH2C02H, -OCHgCONHCHgCONHCH (CHOH) C02H, -0CH2C0NHCH2C0NHCHC02H {CH2C02H) ,-OCH2CONHCH2CONHCH (CHOH) (CH2CH20) h0H20H2002H,-OCH2CONHCH2CONHCH (CHOH) (CH2CH20) h0H20H2002H,-OCHgCONHCHgCONHCH [ (CH2) 4NH23 C02H,-OCH2CONHCH2CONHCH (CH20H) CO {NHCH [ (CH2) 4NH2 ] CO } NHCH-[ (CH2) 4NH2]C02H (SEQ ID NOs : 3-8), -OCH2CONHCH2CO{NHCH[ (CH2) 4NH2 ] CO } pNHCH [ (CH2) 4NH]C02H (SEQ ID NOs: 9-13)and -OCH2CONHCH2CO{NHCH (CH2OH) CO} qNHCH {CH2OH) C02H(SEQ ID NOs : 14-18) ;W is nitrogen (N) or CH;'n' is a number whose average value is one to about eight;'m' is a number whose value is 1 to about 6; 'r' is a number whose value is 1 to about6 ; and'q' is a number whose value is 1 to about

29120

유압 기기 제조업

특허

ko

en

접착 구조를 포함하는 전자 장치본 개시의 다양한 실시예에 따른 전자 장치는, 폴더블 하우징, 플렉서블 디스플레이 모듈, 제 1 접착 구조, 및 제 2 접착 구조를 포함할 수 있다. 상기 폴더블 하우징은, 힌지 구조, 제 1 하우징 구조, 제 2 하우징 구조를 포함할 수 있다. 상기 제 1 하우징 구조는, 상기 힌지 구조에 연결되며, 제 1 방향으로 향하는 제 1 면, 상기 제 1 방향과 반대인 제 2 방향으로 향하는 제 2 면을 포함하는 제 1 미드 플레이트 및 상기 제 1 미드 플레이트 측면의 적어도 일부를 둘러싸는 제 1 측면 부재를 포함할 수 있다. 상기 제 2 하우징 구조는, 상기 힌지 구조에 연결되며, 제 3 방향으로 향하는 제 3 면, 상기 제 3 방향과 반대인 제 4 방향으로 향하는 제 4 면을 포함하는 제 2 미드 플레이트, 및 상기 제 2 미드 플레이트의 적어도 일부를 둘러싸는 제 2 측면 부재를 포함하며, 상기 힌지 구조를 중심으로 상기 제 1 하우징 구조와 접힐 수 있다. 상기 폴더블 하우징은, 접힌(folded) 상태에서 상기 제 1 면이 상기 제 3 면에 대면하고, 펼쳐진 (unfolded) 상태에서 상기 제 3 방향이 상기 제 1 방향과 동일할 수 있다. 상기 플렉서블 디스플레이 모듈은, 상기 제 1 면 위에서 제 3 면 위로 연장되고, 상기 제 1 면에 대면하는 제 5 면, 및 상기 제 3 면에 대면하는 제 6 면을 포함할 수 있다. 상기 제 1 면 및 상기 제 5 면 사이에 배치된 상기 제 1 접착 구조는, 상기 제 1 방향으로 향하는 제 7 면 및 상기 제 2 방향으로 향하는 제 8 면을 포함하는 제 1 서브스트레이트, 상기 제 7 면 상에 배치되며, 제 1 패턴을 포함하는 제 1 접착층 및 상기 제 8 면 상에 배치되며, 상기 제 7 면 위에서 볼 때, 상기 제 1 패턴과 적어도 일부 중첩되지 않는 제 2 패턴을 포함하는 제 2 접착층을 포함할 수 있다. 상기 제 3 면 및 제 6 면 사이에 배치된 상기 제 2 접착 구조는, 상기 제 3 방향으로 향하는 제 9 면 및 상기 제 4 방향으로 향하는 제 10 면을 포함하는 제 2 서브스트레이트, 상기 제 9 면 상에 배치되며, 제 3 패턴을 포함하는 제 3 접착층 및 상기 제 10 면 상에 배치되며, 상기 제 9 면 위에서 볼 때, 상기 제 3 패턴과 적어도 일부 중첩되지 않는 제 4 패턴을 포함하는 제 4 접착층을 포함할 수 있다. 이 밖에 다른 실시예가 가능할 수 있다.전자 장치에 있어서,폴더블 하우징으로서, 힌지 구조; 상기 힌지 구조에 연결되며, 제 1 방향으로 향하는 제 1 면, 상기 제 1 방향과 반대인 제 2 방향으로 향하는 제 2 면을 포함하는 제 1 미드 플레이트, 및 상기 제 1 미드 플레이트 측면의 적어도 일부를 둘러싸는 제 1 측면 부재 포함하는 제 1 하우징 구조; 상기 힌지 구조에 연결되며, 제 3 방향으로 향하는 제 3 면, 상기 제 3 방향과 반대인 제 4 방향으로 향하는 제 4 면을 포함하는 제 2 미드 플레이트, 및 상기 제 2 미드 플레이트의 적어도 일부를 둘러싸는 제 2 측면 부재를 포함하며, 상기 힌지 구조를 중심으로 상기 제 1 하우징 구조와 접히는 제 2 하우징 구조를 포함하며, 접힌 상태에서 상기 제 1 면이 상기 제 3 면에 대면하고, 펼쳐진 상태에서 상기 제 3 방향이 상기 제 1 방향과 동일한 폴더블 하우징; 상기 제 1 면 위에서 제 3 면 위로 연장된 플렉서블 디스플레이 모듈로서, 상기 제 1 면에 대면하는 제 5 면 및 상기 제 3 면에 대면하는 제 6 면을 포함하는 플렉서블 디스플레이 모듈;상기 제 1 면 및 상기 제 5 면 사이에 배치된 제 1 접착 구조로서, 상기 제 1 방향으로 향하는 제 7 면 및 상기 제 2 방향으로 향하는 제 8 면을 포함하는 제 1 서브스트레이트; 상기 제 7 면 상에 배치되며, 제 1 패턴을 포함하는 제 1 접착층; 및 상기 제 8 면 상에 배치되며, 상기 제 7 면 위에서 볼 때, 상기 제 1 패턴과 적어도 일부 중첩되지 않는 제 2 패턴을 포함하는 제 2 접착층을 포함하는 제 1 접착 구조; 및 상기 제 3 면 및 제 6 면 사이에 배치된 제 2 접착 구조로서, 상기 제 3 방향으로 향하는 제 9 면 및 상기 제 4 방향으로 향하는 제 10 면을 포함하는 제 2 서브스트레이트; 상기 제 9 면 상에 배치되며, 제 3 패턴을 포함하는 제 3 접착층; 및 상기 제 10 면 상에 배치되며, 상기 제 9 면 위에서 볼 때, 상기 제 3 패턴과 적어도 일부 중첩되지 않는 제 4 패턴을 포함하는 제 4 접착층을 포함하는 제 2 접착 구조를 포함하는 전자 장치.

ELECTRONIC DEVICE INCLUDING ADHESIVE STRUCTUREAn electronic device is provided. The electronic device includes a foldable housing, a flexible display module, a first adhesive structure, and a second adhesive structure. The foldable housing may include a hinge structure, a first housing structure, and a second housing structure. The flexible display module may be extended from the first surface to the third surface, and include a fifth surface facing the first surface, and a sixth surface facing the third surface. The first adhesive structure may be disposed between the first surface and the fifth surface, and include a first substrate, a first adhesive layer, and a second adhesive layer. The second adhesive structure may be disposed between the third surface and the sixth surface, and include a second substrate, a third adhesive layer, and a fourth adhesive layer. [Image]An electronic device comprising: a foldable housing including: a hinge structure; a first housing structure coupled to the hinge structure, and including a first mid plate including a first surface facing in a first direction and a second surface facing in a second direction opposite to the first direction, and a first side member surrounding at least a part of a side surface of the first mid plate; and a second housing structure coupled to the hinge structure, including a second mid plate including a third surface facing in a third direction and a fourth surface facing in a fourth direction opposite to the third direction, and a second side member surrounding at least a part of a side surface of the second mid plate, and folded to the first housing structure with respect to the hinge structure, wherein the first surface faces the third surface in a folded state, and the third direction is identical to the first direction in an unfolded state; a flexible display module extended from the first surface to the third surface, and including a fifth surface facing the first surface, and a sixth surface facing the third surface; a first adhesive structure disposed between the first surface and the fifth surface, and including: a first substrate including a seventh surface facing in the first direction and an eighth surface facing in the second direction; a first adhesive layer disposed on the seventh surface and including a first pattern; and a second adhesive layer disposed on the eighth surface, and including a second pattern which at least partially does not overlap with the first pattern, when seen from above the seventh surface; and a second adhesive structure disposed between the third surface and the sixth surface, and including: a second substrate including a ninth surface facing in the third direction and a tenth surface facing in the fourth direction; a third adhesive layer disposed on the ninth surface and including a third pattern; and a fourth adhesive layer disposed on the tenth surface, and including a fourth pattern which at least partially does not overlap with the third pattern, when seen from above the ninth surface.

22110

고무 타이어 및 튜브 생산업

특허

ko

en

감소된 광택을 갖는 개선된 카보네이트 중합체 블렌드(a) 카보네이트 중합체, (b) 프로필렌 중합체, (c) 상용화(compatibilizing) 그래프트 공중합체, (d) 그래프트 개질된 프로필렌 중합체 및/또는 알파-올레핀 카복실산 공중합체 및/또는 올레핀 블록 공중합체로부터 선택된 중합체, (e) 임의의 충전제, (f) (a), (b), (c) 또는 (d) 이외의 임의의 열가소성 수지 및 (g) 안정제, 안료, 이형제, 유동 향상제 또는 대전방지제로부터 선택된 임의의 하나 이상의 첨가제를 포함하는 카보네이트 중합체 블렌드 조성물이 개시된다. 상기 카보네이트 중합체 블렌드 조성물은 물리적 특성, 내충격성, 가공성 및 성형품에 있어서의 감소된 광택의 우수한 균형을 갖는다.(a) 약 10 내지 약 90중량부의 양의 카보네이트 중합체;(b) 약 10 내지 약 90중량부의 양의 프로필렌 중합체;(c) 약 2 내지 약 30중량부의 양의 상용화(compatibilizing) 그래프트 공중합체;(d) 하기로부터 선택되는 약 0.1 내지 약 25중량부의 양의 중합체: (i) 그래프트 개질된 프로필렌 중합체 및/또는 (ii) 올레핀-카복실산 공중합체; 및/또는 (iii) 하나 이상의 경질 세그먼트 및 하나 이상의 연질 세그먼트를 포함하는, 하기와 같은 특징을 갖는 올레핀 블록 공중합체: (iii.a) 약 1.7 내지 약 3.5의 중량 평균 분자량/수평균 분자량 비(Mw/Mn), 하나 이상의 융점(Tm) (단위: ℃) 및 밀도(d) (단위: 그램/입방 센티미터(g/cc)를 갖고, 여기서 Tm과 d의 수치는 하기 관계식에 대응함: Tm > -2002.9 + 4538.5(d) - 2422.2(d)2 또는 Tm > -6553.3 + 13735(d) - 7051.7(d)2; 및/또는 (iii.b) 약 1.7 내지 약 3.5의 Mw/Mn을 갖고, 융해열(ΔH) (단위: 줄/그램(J/g)) 및 최고 시차 주사 열량측정법(DSC) 피크와 최고 결정화 분석 분별(CRYSTAF) 피크 사이의 온도차로서 정의되는 델타 양(ΔT) (단위: ℃)에 의해 특징지워지고, 여기서 ΔT와 ΔH의 수치는 하기 관계식을 가짐: ΔT > -0.1299(ΔH) + 62.81 (ΔH가 0 초과 130J/g 이하인 경우), ΔT ≥ 48℃ (ΔH가 130J/g 초과인 경우) (여기서, CRYSTAF 피크는 5% 이상의 누적 중합체(cumulative polymer)를 사용하여 측정되며, 5% 미만의 중합체가 확인가능한 CRYSTAF 피크를 갖는다면, CRYSTAF 온도는 30℃이다); 및/또는 (iii.c) 에틸렌/알파-올레핀 인터폴리머의 압축-성형 필름을 사용하여 측정된 300% 변형률 및 1 사이클에서의 탄성 회복률(Re) (단위: %) 및 밀도(d) (단위: 그램/입방 센티미터(g/cc)를 갖고, 여기서 Re와 d의 수치는, 에틸렌/알파-올레핀 인터폴리머가 가교-결합된 상을 실질적으로 함유하지 않을 때, 하기 관계식을 만족함: Re > 1481-1629(d); 및/또는 (iii.d) TREF를 사용하여 분획화될 때, 40℃와 130℃ 사이에서 용출되는 분자 분획은 당해 분획이 동일한 온도들 사이에서 용출되는 필적할만한 랜덤 에틸렌 인터폴리머 분획의 것보다 5% 이상 더 높은 공단량체의 몰 함량을 갖고, 여기서 상기 필적할만한 랜덤 에틸렌 인터폴리머는 동일한 공단량체(들)를 갖고, 에틸렌/알파-올레핀 인터폴리머의 것의 10% 이내의 용융 지수, 밀도 및 공단량체 몰 함량(중합체 전체를 기준으로 함)을 가짐; 및/또는 (iii.e) 25℃에서의 저장 모듈러스(G'(25℃))와 100℃에서의 저장 모듈러스(G'(100℃))를 갖고, 여기서 G'(25℃) 대 G'(100℃)의 비는 약 1:1 내지 약 9:1의 범위임; 및/또는 (iii.f) TREF를 사용하여 분획화될 때, 40℃와 130℃ 사이에서 용출되는 분자 분획은 당해 분획이 0.5 이상 약 1 이하의 블록 지수 및 약 1.3 초과의 분자량 분포(Mw/Mn)를 가짐을 특징으로 함; 및/또는 (iii.g) 0 초과 약 1.0 이하의 평균 블록 지수 및 약 1.3 초과의 분자량 분포(Mw/Mn)를 가짐;(e) 임의의 충전제;(f) (a), (b), (c) 또는 (d) 이외의 임의의 열가소성 수지; 및 (g) 안정제, 안료, 이형제, 유동 향상제 또는 대전방지제로부터 선택된 임의의 하나 이상의 첨가제를 포함(여기서 부는 상기 카보네이트 중합체 블렌드 조성물의 총 중량을 기준으로 한다)하는, 카보네이트 중합체 블렌드 조성물.

Improved carbonate polymer blends with reduced glossDisclosed is a carbonate polymer blend composition comprising (a) a carbonate polymer, (b) a propylene polymer, (c) a compatibilizing graft copolymer, (d) a polymer selected from a graft modified propylene polymer and/or an alpha-olefin carboxylic acid copolymer, and/or an olefin block copolymer, optionally (e) a filler, (f) optionally a thermoplastic resin other than (a), (b), (c), or (d) and (g) optionally one or more additive selected from stabilizers, pigments, mold release agents, flow enhancers, or antistatic agents. Said carbonate polymer blend composition has a good balance of physical properties, impact resistance, processability, and reduced gloss in molded articles.Carbonate polymer blend composition, it comprises:(a) carbonate polymer, its amount is for about 10 to about 90 weight parts;(b) propene polymer, its amount is for about 10 to about 90 weight parts;(c) consistency graft copolymer, its amount is for about 2 to about 30 weight parts;(d) polymkeric substance, its amount are for about 0.1 to about 25 weight parts, and described polymkeric substance is selected from:(i) propene polymer of graft modification; and/or(ii) alkene-polymers of carboxylic acid; and/or(iii) olefin block copolymers, it contains one or more hard segments and one or more soft chain segment, and described olefin block copolymers has:(iii.a) about 1.7 to about 3.5 weight-average molecular weight/number-average molecular weight ratio (mw/mn), at least one in degree centigrade fusing point (tm) and in the density (d) of gram/cubic centimetre (g/cc), wherein the numerical value of tm and d is corresponding to following relationship:t m＞-2002.9+4538.5 (d)-2422.2 (d) 2or t m＞-6553.3+13735 (d)-7051.7 (d) 2and/or (iii.b) about 1.7 to about 3.5 mw/mn, and be characterised in that in joule/gram (j/g) melting heat (δ h) and in degree centigrade the δ amount, promptly be defined as the δ t of the highest dsc (dsc) peak and the peak-to-peak temperature head of the highest crystal analysis classification (crystaf), wherein the numerical value of δ t and δ h has following relationship:for δ h greater than 0 and 130j/g at the most, δ t＞-0.1299 (δ h)+62.81, for δ h greater than 130j/g, δ t 〉=48 ℃,the accumulation polymkeric substance of wherein said crystaf peak use at least 5% is definite, andif the described polymkeric substance less than 5% has identifiable crystaf peak, then the crystaf temperature is 30 ℃; and/or(iii.c) with the compression moulding film of ethylene/alpha-olefin interpolymer at 300% strain and 1 elastic recovery rate in per-cent (re) that circulation is measured, with the density (d) that has in gram/cubic centimetre (g/cc), wherein work as ethylene/alpha-olefin interpolymer and be substantially free of crosslinked phase time, the numerical value of re and d satisfies following relationship:re＞1481-1629 (d); and/or(iii.d) when using the tref fractionation between 40 ℃ and 130 ℃ effusive molecule cut, it is characterized in that mole co-monomer content ratio effusive mole co-monomer content height at least 5% that compares random ethylene interpolymer cut between uniform temp that described cut has, the wherein said random ethylene interpolymer that compares has one or more identical comonomers and the melt index that has, density and mole co-monomer content (based on block polymer) are at the melt index of described ethylene/alpha-olefin interpolymer, density and the mole co-monomer content 10% in; and/or(iii.e) 25 ℃ storage modulus (g ' (25 ℃)) with at 100 ℃ storage modulus g ' (100 ℃)), wherein the ratio of g ' (25 ℃) and g ' (100 ℃) about 1: 1 to about 9: 1 scope, and/or(iii.f) when using the tref fractionation between 40 ℃ and 130 ℃ effusive molecule cut, be characterised in that described cut has at least 0.5 and about at the most 1 blockiness index and greater than about 1.3 molecular weight distribution mw/mn; and/or(iii.g) greater than 0 and about at the most 1.0 average block index with greater than about 1.3 molecular weight distribution mw/mn;(e) randomly, filler;(f) randomly, remove (a), (b), (c) or (d) thermoplastic resin in addition; with(g) randomly, one or more additives, described additive is selected from stablizer, pigment, releasing agent, flow improver additive or static inhibitor,wherein umber is based on the gross weight of described carbonate polymer blend composition.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

모르폴린 타입의 신나미드 화합물 식 (I)로 표시되는 화합물 또는 약리학적으로 허용되는 염, 및 그 의약으로서의 용도에 관한 것이다. 상기 식 (I)에서, R1, R2, R3 및 R4는 동일하거나 상이하게 수소 원자 또는 C1-6 알킬기이고, X1은 치환될 수 있는 C1-6 알킬렌기이고, Xa는 메톡시기 또는 플루오르 원자이고, Xb는 산소 원자 또는 메틸렌기이고, 단, Xa가 메톡시기이면 Xb는 산소 원자이며, Ar1은 할로겐 원자 등의 치환기를 가질 수 있는 아릴기, 피리디닐기, 아릴옥시기 또는 피리디닐옥시기이다. 식 (I)로 표시되는 화합물 또는 그의 약리학적으로 허용되는 염: [화학식 1] 상기 식 (I)에서, (a) R1, R2, R3 및 R4는 동일하거나 상이하게 수소 원자 또는 C1-6 알킬기이고; X1은 C1-6 알킬렌기(상기 C1-6 알킬렌기는 1 내지 3개의 수산기, C1-6 알킬기(상기 C1-6 알킬기는 1 내지 3개의 수산기로 치환될 수 있음) 또는 상기 C1-6 알킬렌기의 동일 탄소 원자에 결합된 2개의 C1-6 알킬기와 함께 형성된 C3-13 사이클로알킬기로 치환될 수 있음)이고; Xa는 메톡시기 또는 플루오르 원자이고; Xb는 산소 원자 또는 메틸렌기이고, 단 Xa가 메톡시기인 경우에 Xb 는 산소 원자로 한정되며; Ar1은 치환기군 A1으로부터 선택되는 1 내지 3개의 치환기로 치환될 수 있는 아릴기, 피리디닐기, 아릴옥시기 또는 피리디닐옥시기이거나, (b) Ar1-X1-은 벤젠환(벤젠환은 치환기군 A1으로부터 선택되는 1 내지 3개의 치환기로 치환될 수 있음)이 축합된 C3-8 사이클로알킬기이고(상기 C3-8 사이클로알킬기에서 하나의 메틸렌기는 산소 원자로 치환될 수 있으며, 또한 상기 C3-8 사이클로알킬기는 1 내지 3개의 수산기 및/또는 C1-6 알킬기로 치환될 수 있음); 및 R1, R2, R3, R4, Xa 및 Xb는 상기 (a)와 동일하게 정의되거나; (c) R1 및 R2 중 어느 하나와 R3 및 R4 중 어느 하나는 동일하거나 상이하게 수소 원자 또는 C1-6 알킬기이고, R1 및 R2 중 다른 하나와 R3 및 R4 중 다른 하나는 각각 결합된 탄소 원자와 함께 C3-8 사이클로알킬기(상기 C3-8 사이클로알킬기는 치환기군 A1으로부터 선택되는 1 내지 3개의 치환기로 치환될 수 있음)를 형성하고; X1, Xa, Xb 및 Ar1은 (a) 또는 (b)와 동일하게 정의되거나; (d) Ar1-X1- 및 R4는 각각 결합하는 질소 원자 및 탄소 원자와 함께 아릴기 또는 피리디닐기(상기 아릴기 또는 상기 피리디닐기는 치환기군 A1으로부터 선택되는 1 내지 3개의 치환기로 치환될 수 있음)로 치환될 수 있는 4원 또는 8원 질소 함유 헤테로사이클릭환기(상기 4원 또는 8원 질소 함유 헤테로사이클릭환기에서 하나의 메틸렌기는 치환기군 A1으로부터 선택되는 1 내지 2개의 치환기로 치환될 수 있는 메틸렌기, 치환기군 A1으로부터 선택되는 1 내지 2개의 치환기로 치환될 수 있는 비닐렌기, 산소 원자 또는 치환기군 A1으로부터 선택되는 치환기로 치환될 수 있는 이미노기로 치환될 수 있음)를 형성하며; Xb는 산소 원자를 의미하며; R1, R2, R3 및 Xa는 (a) 또는 (b)와 동일하게 정의되거나; (e) R1 및 R2는 결합하는 탄소 원자와 함께 C3-8 사이클로알킬기를 형성하고; R3, R4, X1, Xa, Xb 및 Ar1은 (a) 또는 (b)와 동일하게 정의되거나; 또는 (f) R3 및 R4는 결합하는 탄소 원자와 함께 C3-8 사이클로알킬기를 형성하고; R1, R2, X1, Xa, Xb 및 Ar1은 (a) 또는 (b)와 동일하게 정의되며; 치환기군 A1: (1) 할로겐 원자, (2) 수산기, (3) 시아노기, (4) C3-8 사이클로알킬기, (5) C3-8 사이클로알콕시기, (6) C1-6 알킬기(상기 C1-6 알킬기는 1 내지 5개의 할로겐 원자 또는 1 내지 3개의 C1-6 알콕시기로 치환될 수 있음), (7) 1 내지 2개의 C1-6 알킬기(상기 C1-6 알킬기는 1 내지 5개의 할로겐 원자로 치환될 수 있음)로 치환될 수 있는 아미노기, (8) C1-6 알콕시기(상기 C1-6 알콕시기는 1 또는 5개의 할로겐 원자로 치환될 수 있음) 및 (9) 1 또는 2개의 C1-6 알킬기(상기 C1-6 알킬기는 1 내지 3개의 할로겐 원자로 치환될 수 있음)로 치환될 수 있는 카르바모일기.

MORPHOLINE TYPE CINNAMIDE COMPOUNDThe present invention relates to a compound represented by the formula (I): or a pharmacologically acceptable salt thereof, wherein R1, R2, R3, and R4 are the same or different and each represent a hydrogen atom or a C1-6 alkyl group; X1 represents a C1-6 alkylene group that may be substituted; Xa represents a methoxy group or a fluorine atom; Xb represents an oxygen atom or a methylene group, provided that Xb is only an oxygen atom when Xa is a methoxy group; and Ar1 represents an aryl group, pyridinyl group, aryloxy group, or pyridinyloxy group that may have a substituent such as a halogen atom; and to use of the compound or salt as a pharmaceutical agent.A compound represented by the formula (I): [Formula 1] or a pharmacologically acceptable salt thereof, wherein (a) R1, R2, R3, and R4 are the same or different and each represent a hydrogen atom or a C1-6 alkyl group; X1 represents a C1-6 alkylene group, wherein the C1-6 alkylene group may be substituted with 1 to 3 hydroxyl groups or C1-6 alkyl groups, wherein the C1-6 alkyl groups may be substituted with 1 to 3 hydroxyl groups, or a C3-13 cycloalkyl group formed by two C1-6 alkyl groups together bonded to the same carbon atom of the C1-6 alkylene group; Xa represents a methoxy group or a fluorine atom; Xb represents an oxygen atom or a methylene group, provided that Xb is only an oxygen atom when Xa is a methoxy group; and Ar1 represents an aryl group, pyridinyl group, aryloxy group, or pyridinyloxy group that may be substituted with 1 to 3 substituents selected from Substituent Group A1; (b) Ar1-X1- represents a C3-8 cycloalkyl group condensed with a benzene ring, wherein one methylene group on the C3-8 cycloalkyl group may be substituted with an oxygen atom, the C3-8 cycloalkyl group may be substituted with 1 to 3 hydroxyl groups and/or C1-6 alkyl groups, and the benzene ring may be substituted with 1 to 3 substituents selected from Substituent Group A1; and R1, R2, R3, R4, Xa, and Xb are as defined in (a); (c) one of R1 and R2 and one of R3 and R4 are the same or different and each represent a hydrogen atom or a C1-6 alkyl group; the other of R1 and R2 and the other of R3 and R4, together with the carbon atoms to which they are respectively bonded, form a C3-8 cycloalkyl group, wherein the C3-8 cycloalkyl group may be substituted with 1 to 3 substituents selected from Substituent Group A1; and X1, Xa, Xb, and Ar1 are as defined in (a) or (b); (d) Ar1-X1- and R4, together with the nitrogen atom to which Ar1-X1- is bonded and the carbon atom to which R4 is bonded, form a 4- to 8-membered nitrogen-containing heterocyclic group that may be substituted with an aryl group or pyridinyl group, wherein one methylene group on the 4- to 8-membered nitrogen-containing heterocyclic group may be substituted with a methylene group substituted with 1 or 2 substituents selected from Substituent Group A1, a vinylene group that may be substituted with 1 or 2 substituents selected from Substituent Group A1, an oxygen atom, or an imino group that may be substituted with a substituent selected from Substituent Group A1, and the aryl group or pyridinyl group may be substituted with 1 to 3 substituents selected from Substituent Group A1; Xb represents an oxygen atom; and R1, R2, R3, and Xa are as defined in (a) and (b); (e) R1 and R2, together with the carbon atom to which they are bonded, form a C3-8 cycloalkyl group; and R3, R4, X1, Xa, Xb, and Ar1 are as defined in (a) and (b); or (f) R3 and R4, together with the carbon atom to which they are bonded, form a C3-8 cycloalkyl group; and R1, R2, X1, Xa, Xb, and Ar1 are as defined in (a) and (b). (Substituent Group A1: (1) a halogen atom, (2) a hydroxyl group, (3) a cyano group, (4) a C3-8 cycloalkyl group, (5) a C3-8 cycloalkoxy group, (6) a C1-6 alkyl group, wherein the C1-6 alkyl group may be substituted with 1 to 5 halogen atoms or one to three C1-6 alkoxy groups, (7) an amino group that may be substituted with one or two C1-6 alkyl groups, wherein the C1-6 alkyl groups may be substituted with 1 to 5 halogen atoms, (8) a C1-6 alkoxy group, wherein the C1-6 alkoxy group may be substituted with 1 to 5 halogen atoms, and (9) a carbamoyl group that may be substituted with one or two C1-6 alkyl groups, wherein the C1-6 alkyl groups may be substituted with 1 to 3 halogen atoms.)

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

8-히드록시 퀴놀린 유도체의 에난티오머 및 그의 합성본 발명은 화학식 (I) 및 (II)을 갖는 8-하이드록시퀴놀린 유도체의 신규의 거울상이성질체 유도체 및 그의 합성 및 그의 약제학적으로 허용 가능한 염 및 금속 착물 및 이들 화합물을 포함하는 의학적 및/또는 약제학적 조성물에 관한 것이다. 본 발명의 대상물의 본질은, 종래 기술이 단지 라세미 생성물의 생물학적 효과 및 특성만을 기재하고 있으며, 본 발명에 따른 신규의 거울상이성질체 유도체는 본 출원에서 처음으로 출현한다는 사실에 관한 것이다. 본 발명의 대상물은 추가로, 본 발명에 따른 신규의 거울상이성질체 유도체의 제조를 위한 신규의 입체선택적 합성에 관한 것이다. 이들 거울상이성질체를 포함하는 신규의 의학적 및/또는 약제학적 조성물은 상기 명명된 질환의 치료에 적합하며, 상기 거울상이성질체는 이들 조성물의 제조에 사용된다. 상기 조성물의 제조에 대한 이러한 적용이 또한 본 발명의 대상물이다. 본 발명에 따른 화합물은 바람직하게는, 신경정신성 질환 및 신경계 질환 및 장기이식 및 허혈증과 그의 재관류 손상과 관련된 질환의 치료 및 장기, 유리하게는 피부 이식 거부반응의 억제를 위한 세포보호, 신경보호, 심장보호, 항불안 및 항우울제로서 사용될 수 있다. 본 연구에 따르면, R-거울상이성질체는 몇몇 경우에 유일하거나 높은 생물학적 효과를 갖는다. 화학식 (I)의 8-하이드록시퀴놀린 유도체의 신규의 R-거울상이성질체 유도체 및 화학식 (II)의 8-하이드록시퀴놀린 유도체의 신규의 S-거울상이성질체 유도체, 및 그의 약제학적으로 허용 가능한 염 및 이가 또는 다가 금속과의 착물:여기서, 화학식 (I) 및 (II)에서,R1은 저급 알킬기; 저급 시클로알킬기; 아릴기; 아르알킬기 또는 1, 2 또는 3개의 질소, 산소 또는 황 원자를 포함하는 5 또는 6원 헤테로아릴기; 또는 이들의 조합을 나타내고, 여기서, 상기 기들은 오르소, 메타 또는 파라 위치에서 1, 2, 3 또는 4개의 전자 흡인 기(electron withdrawing group) 또는 전자 공여 기(electron donating group)에 의해 선택적으로 치환될 수 있고;R2는 수소 원자; 아릴기; 아르알킬기; 1, 2 또는 3개의 질소, 산소 또는 황 원자를 포함하는 5 또는 6원 헤테로아릴기; 또는 이들의 조합을 나타내고, 여기서, 상기 기들은 오르소, 메타 또는 파라 위치에서 1, 2, 3 또는 4개의 전자 흡인 기 또는 전자 공여 기에 의해 선택적으로 치환될 수 있고;R3은 수소 원자; 저급 알킬기; -CH2F; -CHF2; -CF3; -CH2CH2F; -CH2CHF2; -CH2CF3; -CH2OR5; -CH2CH2OR6; 또는 -CH2-NR7R8 기를 나타내고;R4는 수소 원자; 할로겐 원자; 메틸티오기; 메틸설피닐기; 메틸설포닐기; 또는 아지도기를 나타내고;R5는 수소 원자; 또는 저급 알킬기를 나타내고;R6은 수소 원자; 또는 저급 알킬기를 나타내고;R7은 수소 원자; 또는 저급 알킬기를 나타내고;R8은 수소 원자; 또는 저급 알킬기를 나타내고;R7 및 R8은 결합하여, -(CH2)n- 기; 또는 -CH2CH2OCH2CH2- 기 또는 -CH2CH2SCH2CH2- 기 또는 -CH2CH2NR9CH2CH2- 기를 나타내고, 여기서, n은 4, 5, 또는 6이고; R9는 저급 알킬기; 또는 -COR10 기를 나타내고;R10은 수소 원자; 저급 알킬기; 메톡시기 또는 에톡시기를 나타내고;화학식 (I)에서,X는 "R" 입체배치를 갖는 수소 치환된 C 원자를 나타내고;화학식 (II)에서,Y는 "S" 입체배치를 갖는 수소 치환된 C 원자를 나타내며;단, R2가 비치환된 페닐기; 또는 비치환된 2-피리딜기; 또는 4-카르복시페닐기; 또는 2-카르복시페닐기를 나타내고;R3이 수소 원자 또는 메틸기를 나타내고;R4가 수소 원자 또는 염소 치환기를 나타내는 경우, R1은 비치환된 페닐기를 나타낼 수 없고;R2가 비치환된 2-피리딜기를 나타내고;R3이 메틸기를 나타내고;R4가 수소 원자를 나타내는 경우, R1은 3,4-디메틸페닐기를 나타낼 수 없고;R2가 비치환된 2-피리딜기를 나타내고;R3이 수소 원자를 나타내고;R4가 염소 치환기를 나타내는 경우, R1은 2-푸릴기를 나타낼 수 없고;R2가 5-메틸이속사졸-3-일기를 나타내고;R3이 수소 원자를 나타내며;R4가 수소 원자를 나타내는 경우, R1은 비치환된 2-피리딜기를 나타낼 수 없음.

ENANTIOMERS OF 8-HYDROXY QUINOLINE DERIVATIVES AND THE SYNTHESIS THEREOFOur invention relates to novel enantiomer derivatives of 8-hydroxyquinoline derivatives with general formula (I) and (II) and the synthesis thereof and pharmaceutically acceptable salts and metal complexes and thereof, and the medicinal and/or pharmaceutical compositions comprising these compounds. The essence of the subject matter of the invention relates to the fact that prior art discloses the biological effect and characteristics only of the racemic products, the novel enantiomer derivatives according to the invention appear in our application for the first. The subject matter of the invention furthermore relates to a novel, stereo selective synthesis for the preparation of the novel enantiomer derivatives according to the invention. The novel medicinal and/or pharmaceutical compositions comprising these enantiomers are suitable for the treatment of the named diseases, and the enenatiomers are used for manufacture of these compositions. These applications for manufacture of the compositions are also the subject matters of the invention. The compounds according to the invention can be used preferably as cytoprotective, neuroprotective, cardioprotective, anxiolytic and antidepressant agent for treatment of neuropsychiatric and neurologic diseases and diseases in connections with transplantations and with ischemia and reperfusion injuries thereof, and inhibition of organ, advantageously skin graft rejection. According to our studies the R-enantiomer has either sole or high biological effect in some cases.Novel R-enantiomeric derivatives of 8-hydroxyquinolinederivatives of general formula (I) and novel S-enantiomer ic derivatives of 8-hydroxyquinoline derivatives of general formula (II), and pharmaceutically acceptable salts and complexes with divalent or polyvalent metals thereof,R-enantiomer S-enantiomer whereinin general formulas (I) and (II)Ri represents lower alkyl group; lower cycloalkyl group; aryl group; aralkyl group or 5 or 6 membered heteroaryl group comprising 1; 2 or 3 nitrogen; oxygen or sulfur atoms or combinations thereof wherein the above groups can be optionally substituted with 1; 2; 3; or 4 electron withdrawing groups or electron donating groups in ortho; meta or para positions;R2 represents a hydrogen atom; aryl group; aralkyl group;5 or 6 membered heteroaryl group comprising 1; 2 or 3 nitrogen; oxygen or sulfur atoms or combinations thereof wherein the above groups can be optionally substituted with 1; 2; 3; or 4 electron withdrawing groups or electron donating groups in ortho; meta or para positions;P-1418 R3 represents a hydrogen atom; lower alkyl group; -CH2F; -CHF2; -CF3; -CH2CH2F; -CH2CHF2; -CH2CF3; -CH2OR5; - CH2CH2OR6; or -CH2-NR7R8 group;R4 represents a hydrogen atom; halogen atom; methylthio group; methylsulfinyl group; methylsulfonyl group; or azido group;R5 represents a hydrogen atom; or lower alkyl group;R6 represents a hydrogen atom; or lower alkyl group;R7 represents a hydrogen atom; or lower alkyl group;R8 represents a hydrogen atom; or lower alkyl group;R7 and R8 represents jointly -(CH2)n- group; or - CH2CH2OCH2CH2- group or-CH2CH2SCH2CH2- group or- CH2CH2NR9CH2CH2- group,whereinn is 4, 5 or 6;R9 represents a lower alkyl group; or -COR10 group,R10 represents a hydrogen atom; lower alkyl group; methoxy group; or ethoxy group;in the general formula (I)X represents a hydrogen substituted C atom with 'R' configuration;in the general formula (II)Y represents a hydrogen substituted C atom with 'S' configu ation;with the proviso thatR1 cannot represent non-substituted phenyl group, in caseR2 represents a non-substituted phenyl group; or non- substituted 2-pyridyl group; or 4-carboxyphenyl group; or 2-carboxyphenylgroup;R3 represents a hydrogen atom or methyl group;R4 represents hydrogen atom or chlorine substituent; and 18 R1 cannot represent 3, 4-dimethylphenyl group, in caseR2 represents a non-substituted 2-pyridyl group;R3 represents methyl group andR4 a hydrogen atom;andR1 cannot represent 2-furyi group, in caseR2 represents a non-substituted 2-pyridyl group;R3 represents a hydrogen atom andR4 represents a chlorine substituent,andR1 cannot represent a non-substituted 2-pyridyl group, in caseR2 represents 5-methylisoxazol-3-yl group;R3 represents a hydrogen atom;R4 represents a hydrogen atom.Novel R-enantiomeric derivatives of 8-hydroxyquinoline derivatives of general formula (Ι') according to claim 1 and pharmaceutically acceptable salts and complexes with divalent or polyvalent metals thereof,R-enantiomerwhereinin general formula (Ι')R1' represents an aryl group substituted with an electron withdrawing group in meta or para position, or an aryl group substituted with an electron donating group in ortho, meta or para position; or a double-substituted aryl group with electron withdrawing groups in meta and para positions; or an aryl group double- substituted with electron withdrawing groups in ortho and para positions; or a substituted or unsubstituted heteroaryl group;R2' represents an aryl group substituted with an electron withdrawing group in para position, or an aryl group substituted with an electron donating group in ortho, meta or para position; or an unsubstitutedheteroaromatic group or a heteroaromatic or aryl group substituted with alkyl group and/or with electron withdrawing groups in ortho, meta or para positions;R3' represents a hydrogen atomR4' represents a hydrogen atom andin general formula (Ι')X represents a hydrogen substituted C atom with 'R'configuration .

26212

유기 발광 표시장치 제조업

특허

ko

en

환상 아진 화합물, 그 제조 방법, 및 그것을 함유하는 유기 전계발광소자하기 식 (1)로 표시되는 1,3,5-환상 트라이아진 화합물, 그것을 전자 수송 재료로 하는 장시간 구동을 가능하게 하는 유기 전계발광소자, 및 해당 화합물의 유기 전계발광소자의 구성 성분으로서의 사용을 제공한다: (식 중, Cz는 (n+1)가의 카바졸기 또는 (n+1)가의 카볼린기(이들 기는, 각각 독립적으로, 불소 원자 등을 치환기로서 지녀도 됨)를 나타내고; Ar1 및 Ar2는, 각각 독립적으로, 탄소수 6 내지 30의 방향족 탄화수소기(각각 독립적으로, 불소 원자 등을 치환기로서 지녀도 됨)를 나타내며; Ar3은 탄소수 6 내지 30의 아릴렌기(불소 원자 등을 치환기로서 지녀도 됨)를 나타내고; Ar4는, 각각 독립적으로, 탄소수 3 내지 30의 질소 함유 헤테로아릴기(각각 독립적으로, 불소 원자 등을 치환기로서 지녀도 됨) 또는 하기 일반식 (A)로 표시되는 치환기를 나타내며; Y 및 Z는, 각각 독립적으로, 질소 원자 또는 CH를 나타낸다. 단, Y 및 Z 중 적어도 한쪽은 질소 원자이다. n은 1 내지 [Cz 상에 형성할 수 있는 최대의 결합수-1]의 정수를 나타낸다.) (식 중, Ar5는, (m+1)가의 탄소수 6 내지 30의 아릴기(각각 독립적으로, 불소 원자 등을 치환기로서 지녀도 됨)를 나타내고; Ar6은, 각각 독립적으로, 탄소수 3 내지 30의 질소 함유 헤테로아릴기(각각 독립적으로, 불소 원자 등을 치환기로서 지녀도 됨)를 나타내며; m은 1 내지 [Ar5 상에 형성할 수 있는 최대의 결합수-1]의 정수를 나타낸다.)하기 일반식 (1)로 표시되는 것을 특징으로 하는 환상 아진 화합물:[이미지](식 중,Cz는 (n+1)가의 카바졸기 또는 (n+1)가의 카볼린기(이들 기는, 각각 독립적으로, 불소 원자, 탄소수 1 내지 4의 알킬기, 탄소수 6 내지 18의 방향족 탄화수소기, 불소 원자를 지니는 탄소수 6 내지 18의 방향족 탄화수소기 또는 탄소수 1 내지 4의 알킬기가 치환된 탄소수 6 내지 18의 방향족 탄화수소기를 치환기로서 지녀도 됨)를 나타낸다.Ar1 및 Ar2는, 각각 독립적으로, 탄소수 6 내지 30의 방향족 탄화수소기(각각 독립적으로, 불소 원자, 탄소수 1 내지 4의 알킬기, 탄소수 3 내지 18의 방향족기, 불소 원자를 지니는 탄소수 3 내지 18의 방향족기 또는 탄소수 1 내지 4의 알킬기가 치환된 탄소수 3 내지 18의 방향족기를 치환기로서 지녀도 됨)를 나타낸다.Ar3은 탄소수 6 내지 30의 아릴렌기(불소 원자, 탄소수 1 내지 4의 알킬기, 탄소수 3 내지 18의 방향족기, 불소 원자를 지니는 탄소수 3 내지 18의 방향족기 또는 탄소수 1 내지 4의 알킬기가 치환된 탄소수 3 내지 18의 방향족기를 치환기로서 지녀도 됨)를 나타낸다.Ar4는, 각각 독립적으로, 탄소수 3 내지 30의 질소 함유 헤테로아릴기(각각 독립적으로, 불소 원자, 탄소수 1 내지 4의 알킬기, 탄소수 3 내지 18의 방향족기, 불소 원자를 지니는 탄소수 3 내지 18의 방향족기 또는 탄소수 1 내지 4의 알킬기가 치환된 탄소수 3 내지 18의 방향족기를 치환기로서 지녀도 됨) 또는 하기 일반식 (A)로 표시되는 치환기를 나타낸다.Y 및 Z는, 각각 독립적으로, 질소 원자 또는 CH를 나타낸다.단, Y 및 Z 중 적어도 한쪽은 질소 원자이다.n은 1 내지 [Cz 상에 형성할 수 있는 최대의 결합수-1]의 정수를 나타낸다.)[이미지](식 중,Ar5는, 각각 독립적으로, (m+1)가의 탄소수 6 내지 30의 아릴기(각각 독립적으로, 불소 원자, 탄소수 1 내지 4의 알킬기, 탄소수 3 내지 18의 방향족기, 불소 원자를 지니는 탄소수 3 내지 18의 방향족기 또는 탄소수 1 내지 4의 알킬기가 치환된 탄소수 3 내지 18의 방향족기를 치환기로서 지녀도 됨)를 나타낸다.Ar6은, 각각 독립적으로, 탄소수 3 내지 30의 질소 함유 헤테로아릴기(각각 독립적으로, 불소 원자, 탄소수 1 내지 4의 알킬기, 탄소수 3 내지 18의 방향족기, 불소 원자를 지니는 탄소수 3 내지 18의 방향족기 또는 탄소수 1 내지 4의 알킬기가 치환된 탄소수 3 내지 18의 방향족기를 치환기로서 지녀도 됨)를 나타낸다.m은, 각각 독립적으로, 1 내지 [Ar5 상에 형성할 수 있는 최대의 결합수-1]의 정수를 나타낸다.)

Cyclic azine compound, method for producing same, and organic electroluminescent element containing sameProvided are a 1,3,5-cyclic triazine compound represented by formula (1), an organic electroluminescent element which uses this compound as an electron transport material and which can be operated for a long period of time, and use of this compound as a constituent component of an organic electroluminescent element. (In the formula, Cz is an (n+1) valent carbazole group or an (n+1) valent carboline group (these groups may each independently have a substituent group such as a fluorine atom), Ar1 and Ar2 are each independently an aromatic hydrocarbon group having 6-30 carbon atoms (these groups may each independently have a substituent group such as a fluorine atom), Ar3 is an arylene group having 6-30 carbon atoms (and may have a substituent group such as a fluorine atom), the Ar4 groups are each independently a nitrogen-containing heteroaryl group having 3-30 carbon atoms (these groups may each independently have a substituent group such as a fluorine atom) or a substituent group represented by general formula (A), and Y and Z are each independently a nitrogen atom or CH. However, at least one of Y and Z is a nitrogen atom. n is an integer between 1 and [maximum number of bonds able to be formed on Cz-1]) (In the formula, Ar5 is an (m+1) valent aryl group having 6-30 carbon atoms (these groups may each independently have a substituent group such as a fluorine atom), the Ar6 groups are each independently a nitrogen-containing heteroaryl group having 3-30 carbon atoms (these groups may each independently have a substituent group such as a fluorine atom), and m is an integer between 1 and [maximum number of bonds able to be formed on Ar5-1]).A cyclic azine compound, it is represented by general formula (1),in formula, cz represents (n+1) carbazyl of valency or the carbolinyl of (n+1) valency, these groups can separately have fluorine atom, the alkyl of carbonatoms 1 ~ 4, carbonatoms 6 ~ 18 aromatic hydrocarbyl, there is fluorine atom and the aromatic hydrocarbyl of carbonatoms 6 ~ 18 or replaced and the aromatic hydrocarbyl alternatively base of carbonatoms 6 ~ 18 by the alkyl of carbonatoms 1 ~ 4ar 1and ar 2separately represent the aromatic hydrocarbyl of carbonatoms 6 ~ 30, they can separately have fluorine atom, the alkyl of carbonatoms 1 ~ 4, carbonatoms 3 ~ 18 aromatic group, there is fluorine atom and the aromatic group of carbonatoms 3 ~ 18 or the aromatic group alternatively base of carbonatoms 3 ~ 18 that replaced by the alkyl of carbonatoms 1 ~ 4 ar 3represent the arylidene of carbonatoms 6 ~ 30, they can have fluorine atom, the alkyl of carbonatoms 1 ~ 4, carbonatoms 3 ~ 18 aromatic group, there is fluorine atom and the aromatic group of carbonatoms 3 ~ 18 or the aromatic group alternatively base of carbonatoms 3 ~ 18 that replaced by the alkyl of carbonatoms 1 ~ 4 ar 4separately represent the nitrogen-containing hetero aryl of carbonatoms 3 ~ 30 or the substituting group shown in general formula (a), wherein, the nitrogen-containing hetero aryl of described carbonatoms 3 ~ 30 can separately have fluorine atom, the alkyl of carbonatoms 1 ~ 4, carbonatoms 3 ~ 18 aromatic group, there is fluorine atom and the aromatic group of carbonatoms 3 ~ 18 or the aromatic group alternatively base of carbonatoms 3 ~ 18 that replaced by the alkyl of carbonatoms 1 ~ 4 y and z separately represents nitrogen-atoms or ch, and wherein, at least one in y and z is nitrogen-atoms,n represents the integer of 1 ~ [the upper maximum bonding number-1 formed of cz],-ar 5-(ar 6) m(a) in formula, ar 5separately represent the aryl of the carbonatoms 6 ~ 30 of (m+1) valency, they can separately have fluorine atom, the alkyl of carbonatoms 1 ~ 4, carbonatoms 3 ~ 18 aromatic group, there is fluorine atom and the aromatic group of carbonatoms 3 ~ 18 or the aromatic group alternatively base of carbonatoms 3 ~ 18 that replaced by the alkyl of carbonatoms 1 ~ 4 ar 6separately represent the nitrogen-containing hetero aryl of carbonatoms 3 ~ 30, they can separately have fluorine atom, the alkyl of carbonatoms 1 ~ 4, carbonatoms 3 ~ 18 aromatic group, there is fluorine atom and the aromatic group of carbonatoms 3 ~ 18 or the aromatic group alternatively base of carbonatoms 3 ~ 18 that replaced by the alkyl of carbonatoms 1 ~ 4 m separately represents 1 ~ [ar 5on the maximum bonding number-1 that can be formed] integer.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

치환된 2,3-디히드로이미다조[1,2-C]퀴나졸린의 용도본 발명은 하기에 관한 것이다. - 자궁내막암 (이하 "EC"로 약칭됨), 특히 제1 선, 제2 선, 재발, 불응성, 유형 I 또는 유형 II EC, 또는 자궁내막증의 치료 또는 예방용 의약의 제조를 위한, 단독 활성제로서 2,3-디히드로이미다조[1,2-c]퀴나졸린 화합물, 또는 이를 함유하는 제약 조성물의, 또는 a) 상기 화합물 또는 상기 화합물을 함유하는 제약 조성물 및 b) 하나 이상의 추가적 활성제의 조합물의 용도 - a) 상기 화합물 및 b) 하나 이상의 추가적 활성제의 조합물; - 자궁내막암 (이하 "EC"로 약칭됨), 특히 제1 선, 제2 선, 재발, 불응성, 유형 I 또는 유형 II EC, 또는 자궁내막증의 치료를 위한 단독 활성제로서 상기 화합물을 함유하는 제약 조성물; - a) 상기 화합물 및 b) 하나 이상의 추가적 활성제의 조합물을 포함하는 제약 조성물 - 상기 화합물에 대한 암 환자의 감수성 및/또는 내성을 예측하고, 감수성을 증가시키고/거나 내성을 극복하기 위한 근거-기반의 투여량을 제공하기 위한, 종양 억제자 PTEN 또는 FBXW7의 상실인 바이오마커의 용도; - 종양 억제자 PTEN 또는 FBXW7의 상실을 결정하는 방법; - PIK3CA, PIK3CB, PIK3CD, PIK3CG, PIK3R1, PIK3R2, PIK3R3, PIK3R4, PIK3R5, FGFR1, FGFR2, FGFR3 및/또는 FGFR4에서의 교란을 결정하는 방법.자궁내막암 (이하 "EC"로 약칭됨), 특히 제1 선, 제2 선, 재발, 불응성, 유형 I 또는 유형 II EC, 또는 자궁내막증의 치료 또는 예방용 의약의 제조를 위한,단독 활성제로서, 하기 화학식 I의 2,3-디히드로이미다조[1,2-c]퀴나졸린 화합물, 또는 그의 생리학상 허용되는 염, 용매화물, 수화물 또는 입체이성질체,또는 상기 화합물, 또는 그의 생리학상 허용되는 염, 용매화물, 수화물 또는 입체이성질체를 함유하는 제약 조성물의 용도.<화학식 I>여기서R1은 -(CH2)n-(CHR4)-(CH2)m-N(R5)(R5')를 나타내고;R2는 1, 2 또는 3개의 R6 기로 임의로 치환된 헤테로아릴을 나타내고;R3은 알킬 또는 시클로알킬을 나타내고;R4는 수소, 히드록시 또는 알콕시를 나타내고;R5 및 R5'는 동일하거나 상이할 수 있고, 독립적으로 수소, 알킬, 시클로알킬알킬 또는 알콕시알킬이거나 또는 R5 및 R5'는 이들이 결합되어 있는 질소 원자와 함께, 산소, 질소 또는 황으로부터 선택되는 적어도 1개의 추가의 헤테로원자를 임의로 함유하고 1개 이상의 R6'기로 임의로 치환될 수 있는 3-7원 질소 함유 헤테로시클릭 고리를 형성할 수 있거나, 또는 R4 및 R5는 이들이 결합되어 있는 원자와 함께, 1개 이상의 질소, 산소 또는 황 원자를 임의로 함유하고 1개 이상의 R6' 기로 임의로 치환될 수 있는 5-6원 질소 함유 헤테로시클릭 고리를 형성할 수 있고;각각의 경우의 R6은 동일하거나 상이할 수 있고, 독립적으로 할로겐, 알킬, 알케닐, 알키닐, 시클로알킬, 시클로알킬알킬, 아릴, 아릴알킬, 헤테로아릴, 헤테로아릴알킬, 헤테로시클릭 고리, 헤테로시클릴알킬, 알킬-OR7, 알킬-SR7, 알킬-N(R7)(R7'), 알킬-COR7, -CN, -COOR7, -CON(R7)(R7'), -OR7, -SR7, -N(R7)(R7'), 또는 -NR7COR7이며, 이들 각각은 1개 이상의 R8 기로 임의로 치환될 수 있고;각각의 경우의 R6'는 동일하거나 상이할 수 있고, 독립적으로 알킬, 시클로알킬알킬, 또는 알킬-OR7이고;각각의 경우의 R7 및 R7'는 동일하거나 상이할 수 있고, 독립적으로 수소, 알킬, 알케닐, 알키닐, 시클로알킬, 시클로알킬알킬, 시클로알케닐, 아릴, 아릴알킬, 헤테로아릴, 헤테로시클릭 고리, 헤테로시클릴알킬, 또는 헤테로아릴알킬이고;각각의 경우의 R8은 독립적으로 니트로, 히드록시, 시아노, 포르밀, 아세틸, 할로겐, 아미노, 알킬, 알콕시, 알케닐, 알키닐, 시클로알킬, 시클로알킬알킬, 시클로알케닐, 아릴, 아릴알킬, 헤테로아릴, 헤테로시클릭 고리, 헤테로시클릴알킬, 또는 헤테로아릴알킬이고;n은 1-4의 정수이고, m은 0-4의 정수이며, 단 R4 및 R5가 이들이 결합되어 있는 원자와 함께 3-7원 질소 함유 고리를 형성할 때, n + m ≤ 4이다.

USE OF SUBSTITUTED 2,3-DIHYDROIMIDAZO[1,2-C]QUINAZOLINESThe present invention relates to : - use of a 2,3-dihydroimidazo[1,2-c]quinazoline compound, or of a pharmaceutical composition containing same, as a sole active agent, or of a combination of a) said compound or a pharmaceutical composition containing said compound and b) one or more further active agents, for the preparation of a medicament for the treatment or prophylaxis of endometrial cancer (hereinafter abbreviated to "EC"), particularly 1st line, 2nd line, relapsed, refractory, type I or type II EC, or endometriosis; - combinations of a) said compound and b) one or more further active agents; - a pharmaceutical composition comprising said compound as a sole active agent for the treatment of endometrial cancer (hereinafter abbreviated to "EC"), particularly 1st line, 2nd line, relapsed, refractory, type I or type II EC, or endometriosis; - a pharmaceutical composition comprising a combination of a) said compound and b) one or more further active agents; - use of biomarkers which is the loss of tumor suppressor PTEN or FBXW7, for predicting the sensitivity and/or resistance of a cancer patient to said compound and providing a rationale-based dosage to increase sensitivity and/or to overcome resistance; - a method of determining the loss of tumor suppressor PTEN or FBXW7; and - a method for determining perturbations in PIK3CA, PIK3CB, PIK3CD, PIK3CG, PIK3R1, PIK3R2, PIK3R3, PIK3R4, PIK3R5, FGFR1, FGFR2, FGFR3 and/or FGFR4.Use of a 2,3-dihydroimidazo[l,2-c]quinazoline compound of general formula :(I) a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof, which :Ri represents -(CH2)n-(CHR4)-(CH2)m-N(R5)(R5') ;R2 represents a heteroaryl optionally substituted with 1, 2 or 3 R6 groups ; R3 represents alkyl or cycloalkyl ;R4 represents hydrogen, hydroxy or alkoxy ;R5 and R5' may be the same or different and are independently, hydrogen, alkyl, cycloalkylalklyl, or alkoxyalkyl or R5 and R5' may be taken together with the nitrogen atom to which they are bound to form a 3-7 membered nitrogen containing heterocyclic ring optionally containing at least one additional heteroatom selected from oxygen, nitrogen or sulfur and which may be optionally substituted with 1 or more R6' groups, or R4 and may be taken together with the atoms to which they are bound to form a 5-6 membered nitrogen containing heterocyclic ring optionally containing 1 or more nitrogen, oxygen or sulfur atoms and which may be optionally substituted with 1 or more R6' groups; each occurrence of R6 may be the same or different and is independently halogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylalklyl, aryl, arylalkyi, heteroaryl, heteroarylalkyl, heterocyclic ring, heterocyclylalkyi, alkyl-OR7, alkyl- SR7, alkyl-N(R7)(R7'), alkyl-COR7,-CN, -COOR7, -CON(R7)(R7'), -OR7, -SR7, -N(R7)(R7'), or -NR7COR7 each of which may be optionally substituted with 1 or more R8 groups; each occurrence of R6' may be the same or different and is independently alkyl, cycloalkylalklyl, or alkyl-OR7; each occurrence of R7 and R7' may be the same or different and is independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylalklyl, cycloalkenyl, aryl, arylalkyi, heteroaryl, heterocyclic ring, heterocyclylalkyi, or heteroarylalkyl; each occurrence of R8 is independently nitro, hydroxy, cyano, formyl, acetyl, halogen, amino, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkylalklyl, cycloalkenyl, aryl, arylalkyi, heteroaryl, heterocyclic ring, heterocyclylalkyi, or heteroarylalkyl; n is an integer from 1-4 and m is an integer from 0-4 with the proviso that when when R4 and R5 are taken together with the atoms to which they are bound to form a 3-7 membered nitrogen containing ring, n + m≤ 4 ; as a sole active agent,or of a pharmaceutical composition containing such a compound or a physiologically acceptable salt, solvate, hydrate or stereoisomer thereof, for the preparation of a medicament for the treatment or prophylaxis of endometrial cancer (hereinafter abbreviated to "EC"), particularly 1st line, 2nd line, relapsed, refractory, type I or type II EC, or endometriosis.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

흑색종 및 기타암 치료용 트리페닐메틸포스포네이트 에스테르 함유 포스포러스 화합물 세포내 암의 치료 및 아폽토시스 조절을 위한 화합물 및 합성 방법, 및 화합물과 결합 치료제의 용도가 개시된다. 특히 포스포네이트 에스테르가 개시된다. 화합물, 화합물의 제조방법, 약물 및 약물의 제조방법, 및 유방암, 흑색종, 대장암, 백혈병 및 림프종, 및 기타 암 세포를 포함하는 암에 대한 적용처에 대한 치료요법이 개시된다. 하기 화학식 FX1을 갖는 화합물: [이미지] (여기서: 아릴 고리 A, B 및 C는 서로 독립적으로, 1 혹은 2개의 탄소 원자가 질소로 대체되고 하나 이상의 고리 탄소 상에 임의 치환된 페닐 고리 혹은 6멤버 방향족 고리로 이루어지는 그룹으로부터 선택되며; XA, XB, XC는 하나 이상의 수소 혹은 할로겐, 하이드록사이드, 알킬, 알케닐, 알키닐, 알콕사이드, 티올, 티오알콕사이드, 에테르, 티오에테르, 니트로, 시아노, 이소시아노, 시아나토, 이소시아나토, 티오시아노, 이소티오시아노, 아민 (-N(R')2), R'-CO-, R'O-CO-, (R')2N-CO-, R'O-COO-, (R')2N-COO-, (R')2N-CONR', R'SO2-, R'NSO2- 기로 이루어진 그룹으로부터 독립적으로 선택된 비-수소 고리 치환체이고, 여기서 이들 치환체 그룹중 탄소 원자는 하나 이상의 할로겐, 하이드록사이드, 티올, 니트로 기, 시아노 기, 이소시아노 기, 시아나토 기, 이소시아나토 기, 티오시아나토 기, 혹은 이소티오시아노 기로 임의 치환되며, 여기서 R'은 분자내 다른 R'과 독립적으로, H, 알킬, 알케닐, 알키닐, 헤테로시클릭, 아릴, 헤테로아릴로부터 선택되며, 이들 모두는 하나 이상의 할로겐, 하이드록사이드, 알킬, 알케닐, 알키닐, 알콕사이드, 티올, 티오알콕사이드, 에테르, 티오에테르, 니트로, 시아노, 이소시아노, 시아나토, 이소시아나토, 티오시아노, 이소티오시아노, 아민 (-N(R')2), R"CO-, R"O-CO-, (R")2N-CO-, R"O-COO-, (R")2N-COO-, (R")2N-CONR", R"SO2-, 혹은 R"2NSO2- 기로 임의 치환되며, 여기서 R"은 분자내 다른 R"와는 독립적으로, 하나 이상의 할로겐, 알킬, 알케닐, 알키닐, 아릴, 하이드록사이드, 티올, 니트로 기, 시아노 기, 이소시아노 기, 시아나토 기, 이소시아나토 기, 티오시아나토 기, 혹은 이소티오시아노 기로 임의 치환된 수소, 알킬, 알케닐, 알키닐, 헤테로시클릭, 아릴, 혹은 헤테로아릴 기로 이루어진 그룹으로부터 선택되며; 여기서 XA, XB, XC 치환체는 아릴 A, B 혹은 C 고리중 2종간 결합 분획을 임의로 포함하며, 여기서 상기 결합 분획은 -O-, -S-, -NH-, 혹은 -CR2"'-로부터 선택되며, 여기서 각 R"'는 어떠한 다른 R"'과는 독립적으로, H 혹은 1-6개의 탄소 원자를 갖는 알킬 기로 이루어진 그룹으로부터 선택되며; OR2는 할로겐, 바람직하게는 클로라이드 혹은 플루오라이드인 Y로 임의 대체되며; R1 및 R2는 서로 독립적으로, 하나 이상의 할로겐, 하이드록사이드, 알킬, 알케닐, 알키닐, 알콕사이드, 티올, 티오알콕사이드, 에테르, 티오에테르, 아민 (-N(R')2), 니트로, 시아노, 이소시아노, 시아나토, 이소시아나토, 티오시아노, 이소티오시아노, R'-CO-, R'O-CO-, (R')2N-CO-, R'O-COO-, (R')2N-COO-, (R')2N-CONR', R'SO2-, 혹은 R'2NSO2- 기로 임의 치환된 알킬, 알케닐, 알키닐, 에테르, 티오에테르, 헤테로시클릭, 아릴 혹은 헤테로아릴 기로 이루어지는 그룹으로부터 선택되며, 여기서 R'는 상술한 바와 같고,여기서 R1 및 R2는 화학식내 2가지 산소간 결합된 2개 이상의 탄소 원자를 갖고 차례로 인과 결합되는 임의 치환된 알킬렌 혹은 알케닐렌 (비라디칼) 기를 형성할 수 있고; 각 R은 분자내 다른 R과는 독립적으로, 수소, 하이드록사이드, 할로겐, 알킬, 알콕사이드로 이루어지는 그룹으로부터 선택되며, 여기서 이들 치환체 그룹중 탄소 원자는 하나 이상의 할로겐, 하이드록사이드, 티올, 니트로 기, 시아노 기, 이소시아노 기, 시아나토 기, 이소시아나토 기, 티오시아나토 기, 혹은 이소티오시아노 기로 임의 치환되며; 그리고 n은 0, 1, 2, 3, 4, 5 혹은 6이다.)

Phosphorous containing compounds including triphenylmethylphosphonate esters for the treatment of melanoma and other cancersCompounds and related methods for synthesis, and the use of compounds and combination therapies for the treatment of cancer and modulation of apoptosis in cells are disclosed. Particularly disclosed are phosphonate esters. Compounds, methods of making the compounds, medicaments and method of manufacture of medicaments and therapeutic methods with applications against cancer including breast cancer, melanoma, colon cancer, leukemia and lymphoma, and other cancer cells are described.The compound of a formula fx1:wherein:aromatic ring a, b and c independently of one another, are selected from wherein one or two carbon atom and are replaced by nitrogen and choose substituted phenyl ring or hexa-atomic aromatic rings on one or more ring carbon atoms wantonly;x a, x b, x crepresent one or more hydrogen or non-hydrogen ring substituents, this non-hydrogen ring substituents is independently selected from halogen, hydroxyl, alkyl, thiazolinyl, alkynyl, alkoxyl, sulfydryl, thio alkoxy, ether, thioether, nitro, cyano group, isocyano group, cyanato-, isocyanate group, thiocyano, isothiocyano, amine (n (r ') 2), r '-co-, r ' o-co-, (r ') 2n-co-, r ' o-coo-, (r ') 2n-coo-, (r ') 2n-conr ', r ' so 2-, r ' 2nso 2-group, wherein the carbon atom of these substituted radicals is optional by one or more halogens, hydroxyl, sulfydryl, nitro, cyano group, isocyano group, cyanato-, isocyanate group, thiocyano or isothiocyano replace, wherein r ' is independent of that other r ' are selected from h in the molecule, alkyl, thiazolinyl, alkynyl, heterocycle, aryl, heteroaryl, all these groups can be chosen wantonly again by one or more halogens, hydroxyl, alkyl, thiazolinyl, alkynyl, alkoxyl, sulfydryl, thio alkoxy, ether, thioether, nitro, cyano group, isocyano group, cyanato-, isocyanate group, thiocyano, isothiocyano, amine (n (r ') 2), r ' co-, r ' o-co-, (r ') 2n-co-, r ' o-coo-, (r ') 2n-coo-, (r ') 2n-conr ', r ' so 2-or r ' 2nso 2-group replaces, r wherein ' be independent of other r in the molecule ' being selected from hydrogen, alkyl, thiazolinyl, alkynyl, heterocycle, aryl or heteroaryl, it is optional to be replaced by one or more halogens, alkyl, thiazolinyl, alkynyl, aryl, hydroxyl, sulfydryl, nitro, cyano group, isocyano group, cyanato-, isocyanate group, thiocyano or isothiocyano; and x wherein a, x b, x creplace the optional coupling part that comprises among aromatic ring a, b or the c between two aromatic rings, wherein saidly connect part and be selected from-o-,-s-,-nh-or-cr 2' '-, each r wherein 2' ' be independent of arbitrarily other r ' ' be selected from h or have the alkyl of 1-6 carbon atom; or 2optional replaced by y, wherein y is halogen, preferably chlorine or fluorine; r 1and r 2be selected from alkyl, thiazolinyl, alkynyl, ether, thioether, heterocycle, aryl or heteroaryl independently of each other, these groups are optional by one or more halogens, hydroxyl, alkyl, thiazolinyl, alkynyl, alkoxyl, sulfydryl, thio alkoxy, ether, thioether, amine (n (r ') 2), nitro, cyano group, isocyano group, cyanato-, isocyanate group, thiocyano, isothiocyano, r '-co-, r ' o-co-, (r ') 2n-co-, r ' o-coo-, (r ') 2n-coo-, (r ') 2n-conr ', r ' so 2-or r ' 2nso 2-group replaces, wherein r ' definition r as above and wherein 1and r 2can form one together and be connected in this formula alkylidene or the alkenylene (double-basis) that optional substituted between two oxygen has 2 or a plurality of carbon atoms, described two oxygen are connected on the phosphorus again; each r is independent of that other r are selected from hydrogen, hydroxyl, halogen, alkyl, alkoxyl in the molecule, and wherein these substituent carbon atoms are optional is replaced by one or more halogens, hydroxyl, sulfydryl, nitro, cyano group, isocyano group, cyanato-, isocyanate group, thiocyano or isothiocyano;and n is 0,1,2,3,4,5 or 6.

20321

화학 살균ㆍ살충제 및 농업용 약제 제조업

특허

ko

en

제초제 화합물본 발명은 화학식 I의 화합물 또는 이들의 염 또는 N-옥사이드의 제초 유효량을 식물 또는 이의 서식지에 시용함을 포함하는, 식물의 방제 방법 또는 식물 성장의 억제 방법에 관한 것이다. 화학식 I 상기 화학식 I에서, A1, A2, A3, A4, R3, R4 및 R5는 제1항에서 정의한 바와 같다. 추가로, 본 발명은 화학식 I의 화합물의 제조방법, 화학식 I의 화합물의 제조에 사용되는 중간체, 화학식 I의 화합물을 포함하는 제초제 조성물, 및 특정한 신규 피리도피리딘, 피리도디아진 및 피리도트리아진에 관한 것이다.화학식 I의 화합물 또는 이들의 염 또는 N-옥사이드의 제초 유효량을 식물 또는 이의 서식지(locus)에 시용함을 포함하는, 식물의 방제 방법.화학식 I상기 화학식 I에서,A1, A2, A3 및 A4는 독립적으로 C-R1 또는 N이며, 단, A1, A2, A3 및 A4 중 하나 이상은 N이고, A1 및 A4가 둘 다 N인 경우, A2 및 A3은 둘 다 C-R1이 아니며;R1은 각각 독립적으로 수소, C1-C4알킬, C1-C4할로알킬, 할로, 시아노, 하이드록시, C1-C4알콕시, C1-C4알킬티오, 아릴 또는 동일하거나 상이할 수 있는 1 내지 5개의 R6에 의해 치환되는 아릴, 또는 헤테로 아릴 또는 동일하거나 상이할 수 있는 1 내지 5개의 R6에 의해 치환되는 헤테로아릴이고;R3은 수소, C1-C10알킬, C1-C4할로알킬, C2-C10알케닐, C2-C4할로알케닐, C2-C10알키닐, C2-C4할로알키닐, C3-C10사이클로알킬, C3-C10사이클로알킬-C1-C6알킬-, C1-C10알콕시-C1-C6알킬-, C1-C10시아노알킬-, C1-C10알콕시카보닐-C1-C6알킬-, N-C1-C3알킬-아미노카보닐-C1-C6알킬-, N,N-디-(C1-C3알킬)-아미노카보닐-C1-C6알킬-, 아릴-C1-C6알킬- 또는 아릴 잔기가 동일하거나 상이할 수 있는 1 내지 3개의 R7에 의해 치환되는 아릴-C1-C6알킬-, 또는 헤테로사이클릴-C1-C6알킬- 또는 헤테로사이클릴 잔기가 동일하거나 상이할 수 있는 1 내지 3개의 R7에 의해 치환되는 헤테로사이클릴-C1-C6알킬-이고;R4는 아릴, 또는 동일하거나 상이할 수 있는 1 내지 5개의 R8에 의해 치환되는 아릴, 또는 헤테로아릴 또는 동일하거나 상이할 수 있는 1 내지 4개의 R8에 의해 치환되는 헤테로아릴이고;R5는 하이드록시 또는, 대사되어 하이드록시 그룹으로 될 수 있는 그룹이고;R6, R7 및 R8은 각각 독립적으로 할로, 시아노, 니트로, C1-C10알킬, C1-C4할로알킬, C2-C10알케닐, C2-C10알키닐, 하이드록시, C1-C10알콕시, C1-C4할로알콕시, C1-C10알콕시-C1-C4알킬-, C3-C7사이클로알킬, C3-C7사이클로알콕시, C3-C7사이클로알킬-C1-C4알킬-, C3-C7사이클로알킬-C1-C4알콕시-, C1-C6알킬카보닐-, 포밀, C1-C4알콕시카보닐-, C1-C4알킬카보닐옥시-, C1-C10알킬티오-, C1-C4할로알킬티오-, C1-C10알킬설피닐-, C1-C4할로알킬설피닐-, C1-C10알킬설포닐-, C1-C4할로알킬설포닐-, 아미노, C1-C10알킬아미노-, 디-C1-C10알킬아미노-, C1-C10알킬카보닐아미노-, 아릴 또는 동일하거나 상이할 수 있는 1 내지 3개의 R13에 의해 치환되는 아릴, 헤테로 아릴 또는 동일하거나 상이할 수 있는 1 내지 3개의 R13에 의해 치환되는 헤테로아릴, 아릴-C1-C4알킬- 또는 아릴 잔기가 동일하거나 상이할 수 있는 1 내지 3개의 R13에 의해 치환되는 아릴-C1-C4알킬, 헤테로아릴-C1-C4알킬- 또는 헤테로아릴 잔기가 동일하거나 상이할 수 있는 1 내지 3개의 R13에 의해 치환되는 헤테로아릴-C1-C4알킬, 아릴옥시- 또는 동일하거나 상이할 수 있는 1 내지 3개의 R13에 의해 치환되는 아릴옥시-, 헤테로아릴옥시- 또는 동일하거나 상이할 수 있는 1 내지 3개의 R13에 의해 치환되는 헤테로아릴옥시-, 아릴티오- 또는 동일하거나 상이할 수 있는 1 내지 3개의 R13에 의해 치환되는 아릴티오-, 헤테로아릴티오- 또는 동일하거나 상이할 수 있는 1 내지 3개의 R13에 의해 치환되는 헤테로아릴티오-이고;R13은 각각 독립적으로 할로, 시아노, 니트로, C1-C6알킬, C1-C6할로알킬 또는 C1-C6알콕시이다.

HERBICIDAL COMPOUNDSThe present invention relates to a method of controlling plants or inhibiting plant growth which comprises applying to the plants or to the locus thereof a herbicidally effective amount of a compound of formula (I): wherein A1, A2, A3, A4, R3, R4 and R5 are as defined in claim 1; or a salt or N-oxide thereof. Furthermore, the present invention relates to processes for preparing compounds of formula (I), to intermediates used in the preparation of compounds of formula (I), to herbicidal compositions comprising compounds of formula (I) and to certain novel pyridopyridines, pyridodiazines and pyridotriazines.A method of controlling plants which comprises applying to the plants or to the locus thereof a herbicidally effective amount of a compound of formula (I) wherein A1, A2, A3 and A4 are independently C-R1 or N, provided at least one of A1, A2, A3 and A4 is N, and provided that if A1 and A4 are both N, A2 and A3 are not both C-R1; each R1 is independently hydrogen, Ci-C4alkyl, Ci-C4haloalkyl, halo, cyano, hydroxy, Ci-C4alkoxy, C]-C4alkylthio, aryl or aryl substituted by one to five R6, which may be the same or different, or heteroaryl or heteroaryl substituted by one to five R6, which may be the same or different;R3 is hydrogen, Ci-CiOalkyl, d-C4haloalkyl, C2-Ci0alkenyl, C2-C4haloalkenyl, C2-C10alkynyl, C2-C4haloalkynyl, C3-Ci0cycloalkyl, 03-Qocycloalkyl-d-Cόalkyl-, C1- C10alkoxy-Ci-C6alkyl-, Ci-Ciocyanoalkyl-, Ci-Cioalkoxycarbonyl-Ci-C6alkyl-, N-Ci- C3alkyl-aminocarbonyl-C1-C6alkyl-, N,Λ/-di-(Ci-C3alkyl)-aminocarbonyl-C]-C6alkyl-, aryl-Ci-Cόalkyl- or aryl-Ci-C6alkyl- wherein the aryl moiety is substituted by one to three R7, which may be the same or different, or heterocyclyl-Ci-C6alkyl- or heterocyclyl-Ci-C6alkyl- wherein the heterocyclyl moiety is substituted by one to three R7, which may be the same or different; R is aryl or aryl substituted by one to five R8, which may be the same or different, or heteroaryl or heteroaryl substituted by one to four R8, which may be the same or different;R5 is hydroxy or a group which can be metabolised to a hydroxy group; each R6, R7 and R8 is independently halo, cyano, nitro, Ci-CiOalkyl, Q-Qhaloalkyl, C2- Cioalkenyl, C2-C1oalkynyl, hydroxy, Cj-Cioalkoxy, Ci-C4haloalkoxy, C1-C1OaIkOXy-C1- C4alkyl-, C3-C7cycloalkyl, C3-C7cycloalkoxy, C3-C7cycloalkyl-Ci-C4alkyl-, C3-C7cycloalkyl-Ci-C4alkoxy-, Ci-C6alkylcarbonyl-, formyl, Ci-C4alkoxycarbonyl-, C1- C4alkylcarbonyloxy-, Q-Cioalkylthio-, Ci-C4haloalkylthio-, Ci-CiOalkylsulfinyl-, C1- C4haloalkylsulfinyl-, C]-Ci0alkylsulfonyl-, C1-C4haloalkylsulfonyl-, amino, d- Cjoalkylamino-, di-d-Cioalkylamino-, Ci-Cioalkylcarbonylamino-, aryl or aryl substituted by one to three R13, which may be the same or different, heteroaryl or heteroaryl substituted by one to three R!3, which may be the same or different, aryl-Cj- C4alkyl- or aryl-C1-C4alkyl- wherein the aryl moiety is substituted by one to three R13, which may be the same or different, heteroaryl-Ci-C4alkyl- or heteroaryl-C]-C4alkyl- wherein the heteroaryl moiety is substituted by one to three R13, which may be the same or different, aryloxy- or aryloxy- substituted by one to three R13, which may be the same or different, heteroaryloxy- or heteroaryloxy- substituted by one to three R13, which may be the same or different, arylthio- or arylthio- substituted by one to three R13, which may be the same or different, or hetero arylthio- or heteroarylthio- substituted by one to three R13, which may be the same or different; and each R13 is independently halo, cyano, nitro, C!-C6alkyl, Ci-C6haloalkyl or Ci-C6alkoxy; or a salt or TV-oxide thereof.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

디아릴아민―함유 화합물 및 조성물, 및 스테로이드 호르몬핵 수용체의 조절제로서의 그들의 용도 디아릴아민 구조적 특성을 포함하는 화합물이 본원에 기재된다. 또한 상기 화합물의 제조 방법, 스테로이드 호르몬 핵 수용체의 활성을 조절하기 위한 상기 화합물의 사용 방법, 및 상기 화합물을 포함하는 제약 조성물 및 의약이 본원에 기재된다. 또한 스테로이드 호르몬 핵 수용체의 활성과 연관된 질환 또는 병을 치료 및/또는 예방하기 위한 상기 화합물, 제약 조성물 및 의약의 사용 방법이 본원에 기재된다.화학식 1의 구조를 갖는 화합물, 또는 그의 제약상 허용가능한 염, 제약상 허용가능한 N-옥시드, 제약상 활성 대사산물, 제약상 허용가능한 프로드러그, 또는 제약상 허용가능한 용매화물. [화학식 1] [이미지] 식 중, (a) A는 CR3=CR4, N=CR4, CR3=N, 또는 CR3R3'이고; Q는 CR5=CR6, N=CR6, CR5=N, 또는 CR6R6'이고; L은 CR9 또는 N이고; Z는 CR8 또는 N이고; (b) R1은 H, OH, NH2, SH, NO2, CN, 및 -L1-알킬, -L1-시클로알킬, -L1-헤테로알킬, -L1-할로알킬, -L1-아릴, -L1-헤테로시클로알킬, 및 -L1-헤테로아릴로부터 선택되는 임의로 치환된 잔기로 이루어지는 군으로부터 선택되고, 여기서 L1은 결합, O, NH, S, -C(O)-, -C(S)-, -C(O)O-, -C(O)NH-, -S(O)-, -S(O)2, 및 -S(O)NH-로부터 선택되고; 여기서 상기 임의의 치환기는 할로겐, OH, C1-6알킬, C1-6알콕시, 할로-C1-6알킬 및 할로-C1-6알콕시로부터 선택되고; (c) R2는 H 및 -L2-알킬, -L2-시클로알킬, -L2-헤테로알킬, -L2-할로알킬, -L2-아릴, -L2-헤테로시클로알킬, 및 -L2-헤테로아릴로부터 선택되는 임의로 치환된 잔기로 이루어지는 군으로부터 선택되고, 여기서 L2는 결합, -C(O)-, -C(S)-, -C(O)O-, -C(O)NH-, -S(O)-, -S(O)2, 및 -S(O)NH-로부터 선택되고; 여기서 상기 임의의 치환기는 할로겐, OH, C1-6알킬, C1-6알콕시, 할로-C1-6알킬, 할로-C1-6알콕시, 아릴, 할로 아릴, 및 헤테로아릴로부터 선택되고; R3, R3', R4, R5, R6, R6', R8 및 R9은 H, 할로겐, OH, NH2, SH, NO2, CN, 및 -L3-알킬, -L3-시클로알킬, -L3-헤테로알킬, -L3-할로알킬, -L3-아릴, -L3-헤테로시클로알킬, 및 -L3-헤테로아릴로부터 선택되는 임의로 치환된 잔기로부터 독립적으로 선택되고, 여기서 L3는 결합, O, NH, S, -C(O)-, -C(S)-, -C(O)O-, -C(O)NH-, -S(O)-, -S(O)2, 및 -S(O)NH-로부터 선택되고; 여기서 상기 임의의 치환기는 할로겐, OH, C1-6알킬, C1-6알콕시, 할로-C1-6알킬 및 할로-C1-6알콕시로부터 선택되고; R2 및 R3는 함께 임의로 치환된 4 내지 8-원 고리를 형성하고; 여기서 고리는 헤테로시클릭, 시클로알킬, 또는 아릴이고; (d) R7은 H, 할로겐, 및 -L4-H, -L4-알킬, -L4-시클로알킬, -L4-헤테로알킬, -L4-할로알킬, -L4-아릴, -L4-헤테로시클로알킬, 및 -L4-헤테로아릴로부터 선택되는 임의로 치환된 잔기로 이루어지는 군으로부터 선택되고, 여기서 L4는 결합, O, NH, OCH2, NHCH2, S, C1-C6알킬렌, -C(O)-, -C(S)-, -C(O)O-, -C(O)NH-, -S(O)-, -S(O)2, 및 -S(O)NH-로부터 선택되고; 여기서 상기 임의의 치환기는 H, 할로겐, 시아노, OH, C1-C6알킬, C1-C6할로알킬, C1-6알콕시, 할로-C1-6알콕시, C1-C4티오알킬, C1-C4티오알콕시 아릴, 아릴, 할로 아릴, 헤테로아릴, 할로 헤테로아릴, 및 NR10R11으로부터 선택되고; (e) R10 및 R11은 C1-C6알킬 및 C1-C6할로알킬로부터 독립적으로 선택되거나, 또는 R10 및 R11은 함께 임의로 치환된 3 내지 8-원 헤테로시클릭 고리를 형성하고; (f) X는 O, NR2 또는 S이고; (g) Y는 N이되; 단, L이 N이고 Z가 C인 경우, 각 R1, R2, R3, R4, R5, R6, R7, R8 및 R9은 H가 아니다.

Diarylamine-containing compounds and compositions, and their use as modulators of steroid hormone nuclear receptorsDescribed herein are compounds that include a diarylamine structural feature. Also described herein are methods for making such compounds, methods for using such compounds to modulate the activity of steroid hormone nuclear receptors, and pharmaceutical compositions and medicaments comprising such compounds. Also described herein are methods of using such compounds, pharmaceutical compositions and medicaments to treat and/or prevent diseases or conditions associated with the activity of steroid hormone nuclear receptors.Have the compound or pharmaceutically acceptable salt thereof of formula (1) structure, pharmaceutically acceptable n-oxide, pharmaceutically active metabolite, pharmaceutically acceptable prodrug or acceptable solvent thingwherein,(a) a is cr 3=cr 4, n=cr 4, cr 3=n or cr 3r 3 'q is cr 5=cr 6, n=cr 6, cr 5=n or cr 6r 6 'l is cr 9or n; z is cr 8or n; (b) r 1be selected from h, oh, nh 2, sh, no 2, cn and optional replace be selected from following group :-l 1-alkyl ,-l 1-cycloalkyl ,-l 1-assorted alkyl ,-l 1-alkylhalide group ,-l 1-aryl ,-l 1-heterocyclylalkyl and-l 1-heteroaryl, wherein l 1be selected from key, o, nh, s ,-c (o)-,-c (s)-,-c (o) o-,-c (o) nh-,-s (o)-,-s (o) 2with-s (o) nh-; wherein said optional substituting group is selected from halogen, oh, c 1-6alkyl, c 1-6alkoxyl, halogen-c 1-6alkyl and halogen-c 1-6alkoxyl; (c) r 2be selected from h and optional replace be selected from following group :-l 2-alkyl ,-l 2-cycloalkyl ,-l 2-assorted alkyl ,-l 2-alkylhalide group ,-l 2-aryl ,-l 2-heterocyclylalkyl and-l 2-heteroaryl, wherein l 2be selected from key ,-c (o)-,-c (s)-,-c (o) o-,-c (o) nh-,-s (o)-,-s (o) 2with-s (o) nh-; wherein said optional substituting group is selected from halogen, oh, c 1-6alkyl, c 1-6alkoxyl, halogen-c 1-6alkyl, halogen-c 1-6alkoxyl, aryl, halogen aryl and heteroaryl; r 3, r 3 ', r 4, r 5, r 6, r 6 ', r 8and r 9be independently selected from h, halogen, oh, nh 2, sh, no 2, cn and optional replace be selected from following group :-l 3-alkyl ,-l 3-cycloalkyl ,-l 3-assorted alkyl ,-l 3-alkylhalide group ,-l 3-aryl ,-l 3-heterocyclylalkyl and-l 3-heteroaryl, wherein l 3be selected from key, o, nh, s ,-c (o)-,-c (s)-,-c (o) o-,-c (o) nh-,-s (o)-,-s (o) 2with-s (o) nh-; wherein said optional substituting group is selected from halogen, oh, c 1-6alkyl, c 1-6alkoxyl, halogen-c 1-6alkyl and halogen-c 1-6alkoxyl; r 2and r 3form optional 4 to 8 yuan of rings that replace together; wherein ring is heterocycle, cycloalkyl or aryl; (d) r 7be selected from h, halogen and optional replace be selected from following group :-l 4-h ,-l 4-alkyl ,-l 4-cycloalkyl ,-l 4-assorted alkyl ,-l 4-alkylhalide group ,-l 4-aryl ,-l 4-heterocyclylalkyl and-l 4-heteroaryl, wherein l 4be selected from key, o, nh, och 2, nhch 2, s, c 1-c 6alkylidene ,-c (o)-,-c (s)-,-c (o) o-,-c (o) nh-,-s (o)-,-s (o) 2with-s (o) nh-; wherein said optional substituting group is selected from h, halogen, cyano group, oh, c 1-c 6alkyl, c 1-c 6alkylhalide group, c 1- 6alkoxyl, halogen-c 1-6alkoxyl, c 1-c 4sulfane base, c 1-c 4thioalkoxy group aryl, aryl, halogen aryl, heteroaryl, halogen heteroaryl and nr 10r 11(e) r 10and r 11be independently selected from c 1-c 6alkyl and c 1-c 6alkylhalide group, perhaps r 10and r 11form optional 3 to 8 yuan of heterocycles that replace together; (f) x is o, nr 2or s; (g) y is n;condition be when l be n and z when being c, r 1, r 2, r 3, r 4, r 5, r 6, r 7, r 8and r 9not h separately.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

피리다지논계 화합물 또는 그의 염, 및 그것들을 함유하는 제초제바람직하지 않은 식물에 대한 현저한 제초 활성을 나타내는 신규 제초제를 제공한다. 일반식 (I):[이미지] (식 중, X는 -O-, -S-, -SO-, -SO2- 또는 -N(Y)-이고; Q는 Z로 치환되어도 되는 단환식 아릴, Z로 치환되어도 되는 단환식 헤테로아릴 등이고; Y는 수소 원자 또는 알킬이고; Z는 할로겐, 알킬 등이고; R1은 알킬, 알케닐 등이고; R2는 수소 원자, 알킬 등이고; R3은 할로겐, 히드록시 등이고; R4는 수소 원자, 알킬 등이고; n은 0 내지 4의 정수임)로 표시되는 피리다지논계 화합물 또는 그의 염.일반식 (I):[이미지](식 중,X는 -O-, -S-, -SO-, -SO2- 또는 -N(Y)-이고;Q는 Z로 치환되어도 되는 단환식 아릴, Z로 치환되어도 되는 단환식 헤테로아릴, Z로 치환되어도 되는 2환식 아릴 또는 Z로 치환되어도 되는 2환식 헤테로아릴이고;Y는 수소 원자 또는 알킬이고;R1은 알킬, 알케닐, 알키닐, 시클로알킬, 시클로알킬알킬, 할로알킬, Z로 치환되어도 되는 단환식 아릴, Z로 치환되어도 되는 단환식 아릴알킬, 알킬티오알킬, 알킬술피닐알킬, 알킬술포닐알킬, 디알킬아미노알킬, 알콕시알킬, 아미노, 니트로, 알킬카르보닐알킬, 알콕시카르보닐알킬 또는 히드록시카르보닐알킬이고;R2는 수소 원자, 알킬, 할로알킬, 시클로알킬, 할로겐, 알콕시, 알킬티오, 알킬술피닐, 알킬술포닐 또는 시아노이고;R3은 할로겐, 히드록시, 알킬, 할로알킬, 알케닐, 할로알케닐, 알키닐, 할로알키닐, 알콕시, 할로알콕시, 니트로, 아미노, 알킬카르보닐 또는 시클로알킬이고;R4는 수소 원자, 알킬, -C(O)R6, -C(S)R6, -SR7, -SOR7, -SO2R7, Z로 치환되어도 되는 단환식 아릴알킬, 알콕시알킬, -CH(J1)OCOOJ2, 알킬카르보닐알킬, Z로 치환되어도 되는 단환식 아릴, Z로 치환되어도 되는 단환식 아릴카르보닐알킬, 알케닐, 알콕시알콕시알킬, 알콕시카르보닐알킬, 알키닐, 시아노알킬, 할로알콕시알킬 또는 디알킬아미노알킬이고;R6은 알킬, 알콕시, 모르폴리노, 디알킬아미노, (Z로 치환되어도 되는 단환식 아릴)(알킬)아미노, 시클로알킬, 알콕시알킬, 알킬티오알킬, 할로알킬, 알킬티오, 알케닐, 알키닐, 알콕시카르보닐알킬, 시클로알킬알킬, 시아노알킬, 알콕시알콕시알킬, Z로 치환되어도 되는 단환식 아릴, Z로 치환되어도 되는 단환식 헤테로아릴, Z로 치환되어도 되는 단환식 아릴알킬, Z로 치환되어도 되는 단환식 아릴옥시, Z로 치환되어도 되는 단환식 아릴티오, Z로 치환되어도 되는 단환식 아릴옥시알킬, Z로 치환되어도 되는 단환식 아릴티오알킬, 알콕시카르보닐, 알콕시알콕시, 할로알콕시, 할로알콕시알콕시, 알킬티오알콕시, 시클로알콕시알콕시, Z로 치환되어도 되는 단환식 아릴알콕시, Z로 치환되어도 되는 단환식 아릴옥시알콕시, Z로 치환되어도 되는 단환식 헤테로아릴옥시알콕시, 알케닐옥시알콕시, 알콕시알콕시알콕시, 알키닐옥시, 알케닐옥시, 할로알케닐, 디알킬아미노알킬, 알킬티오알콕시알콕시, 시클로알킬알콕시, 시클로알킬알콕시알콕시, Z로 치환되어도 되는 단환식 아릴알콕시알콕시, Z로 치환되어도 되는 단환식 헤테로아릴알콕시알콕시 또는 Z로 치환되어도 되는 시클로알콕시이고;R7은 알킬, 할로알킬, 시클로알킬 또는 Z로 치환되어도 되는 단환식 아릴이고;Z는 할로겐, 알킬, 할로알킬, 알콕시, 할로알콕시, 시클로알킬, 시아노, 니트로, -C(O)OR5, 포르밀, 알킬티오, 알킬술피닐, 알킬술포닐, -CH=NOJ3 또는 디알킬아미노카르보닐이고;R5는 수소 원자 또는 알킬이고;J1은 수소 원자 또는 알킬이고;J2는 알킬 또는 시클로알킬이고;J3은 수소 원자, 알킬카르보닐 또는 알콕시알킬이고;n은 0 내지 4의 정수임)로 표시되는 피리다지논계 화합물 또는 그의 염.

PYRIDAZINONE-TYPE COMPOUND OR SALT THEREOF, AND HERBICIDE COMPRISING SAMEThe present invention provides the new herbicide that significant activity of weeding is shown to undesirable plant.Pyridazinone based compound or its salt shown in logical formula (I), (in formula, X is-O- ,-S- ,-SO- ,-SO2Or-N (Y)-；Q is the monocyclic aryl that can have Z substituent group, the monocyclic heteroaryl that can have Z substituent group etc.；Y is hydrogen atom or alkyl；Z is halogen, alkyl etc.；R1For alkyl, alkenyl etc.；R2For hydrogen atom, alkyl etc.；R3For halogen, hydroxyl etc.；R4For hydrogen atom, alkyl etc.；The integer that n is 0~4).Pyridazinone based compound or its salt shown in logical formula (i),in formula,x is-o- ,-s- ,-so- ,-so2or-n (y)-；q is the monocyclic aryl that can have z substituent group, the monocyclic heteroaryl that can have z substituent group, can have z and take the two ring type aryl of dai ji or the two ring type heteroaryls that can have z substituent group；y is hydrogen atom or alkyl；r1for alkyl, alkenyl, alkynyl, naphthenic base, cycloalkyl-alkyl, halogenated alkyl, the monocyclic aryl that can have z substituent group, it can have monocyclic aryl alkyl, alkylthio alkyl, alkylsulfinylalkyl, the alkylsulfonylalkyl, two of z substituent group alkylaminoalkyl group, alkoxyalkyl, amino, nitro, alkylcarbonylalkyl, alkoxy carbonyl alkyl or hydroxycarbonylalkyl；r2for hydrogen atom, alkyl, halogenated alkyl, naphthenic base, halogen, alkoxy, alkylthio group, alkyl sulphinyl, alkyl sulphonyl or cyano；r3for halogen, hydroxyl, alkyl, halogenated alkyl, alkenyl, halogenated alkenyl, alkynyl, halo alkynyl, alkoxy, halogenated alkoxy, nitro, amino, alkyl-carbonyl or naphthenic base；r4for hydrogen atom, alkyl ,-c (o) r6、-c(s)r6、-sr7、-sor7、-so2r7, can have z substituent group monocyclic virtue base alkyl, alkoxyalkyl ,-ch (j1)ocooj2, alkylcarbonylalkyl, the monocyclic aryl that can have z substituent group, can be with monocyclic aryl alkyl carbonyl, alkenyl, alkoxy alkoxy alkyl, alkoxy carbonyl alkyl, alkynyl, cyanogen with z substituent group base alkyl, halogenated alkoxy alkyl or dialkyl aminoalkyl；r6for alkyl, alkoxy, morpholino, dialkyl amido, (the monocyclic aryl that can have z substituent group) (alkyl) amino, naphthenic base, alkoxyalkyl, alkylthio alkyl, halogenated alkyl, alkylthio group, alkenyl, alkynyl, alkoxy carbonyl alkyl, naphthenic base alkyl, alkoxy alkoxy alkyl, the monocyclic aryl that can have z substituent group, can have z substituent group at cyanoalkyl monocyclic heteroaryl, the monocyclic aryl alkyl that can have z substituent group, the monocyclic aryloxy group that can have z substituent group, can with with z substituent group monocyclic arylthio, can have z substituent group monocyclic aryloxy alkyl, can have z substituent group monocyclic arylthio alkyl, alkoxy carbonyl, alkyloxy-alkoxy, halogenated alkoxy, halogenated alkoxy alkoxy, alkylthio group alkoxy, naphthene oxy alkoxy, the monocyclic alkoxy aryl that can have z substituent group, the monocycle that can have z substituent group formula aryloxy group alkyl oxygroup, the monocyclic heteroaryloxy alkoxy that can have z substituent group, alkenyl oxygroup alkoxy, alkoxy alkane oxygroup alkoxy, alkynyl oxygroup, alkenyl oxygroup, halogenated alkenyl, dialkyl aminoalkyl, alkylthioalkoxy alkoxy, cycloalkanes base alkoxy, the monocyclic alkoxy aryl alkoxy that can have z substituent group, can have z at cycloalkyl alkoxy alkoxy the monocyclic heteroarylalkoxy alkoxy of substituent group or the cycloalkyloxy that can have z substituent group；r7for alkyl, halogenated alkyl, naphthenic base or the monocyclic aryl that can have z substituent group；z is halogen, alkyl, halogenated alkyl, alkoxy, halogenated alkoxy, naphthenic base, cyano, nitro ,-c (o) or5, formoxyl, alkylthio group, alkyl sulphinyl, alkyl sulphonyl ,-ch=noj3or dialkyl amino carbonyl；r5for hydrogen atom or alkyl；j1for hydrogen atom or alkyl；j2for alkyl or cycloalkyl；j3for hydrogen atom, alkyl-carbonyl or alkoxyalkyl；the integer that n is 0~4.

20321

화학 살균ㆍ살충제 및 농업용 약제 제조업

특허

ko

en

제초 효과를 갖는 3-아미노카르보닐/3-아미노티오카르보닐 치환된 2-벤조일-시클로헥산-1,3-디온본 발명은 하기 화학식 I(여기에서, R1 및 R2는 수소, 니트로, 할로겐, 시아노, 로다노, 알킬, 할로겐 알킬, 알콕시알킬, 알케닐, 알키닐, -OR5, -OCOR6, -OSO2R6, -SH, -S(O)nR7, -SO2OR5, -SO2NR5R8, -NR8SO2R6 또는 -NR8COR6이며; R3은 수소, 알킬, 할로겐 알킬 또는 알키닐이며; R4는 수소, 임의로 치환된 알킬, 시클로알킬, 알케닐, 시클로알케닐, 알키닐, -COR9, -CO2R9, -COSR9 또는 -CONR8R9이며; X는 산소 또는 황이며; m은 0 또는 1이며; n은 0, 1 또는 2이며; R5는 수소, 알킬, 할로겐 알킬, 알콕시알킬, 알케닐 또는 알키닐이며; R6은 알킬 또는 할로겐 알킬이며; R7은 알킬, 할로겐 알킬, 알콕시알킬, 알케닐 또는 알키닐이며; R8은 수소 또는 알킬이며; R9는 알킬, 알케닐, 알키닐, 페닐 또는 벤질이며; R10은 알킬, 할로겐 알킬, 알케닐 또는 알키닐이며; Q는 2위치에서 연결된 임의로 치환된 시클로헥산-1,3-디온 환이며; R3이 수소인 경우 m은 1임)의 2-벤조일-시클로헥산-1,3-디온에 관한 것이다. 또한, 농업에서 유용한 이들 화합물의 염; 화학식 I의 화합물의 제조 방법 및 이를 위한 중간체, 화학식 I의 화합물을 함유하는 약제 및 화학식 I의 화합물을 함유하는 상기 유도체 또는 약제의, 바람직하지 않은 식물 억제용 용도가 기재되어 있다. 〈화학식 I〉하기 화학식 I의 2-벤조일시클로헥산-1,3-디온 및 이의 농업적으로 유용한 염. 〈화학식 I〉 [이미지] 상기 식에서, R1 및 R2는 수소, 니트로, 할로겐, 시아노, 티오시아네이토, C1-6 알킬, C1-6 할로알킬, C1-6 알콕시-C1-6 알킬, C2-6 알케닐, C2-6 알키닐, -OR5, -OCOR6, -OSO2R6, -SH, -S(O)nR7, -SO2OR5, -SO2NR5R8, -NR8SO2R6 또는 -NR8COR6이며; R3은 수소, C1-6 알킬, C1-6 할로알킬, C3-6 알케닐 또는 C3-6 알키닐이며; R4는 수소, C1-6 알킬, C3-6 시클로알킬, C3-6 알케닐, C4-6 시클로알케닐, C3-6 알키닐, -COR9, -CO2R9, -COSR9 또는 -CONR8R9이며, 상기에 언급한 알킬, 시클로알킬, 알케닐, 시클로알케닐 및 알키닐 라디칼, 및 라디칼 -COR9, -CO2R9, -COSR9 및 -CONR8R9에서 R9는 부분적으로 또는 완전히 할로겐화될 수 있고(거나) 히드록실, 메르캅토, 아미노, 시아노, R10, -OR10, -SR10, -NR8R10, =NOR10, -OCOR10, -SCOR10, -NR8COR10, -CO2R10, -COSR10, -CONR8R10, C1-4 알킬이미노옥시, C1-4 알콕시아미노, C1-4 알킬카르보닐, C1-4 알콕시-C2-6 알콕시카르보닐, C1-4 알킬술포닐, 및 각각이 치환될 수 있는 헤테로시클릴, 헤테로시클릴옥시, 페닐, 페닐-C1-4 알킬, 헤타릴, 페녹시, 페닐-C1-4 알콕시 및 헤타릴옥시 군으로부터 선택된 1 내지 3개의 라디칼이 부착될 수 있으며; X는 산소 또는 황이며; Z는 산소 또는 NR8이며; m은 0 또는 1이며; n은 0, 1 또는 2이며; R5는 수소, C1-6 알킬, C1-6 할로알킬, C1-6 알콕시-C2-6 알킬, C3-6 알케닐 또는 C3-6 알키닐이며; R6은 C1-6 알킬 또는 C1-6 할로알킬이며; R7은 C1-6 알킬, C1-6 할로알킬, C1-6 알콕시-C2-6 알킬, C3-6 알케닐 또는 C3-6 알키닐이며; R8은 수소 또는 C1-6 알킬이며; R9는 C1-6 알킬, C3-6 알케닐, C3-6 알키닐, 페닐 또는 벤질이며; R10은 C1-6 알킬, C1-6 할로알킬, C3-6 알케닐 또는 C3-6 알키닐이며; Q는 2위치에서 연결된 비치환 또는 치환된 시클로헥산-1,3-디온 환이며; R3이 수소인 경우 m은 1이다.

3-aminocarbonyl/1-aminothiocarbonyl-substituted 2-benzoyl-cyclohexan-1,3-diones with herbicidal effectThe invention concerns 2-benzoyl-cyclohexan-1,3-diones of formula (I), in which R, R stand for hydrogen, nitro, halogen, cyano, rhodano, alkyl, halogen alkyl, alkoxyalkyl, alkenyl, alkinyl, -OR, -OCOR, -OSO2R, -SH, -S(O)nR, -SO2OR, -SO2NRR, -NRSO2R or -NRCOR; R stands for hydrogen, alkyl, halogen alkyl or alkinyl; R stands for hydrogen, optionally substituted alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkinyl, -COR, -CO2R, -COSR or -CONRR; X stands for oxygen or sulphur; m equals 0 or 1; n equals 0, 1 or 2; R stands for hydrogen, alkyl, halogen alkyl, alkoxyalkyl, alkenyl or alkinyl; R stands for alkyl or halogen alkyl; R stands for alkyl, halogen alkyl, alkoxyalkyl, alkenyl or alkinyl; R stands for hydrogen or alkyl; R stands for alkyl, alkenyl, alkinyl, phenyl or benzyl; R stands for alkyl, halogen alkyl, alkenyl or alkinyl; Q stands for optionally substituted cyclohexan-1,3-dione ring linked in position 2, whereas m equals 1 when R stands for hydrogen. Also relates to the processes and intermediate products for preparing the compounds of formula (I), agents containing the same and the use of these derivatives or agents containing the same for controlling undesirable plants.The salt that 2-2-benzoyl-cyclohexane-1 shown in the formula i, 3-two ketones and they are suitable on agricultural variable has to give a definition in the formula:r 1, r 2be hydrogen, nitro, halogen, cyano group, thiocyano, c 1-c 6-alkyl, c 1-c 6-haloalkyl, c 1-c 6-alkoxy-c 1-c 6-alkyl, c 2-c 6-alkenyl, c 2-c 6-alkynyl group ,-or 5,-ocor 6, oso 2r 6,-sh, s (o) nr 7,-so 2or 5,-so 2nr 5r 8,-nr 8so 2r 6or-nr 8cor 6r 3be hydrogen, c 1-c 6-alkyl, c 1-c 6-haloalkyl, c 3-c 6-alkenyl or c 3-c 6-alkynyl group; r 4be hydrogen, c 1-c 6-alkyl, c 3-c 6-cycloalkyl, c 3-c 6-alkenyl, c 4-c 6-cycloalkenyl group, c 3-c 6-alkynyl group ,-cor 9, co 2r 9,-cosr 9or-conr 8r 9, abovementioned alkyl, cycloalkyl, alkenyl, cycloalkenyl group and alkynyl group and-cor 9, co 2r 9,-cosr 9or-conr 8r 9r on the group 9may and/or be connected with 1 to 3 following group by halo part or complete: hydroxyl, sulfydryl, amino, cyano group, r 10,-or 10,-sr 10,-nr 8r 10,=nor 10,-ocor 10,-scor 10,-nr 8cor 10,-co 2r 10,-cosr 10,-conr 8r 10, c 1-c 4-alkyl imino oxygen base, c 1-c 4-alkoxy amino, c 1-c 4-alkyl-carbonyl, c 1-c 4-alkoxy-c 2-c 6-carbalkoxy, c 1-c 4-alkyl sulphonyl, heterocyclic radical, heterocyclic oxy group, phenyl, phenyl-c 1-c 4-alkyl, heteroaryl, phenoxy group, phenyl-c 1-c 4-alkoxyl group and heteroaryloxy, back 8 groups may be substituted again; x is oxygen or sulphur;z is oxygen or nr 8m is 0 or 1;n is 0,1 or 2;r 5be hydrogen, c 1-c 6-alkyl, c 1-c 6-haloalkyl, c 1-c 6-alkoxy-c 2-c 6-alkyl, c 3-c 6-alkenyl or c 3-c 6-alkynyl group; r 6be c 1-c 6-alkyl or c 1-c 6-haloalkyl; r 7be c 1-c 6-alkyl, c 1-c 6-haloalkyl, c 1-c 6-alkoxy-c 2-c 6-alkyl, c 3-c 6-alkenyl or c 3-c 6-alkynyl group; r 8be hydrogen or c 1-c 6-alkyl; r 9be c 1-c 6-alkyl, c 3-c 6-alkenyl, c 3-c 6-alkynyl group, phenyl or benzyl; r 10be c 1-c 6-alkyl, c 1-c 6-haloalkyl, c 3-c 6-alkenyl or c 3-c 6-alkynyl group; q be one unsubstituted or substituent hexanaphthene-1 is arranged, 3-diketone ring, it links to each other by 2 with parent;in the formula if r 3be hydrogen, then m is 1.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

ｍＧｌｕ５ 길항제로서의 신규 헤테로 고리 화합물하기 화학식으로 표현되는 화합물 I에 있어서, Z는 하기 화학식들 중 하나로 표현될 수 있는 것이며, m은 0, 1 또는 2이고, n은 0 , 1 또는 2이고, Y는 연결기이거나 부존재 하는 것이며; R'는 H이거나 OH이거나 부존재하는 것이고; ------는 선택적인 이중결합을 나타내며; R1, R2 및 R3은 선택적으로 치환되는 광범위의 알킬, 사이클로알킬, 아릴 및 헤테로고리기으로부터 선택된다. 화합물 I은 mGlu5 길항제로, 포유동물에서의 하부요로의 신경근육 기능장애(neuromuscular dysfunction), 편두통, 위식도 역류성 장애의 치료에 유용하다. 바람직한 화합물 I은 상기 화학식으로 표현되는 것을 갖는 것이다.하기 일반 화학식 I을 갖고, [이미지] (I)여기에서, R'는 수소원자 또는 하이드록시기 또는 부존재하는 것이며;Z는 하기 식의 군을 나타내며;[이미지]또는[이미지]X'은 산소 원자 또는 메틸렌기를 나타내며;R1은,- 수소 또는 할로겐 원자,- 하이드록시기, 시아노, 페닐, C1-C6의 알킬, C1-C6의 알킬카르보닐, C1-C6의 알콕시, C1-C6 알콕시카르보닐, C1-C6 알킬카르보닐옥시, C1-C6의 알콕시카르보닐옥시, C1-C6의 알킬티오, 디-(C1-C6의 알킬)-아미노 또는 C3-C4의 사이클로알킬기, 또는- 질소, 산소 및 황으로부터 선택된 1 내지 3개의 헤테로 원자를 함유하는, 선택적으로 치환된 C1-C9의 헤테로고리기이며;Ra는 수소원자 또는 C1-C6의 알킬기 또는 부존재하는 것이고;R2는,- 질소, 산소 및 황으로부터 선택된 1 내지 3개의 헤테로원자를 함유하는, 선택적으로 치환된 일환형 또는 이환형의 C1-C9의 헤테로고리기,- 선택적으로 치환된 일환형, 이환형 또는 삼환형의 C6-C14의 아릴기,- 선택적으로 치환된 C1-C6의 알킬기 ,- 선택적으로 치환된 C2-C6의 알케닐기, 또는-선택적으로 치환된 C3-C6의 사이클로알킬기, 또는 R2는 R2A가 상기 R2로 정의되는 것인 -C(O)-R2A기이며;R3은,- 수소원자,- 선택적으로 치환된 C1-C6의 알킬기,- 질소, 산소 및 황으로부터 선택된 1 내지 3의 헤테로원자를 함유하는, 선택적으로 치환된 일환형, 이환형 또는 삼환형의 C1-C14의 헤테로고리기,- 선택적으로 치환된 일환형, 이환형 또는 삼환형의 C6-C14의 아릴기,- 선택적으로 친환된 C3-C6의 사이클로알킬기, 또는- 선택적으로 치환된 C3-C6의 사이클로알케닐기이며, Y는 화학식 -C(O)- , -C(S)- , -NH-C(O)-, N(C1-C6 알킬)-C(O)- ,-O-C(O)-, NH-C(S)-, -N(C1-C6 알킬)-C(S)-, -O-C(S)- 또는 -SO2- 또는 부존재하는 것이며, m 은 O, 1 또는 2;n은 0, 1 또는 2; -----은 선택적으로 이중결합; 및 [이미지]은 질소 함유 고리에의 부착하는 지점을 나타내며;각각의 선택적으로 치환된 기에 대한 치환기(substituents)로서, - 할로겐원자 또는 옥소, 니트로, 시아노, 하이드록시, 카바모일기, C1-C6 알킬설포닐, C1-C6 알킬티오, C1-C6 알킬카르보닐 또는 C1-C6 알킬카르보닐-(C1-C6)알킬기 또는 각 R*이 독립적으로 수소원자, C1-C6의 알킬, C1-C6의 알킬카르보닐, 페닐 또는 벤질기를 나타내는 화학식 -NR*R*, 또는- C1-C6 알킬, C2-C6 알케닐, C2-C6 알키닐 또는 C1-C6 알콕시기, 선택적으로 1 내지 8의 독립적으로 선택되는 옥소, 할로, 시아노, 니트로, 아미노, 하이드록시 또는 페닐 치환기를 갖는 것, - 1 내지 3의 독립적으로 선택되는 C1-C6 알킬, 옥소, 할로, 시아노, 니트로, 아미노, 하이드록시 또는 페닐 치환기를 갖는 C3-C9의 일환형 또는 이환형 알킬기, 또는 - -A, -O-A, -C(O)-A, -(CH2)q-A, -NR**-A, -C(0)NR**-A, - NR**C(0)-A or -OC(O)-A 의 화학식으로 표현되는 것으로서, 여기에서 A는, 질소, 산소 또는 황에서 선택되는 1 내지 3의 헤테로원자를 함유하는 페닐기 또는 C1-C8의 헤테로고리기이며, 각각에서, A는 선택적으로 1 내지 3의 독립적으로 선택되는 할로, 하이드록시, 시아노, 니트로 및 C1-C6 알킬 치환기를 갖는 것이며, 각각의 R**은 독립적으로, 수소원자 또는 C1-C6 알킬기이고, q는 0 또는 1 내지 6의 정수인, 화합물 또는 그의 거울상이성질체, 부분입체이성질체, N-산화물 또는 의약적으로 허용되는 이들의 염.

Novel heterocyclic compounds as mGlu5 antagonistsIn Compounds I: Z is a group of the formula, m is 0, 1 or 2; n is 0, 1 or 2; Y is a linking group or is absent; R' is H or OH or is absent; ---- is an optional double bond; and R1, R2 and R3 are selected from a wide range of optionally substituted alkyl, cycloalkyl, aryl and heterocyclic groups. Compounds I are mGlu5 antagonists useful for the treatment of neuromuscular dysfunction of the lower urinary tract, migraine and gastroesophagael reflux disease in mammals. Preferred Compounds I are those having the formula.The compound of general formula i or its enantiomorph, diastereomer, n-oxide compound or pharmacy acceptable saltin the formula,r ' represents hydrogen atom or hydroxyl or does not exist;z represents the following formula groupx ' represention oxygen atom or methylene radical;r 1representative hydrogen or halogen atom,hydroxyl, cyano group, phenyl, c 1-c 6alkyl, c 1-c 6alkyl-carbonyl, c 1-c 6alkoxyl group, c 1-c 6alkoxy carbonyl, c 1-c 6alkyl carbonyl oxy, c 1-c 6alkoxyl group carbonyl oxygen base, c 1-c 6alkylthio, two-(c 1-c 6alkyl)-amino or c 3-c 14cycloalkyl, or contain 1-3 c that is selected from the heteroatomic optional replacement of nitrogen, oxygen and sulphur 1-c 9heterocyclic group; r arepresent hydrogen atom or c 1-c 6alkyl or do not exist; r 2representative contain the list that 1-3 is selected from the heteroatomic optional replacement of nitrogen, oxygen and sulphur-or dicyclo c 1-c 9heterocyclic group; the optional list that replaces-, two-or three ring c 6-c 14aryl, the optional c that replaces 1-c 6alkyl, the optional c that replaces 2-c 6thiazolinyl, or the optional c that replaces 3-c 6cycloalkyl, or r 2represent group-c (o)-r 2a, r wherein 2adefinition and above-mentioned r 2identical; r 3representative hydrogen atom,the optional c that replaces 1-c 6alkyl, contain the list that 1-3 is selected from the heteroatomic optional replacement of nitrogen, oxygen and sulphur-, two-or three ring c 1-c 14heterocyclic group; the optional single, double or three ring c that replace 6-c 14aryl, the optional c that replaces 3-c 6cycloalkyl, or the optional c that replaces 3-c 6cycloalkenyl group, y represent shi-c (o)-,-c (s)-,-nh-c (o)-,-n (c 1-c 6alkyl)-c (o)-,-o-c (o)-,-nh-c (s)-,-n (c 1-c 6alkyl)-c (s)-,-o-c (s)-or-so 2-group or do not exist; m is 0,1 or 2;n is 0,1 or 2;the optional two keys of----representative; withthe tie point that contains azo-cycle shown in the representative; substituting group on each optional group that replaces is:halogen atom or oxo, nitro, cyano group, hydroxyl, carbamyl, c 1-c 6alkyl sulphonyl, c 1-c 6alkylthio, c 1-c 6alkyl-carbonyl or c 1-c 6alkyl-carbonyl-(c 1-c 6) alkyl or formula-nr *r *group, r wherein *represent hydrogen atom or c independently of one another 1-c 6alkyl, c 1-c 6alkyl-carbonyl, phenyl or benzyl, or c 1-c 6alkyl, c 2-c 6thiazolinyl, c 2-c 6alkynyl or c 1-c 6alkoxyl group randomly has oxo, halogen, cyano group, nitro, amino, hydroxyl or phenyl substituent that 1-8 independently selects separately, c 3-c 9single-or bicyclic alkyl, randomly have the c that 1-3 independently selects 1-c 6alkyl, oxo, halogen, cyano group, nitro, amino, hydroxyl or phenyl substituent, or formula-a ,-o-a ,-c (o)-a ,-(ch 2) q-a ,-nr *-a ,-c (o) nr *-a ,-nr *c (o)-a or-group of oc (o)-a, wherein a represents phenyl or contains 1-3 heteroatomic c that is selected from nitrogen, oxygen and sulphur 1-c 8heterocyclic group, each group a can randomly have halogen, hydroxyl, cyano group, nitro and the c that 1-3 independently selects 1-c 6alkyl substituent, r *represent hydrogen atom or c independently of one another 1-c 6alkyl and q is 0 or the integer of 1-6.

20111

석유화학계 기초 화학 물질 제조업

특허

ko

en

니트릴 화합물 및 절지동물 해충 방제를 위한 이의 용도하기 화학식 (I) 로 표시되는, 절지동물 해충에 대한 우수한 방제 효과를 갖는 니트릴 화합물이 제공된다: [식 중, m 은 0 내지 4 의 정수를 나타내고; n 은 1 내지 4 의 정수를 나타내고; q 는 0 내지 4 의 정수를 나타내고; Q 는 C1-C4 플루오로알킬기를 나타내고; Z 는 임의 치환되는 C2-C6 알키닐기 또는 =N-OR3 기를 나타내고; R1 및 R2 는 독립적으로, 할로겐 원자로 임의 치환되는 1 가의 C1-C4 사슬 탄화수소기 등을 나타내고; A 는 임의 치환되는 1 가의 C1-C6 사슬 탄화수소기 등을 나타냄].하기 화학식 (I) 로 표시되는 니트릴 화합물:[식 중, m 은 0 내지 4 의 정수를 나타내고; n 은 1 내지 4 의 정수를 나타내고; q 는 0 내지 4 의 정수를 나타내고;Q 는 C1-C4 플루오로알킬기를 나타내고; Z 는 =N-OR3 기, 또는 그룹 L 로부터 선택되는 기로 임의 치환되는 C2-C6 알키닐기를 나타내고;R1 및 R2 는 독립적으로, -C(=G)R5, 시아노기, 할로겐 원자, 수소 원자, 또는 할로겐 원자로 임의 치환되는 1 가의 C1-C4 사슬 탄화수소기를 나타내고;A 는 -OR6, -SR6, -S(=O)R6, -S(=O)2R6, -C(=O)R7, -OC(=O)R8, 할로겐 원자, 시아노기, 히드록실기, 그룹 L 로부터 선택되는 기로 임의 치환되는 1 가의 C1-C6 사슬 탄화수소기, 또는 할로겐 원자로 임의 치환되는 C3-C6 시클로알킬기를 나타내고, q 가 2 이상인 경우에는 두 개의 A 가 함께 C2-C6 알칸디일기, C4-C6 알켄디일기, -G-, -G-T1-G-, 또는 -G-T1-G-T2- 를 임의로 형성하고;상기 C2-C6 알칸디일기 또는 상기 C4-C6 알켄디일기는 그룹 L 로부터 선택되는 기로 임의 치환되고; G 는 산소 원자 또는 황 원자를 나타내고;T1 및 T2 는 독립적으로, 메틸렌기 또는 C2-C6 알칸디일기를 나타내고;R3 은 수소 원자, 또는 할로겐 원자로 임의 치환되는 C1-C6 사슬 탄화수소기를 나타내고;R5 는 히드록실기, 아미노기, C2-C5 시클릭 아미노기, 수소 원자, 할로겐 원자로 임의 치환되는 C1-C4 알킬기, 할로겐 원자로 임의 치환되는 C1-C4 알콕시기, 할로겐 원자로 임의 치환되는 C3-C6 알케닐옥시기, 할로겐 원자로 임의 치환되는 C3-C6 알키닐옥시기, 할로겐 원자로 임의 치환되는 C1-C4 알킬아미노기, 또는 할로겐 원자로 임의 치환되는 디(C1-C4 알킬)아미노기를 나타내고;R6 은 할로겐 원자로 임의 치환되는 C1-C4 알킬기, 또는 할로겐 원자로 임의 치환되는 C3-C6 시클로알킬기를 나타내고;그룹 L 은 히드록실기, -N(R9)R10, C2-C5 시클릭 아미노기, -C(=O)R7, -OC(=O)R8, 할로겐 원자, 할로겐 원자로 임의 치환되는 C1-C4 알콕시기, 할로겐 원자로 임의 치환되는 C3-C6 알케닐옥시기, 및 할로겐 원자로 임의 치환되는 C3-C6 알키닐옥시기로 이루어지고;R7 은 히드록실기, C2-C5 시클릭 아미노기, 아미노기, 수소 원자, 할로겐 원자로 임의 치환되는 C1-C4 알콕시기, 할로겐 원자로 임의 치환되는 C3-C6 알케닐옥시기, 할로겐 원자로 임의 치환되는 C3-C6 알키닐옥시기, 할로겐 원자로 임의 치환되는 C1-C4 알킬아미노기, 할로겐 원자로 임의 치환되는 디(C1-C4 알킬)아미노기, 또는 할로겐 원자로 임의 치환되는 C1-C4 알킬기를 나타내고;R8 은 C2-C5 시클릭 아미노기, 아미노기, 수소 원자, 할로겐 원자로 임의 치환되는 C1-C4 알콕시기, 할로겐 원자로 임의 치환되는 C3-C6 알케닐옥시기, 할로겐 원자로 임의 치환되는 C3-C6 알키닐옥시기, 할로겐 원자로 임의 치환되는 C1-C4 알킬아미노기, 할로겐 원자로 임의 치환되는 디(C1-C4 알킬)아미노기, 또는 할로겐 원자로 임의 치환되는 C1-C4 알킬기를 나타내고;R9 및 R10 은 독립적으로, 수소 원자, 할로겐 원자로 임의 치환되는 C1-C4 알킬기, 할로겐 원자로 임의 치환되는 C3-C6 알케닐기, 할로겐 원자로 임의 치환되는 C3-C6 알키닐기, 할로겐 원자로 임의 치환되는 C3-C6 시클로알킬기, 또는 할로겐 원자로 임의 치환되는 페닐기를 나타냄].

NITRILE COMPOUND AND ITS USE FOR CONTROL OF ARTHROPOD PESTThere is provided a nitrile compound having an excellent controlling effect on arthropod pests represented by the formula (I): wherein m represents in integer of 0 to 4; n represents an integer of 1 to 4; q represents an integer of 0 to 4; Q represents a C1-C4 fluoroalkyl group; Z represents an optionally substituted C2-C6 alkynyl group or a =N-OR3 group; R1 and R2 independently represent a monovalent C1-C4 chain hydrocarbon group optionally substituted with a halogen atom, etc.; and A represents an optionally substituted monovalent C1-C6 chain hydrocarbon group, etc.A nitrile compound represented by the formula (I) : wherein m represents an integer of 0 to 4; n represents an integer of 1 to 4; q represents an integer of 0 to 4; Q represents a C1-C4 fluoroalkyl group; Z represents a =N-OR3 group, or a C2-C6 alkynyl group optionally substituted with a group selected from the group L;R1 and R2 independently represent -C(=G)R5, a cyano group, a halogen atom, a hydrogen atom, or a monovalent C1-C4 chain hydrocarbon group optionally substituted with a halogen atom; A represents -OR6, -SR6, -S(=O)R6, -S(=O)2R6, -C(=O)R7, -OC (=0) R8, a halogen atom, a cyano group, a hydroxyl group, a monovalent C1-C6 chain hydrocarbon group optionally substituted with a group selected from the group L, or a C3-C6 cycloalkyl group optionally substituted with a halogen atom, and when q is 2 or more, two A's optionally form together a C2-C6 alkanediyl group, a C4-C6 alkenediyl group, -G-, -G-T1-G-, or -G-T1-G-T2-; said C2-C6 alkanediyl group or said C4-C6 alkenediyl group is optionally substituted with a group selected from the group L;G represents an oxygen atom or a sulfur atom; T1 and T2 independently represent a methylene group or a C2-C6 alkanediyl group;R3 represents a hydrogen atom, or a C1-C6 chain hydrocarbon group optionally substituted with a halogen atom; R5 represents a hydroxyl group, an amino group, a C2-C5 cyclic amino group, a hydrogen atom, a C1-C4 alkyl group optionally substituted with a halogen atom, a C1-C4 alkoxy group optionally substituted with a halogen atom, a C3-C6 alkenyloxy group optionally substituted with a halogen atom, a C3-C6 alkynyloxy group optionally substituted with a halogen atom, a C1-C4 alkylamino group optionally substituted with a halogen atom, or a di (C1-C4 alkyl) amino group optionally substituted with a halogen atom; R6 represents a C1-C4 alkyl group optionally substituted with a halogen atom, or a C3-C6 cycloalkyl group optionally substituted with a halogen atom; the group L consists of a hydroxyl group, -N (R9) R10, a C2-C5 cyclic amino group, -C(=O)R7, -OC (=0) R8, a halogen atom, a C1-C4 alkoxy group optionally substituted with a halogen atom, a C3-C6 alkenyloxy group optionally substituted with a halogen atom, and a C3-C6 alkynyloxy group optionally substituted with a halogen atom;R7 represents a hydroxyl group, a C2-C5 cyclic amino group, an amino group, a hydrogen atom, a C1-C4 alkoxy group optionally substituted with a halogen atom, a C3-C6 alkenyloxy group optionally substituted with a halogen atom, a C3-C6 alkynyloxy group optionally substituted with a halogen atom, a C1-C4 alkylamino group optionally substituted with a halogen atom, a di (C1-C4 alkyl) amino group optionally substituted with a halogen atom, or a Cl- C4 alkyl group optionally substituted with a halogen atom; R8 represents a C2-C5 cyclic amino group, an amino group, a hydrogen atom, a C1-C4 alkoxy group optionally substituted with a halogen atom, a C3-C6 alkenyloxy group optionally substituted with a halogen atom, a C3-C6 alkynyloxy group optionally substituted with a halogen atom, a C1-C4 alkylamino group optionally substituted with a halogen atom, a di (C1-C4 alkyl) amino group optionally substituted with a halogen atom, or a C1-C4 alkyl group optionally substituted with a halogen atom; and R9 and R10 independently represent a hydrogen atom, a C1-C4 alkyl group optionally substituted with a halogen atom, a C3-C6 alkenyl group optionally substituted with a halogen atom, a C3-C6 alkynyl group optionally substituted with a halogen atom, a C3-C6 cycloalkyl group optionally substituted with a halogen atom, or a phenyl group optionally substituted with a halogen atom.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

피리딘-피리디논 유도체, 그의 제조법 및 치료 용도본 발명은 (i) 하기 화학식 I을 갖는 피리딘-피리디논 유도체에 관한 것이다. <화학식 I> 상기 식에서, R1은 수소 원자 또는 (C1-C4)알킬 기이고; R2는 (CH2)n-B 기이고, 여기서 n' = 0, 1, 2, 3 또는 4이고, B는 (C3-C5)시클로알킬 기, (C1-C4)알킬 기 또는 (C1-C4)알콕시 기이고; Y, Z, V 및 W는 서로 독립적으로 -CH- 기, 탄소 원자, 헤테로원자이거나 원자가 존재하지 않고, V, W, Y 및 Z를 포함하는 고리는 5 또는 6개의 구성원을 포함하는 고리인 것으로 이해되고, 상기 고리 중 점선은 생성된 고리가 방향족 고리인 것을 나타내는 것으로 이해되고, 상기 고리는 0, 1 또는 2개의 헤테로원자를 포함하는 것으로 이해되고; R3 및 R4는 서로 독립적으로 수소 원자 및 직쇄 (C1-C4)알킬 기 중에서 선택된 동일하거나 상이한 기이거나, 또는 이들이 결합된 탄소와 함께 (C3-C5)시클로알킬 기를 형성하고; m은 1, 2, 3 또는 4의 정수이고; R5는 수소 원자 또는 (C1-C4)알킬 기이고; R6은 (CH2)n-L 기 (여기서, n = 0, 1, 2 또는 3이고, L은 6개의 탄소 원자를 갖는 아릴, 5 또는 6개의 구성원을 갖는 헤테로아릴, 5, 6 또는 7개의 구성원을 포함하는 포화 헤테로사이클 중에서 선택된 기임)이거나, 또는 이들이 연결된 질소 원자와 함께 헤테로사이클 기를 형성한다. 또한, 본 발명은 (ii) 상기 유도체의 제조, 및 (iii) PDGF 리간드를 갖는 수용체 및/또는 FLT3 리간드를 갖는 수용체에서 키나제 활성 억제제로서의 그의 치료 용도에 관한 것이다.염기 형태 또는 산 부가염 형태 및/또는 용매화물 형태의 하기 화학식 I에 상응하는 화합물, 그의 거울상이성질체 및 부분입체이성질체 및 이들의 혼합물.<화학식 I>[이미지]상기 식에서, R1은 수소 원자 또는 (C1-C4)알킬 기를 나타내고;R2는 기 -(CH2)n'-B를 나타내고, 여기서 n' = 0, 1, 2, 3 또는 4이고; B는 (i) (C3-C5)시클로알킬 기 또는 (C1-C4)알킬 기 (상기 기는 1개 이상의 플루오린 원자로 임의로 치환됨) 또는 (ii) (C1-C4)알콕시 기를 나타내고;Y, Z, V 및 W는 서로 독립적으로 -CH- 기, (C1-C4)알킬 기 또는 할로겐 원자를 나타내는 기 R7로 임의로 치환된 탄소 원자, 헤테로원자, 예컨대 질소 원자, 황 원자 또는 산소 원자, 또는 원자 없음을 나타내고,V, W, Y 및 Z가 포함된 고리는 5 또는 6개의 고리원을 포함하는 고리인 것으로 이해되고, 상기 고리 중 점선은 생성된 고리가 방향족 고리인 것을 나타내는 것으로 이해되고, 상기 고리는 0, 1 또는 2개의 헤테로원자를 포함하는 것으로 이해되고;R3 및 R4는 서로 독립적으로 동일하거나 상이할 수 있는 기를 나타내고, R3 및 R4는 수소 원자; 및 선형 (C1-C4)알킬 기로부터 선택되거나; 또는 R3 및 R4는, 이들이 결합된 탄소와 함께, (C3-C5)시클로알킬 기를 형성하고;m은 1, 2, 3 또는 4의 정수이고;R5는 수소 원자 또는 (C1-C4)알킬 기를 나타내고;R6은 기 -(CH2)n-L을 나타내고, 여기서 n = 0, 1, 2 또는 3이고, L은 하기 기:○ 6개의 탄소 원자를 포함하는 아릴;○ 5 내지 6개의 고리원을 포함하고, 질소, 산소 및 황으로부터 선택된 1개 이상의 헤테로원자를 포함하는 헤테로아릴;○ 5, 6 또는 7개의 고리원을 포함하고, 질소 및 산소로부터 선택된 1개 이상의 헤테로원자를 포함하는 포화 헤테로사이클 (상기 헤테로사이클은 임의로 락탐임)로부터 선택된 기이고,상기 아릴, 헤테로아릴 또는 헤테로시클릭 기는 (i) 선형 또는 분지형 (C1-C4)알킬 기, (ii) (C3-C5)시클로알킬 기, (iii) 할로겐 원자, (iv) 아릴 및 (v) 벤질로부터 선택된 1개 이상의 치환기로 임의로 치환되고;L이 헤테로아릴 또는 헤테로사이클이며, 상기 헤테로아릴 또는 헤테로사이클이 1개 이상의 질소 원자를 포함하는 경우에, 후자가 상기 치환기로 임의로 치환될 수 있는 것으로 이해되고; 또는 R5 및 R6은, 이들이 결합된 질소 원자와 함께, 적어도 헤테로아릴, 또는 그 자체가, 5 또는 6개의 원자를 포함하고, 질소 및 산소로부터 선택된 1개 이상의 헤테로원자를 포함하는 헤테로사이클로 치환될 수 있는 (C1-C3)알킬 기 (그것이 1개 이상의 질소 원자를 포함하는 헤테로사이클인 경우에, 후자가 임의로 치환될 수 있는 것으로 이해됨)로 임의로 치환된 헤테로시클릭 기를 형성한다.

Pyridine-pyridinone derivatives, preparation and therapeutic use thereofThe invention relates (i) to pyridine-pyridinone derivatives with the formula (I): where R1 is a hydrogen atom or a (C1-C4)alkyl group; R2 is a (CH2)n-B group, in which n' = 0, 1, 2, 3 or 4 and B is a (C3-C5)cycloalkyl group, a (C1-C4)alkyl group or a (C1-C4)alkoxy group; Y, Z, V and W are, independently from one another, a -CH- group, a carbon atom, a heteroatom or no atom, with the understanding that the cycle, which includes V, W, Y and Z, is a cycle including 5 or 6 members, with the understanding that the dotted lines in said cycle indicate that the resulting cycle is an aromatic cycle and with the understanding that said cycle includes 0, 1 or 2 heteroatoms; R3 and R4 are, independently from one another, identical or different groups selected among a hydrogen atom and a straight (C1-C4)alkyl group, or form a (C3-C5)cycloalkyl group together with the carbon to which the former are bonded; m is an integer equal to 1, 2, 3 or 4; R5 is a hydrogen atom or a (C1-C4)alkyl group; R6 is a (CH2)n-L group where n = 0, 1, 2 or 3, and L is a group selected among aryls with 6 carbon atoms, heteroaryls having 5 or 6 members, the saturated heterocycles including 5, 6 or 7 members or forming a heterocycle group together with the nitrogen atom to which the former are linked. The invention also relates (ii) to the preparation of said derivatives, and (iii) to the therapeutic use thereof as inhibitors of kinase activity in receptors having PDGF ligands and/or receptors with the FLT3 ligand.Formula (i) compound:whereinr1 representes wasserstoffatoms or (c 1-c 4) alkyl; r2 representes group-(ch 2) n '-b, wherein n '=0,1,2,3 or 4; with b representes (i) (c 3-c 5) naphthenic base or (c 1-c 4) alkyl, said group is chosen wantonly and is substituted with one or more fluorine atoms; or (ii) (c 1-c 4) alkoxyl group; y, z, v and w expression independently of one another:-ch-group; the optional carbon atom that is substituted with radicals r 7, said radicals r 7 expression (c 1-c 4) alkyl or halogen atom; heteroatoms, for example nitrogen-atoms, sulphur atom or sauerstoffatom; or no atom;should be understood that the ring that comprises v, w, y and z is 5 or 6 yuan of rings, should be understood that the dotted line in the said ring representes that the gained ring is aromatic ring and should be understood that said ring comprises 0,1 or 2 heteroatoms;r3 and r4 expression independently of one another can be identical or different group, r3 and r4 are selected from: wasserstoffatoms; with straight chain (c 1-c 4) alkyl; or r3 forms (c with r4 with the carbon that they were connected 3-c 5) naphthenic base; m equals 1,2,3 or 4 integer;r5 representes wasserstoffatoms or (c 1-c 4) alkyl; r6 representes group-(ch 2) n-l, wherein n=0,1,2 or 3; with l is selected from following group:zero aryl, it comprises 6 carbon atoms;05 to 6 yuan of heteroaryls, it comprises at least one heteroatoms that is selected from nitrogen, oxygen and sulphur;05,6 or 7 yuan of saturated heterocyclyls, it comprises at least one heteroatoms that is selected from nitrogen and oxygen, and said heterocycle is optional to be lactan;said aryl, heteroaryl or heterocyclic radical are optional to be substituted with at least one substituting group, and said substituting group is selected from (i) straight or branched (c 1-c 4) alkyl, (ii) (c 3-c 5) naphthenic base, (iii) halogen atom, (iv) aryl and (v) benzyl; should be understood that when l is heteroaryl or heterocyclic radical and said heteroaryl or heterocyclic radical when comprising at least one nitrogen-atoms, said nitrogen-atoms can be chosen wantonly and be substituted with said substituting group;or r5 forms heterocyclic radical with r6 with the nitrogen-atoms that they were connected, and said heterocyclic radical is optional to be substituted with at least one in the following group: heteroaryl; or (c 1-c 3) alkyl; itself instead has 5 or 6 yuan of heterocyclic radicals, and said 5 or 6 yuan of heterocyclic radicals comprise the heteroatoms that at least one is selected from nitrogen and oxygen, should be understood that; when said 5 or 6 yuan of heterocyclic radicals are that said nitrogen-atoms can be chosen wantonly and be substituted when comprising the heterocyclic radical of at least one nitrogen-atoms; said formula (i) compound and enantiomer and diastereomer comprise their mixture, be the alkali form or with the additive salt form and/or the solvate forms of acid.

27199

그 외 기타 의료용 기기 제조업

특허

ko

en

ＫＲＡＳ 프라이머 및 프로브본 발명은 KRAS 유전자의 변이를 검출하기 위한 올리고뉴클레오티드 프라이머 또는 프로브를 제공한다. 본 발명은 본 명세서에 개시된 올리고뉴클레오티드 프라이머 또는 프로브를 사용하여 KRAS 유전자에서 변이를 검출하기 위한 방법을 제공한다. 더욱이 본 발명은 표피 성장 인자 수용체 지정된 화학요법제에 대한 환자의 종양의 감수성을 예측하기 위한 방법을 포함하고 상기 방법은 종양으로부터 DNA를 얻는 단계; 및 본 발명의 올리고뉴클레오티드 프라이머 및/또는 프로브 중 적어도 하나를 이용하는 방법을 사용하여 DNA에서 KRAS 유전자의 엑손 2에서 코돈 12의 변이 및/또는 코돈 13의 변이가 있는지 여부를 측정하는 단계를 포함한다.(a) GTCAAGGCACTCTTGCCTAAGT (서열번호:1)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드; (b) GGCCTGCTGAAAATGACTGA (서열번호:2)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(c) 6FAM-CAACTACCACAAGTTT (서열번호:3)의 뉴클레오티드 서열로 이루어진 표지된 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드; (d) AGGCACTCTTGCCTCCGT (서열번호:4)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(e) GCCTGCTGAAAATGACTGAATAT (서열번호:5)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드; (f) 6FAM-CTCCAACTACCACAAGTT (서열번호: 6)의 뉴클레오티드 서열로 이루어진 표지된 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(g) CTTGTGGTAGTTGGAGCTGGTAA (서열번호: 7)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(h) AATATAAACTTGTGGTAGTTGGAGCTTT (서열번호: 8)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(i) GAATATAAACTTGTGGTAGTTGGAGCTAT (서열번호: 9)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(j) TATAAACTTGTGGTAGTTGGAGGTGT (서열번호: 10)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드; (k) TGAAGATGTACCTATGGTCCTAGTAGGA (서열번호: 11)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(l) GTCCTGAGCCTGTTTTGTGTCTA (서열번호: 12)로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(m) 6FAM-TAGAAGGCAAATCACA (서열번호: 13)의 뉴클레오티드 서열로 이루어진 표지된 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(n) TGAATATAAACTTGTGGTAGTTGGAGATA (서열번호:14)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(o) AATATAAACTTGTGGTAGTTGGAGGTC (서열번호:15)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(p) TGAATATAAACTTGTGGTAGTTGGAGTTT (서열번호:16)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(q) AAACTTGTGGTAGTTGGAGCAGA (서열번호:17)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(r) AACTTGTGGTAGTTGGAGCAGC (서열번호:18)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드;(s) CACAAAATGATTCTGAATTAGCTGTATC (서열번호:19)의 뉴클레오티드 서열로 이루어진 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드; 및(t) 6FAM-TCAAGGCACTCTTGCCT (서열번호:20)로 이루어진 표지된 올리고뉴클레오티드 또는 이와 실질적으로 동일한 올리고뉴클레오티드에서 선택된 올리고뉴클레오티드.

KRAS PRIMERS AND PROBESThe present invention provides oligonucleotide primers or probes for the detection of a mutation of the KRAS gene. The invention also provides a method for detecting a mutation in the KRAS gene using the oligonucleotide primers or probes disclosed therein. Furthermore, the present invention encompasses a method for predicting the sensitivity of a tumor in a patient to epidermal growth factor receptor-directed chemotherapy, comprising obtaining DNA from the tumor; and determining whether there is a mutation in codon 12 and/or a mutation in codon 13 in exon 2 of the KRAS gene in the DNA using a method utilizing at least one of the oligonucleotide primers and/or probes of the present invention.An oligonucleotide selected from:(a) an oligonucleotide consisting of a nucleotide sequence ofGTCAAGGCACTCTTGCCTAAGT (SEQ ID NO: l) or an oligonucleotide substantially identical thereto;(b) an oligonucleotide consisting of a nucleotide sequence ofGGCCTGCTGAAAATGACTGA (SEQ ID NO:2) or an oligonucleotide substantially identical thereto;(c) a labeled oligonucleotide consisting of a nucleotide sequence of 6FAM-CAACTACCACAAGTTT (SEQ ID NO:3) or an oligonucleotide substantially identical thereto;(d) an oligonucleotide consisting of a nucleotide sequence ofAGGCACTCTTGCCTCCGT (SEQ ID NO:4) or an oligonucleotide substantially identical thereto; (e) an oligonucleotide consisting of a nucleotide sequence ofGCCTGCTGAAAATGACTGAATAT (SEQ ID NO:5) or an oligonucleotide substantially identical thereto;(f) a labeled oligonucleotide consisting of a nucleotide sequence of6FAM-CTCCAACTACCACAAGTT (SEQ ID NO: 6) or an oligonucleotide substantially identical thereto; (g) an oligonucleotide consisting of a nucleotide sequence ofCTTGTGGTAGTTGGAGCTGGTAA (SEQ ID NO: 7) or an oligonucleotide substantially identical thereto;(h) an oligonucleotide consisting of a nucleotide sequence ofAATATAAACTTGTGGTAGTTGGAGCTTT (SEQ ID NO: 8) or an oligonucleotide substantially identical thereto;(i) an oligonucleotide consisting of a nucleotide sequence ofGAATATAAACTTGTGGTAGTTGGAGCTAT (SEQ ID NO: 9) or an oligonucleotide substantially identical thereto; (j) an oligonucleotide consisting of a nucleotide sequence ofTATAAACTTGTGGTAGTTGGAGGTGT (SEQ ID NO: 10) or an oligonucleotide substantially identical thereto;(k) an oligonucleotide consisting of a nucleotide sequence ofTGAAGATGTACCTATGGTCCTAGTAGGA (SEQ ID NO: 11) or an oligonucleotide substantially identical thereto;(1) an oligonucleotide consisting of a nucleotide sequence ofGTCCTGAGCCTGTTTTGTGTCTA (SEQ ID NO: 12) or an oligonucleotide substantially identical thereto;(m) a labeled oligonucleotide consisting of a nucleotide sequence of 6FAM-TAGAAGGCAAATC AC A (SEQ ID NO : 13) or an oligonucleotide substantially identical thereto; (n) an oligonucleotide consisting of a nucleotide sequence ofTGAATATAAACTTGTGGTAGTTGGAGATA (SEQ ID NO: 14) or an oligonucleotide substantially identical thereto;(o) an oligonucleotide consisting of a nucleotide sequence ofAATATAAACTTGTGGTAGTTGGAGGTC (SEQ ID NO: 15) or an oligonucleotide substantially identical thereto;(p) an oligonucleotide consisting of a nucleotide sequence ofTGAATATAAACTTGTGGTAGTTGGAGTTT (SEQ ID NO: 16) or an oligonucleotide substantially identical thereto; (q) an oligonucleotide consisting of a nucleotide sequence ofAAACTTGTGGTAGTTGGAGCAGA (SEQ ID NO: 17) or an oligonucleotide substantially identical thereto;(r) an oligonucleotide consisting of a nucleotide sequence ofAACTTGTGGTAGTTGGAGCAGC (SEQ ID NO: 18) or an oligonucleotide substantially identical thereto;(s) an oligonucleotide consisting of a nucleotide sequence ofCACAAAATGATTCTGAATTAGCTGTATC (SEQ ID NO: 19) or an oligonucleotide substantially identical thereto; and(t) a labeled oligonucleotide consisting of 6FAM-TCAAGGCACTCTTGCCT (SEQ ID NO:20) or an oligonucleotide substantially identical thereto.

20202

합성수지 및 기타 플라스틱 물질 제조업

특허

ko

en

빛에 안정한 미공질 또는 비-다공질 폴리우레탄 재료 및이의 제조방법본 발명은 방향족기에 직접적으로 결합하지 않는 적어도 2 개의 NCO-기를 갖는 적어도 하나의 이소시아네이트 화합물로 구성된 이소시아네이트 성분 ; 이소시아네이트-반응성 성분 ; 및 실질적으로 납이 포함되어 있지 않으며 적어도 하나의 유기비스무트(Ⅲ) 촉매를 포함하는 촉매 성분을 포함하는 반응성 혼합물로부터 제조되는 폴리우레탄 재료에 관한 것이다. 본 발명은 폴리우레탄 재료의 방출 또는 VOC 수치(휘발성 유기 화합물)를 250 ppm 미만, 바람직하게는 100 ppm 미만으로 유지하기 위한, 적어도 하나의 이소시아네이트-반응성기로 치환된 C14-C20 카르복실레이트기 또는 C2 -C20 카르복실레이트기를 포함하는 유기비스무트(Ⅲ), 유기주석(Ⅱ 또는 Ⅳ) 촉매 또는 둘다의 용도에 관한 것이다. 촉매 성분은 유기아연(Ⅱ) 카르복실레이트를 추가로 포함할 수 있다. 바람직한 촉매는 비스무트 올레이트, 디메틸주석 디올레이트 및 아연 옥토에이트이다. A) 방향족기에 직접적으로 결합되지 않은 적어도 2 개의 NCO-기를 가지고 있는 적어도 하나의 이소시아네이트 화합물로 구성된 이소시아네이트 성분 ; B) 다음의 b1, b2 및 b3 을 포함하는 이소시아네이트-반응성 성분 b1) 일차 및 이차 OH-기, 일차 및 이차 NH-기 및 일차 및 이차 NH2-기 중 하나 또는 그 이상을 포함하는 기능기 ; 2 내지 8 의 공칭 관능기수 ; 및 100 과 4000 사이, 바람직하게는 800 과 2000 사이의 당량 을 갖는 적어도 하나의 활성 수소 함유 화합물로 구성된 활성 수소 함유 성분 ; b2) b1, b2 및 b3 의 성분 100 부 당 100 미만의 당량, 적어도 50 % 가 일차 OH-기인 OH-기 기능기 및 2 내지 6 의 관능기수 를 갖는 약 0 내지 약 30 부, 바람직하게는 약 2 내지 약 30 부의, 적어도 하나의 연쇄연장제 및 적어도 하나의 교차결합제로 구성된 연쇄연장제 성분 및 교차결합제 성분, 또는 적어도 하나의 연쇄연장제로 구성된 연쇄연장제 성분 또는 적어도 하나의 교차결합제로 구성된 교차결합제 성분 ; 및 b3) 하기 촉매 성분 C 와 함께 공-촉매 시스템을 형성하고 2 내지 6 의 관능기수 및 200 또는 그 미만의 당량을 갖는 적어도 하나의 아민 개시제로 구성되어 있으며, 적어도 하나의 지방족 또는 지방족 고리 NH2-기나 NH-기를 포함하는 아민 개시제 성분 ; 및 C) 실질적으로 납을 포함하지 않으며 적어도 하나의 유기비스무트(Ⅲ) 촉매를 포함하는 촉매 성분 을 포함하는 성분으로 구성된 폴리우레탄 전구물질의 반응성 혼합물을 반응시켜, 500 ㎏/㎥ 보다 높은 밀도, 특히 700 ㎏/㎥ 보다 높은 밀도를 갖는 빛에 안정한 미공질 또는 비-다공질 폴리우레탄 재료를 제조하는 방법에 있어서, 상기 유기비스무트 촉매는 하기 화학식 Ⅰ에 해당하는 적어도 하나의 유기비스무트(Ⅲ) 촉매를 포함하고 상기 촉매 성분은 상기 유기비스무트 촉매 이외에 하기 화학식 Ⅱ, 화학식 Ⅲ 또는 화학식 Ⅳ 에 해당하는 적어도 하나의 유기주석(Ⅱ 또는 Ⅳ) 촉매를 포함하거나, 또는 상기 유기비스무트 촉매는 하기 화학식 Ⅰ 에 해당하는 적어도 하나의 유기비스무트(Ⅲ) 촉매를 포함하거나 또는 상기 촉매 성분은 상기 유기비스무트 촉매 이외에 하기 화학식 Ⅱ, 화학식 Ⅲ 또는 화학식 Ⅳ 에 해당하는 적어도 하나의 유기주석(Ⅱ 또는 Ⅳ) 촉매를 포함하고, 제조된 폴리우레탄 재료가 다이머 크라이슬러 PB VWT 709 표준에 따라 측정한 250 ppm 미만, 바람직하게는 150 ppm 미만 및 가장 바람직하게는 100 ppm 또는 그 미만의 VOC 수치를 갖도록 반응성 혼합물의 성분을 추가로 선택함을 특징으로 하는 빛에 안정한 미공질 또는 비-다공질 폴리우레탄 재료의 제조방법 화학식 Ⅰ 이 식에서, m = 0-2 p = 1-3 m + p = 3 R1 은 C1-C8 알킬기이고 ; R2 는 선형이나 가지난 C13-C19 알킬 또는 알켄일기이거나, 적어도 하나의 이소시아네이트-반응성기, 특히 하나 또는 그 이상의 OH-기, NH-기 및 NH2-기 중 하나 또는 그 이상으로 치환된 선형이나 가지난 C1-C19 알킬 또는 알켄일기, 바람직하게는 C7-C19 알킬 또는 알켄일기이다 화학식 Ⅱ 화학식 Ⅲ 화학식 Ⅳ 이 식에서, R1 은 C1-C8 알킬기이고 ; R2 는 선형이나 가지난 C13-C19 알킬 또는 알켄일기이거나, 적어도 하나의 이소시아네이트-반응성기, 특히 하나 또는 그 이상의 OH-기, NH-기 및 NH2-기 중 하나 또는 그 이상으로 치환된 선형이나 가지난 C1-C19 알킬 또는 알켄일기, 바람직하게는 C7-C19 알킬 또는 알켄일기이다.

Micro-cellular or non-cellular light-stable polyurethane material and method for the production thereofThe polyurethane material is produced from a reactive mixture comprising an isocyanate component composed of at least one isocyanate compound having at least two NCO-groups which are not directly attached to an aromatic group; isocyanate-reactive components and a catalyst component which is substantially free of lead and which comprises at least one organobismuth (III) catalyst. In order to be able to keep the emission or VOC value (Volatile Organic Compounds) of the polyurethane material below 250 ppm, preferably below 100 ppm, use is made of an organobismuth (m) and/or of an organotin (II or IV) catalyst comprising either C14-C20 carboxylate groups or C2-C20 carboxylate groups substituted with at least one isocyanate-reactive group. The catalyst component may further comprise an organozinc (11) carboxylate. The preferred catalysts are bismuth oleate, dimethyltin dioleate and zinc octoate. A method for producing a micro-cellular or non-cellular light-stable polyurethane material having a density higher than 500 kg/m3, in particular higher than 700 kg/m3, in which method a reactive mixture of polyurethane precursors is allowed to react to produce the polyurethane material, the reactive mixture being composed of components comprising at least: A)an isocyanate component composed of at least one isocyanate compound having at least two NCO-groups which are not directly attached to an aromatic group; B) isocyanate-reactive components comprising b1) an active hydrogen containing component composed of at least one active hydrogen containing compound having: functional groups comprising primary and/or secondary OH-groups, NH-groups and/or NH2-groups; a nominal functionality of from 2 to 8; and an equivalent weight of between 100 and 4000, preferably of between 800 and 2000; b2) from about 0 to about 30 parts, preferably from about 2 to about 30 parts, per 100 parts of components b1, b2 and b3, of a chain-extender and/or cross-linker component composed of at least one chain-extender and/or of at least one cross-linker having an equivalent weight smaller than 100, the functional groups of which are OH-groups, at least 50% of which are primary OH-groups and the functionality of which is from 2 to 6; and b3) an amine-initiator component which forms a co-catalytic system with catalyst component C and which is composed of at least one amine-initiator which has a functionality of 2 to 6 and an equivalent weight lower or equal to 200 and which comprises at least one aliphatic or alicyclic NH2— or NH-group; and C) a catalyst component which is substantially free of lead and which comprises at least one organobismuth (III) catalyst, characterised in that said organobismuth catalyst comprises at least one organobismuth (III) catalyst corresponding to the following formula (I): wherein m=0−2 p=1−3 m+p=3 R1 is a C1-C8 alkyl group; and R2 is either: a linear or branched C13-C19 alkyl or alkenyl group, or a linear or branched C1-C19 alkyl or alkenyl group, preferably a C7-C19 alkyl or alkenyl group, substituted with at least one isocyanate-reactive group, in particular with one or more OH—, NH— and/or NH2-groups, and/or said catalyst component comprises in addition to said organobismuth catalyst at least one organotin (II or IV) catalyst corresponding to the following formula (II): to the following formula (III): or to the following formula (IV) wherein: R1 is a C1-C8 alkyl group; and R2 is either: a linear or branched C13-C19 alkyl or alkenyl group, or a linear or branched C1-C19 alkyl or alkenyl group, preferably a C7-C19 alkyl or alkenyl group, substituted with at least one isocyanate-reactive group, in particular with one or more OH—, NH— and/or NH2-groups, the components of the reactive mixture being further selected in such a manner that the produced polyurethane material has a VOC value, measured in accordance with the Daimler Chrysler PB VWT 709 standard, lower than 250 ppm, preferably lower than 150 ppm and most preferably lower than or equal to 100 ppm.

20499

그 외 기타 분류 안된 화학제품 제조업

특허

ko

en

N-아릴인돌 및 이를 이용한 제초제 조성물과 식물의 억제방법본 발명은 치환된 N-아릴인돌, 이들의 제조방법 및 이들을 이용한 제초제에 관한 것이다. 특히, 본 발명은 다음 식의 치환된 N-아릴인돌(식중, R은 수소,할로겐,니트로,시아노,알킬,알콕시,알케닐옥시,알키닐옥시,알콕시알킬,카르보닐알콕시,알킬옥시알콕시,시아노알콕시,벤질옥시, 알콕시카르보닐알콕시,알킬카르보닐알콕시,할로알킬,히드록스알킬,포르밀,아지도,카르복시 및 그 염, COO 알킬,아미노,치환된 아미노로서 그중 치환체는 알킬,알콕시,히드록시,포르밀,알킬카르보닐,카르복시 또는 알콕시카르복시로 치환된 알킬카르보닐,알킬술포닐,할로알킬술포닐,아미노카르보닐,(디)알킬아미노카르보닐,알콕시 카르보닐,알콕시알킬,히드록시카르보닐알킬,알콕시카르보닐알킬,아미노 및 (디)알킬 아미노이고,카르복시아미도,치환된 카르복시아미드로서 그중 치환체는 알킬,알킬술포닐 및 할로알킬술포닐에서 선택될 수 있고, 술폰아미도로서 그중 N은 수소 및/또는 알킬로 치환되고, YR4로서 그중 Y는 0 및 S(0)m이고, R4는 수소,알킬,할로알킬,시아노알킬,알콕시카르보닐알킬,히드록시카르보닐알킬 및 아미노카르보닐알킬로서 그중 N은 수소 및/또는 알킬로 치환되는 군에서 선택되고, n은 0~4이고, m은 0~2이고, R1은 수소,알킬,할로겐,시아노,할로알킬,알콕시 및 카르복시와 그 염 또는 에스테르이고, q는 0~2이고, X는 수소,할로겐,시아노,니트로,알킬티오,알킬술피닐,알킬술포닐 및 알콕시이고, k는 0~2이고, Z는 N 및 C-R2로서 그중 R2는 수소,할로겐,할로알킬,시아노,니트로,알킬티오,알킬술피닐,알킬술포닐 및 알콕시이고, R3는 수소,할로알킬,할로알콕시,시아노,할로겐 및 SOyR5로서 그중 R5는 알킬 또는 할로알킬이고, y는 0,1 또는 2임)과 농업적으로 허용되는 그 염에 관한 것이다.다음 식 의 화합물(식중, R은 수소, 할로겐, 니트로, 시아노, 알킬, 알콕시, 알케닐옥시, 알키닐옥시, 알콕시알킬, 카르보닐알콕시, 알킬옥시알콕시, 시아노알콕시, 벤질옥시, 알콕시카르보닐알콕시, 알킬카르보닐알콕시, 할로알킬, 히드록스알킬, 포르밀, 아지도, 카르복시 및 그 염, COO 알킬, 아미노, 치환된 아미노로서 그중 치환체는 알킬, 알콕시, 히드록시, 포르밀, 알킬카르보닐, 카르복시 또는 알콕시카르복시로 치환된 알킬카르보닐, 알킬술포닐, 할로알킬술포닐, 아미노카르보닐, (디)알킬아미노카르보닐, 알콕시카르보닐, 알콕시알킬, 히드록시카르보닐알킬, 알콕시카르보닐알킬, 아미노 및 (디)알킬아미노이고, 카르복시아미도, 치환된카르복시아미드로서 그중 치환체는 알킬, 알킬술포닐 및 할로알킬술포닐중에서 선택될 수 있고, 술폰아미도로서 그중 N은 수소 및/또는 알킬로 치환되고, YR4로서 그중 Y는 0 및 S(0)m이고, R4는 수소, 알킬, 할로알킬, 시아노알킬, 알콕시카르보닐알킬, 히드록시카르보닐알킬 및 아미노카르보닐알킬로서 그중 N은 수소 및/또는 알킬로 치환되는 군에서 선택되고, n은 0~4이고, m은 0~2이고, R1은 수소,알킬,할로겐,시아노,할로알킬,알콕시 및 카르복시와 그 염 또는 에스테르이고, q는 0~2이고, X는 수소,할로겐,시아노,니트로,알킬티오,알킬술피닐,알킬술포닐 및 알콕시이고, k는 0~2이고, Z는 N 및 C-R2로서 그중 R2는 수소,할로겐,할로알킬,시아노,니트로,알킬티오,알킬술피닐,알킬술포닐 및 알콕시이고, R3는 수소,할로알킬,할로알콕시,시아노,할로겐 및 SOyR5로서 그중 R5는 알킬 또는 할로알킬이고. y는 0, 1 또는 2임)과 농업적으로 허용되는 그 염.

N-PHENYLINDOLE AND N-PYRIDYLINDOLE DERIVATIVES, THEIR PREPARATION AND THEIR USE AS HERBICIDESThis invention relates to substituted N-arylindoles, a process for producing them and their use as herbicides. In particular, this invention relates to substituted N-arylindoles of formula (I) in which R is hydrogen; halogen; nitro; cyano; alkyl; alkoxy; alkenyloxy; alkynyloxy; alkoxyalkyl; carbonylalkoxy; alkyloxyalkoxy; cyanoalkoxy; benzyloxy; alkoxycarbonylalkoxy; alkylcarbonylalkoxy; haloalkyl; hydroxalkyl; formyl; azido; carboxy and its salts; COOalkyl; amino; substituted amino wherein the substituents are alkyl, alkoxy, hydroxy, formyl, alkylcarbonyl, substituted alkylcarbonyl substituted with carboxy or alkoxycarboxy, alkylsulfonyl, haloalkylsulfonyl, aminocarbonyl, (di)alkylaminocarbonyl, alkoxycarbonyl, alkoxyalkyl, hydroxycarbonylalkyl, alkoxycarbonylalkyl, amino and (di)alkyl amino; carboxyamido; substituted carboxyamide wherein said substituents can be selected from alkyl, alkylsulfonyl, and haloalkylsulfonyl; sulfonamido wherein the N is substituted with hydrogen and/or alkyl; YR4 wherein Y is O and S(O)m and R4 is selected from the group hydrogen, alkyl, haloalkyl, cyanoalkyl, alkoxycarbonylalkyl, hydroxycarbonylalkyl and aminocarbonylalkyl wherein the N is substituted with hydrogen and/or alkyl; n is 0 to 4 and m is 0 to 2; R1 is hydrogen, alkyl, halogen, cyano, haloalkyl, alkoxy, and carboxy and its salts or esters; q is 0 to 2; X is hydrogen, halogen, cyano, nitro, alkylthio, alkylsulfinyl, alkylsulfonyl, and alkoxy; k is 0 to 2; Z is N and C-R2; wherein R2 is hydrogen, halogen, haloalkyl, cyano, nitro, alkylthio, alkylsulfinyl, alkylsulfonyl and alkoxy; R3 is hydrogen, haloalkyl, haloalkoxy, cyano, halogen, and SOyR5 wherein R5 is alkyl or haloalkyl and y is 0, 1 or 2; and agriculturally acceptable salts thereof.A compound having the formulain which:R is hydrogen; halogen; nitro; cyano; alkyl; alkoxy; alkenyl- oxy; alkynyloxy; alkoxyalkyl; carbonylalkoxy; aIkyloxyalkoxy; cyanoalkoxy; benzyloxy; alkoxycarbonylalkoxy; alkylcarbonyl- alkoxy; haloalkyl; hydroxalkyl; formyl; azido; carboxy and its saltε; COOalkyl; amino; subεtituted amino wherein the εubεti- tuentε are alkyl, alkoxy, hydroxy, formyl, alkylcarbonyl, εubεtituted alkylcarbonyl εubεtituted with carboxy or alkoxy- carboxy, alkylεulfonyl, haloalkylεulfonyl, aminocarbonyl, (di)alkylaminocarbonyl, alkoxycarbonyl, alkoxyalkyl, hydroxy¬ carbonylalkyl, alkoxycarbonylalkyl, amino and (di)alkyl amino; carboxyamido; εubstituted carboxyamide wherein εaid εubεti- tuents can be selected from alkyl, alkylsulfonyl, and halo¬ alkylεulfonyl; εulfonamido wherein the N iε εubεtituted with hydrogen and/or alkyl; YR 4 wherein Y lε 0 and S(O) and R4 i.s selected from the group hydrogen, alkyl, haloalkyl, cyano- alkyl, alkoxycarbonylalkyl, hydroxycarbonylalkyl and aminocar¬ bonylalkyl wherein the N iε εubεtituted with hydrogen and/or alkyl;n iε 0 to 4 andm iε 0 to 2; R iε hydrogen, alkyl, halogen, cyano, haloalkyl, alkoxy, and carboxy and itε salts or eεterε;q iε 0 to 2;X iε hydrogen, halogen, cyano, nitro, alkylthio, alkylεul- finyl, alkylεulfonyl, and alkoxy;k iε 0 to 2;Z iε N and C-R 2; wherein R2 iε hydrogen, halogen, haloalkyl, cyano, nitro, alkythio, alkylεulfinyl, alkylεulfonyl and alkoxy;3R iε hydrogen, haloalkyl, haloalkoxy, cyano, halogen, andSO R 5 wherein R5 iε alkyl or haloalkyl and y iε 0, 1 or 2; andagriculturally acceptable εaltε thereof.

61299

그 외 기타 전기 통신업

특허

ko

en

지불 카드의 사용으로부터 기부금의 발생, 모금 및 분배를 위한 시스템 및 방법지불 카드(50)의 소유자로부터의 기부금의 발생 및 모금을 관리하고 모금된 기부금을 상기 카드 소유자가 선택한 복수의 수취인에게 분배하기 위한 시스템 및 방법. 지불 카드(50)는 카드에 의해 거래금에 비례하는 카드 소유자가 선택한 기부금의 레벨을 나타내는 기부금 계수(CF)를 갖는다. 하나 이상의 수취인(가령, 자선단체)의 선택, 그리고 필요 시, 둘 이상의 수취인에게로의 기부금의 분배가 또한 카드의 고유의 식별자와 연계되어 이뤄진다. 지불 카드 시스템(40, 55)은 거래 네트워크를 통해 통상적인 방식으로 거래를 처리하고, 거래금에 비례하며, 기부금 관리 개체(10, 20)에 의해 보유되는 판매자 계좌를 이용하여 지불된 기부금을 나타내는 데이터(43, 45)를 제공한다. 기부금 관리 개체는 카드 소유자에 의해 선택된 수취인들 간의 모금된 기부금의 분배를 나타낸다. 카드 소유자는 시스템의 인터넷 사이트(30)를 통해, 수취인 데이터를 선택 또는 수정하고, 선택사항으로서, 기부금 계수를 선택 또는 수정할 수 있다. 기부금의 모금과 분배는 간단하고 유연하며, 카드 소유자는 카드(5) 또는 카드의 코딩에 어떠한 수정도 가할 필요 없이, 수취인들을 변경할 수 있다.지불 카드(50)의 소유자들로부터의 기부금의 발생 및 모금을 관리하고, 모금된 기부금을 카드의 소유자가 선택한 복수의 수취인에게 분배하기 위한 시스템에 있어서, 이 관리 및 분배 시스템은, 지불 카드를 카드 소유자에게 발행하는 기관(10, 40)을 포함하는 지불 카드 시스템의 일부이며, 카드를 이용하는 거래가 거래 네트워크(40, 60, 70)를 통해 처리되며, 각각의 카드(50)는 하나씩의 고유 식별자(UID)와 연계되며, 상기 지불 카드 시스템은, 판매자 계좌(42)를 통한 판매자(60)의 지불을 포함하는 지불 카드를 이용한 거래를 처리하고, 개별 카드 소유자에게, 상기 개별 카드 소유자의 지불 카드를 이용하여 이뤄진 거래의 내역서(45)를 제공하기 위해 상기 거래 네트워크를 통해 판매점(point-of-sale)(60)으로 연결 가능한 데이터 처리기(40)를 가지며, 상기 관리 및 분배 시스템은, (a) 지불 카드(50)의 세트를 이용하여, 카드를 이용한 거래액에 비례하여 기부금을 생성하기로 선택한 카드 소유자에 대하여 동작하고, 상기 카드 각각은 자신의 고유 식별자(UID) 및 기부금 계수(CF)와 연계되고, 상기 기부금 계수(CF)는 카드 소유자에 의해 선택 가능하며, 카드를 이용한 거래액에 비례하여 발생되는 카드 소유자가 선택한 기부금의 레벨을 나타내며, (b) 상기 관리 및 분배 시스템은, 각각의 카드의 기부금 계수에 대한 데이터를, 고유의 식별자와 함께 저장하는 제 1 데이터 처리 수단(40)을 포함하고, (c) 상기 제 1 데이터 처리 수단(40)은, 기부금 계수(CF)와 연계된 고유의 식별자를 갖는 지불 카드를 갖는 각각의 카드 소유자를 위해, 카드 소유자에 의해 행해진 거래의 금액에, 카드와 연계된 기부금 계수에 의해 설정된 레벨에 따라 비례하는 카드 소유자 기부금을 나타내는 출력 데이터(43, 45)를 생성하도록 구성되고, (d) 상기 관리 및 분배 시스템은 기부금 관리 개체(10)를 포함하며, 상기 제 1 처리 수단(40)으로부터의 카드 소유자-기부금 출력 데이터(43)의 데이터 전송에 의해, 상기 기부금 관리 개체(10)에 의해 유지되는 판매자 계좌를 이용하여 카드 소유자 기부금이 상기 기부금 관리 개체(10)로 지불 가능하며, (e) 기부금 관리 개체(10)는 제 2 데이터 처리 수단(20)을 가지며, 상기 제 2 데이터 처리 수단(20)은,- 지불 카드의 고유의 식별자(UID) 및 이와 연계된 기부금 계수(CF)에 대한 데이터,- 상기 제 1 데이터 처리 수단(40)으로부터의 카드 소유자-기부금 출력 데이터(43),- 복수의 수취인을 식별하는 수취인 데이터,- 카드 소유자에 의해 선택된 수취인들을 가리키고, 필요 시, 수취인들 간의 분배를 가리키는 분배 데이터(32)로서, 각각의 지불 카드의 고유의 식별자와 연계되어 있는, 상기 분배 데이터(32)를 수신 및 처리하며, (f) 상기 제 2 데이터 처리 수단(20)은, 상기 분배 데이터에 따라, 서로 다른 카드 소유자에 의해 이뤄진 서로 다른 수취인들에게로의 기부금의 분배를 나타내는 데이터(80)를 출력하도록 구성되고, (g) 상기 관리 및 분배 시스템은, 제 2 데이터 처리 수단에 의해 수신된 상기 분배 데이터(32)를 구성하거나 업데이트하기 위해, 카드의 고유의 식별자와 연계하여, 카드 소유자가 하나 이상의 수취인을 각각 선택하거나 선택된 수취인을 변경하도록 하며, 필요한 경우, 둘 이상의 선택된 수취인 간의 기부금의 분배를 선택하거나, 선택된 분배를 변경하도록 하는 데이터 입력 수단(30)을 포함하며,상기 제 1 처리 수단(40)은, 각각의 카드 소유자에 의해 선택된 레벨로 거래액에 비례하는 기부금을 나타내는 데이터(43)를 제공하도록 동작하고, 기부금 관리 개체(10)의 상기 제 2 데이터 처리 수단(20)은 카드 소유자에 의해 선택된 수취인들 간의 모금된 기부금의 분배를 나타내는 데이터(80)를 제공하도록 동작하는 것을 특징으로 하는 관리 및 분배 시스템.

SYSTEM AND METHOD FOR MANAGING THE GENERATION, COLLECTION AND DISTRIBUTION OF CONTRIBUTIONS FROM THE USE OF PAYMENT CARDSA system and method for managing the generation and the collection of financial contributions from holders of payment cards (50) and for distributing the collected contributions among a plurality of beneficiaries selected by the cardholders. The payment cards (50) have a unique identification (UID) that is associated with a contribution factor (CF) representing the cardholder's selected level of contribution to be made in proportion to the amount of transactions made with the card. A selection of one or more beneficiaries such as charities, and where needed a distribution of these contributions among two or more beneficiaries is also associated with the card's unique identification. A payment card system (40,55) processes transactions in the normal way via a transaction network and provides data (43,45) that represent contributions proportional to the amount of transactions and that are paid using a merchant account held by a contributions processing entity (10,20). The latter provides data (80) representing a distribution of the collected contributions amongst the beneficiaries selected by the cardholders. The cardholder can select or modify the beneficiary data and optionally the contribution factor through the system's Internet site (30). Collection and distribution of the contributions is simple and flexible and the cardholder can alter the beneficiaries without this requiring any modification to the cards (50) or their coding.A system for managing the generation and the collection of financial contributions from holders of payment cards (50) and for distributing the collected contributions among a plurality of beneficiaries selected by the cardholders, this management system being part of a payment card system comprising an institution (10,40) that issues payment cards to cardholders and wherein transactions using the cards are processed via a transaction network (40,60,70), wherein the cards (50) are each associated with a unique identification (UID), the payment card system having a data processor (40) that is connectable to points-of-sale (60) via the transaction network for processing transactions made with the payment cards, preferably including the payment of merchants (60) through merchant accounts (42), and for providing to individual cardholders statements (45) of transactions made using the individual cardholder's payment card, which management system is characterized in that:(a) it operates with a set of payment cards (50) for cardholders who elect to make contributions in proportion to the transactions made using the cards, each of said cards being associated by its unique identification (UID) with a contribution factor (CF) that is selectable by the cardholder, representing the cardholder's selected level of contribution to be made in proportion to the amount of transactions made with the card;(b) it comprises first data processing means (40) that stores data on the contribution factors along with the unique identifications of the respective cards;(c) said first data processing means (40) is arranged to generate, for each cardholder having a payment card whose unique identification is associated with a contribution factor (CF), output data (43,45) indicating a cardholder contribution that is a proportion of the value of transactions made by the cardholder according to a level set by the contribution factor associated with the card;(d) it comprises a contributions management entity (10) to which the cardholder contributions are payable by data transfer of the cardholder-contribution output data (43) from said first processing means (40), using a merchant account held by the contributions management entity (10);(e) the contributions management entity (10) has second data processing means (20) for receiving and processing: - data on the unique identifications (UIDs) of the payment cards and the associated contribution factors (CF), cardholder-contribution output data (43) from said first data processing means (40), beneficiary data that identifies a plurality of beneficiaries, and distribution data (32) indicating those beneficiaries that have been selected by the cardholders, and where needed a distribution amongst beneficiaries, this distribution data being associated with the unique identifications of respective payment cards;(f) said second data processing means (20) is arranged to output data (80) which represents a distribution to the different beneficiaries of the contributions made by different cardholders according to said distribution data; and (g) the management system further comprises data input means (30) for enabling cardholders to each select one or more beneficiaries or to alter their selection of beneficiaries and where needed to select or to alter the selection of the distribution of contributions amongst two or more selected beneficiaries, all in association with the unique identifications of their cards, to constitute or to update said distribution data (32) received by the second data processing means, whereby said first processing means (40) is operative to provide data (43) representing contributions proportional to the amounts of transactions at a level selected by each cardholder, and said second data processing means (20) of the contributions management entity (10) is operative to provide data (80) representing a distribution of the collected contributions amongst the beneficiaries selected by the cardholders.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

PI3K 억제제인 피라졸로피리미딘 화합물 및 이의 용도본 발명은 식(I)의 피라졸로피리미딘 화합물 및 이의 약학적으로 허용가능한 염에 관한 것이다. 이러한 화합물은 지방 키나아제 PI3K의 활성을 억제할 수 있고, PI3K에 의해 매개되는 예컨대 암, 염증 및 자가면역질환 등 질환을 치료할 수 있다. 본 발명은 또한, 이러한 화합물을 함유하는 약물 조성물, 이러한 화합물의 제조 방법 및 PI3K에 의해 매개되는 암, 염증 및 자가면역질환을 치료하기 위한 약물을 제조하는데 있어서 이러한 화합물 또는 약물 조성물의 용도에 관한 것이다.식(I)의 화합물 또는 이의 약학적으로 허용가능한 염.(상기 식(I)에서,R1은 H, 할로겐, 시아노기, 알킬기, 알케닐기, 알키닐기, 아릴기, 헤테로아릴기, 시클로알킬기 또는 헤테로시클로알킬기로부터 선택되고, 여기서 상기 알킬기, 알케닐기, 알키닐기, 아릴기, 헤테로아릴기, 시클로알킬기 또는 헤테로시클로알킬기는 선택적으로 1개 내지 5개의 R1a에 의해 치환되며;R1a는 H, 중수소, 할로겐, 시아노기, 알킬기, 알케닐기, 알키닐기, 아릴기, 헤테로아릴기, 시클로알킬기 및 헤테로시클로알킬기로부터 선택되고, 여기서 상기 알킬기, 알케닐기, 알키닐기, 아릴기, 헤테로아릴기, 시클로알킬기 또는 헤테로시클로알킬기는 선택적으로 할로겐, 시아노기, ORa, SRa, NRbRc, 알킬기, 알케닐기, 알키닐기, 시클로알킬기 또는 헤테로시클로알킬기에 의해 치환되며;R2는 아릴기, 헤테로아릴기, 시클로알킬기 또는 헤테로시클로알킬기로부터 선택되고, 여기서 R2는 선택적으로 1개 내지 5개의 R2a에 의해 치환되며;R2a는 H, 할로겐, 시아노기, ORa, SRa, NRbRc, NRbC(O)Rd, NRbC(O)ORd, NRbC(O)NRbRc, NRbS(O)2Rd, NRbS(O)2NRbRc, C(O)NRbRc, C(O)ORd, S(O)2NRbRc, C(O)Rd, S(O)2Rd, P(O)RbRc, 알킬기, 알케닐기 또는 알키닐기로부터 선택되고;R3은 H, 중수소, 알킬기, 알케닐기, 알키닐기, 중수소화 알킬기, 할로겐화 알킬기, 히드록시알킬기, 알콕시알킬기, 시아노알킬기, 시클로알킬기 또는 시클로알킬알킬기로부터 선택되며;R4는 H, 알킬기, 히드록시알킬기, 알콕시알킬기, 할로겐화 알킬기, 시아노알킬기, 시클로알킬기 또는 시클로알킬알킬기로부터 선택되고;R5는 H, 할로겐, 시아노기, 알킬기, 알케닐기, 알키닐기, 아릴기, 헤테로아릴기, 시클로알킬기 또는 헤테로시클로알킬기로부터 선택되고, 여기서 상기 알킬기, 알케닐기, 알키닐기, 아릴기, 헤테로아릴기, 시클로알킬기 또는 헤테로시클로알킬기는 1개 내지 3개의 R5a에 의해 치환될 수 있으며;R5a는 H, 중수소, 할로겐, 시아노기, ORa, SRa, NRbRc, NRbC(O)Rd, NRbC(O)ORd, NRbC(O)NRbRc, NRbS(O)2Rd, NRbS(O)2NRbRc, C(O)NRbRc, C(O)ORd, S(O)2NRbRc, C(O)Rd, S(O)2Rd, P(O)RbRc, 알킬기, 알케닐기, 알키닐기, 아릴기, 헤테로아릴기, 시클로알킬기 또는 헤테로시클로알킬기로부터 선택되고;R6 및 R7은 각각 H, 아미노기 또는 알킬기로부터 선택되며;Ra, Rb, Rc 및 Rd는 독립적으로 H, 알킬기, 할로겐화 알킬기, 히드록시알킬기, 알콕시알킬기, 시아노알킬기, 알케닐기, 알키닐기, 시클로알킬기, 헤테로시클로알킬기, 아릴기 또는 헤테로아릴기로부터 선택되거나; 또는Rb 및 Rc는 이들에 연결된 질소 원자와 함께 4 내지 7원 헤테로시클로알킬기를 형성하고, 선택적으로 1개 내지 3개의 Re에 의해 치환되며;Re는 H, 할로겐, 시아노기, ORa, SRa, NRbRc, NRbC(O)Rd, NRbC(O)ORd, NRbC(O)NRbRc, NRbS(O)2Rd, NRbS(O)2NRbRc, C(O)NRbRc, C(O)ORd, S(O)2NRbRc, C(O)Rd, S(O)2Rd, P(O)RbRc, 알킬기, 알케닐기, 알키닐기, 시클로알킬기, 헤테로시클로알킬기, 아릴기 또는 헤테로아릴기로부터 선택되고, 식(I)의 화합물 중의 임의의 수소 원자는 중수소일 수 있음)

PYRAZOLOPYRIMIDINE COMPOUND AS PI3K INHIBITOR AND USE THEREOFThe present application relates to a pyrazolopyrimidine compound of Formula (I) and a pharmaceutically acceptable salt thereof. Such compounds can be used to inhibit the activity of a lipid kinase PI3K, and can also be used to treat diseases mediated by PI3K, such as cancers, inflammatory diseases, and autoimmune diseases. The present application also relates to a pharmaceutical composition containing such compounds, a method for preparing such compounds, and use of such compounds or pharmaceutical compositions in the preparation of a drug for treating cancers, inflammatory diseases, and autoimmune diseases mediated by PI3K.A compound of Formula (I): or a pharmaceutical salt thereof, wherein: R1 is selected from a group consisting of H, halogen, cyano, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, wherein said alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, or heterocycloalkyl are optionally substituted with one to five R1a; R1a is selected from a group consisting of H, deuterium, halogen, cyano, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, wherein alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, or heterocycloalkyl are optionally substituted with halogen, cyano, ORa, SRa, NRbRc, alkyl, alkenyl, alkynyl, cycloalkyl, or heterocycloalkyl; R2 is selected from a group consisting of aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, wherein R2 is optionally substituted with one to five R2a; R2a is selected from a group consisting of H, halogen, cyano, ORa, SRa, NRbRc, NRbC(O)Rd, NRbC(O)ORd, NRbC(O)NRbRc, NRbS(O)2Rd, NRbS(O)2NRbRc, C(O)NRbRc, C(O)ORd, S(O)2NRbRc, C(O)Rd, S(O)2Rd, P(O)RbRc, alkyl, alkenyl, and alkynyl; R3 is selected from a group consisting of H, deuterium, alkyl, alkenyl, alkynyl, deuterated alkyl, haloalkyl, hydroxyalkyl, alkoxyalkyl, cyanoalkyl, cycloalkyl, and cycloalkylalkyl; R4 is selected from a group consisting of H, alkyl, hydroxyalkyl, alkoxyalkyl, haloalkyl, cyanoalkyl, cycloalkyl, and cycloalkylalkyl; R5 is selected from a group consisting of H, halogen, cyano, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, wherein alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, or heterocycloalkyl are substituted with one to three R5a; R5a is selected from a group consisting of H, deuterium, halogen, cyano, ORa, SRa, NRbRc, NRbC(O)Rd, NRbC(O)ORd, NRbC(O)NRbRc, NRbS(O)2Rd, NRbS(O)2NRbRc, C(O)NRbRc, C(O)ORd, S(O)2NRbRc, C(O)Rd, S(O)2Rd, P(O)RbRc, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl; R6 and R7 are each selected from a group consisting of H, amino, and alkyl; Ra, Rb, Rc, and Rd are independently selected from a group consisting of H, alkyl, haloalkyl, hydroxyalkyl, alkoxyalkyl, cyanoalkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl; or Rb and Rc, together with nitrogen atom(s) to which they are attached, form a four- to seven-membered heterocycloalkyl, and optionally substituted with one to three Re; and Re is selected from a group consisting of H, halogen, cyano, ORa, SRa, NRbRc, NRbC(O)Rd, NRbC(O)ORd, NRbC(O)NRbRc, NRbS(O)2Rd, NRbS(O)2NRbRc, C(O)NRbRc, C(O)ORd, S(O)2NRbRc, C(O)Rd, S(O)2Rd, P(O)RbRc, alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl; and wherein, any hydrogen atom in the compound of Formula (I) may be deuterium.

20119

석탄화학계 화합물 및 기타 기초 유기화학 물질 제조업

특허

ko

en

약제학적 조성물을 위한 티에노피리미딘본 발명은 화학식 I에 따른 티에노피리미딘 화합물을 포함하는 신규의 약제학적 조성물에 관한 것이다. [화학식 I] 또한, 본 발명은 X가 CH 또는 N으로부터 선택된, Mnk1 및/또는 Mnk2(Mnk2a 또는 Mnk2b) 및/또는 이의 변이체의 키나제 활성을 억제시킴으로써 영향을 받을 수 있는 질환의 예방 및/또는 치료를 위한 약제학적 조성물의 제조를 위한 본 발명의 티에노피리미딘 화합물의 용도에 관한 것이다.화학식 I의 화합물, 또는 이의 토토머, 대사산물, 전구약물 또는 약제학적으로 허용되는 염:[화학식 I][이미지]상기 화학식 I에서, X는 CH 또는 N으로부터 선택되며;R2는 H, CN, CF3, CON(R4)2;R3에 의해 임의로 치환된 O-C1-8 알킬; N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C3-10 헤테로사이클릴; N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C5-10 헤테로아릴; 및 R6에 의해 임의로치환된 C1-8 알킬로부터 선택되며; X가 CH인 경우, R2가 또한 F, Cl, SO2NH2일 수 있으며; Y는 하나 이상의 R3에 의해 임의로 치환된 직쇄 또는 측쇄 C1-8 알킬; 하나 이상의 R9에 의해 임의로 치환된 C3-8 사이클로알킬; 및 하나 이상의 R9에 의해 임의로 치환된, 하기 화학식들 중 어느 하나로부터 선택된 헤테로사이클릴 시스템[이미지] (여기서, n은 독립적으로 1 내지 3이며, U는 독립적으로 O 또는 NR5이다)으로부터 선택되며;R1은 H; Cl; 및 N(R4)2 또는 F에 의해 임의로 치환된 C1-8 알킬로부터 선택되며;R3은, R3이 전방으로 부착된 알킬 쇄의 제2 탄소 원자로부터는 OH, OR4 및 N(R4)2; F; CO2H; CON(R4)2; SO2N(R4)2; N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C3-10 헤테로사이클릴(여기서, 상기 질소 원자는 H 또는 C1-3 알킬에 의해 치환될 수 있다); 및 N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C5-10 헤테로아릴로부터 선택되며;R4는 H 및 C1-8 알킬로부터 선택되며; R5는 H; C1-8 알킬; C2-8 알케닐; C3-10 사이클로알킬; N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C3-10 헤테로사이클릴; N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C5-10 헤테로아릴; COR6; CO2R4; CONH(CH2)mR6; (CH2)mR6; CO(CH2)mR6; (CH2)mC(O)R6; SO2R4; 및 SO2(CH2)mR6(여기서, m은 1 내지 4이다)으로부터 선택되며;R6은 H; OH; OR4; OC(O)R4; N(R4)2; F; CO2H; CON(R4)2; SO2N(R4)2; N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C3-10 헤테로사이클릴; 및 C1-3 알킬 또는 N(R4)2에 의해 임의로 치환되는, N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C5-10 헤테로아릴로부터 선택되며;W는 F; Cl; Br; I; CN; -(CH2)1-2NR7R8; -C(S)NH2-; -CONR7R8; -C(=NR7)NR7R8;-CO2R7; 및 -SO2NR7R8로부터 선택되거나; 또는 W가 R1과 함께, N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 5원 내지 7원 헤테로사이클릭 환(여기서, 상기 질소 원자는 H, -C(O)-O-C1-4 알킬, -CO-(CH2)1-2-NH2, -CO-(CH2)1-2-NH(C1-3 알킬) 또는 -CO-(CH2)1-2-N(C1-3 알킬)2에 의해 치환될 수 있다)을 형성할 수 있으며; R7은 H 및 C1-8 알킬로부터 선택되며; R8은 H; R3에 의해 임의로 치환된C1-8 알킬; C1-3 알킬에 의해 임의로 치환되는, N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C3-10 헤테로사이클릴; 및 N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C5-10 헤테로아릴로부터 선택되며;R9는 O 또는 N에 부착된 탄소 원자 이외의 임의의 탄소 원자 상의 OH, OR4, N(R4)2, N(R4)COR4,NR4SO2R4 및 N(R4)-(CH2)m-R4; F; CO2H; CON(R4)2;SO2N(R4)2; SO2R4; (CH2)mOR4; (CH2)mN(R4)2; N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C3-10 헤테로사이클릴; 및 N, S 및 O로부터 선택된 하나 이상의 헤테로원자를 포함하는 C5-10 헤테로아릴로부터 선택되고;단, 에틸 4-(2-메톡시페닐아미노)-5-메틸티에노[2,3-d]피리미딘-6-카르복실레이트 화합물은 제외된다.

Thienopyrimidines for pharmaceutical compositionsThe present invention relates to novel pharmaceutical compositions comprising thienopyrimidine compounds according to formula (I). Moreover, the present invention relates to the use of the thienopyrimidine compounds of the invention for the production of pharmaceutical compositions for the prophylaxis and/or treatment of diseases which can be influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof wherein X is selected from CH or N.General formula (i) compound, or its tautomer, metabolite, prodrug or pharmacy acceptable saltwhereinx is selected from ch or n;r 2be selected from h, cn, cf 3, con (r 4) 2optional through r 3the o-c that replaces 1-8alkyl; comprise the heteroatomic c that at least one is selected from n, s and o 3-10heterocyclic radical; comprise the heteroatomic c that at least one is selected from n, s and o 5-10heteroaryl; and it is optional through r 6the c that replaces 1-8alkyl; and when x is ch, r 2also can be f, cl, so 2nh 2y is selected from optional through one or more r 3the straight or branched c that replaces 1-8alkyl; optional through one or more r 9the c that replaces 3-8cycloalkyl; and it is optional through one or more r 9the heterocyclic radical system that is selected from arbitrary following formula that replaces: wherein n be independently 1 to 3 and u independently for o or nr 5r 1be selected from h; cl; and it is optional through n (r 4) 2or the c of f replacement 1-8alkyl; r 3be selected from oh, or 4and n (r 4) 2, in this case, begin by r from second carbon atom of alkyl chain 3replace; and be selected from f; co 2h; con (r 4) 2so 2n (r 4) 2comprise the heteroatomic c that at least one is selected from n, s and o 3-10heterocyclic radical, wherein this nitrogen-atoms can be through h or c 1-3alkyl replaces; and comprise the heteroatomic c that at least one is selected from n, s and o 5-10heteroaryl; r 4be selected from h and c 1-8alkyl; r 5be selected from h; c 1-8alkyl; c 2-8thiazolinyl; c 3-10cycloalkyl; comprise the heteroatomic c that at least one is selected from n, s and o 3-10heterocyclic radical; comprise the heteroatomic c that at least one is selected from n, s and o 5-10heteroaryl; cor 6co 2r 4conh (ch 2) mr 6(ch 2) mr 6co (ch 2) mr 6(ch 2) mc (o) r 6so 2r 4and so 2(ch 2) mr 6wherein m is 1-4; r 6be selected from h; oh; or 4oc (o) r 4n (r 4) 2f; co 2h; con (r 4) 2so 2n (r 4) 2comprise the heteroatomic c that at least one is selected from n, s and o 3-10heterocyclic radical; and comprise the heteroatomic c that at least one is selected from n, s and o 5-10heteroaryl, it is optional through c 1-3alkyl or n (r 4) 2replace; w is selected from f; cl; br; i; cn;-(ch 2) 1-2nr 7r 8-c (s) nh 2-conr 7r 8-c (=nr 7) nr 7r 8-co 2r 7and-so 2nr 7r 8or w and r 1can form together comprise at least one be selected from n, s and o heteroatomic five yuans to seven element heterocycles, wherein this nitrogen-atoms can through h ,-c (o)-o-c 1-4alkyl ,-co-(ch 2) 1-2-nh 2,-co-(ch 2) 1-2-nh (c 1-3alkyl) or-co-(ch 2) 1-2-n (c 1-3alkyl) 2replace; r 7be selected from h and c 1-8alkyl; r 8be selected from h; optional through r 3the c that replaces 1-8alkyl; comprise the heteroatomic c that at least one is selected from n, s and o 3-10heterocyclic radical, it is optional through c 1-3alkyl replaces; and comprise the heteroatomic c that at least one is selected from n, s and o 5-10heteroaryl; r 9be selected from oh, or 4, n (r 4) 2, n (r 4) cor 4, nr 4so 2r 4and n (r 4)-(ch 2) m-r 4, in this case, substituted carbon atom does not link to each other with o or n; and can be selected from f; co 2h; con (r 4) 2so 2n (r 4) 2so 2r 4(ch 2) mor 4(ch 2) mn (r 4) 2comprise the heteroatomic c that at least one is selected from n, s and o 3-10heterocyclic radical; and comprise the heteroatomic c that at least one is selected from n, s and o 5-10heteroaryl; condition is that compound 4-(2-p-methoxy-phenyl amino)-5-thiotolene is also except [2,3-d] pyrimidine-6-ethyl formate.

29120

유압 기기 제조업

특허

ko

en

적어도 2 개의 오디오 신호들을 믹싱하기 위한 장치다운믹스-장치에서 저주파수들에서 재생 라우드니스에서의 변화들에 대한 정정을 실현하기 위해, 적어도 2 개의 오디오 신호들을 믹싱하기 위한 믹싱 장치가 제공되고, 믹싱 장치에는, 제 1 오디오 신호의 전력에 대한 측정치인 제 1 전력 신호를 도출하기 위한 제 1 유닛(104), 제 2 오디오 신호의 전력에 대한 측정치인 제 2 전력 신호를 도출하기 위한 제 2 유닛(105), 제 1 오디오 신호와 제 2 오디오 신호 사이의 교차-상관(cross-correlation)에 대한 측정치인 교차-상관 신호를 도출하기 위한 교차-상관 유닛(103), 제 1 전력 신호 및 제 2 전력 신호 및 교차-상관 신호로부터 곱셈(multiplication) 파라미터를 도출하기 위한 유닛(106), 및 제 1 오디오 신호 및 제 2 오디오 신호에 대한 신호 프로세싱을 수행하고 그들을 결합하기 위한 곱셈 및 결합 유닛(107)이 제공된다. 곱셈 파라미터를 도출하기 위한 유닛(106)에는, 제 1 전력 신호 및 제 2 전력 신호 및 교차-상관 신호의 결합에 대한 측정치인 결합 신호를 도출하기 위한 결합 유닛(110)이 제공되고, 곱셈 파라미터를 도출하기 위한 유닛에서 스케일링 신호로 신호들 중 하나를 스케일링하기 위한 스케일링 유닛(109)이 제공된다. 스케일링 신호(D[k])는 제 1 주파수 값(kL) 미만에서 실질적으로 일정하고, 제 1 주파수 값(kL)과 제 2 더 높은 주파수 값(kU) 사이에서 증가하고, 제 2 주파수 값을 초과해서 또한 실질적으로 일정한 주파수 특성을 갖는다, 곱셈 파라미터를 도출하기 위한 유닛(106)은 또한 결합 신호로부터 단일 곱셈 파라미터(m[k])를 도출하도록 적응되고, 곱셈 및 결합 유닛(107)은 제 1 오디오 신호 및 제 2 오디오 신호에 대한 신호 프로세싱을 수행하도록 적응되고, 신호 프로세싱은, o 제 1 오디오 신호 및 제 2 오디오 신호와 단일 곱셈 파라미터를 곱셈하는 것, 및 o 곱셈된 제 1 오디오 신호 및 제 2 오디오 신호를 결합하는 것과 동등하다.적어도 2 개의 오디오 신호들을 믹싱하기 위한 장치로서, 상기 적어도 2 개의 오디오 신호들을 수신하기 위한 입력들(101, 102), 제 1 전력 신호를 도출하기 위한 제 1 유닛(104) - 상기 제 1 전력 신호는 상기 제 1 오디오 신호의 전력에 대한 측정치임 - , 제 2 전력 신호를 도출하기 위한 제 2 유닛(105) - 상기 제 2 전력 신호는 상기 제 2 오디오 신호의 전력에 대한 측정치임 - , 상기 제 1 오디오 신호와 제 2 오디오 신호 사이의 교차-상관(cross-correlation)의 측정치인 교차-상관 신호를 도출하기 위한 교차-상관 유닛(103),상기 제 1 전력 신호 및 제 2 전력 신호 및 상기 교차-상관 신호로부터 적어도 하나의 곱셈(multiplication) 파라미터를 도출하기 위한 유닛(106), 상기 제 1 오디오 신호 및 제 2 오디오 신호에 대한 신호 프로세싱을 수행하기 위한 곱셈 및 결합 유닛(107)을 포함하고, 상기 신호 프로세싱은, o 상기 제 1 오디오 신호와 곱셈 파라미터를 곱셈하는 것, o 상기 제 2 오디오 신호와 곱셈 파라미터를 곱셈하는 것, o 믹싱된 오디오 신호를 생성하기 위해 곱셈된 제 1 오디오 신호 및 제 2 오디오 신호를 결합하는 것과 동등하고, 상기 곱셈 파라미터를 도출하기 위한 유닛(106)에는 상기 제 1 전력 신호 및 제 2 전력 신호 및 상기 교차-상관 신호의 결합에 대한 측정치인 결합 신호를 도출하기 위한 결합 유닛(110)이 제공되고, 상기 곱셈 파라미터를 도출하기 위한 유닛(106)에서 스케일링 신호로 신호 컴포넌트를 스케일링하기 위한 스케일링 유닛(109)이 제공되고, 상기 스케일링 신호(D[k])는 제 1 주파수 값(kL) 미만의 주파수 범위에서 실질적으로 일정하고, 상기 제 1 주파수 값(kL)과 제 2 더 높은 주파수 값(kU) 사이의 주파수 범위에서 증가하고, 상기 제 2 주파수 값을 초과하는 주파수 범위에서 또한 실질적으로 일정한 주파수 특성을 갖고,상기 곱셈 파라미터를 도출하기 위한 유닛(106)은 상기 결합 신호로부터 단일 곱셈 파라미터(m[k])를 도출하도록 적응되고,상기 곱셈 및 결합 유닛(107)은 상기 제 1 오디오 신호 및 제 2 오디오 신호에 대한 신호 프로세싱을 수행하도록 적응되고, 상기 신호 프로세싱은, o 상기 제 1 오디오 신호 및 상기 제 2 오디오 신호와 단일 곱셈 파라미터를 곱셈하는 것, 및 o 곱셈된 제 1 오디오 신호 및 제 2 오디오 신호를 결합하는 것과 동등한(도 1, 도 2),적어도 2 개의 오디오 신호들을 믹싱하기 위한 장치.

ARRANGEMENT FOR MIXING AT LEAST TWO AUDIO SIGNALSIn order to realize a correction for changes in the reproduction loudness at low frequencies in a downmix-arrangement, a mixing arrangement is proposed for mixing at least two audio signals, which mixing arrangement is provided with - a first unit (104) for deriving a first power signal, which is a measure for the power of the first audio signal, - a second unit (105) for deriving a second power signal, which is a measure for the power of the second audio signal, - a cross-correlation unit (103) for deriving a cross-correlation signal, which is a measure for a cross-correlation between the first and the second audio signal, - a unit (106) for deriving multiplication parameters from the first and second power signals and the cross-correlation signal, and - a multiplication and combination unit (107) for carrying out a signal processing on the first and second audio signals and combining them. The unit (106) for deriving the multiplication parameters is provided with a combination unit (110) for deriving a combination signal which is a measure for a combination of the first and second power signals and the cross-correlation signal, and is provided with a scaling unit (109) for scaling one of the signals in the unit for deriving the multiplication parameters with a scaling signal. The scaling signal (D[k]) has a frequency characteristic which is a substantially constant below a first frequency value (kL), is increasing between the first frequency value (kL) and a second higher frequency value (kU) and is again substantially constant above the second frequency value. The unit (106) for deriving the multiplication parameters is further adapted to derive a single multiplication parameter m[k]) from the combination signal, and the multiplications and combination unit (107) is adapted to carry out a signal processing on the first and second audio signals which is equivalent to - multiplying the first and second audio signals with this single multiplication parameter, and - combining the so multiplied first and second audio signals.Arrangement for mixing at least two audio signals, comprisinginputs (101,102) for receiving the at least two audio signals,a first unit (104) for deriving a first power signal, which first power signal is a measure for the power of the first audio signal,- a second unit (105) for deriving a second power signal, which second power signal is a measure for the power of the second audio signal,a cross- correlation unit (103) for deriving a cross- correlation signal, which is a measure of the cross-correlation between the first and second audio signal,- a unit (106) for deriving at least one multiplication parameter from the first and second power signals and the cross-correlation signal,a multiplication and combination unit (107) for carrying out a signal processing on the first and second audio signals, which is equivalent too multiplying the first audio signal with a multiplication parameter, o multiplying the second audio signal with a multiplication parameter, o combining the so multiplied first and second audio signals to generate a mixed audio signal,characterized in that the unit (106) for deriving a multiplication parameter is provided with a combination unit (110) for deriving a combination signal which is a measure for the combination of the first and second power signals and the cross-correlation signal, and provided with a scaling unit (109) for scaling a signal component in the unit (106) for deriving a multiplication parameter with a scaling signal,that the scaling signal (D[k]) has a frequency characteristic which is substantially constant in a frequency range below a first frequency value (kL), increases in a frequency range between the first frequency value (kL) and a second higher frequency value (ku) and is again substantially constant in a frequency range above the second frequency value, that the unit (106) for deriving a multiplication parameter is adapted to derive a single multiplication parameter (m[k]) from the combination signal, and that the multiplication and combination unit (107) is adapted to carry out a signal processing on the first and second audio signals which is equivalent too multiply the first audio signal and the second audio signal with the single multiplication parameter, ando combine the so multiplied first and second audio signals.(Fig- 1,2)

27301

광학 렌즈 및 광학 요소 제조업

특허

ko

en

스크랩 발생 시 유휴기(遊休期) 리소스를 활용한 팀빌드에 의한 수익 창출 방법본 발명은 여러 종류의 여러 곳에 산재된 소유주가 다른 유휴 리소스들을 결합하여 철거 현장에서 발생된 금속 스크랩을 제철사로 납품하기 위한 일련의 과정을 수행할 수 있는 유휴 리소스를 이용한 금속 스크랩 납품 방법을 개시한다.본 발명은 이를 위하여 스크랩의 수집, 가공, 납품업을 영위하는 대다수의 소규모 사업자가 구비하고 있는 여러 종류의 굴삭기 및 방통차, 금속 스크랩 압축설비, 야드, 검수 등급 판정 인력 중 불가피하게 발생하는 유휴기 동안의 리소스를 활용하여 스크랩의 발생에서 제강사로의 납품에 이르는 전 과정을 수행하기 위하여 한시적으로 구성된 팀빌드에 의하여 수행하도록 함으로써 소규모 사업자가 보유한 각종의 리소스에 관련한 고정 비용 부담을 줄임으로써 수익을 창출할 수 있도록 하며, 이들 납품 물량을 모아 납품 물량을 증대시켜 줌으로써 제강사로부터 유리한 납품 단가 적용을 받을 수 있게 되는 유용한 효과가 있다.서로 다른 각각의 사업자들이 보유하고 있는 리소스들의 유휴 발생시 사업자 단말기가 웹서버에 연결한 후 웹서버에서 제공하는 양식에 따라 리소스 보유업체 정보와 리소스의 유휴기를 포함한 리소스 데이터를 웹서버에 전송하는 단계와,상기 웹서버가 전송받은 상기 리소스 데이터의 양식 오류 검사 후 상기 양식으로부터 리소스 종류를 장치코드로, 해당 리소스가 소재하고 있는 지역 위치를 지역코드로, 유휴시작 및 유휴종류 예정일자를 유휴기코드로 변환하여 parity check code를 포함한 코드로 코드화한 후 데이터베이스서버에 저장하는 작동을 리소스별로 반복하는 단계와,스크랩 발생데이터를 정보관리자 단말기가 웹서버에 입력하는 단계와,상기 웹서버가 전송받은 스크랩 발생데이터에서 스크랩 성상, 재질, 발생일, 발생지역 정보를 코드화하여 데이터베이스서버에 저장하는 단계와,스크랩 납품 정보 관리자 단말기가 재질, 제강사 입고일 및 제강사 입고 장소의 주소를 포함하는 스크랩 납품데이터를 웹서버에 입력하는 단계와,상기 웹서버가 전송받은 스크랩 납품데이터에서 재질, 제강사 입고일 및 제강사 입고 장소의 주소를 코드화하여 데이터베이스서버에 저장하는 단계와,사업자 단말기에 의하여 입력된 리소스 데이터와 상기 스크랩 발생데이터, 상기 스크랩 납품데이터가 입력된 후 웹서버가 데이터베이스서버로부터 스크랩 납품데이터에 포함된 재질과 제강사 입고일 데이터의 코드를 가져 오는 단계와, 상기 웹서버가 데이터베이스서버로부터 스크랩 발생데이터를 코드비교를 통해 검색하여 스크랩 납품데이터에 포함된 재질과 제강사 입고일을 충족시킬 수 있는 조건의 스크랩 발생데이터가 있는 지의 여부를 검색하는 단계와,상기 스크랩 납품데이터에 포함된 재질과 제강사 입고일을 충족시킬 수 있는 조건의 스크랩 발생데이터가 검색되는 경우 상기 웹서버가 코드화 되어 데이터베이스서버에 저장된 유휴기에 있는 각 사업자들의 리소스 데이터로부터 코드에 의해 팀빌드하고 스크랩의 성상에 따라 해당 공정에 필요한 유휴기에 있는 각 사업자들의 리소스를 스케줄링하는 단계가 구성되되,상기 스케줄링 하는 단계는 상기 웹서버가 상기 데이터베이스서버의 리소스 데이터를 가져다가 유휴기간에 있는 리소스 중의 하나인 굴삭기 매칭데이터가 존재하는 지를 검색하는 단계와; 상기 웹서버가 상기 스크랩 발생데이터에 포함된 위치데이터와 유휴기에 있는 굴삭기 관련 리소스 데이터의 위치가 매칭되는 것으로 판정된 경우 해당 굴삭기가 현장으로 투입되도록 해당 사업자 단말기에 지시하는 단계와; 상기 웹서버가 데이터베이스서버에서 등급판정 인력 관련 리소스 데이터를 가져다가 등급판정 인력 관련 리소스 데이터의 위치데이터가 상기 스크랩 발생 데이터에 포함된 지역코드와 매칭되고, 스크랩 발생 데이터의 발생일시 데이터가 등급판정 인력의 유휴기간 이내에 있는 경우에 해당 등급 판정 인력의 파견을 위하여 해당 사업자 단말기에 지시하는 단계와; 상기 웹서버가 데이터베이스서버로부터 방통차 관련 리소스 데이터를 가져다가 스크랩 발생 데이터와 리소스인 방통차의 지역코드가 매칭되고, 스크랩 발생일시가 방통차의 유휴기간 이내에 있는 경우에 해당 방통차의 투입을 위하여 해당 사업자 단말기에 지시하는 단계와; 상기 웹서버가 데이터베이스서버로부터 리소스 데이터를 가져다가 리소스인 스크랩 압축설비의 지역 코드가 스크랩 발생 데이터의 지역코드와 매칭되고, 금속 스크랩 발생일시가 금속 스크랩 압축 설비의 유휴기간 이내에 있는 경우 해당 금속 스크랩 압축설비의 투입을 위하여 해당 사업자 단말기에 지시하는 단계가 구성됨을 특징으로 하는 스크랩 발생시 유휴기(遊休期) 리소스를 활용한 팀빌드에 의한 수익 창출 방법.

PROFIT GENERATION METHOD BY MEANS OF BUILDING TEAM UTILIZING IDLE RESOURCES ASSOCIATED WITH OCCURRENCE OF SCRAPSThe present invention relates to a scrap metal supply method using idle resources, the method combining the idle resources which are of many types, scattered in many places and owned by different owners, such that a series of steps for supplying scrap metal generated in a demolition site to a steel manufacturer can be performed.A profit generation method by means of a building team using idle resources associated with occurrence of scraps, the method comprising: connecting with a web server when an idle state of resourced involved by businessmen occurs to transmit resource data including types, sizes, quantities, an idle start date, an expected idle finish data of the resources, an area of a corresponding resource, an address and e-mail address information of a resource involving company to a web server according to a form provided from the web server by a terminal; repeating storage of the received resource data in a database server after checking an error for the received resource data by the web server; inputting scrap occurrence information to the web server by an information manager terminal when the scraps occur; inputting scrap supply information including materials, a steel manufacturer warehouse data and an address of a warehouse place of the steel manufacturer by a scrap supply information manager terminal; fetching the materials and the steel manufacturer warehouse date included in the scrap supply information from the database server by the web server after inputting the resource data, scrap occurrence data, and scrap supply data by a businessman terminal; searching the scrap occurrence information from the database server to determine whether scrap occurrence data sufficient to satisfy the materials and the steel manufacturer warehouse date included in the scrap supply date are included in the scrap occurrence information; sequentially listing resources capable of performing steps including collection, processing, and transportation for supplying the scraps when the scrap occurrence data sufficient to satisfy the materials and the steel manufacturer warehouse date included in the scrap supply date are included in the scrap occurrence information; fetching the resource data from the database server to determine whether excavator matching data being one of idle period resources is included in the resource data; instructing warehouse of a corresponding excavator into a field by the web server when a position of resource data on an excavator corresponds to position data included in the scrap occurrence data; fetching data from the database server for introducing a personnel for grade assessment, and comparing occurrence date data of the scrap occurrence data with idle period data of the personnel for grade assessment when a region code included in the scrap occurrence data corresponding to the fetched data to instruct dispatch of a corresponding personnel for grade assessment when the occurrence date data of the scrap occurrence data correspond to the idle period data of the personnel for grade assessment by the web server; fetching the data from the database server for performing a transportation process by a cargo truck being a resource to instruct warehouse of a corresponding cargo truck by the web server when a region code of the cargo truck being the resource corresponds to a region code of the scrap occurrence data and a scrap metal occurrence date is within an idle period of the cargo truck; fetching the resource data from the database server to instruct warehouse of a corresponding scrap metal pressing facility by the web server when a region code of a scrap pressing facility corresponds to the region code of the scrap occurrence data and the scrap metal occurrence date is within an idle period of a scrap metal pressing facility; and fetching the data from the database server for performing a transportation process to a steel manufacturer by the cargo truck being the resource to instruct warehouse of a corresponding cargo truck by the web server when a region code of the cargo truck being the resource corresponds to the region code of the scrap occurrence data and the scrap metal occurrence date is within an idle period of the cargo truck being the resource so that the scraps are transported to the steel manufacturer.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

NADPH 옥시다제 4 억제제본 발명은 화학식 (I)의 2,5-이치환된 벤족사졸 및 벤조티아졸 유도체, 그의 제조 및 약학적 활성 화합물로서의 그의 용도에 관한 것이다: [화학식 I][이미지] 상기 식에서, L, X, Y 및 고리 (A)는 명세서에 기재된 바와 같다. 일부 화합물은 활성 산소 종 (ROS) 생산 장애와 관련된 질환 또는 장애의 예방 또는 치료 및/또는 다양한 섬유증 질환의 예방 또는 치료에 유용할 수 있다.화학식 (I)의 화합물 또는 약학적으로 허용 가능한 그의 염:[화학식 I][이미지]상기 식에서,고리 (A)는 페닐기에 융합된 비방향족 5- 내지 7-원 헤테로사이클릭 고리를 나타내고; 상기 5- 내지 7-원 헤테로사이클릭 고리는 하나의 산소 고리 원자 및 임의로 산소 또는 질소로부터 독립적으로 선택된 하나의 추가 고리 헤테로 원자를 함유하고; 상기 5- 내지 7-원 헤테로사이클릭 고리는 독립적으로 비치환되거나, 또는 일- 또는 이치환되고, 여기서 치환체들은 독립적으로 다음 중에서 선택되고:· 고리 산소 및/또는 고리 질소 원자에 대한 알파 위치의 고리 탄소 원자에 부착된 하나의 옥소 치환체; 및/또는· 자유 원자가를 갖는 고리 질소 원자에 부착된 하나의 C1-3 알킬; 또는· 동일한 고리 탄소 원자에 부착된 2개의 플루오로 치환체;L은 -NH-CO-* 또는 -CO-NH-*를 나타내며, 여기서 별표 (*)는 벤족사졸/벤조티아졸 부분에 연결된 결합을 나타내고;X는 O 또는 S를 나타내고;Y는ㆍ -NR1R2를 나타내고, 여기서 ≫ R1은 ㆍ C1-4 알킬; ㆍ 디-(C1-3-알킬)아미노, 하이드록시 또는 C1-3-알콕시로 일치환된 C2-4 알킬; ㆍ C3-5-사이클로알킬-L1- (여기서 L1은 직접 결합 또는 C1-3 알킬렌을 나타내고; C3-5-사이클로알킬은 임의로 하나의 산소 고리 원자를 함유하고, 상기 C3-5-사이클로알킬은 비치환되거나, 메틸 또는 플루오로로 일치환됨); 또는 ㆍ 피페리딘-3-일, 피페리딘-4-일 또는 피롤리딘-3-일 기 (이들 기는 고리 질소 원자상에서 C3-5-사이클로알킬로 치환되고, 상기 C3-5-사이클로알킬은 임의로 하나의 산소 고리 원자를 함유함); 를 나타내고; ≫ R2는 수소, C1-3-알킬 또는 C3-5-사이클로알킬을 나타내거나; 또는ㆍ Y는 다음으로부터 선택된 포화된 4- 내지 7-원 모노사이클릭 헤테로사이클릴을 나타내고: ≫ 모르폴린-4-일; 2-옥소-피롤리딘-1-일; 1,1-디옥시도티오모르폴린-4-일; 또는 위치 4에서 옥세탄-3-일 또는 C1-3-알킬로 임의로 일치환된 피페라진-1-일; 또는 ≫ 아제티딘-1-일, 피롤리딘-1-일 또는 피페리딘-1-일 (상기 아제티딘-1-일, 피롤리딘-1-일 또는 피페리딘-1-일은 독립적으로 비치환되거나, 또는 ㆍ 동일한 고리 탄소 원자에 부착된 2개의 플루오로 치환체; 또는 ㆍ 비치환된 페닐, 또는 비치환된 5- 또는 6-원 헤테로아릴 중에서 선택된 하나의 치환체; 또는 ㆍ 하이드록시; C1-3-알콕시; -CO-C1-4-알콕시; 디-(C1-3-알킬)아미노; 및 디-(C1-3-알킬)아미노, 하이드록시, 또는 C1-3-알콕시로 일치환된 C1-3-알킬 중에서 선택된 하나의 치환체; 또는 ㆍ 하나는 C1-4-알킬이고, 다른 하나는 하이드록시 또는 디-(C1-3-알킬)아미노중에서 선택되는 2개의 치환체; 또는 ㆍ 모르폴린-4-일; 1,1-디옥시도티오모르폴린-4-일; 또는 위치 4에서 C1-3-알킬로 임의로 일치환된 피페라진-1-일 중에서 선택된 하나의 치환체; 또는 ㆍ 독립적으로 비치환되거나 또는 하이드록시로 일치환되거나, 또는 메틸 및 하이드록시로 이치환된 아제티딘-1-일, 피롤리딘-1-일 또는 피페리딘-1-일 중에서 선택된 하나의 치환체; 로 치환됨); 또는· Y는 적어도 하나의 질소 원자를 함유하는 포화된 7- 내지 11-원의 융합, 가교화 또는 스피로-비사이클릭 헤테로사이클릴을 나타내며, 여기서 상기 질소 원자는 벤족사졸/벤조티아졸 부분에 결합되고, 상기 헤테로사이클릴은 임의로 산소, 질소 및 황으로부터 독립적으로 선택된 하나의 추가 고리 헤테로 원자를 함유하며; 상기 헤테로사이클릴은 비치환되거나, 또는 ≫ 고리 황 고리 원자에서 2개의 옥소 치환체; 또는 ≫ 자유 원자가를 갖는 고리 질소 원자에 부착된 하나의 C1-3-알킬 치환체;로 치환된다.

NADPH oxidase 4 inhibitorsThe invention relates to 2,5-disubstituted benzoxazole and benzothiazole derivatives of Formula (I) Formula (I) wherein L, X, Y, and ring (A) are as described in the description, their preparation andtheir use as pharmaceutically active compounds. Said compounds may be useful for the prevention or treatment of diseases or disorders associated with impaired reactive oxygen species (ROS) production, and/or for the prevention or treatment of various fibrotic diseases.The compound or its pharmaceutically acceptable salt of formula (i),wherein,ring (a) represents non-aromatic 5 ~ 7 circle heterocycles with phenyl fusion, wherein 5 ~ 7 circle heterocycles contain 1 oxygen annular atom and appointed be independently selected from another 1 heteroatom of oxygen or nitrogen to meaning, wherein 5 ~ 7 circle heterocycles be independently unsubstituted, through monosubstituted or through two substitution, wherein substituent independently selected from：1 oxo substituent, it is connected to ring carbon atom in the α positions of epoxy and/or theheterocyclic nitrogen atom, and/or1 c1-3- alkyl, it is connected to the theheterocyclic nitrogen atom with free valency, or2 fluoro substituents, it is connected to same ring carbon atom；l expression-nh-co-* or-co-nh-*, wherein asterisk (*) refer to the key for linking to benzoxazole/benzothiazole part；x represents o or s；andy is represented·-nr1r2, wherein, r1represent■c1-4- alkyl,■c2-4- alkyl, it is with two-(c1-3- alkyl) amino, hydroxyl or c1-3- alkoxy is monosubstituted,■c3-5- cycloalkyl-l1-, wherein l1represent direct key or c1-3- alkylidene, andthe c3-5- cycloalkyl arbitrarily contains 1 oxygen annular atom, and wherein describedc3-5- cycloalkyl is unsubstituted or monosubstituted with methyl or fluorine, or■ piperidines -3- bases, piperidin-4-yl or pyrrolidin-3-yl, the group use c on theheterocyclic nitrogen atom3-5- cycloalkyl substitutes, wherein described c3-5- cycloalkyl arbitrarily contains 1 oxygen annular atom, and r2represent hydrogen, c1-3- alkyl or c3-5- cycloalkyl,or y represents 4 ~ 7 unit monocycle heterocyclic radicals of saturation, it is selected from：morpholine -4- bases, 2- oxo-pyrroli -1- bases, 1,1- dioxies thiomorpholine -4- bases or 4 with oxetanes - 3- bases or c1-3- alkyl arbitrarily mono-substituted piperazine -1- bases,or azetidine -1- bases, pyrrolidin-1-yl or piperidin-1-yl, wherein the azetidine -1- bases, pyrrolidin-1-yl or piperidin-1-yl is independently unsubstituted or with following substitution：2 fluoro substituents of ■, it is connected to same ring carbon atom, or1 substituent of ■, it is selected from unsubstituted phenyl or the substituent of unsubstituted 5 ~ 6 unit's heteroaryl, or1 substituent of ■, it is selected from hydroxyl, c1-3- alkoxy ,-co-c1-4- alkoxy, two-(c1-3- alkyl) amino and with two- (c1-3- alkyl) amino, hydroxyl or c1-3the mono-substituted c of-alkoxy1-3- alkyl, or2 substituents of ■, wherein 1 in the substituent is c1-4- alkyl, and another 1 independently selected from hydroxyl or two- (c1-3- alkyl) amino, or1 substituent of ■, it is selected from morpholine -4- bases, 1,1- dioxies thiomorpholine -4- bases or uses c at 41-3- alkyl is arbitrarily mono-substituted piperazine -1- bases,1 substituent of ■, it is selected from azetidine -1- bases, pyrrolidin-1-yl or piperidin-1-yl, wherein the group is independently not it is substituted, is monosubstituted with hydroxyl or substituted with methyl and hydroxyl two,or y represents the 7 ~ 11 yuan of fusions of saturation, bridge or spiral shell-bicyclic heterocyclic radical, it contains at least one nitrogen-atoms, its described in nitrogen atom bonding to benzoxazole/benzothiazole part, and wherein described heterocyclic radical arbitrarily contain independently selected from another 1 ring hetero atom of oxygen, nitrogen and sulphur, wherein the heterocyclic radical is unsubstituted or with following substitution：2 oxo substituents, its at epithio annular atom, or1 c1-3- alkyl substituent, it is connected to the theheterocyclic nitrogen atom with free valency.

21102

생물학적 제제 제조업

특허

ko

en

페닐렌디아민기를 함유하는 헤르페스 바이러스의헤테로시클릭 카르복사미드-함유 티오우레아 저해제인간 사이토메갈로바이러스, 헤르페스 심플렉스 바이러스, 엡스타인-바르 바이러스, 바리셀라-조스터 바이러스, 인간 헤르페스바이러스-6 및-7, 및 카포시 헤르페스바이러스를 포함하는 헤르페스 바이러스에 관련된 질병의 치료에 유용한 하기 일반식을 갖는 화합물: 여기서, R1-R5는 수소, 1-6 개의 탄소 원자의 알킬, 2-6 개의 탄소원자의 알케닐, 2-6 개의 탄소 원자의 알키닐, 1-6 개의 탄소 원자의 퍼할로알킬, 3-10 개의 탄소 원자의 시클로알킬, 3-10 탄소 구성원의 헤테로시클로알킬, 아릴, 헤테로아릴, 할로겐, CN, NO2, CO2R6, COR6, OR6, SR6 , SOR6, SO2R6, CONR7R8, NR6N(R 7R8), N(R7R8) 또는 W-Y-(CH2)n-Z으로부터 독립적으로 선택되고, R 1-R5 중 적어도 하나는 수소가 아니고; 또는 R2 및 R3 또는 R3 및 R4는 함께 취해져서, 3 내지 7 각의 헤테로시클로알킬 또는 3 내지 7 각의 헤테로 아릴을 형성하며; R6 및 R7은 독립적으로 수소, 1-6 개의 탄소원자의 알킬, 1-6 개의 탄소원자의 퍼할로알킬, 또는 아릴이고; R8은 수소, 1-6 개의 탄소원자의 알킬, 1-6 개의 탄소원자의 퍼할로알킬, 3-10 개의 탄소원자의 시클로알킬, 3-10 구성원의 헤테로시클로알킬, 아릴 또는 헤테로아릴이고, 또는 R7 및 R8은 함께 취해져, 3 내지 7 각의 헤테로시클로알킬을 구성할 수 있고; W는 O, NR6이거나 또는 비어있으며; Y는 -(CO)- 또는 -(CO2)- 이거나 또는 비어있고; Z는 1-4 개의 탄소원자의 알킬, CN, CO2R6, COR6, CONR7R 8, OCOR6, NR6COR7, OCONR6, OR6, SR6, SOR6, SO2R6, SR 6N(R7R8), N(R7R8) 또는 페닐이며; G는 모노시클릭 헤테로아릴이고; X는 결합, -NH, 1-6 개의 탄소원자의 알킬, 1-6 개의 탄소원자의 알케닐, 1-6 개의 탄소원자의 알콕시, 1-6 개의 탄소원자의 티오알킬, 1-6 개의 탄소원자의 알킬아미노, 또는 (CH)J이며; J는 1-6 개의 탄소원자의 알킬, 3-7 개의 탄소원자의 시클로알킬, 페닐 또는 벤질이고; n은 1-6의 정수이다.하기 일반식을 갖는 화합물: [이미지] 여기서, R1-R5는 수소, 1-6 개의 탄소 원자의 알킬, 2-6 개의 탄소원자의 알케닐, 2-6 개의 탄소 원자의 알키닐, 1-6 개의 탄소 원자의 퍼할로알킬, 3-10 개의 탄소 원자의 시클로알킬, 3-10 개의 탄소 구성원의 헤테로시클로알킬, 아릴, 헤테로아릴, 할로겐, -CN, -NO2, -CO2R6, -COR6, -OR6, -SR6 , -SOR6, -SO2R6, -CONR7R8, -NR6N(R 7R8), -N(R7R8) 또는 W-Y-(CH2)n-Z로부터 독립적으로 선택되고, R 1-R5 중 적어도 하나는 수소가 아니고; 또는 R2 및 R3 또는 R3 및 R4는 함께 취해져서, 3 내지 7 각의 헤테로시클로알킬 또는 3 내지 7 각의 헤테로아릴을 형성하며; R6 및 R7은 독립적으로 수소, 1-6 개의 탄소원자의 알킬, 1-6 개의 탄소원자의 퍼할로알킬, 또는 아릴이며; R8은 수소, 1-6 개의 탄소원자의 알킬, 1-6 개의 탄소원자의 퍼할로알킬, 3-10 개의 탄소원자의 시클로알킬, 3-10 구성원의 헤테로시클로알킬, 아릴 또는 헤테로아릴이거나, 또는 R7 및 R8은 함께 취해져, 3 내지 7 각의 헤테로시클로알킬을 형성할 수 있고; W는 O, NR6이거나 또는 비어있으며; Y는 -(CO)- 또는 -(CO2)-이거나 또는 비어있으며; Z는 1-4 개의 탄소원자의 알킬, -CN, -CO2R6, COR6, -CONR7R 8, -OCOR6, -NR6COR7, -OCONR6, -OR6, -SR6, -SOR6, -SO2R6, SR6N(R7R8), -N(R7R8) 또는 페닐이며; G는 모노시클릭 헤테로아릴이며; X는 결합, -NH, 1-6 개의 탄소원자의 알킬, 1-6 개의 탄소원자의 알케닐, 1-6 개의 탄소원자의 알콕시, 1-6 개의 탄소원자의 티오알킬, 1-6 개의 탄소원자의 알킬아미노, 또는 (CH)J이며; J는 1-6 개의 탄소원자의 알킬, 3-7 개의 탄소원자의 시클로알킬, 페닐 또는 벤질이고; n은 1-6의 정수이다.

Heterocyclic carboxamide-containing thiourea inhibitors of herpes viruses containing phenylenediamine groupCompounds having formula (I) wherein R1-R5 are independently selected from hydrogen, alkyl of 1 to 6 carbon atoms, alkenyl of 2 to 6 carbon atoms, alkynyl of 2 to 6 carbon atoms, perhaloalkyl of 1 to 6 carbon atoms, cycloalkyl of 3 to 10 carbon atoms, heterocycloalkyl of 3 to 10 carbon members, aryl, heteroaryl, halogen, CN, NO2, CO2R6, COR6, OR6, SR6, SOR6, SO2R6, CONR7R8, NR6N(R7R8), N(R7R8) or W-Y-(CH2)n-Z provided that at least one of R1-R5 is not hydrogen; or R2 and R3 or R3 and R4, taken together form a 3 to 7 membered heterocycloalkyl or 3 to 7 membered heteroaryl; R6 and R7 are independently hydrogen, alkyl of 1 to 6 carbon atoms, perhaloalkyl of 1 to 6 carbon atoms, or aryl; R8 is hydrogen, alkyl of 1 to 6 carbon atoms, perhaloalkyl of 1 to 6 carbon atoms, cycloalkyl of 3 to 10 carbon atoms, heterocycloalkyl of 3 to 10 members, aryl or heteroaryl, or R7 and R8, taken together may form a 3 to 7 membered heterocycloalkyl; W is O, NR6, or is absent; Y is (CO)- or (CO2)-, or is absent; Z is alkyl of 1 to 4 carbon atoms, CN, CO2R6, COR6, CONR7R8, OCOR6, NR6COR7, OCONR6, OR6, SR6, SOR6, SO2R6, SR6N(R7R8), N(R7R8) or phenyl; G is monocyclic heteroaryl; X is a bond, NH, alkyl of 1 to 6 carbon atoms, alkenyl of 1 to 6 carbon atoms, alkoxy of 1 to 6 carbon atoms, or thioalkyl of 1 to 6 carbon atoms, alkylamino of 1 to 6 carbon atoms, or (CH)J; J is alkyl of 1 to 6 carbon atoms, cycloalkyl of 3 to 7 carbon atoms, phenyl or benzyl; and n is an integer from 1 to 6, useful in the treatment of diseases associated with herpes viruses including human cytomegalovirus, herpes simplex viruses, Epstein-Barr virus, varicella-zoster virus, human herpesviruses -6 and -7, and Kaposi herpesvirus.A compound is characterized in that, this compound has following formula: wherein r 1-r 5be selected from respectively cycloalkyl, a 3-10 carbon atom of perhaloalkyl radical, a 3-10 carbon atom of alkynyl, a 1-6 carbon atom of alkenyl, a 2-6 carbon atom of alkyl, a 2-6 carbon atom of hydrogen, a 1-6 carbon atom heterocyclylalkyl, aryl, heteroaryl, halogen ,-cn ,-no 2,-co 2r 6,-cor 6,-or 6,-sr 6,-sor 6,-so 2r 6,-conr 7r 8,-nr 6n (r 7r 8) ,-n (r 7r 8) or w-y-(ch 2) n-z, condition is r 1-r 5at least one is not a hydrogen; or r 2and r 3, or r 3and r 4form 3-7 unit's heterocyclylalkyl or 3-7 unit heteroaryl altogether; r 6and r 7be respectively the alkyl of hydrogen, a 1-6 carbon atom, the perhaloalkyl radical of a 1-6 carbon atom, or aryl; r 8be the alkyl of hydrogen, a 1-6 carbon atom, the perhaloalkyl radical of a 1-6 carbon atom, cycloalkyl, 3-10 unit heterocyclylalkyl, aryl or the heteroaryl of a 3-10 carbon atom, or r 7and r 8can form 3-7 unit heterocyclylalkyl altogether; w is o, nr 6, or do not exist; y is-(co)-or-(co 2)-, or do not exist; z be 1-4 carbon atom alkyl ,-cn ,-co 2r 6, cor 6,-conr 7r 8,-ocor 6,-nr 6cor 7,-oconr 6,-or 6,-sr 6,-sor 6,-so 2r 6, sr 6n (r 7r 8) ,-n (r 7r 8) or phenyl; g is a bicyclic heteroaryl;x be a key ,-alkylamino of the alkoxyl group of the alkyl of nh, a 1-6 carbon atom, the alkenyl of a 1-6 carbon atom, a 1-6 carbon atom, the alkylthio of a 1-6 carbon atom, a 1-6 carbon atom or (ch) j;j is the alkyl of 1-6 carbon atom, cycloalkyl, phenyl or the benzyl of a 3-7 carbon atom; withn is the integer of 1-6.

21300

의료용품 및 기타 의약 관련제품 제조업

특허

ko

en

EGFR-유도된 암의 세포 증식을 억제하는 방법본 발명은, 환자에게 구조식 (I)의 화합물을 투여함으로써, 엘로티닙 및 제피티닙과 같은 타이로신 키나아제 억제제에 불응성이거나 불응성이 되는, EGFR-유도된 암에 걸린 환자를 치료하는 방법을 특징으로 한다. 본 발명은 또한, 본 명세서에 특정된 EGFR 돌연변이를 갖는 EGFR-유도된 암의 치료를 특징으로 한다.대상 내의 EGFR-유도된 암을 치료하는 방법으로서, 구조식 (I)의 화합물 또는 이의 약학적으로 허용가능한 염의 치료적으로 유효한 양을 대상에 투여하는 것을 포함하는 방법:상기 구조식 (I)에서, Rd가 H, C1-4 알킬, C1-4 알콕시 또는 할로이고; Re가 H 또는 NH2이거나; Rd 및 Re가, 이들이 부착된 피리미딘 고리 원자와 함께 N, S 및 0로부터 독립적으로 선택되는 1, 2 또는 3 개의 헤테로원자를 함유한 5 또는 6원 고리를 형성하며, 상기 5 또는 6원 고리가 Rh로 치환되고;Rh가 H, C1-4 알킬 또는 할로이며;Ra2가 H, C1-6 알콕시, C3-6 알케닐옥시 또는 C3-6 사이클로알킬옥시이고;Rg가 -P(O)(R3A)(R3B), -S(O)N(R3C)(R3D), -S(O)2R3E, -OC(O)N(R3F)(R3G), -NR3HC(O)OR3I, 1, 2, 3 또는 4 개의 N 원자를 포함하는 5 또는 6원 헤테로사이클릭 고리이거나, Rg2와 결합하여 5 내지 7원 헤테로사이클릭 고리를 형성하며, 여기서 각각의 R3A, R3B, R3C, R3D, R3E, R3F, R3G, R3H 및 R3I이 독립적으로, H, 알킬, 알케닐, 알키닐, 사이클로알킬, 사이클로알케닐, 사이클로알키닐 및 헤테로알킬로부터 선택되거나, R3A 및 R3B, 또는 R3C 및 R3D, 또는 R3F 및 R3G가, 이들이 부착된 원자와 함께 비치환 또는 치환된 5 또는 6원 헤테로사이클릭 고리를 형성하기 위해 결합하고;Rg2가 H, F, C1-4 알킬이거나, Rg2 및 Rg가, 이들이 부착된 원자와 함께 P, N, 0 및 S로부터 독립적으로 선택되는 1 내지 3 개의 헤테로원자를 포함하는 5 내지 7원 헤테로사이클릭 고리를 형성하고, 상기 헤테로사이클릭 고리가 비치환 또는 치환되며;Rg1이 H, F이거나, 1 또는 2 개의 N 원자를 포함하는 5 또는 6원 헤테로사이클릭 고리이고, 상기 헤테로사이클릭 고리가 비치환 또는 치환되며;Rb2가 H, F이거나, 1, 2 또는 3 개의 N 또는 O 원자를 함유하는 5 또는 6원 헤테로사이클릭 고리이고, 상기 헤테로사이클릭 고리가 비치환 또는 치환되며;Rb4가 H, F, C1-6 알콕시, C3-6 알케닐옥시 또는 C3-6 사이클로알킬옥시, -OC(O)N(R5A)(R5B), -NR5CC(O)OR5D; 1, 2 또는 3 개의 N 또는 O 원자를 포함하는 비치환 또는 치환된 5 또는 6원 헤테로사이클릭 고리이거나, Rb4 및 Ra1이, 이들이 부착된 원자와 함께 1, 2 또는 3 개의 N 또는 O 원자를 포함하는 비치환 또는 치환된 6원 헤테로사이클릭 고리를 형성하며;각각의 R5A, R5B, R5C 및 R5D가 독립적으로, H, 알킬, 알케닐, 알키닐 및 헤테로알킬로부터 선택되거나, R5A 및 R5B가, 이들이 부착된 원자와 함께 비치환 또는 치환된 5 또는 6원 헤테로사이클릭 고리를 형성하기 위해 결합하고;Ra1이 6원 헤테로사이클릭 고리를 형성하기 위해 Rb4와 결합하거나, H, 할로, -CN, -NO2, -R1 , -OR2, -0-NR1R2, -NR1R2, -NR1-NR1R2, -NR1-OR2, -C(O)YR2, -OC(O)YR2, -NR1C(O)YR2, -SC(O)YR2, -NR1C(=S)YR2, -OC(=S)YR2, -C(=S)YR2, -YC(=NR1)YR2, -YC(=N-OR1)YR2, -YC(=N-NR1R2)YR2, -YP(=O)(YR1)(YR2), -NR1SO2R2, -S(O)rR2, -SO2NR1R2, -NR1SO2NR1R2 또는이고;각각의 Y가 독립적으로, 결합(a bond), -0-, -S- 또는 -NR1-이고;각 경우의 R1 및 R2가 독립적으로, H, 알킬, 알케닐, 알키닐, 사이클로알킬, 사이클로알케닐, 사이클로알키닐, 아릴, 헤테로알킬, 헤테로사이클릭 또는 헤테로아릴이며;각각의 X1 및 X2가 독립적으로, CH 또는 N이며; R4가 알킬, 알케닐, 알키닐, 사이클로알킬, 사이클로알케닐, 사이클로알키닐, 아릴, 헤테로알킬, 헤테로사이클릭 또는 헤테로아릴이다.

METHODS FOR INHIBITING CELL PROLIFERATION IN EGFR-DRIVEN CANCERSThe invention features a method for treating patients who have an EGFR-driven cancer, which is, or has become, refractory to a tyrosine kinase inhibitor, such as eriotinib and gefitinib, by administering a compound of formula (I) to the patient. The invention also features treating EGFR-driven cancers having an EGFR mutation identified herein.A method for treating an EGFR-driven cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I), or a pharmaceutically acceptable salt thereof:whereinRd isH, C1 -4 alkyl, C1 -4 alkoxy, or halo; and Re is H or NH2; or Rd and Re, together with the pyrimidine ring atoms to which they are attached, form a 5- or 6- membered ring containing 1 , 2 or 3 heteroatoms, independently selected from N, S and 0, wherein the 5- or 6-membered ring is substituted by Rh;Rh is H, C1-4 alkyl, or halo;Ra2 is H, C1-6 alkoxy, C3.6 alkenyloxy, or C3-6 cycloalkyloxy;Rg is -P(O)(R3A)(R3B), -S(O)N(R3C)(R3D), -S(O)2R3E, -OC(O)N(R3F)(R3G), -NR3HC(O)OR31, a 5 or 6 member heterocyclic ring comprising 1 , 2, 3 or 4 N atoms, or combined with Rg2 forms a 5- to 7-member heterocyclic ring, wherein each of R3A, R3B, R3C, R3D, R3E, R3F, R3G, R3H, and R31 is, independently, selected from H, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, and heteroalkyl, or R3A and R3B, or R3C and R3D, or R3F and R3G, together with the atoms to which they are attached, combine to form a 5- or 6-membered heterocyclic ring which is unsubstituted or substituted;Rg2 is H, F, C1-4 alkyl, or, R^ and Rg together with the atoms to which they are attached form a 5- to 7-member heterocyclic ring comprising 1 - 3 hetero atoms independently selected from P, N, 0 and S, the heterocyclic ring being unsubstituted or substituted;Rg1 is H, F, or a 5 or 6 member heterocyclic ring comprising 1 or 2 N atoms, the heterocyclic ring being unsubstituted or substituted;Rb2 is H, F, or is a 5 or 6 member heterocyclic ring containing 1 , 2 or 3 N or 0 atoms, the heterocyclic ring being unsubstituted or substituted;Rb4 is H, F, C1-6 alkoxy, C3-6 alkenyloxy, or C3-6 cycloalkyloxy,-OC(O)N(R5A)(R5B), -NR5CC(O)OR5D; a 5 or 6 member heterocyclic ring comprising 1 , 2 or 3 N or 0 atoms, the heterocyclic ring being unsubstituted or substituted, or, Rb4 and Ra1 together with the atoms to which they are attached form a 6 member heterocyclic ring comprising 1 , 2 or 3 N or 0 atoms which is unsubstituted or substituted;each of R5A, R5B, R5C, and R5D is, independently, selected from H, alkyl, alkenyl, alkynyl, and heteroalkyl, or R5A and R5B, together with the atoms to which they are attached, combine to form a 5- or 6-membered heterocyclic ring which is unsubstituted or substituted;Ra1 combines with Rb4 to form a 6 member heterocyclic ring, or Ra1 is H, halo, -CN,-NO2, -R1, -OR2, -0-NR1R2, -NR1R2, -NR1-NR1R2, -NR1-OR2, -C(O)YR2, -OC(O)YR2, -NR1C(O)YR2, -SC(O)YR2, -NR1C(=S)YR2, -OC(=S)YR2, -C(=S)YR2, -YC(=NR1)YR2, - YC(=N-OR1)YR2, -YC(=N-NR1R2)YR2, -YP(=O)(YR1)(YR2), -NR1SO2R2, -S(O)rR2, -SO2NR1R2, -NR1SO2NR1R2, or each Y is, independently, a bond, -O-, -S- or -NR1-;each occurrence of R1 and R2 is, independently H, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroalkyl, heterocyclic or heteroaryl; each of Xi and X2 is, independently, CH or N; andR4 is alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroalkyl, heterocyclic or heteroaryl.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

암 및 Ｃ형 간염과 같은 바이러스 감염의 치료를 위한톨-유사 수용체 조절제인 2-아미도-6-아미노-8-옥소퓨린유도체본 발명은 퓨린 유도체, 그의 제조 방법, 그를 함유하는 조성물 및 그의 용도에 관한 것이다. 본 발명은 하기 화학식 (I)의 화합물의 제공한다. <화학식 I> 상기 식에서, R1, R2, R3, R9, R9a 및 Y는 명세서에 정의된 바와 같다. 더욱 구체적으로, 본 발명은 톨-유사 수용체 (TLR)의 조절, 특히 아고니즘과 관련된 장애를 포함하는 다양한 바이러스 감염 및 면역 또는 염증 장애의 치료에서의 퓨린 유도체의 용도에 관한 것이다. 따라서, 본 발명의 화합물은 감염성 질환, 예를 들어 간염 (예를 들어 HCV, HBV), 유전적으로 연관된 바이러스 감염, 염증 질환, 예를 들어 천식 및 관절염, 및 암의 치료에 유용하다.하기 화학식 (I)의 화합물 또는 그의 호변이성질체 또는 상기 화합물 또는 호변이성질체의 제약상 허용되는 염, 용매화물 또는 다형체: <화학식 I> 상기 식에서, R1 및 R2는 각각 독립적으로 H; C1-6 알킬; C3-7 시클로알킬; 1 내지 3개의 C3-7 시클로알킬, 페닐, 나프틸 또는 헤테로시클로 치환된 C1-6 알킬; C1-6 알킬로 치환된 C3-7 시클로알킬; S(O)nR8; 또는 헤테로시클이거나; R1 및 R2는 이들이 결합된 질소 원자와 함께 헤테로시클을 형성하며; 각 경우에 상기 알킬, 시클로알킬, 페닐, 나프틸 및 헤테로시클은 옥소, 할로겐, CF3, CN, R4, OR4, NR4R5, COR4, CO2R4, S(O)nR4, S(O)nNR4R5, CONR4R5 및 NR4COR5로부터 선택된 1 내지 3개의 원자 또는 기로 치환될 수 있고; R3은 C1-6 알킬; C3-7 시클로알킬; 페닐; 나프틸; 또는 헤테로시클이고; 상기 알킬, 시클로알킬, 페닐, 나프틸 및 헤테로시클은 옥소, 할로겐, CF3, CN, R4, OR4, NR4R5, COR4, CO2R4, S(O)nR4, S(O)nNR4R5, CONR4R5 및 NR4COR5로부터 선택된 1 내지 3개의 원자 또는 기로 치환될 수 있고; R4 및 R5는 각각 독립적으로 H; C1-6 알킬; C3-7 시클로알킬; C2-6 알케닐; 또는 C2-6 알키닐이거나; R4 및 R5는 이들이 동일한 질소 원자에 결합된 경우 헤테로시클을 형성하고; 상기 알킬, 시클로알킬 및 헤테로시클은 페닐, OR6, NR6R7, S(O)nR6, S(O)nNR6R7 및 NR6COR7로부터 선택된 1 내지 3개의 원자 또는 기로 치환될 수 있고; R6 및 R7은 독립적으로 H; C1-6 알킬; 또는 C3-7 시클로알킬로 치환된 C1-6 알킬이거나; R6 및 R7은 이들이 동일한 질소 원자에 결합된 경우 헤테로시클을 형성하고; R8은 H; C1-6 알킬; C3-7 시클로알킬; 페닐; 나프틸; 또는 헤테로시클이고; 상기 알킬, 시클로알킬, 페닐, 나프틸 및 헤테로시클은 옥소, 할로겐, CF3, CN, 페닐, R4, OR4, NR4R5, COR4, CO2R4, S(O)nR4, S(O)nNR4R5, CONR4R5 및 NR4COR5로부터 선택된 1 내지 3개의 원자 또는 기로 치환될 수 있고; R9는 R10, COR10, CO2R10, 또는 CONR10R11이고, R9a는 존재하지 않거나; R9a는 R10, COR10, CO2R10, 또는 CONR10R11이고, R9는 존재하지 않고; R10 및 R11은 각각 독립적으로 H; C1-6 알킬; C3-7 시클로알킬; 1 내지 3개의 C3-7 시클로알킬, 페닐, 나프틸 또는 헤테로시클로 치환된 C1-6 알킬; C1-6 알킬로 치환된 C3-7 시클로알킬; 페닐; 나프틸; 또는 헤테로시클이거나; R10 및 R11은 이들이 결합된 질소 원자와 함께 헤테로시클을 형성하고; 여기서 각각의 경우에 상기 알킬, 시클로알킬, 페닐, 나프틸 및 헤테로시클은 옥소, 할로겐, CF3, CN, R12, OR12, NR12R13, COR12, CO2R12, S(O)pR12, S(O)pNR12R13, CONR12R13 및 NR12COR13으로부터 선택된 1 내지 3개의 원자 또는 기로 치환될 수 있고; R12 및 R13은 독립적으로 H; C1-6 알킬; 또는 C3-7 시클로알킬로 치환된 C1-6 알킬이거나; R12 및 R13은 이들이 동일한 질소 원자에 결합된 경우 헤테로시클을 형성하고; Y는 직접 결합 또는 C1-4 알킬렌이고; n은 0, 1 또는 2이고; p는 0, 1 또는 2이되; 단, Y가 메틸렌이고 R3이 페닐인 경우, R1 및 R2는 동시에 메틸은 아니다.

2-AMIDO-6-AMINO-8-OXOPURINE DERIVATIVES AS TOLL-LIKE RECEPTOR MODULATORS FOR THE TREATMENT OF CANCER AND VIRAL INFECTIONS, SUCH AS HEPATITIS CThis invention relates to purine derivatives, to processes for their preparation, to compositions containing them and to their use. The present invention provides compounds of formula (I) wherein R1, R2, R3, R9, R9a and Y are defined in the description. More particularly, the present invention relates to the use of purine derivatives in the treatment of a variety of viral infections and immune or inflammatory disorders, including those in which the modulation, in particular agonism, of Toll-Like Receptors (TLRs) is implicated. Accordingly, the compounds of the invention are useful in the treatment of infectious disease such as Hepatitis (e.g. HCV, HBV), genetically related viral infections, inflammatory diseases such as asthma and arthritis, and cancer.A compound of formula (I): a tautomer thereof or a pharmaceutically acceptable salt, solvate or polymorph of said compound or tautomer, wherein:Ri and R2 are each independently H; Ci-6 alkyl; C3.7 cycloalkyl; C1-6 alkyl substituted by 1 to 3 C3-7 cycloalkyl(s), a phenyl, a naphthyl or a heterocycle; C3.7 cycioalkyl substituted by C1-6 alkyl; S(O)nR8; or heterocycle; or R1 and R2, taken together with the nitrogen atom to which they are bonded, form a heterocycle; wherein in each instance said alkyl, cycloalkyl, phenyl, naphthyl and heterocycle are optionally substituted by 1 to 3 atoms or groups selected from oxo, halogen, CF3, CN, R4, OR4, NR4R5, COR4, CO2R41 S(O)nR4, S(O)nNR4R5, CONR4R5 and NR4COR5;R3 is d-β alkyl; C3.7 cycloalkyl; phenyl; naphthyl; or heterocycle; wherein said alkyl, cycloalkyl, phenyl, naphthyl and heterocycle are optionally substituted by 1 to 3 atoms or groups selected from oxo, halogen, CF3, CN, R4, OR4, NR4R5, COR4, CO2R41 S(O)nR4, S(O)nNR4R5, CONR4R5 and NR4COR6;R4 and R5 are each independently H; C1-6 alkyl; C3.7 cycloalkyl; C2-s alkenyl; or C2.B alkynyl; or R4 and R5, when bound to the same nitrogen atom, form a heterocycle; wherein said alkyl, cycloalkyl and heterocycle are optionally substituted by 1 to 3 atoms or groups selected from phenyl, ORe, NRBR7, S(O)nR6, S(O)nNR6R7 and NR6COR7;R6 and R7 are independently H; C1-6 alkyl; or C1^ alkyl substituted by C3.7 cycloalkyl; or R6 and R7, when bound to the same nitrogen atom, form a heterocycle;R8 is H; C1-B alkyl; C3.7 cycloalkyl; phenyl; naphthyl; or heterocycle; wherein said alkyl, cycloalkyl, phenyl, naphthyl and heterocycle are optionally substituted by 1 to 3 atoms or groups selected from oxo, halogen, CF3, CN, phenyl, R4, OR4, NR4R5, COR4, CO2R4, S(O)nR4, S(O)nNR4R5, CONR4R5 and NR4COR5;R9 is R10, COR10, CO2Ri0, or CONRi0Rn, and R9a is absent; orR9a is R10, COR10, CO2RiO, or CONRi0Rn, and R9 is absent;Rio and Rn are each independently H; C1^ alkyl; C3.7 cycloalkyl; Ci-6 alkyl substituted by 1 to 3 C3. 7 cycloalkyl(s), a phenyl, a naphthyl or a heterocycle; C3.7 cycloalkyl substituted by Ci.B alkyl; phenyl; naphthyl; or heterocycle; or Rio and Rn, taken together with the nitrogen atom to which they are bonded, form a heterocycle; wherein in each instance said alkyl, cycloalkyl, phenyl, naphthyl and heterocycle are optionally substituted by 1 to 3 atoms or groups selected from oxo, halogen, CF3, CN, Ri2, ORi2, NRi2Ri3, COR12, CO2Ri2, S(O)PR12, S(O)pNRi2Ri3, CONRi2Ri3 and NRi2CORi3; R12 and R13 are independently H; C1^ alkyl; or Ci.β alkyl substituted by C3-7 cycloalkyl; or R12 andR13, when bound to the same nitrogen atom, form a heterocycie; Y is a direct bond or a C1.4 alkylene; n is 0, 1 or 2; p is 0, 1 or 2; with the proviso that when Y is methylene and R3 is phenyl, then Ri and R2 are not simultaneously methyl.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

신규 테트라히드로 벤즈인돌론 유도체하기 식(Ⅰ)으로 표시되는 화합물 또는 그의 약학적으로 허용되는 염 및 그의 제조법이 기재되어 있다. 이 화합물은 프로게스테론 리셉터 결합저해활성을 가지며, 따라서 프로게스테론이 관여하는 질환의 치료약 및 예방약으로서 사용된다. 구체적으로는, 유방암 및 난소암에 대한 항암제, 자궁근종, 자궁내막증, 수막종 및 골수종에 대한 치료약, 낙태약, 경구 피임약, 및 골다공증 및 갱년기장해에 대한 치료약 및 예방약으로서 유용하다.화학식 I [식중, R1알킬기, 또는 아랄킬기를 나타내고, R2는 수소 원자, 알킬카보닐기, 시클로알킬카보닐기, 방향족 아실기, 헤테로방향족 아실기, 포화 헤테로시클릭 아실기, 알킬기, 알케닐기, 아랄킬기, 카바모일기, 알킬카바모일기, 방향족 카바모일기, 아랄킬카모일기, 알킬아미노카보닐기, 시클로알킬카바모일기, 알콕시카보닐기, 아릴옥시카보닐기, 헤테로방향족 티오카보닐기, 포화 헤테로시클릭 티오카보닐기, 또는 알킬-티오카바모일기를 나타내고, R3는 수소 원자, 히드록실기, 알킬옥시기, 알킬카보닐옥시기, 알킬티오기 또는 아릴티오기를 나타낸다.]하기의 식(Ⅰ)으로 표시되는 화합물 또는 그의 약학적으로 허용될 수 있는 염 화학식 I [이미지] 식중, R1은 수소 원자, 임의로 치환된 C1-C10 알킬기, 임의로 치환된 C2-C10알케닐기, 임의로 치환된 C2-C10알키닐기, 임의로 치환된 C3-C10시클로알킬기 또는 임의로 치환된 C3-C15아랄킬기를 나타내고; R2는 수소 원자, 임의로 치환된 C1-C10 알킬카보닐기, 임의로 치환된 C2-C10알케닐카보닐기, 임의로 치환된 C2-C10 알키닐카보닐기, 임의로 치환된 C3-C15 시클로알킬카보닐기, 임의로 치환된 C7-C15 아랄킬카보닐기, 임의로 치환된 C7-C15방향족 아실기, 질소 원자, 산소 원자 및 황 원자로 되는 군 중에서 선택되는 적어도 1개 이상의 헤테로 원자를 갖는 임의로 치환된 C2-C15 헤테로방향족 아실기, 질소 원자, 산소 원자 및 황 원자로 되는 군 중에서 선택되는 적어도 1개 이상의 헤테로 원자를 갖는 임의로 치환된 C3-C15 포화 헤테로시클릭 아실기, 임의로 치환된 C1-C10알킬기, 임의로 치환된 C2-C10 알케닐기, 임의로 치환된 C2-C10알키닐기, 임의로 치환된 C3-C10시클로알킬기, 임의로 치환된 C7-C15아랄킬기, 카바모일기, 임의로 치환된 N-C1-C10 알킬카바모일기, 임의로 치환된 N-C6-C15방향족 카바모일기, 임의로 치환된 N-C7-C15 아랄킬카바모일기, 임의로 치환된 N,N-디-C1-C10알킬아미노카보닐기, 임의로 치환된 N-C3-C10시클로알킬카바모일기, 임의로 치환된 C1-C10알콕시카보닐기, 임의로 치환된 C6-C15아릴옥시카보닐기, 임의로 치환된 C7-C15 아랄킬옥시카보닐기, 질소 원자, 산소 원자 및 황 원자로 되는 군 중에서 선택되는 적어도 1개 이상의 헤테로 원자를 갖는 임의로 치환된 C1-C15 헤테로방향족 티오카보닐기, 질소 원자,산소 원자 및 황 원자로 되는 군 중에서 선택되는 적어도 1개 이상의 헤테로 원자를 갖는 임의로 치환된 C2-C15 포화 헤테로시클릭 티오카보닐기, 또는 임의로 치환된N-C1-C10알킬-티오카바모일기를 나타내고; R3은 수소 원자, 히드록실기, 임의로 치환된 C1-C10알킬옥시기, 임의로 치환된 C2-C10 알케닐옥시기, 임의로 치환된 C2-C10 알키닐옥시기, 임의로 치환된 C3-C10 시클로알킬옥시기, 임의로 치환된 C7-C15 아랄킬옥시기, 임의로 치환된 C1-C10 알킬카보닐옥시기, 임의로 치환된 C2-C10 알케닐카보닐옥시기, 임의로 치환된 C2-C10 알키닐카보닐옥시기, 임의로 치환된 C3-C10 시클로알킬카보닐옥시기, 임의로 치환된 C7-C15 방향족 아실옥시기, 임의로 치환된 C7-C15 아랄킬카보닐옥시기, 임의로 치환된 C1-C10 알킬티오기, 임의로 치환된 C2-C10 알케닐티오기, 임의로 치환된 C2-C10 알키닐티오기, 임의로 치환된 C3-C10 시클로알킬티오기, 임의로 치환된 C6-C15 아릴티오기, 또는 임의로 치환된 C7-C15 아랄킬티오기를 나타낸다.

Novel tetrahydrobenzindolone derivativesCompounds represented by the following formula (I) or pharmaceutically acceptable salts thereof and a process for producing the same are disclosed. The compounds have progesterone receptor binding inhibitory activity and, hence, can be used as therapeutic and prophylactic agents for progesterone-related diseases. Specifically, they are useful as carcinostatic agents for breast cancer and ovarian cancer, therapeutic agents for hysteromyoma, endometriosis, meningioma, and myeloma, abortifacients, oral contraceptive pills, and therapeutic and prophylactic agents for osteoporosis and climacteric disturbance. wherein R represents alkyl or aralkyl; R represents a hydrogen atom, alkylcarbonyl, cycloalkylcarbonyl, aromatic acyl, heteroaromatic acyl, saturated heterocyclic acyl, alkyl, alkenyl, aralkyl, carbamoyl, alkylcarbamoyl, aromatic carbamoyl, aralkylcarbamoyl, alkylaminocarbonyl, cycloalkylcarbamoyl, alkoxycarbonyl, aryloxycarbonyl, heteroaromatic thiocarbonyl, saturated heterocyclic thiocarbonyl, or alkyl-thiocarbamoyl; and R represents a hydrogen atom, a hydroxyl group, alkyloxy, alkylcarbonyloxy, alkylthio, or arylthio.The compound or pharmaceutically acceptable salt thereof of representing by following general formula (i): r wherein 1representative hydrogen atom,the optional c that replaces 1-c 10alkyl, the optional c that replaces 2-c 10alkenyl, the optional c that replaces 2-c 10alkynyl, the optional c that replaces 3-c 10cycloalkyl, or the optional c that replaces 7-c 15aralkyl; r 2representative hydrogen atom,the optional c that replaces 1-c 10alkyl-carbonyl, the optional c that replaces 2-c 10alkenyl carbonyl, the optional c that replaces 2-c 10the alkynyl carbonyl, the optional c that replaces 3-c 15naphthene base carbonyl, the optional c that replaces 7-c 15aromatic alkyl carbonyl, the optional c that replaces 7-c 15aroyl, has at least 1 c that is selected from the heteroatomic optional replacement of nitrogen, oxygen and sulphur 2-c 15the aromatic heterocycle acyl group, has at least 1 c that is selected from the heteroatomic optional replacement of nitrogen, oxygen and sulphur 3-c 15the saturated heterocyclic acyl group, the optional c that replaces 1-c 10alkyl, the optional c that replaces 2-c 10alkenyl, the optional c that replaces 2-c 10alkynyl, the optional c that replaces 3-c 10cycloalkyl, the optional c that replaces 7-c 15aralkyl, formamyl,the optional n-c that replaces 1-c 10alkyl-carbamoyl, the optional n-c that replaces 6-c 15the aromatic nucleus formamyl, the optional n-c that replaces 7-c 15the aryl alkyl amino formyl radical, the optional n that replaces, n-two c 1-c 10alkyl amino-carbonyl, the optional n-c that replaces 3-c 10the cycloalkyl amino formyl radical, the optional c that replaces 1-c 10carbalkoxy, the optional c that replaces 6-c 15aryloxy carbonyl, the optional c that replaces 7-c 15aralkoxycarbonyl, has at least 1 c that is selected from the heteroatomic optional replacement of nitrogen, oxygen and sulphur 1-c 15the aromatic heterocycle thiocarbonyl, has at least 1 c that is selected from the heteroatomic optional replacement of nitrogen, oxygen and sulphur 2-c 15the saturated heterocyclic thiocarbonyl, or the optional n-c that replaces 1-c 10the alkylthio formamyl; and r 3representative hydrogen atom,hydroxyl,the optional c that replaces 1-c 10alkoxyl group, the optional c that replaces 2-c 10alkenyloxy, the optional c that replaces 2-c 10alkynyloxy group, the optional c that replaces 3-c 10cycloalkyloxy, the optional c that replaces 7-c 15aralkoxy, the optional c that replaces 1-c 10alkyl carbonyl oxy, the optional c that replaces 2-c 10alkenyl carbonyl oxygen base, the optional c that replaces 2-c 10alkynyl carbonyl oxygen base, the optional c that replaces 3-c 10cycloalkyl carbonyl oxygen base, the optional c that replaces 7-c 15aryl acyloxy, the optional c that replaces 7-c 15aralkyl carbonyl oxygen base, the optional c that replaces 1-c 10alkylthio, the optional c that replaces 2-c 10alkenyl thio, the optional c that replaces 2-c 10the alkynes sulfenyl, the optional c that replaces 3-c 10cycloalkylthio, the optional c that replaces 6-c 15arylthio; or the optional c that replaces 7-c 15aromatic alkylthio.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

LPA 길항제로서의 피라졸 O-연결된 카르바모일 시클로헥실 산본 발명은 화학식 (I)의 화합물, 또는 그의 입체이성질체, 호변이성질체, 제약상 허용되는 염 또는 용매화물을 제공하고, 여기서 모든 가변기는 본원에 정의된 바와 같다. 이들 화합물은 선택적 LPA 수용체 억제제이다.하기 화학식 (I)에 따른 화합물 또는 그의 입체이성질체, 호변이성질체, 또는 제약상 허용되는 염 또는 용매화물: 여기서 X1, X2, X3, 및 X4는 각각 독립적으로 CR6 또는 N이고; 단 X1, X2, X3, 또는 X4 중 2개 이하가 N이고; Q2는 N 또는 NR5a이고; Q1 및 Q3 중 하나는 CR5이고, 다른 하나는 N 또는 NR5a이고; 파선 원은 방향족 고리를 나타내고; L은 공유 결합이거나 또는 0 내지 4개의 R7로 치환된 C1-4 알킬렌이고; R1은 (-CH2)aR9이고;a는 0 또는 1의 정수이고; R2는 각각 독립적으로 할로, 시아노, 히드록실, 아미노, C1-6 알킬, C3-6 시클로알킬, C4-6 헤테로시클릴, 알킬아미노, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시, 알콕시알킬, 할로알콕시알킬, 또는 할로알콕시이고;n은 0, 1, 또는 2의 정수이고; R3은 수소, C1-6 알킬, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시알킬, 할로알콕시알킬, 알콕시, 또는 할로알콕시이고; R4는 C1-10 알킬, C1-10 중수소화 알킬, C1-10 할로알킬, C1-10 알케닐, C3-8 시클로알킬, 6 내지 10-원 아릴, 3 내지 8-원 헤테로시클릴, -(C1-6 알킬렌)-(C3-8 시클로알킬), -(C1-6 알킬렌)-(6 내지 10-원 아릴), -(C1-6 알킬렌)-(3 내지 8-원 헤테로시클릴), 또는 -(C1-6 알킬렌)-(5 내지 6-원 헤테로아릴)이고; 여기서 각각의 알킬, 알킬렌, 알케닐, 시클로알킬, 아릴, 헤테로시클릴, 및 헤테로아릴은 그 자체로 또는 다른 모이어티의 일부로서 독립적으로 0 내지 3개의 R8로 치환되거나; 또는 대안적으로, R3 및 R4는 이들이 부착되어 있는 N 원자와 함께, 4 내지 9-원 헤테로시클릭 고리 모이어티를 형성하고, 이는 0 내지 3개의 R8로 치환되고; R5a는 수소, C1-6 알킬, 알킬아미노, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시알킬, 할로알콕시알킬, 알콕시, 또는 할로알콕시이고; R5 및 R6은 각각 독립적으로 수소, 할로, 시아노, 히드록실, 아미노, C1-6 알킬, 알킬아미노, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시알킬, 할로알콕시알킬, 알콕시, 또는 할로알콕시이고; R7은 할로, 옥소, 시아노, 히드록실, 아미노, C1-6 알킬, C3-6 시클로알킬, C4-6 헤테로시클릴, 알킬아미노, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시알킬, 할로알콕시알킬, 알콕시, 또는 할로알콕시이고; R8은 각각 독립적으로 중수소, 할로, 히드록실, 아미노, 시아노, C1-6 알킬, C1-6 중수소화 알킬, C2-6 알케닐, C2-6 알키닐, 알킬아미노, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시알킬, 할로알콕시알킬, 알콕시, 할로알콕시, 페닐, 또는 5 내지 6-원 헤테로아릴이거나; 또는 대안적으로, 2개의 R8은 이들이 부착되어 있는 원자(들)와 함께, 3 내지 6-원 카르보시클릭 고리 또는 3 내지 6-원 헤테로시클릭 고리를 형성하고, 이들 각각은 독립적으로 0 내지 3개의 R12로 치환되고; R9는 -CN, -C(O)OR10, -C(O)NR11aR11b,로부터 선택되고; Re는 C1-6 알킬, C3-6 시클로알킬, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시알킬, 또는 할로알콕시알킬이고; R10은 수소 또는 C1-10 알킬이고; R11a 및 R11b는 각각 독립적으로 수소, C1-6 알킬, C3-6 시클로알킬, C4-6 헤테로시클릴, 알킬아미노, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시알킬, 할로알콕시알킬, 알콕시, 또는 할로알콕시이고; R12는 할로, 시아노, 히드록실, 아미노, C1-6 알킬, 알킬아미노, 할로알킬, 히드록시알킬, 아미노알킬, 알콕시알킬, 할로알콕시알킬, 알콕시, 할로알콕시, 페닐, 또는 5 내지 6-원 헤테로아릴이다.

PYRAZOLE O-LINKED CARBAMOYL CYCLOHEXYL ACIDS AS LPA ANTAGONISTSThe present invention provides compounds of Formula (I) or a stereoisomer, tautomer, or pharmaceutically acceptable salt or solvate thereof, wherein all the variables are as defined herein. These compounds are selective LPA receptor inhibitors.A compound according to Formula (I):or a stereoisomer, tautomer, or pharmaceutically acceptable salt or solvate thereof, whereinX1, X2, X3, and X4 are each independently CR6 or N; provided that no more than two of X1, X2, X3, or X4 are N;Q2 is N or NR5a;one of Q1 and Q3 is CR5, and the other is N or NR5a;the dashed circle denotes an aromatic ring;L is a covalent bond or C alkylene substituted with 0 to 4 R7;R1 is (-CH2)aR9;a is an integer of 0 or 1 ;R2 is each independently halo, cyano, hydroxyl, amino, CM alkyl, C3-6 cycloalkyl, C4-6 heterocyclyl, alkylamino, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxy, alkoxyalkyl, haloalkoxyalkyl, or haloalkoxy;n is an integer of 0, 1 , or 2;R3 is hydrogen, CM alkyl, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, haloalkoxyalkyl, alkoxy, or haloalkoxy;R4 is Ci-io alkyl, Ci-io deuterated alkyl, C1-10 haloalkyl, Ci-10 alkenyl,C3-8 cycloalkyl, 6 to lO-membered aryl, 3 to 8-membered heterocyclyl,-(CM alkylene)-(C3-8 cycloalkyl), -(CM alkylene)-(6 to lO-membered aryl), -(Ci -6 alkylene)-(3 to 8-membered heterocyclyl), or -(Ci-6 alkylene)-(5 to 6-membered heteroaryl); wherein each of the alkyl, alkylene, alkenyl, cycloalkyl, aryl, heterocyclyl, and heteroaryl, by itself or as part of other moiety, is independently substituted with 0 to 3 R8; or alternatively, R3 and R4, taken together with the N atom which they are attached, form a 4 to 9-membered heterocyclic ring moiety which is substituted with 0 to 3 R8;R5a is hydrogen, Ci-6 alkyl, alkylamino, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, haloalkoxyalkyl, alkoxy, or haloalkoxy;R5 and R6 are each independently hydrogen, halo, cyano, hydroxyl, amino,Ci-6 alkyl, alkylamino, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl,haloalkoxyalkyl, alkoxy, or haloalkoxy;R7 is halo, oxo, cyano, hydroxyl, amino, Ci-6 alkyl, C3-6 cycloalkyl, C4-6 heterocyclyl, alkylamino, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl,haloalkoxyalkyl, alkoxy, or haloalkoxy;R8 are each independently deuterium, halo, hydroxyl, amino, cyano, Ci-6 alkyl,Ci-6 deuterated alkyl, C2-6 alkenyl, C2-6 alkynyl, alkylamino, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, haloalkoxyalkyl, alkoxy, haloalkoxy, phenyl, or 5 to 6- membered heteroaryl; or alternatively, two R8, taken together with the atom(s) to which they are attached, form a 3 to 6-membered carbocyclic ring or a 3 to 6-membered heterocyclic ring each of which is independently substituted with 0 to 3 R12;R9 is selected from -CN, -C(0)OR10, -C(0)NRl laRllb,Re is Ci-6 alkyl, C3-6 cycloalkyl, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, or haloalkoxyalkyl;R10 is hydrogen or Ci-io alkyl; and Rl la and Rl lb are each independently hydrogen, Ci-6 alkyl, C3-6 cycloalkyl,C4-6 heterocyclyl, alkylamino, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, haloalkoxyalkyl, alkoxy, or haloalkoxy; andR12 is halo, cyano, hydroxyl, amino, Ci-6 alkyl, alkylamino, haloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, haloalkoxyalkyl, alkoxy, haloalkoxy, phenyl, or 5 to 6-membered heteroaryl.

27199

그 외 기타 의료용 기기 제조업

특허

ko

en

병용 요법본 발명은 KRas G12C 암을 치료하기 위한 조합 요법들에 관한 것이다. 특히, 본 발명은 치료적 유효량의, pan ErbB 패밀리 억제제 및 화학식 (I), 화학식 (I-A) 또는 화학식 (I-B)의 KRAS G12C 억제제의 조합을 대상에게 투여하는 단계를 포함하는, 이를 필요로 하는 대상에서 암을 치료하는 방법들, 치료적 유효량의 상기 억제제들을 포함하는 약학적 조성물들, 상기 조성물들을 포함하는 키트들 및 이를 사용하는 방법들에 관한 것이다.이를 필요로 하는 대상에서 암을 치료하는 방법으로서, 치료적 유효량의, pan ErbB 패밀리 억제제 및 하기 화학식 (I)의 KRAS G12C 억제제 또는 이의 약학적으로 허용가능한 염의 조합을 상기 대상에게 투여하는 단계를 포함하는, 방법:[이미지](여기서,X는 4-12원 포화된 또는 부분적으로 포화된 단환형, 가교된 또는 스피로사이클릭 고리이고, 상기 포화된 또는 부분적으로 포화된 단환형 고리는 하나 이상의 R8로 선택적으로 치환되고;Y는 결합, O, S 또는 NR5이고;R1은 -C(O)C(RA) [이미지]C(RB)p 또는 -SO2C(RA) [이미지]C(RB)p이고;R2는 수소, 알킬, 하이드록시알킬, 디하이드록시알킬, 알킬아미닐알킬, 디알킬아미닐알킬, -Z-NR5R10, 헤테로사이클릴, 헤테로사이클릴알킬, 아릴, 헤테로아릴, 또는 헤테로아릴알킬이고, 상기 Z, 헤테로사이클릴, 헤테로사이클릴알킬, 아릴, 헤테로아릴, 및 헤테로아릴알킬 각각은 하나 이상의 R9로 선택적으로 치환될 수 있고;각각의 Z는 C1-C4 알킬렌이고;각각의 R3은 독립적으로 C1-C3 알킬, 옥소, 할로알킬, 하이드록실 또는 할로겐이고;L은 결합, -C(O)- 또는 C1-C3 알킬렌이고;R4는 수소, 사이클로알킬, 헤테로사이클릴, 아릴, 아르알킬 또는 헤테로아릴이고, 상기 사이클로알킬, 헤테로사이클릴, 아릴, 아르알킬 및 헤테로아릴 각각은 하나 이상의 R6, R7 또는 R8로 선택적으로 치환될 수 있고;각각의 R5는 독립적으로 수소 또는 C1-C3 알킬이고;R6은 사이클로알킬, 헤테로사이클릴, 헤테로사이클릴알킬, 아릴, 또는 헤테로아릴이고, 상기 사이클로알킬, 헤테로사이클릴, 아릴, 또는 헤테로아릴 각각은 하나 이상의 R7로 선택적으로 치환될 수 있고;각각의 R7은 독립적으로 할로겐, 하이드록실, C1-C6 알킬, 사이클로알킬, 알콕시, 할로알킬, 아미노, 시아노, 헤테로알킬, 하이드록시알킬 또는 Q-할로알킬이고, Q는 O 또는 S이고;R8은 옥소, C1-C3 알킬, C2-C4 알키닐, 헤테로알킬, 시아노, -C(O)OR5, -C(O)N(R5)2, -N(R5)2이고, 상기 C1-C3 알킬은 시아노, 할로겐, -OR5, -N(R5)2, 또는 헤테로아릴로 선택적으로 치환될 수 있고각각의 R9는 독립적으로 수소, 옥소, 아실, 하이드록실, 하이드록시알킬, 시아노, 할로겐, C1-C6 알킬, 아르알킬, 할로알킬, 헤테로알킬, 사이클로알킬, 헤테로사이클릴알킬, 알콕시, 디알킬아미닐, 디알킬아미도알킬, 또는 디알킬아미닐알킬이고, 상기 C1-C6 알킬은 사이클로알킬로 선택적으로 치환될 수 있고;각각의 R10은 독립적으로 수소, 아실, C1-C3 알킬, 헤테로알킬 또는 하이드록시알킬이고;R11은 할로알킬이고;RA는 존재하지 않거나, 수소, 중수소, 시아노, 할로겐, C1-C3 알킬, 할로알킬, 헤테로알킬, -C(O)N(R5)2, 또는 하이드록시알킬이고;각각의 RB는 독립적으로 수소, 중수소, 시아노, C1-C3 알킬, 하이드록시알킬, 헤테로알킬, C1-C3 알콕시, 할로겐, 할로알킬, -ZNR5R11, -C(O)N(R5)2, -NHC(O)C1-C3 알킬, -CH2NHC(O)C1-C3 알킬, 헤테로아릴, 헤테로아릴알킬, 디알킬아미닐알킬, 또는 헤테로사이클릴알킬이고, 상기 헤테로사이클릴 부분은 할로겐, 하이드록실, 알콕시 및 C1-C3 알킬로부터 독립적으로 선택된 하나 이상의 치환기로 치환되고, 상기 헤테로아릴 또는 상기 헤테로아릴알킬의 헤테로아릴 부분은 하나 이상의 R7로 선택적으로 치환되고;[이미지]이 삼중 결합인 경우, RA는 존재하지 않고, RB는 존재하고, p는 1이거나,또는 [이미지]이 이중 결합인 경우, RA는 존재하고, RB는 존재하고, p는 2이거나, 또는 RA, RB 및 이들이 부착된 탄소 원자는 하나 이상의 R7로 선택적으로 치환된 5-8원 부분적으로 포화된 사이클로알킬을 형성하고;m은 0 또는 1 내지 2의 정수이고;p는 1 또는 2임).

Combination therapyThe present invention relates to combination therapies for the treatment of KRas G12C cancer. In particular, the present invention relates to a method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a pan ErbB family inhibitor in combination with an inhibitor of formula (I), formula I-a or formula I-B KRAS G12C; pharmaceutical compositions comprising a therapeutically effective amount of the inhibitors, kits comprising the compositions, and methods of use thereof.A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a pan erbb family inhibitor in combination with a kras g12c inhibitor of formula (i):or a pharmaceutically acceptable salt thereof:wherein:x is a 4-12 membered saturated or partially saturated monocyclic ring, bridged ring or spirocyclic ring, wherein said saturated or partially saturated monocyclic ring is optionally substituted with one or more r8substitution;y is a bond, o, s or nr5；r1is-c (o) c (r)a)c(rb)por-so2c(ra)c(rb)p；r2is hydrogen, alkyl, hydroxyalkyl, dihydroxyalkyl, alkylaminoalkyl, dialkylaminoalkyl, -z-nr5r10heterocyclyl, heterocyclylalkyl, aryl, heteroaryl, or heteroarylalkyl, wherein each of said z, heterocyclyl, heterocyclylalkyl, aryl, heteroaryl, and heteroarylalkyl may optionally be substituted with one or more r9substitution;each z is a c1-c4 alkylene group;each r3independently is c1-c3 alkyl, oxo, haloalkyl, hydroxy, or halogen;l is a bond, -c (o) -or c1-c3 alkylene;r4is hydrogen, cycloalkyl, heterocyclyl, aryl, aralkyl or heteroaryl, wherein each of the cycloalkyl, heterocyclyl, aryl, aralkyl and heteroaryl may optionally be substituted with one or more r6、r7or r8substitution;each r5independently hydrogen or c1-c3 alkyl;r6is cycloalkyl, heterocyclyl, heterocyclylalkyl, aryl, or heteroaryl, wherein each of said cycloalkyl, heterocyclyl, aryl, or heteroaryl may optionally be substituted with one or more r7substitution;each r7independently halogen, hydroxy, c1-c6 alkyl, cycloalkyl, alkoxy, haloalkyl, amino, cyano, heteroalkyl, hydroxyalkyl, or q-haloalkyl, wherein q is o or s;r8is oxo, c1-c3 alkyl, c2-c4 alkynyl, heteroalkyl, cyano, -c (o) or5、-c(o)n(r5)2、-n(r5)2whereinsaid c1-c3 alkyl group may optionally be substituted by cyano, halogen, -or5、-n(r5)2or heteroaryl substitution;each r9independently hydrogen, oxo, acyl, hydroxy, hydroxyalkyl, cyano, halogen, c1-c6 alkyl, aralkyl, haloalkyl, heteroalkyl, cycloalkyl, heterocyclylalkyl, alkoxy, dialkylamino, dialkylaminoalkyl, or dialkylaminoalkyl, wherein the c1-c6 alkyl can be optionally substituted with cycloalkyl;each r10independently hydrogen, acyl, c1-c3 alkyl, heteroalkyl, or hydroxyalkyl;r11is haloalkyl;raabsent, hydrogen, deuterium, cyano, halogen, c1-c3 alkyl, haloalkyl, heteroalkyl, -c (o) n (r)5)2or a hydroxyalkyl group;each rbindependently hydrogen, deuterium, cyano, c1-c3 alkyl, hydroxyalkyl, heteroalkyl, c1-c3 alkoxy, halogen, haloalkyl, -znr5r11、-c(o)n(r5)2-nhc (o) c1-c3 alkyl, -ch2nhc (o) c1-c3 alkyl, heteroaryl, heteroarylalkyl, dialkylaminoalkyl, or heterocyclylalkyl, wherein the heterocyclyl moiety is substituted with one or more substituents independently selected from the group consisting of halogen, hydroxy, alkoxy, and c1-c3 alkyl, wherein the heteroaryl moiety of the heteroaryl or the heteroarylalkyl is optionally substituted with one or more r7substitution;when in usewhen it is a triple bond, then rais absent, rband p is equal to one and is present,or whenwhen it is a double bond, then raexist, rbis present and p is equal to two, or ra、rband the carbon atom to which it is attached form an optionally substituted groupby one or more r7substituted 5-8 membered partially saturated cycloalkyl;m is zero or an integer between 1 and 2; and isp is one or two.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

심혈관 질환을 치료하기 위한 cGMP 조정제로서의 4-아미노-2-(1H-피라졸로[3,4-B]피리딘-3-일)-6-옥소-6,7-디히드로-5H-피롤로[2,3-D]피리딘 유도체 및 각각의 (1H-인다졸-3-일) 유도체본 발명은 화학식 (I)의 화합물 또는 그의 제약상 허용되는 염을 제공하며, 여기서 X, Y, Z, R1, R2, R4, Ra 및 아래첨자 m, p 및 q는 본원에 기재된 바와 같다.[이미지] 상기 화합물 또는 그의 제약상 허용되는 염은 시클릭 구아노신 모노포스페이트 ("cGMP")의 신체의 생산을 조정할 수 있고, 일반적으로 교란된 cGMP 균형과 연관된 질환, 예컨대 심혈관 질환, 내피 기능장애, 확장기 기능장애, 아테롬성동맥경화증, 고혈압, 심부전, 폐고혈압 (WHO 그룹 I, II, III, IV), 협심증, 혈전증, 재협착, 심근경색, 졸중, 심기능부전, 섬유증, 폐 고긴장증, 발기 기능장애, 천식, 급성 호흡 곤란 증후군 (ARDS), 만성 신장 질환, 낭성 섬유증, 겸상 적혈구성 빈혈, 경피증, 레이노 증후군, 당뇨병, 당뇨병성 망막병증, 간 경변증, 만성 폐쇄성 폐 질환 (COPD), 급성 폐 손상, 폐 섬유증 또는 간질성 폐 질환의 요법 및 예방에 적합하다. 본 발명은 또한 화학식 (I)의 화합물 또는 그의 제약상 허용되는 염을 포함하는 제약 조성물을 제공한다. 본 발명은 또한 상기 언급된 질환의 요법 및 예방에서, 및 이 목적을 위한 제약의 제조에서의 화합물 또는 그의 제약상 허용되는 염의 용도에 관한 것이다.화학식 (I)의 화합물 또는 그의 제약상 허용되는 염.[이미지]여기서:X는 C(H) 또는 N이고;각각의 R1은 독립적으로 할로, 히드록시, C1-C3 알킬, C3-C6 시클로알킬 또는 -O-C1-C3 알킬이고;R2는 하기 (a.) 또는 (b.)이고:(a.) C1-C6 알킬, 여기서 R2의 상기 C1-C6 알킬은 비치환되거나 또는 플루오로 또는 -O-C1-C3 알킬로부터 독립적으로 선택된 1 내지 6개의 모이어티에 의해 치환됨;(b.) 고리 C2, 여기서 고리 C2는: (i.) C3-C12 시클로알킬; (ii.) 페닐; (iii.) N, O, 또는 S로부터 선택된 1 내지 2개의 헤테로원자를 함유하는 5- 또는 6-원 모노시클릭 헤테로아릴; 또는 (iv.) N, O, 또는 S로부터 선택된 1 내지 2개의 헤테로원자를 함유하는 5- 또는 6-원 모노시클릭 헤테로시클릴이고;여기서 고리 C2는 비치환되거나 또는 할로, 시아노, C1-C3 알킬, -O-C1-C3 알킬, 또는 옥소로부터 독립적으로 선택된 1 내지 3개의 모이어티에 의해 치환됨;R4는 C1-C6 알킬, CF3, 또는 C3-C6 시클로알킬이고;고리 C3은:(a.) 페닐;(b.) N, O, 또는 S로부터 선택된 1 내지 3개의 헤테로원자를 함유하는 5- 또는 6-원 모노시클릭 헤테로아릴 또는 9- 내지 10-원 비시클릭 헤테로아릴;(c.) N, O, 또는 S로부터 선택된 1 내지 3개의 헤테로원자를 함유하는 5- 또는 6-원 모노시클릭 헤테로시클릴; 또는(d.) C3-C6 시클로알킬이고;각각의 Ra는 할로, 시아노, C1-C3 알킬, -O-C1-C3 알킬, 옥소, 또는 히드록시로부터 독립적으로 선택되고;Y는:(a.) 결합;(b.) 화학식 [이미지]의 기,여기서 RY1 및 RY2는 독립적으로 H, C1-C3 알킬, 히드록시, 플루오로, C1-C3 히드록시알킬, 또는 아미노이거나; 또는 대안적으로 RY1 및 RY2은 이들이 부착되어 있는 탄소 원자와 함께 C3-C6 시클로알킬을 형성하고;RY3 및 RY4은 독립적으로 H, C1-C3 알킬, 히드록시, 플루오로, 또는 C1-C3 히드록시알킬이거나; 또는 대안적으로 RY3 및 RY4은 이들이 부착되어 있는 탄소 원자와 함께 C3-C6 시클로알킬을 형성함;(c.) 화학식 [이미지]의 기;(d.) 고리 AH, 여기서 고리 AH는 C3-C6 시클로알킬 또는 페닐이고, 여기서 고리 AH는 비치환되거나 또는 할로 또는 C1-C3 알킬로부터 독립적으로 선택된 1 내지 3개의 모이어티에 의해 치환됨;(e.) 기 -CH=CH-; 또는(f.) 기 [이미지]이고;Z는:(a.) -CO2H; (b.) -C(O)N(H)OH; [이미지]; (f.) -SO3H; (g.) -P(=O)(OH)2; 또는 (h.) -C(O)N(H)S(O)2CH3이고;아래첨자 m은 0, 1, 또는 2이고;아래첨자 p는 0, 1, 2, 또는 3이고;아래첨자 q는 0 또는 1이고;아래첨자 r1은 0, 1, 2, 3, 또는 4이고;아래첨자 r2는 0 또는 1이다.

4-AMINO-2-(1H-PYRAZOLO[3,4-B]PYRIDIN-3-YL)-6-OXO-6,7-DIHYDRO-5H-PYRROLO[2,3-D]PYRIMIDINE DERIVATIVES AND THE RESPECTIVE (1H-INDAZOL-3-YL) DERIVATIVES AS CGMP MODULATORS FOR TREATING CARDIOVASCULAR DISEASESThe invention provides compounds of the Formula (I) or a pharmaceutically acceptable salts thereof, wherein X, Y, Z, R1, R2, R4, Ra, and the subscripts m, p, and q are as described herein. The compounds or their pharmaceutically acceptable salts can modulate the body's production of cyclic guanosine monophosphate (cGMP), and are generally suitable for the therapy and prophylaxis of diseases whichare associated with a disturbed cGMP balance, such as cardiovascular disease, endothelial dysfunction, diastolic dysfunction, atherosclerosis, hypertension, heart failure, pulmonary hypertension (WHOgroups I, II, III, IV), angina pectoris, thrombosis, restenosis, myocardial infarction, stroke, cardiac insufficiency, fibrosis, pulmonary hypertonia, erectile dysfunction, asthma, acute respiratory distress syndrome (ARDS), chronic kidney disease, cystic fibrosis, sickle cell anemia, scleroderma, Raynaud's Syndrome, diabetes, diabetic retinopathy, cirrhosis of the liver, chronic obstructive pulmonary disease (COPD), acute lung injury, pulmonary fibrosis or interstitial lung disease. The invention also provides pharmaceutical compositions which comprise compounds of Formula (I) or pharmaceutically acceptable salts thereof. The invention also relates to the compounds or their pharmaceutically acceptable salts for use in the therapy and prophylaxis of the abovementioned diseases and for preparing pharmaceuticals for this purpose.The compound of formula (i)：or its pharmaceutically acceptable salt, wherein：x is c (h) or n；each r1it independently is halogen, hydroxyl, c1-c3alkyl, c3-c6naphthenic base or-o-c1-c3alkyl；r2it is：(a.)c1-c6alkyl, wherein r2the c1-c6alkyl is unsubstituted, or by 1 to 6 independently selected from fluorine or-o- c1-c3the part of alkyl replaces；(b.) ring c2, middle ring c2it is：(i.)c3-c12naphthenic base；(ii.) phenyl；(iii.) the heteroatomic 5 or 6 unit monocycle heteroaryls for being selected from n, o or s containing 1 to 2；or(iv.) the heteroatomic 5 or 6 unit monocycle heterocycles for being selected from n, o or s containing 1 to 2；its middle ring c2it is unsubstituted, or by 1 to 3 independently selected from halogen, cyano, c1-c3alkyl ,-o-c1-c3alkyl or oxygen the part in generation replaces；r4it is c1-c6alkyl, cf3or c3-c6naphthenic base；ring c3it is：(a.) phenyl；(b.) the heteroatomic 5 or 6 unit monocycle heteroaryls or 9 to 10 membered bicyclic heteroaryls for being selected from n, o or s containing 1 to 3；(c.) the heteroatomic 5 or 6 unit monocycle heterocycles for being selected from n, o or s containing 1 to 3；or(d.)c3-c6naphthenic base；each raindependently selected from halogen, cyano, c1-c3alkyl ,-o-c1-c3alkyl, oxo or hydroxyl；y is：(a.) key；(b.) formulagroup；wherein ry1and ry2it independently is h, c1-c3alkyl, hydroxyl, fluorine, c1-c3hydroxy alkyl or amino；or ry1and ry2with it the carbon atom that is connected form c together3-c6naphthenic base；ry3and ry4it independently is h, c1-c3alkyl, hydroxyl, fluorine or c1-c3hydroxy alkyl；or ry3and ry4it is connected to them carbon atom forms c together3-c6naphthenic base；(c.) formulagroup；(d.) ring ah, middle ring ahit is c3-c6naphthenic base or phenyl, middle ring ahit is unsubstituted, or independently selected by 1 to 3 from halogen or c1-c3the part of alkyl replaces；(e.) group-ch=ch-；or(f.) groupz is：(a.)-co2h；(b.)-c(o)n(h)oh；(c.)(d.)(e.) (f.)-so3h；(g.)-p (=o) (oh)2；or (h.)-c (o) n (h) s (o)2ch3；subscript m is 0,1 or 2；subscript p is 0,1,2 or 3；subscript q is 0 or 1；subscript r1 is 0,1,2,3 or 4；andsubscript r2 is 0 or 1.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

제초제로서 피리디닐이미다졸론본 발명은 화학식 I의 디하이드로 히단토인 화합물들에 관한 것으로서, 식 중 X, R3, Ra, Rb Rc 및 Rd는 명세서에 정의된 바와 같다. 또한, 본 발명은 화학식 I의 화합물들을 만들기 위한 방법 및 중간체, 이러한 화합물들을 포함하는 제초 조성물, 및 식물의 성장을 제어하기 위해 이러한 화합물을 사용하는 방법에 관한 것이다. [화학식 I]화학식 I의 제초 화합물, 또는 이의 N-산화물 또는 염 형태.[화학식 I](상기 식 중,X는 O 및 S로부터 선택되고;Ra는 수소 및 할로겐으로부터 선택되며;Rb는 수소, 할로겐, C1-C6 알킬, C2-C6 알케닐, C1-C6 알콕시, C2-C4 알케닐옥시, C2-C4 알키닐옥시, C1-C4 알콕시 C1-C4 알킬, C1-C4 알콕시-C1-C4 알콕시, C1-C4 알콕시 C1-C4 알콕시 C1-C4 알킬, C1-C4 할로알콕시, C1-C4 알킬티오, C1-C4 알킬설피닐, C1-C4 알킬설포닐, R5R6N-기, R5C(O)N(R6)-기, R5S(O2)N(R6)-기, R5R6NSO2-기, R5R6NC(O)-기; 할로겐, 니트로, 시아노, R5C(O)N(R6)-, R5R6NC(O)-, R5R6NSO2-, R5S(O2)N(R6)-, R5S(O)-, R5S(O2)-, C1-C3 알킬, C1-C3 알콕시, C1-C3 알콕시-C1-C3 알킬, C1-C3 할로알킬 및 C1-C3 할로알콕시로부터 독립적으로 선택되는 기 1 개 내지 3 개로 선택적으로 치환된 아릴; 및 할로겐, 니트로, 시아노, R5C(O)NR6-, R5OC(O)-, C1-C3 알킬, C1-C3 알콕시, C1-C3 할로알킬, C1-C3 할로알콕시 및 헤테로사이클릴 기로부터 독립적으로 선택되는 기 1 개 내지 3 개로 선택적으로 치환된 치환된 헤테로아릴로부터 선택되고;Rc는 시아노, C1-C3 알킬 및 C1-C3 알콕시로부터 독립적으로 선택되는 기 1 개 내지 3 개로 선택적으로 치환된 C1-C6 할로알킬, C2-C8 알케닐, C1-C6 시아노알킬, C1-C6 알콕시, C1-C6 하이드록시알킬, C1-C6 알콕시 C1-C6 알킬, C1-C6 알콕시 C1-C6 할로알킬, C2-C6 알케닐옥시 C1-C6 알킬, R5R6NC(O)C1-C6 알킬기 및 C3-C6 사이클로알킬로부터 선택되거나; 또는 Rb가 R5R6NC(O)-일 때, Rc는 상기한 바 이외에 수소, 할로겐 또는 C1-C6 알킬일 수 있으며;Rd는 수소, 할로겐, 시아노, C1-C6 알킬 및 C1-C6 할로알킬로부터 선택되고;R3은 할로겐, 하이드록실, -NR14R15또는 이하 기들 중 임의의 것으로부터 선택되며:R5 및 R6은 수소, C1-C6 알킬, C1-C6 할로알킬, C2-C6 알케닐, C2-C6 알키닐, C1-C6 알콕시, C1-C4 알콕시 C1-C4 알킬, C1-C6 시아노알킬로부터 독립적으로 선택되거나, 또는 R5 및 R6은 이것들이 부착되어 있는 탄소 원자들과 함께, 선택적으로 S, O 및 N으로부터 독립적으로 선택되는 이종 원자 1 개 내지 3 개를 포함하면서, 선택적으로 할로겐 및 C1-C6 알킬로부터 독립적으로 선택되는 기 1 개 내지 3 개로 치환된 3 원 내지 6 원의 포화 또는 부분 불포화 고리를 형성하고;R7 및 R8은 C1-C6 알킬, C1-C6 할로알킬, C2-C6 알케닐, C2-C6 알키닐; N, O 및 S로부터 독립적으로 선택되는 이종 원자 1 개 내지 4 개를 포함하고, 선택적으로 할로겐, C1-C3 알킬, C1-C3 할로알킬 및 C1-C3 알콕시로부터 독립적으로 선택되는 기 1 개 내지 3 개로 치환되는, C5-C10 단일환 헤테로아릴 기; 및 할로겐, 니트로, 시아노, C1-C3 알킬, C1-C3 알콕시, C1-C3 할로알킬 및 C1-C3 할로알콕시로부터 독립적으로 선택되는 기 1 개 내지 3 개로 선택적으로 치환된 C6-C10 아릴기로부터 독립적으로 선택되며;R9는 할로겐, 니트로, 시아노, C1-C3 알킬, C1-C3 알콕시, C1-C3 할로알킬 및 C1-C3 할로알콕시로부터 독립적으로 선택되는 기 1 개 내지 3 개로 선택적으로 치환된 C1-C6 알킬 및 벤질로부터 선택되고;R14 및 R15는 독립적으로 수소, C1-C20 알킬, C1-C20 할로알킬, C2-C20 알케닐, C2-C20 알키닐로부터 선택되거나, 또는 R14 및 R15는 이것들이 부착되어 있는 탄소 원자들과 함께, 선택적으로 S, O 및 N으로부터 독립적으로 선택되는 이종 원자 1 개 내지 3 개를 포함하면서, 선택적으로 할로겐 및 C1-C6 알킬로부터 독립적으로 선택되는 기 1 개 내지 3 개로 치환된 3 원 내지 6 원의 포화 또는 부분 불포화 고리를 형성함)

Herbicidal CompoundsThe invention relates to dihydro hydantoin compounds of the formula (I) wherein X, R3, Ra, Rb Rc and Rd are as defined in the specification. Furthermore, the present invention relates to processes and intermediates for making compounds of formula (I), to herbicidal compositions comprising these compounds and to methods of using these compounds to control plant growth. A herbicidal compound of formula (I) whereinX is selected from O and S;Ra is selected from hydrogen and halogen;Rb is selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C1-C6 alkoxy, C2-C4 alkenyloxy, C2-C4 alkynyloxy, C1-C4 alkoxy C1-C4 alkyl, C1-C4 alkoxy-C1-C4 alkoxy, C1-C4 alkoxy C1-C4 alkoxy C1-C4 alkyl, C1-C4 haloalkoxy, C1-C4 alkylthio, C1-C4 alkylsulfinyl, C1-C4 alkylsulfonyl, a group R5R6N—, a group R5C(O)N(R6)—, a group R5S(O2)N(R6)—, a group R5R6NSO2—, a group R5R6NC(O)—, aryl optionally substituted by from 1 to 3 groups independently selected from halogen, nitro, cyano, R5C(O)N(R6)—, R5R6NC(O)—, R5R6NSO2—, R5S(O2)N(R6)—, R5S(O)—, R5S(O2)—, C1-C3 alkyl, C1-C3 alkoxy, C1-C3 alkoxy-C1-C3 alkyl, C1-C3 haloalkyl and C1-C3 haloalkoxy and heteroaryl optionally substituted by from 1 to 3 groups independently selected from halogen, nitro, cyano, R5C(O)NR6—, R5OC(O)—, C1-C3 alkyl, C1-C3 alkoxy, C1-C3 haloalkyl, C1-C3 haloalkoxy and a heterocyclyl group;Rc is selected from C1-C6 haloalkyl, C2-C8 alkenyl, C1-C6 cyanoalkyl, C1-C6 alkoxy, C1-C6 hydroxyalkyl, C1-C6 alkoxy C1-C6 alkyl, C1-C6 alkoxy C1-C6 haloalkyl, C2-C6 alkenyloxy C1-C6 alkyl, a group R5R6NC(O)C1-C6 alkyl and C3-C6 cycloalkyl optionally substituted by from 1 to 3 groups independently selected from cyano, C1-C3 alkyl and C1-C3 alkoxy, or when Rb is R5R6NC(O)—, Rc can be, in addition to the above, hydrogen, halogen or C1-C6 alkyl;Rd is selected from hydrogen, halogen, cyano, C1-C6 alkyl and C1-C6 haloalkyl;R3 is selected from halogen, hydroxyl, —NR14R15 or any of the following groups R5 and R6 are, independently, selected from hydrogen, C1-C6 alkyl, C1-C6 haloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, C1-C4 alkoxy C1-C4 alkyl, C1-C6 cyanoalkyl, or R5 and R6 together with the carbon atoms to which they are attached form a 3-6 membered saturated or partially unsaturated ring optionally comprising from 1 to 3 heteroatoms independently selected from S, O and N and optionally substituted with from 1 to 3 groups independently selected from halogen and C1-C6 alkyl;R7 and R8 are, independently, selected from C1-C6 alkyl, C1-C6 haloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, a C5-C10 monocyclic heteroaryl group comprising from 1 to 4 heteroatoms independently selected from N, O and S and optionally substituted with from 1 to 3 groups independently selected from halogen, C1-C3 alkyl, C1-C3 haloalkyl and C1-C3 alkoxy and a C6-C10 aryl group optionally substituted with from 1 to 3 groups independently selected from halogen, nitro, cyano, C1-C3 alkyl, C1-C3 alkoxy, C1-C3 haloalkyl and C1-C3 haloalkoxy;R9 is selected from C1-C6 alkyl and benzyl optionally substituted with from 1 to 3 groups independently selected from halogen, nitro, cyano, C1-C3 alkyl, C1-C3 alkoxy, C1-C3 haloalkyl and C1-C3 haloalkoxy;R14 and R15 are, independently, selected from hydrogen, C1-C20 alkyl, C1-C20 haloalkyl, C2-C20 alkenyl, C2-C20 alkynyl, or R14 and R15 together with the carbon atoms to which they are attached form a 3-6 membered saturated or partially unsaturated ring optionally comprising from 1 to 3 heteroatoms independently selected from S, O and N and optionally substituted with from 1 to 3 groups independently selected from halogen and C1-C6 alkyl;or an N-oxide or salt form thereof.

13992

부직포 및 펠트 제조업

특허

ko

en

유기 전계발광 디바이스용 재료본 발명은 전자 디바이스에서의 사용에 적합한 화합물에 관한 것이고, 상기 화합물을 함유하는 전자 디바이스, 특히 유기 전계발광 디바이스에 관한 것이다.하기 식 (1) 의 화합물.식 중, 사용된 기호 및 인덱스들은 하기와 같다:X 는 각각의 경우에 동일 또는 상이하고 CR 또는 N 이며, 여기서 Y1 또는 Y2 기가 이 X 에 결합될 때 X = C 이다;Ar 은 명시적으로 나타낸 탄소 원자들과 함께, 5 내지 14 개의 방향족 고리 원자를 갖고 하나 이상의 R 라디칼로 치환될 수도 있는 아릴 또는 헤테로아릴 기이다;Y1 은 C(R')2, NR', O, S, C=O, Si(R')2, BR', PR', P(=O)R', SO 또는 SO2 이다; Y2 은 단일 결합, C(R')2, C(=C(R'')2), NR', O, S, C=O, Si(R')2, BR', PR', P(=O)R', SO 또는 SO2 이다;R 은 각각의 경우에 동일 또는 상이하고, H, D, F, Cl, Br, I, N(R1)2, N(Ar')2, CN, NO2, OR1, SR1, COOR1, C(=O)N(R1)2, Si(R1)3, B(OR1)2, C(=O)R1, P(=O)(R1)2, S(=O)R1, S(=O)2R1, OSO2R1, 1 내지 20 개의 탄소 원자를 갖는 직쇄형 알킬 기 또는 2 내지 20개의 탄소 원자를 갖는 알케닐 또는 알키닐 기 또는 3 내지 20 개의 탄소 원자를 갖는 분지형 또는 환형 알킬 기 (여기서 상기 알킬, 알케닐 또는 알키닐 기는 각각의 경우에 하나 이상의 R1 라디칼로 치환될 수도 있으며, 하나 이상의 비인접 CH2 기는 Si(R1)2, C=O, NR1, O, S 또는 CONR1 로 대체될 수도 있음), 또는 5 내지 60개 방향족 고리 원자, 바람직하게는 5 내지 40 개의 방향족 고리 원자를 갖고, 각각의 경우에 하나 이상의 R1 라디칼로 치환될 수도 있는 방향족 또는 헤테로방향족 고리 시스템이며; 동시에, 2 개의 R 라디칼은 함께 또한 지방족 또는 헤테로지방족 고리 시스템을 형성할 수도 있다; R' 은 각각의 경우에 동일 또는 상이하고, 1 내지 20 개의 탄소 원자를 갖는 직쇄형 알킬 기 또는 2 내지 20 개의 탄소 원자를 갖는 알케닐 또는 알키닐 기 또는 3 내지 20 개의 탄소 원자를 갖는 분지형 또는 환형 알킬 기 (여기서 상기 알킬, 알케닐 또는 알키닐 기는 각각의 경우에 하나 이상의 R1 라디칼에 의해 치환될 수도 있고, 하나 이상의 비인접 CH2 기는 Si(R1)2, C=O, NR1, O, S 또는 CONR1 에 의해 대체될 수도 있음), 또는 5 내지 60 개의 방향족 고리 원자, 바람직하게는 5 내지 40개의 방향족 고리 원자를 갖고 각각의 경우에 하나 이상의 R1 라디칼에 의해 치환될 수도 있는 방향족 또는 헤테로방향족 고리 시스템이고; 동시에, 2 개의 R' 라디칼은 함께 또한 방향족, 헤테로방향족, 지방족 또는 헤테로지방족 고리 시스템을 형성할 수도 있다; R'' 는 각각의 경우에 동일 또는 상이하며 R 이거나, 또는 하나의 R'' 는 R 이고 다른 하나의 R'' 는 CR1=CR1 또는 CR1=N 이고, Ar과 함께, 방향족 또는 헤테로방향족 고리 시스템을 형성한다;Ar' 은 각 경우에 동일 또는 상이하고, 5 내지 40 개의 방향족 고리 원자를 갖고 하나 이상의 R1 라디칼로 치환될 수도 있는 방향족 또는 헤테로방향족 고리 시스템이다;R1 은 각각의 경우에 동일 또는 상이하고, H, D, F, Cl, Br, I, N(R2)2, CN, NO2, OR2, SR2, Si(R2)3, B(OR2)2, C(=O)R2, P(=O)(R2)2, S(=O)R2, S(=O)2R2, OSO2R2, 1 내지 20 개의 탄소 원자를 갖는 직쇄형 알킬 기, 또는 2 내지 20 개의 탄소 원자를 갖는 알케닐 또는 알키닐 기, 또는 3 내지 20 개의 탄소 원자를 갖는 분지형 또는 환형 알킬 기 (여기서, 상기 알킬, 알케닐 또는 알키닐 기는 각 경우에 하나 이상의 R2 라디칼로 치환될 수도 있고, 하나 이상의 비인접 CH2 기는 Si(R2)2, C=O, NR2, O, S 또는 CONR2 로 대체될 수도 있음), 또는 5 내지 40 개의 방향족 고리 원자를 갖고 각 경우에 하나 이상의 R2 라디칼에 의해 치환될 수도 있는 방향족 또는 헤테로방향족 고리 시스템이고; 동시에, 2개 이상의 R1 라디칼은 함께 고리 시스템을 형성할 수도 있다; R2 는 각각의 경우 동일 또는 상이하며, H, D, F 또는 1 내지 20 개의 탄소 원자를 갖는, 지방족, 방향족 또는 헤테로방향족 유기 라디칼, 특히 하이드로카르빌 라디칼이고, 여기서, 하나 이상의 수소 원자는 또한 F 로 대체될 수도 있다;m, n 은 독립적으로 0 또는 1이고, 단, m + n = 1 또는 2 이다; m = 0 은 Y1 가 부재하고 Y1 이 결합되는 Ar 에서의 탄소 원자에 R 라디칼이 결합된다는 것을 의미한다; 또한, n = 0 은 Y2 기가 부재하고 Y2 가 결합되는 Ar 에서의 탄소 원자에 R 라디칼이 결합되는 화합물.

MATERIALS FOR ORGANIC ELECTROLUMINESCENT DEVICESThe present invention relates to compounds, which are suitable for use in electronic devices, and to electronic devices, in particular organic electroluminescent devices, containing said compounds.A compound of formula (1) where the symbols and indices used are as follows:X is the same or different at each instance and is CR or N, where X═C when a Y1 or Y2 group is bonded to this X;Ar together with the carbon atoms explicitly shown is an aryl or heteroaryl group which has 5 to 14 aromatic ring atoms and may be substituted by one or more R radicals;Y1 is C(R′)2, NR′, O, S, C═O, Si(R′)2, BR′, PR′, P(═O)R′, SO or SO2;Y2 is a single bond, C(R′)2, C(═C(R″)2), NR′, O, S, C═O, Si(R′)2, BR′, PR′, P(═O)R′, SO or SO2;R is the same or different at each instance and is H, D, F, Cl, Br, I, N(R1)2, N(Ar′)2, CN, NO2, OR1, SR1, COOR1, C(═O)N(R1)2, Si(R1)3, B(OR1)2, C(═O)R1, P(═O)(R1)2, S(═O)R1, S(═O)2R1, OSO2R1, a straight-chain alkyl group having 1 to 20 carbon atoms or an alkenyl or alkynyl group having 2 to 20 carbon atoms or a branched or cyclic alkyl group having 3 to 20 carbon atoms, where the alkyl, alkenyl or alkynyl group may in each case be substituted by one or more R1 radicals and where one or more nonadjacent CH2 groups may be replaced by Si(R1)2, C═O, NR1, O, S or CONR1, or an aromatic or heteroaromatic ring system which has 5 to 60 aromatic ring atoms, and may be substituted in each case by one or more R1 radicals; at the same time, two R radicals together may also form an aliphatic or heteroaliphatic ring system;R′ is the same or different at each instance and is a straight-chain alkyl group having 1 to 20 carbon atoms or an alkenyl or alkynyl group having 2 to 20 carbon atoms or a branched or cyclic alkyl group having 3 to 20 carbon atoms, where the alkyl, alkenyl or alkynyl group may in each case be substituted by one or more R1 radicals and where one or more nonadjacent CH2 groups may be replaced by Si(R1)2, C═O, NR1, O, S or CONR1, or an aromatic or heteroaromatic ring system which has 5 to 60 aromatic ring atoms, and may be substituted in each case by one or more R1 radicals; at the same time, two R′ radicals together may also form an aromatic, heteroaromatic, aliphatic or heteroaliphatic ring system;R″ is the same or different at each instance and is R, or one R″ is R and the other R″ is CR1═CR1 or CR1═N and, together with Ar, forms an aromatic or heteroaromatic ring system;Ar′ is the same or different at each instance and is an aromatic or heteroaromatic ring system which has 5 to 40 aromatic ring atoms and may be substituted by one or more R1 radicals;R1 is the same or different at each instance and is H, D, F, Cl, Br, I, N(R2)2, CN, NO2, OR2, SR2, Si(R2)3, B(OR2)2, C(═O)R2, P(═O)(R2)2, S(═O)R2, S(═O)2R2, OSO2R2, a straight-chain alkyl group having 1 to 20 carbon atoms or an alkenyl or alkynyl group having 2 to 20 carbon atoms or a branched or cyclic alkyl group having 3 to 20 carbon atoms, where the alkyl, alkenyl or alkynyl group may in each case be substituted by one or more R2 radicals, where one or more nonadjacent CH2 groups may be replaced by Si(R2)2, C═O, NR2, O, S or CONR2, or an aromatic or heteroaromatic ring system which has 5 to 40 aromatic ring atoms and may be substituted in each case by one or more R2 radicals; at the same time, two or more R1 radicals together may form a ring system;R2 is the same or different at each instance and is H, D, F or an aliphatic, aromatic or heteroaromatic organic radical, especially a hydrocarbyl radical, having 1 to 20 carbon atoms, in which one or more hydrogen atoms may also be replaced by F;M and n are independently 0 or 1, with the proviso that m+n=1 or 2; m=0 means that the Y1 is absent and an R radical is bonded to the carbon atom in Ar to which Y1 would be bonded; in addition, n=0 means that the Y2 group is absent and an R radical is bonded to the carbon atom in Ar to which Y2 would be bonded;where the following compounds are excluded from the invention:

20313

유기질 비료 및 상토 제조업

특허

ko

en

식물 생장 조절 화합물본 발명은 신규한 비스테로이드성 브라시노스테로이드 모방 유도체, 이의 제조를 위한 방법 및 중간체, 이를 포함하는 식물 생장 조절제 조성물 및 식물 생장을 제어하고/제어하거나 종자의 발아를 촉진하기 위해 이를 사용하는 방법에 관한 것이다. [화학식 I]화학식 I의 화합물 또는 이의 염 또는 N-옥사이드:[화학식 I][이미지](상기 식에서각각의 W는 독립적으로 O 또는 S이고;A1은 C-R1이며;A2 및 A4는 각각 독립적으로 C-R1 또는 질소이고, 각각의 R1은 동일 또는 상이할 수 있으며, A2 및 A4 중 적어도 하나는 질소이고,A3은 C-X이며;R1은 H, 시아노, 할로겐, C1-C6알콕시, C1-C6알킬 또는 하나 이상의 할로겐, 하이드록실, 아민에 의해 치환된 C1-C6알킬이고;X는 할로겐, C1-C6할로알킬, 시아노, 티오시아네이트, 니트로, C1-C6알콕시, C1-C6할로알콕시, C1-C6알킬티오, C1-C6할로알킬티오, C1-C6알킬설피닐, C1-C6할로알킬설피닐, C1-C6알킬설포닐, C1-C6할로알킬설포닐, C2-C6알케닐, C2-C6알키닐, 아민, N-C1-C6알킬 아민, N,N-디-C1-C6알킬 아민, C1-C6알킬카르보닐, C1-C6알콕시카르보닐, C1-C6할로알콕시카르보닐, C1-C6할로알킬카르보닐, C3-C8사이클로알킬, 포르밀 또는 메르캅토이거나; 또는 X는 헤테로아릴 또는 하나 이상의 할로겐, 시아노, C1-C3알킬, C1-C3할로알킬로 치환된 헤테로아릴이며;R2는 H, C1-C6알킬, C1-C6할로알킬, C1-C4알킬카르보닐, C1-C6알콕시카르보닐이거나;또는 R2는 하나 이상의 시아노, 아민, 카르보닐아민으로 치환된 C1-C6알킬이고;R3, R4, R5 및 R6은 독립적으로 수소, 할로겐, 니트로, 시아노, C1-C3알킬, C1-C3할로알킬, C1-C3 알콕시, 하이드록실, -OC(O)R9, 아민, N- C1-C3알킬 아민 또는 N,N-디-C1-C3알킬 아민이며;R7은 수소, C1-C6알킬, C1-C6할로알킬, C2-C6알케닐, C2-C6할로알케닐, C2-C6알키닐, C2-C6할로알키닐, C3-C7사이클로알킬, 벤질 또는 R10으로 치환된 벤질, 아릴 또는 1개 내지 5개의 치환체 R10으로 치환된 아릴, 헤테로아릴 또는 1개 내지 5개의 치환체 R10으로 치환된 헤테로아릴, 헤테로사이클릴 또는 1개 내지 5개의 치환체 R10으로 치환된 헤테로사이클릴이고;또는 R7은 하나 이상의 시아노, 니트로, 아민, 하이드록실로 치환된 C1-C6알킬, C1-C6알콕시, C1-C6할로알콕시, C1-C6알킬티오, C1-C6할로알킬티오, C1-C6알킬설피닐, C1-C6할로알킬설피닐, C1-C6알킬설포닐, C1-C6할로알킬설포닐, C3-C7사이클로알킬, N-C1-C6알킬 아민, N,N-디-C1-C6알킬 아민, 벤질 또는 치환체 R10으로 치환된 벤질, 아릴 또는 1개 내지 5개의 치환체 R10으로 치환된 아릴, 헤테로아릴 또는 1개 내지 5개의 치환체 R10으로 치환된 헤테로아릴, 헤테로사이클릴 또는 1개 내지 5개의 치환체 R10으로 치환된 헤테로사이클릴이며;각각의 R10은 독립적으로 시아노, 니트로, 아미노, 하이드록시, 할로겐, C1-C6알킬, C1-C6할로알킬, C1-C4알콕시-C1-C4알킬, C2-C6알케닐, C2-C6할로알케닐, C2-C6알키닐, C2-C6할로알키닐, C3-C6사이클로알킬, C3-C6할로사이클로알킬, C1-C6알콕시, C1-C6할로알콕시, C1-C4알콕시-C1-C4알콕시, C1-C6알킬티오, C1-C6할로알킬티오, C1-C6알킬설피닐, C1-C6할로알킬설피닐, C1-C6알킬설포닐, C1-C6할로알킬설포닐, N-C1-C6알킬아미노, N,N-디-(C1-C6알킬)아미노, N,N-디-(C1-C6알킬)아미노카르보닐, N,N-디-(C1-C6알킬)아미노설포닐, C1-C6알킬카르보닐, C1-C6알킬카르보닐옥시, C1-C6알콕시카르보닐, C1-C6알킬카르보닐아미노이고;R9는 수소, C1-C6알킬, C1-C6알콕시 또는 C1-C6할로알킬임)

Plant growth regulating compoundsThe present invention relates to novel non-steroidal brassinosteroid mimetic derivatives, to processes and intermediates for preparing them, to plant growth regulator compositions comprising them and to methods of using them for controlling the growth of plants and/or promoting the germination of seeds.The compound of a chemical formula (i)whereineach w is o or s independently;a 1c-r 1; a 2with a 4c-r independently of one another 1or nitrogen, wherein, each r 1can be identical or different, and a wherein 2with a 4at least one be nitrogen; a 3c-x; r 1hydrogen, cyano group, halogen, c 1-c 6alkoxyl group, c 1-c 6alkyl or the c being replaced by one or more halogens, hydroxyl, amine 1-c 6alkyl; x is halogen, c 1-c 6alkylhalide group, cyano group, thiocyanic ester, nitro, c 1-c 6alkoxyl group, c 1-c 6halogen alkoxyl group, c 1-c 6alkylthio, c 1-c 6halogenated alkylthio, c 1-c 6alkyl sulphinyl, c 1-c 6alkylhalide group sulfinyl, c 1-c 6alkyl sulphonyl, c 1-c 6alkylhalide group alkylsulfonyl, c 2-c 6thiazolinyl, c 2-c 6alkynyl, amine, n-c 1-c 6alkylamine, n, n-bis--c 1-c 6alkylamine, c 1-c 6alkyl carbonyl, c 1-c 6carbalkoxy, c 1-c 6halo alkoxy carbonyl, c 1-c 6alkylhalide group carbonyl, c 3-c 8cycloalkyl, formyl radical or sulfydryl; or x is heteroaryl or by one or more halogens, cyano group, c 1-c 3alkyl, c 1-c 3the heteroaryl that alkylhalide group replaces; r 2hydrogen, c 1-c 6alkyl, c 1-c 6alkylhalide group, c 1-c 4alkyl-carbonyl, c 1-c 6alkoxy carbonyl; or r 2the c being replaced by one or more cyano group, amine, carbonyl amine 1-c 6alkyl; r 3, r 4, r 5and r 6hydrogen, halogen, nitro, cyano group, c independently 1-c 3alkyl, c 1-c 3alkylhalide group, c 1-c 3alkoxyl group, hydroxyl ,-oc (o) r 9, amine, n-c 1-c 3alkylamine or n, n-bis--c 1-c 3alkylamine; r 7hydrogen, c 1-c 6alkyl, c 1-c 6alkylhalide group, c 2-c 6thiazolinyl, c 2-c 6haloalkenyl group, c 2-c 6alkynyl, c 2-c 6alkynyl halide, c 3-c 7cycloalkyl, benzyl or by substituent r 10the benzyl replacing, aryl or by one to five substituent r 10the aryl replacing, heteroaryl or by one to five substituent r 10the heteroaryl replacing, heterocyclic radical or by one to five substituent r 10the heterocyclic radical replacing; or r 7the c being replaced by one or more cyano group, nitro, amine, hydroxyl 1-c 6alkyl, c 1-c 6alkoxyl group, c 1-c 6halogen alkoxyl group, c 1-c 6alkylthio, c 1-c 6alkyl halide sulfenyl, c 1-c 6alkyl sulphinyl, c 1-c 6alkylhalide group sulfinyl, c 1-c 6alkyl sulphonyl, c 1-c 6alkylhalide group alkylsulfonyl, c 3-c 7cycloalkyl, n-c 1-c 6alkylamine, n, n-bis--c 1-c 6alkylamine, benzyl or by substituent r 10the benzyl replacing, aryl or by one to five substituent r 10the aryl replacing, heteroaryl or by one to five substituent r 10the heteroaryl replacing, heterocyclic radical or by one to five substituent r 10the heterocyclic radical replacing; each r 10cyano group independently, nitro, amino, hydroxyl, halogen, c 1-c 6alkyl, c 1-c 6alkylhalide group, c 1-c 4alkoxy-c 1-c 4alkyl, c 2-c 6thiazolinyl, c 2-c 6haloalkenyl, c 2-c 6alkynyl, c 2-c 6alkynyl halide, c 3-c 6cycloalkyl, c 3-c 6halogen cycloalkyl, c 1-c 6alkoxyl group, c 1-c 6halogen alkoxyl group, c 1-c 4alkoxy-c 1-c 4alkoxyl group, c 1-c 6alkylthio, c 1-c 6alkyl halide sulfenyl, c 1-c 6alkyl sulphinyl, c 1-c 6alkylhalide group sulfinyl, c 1-c 6alkyl sulphonyl, c 1-c 6alkylhalide group alkylsulfonyl, n-c 1-c 6alkylamino, n, n-bis--(c 1-c 6alkyl)-amino, n, n-bis--(c 1-c 6alkyl) aminocarboxyl, n, n-bis--(c 1-c 6alkyl)-amino-sulfonyl, c 1-c 6alkyl-carbonyl, c 1-c 6alkyl-carbonyl oxygen base, c 1-c 6alkoxy carbonyl, c 1-c 6alkyl-carbonyl-amino; and r 9hydrogen, c 1-c 6alkyl, c 1-c 6alkoxyl group or c 1-c 6alkylhalide group; or its salt or n-oxide compound.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

호흡기 질환의 치료를 위한 벤즈히드릴 유도체본 발명은, 포스포디에스테라제 4(PDE4) 효소 억제제이자 무스카린성 M3 수용체 길항제인, 벤즈히드릴 구조를 가지는 식 (I)의 신규 화합물, 상기 화합물을 제조하는 방법, 이들을 함유하는 조성물 및 이들의 치료학적 용도에 관한 것이다.일반식 (I)의 화합물, 피리딘 고리 상의 N-옥사이드, 듀테로화 유도체(deuterated derivative) 및 이들의 약제학적으로 허용가능한 염, 또는 용매화물:[이미지]여기서각각의 R1은 수소이거나, 또는 할로겐, (C1-C4) 알킬, (C1-C4) 알콕시, (C1-C4) 할로알킬, 히드록시, -SO2NR6R7,-CN, -NR8SO2R9, -NR6R7, -CONR6R7 및 -NR8COR9으로 이루어지는 군에서 선택되고, 여기서 상기 (C1-C4) 알킬은 (C3-C7) 시클로알킬, 히드록시 또는 -NR6R7로부터 선택되는 하나 이상의 기에 의해 선택적으로 치환되고, 여기서 상기 (C1-C4) 알콕시는 할로겐 또는 (C3-C7) 시클로알킬기 하나 이상에 의해 선택적으로 치환되며 여기서, R6은 수소이거나 또는 (C1-C6) 알킬이고; R7은 수소이거나 또는 (C1-C6) 알킬이고; R8은 수소이거나 또는 (C1-C6) 알킬이고; R9는 수소이거나 또는 (C1-C6) 알킬이며;n은 1 내지 3의 범위의 정수이고;각각의 R2는 수소이거나, 또는 할로겐, (C1-C4) 알킬, (C1-C4) 알콕시, (C1-C4)할로알킬, 히드록시, -SO2NR10R11,-CN 및 -NR12SO2R13으로 이루어지는 군에서 선택되고, 여기서 상기 (C1-C4) 알킬 및 상기 (C1-C4) 알콕시는 하나의 (C3-C7) 시클로알킬기에 의해 선택적으로 치환되며 여기서 R10은 수소이거나 또는 (C1-C6) 알킬이고; R11은 수소이거나 또는 (C1-C6) 알킬이고; R12는 수소이거나 또는 (C1-C6) 알킬이고; R13은 수소이거나 또는 (C1-C6) 알킬이며;m은 1 내지 3의 범위의 정수이고;R3 및 R4는 다르거나 동일하고, H; -(C3-C7) 시클로알킬카보닐; (C3-C7) 시클로알킬 또는 (C5-C7) 시클로알케닐로부터 선택되는 하나 이상의 치환체에 의해 선택적으로 치환된, (C1-C6) 알킬; (C1-C6) 할로알킬; (C3-C7) 시클로알킬; (C5-C7) 시클로알케닐; (C2-C6) 알케닐; 및 (C2-C6) 알키닐;로 이루어지는 군으로부터 독립적으로 선택되고; 또는 R3 및 R4는, 사이를 연결하는(interconnecting) 원자와 함께, -OR3 및 -OR4기를 가지는 페닐 모이어티(moiety)에 융합된(fused) 식 (r)의 2,2-디플루오로-1,3-디옥솔란 고리를 형성하고, 여기서 별표(asterisk)는 상기 페닐 고리에 공유된 탄소 원자를 나타내며:[이미지]각각의 R5는 CN, NO2, CF3 및 할로겐 원자로 이루어지는 군으로부터 선택되고;k는 0 또는 1 내지 3의 범위의 정수이고;L1은: 결합(bond), -(CH2)p-, [3]-(CH2)p-O-[4] [3]-(CH2)p-NR10-(CH2)t-[4] [3]-(CH2)p-OC(O)-[4] [3]-(CH2)p-NR10C(O)-[4] [3]-(CH2)p-NR10 S(O2)-[4] 및 [3]-(CH2)p-S(O2)-N(R10)-[4] 로 이루어지는 리스트로부터 선택되고 여기서 [3] 및 [4]는, 각각 카보닐기 및 고리 W에 L1기의 부착 지점을 나타내고 여기서 R10은 상기 기재된 바와 같고, p는 1 내지 4의 범위의 정수이고, t는 1 내지 4의 범위의 정수이며;W는 아릴렌, (C5-C6) 헤테로아릴렌 또는 포화된 모노시클릭 (C3-C7) 헤테로시클로알킬렌으로부터 선택되는 2가의 기이고;L2는 결합(bond)이거나, 또는 -C(O)-, -S-, -S(O)-, -S(O)2- 또는 -(CH2)q-(여기서 q는 1 또는 2임)로부터 선택되는 기이고; L3은 부존재(absent)하거나, 또는 오쏘-, 메타-, 파라-페닐렌, 또는 2가의 (C5-C6) 헤테로아릴렌으로부터 선택되고,L4는 -(CH2)r-, [1]-(CH2)r-O-[2], [1]-OC(O)-[2] 또는 [1]-C(O)O-[2]로부터 선택되고, 여기서 r은 1 또는 2이고, [1] 및 [2]는 각각 L2기 및 페닐 고리에 L4기의 부착 지점을 나타내고,Z는 NH, CH2 또는 O로부터 선택되고;A는: - -(CH2)s-NR16R17인 (a)기 (여기서 s는 1 내지 4의 범위의 정수이고, R16 및 R17은 독립적으로 수소 또는 (C1-C4) 알킬임); 또는 - 하나 또는 두개의 R18기 (각 경우에 독립적으로 (C1-C4) 알킬 또는 벤질로부터 선택됨)에 의해 선택적으로 치환된, 포화된 모노시클릭, 비시클릭 또는 트리시클릭 헤테로시클릭 고리 시스템인 (b)기;로부터 선택될 수 있는 질소 함유 기이다.

Benzhydryl derivatives for the treatment of respiratory diseasesThe invention relates to novel compounds of formula (I) having a benzhydryl structure which are both phosphodiesterase 4 (PDE4) enzyme inhibitors and muscarinic M3 receptor antagonists, methods of preparing such compounds, compositions containing them and therapeutic use thereof.The compound of formula (i), the n-oxide on its pyridine ring, deuterated derivant and pharmaceutically acceptable salt or solvatewhereinr1it is individually hydrogen or is selected from: halogen, (c1-c4) alkyl, (c1-c4) alkoxyl, (c1-c4) haloalkyl, hydroxyl ,-so2nr6r7、-cn、-nr8so2r9、-nr6r7、-conr6r7with-nr8cor9, and wherein said (c1-c4) alkyl is optionally selected from (c3-c7) cycloalkyl, hydroxyl and-nr6r7one or more groups replace, and wherein said (c1-c4) alkoxyl is optionally by one or more halogens or group (c3-c7) cycloalkyl substituted, whereinr6it is hydrogen or (c1-c6) alkyl；r7it is hydrogen or (c1-c6) alkyl；r8it is hydrogen or (c1-c6) alkyl；r9it is hydrogen or (c1-c6) alkyl；n is the integer of 1-3；r2it is individually hydrogen or is selected from: halogen, (c1-c4) alkyl, (c1-c4) alkoxyl, (c1-c4) haloalkyl, hydroxyl ,-so2nr10r11,-cn and-nr12so2r13, and wherein said (c1-c4) alkyl and described (c1-c4) alkoxyl is optionally by a group (c3-c7) cycloalkyl substituted, whereinr10it is hydrogen or (c1-c6) alkyl；r11it is hydrogen or (c1-c6) alkyl；r12it is hydrogen or (c1-c6) alkyl；r13it is hydrogen or (c1-c6) alkyl；m is the integer of 1-3；r3and r4identical or different and independently selected from:h；-(c3-c7) naphthene base carbonyl；(c1-c6) alkyl, it is optionally selected from (c by one or more3-c7) cycloalkyl or (c5-c7) cycloalkenyl group substituent group replace；(c1-c6) haloalkyl；(c3-c7) cycloalkyl；(c5-c7) cycloalkenyl group；(c2-c6) thiazolinyl；with(c2-c6) alkynyl；or r3and r4collectively form 2,2-bis-fluoro-dox rings of formula (r) with the atom being connected between two parties, its with group or3and or4phenyl moiety condense, wherein asterisk represents the carbon atom total with this phenyl ring:r5it each is selected from: cn, no2、cf3and halogen atom；k is the integer of 0 or 1-3；l1it is selected from:valence link；-(ch2)p-；[3]-(ch2)p-o-[4]；[3]-(ch2)p-nr10-(ch2)t-[4]；[3]-(ch2)p-oc(o)-[4]；[3]-(ch2)p-nr10c(o)-[4]；[3]-(ch2)p-nr10s(o2)-[4]；with[3]-(ch2)p-s(o2)-n(r10)-[4],wherein [3] and [4] represent group l respectively1it is connected to the point of carbonyl group and ring w, and whereinr10as mentioned above；p is the integer of 1-4；andt is the integer of 1-4；w is chosen from arlydene, (c5-c6) inferior heteroaryl and saturated monocycle (c3-c7) divalent group of sub-heterocyclylalkyl；l2be valence link or selected from-c (o)-,-s-,-s (o)-,-s (o)2-and-(ch2)q-group, wherein q is 1 or 2；l3it is absent from or selected from o-, m-, p-phenylene and bivalence (c5-c6) inferior heteroaryl；l4it is chosen from-(ch2)r-、[1]-(ch2)rthe group of-o-[2], [1]-oc (o)-[2] and [1]-c (o) o-[2], wherein r is 1 or 2, and [1] and [2] represents group l respectively4it is connected to group l2point with described phenyl ring；z is selected from nh, ch2and o；a is the group comprising nitrogen, and it can be selected from:-group (a), it is (ch2)s-nr16r17, wherein s is the integer of 1-4, and r16and r17it is hydrogen or (c independently1-c4) alkyl；with-group (b), it is saturated monocycle, dicyclo or tricyclic heterocyclic ring system, and they are optionally by one or two group r18replace, described group r18when occurring every time independently selected from (c1-c4) alkyl and benzyl.

45000

자동차 및 부품 판매업

특허

ko

en

차량용 폐쇄 탑승 제어 시스템본 발명은 차량 본체가 적어도 하나의 차량 축에 대하여 매달려 있게 되는 차량용 폐쇄 탑승 제어 시스템으로서, 이하의 구성 요소 : 분기부 (38a ~ 38d) 를 통하여 압력 매체 라인 (34) 에 연결되는 압력 매체 챔버 (6a ~ 6d), 압축기 (8), 압력 매체 라인 (4) 에 구성되는 공기 건조기 (10), 압력 매체 저장소 탱크 (12) 로서, 압력 매체 저장소 탱크 (12) 로부터 압력 매체가 압축기 (8) 에 의해 각각의 압력 매체 챔버 (6a ~ 6d) 안으로 전달될 수 있고, 압축기 입구 (14) 는 그 후 방향성 밸브 (2a) 에 의해 스위치되는 압력 매체 라인 (1) 에 의해 압력 매체 저장소 탱크 (12) 에 연결되고 압축기 출구 (16) 는 그 후 방향성 밸브 (4a) 에 의해 스위치되는 압력 매체 라인 (2) 에 의해 하나 이상의 압력 매체 챔버 (6a ~ 6d) 에 연결되고, 각각의 압력 매체 챔버 (6a ~ 6d) 로부터의 압력 매체가 압축기 (8) 에 의해 압력 매체 저장소 탱크 (12) 안으로 전달될 수 있고, 압축기 입구 (14) 는 그 후 방향성 밸브 (4a) 에 의해 스위치되는 압력 매체 라인 (3) 에 의해 하나 이상의 압력 매체 챔버 (6a ~ 6d) 에 연결되고 압축기 출구 (16) 는 방향성 밸브 (2a) 에 의해 스위치되는 압력 매체 라인 (4) 에 의해 압력 매체 저장소 탱크 (12) 에 연결되고, 대기에 연결될 수 있는 압력 매체 라인 (32) 은 방향성 밸브 (30), 방향성 밸브 (4a), 그리고 압력 매체 라인 (3) 에 의해 압축기 입구 (14) 에 그리고 방향성 밸브 (4a), 압력 매체 라인 (2) 그리고 방향성 밸브 (2a) 에 의해 압력 매체 저장소 탱크 (12) 에 연결될 수 있으며, 압축기 (8) 를 통하여 압력 매체 챔버 (6a ~ 6d) 에 연결되는 압력 매체 저장소 탱크를 포함하고, 체크 밸브 (18) 가 방향성 밸브 (2a) 와 공기 건조기 (10) 의 출구 (40) 사이의 압력 매체 라인 (4) 에 놓이는 것을 또한 특징으로 한다. 차량 본체가 적어도 하나의 차량 축에 대하여 매달려 있게 되는 차량용 폐쇄 탑승 제어 시스템으로서, 이하의 구성 요소 :- 분기부 (38a ~ 38d) 를 통하여 압력 매체 라인 (34) 에 연결되는 압력 매체 챔버 (6a ~ 6d),- 압축기 (8), - 압력 매체 라인 (4) 에 구성되는 공기 건조기 (10),- 압력 매체 저장소 (12) 로서, - 압력 매체가 압력 매체 저장소 (12) 로부터 압축기 (8) 를 통하여 각각의 압력 매체 챔버 (6a ~ 6d) 안으로 전달될 수 있고, 압축기 입구 (14) 는 그 후 방향성 밸브 (2a) 에 의해 관통 연결되는 압력 매체 라인 (1) 을 통하여 압력 매체 저장소 (12) 에 연결되고, 압축기 출구 (16) 는 그 후 방향성 밸브 (4a) 에 의해 관통 연결되는 압력 매체 라인 (2) 을 통하여 하나 이상의 압력 매체 챔버 (6a ~ 6d) 에 연결되고, - 압력 매체가 각각의 압력 매체 챔버 (6a ~ 6d) 로부터 압축기 (8) 를 통하여 압력 매체 저장소 (12) 에 전달될 수 있고, 압축기 입구 (14) 는 그 후 방향성 밸브 (4a) 에 의해 관통 연결되는 압력 매체 라인 (3) 을 통하여 하나 이상의 압력 매체 챔버 (6a ~ 6d) 에 연결되고, 압축기 출구 (16) 는 그 후 방향성 밸브 (2a) 에 의해 관통 연결되는 압력 매체 라인 (4) 을 통하여 압력 매체 저장소 (12) 에 연결되고, - 압력 매체 라인 (32) 이 대기에 연결 가능하고 방향성 밸브 (30), 방향성 밸브 (4a) 및 압력 매체 라인 (3) 을 통하여 압축기 입구 (14) 에 연결 가능하고, 방향성 밸브 (4a), 압력 매체 라인 (2) 및 방향성 밸브 (2a) 를 통하여 압력 매체 저장소 (12) 에 연결 가능한 방식으로 압축기 (8) 를 통하여 압력 매체 챔버 (6a ~ 6d) 에 연결되는 압력 매체 저장소를 포함하는 폐쇄 탑승 제어 시스템에 있어서, 비복귀 밸브 (18) 가 공기 건조기 (10) 의 출구 (40) 를 압력 매체 저장소 (12) 에 연결하기 위해 방향성 밸브 (2a) 와 공기 건조기 (10) 의 출구 (40) 사이에 압력 매체 라인 (4) 에 구성되고, 이 압력 매체 라인 (2) 은 비복귀 밸브 (18) 의 상류와 공기 건조기 (10) 의 출구 (40) 에서 압력 매체 라인 (4) 으로부터 분기되고, 비복귀 밸브 (19) 및/또는 스로틀 (22) 은 압력 매체 라인 (20) 에 구성되고, 이 압력 매체 라인 (20) 은 비복귀 밸브 (18) 와 방향성 밸브 (2a) 사이의 지점 (41) 에서 압력 매체 라인 (4) 으로부터 분기되고 공기 건조기 (10) 에서 개방되며, 비복귀 밸브 (19) 는 공기 건조기 (10) 로부터 압력 매체 라인 (4) 으로의 연결부로의 방향으로 막혀있는 것을 특징으로 하는 폐쇄 탑승 제어 시스템.

CLOSED RIDE CONTROL SYSTEM FOR VEHICLESA closed ride control system for vehicles by which a vehicle body is suspended with respect to at least one vehicle axle and which includes the following components: pressure medium chambers which are connected via branches to a pressure medium line, a compressor, an air dryer which is arranged in a pressure medium line, a pressure medium reservoir which is connected via the compressor to the pressure medium chambers, and a non-return valve arranged in the pressure medium line between an outlet of the air dryer and the directional valve in order to connect the outlet of the air dryer to the pressure medium reservoir.Enclosed ride-height control system that is used for vehicle, vehicle body is draped with respect at least one axletree through said ride-height control system, and said ride-height control system comprises with the lower part:-pressure medium chamber (6a-6d), said pressure medium chamber is connected with pressure medium pipeline (34) via branch road (38a-38d),-compressor (8),-air dryer (10), said air dryer are arranged in the pressure medium pipeline (4),-pressure medium receiver (12), said pressure medium receiver is connected with said pressure medium chamber (6a-6d) via said compressor (8) in the following manner:-pressure medium can be delivered in each said pressure medium chamber (6a-6d) via said compressor (8) from said pressure medium receiver (12); wherein, suction port of compressor (14) is connected with said pressure medium receiver (12) via the pressure medium pipeline (1) that is communicated with by means of change-over valve (2a); and compressor outlet (16) is via one or more connection the in the pressure medium pipeline (2) that is communicated with by means of change-over valve (4a) and the said pressure medium chamber (6a-6d)-pressure medium can be delivered in the said pressure medium receiver (12) via said compressor (8) from each said pressure medium chamber (6a-6d); wherein, said suction port of compressor (14) is via one or more connection the in the pressure medium pipeline (3) that is communicated with by means of said change-over valve (4a) and the said pressure medium chamber (6a-6d); and said compressor outlet (16) is connected with said pressure medium receiver (12) via the pressure medium pipeline (4) that is communicated with by means of said change-over valve (2a), and-pressure medium the pipeline (32) that can be connected to environment can be connected with said suction port of compressor (14) via change-over valve (30), said change-over valve (4a) and pressure medium pipeline (3); and can be connected with said pressure medium receiver (12) via said change-over valve (4a), said pressure medium pipeline (2) and said change-over valve (2a)it is characterized in that, between the outlet (40) of said air dryer (10) and said change-over valve (2a), in said pressure medium pipeline (4), be provided with boiler check valve (18) and be connected with said pressure medium receiver (12) with said outlet (40) with said air dryer (10); locate and divide expenditure said pressure medium pipeline (2) from said pressure medium pipeline (4) in the said outlet (40) of said air dryer (10) at the upstream end of said boiler check valve (18); in pressure medium pipeline (20), be provided with boiler check valve (19) and/or air restrictor (22); the position (41) of said pressure medium pipeline (20) between said boiler check valve (18) and said change-over valve (2a) located from said pressure medium pipeline (4) branch expenditure and fed in the said air dryer (10); wherein, said boiler check valve (19) is extremely being blocked with said pressure medium pipeline (4) bonded assembly direction from said air dryer (10).

72919

기타 기술 시험, 검사 및 분석업

특허

ko

en

십자 인장 조인트의 파단 양식 판정 방법 및 십자 인장 조인트용 박강판탄소량이나 탄소 당량이 다른 박강판을 스폿 용접에서 제작한 십자 인장 조인트에 있어서 시험을 수행하지 않고 파단 양식을 판정할 수 있는 십자 인장 조인트의 파단 양식 판정 방법 및 십자 인장 조인트용 박강판을 제공하는 것. 박리 파단과 플러그 파단이 응력 확대 계수와 피크 상당 소성 변형으로 경합하는 해석 모델을 이용하는 십자 인장 조인트의 파단 양식 판정 방법으로서, 박강판의 탄소량 C가 0.10~0.40[%], 탄소 당량 CeqW가 0.30~0.60[%], P≦0.020[%]및 S≦0.010[%]이며 십자 인장 조인트에 있어서의, 탄소 당량 CeqW, 균열 길이 a, 판 두께 t 및 너겟 지름 ND의 관계가 소정의 조건식을 만족함으로써, 십자 인장 조인트의 스폿 용접부의 파단 양식이 박리 파단이 되거나 플러그 파단이 되는지를 판정한다.강판 표면의 타각흔으로 타각원 또는 타각타원으로 중심 0'를 통과하는 X' 축과 상기 X' 축에 직각한 Y' 축을 규정하고 상기 중심 0'를 통과하는 판두께 방향의 선을 Z축으로 하고, 너겟 단면에서 너겟 두께 방향으로 이등분하는 상기 Z축에 직각한 선을 X축으로 하고, 상기 X축과 상기 Z축과의 교점 0을 연결하는 상기 X축에 직각한 방향으로 Y축을 정하고 X-Z너겟 단면에 타각흔을 설치하고 너겟 외각의 메쉬를 반타원, 또는 직사각형과 반원/반타원과의 조합으로 하고, 상기 너겟 외각의 메쉬가 반타원의 경우에는 HAZ 영역을 상기 타각흔까지 상기 교점 0을 중심으로 한 상기 X축 및 상기 Z축에 있어서 등간격으로 상기 반타원을 펼쳐 다른 한쪽, 상기 너겟 외각의 메쉬가 직사각형과 반원/반타원과의 경우에는 HAZ 영역을 타각흔까지 상기 직사각형과 상기 반원/반타원으로 X축 및 Z축에 있어서 등간격으로 펼쳐 상기 HAZ 영역이 상기 타각흔에 접하여에서는 상기 교점 0을 중심으로 하는 반타원에 의해 상기 HAZ 영역 및 모재 영역을 상기 X축 및 상기 Z축에 있어서 등간격으로 펼쳐 X-Z너겟 단면에서 시트 세퍼레이션 종단 형상은 3개의 반타원을 조합한 요철을 가지며, 한쪽의 너겟 방향으로 볼록한 영역의 선단에 균열을 설치하고 그 균열 선단을 중심으로 한 0.4[mm]×0.4[mm]이상의 영역에 25[μm]×25[μm]이하의 메쉬 배열의 영역 A를 설치하고 다른 한쪽으로 시트 세퍼레이션 종단 영역의 요철을 덮는 영역에서 너겟과 반대 방향으로 볼록의 선단을 중심으로 한 0.3[mm]×0.3[mm]이상의 영역에 50[μm]×50[μm]이하의 메쉬 배열의 영역 B를 설치하고 해석 모델이 Z축 주위의 90[°]회전체이며 너겟 영역 및 HAZ 영역에서 경도 분포에 따라 응력-변형 곡선을 입력해 탄소성 유한 요소 해석을 실시하여 상기 영역 A로 상기 균열 선단을 둘러싸는 적분 경로에서 산출한 J적분값의 안정해보다 평면 변형 상태를 가정해 응력 확대 계수 K를 구하고 판정 기준으로서 상기 응력 확대 계수 K가 하기 (3) 식으로 표시되는 시트 세퍼레이션 종단 영역의 피크 상당 소성 변형 Peeq의 한계치에 도달하기 전에 박강판의 탄소량 C[%]에 따라 하기 (1) 식에서 산출되는 값을 상회할 경우에는 박리 파단한다고 예측되고 다른 한쪽으로 상기 판정 기준으로서 시트 세퍼레이션 종단 영역의 반타원 부근부에 집중하는 50[μm]×50[μm]의 피크 상당 소성 변형 Peeq가 하기 (1) 식에서 계산되는 응력 확대 계수 K의 한계치에 도달하기 전에 하기 (2) 식 탄소 당량 CeqW[%]에 따라 하기 (3) 식에서 계산되는 조건을 충족할 경우에는 연성 균열이 발생해 플러그 파단한다고 예측되는, 박리 파단과 플러그 파단이 상기 응력 확대 계수 K와 상기 피크 상당 소성 변형 Peeq로 경합하는 상기 해석 모델을 이용하는, 십자 인장 조인트의 파단 양식 판정 방법으로서, 하기 (1) 식의 탄소량 C의 범위를 0.10~0.40[%]로 하고, 하기 (3) 식의 탄소 당량 CeqW의 범위를 0.30~0.60[%]로 하고, 하기 (1) 식 및 하기 (3) 식은 P≦0.020[%]및 S≦0.010[%]의 강에 적용할 수 있는 것으로서, 상기 판정 기준과 함께 균열 길이를 a[μm], 판 두께를 t[mm]및 너겟 지름을 ND[mm]로 했을 때 하기 (4) 식을 만족할 경우에는 상기 십자 인장 조인트의 스폿 용접부의 파단 양식이 박리 파단이 된다고 판정해, 하기 (5) 식을 만족할 경우에는 상기 십자 인장 조인트의 스폿 용접부의 파단 양식이 플러그 파단이 된다고 판정하는 단계를 포함하는 것을 특징으로 하는 십자 인장 조인트의 파단 양식 판정 방법. 여기서 Ln(C)는 박강판의 탄소량 C[%]의 자연대수이며 e는 자연대수의 바닥이다. 여기서 Peeq＜0일 경우에는 Peeq=0.01으로 한다.

CROSS TENSION JOINT FRACTURE PATTERN DETERMINATION METHOD AND THIN STEEL PLATE FOR CROSS TENSION JOINTTo provide a cross tension joint fracture pattern determination method capable of determining a fracture pattern of a cross tension joint fabricated by spot-welding thin sheet plates having different carbon contents or carbon equivalents without conducting a fracture test and to provide a thin steel plate for the cross tension joint. A cross tension joint fracture pattern determination method uses an analysis model in which delamination fracture and plug fracture compete against each other with respect to a stress intensity factor and peak equivalent plastic strain. In the method, a thin steel plate has a carbon content C of 0.10 to 0.40%, a carbon equivalent CeqW of 0.30 to 0.60%, a phosphorus content of not more than 0.020% and a sulfur content of not more than 0.010%. Depending on how a relation among the carbon equivalent CeqW, a crack length a, a plate thickness t and a nugget diameter ND of a cross tension joint satisfies a predetermined conditional expression, the method determines whether a fracture pattern of a spot-weld section of the cross tension joint is the delamination fracture or the plug fracture.The X 'axis passing through the center 0' in the steel plate surface in the steel plate surface or the X 'axis passes perpendicular to the X' axis, and the line in the thickness direction passing through the center 0 '. Let the z-axis as the z-axis and blast a line perpendicular to the z-axis in the nugget cross section, the x-axis, and in a direction perpendicular to the x-axis connecting the intersection 0 between the x-axis and the z axis. The y-axis is defined, and a marked mark is provided in the XZ nugget cross section, and the mesh of the nugget shell is semi-elliptic or a rectangle and a half-circle / semi-elliptical combination, and the mesh of the nugget shell is a semi-elliptical. In the case of the X-axis and the z-axis, the HAZ region is divided at equal intervals in the X-axis and the Z-axis, the HAZ region is divided at equal intervals, and the mesh of the nugget shell is a rectangle and a half circle / In the case of a semi-elliptical, the HAZ region is extended at equal intervals between the rectangle and the semi-circle / semi-elliptical with the rectangle and the semi-circle / semi-elliptical, and the HAZ region is in contact with the launch mark. , Semi-elliptic centered on the crossing point 0 extend the HAZ region and the base material region at equal intervals on the X-axis and the Z-axis, and in the XZ nugget cross section, the sheet separation termination shape combines three semi-ellenses. 25 [μm] × 25 in the area of ​​0.4 [mm] × 0.4 [mm] or more centered on the leading end of the region, with the tip of the region convex in one nugget direction, 25 [μm] × 25 [μm] The area A of the mesh sequence below is provided, and on the other hand, in the region covering the unevenness of the sheet separation end region, 0.3 [mm] × 0.3 [mm] or more centered on the tip opposite to the nugget. In the region, 50 μm × 50 μm, the area B of the mesh sequence below is provided, and the analysis model is a 90 [°] rotating body around the Z axis, and in the nugget region and the HAZ region, according to the hardness distribution Stress-Strain Curve is input to carry out elasto-plastic finite element analysis, and in the region A, the strain is a planar strain state by the stability solution of the J integral value calculated from the integral path surrounding the crack tip. The carbon content of the thin steel plate C. According to%], when the value calculated by the following equation (1) is exceeded, it is predicted that it is expected to be disconnected, and on the other hand, as the determination criterion, it is concentrated in the vicinity of semi-separation of the sheet separation termination area. Peak equivalent plastic strain PEEQ of μM] × 50 [μm], Before reaching the limit value of the stress expansion coefficient k calculated by the equation (2), if the condition calculated by the following equation (3) is satisfied, the condition calculated by the following equation (3) is satisfied, A crucible type of cross-tensile joint with the analysis model that competes with the stress expansion coefficient K and the peak equivalent plastic strain PEEQ, which is predicted to break up and prolonged cracking. In the determination method, the range of carbon content C in the following equation (1) is 0.10 to 0.40 [%], and the range of carbon equivalent CEQW in the following equation (3) is 0.30 to 0.60 [%], and the following (1) Equations and (3) below are those that can be applied to P ≦ 0.020 [%] and S ≦ 0.010 [%] steel, and in addition to the criteria, the crack length is A [μm], When the plate thickness is T [mm] and the nugget diameter is Nd [mm], if the following equation (4) is satisfied, it is determined that the breaking mode of the spot welding portion in the cross tensile joint becomes disconnected. When the following equation (5) is satisfied, a crucified form determination method of a cross-tensile joint of a cross-tensile joint is characterized in that the breaking mode of the spot welding portion in the cross tensile joint is plug breakage. Here, LN (C) is the natural logarithm of carbon content C [%] of the thin steel plate, and E is the bottom of the natural logarithm. Here, in the case of PEEQ <0, PEEQ = 0.01.

26519

비디오 및 기타 영상 기기 제조업

특허

ko

en

낮은 정보 컨텐츠 장면의 1차원 디지털 표현을 형성하는 머신 비전 시스템낮은 정보 컨텐츠 장면, 예를 들면 조명면에 의해 희미하게 조명되는 장면의 1차원 디지털 표현을 형성하기 위한 머신 비전 시스템이며, 1차원 디지털 표현은 머신 비전 시스템의 직사각형 픽셀 어레이의 컬럼에 대해 형성된 프로젝션이다.낮은 정보 컨텐츠 장면의 1차원 디지털 표현을 형성하는데 유용한 머신 비전 시스템으로서,상기 시스템은 다음을 포함함:a) 이미지 신호를 수신하고, 상기 이미지 신호를 프로세스하여 바이너리 측정 신호를 출력하도록 구성되는 이미지 센서 -상기 이미지 신호는 장면으로부터 수집된 광 에너지를 나타냄- 상기 이미지 센서는 다음을 포함함, i) 로우와 컬럼에 의해 배열된 감광 픽셀과 다크 픽셀의 픽셀 어레이, 상기 어레이는 다음을 포함함, A) 상기 픽셀 어레이의 로우와 일대일 대응인 픽셀 출력 제어 버스의 어레이 -각각의 상기 픽셀 출력 제어 버스는 픽셀 출력 제어 신호를 상기 픽셀 어레이의 각각의 로우 상의 픽셀에 제공하도록 구성되고 배열됨-, 및 B) 상기 픽셀 어레이의 컬럼과 일대일 대응인 픽셀 컬럼 회로의 어레이, 각각의 픽셀 컬럼 회로는 다음을 포함함, Ⅰ) 픽셀 출력 신호를 합산하도록 구성되고 배열되는 픽셀 출력 버스, 및 Ⅱ) 픽셀 제어 버스의 어레이와 일대일 대응으로 커플링되는, 픽셀의 선형 어레이, 상기 픽셀의 선형 어레이는 다음을 포함함, (a) 상기 이미지 신호의 부분을 수신하는 상기 감광 픽셀의 선형 어레이, 각각의 감광 픽셀은 다음을 포함함, (i) 상기 감광 픽셀에 의해 수신된 광 에너지에 응답하는 광 신호 소스, 및 (ii) 픽셀 출력 제어 버스에 커플링되며, 상기 감광 픽셀이 상기 픽셀 출력 버스에 픽셀 출력 신호를 제공하도록 하는 상기 픽셀 출력 버스에 대한 상기 광 신호 소스의 커플링을 제어하는 출력 선택 회로, (b) 상기 다크 픽셀의 선형 어레이, 각각의 다크 픽셀은 다음을 포함함, (i) 상기 다크 픽셀에 의해 수신된 기준 신호에 응답하는 다크 신호 소스, 및 (ii) 다른 픽셀 출력 제어 버스에 커플링되며, 상기 다크 픽셀이 상기 픽셀 출력 버스에 픽셀 출력 신호를 제공하도록 하는 상기 픽셀 출력 버스에 대한 상기 다크 신호 소스의 커플링을 제어하는 출력 선택 회로 ii) 상기 픽셀 어레이와 커플링되는 샘플링 패턴 생성기 -상기 샘플링 패턴 생성기는 상기 픽셀 출력 제어 버스의 어레이에 상기 픽셀 출력 제어 신호의 시퀀스를 제공하도록 구성되며, 또한 상기 다크 픽셀에 상기 기준 신호를 제공하도록 구성됨- 여기서, A) 상기 픽셀 출력 제어 신호의 시퀀스의 각 엘리먼트는 샘플링 패턴 매트릭스의 로우와 대응하고, 이는 상기 출력 버스의 어레이 상의 상기 픽셀 출력 신호의 선택적인 합산을 통해, 상기 픽셀 어레이의 컬럼과 대응하는 측정 계수의 어레이를 형성하도록 미리 결정되며, 측정 계수는 비-표준 기저로 나타낸 상기 이미지 신호의 정보를 포함하고, B) 상기 픽셀 출력 제어 버스의 어레이의 상기 시퀀스의 상기 엘리먼트를 제공함으로써 측정 신호가 상기 픽셀 출력 버스 상에 형성되도록 하며, 상기 측정 신호는 상기 샘플링 패턴 매트릭스의 각 로우에 대한 측정 계수의 어레이를 포함하고, 그리고 C) 상기 픽셀 어레이의 상기 다크 픽셀에 대한 상기 기준 신호를 제공함으로써 상기 측정 신호에 대한 다크 픽셀의 기여를 제어함-, iii) 상기 픽셀 출력 버스의 어레이와 커플링되며, 상기 바이너리 측정 신호를 형성하기 위해 상기 측정 신호를 바이너리화하는 디지타이저(digitizer), 및b) 상기 이미지 센서와 커플링되어, 상기 바이너리 측정 신호를 수신하는 디지털 프로세서 상기 디지털 프로세서는, i) 상기 이미지 센서가 상기 이미지 센서에 의해 수신된 배경 신호를 프로세스할 때, 상기 이미지 센서에 의해 출력되는 배경 바이너리 측정 신호로부터, 상기 픽셀 어레이의 컬럼과 관련된 상기 배경 신호의 부분에 대응하는 컬럼 배경 바이너리 측정치 벡터에 엑세스하기 위한 명령 -상기 배경 신호는 상기 감광 픽셀이 상기 장면으로부터 수집된 상기 광 에너지를 수신하는 것이 방지될 때, 상기 다크 픽셀에 의해 수신된 상기 기준 신호를 포함함-, ii) 상기 바이너리 측정 신호로부터, 상기 픽셀 어레이의 컬럼의 상기 감광 픽셀에 의해 수신되는 상기 이미지 신호의 상기 부분에 대응하는 컬럼 바이너리 측정치 벡터에 엑세스하기 위한 명령, 및 iii) 상기 픽셀 어레이의 컬럼의 상기 감광 픽셀에 의해 수신되는 상기 이미지 신호의 상기 부분의 크기를 나타내는 디지털 값을 형성하기 위한 명령 -상기 디지털 값을 형성하기 위한 명령은 컬럼 배경 바이너리 측정치 벡터와 컬럼 바이너리 측정치 벡터 사이의 거리를 계산하기 위한 명령을 포함함- 으로 구성되는 머신 비전 시스템.

Machine vision system for forming one dimensional digital representation of low information content sceneA machine vision system to form a one dimensional digital representation of a low information content scene, e.g., a scene that is sparsely illuminated by an illumination plane, and the one dimensional digital representation is a projection formed with respect to columns of a rectangular pixel array of the machine vision system.A kind of ni vision builder for automated inspection suitable for forming the one-dimensional digital representation of low information content scene, the system comprises：a) imaging sensor is configured to receive picture signal and handles described image signal to export binary measurement letter number, the light energy that described image signal designation is collected from scene, described image sensor includesi) with the pixel array of the light sensitive pixels of row and column arrangement and dark pixel, the pixel array includesa the pixel output control bus array) corresponded with the row of the pixel array, the pixel output control each of bus is configured and is arranged so that pixel is exported control signal and is provided on the corresponding line of the pixel array pixel, andb) the pixel column gate array corresponded with the column of the pixel array, each pixel column circuits includei) pixel output bus is configured and is arranged to sum to pixel output signal, andii) pixel linear array is coupled with one-to-one correspondence with the pixel control bus array,the pixel linear array includes(a) linear array of the light sensitive pixels of a part of described image signal is received, each light sensitive pixels include(i) optical signal source, in response to the light energy that the light sensitive pixels receive, and(ii) output select circuit is coupled with pixel output control bus to control the optical signal source to the pixel and export the coupling of bus, the light sensitive pixels provide pixel output signal to the pixel output bus by the coupling,(b) linear array of the dark pixel, each dark pixel include(i) dark signal source, in response to the reference signal that the dark pixel receives, and(ii) output select circuit is coupled with another pixel output control bus to control the dark signal source to the pixel the coupling of output bus, the dark pixel provide pixel output signal to the pixel output bus by the coupling,ii the sampling mode generator) coupled with the pixel array, the sampling mode generator are configured to the picture the sequence of element output control signal, which is provided to the pixel, exports control bus array, and is also configured to by the reference signal the dark pixel is provided, whereina) each element in the sequence of the pixel output control signal corresponds to a line of sampling mode matrix, warp it is predetermined to be formed with being summed by the selectivity of the pixel output signal on the output bus array corresponding to the picture the measurement coefficient array of the column of pixel array, measurement coefficient include the information of the described image signal indicated with non-standard substrate,b) element in the sequence is provided to pixel output control bus array to export always in the pixel measuring signal is formed on line, the measuring signal includes the measurement coefficient array for every a line of the sampling mode matrix, andc dark pixel can be controlled to the measuring signal by) providing the reference signal to the dark pixel of the pixel array contribution,iii) digital quantizer, couples with the pixel output bus array with for measuring signal described in binarization, from and the binary measurement signal is formed, andb) digital processing unit is coupled with described image sensor to receive the binary measurement signal, the digital processing device is configured withi) the background letter for being received from described image sensor in the processed described image sensor of described image sensor number when the background binary measurement signal that exports in access array background binary measurement vector instruction, the column background binary system a part that vector corresponds to the background signal associated with the column of the pixel array is measured, the background signal includes the ginseng that the dark pixel is received when the light sensitive pixels are prevented from and receiving from the light energy that the scene is collected signal is examined,ii) the instruction for the access array binary measurement vector from the binary measurement signal, the column binary measurement the part for the described image signal that the light sensitive pixels that vector corresponds to the column of the pixel array receive, with andiii it) is used to form the instruction of digital value, the digital value indicates the light sensitive pixels of the column of the pixel array the magnitude of the part of the described image signal received, the described instruction for being used to form the digital value includes for calculating the instruction of the distance between the column background binary measurement vector and the column binary measurement vector.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

췌장암 치료용 조성물본 발명의 과제는 우수한 항종양 효과를 나타내는 의약 조성물 및 암의 치료 방법을 알아내는 것에 있다. 4-(3-클로로-4-(시클로프로필아미노카르보닐)아미노페녹시)-7-메톡시-6-퀴놀린카르복사미드 및 그 유사 화합물, 또는 그 약리학적으로 허용되는 염, 또는 그들의 용매화물은, 젬사이타빈 또는 엘로티닙, 또는 그 약리학적으로 허용되는 염, 또는 그들의 용매화물과 병용함으로써 우수한 항종양 효과를 나타낼 수 있다. (i) 하기 일반식 (I) 로 나타내는 화합물, 또는 그 약리학적으로 허용되는 염, 또는 그들의 용매화물과, (ⅱ) 젬사이타빈 또는 엘로티닙, 또는 그 약리학적으로 허용되는 염, 또는 그들의 용매화물을 조합하여 이루어지는 의약 조성물. 일반식 (I) [식 (I) 중, R1 은 식 -V1-V2-V3 (식 중, V1 은 치환기를 갖고 있어도 되는 C1-6 알킬렌기를 의미한다 ; V2 는 단결합 또는 산소 원자, 황 원자, 카르보닐기, 술피닐기, 술포닐기, 식 -CONR6- 으로 나타내는 기, 식 -SO2NR6- 으로 나타내는 기, 식 -NR6SO2- 로 나타내는 기, 식 -NR6CO- 로 나타내는 기 또는 식 -NR6- 으로 나타내는 기를 의미한다 (식 중, R6 은 수소 원자, 치환기를 갖고 있어도 되는 C1-6 알킬기 또는 치환기를 갖고 있어도 되는 C3-8 시클로알킬기를 의미한다) ; V3 은 수소 원자, 치환기를 갖고 있어도 되는 C1-6 알킬기, 치환기를 갖고 있어도 되는 C2-6 알케닐기, 치환기를 갖고 있어도 되는 C2-6 알키닐기, 치환기를 갖고 있어도 되는 C3-8 시클로알킬기, 치환기를 갖고 있어도 되는 C6-10 아릴기, 치환기를 갖고 있어도 되는 5 ∼ 10 원자 헤테로아릴기 또는 치환기를 갖고 있어도 되는 3 ∼ 10 원자 비방향족 헤테로 고리형기를 의미한다) 로 나타내는 기를 의미한다 ; R2 는 시아노기, 치환기를 갖고 있어도 되는 C1-6 알콕시기, 카르복실기, 치환기를 갖고 있어도 되는 C2-7 알콕시카르보닐기 또는 식 -CONVa11Va12 (식 중, Va11 은 수소 원자, 치환기를 갖고 있어도 되는 C1-6 알킬기, 치환기를 갖고 있어도 되는 C2-6 알케닐기, 치환기를 갖고 있어도 되는 C2-6 알키닐기, 치환기를 갖고 있어도 되는 C3-8 시클로알킬기, 치환기를 갖고 있어도 되는 C6-10 아릴기, 치환기를 갖고 있어도 되는 5 ∼ 10 원자 헤테로아릴기 또는 치환기를 갖고 있어도 되는 3 ∼ 10 원자 비방향족 헤테로 고리형기를 의미한다 ; Va12 는 수소 원자, 치환기를 갖고 있어도 되는 C1-6 알킬기, 치환기를 갖고 있어도 되는 C2-6 알케닐기, 치환기를 갖고 있어도 되는 C2-6 알키닐기, 치환기를 갖고 있어도 되는 C3-8 시클로알킬기, 치환기를 갖고 있어도 되는 C6-10 아릴기, 치환기를 갖고 있어도 되는 5 ∼ 10 원자 헤테로아릴기, 치환기를 갖고 있어도 되는 3 ∼ 10 원자 비방향족 헤테로 고리형기, 수산기, 치환기를 갖고 있어도 되는 C1-6 알콕시기 또는 치환기를 갖고 있어도 되는 C3-8 시클로알콕시기를 의미한다) 로 나타내는 기를 의미한다 ; Y1 은, 식 (식 중, R7 및 R8 은 각각 독립적으로 수소 원자, 할로겐 원자, 시아노기, 니트로기, 아미노기, 치환기를 갖고 있어도 되는 C1-6 알킬기, 치환기를 갖고 있어도 되는 C3-8 시클로알킬기, 치환기를 갖고 있어도 되는 C1-6 알콕시기, 치환기를 갖고 있어도 되는 C1-6 알킬티오기, 포르밀기, 치환기를 갖고 있어도 되는 C2-7 아실기, 치환기를 갖고 있어도 되는 C2-7 알콕시카르보닐기 또는 식 -CONVd1Vd2 (식 중, Vd1 및 Vd2 는 각각 독립적으로 수소 원자 또는 치환기를 갖고 있어도 되는 C1-6 알킬기를 의미한다) 로 나타내는 기를 의미한다 ; W1 및 W2 는 각각 독립적으로 치환기를 갖고 있어도 되는 탄소 원자 또는 질소 원자를 의미한다) 로 나타내는 기를 의미한다 ; R3 및 R4 는 각각 독립적으로 수소 원자, 치환기를 갖고 있어도 되는 C1-6 알킬기, 치환기를 갖고 있어도 되는 C2-6 알케닐기, 치환기를 갖고 있어도 되는 C2-6 알키닐기, 치환기를 갖고 있어도 되는 C3-8 시클로알킬기, 치환기를 갖고 있어도 되는 C2-7 아실기 또는 치환기를 갖고 있어도 되는 C2-7 알콕시카르보닐기를 의미한다 ; R5 는 수소 원자, 치환기를 갖고 있어도 되는 C1-6 알킬기, 치환기를 갖고 있어도 되는 C2-6 알케닐기, 치환기를 갖고 있어도 되는 C2-6 알키닐기, 치환기를 갖고 있어도 되는 C3-8 시클로알킬기, 치환기를 갖고 있어도 되는 C6-10 아릴기, 치환기를 갖고 있어도 되는 5 ∼ 10 원자 헤테로아릴기 또는 치환기를 갖고 있어도 되는 3 ∼ 10 원자 비방향족 헤테로 고리형기를 의미한다］

COMPOSITION FOR TREATMENT OF PANCREATIC CANCERDisclosed are a pharmaceutical composition having excellent antitumor activity, and a method for treating a cancer. Specifically, excellent antitumor activity is achieved when 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide or an analogous compound thereof, a pharmacologically acceptable salt thereof or a solvate thereof is used in combination with gemcitabine or erlotinib, a pharmacologically acceptable salt thereof or a solvate of any of them.A pharmaceutical composition comprising a combination of: (i) a compound represented by General Formula (I) below, a pharmacologically acceptable salt thereof or a solvate thereof; and (ii) gemcitabine or erlotinib, a pharmacologically acceptable salt thereof or a solvate thereof: [wherein, R1 represents a group represented by Formula -V1-V2-V3 (wherein, V1 represents an optionally substituted C1-6 alkylene group; V2 represents a single bond, an oxygen atom, a sulfur atom, a carbonyl group, a sulfinyl group, a sulfonyl group, a group represented by Formula -CONR6-, a group represented by Formula -SO2NR6-, a group represented by Formula -NR6SO2-, a group represented by Formula -NR6CO- or a group represented by Formula -NR6- (wherein, R6 represents a hydrogen atom, an optionally substituted C1-6 alkyl group or an optionally substituted C3-8 cycloalkyl group); V3 represents a hydrogen atom, an optionally substituted C1-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2-6 alkynyl group, an optionally substituted C3-8 cycloalkyl group, an optionally substituted C6-10 aryl group, an optionally substituted 5-10-membered heteroaryl group or an optionally substituted 3-10-membered nonaromatic heterocyclic group); R2 represents a cyano group, an optionally substituted C1-6 alkoxy group, a carboxyl group, an optionally substituted C2-7 alkoxycarbonyl group or a group represented by Formula -CONVa11Va12 (wherein, Va11 represents a hydrogen atom, an optionally substituted C1-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2-6 alkynyl group, an optionally substituted C3-8 cycloalkyl group, an optionally substituted C6-10 aryl group, an optionally substituted 5-10-membered heteroaryl group or an optionally substituted 3-10-membered nonaromatic heterocyclic group; Va12 represents a hydrogen atom, an optionally substituted C1-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2-6 alkynyl group, an optionally substituted C3-8 cycloalkyl group, an optionally substituted C6-10 aryl group, an optionally substituted 5-10-membered heteroaryl group, an optionally substituted 3-10-membered nonaromatic heterocyclic group, a hydroxyl group, an optionally substituted C1-6 alkoxy group or an optionally substituted C3-8 cycloalkoxy group); Y1 represents a group represented by either one of the following formulae (wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, a cyano group, a nitro group, an amino group, an optionally substituted C1-6 alkyl group, an optionally substituted C3-8 cycloalkyl group, an optionally substituted C1-6 alkoxy group, an optionally substituted C1-6 alkylthio group, a formyl group, an optionally substituted C2-7 acyl group, an optionally substituted C2-7 alkoxycarbonyl group or a group represented by Formula -CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or an optionally substituted C1-6 alkyl group); W1 and W2 each independently represent an optionally substituted carbon atom or nitrogen atom); R3 and R4 each independently represent a hydrogen atom, an optionally substituted C1-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2-6 alkynyl group, an optionally substituted C3-8 cycloalkyl group, an optionally substituted C2-7 acyl group or an optionally substituted C2-7 alkoxycarbonyl group; and R5 represents a hydrogen atom, an optionally substituted C1-6 alkyl group, an optionally substituted C2-6 alkenyl group, an optionally substituted C2-6 alkynyl group, an optionally substituted C3-8 cycloalkyl group, an optionally substituted C6-10 aryl group, an optionally substituted 5-10-membered heteroaryl group or an optionally substituted 3-10-membered nonaromatic heterocyclic group].

73209

패션, 섬유류 및 기타 전문 디자인업

특허

ko

en

신발류 끈 조임 시스템물품용 끈 조임 시스템은 장력화 메커니즘(1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502), 복수의 안내 부재(2410A), 및 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714)을 포함하고, 끈은 장력화 메커니즘(1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502)과 동작 가능하게 커플링되고 복수의 안내 부재(2410A)를 통해서 물품의 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) 경로를 따라 경로화된다. 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714)의 제1 부분(2506, 2606)이 장력화 메커니즘(1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502)으로부터 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) 경로의 상단 단부(1510, 1512, 1612, 1614)까지 직접적으로 경로화되도록 그리고 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714)의 제2 부분(2508, 2608)이 장력화 메커니즘(1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502)으로부터 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) 경로의 하단 단부(1614)에 인접하는 위치까지 직접적으로 경로화되도록, 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714)이 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) 경로를 따라 경로화 된다. 장력화 메커니즘(1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502)을 통한 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714)의 장력화는 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) 경로의 상단 단부(1510, 1512, 1612, 1614) 및 끈(104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) 경로의 하단 단부(1614)에 인접한 위치가 초기에 장력화되게 한다.신발류를 조이기 위한 끈 조임 시스템이며, 신발류는 대향 측면들 및 대향 측면들 사이에서 연장되는 끈 경로를 포함하고, 끈 경로의 하단 단부는 신발류의 앞심 부근에 배치되고, 끈 경로의 상단 단부는 하단 단부에 대향 배치되며, 끈 경로의 중간-부분은 상단 단부 및 하단 단부로부터 대략적으로 동일한 거리에 있으며, 끈 조임 시스템은:장력화 메커니즘; 신발류와 커플링되는 복수의 안내 부재; 및장력화 메커니즘과 동작 가능하게 커플링되고 복수의 안내 부재를 통해서 끈 경로를 따라 신발류 주위로 경로화되는 끈으로서, 장력화 메커니즘의 동작이 제1 부분 및 제2 부분 모두를 동시에 장력화하도록 장력화 메커니즘에 동작 가능하게 각각 커플링되는 제1 부분 및 제2 부분을 포함하는, 끈을 포함하고, 상기 끈은: 제1 부분이 장력화 메커니즘으로부터 끈 경로의 상단 단부까지 직접적으로 경로화되고 그로부터 끈 경로의 중간-부분을 향해서 경로화되도록; 그리고 제2 부분이 장력화 메커니즘으로부터 끈 경로의 중간-부분에 인접하는 곳까지 직접적으로 경로화되고 그로부터 끈 경로의 하단 단부를 향해서 경로화되고, 그에 따라 끈의 제1 부분 및 제2 부분의 장력화는 끈 경로의 상단 단부 및 중간-부분을 곧바로 장력화하고, 그에 의해서 신발류의 상응하는 부분들을 곧바로 조이도록; 끈 경로를 따라서 경로화되고;상기 끈은 끈 경로의 중간-부분과 하단 단부 사이에서 제2 부분에 연결된 제1 부분을 가지는 일체형 부재인, 끈 조임 시스템.

LACING SYSTEM FOR FOOTWEARA lacing system for an article may include a tensioning mechanism (1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502), a plurality of guide members (2410A), and a lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) that is operationally coupled with the tensioning mechanism (1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502) and that is routed along a lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) path of the article via the plurality of guide members (2410A). The lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) is routed along the lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) path so that a first portion (2506, 2606) of the lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) is routed directly from the tensioning mechanism (1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502) to a top end (1510, 1512, 1612, 1614) of the lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) path and so that a second portion (2508, 2608) of the lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) is routed directly from the tensioning mechanism (1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502) to a position that is adjacent a bottom end (1614) of the lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) path. Tensioning of the lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714), via the tensioning mechanism (1004, 1702, 1802, 1808, 1902, 2102, 2122, 2202, 2302, 2402, 2502, 2508, 2602, 2702, 2802, 2902, 3002, 3202, 3302, 3402, 3502), causes the top end (1510, 1512, 1612, 1614) of the lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) path and the position adjacent the bottom end (1614) of the lace (104, 106, 1506, 1604, 2406, 2408, 2506, 2706, 2708, 714) path to be initially tensioned.A lacing system for tightening footwear, the footwear having opposing sides and a lace path extending between the opposing sides with a bottom end that is positioned near a toe box of the footwear, a top end that is positioned opposite the bottom end, and a mid- portion that is roughly equidistant from the top end and the bottom end, the lacing system comprising:a tensioning mechanism;a plurality of guide members that are coupled with the footwear; and a lace that is operationally coupled with the tensioning mechanism and routed about the footwear along the lace path via the plurality of guide members, the lace comprising a first portion and a second portion that are each operationally coupled with the tensioning mechanism so that operation of the tensioning mechanism simultaneously tensions both the first portion and the second portion, wherein the lace is routed along the lace path such that:the first portion is routed directly from the tensioning mechanism to the top end of the lace path and is routed therefrom toward the mid-portion of the lace path; andthe second portion is routed directly from the tensioning mechanism to adjacent the mid-portion of the lace path and is routed therefrom toward the bottom end of the lace path such that tensioning of the first portion and the second portion of the lace immediately tensions the top end and the mid-portion of the lace path and thereby immediately tightens corresponding portions of the footwear;wherein the lace is a unitary member with the first portion connected to the second portion between the mid-portion and the bottom end of the lace path.

20499

그 외 기타 분류 안된 화학제품 제조업

특허

ko

en

신규한 우레아 유도체 본 발명은 우레아 구조를 기본 구조로 하고, 측쇄에 황 원자와 아미드 결합을 갖는 화합물을 제조하고, 그 약리 작용, 특히 TNF-α 생산 저해 작용을 발견하는 것을 목적으로 하는 것이다. 본 발명에 의해 하기 화학식[Ⅰ]의 화합물이 제공된다.화학식 I상기 식 중, R1은 H, 알킬, 방향족, RA-CO-, RC-S- 또는 하기 화학식[Ⅱ]을 나타내고, 화학식 II R2, R3 및 R4는 H, 알킬, 알케닐, 시클로알킬, 시클로알케닐, 방향족을 나타내며, R5 및 R6은 H, 알킬, 알케닐, 시클로알킬, 시클로알케닐, 방향족을 나타내고, 또한 R5와 R6은 비방향족 헤테로시클릭 고리를 형성해도 좋으며, R7은 H, 알킬, 시클로알킬, 히드록시, 머캅토, 페닐, RB-O-, RC-S-, RD-COS-, RE-OCO-, RF-N(RG)-, -CONHOH를 나타내고. A1 및 A2는 알킬렌을 나타낸다. 하기 화학식[Ⅰ]으로 표시되는 화합물 및 그 염류: 화학식 I 상기 식 중, R1은 수소 원자, 저급 알킬기, 방향족기, RA-CO-S-, RC-S- 또는 하기 화학식[Ⅱ]를 나타내고, 화학식 II R2, R3 및 R4는 동일하거나 또는 상이하며, 수소 원자, 저급 알킬기, 저급 알케닐기, 시클로알킬기, 시클로알케닐기 또는 방향족기를 나타내고, R4가 저급 알킬기인 경우, 상기 저급 알킬기는 그것이 결합하고 있는 탄소 원자에 동일 알킬기의 말단 탄소 원자가 연결하여 시클로알킬 고리를 형성해도 좋으며, R5 및 R6은 동일하거나 또는 상이하고, 수소 원자, 저급 알킬기, 저급 알케닐기, 시클로알킬기, 시클로알케닐기 또는 방향족기를 나타내며, R5와 R6이 모두 저급 알킬기인 경우, 이들이 서로 연결하여 질소 원자 및/또는 산소 원자를 고리 내에 갖고 있는 비방향족 헤테로시클릭 고리를 형성해도 좋고, 상기 헤테로시클릭 고리는 저급 알킬기, 저급 알케닐기, 시클로알킬기, 시클로알케닐기, 방향족기 또는 RA-CO-로 치환되어 있어도 좋으며, R7은 수소 원자, 저급 알킬기, 시클로알킬기, 히드록시기, 머캅토기, 페닐기, RB-O-, RC-S-, RD-COS-, RE-OCO-, RF-N(RG)- 또는 -CONHOH를 나타내고, 또한 R7은 A1에 인접하는 황 원자와 연결하여 황 원자를 고리 내에 포함하는 비방향족 헤테로시클릭 고리를 형성해도 좋으며, 또한 상기 고리는 고리 내에 카르보닐기를 갖고 있어도 좋고, A1은 저급 알킬렌기를 나타내며, A2는 저급 알킬렌기를 나타내고, 상기에서 규정한 각 저급 알킬기는 히드록시기, 질소 원자 및/또는 산소 원자를 고리 내에 갖고 있는 비방향족 헤테로시클릭 고리기, 시클로알킬기, 시클로알케닐기, 아다만틸기, 방향족기, 프탈이미드기, 저급 알킬설포닐기 또는 방향족 설포닐기로 치환되어 있어도 좋은 구아니디노기, RA-CO-, RB-O-, RC-S-, RD-COS-, RE-OCO-, RF-N(RG)-, RH-N(RJ)CO-, RK-CONH- 또는 -CONHOH로 치환되어 있어도 좋으며, 상기에서 규정한 각 저급 알케닐기는 히드록시기, 저급 알킬기, 저급 알콕시기, 시클로알킬기, 시클로알케닐기 또는 방향족기로 치환되어 있어도 좋고, 상기에서 규정한 각 시클로알킬기는 저급 알킬기, 히드록시기, 옥소기 또는 RE-OCO-로 치환되어 있어도 좋으며, 상기에서 규정한 각 방향족기는 저급 알킬기, 히드록시기, 저급 알콕시기, 저급 알카노일옥시기, 할로겐 원자, 니트로기, 방향족기, 저급 알킬설포닐기, 방향족 설포닐기, RE-OCO-, RF-N(RG)- 또는 RK-CONH-로 치환되어 있어도 좋고, 상기에서 규정한 질소 원자 및/또는 산소 원자를 고리 내에 갖고 있는 비방향족 헤테로시클릭 고리기는 저급 알킬기, 시클로알킬기, 방향족기 또는 RA-CO-로 치환되어 있어도 좋으며, 또한 상기 저급 알킬기는 히드록시기, 시클로알킬기, 시클로알케닐기, 방향족기, RA-CO-, RB-O-, RE-OCO- 또는 RF-N(RG)-으로 치환되어 있어도 좋고, RA는 저급 알킬기, 할로게노 저급 알킬기, 방향족기, 저급 알콕시기, 방향족저급 알콕시기 또는 RF-N(RG)-를 나타내며, RB는 저급 알킬기 또는 방향족기를 나타내고, RC는 수소 원자, 저급 알킬기 또는 방향족기를 나타내며, RD는 저급 알킬기 또는 방향족기를 나타내고, RE는 수소 원자, 저급 알킬기 또는 방향족기를 나타내며, RF 및 RG는 동일하거나 또는 상이하고, 수소 원자, 저급 알킬기, 시클로알킬기 또는 방향족기를 나타내며, RH 및 RJ는 동일하거나 또는 상이하고, 수소 원자, 저급 알킬기, 시클로일킬기 또는 방향족기를 나타내며, RK는 저급 알킬기, 저급 알콕시기 또는 방향족기를 나타낸다.

NOVEL UREA DERIVATIVESObjects of the present invention are to create compounds having urea structure as basic structure and having a sulfur atom and an amide bond in side chains and to find pharmacological effects thereof, particularly TNF-α production inhibitory effects. The present invention provides compounds represented by the following formula [I] wherein R1 is H, alkyl, aromatic, RA -CO-, RC -S- or the formula [II]; R2 , R3 and R4 are H, alkyl, alkenyl, cycloalkyl, cycloalkenyl or aromatic; R5 and R6 are H, alkyl, alkenyl, cycloalkyl, cycloalkenyl or aromatic; R5 and R6 can together form a nonaromatic heterocyclic ring; R7 is H, alkyl, cycloalkyl, hydroxy, mercapto, phenyl, RB -O-, RC -S-, RD -COS-, RE -OCO-, RF -N(RG )- or ―CONHOH; and A1 and A2 are alkylene. A compound represented by the following general formula [I] or a salt thereof [whereinR1 is hydrogen, lower alkyl, an aromatic group, RA -CO-, RC -S- or a group of the following formula [II].R2 , R3 and R4 , being the same or different, are hydrogen, lower alkyl, lower alkenyl, cycloalkyl, cycloalkenyl or an aromatic group. When R4 is lower alkyl, terminal carbon of the lower alkyl can join with carbon to which the alkyl is bonded to form a cycloalkyl ring.R5 and R6 , being the same or different, are hydrogen, lower alkyl, lower alkenyl, cycloalkyl, cycloalkenyl or an aromatic group. When both R5 and R6 are lower alkyl, they can join each other to form a nonaromatic heterocyclic ring having nitrogen and/or oxygen in the ring, and the heterocyclic ring can be substituted by lower alkyl, lower alkenyl, cycloalkyl, cycloalkenyl, an aromatic group or RA -CO-.R7 is hydrogen, lower alkyl, cycloalkyl, hydroxy, mercapto, phenyl, RB -O-, RC -S-, RD -COS-, RE -OCO-, RF -N(RG )- or ―CONHOH. R7 can join with sulfur adjacent to A1 to form a nonaromatic heterocyclic ring containing sulfur in the ring, and the ring can further have carbonyl in the ring.A1 is lower alkylene.A2 is lower alkylene.Each lower alkyl defined above can be substituted by hydroxy, a nonaromatic heterocyclic ring having nitrogen and/or oxygen in the ring, cycloalkyl, cycloalkenyl, adamantyl, an aromatic group, phthalimido, guanidino which can be substituted by lower alkylsulfonyl or aromatic sulfonyl, RA -CO-, RB -O-, RC -S-, RD -COS-, RE -OCO-, RF -N(RG )-, RH -N(RJ )CO-, RK -CONH- or ―CONHOH.Each lower alkenyl defined above can be substituted by hydroxy, lower alkyl, lower alkoxy, cycloalkyl, cycloalkenyl or an aromatic group.Each cycloalkyl defined above can be substituted by lower alkyl, hydroxy, oxo or RE -OCO-.Each aromatic group defined above can be substituted by lower alkyl, hydroxy, lower alkoxy, lower alkanoyloxy, halogen, nitro, an aromatic group, lower alkylsulfonyl, aromatic sulfonyl, RE -OCO-, RF -N(RG )- or RK -CONH-.The nonaromatic heterocyclic ring having nitrogen and/or oxygen in the ring defined above can be substituted by lower alkyl, cycloalkyl, an aromatic group or RA -CO-, and the lower alkyl can be substituted by hydroxy, cycloalkyl, cycloalkenyl, an aromatic group, RA -CO-, RB -O-, RE -OCO- or RF -N(RG )-.RA is lower alkyl, halogeno-lower alkyl, an aromatic group, lower alkoxy, aromatic-lower alkoxy or RF -N(RG )-. RB is lower alkyl or an aromatic group. RC is hydrogen, lower alkyl or an aromatic group. RD is lower alkyl or an aromatic group. RE is hydrogen, lower alkyl or an aromatic group. RF and RG , being the same or different, are hydrogen, lower alkyl, cycloalkyl or an aromatic group. RH and RJ , being the same or different, are hydrogen, lower alkyl, cycloalkyl or an aromatic group. RK is lower alkyl, lower alkoxy or an aromatic group.].

20111

석유화학계 기초 화학 물질 제조업

특허

ko

en

양이온성 지질본 발명은, 핵산을, 세포 내에 도입하는 것을 용이하게 하는, 하기 식 (I)로 표시되는 양이온성 지질, 이 양이온성 지질 및 핵산을 함유하는 조성물, 이 양이온성 지질 및 핵산을 함유하는 조성물을 이용하여 핵산을 세포 내에 도입하는 방법 등을 제공한다: (상기 식에서, R1 및 R2는 동일하거나 또는 상이하여 알케닐 등이고, X1 및 X2는 수소 원자이거나, 또는 함께 단결합 혹은 알킬렌을 형성하며, X3은 존재하지 않거나, 알킬 등이고, Y는 존재하지 않거나, 음이온이며, a 및 b는, 동일하거나 또는 상이하여 0∼3이고, L3은 단결합 등이며, R3은 알킬 등이고, L1 및 L2는 -O-, -CO-O- 또는 -O-CO-임)식 (I)로 표시되는 양이온성 지질:[이미지](상기 식에서, R1 및 R2는 동일하거나 혹은 상이하여 탄소수 12∼24의 직쇄상 혹은 분지쇄상의 알킬, 알케닐 혹은 알키닐이거나, 또는 R1 및 R2가 함께 디알킬메틸렌, 디알케닐메틸렌, 디알키닐메틸렌 혹은 알킬알케닐메틸렌을 형성하고,X1 및 X2는 수소 원자이거나 또는 함께 단결합 혹은 알킬렌을 형성하며,X3은 존재하지 않거나, 탄소수 1∼6의 알킬 또는 탄소수 3∼6의 알케닐이고, X3이 존재하지 않는 경우에는, Y도 존재하지 않고, a 및 b는 0이며, L3은 단결합이고, R3은 탄소수 1∼6의 알킬, 탄소수 3∼6의 알케닐, 피롤리딘-3-일, 피페리딘-3-일, 피페리딘-4-일 또는 동일하거나 혹은 상이하여 1∼3개의 아미노, 모노알킬아미노, 디알킬아미노, 트리알킬암모니오, 히드록시, 알콕시, 카르바모일, 모노알킬카르바모일, 디알킬카르바모일, 피롤리디닐, 피페리딜 혹은 모르폴리닐로 치환된 탄소수 1∼6의 알킬 혹은 탄소수 3∼6의 알케닐이며, L1 및 L2는 -O-이거나, Y도 존재하지 않고, a 및 b는, 동일하거나 또는 상이하여 0∼3이며, 또한 a와 b가 동시에 0은 아니며, L3은 단결합이고, R3은 탄소수 1∼6의 알킬, 탄소수 3∼6의 알케닐, 피롤리딘-3-일, 피페리딘-3-일, 피페리딘-4-일 또는 동일하거나 혹은 상이하여 1∼3개의 아미노, 모노알킬아미노, 디알킬아미노, 트리알킬암모니오, 히드록시, 알콕시, 카르바모일, 모노알킬카르바모일, 디알킬카르바모일, 피롤리디닐, 피페리딜 혹은 모르폴리닐로 치환된 탄소수 1∼6의 알킬 혹은 탄소수 3∼6의 알케닐이며, L1 및 L2는 동일하거나 또는 상이하여 -O-, -CO-O- 또는 -O-CO-이거나, Y도 존재하지 않고, a 및 b는, 동일하거나 또는 상이하여 0∼3이며, L3은 단결합이고, R3은 수소 원자이며, L1 및 L2는, 동일하거나 또는 상이하여 -O-, -CO-O- 또는 -O-CO-이거나, 혹은 Y도 존재하지 않고, a 및 b는, 동일하거나 또는 상이하여 0∼3이며, L3은 -CO- 또는 -CO-O-이고, R3은 피롤리딘-2-일, 피롤리딘-3-일, 피페리딘-2-일, 피페리딘-3-일, 피페리딘-4-일, 모르폴린-2-일, 모르폴린-3-일 또는 동일하거나 혹은 상이하여 1∼3개의 아미노, 모노알킬아미노, 디알킬아미노, 트리알킬암모니오, 히드록시, 알콕시, 카르바모일, 모노알킬카르바모일, 디알킬카르바모일, 피롤리디닐, 피페리딜 혹은 모르폴리닐로 치환된 탄소수 1∼6의 알킬 혹은 탄소수 3∼6의 알케닐이며, 이 치환기 중 적어도 하나는, 아미노, 모노알킬아미노, 디알킬아미노, 트리알킬암모니오, 피롤리디닐, 피페리딜 또는 모르폴리닐이고, L1 및 L2는, 동일하거나 또는 상이하여 -O-, -CO-O- 또는 -O-CO-이며, X3이 탄소수 1∼6의 알킬 또는 탄소수 3∼6의 알케닐인 경우에는, Y는 제약상 허용되는 음이온이고, a 및 b는, 동일하거나 또는 상이하여 0∼3이며, L3은 단결합이고, R3은 탄소수 1∼6의 알킬, 탄소수 3∼6의 알케닐, 피롤리딘-3-일, 피페리딘-3-일, 피페리딘-4-일 또는 동일하거나 혹은 상이하여 1∼3개의 아미노, 모노알킬아미노, 디알킬아미노, 트리알킬암모니오, 히드록시, 알콕시, 카르바모일, 모노알킬카르바모일, 디알킬카르바모일, 피롤리디닐, 피페리딜 혹은 모르폴리닐로 치환된 탄소수 1∼6의 알킬 혹은 탄소수 3∼6의 알케닐이며, L1 및 L2는, 동일하거나 또는 상이하여 -O-, -CO-O- 또는 -O-CO-임)

Cationic lipidProvided is a cationic lipid expressed in the following formula (I), which facilitates introduction of a nucleic acid into a cell, a composition containing the cationic lipid and the nucleic acid, a method for introducing the nucleic acid into the cell by using the composition containing the cationic lipid and the nucleic acid, and the like (In the formula, R1 and R2 are the same alkenyl or different alkenyls, X1 and X2 are hydrogen atoms or together form a single bond or alkylene, X3 is not present or is alkyl and the like, Y is not present or is an anion, a and b are the same or different between 0 and 3, L3 is a single bond and the like, R3 is alkyl and the like, and L1 and L2 are -O-, -CO-O-, or -O-CO-).The cationic lipid that formula (i) represents,in formula, r 1and r 2identical or different, be the straight chain shape of carbonatoms 12～24 or alkyl, alkenyl or the alkynyl of a chain, or r 1and r 2be joined together to form dialkyl group methylene radical, two alkenyl methylene radical, diynyl methylene radical or alkyl chain thiazolinyl methylene radical, x 1and x 2for hydrogen atom, or be joined together to form singly-bound or alkylidene group, x 3do not exist, or be the alkyl of carbonatoms 1～6 or the alkenyl of carbonatoms 3～6, x 3while not existing, y does not exist yet, and a and b are 0, l 3for singly-bound, r 3for the alkyl of carbonatoms 1～6, the alkenyl of carbonatoms 3～6, pyrrolidin-3-yl, piperidines-3-base, piperidin-4-yl or the alkyl of carbonatoms 1～6 or the alkenyl of carbonatoms 3～6 that are replaced by 1～3 identical or different amino, alkyl monosubstituted amino, dialkyl amido, trialkyl ammonium, hydroxyl, alkoxyl group, formamyl, alkyl monosubstituted amino formyl radical, dialkyl amido formyl radical, pyrrolidyl, piperidyl or morpholinyl, l 1and l 2for-o-, or y does not exist yet, and a and b are identical or different is 0～3, and a is 0, l when different with b 3for singly-bound, r 3for the alkyl of carbonatoms 1～6, the alkenyl of carbonatoms 3～6, pyrrolidin-3-yl, piperidines-3-base, piperidin-4-yl or the alkyl of carbonatoms 1～6 or the alkenyl of carbonatoms 3～6 that are replaced by 1～3 identical or different amino, alkyl monosubstituted amino, dialkyl amido, trialkyl ammonium, hydroxyl, alkoxyl group, formamyl, alkyl monosubstituted amino formyl radical, dialkyl amido formyl radical, pyrrolidyl, piperidyl or morpholinyl, l 1and l 2identical or different, for-o-,-co-o-or-o-co-, or y does not exist yet, and a and b are identical or different is 0～3, l 3for singly-bound, r 3for hydrogen atom, l 1and l 2identical or different, for-o-,-co-o-or-o-co-, or y does not exist yet, and a and b are identical or different, is 0～3, l 3for-co-or-co-o-, r 3for pyrrolidin-2-yl, pyrrolidin-3-yl, piperidin-2-yl, piperidines-3-base, piperidin-4-yl, morpholine-2-ji, morpholine-3-base or by 1～3 identical or different amino, alkyl monosubstituted amino, dialkyl amido, trialkyl ammonium, hydroxyl, alkoxyl group, formamyl, alkyl monosubstituted amino formyl radical, dialkyl amido formyl radical, pyrrolidyl, the alkyl of carbonatoms 1～6 or the alkenyl of carbonatoms 3～6 that piperidyl or morpholinyl replace, this substituent at least one be amino, alkyl monosubstituted amino, dialkyl amido, trialkyl ammonium, pyrrolidyl, piperidyl or morpholinyl, l 1and l 2identical or different, for-o-,-co-o-or-o-co-, x 3during for the alkyl of carbonatoms 1～6 or the alkenyl of carbonatoms 3～6, y is the negatively charged ion that can allow in pharmacy, and a and b are identical or different, is 0～3, l 3for singly-bound, r 3for the alkyl of carbonatoms 1～6, the alkenyl of carbonatoms 3～6, pyrrolidin-3-yl, piperidines-3-base, piperidin-4-yl or the alkyl of carbonatoms 1～6 or the alkenyl of carbonatoms 3～6 that are replaced by 1～3 identical or different amino, alkyl monosubstituted amino, dialkyl amido, trialkyl ammonium, hydroxyl, alkoxyl group, formamyl, alkyl monosubstituted amino formyl radical, dialkyl amido formyl radical, pyrrolidyl, piperidyl or morpholinyl, l 1and l 2identical or different, for-o-,-co-o-or-o-co-.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

키나제 억제제로서의 2-헤테로아릴아미노-피리미딘 유도체본 발명은 단백질 키나제 억제제로서 유용한 화학식 1의 화합물 및 그의 제약 조성물, 및 상기 화합물을 사용하여 이상 또는 탈조절된 키나제 활성과 관련된 병태를 치료, 완화 또는 예방하기 위한 방법을 제공한다. 몇몇 실시양태에서, 본 발명은 상기 화합물을 사용하여 c-kit, PDGFRα, PDGFRβ, CSF1R, Abl, BCR-Abl, CSK, JNK1, JNK2, p38, p70S6K, TGFβ, SRC, EGFR, trkB, FGFR3, Fes, Lck, Syk, RAF, MKK4, MKK6, SAPK2β, BRK, Fms, KDR, c-raf 또는 b-raf 키나제의 이상 활성을 포함하는 질환 또는 장애를 치료, 완화 또는 예방하기 위한 방법을 제공한다. <화학식 I>하기 화학식 1의 화합물 또는 그의 제약상 허용되는 염.<화학식 1>[이미지]식 중,X1, X2, X3, X4, X5 및 X6 중 1개 내지 4개는 N이고, 나머지는 CR3이며, 고리 E는 탄소 원자를 통해 NR, R2 및 R3에 부착되고;Ar은 임의로 치환된 5원 또는 6원 아릴 또는 헤테로아릴이되, 단 Ar은 이미다졸릴이 아니고;R1 및 R2는 독립적으로 C1-6 알킬, C2-6 알케닐 또는 C2-6 알키닐 (이들 각각은 할로, 아미노 또는 히드록실기로 임의로 치환될 수 있음); 할로, 시아노, 니트로, (CR2)kOR7, (CR2)kO(CR2)1-4R7, (CR2)kSR7, (CR2)kNR9R10, (CR2)kC(O)O0-1R7, OC(O)R7, (CR2)kC(S)R7, (CR2)kC(O)NR9R10, (CR2)kC(O)NR(CR2)0-6C(O)O0-1R7, (CR2)kNRC(O)O0-1R7, (CR2)kS(O)1-2NR9R10, (CR2)kS(O)1-2R8, (CR2)kNRS(O)1-2R8 또는 (CR2)kR6이거나; 또는 임의의 2개의 인접한 R2기는 이들이 부착된 원자와 함께 임의로 치환된 5원 내지 8원 카르보시클릭, 헤테로시클릭, 아릴 또는 헤테로아릴 고리를 형성할 수 있고;R3은 -L-NR4R5, -X-NR-C(O)R8 또는 -X-NR-C(O)NR4R5이고, 여기서 L은 -X-C(O), -X-OC(O), -SO0-2(CR2)j, (CR2)1-4, -O(CR2)1-4 또는 [이미지]이며; X는 (CR2)j 또는 [C(R)(CR2OR)]이고;R4, R5, R9 및 R10은 독립적으로 H; C1-6 알킬, C2-6 알케닐 또는 C2-6 알키닐 (이들 각각은 할로, 아미노, 히드록실, 알콕시, 시아노, 카르복실 또는 R6으로 임의로 치환될 수 있음); (CR2)kCN, (CR2)1-6NR7R7, (CR2)1-6OR7, (CR2)kC(O)O0-1R7, (CR2)kC(O)NR7R7 또는 (CR2)k-R6이고;R6은 임의로 치환된 C3-7 시클로알킬, C6-10 아릴, 또는 5원 내지 10원 헤테로아릴 또는 5원 내지 7원 헤테로시클릭 고리이고;R7 및 R8은 독립적으로 (CR2)k-R6, 또는 C1-6 알킬, C2-6 알케닐 또는 C2-6 알키닐 (이들 각각은 할로, 아미노, 아미도, 히드록실, 알콕시, 시아노, 카르복실 또는 R6으로 임의로 치환될 수 있음)이거나; 또는 R7은 H이거나;별법으로, R4 및 R5는 각각의 NR4R5에서의 N과 함께, R7 및 R7은 NR7R7에서의 N과 함께, 또는 R9 및 R10은 NR9R10에서의 N과 함께, 1개 내지 3개의 R11기로 임의로 치환되며 NR12, O, S, =O 또는 2중 결합을 임의로 함유하는 4원 내지 7원 헤테로시클릭 고리를 형성할 수 있고;R11은 R8, (CR2)k-OR7, CO2R7, (CR2)k-C(O)-(CR2)k-R8, (CR2)kC(O)NR7R7, (CR2)kC(O)NR(CR2)0-6C(O)O0-1R7, (CR2)kNRC(O)O0-1R7, (CR2)kS(O)1-2NR7R7, (CR2)kS(O)1-2R8 또는 (CR2)kNRS(O)1-2R8이고;R12는 H, R8, -(CR2)1-4CO2R7, (CR2)k-C(O)-(CR2)k-R8, (CR2)kC(O)NR7R7, (CR2)kC(O)NR(CR2)0-6C(O)O0-1R7, (CR2)1-4NRC(O)O0-1R7, (CR2)kS(O)1-2NR7R7, (CR2)kS(O)1-2R8 또는 (CR2)kNRS(O)1-2R8이고;각각의 R은 H 또는 C1-6알킬이고;각각의 k는 0 내지 6이고;j 및 m은 독립적으로 0 내지 4이되;단, Ar이 페닐이며 X가 (CR2)0인 경우, -X-NR-C(O)R8에서의 R8은 페닐이 아니다.

2-heteroarylamino-pyrimidine derivatives as kinase inhibitorsThe invention provides compounds of Formula (I) and pharmaceutical compositions thereof, which are useful as protein kinase inhibitors, as well as methods for using such compounds to treat, ameliorate or prevent a condition associated with abnormal or deregulated kinase activity. In some embodiments, the invention provides methods for using such compounds to treat, ameliorate or prevent diseases or disorders that involve abnormal activation of c-kit, PDGFRa, PDGFRss, CSF1R, Abl, BCR-Abl, CSK, JNK1, JNK2, p38, p70S6K, TGFss, SRC, EGFR, trkB, FGFR3, Fes, Lck, Syk, RAF, MKK4, MKK6, SAPK2ss, BRK, Fms, KDR, c-raf or b-raf kinases.Formula (1) compound or pharmaceutically acceptable salt thereof:wherein1-4 x 1, x 2, x 3, x 4, x 5and x 6be that n and remaining are cr 3, and the e ring is by carbon atom and nr, r 2and r 3connect; ar is optional substituted 5-6 unit's aryl or heteroaryl, and condition is that ar is not an imidazolyl;r 1and r 2independently be c 1-6alkyl, c 2-6alkenyl or c 2-6alkynyl, wherein each group all can randomly be replaced by halogen, amino or hydroxyl; or halogen, cyano group, nitro, (cr 2) kor 7, (cr 2) ko (cr 2) 1-4r 7, (cr 2) ksr 7, (cr 2) knr 9r 10, (cr 2) kc (o) o 0-1r 7, oc (o) r 7, (cr 2) kc (s) r 7, (cr 2) kc (o) nr 9r 10, (cr 2) kc (o) nr (cr 2) 0-6c (o) o 0-1r 7, (cr 2) knrc (o) o 0-1r 7, (cr 2) ks (o) 1-2nr 9r 10, (cr 2) ks (o) 1-2r 8, (cr 2) knrs (o) 1-2r 8or (cr 2) kr 6or any two adjacent r 2the connected atom of group can form optional 5-8 unit carbocyclic ring, heterocycle, aryl or the heteroaryl ring that replaces together; r 3be-l-nr 4r 5,-x-nr-c (o) r 8or-x-nr-c (o) nr 4r 5, wherein l be-x-c (o) ,-x-oc (o) ,-so 0-2(cr 2) j, (cr 2) 1-4,-o (cr 2) 1-4or and x is (cr 2) jor [c (r) (cr 2or)]; r 4, r 5, r 9and r 10independently be h; c 1-6alkyl, c 2-6alkenyl or c 2-6alkynyl, wherein each group all can be randomly by halogen, amino, hydroxyl, alkoxyl group, cyano group, carboxyl or r 6replace; or (cr 2) kcn, (cr 2) 1-6nr 7r 7, (cr 2) 1-6or 7, (cr 2) kc (o) o 0-1r 7, (cr 2) kc (o) nr 7r 7or (cr 2) k-r 6r 6be the optional c that replaces 3-7cycloalkyl, c 6-10aryl or 5-10 unit's heteroaryl or 5-7 unit heterocycle; r 7and r 8independently be (cr 2) k-r 6or c 1-6alkyl, c 2-6alkenyl or c 2-6alkynyl, wherein each group all can be randomly by halogen, amino, amide group, hydroxyl, alkoxyl group, cyano group, carboxyl or r 6replace; or r 7be h; perhaps r 4and r 5with nr 4r 5in n together, r 7and r 7with nr 7r 7in n together or r 9and r 10with nr 9r 10in n together, can form 4-7 unit heterocycle, described heterocycle is optional by 1-3 r 11group replaces and the optional nr that contains 12, o, s ,=o or two key; r 11be r 8, (cr 2) k-or 7, co 2r 7, (cr 2) k-c (o)-(cr 2) k-r 8, (cr 2) kc (o) nr 7r 7, (cr 2) kc (o) nr (cr 2) 0-6c (o) o 0-1r 7, (cr 2) knrc (o) o 0-1r 7, (cr 2) ks (o) 1-2nr 7r 7, (cr 2) ks (o) 1-2r 8or (cr 2) knrs (o) 1-2r 8r 12be h, r 8,-(cr 2) 1-4co 2r 7, (cr 2) k-c (o)-(cr 2) k-r 8, (cr 2) kc (o) nr 7r 7, (cr 2) kc (o) nr (cr 2) 0-6c (o) o 0-1r 7, (cr 2) 1-4nrc (o) o 0-1r 7, (cr 2) ks (o) 1-2nr 7r 7, (cr 2) ks (o) 1-2r 8or (cr 2) knrs (o) 1-2r 8r is h or c 1-6alkyl; k is 0-6;j and m independently are 0-4;condition is that ar is that phenyl and x are (cr 2) 0the time ,-x-nr-c (o) r 8in r 8it or not phenyl.

26299

그 외 기타 전자 부품 제조업

특허

ko

en

바이아릴 유도체 및 이를 포함하는 약제표재성 진균증 (superficial mycosis)의 주요 원인 미생물인 백선균 진균류에 대한 뛰어난 항진균 활성, 및 백선균 진균에 의해 유발되는 질환에 대한 우수한 효과를 보이는 화합물이 제공된다. 화학식 (I) 로 표시되는 바이아릴 유도체 또는 그의 염: 여기서 고리 A는 선택적으로 치환된 페닐, 또는 선택적으로 치환된 5- 또는 6-원 고리 헤테로아릴이고 (고리 A는 선택적으로 치환된 융합된 고리를 형성하기 위해 추가로 축합될 수 있다); Q는 CH2, C=O, NH, O, S 등이고; X1, X2 및 X3은 CR1 또는 N이고; Y는 CH 또는 N이고; Z는 CR2b 또는 N이고; R2a 및 R2b는 각각 수소 원자, 할로겐 원자, 선택적으로 치환된 C1-C6 알킬기, C1-C6 할로알킬기 등이고; R2a 및 R2b는 이에 결합하는 탄소 원자와 함께, 선택적으로 치환된 카르보시클 또는 선택적으로 치환된 헤테로시클을 형성할 수 있다.하기 화학식 (I)의 바이아릴 유도체 또는 그의 염: 여기서,고리 A는 선택적으로 치환된 페닐, 또는 선택적으로 치환된 5- 또는 6-원 고리 헤테로아릴이고 (상기 고리 A는 선택적으로 치환된 융합된 고리를 형성하기 위해 선택적으로 추가로 축합된다), Q는 CH2, CF2, S=O, SO2, C=O, NH, O 또는 S이고, X1, X2 및 X3은 각각 독립적으로 CH, CR1 또는 N이고, Y는 CH 또는 N이고, Z는 CR2b 또는 N이고, R1은 수소 원자, 할로겐 원자, C1-C6 알킬기, C1-C6 할로알킬기, C1-C6 알콕시기 또는 C1-C6 할로알콕시기이고, R2a 및 R2b는 각각 독립적으로 수소 원자, 할로겐 원자, 히드록실기, 시아노기, 포르밀기, 선택적으로 치환된 C1-C6 알킬기, 선택적으로 치환된 C1-C6 할로알킬기, 선택적으로 치환된 C1-C6 알콕시기, 선택적으로 치환된 C1-C6 할로알콕시기, 선택적으로 치환된 C1-C4 알콕시-C1-C4 알킬기, 선택적으로 치환된 C1-C4 알콕시-C1-C4 할로알킬기, 선택적으로 치환된 C1-C6 알킬카르보닐기, 선택적으로 치환된 C1-C6 알콕시카르보닐기, 선택적으로 치환된 C1-C6 알킬카르보닐옥시기, 선택적으로 치환된 C3-C7 시클로알킬기, 선택적으로 치환된 헤테로시클로알킬기, 선택적으로 치환된 헤테로시클로알킬옥시기, 선택적으로 치환된 C2-C6 알케닐기, 선택적으로 치환된 C2-C6 알케닐옥시기, 선택적으로 치환된 C2-C6 알케닐-C1-C6 알킬기, 선택적으로 치환된 C2-C6 알케닐-C1-C6 알콕시기, 선택적으로 치환된 C2-C6 알케닐옥시-C1-C4 알킬기, 선택적으로 치환된 C2-C6 알케닐옥시-C1-C4 알콕시기, 선택적으로 치환된 C2-C6 알케닐옥시-C1-C4 할로알킬기, 선택적으로 치환된 C2-C6 알케닐옥시-C1-C4 할로알콕시기, 선택적으로 치환된 C2-C6 알키닐기, 선택적으로 치환된 C2-C6 알키닐옥시기, 선택적으로 치환된 C2-C6 알키닐-C1-C6 알킬기, 선택적으로 치환된 C2-C6 알키닐-C1-C6 알콕시기, 선택적으로 치환된 C2-C6 알키닐옥시-C1-C4 알킬기, 선택적으로 치환된 C2-C6 알키닐옥시-C1-C4 알콕시기, 선택적으로 치환된 C2-C6 알키닐옥시-C1-C4 할로알킬기, 선택적으로 치환된 C2-C6 알키닐옥시-C1-C4 할로알콕시기, -NRaRb {Ra 및 Rb는 각각 독립적으로 수소 원자 또는 선택적으로 치환된 C1-C6 알킬기이다 (단, Ra 및 Rb는 동시에 수소 원자는 아니다)}, 선택적으로 치환된 C1-C6 알킬티오기, 선택적으로 치환된 C1-C6 할로알킬티오기, 펜타플루오로설파닐기, 또는 화학식 (I-A)로 표시되는 그룹{여기서, L은 단일 결합, -(CH2)p-, -O(CH2)p-, -(CH2)pO-, -(CH2)pO(CH2)q-, -NRc(CH2)p-, -(CH2)pNRc- 또는 -(CH2)pNRc(CH2)q-이고, 여기서 (CH2)p 및 (CH2)q 중 1 이상의 수소 원자는 할로겐 원자, C1-C4 알킬기 또는 C3-C7 시클로알킬기에 의해 각각 선택적으로 치환되고, p는 1, 2 또는 3이고, q는 1, 2 또는 3이고, Rc는 수소 원자 또는 C1-C6 알킬기이고, 고리 B는 선택적으로 치환된 카르보시클, 또는 선택적으로 치환된 헤테로시클이다}이거나,Z가 CR2b일 때, R2a 및 R2b는 이에 결합하는 탄소 원자와 함께, 선택적으로 치환된 카르보시클 또는 선택적으로 치환된 헤테로시클을 선택적으로 형성하고,R3은 수소 원자, 할로겐 원자, 선택적으로 치환된 C1-C6 알킬기, C1-C6 할로알킬기, 선택적으로 치환된 C1-C6 알콕시기, C1-C6 할로알콕시기, 선택적으로 치환된 C3-C7 시클로알킬기, 선택적으로 치환된 C2-C6 알케닐기, 선택적으로 치환된 C2-C6 알키닐기, 또는 선택적으로 치환된 아르알킬기이다.

BIARYL DERIVATIVE AND MEDICINE CONTAINING SAMEProvided is a compound showing excellent antifungal activity against Trichophyton fungus, which is a major causative microorganism of superficial mycosis, and high effectiveness on diseases caused by Trichophyton fungi. A biaryl derivative represented by the formula (I) or a salt thereof: wherein ring A is an optionally substituted phenyl, or an optionally substituted 5- or 6-membered ring heteroaryl (ring A may be further condensed to form an optionally substituted fused ring); Q is CH2, C=O, NH, O, S or the like; X1, X2 and X3 are CR1 or N; Y is CH or N; Z is CR2b or N; R2a and R2b are each a hydrogen atom, a halogen atom, an optionally substituted C1-C6 alkyl group, a C1-C6 haloalkyl group or the like; R2a and R2b may form, together with carbon atoms bonded thereto, an optionally substituted carbocycle, or an optionally substituted heterocycle.A biaryl derivative represented by the formula (I) or a salt thereof: wherein, ring A is an optionally substituted phenyl, or an optionally substituted 5- or 6-membered ring heteroaryl (said ring A is optionally further condensed to form an optionally substituted fused ring), Q is CH2, CF2, S=O, SO2, C=O, NH, O or S, X1, X2 and X3 are each independently CH, CR1 or N, Y is CH or N, Z is CR2b or N, R1 is a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a C1-C6 haloalkyl group, a C1-C6 alkoxy group or a C1-C6 haloalkoxy group, R2a and R2b are each independently a hydrogen atom, a halogen atom, a hydroxyl group, a cyano group, a formyl group, an optionally substituted C1-C6 alkyl group, an optionally substituted C1-C6 haloalkyl group, an optionally substituted C1-C6 alkoxy group, an optionally substituted C1-C6 haloalkoxy group, an optionally substituted C1-C4 alkoxy-C1-C4 alkyl group, an optionally substituted C1-C4 alkoxy-C1-C4 haloalkyl group, an optionally substituted C1-C6 alkylcarbonyl group, an optionally substituted C1-C6 alkoxycarbonyl group, an optionally substituted C1-C6 alkylcarbonyloxy group, an optionally substituted C3-C7 cycloalkyl group, an optionally substituted heterocycloalkyl group, an optionally substituted heterocycloalkyloxy group, an optionally substituted C2-C6 alkenyl group, an optionally substituted C2-C6 alkenyloxy group, an optionally substituted C2-C6 alkenyl-C1-C6 alkyl group, an optionally substituted C2-C6 alkenyl-C1-C6 alkoxy group, an optionally substituted C2-C6 alkenyloxy-C1-C4 alkyl group, an optionally substituted C2-C6 alkenyloxy-C1-C4 alkoxy group, an optionally substituted C2-C6 alkenyloxy-C1-C4 haloalkyl group, an optionally substituted C2-C6 alkenyloxy-C1-C4 haloalkoxy group, an optionally substituted C2-C6 alkynyl group, an optionally substituted C2-C6 alkynyloxy group, an optionally substituted C2-C6 alkynyl-C1-C6 alkyl group, an optionally substituted C2-C6 alkynyl-C1-C6 alkoxy group, an optionally substituted C2-C6 alkynyloxy-C1-C4 alkyl group, an optionally substituted C2-C6 alkynyloxy-C1-C4 alkoxy group, an optionally substituted C2-C6 alkynyloxy-C1-C4 haloalkyl group, an optionally substituted C2-C6 alkynyloxy-C1-C4 haloalkoxy group, -NRaRb {Ra and Rb are each independently a hydrogen atom or an optionally substituted C1-C6 alkyl group (provided that Ra and Rb are not hydrogen atoms at the same time)}, an optionally substituted C1-C6 alkylthio group, an optionally substituted C1-C6 haloalkylthio group, a pentafluorosulfanyl group, or a group represented by the formula (I-A) {wherein, L is a single bond, -(CH2)p-, -O(CH2)p-, -(CH2)pO-,-(CH2)pO(CH2)q-, -NRc(CH2)p-, -(CH2)pNRc- or -(CH2)pNRc(CH2)q-, wherein one or more hydrogen atoms of (CH2)p and (CH2)q are each optionally substituted by a halogen atom, a C1-C4 alkyl group or a C3-C7 cycloalkyl group, p is 1, 2 or 3, q is 1, 2 or 3, Rc is a hydrogen atom or a C1-C6 alkyl group, and ring B is an optionally substituted carbocycle, or an optionally substituted heterocycle}, or when Z is CR2b, R2a and R2b optionally form, together with carbon atoms bonded thereto, an optionally substituted carbocycle or an optionally substituted heterocycle, and R3 is a hydrogen atom, a halogen atom, an optionally substituted C1-C6 alkyl group, a C1-C6 haloalkyl group, an optionally substituted C1-C6 alkoxy group, a C1-C6 haloalkoxy group, an optionally substituted C3-C7 cycloalkyl group, an optionally substituted C2-C6 alkenyl group, an optionally substituted C2-C6 alkynyl group, or an optionally substituted aralkyl group.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

제초성 비시클릭 에테르본 발명은 일반식(I) 내지 (Ⅳ)의 특성 제초성 에테르, 그의 농업적으로 적합한 조성물 및 광범위한 스펙트럼의 발아전 또는 발아후 제초제로서의 그의 사용 방법에 관한 것이다.하기 일반식(I),(Ⅱ),(Ⅲ) 및 (Ⅳ)의 화합물. [이미지] 상기식중, R1은 직쇄 C1-C3알킬이고, R2은 수소, C1-C4알킬, C2-C4알케닐 또는 C2-C4알키닐이고, R3 및 R4는 독립적으로 수소, C1-C4알킬, C2-C4알케닐 또는 C2-C4알키닐, 또는 OCH3 또는 OCH2CH3로 치환된 C1-C3알킬이고, X는 CR5R6Y1, CR6Y3 또는 [이미지]이고, R5및 R6은 독립적으로 수소 또는 C1-C3알킬이고, Y1은 수소; Y2로 치환될 수도 있는 C1-C4알킬; C3-C6시클로알킬; CN; C(O)NR7R8; C(O)NHOR9; CO2R10; C(O)R11; C(OR22)(OR23)R11; CHO; CH(OR23); CH=NOR16; CR11=NOR17; SR15, 할로겐, 1내지 3개의 할로겐, CO2(C1-C3알킬), CN 또는 CHO로 치환될 수도 있는 C2-C4알케닐; 할로겐으로 치환될 수도 있는 C2-C4알키닐; S(O)nR12; SO2NR13R14; NO2; N3; SCN; CH3, OCH3, CF3및 할로겐으로부터 선택된 1내지 3개의 치환체에 의해 치환될 수도 있는 페닐; 이미다졸; 트리아졸; 테트라졸; 또는 [이미지]이고, Y2는 CN; C(O)NR7R8; C(O)NHOR9; CO2R10; C(O)R11; CHO; CH=NOR16; CR11=NOR17; SR15, 할로겐, 1내지 3개의 할로겐으로 치환될 수도 있는 C2-C4알케닐; 할로겐으로 치환될 수도 있는 C2-C4알키닐; S(O)nR12; SO2NR13R14; NO2; N3; SCN; CH3, OCH3, CF3및 할로겐으로부터 선택된 1내지 3개의 치환체에 의해 치환될 수도 있는 페닐; 이미다졸; 트리아졸; 테트라졸; 또는 [이미지]이고, Y3는 수소, C1-C3알킬, CN, CO2R10, C(O)R11, CHO또는 할로겐이고, R7, R8, R13 및 R14는 독립적으로 수소 또는 C1-C3알킬이고; R7및 R8은 함께 5-원 또는 6-원 고리를 형성할 수 있고, R13및 R14는 함께 5-또는 6-원 고리를 형성할 수 있고, R9, R12, R16 및 R17은 독립적으로 C1-C3알킬이고, R10은 수소; 1 내지 3의 할로겐, OR18, CN 또는 할로겐, CH3 및 OCH3로부터 선택된 1 내지 3개의 치환체로 치환될 수도 있는 페닐로 치환될 수도 있는 C1-C6알킬; C3-C4알케닐; 또는 C3-C4알키닐이고, R11은 1내지 3의 할로겐, OR18, CN 또는 할로겐, CH3 및 OCH3로부터 선택된 1 내지 3개의 치환체로 치환될 수도 있는 페닐로 치환될 수도 있는 C1-C6알킬; C3-C4알케닐; 또는 C3-C4알키닐이고, R11은 1내지 3의 할로겐, OR18, CN 또는 할로겐, CH3 및 OCH3로부터 선택된 1 내지 3개의 치환체로 치환될 수도 있는 페닐이고, R16는 수소, C1-C3알킬 또는 벤질이고, n은 1 또는 2이고, Q는 CH2W 또는 [이미지] 이고, q 및 r은 독립적으로 0 내지 2이고, R18은 수소, C1-C3알킬이고, R19은 수소, 할로겐, C1-C3알킬, OR20, SR20 또는 CN이고, R20은 C1-C3알킬 또는 C1-C3할로알킬이고, Z는 CH2, NR21, 산소, 황 또는 CH일수 있으며, 인접 탄소와 2중 결합을 형성할 수 있으며, R21은 수소 또는 C1-C3알킬이고, R22및 R23은 독립적으로 C1-C3알킬이거나, 또는 함께 5-또는 6-원 고리를 형성할 수 있고, R24, R25및 R26은 독립적으로 수소 또는 C1-C2알킬이고, W는 할로겐, C1-C3알킬, C1-C3알콕시, 히드록실, CN, C1-C3할로알킬, C1-C3할로알콕시, C1-C3알킬티오, C2-C4알케닐 및 C2-C4알키닐로부터 선택된 1내지 3개의 치환체로 치환될 수도 있는 페닐이거나, 또는 W는 0내지 2질소, 0내지 2산소 및 0내지 2황으로 이루어진 군으로부터 선택된 1 내지 3헤테로 원자를 함유한, 할로겐, CH3및 OCH3로 부터 선택된 1 내지 2개의 치환체로 치환될 수도 있는 5-, 6- 또는 7-원 헤테로시클릭 고리이며, 단, 1)일반식(I)및 (Ⅱ)의 화합물에서, Y1은 수소, C1-C4알킬 또는 할로겐이 아니고, Y2는 할로겐(들)이 아니며, 2) 일반식(Ⅳ)의 화합물에서, Q가 CH2W가 아닐 때, Y1은 수소 또는 C1-C4알킬이 아니고, 3) q 및 r이 합이 0 내지 2이고, 4) q 및 r의 합이 0이면 Z는 CH2이다.

Herbicidal bicyclic ethersThis invention relates to certain herbicidal ethers, agriculturally suitable compositions thereof, and a method for their use as broad spectrum preemergent or postemergent herbicides.Formula i, ii, iii and iv compoundwherein:r 1be straight chain c 1-c 3alkyl; r 2be h, c 1-c 4alkyl, c 2-c 4alkenyl or c 2-c 4alkynyl; r 3and r 4be alone h, c 1-c 4alkyl, c 2-c 4alkenyl, c 2-c 4alkynyl or by och 3or och 2ch 3the c that replaces 1-c 3alkyl; x is cr 5r 6y 1, cr 5=cr 6y 3or r 5and r 6be alone h or c 1-c 3alkyl; y 1be h; by y 2any c that replaces 1-c 4alkyl; c 3-c 6cycloalkyl; cn; c (o) nr 7r 8c (o) nhor 9co 2r 10c (o) r 11c (or 22) (or 23) r 11cho; ch (or 22) (or 23); ch=nor 16cr 11=nor 17sr 15halogen; by 1-3 halogen, co 2(c 1-c 3alkyl), any c that replaces of cn or cho 2-c 4alkenyl; by any c that replaces of halogen 2-c 4alkynyl; s (o) nr 12so 2nr 13r 14no 2n 3scn; be selected from ch by 1-3 3, och 3, sch 3, cf 3with any phenyl that replaces of the substituting group of halogen; imidazoles; triazole; tetrazolium; or y 2be cn; c (o) nr 7r 8c (o) nhor 9co 2r 10c (o) r 11cho; ch=nor 16cr 11=nor 17sr 151-3 halogen; by any c that replaces of 1-3 halogen 2-c 4alkenyl; by any c that replaces of halogen 2-c 4alkynyl; s (o) nr 12so 2nr 13r 14no 2n 3scn; be selected from ch by 1-3 3, och 3, sch 3, cf 3with any phenyl that replaces of the substituting group of halogen; imidazoles; triazole; tetrazolium; or y 3be h, c 1-c 3alkyl, cn, co 2r 10, c (o) r 11, cho or halogen; r 7, r 8, r 13and r 14be alone h or c 1-c 3alkyl; r 7and r 8can form 5-or 6-person ring together; and r 13and r 14can form 5-or 6-person ring together; r 9, r 12, r 16and r 17be alone c 1-c 3alkyl; r 10be h; by 1-3 halogen, or 18, cn or be selected from halogen, ch by 1-3 3and och 3the c of replacement arbitrarily of the phenyl institute that replaces arbitrarily of substituting group 1-c 6alkyl; c 3-c 4alkenyl; or c 3-c 4alkynyl; r 11for by 1-3 halogen, or 18, cn or be selected from halogen, ch by 1-3 3and och 3the c of replacement arbitrarily of the phenyl institute that replaces arbitrarily of substituting group 1-c 6alkyl; c 2-c 4alkenyl; c 2-c 4alkynyl; or by the individual halogen, ch of being selected from of 1-3 3and och 3the phenyl that replaces arbitrarily of substituting group; r 15be h, c 1-c 3alkyl or benzyl; n is 1 or 2;q is ch 2w or q and r are alone 0-2,r 18be h or c 1-c 3alkyl; r 19be h, halogen, c 1-c 3alkyl, or 20, sr 20or cn; r 20be c 1-c 3alkyl or c 1-c 3haloalkyl; z is ch 2, nr 21, o, s or ch and and adjacent carbon form two keys; r 21be h or c 1-c 3alkyl; r 22and r 23be c independently 1-c 3alkyl or form together 5-or 6-person the ring; r 24, r 25and r 26be h or c independently 1-c 2alkyl; w is for being selected from halogen, c by 1-3 1-c 3alkyl, c 1-c 3alkoxyl group, oh, cn, c 1-c 3haloalkyl, c 1-c 3halogenated alkoxy, c 1-c 3alkylthio, c 2-c 4alkenyl and c 2-c 4the phenyl that the substituting group of alkynyl replaces arbitrarily; or w is-5-, and 6-or 7-person contain 1 to 3 and be selected from 0-2 nitrogen-atoms, the heterocycle that the heteroatoms of 0-2 sauerstoffatom and 0-2 sulphur atom forms, and each ring can be selected from halogen, ch by 1-2 3and och 3substituting group replace arbitrarily; its condition is:1) in formula i and ii compound, y 1not h, c 1-c 4alkyl or halogen, y 2it is not halogen; 2) in the formula iv compound, when q is not ch 2during w, y 1not h or c 1-c 4alkyl; 3) summation of q and r is 0-2; with4) if the summation of q and r is o then z is ch 2

20424

표면 광택제 및 실내 가향제 제조업

특허

ko

en

릴렌 모노이미드 유도체, 및 태양 전지 및 광검출기에서 감광제로서의 이의 용도본 발명은 하기 화학식 Ia, Ib 또는 Ic의 화합물에 관한 것이다: 상기 식에서, R은 동일하거나 상이한 아릴옥시, 아릴티오, 헤트아릴옥시, 헤트아릴티오, 아릴, 다이아릴아미노 또는 다이알킬아미노 라디칼이고, n은, m이 0인 경우에는 0, 1, 2 또는 3이고, m이 1인 경우에는 0, 1, 2, 3, 4 또는 5이고, m은 0 또는 1이고, A는 -COOM, -SO3M 또는 -PO3M이고, M은 수소, 알칼리 금속 양이온 또는 [NR']4+이고, R'는 수소 또는 알킬이고, R' 라디칼들은 동일하거나 상이할 수 있고, B는 C1-C6-알킬렌이거나 1,4-페닐렌이고, 이때 페닐렌 라디칼은 알킬, 나이트로, 시아노 및/또는 할로겐으로 단일- 또는 다중 치환될 수 있으며, L은, 화학적 단일 결합이거나, 또는 페닐, 알킬, 알콕시, 알킬티오 및/또는 -NR4R5로 단일- 또는 다중 치환될 수 있는 화학식 -(Het)Ar- 또는 -(Het)Ar-(Het)Ar-의 가교이고, 이때 (Het)Ar은, 헤테로원자를 포함할 수 있는 포화되거나 불포화된 5- 내지 18-원 고리에 융합될 수 있는 아릴 또는 헤트아릴이고, 두 개의 (Het)Ar인 경우, 이들은 동일하거나 상이할 수 있으며, q는 0 또는 1이고, R1, R2는 각각 독립적으로, 하기 화학식 IIa, IIb 또는 IIc의 라디칼이고:, R3은 페닐, 알킬, 알콕시, 알킬티오 또는 -NR6R7이고, X는 C(R8R9)2, NR10, 산소 또는 황이고, R4 내지 R10은 각각 독립적으로, 수소, 알킬(이의 탄소 쇄에 하나 이상의 -O-, -S-, -CO-, -SO- 및/또는 -SO2- 잔기가 개재될 수 있음), 또는 아릴 또는 헤트아릴(이들은 각각 알킬, 알콕시 및/또는 알킬티오로 단일- 또는 다중 치환될 수 있음)이고, p는 0, 1, 2, 3, 4 또는 5이고, Y는 NR11 또는 황이고, R11은 수소, 알킬(이의 탄소 쇄에 하나 이상의 -O-, -S-, -CO-, -SO- 및/또는 -SO2- 잔기가 개재될 수 있음), 또는 아릴, 헤트아릴, 아르알킬 또는 헤트아르알킬이다. 또한 본 발명은, 화학식 Ia, Ib 및 Ic의 화합물 또는 화학식 Ia, Ib 및 Ic의 화합물들의 혼합물, 및/또는 화학식 Ia, Ib 및 Ic의 화합물의 이성질체 또는 이성질체들의 혼합물의, 태양 전지 및 광검출기에서 감광제로서의 용도, 및 화학식 Ia, Ib 및 Ic의 화합물 또는 화학식 Ia, Ib 및 Ic의 화합물들의 혼합물, 및/또는 화학식 Ia, Ib 및 Ic의 화합물의 이성질체 또는 이성질체들의 혼합물을 감광제로서 포함하는, 태양 전지 또는 광검출기에 관한 것이다.하기 화학식 Ia, Ib 또는 Ic의 화합물:[이미지]상기 식에서,R은 동일하거나 상이한 아릴옥시, 아릴티오, 헤트아릴옥시, 헤트아릴티오, 아릴, 다이아릴아미노 또는 다이알킬아미노 라디칼이고,n은, m이 0인 경우에는 0, 1, 2 또는 3이고, m이 1인 경우에는 0, 1, 2, 3, 4 또는 5이고,m은 0 또는 1이고,A는 -COOM, -SO3M 또는 -PO3M이고,M은 수소, 알칼리 금속 양이온 또는 [NR']4+이고,R'는 수소 또는 알킬이고, R' 라디칼들은 동일하거나 상이할 수 있고,B는 C1-C6-알킬렌이거나 1,4-페닐렌이고, 이때 페닐렌 라디칼은 알킬, 나이트로, 시아노 및/또는 할로겐으로 단일- 또는 다중 치환될 수 있으며,L은, 화학적 단일 결합이거나, 또는 페닐, 알킬, 알콕시, 알킬티오 및/또는 -NR4R5로 단일- 또는 다중 치환될 수 있는 화학식 -(Het)Ar- 또는 -(Het)Ar-(Het)Ar-의 가교이고, 이때 (Het)Ar은, 헤테로원자를 포함할 수 있는 포화되거나 불포화된 5- 내지 18-원 고리에 융합될 수 있는 아릴 또는 헤트아릴이고, 두 개의 (Het)Ar인 경우, 이들은 동일하거나 상이할 수 있으며,q는 0 또는 1이고,R1, R2는 각각 독립적으로, 하기 화학식 IIa, IIb 또는 IIc의 라디칼이고:[이미지],R3은 페닐, 알킬, 알콕시, 알킬티오 또는 -NR6R7이고,X는 C(R8R9)2, NR10, 산소 또는 황이고,R4 내지 R10은 각각 독립적으로, 수소, 알킬(이의 탄소 쇄에 하나 이상의 -O-, -S-, -CO-, -SO- 및/또는 -SO2- 잔기가 개재될 수 있음), 또는 아릴 또는 헤트아릴(이들은 각각 알킬, 알콕시 및/또는 알킬티오로 단일- 또는 다중 치환될 수 있음)이고,p는 0, 1, 2, 3, 4 또는 5이고,Y는 NR11 또는 황이고,R11은 수소, 알킬(이의 탄소 쇄에 하나 이상의 -O-, -S-, -CO-, -SO- 및/또는 -SO2- 잔기가 개재될 수 있음), 또는 아릴, 헤트아릴, 아르알킬 또는 헤트아르알킬이다.

RYLENE MONOIMIDE DERIVATES AND USE THEREOF AS PHOTOSENTIZERS IN SOLAR CELLS AND PHOTODETECTORSThe invention relates to compounds of the formulae Ia,Ib and Ic in which R are identical or different aryloxy, arylthio, hetaryloxy, hetarylthio, aryl, diarylamino or dialkylamino radicals, n when m is 0: 0, 1, 2 or 3, when m is 1: 0, 1, 2, 3, 4 or 5, m is 0 or 1, A is -COOM, -SO3M or -PO3M, M is hydrogen, an alkali metal cation or [NR']4+, R' is hydrogen or alkyl, where the R' radicals may be the same or different, B is C1-C6-alkylene or 1,4-phenylene, where the phenylene radical may be 2 mono-or polysubstituted by alkyl, nitro, cyano and/or halogen, L is a chemical single bond or a bridge of the formula -(Het)Ar-or -(Het)Ar-(Het)Ar- which may be mono-or polysubstituted by phenyl, alkyl, alkoxy, alkylthio and/or -NR4R5 and in which (Het)Ar is aryl or hetaryl which may be fused to saturated or unsaturated 5-to 18-membered rings which maycomprise heteroatoms, where, in the case of two (Het)Ar, these may be the same or different, q is 0 or 1, R1, R2 are each independently radicals of the formula IIa, IIb or IIc R3 is phenyl, alkyl, alkoxy, alkylthio or -NR6R7, X is C(R8R9)2, NR10, oxygen or sulfur, R4 to R10 are each independently hydrogen, alkyl whose carbon chain may be interrupted by one or more -O-, -S-, -CO-, -SO- and/or -SO2 -moieties, or aryl or hetaryl, each of which may be mono-or polysubstituted by alkyl, alkoxy and/or alkylthio, p is 0, 1, 2, 3, 4 or 5, Y is NR11 or sulfur, and R11 is hydrogen, alkyl whose carbon chain may be interrupted by one or more -O-, -S-, -CO-, -SO- and/or -SO2 -moieties, or aryl, hetaryl, aralkyl or hetaralkyl. The present invention further relates to the use of compounds of the formulae Ia, Ib and Ic or mixtures of compounds of the formulae Ia, Ib and Icand/or isomers thereof or mixtures of isomers of the compounds of the formulae Ia, Ib and Ic as photosensitizers in solar cells and photodetectors, and to solar cells and photodetectors comprising compounds of the formulae Ia, Ib and Ic or mixtures of compounds of the formulae Ia, Ib and Ic and/or isomers thereof or mixtures of isomers of the compounds of the formulae Ia, Ib and Ic as photosensitizers.The compound of formula ia, ib or ic:wherein:r is identical or different aryloxy, arylthio, heteroaryloxy, heteroarylthio, aryl, ammonia diaryl base or dialkyl amido,n is when m is 0: be 0,1,2 or 3,when m is 1: be 0,1,2,3,4 or 5,m is 0 or 1,a is-coom ,-so 3m or-po 3m, m is hydrogen, alkali metal cation or [nr '] 4+, r ' is hydrogen or alkyl, and wherein r ' group can be identical or different,b is c 1-c 6alkylidene group or isosorbide-5-nitrae-phenylene, wherein phenylene can by alkyl, nitro, cyano group and/or halogen list-or polysubstituted, l is the bridge of chemical single bond or following formula:-(het) ar-or-(het) ar-(het) ar-it can by phenyl, alkyl, alkoxyl group, alkylthio and/or-nr 4r 5single-or polysubstituted, and its in (het) ar be aryl or heteroaryl, it can condense in comprising heteroatomic saturated or unsaturated 5-18 ring, and wherein when two (het) ar, these can be identical or different,q is 0 or 1,r 1, r 2be the group of formula iia, iib or iic independently of one another: r 3for phenyl, alkyl, alkoxyl group, alkylthio or-nr 6r 7, x is c (r 8r 9) 2, nr 10, oxygen or sulphur, r 4-r 10be hydrogen independently of one another, its carbochain can by one or more-o-,-s-,-co-,-so-and/or-so 2the alkyl at-structure division interval, or separately can by alkyl, alkoxyl group and/or alkylthio list-or polysubstituted aryl or heteroaryl, p is 0,1,2,3,4 or 5,y is nr 11or sulphur, r 11for hydrogen, its carbochain can by one or more-o-,-s-,-co-,-so-and/or-so 2the alkyl at-structure division interval, or aryl, heteroaryl, aralkyl or assorted alkyl.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

ＣＣＲ-５ 길항제로서의 퀴놀릴 아미드 유도체본 발명은 하기 화학식 I의 CCR-5 수용체 길항제인 일련의 화합물, 또는 그의 제약상 허용되는 염에 관한 것이다. <화학식 I> 상기 식에서, 가변기는 본 명세서에 정의되어 있다.하기 화학식 I의 화합물, 또는 그의 거울상이성질체, 부분입체이성질체 또는 제약상 허용되는 염. <화학식 I> 상기 식에서, Y는 각각 R5 또는 R6인 1 내지 3개의 독립적으로 선택된 잔기로 임의로 치환된 7 내지 10원 비시클릭(bicyclic) 헤테로사이클이고; A는 -CO- 또는 -SO2-이고; W는 N 또는 CH이되, 단 W가 CH일 경우, X는 -C(R8)2-, -C(R8)(R9)-, -C(O)-, -O-, -NH-, -N(C1-6 알킬)-, -C(R8)(OR10), -C(R8)(CH2-C1-5알킬-R10)-, -C(=CHR11)-, -C(=NOR12)-, -C(R8)(O-C1-6-알킬)-, -C(=CH-C1-6 알킬)-, -C(R8)(O-C(O)-C1-6 알킬)-, -C(R8)(O-C(O)-O-C1-6 알킬)-, -C(R8)(O-C(O)-NH-C1-6 알킬)-, -C(R8)(O-C(O)-N(C1-6 알킬)2)-, -C(R8)(NR13-C(O)-C1-6 알킬)-, -C(R8)(NR13-C(O)-O-C1-6 알킬)-, -C(R8)(NR13-C(O)-NH-C1-6 알킬)-, -C(R8)(NR13-C(O)-N-(C1-6 알킬)2)-, -N(C(O)-C1-6 알킬)-, -C(R8)(OH)-, -C(R8)(OTMS)-, -CHR8-, -CHR11- 또는 -CHR14-이고; W가 N일 경우, X는 -C(R8)(R15)- 또는 -C(O)-이고; Z는 R7-페닐, R7-피리딜, R7-티오페닐 또는 R7-나프틸이고; R1은 수소, C1-6 알킬 또는 C2-6 알케닐이고; R2, R3, R4 및 R8은 각각 독립적으로 수소, C2-6 알케닐, CF3 또는 C1-6 알킬이고; R5 및 R6은 독립적으로 할로겐, C1-6 알킬, CF3, 니트로, 시아노, NR13R11, 히드록시, 아릴, 에스테르, 카르복시, -C02R11, OC1-6 알킬이고; R7은 각각 수소, 할로겐, 니트로, -NR13R11, -CF3, CF3O-, -CN, CF3SO2-, R19-페닐, -NHCOCF3, C1-6 알킬, -CO2C1-6 알콕시, 5-원 헤테로아릴, CH3SO2- 또는 (여기서, Q는 -O-, -NH- 또는 -N(CH3)-임)인 1 내지 3개의 독립적으로 선택된 잔기이고; R9는 R7-페닐, R7-헤테로아릴, R7-나프틸, C3-10 시클로알킬, C3-10 시클로알킬 -C1-6 알킬 또는 C1-6 알콕시-C1-6 알킬이고; R10은 R17-페닐, 피리딜, 피리미딜, 피라지닐 또는 티아졸릴이고; R11은 H 또는 C1-6 알킬이고; R12는 수소, -C1-6 알킬; 또는 C3-7 시클로알킬, -C1-6 알킬, 플루오로-C1-6 알킬, 시클로프로필메틸-, -CH2CH2OH, -CH2CH2-O-C1-6 알킬, -CH2C(O)-O-C1-6 알킬, -CH2C(O)NH2, -CH2C(O)-NHC1-6 알킬, -CH2CH2C1-6 알킬, -CH2C(O)-C1-6 알킬 또는 -CH2C(O)-N(C1-6 알킬)2로 치환된 -C1-6 알킬이고; R13은 수소 또는 C1-6 알킬이고; R14는 -OH, -CF3 또는 O-피리디닐이고; R15는 수소, C1-6 알킬, C1-C6 알콕시-C1-6 알킬, C3-10 시클로알킬, C3-10 시클로알킬-C1-6 알킬, R16-페닐, R16-페닐-C1-6 알킬, R16-나프틸, R16-나프틸-C1-6 알킬, R16-헤테로아릴 또는 R16-헤테로아릴-C1-6 알킬이고; R16은 각각 수소, 할로겐, C1-6 알킬, C1-6-알콕시, -CF3, CF3O-, CH3C(O)-, -CN, CH3SO2-, CF3SO2-, R18-페닐, R18-벤질, CH3C(=NOCH3)-, CH3C(=NOCH2CH3)-, -NH2, -NHCOCF3, -NHCONH-(C1-6 알킬), -NHCO(C1-6 알킬), -NHSO2(C1-6 알킬), 5-원 헤테로아릴, 또는 (여기서, Q는 -NH- 또는 -N(CH3)임)인 1 내지 3개의 독립적으로 선택된 잔기이고; R17은 C1-6 알킬, -NH2 또는 R19-페닐-이고; R18은 각각 수소, C1-6-알킬, -CF3, -CO2H, -CO2C1-6 알콕시, -CN, C1-6 알콕시 또는 할로겐인 1 내지 3개의 독립적으로 선택된 잔기이고; R19는 각각 수소, C1-6 알킬, -CF3, -CO2R11, -CN, C1-6 알콕시 또는 할로겐인 1 내지 3개의 독립적으로 선택된 잔기이다.

QUINOLYL AMIDE DERIVATIVES AS CCR-5 ANTAGONISTSThe present invention relates to a series of compounds which are CCR-5 receptor antagonists of the general formula (I): or a pharmaceutically acceptable salt thereof, wherein the variables are defined herein.A compound of Formula (I) enantiomers, diastereomers or pharmaceutically acceptable salts thereof, wherein Y is a 7 to 10 member bicyclic heterocycle optionally substituted with 1-3 independently selected moieties each of which is R5 or R6;A is -CO-, or -SO,W is N or CH, provided when W is CH then X is -C(R8)2-, -C(R8)(R9)-, -C(O)-, -O-, -NH-, -N(C e alkyl)-, -C(R8) (OR10)-, -C(R8)(CH2-Cr5alkyl-R10 )-, -C(=CHR11)-, -C(=NOR12)-, -C(R8)(O-d-6-alkyl)-, -C(=CH-C e alkyl)-, -C(R8)(O-C(O)-Cι-6 alkyl)-, -C(R8)(O-C(O)-O-d-6 alkyl)-,-C(R8)(O-C(O)-NH-d-6 alkyl)- , -C(R8)(O-C(O)-N(Cre alkyl)2 )- -C(R8)(NR13-C(O)-d-e alkyl)- , -C(R8)(NR13-C(O)-O-Cre alkyl)-, -C(R8)(NR13-C(O)-NH-d-e alkyl)- , -C(R8)(NR13-C(O)-N-(d-6 alkyl)2)-, -N(C(O)-d-e alkyl)-, -C(R8)(OH)-, -C(R8)(OTMS)-, -CHR8-, -CHR11-, -CHR14-; and when W is N then X is -C(R8 )(R15)-, or -C(O)-;Z is R7-phenyl, R7-pyridyl, R7-thiophenyl or R7-naphthyl;R1 is hydrogen, Cre alkyl or C2-6 alkenyl;R2, R3, R4, and R8 are each independently hydrogen, C2-6 alkenyl, CF3 or C1-6 alkyl;R5 and R6 are independently selected from halogen, C1-6 alkyl, CF3, nitro, cyano, NR13R11, hydroxy, aryl, ester, carboxy, -CO2R11, OC1-6 alkyl; R' is 1 to 3 independently selected moieties each of which is hydrogen, halogen, nitro,-NR13R11, -CF3, CF3O-, -CN, CF3SO2-, R19-phenyl,-NHCOCF3, Cre alkyl, -CO2Cre alkoxy, 5-membered heteroaryl, CH3SO2- or wherein Q is ,-O-, -NH-or -N(CH3)- ;R9 is R7-phenyl, R7-heteroaryl, R7-naphthyl, C3-10 cycloalkyl, C3-10 cycloalkyl -Crealkyl or d-e alkoxy-d-e alkyl; R 0 is R17-phenyl, pyridyl, pyrimidyl, pyrazinyl or thiazolyl; R11 is H or d-e alkyl.R12 is hydrogen, -C e alkyl, -Crealkyl substituted by C3-7 cycloalkyl, -C e alkyl, fluoro-Cre alkyl, cyclopropylmethyl-,-CH2CH2OH, -CH2CH2-O-Cre alkyl, -CH2C(O)-O-d-e alkyl, -CH2C(O)NH2, -CH2C(O)-NHCre alkyl, -CH2CH2 C β alkyl, -CH2C(O)-d-e alkyl or -CH2C(O)-N(Cre alkyl)2; R13 is hydrogen or d-e alkyl; R14 is -OH, -CF3, or O-pyridinyl;R15 is hydrogen, Cre alkyl, d-d alkoxy-Cre alkyl, C3-10 cycloalkyl, C3-10cycloalkyl-Cre alkyl, R16-phenyl, R16-phenyl-d-e alkyl, R16-naphthyl, R16-naphthyl-d-e alkyl, R16-heteroaryl or R16-heteroaryl-d-e alkyl; R16 is 1 to 3 independently selected moieties each of which is hydrogen, halogen, d-e alkyl, C e-alkoxy, -CF3, CF3O-, CH3C(O)-, -CN, CH3SO2-, CF3SO2-, R18-phenyl, R18- benzyl,CH3C(=NOCH3)-, CH3C(=NOCH2CH3)-, -NH2 , -NHCOCF3,-NHCONH-(d-e alkyl), -NHCO(Cre alkyl), -NHSO2(d-e alkyl), 5-membered heteroaryl , or , wherein Q is, -NH- or -N(CH3);R17 is Cre alkyl , -NH2 or R19-phenyl-;R18 is 1 to 3 independently selected moieties each of which is hydrogen, d-e-alkyl, -CF3,CO2H, -CO2d-6 alkoxy, -CN, Cre alkoxy or halogen; R19 is 1 to 3 independently selected moieties each of which is hydrogen, C1-6 alkyl, -CF3, - CO2R11, -CN, d-e alkoxy or halogen.

21102

생물학적 제제 제조업

특허

ko

en

고체- 및 용액-상 조합 기법을 사용한 인슐린친화성 펩타이드 합성본 발명은 고체-상 및 용액-상("혼성") 접근법을 이용하여 합성되는 인슐린친화성 펩타이드의 제조 방법에 관한 것이다. 일반적으로, 이 접근법은 고체-상 화학을 이용하여 3가지 상이한 펩타이드 중간체 단편을 합성함을 포함한다. 이어, 용액-상 화학을 이용하여 추가적인 아미노산 물질을 제 3 단편에 부가하고, 이를 이어서 제 2 단편에 커플링 시키고, 이 후 용액 상태의 제 1 단편과 커플링시킨다. 다르게는, 상이한 제 2 단편을 용액-상인 제 1 단편과 커플링 시킨다. 이어, 용액-상 화학을 이용하여 추가적인 아미노산 물질을 상이한 제 3 단편에 부가한다. 이어서, 이러한 상이한 제 3 단편을 용액-상인 커플링된 제 1 및 상이한 제 2 단편에 커플링시킨다. 단편 중 하나에 슈도프롤린을 사용하면 그 단편의 고체-상 합성이 용이해지고, 또한 이 단편과 다른 단편의 후속 용액-상 커플링도 용이해진다. 본 발명은 GLP-1(7-36) 및 이들의 천연 및 비-천연 대응물과 같은 인슐린친화성 펩타이드를 생성시키는데 매우 유용하다.(a) 하기 서열 식별 번호: 5의 아미노산 서열을 포함하는 제 1 펩타이드 단편을 제공하는 단계:서열 식별 번호: 5Z-QAAKEFIAWLVKX35-B'(여기에서, X35는 비키랄성의, 선택적으로 입체 장애된 아미노산 잔기이고;Z는 N-말단 보호기이고;B'는 -OH이고;상기 서열 중 하나 이상의 잔기는 선택적으로 측쇄 보호를 포함한다)(b) 용액 상태의 제 1 펩타이드 단편을 아르기닌 아마이드와 커플링시켜 하기 서열 식별 번호: 6의 아미노산 서열을 포함하는 제 2 펩타이드 단편을 제공하는 단계:서열 식별 번호: 6Z-QAAKEFIAWLVKX35R-NH2(여기에서,Z는 N-말단 보호기 Fmoc-이고;X35는 비키랄성의, 선택적으로 입체 장애된 아미노산 잔기이고;상기 서열 중 하나 이상의 잔기는 선택적으로 측쇄 보호를 포함한다)(c) N-말단 보호기를 제거하여 하기 서열 식별 번호: 6의 아미노산 서열을 포함하는 제 3 펩타이드 단편을 수득하는 단계:서열 식별 번호: 6Z-QAAKEFIAWLVKX35R-NH2(여기에서,Z는 H-이고;X35는 비키랄성의, 선택적으로 입체 장애된 아미노산 잔기이고;상기 서열 중 하나 이상의 잔기는 선택적으로 측쇄 보호를 포함한다)(d) 하기 서열 식별 번호: 7의 아미노산 서열을 포함하는 제 4 펩타이드 단편을 제공하는 단계:서열 식별 번호: 7Z-TFTSDVX17-18YLEG-B'(여기에서,X17-18은 슈도프롤린의 다이펩타이드 잔기이고;Z는 N-말단 보호기이고;B'는 -OH이고;상기 서열 중 하나 이상의 잔기는 선택적으로 측쇄 보호를 포함한다)(e) 제 4 펩타이드 단편을 용액 상태의 제 3 펩타이드 단편과 커플링시켜 하기 서열 식별 번호: 8의 아미노산 서열을 포함하는 제 5 펩타이드 단편을 제공하는 단계:서열 식별 번호: 8Z-TFTSDVX17-18YLEGQAAKEFIAWLVKX35R-NH2(여기에서,Z는 N-말단 보호기이고;X17-18은 슈도프롤린의 다이펩타이드 잔기이고;X35는 비키랄성의, 선택적으로 입체 장애된 아미노산 잔기이고;상기 서열 중 하나 이상의 잔기는 선택적으로 측쇄 보호를 포함한다)(f) N-말단 보호기를 제거하여 하기 서열 식별 번호: 14의 아미노산 서열을 포함하는 제 6 펩타이드 단편을 수득하는 단계:서열 식별 번호: 14Z-TFTSDVX17-18YLEGQAAKEFIAWLVKX35R-NH2(여기에서,Z는 H-이고;X17-18은 슈도프롤린의 다이펩타이드 잔기이고;X35는 비키랄성의, 선택적으로 입체 장애된 아미노산 잔기이고;상기 서열 중 하나 이상의 잔기는 선택적으로 측쇄 보호를 포함한다)(g) 하기 서열 식별 번호: 9의 아미노산 서열을 포함하는 제 7 펩타이드 단편을 제공하는 단계:서열 식별 번호: 9Z-HX8EX10-B'(여기에서,X8 및 X10은 각각 독립적으로 비키랄성의, 선택적으로 입체 장애된 아미노산 잔기이고;Z는 N-말단 보호기이고;B'는 -OH이고;H 및 E 각각은 선택적으로 측쇄 보호를 포함한다), 및(h) 제 7 펩타이드 단편을 용액 상태의 제 6 펩타이드 단편과 커플링시켜 하기 서열 식별 번호: 10의 아미노산 서열을 포함하는 인슐린친화성 펩타이드를 제공하는 단계:서열 식별 번호: 10Z-HX8EX10TFTSDVX17-18YLEGQAAKEFIAWLVKX35R-NH2(여기에서,Z는 N-말단 보호기이고;X17-18은 슈도프롤린의 다이펩타이드 잔기이고;X8, X10 및 X35는 각각 독립적으로 비키랄성의, 선택적으로 입체 장애된 아미노산 잔기이고;상기 서열 중 하나 이상의 잔기는 선택적으로 측쇄 보호를 포함한다)를 포함하는, 인슐린친화성 펩타이드의 제조 방법.

INSULINOTROPIC PEPTIDE SYNTHESIS USING SOLID AND SOLUTION PHASE COMBINATION TECHNIQUESThe present invention relates to the preparation of insulinotropic peptides that are synthesized using a solid and solution phase ("hybrid") approach. Generally, the approach includes synthesizing three different peptide intermediate fragments using solid phase chemistry. Solution phase chemistry is then used to add additional amino acid material to the third fragment which is then coupled to the second fragment and then the first fragment in solution. Alternatively, a different second fragment is coupled to the first fragment in the solid phase. Then, solution phase chemistry is then used to add additional amino acid material to a different third fragment. Subsequently, this different third fragment is coupled to the coupled first and different second fragment in the solution phase. The use of a pseudoproline in one of the fragments eases solid phase synthesis of that fragment and also eases subsequent solution phase coupling of this fragment to the other fragments. The present invention is very useful for forming insulinotropic peptides such as GLP- 1(7-36) and its natural and non-natural counterparts.A method of making an insulinotropic peptide, comprising the steps of: a) providing a first peptide fragment including the amino acid sequence of (SEQ ID NO. 5)Z-QAAKEFI AWL VKX35-B 'whereinX35 is an achiral, optionally sterically hindered amino acid residue;Z is an N-terminal protecting group;B' is -OH; andone or more residues of said sequence optionally includes side chain protection;b) coupling the first peptide fragment in solution to arginine amide in order to provide a second peptide fragment including the amino acid sequence of (SEQ ID NO. 6)Z-QAAKEFIAWLVKX35R-NH2 whereinZ is N-terminal protecting group Fmoc-;X35 is an achiral, optionally sterically hindered amino acid residue; andone or more residues of said sequence optionally includes side chain protection; c) removing the N-terminal protecting group to afford a third peptide fragment including the amino acid sequence of (SEQ ID NO. 6)Z- QAAKEFIAWLVKX35R-NH2 whereinZ is H-;X35 is an achiral, optionally sterically hindered amino acid residue; andone or more residues of said sequence optionally includes side chain protection; d) providing a fourth peptide fragment including the amino acid sequence of (SEQ ID NO. 7)Z-TFTSD VX17 18YLEG-B ' whereinX17'18 is a dipeptide residue of a pseudoproline; Z is an N-terminal protecting group;B' is -OH; andone or more residues of said sequence optionally includes side chain protection; e) coupling the fourth peptide fragment to the third peptide fragment in solution in order to provide a fifth peptide fragment including the amino acid sequence of (SEQ ID NO. 8)Z-TFTSDVX17 18YLEGQAAKEFIAWLVKX35R-NH2 whereinZ is an N-terminal protecting group;X17'18 is a dipeptide residue of a pseudoproline;X35 is an achiral, optionally sterically hindered amino acid residue; andone or more residues of said sequence optionally includes side chain protection; f) removing the N-terminal protecting group to afford a sixth peptide fragment including the amino acid sequence of (SEQ ID NO. 14)Z-TFTSDVX17 18YLEGQAAKEFIAWLVKX35R-NH2 whereinZ is H-;X17'18 is a dipeptide residue of a pseudoproline;X35 is an achiral, optionally sterically hindered amino acid residue; andone or more residues of said sequence optionally includes side chain protection; g) providing a seventh peptide fragment including the amino acid sequence of (SEQ ID NO. 9)Z-HX8EX10-B'whereinX8 and X10 are each independently achiral, optionally sterically hindered amino acid residues;Z is an N-terminal protecting group;B' is -OH; andeach of H and E optionally includes side chain protection; andh) coupling the seventh peptide fragment to the sixth peptide fragment in solution to provide an insulinotropic peptide including the amino acid sequence of (SEQ ID NO. 10)Z-HX8EX10TFTSDVX17 18YLEGQAAKEFIAWLVKX35R-NH2 whereinZ is an N-terminal protecting group;X17'18 is a dipeptide residue of a pseudoproline; X8, X10 and X35 are each independently achiral, optionally sterically hindered amino acid residues; andone or more residues of said sequence optionally includes side chain protection.

26221

인쇄회로기판용 적층판 제조업

특허

ko

en

인쇄 회로 기판 제조 시의 비선형 이미지 왜곡 보정본 발명은, 다층 아티클(multilayer article)의 적어도 2개의 층 상의 도전체 패턴들 사이에 전기적인 접속들을 갖는 다층 아티클들을 제조하기 위한 방법에 관한 것이다. 이 방법은 a) 상부에 도전체 패턴을 갖는 제1 아티클 또는 층을 묘사하는 이미지 데이터의 초기 세트를 이용하여 상부에 도전 재료 패턴을 갖는 상기 제1 아티클 또는 층을 형성하는 단계; b) 상기 제1 아티클 또는 층 상의 상기 도전 재료 패턴의 이미지의 데이터를 취득하는 단계; c) 상기 제1 아티클 또는 층 상의 상기 도전 재료 패턴의 상기 이미지로부터 상부에 도전체 패턴을 갖는 적어도 제2 층 상의 도전 재료 패턴 상의 사이트들에 접속되는 상기 제1 아티클 또는 층 상의 상기 도전 재료 패턴 내의 관련 위치를 판정하고, 이후에 I) 상기 도전 재료 패턴 내에서 각 도전 사이트를 보정하기 위해 상기 제1 아티클 또는 층에 대한 상기 이미지 데이터의 초기 세트를 수정하고 이미지 데이터의 보정된 세트를 생성하는 단계; II) 상기 제1 아티클 또는 층 상의 사이트들에 접속되는 도전 재료 패턴 내의 사이트들을 갖는 적어도 제2 층에 대한 데이터의 초기 세트를 수정하고 - 상기 수정은 상기 제2 층에 대한 상기 이미지 데이터의 초기 세트와 상기 제1 아티클 또는 층의 단계 b)에서 취득된 이미지 데이터의 비교에 기초함 - , 상기 제2 층에 대한 이미지 데이터의 보정된 세트를 생성하는 단계; III) 다른 층 상의 사이트들에 접속되는 도전 재료 패턴 내의 사이트들을 갖는 제2 층에 대한 데이터의 초기 세트를 수정하고 - 상기 수정은 상기 제2 층에 대한 상기 이미지 데이터의 초기 세트와 제조된 제2 층에서 취득된 이미지 데이터의 비교에 기초함 -, 상기 도전 재료 패턴 내의 각 도전 사이트를 보정하기 위해서 상기 이미지 데이터의 초기 세트를 수정함으로써, 적어도 상기 제1 아티클 또는 층 및 상기 제2 층에 대한 데이터의 보정된 세트를 생성하는 단계; 및 IV) 다수의 층에 대한 데이터의 초기 세트를 수정하고 - 각 층은 다른 층 상의 사이트들에 접속되는 도전 재료 패턴 내의 사이트들을 갖고, 상기 수정은 상기 다수의 층의 각각에 대한 이미지 데이터의 초기 세트들과 상기 다수의 층의 각각에 대한 제조된 층에서 취득된 이미지 데이터의 비교에 기초함 -, 상기 다수의 층의 각각 내의 도전 재료 패턴 내의 각 도전 사이트를 보정하기 위해서 상기 다수의 층의 각각에 대한 상기 이미지 데이터의 초기 세트를 수정함으로써, 상기 다수의 층의 각각에 대한 보정된 세트를 생성하는 단계로 이루어진 그룹으로부터 선택된 단계들을 수행하는 단계; 및 상기 적어도 하나의 층을 제조하기 위한 데이터의 보정된 세트를 이용하여 내부에 도전 사이트들을 갖는 적어도 하나의 층을 제조하는 단계를 포함한다.다층 아티클(multilayer article)의 적어도 2개의 층 상의 도전체 패턴들 사이에 전기적인 접속들을 갖는 다층 아티클들을 제조하기 위한 방법에 있어서, a) 상부에 도전체 패턴을 갖는 제1 층을 묘사하는 이미지 데이터의 초기 세트를 이용하여 상부에 도전 재료 패턴을 갖는 상기 제1 층을 형성하는 단계; b) 상기 제1 층 상의 상기 도전 재료 패턴의 이미지의 데이터를 취득하는 단계; c) 상기 제1 층 상의 상기 도전 재료 패턴의 상기 이미지로부터 상부에 도전체 패턴을 갖는 적어도 제2 층 상의 도전 재료 패턴 상의 사이트들에 접속되는 상기 제1 층 상의 상기 도전 재료 패턴 내에서 관련 위치를 판정하고, 이후에 I) 상기 도전 재료 패턴 내의 각 도전 사이트를 보정하기 위해 상기 제1 층에 대한 상기 이미지 데이터의 초기 세트를 수정하고 이미지 데이터의 보정된 세트를 생성하는 단계; II) 상기 제1 층 상의 사이트들에 접속되는 도전 재료 패턴 내의 사이트들을 갖는 적어도 제2 층에 대한 데이터의 초기 세트를 수정하고 - 상기 수정은 상기 제2 층에 대한 상기 이미지 데이터의 초기 세트와 상기 제1 층의 단계 b)에서 취득된 이미지 데이터의 비교에 기초함 - , 상기 제2 층에 대한 이미지 데이터의 보정된 세트를 생성하는 단계; III) 다른 층 상의 사이트들에 접속되는 도전 재료 패턴 내의 사이트들을 갖는 제2 층에 대한 데이터의 초기 세트를 수정하고 - 상기 수정은 상기 제2 층에 대한 상기 이미지 데이터의 초기 세트와 제조된 제2 층에서 취득된 이미지 데이터의 비교에 기초함 -, 상기 도전 재료 패턴 내의 각 도전 사이트를 보정하기 위해 상기 제1 층에 대한 상기 이미지 데이터의 초기 세트를 수정함으로써, 적어도 상기 제1 층 및 상기 제2 층에 대한 데이터의 보정된 세트를 생성하는 단계; 및 IV) 다수의 층에 대한 데이터의 초기 세트를 수정하고 - 각 층은 다른 층 상의 사이트들에 접속되는 도전 재료 패턴 내의 사이트들을 갖고, 상기 수정은 상기 다수의 층의 각각에 대한 이미지 데이터의 초기 세트들과 상기 다수의 층의 각각에 대한 제조된 층에서 취득된 이미지 데이터의 비교에 기초함 -, 상기 다수의 층의 각각 내의 도전 재료 패턴 내의 각 도전 사이트를 보정하기 위해 상기 다수의 층의 각각에 대한 상기 이미지 데이터의 초기 세트를 수정함으로써, 상기 다수의 층의 각각에 대한 보정된 세트를 생성하는 단계 로 이루어진 그룹으로부터 선택된 단계들을 수행하는 단계; 및 상기 적어도 하나의 층을 제조하기 위한 데이터의 보정된 세트를 이용하여 내부에 도전 사이트들을 갖는 적어도 하나의 층을 제조하는 단계를 포함하는 것을 특징으로 하는 방법.

Nonlinear image distortion correction in printed circuit board manufacturingThe present invention relates to a process for the fabrication for multilayer articles having electrical connections between conductor patterns on at least two layers, of the multilayer article. The process comprises at least the steps of: a) using an initial set of image data describing a first article or layer having a conductor pattern thereon, forming the first article or layer having a pattern of conductive material thereon; b) taking data of an image of the pattern of conductive material on the first article or layer; c) determining from the image of the pattern of conductive material on said first article or layer that are to be connected to sites on a pattern of conductive material on at least a second layer having conductor patterns thereon; and thereafter performing steps selected from the group consisting.A method that is used to make multi-layer articles wherein has electrical connection between the conductor fig at least two layers of multi-layer articles, said method comprising the steps of:a) the one group of initial view data that has the ground floor of conductor fig on it is described in use, forms the described ground floor of the figure that has conductive material on it;b) read in the data of the image of the conductive material figure on the described ground floor;c) determine the relative position of the position that the position on the conductive material figure on the second layer that will have conductive pattern with at least one on it in the conductive material figure on described ground floor is connected by the image of the conductive material figure on the described ground floor; andafter this, carry out the step from following step, selected:i) one group of original data of the described ground floor of correction is proofreaied and correct each conductive site in the conductive material figure, and produces one group of view data of proofreading and correct;ii) correction has one group of primary data of the second layer at least of the position in the conductive material figure that will be connected with the position on the described ground floor, described correction as relatively the carrying out of the data and the view data of getting, and produces one group of view data of proofreading and correct of the described second layer according to the initial set of diagrams of the second layer in the step b) of ground floor;iii) one group of primary data of a second layer of correction, a described second layer has the position in the conductive material figure that will be connected with the position on another layer, described correction is relatively carried out according to the view data of being got of the one group of original data of the described second layer and the manufactured second layer, and revise one group of original data of described ground floor, so that each conductive site in the conductive material figure is proofreaied and correct, so as to producing one group of data of proofreading and correct of the described at least ground floor and the described second layer; andiv) one group of primary data of correction several layers, every layer have will with the position in the conductive material figure that the position of another layer links to each other, described correction is relatively carried out according to the view data of being got of the manufacturing layer of each layer of one group of original data of each layer of described several layers and described several layers, and revise one group of original data of each layer of described several layers, thereby each conductive site in the conductive material figure in each layer of described several layers is proofreaied and correct, so as to one group of view data of proofreading and correct of each layer of producing described several layers; andbe used to make one group of one deck at least that the data manufacturing of proofreading and correct wherein has conductive site of described one deck at least then.

21102

생물학적 제제 제조업

특허

ko

en

신규한 파네실 트랜스퍼라제 저해제, 이의 제조 방법 및 이를 함유하는 약학 조성물(NOVEL FARNESYL TRANSFERASE INHIBITORS, THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONHS CONTAINING SAME)화학식 (Ⅰ)의 신규한 파네실 트랜스퍼라제, 이의 제조 방법 및 이를 함유하는 약학 조성물. 화학식 (Ⅰ)에서, R1은 Y-S-A1-이고(Y는 수소 원자, 아미노산 잔기, 지방산 잔기, 알킬 또는 알콕시카보닐 라디칼, 또는 R4가 페닐라디칼로 임의로 치환된 1 내지 4개의 탄소 원자를 포함하는 알킬 라디칼 또는 화학식 (Ⅱ)의 라디칼 [여기에서, A1, X1, Y1, R′1, R2, R′2 및 R은 하기와 같이 정의된다]인 R4-S라디칼이고, A1은 그룹 C(X1)(Y1)에 대해 α위치에서 아미노 또는 알킬아미노, 디알킬아미노, 알카닐아미노 또는 알콕시카보닐아미노 라디칼로 임의로 치환된, 1 내지 4개의 탄소 원자를 포함하는 알킬렌 라디칼이다. X1 및 Y1은 각각 수소 원자이거나, 이들이 연결되는 탄소 원자와 함께 C=O 그룹을 형성하며, R′1은 수소 또는 메틸이고, R2는 히드록시, 알콕시, 머캅토, 알킬티오, 알킬설피닐 또는 알킬설포닐로 임의로 치환된 1 내지 6개의 탄소 원자를 포함하는 알킬, 알케닐 또는 알키닐 라디칼이고, R2가 히드록시 라디칼로 치환된 알킬 라디칼인 가정하에 R2는 α위치에 카복시 라디칼을 갖는 락톤을 형성할 수 있으며, R′2는 수소 또는 메틸이고, R은 수소 원자 또는 임의로 치환된 알킬 라디칼 또는 임의로 치환된 페닐 라디칼이며, 이는 라디칼(a)가 나프틸 고리의 위치 5 또는 6에 있다는 조건하에서이다. 신규한 생성물은 항암성을 갖는다.화학식(Ⅰ)의 신규한 생성물. [화학식 Ⅰ] [이미지] 상기식에서, R1은 Y-S-A1-의 라디칼[여기에서, Y는 수소 원자 또는 아미노산 잔기 또는 지방산 잔기 또는 알킬 또는 알킬 또는 알콕시카보닐 라디칼 또는 R4-S 라디칼(여기에서, R4는 1 내지 4개의 탄소 원자를 함유하고 페닐 라디칼로 임의로 치환된 알킬 라디칼, 또는 화학식(Ⅱ)의 라디칼: [화학식 Ⅱ] [이미지] 을 나타낸다)을 나타내고, A1은 1 내지 4개의 탄소 원자를 함유하고, C(X1)(Y1) 그룹에 대한 α위치에서 아미노 라디칼, 1 내지 6개의 잭쇄 또는 측쇄 탄소 원자를 함유하는 알킬아미노 라디칼, 각각의 알킬부가 1 내지 6개의 직쇄 또는 측쇄 탄소 원자를 함유하는 디알킬아미노 라디칼, 1 내지 6개의 직쇄 도는 측쇄 탄소 원자를 함유하는 알카노일아미노 라디칼 또는 알킬부가 1 내지 6개의 직쇄 또는 측쇄 탄소 원자를 함유하는 알콕시카보닐아미노 라디칼로 임의로 치환된 직쇄 또는 측쇄 알킬렌 라디칼을 나타내며, X1 및 Y1은 각각 수소 원자를 나타내거나 이들이 결합되는 탄소 원자와 함께 C=O 그룹을 형성하며, R′1은 수소 원자 또는 메틸 라디칼을 나타내며, R2는 1 내지 6개의 탄소 원자를 함유하고, 히드록실 라디칼, 1 내지 4개의 탄소 원자를 함유하는 알콕시 라디칼, 머캅토 라디칼, 1 내지 4개의 탄소 원자를 함유하는 알킬티오 라디칼, 1 내지 4개의 탄소 원자를 함유하는 알킬설피닐 라디칼 또는 1 내지 4개의 탄소 원자를 함유하는 알킬설포닐 라디칼로 임의로 치환된 직쇄 또는 측쇄 알킬, 알케닐 또는 알키닐 라디칼을 나타내며, R2가 히드록시 라디칼로 치환된 알킬 라디칼을 나타낼 때, R2는 α위치에 카복시 라디칼을 갖는 락톤을 형성할 수 있으며, R'2 는 수소 원자 또는 메틸 라디칼을 나타내며, R은 수소 원자이거나 1 내지 6개의 탄소 원자를 함유하고, 1 내지 4개의 탄소 원자를 함유하는 알콕시 라디칼, 1내지 4개의 탄소 원자를 함유하는 알킬티오 라디칼, 1 내지 4개의 탄소 원자를 함유하는 알킬설피닐 라디칼, 1 내지 4개의 탄소 원자를 함유하는 알킬설포닐 라디칼, 페닐 라디칼, 페녹시 라디칼, 페닐티오 라디칼, 페닐설피닐 라디칼, 페닐설포닐 라디칼, 1 내지 4개의 탄소 원자를 함유하는 알킬아미노 라디칼 또는 각각의 알킬부가 1 내지 4개의 탄소 원자를 함유하는 디알킬아미노 라디칼로 임의로 치환된 알킬 라디칼, 또는 할로겐 원자 및 알킬, 알킬옥시, 알킬티오 또는 알카노일 라디칼중에서 선택된 하나 이상의 원자 또는 라디칼로 임의로 치환된 페닐 라디칼을 나타내며, 라디칼 [이미지] 는 나프틸환의 5- 또는 6-위치에 있다.

Novel farnesyl transferase inhibitors, their preparation and pharmaceutical compositions containing sameThis invention relates to transferase inhibitors of the formula (I), their preparation, and pharmaceutical compositions containing them. (I) In formula (I), R1 is Y-S-A1-(Y is a hydrogen atom, an amino acid residue, a fatty acid residue, an alkyl radical, an alkoxycarbonyl radical, or an R4-S- radical in which R4 is an alkyl radical containing 1 to 4 carbon atoms optionally substituted by a phenyl radical or a radical of the formula (II)(II) in which A1 is an alkylene radical containing 1 to 4 carbon atoms optionally substituted at the position alpha in the grouping >C(X1)(Y1) with an amino, alkylamino, dialkylamino, alkanoylamino, or alkoxycarbonylamino radical); X1 and Y1 are each a hydrogen atom or form, together with the carbon atom to which they are connected, a >C=O grouping; R'1 is hydrogen or methyl; R2 is an alkyl, alkenyl or an alkynyl radical containing 1 to 6 carbon atoms optionally substituted by a hydroxyl, alkoxy, mercapto, alkylthio, alkylsulphinyl, or alkylsulphonyl, wherein when R2 is an alkyl radical substituted by a hydroxyl radical, R2 can form a lactone with the carboxyl radical at the alpha position; R'2 is hydrogen or methyl; and R is a hydrogen atom or an optionally substituted alkyl radical or an optionally substituted phenyl radical; and the radical is in position 5 or 6 of the naphthyl ring. These compounds have anti-cancer properties.The novel cpd shown in the general formula i: in general formula (i), r 1represent general formula y-s-a 1-shown in group, wherein y represents hydrogen atom, or the residue of amino acid whose rest part or lipid acid or alkyl or carbalkoxy or r wherein 4represent c 1-4alkyl, the radicals r that depends on the needs and replaced by group shown in phenyl or the following general formula 4-s- a in the formula 1, x 1, r 1', r 2, r 2' with r as giving a definition a 1represent straight or branched c 1-4alkylidene group is at group＞c (x 1) (y 1) the α position can depend on the needs and replaced by following groups: amino, straight or branched c 1-6alkylamino, wherein each moieties is c 1-6the straight or branched dialkyl amido of alkyl, straight or branched c 1-6alkanoyl amido or wherein moieties be straight or branched c 1-6the alkoxycarbonyl amido of alkyl, x 1and y 1represent hydrogen atom or the two together with forming group＞c=o, r jointly respectively with its bonded carbon atom 1' represent hydrogen atom or methyl, r 2representative can be determined on a case-by-case basis by hydroxyl, c 1-4alkoxyl group, sulfydryl, c 1-4alkylthio, c 1-4alkyl sulphinyl or c 1-4the c that alkyl sulphonyl replaces 1-6straight or branched alkyl, alkenyl or alkynyl are worked as r 2during alkyl that representative is replaced by hydroxyl, r 2can form lactone, r with α position carboxyl 2' the c that represents hydrogen atom or methyl, r to represent hydrogen atom or can be replaced by following groups 1-6alkyl: c 1-4alkoxyl group, c 1-4alkyl sulfide, c 1-4alkyl sulfenyl, c 1-4alkyl sulfonyl, phenyl, phenoxy group, thiophenyl, phenyl sulfinyl, benzene sulfonyl, c 1-4alkylamino, wherein each alkyl all contains the dialkyl amido of 1-4 carbon atom, perhaps can be by the one or more atom of hydrogen atom and alkyl, alkoxyl group, alkylthio or alkanoyl or phenyl that group replaces of being selected from, and condition is a group be in 5 or 6 that naphthalene is examined.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

트립토판 2,3-디옥시제나제(Tryptophan 2,3-dioxygenase)의 억제제 (Inhibitors of Tryptophan 2,3-dioxygenase)이 발명은 하기 화학식 I의 화합물에 관한 것으로, 특히 하기 화학식 I의 화합물, 이의 약학적으로 허용되는 거울상 이성질체(enantiomers), 또는 이들의 염이다. 본원 발명은 트립토판 2,3-디옥시게나아제(Tryptophan 2,3-dioxygenase)의 억제제로 사용되는 하기 화학식 I의 상기 화합물들의 용도에 관한 것이다. 본원 발명은 또한 암과 중추 신경계 질환 또는 중추 신경계 장애에 대한 치료 및 예방에 사용되는 하기 화학식 I의 상기 화합물들의 용도에 관한 것이다. 이들 치료 및 예방에 하기 화학식 I의 상기 화합물들은 단독 또는 다른 치료법과 같이 사용될 수 있다. [화학식 I][이미지]아래 화학식 I의 화합물 또는 약학적으로 허용되는 이들의 염. [화학식 I][이미지]위 화학식 I에서 R1은 수소 또는 불소 원자이고, ,R2는 수소 또는 불소 원자이며, 여기서 단 R1이 불소 원자이면 R2는 수소이고, R1이 수소이면, R2는 불소 원자이다R3은 수소, 할로겐, (C1-C6)알킬 및 (C1-C6)알콕시로 구성된 그룹으로부터 선택되는 어느 하나이고, R4는 수소, 할로겐, (C1-C6)알킬 및 (C1-C6)알콕시로 구성된 그룹으로부터 선택되는 어느 하나이며, R5는 수소, 할로겐, (C1-C6)알킬 및 (C1-C6)알콕시로 구성된 그룹으로부터 선택되는 어느 하나이고, R6은 수소, 할로겐, (C1-C6)알킬 및 (C1-C6)알콕시로 구성된 그룹으로부터 선택되는 어느 하나이며, A는 아래의 그룹으로부터 선택되는 어느 하나이고:[이미지],R7은 아래의 그룹으로부터 선택되는 어느 하나이며:(a) 수소,(b) 히드록시(C1-C6)알킬옥시,(c) 히드록시(C1-C6)알킬,(d) 디[(C1-C6)알킬]아미노(C1-C6)알킬,(e) 아미노카보닐(C1-C6)알킬,(f) 아미노(C1-C6)알킬,(g) (C6-C10)아릴(C1-C6)알킬,(h) (C3-C7)시클로알킬(C1-C6)알킬,(i) (C3-C7)시클로알킬,(j) (C2-C7)헤테로시클로알킬(C1-C6)알킬,(k) (C2-C7)헤테로시클로알킬,(l) (C1-C9)헤테로아릴(C1-C6)알킬,(m) (C1-C6)알킬,(n) (C1-C6)알콕시카보닐(C1-C6)알킬,(o) (C1-C6)알콕시(C1-C6)알킬,(p) (C1-C5)헤테로아릴,(q) (C1-C6)알킬옥시카보닐(C1-C6)알킬R7은 특히 할로겐, 히드록시, 아미노, 시아노, 히드록시(C1-C6)알킬, 디[(C1-6C)알킬]아미노(C1-C6)알킬, (C6-C10)아릴, (C3-C7)시클로알킬, (C2-C7)헤테로시클로알킬, (C1-C6)알킬, (C1-C6)알킬카보닐, (C1-C6)알킬옥시카보닐, 아미노술포닐, (C1-C6)알킬술포닐, (C1-C6)알킬아미노티오카보닐, (C1-C6)알킬아미노카보닐 또는 (C1-C6)알콕시로부터 선택되는 하나 또는 그 이상의 그룹으로 선택적 치환될 수 있다. R8은 아래 그룹으로부터 선택되는 어느 하나이다:(a) 수소(b) (C1-C6)알킬,R7 및 R8은 또한 이들이 결합된 N 원자와 함께, 하나 이상의 할로겐, 아미노 또는 히드록시(C1-C6)알킬기로 선택적 치환된 (C1-C5)헤테로알릴 또는 (C2-C7)헤테로시클로아릴을 형성할 수 있다.R9는 아래 그룹으로부터 선택되는 어느 하나이고:(a) 수소(b) (C1-C6)알킬,R10은 아래 그룹으로부터 선택되는 어느 하나이다:(a) 수소,(b) (C1-C6)알킬 c) 히드록시(C1-C6)알킬,(d) (C6-C10)아릴(C1-C6)알킬,(e) (C3-C7)시클로알킬(C1-C6)알킬,(f) (C3-C7)시클로알킬,(g) (C2-C7)헤테로시클로알킬(C1-C6)알킬,(h) (C2-C7)헤테로시클로알킬(i) (C1-C6)알콕시(C1-C6)알킬,(j) (C1-C6)알킬티오(C1-C6)알킬,(k) (C1-C6)알킬술포닐(C1-C6)알킬,(l) (C1-C6)알콕시카보닐(C1-C6)알킬,(m) (C1-C6)알킬아미노(C1-C6)알킬,(n) (C1-C5)헤테로아릴(C1-C6)알킬,(o) N(R101R102),R10은 특히 할로겐, 히드록시, 아미노, 시아노, (C1-C6)알킬 또는 (C2-C7)헤테로시클로알킬로부터 선택된 하나 또는 그 이상으로 치환될 수 있다. R101은 아래 그룹으로부터 선택되는 어느 하나이고:(a) 수소,(b) (C1-C6)알킬, R102는 아래 그룹으로부터 선택되는 어느 하나이다(a) 수소,(b) (C1-C6)알킬.

INHIBITORS OF TRYPTOPHAN 2,3-DIOXYGENASEThe invention relates to a compound of Formula I: Formula I, or pharmaceutically acceptable enantiomers, or salts thereof. The invention also relates to the use of compounds of Formula (I) as selective inhibitors of tryptophan 2,3-dioxygenase. The invention also relates to the use of the compounds of Formula (I) for the treatment or prevention of cancer and central nervous system disease or disorder, either as a single agent or in combination with other therapies.The compound of formulas i:or its pharmaceutically acceptable salt, in which:r1selected from hydrogen or fluorine,r2selected from hydrogen or fluorine,on condition that working as r1when being fluorine, r2it is hydrogen；work as r1when being hydrogen, r2it is fluorine,r3selected from hydrogen, halogen, (1-6c) alkyl or (1-6c) alkoxy,r4selected from hydrogen, halogen, (1-6c) alkyl or (1-6c) alkoxy,r5selected from hydrogen, halogen, (1-6c) alkyl or (1-6c) alkoxy,r6selected from hydrogen, halogen, (1-6c) alkyl or (1-6c) alkoxy,a is selected from:r7it is selected from:a) hydrogen,b) hydroxyl (1-6c) alkoxy,c) hydroxyl (1-6c) alkyl,d) two [(1-6c) alkyl] amino (1-6c) alkyl,e) amino carbonyl (1-6c) alkyl,f) amino (1-6c) alkyl,g) (6-10c) aryl (1-6c) alkyl,h) (3-7c) naphthenic base (1-6c) alkyl,i) (3-7c) naphthenic base,j) (2-7c) heterocyclylalkyl (1-6c) alkyl,k) (2-7c) heterocyclylalkyl,l) (1-9c) heteroaryl (1-6c) alkyl,m) (1-6c) alkyl,n) (1-6c) alkoxy carbonyl (1-6c) alkyl,o) (1-6c) alkoxy (1-6c) alkyl,p) (1-5c) heteroaryl,q) (1-6c) alkoxy carbonyl (1-6c) alkyl,r7optionally be substituted with one or more groups selected from the following: halogen, hydroxyl, amino, cyano, hydroxyl (1-6c) alkyl, two [(1-6c) alkyl] amino (1-6c) alkyl, (6-10c) aryl, (3-7c) naphthenic base, (2-7c) heterocyclylalkyl, (1-6c) alkane base, (1-6c) alkyl-carbonyl, (1-6c) alkoxy carbonyl, amino-sulfonyl, (1-6c) alkyl sulphonyl, (1-6c) alkyl amino thiocarbonyl, (1-6c) alkyl amino-carbonyl or (1-6c) alkoxy,r8it is selected from:a) hydrogen,b) (1-6c) alkyl,or r7and r8n atom connected to them is formed together (1-5c) heteroaryl or (2-7c) heterocyclylalkyl, optionally replaced by one or more halogens, amino or hydroxyl (1-6c) alkyl,r9it is selected from:a) hydrogen,b) (1-6) alkyl),r10it is selected from:a) hydrogen,b) (1-6c) alkyl,c) hydroxyl (1-6c) alkyl,d) (6-10c) aryl (1-6c) alkyl,e) (3-7c) naphthenic base (1-6c) alkyl,f) (3-7c) naphthenic base,g) (2-7c) heterocyclylalkyl (1-6c) alkyl,h) (2-7c) heterocyclylalkyl,i) (1-6c) alkoxy (1-6c) alkyl,j) (1-6c) alkylthio group (1-6c) alkyl,k) (1-6c) alkyl sulphonyl (1-6c) alkyl,l) (1-6c) alkoxy carbonyl (1-6c) alkyl,m) (1-6c) alkyl amino (1-6c) alkyl,n) (1-5c) heteroaryl (1-6c) alkyl,o)n(r101r102),r10optionally be substituted with one or more groups selected from the following: halogen, hydroxyl, amino, cyano, (1-6c) alkyl or (2-7c) heterocyclylalkyl,r101it is selected from:a) hydrogen,b) (1-6c) alkyl,r102it is selected from:a) hydrogen,b) (1-6c) alkyl.

20111

석유화학계 기초 화학 물질 제조업

특허

ko

en

신규 설폰아미드 유도체본 발명은 독성이 적고, 강한 튜뷸린 중합저해작용을 갖는 하기의 설폰아미드유도체를 제공하는 것으로서, 이 화합물을 유효성분으로 하는 의약은 면역계의 이상을 시정하고, 염증성 류머티즘 등의 류머티즘의 예방 또는 치료제 또는 항암제로서 유용하다. 즉 본 발명은 하기 일반식(1)로 나타내어지는 설폰아미드 유도체 또는 그 약리학적으로 허용되는 염 및 그 의약물으로서의 용도에 관한 것이다: 식중, 바람직하게는 R1은 저급알콕시기, R2, R3, R4, R5 및 R6은 독립적으로 동일하거나 상이할 수 있으며, 각각 독립적으로 수소원자, 할로겐원자, 니트로기, 저급알킬기, 임의로 치환된 아미노기 또는 알킬아미노기를 가리킨다. A는 (1) 적어도 1개의 질소원자를 갖는 복소5원환기를 가리키며, 상기 복소5원환은 임의로 치환될 수 있고, 또한 5원환중에 추가로 헤테로원자로서 질소, 산소 및 황원자로부터 선택되는 원자를 포함할 수 있거나(단, 트리아졸을 제외한다), (2) 임의로 치환될 수 있는 지환식탄화수소기 또는 (3) 환중에 적어도 1개의 질소원자를 포함하는 지환식탄화수소기(상기 환중에 헤테로원자로서 추가로 질소, 산소, 또는 황원자를 포함할 수 있다)중에서 어느 하나의 기를 가리킨다.하기 일반식(1)로 나타내지는 설폰아미드 유도체 또는 그의 약리학적으로 허용되는 염: [이미지] 식중, R1, R2는 동일하거나 상이할 수 있으며, 각각 독립적으로 수소원자, 할로겐원자, 저급알킬기, 저급알콕시기, 니트로기, 수산기, 시아노기, 탄소수 1∼8의 아실기, 임의로 치환될 수 있는 페녹시기 또는 임의로 치환될 수 있는 아미노기를 나타내고; R3, R4는 동일하거나 상이할 수 있으며, 각각 독립적으로 수소원자, 할로겐원자, 저급알킬기, 저급알콕시기, 니트로기, 수산기, 하기 일반식(2): -(CH2)n-CO-R7 (2) (식중, R7은 수소원자, 수산기, 저급알킬기, 저급알콕시기 또는 임의로 치환될 수 있는 아미노기를 나타내며, n은 0∼5의 정수를 의미한다)로 나타내어지는 기, 하기 일반식(3): -(CH2)n-B (3) (식중, B는 이미다졸릴기, 트리아졸릴기, 테트라졸릴기 또는 임의로 치환될 수 있는 아미노기를 나타내며, n은 0∼5의 정수를 의미한다)로 나타내어지는 기, 하기 일반식(4): [이미지] (식중, R8은 저급알킬기, 1 또는 2개의 히드록시기로 치환된 탄소수 1∼5인 알킬기, 탄소수 1∼5인 알콕시카르보닐기로 치환된 탄소수 1∼5인 알킬기, 탄소수 1∼5인 아실기 또는 피리딜기를 의미하고, R9는 저급알킬기 또는 히드록시기를 의미하며, a는 0∼3의 정수를 의미하고, n은 0∼6의 정수를 의미한다)로 나타내어지는 기, 하기 일반식(5): [이미지] (식중, R9는 상기와 동일하고, b는 0∼3의 정수를 의미하며, n은 0∼6의 정수를 의미한다)로 나타내어지는 기, 하기 일반식(6): [이미지] 〔식중, R9는 상기와 동일하고, c는 0∼3의 정수, n은 0∼6의 정수를 의미하고, Q는 산소원자, 황원자 또는 하기 일반식(7): [이미지] (식중, d는 1 또는 2를 의미한다)로 나타내어지는 기를 의미한다 〕으로 나타내어지는 기, 하기 일반식(8): -(CH2)n-NR10R11 (8) (식중, R10, R11은 동일하거나 또는 상이할 수 있으며, 각각 독립적으로 수소원자, 저급알킬기, 아미노기상에 임의로 치환될 수 있는 아미노저급알킬기, n은 0∼6의 정수를 의미한다)로 나타내어지는 기, 하기 일반식(9): -(CH2)n-S(O)e-R12 (9) (식중, R12는 수소원자, 저급알킬기, 아릴기, 아르알킬기 또는 임의로 치환될수 있는 아미노기를 의미하고, n은 0∼6의 정수, e는 0∼3의 정수를 의미한다)로 나타내어지는 기, 또는 하기 일반식(10): -(CH2)n-OR13 (10) (식중, R13은 수소원자, 저급알킬기, 아실기, 인산기 또는 임의로 치환될 수 있는 아미노알킬기를 의미하고, n은 1∼6의 정수를 의미한다)로 나타내어지는 기를 나타내며, R5, R6은 동일하거나 상이할 수 있으며, 각각 독립적으로 수소원자, 할로겐원자, 저급알킬기, 아실기 또는 임의로 치환될 수 있는 아미노기를 나타내고; A는 (1) 적어도 1개의 질소원자를 갖는 복소5원환기를 나타내고, 상기 복소 5원환은 임의로 치환될 수 있고, 5원환중에 추가로 헤테로원자로서 질소, 산소 및 황원자로부터 선택되는 원자를 포함할 수 있거나(단, 트리아졸을 제외한다), (2) 임의로 치환될 수 있는 지환식탄화수소기 또는 (3) 환중에 적어도 1개의 질소원자를 포함하는 지환식탄화수소기(상기 환중에는 헤테로원자로서 추가로 질소, 산소, 또는 황원자를 포함할 수 있다)중에서 어느 하나의 기를 나타낸다.

Novel sulfonamide derivativesThe present invention provides a method for inhibiting tubulin polymerization and for treating rheumatism by administering to individuals in need thereof an effective amount of sulfonamide derivatives represented by the general formula (1):wherein R1 and R2 may be the same or different and each independently represents a hydrogen atom, a halogen atom, a lower alkyl group, a lower alkoxy group, a nitro group, a hydroxy group; each R3, R4, R5 and R6 represents a hydrogen atom; A represents any group of (1) 5-membered heterocyclic group which is optionally substituted by a lower alkyl group or phenyl group, whose ring members include at least 1 nitrogen atom and may include any atom(s) selected from the group consisting of nitrogen atom, oxygen atom, and sulfur atom, (2) an alicyclic group which is optionally substituted by a lower alkyl group or phenyl group, and (3) an alicyclic group whose ring members include at least 1 nitrogen atom and may include any atom(s) selected from the group consisting of nitrogen atom, oxygen atom, and sulfur atom, or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable excipient or carrier. The sulfonamide derivatives have low toxicity and a potent effect of inhibiting tubulin polymerization.By the sulphone amide derivative and the acceptable salt of medicine thereof of general formula (1) expression; r wherein 1, r 2can be identical or different and each represent hydrogen atom, halogen atom, low-carbon alkyl, low-carbon alkoxy, nitro, hydroxyl, cyano group, c respectively 1-c 8acyl group, the phenoxy group that replaces arbitrarily or the amino that replaces arbitrarily; r 3, r 4can be identical or different and each represent hydrogen atom respectively, halogen atom, low-carbon alkyl, low-carbon alkoxy, nitro, hydroxyl, the group shown in following general formula (2): -(ch 2) n-co-r 7(2) (r wherein 7the amino of representing hydrogen atom, hydroxyl, low-carbon alkyl, low-carbon alkoxy or replacing arbitrarily, and n is the integer of 1-5), the group shown in following general formula (3): -(ch 2) n-b (3) (the b amino representing imidazolyl, triazolyl, tetrazyl or replace arbitrarily wherein, n are between the 1-5 integer) arbitrarily, the group shown in following general formula (4): (r wherein 8the c that represents low-carbon alkyl, replaces by 1 or 2 hydroxyl 1-c 5alkyl, by c 1-c 5the c that carbalkoxy replaces 1-c 5alkyl, c 1-c 5acyl group or pyridyl; r 9represent a low-carbon alkyl or hydroxyl; a and n are respectively the arbitrary integer of 0-3 and 0-6), the group shown in following general formula (5): (r wherein 9represent a low-carbon alkyl or hydroxyl; b and n are respectively the arbitrary integer of 0-3 and 0-6), the group shown in following general formula (6): (r wherein 9represent a low-carbon alkyl or hydroxyl; c and n are respectively the arbitrary integer of 0-3 and 0-6; group shown in q represention oxygen atom, sulphur atom or the following general formula (7): (wherein d is 1 or 2)), the group shown in following general formula (8): -(ch 2) n-nr 10r 11(8) (r wherein 10, r 11the amino low-carbon alkyl that can represent hydrogen atom, low-carbon alkyl identical or different and independently of one another or replace arbitrarily; n is the arbitrary integer of 0-6), the group shown in following general formula (9): -(ch 2) n-s (o) e-r 12(9) (r wherein 12the amino of representing hydrogen atom, low-carbon alkyl or aryl, aralkyl or replacing arbitrarily; e and n are respectively the arbitrary integer of 0-3 and 0-6), or the group shown in following general formula (10): -(ch 2) n-or 13(10) (r wherein 13represent hydrogen atom, low-carbon alkyl or acyl group, aminoalkyl group phosphate-based or that replace arbitrarily; and n is the arbitrary integer of 1-6), r 5, r 6the amino that can be identical or and does not independently of one another represent hydrogen atom, halogen atom, low-carbon alkyl, acyl group or replace arbitrarily; a represents any a group in following group: the 5-membered heterocycles group (except the triazole) that (1) replaces arbitrarily, the ring atom of this 5-membered heterocycles comprises at least one nitrogen-atoms, and can comprise any atom that is selected from the group of forming by nitrogen-atoms, sauerstoffatom and sulphur atom, (2) alicyclic hydrocarbon radical that replaces arbitrarily, (3) a kind of alicyclic hydrocarbon radical, atom on this alicyclic hydrocarbon basic ring comprises at least one nitrogen-atoms, and can comprise any atom that is selected from the group of being made up of nitrogen-atoms, sauerstoffatom and sulphur atom.

28112

변압기 제조업

특허

ko

en

3상 전원 전압을 자동으로 조정하는 변압 장치3상 전원의 전압을 자동으로 조정하는 변압 장치는 3개의 입력 단자와, 3개의 출력 단자와, Y 결선 3상 변압기와, 스위치 그룹과, 스위치 전환 회로를 포함한다. 상기 3개의 입력 단자는 상기 3상 전원의 3개의 메인 라인에 각각 접속되고, 상기 3개의 출력 단자는 부하 설비에 접속된다. 상기 Y 결선 3상 변압기는 코어와, R상 권선 회로, S상 권선 회로, 및 T상 권선 회로를 포함한다. 상기 R상 권선 회로에서는 R상 메인 권선, R상 제1 보조 권선, R상 제1 스위치, R상 제2 보조 권선, 및 R상 제3 보조 권선이 이 순서대로 상기 입력 단자와 중성점(O) 사이에 직렬로 접속되고, 상기 출력 단자는 상기 R상 메인 권선의 타단에 접속된다. 상기 R상 제2 스위치는 상기 R상 제1 보조 권선과 R상 제1 스위치의 직렬 회로에 병렬로 접속된다. 상기 R상 제3 스위치는 상기 R상 제1 보조 권선, R상 제1 스위치, 및 R상 제2 보조 권선의 직렬 회로에 병렬로 접속된다. 상기 R상 제4 스위치는 상기 R상 제2 보조 권선과 R상 제3 보조 권선의 직렬 회로에 병렬로 접속된다. 상기 스위치 전환 회로는 상기 출력 단자의 전압 레벨에 기초해 스위치들을 제어하여 제1 내지 제4 모드 중에서 선택적으로 전환하게 한다.3상 전원의 전압을 자동으로 조정하는 변압 장치에 있어서, 3개의 입력 단자(Rin, Sin, Tin)와, 3개의 출력 단자(Rout, Sout, Tout)와, Y 결선 3상 변압기와, 스위치 그룹과, 스위치 전환 회로 를 포함하며, 상기 3개의 입력 단자(Rin, Sin, Tin)는 상기 3상 전원의 3개의 메인 라인에 각각 접속되고, 상기 3개의 출력 단자(Rout, Sout, Tout)는 부하 설비에 접속되며, 상기 Y 결선 3상 변압기는 코어와, R상 권선 회로, S상 권선 회로, 및 T상 권선 회로를 포함하고, 상기 R상 권선 회로에서는 R상 메인 권선, R상 제1 보조 권선, R상 제1 스위치, R상 제2 보조 권선, 및 R상 제3 보조 권선이 이 순서대로 상기 입력 단자와 중성점 O 사이에 직렬로 접속되고, 상기 출력 단자는 상기 R상 메인 권선의 타단에 접속되며, 상기 스위치 그룹의 R상 제2 스위치는 상기 R상 제1 보조 권선과 R상 제1 스위치의 직렬 회로에 병렬로 접속되고, 상기 스위치 그룹의 R상 제3 스위치는 상기 R상 제1 보조 권선, R상 제1 스위치, 및 R상 제2 보조 권선의 직렬 회로에 병렬로 접속되며, 상기 스위치 그룹의 R상 제4 스위치는 상기 R상 제2 보조 권선과 R상 제3 보조 권선의 직렬 회로에 병렬로 접속되고, 상기 S상 권선 회로에서는 S상 메인 권선, S상 제1 보조 권선, S상 제1 스위치, S상 제2 보조 권선, 및 S상 제3 보조 권선이 이 순서대로 상기 입력 단자와 중성점 O 사이에 직렬로 접속되고, 상기 출력 단자 Sout는 상기 S상 메인 권선의 타단에 접속되며, 상기 스위치 그룹의 S상 제2 스위치는 상기 S상 제1 보조 권선과 S상 제1 스위치의 직렬 회로에 병렬로 접속되고, 상기 스위치 그룹의 S상 제3 스위치는 상기 S상 제1 보조 권선, S상 제1 스위치, 및 S상 제2 보조 권선의 직렬 회로에 병렬로 접속되며, 상기 스위치 그룹의 S상 제4 스위치는 상기 S상 제2 보조 권선과 S상 제3 보조 권선의 직렬 회로에 병렬로 접속되고, 상기 T상 권선 회로에서는 T상 메인 권선, T상 제1 보조 권선, T상 제1 스위치, T상 제2 보조 권선, 및 T상 제3 보조 권선이 이 순서대로 상기 입력 단자와 중성점 O 사이에 직렬로 접속되고, 상기 출력 단자는 상기 T상 메인 권선의 타단에 접속되며, 상기 스위치 그룹의 T상 제2 스위치는 상기 T상 제1 보조 권선과 T상 제1 스위치의 직렬 회로에 병렬로 접속되고, 상기 스위치 그룹의 T상 제3 스위치는 상기 T상 제1 보조 권선, T상 제1 스위치, 및 T상 제2 보조 권선의 직렬 회로에 병렬로 접속되며, 상기 스위치 그룹의 T상 제4 스위치는 상기 T상 제2 보조 권선과 T상 제3 보조 권선의 직렬 회로에 병렬로 접속되고, 상기 스위치 전환 회로는 상기 출력 단자 또는 입력 단자의 전압 레벨에 기초해 스위치들을 제어하여 제1 내지 제4 모드중에서 선택적으로 전환하게 하며, 상기 제1 모드에서는 각 상의 제1 스위치가 온이 되고, 각 상의 제2, 제3, 제4 스위치는 오프가 되며, 상기 제2 모드에서는 각 상의 제2 스위치가 온이 되고, 각 상의 제1, 제3, 제4 스위치는 오프가 되며, 상기 제3 모드에서는 각 상의 제3 스위치가 온이 되고, 각 상의 제1, 제2, 제4 스위치는 오프가 되며, 상기 제4 모드에서는 각 상의 제4 스위치가 온이 되고, 각 상의 제1, 제2, 제3 스위치는 오프가 되며, 상기 스위치 전환 회로는 각 상의 전압 순시값이 제로가 되는 타이밍에서 각 상의 스위치들을 온/오프 전환하여 모드를 전환하게 하는 것인 변압 장치.

Transforming apparatus for automatically adjusting three-phase power supply voltageA transforming apparatus automatically adjusting the voltage of three-phase power supply comprising three input terminals, three output terminals, a Y-connection three-phase transformer, a switch group, and a switch switching circuit. The three input terminals are respectively connected to three main lines of the three-phase power supply, and the three output terminals are connected to a load installation. The Y-connection three-phase transformer comprises a core, an R-phase winding circuit, an S-phase winding circuit, and a T-phase winding circuit. In the R-phase winding circuit, an R-phase main winding, an R-phase first auxiliary winding, an R-phase first switch, an R-phase second auxiliary winding, and an R-phase third auxiliary winding are serially connected in that order between the input terminal Rin and a neutral point O, the output terminal Rout being connected to the other end of the R-phase main winding. An R-phase second switch is connected in parallel with a series circuit of the R-phase first auxiliary winding and the R-phase first switch. An R-phase third switch is connected in parallel with a series circuit of the R-phase first auxiliary winding, the R-phase first switch, and the R-phase second auxiliary winding. An R-phase fourth switch is connected in parallel with a series circuit of the R-phase second auxiliary winding and the R-phase third auxiliary winding. The switch switching circuit controls the switches based on the voltage levels of the output terminals to switch between first to fourth modes in an alternative manner.A transforming apparatus automatically adjusting the voltage of a three-phase power supply comprising: three input terminals (Rin, Sin, Tin); three output terminals (Rout, Sout, Tout); a Y-connection three-phase transformer; a switch group; and a switch switching circuit, wherein: the three input terminals (Rin, Sin, Tin) are respectively connected to three main lines of the three-phase power supply; the three output terminals (Rout, Sout, Tout) are connected to a load installation; the Y-connection three-phase transformer comprises a core, an R-phase winding circuit, an S-phase winding circuit, and a T-phase winding circuit; in the R-phase winding circuit, an R-phase main winding, an R-phase first auxiliary winding, an R-phase first switch, an R-phase second auxiliary winding, and an R-phase third auxiliary winding are serially connected in that order between the input terminal Rin and a neutral point O, the output terminal Rout being connected to the other end of the R-phase main winding; an R-phase second switch of the switch group is connected in parallel with a series circuit of the R-phase first auxiliary winding and the R-phase first switch; an R-phase third switch of the switch group is connected in parallel with a series circuit of the R-phase first auxiliary winding, the R-phase first switch, and the R-phase second auxiliary winding; an R-phase fourth switch of the switch group is connected in parallel with a series circuit of the R-phase second auxiliary winding and the R-phase third auxiliary winding; in the S-phase winding circuit, an S-phase main winding, an S-phase first auxiliary winding, an S-phase first switch, an S-phase second auxiliary winding, and an S-phase third auxiliary winding are serially connected in that order between the input terminal Sin and the neutral point O, the output terminal Sout being connected to the other end of the S-phase main winding; an S-phase second switch of the switch group is connected in parallel with a series circuit of the S-phase first auxiliary winding and the S-phase first switch; an S-phase third switch of the switch group is connected in parallel with a series circuit of the S-phase first auxiliary winding, the S-phase first switch, and the S-phase second auxiliary winding; an S-phase fourth switch of the switch group is connected in parallel with a series circuit of the S-phase second auxiliary winding and the S-phase third auxiliary winding; in the T-phase winding circuit, a T-phase main winding, a T-phase first auxiliary winding, a T-phase first switch, a T-phase second auxiliary winding, and a T-phase third auxiliary winding are serially connected in that order between the input terminal Tin and the neutral point O, the output terminal Tout being connected to the other end of the T-phase main winding; a T-phase second switch of the switch group is connected in parallel with a series circuit of the T-phase first auxiliary winding and the T-phase first switch; a T-phase third switch of the switch group is connected in parallel with a series circuit of the T-phase first auxiliary winding, the T-phase first switch, and the T-phase second auxiliary winding; a T-phase fourth switch of the switch group is connected in parallel with a series circuit of the T-phase second auxiliary winding and the T-phase third auxiliary winding; the switch switching circuit controls the switches based on the voltage levels of the output terminals (Rout, Sout, Tout) or the input terminals (Rin, Sin, Tin) to switch between first to fourth modes in an alternative manner; in the first mode, the first switch of each phase is ON, and the second, third and fourth switches of each phase are OFF; in the second mode, the second switch of each phase is ON, and the first, third, and fourth switches of each phase are OFF; in the third mode, the third switch of each phase is ON, and the first, second, and fourth switches of each phase are OFF; in the fourth mode, the fourth switch of each phase is ON, and the first, second, and third switches of each phase are OFF; and the switch switching circuit switches on/off the switches of each phase at a timing that the voltage instantaneous value of the phase becomes zero to switch the modes.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

ＭＤＭ2-Ｐ-53 상호작용 억제제로서의 신규 Ｎ-치환된-피롤리딘본 발명은, 항암제로서 유용한 화학식 I의 화합물, 및 이의 거울상 이성질체, 약학적으로 허용가능한 염 및 에스터에 관한 것이다: [화학식 I] 상기 식에서, X, Y, R1, R2, R3, R3, R4, 및 R5는 본원에 기재된 바와 같다.하기 화학식 I의 화합물, 또는 이의 약학적으로 허용가능한 염 또는 에스터:[화학식 I]상기 식에서,X는 H, F, Cl, Br, I, 시아노, 니트로, 에틴일, 사이클로프로필, 메틸, 에틸, 이소프로필, 비닐 및 메톡시로 이루어진 군으로부터 선택되고,Y는 독립적으로 H, F, Cl, Br, I, CN, OH, 니트로, 저급 알킬, 사이클로알킬, 저급 알콕시, 저급 알켄일, 사이클로알켄일, 저급 알킨일, 아릴, 헤테로아릴, 헤테로사이클, COOR', OCOR', CONR'R", NR'COR", NR"SO2R', SO2NR'R" 및 NR'R"로 이루어진 기로부터 선택된 1 내지 4개의 기이고, 이때,R' 및 R"는 독립적으로 H, 저급 알킬, 치환된 저급 알킬, 저급 사이클로알킬, 치환된 저급 사이클로알킬, 저급 알켄일, 치환된 저급 알켄일, 저급 사이클로알켄일, 치환된 저급 사이클로알켄일, 아릴, 치환된 아릴, 헤테로아릴, 치환된 헤테로아릴, 헤테로사이클, 또는 치환된 헤테로사이클로부터 선택되고,R' 및 R"는 또한, 독립적으로, 연결되어 치환된 또는 비치환된 사이클로알킬, 치환된 또는 비치환된 사이클로알켄일, 치환된 또는 비치환된 헤테로아릴 또는 치환된 또는 비치환된 헤테로사이클로부터 선택된 환형 구조를 형성할 수 있고,R1 및 R2중 하나는 저급 알킬, 치환된 저급 알킬, 저급 알켄일, 치환된 저급 알켄일, 아릴, 치환된 아릴, 헤테로아릴, 치환된 헤테로아릴, 헤테로사이클, 치환된 헤테로사이클, 사이클로알킬, 치환된 사이클로알킬, 사이클로알켄일 및 치환된 사이클로알켄일로 이루어진 군으로부터 선택되고, 다른 하나는 수소이고,R3 및 R4 중 하나는 저급 알킬, 치환된 저급 알킬, 저급 알켄일, 치환된 저급 알켄일, 아릴, 치환된 아릴, 헤테로아릴, 치환된 헤테로아릴, 헤테로사이클, 치환된 헤테로사이클, 사이클로알킬, 치환된 사이클로알킬, 사이클로알켄일, 및 치환된 사이클로알켄일로 이루어진 군으로부터 선택되고, 다른 하나는 수소이고, R5는 저급 알킬, 치환된 저급 알킬, -CH2(CH2)n-CHOH-R', -CH2(CH2)n-CHOH-CH2-(CH2)n-NR'R", -CH2(CH2)n-CO(CH2)nNR'R", -CO(CH2)n-R', -CO(CH2)n-NR'-(CH2)n-CHOH-R', -CO(CH2)n-NR'R", -(CH2)n-NR'SO2R", -COCH2(CH2)n-COOH, -(CH2)n-COOR', -(CH2)n-CONR'R", -CO(CH2)n-OR', -COCH2(CH2)n-SR', -COCH2(CH2)n-SOR', -COCH2(CH2)n-SO2R', -COCH2(CH2)n-COR', -COCH2(CH2)n-SO3H, -COCH2(CH2)n-SONR'R", -COCH2(CH2)n-SO2NR'R", -COCH2(CH2CH2O)m-(CH2)n-R', -COCH2(CH2CH2O)m-(CH2)n-OH, -COCH2(CH2CH2O)m-(CH2)n-OR', -COCH2(CH2CH2O)m-(CH2)n-NR'R", -COCH2(CH2CH2O)m-(CH2)n-NR'COR", -COCH2(CH2CH2O)m-(CH2)n-NR'SO2R", -COCH2(CH2CH2O)m-(CH2)n-COOH, -COCH2(CH2CH2O)m-(CH2)n-COOR', -COCH2(CH2CH2O)m-(CH2)n-CONR'R", -COCH2(CH2CH2O)m-(CH2)n-SO2R', -COCH2(CH2CH2O)m-(CH2)n-COR', -COCH2(CH2CH2O)m-(CH2)n-SONR'R", -COCH2(CH2CH2O)m-(CH2)n-SO2NR'R", -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-R', -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-OH, -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-OR', -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-NR'R", -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-NR'COR", -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-NR'SO2R", -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-COOH, -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-COOR', -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-CONR'R", -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-SO2R', -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-COR', -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-SONR'R", -COCH2(CH2)p-(CH2CH2O)m-(CH2)n-SO2NR'R", -COCH2-COR', -COCH2-SOR' 및 -COCH2SO2R'로 이루어진 군으로부터 선택되고, 이때, R' 및 R"은 상기와 같고,m, n, 및 p는 독립적으로 0 내지 6이다.

NOVEL N-SUBSTITUTED-PYRROLIDINES AS INHIBITORS OF MDM2-P-53 INTERACTIONSThere are provided compounds of the formula (I) wherein X, Y, R1, R2, R3, R3, R4, and R5 are as described herein and enantiomers and pharmaceutically acceptable salts and esters thereof which are useful as anticancer agents.A compound of the formula (I)whereinX is selected from the group consisting of H, F, CI, Br, I, cyano, nitro, ethynyl, cyclopropyl, methyl, ethyl, isopropyl, vinyl and methoxy,Y is one to four group(s) independently selected from the group consisting of H, F, CI, Br,I, CN, OH, nitro, lower alkyl, cycloalkyl, lower alkoxy, lower alkenyl, cycloalkenyl, lower alkynyl, aryl, heteroaryl, heterocycle, COOR', OCOR', CONR'R', NR'COR', NR'S02R',S02NR'R' and NR'R' whereinR' and R' are independently selected from H, lower alkyl, substituted lower alkyl, lower cycloalkyl, substituted lower cycloalkyl, lower alkenyl, substituted lower alkenyl, lower cycloalkenyl, substituted lower cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, or substituted heterocycleand in the case of R and R may independently link to form a cyclic structure selected from substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heteroaryl or substituted or unsubstituted heterocycle,one of Ri and R2 is selected from the group consisting of lower alkyl,substituted lower alkyl, lower alkenyl, substituted lower alkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, substituted heterocycle, cycloalkyl, substituted cycloalkyl, cycloalkenyl, and substituted cycloalkenyl and the other is hydrogen,one of R3 and R4 is selected from the group consisting of lower alkyl, substituted lower alkyl, lower alkenyl, substituted lower alkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, substituted heterocycle, cycloalkyl, substituted cycloalkyl, cycloalkenyl, and substituted cycloalkenyl and the other is hydrogen, R5 is selected from the group consisting of lower alkyl, substituted lower alkyl,-CH2(CH2)n-CHOH-R', -CH2(CH2)n-CHOH-CH2-(CH2)n-NR'R', -CH2(CH2)n-CO(CH2)nNR'R', -CO(CH2)n-R', -CO(CH2)n-NR'-(CH2)n-CHOH-R', -CO(CH2)n-NR'R', -(CH2)n-NR'S02R', -COCH2(CH2)n-COOH, -(CH2)n-COOR', -(CH2)n-CONR'R', -CO(CH2)n-OR',-COCH2(CH2)n-SR' , -COCH2(CH2)n-SOR' , -COCH2(CH2)n-S02R' , -COCH2(CH2)n-COR' , -COCH2(CH2)n-S03H, -COCH2(CH2)n-SONR'R', -COCH2(CH2)n-S02NR'R',-COCH2(CH2CH20)m-(CH2)n-R' , -COCH2(CH2CH20)m-(CH2)n-OH,-COCH2(CH2CH20)m-(CH2)n-OR', -COCH2(CH2CH20)m-(CH2)n-NR'R',-COCH2(CH2CH20)m-(CH2)n-NR'COR', -COCH2(CH2CH20)m-(CH2)n-NR'S02R',-COCH2(CH2CH20)m-(CH2)n-COOH, -COCH2(CH2CH20)m-(CH2)n-COOR',-COCH2(CH2CH20)m-(CH2)n-CONR'R', -COCH2(CH2CH20)m-(CH2)n-S02R',-COCH2(CH2CH20)m-(CH2)n-COR', -COCH2(CH2CH20)m-(CH2)n-SONR'R',-COCH2(CH2CH20)m-(CH2)n-S02NR'R', -COCH2(CH2)p-(CH2CH20)m-(CH2)n-R',-COCH2(CH2)p- (CH2CH20)m-(CH2)n-OH, -COCH2(CH2)p-(CH2CH20)m-(CH2)n-OR' ,-COCH2(CH2)p-(CH2CH20)m-(CH2)n-NR'R', -COCH2(CH2)p-(CH2CH20)m-(CH2)n-NR'COR', -COCH2(CH2)p-(CH2CH20)m-(CH2)n-NR'S02R', -COCH2(CH2)p-(CH2CH20)m-(CH2)n-COOH, -COCH2(CH2)p-(CH2CH20)m-(CH2)n-COOR', -COCH2(CH2)p-(CH2CH20)m-(CH2)n-CONR'R', -COCH2(CH2)p-(CH2CH20)m-(CH2)n-S02R' , -COCH2(CH2)p-(CH2CH20)m-(CH2)n-COR' , -COCH2(CH2)p-(CH2CH20)m-(CH2)n-SONR'R',-COCH2(CH2)p-(CH2CH20)m-(CH2)n-S02NR'R', -COCH2-COR', -COCH2-SOR' and-COCH2S02R' wherein R' and R' are as above,m, n, and p are independently 0 to 6,and the pharmaceutically acceptable salts and esters thereof. 2. A compound of claim 1 of the formula (IA)whereinX is selected from the group consisting of F, CI and Br, Y is one to two group(s) independently selected from the group consisting of H, F, CI, Br, I, CN, OH, nitro, lower alkyl, cycloalkyl and lower alkoxy,Ri is hydrogen,one of R2 and R3 is selected from aryl, substituted aryl, heteroaryl or substituted heteroaryl and the other is selected from the group consisting of lower alkyl, substituted lower alkyl, lower alkenyl, substituted lower alkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, substituted heterocycle, cycloalkyl, substituted cycloalkyl, cycloalkenyl and substituted cycloalkenyl,R4 is hydrogen,R5 is selected from the group consisting of lower alkyl, substituted lower alkyl,-CH2(CH2)n-CHOH-R', -CH2(CH2)n-CHOH-CH2-(CH2)n-NR'R', -CH2(CH2)n-CO(CH2)nNR'R', -CO(CH2)n-R', -CO(CH2)n-NR'-(CH2)n-CHOH-R', -CO(CH2)n-NR'R', -(CH2)n-NR'S02R', -COCH2(CH2)n-COOH, -(CH2)n-COOR -(CH2)n-CONR'R', -CO(CH2)n-OR',-COCH2(CH2)n-SR', -COCH2(CH2)n-SOR', -COCH2(CH2)n-S02R', -COCH2(CH2)n-COR', -COCH2(CH2)n-S03H, -COCH2(CH2)n-SONR'R', -COCH2(CH2)n-S02NR'R',-COCH2(CH2CH20)m-(CH2)n-R' , -COCH2(CH2CH20)m-(CH2)n-OH,-COCH2(CH2CH20)m-(CH2)n-OR', -COCH2(CH2CH20)m-(CH2)n-NR'R',-COCH2(CH2CH20)m-(CH2)n-NR'COR', -COCH2(CH2CH20)m-(CH2)n-NR'S02R',-COCH2(CH2CH20)m-(CH2)n-COOH, -COCH2(CH2CH20)m-(CH2)n-COOR' ,-COCH2(CH2CH20)m-(CH2)n-CONR'R', -COCH2(CH2CH20)m-(CH2)n-S02R',-COCH2(CH2CH20)m-(CH2)n-COR', -COCH2(CH2CH20)m-(CH2)n-SONR'R',-COCH2(CH2CH20)m-(CH2)n-S02NR'R', -COCH2(CH2)p-(CH2CH20)m-(CH2)n-R',-COCH2(CH2)p- (CH2CH20)m-(CH2)n-OH, -COCH2(CH2)p-(CH2CH20)m-(CH2)n-OR' ,-COCH2(CH2)p-(CH2CH20)m-(CH2)n-NR'R', -COCH2(CH2)p-(CH2CH20)m-(CH2)n-NR'COR', -COCH2(CH2)p-(CH2CH20)m-(CH2)...

20111

석유화학계 기초 화학 물질 제조업

특허

ko

en

안과 질환 및 장애 치료용 화합물화합물, 그 약학적 조성물, 및 상기 화합물 및 조성물을 사용하여 안과 질환 및 장애, 예컨대 노인성 황반 변성 및 스타가르트 질환의 치료 방법을 제공한다.하기식 (I) 의 화합물 또는 호변체, 입체이성질체, 기하학적 이성질체 또는 그 약학적으로 허용가능한 용매화물, 수화물, 염, N-옥시드 또는 프로드러그:[식 중,Z 는 결합, -C(R1)(R2)-, -C(R9)(R10)-C(R1)(R2)-, -X-C(R31)(R32)-, -C(R9)(R10)-C(R1)(R2)-C(R36)(R37)-, -C(R38)(R39)-X-C(R31)(R32)- 또는 -X-C(R31)(R32)-C(R1)(R2)- 이고;X 는 -O-, -S-, -S(=O)-, -S(=O)2-, -N(R30)-, -C(=O)-, -C(=CH2)-, -C(=N-NR35)- 또는 -C(=N-OR35)- 이고;G 는 -N(R42)-SO2-R40, -N(R42)C(=O)-R40, -N(R42)C(=O)-OR40, -N(R42)-C(R42)(R42)-R40, -N(R42)-C(=O)-N(R43)(R43) 또는 -N(R42)-C(=S)-N(R43)(R43) 으로부터 선택되고;R40 은 -C(R16)(R17)(R18), 아릴 또는 헤테로아릴로부터 선택되고;각 R42 는 독립적으로 수소, 알킬 또는 아릴로부터 선택되고;각 R43 은 독립적으로 수소, 알킬, 시클로알킬, 아르알킬, 알케닐, 알키닐, C-부착된 헤테로시클릴, 아릴 또는 헤테로아릴로부터 선택되거나; 또는 2 개의 R43 기는 이들이 부착되어 있는 질소와 함께 헤테로시클릴을 형성할 수 있고;R1 및 R2 는 각각 독립적으로 수소, 할로겐, C1-C5 알킬, 플루오로알킬, -OR6 또는 -NR7R8 로부터 선택되거나; 또는 R1 및 R2 는 함께 옥소를 형성하고;R31 및 R32 는 각각 독립적으로 수소, C1-C5 알킬 또는 플루오로알킬로부터 선택되고;R38 및 R39 는 각각 독립적으로 수소, C1-C5 알킬 또는 플루오로알킬로부터 선택되고;R36 및 R37 은 각각 독립적으로 수소, 할로겐, C1-C5 알킬, 플루오로알킬, -OR6 또는 -NR7R8 로부터 선택되거나; 또는 R36 및 R37 은 함께 옥소를 형성하거나; 또는 임의적으로는, R36 및 R1 은 함께 직접 결합을 형성하여 이중 결합을 제공하거나; 또는 임의적으로는, R36 및 R1 은 함께 직접 결합을 형성하고, R37 및 R2 는 함께 직접 결합을 형성하여 삼중 결합을 제공하고;R3 및 R4 는 각각 독립적으로 수소, 알킬, 알케닐, 플루오로알킬, 아릴, 헤테로아릴, 카르보시클릴 또는 C-부착된 헤테로시클릴로부터 선택되거나; 또는 R3 및 R4 는 이들이 부착되어 있는 탄소 원자와 함께 카르보시클릴 또는 헤테로시클릴을 형성하거나; 또는 R3 및 R4 는 함께 이미노를 형성하고;R7 및 R8 은 각각 독립적으로 수소, 알킬, 카르보시클릴, 헤테로시클릴, -C(=O)R13, SO2R13, CO2R13 또는 SO2NR24R25 로부터 선택되거나; 또는 R7 및 R8 은 이들이 부착되어 있는 질소 원자와 함께 N-헤테로시클릴을 형성하고; R9 및 R10 은 각각 독립적으로 수소, 할로겐, 알킬, 플루오로알킬, -OR19, -NR20R21 또는 카르보시클릴로부터 선택되거나; 또는 R9 및 R10 은 옥소를 형성하거나; 또는 임의적으로는, R9 및 R1 은 함께 직접 결합을 형성하여 이중 결합을 제공하거나; 또는 임의적으로는, R9 및 R1 은 함께 직접 결합을 형성하고, R10 및 R2 는 함께 직접 결합을 형성하여 삼중 결합을 제공하고;R11 및 R12 는 각각 독립적으로 수소, 알킬, 카르보시클릴, -C(=O)R23, -C(NH)NH2, SO2R23, CO2R23 또는 SO2NR28R29 로부터 선택되거나; 또는 R11 및 R12 는 이들이 부착되어 있는 질소 원자와 함께 N-헤테로시클릴을 형성하고;각 R13, R22 및 R23 은 독립적으로 알킬, 헤테로알킬, 알케닐, 아릴, 아르알킬, 카르보시클릴, 헤테로아릴 또는 헤테로시클릴로부터 선택되고;R6, R19, R30, R34 및 R35 는 각각 독립적으로 수소 또는 알킬이고;R20 및 R21 은 각각 독립적으로 수소, 알킬, 카르보시클릴, 헤테로시클릴, -C(=O)R22, SO2R22, CO2R22 또는 SO2NR26R27 로부터 선택되거나; 또는 R20 및 R21 은 이들이 부착되어 있는 질소 원자와 함께 N-헤테로시클릴을 형성하고;각 R24, R25, R26, R27, R28 및 R29 는 독립적으로 수소, 알킬, 알케닐, 플루오로알킬, 아릴, 헤테로아릴, 카르보시클릴 또는 헤테로시클릴로부터 선택되고;R16 및 R17 은 각각 독립적으로 수소, 알킬, 할로, 아릴, 헤테로아릴, 아르알킬, 헤테로아르알킬 또는 플루오로알킬로부터 선택되거나; 또는 R16 및 R17 은 이들이 부착되어 있는 탄소와 함께 카르보시클릴 또는 헤테로사이클을 형성하고;R18 은 수소, 알킬, 알콕시, 히드록시, 할로 또는 플루오로알킬로부터 선택되고; 각 R33 은 독립적으로 할로겐, OR34, 알킬 또는 플루오로알킬로부터 선택되고; n 은 0, 1, 2, 3 또는 4 임].

COMPOUNDS FOR TREATING OPHTHALMIC DISEASES AND DISORDERSProvided are compounds, pharmaceutical compositions thereof, and methods of treating ophthalmic diseases and disorders, such as age-related macular degeneration and Stargardt's Disease, using said compounds and compositions.A compound of Formula (I) or tautomer, stereoisomer, geometric isomer or a pharmaceutically acceptable solvate, hydrate, salt, λf-oxide or prodrug thereof: wherein, Z is a bond, -C(R1XR2)-, -C(R9)(R10)-C(R1)(R2)-, -X-C(R31)(R32)-, -C(R9)(R10)-C(R1)(R2)-C(R36XR37)-, -C(R38)(R39)-X-C(R31)(R32)-, or -X-C(R31)(R32)-C(R1)(R2)-;X is -O-, -S-, -S(=O)-, -S(O)2-, -N(R30)-, -C(=O)-, -C(=CH2)-, -C(=N-NR35)-, or -C(=N-OR35)-; G is selected from -N(R42)- SO2-R40, -N(R42)C(=O)-R40, -N(R42)C(=O)-OR40, -N(R42)-C(R42)(R42)-R40, -N(R42)-C(=O)-N(R43)(R43), or -N(R42)-C(=S)-N(R43)(R43); R40 is selected from -C(R16)(R17)(R18), aryl, or heteroaryl; each R42 is independently selected from hydrogen, alkyl or aryl; each R43 is independently selected from hydrogen, alkyl, cycloalkyl, aralkyl, alkenyl, alkynyl, C- attached heterocyclyl, aryl, or heteroaryl; or two R43 groups, together with the nitrogen to which they are attached, may form a heterocyclyl; R1 and R2 are each independently selected from hydrogen, halogen, C1-C5 alkyl, fluoroalkyl, -OR6 or-NR7R8; or R1 and R2 together form an oxo;R31 and R32 are each independently selected from hydrogen, C1-C5 alkyl, or fluoroalkyl; R38 and R39 are each independently selected from hydrogen, C1-C5 alkyl, or fluoroalkyl;R36 and R37 are each independently selected from hydrogen, halogen, C1-C5 alkyl, fluoroalkyl, -OR6 or -NR7R8; or R36 and R37 together form an oxo; or optionally, R36 and R1 together form a direct bond to provide a double bond; or optionally, R36 and R1 together form a direct bond, and R37 and R2 together form a direct bond to provide a triple bond; R3 and R4 are each independently selected from hydrogen, alkyl, alkenyl, fluoroalkyl, aryl, heteroaryl, carbocyclyl or C-attached heterocyclyl; or R3 and R4 together with the carbon atom to which they are attached, form a carbocyclyl or heterocyclyl; or R3 and R4 together form an imino; R7 and R8 are each independently selected from hydrogen, alkyl, carbocyclyl, heterocyclyl, - C(=O)R13, SO2R13, CO2R13 or SO2NR24R25; or R7 and R8 together with the nitrogen atom to which they are attached, form an iV-heterocyclyl;R9 and R10 are each independently selected from hydrogen, halogen, alkyl, fluoroalkyl, -OR19, - NR20R21 or carbocyclyl; or R9 and R10 form an oxo; or optionally, R9 and R1 together form a direct bond to provide a double bond; or optionally, R9 and R1 together form a direct bond, and R10 and R2 together form a direct bond to provide a triple bond; R11 and R12 are each independently selected from hydrogen, alkyl, carbocyclyl, -C(=O)R23, -C(NH)NH2, SO2R23, CO2R23 or SO2NR28R29; or R11 and R12, together with the nitrogen atom to which they are attached, form an iV-heterocyclyl; each R13, R22 and R23 is independently selected from alkyl, heteroalkyl, alkenyl, aryl, aralkyl, carbocyclyl, heteroaryl or heterocyclyl;R6, R19, R30, R34 and R35 are each independently hydrogen or alkyl;R20 and R21 are each independently selected from hydrogen, alkyl, carbocyclyl, heterocyclyl, - C(=O)R22, SO2R22, CO2R22 or SO2NR26R27; or R20 and R21 together with the nitrogen atom to which they are attached, form an iV-heterocyclyl; and each R24, R25, R26, R27, R28 and R29 is independently selected from hydrogen, alkyl, alkenyl, fluoroalkyl, aryl, heteroaryl, carbocyclyl or heterocyclyl;R16 and R17 are each independently selected from hydrogen, alkyl, halo, aryl, heteroaryl, aralkyl, heteroaryalkyl or fluoroalkyl; or R16 and R17, together with the carbon to which they are attached form a carbocyclyl or heterocycle;R18 is selected from hydrogen, alkyl, alkoxy, hydroxy, halo or fluoroalkyl; each R33 is independently selected from halogen, OR34, alkyl, or fluoroalkyl; and n is 0, 1, 2, 3, or 4. 2. The compound of claim 1 wherein, Z is a bond, -C(R1XR2)-, -C(R9)(R10)-C(R1)(R2)-, -X-C(R31)(R32)-, -C(R9)(R10)-C(R1)(R2)-C(R36XR37)- or -X-C(R31XR32K(R1XR2)-;X is -O-, -S-, -S(=O)-, -S(O)2-, -N(R30)-, -C(=O)-, -C(=CH2)-, -C(=N-NR35)-, or -C(=N-OR35)-; R1 and R2 are each independently selected from hydrogen, halogen, C1-C5 alkyl, fluoroalkyl, -OR6 or-NR7R8; or R1 and R2 together form an oxo; R31 and R32 are each independently selected from hydrogen, C1-C5 alkyl, or fluoroalkyl;R36 and R37 are each independently selected from hydrogen, halogen, C1-C5 alkyl, fluoroalkyl, -OR6 or -NR7R8; or R36 and R37 together form an oxo; R3 and R4 are each independently selected from hydrogen, alkyl, alkenyl, fluoroalkyl, aryl, heteroaryl, carbocyclyl or C-attached heterocyclyl; or R3 and R4 together with the carbon atom to which they are attached, form a carbocyclyl or heterocyclyl; or R3 and R4 together form an imino;R7 and R8 are each independently selected from hydrogen, alkyl, carbocyclyl, heterocyclyl, - C(=O)R13, SO2R13, CO2R13 or SO2NR24R25; or R7 and R8 together with the nitrogen atom to which they are attached, form an iV-heterocyclyl;R9 and R10 are each independently selected from hydrogen, halogen, alkyl, fluoroalkyl, -OR19, - NR20R21 or carbocyclyl; or R9 and R1...

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

결핵 약물과 조합 사용되는 고리-융합된 티아졸리노 2-피리돈본 발명은 (i) bc1 복합체의 사이토크롬 b 서브유닛을 저해하는 결핵 약물로서, 상기 사이토크롬 b 서브유닛이 마이코박테리움 투베르쿨로시스에서 유전자 qcrB에 의해 코딩된 것인, 결핵 약물 또는 이의 약제학적으로 허용가능한 염; 및 (ii) 식 II의 화합물 또는 이의 약제학적으로 허용가능한 염을 포함하는 조합을 개시한다.[이미지]하기 (i) 및 (ii)를 포함하는 조합:(i) bc1 복합체의 사이토크롬 b 서브유닛을 저해하는 결핵 약물로서, 상기 사이토크롬 b 서브유닛이 마이코박테리움 투베르쿨로시스에서 유전자 qcrB에 의해 코딩된 것인, 결핵 약물 또는 이의 약제학적으로 허용가능한 염; 및(ii) 식 II의 화합물 또는 이의 약제학적으로 허용가능한 염:[이미지]상기 식에서, R1은 a) - l)로 이루어진 군으로부터 선택되고: a) C(O)OH; b) 테트라졸릴; c) CH2OH; d) C(O)NR6aR6b; e) C(O)NHSO2R7; f) C(O)OR8; g) NH2; h) H; i) [이미지]; j) [이미지]; k) [이미지]; 및 l) 이미다졸 카르복실레이트,R2는 a) - e)로 이루어진 군으로부터 선택되고: a) H; b) Cl, F, Br 또는 I; c) CH2OH; d) C1-C4 알킬; 및 e) NY1Y2,R3는 a) - m)으로 이루어진 군으로부터 선택되고: a) 독립적으로 메틸, 플루오로, 클로로, 브로모, 시아노 및 메톡시로 이루어진 군으로부터 선택되는 치환기 0, 1, 2 또는 3개로 각각 치환된, 1-나프틸, 2-나프틸 또는 1-나프틸옥시; b) 독립적으로 메틸, 플루오로, 클로로, 시아노 및 트리플루오로메틸로 이루어진 군으로부터 선택되는 치환기 0, 1, 2 또는 3개로 치환된 페닐; c) 독립적으로 메틸, 플루오로, 클로로 및 트리플루오로메틸로 이루어진 군으로부터 선택되는 치환기 0, 1, 2 또는 3개로 치환된 아미노페닐; d) 2-(3-메틸)페닐메틸렌; e) 벤조티오펜-2-일; f) H; g) C1-C4 알킬; h) 2-메틸-1-아자-2-bora-1H-나프트-5-일옥시; i) 2-메틸-1-아자-2-bora-1H-나프트-5-일; j) 메틸, 1-나프틸, 2-나프틸, 1-안트릴, m-트리플루오로메틸페닐, 3,5-다이트리플루오로메틸페닐, 3,4-메틸렌다이옥시페닐, 티오펜 또는 페닐로 선택적으로 치환된 이속사졸-5-일; k) m-트리플루오로메틸페닐 또는 1-나프틸로 치환된 이속사졸-3-일; l) 벤즈옥사졸-2-일; 및 m) [이미지],R4는 a) - h)로 이루어진 군으로부터 선택되고: a) 플루오로 0, 1, 2, 3 또는 4개로 치환된 C1-C4 알킬; b) C3-C6 사이클로알킬; c) 플루오로 0, 1, 2, 3 또는 4개로 치환된 C1-C4 알콕시; d) C3-C6 사이클로알콕시; e) 페닐 및 1-나프틸로 이루어진 군으로부터 선택되는 치환기 0 또는 1개로 치환된, 3-, 4-, 5- 또는 6-원성 헤테로사이클; f) N-메틸 3-인돌릴; g) NR9aR9b; 및 h) C2-C4 알키닐,R5는 a) - f)로 이루어진 군으로부터 선택되고: a) H; b) 메틸기 0, 1, 2 또는 3개로 치환된 페닐; c) 벤질; d) 티에닐; e) C1-C4 알콕시; 및 f) 3-, 4-, 5- 또는 6-원성 헤테로사이클,상기한 정의에서,R6a는 H 및 C1-C4 알킬로 이루어진 군으로부터 선택되고;R6b는 H, C1-C4 알킬, C1-C4 알콕시 및 이소니코티노일아미노로 이루어진 군으로부터 선택되고;R7은 C1-C4 알킬 또는 페닐이고;R8은 2-{2-[1-(하이드록시메틸)프로필아미노]에틸아미노}부틸)이고;R9a는 C1-C4 알킬이고;R9b는 C1-C4 알킬이고;R10은 H; F 0, 1, 2 또는 3개로 치환된 C1-C4 알킬; 트리플루오로메틸 0 또는 1개로 치환된 벤질; 또는 나프탈렌-1-일-메틸렌이고;Y1 및 Y2는 각각 독립적으로 수소, 메틸, CH3S(O)2 또는 C(O)CH3이거나; 또는Y1 및 Y2는 함께 CH2CH2CH2CH2 또는 CH2CH2CH2CH2CH2를 형성하고;m은 0 또는 1이고;n은 0 또는 1이고;X는 S, SO 또는 SO2이고; 및Z는 F 0, 1, 2 또는 3개로 치환된 C1-C4 알킬; F 0, 1, 2 또는 3개로 치환된 C1-C4 알콕시; 또는 Cl, F. Br 또는 I로부터 선택되는 할로겐임.

RING-FUSED THIAZOLINO 2-PYRIDONES IN COMBINATION WITH A DRUG AGAINST TUBERCULOSISThe present disclosure provides a combination comprising: (i). a drug against tuberculosis inhibiting the cytochrome b subunit of the bc1 complex, said cytochrome b subunit being encoded by the gene qcrB,in Mycobacterium tuberculosis, or a pharmaceutically acceptable salt thereof, and (ii) a compound of Formula (II), or a pharmaceutically acceptable salt thereof.A combination, comprising:(i) an anti-tubercular drug that inhibits the cytochrome b subunit of the bc1 complex in mycobacterium tuberculosis (mycobacterium tuberculosis), said cytochrome b subunit being encoded by the qcrb gene, or a pharmaceutically acceptable salt thereof; and(ii) a compound of formula ii or a pharmaceutically acceptable salt thereof,whereinr1selected from the group consisting of:a)c(o)oh，b) the structure of the tetrazolyl group is,c)ch2oh，d)c(o)nr6ar6b，e)c(o)nhso2r7，f)c(o)or8，g)nh2，h)h，i)j)k)andl) a salt of an imidazole carboxylic acid,r2selected from the group consisting of:a)h，b) cl, f, br or i,c)ch2oh，d)c1-c4alkyl, ande)ny1y2，r3selected from the group consisting of:a) 1-naphthyl, 2-naphthyl or 1-naphthyloxy, each of which is independently substituted with 0, 1,2 or 3 substituents selected from the group consisting of methyl, fluoro, chloro, bromo, cyano and methoxy,b) phenyl substituted with 0, 1,2 or 3 substituents independently selected from the group consisting of methyl, fluoro, chloro, cyano and trifluoromethyl,c) an aminophenyl group substituted with 0, 1,2, or 3 substituents independently selected from the group consisting of methyl, fluoro, chloro, and trifluoromethyl,d)2- (3-methyl) phenylmethylene,e) a benzothiophen-2-yl group,f)h，g)c1-c4an alkyl group, a carboxyl group,h) 2-methyl-1-aza-2-boro-1h-naphthalen-5-yloxy,i) 2-methyl-1-aza-2-boro-1h-naphthalen-5-yl,j) isoxazol-5-yl optionally substituted with methyl, 1-naphthyl, 2-naphthyl, 1-anthracenyl, m-trifluoromethylphenyl, 3, 5-di (trifluoromethyl) phenyl, 3, 4-methylenedioxyphenyl, thiophene or phenyl,k) isoxazol-3-yl substituted with meta-trifluoromethylphenyl or 1-naphthyl,l) benzoxazol-2-yl, andm)r4selected from the group consisting of:a) c substituted by 0, 1,2,3 or 4 fluorine1-c4an alkyl group, a carboxyl group,b)c3-c6a cycloalkyl group,c) c substituted by 0, 1,2,3 or 4 fluorine1-c4an alkoxy group,d)c3-c6a cycloalkoxy group,e) a 3-, 4-, 5-or 6-membered heterocyclic ring substituted with 0 or 1 substituent selected from the group consisting of phenyl and 1-naphthyl,f) n-methyl-3-indolyl (i) and (ii),g)nr9ar9band are andh)c2-c4an alkynyl group,r5selected from the group consisting of:a)h，b) phenyl substituted with 0, 1,2 or 3 methyl groups,c) a benzyl group, a phenyl group,d) a thienyl group,e)c1-c4alkoxy, andf) a 3-, 4-, 5-or 6-membered heterocyclic ring,and in the above definition:r6aselected from h and c1-c4a group consisting of alkyl groups,r6bselected from the group consisting of h, c1-c4alkyl radical, c1-c4alkoxy groups and isonicotinyl amino groups,r7is c1-c4an alkyl group or a phenyl group, or a substituted or unsubstituted alkyl group,r8represents 2- {2- [1- (hydroxymethyl) propylamino]ethylamino } butyl),r9ais represented by c1-c4an alkyl group, a carboxyl group,r9bis represented by c1-c4an alkyl group, a carboxyl group,r10represents: h; c substituted by 0, 1,2 or 3 fluorine1-c4an alkyl group; benzyl substituted with 0 or 1 trifluoromethyl; or a naphthalen-1-yl-methylene group,y1and y2each independently represents hydrogen, methyl, ch3s(o)2or c (o) ch3or is ory1and y2together form ch2ch2ch2ch2or ch2ch2ch2ch2ch2，m is a number of 0 or 1,n is a number of 0 or 1,x is s, so or so2and is andz represents: c substituted by 0, 1,2 or 3 fluorine1-c4an alkyl group; c substituted by 0, 1,2 or 3 fluorine1-c4an alkoxy group; or a halogen selected from cl, f, br or i.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

신규한 아미노-피리미도닐-피페리디닐 유도체, 이의 제조 방법 및 이를 함유한 약학적 조성물본 발명은 하기 화학식 (I)의 화합물 및 약제에 관한 것이다:[이미지] 상기 식에서, R1, R2, R3, R4, R5, n 및 Q는 설명에서 정의된 바와 같다.하기 화학식 (I)의 화합물, 이들의 거울상이성질체, 부분입체이성질체, 및 이의 약학적으로 허용되는 산 또는 염기와의 부가염:[이미지]상기 식에서,◆ Q는 산소 원자 또는 황 원자를 나타내며,◆ R1은 사이클로알킬 기, 헤테로사이클로알킬 기, 아릴 기, 또는 헤테로아릴 기를 나타내며,◆ R2는 아릴 기 또는 헤테로아릴 기를 나타내며,◆ R3은 수소 원자, 선형 또는 분지형 (C1-C6)알킬 기, 선형 또는 분지형 할로(C1-C6)알킬, 선형 또는 분지형 하이드록시(C1-C6)알킬 기, -C(O)-R8 기, -C(O)-OR8 기, -C(O)-NH-R8 기 또는 [이미지]기를 나타내며,◆ R4는 수소 원자 또는 할로겐 원자를 나타내며,◆ R5는 수소 원자, 선형 또는 분지형 (C1-C6)알킬 기, 선형 또는 분지형 할로(C1-C6)알킬 기, 또는 아릴(C1-C6)알킬 기를 나타내며,◆ n은 0, 1 또는 2의 정수이며,◆ J는 -C(O)- 기, -CH(R6)- 기, -SO2- 기, -C(X)-N(R7)-, -CH2-C(O)-N(R7)- 기 또는 [이미지] 기를 나타내며, ◆ R6은 수소 원자, 선형 또는 분지형 (C1-C6)알킬 기, 또는 -C(O)-OR8 기를 나타내며,◆ R7은 수소 원자 또는 선형 또는 분지형 (C1-C6)알킬 기를 나타내며,◆ R8은 수소 원자, 선형 또는 분지형 (C1-C6)알킬 기, 또는 선형 또는 분지형 할로(C1-C6)알킬 기를 나타내며,◆ K는 결합 또는 -Cy1- 기를 나타내며,◆ L은 선형 또는 분지형 (C1-C6)알킬 기, -Cy2 기 또는 -C(R9)2-Cy2 기를 나타내며,◆ X는 산소 원자 또는 황 원자를 나타내며,◆ R9는 수소 원자 또는 할로겐 원자를 나타내며,◆ Cy1은 사이클로알킬 기, 헤테로사이클로알킬 기, 아릴 기, 또는 헤테로아릴 기를 나타내며, 이는 기 J에 및 기 L에 결합되며,◆ Cy2는 사이클로알킬 기, 헤테로사이클로알킬 기, 아릴 기, 또는 헤테로아릴 기를 나타내며,- "아릴"은 페닐, 나프틸, 또는 인다닐 기를 의미하고,- "헤테로아릴"은 5 내지 10개의 고리 구성원으로 구성되고, 적어도 하나의 방향족 모이어티를 갖고 산소, 황 및 질소로부터 선택된 1 내지 3개의 헤테로원자를 함유하는 임의의 모노- 또는 융합된 바이사이클릭 기를 의미하고,- "사이클로알킬"은 3 내지 7개의 고리 구성원을 함유하는 임의의 모노- 또는 융합된 바이사이클릭 비방향족 카르보사이클릭 기를 의미하고,- "헤테로사이클로알킬"은 3 내지 10개의 고리 구성원을 함유하고, 산소, 황 및 질소로부터 선택된 1 내지 3개의 헤테로원자를 함유하는 임의의 비방향족 모노- 또는 융합된 바이사이클릭 기를 의미하는 것으로 이해되고,이렇게 정의된 아릴, 헤테로아릴, 사이클로알킬 및 헤테로사이클로알킬 기는 선형 또는 분지형 (C1-C6)알킬, 선형 또는 분지형 (C2-C6)알케닐, 선형 또는 분지형 (C2-C6)알키닐, 선형 또는 분지형 할로(C1-C6)알킬, -Y1-OR', -Y1-NR'R", -Y1-S(O)m-R', 옥소, 적절한 경우 N-옥사이드, 펜타플루오로설파이드, 니트로, -Y1-CN, -C(O)-R', -C(O)-OR', -O-C(O)-R', -Y1-C(O)-NR'R", -Y1-NR'-C(O)-R", -Y1-NR'-C(O)-OR", 할로겐, 사이클로프로필, 및 선형 또는 분지형 (C1-C6)알킬 기로 치환될 수 있는 피리디닐로부터 선택된 1 내지 4개의 기로 치환될 수 있는 것으로 이해되며,- Y1은 결합, 선형 또는 분지형 (C1-C4)알킬렌 기, 또는 선형 또는 분지형 할로(C1-C4)알킬렌 기를 나타내며,- R' 및 R"는 서로 독립적으로 수소 원자, 선형 또는 분지형 (C1-C6)알킬 기, 선형 또는 분지형 (C2-C6)알케닐 기, 선형 또는 분지형 (C1-C6)알키닐 기, 선형 또는 분지형 (C1-C6)알콕시 기, 선형 또는 분지형 할로(C1-C6)알킬, 선형 또는 분지형 하이드록시(C1-C6)알킬 기, 선형 또는 분지형 (C1-C6)알콕시(C1-C6)알킬 기, 포르밀 기, 페닐 기, 벤질 기, 사이클로프로필 기, 사이클로프로필메틸 기, 테트라하이드로피라닐 기를 나타내거나, 쌍(R', R")은 이들을 수반하는 질소 원자와 함께 산소 및 질소로부터 선택된 제2 헤테로원자를 질소에 추가하여 함유할 수 있는 4 내지 7개의 고리 구성원으로 구성되는 비방향족 고리를 형성하며, 해당 제2 질소는 수소 원자 또는 선형 또는 분지형 (C1-C6)알킬 기를 나타내는 1 내지 2개의 기로 치환될 수 있으며,- m은 0, 1 및 2의 정수인 것으로 이해된다.

Novel amino-pyrimidinone-piperidinyl derivatives, process for their preparation and pharmaceutical compositions containing themA compound of formula (I) wherein R1、R2、R3、R4、R5N and Q are as defined in the specification. A medicine is provided.A compound of formula (i), enantiomers, diastereomers, and addition salts thereof with a pharmaceutically acceptable acid or base:wherein:q represents an oxygen atom or a sulfur atom,◆r1represents cycloalkyl, heterocycloalkyl, aryl or heteroaryl,◆r2represents an aryl group or a heteroaryl group,◆r3represents a hydrogen atom, linear or branched (c)1-c6) alkyl, straight or branched halo (c)1-c6) alkyl, straight or branched hydroxy (c)1-c6) alkyl, -c (o) -r8group, -c (o) -or8the group, -c (o) -nh-r8group orthe radical(s) is (are),◆r4represents a hydrogen atom or a halogen atom,◆r5represents a hydrogen atom, linear or branched (c)1-c6) alkyl, straight or branched halo (c)1-c6) alkyl or aryl (c)1-c6) an alkyl group, a carboxyl group,n is an integer equal to 0,1 or 2,j stands for a-c (o) -group, -ch (r)6) -group, -so2-a group, -c (x) -n (r)7) -group, -ch2-c(o)-n(r7) -a radical orthe radical(s) is (are),◆r6represents a hydrogen atom, linear or branched (c)1-c6) alkyl or-c (o) -or8the radical(s) is (are),◆r7represents a hydrogen atom or a linear or branched (c)1-c6) an alkyl group, a carboxyl group,◆r8represents a hydrogen atom, linear or branched (c)1-c6) alkyl or straight or branched halo (c)1-c6) an alkyl group, a carboxyl group,k represents a bond or-cy1-a group of,l represents a linear or branched chain (c)1-c6) alkyl, -cy2a radical or-c (r)9)2-cy2the radical(s) is (are),x represents an oxygen atom or a sulfur atom,◆r9representsa hydrogen atom or a halogen atom,◆cy1represents cycloalkyl, heterocycloalkyl, aryl or heteroaryl, which is linked to the group j and the group l,◆cy2represents cycloalkyl, heterocycloalkyl, aryl or heteroaryl,it should be understood that:- 'aryl' means phenyl, naphthyl or indanyl,- 'heteroaryl' means any monocyclic or fused bicyclic group consisting of 5 to 10 ring members, having at least 1 aromatic moiety and containing 1 to 3 heteroatoms selected from oxygen, sulfur and nitrogen,- 'cycloalkyl' means any monocyclic or fused bicyclic non-aromatic carbocyclic group comprising 3 to 7 ring members,- 'heterocycloalkyl' means any non-aromatic monocyclic or fused bicyclic group comprising 3 to 10 ring members and comprising 1 to 3 heteroatoms selected from oxygen, sulphur and nitrogen,the defined aryl, heteroaryl, cycloalkyl and heterocycloalkyl groups may be substituted by 1 to 4 groups selected from: straight-chain or branched (c)1-c6) alkyl, straight-chain or branched (c)2-c6) alkenyl, straight-chain or branched (c)2-c6) alkynyl, straight-chain or branched halo (c)1-c6) alkyl, -y1-or’、-y1-nr’r”、-y1-s(o)m-r', oxo, n-oxide (where appropriate), pentafluorothio, nitro, -y1-cn、-c(o)-r’、-c(o)-or’、-o-c(o)-r’、-y1-c(o)-nr’r”、-y1-nr’-c(o)-r”、-y1-nr '-c (o) -or', halogen, cyclopropyl and (c) which may be straight or branched1-c6) an alkyl-substituted pyridyl group, wherein the pyridyl group is substituted with an alkyl group,it should be understood that:-y1represents a bond, linear or branched (c)1-c4) alkylene or straight-or branched-chain halo (c)1-c4) an alkylene group or a substituted alkylene group,-r 'and r' independently of one another represent a hydrogen atomsub, straight-chain or branched (c)1-c6) alkyl, straight-chain or branched (c)2-c6) alkenyl, straight-chain or branched (c)2-c6) alkynyl, straight-chain or branched (c)1-c6) alkoxy, straight or branched halo (c)1-c6) alkyl, straight or branched hydroxy (c)1-c6) alkyl, straight-chain or branched (c)1-c6) alkoxy (c)1-c6) alkyl, formyl, phenyl, benzyl, cyclopropyl, cyclopropylmethyl, tetrahydropyranyl, or substituent pair (r ', r') together with the nitrogen atom to which they are attached form a non-aromatic ring of 4 to 7 ring members, which ring may contain, in addition to nitrogen, a second heteroatom selected from oxygen and nitrogen, it being understood that the second nitrogen may be interrupted by 1 to 2 members representing a hydrogen atom or a straight or branched (c)1-c6) the radical substitution of an alkyl radical,-m is an integer equal to 0,1 and 2.

31311

유인 항공기, 항공 우주선 및 보조장치 제조업

특허

ko

en

호버링 가능한 항공기용 로터항공기(1)용 로터(3, 3', 3'', 3''')는: 축(A) 주위로 회전 가능하고, 차례로 복수의 블레이더들(9); 항공기(1)의 부재를 구동하기 위해 연결될 수 있고 축(A) 주위로 허브(5)를 회전 구동하기 위해 허브(5)에 연결되는 마스트(6); 및 축(A)에 직교하는 평면내의 마스트(6) 진동의 전달을 감쇠하기 위한 감쇠 수단들(15; 20a, 20b; 21a, 21b)을 포함하는 허브(5)를 포함하고, 상기 감쇠 수단들(15; 20a, 20b; 21a, 21b)은 각각 제1 및 제2 각속도((N-1)*Ω; -(N+1)*Ω))로 축(A) 주위로 편심 회전할 수 있는 적어도 제1 매스(20a, 20b) 및 제2 매스(21a, 21b)를 포함하고; 제1 매스(20a, 20b) 및 제2 매스(21a, 21b)는 축(A)에 방사형 방향으로 주요 요소를 갖는 마스트(6)상에서 각각의 제1 및 제2 감쇠력을 발생하기 위해 마스트(6)에 작용하도록 연결되고; 상기 로터(3, 3', 3'', 3''') 는 제1 및 제2 매스들(20a, 20b; 21a, 21b)을 회전 구동하기 위해 마스트(6)와 제1 및 제2 매스들(20a, 20b; 21a, 21b) 사이에 개재된 전달 유닛(19, 19', 19'', 19''')을 포함한다.호버링 가능한 항공기(1)용 로터(3, 3', 3''')로서,- 제1 축(A) 주위로 회전 가능하고, 복수의 블레이드들(9)을 차례로 포함하는 허브(5);- 상기 항공기(1)의 구동 부재에 연결 가능하고, 상기 제1 축(A) 주위로 상기 허브(5)를 회전 구동하기 위해 상기 허브(5)에 작동 가능하게 연결된 마스트(6);를 포함하고,감쇠 수단들(15; 20a, 20b; 21a, 21b)은 상기 제1 축(A)에 직교하는 평면내에서 상기 마스트(6)로의 진동의 전달을 감쇠하고;상기 감쇠 수단들(15; 20a, 20b; 21a, 21b)은 상기 마스트(6)에 대해 각각의 제1 및 제2 회전속도(((N-1)*Ω; -(N+1)*Ω))를 가지고 상기 제1 축(A) 주위로 편심 회전하는 적어도 하나의 제1 매스(mass)(20a, 20b) 및 적어도 하나의 제2 매스(21a, 21b)를 차례로 포함하고;상기 제1 매스(20a, 20b) 및 제2 매스(21a, 21b)는 상기 제1 축(A)에 방사 방향으로 주요 요소를 갖는 상기 마스트(6)상에 각각 제1 및 제2 감쇠력을 발생시키기 위해 상기 마스트(6)에 작동 가능하게 연결되고;상기 로터(3, 3', 3''')는 서로 반대 방향으로 회전하는 상기 제1 및 제2 매스들(20a, 20b; 21a, 21b)을 구동하기 위해 상기 마스트(6)와 상기 제1 및 제2 매스들(20a, 20b; 21a, 21b) 사이에 기능적으로 개재된 전달 유닛(19, 19', 19''')을 더 포함하는, 호버링 가능한 항공기(1)용 로터(3, 3', 3''')에 있어서,상기 제1 및 제2 매스들(20a, 20b; 21a, 21b)은 사용시 상기 마스트(6)상에서 정현파 형태의 합력(resultant force)을 발생시키고;상기 로터(3, 3', 3''')는 상기 합력의 진폭 및 위상을 변경하기 위해 선택적으로 동작 가능한 액추에이터 수단들(80a, 80b, 81a, 81b)을 더 포함하고;상기 액추에이터 수단들(80a, 80b, 81a, 81b)은:- 구동 부재(82);- 상기 제1 및 제2 매스들(20a, 20b; 21a, 21b) 중 하나에 작동 가능하게 연결되고, 상기 마스트(6)에 대해 회전할 수 있는 지지 요소(66);- 상기 구동 부재(82)에 의해 구동될 수 있고, 사용시 상기 지지 요소(66)를 구동하도록 설계된 추가의 전달 유닛(65, 67);을 포함하고,상기 추가의 전달 유닛(65, 67)은 상기 구동 부재(82)의 출력 부재(83)로부터 상기 지지 요소(66)로만 운동을 비가역적으로 전달하고, 상기 지지 요소(66)로부터 상기 구동 부재(82)로의 반대 방향으로의 운동의 전달을 방지하도록 구성되고;상기 추가의 전달 유닛(65, 67)은, 상기 구동 부재(82)에 의해 동작될 수 있는 웜 스크루(65)와 상기 지지 요소(66)에 의해 운반되고 상기 웜 스크루(65)와 비가역적으로 맞물리는 헬리컬의 기어치(67)를 포함하고;상기 로터(3, 3', 3''')는, 각각의 상기 제1 매스(20a, 20b) 및 제2 매스(21a, 21b)에 대해서, 연관된 케이싱(62, 63)을 포함하고;상기 연관된 케이싱(62, 63)은 상기 제1 축(A) 주위로 상기 마스트(6) 및 상기 구동 부재(82)와 일체로 회전하고, 상기 추가의 전달 유닛(66, 67)을 적어도 부분적으로 수용하고;연관된 출력 부재(83)가 상기 제1 축(A)에 횡방향인 제2 축(B) 주위로 상기 케이싱(62, 63)에 대해 회전하고;상기 지지 요소(66)는 상기 제1 축(A) 주위로 상기 케이싱(62, 63)과 각을 이루어 일체형으로 장착되는 것을 특징으로 하는, 호버링 가능한 항공기(1)용 로터(3, 3', 3''').

ROTOR FOR A HOVER-CAPABLE AIRCRAFTA rotor for an aircraft is described that comprises: a hub rotatable about an axis and, in turn, comprising a plurality of blades; a mast connectable to a drive member of the aircraft and connected to the hub to drive the hub in rotation about the axis; and damping means to dampen the transmission of vibrations to the mast in a plane orthogonal to the axis; the damping means comprising at least a first mass and a second mass that can eccentrically rotate about the axis with a first and a second speed of rotation, respectively; the first mass and second mass are operatively connected to the mast to generate, respectively, a first and a second damping force on the mast having a main component in a direction radial to the axis; the rotor comprises a transmission unit, which is interposed between the mast and the first and second masses so as to drive the first and second masses in rotation.A rotor (3, 3′, 3′″) for a hover-capable aircraft (1), comprising: a hub (5) rotatable about a first axis (A) and, in turn, comprising a plurality of blades (9);a mast (6) connectable to a drive member of said aircraft (1) and operatively connected to said hub (5) to drive the hub (5) in rotation about said first axis (A);damping means (15; 20a, 20b; 21a, 21b) to dampen the transmission of vibrations to said mast (6) in a plane orthogonal to said first axis (A);said damping means (15; 20a, 20b; 21a, 21b) in turn comprising at least one first mass (20a, 20b) and at least one second mass (21a, 21b) that can eccentrically rotate about said first axis (A), respectively with a first and a second speed of rotation ((N−1)*Ω; (N+1)*Ω) with respect to said mast (6);said first mass (20a, 20b) and second mass (21a, 21b) being operatively connected to said mast (6) to generate, respectively, a first and a second damping force on said mast (6) having a main component in a direction radial to said first axis (A);said rotor (3, 3′, 3′″) further comprising a transmission unit (19, 19′, 19′″), which is functionally interposed between said mast (6) and said first and second masses (20a, 20b; 21a, 21b) so as to drive said first and second masses (20a, 20b; 21a, 21b) in rotation in opposite directions to each other;characterized in that said first and second masses (20a, 20b; 21a, 21b) generate, in use, a resultant force with a sinusoidal course on said mast (6);said rotor (3, 3′, 3′″) further comprising actuator means (80a, 80b, 81a, 81b) selectively operable to vary the amplitude and phase of said resultant force;said actuator means (80a, 80b, 81a, 81b) comprising:a drive member (82);a support element (66) operatively connected to one of said first and second masses (20a, 20b; 21a, 21b) and rotatable with respect to said mast (6); anda further transmission unit (65, 67) that can be driven by said drive member (82) and designed to drive, in use, said support element (66);said further transmission unit (65, 67) being configured so as to irreversibly transmit motion only from an output member (83) of said drive member (82) to said support element (66) and to prevent the transmission of motion in the opposite direction from said support element (66) to said drive member (82);said further transmission unit (65, 67) comprising a worm screw (65) that can be operated by said drive member (82), and helical gear teeth (67) carried by said support element (66) and irreversibly meshing with said worm screw (65);said rotor (3, 3′, 3′″) comprising, for each said first mass (20a, 20b) and second mass (21a, 21b), an associated casing (62, 63);said associated casing (62, 63) rotating integrally with said mast (6) and with said drive member (82) about said first axis (A), and at least partly housing said further transmission unit (66, 67); the associated output member (83) rotating with respect to said casing (62, 63) about a second axis (B) transversal to said first axis (A);said support element (66) being mounted in a manner angularly integral with said casing (62, 63) about said first axis (A).

21102

생물학적 제제 제조업

특허

ko

en

LAG-3-결합 분자 및 그 사용 방법본 발명은 항-LAG-3 항체, LAG-3 mAb 1, LAG-3 mAb 2, LAG-3 mAb 4, LAG-3 mAb 5, 및 LAG-3 mAb 6, 및 이러한 항체의 인간화 및 키메라 버전에 관한 것이다. 본 발명은 추가적으로 이러한 항-LAG-3 항체의 LAG-3의 LAG-3 결합 단편을 포함하는 LAG-3-결합 분자, 면역컨쥬게이트, 및 (i) 이러한 LAG-3-결합 단편, 및 (ii) 디아바디, BiTE, 이중특이적 항체, 등을 포함하는, 면역 세포의 표면 상에 존재하는 면역 체크포인트를 조절하는데 수반되는 분자의 에피토프에 결합할 수 있는 도메인을 포함하는 이중특이적 분자에 관한 것이다. 본 발명은 또한 LAG-3을 검출하는 방법, 뿐만 아니라 면역 반응을 자극하기 위해 LAG-3에 결합하는 분자를 사용하는 방법에 관한 것이다. 인간 LAG-3 및 시노몰구스 원숭이 LAG-3 둘 다에 결합할 수 있는 LAG-3-결합 분자로서, 상기 LAG-3-결합 분자는 가변 중쇄 도메인 및 가변 경쇄 도메인을 포함하며, 상기 가변 중쇄 도메인은 CDRH1 도메인, CDRH2 도메인 및 CDRH3 도메인을 포함하고, 상기 가변 경쇄 도메인은 CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인을 포함하는데, 여기에서:(A) (1) CDRH1 도메인, CDRH2 도메인, 및 CDRH3 도메인은 LAG-3 mAb 1의 중쇄 CDR이고, 각각 아미노산 서열, 서열 번호:8, 서열 번호:9, 및 서열 번호:10을 갖고; (2) CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인은 LAG-3 mAb 1의 경쇄 CDR이고, 각각 아미노산 서열, 서열 번호:13, 서열 번호:14, 및 서열 번호:15를 갖거나;또는(B) (1) CDRH1 도메인, CDRH2 도메인, 및 CDRH3 도메인은 hLAG-3 mAb 1의 중쇄 CDR이고, 각각 아미노산 서열, 서열 번호:8, 서열 번호:9, 및 서열 번호:10을 갖고; (2) CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인은 hLAG-3 mAb 1의 경쇄 CDR이고, 각각 아미노산 서열, 서열 번호:28, 서열 번호:14, 및 서열 번호:15를 갖거나;또는(C) (1) CDRH1 도메인, CDRH2 도메인, 및 CDRH3 도메인은 LAG-3 mAb 2의 중쇄 CDR이고, 각각 아미노산 서열, 서열 번호:31, 서열 번호:32, 및 서열 번호:33을 갖고; (2) CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인은 LAG-3 mAb 2의 경쇄 CDR이고, 각각 아미노산 서열, 서열 번호:36, 서열 번호:37, 및 서열 번호:38을 갖거나;또는(D) (1) CDRH1 도메인, CDRH2 도메인, 및 CDRH3 도메인은 LAG-3 mAb 3의 중쇄 CDR이고, 각각 아미노산 서열, 서열 번호:41, 서열 번호:42, 및 서열 번호:43을 갖고; (2) CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인은 LAG-3 mAb 3의 경쇄 CDR이고, 각각 아미노산 서열, 서열 번호:46, 서열 번호:47, 및 서열 번호:48을 갖거나;또는(E) (1) CDRH1 도메인, CDRH2 도메인, 및 CDRH3 도메인은 LAG-3 mAb 4의 중쇄 CDR이고, 각각 아미노산 서열, 서열 번호:51, 서열 번호:52, 및 서열 번호:53을 갖고; (2) CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인은 LAG-3 mAb 4의 경쇄 CDR이고, 각각 아미노산 서열, 서열 번호:56, 서열 번호:57, 및 서열 번호:58을 갖거나;또는(F) (1) CDRH1 도메인, CDRH2 도메인, 및 CDRH3 도메인은 LAG-3 mAb 5의 중쇄 CDR이고, 각각 아미노산 서열, 서열 번호:61, 서열 번호:62, 및 서열 번호:63을 갖고; (2) CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인은 LAG-3 mAb 5의 경쇄 CDR이고, 각각 아미노산 서열, 서열 번호:66, 서열 번호:67, 및 서열 번호:68을 갖거나;또는(G) (1) CDRH1 도메인, CDRH2 도메인, 및 CDRH3 도메인은 LAG-3 mAb 6 VH1의 중쇄 CDR이고, 각각 아미노산 서열, 서열 번호:71, 서열 번호:72, 및 서열 번호:73을 갖고 (2) CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인은 LAG-3 mAb 6의 경쇄 CDR이고, 각각 아미노산 서열, 서열 번호:76, 서열 번호:77, 및 서열 번호:78을 갖거나; 또는 (H) (1) CDRH1 도메인, CDRH2 도메인, 및 CDRH3 도메인은 LAG-3 hAb 6의 중쇄 CDR이고, 각각 아미노산 서열, 서열 번호:71, 서열 번호:72, 및 서열 번호:73을 갖고; (2) CDRL1 도메인, CDRL2 도메인, 및 CDRL3 도메인은 hLAG-3 hAb 6의 경쇄 CDR이고, 각각 아미노산 서열, 서열 번호:87, 서열 번호:77, 및 서열 번호:78을 갖는 LAG-3-결합 분자.

LAG-3-BINDING MOLECULES AND METHODS OF USE THEREOFThe present invention is directed to the anti -LAG-3 antibodies, LAG-3 mAb 1, LAG-3 mAb 2, LAG-3 mAb 4, LAG-3 mAb 5, and LAG-3 mAb 6, and to humanized and chimeric versions of such antibodies. The invention additionally pertains to LAG-3 - binding molecules that comprise LAG-3 binding fragments of such anti-LAG-3 antibodies, immunocongugates, and to bispecific molecules, including diabodies, BiTEs, bispecific antibodies, etc., that comprise (i) such LAG-3-binding fragments, and (ii) a domain capable of binding an epitope of a molecule involved in regulating an immune check point present on thesurface of an immune cells. The present invention also pertains to methods of detecting LAG-3, as well as methods of using molecules that bind LAG-3 for stimulating immune responses.A kind of combination lag-3 molecule, it can be bound to people lag-3 and be bound to machin lag-3, wherein the combination lag-3 molecule includes variable heavy chain domain and variable light chain domain, wherein：the variable heavy chain domain includes cdrh1 domain, cdrh2 domains and cdrh3 domains, and described lighten hinge domain includes cdrl1 domain, cdrl2 domains and cdrl3 domains, wherein：(a) (1) cdrh1 domain, cdrh2 domains and cdrh3 domains are lag-3 mab 1 heavy chain cdr, and there is amino acid sequence respectively：seq id no:8、seq id no:9 and seq id no:10；with(2) cdrl1 domain, cdrl2 domains and cdrl3 domains are lag-3 mab 1 light chain cdr, and respectively with amino acid sequence：seq id no:13、seq id no:14 and seq id no:15；or(b) (1) cdrh1 domain, cdrh2 domains and cdrh3 domains are hlag-3 mab 1 heavy chain cdr, and there is amino acid sequence respectively：seq id no:8、seq id no:9 and seq id no:10；with(2) cdrl1 domain, cdrl2 domains and cdrl3 domains are hlag-3 mab 1 light chain cdr, and point ju you not amino acid sequence：seq id no:28、seq id no:14 and seq id no:15；or(c) (1) cdrh1 domain, cdrh2 domains and cdrh3 domains are lag-3 mab 2 heavy chain cdr, and there is amino acid sequence respectively：seq id no:31、seq id no:32 and seq id no:33；with(2) cdrl1 domain, cdrl2 domains and cdrl3 domains are lag-3 mab 2 light chain cdr, and respectively with amino acid sequence：seq id no:36、seq id no:37 and seq id no:38；or(d) (1) cdrh1 domain, cdrh2 domains and cdrh3 domains are lag-3 mab 3 heavy chain cdr, and there is amino acid sequence respectively：seq id no:41、seq id no:42 and seq id no:43；with(2) cdrl1 domain, cdrl2 domains and cdrl3 domains are lag-3 mab 3 light chain cdr, and respectively with amino acid sequence：seq id no:46、seq id no:47 and seq id no:48；or(e) (1) cdrh1 domain, cdrh2 domains and cdrh3 domains are lag-3 mab 4 heavy chain cdr, and there is amino acid sequence respectively：seq id no:51、seq id no:52 and seq id no:53；with(2) cdrl1 domain, cdrl2 domains and cdrl3 domains are lag-3 mab 4 light chain cdr, and respectively with amino acid sequence：seq id no:56、seq id no:57 and seq id no:58；or(f) (1) cdrh1 domain, cdrh2 domains and cdrh3 domains are lag-3 mab 5 heavy chain cdr, and there is amino acid sequence respectively：seq id no:61、seq id no:62 and seq id no:63；with(2) cdrl1 domain, cdrl2 domains and cdrl3 domains are lag-3 mab 5 light chain cdr, and respectively with amino acid sequence：seq id no:66、seq id no:67 and seq id no:68；or(g) (1) cdrh1 domain, cdrh2 domains and cdrh3 domains are the vh1 of lag-3 mab 6 heavy chain cdr, and there is amino acid sequence respectively：seq id no:71、seq id no:72 and seq id no:73；with(2) cdrl1 domain, cdrl2 domains and cdrl3 domains are lag-3 mab 6 light chain cdr, and respectively with amino acid sequence：seq id no:76、seq id no:77 and seq id no:78；or(h) (1) cdrh1 domain, cdrh2 domains and cdrh3 domains are lag-3 hab 6 heavy chain cdr, and there is amino acid sequence respectively：seq id no:71、seq id no:72 and seq id no:73；with(2) cdrl1 domain, cdrl2 domains and cdrl3 domains are hlag-3 hab 6 light chain cdr, and point ju you not amino acid sequence：seq id no:87、seq id no:77 and seq id no:78.

27213

물질 검사, 측정 및 분석 기구 제조업

특허

ko

en

무기 반도전성 재료 및 유기 결합제를 포함하는 반도체 조성물본 발명은 무기 반도전성 재료 및 유기 결합제를 포함하는 반도체 조성물에 관한 것이다. 본 발명은 또한 이러한 반도체 조성물로 이루어지는 반도전성 층을 포함하는 전자 소자에 관한 것이다.무기 반도전성 재료 및 유기 결합제를 포함하는 반도전성 조성물로서, 상기 유기 결합제가 화학식 (I) 의 것인 반도체 조성물:[이미지][식 중,a 는 각 경우 서로 독립적으로, 1, 2, 3, 4, 5, 6 및 7 로 이루어진 군에서 선택되는 정수이고,A0 및 A1 은 각 경우 서로 독립적으로, C-R5 또는 N 이고, 단, A0 및 A1 중 하나 이상은 N 이고,b1, b2, b3, b4, c1, c2, c3 및 c4 는 각각, 각 경우 서로 독립적으로, 0 또는 1 이고,Sp1, Sp2, Sp3 및 Sp4 는 각 경우 서로 독립적으로, 화학식 (III-a) 내지 (III-h)[이미지][이미지]로 이루어진 군에서 선택되고,Ar1, Ar2, Ar3 및 Ar4 는 각 경우 서로 독립적으로, 화학식 (II)[이미지](식 중, * 는 각각의 기 Sp1, Sp2, Sp3 또는 Sp4 또는 - 이것이 존재하지 않는 경우 - 화학식 (II) 의 중심 단위, 각각의 기 R1, R2, R3 또는 R4 및 치환기 R7 및 R8 에 대한 각각의 결합을 나타낸다)에서 선택되고,R1, R2, R3, R4 및 - 존재하는 경우 - R5 및 R6 은 각 경우 서로 독립적으로, 기 RA 또는 기 RB 이고, 단, R1, R2, R3, R4 및 - 존재하는 경우 - R5 및 R6 중 하나 이상은 기 RA 이고,RA 는 각 경우 독립적으로,(i) H, F, Br, Cl, -CN, -CH2Br, -CH2OR0, -NC, -NCO, -NCS, -OCN, -SCN, -C(O)NR0R00, -C(O)X0, -C(O)R0, -C(O)R0-OR00, -NR0R00, -PR0R00, -O-P(OR0)(OR00), -O-PH(O)-OR0, -SH, -SR0, -S(O)R0, -SO3H, -SO2R0, -SO3R0, -NO2, -SF5, -C≡C-R0, -CR0=CR00R000,(ii) 1 내지 40 개의 탄소 원자를 갖는 불소화 알킬,(iii) 1 내지 40 개의 탄소 원자를 갖는 알킬 또는 불소화 알킬 (2 개의 인접한 탄소 원자는 -CR0=CR00- 또는 -C≡C- 로 대체된다),(iv) 1 내지 40 개의 탄소 원자를 갖는 알킬 또는 불소화 알킬 (하나 이상의, 바람직하게는 비-인접한, 탄소 원자는 헤테로원자 또는 헤테로원자 기로 대체된다),(v) 6 내지 30 개의 탄소 고리 원자를 갖는 아릴,(vi) 5 내지 30 개의 고리 원자를 갖는 헤테로아릴(상기 아릴 및 헤테로아릴은 비치환될 수 있거나 또는 하나 이상의 기 RS 로 치환될 수 있고, 상기 알킬 및 불소화 알킬은 RS, 본원에서 정의한 바와 같은 아릴 및 헤테로아릴로 이루어진 군에서 선택되는 하나 이상의 기로 치환될 수 있다)로 이루어진 군에서 선택되고,RB 는 각 경우 독립적으로,(i) H, -SiR0R00R000,(ii) 1 내지 40 개의 탄소 원자를 갖는 알킬,(iii) 1 내지 39 개의 탄소 원자를 갖는 알콕시,(iv) -(CH2)d-R9 (식 중, d 는 1 내지 5 의 정수이고, R9 는(a) -SiR0R00R000, -C≡C-SiR0R00R000,(b) 1 내지 19 개의 탄소 원자를 갖는 알킬,(c) 1 내지 19 개의 탄소 원자를 갖는 알킬 (2 개의 인접한 탄소 원자는 -CR0=CR00- 또는 -C≡C- 로 대체된다),(d) 1 내지 19 개의 탄소 원자를 갖는 알킬 (하나 이상의, 바람직하게는 비-인접한, 탄소 원자는 본원에서 정의한 바와 같은 헤테로원자 또는 헤테로원자 기로 대체된다),(e) 6 내지 30 개의 탄소 고리 원자를 갖는 아릴, 및(f) 5 내지 30 개의 고리 원자를 갖는 헤테로아릴(상기 아릴 및 헤테로아릴은 비치환될 수 있거나 또는 하나 이상의 기 RS 로 치환될 수 있고, 상기 알킬 및 불소화 알킬은 RS, 아릴 및 헤테로아릴로 이루어진 군에서 선택되는 하나 이상의 기로 치환될 수 있다)로 이루어진 군에서 선택된다)로 이루어진 군에서 선택되고,R0, R00 및 R000 은 각 경우 서로 독립적으로, H, F, C1-40 오르가닐 또는 오르가노헤테릴, 및 치환 C1-40 오르가닐 또는 오르가노헤테릴로 이루어진 군에서 선택되고,X0 은 각 경우 독립적으로, F, Cl, Br 및 I 로 이루어진 군에서 선택되고,RS 는 각 경우 독립적으로, 1 내지 30 개의 탄소 원자를 갖는 알킬, 1 내지 30 개의 탄소 원자를 갖는 할로겐화 알킬, 6 내지 30 개의 탄소 고리 원자를 갖는 아릴, F, Cl, Br, I, 1 내지 30 개의 탄소 원자를 갖는 알킬 및 1 내지 30 개의 탄소 원자를 갖는 할로겐화 알킬로 이루어진 군에서 독립적으로 선택되는 하나 이상의 기로 치환되는 6 내지 30 개의 탄소 고리 원자를 갖는 아릴, 1 내지 30 개의 고리 원자를 갖는 헤테로아릴, F, Cl, Br, I, 1 내지 30 개의 탄소 원자를 갖는 알킬 및 1 내지 30 개의 탄소 원자를 갖는 할로겐화 알킬로 이루어진 군에서 독립적으로 선택되는 하나 이상의 기로 치환되는 1 내지 30 개의 고리 원자를 갖는 헤테로아릴로 이루어진 군에서 선택된다].

Semiconductor composition comprising an inorganic semiconducting material and an organic binderThe present invention relates to a semiconductor composition comprising an inorganic semiconducting material and an organic binder. The present invention further relates to an electronic device comprising a semiconducting layer consisting of such semiconductor composition.Semiconductor composition, it includes inorganic semiconductor material and organic bond, and the organic bond has formula (i)whereina at each occurrence independently of other any ground be selected from 1,2,3,4,5,6 and 7 integer,a0and a1it is c-r independently of one another at each occurrence5or n, condition is a0and a1at least one of be n,b1, b2, b3, b4, c1, c2, c3 and c4 are each 0 or 1 independently of one another at each occurrence,sp1, sp2, sp3and sp4formula (iii-a) to (iii-h) is independently from each other at each occurrencear1, ar2, ar3and ar4formula (ii) is independently from each other at each occurrence,wherein * is represented to each group sp1, sp2, sp3or sp4if each key or they be not present, then it represents that to formula (ii) each key of center cell, to each group r1, r2, r3or r4each key and to substituent r7and r8each key；r1, r2, r3, r4if with the r existed5and r6it is group r independently of one another at each occurrenceaor group rb, condition is r1, r2, r3, r4if with the r existed5and r6at least one of be group ra,raat each occurrence independently selected from(i) h, f, br, cl ,-cn ,-ch2br ,-ch2or0,-nc ,-nco ,-ncs ,-ocn ,-scn ,-c (o) nr0r00,-c (o) x0,-c (o) r0,-c (o) r0-or00,-nr0r00,-pr0r00,-o-p (or0)(or00) ,-o-ph (o)-or0,-sh ,-sr0,-s (o)r0,-so3h ,-so2r0,-so3r0,-no2,-sf5,-c ≡ c-r0,-cr0=cr00r000,(ii) there is the fluorinated alkyl of 1 to 40 carbon atom,(iii) there is the alkyl or fluorinated alkyl of 1 to 40 carbon atom, the adjacent carbon atom of two of which is by-cr0=cr00- or-c ≡ c- are substituted,(iv) there is the alkyl or fluorinated alkyl of 1 to 40 carbon atom, wherein one or more, preferably non-conterminous carbon atom quilt hetero atom or heteroatom group are substituted,(v) there is the aryl of 6 to 30 carboatomic ring atoms,(vi) there is the heteroaryl of 5 to 30 annular atoms,wherein described aryl and heteroaryl can be unsubstituted or by one or more group rssubstitution, and wherein described alkyl and fluorine r can be selected from by one or more by changing alkyls, the substituent group of aryl and heteroaryl as defined herein,rbat each occurrence independently selected from(i) h ,-sir0r00r000,(ii) there is the alkyl of 1 to 40 carbon atom,(iii) there is the alkoxy of 1 to 39 carbon atom,(iv)-(ch2)d-r9, wherein d is integer 1 to 5, and r9it is selected from(a)-sir0r00r000,-c ≡ c-sir0r00r000,(b) there is the alkyl of 1 to 19 carbon atom,(c) there is the alkyl of 1 to 19 carbon atom, the adjacent carbon atom of two of which is by-cr0=cr00- or-c ≡ c- replacements,(d) there is the alkyl of 1 to 19 carbon atom, wherein one or more, preferably non-conterminous carbon atom is defined herein hetero atom or heteroatom group substitute,(e) there is the aryl of 6 to 30 carboatomic ring atoms, and(f) there is the heteroaryl of 5 to 30 annular atoms,wherein described aryl and heteroaryl can be unsubstituted or by one or more group rssubstitution, and wherein described alkyl and fluorine r can be selected from by one or more by changing alkyls, the substituent group of aryl and heteroaryl,r0, r00and r000h, f, c are independently from each other at each occurrence1-40organic group or organic miscellaneous base, and the c replaced1-40 organic group or organic miscellaneous base,x0at each occurrence independently selected from f, cl, br and i,rsat each occurrence independently selected from the alkyl with 1 to 30 carbon atom, the alkyl halide with 1 to 30 carbon atom base, the aryl with 6 to 30 carboatomic ring atoms, by least one independently selected from f, cl, br, i substituent group have 6 to the aryl of 30 carboatomic ring atoms, the alkyl with 1 to 30 carbon atom and the haloalkyl with 1 to 30 carbon atom, with 1 to the heteroaryl of 30 annular atoms, by least one independently selected from f, cl, br, i substituent group has 1 to 30 ring original the heteroaryl of son, the alkyl with 1 to 30 carbon atom and the haloalkyl with 1 to 30 carbon atom.

20202

합성수지 및 기타 플라스틱 물질 제조업

특허

ko

en

친수성 치환기를 갖는 중합성 폴리실록산본 발명은 실록산 단위의 실리콘 원자와 연결된 저분자량 친수성 중합체 사슬을 갖는 적어도 하나의 실록산 단위를 포함하는 폴리실록산 분절을 포함하는 폴리실록산 중합체 사슬, 및 폴리실록산 중합체 사슬의 말단 중 하나 및/또는 하나의 실리콘 원자와 각각 연결된 저분자량 친수성 중합체 사슬들 중 하나의 말단에 각각 공유 결합된 (메트)아크릴아미도기를 포함하는 화학선 중합성 양친매성 폴리실록산을 제공한다. 본 발명은 또한, 본 발명의 화학선 중합성 양친매성 폴리실록산으로부터 유도된 반복 단위를 포함하는, 중합체, 화학선 가교성 실리콘-함유 예비중합체, 실리콘 하이드로겔 고분자 재료, 또는 실리콘 하이드로겔 콘택트렌즈에 관한 것이다. 또한, 본 발명은 본 발명의 화학선 중합성 양친매성 폴리실록산을 포함하는 수계 렌즈 형성 배합물을 사용하여 실리콘 하이드로겔 콘택트렌즈를 제조하는 방법을 제공한다.화학식 (1) 또는 (2)의 화학선 중합성 양친매성 폴리실록산.[화학식 1][화학식 2]여기서,υ1, υ2, 및 ω1은 서로 독립적으로 1 내지 500의 정수이고;ω2는 서로 독립적으로 1 내지 10의 정수이고;R3와 R4는 서로 독립적으로 직접 결합 또는 치환 또는 비치환된 C1-C10 알킬렌 2가 라디칼이고;R10과 R11은 서로 독립적으로 치환 또는 비치환된 C1-C10 알킬렌 2가 라디칼이고;R5, R6, R7, R8, R9, R12, R13, R14, R15, R16, 및 R17은 서로 독립적으로 C1-C8-알킬, C1-C4 알킬- 또는 C1-C4 알콕시-치환 페닐, 또는 플루오로-치환 C1-C18 알킬, (그러나, 바람직하게는 메틸)이고;L1은 의 2가 라디칼이며, 여기서 R18은 치환 또는 비치환된 C1-C10 알킬렌 2가 라디칼이고, R18'은 직접 결합 또는 치환 또는 비치환된 C1-C10 알킬렌 2가 라디칼이고, X1은 직접 결합, 티오 에테르 결합 (-S-), -NR20- 이며, 여기서 R20은 치환 또는 비치환된 C1-C10 알킬, 또는 , , , , , , 또는 의 2가 라디칼이며, 여기서 R19는 치환 또는 비치환된 C1-C10 알킬렌 2가 라디칼이고 R20은 치환 또는 비치환된 C1-C10 알킬이고;L2는 직접 결합 또는 치환 또는 비치환된 C1-C10 알킬렌 2가 라디칼이고;E1, E2 및 E3는 서로 독립적으로 수소, 치환 또는 비치환된 C1-C8-알킬, C1-C8-알콕시, -NH2, R'이 C1-C10 알킬인 -NHR', 하이드록실, 카르복실, Br, Cl, 티올, 또는 중합성기이며, 여기서, r1과 r2는 서로 독립적으로 0 또는 1의 정수이고, R"은 수소 또는 메틸이고, R21은 치환 또는 비치환된 C1-C10 알킬렌 2가 라디칼이고, X2는 , , , , , 이며, 여기서 R22와 R23은 서로 독립적으로 C1-C8 알킬(바람직하게는 메틸)이고, R19는 치환 또는 비치환 C1-C10 알킬렌 2가 라디칼이며, 단, (i) E1과 E2가 모두 중합성기이거나 (ii) E3가 중합성기이고;hPC는 (1) 옥사졸린의 개환 중합에서 얻어지는 폴리옥사졸린 분절(, 여기서 R1은 수소, 메틸 또는 에틸기, q는 3 내지 500의 정수임), (2) 아스파라긴, 글루타민, 알라닌, 글리신, 및 이들의 조합으로 이루어진 군으로부터 선택되는 적어도 하나의 아미노산으로 이루어진 폴리펩티드 분절, 및 (3) (메트)아크릴아미드, N,N-디메틸 (메트)아크릴아미드, 디메틸아미노에틸 (메트)아크릴레이트, 디메틸아미노에틸 (메트)아크릴아미드, N-비닐-2-피롤리돈, N-비닐-N-메틸 이소프로필아미드, N-비닐-N-메틸 아세트아미드, N-비닐 포름아미드, N-비닐 아세트아미드, N-비닐 이소프로필아미드, N-비닐-N-메틸 아세트아미드, N-메틸-3-메틸렌-2-피롤리돈, 1-에틸-3-메틸렌-2-피롤리돈, 1-메틸-5-메틸렌-2-피롤리돈, 1-에틸-5-메틸렌-2-피롤리돈, 5-메틸-3-메틸렌-2-피롤리돈, 5-에틸-3-메틸렌-2-피롤리돈, 1-n-프로필-3-메틸렌-2-피롤리돈, 1-n-프로필-5-메틸렌-2-피롤리돈, 1-이소프로필-3-메틸렌-2-피롤리돈, 1-이소프로필-5-메틸렌-2-피롤리돈, 1-n-부틸-3-메틸렌-2-피롤리돈, 1-tert-부틸-3-메틸렌-2-피롤리돈, 및 이들의 혼합물로 이루어진 군으로부터 선택되는 적어도 하나의 친수성 비닐계 단량체로부터 유도된 친수성 단량체 단위로 이루어진 친수성 중합체 분절로 이루어진 군으로부터 선택된 친수성 중합체 분절임.

POLYMERIZABLE POLYSILOXANES WITH HYDROPHILIC SUBSTITUENTSThe invention provides an actinically-polymerizable amphiphilic polysiloxane which comprises a polysiloxane polymer chain comprising a polylsiloxane segments comprising at least one siloxane unit having a low molecular weight hydrophilic polymer chain connected with a silicone atom of the siloxane unit, and (meth)acrylamido groups each covalently bonded to one of the ends of the polysiloxane polymer chain and/or to the end of one of low molecular weight hydrophilic polymer chains each connected with one silicone atom. The present invention is also related to a polymer, an actinically-crosslinkable silicone-containing prepolymer, a silicone hydrogel polymeric material, or a silicone hydrogel contact lens, which comprises repeating units derived from an actinically-polymerizable amphiphilic polysiloxane of the invention. In addition, the invention provides a method for making silicone hydrogel contact lenses using a water-based lens-forming formulation comprising an actinically-polymerizable amphiphilic polysiloxane of the invention.Anin which:υ1 , υ2, and ω1 independently of one another are an integer of from 1 to 500; a>2 independent of each other are an integer of from 1 to 10;R3 and R4, independently of each other, are a direct bond or a substituted or unsubstituted C1-C10 alkylene divalent radical;R10 and R11 , independently of each other, are a substituted or unsubstituted C-i- C10 alkylene divalent radical;R5, R6, R7, Re, Rg, R12, R-I3, Ri4, Ri5, R16, and R-|7, independently of one another, are C C8-alkyl, C C4 alkyl- or C C4 alkoxy-substituted phenyl, or fluoro- substituted CrCi8-alkyl, (but preferably are methyl);Li is a divalent radical of '^CH2 ~R 8 Xl Rl8 jn which R18 is a substituted or unsubstituted C1-C10 alkylene divalent radical and Ri8' is a direct bond or a substituted or unsubstituted C1-C10 alkylene divalent radical, Xi is a direct bond, a thio ether bond (-S-), -NR2o- in which R2o is a substituted or unsubstituted CrC10 alkyl, or a divalent radical of NH 0 0 R20 OH R20 OH— NH-C-R19-S— ^ -C-NH-R19-S- ^ -N-CH2-CH-CH2-NH- ^ OR -N-CH2-CH-CH2-S- jn which R19 is a substituted or unsubstituted C1-C10 alkylene divalent radical and R20 is a substituted or unsubstituted C1-C10 alkyl;L2 is a direct bond or a substituted or unsubstituted C1-C10 alkylene divalent radical;E2 and E3, independent of one another, are hydrogen, substituted or unsubstituted CrC8-alkyl, d-C8-alkoxy, -NH2, -NHR' with R' being C1-C10 alkyl, hydroxyl, carboxyl, Br, CI, thiol, or a polymerizable group which is in which r1 and r2 independent of each other are integer of 0 or 1 , R' is hydrogen or methyl, R2i is a substituted or unsubstitutedR22 oO O _c y_co-ou— d-C10 alkylene divalent radical, X2 is — NH-C- _ -C-NH- _ R23R22 o— C C-O— R-ig-S—-NH-C-R19-S— -C-NH-R19-S- _ R23 JN W CH R^ GND R^ independent of each other are C C8 alkyl (preferably methy), and R19 is a substituted or unsubstituted C1-C10 alkylene divalent radical, provided that either (i) Ei and E2 both are a polymerizable group or (ii) E3 is a polymerizable group; andhPC is a hydrophilic pol segment selected from the group consisting of (1 ) polyoxazoline segment in which R is hydrogen, methyl or ethyl group, and q is an integer from 3 to 500) which is obtained in a ring-opening polymerization of oxazoline, (2) a polypeptide segment composed of at least one amino acid selected from the group consisting of asparagine, glutamine, alanine, glycine, and combinations thereof, and (3) a hydrophilic polymer segment composed of hydrophilic monomeric units derived from at least one hydrophilic vinylic monomer selected from the group consisting of (meth)acrylamide, N,N- dimethyl (meth)acrylamide, dimethylaminoethyl (meth)acrylate,dimethylaminoethyl (meth)acrylamide, N-vinyl-2-pyrrolidone, N-vinyl-N-methyl isopropylamide, N-vinyl-N-methyl acetamide, N-vinyl formamide, N-vinyl acetamide, N-vinyl isopropylamide, N-vinyl-N-methyl acetamide, N-methyl-3- methylene-2-pyrrolidone, 1 -ethyl-3-methylene-2-pyrrolidone, 1 -methyl-5- methylene-2-pyrrolidone, 1 -ethyl-5-methylene-2-pyrrolidone, 5-methyl-3- methylene-2-pyrrolidone, 5-ethyl-3-methylene-2-pyrrolidone, 1 -n-propyl-3- methylene-2-pyrrolidone, 1 -n-propyl-5-methylene-2-pyrrolidone, 1 -isopropyl-3- methylene-2-pyrrolidone, 1 -isopropyl-5-methylene-2-pyrrolidone, 1 -n-butyl-3- methylene-2-pyrrolidone, 1-tert-butyl-3-methylene-2-pyrrolidone, and mixtures thereof.The actinically-polymerizable amphiphilic polysiloxane of any one of claim 1 , wherein Ei and E2 are an polymerizable group of .The actinically-polymerizable amphiphilic polysiloxane of claim 1 or 2, wherein E1 and E2 are hydrogen, substituted or unsubstituted CrC8-alkyl, CrC8-alkoxy, -NH2, -NHR' with R' being C Cio alkyl, hydroxyl, carboxyl, Br, CI, or thiol.The actinically-polymerizable amphiphilic polysiloxane of any one of claims 1 to 3, wherein E3 is an polymerizable group of .

20119

석탄화학계 화합물 및 기타 기초 유기화학 물질 제조업

특허

ko

en

헤테로 축합된 페닐퀴나졸린 및 전자 소자에서의 그의 용도본 발명은 하기 화학식 (I)의 화합물 및 그의 제조 방법, 이들 화합물 중 적어도 1종을 포함하는 전자 소자, 화학식 (I)의 적어도 1종의 화합물을 포함하는, 바람직하게는 전자 소자에 존재하는 발광층, 및 전자 소자에서 호스트 물질 및/또는 전하 수송 물질로서의 화학식 (I)에 따른 화합물의 용도에 관한 것이다.[이미지](I)하기 화학식 (I)의 화합물.[이미지](I)[식 중,X1은 CR1 또는 N이고,X2는 CR2 또는 N이고,X3은 CR3 또는 N이고,X4는 CR4 또는 N이고,X5는 CR5 또는 N이고,X6은 CR6 또는 N이고,X7은 CR7 또는 N이고,X8은 CR8 또는 N이고,X9는 CR9 또는 N이고,X10은 CR10 또는 N이고,상기 X1 및 X3은 동시에 CR1 및 CR3은 아니고,Y는 NR11, O 또는 S로부터 선택되고,R1, R2, R3, R4, R5, R6, R7, R8, R9, R10 및 R11은 서로 독립적으로 H, E, 화학식 -(L1)o-(L2)p-(L3)q-(L4)r-R14의 기, 비치환된 또는 적어도 하나의 기 E에 의해 치환되고 및/또는 적어도 하나의 기 D가 개재된 C1-C25 알킬기, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C7-C25 아르알킬, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C5-C12 시클로알킬기로부터 선택되거나, 또는R4, R5, R6, R7, R8, R9 또는 R10 중 적어도 2개는, 인접한 탄소 원자에 존재하는 경우, 함께 적어도 하나의 C6-C18 아릴 또는 C1-C18 헤테로아릴 고리 또는 고리계를 형성하고,o는 서로 독립적으로 0 또는 1이고, p는 서로 독립적으로 0 또는 1이고, q는 서로 독립적으로 0 또는 1이고, r은 서로 독립적으로 0 또는 1이고,L1, L2, L3 및 L4는 서로 독립적으로 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C6-C40 아릴기, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C1-C24 헤테로아릴기로부터 선택되고,R14는 서로 독립적으로 H, E, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C6-C24 아릴기, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C1-C24 헤테로아릴기, 비치환된 또는 적어도 하나의 기 E에 의해 치환되고 및/또는 적어도 하나의 기 D가 개재된 C1-C25 알킬기, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C7-C25 아르알킬, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C5-C12 시클로알킬기로부터 선택되고,D는 서로 독립적으로 -CO-, -COO-, -S-, -SO-, -SO2, -O-, -CR15=CR16-, -NR17-, -SiR22R23-, -POR25-, -C≡C-이고,E는 서로 독립적으로 -OR21, -SR21, -NR17R18, -COR20, -COOR19, -CONR17R18, -CN, -SiR22R23R24, -POR25R27, 할로겐, 비치환된 또는 적어도 하나의 -F, -CF3, -CF2CF3, -CF2CF2CF3, -CF(CF3)2, -(CF2)3CF3 또는 -C(CF3)3에 의해 치환된 C6-C60 아릴기, C1-C18 알킬 또는 적어도 하나의 O가 개재된 C1-C18 알킬기, 비치환된 또는 적어도 하나의 -F, -CF3, -CF2CF3, -CF2CF2CF3, -CF(CF3)2, -(CF2)3CF3 또는 -C(CF3)3에 의해 치환된 C1-C60 헤테로아릴기이고,R15 및 R16은 서로 독립적으로 H, 비치환된 또는 적어도 하나의 C1-C18 알킬기 또는 적어도 하나의 C1-C18 알콕시기에 의해 치환된 C6-C18 아릴기, C1-C18 알킬기 또는 적어도 하나의 O가 개재된 C1-C18 알킬기이고,R17 및 R18은 서로 독립적으로 H, 비치환된 또는 적어도 하나의 C1-C18 알킬기 또는 적어도 하나의 C1-C18 알콕시기에 의해 치환된 C6-C18 아릴기, C1-C18 알킬기 또는 적어도 하나의 O가 개재된 C1-C18 알킬기이거나, 또는R17 및 R18은 함께 5원 또는 6원 지방족, 방향족 또는 헤테로방향족 고리를 형성하고,R19는 H, 비치환된 또는 적어도 하나의 C1-C18 알킬기 또는 적어도 하나의 C1-C18 알콕시기에 의해 치환된 C6-C18 아릴기, C1-C18 알킬기 또는 적어도 하나의 O가 개재된 C1-C18 알킬기이고,R20은 H, 비치환된 또는 적어도 하나의 C1-C18 알킬기 또는 적어도 하나의 C1-C18 알콕시기에 의해 치환된 C6-C18 아릴기, C1-C18 알킬기 또는 적어도 하나의 O가 개재된 C1-C18 알킬기이고,R21은 서로 독립적으로 H, 비치환된 또는 적어도 하나의 C1-C18 알킬기 또는 적어도 하나의 C1-C18 알콕시기에 의해 치환된 C6-C18 아릴기, C1-C18 알킬기 또는 적어도 하나의 O가 개재된 C1-C18 알킬기이고,R22, R23 및 R24는 서로 독립적으로 H, C1-C18 알킬기, 비치환된 또는 적어도 하나의 C1-C18 알킬기에 의해 치환된 C6-C18 아릴기이고,R25 및 R27은 서로 독립적으로 H, C1-C18 알킬기, 비치환된 또는 적어도 하나의 C1-C18 알킬기에 의해 치환된 C6-C18 아릴기, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C7-C25 아르알킬기, 비치환된 또는 적어도 하나의 기 E에 의해 치환된 C5-C12 시클로알킬기이다.]

HETERO-CONDENSED PHENYLQUINAZOLINES AND THEIR USE IN ELECTRONIC DEVICESThe present invention relates to compounds of the general formula (I) and to a process for their preparation, to an electronic device comprising at least one of these compounds, to an emitting layer,preferably present in an electronic device, comprising at least one compound of general formula (I) and to the use of a compound according to general formula (I) in an electronic device as a host material and/or charge transporting material.The compound of logical formula (i),(i),wherein,x1it is cr1or n,x2it is cr2or n,x3it is cr3or n,x4it is cr4or n,x5it is cr5or n,x6it is cr6or n,x7it is cr7or n,x8it is cr8or n,x9it is cr9or n,x10it is cr10or n,wherein, x1and x3it is asynchronously cr1and cr3,y is selected from nr11, o or s,r1,r2,r3,r4,r5,r6,r7,r8,r9,r10and r11it is independently from each other h, e, formula-(l1)o-(l2)p-(l3)q-(l4)r- r14group, the unsubstituted or c that is replaced and/or interrupted by least one group d by least one group e1-c25alkyl does not take generation or the c replaced by least one group e7-c25aralkyl, the unsubstituted or c that is replaced by least one group e5-c12cycloalkanes base,orr4,r5,r6,r7,r8,r9or r10in both at least form at least one together in the case where being present on adjacent carbon atom a c6-c18aryl or c1-c18heteroaryl ring or member ring systems,o is 0 or 1 independently of one another, and p is 0 or 1 independently of one another, and q is 0 or 1 independently of one another, and r be independently of one another 0 or 1,l1,l2,l3and l4it is independently from each other c that is unsubstituted or being replaced by least one group e6-c40aryl, it is unsubstituted or by the c of at least one group e substitutions1-c24heteroaryl,r14it is independently from each other h, e, the unsubstituted or c that is replaced by least one group e6-c24it is aryl, unsubstituted or by least the c of one group e substitution1-c24it is heteroaryl, unsubstituted or replaced by least one group e and/or by least one group d disconnected c1-c25alkyl, the unsubstituted or c that is replaced by least one group e7-c25it is aralkyl, unsubstituted or by least one group the c of e substitutions5-c12naphthenic base,d is-co- ,-coo- ,-s- ,-so- ,-so independently of one another2-,-o-,-cr15=cr16-,-nr17-,-sir22r23-,- por25,-c ≡ c-,e is-or independently of one another21,-sr21,-nr17r18,-cor20,-coor19,-conr17r18,-cn,-sir22r23r24, por25r27, it is halogen, unsubstituted or by least one-f ,-cf3,-cf2cf3,-cf2cf2cf3,-cf(cf3)2,-(cf2)3cf3or- c(cf3)3substituted c6-c60aryl, c1-c18alkyl or by the c of at least one o interruption1-c18it is alkyl, unsubstituted or by least one-f ,-cf3,-cf2cf3,-cf2cf2cf3,-cf(cf3)2,-(cf2)3cf3or-c (cf3)3substituted c1-c60heteroaryl,r15and r16it is h independently of one another, unsubstituted or by least one c1-c18alkyl or at least one c1-c18alkoxy replaces c6-c18aryl, c1-c18alkyl or by the c of at least one o interruption1-c18alkyl,r17and r18it is h independently of one another, unsubstituted or by least one c1-c18alkyl or at least one c1-c18alkoxy replaces c6-c18aryl, c1-c18alkyl or by the c of at least one o interruption1-c18alkyl, orr17and r185 or 6 yuan of aliphatic, aromatics or heteroaromatic rings are formed together,r19it is h, unsubstituted or by least one c1-c18alkyl or at least one c1-c18the c of alkoxy substitution6-c18aryl, c1- c18alkyl or by the c of at least one o interruption1-c18alkyl,r20it is h or unsubstituted or by least one c1-c18alkyl or at least one c1-c18the c of alkoxy substitution6-c18virtue base, c1-c18 alkyl or by the c of at least one o interruption1-c18alkyl,r21it is h independently of one another, unsubstituted or by least one c1-c18alkyl or at least one c1-c18the c of alkoxy substitution6- c18aryl, c1-c18alkyl or by the c of at least one o interruption1-c18alkyl,r22,r23and r24it is h, c independently of one another1-c18it is alkyl, unsubstituted or by least one c1-c18alkyl-substituted c6-c18 aryl, andr25and r27it is h, c independently of one another1-c18it is alkyl, unsubstituted or by least one c1-c18alkyl-substituted c6-c18aryl, c that is unsubstituted or being replaced by least one group e7-c25aralkyl, the unsubstituted or c that is replaced by least one group e5-c12ring alkyl.

20132

염료, 조제 무기 안료, 유연제 및 기타 착색제 제조업

특허

ko

en

ＩＫＫ 억제제로서의 티에노피리다진본 발명은 하기 화학식 (I) 의 화합물 또는 그의 약학적으로 허용가능한 염, 용매화물 또는 전구약물에 관한 것이다 : [화학식 Ⅰ] (여기서, A, Y, Z 및 R1 은 상세한 설명 및 청구항에서 정의된 바와 같음). 상기 화합물은 IKK 를 억제시키고, 약제로서 사용될 수 있다.하기 화학식 Ⅰ 의 화합물 또는 그의 약학적으로 허용가능한 염, 용매화물 또는 전구약물 : [화학식 Ⅰ] {식 중 : R1 은 아릴 또는 헤테로아릴이고 ; A 는 S 또는 O 이고 ; Y 및 Z 중의 하나는 -NR2R3 또는 시아노이고, 나머지 하나는 -C(O)NR4R5 이고 ; R2, R3, R4, 및 R5 는 각각 독립적으로 수소 또는 C1-12 알킬이고 ; 여기서, 용어 "아릴" 은 C1-12 알킬, 시클로알킬, 시클로알킬-C1-12 알킬, 헤테로알킬, 히드록실-C1-12 알킬, 시아노-C1-12 알킬, 헤테로시클릴-C1-12 알킬, 할로, 니트로, 시아노, 히드록시, C1-12 알콕시, 아미노, 아실아미노, 모노-C1-12 알킬치환된 아미노, 디-C1-12 알킬아미노, 할로-C1-12 알킬, 할로-C1-12 알콕시, -COR (여기서, R 은 수소, C1-12 알킬, 페닐 또는 페닐-C1-12 알킬임), -(CR'R")n-COOR (여기서, n 은 0 내지 5 의 정수이고, R' 및 R" 는 독립적으로 수소 또는 C1-12 알킬이고, R 은 수소, C1-12 알킬, 시클로알킬, 시클로알킬-C1-12 알킬, 페닐 또는 페닐-C1-12 알킬임) 또는 -(CR'R")n-CONRaRb (여기서, n 은 0 내지 5 의 정수이고, R' 및 R" 는 독립적으로 수소 또는 C1-12 알킬이고, Ra 및 Rb 는 서로 독립적으로 수소, C1-12 알킬, 시클로알킬, 시클로알킬-C1-12 알킬, 페닐 또는 페닐-C1-12 알킬임) 로 이루어진 군으로부터 독립적으로 선택되는 1, 2, 3 또는 4 개의 치환체에 의해 임의로 치환되는 1-, 2- 또는 3-환형 방향족 고리로 이루어진 1 가 환형 방향족 탄화수소 부분을 의미하고 ; 용어 "헤테로아릴" 은 N, O, 또는 S 로부터 선택되는 1, 2, 또는 3 개의 고리 헤테로원자를 함유하고 남은 고리 원자는 C 인 하나 이상의 방향족 고리를 갖는 5 내지 12 개의 고리 원자의 1-환형 또는 2-환형 1 가 라디칼을 의미하며, 헤테로아릴 라디칼의 결합점은 방향족 고리 상에 있을 것이고, 헤테로아릴은 임의로 C1-12 알킬, 시클로알킬, 시클로알킬-C1-12 알킬, 헤테로알킬, 히드록실-C1-12 알킬, 시아노-C1-12 알킬, 헤테로시클릴-C1-12 알킬, 할로, 니트로, 시아노, 히드록시, C1-12 알콕시, 아미노, 아실아미노, 모노-C1-12 알킬치환된 아미노, 디-C1-12 알킬아미노, 할로-C1-12 알킬, 할로-C1-12 알콕시, -COR (여기서, R 은 수소, C1-12 알킬, 페닐 또는 페닐 C1-12 알킬임), -(CR'R")n-COOR (여기서, n 은 0 내지 5 의 정수이고, R' 및 R" 는 독립적으로 수소 또는 C1-12 알킬이고, R 은 수소, C1-12 알킬, 시클로알킬, 시클로알킬-C1-12 알킬, 페닐 또는 페닐-C1-12 알킬임) 또는 -(CR'R")n-CONRaRb (여기서, n 은 0 내지 5 의 정수이고, R' 및 R" 는 독립적으로 수소 또는 C1-12 알킬이고, Ra 및 Rb 는 서로 독립적으로 수소, C1-12 알킬, 시클로알킬, 시클로알킬-C1-12 알킬, 페닐 또는 페닐-C1-12 알킬임) 로 이루어진 군으로부터 독립적으로 선택되는 1, 2, 3 또는 4 개의 치환체에 의해 치환되는 것으로 이해되고 ; 용어 "헤테로알킬" 은, 1, 2 또는 3 개의 수소 원자가 -ORa, -NRbRc 및 -S(O)nRd (여기서, n 은 0 내지 2 의 정수임) 로 이루어진 군으로부터 독립적으로 선택되는 치환체로 대체되는 C1-12 알킬을 의미하고, 헤테로알킬 라디칼의 결합점은 탄소 원자를 통해서이며, 여기서 Ra 는 수소, 아실, C1-12 알킬, 시클로알킬 또는 시클로알킬 C1-12 알킬이고 ; Rb 및 Rc 는 서로 독립적으로 수소, 아실, C1-12 알킬, 시클로알킬, 또는 시클로알킬-C1-12 알킬이고 ; n 이 0 일 때, Rd 는 수소, C1-12 알킬, 시클로알킬, 또는 시클로알킬 C1-12 알킬이고, n 이 1 또는 2 일 때, Rd 는 C1-12 알킬, 시클로알킬, 시클로알킬-C1-12 알킬, 아미노, 아실아미노, 모노-C1-12 알킬아미노 또는 디-C1-12 알킬아미노인 것으로 이해하고 ; 용어 "시클로알킬" 은 시클로프로필, 시클로부틸, 시클로펜틸, 시클로헥실 또는 시클로헵틸을 의미하고 ; 용어 "헤테로시클릴" 은 질소, 산소 및 황으로부터 선택되는 1, 2, 3 또는 4 개의 헤테로원자를 혼입하는 1 내지 3 개의 고리로 이루어진 1 가 포화된 부분을 의미함}.

THIENOPYRIDAZINES AS IKK INHIBITORSThe invention is concerned with a compound of formula (I): or a pharmaceutically acceptable salt, a solvate or a prodrug thereof, wherein A, Y, Z and Rl are as defined in the description and the claims. These compounds inhibit IKK and can be used as medicaments.A compound of formula I: wherein: R1 is aryl or heteroaryl; A is S or O; one of Y and Z is -NR2R3 or cyano and the other is -C(O)NR4R5; and R2, R3, R4, and R5 each independently is hydrogen or Cι-12 alkyl; or a pharmaceutically acceptable salt, a solvate or a prodrug thereof; wherein the term 'aryl' means a monovalent cyclic aromatic hydrocarbon moiety consisting of a mono-, bi- or tricyclic aromatic ring, optionally substituted by one, two, three or four substituents independently selected from the group consisting of Cι-12 alkyl, cycloalkyl, cycloalkyl-Cι-12 alkyl, heteroalkyl, hydroxyl-Cι-ι2 alkyl, cyano-Cj-ι alkyl, heterocyclyl-Cι-12 alkyl, halo, nitro, cyano, hydroxy, Cι-12 alkoxy, amino, acylamino, mono-Cι-ι2 alkylsubstiτuted amino, di-Ci-π alkylamino, halo-Cι_ι2 alkyl, halo-Cι-ι2 alkoxy, -COR (where R is hydrogen, C1-12 alkyl, phenyl or phenyl- C1-12 alkyl), -(CR'R')n-COOR (where n is an integer from 0 to 5, R' and R' are independently hydrogen or C1-12 alkyl, and R is hydrogen, Cj-12 alkyl, cycloalkyl, cycloalkyl-Cι-12 alkyl, phenyl or phenyl-Cι-12 alkyl) or -(CR'R')n-CONRaR (where n is an integer from 0 to 5, R' and R' are independently hydrogen or -12 alkyl, and Ra and RD are, independently of each other, hydrogen, Cι-ι2 alkyl, cycloalkyl, cycloalkyl-Cι-12 alkyl, phenyl or phenyl-Cι-12 alkyl); the term 'heteroaryl' means a monocyclic or bicyclic monovalent radical of 5 to 12 ring atoms having at least one aromatic ring containing one, two, or three ring heteroatoms selected from N, O, or S, the remaining ring atoms being C, with the understanding that the attachment point of the heteroaryl radical will be on an aromatic ring, and heteroaryl is optionally substituted by one, two, three or four substituents independently selected from the group consisting of Cι-12 alkyl, cycloalkyl, cycloalkyl-Cι-12 alkyl, heteroalkyl, hydroxyl-Cι-12 alkyl, cyano-Cι-12 alkyl, heterocycryι-Cι_12 alkyl, halo, nitro, cyano, hydroxy, CM2 alkoxy, amino, acylamino, mono-Cι-12 alkylsubstituted amino, di-Cι_12 alkylamino, halo-Cj-π alkyl, halo-C^^ alkoxy, -COR (where R is hydrogen, C1-12 alkyl, phenyl or phenyl-C1-12 alkyl), -(CR'R')n-COOR (where n is an integer from 0 to 5, R' and R' are independently hydrogen or C1-12 alkyl, and R is hydrogen, C1.12 alkyl, cycloalkyl, cycloalkyl-Cι.12 alkyl, phenyl or phenyl-Cι-12 alkyl) or -(CR'R')n~CONRaRD (where n is an integer from 0 to 5, R' and R' are independently hydrogen or C1-12 alkyl, and Ra and Rb are, independently of each other, hydrogen, Cι_i2 alkyl, cycloalkyl, cycloalkyl-Cι-ι2 alkyl, phenyl or phenyl-Cι-ι2 alkyl); the term'heteroalkyl' means C1-12 alkyl wherein one, two or three hydrogen atoms are replaced with a substituent independently selected from the group consisting of -OR -NRbRc and -S(O)nRd (where n is an integer from 0 to 2), with the understanding that the point of attachment of the heteroalkyl radical is through a carbon atom, wherein Ra is hydrogen, acyl, C1-.2 alkyl, cycloalkyl or cycloalkyl-Ci- 12 alkyl; R and Rc are independently of each other hydrogen, acyl, C1-12 alkyl, cycloalkyl, or cycloalkyl-Cj-ϊ2 alkyl; and when n is 0, Rd is hydrogen, Cj-12 alkyl, cycloalkyl, or cycloalkyl-Cι-12 alkyl, and when n is 1 or 2, Rd is Cι-12 alkyl, cycloalkyl, cycloalkyl-Cι-12 alkyl, amino, acylamino, mono-Cι-12 alkylamino or di-Ci-12 alkylamino; the term 'cycloalkyl' means cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl; the term 'heterocyclyl' means a monovalent saturated moiety, consisting of one to three rings, incorporating one, two, or three or four heteroatoms selected from nitrogen, oxygen and sulfur.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

종양 치료를 위한 피페리딘 및 피페라진 유도체식 (I)의 화합물은 종양의 치료를 위해 이용될 수 있다: [식 중, R1, R2, R3, D, G, Q 및 W 는 청구항 제 1 항에 지시된 의미를 가짐].식 I 의 화합물 및 이의 약학적으로 사용가능한 호변이성체, 염 및 입체이성질체, 및 모든 비율의 이들의 혼합물:[이미지][식 중,R1 은 1 내지 4 개의 N, O 및/또는 S 원자를 가진 비(bi)시클릭 불포화 또는 방향족 헤테로사이클을 나타내고, 이는 비(非)치환 또는 A, Hal, NR2, (CR2)nCN, OR5 및/또는 =O (카르보닐 산소)로 단일-, 이중 또는 삼중치환될 수 있고,D 는 C 또는 S 를 나타내고,G 는 N 또는 C 를 나타내고,G = N 인 경우:R2 는 부재이고,G = C 인 경우:R2 는 H 또는 Ar1 을 나타내거나,또한, R2 에 결합된 C 원자 및 E-W 와 함께, 하기 군으로부터 선택되는 스피로시클릭 라디칼을 나타내고[이미지],Q 는 탄소수 1, 2, 3 또는 4 인 비(非)분지형 또는 분지형 알킬렌을 나타내고, 이때 1-5 개의 H 원자는 A, (CR2)n[X(CR2)n]p-Y, F 및/또는 Cl 로 대체될 수 있고,R3 은 H, A, Ar, OR, SR, NR2, Hal, NO2, CN 또는 (CR2)n[X(CR2)n]p-Y 를 나타내고,X 는 O, NR 또는 CR2 를 나타내고,Y 는 OR 또는 NR2 를 나타내고,R5 는 H 또는 탄소수 1, 2, 3, 4, 5 또는 6 인 비분지형 또는 분지형 알킬을 나타내고, 이때 1-7 개의 H 원자는 F 및/또는 Cl 로 대체될 수 있고, E 는 COO(CR2)n, COO(CRR4), CO(CR2)mO, CONH(CR2)n, C(=S)NH(CR2)n, S(O)qNH(CR2)n, S(O)q(CR2)n, CO(CR2)n, (CR2)n, CO(CR2)mO(CR2)n, CO(CR2)mNH(CR2)n, CO(CH2)nCO, COCHR6CHR7, C(=S)O(CR2)n, CO(CRR4)(CR2)n, COO(CRR4), (CRR4)(CR2)n, S(O)qCR=CR, COCR=CR, (CR2)mCO, CONH(CR2)mCRR4 또는 (CR2)mCONR 을 나타내고,R4 는 COOR5, Ar1, NRCOOR8, (CR2)nNR2 또는 NRCOOA 를 나타내고,R6, R7 은 함께 (CH2)1-4 를 나타내고,R8 은 페닐, 나프틸 또는 플루오레닐을 나타내고,R 은 H 또는 탄소수 1, 2, 3, 4, 5 또는 6 인 비분지형 또는 분지형 알킬을 나타내고,W 는 Ar 또는 Het 을 나타내고,Ar 은 페닐, 인다닐, 나프틸 또는 비페닐을 나타내고, 이들은 각각 비치환 또는 Hal, A, (CR2)nOR, O(CR2)nAr1, (CR2)nNR2, SR, NO2, CN, COOR, CONR2, NRCOA, NRSO2A, SO2NR2, S(O)qA, CO-Het, (CR2)nHet, O(CR2)nNR2, O(CR2)nHet, NHCOOA, NHCONR2, NHCOO(CR2)nNR2, NHCOO(CR2)nHet, CR5=CR5Ar1, SO2Het, NHCONH(CR2)nNR2, NHCONH(CR2)nHet, OCONH(CR2)nNR2, OCONH(CR2)nHet, CONR(CR2)nNR2, CONR(CR2)nHet 및/또는 COA 로 단일-, 이중-, 삼중-, 사중- 또는 오중치환되고,Het 은 1 내지 4 개의 N, O 및/또는 S 원자를 가진 모노-, 비- 또는 트리시클릭 포화, 불포화 또는 방향족 헤테로사이클을 나타내고, 이는 비치환 또는 Hal, A, (CR2)nAr1, O(CR2)nAr1, (CR2)nOR, (CR2)nNR2, SR, NO2, CN, COOR, CONR2, NRCOA, NRSO2A, SO2NR2, S(O)qA, CO-Het1, (CR2)nHet1, O(CR2)nNR2, O(CR2)nHet1, NHCOOA, NHCONR2, NHCOO(CR2)nNR2, NHCOO(CR2)nHet1, NHCONH(CR2)nNR2, NHCONH(CR2)nHet1, OCONH(CR2)nNR2, OCONH(CR2)nHet1, CO-Het1, CHO, COA, =S, =NH, =NA 및/또는 =O (카르보닐 산소)로 단일-, 이중- 또는 삼중치환될 수 있고,Het1 은 1 내지 2 개의 N 및/또는 O 원자를 가진 모노시클릭 포화 헤테로사이클을 나타내고, 이는 A, OA, OH, Hal 및/또는 =O (카르보닐 산소)로 단일- 또는 이중치환될 수 있고,Ar1 은 비치환 또는 Hal, CN, A 및/또는 (CR2)nOR 로 단일-, 이중-, 삼중-, 사중- 또는 오중치환된 페닐을 나타내고, A 는 탄소수 1-10 인 비분지형 또는 분지형 알킬 (이때 1-7 개의 H 원자는 OR, CN, NR2, F 및/또는 Cl 로 대체될 수 있고/있거나 1 또는 2 개의 비(非)인접 CH2 기는 O, NH, S, SO, SO2 및/또는 CH=CH 기로 대체될 수 있음),또는탄소수 3-7 인 시클릭 알킬을 나타내고,m 은 1, 2, 3, 4, 5 또는 6 을 나타내고, n 은 0, 1, 2, 3, 4, 5, 6, 7 또는 8 을 나타내고,p 는 1, 2, 3, 4, 5 또는 6 을 나타내고,q 는 0, 1 또는 2 를 나타내고,Hal 은 F, Cl, Br 또는 I 를 나타냄].

Piperidine and piperazine derivativesThe invention relates to compounds of formula (I), in which R1, R2, R3, D, G, Q and W can be defined as cited in claim (1). Said compounds are used for treating tumours.The compound of formula iwhereinr 1expression has the unsaturated or aromatic heterocycle of dicyclo of 1 to 4 n, o and/or s atom, and it can be unsubstituted or by a, hal, nr 2, (cr 2) ncn, or 5and/or=single, two or three replacements of o (ketonic oxygen), d represents c or s,g represents n or c,if g=n:r 2do not exist, if g=c:r 2expression h or ar 1perhaps, together with r 2the c atom of bonding and together with e-w, expression is selected from the volution group of following group q represents to have the alkylidene group of the straight or branched of 1,2,3 or 4 c atom, and wherein 1-5 h atom can be by a, (cr 2) n[x (cr 2) n] p-y, f and/or cl replace, r 3expression h, a, ar, or, sr, nr 2, hal, no 2, cn or (cr 2) n[x (cr 2) n] p-y, x represents o, nr or cr 2, y represents or or nr 2, r 5expression h or have the straight or branched alkyl of 1,2,3,4,5 or 6 c atom, wherein 1-7 h atom can be by f and/or cl replacement, e represents coo (cr 2) n, coo (crr 4), co (cr 2) mo, conh (cr 2) n, c (=s) nh (cr 2) n, s (o) qnh (cr 2) n, s (o) q(cr 2) n, co (cr 2) n, (cr 2) n, co (cr 2) mo (cr 2) n, co (cr 2) mnh (cr 2) n, co (ch 2) nco, cochr 6chr 7, c (=s) o (cr 2) n, co (crr 4) (cr 2) n, coo (crr 4), (crr 4) (cr 2) n, s (o) qcr=cr, cocr=cr, (cr 2) mco, conh (cr 2) mcrr 4or (cr 2) mconr, r 4expression coor 5, ar 1, nrcoor 8, (cr 2) nnr 2or nrcooa, r 6, r 7represent (ch altogether 2) 1-4, r 8expression phenyl, naphthyl or fluorenyl, r represents h or has the straight or branched alkyl of 1,2,3,4,5 or 6 c atom,w represents ar or het,ar represents phenyl, indanyl, naphthyl or biphenyl, and wherein each is unsubstituted or by following group list, two, three, four or five replacement: hal, a, (cr 2) nor, o (cr 2) nar 1, (cr 2) nnr 2, sr, no 2, cn, coor, conr 2, nrcoa, nrso 2a, so 2nr 2, s (o) qa, co-het, (cr 2) nhet, o (cr 2) nnr 2, o (cr 2) nhet, nhcooa, nhconr 2, nhcoo (cr 2) nnr 2, nhcoo (cr 2) nhet, cr 5=cr 5ar 1, so 2het, nhconh (cr 2) nnr 2, nhconh (cr 2) nhet, oconh (cr 2) nnr 2, oconh (cr 2) nhet, conr (cr 2) nnr 2, conr (cr 2) nhet and/or coa, het represents to have single, two or three ring fillings of 1 to 4 n, o and/or s atom, unsaturated or aromatic heterocycle, and it can be unsubstituted or by following group list, two or three replacement: hal, a, (cr 2) nar 1, o (cr 2) nar 1, (cr 2) nor, (cr 2) nnr 2, sr, no 2, cn, coor, conr 2, nrcoa, nrso 2a, so 2nr 2, s (o) qa, co-het 1, (cr 2) nhet 1, o (cr 2) nnr 2, o (cr 2) nhet 1, nhcooa, nhconr 2, nhcoo (cr 2) nnr 2, nhcoo (cr 2) nhet 1, nhconh (cr 2) nnr 2, nhconh (cr 2) nhet 1, oconh (cr 2) nnr 2, oconh (cr 2) nhet 1, co-het 1, cho, coa ,=s ,=nh ,=na and/or=o (ketonic oxygen), het 1expression has the monocycle saturated heterocyclic of 1 to 2 n and/or o atom, its can by a, oa, oh, hal and/or=o (ketonic oxygen) is single or two replace, ar 1represent unsubstituted or by hal, cn, a and/or (cr 2) nsingle, two, three, four or five phenyl that replace of or, a represents to have the straight or branched alkyl of 1-10 c atom, and wherein 1-7 h atom can be by or, cn, nr 2, f and/or cl replace, and/or one of them or two non-adjacent ch 2group can be by o, nh, s, so, so 2and/or replaced by the ch=ch group; orcycloalkyl with 3-7 c atom;m represents 1,2,3,4,5 or 6,n represents 0,1,2,3,4,5,6,7 or 8,p represents 1,2,3,4,5 or 6,q represents 0,1 or 2,hal represents f, cl, br or i,with its pharmaceutically acceptable tautomer, salt and steric isomer, comprise its mixture with all proportions.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

단백질 키나제 억제제로서의 화합물 및 조성물본 발명은 신규 부류의 화합물, 상기 화합물을 포함하는 제약 조성물, 및 비정상적 또는 탈조절된 키나제 활성과 연관된 질환 또는 장애, 특히 Abl, Bcr-Abl, Bmx, b-RAF, c-RAF, c-SRC, KDR, CSK, FGFR3, JAK2, Lck, Met, PKCα, SAPK2α, Tie2, TrkB 및 P70S6K 키나제의 비정상적 활성화를 수반하는 질환 또는 장애를 치료 또는 예방하기 위한 상기 화합물의 사용 방법을 제공한다. 상기 화합물, 및 그의 제약상 허용되는 염, 수화물, 용매화물 및 이성질체는 하기의 구조 (화학식 I)를 갖는다. <화학식 I> 상기 식에서, R1은 -NR6R7 및 -NR6C(O)R8로부터 선택되며; 여기서 R6은 수소 및 C1-6알킬로부터 선택되고; R7은 수소, C1-6알킬, -NR9R10, C6-10아릴-C0-4알킬, C1-10헤테로아릴-C0-4알킬, C3-12시클로알킬-C0-4알킬 및 C3-8헤테로시클로알킬-C0-4알킬로부터 선택되며; 여기서 R7의 모든 아릴, 헤테로아릴, 시클로알킬 또는 헤테로시클로알킬은 C1-6알킬, C1-6알콕시, -QNR9R10 및 C3-8헤테로시클로알킬-C0-4알킬로부터 독립적으로 선택된 1 내지 3개의 라디칼에 의해 임의로 치환될 수 있으며; 여기서 Q는 결합 및 C1-4알킬렌으로부터 선택되고; R8은 수소 및 C1-6알킬로부터 선택되고; R9 및 R10은 수소 및 C1-6알킬로부터 독립적으로 선택되고; R2는 수소 및 C1-6알킬로부터 선택되고; R3은 수소 및 C1-6알킬로부터 선택되고; R4는 수소, 할로, C1-6알킬, C1-6알콕시, 할로-치환-C1-6알킬 및 할로-치환-C1-6알콕시로부터 선택되고; R5는 -C(O)NHR11 및 -NHC(O)R11로부터 선택되며; 여기서 R11은 C6-10아릴 및 C1-10헤테로아릴로부터 선택되며; 여기서 R11의 모든 아릴 또는 헤테로아릴은 할로, C1-6알킬, C1-6알콕시, 할로-치환-C1-6알킬, 할로-치환-C1-6알콕시, 디-C1-4알킬-아미노-C1-6알콕시, 디-C1-4알킬-아미노-C1-6알킬(C1-4알킬)아미노, C1-10헤테로아릴-C0-4알킬, C3-8헤테로시클로알킬-C0-4알킬 및 C3-8헤테로시클로알킬-옥시로부터 독립적으로 선택된 1 내지 3개의 라디칼로 임의로 치환되며; 여기서 R11의 모든 헤테로아릴 또는 헤테로시클로알킬 치환기는 추가로 C1-6알킬 및 히드록시-C1-6알킬로부터 독립적으로 선택된 1 내지 2개의 라디칼에 의해 임의로 치환되고; X 및 Y는 N 및 CH로부터 독립적으로 선택된다. 하기 화학식 I의 화합물, 및 그의 제약상 허용되는 염, 수화물, 용매화물 및 이성질체. <화학식 I> [이미지] 상기 식에서, R1은 -NR6R7 및 -NR6C(O)R8로부터 선택되며; 여기서 R6은 수소 및 C1-6알킬로부터 선택되고; R7은 수소, C1-6알킬, -NR9R10, C6-10아릴-C0-4알킬, C1-10헤테로아릴-C0-4알킬, C3-12시클로알킬-C0-4알킬 및 C3-8헤테로시클로알킬-C0-4알킬로부터 선택되며; 여기서 R7의 모든 아릴, 헤테로아릴, 시클로알킬 또는 헤테로시클로알킬은 C1-6알킬, C1-6알콕시, -QNR9R10 및 C3-8헤테로시클로알킬-C0-4알킬로부터 독립적으로 선택된 1 내지 3개의 라디칼에 의해 임의로 치환될 수 있으며; 여기서 Q는 결합 및 C1-4알킬렌으로부터 선택되고; R8은 수소 및 C1-6알킬로부터 선택되고; R9 및 R10은 수소 및 C1-6알킬로부터 독립적으로 선택되고; R2는 수소 및 C1-6알킬로부터 선택되고; R3은 수소 및 C1-6알킬로부터 선택되고; R4는 수소, 할로, C1-6알킬, C1-6알콕시, 할로-치환-C1-6알킬 및 할로-치환-C1-6알콕시로부터 선택되고; R5는 -C(O)NHR11 및 -NHC(O)R11로부터 선택되며; 여기서 R11은 C6-10아릴 및 C1-10헤테로아릴로부터 선택되며; 여기서 R11의 모든 아릴 또는 헤테로아릴은 할로, C1-6알킬, C1-6알콕시, 할로-치환-C1-6알킬, 할로-치환-C1-6알콕시, 디-C1-4알킬-아미노-C1-6알콕시, 디-C1-4알킬-아미노-C1-6알킬(C1-4알킬)아미노, C1-10헤테로아릴-C0-4알킬, C3-8헤테로시클로알킬-C0-4알킬 및 C3-8헤테로시클로알킬-옥시로부터 독립적으로 선택된 1 내지 3개의 라디칼로 임의로 치환되며; 여기서 R11의 모든 헤테로아릴 또는 헤테로시클로알킬 치환기는 추가로 C1-6알킬 및 히드록시-C1-6알킬로부터 독립적으로 선택된 1 내지 2개의 라디칼에 의해 임의로 치환되고; X 및 Y는 N 및 CH로부터 독립적으로 선택된다.

Compounds and compositions as protein kinase inhibitorsThe invention provides a novel class of compounds, pharmaceutical compositions comprising such compounds and methods of using such compounds to treat or prevent diseases or disorders associated with abnormal or deregulated kinase activity, particulary diseases or disorders that involve abnormal activation of the Abl.Bcr-Abl, Bmx, b-RAF, c-RAFI c-SRC,KDR,CSKlFGFR3,JAK2ILck,Met,PKCalpha,SAPK2alpha)Tie2,TrkB and P70S6K kinases. These compounds have the following structure: (Formula I); in which: R1 is selected from -NR6R7 and -NR6C(O)R8; wherein R6 is selected from hydrogen and C1-6alkyl; R7 is selected from hydrogen, C1-6alkyl. -NR9R10, C6-10aryl-C0-4alkyl, C1-10heteroaryl-C0-4alkyl, C3-12cycloalkyl-C0-4alkyl and C3-8heterocycloalkyl-C0-4alkyl; wherein any aryl, heteroaryl, cycloalkyl or heterocycloalkyl of R7 can be optionally substituted by 1 to 3 radicals independently selected from C1-6alkyl, C1-6alkoxy, -QNR9R10 and C3-8heterocycloalkyl-C0-4alkyl; wherein Q is selected from a bond and C1-4alkylene; R8 is selected from hydrogen and C1-4alkyl; R9 and R10 are independently selected from hydrogen and C1-6alkyl; R2 is selected from hydrogen and C1-6alkyl; R3 is selected from hydrogen and C1-6alkyl; R4 is selected from hydrogen, halo, C1-6alkyl, C1-6alkoxy, halosubstituted-C1-6alkyl and halosubsb'tuted-C1-6alkoxy; R5 is selected from -C(O)NHR11 and -NHC(O)R11; wherein R11 is selected from C6-10aryl and C1-10heteroaryl.The compound of formula i and pharmacologically acceptable salt thereof, hydrate, solvate and isomer:wherein:r 1be selected from-nr 6r 7with-nr 6c (o) r 8r wherein 6be selected from hydrogen and c 1-6alkyl; r 7be selected from hydrogen, c 1-6alkyl ,-nr 9r 10, c 6-10aryl-c 0-4alkyl, c 1-10heteroaryl-c 0-4alkyl, c 3-12cycloalkyl-c 0-4alkyl and c 3-8heterocyclylalkyl-c 0-4alkyl; r wherein 7any aryl, heteroaryl, cycloalkyl or heterocyclylalkyl can randomly be independently selected from c by 1 to 3 1-6alkyl, c 1-6alkoxyl group ,-qnr 9r 10and c 3-8heterocyclylalkyl-c 0-4the group of alkyl replaces; wherein q is selected from a kind of key and c 1-4alkylidene group; r 8be selected from hydrogen and c 1-6alkyl; r 9and r 10be independently selected from hydrogen and c 1-6alkyl; r 2be selected from hydrogen and c 1-6alkyl; r 3be selected from hydrogen and c 1-6alkyl; r 4be selected from hydrogen, halogen, c 1-6alkyl, c 1-6alkoxyl group, halo-c 1-6alkyl and halo-c 1-6alkoxyl group; r 5be selected from-c (o) nhr 11with-nhc (o) r 11r wherein 11be selected from c 6-10aryl and c 1-10heteroaryl; r wherein 11any aryl or heteroaryl randomly be independently selected from halogen, c by 1 to 3 1-6alkyl, c 1-6alkoxyl group, halo-c 1-6alkyl, halo-c 1-6alkoxyl group, two-c 1-4alkyl-amino-c 1-6alkoxyl group, two-c 1-4alkyl-amino-c 1-6alkyl (c 1-4alkyl) amino, c 1-10heteroaryl-c 0-4alkyl, c 3-8heterocyclylalkyl-c 0-4alkyl and c 3-8the group of heterocyclylalkyl-oxygen base replaces; r wherein 11any heteroaryl or heterocyclylalkyl substituting group further randomly be independently selected from c by 1 to 2 1-6alkyl and hydroxyl-c 1-6the group of alkyl replaces; x and y are independently selected from n and ch.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

환상 아민 유도체 또는 그의 염본 발명은 충분히 안전한 NMDA 길항약이고, 알츠하이머병, 뇌혈관성 치매증(뇌혈관성 인지증), 파킨슨병, 허혈성 뇌졸중, 동통의 치료제, 및 이들의 예방제로서 유용한 화합물을 제공한다. 본 발명에 따르면, 아민을 포함하는 구조 A가 X1(결합, 또는 저급 알킬렌 등)을 통해 2 또는 3환 축합환(인단, 테트라론, 4,5,6,7-테트라히드로벤조티오펜, 4,5,6,7-테트라히드로벤조푸란, 7,8-디히드로-6H-인데노[4,5-b]푸란, 2,3-디히드로-1H-시클로펜타[a]나프탈렌 등)과 결합하는 것을 특징으로 한다. 본 발명의 NMDA 길항약은 아민 유도체 또는 그의 염, 및 이들을 유효 성분으로 한다.하기 화학식 (I)로 표시되는 환상 아민 유도체 또는 그의 염. 상기 화학식 (I) 중 기호는 각각 이하의 의미를 갖는데, A: 환 내에 이중 결합을 가질 수도 있고 가교를 가질 수도 있으며 R7 내지 R11 치환기를 가질 수도 있는 5 내지 8원 환상 아민, -NH2, -NH(저급 알킬), 또는 -N(저급 알킬)2이고, B환: 벤젠, 티오펜, 푸란, 피롤, 5 내지 7원 시클로알칸, 또는 5 내지 7원 시클로알켄이고, X1: 결합, 저급 알킬렌, 또는 -L3-D-L4-이고, L3 및 L4: 동일하거나 상이하며, 결합, 또는 저급 알킬렌이고, D: 치환기를 가질 수도 있는 5 내지 6원 탄소환 또는 5 내지 6원 헤테로환이고, X2: -(CR12R13)n-, -N(R14)-, -N(R14)CO-, -CON(R14)-, -O-, -S-, -CO-, -CH(OH)-, -N(R14)-(CR12R13)n-, -(CR12R13)n-N(R14)-, -CON(R14)-(CR12R13)n-, -N(R14)CO-(CR12R13)n-, -(CR12R13)n-N(R14)CO-, -(CR12R13)n-CON(R14)-, -CO-(CR12R13)n-, -(CR12R13)n-CO-, -O-(CR12R13)n-, -(CR12R13)n-O-, -S-(CR12R13)n-, 또는 -(CR12R13)n-S-이고, Y1: -OH, -O-저급 알킬, -NH2, 또는 -N3이고, R1 및 R2: 동일하거나 상이하며, 할로겐 원자, 저급 알킬, 또는 -저급 알킬렌-OH, R3 내지 R6: 동일하거나 상이하며, 수소 원자, 할로겐 원자, 저급 알킬, 저급 알케닐, 저급 알키닐, -O-저급 알킬, -OH, -NH2, -NH(저급 알킬), -N(저급 알킬)2, -NH-CO-저급 알킬, -N(저급 알킬)-CO-저급 알킬, -NH-CO-O-저급 알킬, -N(저급 알킬)-CO-O-저급 알킬, -CN, -NO2, -CF3, -저급 알킬렌-OH, -저급 알킬렌-할로겐 원자, -O-저급 알킬렌-OH, -저급 알킬렌-O-저급 알킬, -CO-N(저급 알킬)2, -CO-NH-(저급 알킬), -O-CO-N(저급 알킬)2, -O-CO-NH-(저급 알킬), 5 내지 8원 환상 아민, -CO-5 내지 8원 환상 아민, -COOH, -COO-저급 알킬, -COO-저급 알킬렌-아릴, 5 내지 6원 헤테로환, -저급 알킬렌-5 내지 6원 헤테로환, 치환기를 가질 수도 있는 아릴, 또는 -저급 알킬렌- 치환기를 가질 수도 있는 아릴이고, R7: 수소 원자, 저급 알킬, -저급 알킬렌-아릴, 또는 -저급 알킬렌-헤테로아릴이며, 여기서 R7은 환상 아민의 질소 원자 상의 치환기를 나타내고, R8 내지 R14: 동일하거나 상이하며, 수소 원자, 또는 저급 알킬이고, n: 1, 2, 또는 3의 정수인데, 이 경우에서, R5 및 R6, R4 및 R5, 또는 R3 및 R4는 각각 하나가 되어 저급 알킬렌, -O-저급 알킬렌-O-, -O-저급 알킬렌-, -저급 알킬렌-O-, -S-저급 알킬렌-, -저급 알킬렌-S-, -N(R19)-저급 알킬렌-, -저급 알킬렌-N(R19)-, -C(R15)=C(R16)-O-, -O-C(R15)=C(R16)-, -C(R15)=C(R16)-C(R17)=C(R18)-, -S-C(R15)=C(R16)-, -C(R15)=C(R16)-S-, -N(R19)-C(R15)=C(R16)-, -C(R15)=C(R16)-N(R19)-, -N(R19)-C(R15)=N-, -N=C(R15)-N(R19)-, -N=C(R15)-C(R16)=C(R17)-, -C(R15)=C(R16)-C(R17)=N-, -C(R15)=N-C(R16)=C(R17)-, 또는 -C(R15)=C(R16)-N=C(R17)-을 형성할 수도 있고, R3 및 Y1은 하나가 되어 -O-저급 알킬렌-O-, -저급 알킬렌-O-, 또는 -N(R19)-저급 알킬렌-O-를 형성할 수도 있으며, R1과 Y1은 하나가 되어 -저급 알킬렌-O-를 형성할 수도 있고, Y1과 -X1-A 상의 분지는 하나가 되어 -O- 또는 -O-저급 알킬렌을 형성할 수도 있고, R15 내지 R18: 동일하거나 상이하며, 수소, 할로겐, 또는 저급 알킬기이고, R19: 수소, 또는 저급 알킬기이며, 단, 상기 화합물로부터 6-클로로-2,2-디메틸-1-(1-메틸-4-피페리디닐)인단-1-올은 제외한다.

Cyclic amine derivative or salt thereofProvided are compounds which are an NMDA antagonist having a broad safety margin and are useful as a treating agent or a preventing agent for Alzheimer's disease, cerebrovascular dementia, Parkinson's disease, ischemic apoplexy, pain, etc. Concretely provided are an amine derivative or its salt characterized in that the amine-containing structure A therein bonds to a 2- or 3-cyclic condensed ring (e.g., indane, tetralone, 4,5,6,7-tetrahydrobenzothiophene, 4,5,6,7-tetrahydrobenzofuran, 7,8-dihydro-6H-indeno[4,5-b]furan, 2,3-dihydro-1H-cyclopenta[1]naphthalene) via X1 (bond or lower alkylene); and an NMDA antagonist containing it as an active ingredient thereof. A cyclic amine and its salt of the following formula (I): (wherein the symbols have the following meanings: A: a 5- to 8-membered cyclic amine optionally having a double bond, optionally having a bridge structure and optionally having a substitutent of R7 to R11 in the ring, or —NH2, —NH(lower alkyl), or —N(lower alkyl)2; Ring B: benzene, thiophene, furan, pyrrole, a 5- to 7-membered cycloalkane, or a 5- to 7-membered cycloalkene; X1: a bond, a lower alkylene, or -L3-D-L4-; L3 and L4 are the same or different, each representing a bond or a lower alkylene; D: a 5- or 6-membered carbon ring or 5- or 6-membered hetero ring, optionally having a substitutent; X2: —(CR12R13)n—, —N(R14)—, —N(R14)CO—, —CON(R14)—, —O—, —S—, —CO—, —CH(OH)—, —N(R14)—(CR12R13)n—, —(CR12R13)n—N(R14)—, —CON(R14)—(CR12R13)n—, —N(R14)CO—(CR12R13)n—, —(CR12R13)n—N(R14)CO—, —(CR12R13)n—CON(R14)—, —CO—(CR12R13)n—, —(CR12R13)n—CO—, —O—(CR12R13)n—, —(CR12R13)n—O—, —S—(CR12R13)n—, or —(CR12R13)n—S—; Y1: —OH, —O-lower alkyl, —NH2, or —N3; R1 and R2: the same or different, and a halogen atom, a lower alkyl, or a lower alkylene-OH; R3 to R6: the same or different, and a hydrogen atom, a halogen atom, a lower alkyl, a lower alkenyl, a lower alkynyl, —O-lower alkyl, —OH, —NH2, —NH(lower alkyl), —N(lower alkyl)2, —NH—CO-lower alkyl, —N(lower alkyl)-CO-lower alkyl, —NH—CO—O-lower alkyl, —N(lower alkyl)-CO—O-lower alkyl, —CN—, —NO2, —CF3, -lower alkylene-OH, -lower alkylene-halogen atom, —O-lower alkylene-OH, -lower alkylene-O-lower alkyl, —CO—N(lower alkyl)2, —CO—NH-(lower alkyl), —O—CO—N(lower alkyl)2, —O—CO—NH-(lower alkyl), a 5- to 8-membered cyclic amine, —CO-5- to 8-membered cyclic amine, —COOH, —COO-lower alkyl, —COO-lower alkylene-aryl, a 5- or 6-membered hetero ring, -lower alkylene-5- or 6-membered hetero ring, an aryl optionally having a substitutent, or an aryl optionally having -lower alkylene-substitutent; R7: a hydrogen atom, a lower alkyl, -lower alkylene-aryl, or -lower alkylene-heteroaryl: R7 is a substitutent on the nitrogen atom of the cyclic amine; R8 to R14: the same or different, and a hydrogen atom, or a lower alkyl; n: an integer of 1, 2 or 3; wherein R5 and R6, R4 and R5, or R3 and R4 may together form a lower alkylene, —O-lower alkylene-O—, —O-lower alkylene-, -lower alkylene-O—, —S-lower alkylene-, -lower alkylene-S—, —N(R19)-lower alkylene-, -lower alkylene-N(R19)—, —C(R15)═C(R16)—O—, —O—C(R15)═C(R16)—, —C(R15)═C(R16)—C(R17)═C(R18)—, —S—C(R15)═C(R16)—, —C(R15)═C(R16)—S—, —N(R19)—C(R15)═C(R16)—, —C(R15)═C(R16)—N(R19)—, —N(R19)—C(R15)═N—, —N═C(R15)—N(R19)—, —N═C(R15)—C(R16)═C(R17)—, —C(R15)═C(R16)—C(R17)═N—, —C(R15)═N—C(R16)═C(R17)—, or —C(R15)═C(R16)—N═C(R17)—; R3 and Y1 may together form —O-lower alkylene-O—, -lower alkylene-O—, or —N(R19)-lower alkylene-O—; R1 and Y1 may together form -lower alkylene-O—; and yl and the branch on —X1-A may together form —O—, or —O-lower alkylene; R15 to R18: the same or different, and a hydrogen atom, a halogen atom, or a lower alkyl group; R19: a hydrogen atom, or a lower alkyl group; provided that 6-chloro-2,2-dimethyl-1-(1-methyl-4-piperidinyl)indan-1-ol is excluded from the compound).

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

Ｋｖ4 이온 채널 활성을 갖는 화합물 본 발명은 이온 채널과 상호 작용하는 화합물에 관한 것이다. 특히, 본 발명은 하기 화학식 I, II, III 또는 IV(여기서 X1, X2, Y, Z, W, R1, R8, R10, L, A, z 및 n은 제1항에서 정의된 의미를 가짐)를 갖는 화합물, 이의 입체 이성체, 호변 이성체, 라세미체, 프로드럭, 대사물, 또는 이의 약학적으로 허용 가능한 염 및/또는 용매화물에 관한 것이다. 본 발명은 또한 상기 화합물의 제조 방법, 상기 화합물을 포함하는 약학적 조성물, 및 상기 화합물의 인체 및 동물 신체의 치료 방법에서의 용도에 관한 것이다. 하기 화학식 I, II, III 또는 IV를 갖는 화합물, 이의 입체 이성체, 호변 이성체, 라세미체, 프로드럭, 대사물, 또는 이의 약학적으로 허용 가능한 염 및/또는 용매화물: [이미지] 상기 화학식들에서, X1은 -O-, -S-, -N= 또는 -N(R3)-(여기서 R3은 알킬, 아랄킬 또는 알킬카르보닐 중에서 선택됨) 중에서 선택되는 헤테로 원자이고, X2는 =C-, =CH- 또는 -CH2- 중에서 선택되며, n은 0 또는 1 중에서 선택되는 정수이고, Y는 C, -C(R5)- 또는 N(여기서 R5는 수소, 아미노, 알킬, 히드록실, 알킬아미노, 헤테로아릴, 알킬카르보닐옥시, 알킬아미딜 또는 알킬아미노카르보닐아미노 중에서 선택됨) 중에서 선택되며, Z는 -C(=O)-, -CH2- 또는 -NH- 중에서 선택되고, W는 화학식 I에서는 -C(=O)-, -N(R2)-, -N(R2)-NH-, -C(=O)-NH-, -CH=, -O- 또는 -CH2-(여기서 R2는 수소, 알킬, 시클로알킬, 시아노알킬, 알케닐, 아릴, 아미노카르보닐, 할로알킬, 아랄킬, 시클로알킬알킬, 아실 또는 알키닐 중에서 선택됨) 중에서 선택되고, W는 화학식 II, III 또는 IV에서는 N 또는 CH이며, R1은 수소, 할로겐, 히드록시, 니트로, 아미노, 아지도, 시아노, 또는 알킬, 시클로알킬, 알킬아미노, 알콕시, 카르복시, 알킬아미노카르보닐, 알킬카르보닐, 헤테로시클릴-알킬, 헤테로아릴알킬, 알콕시카르보닐, 아미노카르보닐, 알킬아미노(알킬 치환된)알킬, 알킬카르보닐아미노알킬 또는 알킬티오(각각은 1 이상의 치환체로 임의로 치환됨) 중에서 선택되고, z는 1, 2, 3 또는 4 중에서 선택되는 정수이며, A는 아릴, 시클로알킬, 헤테로시클릴 및 헤테로아릴[각각은 할로겐, 히드록시, 니트로, 아지도, 히드라지노, 시아노, 알킬, 아릴, [이미지], 헤테로아릴알킬, 시클로알킬, 아실, 알킬아미노, 알킬아미노카르보닐, -SO2R15, 알킬카르보닐옥시, 융합된 헤테로시클릴, 할로알킬, 알킬카르보닐, 아릴옥시, 아릴카르보닐, 할로알콕시, 알콕시, 알킬티오, 카르복시, 아실아미노, 알킬 에스테르, 카르바메이트, 티오아미드, 알킬옥시카르보닐, 우레아 또는 설폰아미드(여기서 R15는 알킬, 알킬아미노 또는 시클로알킬임) 중에서 선택되는 1 이상의 치환체로 임의로 치환됨] 중에서 선택되고, L은 단일 결합, 화학식 -R8-R9-의 기, 알킬린, 알케닐릴, 시클로알킬렌, -NH-(C(R4)(R4))q-, -(C(R4)(R4))q-, -(C(R4)(R4))v-O-(C(R4)(R4))w-, -(C(R4)(R4))v-N-(C(R4)(R4))w-, -(C(R4)(R4))v-(C(R4))w=, -(C(R4)(R4))q-(C=O)- 또는 시클로알킬렌옥시알킬렌[여기서 -(C(R4)(R4))q-, (C(R4)(R4))w 및 -(C(R4)(R4))v-는 각각 독립적으로 지방족이거나 또는 시클로알킬을 형성하고, 각각의 R4는 독립적으로 수소, 히드록실, 알킬, 카르복시, 히드록시알킬, 알콕시알킬, 알킬아미노, 알킬아미노알킬 또는 알킬옥시카르보닐 중에서 선택되며; q는 0, 1, 2, 3, 4, 5 또는 6 중에서 선택되는 정수이고; v는 0, 1, 2, 3, 4, 5 또는 6 중에서 선택되는 정수이며; w는 0, 1, 2, 3, 4, 5 또는 6 중에서 선택되는 정수임] 중에서 선택되는 연결기이고, R8은 알킬린, -(C(R4)(R4))p-C(R14) 또는 -(C(R4)(R4))p-C(R4)=C이고, R9는 단일 결합, -(C(R4)(R4))q- 또는 -C(=O)-(여기서 R14는 수소, 히드록실 또는 알킬 중에서 선택되고, p는 0, 1, 2 또는 3 중에서 선택되는 정수임) 중에서 선택되며, R10은 -(C(R4)(R4))m-, -(C(R4)(R4))m-C(=O)O-(C(R4)(R4))q- 또는 -(C(R4)(R4))m-N(R12)-(C(R4)(R4))q-(여기서 m은 1, 2, 3, 4, 5 또는 6 중에서 선택되는 정수이고, R12는 수소, 알킬, 아릴, 아릴알킬 또는 알킬카르보닐 중에서 선택됨) 중에서 선택된다.

Compounds with Kv4 ion channel activityThe present invention relates to compounds that interact with ion channels. In particular, the invention relates to compounds having the structural Formula (I), (II), (III) or (IV), stereoisomers, tautomers, racemics, prodrugs, metabolites thereof, or a pharmaceutically acceptable salt and/or solvate thereof, Formula (I), (II), (III), (IV), wherein X, X, Y, Z, W, R, R , R, R, L, A, z, and n have the meaning defined in claim 1. The invention also relates to methods for preparing said compounds, to pharmaceutical compositions comprising said compounds, and to the use of said compounds in methods for treatment of the human and animal body.The compound that has structural formula i, ii, iii or iv, its steric isomer, tautomer, racemic modification, prodrug, metabolite or acceptable salt of its pharmacy and/or solvate,x wherein 1be be selected from-o-,-s-,-n=or-n (r 3)-heteroatoms, r wherein 3be selected from alkyl, aralkyl or alkyl-carbonyl, x wherein 2be selected from=c-,=ch-or-ch 2-, wherein n is selected from 0 or 1 integer,wherein y be selected from c ,-c (r 5)-or n, wherein r 5be selected from hydrogen, amino, alkyl, hydroxyl, alkylamino, heteroaryl, alkyl-carbonyl oxygen base, alkylamidoalkyl or alkyl amino-carbonyl amino, wherein z be selected from-c (=o)-,-ch 2-or-nh-, wherein in formula i w be selected from-c (=o)-,-n (r 2)-,-n (r 2)-nh-,-c (=o)-nh-,-ch=,-o-or-ch 2-, w is selected from n or ch in formula ii, iii or iv, r wherein 1be selected from hydrogen, halogen, hydroxyl, nitro, amino, nitrine, cyano group or alkyl, cycloalkyl, alkylamino, alkoxyl group, carboxyl, alkyl amino-carbonyl, alkyl-carbonyl, heterocyclic radical-alkyl, heteroarylalkyl, carbalkoxy, aminocarboxyl, alkylamino (alkyl replacement) alkyl, alkyl-carbonyl-amino alkyl or alkylthio, each is randomly replaced by one or more substituting group, wherein z is selected from 1,2,3 or 4 integer r wherein 2be selected from hydrogen, alkyl, cycloalkyl, cyano group alkyl, thiazolinyl, aryl, aminocarboxyl, haloalkyl, aralkyl, cycloalkylalkyl, acyl group or alkynyl, wherein a be selected from aryl, cycloalkyl, heterocyclic radical and heteroaryl, each randomly by one or more be selected from halogen, hydroxyl, nitro, nitrine, diazanyl, cyano group, alkyl, aryl, heteroarylalkyl, cycloalkyl, acyl group, alkylamino, alkyl amino-carbonyl ,-so 2r 15, alkyl-carbonyl oxygen base, annelated heterocycles base, haloalkyl, alkyl-carbonyl, aryloxy, aryl carbonyl, halogenated alkoxy, alkoxyl group, alkylthio, carboxyl, acyl amino, alkyl ester, carbamate/salt, thioamides, alkoxy carbonyl, urea or sulphonamide substituting group replace r wherein 15be alkyl, alkylamino or cycloalkyl, wherein l is selected from singly-bound, formula-r 8-r 9-group, alkylidene, inferior thiazolinyl, cycloalkylidene ,-nh-(c (r 4) (r 4)) q-,-(c (r 4) (r 4)) q-,-(c (r 4) (r 4)) v-o-(c (r 4) (r 4)) w-,-(c (r 4) (r 4)) v-n-(c (r 4) (r 4)) w-,-(c (r 4) (r 4)) v-(c (r 4)) w=,-(c (r 4) (r 4)) q-(c=o)-or the linking group of cycloalkylidene oxygen base alkylidene group, wherein-(c (r 4) (r 4)) q-, (c (r 4) (r 4)) wand-(c (r 4) (r 4)) v-be aliphatics or form cycloalkyl, each r wherein independently separately 4be independently selected from hydrogen, hydroxyl, alkyl, carboxyl, hydroxyalkyl, alkoxyalkyl, alkylamino, alkyl amino alkyl or carbalkoxy; q is selected from 0,1,2,3,4,5 or 6 integer; v is selected from 0,1,2,3,4,5 or 6 integer and w to be selected from 0,1,2,3,4,5 or 6 integer, r wherein 8be alkylidene ,-(c (r 4) (r 4)) p-c (r 14) or-(c (r 4) (r 4)) p-c (r 4)=c, r wherein 9be selected from singly-bound ,-(c (r 4) (r 4)) q-or-c (=o)-, r wherein 14be selected from hydrogen, hydroxyl or alkyl, wherein p is selected from 0,1,2 or 3 integer, and r wherein 10be selected from-(c (r 4) (r 4)) m-,-(c (r 4) (r 4)) m-c (=o) o-(c (r 4) (r 4)) q-or-(c (r 4) (r 4)) m-n (r 12)-(c (r 4) (r 4)) q-, wherein m is selected from 1,2,3,4,5 or 6 integer, wherein r 12be selected from hydrogen, alkyl, aryl, aralkyl or alkyl-carbonyl.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

Ｎ-아실 시클릭 아민 유도체 또는 이의 의약상 허용되는 염본 발명은 정신분열증에서의 양성 증상, 음성 증상 및 인지 기능장애에 높은 유효성을 발휘하고, 종래의 부작용 리스크를 경감할 뿐 아니라, 정신분열증 이외의 인지 기능장애를 수반하는 중추 신경 질환에 대해서도 현저한 효과를 가지는 화합물을 제공한다. 하기 식 (1) 의 N-아실 시클릭 아민 유도체 또는 이의 의약상 허용되는 염이 제공된다: [식 중, Ar1 및 Ar2 는 아릴 또는 헤테로아릴이고; V 는 질소 또는 CR3 이며; W1 은 단일 결합, -C(O)- 등이고; W2 는 C1-3 알킬렌이며; W3 은 단일 결합, 메틸렌, -NH-, -CR4=CR5- 등이고; 고리 Q 는 하기 식 (a) (식 중, n 은 0 또는 1 이며; m 은 0 내지 2 이고; k 는 1 내지 3 이며; Z 는 단일 결합, 메틸렌, 산소 등이고; R1a, R1b 및 R1c 는 각각 동일 또는 상이하며, 수소, 히드록실, 할로겐, 시아노, C1-6 알킬 등이다) 의 기이다].하기 식 (1) 의 화합물 또는 이의 의약상 허용되는 염:[화학식 1][식 중, Ar1 및 Ar2 는 각각 독립적으로 임의로 치환되는 C6-10 아릴 또는 임의로 치환되는 헤테로아릴이고;V 는 질소 또는 CR3 (식 중, R3 은 수소, 히드록실, 할로겐, 시아노 또는 임의로 치환되는 C1-6 알킬이다) 이며;V 가 질소인 경우, W1 은 단일 결합 또는 -C(O)- 이고,V 가 CR3 인 경우, W1 은 단일 결합, 산소, 황, -C(O)- 또는 -NR2- (식 중, R2 는 수소 또는 임의로 치환되는 C1-6 알킬이다) 이며,V 가 질소인 경우의 피페라진 고리 및 V 가 CR3 인 경우의 피페리딘 고리는 각각 독립적으로 임의의 치환기 위치에서, 히드록실, 할로겐, 시아노, C1-6 알킬 및 C1-6 알콕시로 이루어진 군에서 선택되는 하나 이상의 동일 또는 상이한 기로 임의로 치환될 수 있고;W2 는 임의로 치환되는 에틸렌이며;W3 은 단일 결합, 산소, 황, -NH-, 임의로 치환되는 메틸렌, 임의로 치환되는 에틸렌 또는 -CR4=CR5- (식 중, R4 및 R5 는 각각 독립적으로 수소, 할로겐 또는 임의로 치환되는 C1-6 알킬이다) 이고;고리 Q 는 하기 식 (a) 의 기이다:[화학식 2](식 중, n 은 0 이며;m 은 0, 1 또는 2 이고;k 는 1, 2 또는 3 이며;Z 는 단일 결합, 메틸렌, 산소, 황, -S(O)-, -S(O)2- 또는 -NR21- (식 중, R21 은 수소 또는 임의로 치환되는 C1-6 알킬이다) 이고;R1a, R1b 및 R1c 는 각각 동일 또는 상이하며, 수소, 히드록실, 할로겐, 시아노, 카르복실, 임의로 치환되는 아미노, 임의로 치환되는 C1-6 알킬, 임의로 치환되는 C3-7 시클로알킬, 임의로 치환되는 C3-7 시클로알킬-C1-4 알킬, 임의로 치환되는 C7-14 아르알킬, 임의로 치환되는 헤테로아릴-C1-4 알킬, 임의로 치환되는 포화 헤테로시클릭 C1-4 알킬, 임의로 치환되는 C6-10 아릴, 임의로 치환되는 헤테로아릴, 임의로 치환되는 포화 헤테로사이클, 임의로 치환되는 C1-6 알콕시, 임의로 치환되는 C3-7 시클로알콕시, 임의로 치환되는 C6-10 아릴옥시, 임의로 치환되는 헤테로아릴옥시, 임의로 치환되는 포화 헤테로시클릭 옥시, 임의로 치환되는 C7-14 아르알킬옥시, 임의로 치환되는 C1-6 알킬카르보닐아미노, 임의로 치환되는 C3-7 시클로알킬카르보닐아미노, 임의로 치환되는 C6-10 아릴카르보닐아미노, 임의로 치환되는 포화 헤테로시클릭 카르보닐아미노, 임의로 치환되는 헤테로아릴카르보닐아미노, 임의로 치환되는 C1-6 알킬카르보닐옥시, 임의로 치환되는 아미노카르보닐옥시, 임의로 치환되는 C1-6 알콕시카르보닐아미노, 임의로 치환되는 C3-7 시클로알콕시카르보닐아미노, 임의로 치환되는 포화 헤테로시클릭 옥시카르보닐아미노, 임의로 치환되는 아미노카르보닐아미노 또는 임의로 치환되는 아미노술포닐아미노, 임의로 치환되는 C1-6 알킬술포닐아미노, 임의로 치환되는 C3-7 시클로알킬술포닐아미노, 임의로 치환되는 C6-10 아릴술포닐아미노, 임의로 치환되는 포화 헤테로시클릭 술포닐아미노 또는 임의로 치환되는 헤테로아릴술포닐아미노이고,대안적으로는, R1a 및 R1b 가 연결되어, 이들이 결합하는 탄소 원자와 함께 C3-7 시클로알킬 고리 또는 포화 헤테로사이클 (상기 C3-7 시클로알킬 고리 및 포화 헤테로사이클은 히드록실, 할로겐, 시아노, C1-6 알킬, C1-6 알콕시, C6-10 아릴, 헤테로아릴 및 4- 내지 7-원 포화 헤테로사이클로 이루어진 군에서 선택되는 하나 이상의 동일 또는 상이한 기로 임의로 치환될 수 있다) 을 형성할 수 있다)].

N-ACYL CYCLIC AMINE DERIVATIVE OR PHARMACEUTICALLY ACCEPTABLE SALT THEREOFThe present invention provides compounds which show high effectiveness against positive symptoms, negative symptoms and cognitive dysfunction in schizophrenia and reduce conventional side-effect risks as well as have remarkable effects for central neurological diseases associated with cognitive dysfunction other than schizophrenia. N-Acyl cyclic amine derivatives of formula (1): wherein Ar1 and Ar2 are aryl or heteroaryl; V is nitrogen, or CR3; W1 is a single bond, -C(O)-, etc.; W2 is C1- alkylene; W3 is a single bond, methylene, -NH-, -CR4=CR5-, etc.; Ring Q is a group of formula (a) in which n is 0 or 1; m is 0 to 2; k is 1 to 3; Z is a single bond, methylene, oxygen, etc.; R1a, R1b and R1c are each, same or different, hydrogen, hydroxyl, halogen, cyano, C1-6 alkyl, etc.; or pharmaceutically acceptable salts thereof are provided.A compound of the following formula (1): wherein Ar1 and Ar2 are each independently optionally substituted C6-10 aryl or optionally substituted heteroaryl; V is nitrogen, or CR3, in which R3 is hydrogen, hydroxyl, halogen, cyano, or optionally substituted d-6 alkyl;when V is nitrogen, W1 is a single bond or -C(O)-,when V is CR3, W1 is a single bond, oxygen, sulfur, -C(O)- or -NR2-, in which R2 is hydrogen or optionally substituted C1-6 alkyl,piperazine ring in case that V is nitrogen and piperidine ring in case that V is CR3 may be each independently optionally substituted by one or more and same or different groups selected from the group consisting of hydroxyl, halogen, cyano, d-6 alkyl and d^ alkoxy on any substituent positions;W2 is optionally substituted ethylene;W3 is a single bond, oxygen, sulfur, - H-, optionally substituted methylene, optionally substituted ethylene, or -CR4=CR5-, in which R4 and R5 are each independently hydrogen, halogen or optionally substituted C1-6 alkyl;Ring Q is a group of the following formula (a):in which n is 0;m is 0, 1 or 2;k is 1, 2 or 3;Z is a single bond, methylene, oxygen, sulfur, -S(O)-, -S(0)2- or -NR21-, in which R21 is hydrogen or optionally substituted C1-6 alkyl;Rla, Rlb and Rlc are each, same or different, hydrogen, hydroxyl, halogen, cyano, carboxyl, optionally substituted amino, optionally substituted C1-6 alkyl, optionally substituted C3-7 cycloalkyl, optionally substituted C3-7 cycloalkyl-C1 -4 alkyl, optionally substituted C7-14 aralkyl, optionally substituted heteroaryl-C1-4 alkyl, optionally substituted saturated heterocyclic C1-4 alkyl, optionally substituted C6-10 aryl, optionally substituted heteroaryl, optionally substituted saturated heterocycle, optionally substituted C1-6 alkoxy, optionally substituted C3-7 cycloalkoxy, optionally substituted Ce-ιο aryloxy, optionally substituted heteroaryloxy, optionally substituted saturated heterocyclic oxy, optionally substituted C7-14 aralkyloxy, optionally substituted C!.6 alkylcarbonylamino, optionally substituted C3-7 cycloalkylcarbonylamino, optionally substituted Ce-io arylcarbonylamino, optionally substituted saturated heterocyclic carbonylamino, optionally substituted heteroaryl carbonylamino, optionally substituted C1-6 alkylcarbonyloxy, optionally substituted aminocarbonyloxy, optionally substituted C1-6 alkoxycarbonylamino, optionally substituted C3-7 cycloalkoxycarbonylamino, optionally substituted saturated heterocyclic oxycarbonylamino, optionally substituted aminocarbonylamino, or optionally substituted aminosulfonylamino, optionally substituted Cue alkylsulfonylamino, optionally substituted C3- 7 cycloalkylsulfonylamino, optionally substituted C6-10 arylsulfonylamino, optionally substituted saturated heterocyclic sulfonylamino, or optionally substituted heteroarylsulfonylamino,alternatively, Rla and Rlb may combine each other together with the carbon atom to which they bind to form C3-7 cycloalkyl ring, or saturated heterocycle, in which the C3 -7 cycloalkyl ring and the saturated heterocycle may be optionally substituted by one or more and same or different groups selected from the group consisting of hydroxyl, halogen, cyano, Ci-6 alkyl, C1-6 alkoxy, Ce-io ryl, heteroaryl and 4- to 7-membered saturated heterocycle; or a pharmaceutically acceptable salt thereof.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

치환된 피리디논 함유 트리시클릭 화합물, 및 그의 사용 방법본 발명은 환자에서 B형 간염 바이러스 (HBV) 감염을 치료 또는 예방하는 데 사용될 수 있는, 치환된 피리디논 함유 트리시클릭 화합물, 및 상기를 포함하는 조성물을 포함한다. 특정 실시양태에서, 본 발명의 화합물 및 조성물은 HBsAg 분비를 억제 및/또는 감소시킨다.하기 화학식 (IIIa)의 화합물, 또는 그의 염, 용매화물, 입체이성질체, 기하 이성질체, 호변이성질체, 또는 임의의 혼합물:<화학식 (IIIa)>[이미지]상기 식에서,R1은 H; 할로; -OR8; -C(R9)(R9)OR8; -C(=O)R8; -C(=O)OR8; -C(=O)NH-OR8; -C(=O)NHNHR8; -C(=O)NHNHC(=O)R8; -C(=O)NHS(=O)2R8; -CH2C(=O)OR8; -CN; -NH2; -N(R8)C(=O)H; -N(R8)C(=O)R10; -N(R8)C(=O)OR10; -N(R8)C(=O)NHR8; -NR9S(=O)2R10; -P(=O)(OR8)2; -B(OR8)2; 2,5-디옥소-피롤리딘-1-일; 2H-테트라졸-5-일; 3-히드록시-이속사졸-5-일; 1,4-디히드로-5-옥소-5H-테트라졸-1-일; C1-C6 알킬로 임의적으로 치환된 피리딘-2-일; C1-C6 알킬로 임의적으로 치환된 피리미딘-2-일; (피리딘-2-일)메틸; (피리미딘-2-일)메틸; (피리미딘-2-일)아미노; 비스-(피리미딘-2-일)-아미노; 5-R8-1,3,4,-티아디아졸-2-일; 5-티옥소-4,5-디히드로-1H-1,2,4-트리아졸-3-일; 1H-1,2,4-트리아졸-5-일; 1,3,4-옥사디아졸-2-일; 1,2,4-옥사디아졸-5-일, 및 3-R10-1,2,4-옥사디아졸-5-일로 이루어진 군으로부터 선택되고;R2는 =O, =NR9, =N(OR9), 및 =N(NR9R9)로 이루어진 군으로부터 선택되거나; 또는 R1 및 R2는 결합하여 =N-O-C(=O)- 또는 =N-N(R9)-C(=O)-를 형성하고, 여기서, =N 기는 "*"로 표시된 고리 탄소 원자에 결합하고;X1은 CR6I 및 N으로 이루어진 군으로부터 선택되고, X2는 CR6II 및 N으로 이루어진 군으로부터 선택되고, X3은 CR6III 및 N으로 이루어진 군으로부터 선택되고, X4는 CR6IV 및 N으로 이루어진 군으로부터 선택되거나, 또는 X3 및 X4, 또는 X1 및 X2는 결합하여 -S-를 형성하고; 여기서, X1, X2, X3 및 X4로 이루어진 군으로부터 선택되는 1-2개의 치환기는 N이고; 존재할 경우, 이들은 각각, 고리 내의 인접한 탄소 원자가 -OH로 치환된다면, C1-C6 알킬로 임의적으로 알킬화되고;R6I, R6II, R6III 및 R6IV는 독립적으로 H, 할로, -CN, 피롤리디닐, 임의적으로 치환된 C1-C6 알킬, 임의적으로 치환된 C1-C6 알케닐, 임의적으로 치환된 C3-C8 시클로알킬, 임의적으로 치환된 헤테로시클릴, -OR, C1-C6 할로알콕시, -N(R)(R), -NO2, -S(=O)2N(R)(R), 아실, 및 C1-C6 알콕시카르보닐로 이루어진 군으로부터 선택되고,여기서, 각 경우에 R은 독립적으로 H, C1-C6 알킬, R'-치환된 C1-C6 알킬, C1-C6 히드록시알킬, 임의적으로 치환된 (C1-C6 알콕시)-C1-C6 알킬, 및 임의적으로 치환된 C3-C8 시클로알킬로 이루어진 군으로부터 선택되고, 여기서, 각 경우에 R'은 독립적으로 -NH2, -NH(C1-C6 알킬), -N(C1-C6 알킬)(C1-C6 알킬), -NHC(=O)OtBu, -N(C1-C6 알킬)C(=O)OtBu, 또는 임의적으로 N-연결된, 5- 또는 6-원 헤테로시클릭 기로 이루어진 군으로부터 선택되거나; 또는 X2는 CR6II이고, X3은 CR6III이고, R6II 및 R6III은 결합하여 -O(CHF)O-, -O(CF2)O-, -O(CR9R9)O-, -O(CH2)(CH2)O- 및 -O(CH2)(CR11R11)(CH2)O-로 이루어진 군으로부터 선택되는 2가 기를 형성하고;R7은 H, OH, 할로, C1-C6 알콕시, 및 임의적으로 치환된 C1-C6 알킬로 이루어진 군으로부터 선택되고;R8은 H, 임의적으로 치환된 C1-C6 알킬, 및 임의적으로 치환된 C3-C8 시클로알킬로 이루어진 군으로부터 선택되고;각 경우에 R9는 독립적으로 H 및 C1-C6 알킬로 이루어진 군으로부터 선택되고;R10은 임의적으로 치환된 C1-C6 알킬 및 임의적으로 치환된 페닐로 이루어진 군으로부터 선택되고;각 경우에 R11은 독립적으로 H, OH, C1-C6 알킬, C1-C6 알콕시, 알콕시-C1-C6 알킬 및 알콕시-C1-C6 알콕시로 이루어진 군으로부터 선택되고, 여기서, 동일 탄소 원자에 결합된 2개의 R11 기는 동시에 OH가 아니거나; 또는 2개의 R11 기는 그들이 결합된 탄소 원자와 결합하여 C=O, C=CH2 및 옥세탄-3,3-디일로 이루어진 군으로부터 선택되는 모이어티(moiety)를 형성한다.

SUBSTITUTED PYRIDINONE-CONTAINING TRICYCLIC COMPOUNDS, AND METHODS USING SAMEThe present invention includes substituted pyridinone-containing tricyclic compounds, and compositions comprising the same, that can be used to treat or prevent hepatitis B virus (HBV) infection in apatient. In certain embodiments, the compounds and compositions of the invention inhibit and/or reduce HBsAg secretion.The compound or its salt of formula (iiia), solvate, stereoisomer, geometric isomer, tautomer are appointed meaning mixture:wherein:riselected from h；halogen；-or8；-c(r9)(r9)or8；- c (=o) r8；- c (=o) or8；- c (=o) nh-or8；- c (=o) nhnhr8；- c (=o) nhnhc (=o) r8；- c (=o) nhs (=o)2r8；-ch2c (=o) or8；-cn；-nh2；-n(r8) c (= o)h；-n(r8) c (=o) r10；-n(r8) c (=o) or10；-n(r8) c (=o) nhr8；-nr9s (=o)2r10；- p (=o) (or8)2；-b(or8)2；2,5- bis- oxygroups-pyrrolidin-1-yl；2h- tetrazolium -5- base；3- hydroxyl-differentazoles -5- base；isosorbide-5-nitrae-two hydrogen -5- oxygroup -5h- tetrazolium -1- base；through c1-c6pyridine -2- the base that alkyl optionally replaces；through c1-c6alkyl optionally replaces phonetic pyridine -2- base；(pyridine -2- base) methyl；(pyrimidine -2-base) methyl；(pyrimidine -2-base) amino；double-(pyrimidine -2-base)-amino； 5-r8- 1,3,4,-thiadiazoles -2- base；5- is thio -4,5- dihydro -1h-1,2,4- triazole -3- bases；1h-1,2,4- triazole -5- base；1,3,4-diazole -2- base；1,2,4-diazole -5- base and 3-r10- 1,2,4-diazole -5- base；r2selected from=o ,=nr9,=n (or9) and=n (nr9r9)；or r1and r2in conjunction with formation=n-o-c (=o)-or=n-n (r9)-c (=o)-, wherein described=n group be bonded to it is marked with the ring carbon atom of ' * '；x1selected from cr6iand n, x2selected from cr6iiand n, x3selected from cr6iiiand n, x4selected from cr6ivand n or x3and x4or x1and x2, knot it closes to form-s-；wherein it is selected from x1, x2, x3and x41-2 substituent group be n；in case of presence, wherein it is each through c1-c6alkyl is optional if ground is alkylated --- the adjacent carbon atom warp-oh in ring replaces；r6i、r6ii、r6iiiand r6ivindependently selected from h, halogen ,-cn, pyrrolidinyl, the optionally c that replaces1-c6alkyl optionally replaces c1-c6alkenyl, the c optionally replaced3-c8naphthenic base, the heterocycle optionally replaced ,-or, c1-c6halogen alkoxy ,-n (r) (r)、-no2,-s (=o)2n (r) (r), acyl group and c1-c6alkoxy carbonyl group,wherein each existing r is independently selected from h, c1-c6the c that alkyl, r '-replace1-c6alkyl, c1-c6hydroxyalkyl optionally takes (the c in generation1-c6alkoxy)-c1-c6alkyl and the c optionally replaced3-c8naphthenic base,wherein each existing r ' is independently selected from-nh2、-nh(c1-c6alkyl) ,-n (c1-c6alkyl) (c1-c6alkyl) ,-nhc (=o) otbu、-n(c1-c6alkyl) c (=o) otbu is optionally 5- or 6 circle heterocyclic ring groups that n- is bonded；or x2it is cr6ii, x3it is cr6iiiand r6iiand r6iii- o (chf) o- ,-o (cf are selected from conjunction with to be formed2)o-、-o(cr9r9) o-、-o(ch2)(ch2) o- and-o (ch2)(cr11r11)(ch2) o- bivalent group；r7selected from h, oh, halogen, c1-c6alkoxy and the c optionally replaced1-c6alkyl；r8selected from h, optionally the c replaced1-c6alkyl and the c optionally replaced3-c8naphthenic base；each existing r9independently selected from h and c1-c6alkyl；r10selected from the c optionally replaced1-c6alkyl and the phenyl optionally replaced；with,each existing r11independently selected from h, oh, c1-c6alkyl, c1-c6alkoxy, alkoxy -c1-c6alkyl and alkoxy- c1-c6alkoxy, wherein being bonded to two r of identical carbon atoms11group is not oh simultaneously；or two r11group and their institute's keys the carbon atom of knot is combined to be formed and be selected from c=o, c=ch2with the part of oxetanes -3,3- diyl.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

HPK1의 억제제인 이소퀴놀린본 발명은 HPK1(조혈 전구 키나제 1)의 억제제인 이소퀴놀린 화합물 및 이의 용도에 관한 것이다. 상기 화합물은 HPK1-의존성 장애의 치료 및 면역 반응의 강화에 유용하다. 본 발명은 또한 HPK1의 억제 방법, HPK1-의존성 장애의 치료 방법, 면역 반응의 강화 방법, 및 이소퀴놀린 화합물의 제조 방법에 관한 것이다.하기 화학식 I의 화합물 또는 이의 약학적으로 허용되는 염:[화학식 I][이미지]상기 식에서,R1은 수소, 할로겐, 시아노, C1-6 알킬, C3-7 사이클로알킬, C1-6 할로알킬, C1-6 하이드록시알킬, 하이드록실, C1-6 알콕실, 임의적으로 치환된 아미노 또는 임의적으로 치환된 아실아미노이고;R2는 (a) O, S 및 N으로부터 선택되는 1 내지 4개의 헤테로원자를 갖고 1, 2, 3, 4 또는 5개의 치환기로 임의적으로 치환된 5 내지 10원 헤테로아릴 또는 5 내지 10원 헤테로사이클릴; (b) 1, 2, 3, 4 또는 5개의 치환기로 임의적으로 치환된 C6-10 아릴; (c) 수소, 할로겐, 시아노; 또는 Ra가 각각 독립적으로 C1-6 알킬이고, Rb가 각각 독립적으로 수소 또는 C1-6 알킬이거나, Ra 및 Rb가 이들이 부착된 원자와 함께 임의적으로 치환된 5 내지 10원 헤테로사이클릴을 형성하는, -NRbC(O)Ra, -NRbSO2Ra, -SO2NRaRb 또는 -SO2Ra; (d) Ra1이 각각 독립적으로 C6-10 아릴로 임의적으로 치환된 C1-6 알킬; 5 내지 10원 헤테로아릴; 또는 5 내지 10원 헤테로사이클릴이고, 상기 C6-10 아릴, 5 내지 10원 헤테로아릴 및 5 내지 10원 헤테로사이클릴이 임의적으로 치환된, -ORa1 또는 -(C1-6 알킬렌)-ORa1; (e) 1 내지 5개의 치환기로 각각 임의적으로 치환된 C1-6 알킬, C2-6 알켄일 또는 C2-6 알킨일; (f) 1 내지 5개의 치환기로 임의적으로 치환된 C3-8 사이클로알킬; (g) Ra2가 각각 독립적으로 수소 또는 C1-6 알킬이고, Rb2가 수소, C1-6 알킬, C6-10 아릴, 5 내지 10원 헤테로아릴 또는 5 내지 10원 헤테로사이클릴이거나, Ra2 및 Rb2가 이들이 부착된 원자와 함께 임의적으로 치환된 5 내지 10원 헤테로사이클릴을 형성하고, C1-6 알킬, C6-10 아릴, 5 내지 10원 헤테로아릴 및 5 내지 10원 헤테로사이클릴이 임의적으로 치환된, -C(O)NRa2Rb2 또는 -NRa2(CO)Rb2; 또는 (h) 5 또는 6원 헤테로아릴, 5 내지 10원 헤테로사이클릴, C6-10 아릴 및 C3-7 사이클로알킬로 이루어진 군으로부터 선택되는 고리와 융합된 5 내지 10원 헤테로아릴이고, 이때 R2의 5 내지 10원 헤테로아릴 및 융합된 고리는 1 내지 4개의 치환기로 임의적으로 치환되고;R3은 수소, 시아노, 할로겐, 임의적으로 치환된 C1-6 알킬, 임의적으로 치환된 C2-9 헤테로사이클릴 또는 임의적으로 치환된 C1-6 알콕시이고;R4는 A-C(O)- 또는 D이고;A는 C1-6 알킬, C3-7 사이클로알킬, C2-9 헤테로아릴, C2-9 헤테로사이클릴, -NHRg 또는 -ORh이고, 이때 A의 C1-6 알킬, C3-7 사이클로알킬, C2-9 헤테로아릴 및 C2-9 헤테로사이클릴은 독립적으로 1, 2, 3, 4 또는 5개의 치환기로 임의적으로 치환되고;Rg 및 Rh는 독립적으로 C1-6 알킬, C2-6 알켄일, C3-7 사이클로알킬, C6-10 아릴, C2-9 헤테로아릴 또는 C2-9 헤테로사이클릴이고, 이때 Rg 및 Rh의 C1-6 알킬, C2-6 알켄일, C3-7 사이클로알킬, C6-10 아릴, C2-9 헤테로아릴 및 C2-9 헤테로사이클릴은 독립적으로 1, 2, 3, 4 또는 5개의 치환기로 임의적으로 치환되고;D는 수소, C6-10 아릴; O, S 및 N으로부터 선택되는 1 내지 4개의 헤테로원자를 갖는 5 내지 10원 헤테로아릴; 또는 5 또는 6원 헤테로아릴, 5 내지 10원 헤테로사이클릴, C6 아릴 및 C3-8 사이클로알킬로 이루어진 군으로부터 선택되는 고리와 융합된 5 내지 10원 헤테로아릴이고, 이때 D의 5 내지 10원 헤테로아릴 및 융합된 고리는 1, 2, 3, 4 또는 5개의 치환기로 임의적으로 치환되되,상기 화합물은 N-(8-아미노-3-이소퀴놀린일)-N'-에틸-우레아, 5-[(8-아미노-3-이소퀴놀린일)아미노]-2-피라진카보니트릴 및 5-[(8-아미노-3-이소퀴놀린일)아미노]-3-[(1R)-2-(다이메틸아미노)-1-메틸에톡시]-2-피라진카보니트릴로 이루어진 군으로부터 선택되는 화합물 및 이의 약학적으로 허용되는 염이 아니다.

Isoquinolines as inhibitors of HPK1Isoquinoline compounds and their use as inhibitors of HPK1 (hematopoietic kinase 1) are described. The compounds are useful in treating HPK1 -dependent disorders and enhancing an immune response. Alsodescribed are methods of inhibiting HPK1, methods of treating HPK1 -dependent disorders, methods for enhancing an immune response, and methods for preparing the isoquinoline compounds.A compound of formula i:or a pharmaceutically acceptable salt thereof, wherein,r1is hydrogen, halogen, cyano, c1-6alkyl radical, c3-7cycloalkyl radical, c1-6haloalkyl, c1-6hydroxyalkyl, hydroxy, c1-6alkoxy, optionally substituted amino or optionally substituted amido;r2is (a), (b), (c), (d), (e), (f), (g) or (h):(a) a 5-10 membered heteroaryl or 5-10 membered heterocyclyl having 1-4 heteroatoms selected from o, s and n; and optionally substituted with 1, 2, 3, 4 or 5 substituents; or(b) c optionally substituted with 1, 2, 3, 4 or 5 substituents6-10an aryl group; or(c) hydrogen, halogen, cyano, -nrbc(o)ra、–nrbso2ra、–so2nrarb(ii) a or-so2ra(ii) a wherein r isaeach independently is c1-6alkyl, and rbindependently is hydrogen or c1-6an alkyl group; or raand rbto which they are connectedthe atoms taken together form an optionally substituted 5-10 membered heterocyclyl; or(d)–ora1or- (c)1-6alkylene) -ora1(ii) a wherein r isa1each independently is optionally a ground warp c6-10aryl substituted c1-6an alkyl group; 5-10 membered heteroaryl; or a 5-10 membered heterocyclic group; wherein said c6-10aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl are optionally substituted; or(e)c1-6alkyl radical, c2-6alkenyl or c2-6alkynyl, each of which is optionally substituted with 1 to 5 substituents; or(f)c3-8cycloalkyl, optionally substituted with 1 to 5 substituents;(g)–c(o)nra2rb2or-nra2(co)rb2wherein r isa2each independently is hydrogen or c1-6alkyl, and rb2is hydrogen, c1-6alkyl radical, c6-10aryl, 5-10 membered heteroaryl or 5-10 membered heterocyclyl; or ra2and rb2together with the atoms to which they are attached form an optionally substituted 5-10 membered heterocyclyl; wherein said c1-6alkyl radical, c6-10aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl are optionally substituted; or(h)5-10 membered heteroaryl with a compound selected from 5-or 6-membered heteroaryl, 5-10 membered heterocyclyl, c6-10aryl and c3-7ring fusion of cycloalkyl, wherein r2said 5-10 membered heteroaryl and said fused ring of (a) are optionally substituted with 1 to 4 substituents;r3is hydrogen, cyano, halogen, optionally substituted c1-6alkyl, optionally substituted c2-9heterocyclyl, or optionally substituted c1-6an alkoxy group; andr4is a-c (o) -or d;a is c1-6alkyl radical, c3-7cycloalkyl radical, c2-9heteroaryl group, c2-9heterocyclyl, -nhrgor-orh(ii) a wherein said c of a1-6alkyl radical, c3-7cycloalkyl, 7c2-9heteroaryl and c2-9heterocyclic radicaloptionally independently substituted with 1, 2, 3, 4 or 5 substituents;rgand rhindependently is c1-6alkyl radical, c2-6alkenyl radical, c3-7cycloalkyl radical, c6-10aryl radical, c2-9heteroaryl or c2-9a heterocyclic group; wherein r isgand rhsaid c of1-6alkyl radical, c2-6alkenyl radical, c3-7cycloalkyl radical, c6-10aryl radical, c2-9heteroaryl and c2-9heterocyclyl is optionally independently substituted with 1, 2, 3, 4 or 5 substituents; andd is hydrogen or c6-10aryl or 5-10 membered heteroaryl having 1-4 heteroatoms selected from o, s and n; or 5-10 membered heteroaryl with a group selected from 5-or 6-membered heteroaryl, 5-10 membered heterocyclyl, c6aryl and c3-8ring fusion of cycloalkyl; wherein the 5-10 membered heteroaryl and the fused ring of d are optionally substituted with 1, 2, 3, 4, or 5 substituents;with the proviso that the compound is not a compound selected from the group consisting of n- (8-amino-3-isoquinolinyl) -n' -ethyl-urea, 5- [ (8-amino-3-isoquinolinyl) amino ] -2-pyrazinecarbonitrile and 5- [ (8-amino-3-isoquinolinyl) amino ] -3- [ (1r) -2- (dimethylamino) -1-methylethoxy ] -2-pyrazinecarbonitrile, and pharmaceutically acceptable salts thereof.

22212

플라스틱 필름 제조업

특허

ko

en

필름 및 그 제조 방법내파괴성 및 균일 연신성이 우수한 필름 및 그 제조 방법의 제공. 단층의 필름으로서, ETFE, PFA, FEP, ECTFE 및 PMP 중 어느 하나에 함께 속하는 수지 2 종의 블렌드 수지로 이루어지고, 필름의 용융 유량이 6 g/10 분 이상 20 g/10 분 미만이며, 또한 소정의 측정 방법으로 측정되는 필름의 α 가 0.99 이상인 것을 특징으로 하는 필름.단층의 필름으로서, 이하의 ETFE, PFA, FEP, ECTFE 및 PMP 중 어느 하나에 함께 속하는 수지 2 종의 블렌드 수지로 이루어지고, 이하의 측정 방법으로 측정되는 필름의 용융 유량이 6 g/10 분 이상 20 g/10 분 미만이며, 또한 이하의 측정 방법으로 측정되는 필름의 α 가 0.99 이상인 것을 특징으로 하는 필름.ETFE : 테트라플루오로에틸렌 단위와 에틸렌 단위를 포함하고, 테트라플루오로에틸렌 단위/에틸렌 단위의 몰비가 60/40 ∼ 40/60 이고, 테트라플루오로에틸렌 단위와 에틸렌 단위의 합계에 대한 다른 단량체에 기초하는 단위의 비율이 0 ∼ 6 몰％ 인 공중합체.PFA : 테트라플루오로에틸렌 단위와 퍼플루오로(알킬비닐에테르) 단위를 포함하고, 테트라플루오로에틸렌 단위/퍼플루오로(알킬비닐에테르) 단위의 몰비가 99/1 ∼ 85/15 이고, 테트라플루오로에틸렌 단위와 퍼플루오로(알킬비닐에테르) 단위의 합계에 대한 다른 단량체에 기초하는 단위의 비율이 0 ∼ 5 몰％ 인 공중합체.FEP : 테트라플루오로에틸렌 단위와 헥사플루오로프로필렌 단위를 포함하고, 테트라플루오로에틸렌 단위/헥사플루오로프로필렌 단위의 몰비가 75/25 ∼ 95/5 이고, 테트라플루오로에틸렌 단위와 헥사플루오로프로필렌 단위의 합계에 대한 다른 단량체에 기초하는 단위의 비율이 0 ∼ 5 몰％ 인 공중합체.ECTFE : 클로로트리플루오로에틸렌 단위와 에틸렌 단위를 포함하고, 클로로트리플루오로에틸렌 단위/에틸렌 단위의 몰비가 60/40 ∼ 40/60 이고, 클로로트리플루오로에틸렌 단위와 에틸렌 단위의 합계에 대한 다른 단량체에 기초하는 단위의 비율이 0 ∼ 5 몰％ 인 공중합체.PMP : 4-메틸-1-펜텐 단위 85 ∼ 100 몰％ 와, 에틸렌 및 탄소수 3 ∼ 20 의 α-올레핀으로 이루어지는 군에서 선택되는 적어도 1 종의 단량체에 기초하는 단위 0 ∼ 15 몰％ 로 이루어지는 중합체.(필름의 용융 유량의 측정 방법) 상기 수지 2 종이 ETFE 인 경우에는, ASTM D3159 에 준거하여 하중 49 N, 297 ℃ 에서 측정하고, PFA 인 경우에는, ASTM D1238 에 준거하여 하중 49 N, 372 ℃ 에서 측정하고, FEP 인 경우에는, ASTM D1238 에 준거하여 하중 49 N, 372 ℃ 에서 측정하고, ECTFE 인 경우에는, ASTM D1238 에 준거하여 하중 21.168 N, 온도 271.5 ℃ 에서 측정하고, PMP 인 경우에는, ASTM D1238 에 준거하여 하중 49 N, 온도 260 ℃ 에서 측정한다.(필름의 α 의 측정 방법) 상기 필름에 대하여, ISO 6721-10 : 1999 에 준거하여, 용융 점탄성 측정기를 사용하고, 상기 용융 유량과 동일한 측정 온도에 있어서, 20 ㎜ 의 동축 평행 원판을 1 ㎜ 갭으로, 이하의 15 점 각각의 각주파수의 정현파를 가했을 때에 있어서의 복소 전단 점도 (Pa·s) 를, 변형 제어 방식에 있어서 변형 1 ％ 의 조건에서 측정한다.각주파수 : 0.31, 0.52, 0.84, 1.4, 2.3, 3.7, 6.1, 10, 16, 27, 44, 73, 120, 210, 310 (rad/s).측정된 복소 전단 점도를 η, 각주파수를 ω 로 하고, 각각의 자연 대수 LN(η) 를 세로축, LN(ω) 를 가로축에 취한 그래프에 있어서, 모든 점을 포함한 근사 2 차 함수를 하기의 순서에 따라 최소 이승법으로 구하고, 그 때의 결정 계수 R2 을 하기의 순서에 따라 구하여 그 값을 α 로 한다.<근사 2 차 함수를 구하는 방법 (최소 이승법)> (x, y) 평면에 있어서, (LN(ηi), LN(ωi)) 를 플롯하고, 이하의 식 E ＝ Σ{LN(ηi) － a2LN2(ωi) － a1LN(ωi) － a0}을 세웠을 때에, E 를 각각의 계수로 편미분한 식을 0 으로 한 이하의 3 원 연립 방정식δ(E)/δa2 ＝ 0 δ(E)/δa1 ＝ 0 δ(E)/δa0 ＝ 0 을 세우고, 이것이 성립되는 a2, a1, a0 을 구한다. 이래 첨자 i 는, 상기 15 점의 각주파수 중 i 번째 (i 는 1 ∼ 15 의 정수) 의 각주파수에 대응하는 것을 나타낸다. 구한 a2, a1, a0 을 계수로 하여, f(x) ＝ a2x2 ＋ a1x ＋ a0 을 근사 2 차 함수로 한다.<결정 계수 R2 을 구하는 방법>이하의 식에 의해 결정 계수 R2 을 구한다.R2 ＝ 1 － (Σ(yi － fi)2/Σ(yi － ya)2) 식 중, yi 는, LN(ηi) 를 나타내고, fi 는, 상기 근사 2 차 함수에 의한 추정치를 나타내고, ya 는, LN(ηi) 의 평균치를 나타낸다.

FILM AND METHOD FOR PRODUCING SAMEProvided are a film exhibiting excellent breakage resistance and uniform elongation, and a method for producing the same. A single-layer film comprising a blended resin of two types of resin which both belong to any one resin among ETFE, PFA, FEP, ECTFE, and PMP, the film being characterized in that the melt flow rate of the film is at least 6g/10 minutes and less than 20g/10 minutes, and the alpha of the film as measured using a prescribed measurement method is 0.99 or higher.A kind of film is the film of single layer, which is characterized in thatby the hybrid resin structure for belonging to 2 kinds of resins of wantonly a kind of resin of etfe, pfa, fep, ectfe and pmp below simultaneously at,the melt flow rate (mfr) for the film that measuring method below is measured was 6g/10 minutes or more lower than 20g/10 minutes, and with under the α of film that is measured of measuring method 0.99 or more；etfe: being 60/40~40/ containing tetrafluoroethylene units and ethylene unit, tetrafluoroethylene units/ethylene unit molar ratio it 60, is 0~6 mole of %'s relative to the ratio of the unit based on other monomers of the total of tetrafluoroethylene units and ethylene unit copolymer；pfa: contain tetrafluoroethylene units and perfluor (alkyl vinyl ether) unit, tetrafluoroethylene units/perfluor (alkyl vinyl ether) unit molar ratio be 99/1~85/15, relative to the total of tetrafluoroethylene units and perfluor (alkyl vinyl ether) unit the unit based on other monomers ratio be 0~5 mole of % copolymer；fep: being 75/ containing tetrafluoroethylene units and hexafluoropropene unit, tetrafluoroethylene units/hexafluoropropene unit molar ratio 25~95/5, the ratio relative to the unit based on other monomers of tetrafluoroethylene units and the total of hexafluoropropene unit is 0 the copolymer of~5 moles of %；ectfe: being 60/40 containing chlorotrifluoroethylene unit and ethylene unit, chlorotrifluoroethylene unit/ethylene unit molar ratio it~40/60, is 0~5 relative to the ratio of the unit based on other monomers of the total of chlorotrifluoroethylene unit and ethylene unit the copolymer of mole %；pmp: be based on selected from ethylene and carbon number 3 by 85~100 moles of %4- methyl-1-pentene units and 0~15 mole of %~ the polymer that the unit of at least one kind of monomer of 20 alpha-olefin is constituted；(measuring method of the melt flow rate (mfr) of film)in the case where 2 kinds of resins are etfe, measured at loading 49n, 297 deg c according to astm d3159, for pfa's in the case of, it is measured at loading 49n, 372 deg c according to astm d1238, for fep, according to astm d1238 in lotus weight 49n, it measures at 372 deg c, for ectfe, according to astm d1238 at loading 21.168n, 271.5 deg c of temperature measurement, in the case where pmp, measures at loading 49n, 260 deg c of temperature according to astm d1238；(measuring method of the α of film)for the film, according to iso 6721-10:1999, using melting determination of viscoelasticity machine, with the melt flow rate (mfr) under identical measuring temperature, the coaxial parallel cylinder of 20mm be set as the gap 1mm, in a manner of shape control, in the condition of deformation 1% the lower complex shear viscosity measured when applying the sine wave of 15 angular frequencies below respectively, unit pas；angular frequency: 0.31,0.52,0.84,1.4,2.3,3.7,6.1,10,16,27,44,73,120,210,310rad/s；by the complex shear viscosity of measurement is set as η, angular frequency is set as ω, by respective natural logrithm ln (η) as the longitudinal axis, by ln (ω) finds out the approximate quadratic function comprising all points with least square method as steps described below, presses as in the figure of horizontal axis coefficient of determination r at this time is found out according to following step2, using its value as α；<method for seeking approximate quadratic function: least square method>in (x, y) plane, to (ln (ηi), ln (ωi)) map, establish following formulae=σ { ln (ηi)-a2ln2(ωi)-a1ln(ωi)-a0}when, the formula after carrying out partial differential to e with respective coefficient is established as 0 ternary simultaneous equations belowδ(e)/δa2=0δ(e)/δa1=0δ(e)/δa0=0find out a for setting up it2、a1、a0；subscript type i indicates i-th of the angular frequency corresponded in 15 angular frequencies, the integer that middle i is 1~15；the a that will be found out2、a1、a0as coefficient, by f (x)=a2x2+a1x+a0as approximate quadratic function；< seek coefficient of determination r2method >coefficient of determination r is found out by following formula2；r2=1- (σ (yi-fi)2/σ(yi-ya)2)in formula, yiindicate ln (ηi), fiindicate the presumed value based on the approximate quadratic function, yaindicate ln (ηi) average value.

20499

그 외 기타 분류 안된 화학제품 제조업

특허

ko

en

ACSS2 저해제 및 이의 사용 방법 본 발명은 항암 요법, 알코올 중독 및 바이러스 감염 (예를 들어, CMV)의 치료제로서 활성을 갖는 신규한 ACSS2 저해제, 이의 조성물 및 이의 제조 방법, 및 바이러스 감염, 알코올 중독, 알코올성 지방간염 (ASH), 비알콜올성 지방간염 (NASH), 비만/체중 증가, 불안증, 우울증, 외상 후 스트레스 장애, 염증성/자가면역 병태, 및 다양한 유형의 전이암, 진행암 및 약물 내성 암을 포함하는 암의 치료를 위한 이의 용도에 관한 것이다. 화학식 (I)의 구조로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염, 광학 이성질체, 호변이성질체, 수화물, N-산화물, 전구약물, 동위원소 변이체, PROTAC, 약학적 생성물, 또는 이들의 임의의 조합:(I)식 중,A 및 B 고리는, 각각 독립적으로, 단일 또는 융합된 방향족 또는 헤테로방향족 고리 시스템, 또는 단일 또는 융합된 C3-C10 시클로알킬, 또는 단일 또는 융합된 C3-C10 헤테로시클릭 고리이고;R1및 R2는, 각각 독립적으로, H, F, Cl, Br, I, OH, SH, R8-OH, R8-SH, -R8-O-R10, CF3, CD3, OCD3, CN, NO2, -CH2CN, -R8CN, NH2, NHR, N(R)2, R8-N(R10)(R11), R9-R8-N(R10)(R11), B(OH)2, -OC(O)CF3, -OCH2Ph, NHC(O)-R10, NHCO-N(R10)(R11), COOH, -C(O)Ph, C(O)O-R10, R8-C(O)-R10, C(O)H, C(O)-R10, C1-C5 선형 또는 분지형 C(O)-할로알킬, -C(O)NH2, C(O)NHR, C(O)N(R10)(R11), SO2R, SO2N(R10)(R11), C1-C5 선형 또는 분지형, 치환 또는 미치환된 알킬, C1-C5 선형 또는 분지형 할로알킬, C1-C5 선형, 분지형 또는 시클릭 알콕시 (선택적으로 상기 알콕시에서 적어도 하나의 메틸렌기 (CH2)는 산소 원자로 대체됨), C1-C5 선형 또는 분지형 티오알콕시, C1-C5 선형 또는 분지형 할로알콕시, C1-C5 선형 또는 분지형 알콕시알킬, 치환 또는 미치환된 C3-C8 시클로알킬, 치환 또는 미치환된 C3-C8 헤테로시클릭 고리, 치환 또는 미치환된 아릴 (여기서 치환기에는 F, Cl, Br, I, C1-C5 선형 또는 분지형 알킬, OH, 알콕시, N(R)2, CF3, CN 또는 NO2가 포함됨), CH(CF3)(NH-R10)이거나,또는 R2 및 R1은 함께 연결되어 5 또는 6-원의 치환 또는 미치환된, 지방족 또는 방향족, 카르보시클릭 또는 헤테로시클릭 고리를 형성하고;R3및 R4는, 각각 독립적으로, H, F, Cl, Br, I, OH, SH, R8-OH, R8-SH, -R8-O-R10, CF3, CD3, OCD3, CN, NO2, -CH2CN, -R8CN, NH2, NHR, N(R)2, R8-N(R10)(R11), R9-R8-N(R10)(R11), B(OH)2, -OC(O)CF3, -OCH2Ph, -NHCO-R10, NHCO-N(R10)(R11), COOH, -C(O)Ph, C(O)O-R10, R8-C(O)-R10, C(O)H, C(O)-R10, C1-C5 선형 또는 분지형 C(O)-할로알킬, -C(O)NH2, C(O)NHR, C(O)N(R10)(R11), SO2R, SO2N(R10)(R11), C1-C5 선형 또는 분지형, 치환 또는 미치환된 알킬, C1-C5 선형 또는 분지형 할로알킬, C1-C5 선형, 분지형 또는 시클릭 알콕시, C1-C5 선형 또는 분지형 티오알콕시, C1-C5 선형 또는 분지형 할로알콕시, C1-C5 선형 또는 분지형 알콕시알킬, 치환 또는 미치환된 C3-C8 시클로알킬, 치환 또는 미치환된 C3-C8 헤테로시클릭 고리, 치환 또는 미치환된 아릴 (여기서 치환기에는 F, Cl, Br, I, C1-C5 선형 또는 분지형 알킬, OH, 알콕시, N(R)2, CF3, CN 또는 NO2가 포함됨), CH(CF3)(NH-R10)이거나,또는 R3 및 R4는 함께 연결되어 5 또는 6-원의 치환 또는 미치환된, 지방족 또는 방향족, 카르보시클릭 또는 헤테로시클릭 고리를 형성하고;R5는 H, C1-C5 선형 또는 분지형, 치환 또는 미치환된 알킬, C1-C5 선형 또는 분지형 할로알킬, R8-아릴, 치환 또는 미치환된 아릴, 치환 또는 미치환된 헤테로아릴 (여기서 치환기에는 F, Cl, Br, I, C1-C5 선형 또는 분지형 알킬, OH, 알콕시, N(R)2, CF3, CN 또는 NO2가 포함됨)이고;R6은 H, C1-C5 선형 또는 분지형 알킬이고;R8은 [CH2]p이며,여기서 p는 1 내지 10이고;R9는 [CH]q, [C]q이며,여기서 q는 2 내지 10이고;R10 및 R11은, 각각 독립적으로, H, C1-C5 선형 또는 분지형 알킬, C(O)R 또는 S(O)2R이고;R은 H, C1-C5 선형 또는 분지형 알킬, C1-C5 선형 또는 분지형 알콕시, 페닐, 아릴 또는 헤테로아릴이거나, 또는 2개의 같은자리 R 치환기는 함께 연결되어 5 또는 6-원 헤테로시클릭 고리를 형성하고;m, n, l 및 k는, 각각 독립적으로, 0 내지 4의 정수이고;Q1및 Q2는, 각각 독립적으로, S 또는 O임.

ACSS2 INHIBITORS AND METHODS OF USE THEREOFThe present invention relates to novel ACSS2 inhibitors having activity as anti-cancer therapy, treatment of alcoholism, and viral infection (e.g., CMV), composition and methods of preparation thereof, and uses thereof for treating viral infection, alcoholism, alcoholic steatohepatitis (ASH), non-alcoholic steatohepatitis (NASH), obesity/weight gain, anxiety, depression, post-traumatic stress disorder, inflammatory/autoimmune conditions and cancer, including metastatic cancer, advanced cancer, and drug resistant cancer of various types.A compound represented by the structure of formula (I):whereinA and B rings are each independently a single or fused aromatic or heteroaromatic ring system, or a single or fused C3-C10 cycloalkyl or a single or fused C3-C10 heterocyclic ring;Ri and R2 are each independently H, F, Cl, Br, I, OH, SH, Rg-OH, Rg-SH, -Rg-O-Rio, CF3, CD3 OCD3, CN, N02, -CH2CN, -RgCN, NH2, NHR, N(R)2, Rg-N(R10)(Rn), R9-Rg-N(R10)(Rn) B(OH)2, - 0C(0)CF3, -OCH2Ph, NHC(0)-Rio NHCO-N(R10)(Rn) COOH, -C(0)Ph, C(O)O-Ri0, Rg-C(O)-Ri0,C(0)H, C(0)-Rio, C1-C5 linear or branched C(0)-haloalkyl, -C(0)NH2, C(0)NHR, C(O)N(R10)(Rn), SO2R, S02N(Rio)(Rn), C1-C5 linear or branched, substituted or unsubstituted alkyl, C1-C5 linear or branched haloalkyl, C1-C5 linear, branched or cyclic alkoxy optionally wherein at least one methylene group (CH2) in the alkoxy is replaced with an oxygen atom, C1-C5 linear or branched thioalkoxy, C1-C5 linear or branched haloalkoxy, C1-C5 linear or branched alkoxyalkyl, substituted or unsubstituted C3-Cg cycloalkyl, substituted or unsubstituted C3-Cg heterocyclic ring, substituted or unsubstituted aryl (wherein substitutions include: F, Cl, Br, I, C1-C5 linear or branched alkyl, OH, alkoxy, N(R)2, CF3, CN or N02), CH(CF3)(NH-RIO) ;or R2 and Ri are joint together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;R3 and R4 are each independently H, F, Cl, Br, I, OH, SH, Rg-OH, Rg-SH, -Rg-O-Rio, CF3, CD3,OCD3, CN, N02, -CH2CN, -RgCN, NH2, NHR, N(R)2, Rg-N(R10)(Rn), R9-Rg-N(R10)(Rn), B(OH)2, - 0C(0)CF3, -OCH2Ph, -NHCO-R10, NHCO-N(R10)(Rn), COOH, -C(0)Ph, C(O)O-Ri0, Rg-C(O)-Ri0,C(0)H, C(0)-Rio, C1-C5 linear or branched C(0)-haloalkyl, -C(0)NH2, C(0)NHR, C(O)N(R10)(Rn), SO2R, S02N(Rio)(Rn), C1-C5 linear or branched, substituted or unsubstituted alkyl, C1-C5 linear or branched haloalkyl, C1-C5 linear, branched or cyclic alkoxy, C1-C5 linear or branched thioalkoxy, C1-C5 linear or branched haloalkoxy, C1-C5 linear or branched alkoxyalkyl, substituted or unsubstituted C3-Cg cycloalkyl, substituted or unsubstituted C3-Cg heterocyclic ring, substituted or unsubstituted aryl, (wherein substitutions include: F, Cl, Br, I, C1-C5 linear or branched alkyl, OH, alkoxy, N(R)2, CF3, CN or N02), CH(CF3)(NH-RIO) ;or R3 and R4 are joint together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; R5 is H, C1-C5 linear or branched, substituted or unsubstituted alkyl, C1-C5 linear or branched haloalkyl, Rs-aryl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl (wherein substitutions include: F, Cl, Br, I, C1-C5 linear or branched alkyl, OH, alkoxy, N(R)2, CF3, CN or NO2);Re is H, C1-C5 linear or branched alkyl;R8 is [CH2]Pwherein p is between 1 and 10;R9 is [CH]q , [C]qwherein q is between 2 and 10;Rio and R11 are each independedntly H, C1-C5 linear or branched alkyl, C(0)R, or S(0)2R;R is H, C1-C5 linear or branched alkyl, C1-C5 linear or branched alkoxy, phenyl, aryl or heteroaryl, or two gem R substiuents are joint together to form a 5 or 6 membered heterocyclic ring; m, n, 1 and k are each independedntly an integer between 0 and 4;Qi and Q2 are each independently S or O;or its pharmaceutically acceptable salt, optical isomer, tautomer, hydrate, /V-oxide, prodrug, isotopic variant, PROTAC, pharmaceutical product or any combination thereof.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

ＩＡＰ의 억제제본 발명은 악성종양을 치료하기 위한 치료제로 유용한 하기 화학식 I의 화합물인 IAP의 신규한 억제제를 제공한다. <화학식 I> (식 중, Q, X1, X2, Y, Z1, Z2, Z3, Z4, R1, R2, R3, R3', R4, R4', R5, R6 및 R6' 및 n은 본원에 기재된 바와 같음).하기 화학식 I의 화합물. <화학식 I> [이미지] 상기 식에서, X1 및 X2는 각각 독립적으로 O 또는 S이고; Y는 결합, (CR7R7)n, O 또는 S이고; Z1은 NR8, O, S, SO 또는 SO2이고; Z2, Z3 및 Z4는 독립적으로 CQ 또는 N이고; Q는 H, 할로겐, 히드록실, 카르복실, 아미노, 니트로, 시아노, 알킬, 카르보사이클, 헤테로사이클이고; 여기서 알킬의 하나 이상의 CH2 또는 CH 기는 -O-, -S-, -S(O)-, S(O)2, -N(R8)-, -C(O)-, -C(O)-NR8-, -NR8-C(O)-, -SO2-NR8-, -NR8-SO2-, -NR8-C(O)-NR8-, -NR8-C(NH)-NR8-, -NR8-C(NH)-, -C(O)-O- 또는 -O-C(O)-로 임의로 치환되고; 알킬, 카르보사이클 및 헤테로사이클은 하나 이상의 히드록실, 알콕시, 아실, 할로겐, 머캅토, 옥소, 카르복실, 아실, 할로-치환된 알킬, 아미노, 시아노, 니트로, 아미디노, 구아니디노, 임의로 치환된 카르보사이클 또는 임의로 치환된 헤테로사이클로 임의로 치환되고; R1은 H, OH 또는 알킬이거나; 또는 R1 및 R2는 함께 5-원 내지 8-원 헤테로사이클을 형성하고; R2는 알킬, 카르보사이클, 카르보시클릴알킬, 헤테로사이클 또는 헤테로시클릴알킬이고, 이들은 각각 할로겐, 히드록실, 옥소, 티온, 머캅토, 카르복실, 알킬, 할로알킬, 아실, 알콕시, 알킬티오, 술포닐, 아미노 및 니트로로 임의로 치환되고, 여기서 상기 알킬, 아실, 알콕시, 알킬티오 및 술포닐은 히드록시, 머캅토, 할로겐, 아미노, 알콕시, 히드록시알콕시 및 알콕시알콕시로 임의로 치환되고; R3은 H, 또는 할로겐 또는 히드록실로 임의로 치환된 알킬이거나; 또는 R3 및 R4는 함께 3-6 헤테로사이클을 형성하고; R3'는 H이거나, 또는 R3 및 R3'는 함께 3-6 카르보사이클을 형성하고; R4 및 R4'는 독립적으로 H, 히드록실, 아미노, 알킬, 카르보사이클, 카르보시클로알킬, 카르보시클로알킬옥시, 카르보시클로알킬옥시카르보닐, 헤테로사이클, 헤테로시클로알킬, 헤테로시클로알킬옥시 또는 헤테로시클로알킬옥시카르보닐이고; 여기서 알킬, 카르보시클로알킬, 카르보시클로알킬옥시, 카르보시클로알킬옥시카르보닐, 헤테로사이클, 헤테로시클로알킬, 헤테로시클로알킬옥시 및 헤테로시클로알킬옥시카르보닐은 각각 할로겐, 히드록실, 머캅토, 카르복실, 알킬, 알콕시, 아미노, 이미노 및 니트로로 임의로 치환되거나; 또는 R4 및 R4'는 함께 헤테로사이클을 형성하고; R5는 H 또는 알킬이고; R6 및 R6'는 각각 독립적으로 H, 알킬, 아릴 또는 아르알킬이고; R7은 H, 시아노, 히드록실, 머캅토, 할로겐, 니트로, 카르복실, 아미디노, 구아니디노, 알킬, 카르보사이클, 헤테로사이클 또는 -U-V이고; 여기서 U는 -O-, -S-, -S(O)-, S(O)2, -N(R8)-, -C(O)-, -C(O)-NR8-, -NR8-C(O)-, -SO2-NR8-, -NR8-SO2-, -NR8-C(O)-NR8-, -NR8-C(NH)-NR8-, -NR8-C(NH)-, -C(O)-O- 또는 -OC(O)-이고, V는 알킬, 카르보사이클 또는 헤테로사이클이고; 알킬의 하나 이상의 CH2 또는 CH 기는 -O-, -S-, -S(O)-, S(O)2, -N(R8)-, -C(O)-, -C(O)-NR8-, -NR8-C(O)-, -SO2-NR8-, -NR8-SO2-, -NR8-C(O)-NR8-, -C(O)-O- 또는 -O-C(O)-로 임의로 치환되고; 알킬, 카르보사이클 및 헤테로사이클은 히드록실, 알콕시, 아실, 할로겐, 머캅토, 옥소, 카르복실, 아실, 할로-치환된 알킬, 아미노, 시아노, 니트로, 아미디노, 구아니디노, 임의로 치환된 카르보사이클 또는 임의로 치환된 헤테로사이클로 임의로 치환되고; R8은 H, 알킬, 카르보사이클 또는 헤테로사이클이고, 여기서 상기 알킬의 하나 이상의 CH2 또는 CH 기는 -O-, -S-, -S(O)-, S(O)2, -N(R8) 또는 -C(O)-로 임의로 치환되고; 상기 알킬, 카르보사이클 및 헤테로사이클은 히드록실, 알콕시, 아실, 할로겐, 머캅토, 옥소 (=O), 카르복실, 아실, 할로-치환된 알킬, 아미노, 시아노, 니트로, 아미디노, 구아니디노, 임의로 치환된 카르보사이클 또는 임의로 치환된 헤테로사이클로 임의로 치환되고; n은 O 내지 4이다.

Inhibitors of IAPThe invention provides novel inhibitors of IAP that are useful as therapeutic agents for treating malignancies where the compounds have the general formula (I): wherein Q, X1, X2, Y, Z1, Z2, Z3, Z4, R1, R2, R3, R3', R4, R4', R5, R6, R6' and n are as described herein.The compound of formula (i)whereinx 1and x 2be o or s independently of one another; y is direct key, (cr 7r 7) n, o or s; z 1be nr 8, o, s, so or so 2z 2, z 3and z 4be cq or n independently; q is h, halogen, hydroxyl, carboxyl, amino, nitro, cyano group, alkyl, carbocyclic ring, heterocycle; one or more ch of alkyl wherein 2or the ch group is optional is replaced by following group :-o-,-s-,-s (o)-, s (o) 2,-n (r 8)-,-c (o)-,-c (o)-nr 8-,-nr 8-c (o)-,-so 2-nr 8-,-nr 8-so 2-,-nr 8-c (o)-nr 8-,-nr 8-c (nh)-nr 8-,-nr 8-c (nh)-,-c (o)-o-or-o-c (o)-; with alkyl, carbocyclic ring and heterocycle is to choose alkyl, amino, cyano group, nitro, amidino groups, guanidine radicals, optional carbocyclic ring that replaces that is substituted with one or more hydroxyls, alkoxyl group, acyl group, halogen, sulfydryl, oxo, carboxyl, acyl group, halogen replacement or the heterocycle of choosing replacement wantonly wantonly; r 1be h, oh or alkyl; or r 1and r 2form 5-8 unit heterocycle together; r 2be alkyl, carbocyclic ring, carbocyclic ring alkyl, heterocycle or heterocyclylalkyl, described alkyl, carbocyclic ring, carbocyclic ring alkyl, heterocycle or heterocyclylalkyl are optional separately to be replaced by following group: halogen, hydroxyl, oxo, thioketones, sulfydryl, carboxyl, alkyl, haloalkyl, acyl group, alkoxyl group, alkylthio, alkylsulfonyl, amino and nitro, wherein said alkyl, acyl group, alkoxyl group, alkylthio and alkylsulfonyl are chosen wantonly and are substituted with following substituting group: hydroxyl, sulfydryl, halogen, amino, alkoxyl group, hydroxy alkoxy base and alkoxyl group alkoxyl group; r 3be h or the optional alkyl that is substituted with halogen or hydroxyl; or r 3and r 4form 3-6 unit heterocycle together; r 3' be h or r 3and r 3' form 3-6 unit carbocyclic ring together; r 4and r 4' be h, hydroxyl, amino, alkyl, carbocyclic ring, carbocyclic ring alkyl, carbocyclic ring alkyl oxy, carbocyclic ring alkyl oxy carbonyl, heterocycle, heterocyclylalkyl, heterocycle alkoxyl group or heterocycle alkoxy carbonyl independently; optional separately halogen, hydroxyl, sulfydryl, carboxyl, alkyl, alkoxyl group, amino, imino-and the nitro of being substituted with of described alkyl, carbocyclic ring alkyl, carbocyclic ring alkyl oxy, carbocyclic ring alkyl oxy carbonyl, heterocycle, heterocyclylalkyl, heterocycle alkoxyl group and heterocycle alkoxy carbonyl; or r 4and r 4' form heterocycle together; r 5be h or alkyl; r 6and r 6' be h, alkyl, aryl or aralkyl independently of one another; r 7be h, cyano group, hydroxyl, sulfydryl, halogen, nitro, carboxyl, amidino groups, guanidine radicals, alkyl, carbocyclic ring, heterocycle or-u-v; wherein u be-o-,-s-,-s (o)-, s (o) 2,-n (r 8)-,-c (o)-,-c (o)-nr 8-,-nr 8-c (o)-,-so 2-nr 8-,-nr 8-so 2-,-nr 8-c (o)-nr 8-,-nr 8-c (nh)-nr 8-,-nr 8-c (nh)-,-c (o)-o-or-o-c (o)-and v be alkyl, carbocyclic ring or heterocycle; one or more ch of alkyl wherein 2or the ch group is optional is replaced by following group :-o-,-s-,-s (o)-, s (o) 2,-n (r 8)-,-c (o)-,-c (o)-nr 8-,-nr 8-c (o)-,-so 2-nr 8-,-nr 8-so 2-,-nr 8-c (o)-nr 8-,-c (o)-o-or-o-c (o)-; with optional alkyl, amino, cyano group, nitro, amidino groups, guanidine radicals, the optional carbocyclic ring that replaces or the optional heterocycle that replaces that is substituted with hydroxyl, alkoxyl group, acyl group, halogen, sulfydryl, oxo, carboxyl, acyl group, halogen replacement of alkyl, carbocyclic ring and heterocycle; r 8be h, alkyl, carbocyclic ring or heterocycle, one or more ch of wherein said alkyl 2or the ch group is optional is replaced by following group :-o-,-s-,-s (o)-, s (o) 2,-n (r 8) or-c (o)-; with described alkyl, carbocyclic ring and heterocycle optional be substituted with hydroxyl, alkoxyl group, acyl group, halogen, sulfydryl, oxo (=o), carboxyl, acyl group, the halogen alkyl, amino, cyano group nitro, amidino groups, guanidine radicals, the optional carbocyclic ring that replaces or the optional heterocycle that replaces that replace; with n is 0-4.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

항바이러스제로서의 4-히드록시신놀린-3-카르복시아미드본 발명의 화학식 II의 화합물 또는 그의 제약상 허용가능한 염 (식 중, A는 (a) Cl, (b) Br, (c) CN, (d) NO2 또는 (e) F임)은 헤르페스 바이러스의 치료 또는 예방에 유용하다.하기 화학식 II의 화합물 또는 그의 제약상 허용가능한 염. <화학식 II> [이미지] 상기 식에서, A는 (a) Cl, (b) Br, (c) CN, (d) NO2 또는 (e) F이고; R1은 (a) 아릴, (b) S(O)mR6, (c) (C=O)R6이되, 단 R6 가 NR7R8일 때, R7 및 R8은 둘다 동시에 H가 아님, (d) (C=O)OR9, (e) 시아노, (f) 탄소 원자를 통하여 결합된 het, (g) Ohet, (h) NR7R8이되, 단 R7 및 R8은 둘다 동시에 H가 아님, (i) SR10, (j) Shet, (k) NHCOR12, (l) NHSO2R12, (m) 부분적으로 불포화된 것일 수 있고, R11, OR13, SR10, SR13, NR7R8, 할로, (C=O)C1-7 알킬 또는 SOmR9 군의 1개 이상의 치환체에 의해 임의로 치환된 C1-7알킬, 또는 (n) R11, OR13, SR10, SR 13, NR7R8, 할로, (C=O)C1-7알킬 또는 SOmR9 군의 선택된 1개 이상의 치환체에 의해 치환된 C1-7알킬이고; R2는 (a) H, (b) 할로, (c) 아릴, (d) S(O)mR6, (e) (C=O)R6, (f) (C=O)OR9, (g) 시아노, (h) 탄소 원자를 통하여 결합된 het, (i) OR10, (j) Ohet, (k) NR7R8 , (l) SR10, (m) Shet, (n) NHCOR12, (o) NHSO2R12, 또는 (p) 부분적으로 불포화된 것일 수 있고, R11, OR13, SR10, SR13, NR7R8, 할로, (C=O)C1-7알킬 또는 SOmR9 군의 1개 이상의 치환체에 의해 임의로 치환된 C1-7알킬, 또는 (q) R1과 R2이 함께 OR 14에 의해 임의로 치환될 수 있는 C1-7알킬 또는 NR7R8에 의해 임의로 치환될 수 있는 카르보시클릭 또는 het을 형성할 수 있고; R6는 (a) C1-7알킬, (b) NR7R8, (c) 아릴, 또는 (d) 탄소 원자를 통하여 결합된 het이고; R7 및 R8은 독립적으로 (a) H, (b) 아릴, (c) 부분적으로 불포화된 것일 수 있고, NR10R10, R11, SOmR9, CONR10R 10 또는 할로로부터 선택된 1개 이상의 치환체에 의해 임의로 치환된 C1-7알킬이거나, 또는 (d) R7 및 R8이 이들이 결합한 질소와 함께 het을 형성하고; R9는 (a) 아릴, (b) het, (c) C3-8시클로알킬, (d) 메틸, 또는 (e) 부분적으로 불포화된 것일 수 있고, NR10R10, R11, SH, CONR10R10 또는 할로로부터 선택된 1개 이상의 치환체에 의해 임의로 치환된 C2-7알킬이고; R10은 (a) H, (b) 메틸, 또는 (c) OH에 의해 임의로 치환된 C2-7알킬이고; R11은 (a) OR10, (b) Ohet, (c) O아릴, (d) CO2R10, (e) het, (f) 아릴, (g) CN 또는 (h) 부분적으로 불포화된 것일 수 있고, R11, NR7R8 또는 SOm R9에 의해 임의로 치환된 C1-7알킬, R11, NR7R8, SOmR9로 이루어진 군에서 선택된 1개 이상의 치환체에 의해 임의로 치환될 수 있는 C3-8시클로알킬이고; R12는 (a) H, (b) het, (c) 아릴, (d) C3-8시클로알킬, (e) 메틸, 또는 (f) NR7R8 또는 R11에 의해 임의로 치환된 C2-7알킬이고; R13은 (a) (P=O)(OR14)2, (b) CO(CH2)nCON(CH3 )-(CH2)nSO3-M+, (c) 아미노산, (d) C(=O)아릴, 또는 (e) NR7R8, 아릴, het, C02H 또는 O(CH2)n CO2R14에 의해 임의로 치환된 C(=O)C1-7알킬이며; R14는 (a) H 또는 (b) C1-7알킬이고; n은 각각 독립적으로 1, 2, 3, 4 또는 5이고; m은 각각 독립적으로 0, 1 또는 2이고; M은 나트륨, 칼륨 또는 리튬이고; 아릴은 페닐 라디칼이거나, 또는 1개 이상의 고리가 방향족인 오르토-융합된 비시클릭 카르보시클릭 라디칼이며, 임의의 아릴은 1 내지 3개의 SR14, NR14R14 , OR14 또는 CO2R14기에 의해 추가로 치환될 수 있는 C1-6알킬, 할로, OH, 시아노, C02R14, CF3 및 C1-6알콕시로 이루어진 군에서 선택된 1개 이상의 치환체에 의해 임의로 치환되고; het은 산소, 황 및 질소로 이루어진 군에서 선택된 1, 2 또는 3개의 헤테로원자를 함유하는 4, 5, 6 또는 7-원 포화 또는 불포화 헤테로시클릭 고리로서, 벤젠 고리 또는 임의의 비시클릭 헤테로사이클기에 임의로 융합되며, 임의의 het은 1 내지 3개의 SR14, NR14R14, OR14 또는 CO2R14 기에 의해 추가로 치환될 수 있는 C1-6알킬, 할로, OH, 시아노, 페닐, C02R14, CF3, C1-6알콕시, 옥소 및 옥심으로 이루어진 군에서 선택된 1개 이상의 치환체에 의해 임의로 치환된다.

4-hydroxycinnoline-3-carboxyamides as antiviral agentsCompounds of formula (II) or a pharmaceutically acceptable salt thereof wherein, A is (a) Cl, (b) Br, (c) CN, (d) NO2, or (e) F; are useful for treatment or prevention of herpes viruses.Formula ii compound or pharmaceutically acceptable salt thereof: wherein,a is(a)cl，(b)br，(c)cn，(d) no 2or (e)f；r 1be (a) aryl,(b)s(o) mr 6， (c) (c=o) r 6, condition is, if r 6be nr 7r 8, r then 7and r 8be not h simultaneously, (d)(c＝o)or 9， (e) cyano group,(f) het, wherein said het connects by carbon atom,(g)ohet，(h) nr 7r 8, condition is r 7and r 8be not h simultaneously (i)sr 10， (j)shet，(k)nhcor 12， (1)nhso 2r 12(m) c 1-7alkyl, it is that part is undersaturated and optionally be selected from following substituting group and replace by one or more: r 11, or 13, sr 10, sr 13, nr 7r 8, halogen, (c=o) c 1-7alkyl or so mr 9, or (n) c 1-7alkyl, it is selected from following substituting group and replaces by one or more: r 11, or 13, sr 10, sr 13, nr 7r 8, halogen, (c=o) c 1-7alkyl or so mr 9r 2be (a)h，(b) halogen,(c) aryl,(d)s(o) mr 6， (e)(c＝o)r 6， (f)(c＝o)or 9， (g) cyano group,(h) het, wherein said het connects by carbon atom,(i)or 10， (j)ohet，(k)nr 7r 8， (1)sr 10， (m)shet，(n)nhcor 12， (o) nhso 2r 12or (p) c 1-7alkyl, it is that part is undersaturated and optionally be selected from following substituting group and replace by one or more: r 11, or 13, sr 10, sr 13, nr 7r 8, halogen, (c=o) c 1-7alkyl or so mr 9, perhaps (q) r 1and r 2lump together and form carbocyclic ring or het, it can be optionally by nr 7r 8or c 1-7alkyl replaces, described c 1-7alkyl can be optionally by or 14replace; r 6be (a) c 1-7alkyl, (b)nr 7r 8， (c) aryl, or(d) het, wherein said het connects by carbon atom; r 7and r 8be independently of one another (a)h，(b) aryl,(c) c 1-7alkyl, it can be that part is undersaturated and optionally be selected from following substituting group and replace by one or more: nr 10r 10, r 11, so mr 9, conr 10r 10or halogen, perhaps, (d) r 7and r 8the nitrogen that is connected with them lumps together and forms het; r 9be (a) aryl,(b)het，(c) c 3-8cycloalkyl, (d) methyl, or(e) c 2-7alkyl, it can be that part is undersaturated and optionally be selected from following substituting group and replace by one or more: nr 10r 10, r 11, sh, conr 10r 10or halogen; r 10be (a)h，(b) methyl, or(c) c that is optionally replaced by oh 2-7alkyl; r 11be (a)or 10， (b)ohet，(c) o aryl,(d)co 2r 10， (e)het，(f) aryl,(g) cn, or(h) c 3-8cycloalkyl, it can be that part is undersaturated and optionally be selected from following substituting group and replace by one or more: r 11, nr 7r 8, so mr 9or optionally by r 11, nr 7r 8or so mr 9the c that replaces 1-7alkyl; r 12be (a)h，(b)het，(c) aryl,(d) c 3-8cycloalkyl, (e) methyl, or(f) optionally by nr 7r 8or r 11the c that replaces 2-7alkyl; r 13be (a)(p＝o)(or 14) 2， (b)co(ch 2) ncon(ch 3)-(ch 2) nso 3-m +， (c) amino acid,(d) c (=o) aryl, or(e) c (=o) c 1-7alkyl, it is optionally by nr 7r 8, aryl, het, co 2h or o (ch 2) nco 2r 14replace; r 14be (a) h, or(b) c 1-7alkyl; each n is 1,2,3,4 or 5 independently of one another; each m is 0,1 or 2 independently of one another; m is sodium, potassium or lithium; aryl is two ring carbon ring groups of phenyl or ortho-condensed, and wherein having a ring at least is aromatic ring; any aryl wherein is all optionally by one or more halogen, oh, cyano group, co of being selected from 2r 14, cf 3, c 1-6alkoxyl group and c 1-6the substituting group of alkyl replaces, described c 1-6alkyl can also be further by 1 to 3 sr 14, nr 14r 14, or 14or co 2r 14group replaces; het contains 1,2 or 3 saturated or undersaturated heterocycle of heteroatomic four (4), five (5), six (6) or seven (7) units that is selected from oxygen, sulphur and nitrogen, and it optionally condenses with phenyl ring, or any bicyclic heterocyclic group; the equal selectivity of any het wherein is by one or more halogen, oh, cyano group, phenyl, co of being selected from 2r 14, cf 3, c 1-6alkoxyl group, oxo, oxime and c 1-6the substituting group of alkyl replaces, described c 1-6alkyl can also be further by 1 to 3 sr 14, nr 14r 14, or 14or co 2r 14group replaces.

27192

정형 외과용 및 신체 보정용 기기 제조업

특허

ko

en

2상 정밀 가이드와 낮은 높이의 턱뼈에 짧은 길이의 치과용 임플란트 기능을 하는 삼각대를 고정하는 방법2상 정밀 가이드와 낮은 높이의 턱뼈에 짧은 길이의 치과용 임플란트 기능을 하는 삼각대를 고정하는 방법은 간단한 두 단계로 낮은 높이의 턱뼈에 골융합 삼각대를 위치시키는데 사용하는 가이드이다. 2상 가이드(45)는 두 가지 요소인 고정가이드(1)와 드릴가이드(25)로 구성된다. 제1 사용단계에서 2상 가이드(45)는 삼각대 본체(2A)에 연결된 고정가이드(1)를 이용하여 내부에 5개의 천공을 가진 삼각대 본체(2A)를 턱뼈에 위치하도록 기능한다. 턱뼈에 삼각대 본체(2A)가 고정되면, 제2 사용단계에서 2상 가이드(45)는 드릴가이드(25)를 상기 두 요소인 고정가이드(1)와 삼각대 본체(2A)에 연결하여 안전하게 사용할 수 있도록 해준다. 드릴링이 실시되면 2상 가이드(45)의 두 부분을 제거하고 청구된 삼각대 본체(2A)를 이용하여 턱뼈에 3개의 동일한 다리를 고정한다. 뼈에 삼각대의 다리가 고정되면 삼각대 위에 치아 보철물을 놓을 수 있으므로, 필요한 경우 그러한 용도로 삼각대를 이용할 수 있다.낮은 높이의 턱뼈에 짧은 길이의 치과용 임플란트 기능을 갖춘 삼각대를 고정하기 위한 정밀 2상(二相) 가이드(45)는 고정가이드(1)와 드릴가이드(25)를 포함한다. 상기 고정가이드(1)는, 손잡이가 없는 컵 모양의 단단한 블록으로, 밑부분(11)은 다면체이고 배 부분(6)은 위쪽으로 열려 있는 다면체 홈을 포함하는 원통형이다. 고정가이드의 밑부분(11)은 5개의 구멍을 포함한다. 그 중 3개(13A, 13B, 13C)는 경사진 원통형이다. 3개의 구멍의 중심축은 위쪽으로 같은 지점에서 고정가이드(1)의 중심축과 교차한다. 3개의 구멍(13A, 13B, 13C)는 서로 닿지 않으며 밑부분(11)의 상부 베이스를 완전히 가로지른다. 3개 구멍(13A, 13B, 13C) 입구의 중심은 고정가이드(1)의 밑부분(11)의 상부 베이스에 위치하며, 정삼각형을 이룬다. 3개 구멍(13A, 13B, 13C) 출구의 중심은 고정가이드(1)의 밑부분(11)의 하부 베이스에 위치하며, 조금 더 큰 정삼각형을 이룬다. 3개의 구멍 중 2개 사이에는 고정가이드(1)의 중심축에 평행한 원통형의 네 번째 구멍(14)이 있다. 네 번째 구멍(14)은 중앙 축에 수직인 원형 테두리(15)에 의해 내부로 좁아져 직경이 작은 새로운 원통형 구멍이 된다. 고정가이드(1)의 밑부분(11)의 상부 베이스에 위치한 네 번째 구멍(14)의 입구는 고정가이드(1)의 밑부분(11)의 하부 베이스에 위치한 출구보다 조금 더 넓다. 이 4개의 구멍은 고정가이드(11)의 밑부분(11)의 상부 베이스의 중심으로부터 아래로 완전히 관통하지 않고 아래쪽으로 천공된 다섯 번째 다면체 구멍(16)을 건드리지 않은 채 둘러싸고 있다. 이 밑부분의 위와 주변에는 고정가이드(1)의 밑부분(11)의 위와 바깥 쪽을 둘러싸고 고정되어 있고, 고정가이드(1)의 밑부분(11)의 상부 베이스에 의해 아래로 경계가 정해진 다면체 홈을 포함하는 원통형 링인 고정가이드(1)의 배(6)가 위치한다. 배(6)의 외주면에 고정가이드(1)의 중심축과 평행한 3개의 레일(7A, 7B, 7C)이 있다. 이들은 전술한 3개의 경사진 구멍(13A, 13B, 13C)의 3개의 시상면에 각각 위치한다. 드릴가이드(25)는 고정가이드에 배치되며, 고정가이드(1)의 다면체 홈(8)과 정확히 일치하는 형태의 다면체 슬래브이다. 드릴가이드(25)는 바닥의 중심에서 아래로 돌출된 다면체 피벗(25)을 포함한다. 다면체 피벗(29)은 고정가이드(1)의 다섯 번째 다면체 구멍(16)과 만난다. 고정가이드의 상부 베이스 위쪽의 한쪽 귀퉁이에 또 하나의 돌출된 피벗 또는 핸들(26)이 있다. 드릴가이드(25)는 3개의 경사진 원통형 홀(27A, 27B, 27C)을 포함한다. 3개의 홀은 형태가 동일하며, 중심 축들은 위쪽으로 동일한 지점에서 드릴가이드(25)의 중심축과 교차한다. 3개의 홀은 서로 닿지 않으며 드릴가이드(25)를 완전히 통과한다. 드릴가이드(25)의 상부 베이스에 위치한 3개의 홀의 입구의 중심은 정삼각형을 이루고, 드릴가이드(25)의 하부 베이스에 위치한 3개의 홀의 출구의 중심은 조금 더 큰 정삼각형을 이룬다. 이들 홀(27A, 27B, 27C)의 폭은 고정가이드(1)의 경사진 구멍(13A, 13B y 13C)보다 좁다. 드릴가이드(25)의 경사진 3개의 홀의 출구는 위쪽으로 연결되어 고정가이드(1)의 경사진 3개의 천공의 입구이기도 하다. 드릴가이드(25)의 3개의 경사진 홀 중 2개 사이에는 네 번째 원통형 홀이 있다. 이 홀(28)은 드릴가이드(25)의 중심축과 평행하며 드릴가이드를 완전히 통과한다. 또한 홀의 중심 축에 수직인 환형 테두리(30)에 의해 내부가 좁아져 직경이 더 작은 새로운 원통형 홀이 생성된다. 따라서 드릴가이드(25)의 상부 베이스에 위치한 홀의 입구는, 드릴가이드(25)의 하부 베이스에 위치한 홀의 출구보다 더 넓다. 홀의 출구의 직경은 고정가이드(1)의 네 번째 구멍(14)의 입구의 그것과 동일하다.

TWO-STAGE PRECISION GUIDE AND METHOD FOR FIXING TO A LOW-HEIGHT MAXILLARY BONE A TRIPOD WITH SHORT DENTAL IMPLANT FUNCTIONThe invention relates to a two-stage precision guide (45) and a method for fixing to a low-height maxillary bone a tripod with short dental implant function, said guide allowing an osteointegrated tripod to be positioned on a low-height maxillary bone in two simple steps. The guide (45) is formed by two elements, which are a fixation guide (1) and a drilling guide (25). In the first stage of use, using the fixation guide (1) adhered to the body (2A) of the tripod, the two-stage guide (45) allows the body (2A) of the tripod, which is characterised in that it contains five perforations, to be positioned on the bone. In the second stage of use, and once the body (2A) of the tripod has been fixed to the bone, the two-stage guide (45) allows the bone to be worked on safely using the drilling guide (25), by coupling the drilling guide to the two elements described above, that is to say, the fixation guide (1) and the body (2A) of the tripod. Once the holes have been made, the two parts of the two-stage guide (45) are removed to be subsequently fixed to the bone by means of the body (2A) of the tripod claimed, which has three identical feet. With the feet in place in the bone, a dental prosthesis can immediately be situated on the tripod when required, the tripod thus acting as a short dental implantTwo stage precision guide (45) to fix a tripod with a short dental implant function in a low-lying maxillary bone, is composed of two components: the fixation guide (1) and the drill guide (25). The fixation guide (1) is a solid cup-shaped block without a shaft whose foot (11) is polyhedral and whose chalice (6) is cylindrical that contains a cavity (8) open upwards and polyhedral. The foot (11) of the fixation guide (1) has five holes. Three of these holes (13A, 13B and 13C) are inclined, cylindrical, identical between them and their central axes cross with the central axis of the fixation guide (1) at the same point above the object. These holes (13A, 13B and 13C) do not touch each other and cross the foot (11) completely. The centres of the entrances of these holes (13A, 13B and 13C), located in the upper base of the foot (11) of the fixation guide (1), draw an equilateral triangle. The centres of the outlets of these holes (13A, 13B and 13C), located at the bottom base of the foot (11) of the fixation guide (1) draw a larger sized equilateral triangle. Between two of these holes and without touching them, there is a fourth hole (14) cylindrical and parallel to the central axis of the fixation guide (1). This fourth hole (14) tapers inside by means of an annular edge (15) that is perpendicular to the central axis of this hole, converting it into a new cylindrical and smaller diameter hole. The entrance of the fourth hole (14), located in the upper base of the foot (11) of the fixation guide (1) is wider than its exit that's located in the lower base of the foot (11) of the fixation guide (1). These four holes surround without touching it a fifth polyhedral hole (16), drilled from the centre of the upper base of the foot (11) of the fixation guide (1) downwards without crossing it completely. Above and around this foot there is the chalice (6) of the fixation guide (1) which is a cylindrical ring that is fixed and surrounds above and outside the foot (11) of the fixation guide (1). It contains a polyhedral cavity (8) delimited from below by the upper base of the foot (11) of the fixation guide (1). Adhered to the outside wall of this chalice (6) there are three rails (7A, 7B and 7C), parallel to the central axis of the fixation guide (1). These are each located in one of the three sagittal planes of the three inclined holes (13A, 13B and 13C) mentioned above. The drill guide (25) is a polyhedral slab with the exact polyhedral shape of the polyhedral cavity (8) of the fixation guide (1) where it will be placed. This drill guide (25) has a polyhedral pivot (29) projecting from the center of its bottom base downwards. This pivot (29) will correspond to the fifth polyhedral hole (16) of the fixing guide (1). Above and in a corner of the upper base of the drill guide there is a protruding pivot or handle (26) with polymorphous shape. This drill guide (25) contains three inclined holes (27A, 27B and 27C), cylindrical and identical between them. Its central axes intersect with the central axis of the drill guide (25) at the same point above this object. These holes do not touch each other and go through the guide (25) completely. The centres of the inlets of these holes, located in the upper base of the drill guide (25), draw an equilateral triangle and, the centres of the outlets of these holes, located in the lower base of the drill guide (25), draw a larger equilateral triangle. The width of these holes (27A, 27B and 27C) is less than the width of the inclined holes (13A, 13B and 13C) of the fixation guide (1). The outlets of these three inclined holes of the drill guide (25) serve as a continuation upwards of the entrances of the three inclined holes of the fixation guide (1). Between two of these three drill guide's (25) inclined holes and without touching them, there is a fourth cylindrical hole (28), parallel to the central axis of the drill guide (25) that traverses it completely. This hole (28) tapers inside by means of an annular edge (30) that's perpendicular to its central axis. This edge (30) turns the hole (28) into a new smaller diameter cylindrical hole: the entrance of the hole (28), located in the upper base of the drill guide (25), is wider than the exit of this, located in the lower base of this guide (25). This outlet also has the same width as that of the entrance of the fourth hole (14) of the fixation guide (1).

22193

고무 의류 및 기타 위생용 비경화 고무제품 제조업

특허

ko

en

폴리글리세롤 에스테르를 포함하는 자가-가역성 인버스 라텍스, 증점제로서의 이의 용도, 및 이를 포함하는 화장품 조성물본 발명은 폴리글리세롤 에스테르 패밀리(이의 알킬 사슬은 8 내지 18개의 탄소 원자를 가지며, 폴리글리세롤은 1 내지 10개의 글리세롤 단위를 가짐)의 계면활성제 종을 반전제로서 포함하는 자가-가역성 인버스 라텍스; 화장품, 피부제약 또는 제약 국소용 조성물을 위한 증점제 및/또는 유화제 및/또는 안정제로서의 이의 용도, 및 이를 함유하는 화장품, 피부제약 또는 제약 국소용 조성물에 관한 것이다. 또한, 알킬 사슬이 8 내지 18개의 탄소 원자를 갖고 폴리글리세롤이 1 내지 10개의 글리세롤 단위를 갖는 폴리글리세롤 에스테르를 포함하는 계면활성제 조성물이 개시된다.가교결합된 음이온성 고분자전해질 (P)의 자가-가역성 인버스(self-invertible inverse) 라텍스로서, 100 몰%당,(a1) - 25 몰% 이상 및 80 몰% 이하의 비율의, 유리산 또는 부분 또는 완전 염화된 형태의 2-메틸-2-[(1-옥소-2-프로페닐)아미노]-1-프로판술폰산으로부터 유도된 단량체 단위;(a2) - 20 몰% 이상 및 75 몰% 이하의 비율의, 아크릴아미드, N,N-디메틸 아크릴아미드; 메타크릴아미드 또는 N-이소프로필아크릴아미드로 이루어진 군의 요소로부터 선택되는 적어도 하나의 단량체로부터 유도된 단량체 단위;(a3) - 선택적으로, 0 몰% 초과 및 10 몰% 이하의 비율의, 아크릴산, 메타크릴산, 2-카르복시에틸아크릴산, 이타콘산, 말레산, 3-메틸-3-[(1-옥소-2-프로페닐)아미노]부탄산으로 이루어진 군의 요소로부터 선택되는 적어도 하나의 단량체(상기 단량체의 카르복실 작용기는 유리산 또는 부분 또는 완전 염화된 형태임)로부터 유도된 단량체 단위;(a4) - 0 몰% 초과 및 1 몰% 이하의 비율의, 적어도 하나의 디에틸렌계 또는 폴리에틸렌계 가교결합 단량체 (AR)로부터 유도된 단량체 단위를 포함하며;a1), a2), a3) 및 a4)에 따른 단량체 단위들의 상기 몰 비율의 합은 100 몰%이고;상기 자가-가역성 인버스 라텍스는, 그 중량 100%당,a) - 10 중량% 내지 90 중량%의 상기 가교결합된 음이온성 고분자전해질 (P);b) - 5 중량% 내지 50 중량%의, 적어도 하나의 오일로 이루어진 지방 상 (O);c) - 1 중량% 내지 50 중량%의 물;d) - 0.5 중량% 내지 10 중량%의, 유중수형의 유화 시스템 (S1); 및e) - 2 중량% 내지 10 중량%의, 수중유형의 유화 시스템 (S2)을 포함하는 유중수형의 에멀젼 (E)이며;a), b), c), d) 및 e)에 따른 화합물들의 중량 비율의 합은 100 중량%이고;상기 자가-가역성 인버스 라텍스는, 상기 수중유형의 유화 시스템 (S2)이, 그 중량 100%당,f) - 50 중량% 이상 및 100% 이하의 비율의 조성물 (Ce)을 포함하는 것을 특징으로 하며, 상기 조성물 (Ce)은, 그 중량 100%당,e1) - 10 중량% 내지 60 중량%의, 화학식 (I)의 적어도 하나의 화합물:[화학식 I]HO-[CH2-CH(OH)-CH2-O]n-H(여기서, n은 1 이상 및 15 이하의 정수를 나타냄);e2) - 40 중량% 내지 90 중량%의, 화학식 (II)의 적어도 하나의 화합물:[화학식 II]R1-(C=O)-[O-CH2-CH(OH)-CH2]p-OH(여기서, p는, n과 상이하거나 동일하며, 1 이상 및 15 이하의 정수를 나타내고; 기 R1-(C=O)-는 6 내지 22개의 탄소 원자를 포함하는 포화 또는 불포화, 선형 또는 분지형 지방족 라디칼을 나타냄); 및 선택적으로e3) - 30 중량% 이하의, 화학식 (III)으로 표시되는 적어도 하나의 조성물 (C11):[화학식 III]HO-[CH2-CHOH-CH2-O-]q-(G)r-H(여기서, q는, n과 상이하거나 동일하며, 1 이상 및 3 이하의 정수를 나타내고, G는 환원당 잔기를 나타내고, r은 1.05 이상 및 5.00 이하의 소수를 나타냄)을 포함하고;상기 조성물 (C11)은, a1, a2, a3, a4 및 a5에 각각 해당하는 화학식 (III1), (III2), (III3), (III4) 및 (III5)의 화합물들의 혼합물로 이루어지되, 합 (a1 + a2 + a3 + a4 + a5)이 1이 되고 합 (a1 + 2a2 + 3a3 + 4a4 + 5a5)이 r이 되도록 하는 몰 비율의 상기 화학식 (III1), (III2), (III3), (III4) 및 (III5)의 화합물들의 혼합물로 이루어지고:[화학식 III1]HO-[CH2-CHOH-CH2-O-]q-O-(G)1-H[화학식 III2]HO-[CH2-CHOH-CH2-O-]q-O-(G)2-H[화학식 III3]HO-[CH2-CHOH-CH2-O-]q-O-(G)3-H[화학식 III4]HO-[CH2-CHOH-CH2-O-]q-O-(G)4-H[화학식 III5]HO-[CH2-CHOH-CH2-O-]q-O-(G)5-H;e1), e2) 및 e3)에 따른 화합물들의 중량 비율의 합은 100 중량%인, 자가-가역성 인버스 라텍스.

SELF-INVERTIBLE INVERSE LATEX COMPRISING POLYGLYCYEROL ESTERS, USE THEREOF AS A THICKENING AGENT, AND COSMETIC COMPOSITIONS COMPRISING SAMEThe invention relates to a self-invertible inverse latex comprising, as an inverting agent, surfactant species of the polyglycerol ester family, the alkyl chain of which has from 8 to 18 carbon atoms,with polyglycerols having 1 to 10 glycerol units, and the use thereof as a thickening and/or emulsifying and/or stabilizing agent for a cosmetic, dermopharmaceutical or pharmaceutical topical composition, and cosmetic, dermopharmaceutical or pharmaceutical topical compositions comprising same. Also disclosed are surfactant compositions comprising polyglycerol esters, the alkyl chain of which hasfrom 8 to 18 carbon atoms, and polyglycerols having 1 to 10 glycerol units.Self-reversible inverse latex of a crosslinked anionic polyelectrolyte (p) comprising, per 100 mol%:(a1) -a proportion derived from 2-methyl-2- [ (1-oxo-2-propenyl) amino in free acid or partially or fully salified form greater than or equal to 25 mol% and less than or equal to 80 mol%]-monomeric units of 1-propanesulfonic acid;(a2) -a proportion of greater than or equal to 20 mol% and less than or equal to 75 mol% of monomer units derived from at least one monomer chosen from the elements of the group consisting of: acrylamide, n-dimethylacrylamide, methacrylamide or n-isopropylacrylamide;(a3) -optionally a proportion of more than 0 mol% and less than or equal to 10% of monomer units derived from at least one monomer selected from the elements of the group consisting of: acrylic acid, methacrylic acid, 2-carboxyethylacrylic acid, itaconic acid, maleic acid, 3-methyl-3- [ (1-oxo-2-propenyl) amino group]butyric acid, the carboxylic acid function of which is in the free acid or in partially or fully salified form;(a4) -a proportion of monomeric units derived from at least one diene or polyene crosslinking monomer (ar) greater than 0 mol% and less than or equal to 1 mol%;according to a1)、a2)、a3) and a4) the sum of the molar proportions of the monomer units (a) is equal to 100 mol%;the self-invertible inverse latex is a water-in-oil emulsion (e) comprising, per 100% of its weight:a) -from 10% by weight to 90% by weight of said crosslinked anionic polyelectrolyte (p);b) -from 5% by weight to 50% by weight of a fatty phase constituted by at least one oil (h);c) -from 1% by weight to 50% by weight of water;d) -from 0.5% by weight to 10% by weight of an emulsifying system of the water-in-oil type (s)1) (ii) a ande) from 2% by weight to 10% by weight of an emulsifying system of the oil-in-water type (s)2)；the sum of the proportions by weight of the compounds according to a), b), c), d) and e) being equal to 100% by weight;said self-invertible inverse latex being characterized by said oil-in-water emulsifying system (s)2) comprises per 100% of its weight:f) -a proportion of greater than or equal to 50% by weight and less than or equal to 100% of a composition (ce) comprising, per 100% of its weight:e1) -from 10% by weight to 60% by weight of at least one compound having formula (i):ho-[ch2-ch(oh)-ch2-o]n-h (i)wherein n represents an integer greater than or equal to 1 and less than or equal to 15;e2) -from 40% by weight to 90% by weight of at least one compound having formula (ii):r1-(c＝o)-[o-ch2-ch(oh)-ch2]p-oh (ii)，wherein p, different from or the same as n, represents an integer of 1 or more and 15 or less; and wherein the radical r1- (c ═ o) -represents a saturated or unsaturated, linear or branched aliphatic group containing from 6 to 22 carbon atoms; and optionallye3) up to 30% by weight of at least one composition (c) represented by formula (iii)11)：ho-[ch2-choh-ch2-o-]q-(g)r-h (iii)，wherein q, which is different from or the same as n, represents an integer of 1 or more and 3 or less, g represents a reducing sugar residue and r represents a decimal of 1.05 or more and 5.00 or less;the composition (c)11) is prepared from a compound of the formula (iii)1)、(iii2)、(iii3)、(iii4) and (iii)5) the mixture of compounds of (a):ho-[ch2-choh-ch2-o-]q-o-(g)1-h (iii1)，ho-[ch2-choh-ch2-o-]q-o-(g)2-h (iii2)，ho-[ch2-choh-ch2-o-]q-o-(g)3-h (iii3)，ho-[ch2-choh-ch2-o-]q-o-(g)4-h (iii4)，ho-[ch2-choh-ch2-o-]q-o-(g)5-h (iii5)，said has the formula (iii)1)、(iii2)、(iii3)、(iii4) and (iii)5) are each in a molar ratio of1、a2、a3、a4and a5so that (a)1+a2+a3+a4+a5) the sum is equal to 1, and (a) is made1+2a2+3a3+4a4+5a5) the sum is equal to r;according to e1)、e2) and e3) the sum of the proportions by weight of the compounds of (a) is equal to 100% by weight.

30121

승용차 및 기타 여객용 자동차 제조업

특허

ko

en

열쇠없는 도난 방지 장치본 발명은 이송 기계 공학에 관한 것으로, 특히 차량의 변속기를 잠그는 도난 방지 장치에 관한 것이며, 트럭 및 승용차에 설치하도록 사용될 수 있다. 장치 사용의 기술적인 결과는, 구동기구 잠금 수단에 유연하게 연결을 이루는 비밀 부분에 의해서 코드 선택을 차단시킴으로써 비밀성을 증대시키고, 설계를 단순화하는 것이다. 상기 장치는 코드와 허위 키들의 세트로서 이루어진 비밀 부분을 포함하고, 공간 레버들에 의해서 상기 잠금 수단을 구동하기 위한 메카니즘의 싱커들에 연결된 봉들을 구비하며(코드 키들의 싱커-카운터 웨이트와, 허위 키들의 싱커-캔틀리지), 이는 기어박스 레버 스트로크 제한기를 갖는 로커로서 설계되어 있다. 모든 싱커들은 바스켓내에 자유롭게 배치되며, 이는 상기 언급된 로커에 견고하게 연결되어 있다. 상기 로커의 축에 대한 토크는, 싱커-카운터 웨이트와 로커의 밸러스트 부의 총 중량에 기인하여 그 잠금부의 총 중량의 반작용 토크를 초과하며, 그리고 상기 언급된 각각의 코드 키 부품들의 각각의 변위와, 그것에 연관된 싱커-캔틀리지의 변위는 값 B와 같고, 기어박스의 변속 기어 잠금 위치에서, 상기 로커의 밸러스트 부의 바스켓의 바닥에 후자의 정지를 제공할 수 있으며, 상기 변위 값 B는 허위 키의 모든 싱커-캔틀리지내에 존재하고, 상기 로커 축으로부터 보다 먼 거리까지 분리된 상태에서, 상기 로커의 잠금부내의 허위 키 바스켓 바닥으로부터, 그들 접촉시의 플럼브들 까지의 거리는, 값 B와 K2의 합과 같고, 여기서 값 K2는 기어박스 정지 레버 맞물림으로부터 상기 로커의 해제를 차단하는 수단의 변위 값 K1보다 작고, 상기 값 B는 값 K1 이상이다. 각각의 봉들은 회전 제한기, 축방향 상,하 변위의 회전-상부 위치 제한기들이 제공되어 있으며, 이것은 힌지 포스트(16)로서 제작되고, 그리고 상기 비밀 부분에는 각각의 이동 요소들의 총 중량을 균형잡기 위한 균형 수단이 구비되어 있고, 그리고 상기 기어박스의 상부에는, 상기 로커의 개방 위치에서의 베인 타입의 바인더가 배치되어 있으며, 상기 언급된 싱커-카운터 웨이트들과 싱커-캔틀리지들은 자기 저항 재료로 제작된다. 잠금 수단, 로커의 개방-유지 위치 스토퍼, 상기 비밀 부분의 이동 요소들의 총 중량 균형 수단들의 실시 예들이 제공된다.비밀 부분, 기어박스 레버 잠금 수단과, 구동기구 잠금 수단을 포함하고, 여기서 상기 비밀 부분은 기어박스내에서 밀봉으로 배치되고, 상기 구동기구 잠금 수단의 플럼브(plumbs)들과 레버들에 의해서 연결된 봉들을 구비하며, 축에 대하여 수직 회전이 가능하도록 장착된 로커의 형태를 갖는 코드 및 허위 키 세트로 설계되어 있고, 상기 로커의 잠금 단부는 기어박스 제한기가 제공되어 상호 작용하며, 상기 제한기는 기어박스의 기어 레버에 견고하게 부착되어 있고, 상기 장치는 상기 로커 단부의 하향 이동을 잠그기 위한 제한기가 장착되어 있으며, 상기 공간 레버들은 유연한 커넥터들에 의해서 싱커들과 연결되고, 여기서 모든 싱커들은 상부 개방형 바스켓내에서 자유롭게 배치되어 있고, 상기 바스켓들은 상기 언급된 로커와 견고하게 연결되어 있으며, 안테나가 장착되어 있어서 바스켓으로부터 싱커들의 빠짐이 차단되어 있고, 바스켓들은 상기 로커 장착대의 축의 양측방에서 길이 방향으로, 적어도 하나의 수평 열로 배열되어 있으며, 상기 바스켓들은 상기 로커의 잠금부에 견고하게 고정되어 있고, 싱커-캔틀리지들은 허위 키들과 연결되며, 상기 로커의 나머지 밸러스트 부분들에는 바스켓들이 견고하게 고정되고, 그 내부에 상기 키 코드들에 결합된 적어도 3개의 싱커-캔틀리지들이 배치될 수 있으며, 상기 로커의 잠금 및 밸러스트 부분들의 전체 중량의 비율은 아래에 기재된 것들에 의해서 수행되며: 싱커-캔틀리지들의 세트를 로딩할 때, 상기 밸러스트 부분을 향한 로커의 회전 가능성; 부하가 가해질 때, 밸러스트 부로부터 동시적인 바스켓들의 최대 부하를 갖거나, 또는 로커의 밸러스트 및 잠금부들 모두의 무부하를 갖는 적어도 하나의 싱커-캔틀리지에 의한, 그 잠금부쪽으로 향한 로커의 회전 가능성들이며, 상기 언급된 각각의 코드 키 부품(stocks)들의 변위와, 그것과 연관된 싱커-캔틀리지들의 변위는 값 B와 같으며, 기어박스의 변속 기어 잠금 위치에서, 상기 로커의 밸러스트 부의 바스켓의 바닥에 후자의 정지를 제공할 수 있고, 상기 변위 값 B는 모든 허위 키의 싱커-캔틀리지내에 존재하고, 상기 로커 축으로부터 보다 먼 거리까지 분리된 상태에서, 상기 로커의 잠금부내의 허위 키 바스켓 바닥으로부터, 그들 접촉시의 플럼브들 까지의 거리는, 값 B와 K2의 합과 같고, 여기서 값 K2는 기어박스 정지 레버 맞물림으로부터 상기 로커의 해제를 차단하는 수단의 변위 값 K1보다 작고, 상기 값 B는 값 K1 이상이며, 각각의 봉들은 회전 정지기 및 축방향 상,하 변위의 회전-상부 위치 정지기들이 제공되어 있으며, 이것은 힌지 포스트(16)로서 제작되고, 그리고 상기 비밀 부분에는 각각의 이동 요소들의 총 중량을 균형잡기 위한 균형 수단이 구비되어 있고, 그리고 상기 기어박스의 상부에는, 상기 로커(9)의 개방 위치에서의 베인 타입의 바인더가 배치되어 있으며, 상기 언급된 싱커-카운터 웨이트(8)들과 싱커-캔틀리지들은 자기 저항 재료로 제작되고, 레버와 봉들은 상기 베이스 플레이트를 관통하도록 구성된 것임을 특징으로 하는 열쇠없는 도난 방지 장치.

KEYLESS ANTI-THEFT DEVICEThe technical solution relates to anti-theft devices for locking the transmission of goods and passenger vehicles. The device comprises a security part in the form of a set of code and false keys with rods which are connected by means of three-dimensional levers to weights of a drive mechanism of a locking means, which is in the form of a rocker arm with a limiter for limiting the travel of a gearbox lever. The weights are arranged in baskets which are rigidly connected to the rocker arm. The torque relative to the axis of the rocker arm from the action of the total weight of counterweights and a ballast part of said rocker arm exceeds the counteracting torque from the action of the weight of the locking part thereof. In the locking position of the gearbox lever, the rods of the code keys rest in the base of the basket of the ballast part of the rocker arm. All of the tightening weights of the false keys also have a movement value. The distance from the base of the baskets of the false keys in the locking part of the rocker arm is greater than the distance from the axis of the rocker arm to the weights on contact between the two. Each of the rods is equipped with a rotation limiter, axial movement limiters and an upper position stop. The security part is equipped with means for balancing the total weight of the moveable elements of said security part. The counterweights and the tightening weights are formed from magnetically resistant materials. An increase in the security and a simplification of the design are achieved.Keyless anti-theft device comprising a security part, locking means of gearbox lever and drive mechanism of a locking means, wherein the security part is formed as a set of code and false keys with rods mounted by means of sealing into a gearbox and connected by means of three-dimensional levers to weights of a drive mechanism of a locking means, having the form of a rocker arm; said rocker arm is set to allow its vertical rotation with respect to axis, wherein locking end of the rocker arm having a limiter for limiting the travel of a gearbox lever, adapted for interaction with stopper, which is rigidly connected to the gearbox lever, wherein the device is equipped with a downstroke movement limiter for limiting the rocker arm locking end descending travel, wherein three-dimensional levers are connected to the weights by means of flexible connections, wherein all the weights are freely placed in open at the top baskets rigidly connected with said rocker arm and equipped with antennae preventing fallout of weights out of the baskets, the baskets are arranged longitudinally on either side of the rocker arm mounting axis, thus forming at least one horizontal row, wherein the baskets rigidly connected with the locking part of the rocking arm, tightening weights of which connected with false keys, and to the other ballast side of the rocker arm rigidly connected baskets with the possibility of placing in them at least three counterweights, connected to the code keys, wherein the ratio of total weights relating to the locking and the ballast parts of the rocker arm is performed in order to allow rotation of the rocker arm towards the ballast part when loaded with a set of counterweights; and allowing rotation of the rocker arm toward the locking part when loaded with at least one tightening weight with simultaneous full load of baskets of the ballast part or when the rocker arm locking and ballast parts are not loaded at all; wherein the travel of each of said code key rods and the travel of associated counterweights is equal to the value B, thus allowing the latter stopping at the bottom of the baskets of the rocker arm ballast part in the locked position of the gearbox lever, wherein the value B is inherent to all the false key tightening weights, whereby the distance between the bottom of the false key baskets, more remote from the arm rocker axis, within the rocker arm locking part and the weights being in contact is equal to B+κ2, the value κ2 being less than that of travel κ1 of the rocker arm locking means till the gearbox lever coming out of the stop piece interaction, and the value B is not less than κ1, wherein each of the rods is equipped with a rotation limiter, axial movement limiters up and down and an upper position stop formed as a hinge rack, wherein the security part is equipped a means for balancing the total weight of all the movable elements of said security part, wherein at the top portion of gearbox located vane-type lock of the rocker arm in the open position, wherein said tightening weights and counterweights are made of magnetically resistant materials, the lever and rods being passed through a support plate.

26212

유기 발광 표시장치 제조업

특허

ko

en

유기 전계발광 소자용 물질본 발명은 플루오렌 유도체, 및 이러한 화합물이 방사층에서 매트릭스 물질로서 및/또는 정공 수송 물질로서 및/또는 전자 차단제 또는 여기 차단제 물질로서 및/또는 전자 수송 물질로서 사용되는 유기 전자 소자에 관한 것이다.하나 이상의 하기 화학식 (I) 의 구조를 포함하는 화합물:[이미지][식 중, 사용된 기호는 하기와 같음:A1, A2, A3, A4 는 각 경우에 동일 또는 상이하고, N 또는 CR1, 바람직하게는 CR1 이고, 단 1 개의 사이클에서 A1, A2, A3, A4 기 중 둘 이하는 N 이고;V1, V2, V3 은 각 경우에 동일 또는 상이하고, N 또는 CR2, 바람직하게는 CR2 이고, 단 1 개의 사이클에서 V1, V2, V3 기 중 둘 이하는 N 이고;W1, W2, W3 은 각 경우에 동일 또는 상이하고, N 또는 CR3, 바람직하게는 CR3 이고, 단 1 개의 사이클에서 W1, W2, W3 기 중 둘 이하는 N 이고;X1, X2, X3 는 각 경우에 동일 또는 상이하고, N 또는 CR4, 바람직하게는 CR4 이고, 단 1 개의 사이클에서 X1, X2, X3 기 중 둘 이하는 N 이고;R1, R2, R3, R4 는 각 경우에 동일 또는 상이하고, H, D, F, Cl, Br, I, B(OR5)2,CHO, C(=O)R5, CR5=C(R5)2, CN, C(=O)OR5, C(=O)N(R5)2,Si(R5)3, N(R5)2, NO2, P(=O)(R5)2, OSO2R5, OR5, S(=O)R5, S(=O)2R5, 탄소수 1 내지 40 의 직쇄형 알킬, 알콕시 또는 티오알콕시 기, 또는 탄소수 3 내지 40 의 분지형 또는 시클릭 알킬, 알콕시 또는 티오알콕시 기 (이들 각각은 하나 이상의 R5 라디칼에 의해 치환될 수 있고, 여기서 하나 이상의 비인접 CH2 기는 -R5C=CR5-, -C≡C-, Si(R5)2, Ge(R5)2, Sn(R5)2, C=O, C=S, C=Se, C=NR5, -C(=O)O-, -C(=O)NR5-, NR5, P(=O)(R5), -O-, -S-, SO 또는 SO2 로 대체될 수 있고, 하나 이상의 수소 원자는 D, F, Cl, Br, I, CN 또는 NO2 로 대체될 수 있음), 또는 5 내지 40 개의 방향족 고리 원자를 갖고 각 경우에 하나 이상의 R5 라디칼에 의해 치환될 수 있는 방향족 또는 헤테로방향족 고리계, 또는 5 내지 40 개의 방향족 고리 원자를 갖고 하나 이상의 R5 라디칼에 의해 치환될 수 있는 아릴옥시 또는 헤테로아릴옥시 기, 또는 이러한 계의 조합이고; 동시에 둘 이상의 인접한 R1 치환기는 함께 모노- 또는 폴리시클릭, 지방족 또는 방향족 고리계를 또한 형성할 수 있고; 동시에 둘 이상의 인접한 R2 치환기는 함께 모노- 또는 폴리시클릭, 지방족 또는 방향족 고리계를 또한 형성할 수 있고; 동시에 둘 이상의 인접한 R3 치환기는 함께 모노- 또는 폴리시클릭, 지방족 또는 방향족 고리계를 또한 형성할 수 있고; 동시에 둘 이상의 인접한 R4 치환기는 함께 모노- 또는 폴리시클릭, 지방족 또는 방향족 고리계를 또한 형성할 수 있고;R5 는 각 경우에 동일 또는 상이하고, H, D, F, Cl, Br, I, B(OR6)2,CHO, C(=O)R6, CR6=C(R6)2, CN, C(=O)OR6, C(=O)N(R6)2,Si(R6)3, N(R6)2, NO2, P(=O)(R6)2, OSO2R6, OR6, S(=O)R6, S(=O)2R6, 탄소수 1 내지 40 의 직쇄형 알킬, 알콕시 또는 티오알콕시 기, 또는 탄소수 3 내지 40 의 분지형 또는 시클릭 알킬, 알콕시 또는 티오알콕시 기 (이들 각각은 하나 이상의 R6 라디칼에 의해 치환될 수 있고, 여기서 하나 이상의 비인접 CH2 기는 -R6C=CR6-, -C≡C-, Si(R6)2, Ge(R6)2, Sn(R6)2, C=O, C=S, C=Se, C=NR6, -C(=O)O-, -C(=O)NR6-, NR6, P(=O)(R6), -O-, -S-, SO 또는 SO2 로 대체될 수 있고, 하나 이상의 수소 원자는 D, F, Cl, Br, I, CN 또는 NO2 로 대체될 수 있음), 또는 5 내지 40 개의 방향족 고리 원자를 갖고 각 경우에 하나 이상의 R6 라디칼에 의해 치환될 수 있는 방향족 또는 헤테로방향족 고리계, 또는 5 내지 40 개의 방향족 고리 원자를 갖고 하나 이상의 R6 라디칼에 의해 치환될 수 있는 아릴옥시 또는 헤테로아릴옥시 기, 또는 이러한 계의 조합이고; 동시에, 둘 이상의 인접한 R5 치환기는 함께 모노- 또는 폴리시클릭, 지방족 또는 방향족 고리계를 또한 형성할 수 있고;R6 은 각 경우에 동일 또는 상이하고, H, D, F 또는 탄소수 1 내지 20 의 지방족, 방향족 및/또는 헤테로방향족 히드로카르빌 라디칼 (여기서 수소 원자는 또한 F 로 대체될 수 있음) 이고; 동시에, 둘 이상의 인접한 R6 치환기는 함께 모노- 또는 폴리시클릭, 지방족 또는 방향족 고리계를 또한 형성할 수 있고;단,W1 및 V1 라디칼은 서로 가교되지 않고;V1, V2, V3 기의 R2 라디칼 및 X1, X2, X3 기의 R4 라디칼은 총 12 개 이상의 방향족 탄소 고리 원자를 포함하고;R1, R2, R3 및 R4 라디칼은 트리아진 구조를 포함하지 않고,V1, V2, V3 및 W1, W2, W3 기는 방향족 또는 헤테로방향족 고리계를 포함하는 CR2 및/또는 CR3 기를 총 2 개 이하 포함함].

MATERIALS FOR ORGANIC ELECTROLUMINESCENT DEVICESThe present invention relates to the fluorene derivatives and to organic electronic devices in which these Compounds are used as matrix material in the emitting layer and/or as hole transport materialand/or as electron blocker or exciton blocker material and/or as electron transport material.A kind of compound, it includes the structure of at least one formula (i)the symbol wherein used is as follows：a1、a2、a3、a4it is identical or different in each case and is n or cr1, preferably cr1, condition is in a ring the a1、a2、a3、a4it is n to be no more than two in group；v1、v2、v3it is identical or different in each case and is n or cr2, preferably cr2, condition is the institute in a ring state v1、v2、v3it is n to be no more than two in group；w1、w2、w3it is identical or different in each case and is n or cr3, preferably cr3, condition is the institute in a ring state w1、w2、w3it is n to be no more than two in group；x1、x2、x3it is identical or different in each case and is n or cr4, preferably cr4, condition is the institute in a ring state x1、x2、x3it is n to be no more than two in group；r1、r2、r3、r4it is identical or different in each case and is h, d, f, cl, br, i, b (or5)2, cho, c (=o) r5, cr5=c (r5)2, cn, c (=o) or5, c (=o) n (r5)2, si (r5)3, n (r5)2, no2, p (=o) (r5)2, oso2r5, or5, s (=o) r5, s (=o)2r5, there is the alkyl, alkoxy or thio alkoxy group or tool of the straight chain of 1 to 40 carbon atom there are the side chain of 3 to 40 carbon atoms or alkyl, alkoxy or the thio alkoxy group of ring-type, each in the group can quilt one or more r5group substitutes, wherein one or more non-adjacent ch2group can be by-r5c=cr5-、-c≡c-、si (r5)2、ge(r5)2、sn(r5)2, c=o, c=s, c=se, c=nr5,-c (=o) o- ,-c (=o) nr5-、nr5, p (=o) (r5) ,-o- ,-s-, so or so2instead of and wherein one or more hydrogen atoms can be by d, f, cl, br, i, cn or no2instead of, or and in each case can be by one or more r with 5 to 40 aromatic ring atoms5the aromatics or heteroaromatic rings of group substitution system, or with 5 to 40 aromatic ring atoms and can be by one or more r5the aryloxy group or heteroaryloxy group of group substitution, or the combination of these systems；meanwhile two or more adjacent r1substituent can also form monocyclic or polycyclic aliphatic series together or aromatics ring system；meanwhile two or more adjacent r2substituent can also form monocyclic or polycyclic aliphatic series or aromatics together ring system；meanwhile two or more adjacent r3substituent can also form monocyclic or polycyclic aliphatic series or aromatics ring system together；together when, two or more adjacent r4substituent can also form monocyclic or polycyclic aliphatic series or aromatics ring system together；r5it is identical or different in each case and is h, d, f, cl, br, i, b (or6)2, cho, c (=o) r6, cr6=c (r6)2, cn, c (=o) or6, c (=o) n (r6)2, si (r6)3, n (r6)2, no2, p (=o) (r6)2, oso2r6, or6, s (=o) r6, s (=o)2r6, alkyl, alkoxy or the thio alkoxy group of the straight chain with 1 to 40 carbon atom or with 3 to 40 the side chain of the individual carbon atom or alkyl of ring-type, alkoxy or thio alkoxy group, in the group it is each can by one or multiple r6group substitutes, wherein one or more non-adjacent ch2group can be by-r6c=cr6-、-c≡c-、si(r6)2、ge (r6)2、sn(r6)2, c=o, c=s, c=se, c=nr6,-c (=o) o- ,-c (=o) nr6-、nr6, p (=o) (r6)、-o-、- s-, so or so2instead of and wherein one or more hydrogen atoms can be by d, f, cl, br, i, cn or no2instead of, or with 5 to 40 individual aromatic ring atom and in each case can be by one or more r6the aromatics of group substitution or heteroaromatic ring system, or have 5 to 40 aromatic ring atoms and can be by one or more r6the aryloxy group or heteroaryloxy group of group substitution, or these bodies the combination of system；meanwhile two or more adjacent r5substituent can also form monocyclic or polycyclic aliphatic series or aromatic ring together system；r6be identical or different in each case and be h, d, f or aliphatic series with 1 to 20 carbon atom, aromatics and/or heteroaromatic hydrocarbyl group, wherein hydrogen atom can also be replaced by f；meanwhile two or more adjacent r6substituent can also be together form monocyclic or polycyclic aliphatic series or aromatics ring system；condition isthe w1and v1group is without bridging each other；the v1、v2、v3r in group2group and the x1、x2、x3r in group4group includes at least 12 aromatic carbons altogether annular atom；the r1、r2、r3and r4group does not include triazine structure, andthe v1、v2、v3and w1、w2、w3group includes is no more than two cr comprising aromatics or heteroaromatic ring system altogether2and/or cr3group.

20499

그 외 기타 분류 안된 화학제품 제조업

특허

ko

en

프탈로시아닌 화합물, 잉크, 잉크젯 기록용 잉크, 잉크젯기록 방법 및 칼라 화상 재료의 오존 가스 내성 개선 방법본 발명에 따르면, 특정 구조를 갖는 신규한 프탈로시아닌 화합물이 제공되며, 이를 각각 이용한 잉크, 잉크젯 기록용 잉크, 잉크젯 기록방법 및 형성된 화상의 보존성을 향상시키는 방법도 제공된다. 본 발명의 신규한 프탈로시아닌 화합물은 환경에서 빛, 열, 습도 및 활성 가스에 대해 충분히 높은 견뢰도를 가지며, 프탈로시아닌 화합물을 함유하는 잉크, 특히 잉크젯 기록용 잉크를 사용하여, 빛 및 오존에 대해 높은 견뢰도를 갖는 화상 환경에서 가스가 형성될 수 있습니다.하기 화학식 I 또는 II로 표시되는 하나 이상의 화합물을 포함하는 잉크: [화상] 상기 식에서, X1, X2, X3 및 X4는 각각 독립적으로 αSO-Z 또는 αSO2-Z를 나타내고, 여기서 각각의 Z는 독립적으로 a를 나타낸다. 치환 또는 비치환된 알킬기, 치환 또는 비치환된 시클로알킬기, 치환 또는 비치환된 알케닐기, 치환 또는 비치환된 아랄킬기, 치환 또는 비치환된 아릴기 또는 치환 또는 비치환된 헤테로고리기; Y1, Y2, Y3 및 Y4는 각각 독립적으로 수소 원자, 할로겐 원자, 알킬기, 시클로알킬기, 알케닐기, 아랄킬기, 아릴기, 헤테로환기, 시아노기, 수산기를 나타내고, 니트로기, 아미노기, 알킬아미노기, 알콕시기, 아릴옥시기, 아미도기, 아릴아미노기, 우레이도기, 술파모일아미노기, 알킬티오기, 아릴티오기, 알콕시카르보닐아미노기, 술폰아미도 기, 카르바모일기, 알콕시카르보닐기, 헤테로고리 옥시기, 아조기, 아실옥시기, 카르바모일옥시기, 실릴옥시기, 아릴옥시카르보닐기, 아릴옥시카르보닐아미노기, 이미도기, 헤테로고리 티오기, 포스포릴 기, 아실기 또는 이온성 친수성기이며, 이들 기는 각각 치환기를 더 가질 수 있고; a1 내지 a4 및 b1 내지 b4는 각각 다수의 치환기 X1 내지 X4 및 Y1 내지 Y4를 나타내고, a1 내지 a4는 각각 독립적으로 0 내지 4의 정수를 나타내며, 단, 동시에 모두 0이 아니며, b1 내지 b4 각각 독립적으로 0 내지 4의 정수를 나타내고; M은 수소 원자, 금속 원소 또는 이들의 산화물, 수산화물 또는 할로겐화물을 나타내고; 단, X1, X2, X3, X4, Y1, Y2, Y3 및 Y4 중 적어도 하나는 이온성 친수성 기 또는 이온성 친수성 기를 치환기로 갖는 기이고; [화상] X11, X12, X13 및 X14는 각각 독립적으로 δSO2NR1R2 및/또는 설포기를 나타내며, 단 X11, X12, X13 및 X14는 모두 동시에 설포기가 아니며, 여기서 R1은 복수인 경우 의 R1이 존재하고, 각각 독립적으로 수소 원자, 치환 또는 비치환된 알킬기, 치환 또는 비치환된 시클로알킬기, 치환 또는 비치환된 알케닐기, 치환 또는 비치환된 아랄킬기, 치환 또는 비치환된 아릴기 또는 치환된 또는 비치환 헤테로고리기, R2는, R2가 복수 존재하는 경우, 각각 독립적으로, 치환 또는 비치환의 알킬기, 치환 또는 비치환의 시클로알킬기, 치환 또는 비치환의 알케닐기, 치환 또는 비치환의 아랄킬기, 치환 또는 비치환의 아릴기 또는 치환 또는 비치환된 헤테로고리기이고, R1 및 R2는 서로 결합하여 5원 또는 6원을 형성할 수 있고, 질소 함유 복소환; 여기서, 이온성 친수성 기를 갖는 하나 이상의 αSO2NR1R2기는 화학식 II의 2-, 3-, 6-, 7-, 10-, 11-, 14- 또는 15-위치에 존재하고; 여기서 설포기가 벤젠 핵에 직접 결합되는 경우, 설포기는 화학식 II의 2-, 3-, 6-, 7-, 10-, 11-, 14- 또는 15-위치에 결합되고; Y11, Y12, Y13, Y14, Y15, Y16, Y17 및 Y18은 각각 독립적으로 수소 원자, 할로겐 원자, 알킬기, 시클로알킬기, 알케닐기, 아랄킬기, 아릴기, 복소환기를 나타내고, 시아노기, 수산기, 니트로기, 아미노기, 알킬아미노기, 알콕시기, 아릴옥시기, 아미도기, 아릴아미노기, 우레이도기, 술파모일아미노기, 알킬티오기, 아릴티오 기, 알콕시카르보닐아미노기, 술폰아미도기, 카르바모일기, 알콕시카르보닐기, 헤테로고리 옥시기, 아조기, 아실옥시기, 카르바모일옥시기, 실릴옥시기, 아릴옥시카르보닐기, 아릴옥시카르보닐아미노기, 이미도기 , 헤테로사이클릭 티오 그룹, 포스포릴 그룹, 아실 그룹 또는 이온성 친수성 그룹이고, 이들 그룹은 각각 치환기를 더 가질 수 있고; a11 내지 a14는 각각 다수의 치환기 X11 내지 X14를 나타내고, 각각 독립적으로 0 내지 2의 정수를 나타내며, 단, 동시에 0은 아니며; M은 수소 원자, 금속 원소 또는 이들의 산화물, 수산화물 또는 할로겐화물을 나타내고; 단, X11, X12, X13, X14, Y11, Y12, Y13, Y14, Y15, Y16, Y17 및 Y18 중 적어도 하나는 이온성 친수성기 또는 이온성 친수성기를 치환기로 갖는 기인, 잉크.

Phthalocyanine compound, ink, inkjet recording ink, ink-jet recording method and method for improving ozone gas resistance of color image materialAccording to the present invention, a novel phthalocyanine compound having a specific structure is provided, and an ink, an inkjet recording ink, an inkjet recording method and a method for improving preservability of a formed image, each using the compound, are also provided. The novel phthalocyanine compound of the present invention has a sufficiently high fastness to light, heat, humidity and active gases in the environment and by using an ink, particularly inkjet recording ink, containing the phthalocyanine compound, an image having high fastness to light and ozone gas in the environment can be formed.An ink comprising at least one compound represented by the following formula (I) or (II): [Image] wherein X1, X2, X3 and X4 each independently represents ?SO-Z or ?SO2-Z, wherein each Z independently represents a substituted or unsubstituted alkyl group, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted alkenyl group, a substituted or unsubstituted aralkyl group, a substituted or unsubstituted aryl group or a substituted or unsubstituted heterocyclic group; Y1, Y2, Y3 and Y4 each independently represents a hydrogen atom, a halogen atom, an alkyl group, a cycloalkyl group, an alkenyl group, an aralkyl group, an aryl group, a heterocyclic group, a cyano group, a hydroxyl group, a nitro group, an amino group, an alkylamino group, an alkoxy group, an aryloxy group, an amido group, an arylamino group, a ureido group, a sulfamoylamino group, an alkylthio group, an arylthio group, an alkoxycarbonylamino group, a sulfonamido group, a carbamoyl group, an alkoxycarbonyl group, a heterocyclic oxy group, an azo group, an acyloxy group, a carbamoyloxy group, a silyloxy group, an aryloxycarbonyl group, an aryloxycarbonylamino group, an imido group, a heterocyclic thio group, a phosphoryl group, an acyl group or an ionic hydrophilic group, which groups each may further have a substituent; a1 to a4 and b1 to b4 represent a number of substituents X1 to X4 and Y1 to Y4, respectively, a1 to a4 each independently represents an integer of 0 to 4, provided that all are not 0 at the same time, and b1 to b4 each independently represents an integer of 0 to 4; and M represents a hydrogen atom, a metal element or an oxide, hydroxide or halide thereof; provided that at least one of X1, X2, X3, X4, Y1, Y2, Y3 and Y4 is an ionic hydrophilic group or a group having an ionic hydrophilic group as a substituent; [Image] wherein X11, X12, X13 and X14 each independently represents ?SO2NR1R2 and/or a sulfo group, provided that X11, X12, X13 and X14 all are not a sulfo group at the same time, wherein R1 represents, when a plurality of R1s are present, each independently represents a hydrogen atom, a substituted or unsubstituted alkyl group, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted alkenyl group, a substituted or unsubstituted aralkyl group, a substituted or unsubstituted aryl group or a substituted or unsubstituted heterocyclic group, R2 represents, when a plurality of R2s are present, each independently represents a substituted or unsubstituted alkyl group, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted alkenyl group, a substituted or unsubstituted aralkyl group, a substituted or unsubstituted aryl group or a substituted or unsubstituted heterocyclic group, and R1 and R2 may combine with each other to form a 5- or 6-membered nitrogen-containing heterocyclic ring; wherein at least one ?SO2NR1R2 group having an ionic hydrophilic group is present at the 2-, 3-, 6-, 7-, 10-, 11-, 14- or 15-position of formula (II); wherein when a sulfo group is directly bonded to a benzene nucleus, the sulfo group is bonded at the 2-, 3-, 6-, 7-, 10-, 11-, 14- or 15-position of formula (II); Y11, Y12, Y13, Y14, Y15, Y16, Y17 and Y18 each independently represents a hydrogen atom, a halogen atom, an alkyl group, a cycloalkyl group, an alkenyl group, an aralkyl group, an aryl group, a heterocyclic group, a cyano group, a hydroxyl group, a nitro group, an amino group, an alkylamino group, an alkoxy group, an aryloxy group, an amido group, an arylamino group, a ureido group, a sulfamoylamino group, an alkylthio group, an arylthio group, an alkoxycarbonylamino group, a sulfonamido group, a carbamoyl group, an alkoxycarbonyl group, a heterocyclic oxy group, an azo group, an acyloxy group, a carbamoyloxy group, a silyloxy group, an aryloxycarbonyl group, an aryloxycarbonylamino group, an imido group, a heterocyclic thio group, a phosphoryl group, an acyl group or an ionic hydrophilic group, which groups each may further have a substituent; a11 to a14 represent a number of substituents X11 to X14, respectively, and each independently represents an integer of 0 to 2, provided that all are not 0 at the same time; and M represents a hydrogen atom, a metal element or an oxide, hydroxide or halide thereof; provided that at least one of X11, X12, X13, X14, Y11, Y12, Y13, Y14, Y15, Y16, Y17 and Y18 is an ionic hydrophilic group or a group having an ionic hydrophilic group as a substituent.

20111

석유화학계 기초 화학 물질 제조업

특허

ko

en

아릴 화합물의 합성화학식 (1)의 아릴 화합물의 합성 방법. [이미지]화학식 (2)의 화합물을 화학식 (3)의 화합물과 제1 세트의 반응 조건하에 반응시켜 화학식 (4)의 화합물을 생성시킨 다음에 화학식 (4)의 화합물을 하나 이상의 시약과 제2 세트의 반응 조건하에 반응시켜 화학식 (1)의 화합물을 생성시키는 단계를 포함하는, 화학식 (1)의 화합물의 합성 방법:[이미지]화학식 (1)[이미지]화학식 (2)[이미지]화학식 (3)[이미지]화학식 (4)상기 식에서,n은 1 - 6이고;U는 벤젠 또는 피리딘이고;T는 [이미지], [이미지] 또는 [이미지]이고;V는 [이미지] 또는 [이미지]이고;W는 벤젠 또는 피리딘이고;Y는 -BK-GIMJ+이고;G는 할로겐이고;M은 임의의 (I)족 또는 (II)족 금속이고;K는 1 또는 2이고;I는 3 또는 4이고;J는 1 또는 2이고;X는 할로겐이고;각각의 R1은 i-xxxiii 중 임의의 하나 이상으로부터 독립적으로 선택될 수 있으며: i. H;ii. C1-8 알킬;iii. C1-8 헤테로알킬;iv. 하기로부터 독립적으로 선택된 카르복실산 및 관련 유도체:a) 카르복실산, [이미지],b) 알킬 카르복실산, [이미지] (여기서 n= 1-8이다);c) 티오카르복실산, [이미지],d) 알킬 티오카르복실산, [이미지] (여기서 n= 1-8이다);e) 에스테르, [이미지], f) 알킬 에스테르, [이미지] (여기서 n= 1-8이다);g) 티오에스테르, [이미지], h) 알킬 티오에스테르, [이미지] (여기서 n= 1-8이다),i) 디티오에스테르, [이미지],j) 알킬 디티오에스테르, [이미지] (여기서 n= 1-8이다),v. 하기로부터 독립적으로 선택된 카르복실산의 아미드 유도체:k) 아미드, [이미지],l) 티오아미드, [이미지],vi. 하기로부터 독립적으로 선택된 알데히드, 케톤 및 그의 유도체:m) 알데히드, [이미지],n) 티알, [이미지],o) 케톤, [이미지],p) 티오케톤, [이미지], q) 아세탈, [이미지] (여기서 n =1-3이다),r) 디티오아세탈, [이미지] (여기서 n =1-3이다),vii. 하기로부터 독립적으로 선택된 아민, 알킬 아민 및 그의 유도체:s) 아민, [이미지],t) 아미드, [이미지],u) 티오아미드, [이미지],v) 암모늄 염, [이미지],w) 알킬 아민, [이미지] (여기서 n = 1-8이다),x) 알킬 아미드, [이미지] (여기서 n = 1-8이다),y) 알킬 티오아미드, [이미지] (여기서 n = 1-8이다),z) 알킬 암모늄 염, [이미지] (여기서 n = 1-8이다), aa) 이민, [이미지] 및 [이미지],bb) 구아니딘, [이미지],cc) 아미딘, [이미지],viii. 니트릴 (시아노), [이미지],ix. 이소니트릴, [이미지],x. 시아네이트, [이미지],xi. 이소시아네이트, [이미지],xii. 티오시아네이트, [이미지],xiii. 이소티오시아네이트, [이미지],xiv. 아조, [이미지],xv. 니트로, [이미지],xvi. 니트라이트, [이미지],xvii. 니트로소, [이미지],xviii. N-말단 펩티드 서열, [이미지] (여기서 q= 1 - 3이고 Rpep는 아미노산을 형성하는 임의의 기이다),xix. C-말단 펩티드 서열, [이미지] (여기서 q= 1 - 3이고 Rpep는 아미노산을 형성하는 임의의 기이다),xx. 하기로부터 독립적으로 선택된 인계 치환기 (여기서 인 원자는 3+ 또는 5+ 산화 상태로 존재한다):dd) 알킬　포스핀, [이미지] (여기서 n = 1-8이다),ee) 알킬　포스포늄 염, [이미지] (여기서 n = 0-8이다),ff) 포스핀, [이미지],gg) 포스핀 옥시드, [이미지],hh) 포스파이트, [이미지],ii) 포스페이트, [이미지],jj) 포스피나이트, [이미지],kk) 포스피네이트, [이미지],ll) 포스피나이트, [이미지],mm) 포스포네이트, [이미지],xxi. 황계 치환기:nn) 술페이트, [이미지],oo) 술폰, [이미지],pp) 술폭시드, [이미지],qq) 술핀산, [이미지],rr) 술피민, [이미지],ss) 술폰 아미드, [이미지],tt) 트리플레이트, [이미지],xxii. 붕소계 치환기:uu) 보론산, [이미지],vv) 보론산 에스테르, [이미지],xxiii. 세미카르바존, [이미지],xxiv. 티오세미카르바존, [이미지],xxv. 시안이미드, [이미지],xxvi. 히드라존, [이미지],xxvii. 옥심, [이미지],xxviii. 니트로아민, [이미지],xxix. 니트로네이트, [이미지],xxx. 니트론, [이미지],xxxi. 카르보네이트, [이미지],xxxii. 카르바메이트, [이미지],xxxiii. 디티오카르바메이트, [이미지],여기에서 i-xxxiii에서의 Ra, Rb, Rc 및 Rd는 수소 또는 알킬 (C1-4)로부터 독립적으로 선택된다.

SYNTHESIS OF ARYL COMPOUNDSA method for the synthesis of an aryl compound of Formula (1) is disclosed.One kind is used for the method for synthesis type (1) compound；it the described method comprises the following steps：under first group of reaction condition, by formula (2) compound；reacted with formula (3) compound；v-yformula (3)with production (4) compound：then, under second group of reaction condition, by the formula (4) compound and one or more reagent reactings, with described in generation formula (1) compound；wherein；n is 1-6；u is benzene or pyridine；t is-,=or ≡；v is=or ≡；w is benzene or pyridine；y is-bk-gimj+；g is halogen；m is any (i) race or (ii) race metal；k is 1 or 2；i is 3 or 4；j is 1 or 2；x is halogen；each r1can be independently selected from any one or more in i-xxxiii：i.h；ii.c1-8alkyl；iii.c1-8miscellaneous alkyl；iv. independently selected from following carboxylic acid and related derivatives：a) carboxylic acid,b) alkyl carboxylic acid,wherein n=1-8；c) thiocarboxylic acid,d) alkylthio carboxylic acid,wherein n=1-8；e) ester,f) arrcostab,wherein n=1-8；g) thioesters,h) alkyl thioesters,wherein n=1-8i) dithioesters,j) alkyl dithioesters,wherein n=1-8v. independently selected from the amide derivatives of following carboxylic acid：k) acid amides,l) thioamides,vi. independently selected from following aldehyde, ketone and its derivative：m) aldehyde,n) thioaldehydes,o) ketone,p) thioketones,q) acetal,wherein n=1-3r) dithioacetals,wherein n=1-3vii. independently selected from following amine, alkylamine and its derivative：s) amine,t) acid amides,u) thioamides,v) ammonium salt,w) alkylamine,wherein n=1-8x) alkylamide,wherein n=1-8y) alkylthioamide,wherein n=1-8z) alkylammonium salt,wherein n=1-8,aa) imines,withbb) guanidine,cc) amidine,viii. nitrile (cyano group) ,-c ≡ n,ix. isonitrile,x. cyanate ,-o-c ≡ n,xi. isocyanates ,-n=c=o,xii. thiocyanates ,-s-c ≡ n,xiii. isothiocyanates ,-n=c=s,xiv. azo ,-n=nh,xv. nitro,xvi. nitrous acid ester ,-o-n=o,xvii. nitroso ,-n=o,xviii.n- terminal peptide sequences,wherein q=1-3, and rpepit is to cause amino acids formed any base group,xix.c- terminal peptide sequences,wherein q=1-3, and rpepit is to cause amino acids formed any base group,xx. 3 are in independently selected from the following substituent based on phosphorus, wherein phosphorus atoms+or 5+oxidation state：dd) alkylphosphines,wherein n=1-8ee) wan ji phosphonium salts,wherein n=0-8ff) phosphine,gg) phosphine oxide,hh) phosphite ester,ii) phosphate,jj) phosphinate,kk) phosphinate,ll) phosphinate,mm) phosphonate ester,xxi. the substituent based on sulphur,nn) sulfuric ester,oo) sulfone,pp) sulfoxide,qq) sulfinic acid,rr) sulfilimine,ss) sulfonamide,tt) triflate,xxii. the substituent based on boron,uu) boric acid,vv) borate,xxiii. semicarbazones,xxiv. thiosemicarbazones,xxv. cyanamide,xxvi. hydrazone,xxvii. oxime,xxviii. nitramine,xxix. nitronate,xxx. nitrone,xxxi. carbonic ester,xxxii. carbamate,xxxiii. dithiocarbamate,r in wherein i-xxxiiia、rb、rcand rdindependently selected from hydrogen or alkyl (c1-4)。

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

아세트아미드 티에노트리아졸로디아제핀 및 그의 용도본 발명은 화학식 (I)을 갖는 화합물 및 그의 제약 조성물을 제공한다. 화학식 (I)을 갖는 화합물은 브로모도메인 및/또는 브로모도메인-함유 단백질 (예를 들어, 브로모 및 말단외 (BET) 단백질)의 결합제이다. 또한, 브로모도메인 및/또는 브로모도메인-함유 단백질의 활성 (예를 들어, 증가된 활성)을 억제하고, 대상체에서 브로모도메인 또는 브로모도메인-함유 단백질과 연관된 질환 (예를 들어, 증식성 질환, 심혈관 질환, 바이러스 감염, 섬유화 질환, 대사 질환, 내분비 질환, 및 방사선 중독)을 치료 및/또는 예방하기 위해 화합물 및 제약 조성물을 사용하는 방법, 용도, 및 키트가 제공된다. 화합물, 제약 조성물, 및 키트는 또한 웅성 피임에 유용하다.화학식 (I)을 갖는 화합물 또는 그의 제약상 허용되는 염, 입체이성질체, 또는 호변이성질체.여기서:Y는 하기 화학식을 가지며,여기서:R3은 수소, 임의로 치환된 알킬, 임의로 치환된 아실, 또는 질소 보호기이고;L1은 임의로 치환된 알킬렌이고;L4는 비치환된 분지형 알킬렌 또는 치환된 알킬렌이고;X4는 할로겐, -ORf, -SRf, 또는 -N(Rf)2이고;고리 D는 카르보시클릭 또는 헤테로시클릭 고리이며, 여기서 헤테로시클릭 고리는 1개의 헤테로원자를 함유하고, 헤테로원자는 N이고;고리 G는 비시클릭 헤테로시클릭 또는 비시클릭 헤테로아릴 고리이며, 여기서 고리는 정확히 2개의 원자를 공유하고;E는 O, S, NRE, 또는 CHRE이며, 여기서 RE는 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 또는 임의로 치환된 헤테로아릴이고;각 경우의 RD는 독립적으로 수소, 할로겐, 임의로 치환된 알킬, 임의로 치환된 헤테로알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 임의로 치환된 헤테로아릴, 임의로 치환된 아실, -ORf, -SRf, -N(Rf)2, -NO2, 또는 -CN이거나, 또는 인접한 원자에 부착된 2개의 RD는 연결되어 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 임의로 치환된 헤테로아릴 고리를 형성하고;z는 0, 1, 또는 2이고;d는 0, 1, 2, 3, 또는 4이고;RA1은 수소, 할로겐, 임의로 치환된 알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 임의로 치환된 헤테로아릴, 임의로 치환된 아실, -ORf, -SRf, -N(Rf)2, -NO2, 또는 -CN이고;RA2는 수소, 할로겐, 임의로 치환된 알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 임의로 치환된 헤테로아릴, 임의로 치환된 아실, -ORf, -SRf, -N(Rf)2, -NO2, 또는 -CN이고;X1은 N 또는 CR5이며, 여기서 R5는 수소, 할로겐, 임의로 치환된 알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 임의로 치환된 헤테로아릴, 임의로 치환된 아실, -ORf, -SRf, -N(Rf)2, -NO2, 또는 -CN이고;RB는 수소, 할로겐, 임의로 치환된 알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 임의로 치환된 헤테로아릴, 임의로 치환된 아실, -ORf, -SRf, -N(Rf)2, -NO2, 또는 -CN이고;고리 C는 아릴 또는 헤테로아릴이고;각 경우의 RC는 독립적으로 할로겐, 임의로 치환된 알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 임의로 치환된 헤테로아릴, 임의로 치환된 아실, 임의로 치환된 술포닐, -ORf, -SRf, -N(Rf)2, -NO2, 또는 -CN이고;c는 0, 1, 2, 3, 또는 4이고;n은 0, 1, 2, 3, 또는 4이고;R2는 수소, 할로겐, 또는 임의로 치환된 알킬이고;각 경우의 Rf는 독립적으로 수소, 임의로 치환된 알킬, 임의로 치환된 알케닐, 임의로 치환된 알키닐, 임의로 치환된 카르보시클릴, 임의로 치환된 헤테로시클릴, 임의로 치환된 아릴, 임의로 치환된 헤테로아릴, 임의로 치환된 아실, 임의로 치환된 술포닐, 산소 보호기, 또는 질소 보호기이거나, 또는 2개의 Rf는 연결되어 임의로 치환된 헤테로시클릭 또는 임의로 치환된 헤테로아릴 고리를 형성한다.

ACETAMIDE THIENOTRIAZOLODIAZEPINES AND USES THEREOFThe present invention provides compounds of Formula (I), and pharmaceutically compositions thereof. Compounds of Formula (I) are binders of bromodomains and/or bromodomain-containing proteins (e.g., bromo and extra terminal (BET) proteins). Also provided are methods, uses, and kits using the compounds and pharmaceutical compositions for inhibiting the activity (e.g., increased activity) of bromodomains and/or bromodomaincontaining proteins and for treating and/or preventing in a subject diseases associated with bromodomains or bromodomain-containing proteins (e.g., proliferative diseases, cardiovascular diseases, viral infections, fibrotic diseases, metabolic diseases, endocrine diseases, and radiation poisoning). The compounds, pharmaceutical compositions, and kits are also useful for male contraception.A compound of Formula (I):or a pharmaceutically acceptable salt, stereoisomer, or tautomer thereof, wherein:Y is of formula: , wherein:R hydrogen, optionally substituted alkyl, optionally substituted acyl, or a nitrogen protecting group;L1 is optionally substituted alkylene;L4 is unsubstituted branched alkylene or substituted alkylene;X4 is halogen, -ORf, -SRf, or -N(Rf)2;Ring D is a carbocyclic or a heterocyclic ring, wherein the heterocyclic ring contains one heteroatom, and the heteroatom is N;Ring G is a bicyclic heterocyclic or bicyclic heteroaryl ring, wherein the rings share exactly two atoms;E is O, S, NR E , or CHRE , wherein R E is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl;each occurrence of RD is independently hydrogen, halogen, optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted acyl, -ORf, -SRf, -N(Rf)2, -N02, or -CN, or two RD attached to adjacent atoms are joined to form an optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl ring;z is 0, 1, or 2; andd is 0, 1, 2, 3, or 4;RA1 is hydrogen, halogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted acyl, -ORf, -SRf, -N(Rf)2, -N02, or -CN;RA2 is hydrogen, halogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted acyl, -ORf, -SRf, -N(Rf)2, -N02, or -CN;X1 is N or CR5, wherein R5 is hydrogen, halogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted acyl, -ORf, -SRf, -N(Rf)2, -N02, or -CN;R is hydrogen, halogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted acyl, -ORf, -SRf, -N(Rf)2, -N02, or -CN;Ring C is aryl or heteroaryl;each occurrence of R is independently halogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted acyl, optionally substituted sulfonyl, -OR f , -SR f ,-N(Rf)2, -N02, or -CN;c is 0, 1, 2, 3, or 4;n is 0, 1, 2, 3, or 4;R is hydrogen, halogen, or optionally substituted alkyl; andeach occurrence of R is independently hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted acyl, optionally substituted sulfonyl, an oxygen protecting group, or a nitrogen protecting group, or two R are joined to form an optionally substituted heterocyclic or optionally substituted heteroaryl ring.

21210

완제 의약품 제조업

특허

ko

en

ＩＬ-８ 수용체 길항제본 발명은 케모킨, 인터루킨-8(IL-8)에 의해 매개되는 질환 상태를 치료하는데 있어서 디아닐리노 스쿠아레이트의 신규 용도에 관한 것이다.하기 화학식 I의 화합물. <화학식 I> [이미지] 식 중, R은 OH, SH 및 NHSO2Rd로 이루어진 군으로부터 선택되고; Rd는 NR6R7, 알킬, 아릴C1-4알킬, 아릴C2-4알케닐, 헤테로아릴, 헤테로아릴C1-4알킬, 헤테로아릴C2-4알케닐, 헤테로시클릭 및 헤테로시클릭C1-4알킬로 이루어진 군으로부터 선택되고, 여기서 아릴, 헤테로아릴 및 헤테로시클릭 고리는 모두 임의 치환되고; R6 및 R7은 독립적으로 수소 또는 C1-4알킬기이거나, R6 및 R7은 이들이 결합한 질소와 함께 산소, 질소 또는 황으로부터 선택되는 추가의 헤테로원자를 임의로 포함하고, 임의로 치환될 수 있는 5원 내지 7원 고리를 형성하고; R1은 수소, 할로겐, 니트로, 시아노, 할로치환된 C1-10알킬, C1-10알킬, C2-10알케닐, C1-10알콕시, 할로치환된 C1-10알콕시, 아지드, (CR8R8) qS(O)tR4, 히드록시, 히드록시C1-4알킬, 아릴, 아릴C1-4알킬, 아릴옥시, 아릴C1-4알킬옥시, 헤테로아릴, 헤테로아릴알킬, 헤테로시클릭, 헤테로시클릭C1-4알킬, 헤테로아릴C1-4알킬옥시, 아릴C2-10 알케닐, 헤테로아릴C2-10알케닐, 헤테로시클릭C2-10알케닐, (CR8R8) qNR4R5, C2-10알케닐 C(O)NR4R5, (CR8R8)qC(O)NR4R5 , (CR8R8)qC(O)NR4R10, S(0)3H, S(O)3R8, (CR8R8)qC(O)R11, C2-10알케닐C(O)R11, C2-10알케닐C(O)OR11(CR8R 8)qC(O)OR12, (CR8R8)qOC(O)R11 , (CR8R8)qNR4C(O)R11, (CR8R8) qNHS(O)2R17, (CR8R8)qS(O)2NR 4R5로 이루어진 군으로부터 독립적으로 선택되거나; 2개의 R1 부분이 함께 O-(CH2)sO- 또는 5원 또는 6원 불포화 고리를 형성하고; q는 0, 또는 1 내지 10의 정수이고; t는 0, 또는 1 또는 2의 정수이고; s는 1 내지 3의 정수이고; R4 및 R5는 수소, 임의 치환된 C1-4알킬, 임의 치환된 아릴, 임의 치환된 아릴C1-4알킬, 임의 치환된 헤테로아릴, 임의 치환된 헤테로아릴C1-4알킬, 헤테로시클릭 및 헤테로시클릭C1-4알킬로 이루어진 군으로부터 독립적으로 선택되거나, R4 및 R5는 이들이 결합한 질소와 함께 산소, 질소 또는 황으로부터 선택된 추가의 헤테로원자를 임의로 포함하는 5원 내지 7원 고리를 형성하고; Y는 수소, 할로겐, 니트로, 시아노, 할로치환된 C1-10알킬, C1-10알킬, C2-10 알케닐, C1-10알콕시, 할로치환된 C1-10알콕시, 아지드, (CR8R8) qS(O)tR4, 히드록시, 히드록시C1-4알킬, 아릴, 아릴C1-4알킬, 아릴옥시, 아릴C1-4알킬옥시, 헤테로아릴, 헤테로아릴알킬, 헤테로아릴C1-4알킬옥시, 헤테로시클릭, 헤테로시클릭C1-4알킬, 아릴C2-10 알케닐, 헤테로아릴C2-10알케닐, 헤테로시클릭C2-10알케닐, (CR8R8) qNR4R5, C2-10알케닐C(O)NR4R5, (CR8R8)qC(O)NR 4R5, (CR8R8)qC(O)NR4R10, S(0)3H, S(0)3R8, (CR8R8)qC(O)R11, C2-10알케닐C(O)R11, C2-10알케닐C(O)OR11, C(O)R11, (CR8R8)qC(O)OR 12, (CR8R8)qOC(O)R11, (CR8R8)qNR 4C(O)R11, (CR8R8)qNHS(O)2Rd 및 (CR8R8)qS(O)2NR4R5로 이루어진 군으로부터 독립적으로 선택되거나; 2개의 Y 부분이 함께 0-(CH2)sO- 또는 5원 내지 6원 불포화 고리를 형성하고; n은 1 내지 5의 정수이고; m은 1 내지 4의 정수이고; R8은 수소 또는 C1-4알킬이고; R10은 C1-10알킬C(O)2R8이고; R11은 수소, C1-4알킬, 임의 치환된 아릴, 임의 치환된 아릴C1-4알킬, 임의 치환된 헤테로아릴, 임의 치환된 헤테로아릴C1-4알킬, 임의 치환된 헤테로시클릭 및 임의 치환된 헤테로시클릭C1-4알킬로 이루어진 군으로부터 선택되고; R12는 수소, C1-10알킬, 임의 치환된 아릴 및 임의 치환된 아릴알킬로부터 선택되고; R17은 C1-4알킬, 아릴, 아릴알킬, 헤테로아릴, 헤테로아릴C1-4알킬, 헤테로시클릭 및 헤테로시클릭C1-4알킬로 이루어진 군으로부터 선택되고, 여기서, 아릴, 헤테로아릴 및 헤테로시클릭 고리는 모두 임의 치환된다.

IL-8 receptor antagonstsThis invention relates to the novel use of dianilino squarates in the treatment of disease states mediated by the chemokine, Interleukin-8 (IL-8).The chemical compound that has the following formula structure: wherein: r is selected from oh, sh, and nhso 2r dr dbe selected from nr 6r 7, alkyl, aryl c 1-4alkyl, aryl c 2-4alkenyl, heteroaryl, heteroaryl-c 1-4alkyl, heteroaryl c 2-4alkenyl, heterocyclic radical and heterocyclic radical c 1-4alkyl, aryl wherein, heteroaryl and heterocyclic radical all are optional replacements; r 6and r 7be hydrogen independently, or c 1-4alkyl, or r 6and r 7form 5-7 unit ring with the nitrogen that it connected, described ring is optional to comprise another hetero atom that is selected from oxygen, nitrogen or sulfur and described ring can be optional the replacement; r 1be independently selected from hydrogen, halogen, nitro, cyano group, the c that halogen replaces 1-10alkyl, c 1-10alkyl, c 2-10alkenyl, c 1-10alkoxyl, the c that halogen replaces 1-10alkoxyl, azido, (cr 8r 8) qs (o) tr 4, hydroxyl, hydroxyl c 1-4alkyl, aryl, aryl c 1-4alkyl, aryloxy group, aryl c 1-4alkoxyl, heteroaryl, heteroarylalkyl, heterocyclic radical, heterocyclic radical c 1-4alkyl, heteroaryl c 1-4alkoxyl, aryl c 2-10alkenyl, heteroaryl c 2-10alkenyl, heterocyclic radical c 2-10alkenyl, (cr 8r 8) qnr 4r 5, c 2-10alkenyl c (o) nr 4r 5, (cr 8r 8) qc (o) nr 4r 5, (cr 8r 8) qc (o) nr 4r 10, s (o) 3h, s (o) 3r 8, (cr 8r 8) qc (o) r 11, c 2-10alkenyl c (o) r 11, c 2-10alkenyl c (o) or 11(cr 8r 8) qc (o) or 12, (cr 8r 8) qoc (o) r 11, (cr 8r 8) qnr 4c (o) r 11, (cr 8r 8) qnhs (o) 2r 17, (cr 8r 8) qs (o) 2nr 4r 5or two r 1group forms o-(ch together 2) sthe unsaturated ring of o-or 5-6 unit; q is 0, or the integer of 1-10;t is 0, or 1 or 2 integer;s is the integer of 1-3;r 4and r 5be independently selected from hydrogen, the optional c that replaces 1-4alkyl, the optional aryl that replaces, the optional aryl c that replaces 1-4alkyl, the optional heteroaryl that replaces, the optional heteroaryl c that replaces 1-4alkyl, heterocyclic radical and heterocyclic radical c 1-4alkyl, or r 4and r 5form 5-7 unit ring with the nitrogen that it connected, described ring is chosen wantonly and is comprised the hetero atom that another is selected from oxygen, nitrogen or sulfur; y is independently selected from hydrogen, halogen, nitro, cyano group, the c that halogen replaces 1-10alkyl, c 1-10alkyl, c 2-10alkenyl, c 1-10alkoxyl, the c that halogen replaces 1-10alkoxyl, azido, (cr 8r 8) qs (o) tr 4, hydroxyl, hydroxyl c 1-4alkyl, aryl, aryl c 1-4alkyl, aryloxy group, aryl c 1-4alkoxyl, heteroaryl, heteroarylalkyl, heteroaryl c 1-4alkoxyl, heterocyclic radical, heterocyclic radical c 1-4alkyl; aryl c 2-10alkenyl, heteroaryl c 2-10alkenyl, heterocyclic radical c 2-10alkenyl, (cr 8r 8) qnr 4r 5, c 2-10alkenyl c (o) nr 4r 5, (cr 8r 8) qc (o) nr 4r 5, (cr 8r 8) qc (o) nr 4r 10, s (o) 3h, s (o) 3r 8, (cr 8r 8) qc (o) r 11, c 2-10alkenyl c (o) r 11, c 2-10alkenyl c (o) or 11, c (o) r11, (cr 8r 8) qc (o) or 12, (cr 8r 8) qoc (o) r 11, (cr 8r 8) qnr 4c (o) r 11, (cr 8r 8) qnhs (o) 2r dand (cr 8r 8) qs (o) 2nr 4r 5or two y groups form o-(ch together 2) sthe unsaturated ring of o-or 5-6 unit; n is the integer of 1-5;m is the integer of 1-4;r 8be hydrogen or c 1-4alkyl; r 10be c 1-10alkyl c (o) 2r 8r 11be selected from hydrogen, c 1-4alkyl, the optional aryl that replaces, the optional aryl c that replaces 1-4alkyl, the optional heteroaryl that replaces, the optional heteroaryl c that replaces 1-4alkyl, optional heterocyclic radical that replaces and the optional heterocyclic radical c that replaces 1-4alkyl; r 12be selected from hydrogen, c 1-10alkyl, optional aryl that replaces and the optional aralkyl that replaces; with r 17be selected from c 1-4alkyl, aryl, aralkyl, heteroaryl, heteroaryl c 1-4alkyl, heterocyclic radical and heterocyclic radical c 1-4alkyl, wherein aryl, heteroaryl and heterocyclic radical are optional the replacements.

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

신나미드 화합물의 프로드럭본 발명은 식 (I)로 표시되는 신나미드 화합물에 대한 최적의 프로드럭을 제공한다: [상기 식에서, Ra 및 Rb는 C1-6 알킬기 등이고, Xa는 메톡시기 또는 플루오르 원자이고, Y는 포스포노기 등이고, A는 환상 락탐 유도체임]식 (I)으로 표시되는 화합물 또는 그의 약리학적으로 허용되는 염: (화학식 1) [이미지] [상기 식에서, Ra 및 Rb는 동일하거나 상이하게, 수소 원자 또는 C1-6 알킬기이고; Xa는 메톡시기 또는 플루오르 원자이고; Y는 -CO-(O)n-Rc· Ma-(식에서, Rc는 치환기군 A1으로부터 선택되는 동일하거나 상이한 1 내지 5개의 치환기로 치환될 수 있는, C1-6 알킬기, 6 내지 14원의 방향족 탄화수소환기, 5 내지 14원의 방향족 복소환기, 6 내지 14원의 비방향족 탄화수소환기, 또는 5 내지 14원의 비방향족 복소환기이고, n은 0 또는 1이고, Ma-은 음이온임), -P(=O)(ORd)2· Ma-(식에서, Rd는 치환군 A2로부터 선택되는 동일하거나 상이한 1 내지 3개의 치환기로 치환될 수 있는 C1-6 알킬기이고, Ma-은 상기 의미와 동일한 의미임), -P(=O)(OH)2· Ma-(식에서, Ma-은 상기 의미와 동일한 의미임), -P(=O)(-O-)(OH) 또는 -P(=O)(-O-)(-O-Mb+) (식에서, Mb+은 양이온임)이고, A는, 식 (A-1): (화학식 2) [이미지] [상기 식에서, (a) R1, R2, R3 및 R4는 동일하거나 상이하게, 수소 원자 또는 C1-6 알킬기이고, X1은 C1-6 알킬렌기(이 C1-6 알킬렌기는 1 내지 3개의 수산기 또는 C1-6 알킬기(이 C1-6 알킬기는 1 내지 3개의 수산기로 치환될 수 있음)로 치환될 수 있음)이고, X2는 산소 원자 또는 메틸렌기(이 메틸렌기는 1 또는 2개의 C1-6 알킬기로 치환될 수 있음)이고, Ar1은, -X1-a-Ar1-a (식에서, Ar1-a는, 치환기군 A2로부터 선택되는 동일하거나 상이한 1 내지 3개의 치환기로 치환될 수 있는, 6 내지 14원의 방향족 탄화수소환기 또는 5 내지 14원의 방향족 복소환기이고, X1-a는 단일 결합 또는 산소 원자임)이거나, 또는 (b) R1, R2, R3, R4 및 X2는 상기 의미와 동일한 의미이고, Ar1-X1-은 벤젠환(이 벤젠환은 치환기군 A2로부터 선택되는 동일하거나 상이한 1 내지 3개의 치환기로 치환될 수 있음)이 축합된 C3-8 사이클로알킬기(이 C3-8 사이클로알킬기의 1개의 메틸렌기는 산소 원자로 치환될 수 있음)임], 또는 식 (A-2): (화학식 3) [이미지] [상기 식에서, [이미지]는 단일 결합 또는 이중 결합이고, Ar2는 치환기군 A2로부터 선택되는 동일하거나 상이한 1 내지 3개의 치환기로 치환될 수 있는, 6 내지 14원의 방향족 탄화수소환기 또는 5 내지 14원의 방향족 복소환기이고, R5 및 R6은, 동일하거나 상이하게, 치환기군 A2로부터 선택되는 기이고, Z1 및 Z2은, 동일하거나 상이하게, 치환기군 A2로부터 선택되는 동일하거나 상이한 1 또는 2개의 치환기로 치환될 수 있는, 메틸렌기 또는 비닐렌기, 산소 원자, 또는 C1-6 알킬기 또는 C1-6 아실기로 치환될 수 있는 이미노기이고, p, q 및 r은, 동일하거나 상이하게, 0 내지 2의 정수임]을 나타냄], 치환기군 A1: (1) 수산기, (2) 시아노기, (3) C3-8 사이클로알콕시기, (4) C1-6 알콕시기(이 C1-6 알콕시기는, 할로겐 원자, 수산기, 시아노기, C3-8 사이클로알킬기 및 C3-8 사이클로알콕시기로 이루어지는 군으로부터 선택되는 1 내지 3개의 치환기로 치환될 수 있음), (5) 1 또는 2개의 C1-6 알킬기(이 C1-6 알킬기는 1 내지 3개의 할로겐 원자로 치환될 수 있음)로 치환될 수 있는 아미노기, (6) 1 또는 2개의 C1-6 알킬기(이 C1-6 알킬기는 1 내지 3개의 할로겐 원자로 치환될 수 있음)로 치환될 수 있는 카르바모일기, (7) 카르복실기, (8) 피리디닐기 및 (9) 당 잔기, 치환기군 A2: (1) 할로겐 원자, (2) 수산기, (3) 시아노기, (4) C3-8 사이클로알킬기, (5) C3-8 사이클로알콕시기, (6) C1-6 알킬기(이 C1-6 알킬기는, 할로겐 원자, 수산기, 시아노기, C3-8 사이클로알킬기, C1-6 알콕시기 및 C3-8 사이클로알콕시기로 이루어지는 군으로부터 선택되는 1 내지 3개의 치환기로 치환될 수 있음), (7) C1-6 알콕시기(이 C1-6 알콕시기는, 할로겐 원자, 수산기, 시아노기, C3-8 사이클로알킬기 및 C3-8 사이클로알콕시기로 이루어진 군으로부터 선택되는 1 내지 3개의 치환기로 치환될 수 있음), (8) 1 또는 2개의 C1-6 알킬기(이 C1-6 알킬기는 1 내지 3개의 할로겐 원자로 치환될 수 있음)로 치환될 수 있는 아미노기, 및 (9) 1 또는 2개의 C1-6 알킬기(이 C1-6 알킬기는 1 내지 3개의 할로겐 원자로 치환될 수 있음)로 치환될 수 있는 카르바모일기.

Prodrug of cinnamide compoundDisclosed is an optimal prodrug of a cinnamide compound represented by Formula (I) below. In the formula, R a and R b respectively represent a C1-6 alkyl group or the like; X a represents a methoxy group or a fluorine atom; Y represents a phosphono group or the like; and A represents a cyclic lactam derivative.Acceptable salt on the compound of formula (i) representative or its pharmacology:[formula 1]wherein:r aand r bidentical or different, each all represents hydrogen atom or c1-6 alkyl; x arepresentation methoxy or fluorine atom; y representative :-co-(o) n-r cm a-, r wherein crepresent c1-6 alkyl, 6-14 unit aromatic hydrocarbon cyclic group, 5-14 unit aromatic heterocyclic group, non-aromatics hydrocarbon cyclic base group of 6-14 unit or 5-14 unit non-aromatic heterocyclic group, they can replace by selected 1-5 identical or different substituting group from substituting group a1 group, n is 0 or 1, m a-represent negatively charged ion;-p (=o) (or d) 2m a-, r wherein drepresent the c1-6 alkyl, this alkyl can replace m by selected 1-3 identical or different substituting group from substituting group a2 group a-represent negatively charged ion;-p (=o) (oh) 2m a-, m wherein a-represent negatively charged ion;-p (=o) (o-) (oh) or-p (=o) (o -) (o -m b+), m wherein b+represent positively charged ion; a is by formula (a-1) representative:[formula 2]wherein:(a) r 1, r 2, r 3and r 4identical or different, each all represents hydrogen atom or c1-6 alkyl; x 1represent the c1-6 alkylidene group, this alkylidene group can be replaced by 1-3 hydroxyl or c1-6 alkyl, and described alkyl can be replaced by 1-3 hydroxyl; x 2represent oxygen or methylene radical, it can be replaced by 1 or 2 c1-6 alkyl; ar 1representative-x 1-a-ar 1-a, ar wherein 1-arepresent 6-14 unit's aromatic hydrocarbon ring or 5-14 unit aromatic heterocyclic group, they can replace x by selected 1-3 identical or different substituting group from substituting group a2 group 1-arepresent singly-bound or sauerstoffatom; perhaps (b) r 1, r 2, r 3, r 4and x 2as hereinbefore defined, ar 1-x 1-representative contain methylene radical, can with the c3-8 cycloalkyl of phenyl ring condensed, described methylene radical can be substituted by sauerstoffatom, described phenyl ring can be selected replaces from 1-3 identical or different substituting group of substituting group a2 group; perhaps a is by formula (a-2) representative:[formula 3]wherein generation list key or two key; ar 2represent 6-14 unit's aromatic hydrocarbon ring or 5-14 unit aromatic heterocyclic group, they can replace by selected 1-3 identical or different substituting group from substituting group a2 group; r 5and r 6identical or different, each all represents the substituting group that is selected from 2 groups of substituent a; z 1and z 2identical or different, each all represent can be selected from 1 or 2 methylene radical or vinylidene, sauerstoffatom or imino-that identical or different substituting group replaces of substituting group a2 group, described imino-can be by c1-6 alkyl or c1-6 acyl substituted; p, q and r are identical or different, and each all represents the integer of 0-2, wherein: substituent a comprises (1) hydroxyl for 1 group, (2) cyano group, (3) c3-8 cycloalkyloxy, (4) c1-6 alkoxyl group, 1-3 the substituting group that it can be selected from following groups replaces: halogen atom, hydroxyl, cyano group, c3-8 cycloalkyl and c3-8 cycloalkyloxy, (5) amino, it can be replaced by 1 or 2 c1-6 alkyl, this alkyl can be replaced by 1-3 halogen atom, (6) formamyl, it can be replaced by 1 or 2 c1-6 alkyl, and this alkyl can be replaced (7) carboxyl by 1-3 halogen atom, (8) pyridyl and (9) saccharide residue;substituent a comprises (1) halogen atom for 2 groups; (2) hydroxyl; (3) cyano group; (4) c3-8 cycloalkyl; (5) c3-8 cycloalkyloxy; (6) c1-6 alkyl; 1-3 the substituting group that it can be selected from following groups replaces: halogen atom; hydroxyl; cyano group; the c3-8 cycloalkyl; c1-6 alkoxyl group and c3-8 cycloalkyloxy; (7) c1-6 alkoxyl group; 1-3 the substituting group that it can be selected from following groups replaces: halogen atom; hydroxyl; cyano group; c3-8 cycloalkyl and c3-8 cycloalkyloxy; (8) amino; it can be replaced by 1 or 2 c1-6 alkyl, and this alkyl can be replaced (9) formamyl by 1-3 halogen atom; it can be replaced by 1 or 2 c1-6 alkyl, and this alkyl can be replaced by 1-3 halogen atom.

26121

발광 다이오드 제조업

특허

ko

en

유기 일렉트로루미네선스 소자고효율, 고내구성의 유기 EL 소자용의 재료로서 정공 및 전자의 주입·수송 성능, 전자 저지 능력, 박막 상태에서의 안정성이나 내구성이 우수한 유기 일렉트로루미네선스 소자용의 각종 재료를, 각각의 재료가 가지는 특성이 효과적으로 발현할 수 있도록 조합하는 것으로, 저구동 전압이며, 고발광 효율, 또한 장수명의 유기 일렉트로루미네선스 소자를 제공하는 것. 적어도 양극, 정공 수송층, 발광층, 전자 수송층 및 음극을 이 순서로 가지는 유기 일렉트로루미네선스 소자에 있어서, 상기 정공 수송층이 하기 일반식 (1)로 나타내는 아릴아민 화합물을 함유하고, 상기 발광층이 하기 일반식 (2)로 나타내는 축합환 구조를 가지는 아민 유도체를 함유하는 것을 특징으로 하는 유기 일렉트로루미네선스 소자. [화학식 1]적어도 양극, 정공 수송층, 발광층, 전자 수송층 및 음극을 이 순서로 가지는 유기 일렉트로루미네선스 소자에 있어서, 상기 정공 수송층이 하기 일반식 (1)로 표시되는 아릴아민 화합물을 함유하고, 상기 발광층이 하기 일반식 (2)로 표시되는 축합환 구조를 가지는 아민 유도체를 함유하는 것을 특징으로 하는 유기 일렉트로루미네선스 소자. [화학식 1](식 중, Ar1 ~ Ar4는 서로 동일해도 좋고 달라도 좋고, 치환 혹은 무치환의 방향족 탄화수소기, 치환 혹은 무치환의 방향족 복소환기, 또는 치환 혹은 무치환의 축합 다환 방향족기를 나타낸다.)[화학식 2](식 중, A1은 치환 혹은 무치환의 방향족 탄화수소의 2가기, 치환 혹은 무치환의 방향족 복소환의 2가기, 치환 혹은 무치환의 축합 다환 방향족의 2가기, 또는 단결합을 나타내고, Ar5와 Ar6은 서로 동일해도 좋고 달라도 좋고, 치환 혹은 무치환의 방향족 탄화수소기, 치환 혹은 무치환의 방향족 복소환기, 치환 혹은 무치환의 축합 다환 방향족기로서, 단결합, 치환 혹은 무치환의 메틸렌기, 산소 원자 또는 유황 원자를 개재하여 서로 결합하여 환을 형성해도 좋다. R1 ~ R4는 서로 동일해도 좋고 달라도 좋고, 수소 원자, 중수소 원자, 불소 원자, 염소 원자, 시아노기, 니트로기, 치환기를 가지고 있어도 좋은 탄소 원자수 1 내지 6의 직쇄 형상 혹은 분지 형상의 알킬기, 치환기를 가지고 있어도 좋은 탄소 원자수 5 내지 10의 시클로알킬기, 치환기를 가지고 있어도 좋은 탄소 원자수 2 내지 6의 직쇄 형상 혹은 분지 형상의 알케닐기, 치환기를 가지고 있어도 좋은 탄소 원자수 1 내지 6의 직쇄 형상 혹은 분지 형상의 알킬옥시기, 치환기를 가지고 있어도 좋은 탄소 원자수 5 내지 10의 시클로알킬옥시기, 치환 혹은 무치환의 방향족 탄화수소기, 치환 혹은 무치환의 방향족 복소환기, 치환 혹은 무치환의 축합 다환 방향족기, 치환 혹은 무치환의 아릴옥시기, 또는 방향족 탄화수소기, 방향족 복소환기 혹은 축합 다환 방향족기로부터 선택되는 기에 의해서 치환된 디치환 아미노기로서, 각각의 기끼리 단결합, 치환 혹은 무치환의 메틸렌기, 산소 원자 또는 유황 원자를 개재하여 서로 결합하여 환을 형성해도 좋고, R1 ~ R4가 결합하고 있는 벤젠환과, 치환 혹은 무치환의 메틸렌기, 산소 원자, 유황 원자, 또는 1치환 아미노기를 개재하여 서로 결합하여 환을 형성해도 좋다. R5 ~ R7은 서로 동일해도 좋고 달라도 좋고, 수소 원자, 중수소 원자, 불소 원자, 염소 원자, 시아노기, 니트로기, 치환기를 가지고 있어도 좋은 탄소 원자수 1 내지 6의 직쇄 형상 혹은 분지 형상의 알킬기, 치환기를 가지고 있어도 좋은 탄소 원자수 5 내지 10의 시클로알킬기, 치환기를 가지고 있어도 좋은 탄소 원자수 2 내지 6의 직쇄 형상 혹은 분지 형상의 알케닐기, 치환기를 가지고 있어도 좋은 탄소 원자수 1 내지 6의 직쇄 형상 혹은 분지 형상의 알킬옥시기, 치환기를 가지고 있어도 좋은 탄소 원자수 5 내지 10의 시클로알킬옥시기, 치환 혹은 무치환의 방향족 탄화수소기, 치환 혹은 무치환의 방향족 복소환기, 치환 혹은 무치환의 축합 다환 방향족기, 또는 치환 혹은 무치환의 아릴옥시기로서, 각각의 기끼리 단결합, 치환 혹은 무치환의 메틸렌기, 산소 원자 또는 유황 원자를 개재하여 서로 결합하여 환을 형성해도 좋고, R5 ~ R7이 결합하고 있는 벤젠환과, 치환 혹은 무치환의 메틸렌기, 산소 원자, 유황 원자, 또는 1치환 아미노기를 개재하여 서로 결합하여 환을 형성해도 좋다. R8과 R9는 서로 동일해도 좋고 달라도 좋고, 치환기를 가지고 있어도 좋은 탄소 원자수 1 내지 6의 직쇄 형상 혹은 분지 형상의 알킬기, 치환기를 가지고 있어도 좋은 탄소 원자수 5 내지 10의 시클로알킬기, 치환기를 가지고 있어도 좋은 탄소 원자수 2 내지 6의 직쇄 형상 혹은 분지 형상의 알케닐기, 치환 혹은 무치환의 방향족 탄화수소기, 치환 혹은 무치환의 방향족 복소환기, 치환 혹은 무치환의 축합 다환 방향족기, 또는 치환 혹은 무치환의 아릴옥시기로서, 각각의 기끼리 단결합, 치환 혹은 무치환의 메틸렌기, 산소 원자, 유황 원자, 또는 1치환 아미노기를 개재하여 서로 결합하여 환을 형성해도 좋다.)

ORGANIC ELECTROLUMINESCENT ELEMENT[Object]An organic electroluminescent device having low driving voltage, high luminous efficiency, and a long lifetime is provided by combining various materials for an organic EL device, which are excellent, as materials for an organic electroluminescent device having high efficiency and high durability, in hole and electron injection/transport performances, electron blocking ability, stability in a thin-film state and durability, so as to allow the respective materials to effectively reveal their characteristics.[Means of Realizing the Object]In the organic electroluminescent device having at least an anode, a hole transport layer, a light emitting layer, an electron transport layer and a cathode in this order, the hole transport layer includes an arylamine compound represented by the following general formula (1), and the light emitting layer includes an amine derivative of the following general formula (2) having a condensed ring structure. An organic electroluminescent device comprising at least an anode, a hole transport layer, a light emitting layer, an electron transport layer and a cathode in this order, wherein the hole transport layer comprises an arylamine compound of the following general formula (1), and the light emitting layer comprises an amine derivative of the following general formula (2) having a condensed ring structure: wherein Ar1 to Ar4 may be the same or different, and represent a substituted or unsubstituted aromatic hydrocarbon group, a substituted or unsubstituted aromatic heterocyclic group, or a substituted or unsubstituted condensed polycyclic aromatic group, wherein A1 represents a divalent group of a substituted or unsubstituted aromatic hydrocarbon, a divalent group of a substituted or unsubstituted aromatic heterocyclic ring, a divalent group of substituted or unsubstituted condensed polycyclic aromatics, or a single bond; Ar5 and Ar6 may be the same or different, and represent a substituted or unsubstituted aromatic hydrocarbon group, a substituted or unsubstituted aromatic heterocyclic group, or a substituted or unsubstituted condensed polycyclic aromatic group, where Ar5 and Ar6 may bind to each other via a single bond, substituted or unsubstituted methylene, an oxygen atom, or a sulfur atom to form a ring; R1 to R4 may be the same or different, and represent a hydrogen atom, a deuterium atom, a fluorine atom, a chlorine atom, cyano, nitro, linear or branched alkyl of 1 to 6 carbon atoms that may have a substituent, cycloalkyl of 5 to 10 carbon atoms that may have a substituent, linear or branched alkenyl of 2 to 6 carbon atoms that may have a substituent, linear or branched alkyloxy of 1 to 6 carbon atoms that may have a substituent, cycloalkyloxy of 5 to 10 carbon atoms that may have a substituent, a substituted or unsubstituted aromatic hydrocarbon group, a substituted or unsubstituted aromatic heterocyclic group, a substituted or unsubstituted condensed polycyclic aromatic group, substituted or unsubstituted aryloxy, or a disubstituted amino group substituted with a group selected from an aromatic hydrocarbon group, an aromatic heterocyclic group, and a condensed polycyclic aromatic group, where R1 to R4 may bind to each other via a single bond, substituted or unsubstituted methylene, an oxygen atom, or a sulfur atom to form a ring, and R1 to R4 and the benzene ring binding with R1 to R4 may bind to each other via substituted or unsubstituted methylene, an oxygen atom, a sulfur atom, or a mono-substituted amino group; R5 to R7 may be the same or different, represent a hydrogen atom, a deuterium atom, a fluorine atom, a chlorine atom, cyano, nitro, linear or branched alkyl of 1 to 6 carbon atoms that may have a substituent, cycloalkyl of 5 to 10 carbon atoms that may have a substituent, linear or branched alkenyl of 2 to 6 carbon atoms that may have a substituent, linear or branched alkyloxy of 1 to 6 carbon atoms that may have a substituent, cycloalkyloxy of 5 to 10 carbon atoms that may have a substituent, a substituted or unsubstituted aromatic hydrocarbon group, a substituted or unsubstituted aromatic heterocyclic group, a substituted or unsubstituted condensed polycyclic aromatic group, or substituted or unsubstituted aryloxy, where R5 to R7 may bind to each other via a single bond, substituted or unsubstituted methylene, an oxygen atom, or a sulfur atom to form a ring, and R5 to R7 and the benzene ring binding with R5 to R7 may bind to each other via substituted or unsubstituted methylene, an oxygen atom, a sulfur atom, or a mono-substituted amino group; and R8 and R9 may be the same or different, linear or branched alkyl of 1 to 6 carbon atoms that may have a substituent, cycloalkyl of 5 to 10 carbon atoms that may have a substituent, linear or branched alkenyl of 2 to 6 carbon atoms that may have a substituent, a substituted or unsubstituted aromatic hydrocarbon group, a substituted or unsubstituted aromatic heterocyclic group, a substituted or unsubstituted condensed polycyclic aromatic group, or substituted or unsubstituted aryloxy, where R8 and R9 may bind to each other via a single bond, substituted or unsubstituted methylene, an oxygen atom, a sulfur atom, or a mono-substituted amino group to form a ring.

20119

석탄화학계 화합물 및 기타 기초 유기화학 물질 제조업

특허

ko

en

방향족 카보네이트류를 공업적으로 제조하는 방법본 발명이 해결하고자 하는 과제는, 디알킬카보네이트와 방향족 모노히드록시 화합물로부터 2 기의 연속 다단 증류탑을 사용하여 방향족 카보네이트를 1 시간당 1 톤 이상의 공업적 규모이고, 고선택률ㆍ고생산성이며 장기간 안정적으로 제조할 수 있는 구체적인 방법을 제공하는 것에 있다. 반응 증류법에 의한 방향족 카보네이트류의 제조 방법에 관한 많은 제안이 있지만, 이들은 모두 소규모, 단기간의 실험실적 레벨의 것이며, 공업적 규모의 대량 생산을 가능하게 하는 구체적인 방법이나 장치의 개시는 전혀 없었다. 본 발명에서는 2 기의 특정한 연속 다단 증류탑이 제공되고, 이들을 접속한 장치를 사용하여 디알킬카보네이트와 방향족 모노히드록시 화합물로부터 1 시간당 1 톤 이상의 공업적 규모이고, 고선택률ㆍ고생산성이며 방향족 카보네이트를 장기간 안정적으로 제조할 수 있는 구체적인 방법이 제공된다. 디알킬카보네이트와 방향족 모노히드록시 화합물을 원료로 하여, 디아릴카보네이트류를 주생성물로 하는 방향족 카보네이트류를 제조하는 방법으로서, (i) 그 원료를, 촉매가 존재하는 제 1 연속 다단 증류탑 내에 연속적으로 공급하는 공정과, (ii) 알코올류 및 알킬아릴카보네이트류가 생성되도록, 그 원료를 그 제 1 탑 내에서 반응시키는 공정과, (iii) 생성되는 알코올류를 함유하는 제 1 저비점 반응 혼합물을 그 제 1 탑 상부로부터 연속적으로 발출함과 함께, 생성되는 알킬아릴카보네이트류를 함유하는 제 1 탑 고비점 반응 혼합물을 그 제 1 탑 하부로부터 액상으로 연속적 발출하는 공정과, (iv) 그 제 1 탑 고비점 반응 혼합물을, 그 제 1 연속 다단 증류탑과 연결된, 촉매가 존재하는 제 2 연속 다단 반응 증류 탑 내에 연속적으로 공급함과 함께, 디알킬카보네이트류 및 디아릴카보네이트류가 생성되도록 그 제 2 탑 내에서 반응시키는 공정과, (v) 생성된 디알킬카보네이트류를 함유하는 제 2 탑 저비점 반응 혼합물을 그 제 2 탑 상부로부터 가스 형상으로 연속적으로 발출함과 함께, 생성된 디아릴카보네이트류를 함유하는 제 2 탑 고비점 반응 혼합물을 그 제 2 탑 하부로부터 액상으로 연속적으로 발출하는 공정을 포함하고, (a) 그 제 1 연속 다단 증류탑 내에 연속적으로 공급되는 디알킬카보네이트가 방향족 모노히드록시 화합물에 대하여, 몰비로 0.1 ∼ 10 이며, (b) 그 제 1 연속 다단 증류탑이, 길이 L1 (㎝), 내경 D1 (㎝) 의 원통형의 동체부의 상하에 경판부를 갖고, 내부에 단수(段數) n1 을 갖는 인터널을 갖는 구조를 하고 있으며, 탑정부 또는 거기에 가까운 탑의 상부에 내경 d11 (㎝) 의 가스 발출구, 탑저부 또는 거기에 가까운 탑의 하부에 내경 d12 (㎝) 의 액 발출구, 그 가스 발출구보다 하부이며 탑의 상부 및/또는 중간부에 1 개 이상의 도입구, 그 액 발출구보다 상부이며 탑의 하부에 1 개 이상의 도입구를 갖는 것으로서, (1) 길이 L1 (㎝) 이 식 (1) 을 만족시키는 것이고, 1500 ≤ L1 ≤ 8000 식 (1) (2) 탑의 내경 D1 (㎝) 이 식 (2) 를 만족시키는 것이고, 100 ≤ D1 ≤ 2000 식 (2) (3) 길이 L1 (㎝) 과 탑의 내경 D1 (㎝) 의 비가 식 (3) 을 만족시키는 것이고, 2 ≤ L1 / D1 ≤ 40 식 (3) (4) 단수 n1 이 식 (4) 를 만족시키는 것이고, 20 ≤ n1 ≤ 120 식 (4) (5) 탑의 내경 D1 (㎝) 과 가스 발출구의 내경 d11 (㎝) 의 비가 식 (5) 를 만족시키는 것이고, 5 ≤ D1 / d11 ≤ 30 식 (5) (6) 탑의 내경 D1 (㎝) 과 액 발출구의 내경 d12 (㎝) 의 비가 식 (6) 을 만족시키는 것이고, 3 ≤ D1 / d12 ≤ 20 식 (6) (c) 그 제 2 연속 다단 증류탑이, 길이 L2 (㎝), 내경 D2 (㎝) 의 원통형의 동체부의 상하에 경판부를 갖고, 내부에 단수 n2 를 갖는 인터널을 갖는 구조를 하고 있으며, 탑정부 또는 거기에 가까운 탑의 상부에 내경 d21 (㎝) 의 가스 발출구, 탑저부 또는 거기에 가까운 탑의 하부에 내경 d22 (㎝) 의 액 발출구, 그 가스 발출구보다 하부이며 탑의 상부 및/또는 중간부에 1 개 이상의 도입구, 그 액 발출구보다 상부이며 탑의 하부에 1 개 이상의 도입구를 갖는 것으로서, (1) 길이 L2 (㎝) 가 식 (7) 을 만족시키는 것이고, 1500 ≤ L2 ≤ 8000 식 (7) (2) 탑의 내경 D2 (㎝) 가 식 (8) 을 만족시키는 것이고, 100 ≤ D2 ≤ 2000 식 (8) (3) 길이 L2 (㎝) 와 탑의 내경 D2 (㎝) 의 비가 식 (9) 를 만족시키는 것이고, 2 ≤ L2 / D2 ≤ 40 식 (9) (4) 단수 n2 가 식 (10) 을 만족시키는 것이고, 10 ≤ n2 ≤ 80 식 (10) (5) 탑의 내경 D2 (㎝) 와 가스 발출구의 내경 d21 (㎝) 의 비가 식 (11) 을 만족시키는 것이고, 2 ≤ D2 / d21 ≤ 15 식 (11) (6) 탑의 내경 D2 (㎝) 와 액 발출구의 내경 d22 (㎝) 의 비가 식 (12) 를 만족시키는 것 5 ≤ D2 / d22 ≤ 30 식 (12) 을 특징으로 하는 방법.

PROCESS FOR PRODUCING AROMATIC CARBONATE ON INDUSTRIAL SCALEIt is an object of the present invention to provide a specific process that enables aromatic carbonates to be produced with high selectivity and high productivity stably for a prolonged period of time on an industrial scale of not less than 1 ton per hour from a dialkyl carbonate and an aromatic monohydroxy compound using two continuous multi-stage distillation columns. Although there have been various proposals regarding processes for the production of aromatic carbonates by means of a reactive distillation method, these have all been on a small scale and short operating time laboratory level, and there have been no disclosures whatsoever on a specific process or apparatus enabling mass production on an industrial scale. According to the present invention, there are provided two specified continuous multi-stage distillation columns, and there is also provided a specific process that enables aromatic carbonates to be produced with high selectivity and high productivity stably for a prolonged period of time on an industrial scale of not less than 1 ton per hour from a dialkyl carbonate and an aromatic monohydroxy compound using a apparatus in which these two continuous multi-stage distillation columns are connected together.A process for the production of an aromatic carbonate containing a diaryl carbonate as a main product from a dialkyl carbonate and an aromatic monohydroxy compound as a starting material, which comprises the steps of: (i) continuously feeding said starting material into a first continuous multi-stage distillation column in which a catalyst is present; (ii) carrying out the reaction in said first column to produce an alcohol and an alkyl aryl carbonate; (iii) continuously withdrawing a first column low boiling point reaction mixture containing a produced alcohol from an upper portion of said first column in a gaseous form while continuously withdrawing a first column high boiling point reaction mixture containing an alkyl aryl carbonate from a lower portion of said first column in a liquid form; (IV) continuously feeding said first column high boiling point reaction mixture into a second continuous multi-stage distillation column in which a catalyst is present and which is connected to said first column while carrying out the reaction in said second column to produce a dialkyl carbonate and a diaryl carbonate; (V) continuously withdrawing a second column low boiling point reaction mixture containing said produced dialkyl carbonate from an upper portion of said second column in a gaseous form while continuously withdrawing a second column high boiling point reaction mixture containing said produced diaryl carbonate from a lower portion of said second column in a liquid form; wherein (a) a molar ratio of the dialkyl carbonate to the aromatic monohydroxy compound in said starting material which is fed continuously into said first continuous multi-stage distillation column is in a range of from 0.1 to 10; (b) said first continuous multi-stage distillation column comprises a structure having a pair of end plates above and below a cylindrical trunk portion having a length L1 (cm) and an inside diameter D1 (cm), and having an internal with a number of stages n1 thereinside, and has a gas outlet having an inside diameter d11 (cm) at the top of the column or in an upper portion of the column near to the top, a liquid outlet having an inside diameter d12 (cm) at the bottom of the column or in a lower portion of the column near to the bottom, at least one inlet provided in the upper portion and/or a middle portion of the column below the gas outlet, and at least one inlet provided in the lower portion of the column above the liquid outlet, wherein (1) said length L1 (cm) satisfies the following formula (1), 1500≦L1≦8000 (2) said inside diameter D1 (cm) of the column satisfies the following formula (2), 100≦D1≦2000 (3) a ratio of said length L1 (cm) to said inside diameter D1 (cm) of the column satisfies the following formula (3), 2≦L1/D1≦40 (4) said number of stages n1 satisfies the following formula (4), 20≦n1≦120 (5) a ratio of said inside diameter D1 (cm) of the column to said inside diameter d11 (cm) of the gas outlet satisfies the following formula (5), 5≦D1/d11≦30 and (6) a ratio of said inside diameter D1 (cm) of the column to said inside diameter d12 (cm) of the liquid outlet satisfies the following formula (6), 3≦D1/d12≦20 (c) said second continuous multi-stage distillation column comprises a structure having a pair of end plates above and below a cylindrical trunk portion having a length L2 (cm) and an inside diameter D2 (cm), and having an internal with a number of stages n2 thereinside, and has a gas outlet having an inside diameter d21 (cm) at the top of the column or in an upper portion of the column near to the top, a liquid outlet having an inside diameter d22 (cm) at the bottom of the column or in a lower portion of the column near to the bottom, at least one inlet provided in the upper portion and/or a middle portion of the column below the gas outlet, and at least one inlet provided in the lower portion of the column above the liquid outlet, wherein (1) said length L2 (cm) satisfies the following formula (7), 1500≦L2≦8000 (2) said inside diameter D2 (cm) of the column satisfies the following formula (8), 100≦D2≦2000 (3) a ratio of the length L2 (cm) to said inside diameter D2 (cm) of the column satisfies the following formula (9), 2≦L2/D2≦40 (4) said number of stages n2 satisfies the following formula (10), 10≦n2≦80 (5) a ratio of said inside diameter D2 (cm) of the column to said inside diameter d21 (cm) of the gas outlet satisfies the following formula (11), 2≦D2/d21≦15 and (6) a ratio of said inside diameter D2 (cm) of the column to said inside diameter d22 (cm) of the liquid outlet satisfies the following formula (12), 5≦D2/d22≦30

31311

유인 항공기, 항공 우주선 및 보조장치 제조업

특허

ko

en

하이브리드 동력 무인기하이브리드 동력 무인기는 무인기 기술 분야에 속한다. 이는 연료 연소식 엔진(10); 영구자석 직류 브러시리스 모터(20), 충전 전지 어셈블리(30), 시동 제어 회로(40), 전자 속도조절기, 비행 제어기, 로터 블레이드를 포함하며, 시동 제어 회로(40)를 통해 충전 전지 어셈블리(30) 중의 전기를 영구자석 직류 브러시리스 모터(20)로 제공함으로써, 영구자석 직류 브러시리스 모터(20)로 연료 연소식 엔진(10)을 구동시켜 연료 연소식 엔진(10)을 점화 및 시동시키고; 연료 연소식 엔진(10)이 점화 시동된 후, 시동 제어 회로(40)는 다시 충전 전지 어셈블리(30)가 영구자석 직류 브러시리스 모터(20)로 전기를 공급하는 것을 차단하며, 이와 동시에 연료 연소식 엔진(10)이 영구자석 직류 브러시리스 모터(20)를 구동시켜 전기를 발생시키고, 영구자석 직류 브러시리스 모터(20)가 발생시킨 전기로 충전 전지 어셈블리(30)를 충전시키며, 영구자석 직류 브러시리스 모터(20)의 전력 출력단 및/또는 충전 전지 어셈블리(30)의 전력 출력단은 전원공급장치의 전력 출력 인터페이스로서 사용된다. 전지를 유일한 전원공급장치로 사용하는 것에 비해, 연료-전기 하이브리드 동력을 전원공급장치로 사용할 경우 에너지밀도가 비교적 높아, 1000~1500Wh/kg에 이를 수 있다.하이브리드 동력 무인기에 있어서,연료 연소식 엔진;영구자석 직류 브러시리스 모터로서, 상기 영구자석 직류 브러시리스 모터의 동력 입력단이 상기 연료 연소식 엔진의 동력 출력단과 전동 연결되는, 영구자석 직류 브러시리스 모터;충전 전지 어셈블리로서, 상기 충전 전지 어셈블리의 전력 입력단이 상기 영구자석 직류 브러시리스 모터의 전력 출력단과 전기적으로 연결되는, 충전 전지 어셈블리;시동 제어 회로로서, 상기 충전 전지 어셈블리가 상기 영구자석 직류 브러시리스 모터로 전기 공급을 시작/정지하도록 제어하기 위해, 상기 시동 제어 회로의 전력 입력단이 상기 충전 전지 어셈블리의 전력 입력단과 연결되고, 상기 시동 제어 회로의 전력 입력단이 상기 영구자석 직류 브러시리스 모터의 전력 입력단과 연결되는, 시동 제어 회로;상기 영구자석 직류 브러시리스 모터의 전력 출력단 및/또는 상기 충전 전지 어셈블리의 전력 출력단은 전원공급장치의 동력출력 인터페이스로 사용되며;전자 속도 조절기로서, 상기 전자 속도 조절기의 전력 입력단이 영구자석 직류 브러시리스 모터, 및, 충전 전지 어셈블리에 동시에 연결되는, 전자 속도조절기;브러시리스 모터로서, 상기 브러시리스 모터의 전력 입력단이 상기 전자 속도조절기와 연결되는, 브러시리스 모터;발전 제어 유닛, 및, 상기 전자 속도조절기를 제어하기 위한 비행 제어기;로터 블레이드로서, 상기 로터 블레이드의 동력 입력단이 상기 브러시리스 모터와 연결되는, 로터 블레이드를 포함하며,상기 충전 전지 어셈블리는 AC-DC 전원 모듈, DC-DC 전원 모듈, 충전 전지팩을 포함하며; 상기 AC-DC 전원 모듈(31)의 전력 입력단은, 상기 영구자석 직류 브러시리스 모터(20)로부터 접속되는 교류전기를 직류 전기로 변환하기 위해, 상기 영구자석 직류 브러시리스 모터(20)의 전력 출력단과 전기적으로 연결되고;상기 DC-DC 전원 모듈(32)의 전력 입력단은, 상기 AC-DC 전원 모듈(31)로부터 접속되는 직류 전기를 변압하기 위해, 상기 AC-DC 전원 모듈(31)의 전력 출력단과 전기적으로 연결되며; 상기 충전 전지팩(33)의 전력 입력단은 상기 DC-DC 전원 모듈(32)의 전력 출력단과 전기적으로 연결되며,상기 충전 전지팩의 제1 전력 출력단은 상기 DC-DC 전원 모듈의 전력 출력단과 연결되고, 제1 전기에너지 출력 인터페이스로서 사용되며,상기 충전 전지팩의 제1 전력 출력단은 제2 전기에너지 출력 인터페이스로서 사용되며,상기 하이브리드 동력 무인기는 제3 전기에너지 출력 인터페이스, DC-DC 전원 변압기, 전원 스위칭 회로, 전기신호 수집회로를 더 포함하며;상기 전기신호 수집회로는, 상기 DC-DC 전원 모듈의 전력 출력단 또는 상기 DC-DC 전원 모듈의 전력 입력단의 전기신호값을 수집하기 위해, 상기 DC-DC 전원 모듈의 전력 출력단 또는 상기 DC-DC 전원 모듈의 전력 입력단과 연결되고;상기 충전 전지팩의 제1 전력 출력단은 상기 DC-DC 전원 모듈의 전력 출력단과 연결되고, 상기 전원 스위칭 회로의 제1 전기에너지 접속단과 연결되며;상기 DC-DC 전원 변압기는, 상기 충전 전지팩의 제2 전력 출력단이 출력하는 정격 전압값을 상기 충전 전지팩의 제1 전력 출력단과 상기 DC-DC 전원 모듈의 전력 출력단이 연결되어 정격 전압값으로 변압하기 위해, 각각 상기 충전 전지팩의 제2 전력 출력단 및 상기 전원 스위칭 회로의 제2 전기에너지 접속단과 연결되고;상기 전원 스위칭 회로의 전기에너지 출력단은 상기 제3 전기에너지 출력 인터페이스와 연결되며;상기 전원 스위칭 회로의 신호 수집단은 전기신호값을 수신하여, 전기신호값의 크기에 따라 상기 전원 스위칭 회로의 제1 전기에너지 접속단과 상기 전원 스위칭 회로의 제2 전기에너지 접속단을 스위칭하기 위해, 상기 전기신호 수집회로와 연결되는 것을 특징으로 하는 하이브리드 동력 무인기.

Hybrid-powered unmanned vehicleThe present invention relates to a hybrid-powered unmanned vehicle, comprising: a fuel engine (10), a permanent magnet brushless DC motor (20), a rechargeable battery component (30), an startup control circuit (40), an electronic speed regulator, a flight controller, and a propeller. The startup control circuit (40) supplies power from the chargeable battery assembly to the permanent magnet brushless DC motor such that the permanent magnet brushless DC motor drives an operation of the fuel engine. The power generated by the permanent magnet brushless DC motor can charge the rechargeable battery component. When compared to using a battery as sole power supply device, the use of hybrid-power provides greater energy density of up to 1,000-1,500 Wh/kg.A hybrid unmanned aerial vehicle, comprising: a fuel engine; a permanent-magnet DC brushless motor, whose impetus input end is in transmission connection with an impetus output end of the fuel engine; a rechargeable battery component, whose power input end is electrically connected with a power output end of the permanent-magnet DC brushless motor; a startup control circuit, whose power input end is connected with the power input end of the rechargeable battery component and is connected with the power input end of the permanent-magnet DC brushless motor for controlling a start and stop of powering the permanent-magnet DC brushless motor by the rechargeable battery component; the power output end of the permanent-magnet DC brushless motor and/or the power output end of the rechargeable battery component are used as an electric power output interface of an electric supply apparatus; an electronic speed regulator, whose input end is connected with the permanent-magnet DC brushless motor and the rechargeable battery component at the same time; a brushless motor, whose input end is connected with the electronic speed regulator; a flight controller used for controlling a power generation control unit and the electronic speed regulator; and a propeller, whose input end is connected with the brushless motor; wherein the rechargeable battery component comprises an AC-DC power supply module, a DC-DC power supply module and a rechargeable battery pack; the power input end of the AC-DC power supply module is electrically connected with the power output end of the permanent-magnet DC brushless motor for converting AC accessing from the permanent-magnet DC brushless motor into DC; the power input end of the DC-DC power supply module is electrically connected with the power output end of the AC-DC power supply module for performing voltage transformation on the DC accessing from the AC-DC power supply module; and the power input end of the rechargeable battery pack is electrically connected with the power output end of the DC-DC power supply module; a first power output end of the rechargeable battery pack is connected with the power output end of the DC-DC power supply module to serve as a first electric energy output interface after being coupled; the first power output end of the rechargeable battery pack is used as a second electric energy output interface; the hybrid unmanned aerial vehicle further comprising a third electric energy output interface, a DC-DC power supply transformer, a power switching circuit and an electric signal acquisition circuit and wherein the electric signal acquisition circuit is connected with the power output end of the DC-DC power supply module or the power input end of the DC-DC power supply module for acquiring an electric signal value of the power output end of the DC-DC power supply module or the power input end of the DC-DC power supply module; a first power output end of the rechargeable battery pack is connected with the power output end of the DC-DC power supply module, and is connected with a first electric energy access end of the power switching circuit after being coupled; the DC-DC power supply transformer is respectively connected with a second power output end of the rechargeable battery pack and a second electric energy access end of the power switching circuit for converting a rated voltage value output by the second power output end of the rechargeable battery pack into a rated voltage value after the first power output end of the rechargeable battery pack and the power output end of the DC-DC power supply module are connected and coupled; an electric energy output end of the power switching circuit is connected with the third electric energy output interface; and a signal acquisition end of the power switching circuit is connected with the electric signal acquisition circuit for receiving the electric signal value and switching the first electric energy access end of the power switching circuit and the second electric energy access end of the power switching circuit according to a magnitude of the electric signal value.

26299

그 외 기타 전자 부품 제조업

특허

ko

en

접지 단자 영역을 갖는 플러그-인 커넥터헤비-듀티 플러그-인 커넥터(C)가 편리하게 조립될 수 있는 접지 단자 영역(63)을 갖도록 의도되고, 그리고 또한 가능한 한 가장 많은 수의 전기 크림프 플러그-인 콘택(4, 4', 5, 5')을 포함하도록 의도된다. 이를 위해서, 접지 플러그-인 콘택(4', 5')은, 크림핑 구성과 유사하게, 금속 보호 어스 요소(3, 3', 3", 3"')와의 전기적 접촉을 위해서 콘택 캐리어(1, 2)의 형성부(13, 13', 23, 23') 내에 피팅된다. 상기 접촉을 위해서, 형성부(13, 13', 23, 23')는 각각의 개구부(130, 130') 또는 통로(230, 230')를 갖는다. 형성부(13, 13', 23, 23')내에서, 플러그-인 커넥터(C)의 플러그-인 콘택(4, 4', 5, 5')의 수가 상당히 증가되도록, 접지 플러그-인 콘택(4', 5')뿐만 아니라 추가적인 플러그-인 콘택(4, 5)이 배열된다.플러그(A) 및 교합 플러그(B)를 포함하는 플러그-인 커넥터(C)이며, - 상기 플러그(A)는 핀 콘택 캐리어(1), 및 그 내부에 수용된 또는 수용될 많은 수의 핀 콘택(4, 4')을 가지고, o 상기 핀 콘택(4, 4')은, 각각의 경우에, 단자 영역(42) 및 콘택 핀(41)을 가지고, o 상기 핀 콘택 캐리어(1)는 유지 부분(12), 및 주변 칼라(111)를 갖춘 플러깅 부분(11)을 포함하고, o 상기 핀 콘택(4, 4')의 단자 영역(42)은 상기 유지 부분(12)의 연속적인 핀 콘택 수용부(10, 10') 내에 수용되고 그 곳에서 고정되거나, 적어도 그 내부에 수용되고 고정될 수 있고, 그에 의해서 수용된 상태의 상기 핀 콘택(4, 4')은 상기 핀 콘택 캐리어(1) 내에서 안정적으로 유지되고 그 노출된 콘택 핀(41)이 상기 플러깅 부분(11) 내로 돌출되며,- 상기 교합 플러그(B)는 소켓 콘택 캐리어(2), 및 그 내부에 수용된 또는 수용될 많은 수의 소켓 콘택(5, 5')을 가지고, o 상기 소켓 콘택(5, 5')은, 각각의 경우에, 단자 영역(52) 및 콘택 소켓(51)을 가지고, 그리고 o 상기 소켓 콘택 캐리어(2)는 단자 부분(22) 및 교합 플러깅 부분(21)을 가지고, o 상기 소켓 콘택 캐리어(2)는 상기 소켓 콘택(5, 5')을 완전히 또는 적어도 부분적으로 수용하기 위한 연속적인 소켓 콘택 수용부(20, 20')를 가지며, 상기 소켓 콘택 수용부(20, 20')는 상기 단자 부분(22)을 통해서 그리고 상기 소켓 콘택 캐리어(2)의 교합 플러깅 부분(21)을 통해서 연장되고, 수용된 상태에서, 상기 소켓 콘택(5, 5')은, 상기 단자 부분(22) 내의 그 단자 영역(52)과 그리고 상기 소켓 콘택 캐리어(2)의 교합 플러깅 부분(21) 내의 그 콘택 소켓(51)과 배열되고, 그 내부에서 유지되며,- 상기 핀 콘택 캐리어(1) 및 상기 소켓 콘택 캐리어(2)가 함께 플러그될 수 있고, 플러그된 상태에서, 상기 핀 콘택 캐리어(1)의 주변 칼라(111)는 상기 소켓 콘택 캐리어(2)의 교합 플러깅 부분(21)을 둘러싸고, 동시에, 상기 핀 콘택 캐리어(1) 내에 수용된 핀 콘택(4, 4')은, 전기 전도 방식으로, 상기 소켓 콘택 캐리어(2) 내에 수용된 소켓 콘택(5, 5')에 연결되고, 여기에서 각각의 콘택 핀(41)이 각각의 콘택 소켓(51)에 의해서 완전히 또는 적어도 부분적으로 수용되며,- 상기 플러그-인 커넥터(C)는 또한 적어도 하나의 접지 단자 영역(63)을 가지고, 상기 접지 단자 영역은 핀 콘택 캐리어 형성부(13) 및 소켓 콘택 캐리어 형성부(23)를 포함하고, 플러그된 상태에서, 상기 핀 콘택 캐리어 형성부 및 상기 소켓 콘택 캐리어 형성부가 서로 결합되거나 서로에 대항하여 맞대어지거나 적어도 인접 배열되고,- 상기 플러그-인 커넥터(C)는, 상기 핀 콘택 캐리어 형성부(13)의 외부 영역에 체결되거나 적어도 체결될 수 있는, 제1 보호 어스 요소(3)를 포함하고,- 많은 수의 핀 콘택(4, 4')이 상기 핀 콘택 캐리어 형성부(13) 내에 수용되거나 수용될 수 있고, 핀 콘택 중 적어도 하나가 접지 핀 콘택(4')이고, 상기 접지 핀 콘택(4')의 단자 영역이 내부에 수용된 또는 수용될 그러한 핀 콘택 수용부는 접지 핀 콘택 수용부(10')이고, 이는 상기 핀 콘택 캐리어 형성부(13)의 외부 영역을 관통하는 개구부(130)에 의해서 구분되고, 상기 개구부를 통해서 상기 수용된 접지 핀 콘택(4')은, 전기 전도 방식으로, 상기 제1 보호 어스 요소(3)에 연결되고, 그리고- 상기 플러그-인 커넥터는, 상기 소켓 콘택 캐리어 형성부(23)의 외부 영역에 체결되거나 적어도 체결될 수 있는, 제2 보호 어스 요소(3')를 포함하며,- 많은 수의 소켓 콘택(5, 5')이 상기 소켓 콘택 캐리어 형성부(23) 내에 수용되거나 수용될 수 있고, 상기 소켓 콘택 중 적어도 하나가 접지 소켓 콘택(5')이고, 상기 접지 소켓 콘택(5')이 내부에 수용된 또는 수용될 그러한 소켓 콘택 수용부는 접지 소켓 콘택 수용부(20')이고, 이는, 상기 소켓 콘택 캐리어 형성부(23)의 외부 영역까지의 관통 통로(230)에 의해서 구분되고, 상기 통로를 통해서, 상기 수용된 접지 소켓 콘택(5')은, 전기 전도 방식으로, 상기 제2 보호 어스 요소(3')에 연결되는, 플러그-인 커넥터(C).

PLUG-IN CONNECTOR WITH GROUND TERMINAL REGIONA heavy-duty plug-in connector (C) is intended to have a ground terminal region (63) that can be conveniently assembled and is also intended to comprise the greatest possible number of electrical crimp plug-in contacts (4, 4', 5, 5'). For this purpose, ground plug-in contacts (4', 5'), likewise of a crimping configuration, are fitted in formations (13, 13', 23, 23') of the contact carriers (1, 2) for electrical contacting with metallic protective earthing elements (3, 3', 3'', 3'''). For said contacting, the formations (13, 13', 23, 23') have a respective opening (130, 130') or passage (230, 230'). In the formations (13, 13', 23, 23'), not only ground plug-in contacts (4', 5') but also further plug-in contacts (4, 5) are arranged, so that the number of plug-in contacts (4, 4', 5, 5') of the plug-in connector (C) is increased considerably.A plug-in connector (C) , comprising a plug (A) and a mating plug (B) ,- wherein the plug (A) has a pin contact carrier (1) and a number of pin contacts (4, 4′) that are received or are to be received therein,ο wherein the pin contacts (4, 4′) have in each case a terminal region (42) and a contact pin (41) ,ο wherein the pin contact carrier (1) comprises a holding portion (12) and a plugging portion (11) with a peripheral collar (111) ,ο wherein the terminal region (42) of the pin contacts (4, 4′) is received in continuous pin contact receptacles (10, 10′) of the holding portion (12) and fixed therein, or at least can be received and fixed therein, whereby the pin contacts (4, 4′) in the received state are held stably in the pin contact carrier (1) and protrude with their exposed contact pins (41) into the plugging portion (11) thereof,- wherein the mating plug (B) has a socket contact carrier (2) and a number of socket contacts (5, 5′) that are received or are to be received therein,ο wherein the socket contacts (5, 5′) have in each case a terminal region (52) and a contact socket (51) , andο wherein the socket contact carrier (2) has a terminal portion (22) and a mating plugging portion (21) ,ο wherein the socket contact carrier (2) has continuous socket contact receptacles (20, 20′) for completely or at least partially receiving the socket contacts (5, 5′) , wherein the socket contact receptacles (20, 20′) run both through the terminal portion (22) and through the mating plugging portion (21) of the socket contact carrier (2) , wherein, in the received state, the socket contacts (5, 5′) are arranged with their terminal region (52) in the terminal portion (22) and with their contact sockets (51) in the mating plugging portion (21) of the socket contact carrier (2) and are held therein,- wherein the pin contact carrier (1) and the socket contact carrier (2) can be plugged together, wherein in the plugged state, the peripheral collar (111) of the pin contact carrier (1) encloses the mating plugging portion (21) of the socket contact carrier (2) and, at the same time, the pin contacts (4, 4′) received in the pin contact carrier (1) are connected in an electrically conducting manner to the socket contacts (5, 5′) received in the socket contact carrier (2) , in that a respective contact pin (41) is completely or at least partially received by a respective contact socket (51) ,- wherein the plug-in connector (C) also has at least one ground terminal region (63) , which includes a pin contact carrier formation (13) and a socket contact carrier formation (23) , which, in the plugged state, engage in one another or butt against one another or are at least arranged adjacently,- wherein the plug-in connector (C) comprises a first protective earthing element (3) , which is fastened, or at least can be fastened, on an outer region of the pin contact carrier formation (13) ,- wherein a number of pin contacts (4, 4′) are received or can be received in the pin contact carrier formation (13) , at least one of which is a ground pin contact (4′) , wherein that pin contact receptacle in which the terminal region of the ground pin contact (4′) is received or is to be received is a ground pin contact receptacle (10′) , which is distinguished by an opening (130) through to the outer region of the pin contact carder formation (13) , through which the received ground pin contact (4′) is connected in an electrically conducting manner to the first protective earthing element (3) , and- wherein the plug-in connector comprises a second protective earthing element (3′) , which is fastened or at least can be fastened on an outer region of the socket contact carrier formation (23) ,- wherein a number of socket contacts (5, 5′) are received or are to be received in the socket contact carrier formation (23) , at least one of which is a ground socket contact (5′) , wherein that socket contact receptacle in which the ground socket contact (5′) is received or is to be received is a ground socket contact receptacle (20′) , which is distinguished by a passage (230) through to the outer region of the socket contact carrier formation (23) , through which the received ground socket contact (5′) is connected in an electrically conducting manner to the second protective earthing element (3′) .

21101

의약용 화합물 및 항생물질 제조업

특허

ko

en

항바이러스제로서 작용화된 헤테로사이클본 발명은 B형 간염 바이러스(HBV)에 의해 인코딩된 단백질(들)을 억제하거나 HBV의 생애 주기를 방해하고, 또한 항바이러스제로서 유용한 화학식 (I)의 화합물, 또는 이의 약학적으로 허용되는 염을 개시한다. 본 발명은 추가로 HBV 감염을 앓고 있는 대상체에게 투여하기 위한 상기 언급된 화합물을 포함하는 약학 조성물에 관한 것이다. 본 발명은 또한 본 발명의 화합물을 포함하는 약학 조성물을 투여함으로써 대상체에서 HBV 감염을 치료하는 방법에 관한 것이다.[이미지]화학식 (I)로 표시되는 화합물, 또는 이의 약학적으로 허용되는 염:[이미지]상기 식에서, Z1은 O, NR1, 또는 S이고; Z2는 N 또는 CR2이고;Z3은 N 또는 CR3이고;Z4는 N 또는 CR4이고;Z5는 N 또는 CR5이고;R1은 수소, 임의로 치환된 -C1-C8 알킬, 임의로 치환된 -C2-C8 알케닐, 임의로 치환된 -C3-C8 사이클로알킬, 임의로 치환된 3 내지 8원의 헤테로사이클로알킬, 임의로 치환된 아릴, 또는 임의로 치환된 헤테로아릴이고;R2, R3, R4, 및 R5는 각각 독립적으로 1) 수소;2) 할로겐;3) -NO2;4) 시아노;5) 임의로 치환된 -C1-C8 알킬;6) 임의로 치환된 -C2-C8 알케닐;7) 임의로 치환된 -C2-C8 알키닐;8) 임의로 치환된 -C3-C8 사이클로알킬;9) 임의로 치환된 3 내지 8원의 헤테로사이클로알킬;10) 임의로 치환된 아릴;11) 임의로 치환된 아릴알킬;12) 임의로 치환된 헤테로아릴; 13) 임의로 치환된 헤테로아릴알킬;14) -SR11;15) -S(O)2R11;16) -S(O)2N(R11)(R12);17) -C(O)R11;18) -C(O)OR11;19) -C(O)N(R11)(R12);20) -C(O)N(R11)S(O)2(R12);21) -N(R11)(R12);22) -N(R13)C(O)N(R11)(R12);23) -N(R11)C(O)(R12); 24) -N(R11)C(O)2(R12);25) -N(R13)S(O)2N(R11)(R12); 26) -N(R11)S(O)2(R12); 27) -OR11;28) -OC(O)R11;29) -OC(O)OR11; 및30) -OC(O)N(R11)(R12)로부터 선택되고;여기서, R11, R12, 및 R13은 각각 독립적으로 수소, 임의로 치환된 -C1-C8 알킬, 임의로 치환된 -C2-C8 알케닐, 임의로 치환된 -C3-C8 사이클로알킬, 임의로 치환된 3 내지 8원의 헤테로사이클로알킬, 임의로 치환된 아릴, 및 임의로 치환된 헤테로아릴로부터 선택되고; 대안적으로, R11 및 R12는 이들이 결합된 질소 원자와 함께 0, 1, 2, 또는 3개의 이중 결합을 함유하는 임의로 치환된 3 내지 8원의 헤테로사이클릭을 형성하고; 대안적으로, Z2는 CR2이고, Z3은 CR3이고, R2 및 R3은 이들이 결합된 탄소 원자와 함께 0, 1, 2, 또는 3개의 이중 결합을 함유하는 임의로 치환된 3 내지 8원의 헤테로사이클릭 또는 카보사이클릭 고리를 형성하고; 대안적으로, Z3은 CR3이고, Z4는 CR4이고, R3 및 R4는 이들이 결합된 탄소 원자와 함께 0, 1, 2, 또는 3개의 이중 결합을 함유하는 임의로 치환된 3 내지 8원의 헤테로사이클릭 또는 카보사이클릭 고리를 형성하고; 대안적으로, Z4는 CR4이고, Z5는 CR5이고, R4 및 R5는 이들이 결합된 탄소 원자와 함께 0, 1, 2, 또는 3개의 이중 결합을 함유하는 임의로 치환된 3 내지 8원의 헤테로사이클릭 또는 카보사이클릭 고리를 형성하고; Q1, Q2, Q3, 및 Q4는 각각 독립적으로 수소, 할로, NR11, 임의로 치환된 -C1-C6 알킬, 임의로 치환된 -C1-C6 알콕시, 임의로 치환된 -C3-C8 사이클로알킬; 임의로 치환된 3 내지 8원의 헤테로사이클로알킬; 임의로 치환된 아릴; 및 임의로 치환된 헤테로아릴로부터 선택되고; 대안적으로, Q1은 Q2 또는 Q3 및 이들이 결합된 탄소 원자와 함께 0, 1, 2, 또는 3개의 이중 결합을 함유하는 임의로 치환된 3 내지 8원의 헤테로사이클릭 또는 카보사이클릭 고리를 형성하고;대안적으로, Q2는 Q4 및 이들이 결합된 탄소 원자와 함께 0, 1, 2, 또는 3개의 이중 결합을 함유하는 임의로 치환된 3 내지 8원의 헤테로사이클릭 또는 카보사이클릭 고리를 형성하고;대안적으로, Q3 및 Q4는 이들이 결합된 탄소 원자와 함께 0, 1, 2, 또는 3개의 이중 결합을 함유하는 임의로 치환된 3 내지 8원의 헤테로사이클릭 또는 카보사이클릭 고리를 형성하고;Y1은 수소, 할로, 또는 임의로 치환된 C1-C6 알킬이고; Y2는 O, NR11, N(OR11), 또는 N(NR11)이고;Y3은 -COOR11, -C(O)NHSO2R11, -C(O)NHSO2NR11R12, 5-테트라졸릴, 또는 1,2,4-옥사디아졸-3-일-5(4H)-온이고; Y4는 수소 또는 임의로 치환된 메틸이고;대안적으로, Y2 및 Y3은 이들이 결합된 탄소 원자와 함께 1, 2, 또는 3개의 이중 결합을 함유하는 임의로 치환된 5 내지 12원의 헤테로사이클릭 고리를 형성한다.

Functionalized heterocyclic compounds as antiviral agentsThe present invention discloses compounds of formula (I), or a pharmaceutically acceptable salt thereof: formula (I) which inhibits one or more proteins encoded by the Hepatitis B Virus (HBV) or interferes with the function of the HBV life cycle of the hepatitis B virus, and is also useful as an antiviral agent. The invention further relates to pharmaceutical compositions comprising the above compounds for administration to a subject suffering from HBV infectionThe pharmaceutical composition of (1). The invention also relates to methods of treating HBV infection in a subject by administering a pharmaceutical composition comprising a compound of the invention.A compound represented by formula (i):or a pharmaceutically acceptable salt thereof, wherein:z1is o, nr1or s;z2is n or cr2；z3is n or cr3；z4is n or cr4；z5is n or cr5；r1is hydrogen, optionally substituted-c1-c8alkyl, optionally substituted-c2-c8alkenyl, optionally substituted-c3-c8cycloalkyl, optionally substituted 3-to 8-membered heterocycloalkyl, optionally substituted aryl or optionally substituted heteroaryl;r2、r3、r4and r5each independently selected from:1) hydrogen;2) halogen;3)-no2；4) a cyano group;5) optionally substituted-c1-c8an alkyl group;6) optionally substituted-c2-c8an alkenyl group;7) optionally substituted-c2-c8an alkynyl group;8) optionally substituted-c3-c8a cycloalkyl group;9) optionally substituted 3-to 8-membered heterocycloalkyl;10) optionally substituted aryl;11) optionally substituted arylalkyl;12) optionally substituted heteroaryl;13) optionally substituted heteroarylalkyl;14)–sr11；15)–s(o)2r11；16)–s(o)2n(r11)(r12)；17)–c(o)r11；18)–c(o)or11；19)–c(o)n(r11)(r12)；20)–c(o)n(r11)s(o)2(r12)；21)-n(r11)(r12)；22)-n(r13)c(o)n(r11)(r12)；23)-n(r11)c(o)(r12)；24)-n(r11)c(o)2(r12)；25)-n(r13)s(o)2n(r11)(r12)；26)-n(r11)s(o)2(r12)；27)–or11；28)–oc(o)r11；29)–oc(o)or11(ii) a and30)–oc(o)n(r11)(r12)；wherein r is11、r12and r13each independently selected from hydrogen, optionally substituted-c1-c8alkyl, optionally substituted-c2-c8alkenyl, optionally substituted-c3-c8cycloalkyl, optionally substituted 3-to 8-membered heterocycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl; alternatively, r11and r12together with the nitrogen atom to which they are attached form an optionally substituted 3-8 membered heterocyclic ring containing 0,1, 2 or 3 double bonds;alternatively, z2is cr2，z3is cr3and r is2and r3together with the carbon atom to which they are attached form an optionally substituted 3-8 membered heterocyclic or carbocyclic ring containing 0,1, 2 or 3 double bonds;alternatively, z3is cr3，z4is cr4and r is3and r4together with the carbon atom to which they are attached form an optionally substituted 3-8 membered heterocyclic or carbocyclic ring containing 0,1, 2 or 3 double bonds;substitutionearth, z4is cr4，z5is cr5and r is4and r5together with the carbon atom to which they are attached form an optionally substituted 3-8 membered heterocyclic or carbocyclic ring containing 0,1, 2 or 3 double bonds;q1、q2、q3and q4each independently selected from hydrogen, halogen, nr11optionally substituted-c1-c6alkyl, optionally substituted-c1-c6alkoxy, optionally substituted-c3-c8a cycloalkyl group; optionally substituted 3-to 8-membered heterocycloalkyl; optionally substituted aryl; and optionally substituted heteroaryl;alternatively, q1and q2or q3and the carbon atoms to which they are attached together form an optionally substituted 3-8 membered heterocyclic or carbocyclic ring containing 0,1, 2 or 3 double bonds;alternatively, q2and q4and the carbon atoms to which they are attached together form an optionally substituted 3-8 membered heterocyclic or carbocyclic ring containing 0,1, 2 or 3 double bonds;alternatively, q3and q4together with the carbon atom to which they are attached form an optionally substituted 3-8 membered heterocyclic or carbocyclic ring containing 0,1, 2 or 3 double bonds;y1is hydrogen, halogen or optionally substituted c1-c6an alkyl group;y2is o, nr11、n(or11) or n (nr)11)；y3is-coor11、-c(o)nhso2r11、-c(o)nhso2nr11r125-tetrazolyl or 1,2, 4-oxadiazol-3-yl-5 (4h) -one; and isy4is hydrogen or optionally substituted methyl;alternatively, y2and y3together with the carbon atom to which they are attached form an optionally substituted 5-12 membered heterocyclic ring containing 1,2 or 3 double bonds.

20132

염료, 조제 무기 안료, 유연제 및 기타 착색제 제조업

특허

ko

en

이소시트레이트 탈수소효소 억제제의 화학적 화합물 및 이의 적용의약 화학 분야에 속하는 이소시트레이트 탈수소효소 억제제의 화학적 화합물, 및 이의 적용이 제공되며; 구체적으로, 식(I),로 표시되는 화학적 화합물, 또는 이의 이성질체, 약학적으로 허용가능한 염, 결정체, 용매화물, 또는 프로드러그, 그리고 이들의 제조 방법 및 상기 화학적 화합물을 함유하는 약학적 조성물, 및 상기 화학적 화합물 또는 조성물의 적용이 제공된다. 상기 화학적 화합물은 돌연변이 IDH2 효소 활성을 억제하고, 돌연변이 IDH2 신생 세포를 억제하는 매우 우수한 능력을 가지며, 돌연변이 IDH2의 존재를 특징으로 하는 종양의 예방 및/또는 치료에 사용될 수 있다.식 (I)로 표시되는 화합물, 또는 이의 이성질체, 약학적으로 허용가능한 염, 결정체, 용매화물 또는 프로드러그, ,여기서,R1 및 R2는 각각 독립적으로 수소, 할로겐, 하이드록실, 알킬, 사이클로알킬, 헤테로사이클릴, 할로알킬, 하이드록시알킬, 알콕시, 할로알콕시, 하이드록시알콕시, 아미노, 알킬아미노, 알킬아실아미노, 알킬아실, 아미노아실, 알킬아미노아실, 카르복실, 니트로 및 시아노로 이루어진 군으로부터 선택되고, 상기 할로겐, 하이드록실, 알킬, 사이클로알킬, 헤테로사이클릴, 할로알킬, 하이드록시알킬, 알콕시, 할로알콕시, 하이드록시알콕시, 아미노, 알킬아미노, 알킬아실아미노, 알킬아실, 아미노아실, 알킬아미노아실, 카르복실, 니트로 및 시아노는 할로겐, 하이드록실, 알킬, 할로알킬, 하이드록시알킬, 알콕시, 할로알콕시, 하이드록시알콕시, 니트로, 카르복실, 시아노, 아미노, 모노알킬아미노, 디알킬아미노, 사이클로알킬, 헤테로사이클릴, 아릴 및 헤테로아릴로 이루어진 군으로부터 선택된 하나 이상의 기로 임의로 치환되며;X는 N(R3), O, S, 및 C(R4)로 이루어진 군으로부터 선택되고, 여기서 R3은 수소, 알킬, 할로알킬, 하이드록시알킬, 아미노알킬, 메르캅토알킬 및 아미노메르캅토알킬로 이루어진 군으로부터 선택되거나, 또는 R3 및 Y는 이들이 부착된 질소 원자와 함께 임의로 치환된 헤테로사이클릴을 형성하고, 그리고 R4는 수소, 알킬, 알케닐, 할로알킬, 하이드록실, 하이드록시알킬, 할로겐, 옥소기, 알콕시, 카르복실, 시아노, 아미노 및 아미노알킬로 이루어진 군으로부터 선택되거나, 또는 R4 및 Y는 이들이 부착된 탄소 원자와 함께 임의로 치환된 카르보사이클릴 또는 헤테로사이클릴을 형성하고, 상기 알킬, 할로알킬, 하이록시알킬, 아미노알킬, 메르캅토알킬, 아미노메르캅토알킬, 알케닐, 하이드록실, 할로겐, 옥소기, 알콕시, 카르복실, 시아노 및 아미노는 할로겐, 하이드록실, 알킬, 할로알킬, 하이드록시알킬, 알콕시, 할로알콕시, 하이드록시알콕시, 니트로, 카르복실, 시아노, 아미노, 모노알킬아미노, 디알킬아미노, 사이클로알킬, 헤테로사이클릴, 아릴 및 헤테로아릴로 이루어진 군으로부터 선택된 하나 이상의 기로 임의로 치환되며;Y는 임의로 치환된 알킬, O(R5), N(R6R7), 사이클로알킬, 헤테로사이클 릴, 할로알킬, 하이드록시알킬, 알콕시, 할로알콕시, 알킬아미노, 알킬아실아미노, 알킬아실, 아미노아실 및 알킬아미노아실로 이루어진 군으로부터 선택되며, 여기서 R5, R6 및 R7은 임의로 치환된 알킬, 사이클로알킬 및 헤테로사이클릴로 이루어진 군으로부터 각각 독립적으로 선택되거나, 또는 R6 및 R7은 이들이 부착된 질소 원자와 함께 헤테로사이클릴을 형성하며, 그리고X가 N(R3)이고, R3이 수소인 경우, Y는 임의로 치환된 O(R5) 및 N(R6R7)로 이루어진 군으로부터 선택되고, X와 Y 사이의 점선은 단일 결합을 나타내며;X가 N(R3)이고, R3은 알킬, 할로알킬, 하이드록시알킬, 아미노알킬, 메르캅토알킬 및 아미노메르캅토알킬로 이루어진 군으로부터 선택되는 경우, Y는 임의로 치환된 알킬, O(R5) 및 N(R6R7)로 이루어진 군으로부터 선택되고, X와 Y 사이의 점선은 단일 결합을 나타내거나, 또는 R3 및 Y는 이들이 부착된 질소 원자와 함께 임의로 치환된 헤테로사이클릴을 형성하며;X가 O 및 S로 이루어진 군으로부터 선택되는 경우, Y는 임의로 치환된 알킬, 사이클로알킬, 헤테로사이클릴, 할로알킬, 하이드록시알킬, 알콕시, 할로알콕시, 알킬아미노, 알킬아실아미노, 알킬아실, 아미노아실 및 알킬아미노아실로 이루어진 군으로부터 선택되고, X와 Y 사이의 점선은 단일 결합을 나타내며; 그리고X가 C(R4)인 경우, Y는 임의로 치환된 알킬, 사이클로알킬, 헤테로사이클릴, 할로알킬, 하이드록시알킬, 알콕시, 할로알콕시, 알킬아미노, 알킬아실아미노, 알킬아실, 아미노아실 및 알킬아미노아실로 이루어진 군으로부터 선택되고, X와 Y 사이의 점선은 단일 결합, 이중 결합 또는 삼중 결합을 나타내거나, 또는 R4 및 Y는 이들이 부착된 탄소 원자와 함께 임의로 치환된 카르보사이클릴 또는 헤테로사이클릴을 형성한다.

CHEMICAL COMPOUND OF ISOCITRATE DEHYDROGENASE INHIBITOR, AND APPLICATION THEREOFProvided are a chemical compound of an isocitrate dehydrogenase inhibitor, and an application thereof, belonging to the field of medicinal chemistry; specifically provided is the chemical compound represented by formula I, or its isomer, pharmaceutically acceptable salt, crystal, solvate, or prodrug, as well as their preparation methods and pharmaceutical compositions containing said chemical compound, and an application of said chemical compound or composition. The chemical compound has very good ability to inhibit mutant IDH2 enzyme activity and to inhibit mutant IDH2 neoplastic cells, and may be used for preventing and/or treating a tumor characterized by the presence of mutant IDH2.A compound represented by formula (I) or an isomer, a pharmaceutically acceptable salt, crystal, solvate or prodrug thereof, wherein R1 and R2 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, alkyl, cycloalkyl, heterocyclyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, hydroxyalkoxy, amino, alkylamino, alkylacylamino, alkylacyl, aminoacyl, alkylaminoacyl, carboxyl, nitro and cyano, wherein the halogen, hydroxyl, alkyl, cycloalkyl, heterocyclyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, hydroxyalkoxy, amino, alkylamino, alkylacylamino, alkylacyl, aminoacyl, alkylaminoacyl, carboxyl, nitro and cyano are optionally substituted with one or more groups selected from the group consisting of halogen, hydroxyl, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, hydroxyalkoxy, nitro, carboxyl, cyano, amino, monoalkylamino, dialkylamino, cycloalkyl, heterocyclyl, aryl and heteroaryl; X is selected from the group consisting of N(R3), O, S, and C(R4), wherein R3 is selected from the group consisting of hydrogen, alkyl, haloalkyl, hydroxyalkyl, aminoalkyl, mercaptoalkyl and aminomercaptoalkyl, or R3 and Y together with the nitrogen atom to which they are attached form optionally substituted heterocyclyl, and R4 is selected from the group consisting of hydrogen, alkyl, alkenyl, haloalkyl, hydroxyl, hydroxyalkyl, halogen, oxo group, alkoxy, carboxyl, cyano, amino and aminoalkyl, or R4 and Y together with the carbon atom to which they are attached form optionally substituted carbocyclyl or heterocyclyl, wherein the alkyl, haloalkyl, hydroxyalkyl, aminoalkyl, mercaptoalkyl, aminomercaptoalkyl, alkenyl, hydroxyl, halogen, oxo group, alkoxy, carboxyl, cyano and amino are optionally substituted with one or more groups selected from the group consisting of halogen, hydroxyl, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, hydroxyalkoxy, nitro, carboxyl, cyano, amino, monoalkylamino, dialkylamino, cycloalkyl, heterocyclyl, aryl and heteroaryl; Y is selected from the group consisting of optionally substituted alkyl, O(R5), N(R6R7), cycloalkyl, heterocyclyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkylamino, alkylacylamino, alkylacyl, aminoacyl and alkylaminoacyl, wherein R5, R6 and R7 are each independently selected from the group consisting of optionally substituted alkyl, cycloalkyl and heterocyclyl, or R6 and R7 together with the nitrogen atom to which they are attached form heterocyclyl, and when X is N(R3) and R3 is hydrogen, Y is selected from the group consisting of optionally substituted O(R5) and N(R6R7), and the dotted line between X and Y represents a single bond; when X is N(R3) and R3 is selected from the group consisting of alkyl, haloalkyl, hydroxyalkyl, aminoalkyl, mercaptoalkyl and aminomercaptoalkyl, Y is selected from the group consisting of optionally substituted alkyl, O(R5) and N(R6R7), and the dotted line between X and Y represents a single bond, or R3 and Y together with the nitrogen atom to which they are attached form optionally substituted heterocyclyl; when X is selected from the group consisting of O and S, Y is selected from the group consisting of optionally substituted alkyl, cycloalkyl, heterocyclyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkylamino, alkylacylamino, alkylacyl, aminoacyl and alkylaminoacyl, and the dotted line between X and Y represents a single bond; and when X is C(R4), Y is selected from the group consisting of optionally substituted alkyl, cycloalkyl, heterocyclyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkylamino, alkylacylamino, alkylacyl, aminoacyl and alkylaminoacyl, and the dotted line between X and Y represents a single bond, a double bond or a triple bond, or R4 and Y together with the carbon atom to which they are attached form optionally substituted carbocyclyl or heterocyclyl.