Datasets:

LeaBresson

/

pubmed-summarization-sample2

like 1

when a drug is used in a way that is different from that described in regulatory body approved drug label , it is said to be off - label use. this term implies that the drug is given either for a different indication , different dose , different dosage form , different route or different age group as compared to approval criteria . in medicine , in general , off - label use is not necessarily inappropriate ; it may be backed by good clinical data , but that may not have been used by physicians to update the regulatory authorities . an anaesthesiologist or perioperative physician needs to administer a variety of drugs such as sedatives , analgesics , anaesthetics and adjuvant drugs through different routes for patient comfort and safety . in this process , drugs may sometimes be used in doses , routes or indications different than described , depending on clinician 's experience and choice . for individual clinician , the absence of formal approval by drug authority is not a major impediment to use drug in actual clinical practice . anaesthesia techniques are varied , such as general , topical , infiltration and intravenous regional anaesthesia . it has been estimated that globally , 234.1 million major surgical procedures requiring some form of anaesthesia ( inclusive of general or local or spinal anaesthesia ) are undertaken every year . research has shown that medication errors in the perioperative setup are associated with 7.2% risk of patient harm as compared to medication errors in outpatient or any other clinical setup ( associated with 1.8% risk of patient harm ) . this observed difference could be due to certain variations in the use of perioperative medication by anaesthesiologists which sometimes crosses safety network of this setup . lack of rigid regulatory guidelines regarding off - label drug use has left its use at discretion of the prescriber . the main concern of such use is lack of adequate safety and efficacy data in relation to the products . moreover , during perioperative period , plenty of drugs are used and so chances of off - label use increases . due to difficulty in accessing patients in the perioperative period , very few studies have been done to evaluate drug utilisation and off - label use of perioperative medications during anaesthesia . keeping these factors in mind , it was planned to conduct a study to determine the prescription pattern and incidence of off - label use of perioperative medications during anaesthesia in patients undergoing surgery and to identify the occurrence of adverse events in patients prescribed off - label drugs . it was an observational , prospective , cross - sectional study conducted in general surgery , paediatric surgery and orthopaedics operation theatre waiting rooms and post - operative wards from july 2012 to october 2013 . these included 250 from general surgery , 100 from orthopaedic and 50 from paediatric surgery departments . patients scheduled for surgery were included in the study . after obtaining written informed consent , demographic details all possible adverse events related to perioperative medications were enquired about in accordance with the checklist in the case record form . adverse events were noted both pre - operatively and post - operatively to ensure that the post - operative event is not a continuation of the event before surgery . this consisted of weight of patient , diagnosis , surgery performed , type of anaesthesia , associated disease and treatment and pre - operative , intraoperative and post - operative prescriptions . the intravenous fluids as prescriptions were not included in the study . to decide whether a particular drug is prescribed off - label , national formulary of india 2011 ( nfi ) was used as the sole reference material . if the drug information was not available in nfi 2011 , then information was extracted from package insert of the drug . in rare cases where package inserts could not be procured , chi - square test was employed to assess the association between the off - label drug use and occurrence of adverse events . the statistical software used was graphpad instat dataset1.isd ( windows 7 , graphpad software , san diego , california usa , www.graphpad.com ) . the age of the participants was 36.12 19.24 years ( mean standard deviation ) ; 315 participants were males and 85 were females . each patient had received maximum of three prescriptions , that is , pre - operative , intraoperative and post - operative , accounting to a total of 1200 prescriptions . a total of 3705 drugs were prescribed to 400 participants of the study . out of these , 2381 ( 64.27% ) drugs were prescribed pre - operatively , 654 ( 17.65% ) intra - operatively and 670 ( 18.08% ) post - operatively . out of 400 patients , 209 patients were administered general anaesthesia , 156 spinal anaesthesia , 23 combined ( general + epidural ) anaesthesia , while 12 patients were administered local anaesthesia . the drugs prescribed have been classified into three broad categories and are represented in table 1 and the analysis of the various prescribing indicators is shown in table 2 . classification of drugs into three broad categories analysis of who prescribing indicators the drugs most commonly prescribed by brand name were buprenorphine , hydrocortisone and midazolam . the drugs most commonly prescribed from outside the hospital schedule were fentanyl , ramosetron , buprenorphine and glycopyrrolate . midazolam formed the highest , i.e , 7.53% of the overall drugs prescribed in the study followed by propofol 7.31% . out of 298 adverse events , 167 adverse events were related to general anaesthesia , 113 to spinal anaesthesia followed by 15 to combined anaesthesia and three to other anaesthesia procedures . the most common adverse events noted were nausea and vomiting in 75 patients , dry mouth in 59 patients and sedation in 38 patients . headache was noted in 28 patients in spinal anaesthesia group . to decide the off - label status of a drug , out of the 54 different drugs analysed , nfi 2011 was used as reference material for 40 drugs , package insert for 11 drugs and cims for three drugs . analysis of prescriptions for off - label drug use [ table 3 ] revealed that 20.19% of the overall drugs prescribed were off - label . 46.26% off - label drug use was due to inappropriate dose followed by inappropriate indication in 33.29% occasions . average number of off - label drugs per prescription was 0.62 , while average number of off - label drugs per patient was 1.87 . out of total 748 off label drugs , 625 off label drugs were prescribed pre - operatively and average number of off - label drugs per preoperative prescription is 1.56 ; moreover , 82.5% of patients were prescribed at least one off - label drug . out of the 346 drugs which were off - label by dose , out of the 449 off label drugs , 199 were from general surgery department , 150 from pediatric surgery department and 100 from orthopaedics department . distribution of off - label drug use in different categories percentage distribution of off - label drugs among three major drug classes the most common drug to be prescribed off - label by indication was ramosetron ( not approved for post - operative nausea vomiting in india ) , while buprenorphine was the most common drug to be prescribed off - label by dose with 100% off - label usage for both drugs . moreover , most common drugs to be prescribed off - label by route were buprenorphine and fentanyl ( not approved for epidural route ) , and propofol by age group ( not approved for children <3 years ) . none of the drugs was found to be off - label by dosage considerations . as shown in table 4 , all ( 100% ) prescriptions for the drugs ramosetron , amikacin , dexamethasone , clonidine , buprenorphine tramadol , pantoprazole , piperacillin plus tazobactam , meropenem , cefoperazone plus sulbactam and ceftazidime were off - label . the percentage contribution of ramosetron towards off - label drug use was highest , that is , 16.76% followed by 11.99% for propofol . the total number of off - label use of drugs in table 3 exceeds the off - label drug prescriptions in table 4 because a prescription may be off - label for more than one category . list of off - label drugs used , their total prescriptions and percentage of off - label as shown in table 5 , chi - square test showed that there was 1.6 times greater risk of occurrence of adverse events associated with the use of off - label drugs . 47.88% of off - label drug users reported adverse event as against 30% of non - off - label drug users . there was an increasing trend in the occurrence of adverse events with increasing instances of off - label drugs encountered per patient e.g. , 33.7% of patients prescribed one off - label drug each had adverse events whereas 66.6% of patients prescribed four off- label drugs had adverse events . our study revealed that nearly 100% of the prescriptions were complete in terms of describing the dose , route of administration , frequency and duration of treatment . this implies that basic principles of rational use of medicines were being followed at our institute . the prescriptions by brand names in 27.93% instances can be explained by lack of training in rational use at both postgraduate and undergraduate levels along with non - availability of the drugs in generic form . use of abbreviations to represent drug names ( such as atra instead of atracurium ) can lead to fatal consequences , if misinterpreted . one of the positive findings was that only 15.7% of drugs were prescribed from outside the hospital schedule , largely related to the stringent regulations governing procurement and use of opioids . in patients undergoing general anaesthesia , the most common drug used was propofol , similar to the findings by di filippo et al . bupivacaine was the preferred drug used for induction of spinal anaesthesia in all the cases , in contrast to the study by schiere et al . variability in drug use , apprehension of transient neurological symptoms with lignocaine and availability of safer drugs such as bupivacaine in the hospital schedule can be attributed to this . the maximum use of vecuronium could be due to its favourable pharmacokinetic profile to overcome the persistent blockade and difficulty in complete reversal after surgery associated with rocuronium and pancuronium , similar to the findings of zhang et al . amongst antibiotics , the higher use of ceftriaxone was in agreement with a plethora of guidelines and studies reporting and recommending the use of third generation cephalosporins for surgical prophylaxis . we found that overall , 20.19% of drugs prescribed in the study were off - label with 82.5% of patients prescribed at least one off - label drug . a retrospective study by doherty et al . in 2009 from a canadian paediatric intensive care unit and neonatal intensive care unit reported that 59.4% of drugs were off - label and 89 - 99% of the patients were administered at least one off - label drug . this study included paediatric population as against our study wherein paediatric population consisted of 12.5% of the total , so the overall off - label drug use was less in our study . interestingly , the most common form of off - label use in our study was in the form of inappropriate dose followed by inappropriate indication . this finding was quite similar to that by doherty et al . , and bavdekar et al . under dosages can lead to inappropriate management of the patients as there is no scientific basis or evidence for it . the risk of occurrence of adverse events associated with the use of off - label use is 1.6 times greater than for non - off - label use . adverse events can not be attributed definitely to off - label use , and the observed increase in adverse events ( odds ratio 1.6 ) is an association , not a causation . study by horen et al . at france in 2000 - 2001 in paediatric outpatients reported a 3.44 times risk of adverse events with off - label use of drugs . the adverse events that could be possibly attributed to off - label use were nausea and vomiting , sedation , etc . in our study , 92% of paediatric patients were prescribed at least one off - label drug . furthermore , anaesthesia delivery among paediatric patients is no longer confined to the operation theatres and intensive care units but is also being increasingly used in the non - surgical settings such as long diagnostic procedures , radiological and interventional studies , to allay pain and anxiety and to maintain stable vitals . among the most commonly prescribed drugs as off - label in this study , due to equivalent efficacy of both ondansetron and ramosetron , the cheaper alternative ondansetron remained a better choice in our set up . moreover , there was an observational study of ramosetron in progress in the hospital during the study . however , there was no selection bias regarding inclusion of all or many cases where ramosetron was used which would have increased the total number of off - label drug usage . buprenorphine - approved dose is 300 - 450 g for perioperative analgesia , but it was used in off - label manner at a lower dose , that is , 150 g in all cases.(32 occasions by iv route and 2 by epidural route ) moreover , buprenorphine has been found to be a potent analgesic at a dose of 0.3 mg by oral route . anaesthesiologists might have used this lower dose considering the body mass index of indian patients . the other drug which we found it is approved only for intravenous use for perioperative analgesia , but in 25 cases it was used by epidural route . in spite of safety constraints such as hypotension , nausea , vomiting and pruritus , in some cases , it 's well - proven efficacy and safety makes its use clinically justifiable . there is ample evidence suggesting that propofol use in children for sedation is associated with minor adverse events that can be easily managed under expert supervision . however , the fact lies that this sedation is only for minor procedures with minimal intervention . even though majority of the studies focus on overall paediatric population , the risk is more in children less than three years of age . this was not specific for propofol but use off label drug usage was also greater in paediatric surgery department as compared to other two departments . cost and logistic considerations , small market share and ethical issues due to vulnerability of paediatric population are the cruces of lack of enthusiasm in pharmaceutical industry to conduct clinical trials in children enhancing off - label use . the latest fda guidelines regarding off - label drug use allow companies to distribute texts and peer - reviewed scientific articles describing off - label use to physicians which are subject to new regulations . indian medical association is of the view that off - label drug use is imperative for certain conditions and should be left at the discretion of physician . if off - label drug use is based on sound scientific evidence , accurate clinical judgement and practiced in the best of patients ' interest , then it can be considered as neither illegal nor unethical . however , the sole responsibility of the off - label prescription here lies with the prescriber . the prescriber in our study is the anaesthetist who works in a critical care setup , where already the risk involved and chances of morbidity and mortality are quite high . a detailed analysis of the cause of complications related to off - label use of drugs has not been carried out , which was a limitation of the study . investigation into the off - label use of medications in anaesthesia in surgical wards revealed that such use was practiced in anaesthesia department with questionable clinical justification in some instances .

background and aims : when a drug is used in a way that is different from that described in regulatory body approved drug label , it is said to be off label use. perioperative phase is sensitive from the point of view of patient safety and off - label drug use in this setup can prove to be hazardous to patient . hence , it was planned to assess the pattern of drug utilisation and off - label use of perioperative medication during anaesthesia.methods:preoperatively , demographic details and adverse events check list were filled from a total of 400 patients from general surgery , paediatric surgery and orthopaedics departments scheduled to undergo surgery . the perioperative assessment form was assessed to record all prescriptions followed by refilling of adverse events checklist in case record form . world health organization ( who ) prescribing indicators were used for analysis of drug utilisation data . national formulary of india 2011 was used as reference material to decide off - label drug use in majority instances along with package insert.results:a total of 3705 drugs were prescribed to the 400 participants and average number of drugs per patient was 9.26 3.33 . prescriptions by generic name were 68.07% whereas 85.3% drugs were prescribed from hospital schedule . off - label drugs overall formed 20.19% of the drugs prescribed . at least one off - label drug was prescribed to 82.5% of patients . inappropriate dose was the most common form of off - label use . there was 1.6 times greater risk of occurrence of adverse events associated with the use of off - label drugs.conclusion:prescription indicators were who compliant . off - label drug use was practiced in anaesthesia department with questionable clinical justification in some instances .

the european investigation into cancer and nutrition ( epic)-nl cohort consists of the two dutch contributions to the epic project : the prospect cohort and the monitoring project on risk factors for chronic diseases ( morgen ) cohorts . the study design of this combined cohort has previously been described in detail ( 13 ) . in brief , prospect is a prospective cohort study among 17,357 women aged 4970 years who participated in the breast cancer screening between 1993 and 1997 . the morgen cohort consists of 22,654 men and women aged 2059 years recruited from three dutch towns ( amsterdam , doetinchem , and maastricht ) . from 1993 to 1997 , each year a new random sample of ~5,000 individuals was examined for the morgen cohort . both studies complied with the declaration of helsinki . the prospect - epic study was approved by the institutional review board of the university medical center utrecht , and the morgen project was approved by the medical ethics committee of tno , the netherlands ( 13 ) . analyses were performed in two subsets composed of epic - nl participants , in whom all mets features were measured : the epic - nl case - cohort study ( 13 ) and a subset of epic - nl morgen participants ( 14 ) . the epic - nl case - cohort study consists of a subcohort , i.e. , 6.5% baseline random sample of the total epic - nl study ( n = 2,604 ) , all incident diabetes cases ( n = 924 ) , and all incident cvd cases ( n = 2,030 ) . by virtue of the random selection of a subcohort and use of the appropriated statistics for this type of research design , the results are expected to be generalizable to the entire cohort ( 15 ) . in the epic - nl case - cohort study , in addition to information on traditional mets features , information on nontraditional mets features , such as high - sensitivity c - reactive protein ( hscrp ) , was available . the epic - nl morgen subset was used as a replication sample for the analysis on model fit . this subset consists of 1,379 nondiabetic participants , who indicated that their last meal was on the day before blood sampling . in contrast to the epic - nl case - cohort study , plasma glucose was measured instead of hba1c , while information on nontraditional mets features was not available . participants with missing blood samples ( 157 participants in the random sample , 174 incident cvd case subjects , and 66 incident type 2 diabetes case subjects ) , participants who were taking glucose - lowering or blood pressure lowering medication ( 282 participants in the random sample , 409 incident cvd case subjects , and 279 incident type 2 diabetes case subjects and 46 participants of the morgen subset ) or participants with missing values for one of the mets or mets - related features ( 237 participants in the random sample , 34 incident diabetes case subjects , and 135 incident cvd case subjects ) were excluded ( supplementary fig . subjects with missing blood samples were on average 2.4 years older and had a 1.1 kg / m higher bmi than those without missing blood samples . age and bmi were similar between subjects with and without missing values for one of the mets or mets - related features . finally , the epic - nl case - cohort study consisted of 545 incident diabetes case subjects , 1,312 incident cvd case subjects , and 1,928 participants in the random sample . of the random - sample participants , 53 were incident type 2 diabetes case subjects and 88 were incident cvd case subjects . an overlap between the case set and the random sample is a design feature of a case - cohort study . for the risk prediction analyses , prevalent type 2 diabetes and cvd case subjects were excluded from the random sample . the epic - nl morgen subset consisted of 1,333 participants , including 133 participants who were also included in the epic - nl case - cohort study . the ascertainment and verification of diabetes cases has previously been described in detail ( 16 ) . in short , diabetes was ascertained via self - report , a urinary glucose strip test , and linkage to registers of hospital discharge diagnoses . self - reported diabetes status was assessed in the baseline questionnaire and in two follow - up questionnaires , which were sent out at regular intervals of 35 years . for prospect participants only , a urinary glucose strip was sent out with the first follow - up questionnaire . follow - up by linkage to registers of hospital discharge diagnoses was completed on 1 january 2006 . potential cases were verified against participants ' general practitioner or pharmacist information . only verified type 2 diabetes cases were included . subsequently , primary and secondary causes of death were obtained through linkage with statistics netherlands . coronary heart disease ( chd ) was coded with icd-9 codes ( 410414 ) or with icd-10 codes ( i20i25 ) , and cerebrovascular accident ( cva ) was coded with icd-9 codes ( 430434 and 436 ) or with icd-10 codes cvd was defined as the presence of chd , cva , or both ( 17 ) . the study protocol of the epic - nl morgen study and the study protocol of the epic - nl prospect study were essentially similar . at baseline , a physical examination was performed and nonfasting blood samples were drawn . furthermore , a general questionnaire and a food frequency questionnaire ( ffq ) were filled out by each participant ( 13 ) . the protocol for the anthropometric measurements and the blood sampling protocol were identical for the epic - nl prospect and the epic - nl morgen studies . body weight was measured with light indoor clothing without shoes on to the nearest 100 g. during the physical examination , systolic and diastolic blood pressure measurements were performed twice in the supine position on the right arm using a boso oscillomat ( bosch & son , jungingen , germany ) ( prospect ) or twice on the left arm using a random zero sphygmomanometer ( morgen ) . triglycerides , alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , glutamyltransferase ( ggt ) , uric acid , and glucose were measured using enzymatic methods , whereas hscrp was measured with a turbidimetric method . these assays were all performed on an autoanalyzer ( lx20 ; beckman coulter , mijdrecht , the netherlands ) ( 13,14 ) . data on smoking habits , educational level , self - reported medication use , physical activity , and alcohol intake were obtained by general questionnaires and an ffq . triglycerides , hscrp , alt , ast , and ggt were log transformed to improve normality . using cfa , we designed several second - order one - factor mets models based on the mets model of shen et al . ( 9 ) consisting of three levels : a single mets factor ; several first - order factors ( e.g. , lipids ) , which defined the single mets factor ; and some second - order factors ( e.g. , triglycerides and hdl cholesterol ) , which defined the first - order factors . we designed the following one - factor mets models : model 1 , a standard mets model , based on the current definition of mets ( 1 ) , including the traditional mets features , i.e. , waist circumference , triglycerides , hdl cholesterol , systolic blood pressure , diastolic blood pressure , and as marker of glucose status , either hba1c or glucose ( fig . 1a and b ) ; model 2 , a standard mets model excluding the blood pressure factor ; and model 3 , a standard mets model extended with an hscrp factor ( fig . 1c ) , an albumin factor , a uric acid factor , or a liver enzymes factor . the liver enzymes factor was a first - order factor defined by the second - order factors alt , ast , and ggt . in all models , the factor variance of the mets factor , the factor loading of triglycerides , and the factor loading of systolic blood pressure were fixed to 1 . for model 3 , the mets model excluding blood pressure , not enough df were available to calculate model fit . therefore , the error variance of the factor with the highest factor loading ( waist circumference ) was fixed to 1 for the model fit calculations of this model . a : the standard second - order one - factor mets model in the random sample of epic - nl . b : the standard second - order one - factor mets model in the subset of the morgen study . c : the standard second - order one - factor mets model extended with hscrp in the random sample of epic - nl . the first - order factors are waist circumference ( wc ) , lipids , hba1c , fpg , and blood pressure . the second - order factors are triglyceride ( tg ) , hdl , systolic blood pressure ( sbp ) , and diastolic blood pressure ( dbp ) . model fit of mets models composed of traditional mets features was calculated in the random sample of epic - nl and in the epic - nl morgen subset . model fit of mets models including nontraditional features was calculated only in the random sample of epic - nl . we compared the model fit of all alternative mets models with the model fit of the standard one - factor mets model ( model 1 ) . the test , the comparative fit index ( cfi ) , the standardized root means square residual ( srmr ) , and the root mean square error of approximation ( rmsea ) were used to assess model fit . models with rmsea > 0.10 , cfi < 0.95 , or srmr > 0.08 were rejected ( 19 ) . the difference test was used to compare model fit across different models . for mets models with an acceptable model fit , we compared the predictive ability of the factor scores for incidence of type 2 diabetes , cvd , chd , and cva in the epic - nl case - cohort study . we calculated the factor scores using the factor score coefficients of the different mets features extracted by the regression method from the random sample . all factor score coefficients were standardized to the means and ses of the mets features in the random sample . for all factor scores , we calculated cox proportional hazard ratios ( hrs ) , c statistics , and integral discrimination indices ( idis ) for incidence of type 2 diabetes , cvd , chd , and cva . hrs were adjusted for the overrepresentation of cases in the case - cohort study with a pseudolikelihood method ( 20 ) , whereas idis and c statistics were adjusted for this overrepresentation by inverse probability weighing . hrs were calculated per sd of the factor score and adjusted for age , sex , cohort , smoking ( current , former , and never ) , educational level , cambridge physical activity index , and alcohol intake . the change in c statistics and the idis were used to compare predictive ability of the standard mets model , model 1 , with the alternative models . the c statistic is equivalent to the probability that the predicted risk is higher for a case than for a noncase subject ( 21 ) . the idi can be viewed as the difference in the proportion of variance explained by two models ( 22 ) . cfa analyses were performed in mplus , sixth edition ( muthn & muthn , los angeles , ca ) . hrs , c statistics , and idis were calculated in sas version 9.2 ( sas institute , cary , nc ) . the european investigation into cancer and nutrition ( epic)-nl cohort consists of the two dutch contributions to the epic project : the prospect cohort and the monitoring project on risk factors for chronic diseases ( morgen ) cohorts . the study design of this combined cohort has previously been described in detail ( 13 ) . in brief , prospect is a prospective cohort study among 17,357 women aged 4970 years who participated in the breast cancer screening between 1993 and 1997 . the morgen cohort consists of 22,654 men and women aged 2059 years recruited from three dutch towns ( amsterdam , doetinchem , and maastricht ) . from 1993 to 1997 , each year a new random sample of ~5,000 individuals was examined for the morgen cohort . both studies complied with the declaration of helsinki . the prospect - epic study was approved by the institutional review board of the university medical center utrecht , and the morgen project was approved by the medical ethics committee of tno , the netherlands ( 13 ) . analyses were performed in two subsets composed of epic - nl participants , in whom all mets features were measured : the epic - nl case - cohort study ( 13 ) and a subset of epic - nl morgen participants ( 14 ) . the epic - nl case - cohort study consists of a subcohort , i.e. , 6.5% baseline random sample of the total epic - nl study ( n = 2,604 ) , all incident diabetes cases ( n = 924 ) , and all incident cvd cases ( n = 2,030 ) . by virtue of the random selection of a subcohort and use of the appropriated statistics for this type of research design , the results are expected to be generalizable to the entire cohort ( 15 ) . in the epic - nl case - cohort study , in addition to information on traditional mets features , information on nontraditional mets features , such as high - sensitivity c - reactive protein ( hscrp ) , was available . the epic - nl morgen subset was used as a replication sample for the analysis on model fit . this subset consists of 1,379 nondiabetic participants , who indicated that their last meal was on the day before blood sampling . in contrast to the epic - nl case - cohort study , plasma glucose was measured instead of hba1c , while information on nontraditional mets features was not available . participants with missing blood samples ( 157 participants in the random sample , 174 incident cvd case subjects , and 66 incident type 2 diabetes case subjects ) , participants who were taking glucose - lowering or blood pressure lowering medication ( 282 participants in the random sample , 409 incident cvd case subjects , and 279 incident type 2 diabetes case subjects and 46 participants of the morgen subset ) or participants with missing values for one of the mets or mets - related features ( 237 participants in the random sample , 34 incident diabetes case subjects , and 135 incident cvd case subjects ) were excluded ( supplementary fig . subjects with missing blood samples were on average 2.4 years older and had a 1.1 kg / m higher bmi than those without missing blood samples . age and bmi were similar between subjects with and without missing values for one of the mets or mets - related features . finally , the epic - nl case - cohort study consisted of 545 incident diabetes case subjects , 1,312 incident cvd case subjects , and 1,928 participants in the random sample . of the random - sample participants , 53 were incident type 2 diabetes case subjects and 88 were incident cvd case subjects . an overlap between the case set and the random sample is a design feature of a case - cohort study . for the risk prediction analyses , the epic - nl morgen subset consisted of 1,333 participants , including 133 participants who were also included in the epic - nl case - cohort study . the ascertainment and verification of diabetes cases has previously been described in detail ( 16 ) . in short , diabetes was ascertained via self - report , a urinary glucose strip test , and linkage to registers of hospital discharge diagnoses . self - reported diabetes status was assessed in the baseline questionnaire and in two follow - up questionnaires , which were sent out at regular intervals of 35 years . for prospect participants only , a urinary glucose strip was sent out with the first follow - up questionnaire . follow - up by linkage to registers of hospital discharge diagnoses was completed on 1 january 2006 . potential cases were verified against participants ' general practitioner or pharmacist information . only verified type 2 diabetes cases were included . coronary heart disease ( chd ) was coded with icd-9 codes ( 410414 ) or with icd-10 codes ( i20i25 ) , and cerebrovascular accident ( cva ) was coded with icd-9 codes ( 430434 and 436 ) or with icd-10 codes cvd was defined as the presence of chd , cva , or both ( 17 ) . the study protocol of the epic - nl morgen study and the study protocol of the epic - nl prospect study were essentially similar . at baseline , a physical examination was performed and nonfasting blood samples were drawn . furthermore , a general questionnaire and a food frequency questionnaire ( ffq ) were filled out by each participant ( 13 ) . the protocol for the anthropometric measurements and the blood sampling protocol were identical for the epic - nl prospect and the epic - nl morgen studies . body weight was measured with light indoor clothing without shoes on to the nearest 100 g. during the physical examination , systolic and diastolic blood pressure measurements were performed twice in the supine position on the right arm using a boso oscillomat ( bosch & son , jungingen , germany ) ( prospect ) or twice on the left arm using a random zero sphygmomanometer ( morgen ) . triglycerides , alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , glutamyltransferase ( ggt ) , uric acid , and glucose were measured using enzymatic methods , whereas hscrp was measured with a turbidimetric method . these assays were all performed on an autoanalyzer ( lx20 ; beckman coulter , mijdrecht , the netherlands ) ( 13,14 ) . data on smoking habits , educational level , self - reported medication use , physical activity , and alcohol intake were obtained by general questionnaires and an ffq . triglycerides , hscrp , alt , ast , and ggt were log transformed to improve normality . using cfa , we designed several second - order one - factor mets models based on the mets model of shen et al . ( 9 ) consisting of three levels : a single mets factor ; several first - order factors ( e.g. , lipids ) , which defined the single mets factor ; and some second - order factors ( e.g. , triglycerides and hdl cholesterol ) , which defined the first - order factors . we designed the following one - factor mets models : model 1 , a standard mets model , based on the current definition of mets ( 1 ) , including the traditional mets features , i.e. , waist circumference , triglycerides , hdl cholesterol , systolic blood pressure , diastolic blood pressure , and as marker of glucose status , either hba1c or glucose ( fig . 1a and b ) ; model 2 , a standard mets model excluding the blood pressure factor ; and model 3 , a standard mets model extended with an hscrp factor ( fig . 1c ) , an albumin factor , a uric acid factor , or a liver enzymes factor . the liver enzymes factor was a first - order factor defined by the second - order factors alt , ast , and ggt . in all models , the factor variance of the mets factor , the factor loading of triglycerides , and the factor loading of systolic blood pressure were fixed to 1 . for model 3 , the mets model excluding blood pressure , not enough df were available to calculate model fit . therefore , the error variance of the factor with the highest factor loading ( waist circumference ) was fixed to 1 for the model fit calculations of this model . a : the standard second - order one - factor mets model in the random sample of epic - nl . b : the standard second - order one - factor mets model in the subset of the morgen study . c : the standard second - order one - factor mets model extended with hscrp in the random sample of epic - nl . the first - order factors are waist circumference ( wc ) , lipids , hba1c , fpg , and blood pressure . the second - order factors are triglyceride ( tg ) , hdl , systolic blood pressure ( sbp ) , and diastolic blood pressure ( dbp ) . model fit of mets models composed of traditional mets features was calculated in the random sample of epic - nl and in the epic - nl morgen subset . model fit of mets models including nontraditional features was calculated only in the random sample of epic - nl . we compared the model fit of all alternative mets models with the model fit of the standard one - factor mets model ( model 1 ) . the test , the comparative fit index ( cfi ) , the standardized root means square residual ( srmr ) , and the root mean square error of approximation ( rmsea ) were used to assess model fit . models with rmsea > 0.10 , cfi < 0.95 , or srmr > 0.08 were rejected ( 19 ) . the difference test was used to compare model fit across different models . for mets models with an acceptable model fit , we compared the predictive ability of the factor scores for incidence of type 2 diabetes , cvd , chd , and cva in the epic - nl case - cohort study . we calculated the factor scores using the factor score coefficients of the different mets features extracted by the regression method from the random sample . all factor score coefficients were standardized to the means and ses of the mets features in the random sample . for all factor scores , we calculated cox proportional hazard ratios ( hrs ) , c statistics , and integral discrimination indices ( idis ) for incidence of type 2 diabetes , cvd , chd , and cva . hrs were adjusted for the overrepresentation of cases in the case - cohort study with a pseudolikelihood method ( 20 ) , whereas idis and c statistics were adjusted for this overrepresentation by inverse probability weighing . hrs were calculated per sd of the factor score and adjusted for age , sex , cohort , smoking ( current , former , and never ) , educational level , cambridge physical activity index , and alcohol intake . the change in c statistics and the idis were used to compare predictive ability of the standard mets model , model 1 , with the alternative models . the c statistic is equivalent to the probability that the predicted risk is higher for a case than for a noncase subject ( 21 ) . the idi can be viewed as the difference in the proportion of variance explained by two models ( 22 ) . cfa analyses were performed in mplus , sixth edition ( muthn & muthn , los angeles , ca ) . hrs , c statistics , and idis were calculated in sas version 9.2 ( sas institute , cary , nc ) . participants in the epic - nl case - cohort study were on average 51.8 years old , and 28.5% was male . mets prevalence was higher in incident diabetes case subjects ( 70.5% ) and incident cvd case subjects ( 38.6% ) than in the random sample ( 21.2% ) . in the morgen subset , participants were on average 39.1 years old , and 50.5% was male . mets prevalence was somewhat lower ( 14.9% ) than in the random sample of epic - nl ( 21.2% ) . baseline characteristics of the epic - nl study the standard one - factor mets model ( model 1 ) ( fig . 1a and b ) , which is based on the current definition of mets , had an acceptable model fit with a cfi of 0.95 ( table 2 ) . other one - factor mets models with a good model fit were the mets model excluding blood pressure ( model 2 ) and the mets model extended with hscrp ( model 3 ) ( fig . the cfis of one - factor mets models extended with uric acid , liver enzymes , or albumin were < 0.95 , indicating that their model fit was unacceptable . these extended mets models also did not fit well after the exclusion of the blood pressure factor ( data not shown ) . compared with the standard mets model ( model 1 ) , the standard mets model excluding blood pressure ( model 2 ) fitted better , whereas the model extended with hscrp ( model 3 ) fitted worse . model fit indices of several mets models in the random sample of the epic - nl study and in a subset with participants of the morgen study hrs for type 2 diabetes ( hr 2.71 [ 95% ci 2.303.18 ] ) and cvd ( 1.25 [ 1.131.39 ] ) were lowest in the mets model excluding blood pressure ( model 2 ) , whereas they were highest in the mets model extended with hscrp ( type 2 diabetes hr 3.94 [ 3.284.74 ] ; cvd 1.28 [ 1.161.42 ] ) ( table 3 ) . hrs were essentially similar after additional adjustment for fiber and energy intake ( data not shown ) . of all mets models , the model extended with hscrp ( model 3 ) predicted type 2 diabetes , chd , cva , and cvd the best ( type 2 diabetes c index 0.8013 ; cvd c index 0.6352 ) . for all models , the hosmer - lemeshow test was not significant , indicating a good calibration . we have examined the factor structure of mets using cfa in two population - based study samples . the good model fit of the standard one - factor mets model , representing the current definition , indicated that it is valid to compose one entity out of the traditional mets features . when the standard mets model was extended with hscrp , predictive ability for type 2 diabetes and cvd increased slightly , while model fit was still acceptable . in line with the results of previous cfa studies ( 79 ) , we found that it is valid to compose one entity , i.e. , one factor out of the five traditional mets features . the model fit of a one - factor mets model , composed of the traditional mets features , was even better after exclusion of the blood pressure factor . this is consistent with other studies indicating that blood pressure is distinct from the other traditional mets features , both from a physiological ( 23 ) and a statistical point of view . for example , blood pressure generally has the lowest factor loading in cfa mets models ( 711 ) . furthermore , blood pressure is identified as a separate factor in most efa studies ( 6 ) . although omitting the blood pressure factor improved model fit , it also considerably decreased the predictive ability for type 2 diabetes , cva , and chd . since this predictive ability is of clinical relevance , removal of blood pressure from the mets definition is questionable . of the one - factor mets models extended with nontraditional mets features , only the mets model extended with hscrp had an acceptable model fit . in 645 non - hispanic whites or african americans , an essentially similar mets model also had a good model fit ( 8) . in our data , the mets model extended with hscrp predicted type 2 diabetes , cva , and chd slightly better than the standard mets model . in contrast to type 2 diabetes and cva , the improvement in c index was not significant for chd . this suggests that in our data , the improvement in c index for cvds is mainly driven by the improvement for cva . in two large prospective cohort studies , though our findings are in line with these previous studies , the addition of hscrp to mets was clinically relevant in the earlier reports but not in our study . the reason for this discrepancy might be explained by a difference in study population ; e.g. , in our study compared with the previous studies , hscrp levels were lower . part of the added predictive power of hscrp may be explained by the association of hscrp with insulin resistance and fibrinolysis . both increase the risk of type 2 diabetes and cvd but are not included in the current definition of mets ( 26 ) . in our study , the model fit of other one - factor mets models extended with additional features , i.e. , albumin , liver enzymes , or uric acid , was not acceptable . to the best of our knowledge , models extended with albumin or liver enzymes have not previously been studied . our results are , however , in line with several efa studies ( 2427 ) . contrary to our results , among 410 spanish participants a one - factor mets model extended with uric acid had a very good model fit ( cfi 0.99 ) ( 4 ) . the relatively low factor loading of mets features strongly associated with uric acid , such as glucose ( 28 ) , may explain the bad model fit of the model extended with uric acid in our data . the strength of our study was the hypothesis - driven cfa approach , which we used to compare the model fit of a standard mets model with several modified mets models . furthermore , we tested the model fit of the mets models in two relatively large study samples , and results were very similar . we have adjusted the hrs for several lifestyle factors . as the hrs were similar before and after adjustment , the confounding effect of these lifestyle factors was probably small . the use of nonfasting triglycerides and hba1c instead of the conventional mets features , i.e. , fasting triglycerides and glucose , in the epic - nl case - cohort study may have affected model fit . as postprandial triglyceride levels are more strongly correlated with the other mets features than fasting triglyceride levels ( 29 ) , the use of postprandial triglycerides levels may have improved model fit and increased the factor loadings of the lipid factor in the epic - nl case - cohort . in contrast , for most mets features the correlations with hba1c and fasting plasma glucose were similar in 160 epic - nl participants with both measurements available . only the correlation of waist circumference and hba1c was weaker than the correlation of waist circumference and fasting plasma glucose . this weak correlation resulted in a relative low factor loading for the glucose factor ( based on hba1c ) and perhaps in somewhat lower model fit . however , although nonfasting triglycerides and hba1c were used in the epic - nl case - cohort study , conclusions regarding model fit in the epic - nl case - cohort study were similar to the morgen subset in which fasting plasma glucose and triglycerides were used . compared with fasting plasma glucose , therefore , inclusion of hba1c instead of fasting glucose in the epic - nl mets models has most likely increased predictive ability . however , as this applies to all mets models , the comparisons between the different mets models would probably have yielded similar conclusions if fasting plasma glucose had been included . moreover , as fasting plasma glucose levels were not available , we may have missed some undiagnosed type 2 diabetes cases . underestimation of diabetic cases may have weakened the associations with diabetes we found in epic - nl . the participants ( 7% ) we excluded from the epic - nl case - cohort owing to missing blood samples had on average a 1.1 kg / m higher bmi . as the correlations between waist circumference and other mets features were slightly higher in the group with missing blood samples , exclusion of these participants may have resulted in somewhat lower factor loadings for the waist circumference factor . additionally , the two datasets we used were not completely independent , as 133 subjects were present both in the epic - nl case - cohort study and in the morgen subset . however , when we excluded these 133 participants from the morgen subset , results were essentially similar . finally , in order to be able to estimate model fit of the mets model excluding blood pressure , we fixed the error variance of waist circumference in this model to one . this fixation has probably worsened the model fit . therefore , we may have underestimated the improvement in model fit obtained by deleting the blood pressure factor . in conclusion , it is valid to compose out of the traditional mets features one entity and consequently to view mets as a single disorder . a model additionally including hscrp still represented a single entity and predicted type 2 diabetes , cva , and chd somewhat better than a mets model with only the traditional features . cfa mets models , like ours , including the traditional mets features and possibly hscrp may be used as the basis to develop a new continuous mets definition with differential weights for the different mets features , using an approach described by hillier et al .

objectivemetabolic syndrome ( mets ) is a cluster of abdominal obesity , hyperglycemia , hypertension , and dyslipidemia , which increases the risk for type 2 diabetes and cardiovascular diseases ( cvds ) . some argue that mets is not a single disorder because the traditional mets features do not represent one entity , and they would like to exclude features from mets . others would like to add additional features in order to increase predictive ability of mets . the aim of this study was to identify a mets model that optimally predicts type 2 diabetes and cvd while still representing a single entity.research design and methodsin a random sample ( n = 1,928 ) of the epic - nl cohort and a subset of the epic - nl morgen study ( n = 1,333 ) , we tested the model fit of several one - factor mets models using confirmatory factor analysis . we compared predictive ability for type 2 diabetes and cvd of these models within the epic - nl case - cohort study of 545 incident type 2 diabetic subjects , 1,312 incident cvd case subjects , and the random sample , using survival analyses and reclassification.resultsthe standard model , representing the current mets definition ( epic - nl comparative fit index [ cfi ] = 0.95 ; morgen cfi = 0.98 ) ; the standard model excluding blood pressure ( epic - nl cfi = 0.95 ; morgen cfi = 1.00 ) ; and the standard model extended with hscrp ( epic - nl cfi = 0.95 ) had an acceptable model fit . the model extended with hscrp predicted type 2 diabetes ( integral discrimination index [ idi ] : 0.34 ) and cvd ( idi : 0.07 ) slightly better than did the standard model.conclusionsit seems valid to represent the traditional mets features by a single entity . extension of this entity with hscrp slightly improves predictive ability for type 2 diabetes and cvd .

sitting and rising from the floor is a basic functional task which requires appropriate levels of muscle strength , joint coordination , balance and flexibility . after stroke , decreased muscle strength , impaired postural control and asymmetrical limb loading may cause functional decline , and affect activities such as rising from a sitting position1 . previous studies have reported that people with stroke are two times more prone to falls than older adults in general2 . people with stroke often experience difficulty in rising from the floor after falling3 , and morbidity may result from being unable to rise from the floor4 . thus , the ability to get up from the floor is especially vital for patients with stroke . the sitting - rising test ( srt ) is a simple test which was developed to evaluate the ability to sit and rise from the floor5 , 6 . the srt objectively quantifies the number of supports ( ie , hand or knee ) needed and the presence or absence of stability in the actions5 . the maximum score is 10 , and points are deducted for additional hand support or loss of balance . srt scores have been shown to have high reliability in assessing healthy subjects5 , 6 . therefore , the srt is also a potentially useful test for assessing the ability of sitting and rising from the floor of people with chronic stroke . although the srt may be useful for assessing chronic stroke patients , evidence for its reliability and validity in chronic stroke cases is still lacking . it is not known whether srt can reflect the impairment , activity and participation levels of people with chronic stroke . therefore , this study was designed to investigate the inter - rater and test - retest reliabilities of srt scores , the correlation of srt scores with measures of muscle strength , balance , functional mobility , community integration and quality of life , and the cut - off score which best differentiates healthy subjects from people with chronic stroke . a sample size calculation showed that a total of 29 subjects could deliver 80% power of detecting an intra - class correlation coefficient ( icc ) of 0.8 under the alternative hypothesis , and an icc of 0.6 under the null hypothesis with 0.05 as the significance level . thirty people with chronic stroke ( 23 males , 7 females ; mean age 61.7 years , sd 6.1 years ; mean post - stroke duration 7.9 years , sd 3.1 years ) were recruited from a local stroke self - help organization . the inclusion criteria were : a single stroke more than 12 months previously ; a score of 7 or higher in the abbreviated mental test ( amt ) ; and a medical condition suitable for the research . subjects with other neurological conditions such as spinal cord injury or parkinson s disease , or other limiting disabilities such as arthritis or cataract were excluded . thirty healthy older adults ( 11 males , 19 females ; mean age 64.2 years , sd 7.3 years ) were recruited at a local community centre via a poster advertisement . all study protocols were approved by the ethics committee of the hong kong polytechnic university and met the guidelines of the declaration of helsinki . prior to the test , the purpose and procedures of the study were explained to all eligible subjects , and all gave their written consent to participation in the study . each subject with stroke was assessed by 2 independent assessors ( assessor a and assessor b ) for the analysis of the inter - rater reliability . the stroke subjects were also required to attend another assessment session 7 days after the first session ( day 1 and 2 ) for the determination of the test - retest reliability . the healthy older adults performed the srt only once and their data was used to determine the cut off score . flow chart showing the data collection procedures apart from the srt , the subjects with stroke were also required to complete ankle plantarflexor ( pf ) and dorsiflexor ( df ) muscle strength tests , the fugl - meyer assessment for the lower limbs ( fma - ll ) , the berg balance scale ( bbs ) test , the timed up and go test ( tug ) , the five times sit - to - stand test ( ftsts ) , and the limits of stability test ( los ) , as well as complete the community integration measure ( cim ) , and the short - form 12 health survey ( sf-12 ) . the testing order was randomized by drawing lots , and 2-minute rests were given between each test to reduce fatigue . it was conducted on a flat and non - slippery surface . to ensure a clear view , the assessors stood in front of the subjects to score . prior to the test , the assessors gave the following instruction : without worrying about the speed of movement , try to sit and then to rise from the floor , using the minimum support that you believe is needed6 . the sitting and rising maneuvers have maximum scores of 5 points , respectively , with a maximum possible total of 10 points . the highest sitting and rising scores were added to obtain the total srt score . one point was deducted for placing a hand , forearm , knee , or the side of the leg on the floor for support , or if the participant put his / her hand on the knee to facilitate rising or sitting . half a point was deducted if the evaluator perceived partial loss of balance at any time during the maneuver . crossing the legs during the test was allowed , but the participants were told not to use the side of feet for support . each subject repeated the test twice in each session , once in front of each examiner5 , 6 . lying , the subjects were asked to press maximally on the dynamometer using their ankles in dorsiflexion and plantarflexion . the fma - ll was used to assess synergy , reflexes and coordination of the lower limbs8 . the assessment consists of 17 items , which are scored on a 3-point ordinal scale ( 0=cannot perform , 1=can partially perform , 2=can fully perform ) , with a maximum score of 34 points . the fma - ll has excellent inter - rater reliability for subjects with chronic stroke ( icc=0.93)9 , 10 . it has high inter - rater and intra - rater reliabilities ( icc=0.980.99 ) for people with stroke12 . the ftsts was used to quantify the functional muscle strength of the lower limbs . the time in seconds required to complete 5 full stands from a sitting position was recorded . subjects rise from a chair and walk along a 3-metre path as fast as possible . a smart balance master system was used to quantify the maximum distance that each subject could shift their center of gravity ( cog ) without losing balance . reaction time ( rt ) , movement velocity ( mvl ) and maximum excursion ( mxe ) were measured . rt refers to the time between the appearance of the movement signal and the first initiation of movement . mvl is the average speed of cog displacement from the first movement to attaining the target . mxe is the maximum displacement of the cog expressed as a percentage of the distance to the target . the los test has good test - retest reliability ( icc=0.780.91 ) for patients with stroke15 , 16 . the 10 items are scored using a five - point scale and summed , giving scores from 10 to 50 . the cim has been shown to have good internal consistency ( cronbach s alpha = 0.87)17 . the sf-12 has good test - retest reliability for both its physical ( icc=0.88 ) and mental ( icc=0.92 ) components19 . descriptive statistics were compiled describing the characteristics of the stroke survivors and the controls . pearson or spearman correlation coefficients , depending on the normality of the data , were calculated to examine the significance of relationships between the srt scores and the other outcome measures . intra - class correlation coefficients , icc2,2 and icc3,2 , were used to quantify the inter - rater reliability and test - retest reliability respectively . model 2 icc considers both the assessors and the subjects as random effects , while model 3 icc considers only one of them as random20 . receiver operating characteristic ( roc ) curves were plotted to determine the cut - off srt score which best distinguished between the healthy controls and the subjects with chronic stroke . true - positive and false - positive probabilities are indicated by the sensitivity and specificity , respectively . a trade - off between 1 minus specificity and sensitivity is indicated by youden s index , which was used to determine the optimal cut - off score . the area under the roc curve ( auc ) measures the accuracy of the cut - off score quantitatively based on the null hypothesis of auc=0.520 . the descriptive statistics describing the characteristics of the subjects are presented in table 1table 1.descriptive statistics of the subjects with stroke and healthy older adultssubjects with stroke ( n=30)healthy older adults ( n=30)gender , n ( % ) male23 ( 76.7)11 ( 36.7)female7 ( 23.3)19 ( 63.3)age , years , mean ( sd)61.7 ( 6.1)64.2 ( 7.3)height , cm , mean ( sd)165.5 ( 7.11)161.3 ( 9.53)weight , kg , mean ( sd)68.3 ( 9.03)58.0 ( 10.42)bmi , kg / m , mean ( sd)24.9 ( 2.77)22.3 ( 3.55)post stroke duration , years , mean ( sd)7.94 ( 3.06)n / aaffected side , n ( % ) n / aleft18 ( 60)right12 ( 40)nature of stroke , n ( % ) n / aischemic22 ( 73.3)hemorrhagic 8 ( 26.7)number of falls in the past 6 months , mean ( sd)0.13 ( 0.35)0.13 ( 0.43)mobility status , n ( % ) unaided18 ( 60)30 ( 100)stick 12 ( 40)0amt total score , mean ( sd)9.63 ( 0.62)n / asrt score , mean ( sd)sitting score3.32 ( 0.84)4.4 ( 0.52)rising score2.99 ( 0.95)4.23 ( 0.68)total score6.30 ( 1.66)8.63 ( 1.09)sd : standard deviation ; bmi : body mass index ; amt : abbreviated mental test ; srt : sitting - rising test ; n / a : not available . the mean values for the outcome measures are presented in table 2table 2.mean values of all the outcome measures of the subjects with strokeoutcome measuresrt score , mean ( sd ) ( full sitting score : 5 ; sitting scorerising scoretotal scorefull rising score : 5 ; full total score : 10)day 1 rater a3.37 ( 0.87)3.12 ( 0.90 ) 6.48 ( 1.71)day 1 rater b3.35 ( 0.79 ) 2.82 ( 1.01 ) 6.17 ( 1.70)day 2 rater a3.28 ( 0.87 ) 3.07 ( 0.92 ) 6.35 ( 1.58)day 2 rater b3.27 ( 0.86 ) 2.95 ( 0.98 ) 6.22 ( 1.72)muscle strength of lower limb , kg , mean ( sd)ankle df ( affected side)9.29 ( 4.74)ankle pf ( affected side ) 9.87 ( 6.85)ankle df ( unaffected side)14.09 ( 3.64)ankle pf ( unaffected side)13.80 ( 5.86)fma - ll score , median ( iqr ) ( full score : 34)26.5 ( 6.25)bbs score , median ( iqr ) ( full score : 56)54 ( 2.25)tug time , s , mean ( sd)15.80 ( 5.16)ftsts time , s , mean ( sd)19.78 ( 6.78)los rt , s , mean ( sd)forward1.32 ( 0.60)backward1.09 ( 0.65)unaffected side1.13 ( 0.45)affected side1.20 ( 0.71)los mvl , m / s , mean ( sd)forward2.29 ( 1.42)backward2.63 ( 1.34)unaffected side4.16 ( 1.98)affected side3.85 ( 1.96)los mxe , % , mean ( sd)forward58.17 ( 13.90)backward54.40 ( 17.76)unaffected side78.77 ( 12.50)affected side74.23 ( 16.63)cim score , median ( iqr ) ( full score : 50)46 ( 10.25)sf-12 ( pcs ) , median ( iqr)43.5 ( 14)(full score : 100)sf-12 ( mcs ) , median ( iqr)51 ( 18.25)(full score : 100)srt : sitting - rising test ; tug : timed up and go test ; ftsts : five times sit - to - stand test ; bbs : berg balance scale ; fma - ll : fugl - meyer assessment ( lower extremity ) ; los : limit of stability ; rt : reaction time ; mvl : movement velocity ; mxe : maximal excursion ; df : dorsiflexion ; pf : plantar flexion ; cim : community integration measure ; sf-12 : the 12-item short form health survey ; pcs : physical component score ; mcs : mental component score ; sd : standard deviation ; iqr : inter - quartile range . table 3table 3.reliability of the srt scores of the subjects with strokereliabilityraterdayscoreicc ( 95% ci)inter - rater reliabilityicc ( 2,2)a , b1sitting0.965 ( 0.9260.983 ) rising0.932 ( 0.8560.967 ) total0.967 ( 0.9310.984 ) 2sitting0.967 ( 0.9310.984 ) rising0.872 ( 0.7300.939 ) total0.950 ( 0.8950.976 ) test - retest reliabilityicc ( 3,2)a12sitting0.863 ( 0.7130.935 ) rising0.679 ( 0.3260.847 ) total0.846 ( 0.6750.926 ) bsitting0.837 ( 0.6580.923 ) rising0.815 ( 0.6100.912 ) total0.858 ( 0.7020.933 ) srt : sitting - rising test ; icc : intra - class correlation coefficient ; 95% ci : 95% confidence interval ; sd : standard deviation shows that the inter - rater reliability was excellent ( icc=0.8720.967 ) , and the test - retest reliability was good ( icc=0.6790.863 ) . the test - retest reliability for the rising score of rater a was slightly lower than that of rater b ( icc=0.679 ) . sd : standard deviation ; bmi : body mass index ; amt : abbreviated mental test ; srt : sitting - rising test ; n / a : not available srt : sitting - rising test ; tug : timed up and go test ; ftsts : five times sit - to - stand test ; bbs : berg balance scale ; fma - ll : fugl - meyer assessment ( lower extremity ) ; los : limit of stability ; rt : reaction time ; mvl : movement velocity ; mxe : maximal excursion ; df : dorsiflexion ; pf : plantar flexion ; cim : community integration measure ; sf-12 : the 12-item short form health survey ; pcs : physical component score ; mcs : mental component score ; sd : standard deviation ; iqr : inter - quartile range srt : sitting - rising test ; icc : intra - class correlation coefficient ; 95% ci : 95% confidence interval ; sd : standard deviation table 4table 4.correlations between the srt scores and the other outcome measures ( n=30)outcome measuressitting scorerising scoretotal scorepearson s rpearson s rpearson s rmuscle strength of lower limbankle df affected side ave0.3010.455 * 0.392*ankle df affected side peak0.2780.449 * 0.377*ankle pf affected side ave0.1870.376 * 0.289ankle pf affected side peak0.2140.38 * 0.308fma - ll0.2520.280.28bbs total0.1560.2290.2ftsts ave0.2490.0130.133tug ave0.0550.1290.04los forwardrt0.0070.0570.034mvl0.1080.1110.065mxe0.0510.060.094los unaffected side rt0.1570.130.384*mvl0.416*0.404*0.049mxe0.0490.0320.008los backwardrt0.1280.1380.138mvl0.1020.0710.089mxe0.2040.0010.103los affected sidert0.1050.0350.035mvl0.0940.110.106mxe0.0120.0790.047cim0.3270.3030.325sf-12 ( pcs ) 0.020.020.001sf-12 ( mcs ) 0.2870.280.293*significant at the 5% level of confidence.fma-ll : fugl - meyer motor assessment for the lower limbs ; ftsts : five times sit - to - stand test ; bbs : berg balance scale ; tug : timed up and go test ; los : limit of stability ; df : dorsiflexion ; pf : plantar flexion ; rt : reaction time ; mvl : movement velocity ; mxe : maximal excursion ; ave : average ; cim : community integration measure ; sf-12 : the 12-item short form health survey ; pcs : physical component score ; mcs : mental component score shows the correlations between srt scores and the other outcome measures . since all the variables were normally distributed , pearson correlation coefficients were used . among the stroke subjects , srt rising scores correlated significantly with both df and pf strength of the ankle on the affected side . the srt total score also correlated significantly with ankle pf strength on the affected side . both sitting and rising scores only demonstrated significant correlation with maximal velocity toward the unaffected side in the los test . however srt scores did not correlate significantly with fma - ll scores , bbs scores , ftsts times , tug times , other los measures , cim scores or sf-12 scores . * fma - ll : fugl - meyer motor assessment for the lower limbs ; ftsts : five times sit - to - stand test ; bbs : berg balance scale ; tug : timed up and go test ; los : limit of stability ; df : dorsiflexion ; pf : plantar flexion ; rt : reaction time ; mvl : movement velocity ; mxe : maximal excursion ; ave : average ; cim : community integration measure ; sf-12 : the 12-item short form health survey ; pcs : physical component score ; mcs : mental component score a total srt score of 7.8 was found to best differentiate healthy controls and subjects with stroke with high levels of stroke - specific impairments ( both sensitivity and specificity 80.0% ; auc=0.89 ; p0.0001 ) . a cut - off score of 3.9 for either component was also found to differentiate well between both groups ( sitting score : sensitivity 90.0% , specificity 66.7% , auc = 0.87 , p0.0001 ) ; rising score : both sensitivity and specificity 80.0% , auc=0.86 , p0.0001 ) . our subjects showed the expected decline in srt score with age9 . according to a previous study , subjects 71 years old ( 7.0 ) normally have srt scores of 0 to 3 , while those 59 years old ( 6.3 ) typically score 8 to 10 points6 . the mean age of subjects was about 57 for scores lower than 7.5 , and about 44 for scores below 96 . older adults are likely to use hand support to overcome problems such as muscle weakness and poor balance . this is expected , as physical function21 , muscle strength22 , 23 , and postural stability24 decline with age . the subjects with chronic stroke studied here had a mean age of 61.73 and a mean srt score of 6.2 . subjects with a mean age of 61 had mean srt scores of 7.58 in a previous study6 . the difference between these results presumably reflects the impaired motor control and balance of the chronic stroke subjects . residual brain lesions affect the activation of motor neurons , reducing their mean discharge rate25 . the recruitment threshold and range this is the first study to have examined the reliability of the srt in assessing subjects with chronic stroke . the inter - rater and test - retest reliabilities were both high , indicating that the test is reliable for assessing the quality of movement in sitting and rising from the floor . this probably results from the test s simple , clear design which allows the assessor to follow the performance with ease . a week was given to minimize fatigue and learning effects and to ensure true performance . however , a slightly lower test - retest reliability was found for the rising score of rater a. since the test - retest reliability for all the other conditions was high , it is likely that this was caused by a random error during the assessment . the rising scores significantly correlated with the strength of the ankle dorsiflexors and plantarflexors ( r = 0.376 and 0.455 respectively ) . when standing up , the ankle plantarflexors work concentrically while the dorsiflexors contract eccentrically27 . excellent ankle strength is required to stand from sitting on the floor without using the hands and without swaying or losing balance1 . it is surprising that there was no significant correlation between the srt scores and fma scores , since the fma assesses motor control of the lower limbs . a possible reason for the absence of correlation is that the srt involves closed - chain actions with the feet on the ground , while the fma involves open - chain actions in lying or sitting . also , the srt involves complex movements while the fma uses simple movements only28 . it was rather unexpected that tug times and ftsts times did not correlate with the srt scores , since both tests involve sitting and rising . a possible explanation for this is that the tug and ftsts tests use time as the performance measure while the srt assesses the quality of movement . furthermore , tug times29 and ftsts times30 correlate significantly with balance , while the srt may not demand good balance . it was also surprising that bbs scores did not correlate with srt scores , because some of the tasks involved are similar . bbs item ( 1 ) is a sit - to - stand maneuver , and item ( 4 ) is sitting from standing . however , some of the bbs tasks take time into account , while srt only measures the quality of movement . bbs also includes other items assessing balance in activities such as turning and reaching which would dilute any relationship . the lack of a significant correlation again suggests that perhaps subjects do not actually need good balance to achieve high srt scores . it was expected that there would be no significant correlation between srt scores and the los results . the los test includes reaction time , speed and maximal excursion , none of which clearly relate to movement quality in rising from the floor . this is not unexpected , as rising from the floor is not closely related to the whole picture of a person s quality of life or their community integration as measured by the sf-12 and cim , respectively . this study is the first to have investigated the optimal cut - off score to distinguish healthy older adults from people with chronic stroke . a cut - off srt total score of 7.8 was found to best differentiate the healthy subjects from subjects with more severe stroke - specific impairments . the auc of 89.3% indicates the probability of correctly identifying subjects suffering from stroke - specific or related impairments using the srt . the srt mainly examines the quality of movement and degree of using hand support in sitting and rising movements , but the other outcome measures chosen for examining correlations with srt only examine factors potentially affecting mobility , such as muscle strength and balance . speed is also often a chosen outcome measure , while the speed of completing the sitting - rising movement is not considered in the srt . speed may be a factor affecting the performance of daily activities by people with chronic stroke . the sample size may have been insufficient to detect significant correlations between srt scores and the other outcome measures . the majority of the stroke subjects were males , which presumably created a gender bias . gender may predict muscle strength31 and functional task performance32 , and both would be expected to affect srt performance . furthermore , all the stroke subjects were recruited from a stroke self - help organization , which may have reduced the generalizability of the results . the stroke subjects generally had better mobility than the average stroke survivor , indicating that their srt performance might also be untypical . future studies should recruit a more diverse stroke group with a larger sample size and better gender balance to enable generalization of the results to the overall stroke population . finally , the cut - off score established was merely a distinction between healthy older adults and subjects with severe stroke - related impairments . it did not reflect the difference in srt performance in relation to stroke severity , which would presumably be the test s clinical implication . future studies are warranted to further expand the knowledge of how the srt can best be applied in clinical practice . the srt is recommended for assessing people with chronic stroke in clinical practice as it is a simple and reliable test which assesses the ability to sit and rise from the floor . it has good inter - rater and test - retest reliability , as well as good sensitivity and specificity . a cut - off score of 7.8 can adequately differentiate healthy elderly subjects from those with more severe stroke - related impairments . studies with larger sample sizes and subjects with different mobility levels are warranted to further define the test s applicability .

[ purpose ] to investigate the inter - rater and test - retest reliability of the sitting - rising test ( srt ) , the correlations of sitting - rising test scores with measures of strength , balance , community integration and quality of life , as well as the cut - off score which best discriminates people with chronic stroke from healthy older adults were investigated . [ subjects and methods ] subjects with chronic stroke ( n=30 ) and healthy older adults ( n=30 ) were recruited . the study had a cross - sectional design , and was carried out in a university rehabilitation laboratory . sitting - rising test performance was scored on two occasions . other measurements included ankle dorsiflexor and plantarflexor strength , the fugl - meyer assessment , the berg balance scale , the timed up and go test , the five times sit - to - stand test , the limits of stability test , and measures of quality of health and community integration . [ results ] sitting - rising test scores demonstrated good to excellent inter - rater and test - retest reliabilities ( icc=0.679 to 0.967 ) . sitting - rising test scores correlated significantly with ankle strength , but not with other test results . the sitting - rising test showed good sensitivity and specificity . a cut - off score of 7.8 best distinguished healthy older adults from stroke subjects . [ conclusions ] the sitting - rising test is a reliable and sensitive test for assessing the quality of sitting and rising movements . further studies with a larger sample are required to investigate the test s validity .

mixed anxiety depression was initially introduced by overall and colleagues in 1966 and was later reported by paykel in 1971 ( 1 ) . patients with mixed anxiety - depressive disorder ( madd ) have a combination of both anxiety and depressive symptoms ( 2 ) . according to icd-10 , madd is considered when the patient suffers from symptoms of both anxiety and depression , but neither is predominantly significant , nor meets the diagnostic criteria as a separate disorder ( 3 ) . most trials in the literature have studied the effects of medications on significant depression or anxiety even though many patients do not full fill the criteria for these two psychiatric disorders . therefore studies on the effects of medications in patients with madd seem to be of importance . in a study by kara et al . ( 1 ) , it was noted that patients diagnosed with madd had less depressive and more anxiety symptoms when compared with those suffering major depressive disorder ( mdd ) . this study did not show any differences in the results of both dexamethasone suppression and thyroid function tests between the two groups . however , in madd patients , proportional over - activation of hypothalamic - pituitary - adrenal ( hpa ) axes was noted after stabilization of severe symptoms . the prevalence of madd is a subject of conflicts . the prevalence of madd in a study including 21,644 primary care patients in italy was about 1.8% ( 2 ) . based on the data in the netherlands mental health and incidence study , spijker et al . ( 4 ) reported a 12-month prevalence of madd of about 0.6% in the general population . it has been proposed that stressful life events are not the predisposing factors for madd ( 1 ) . the mainstay of pharmacotherapy in this disorder consists of combination of antidepressants and anxiolytics ( 5 ) . because of their better tolerability ( 6 ) , similarity in terms of efficacy and better safety in overdose , second - generation antidepressants including selective serotonin reuptake inhibitors ( ssris ) have gradually substituted tricyclic antidepressants ( tcas ) since mid-1980s and became the first - line medications for the treatment of depression ( 7 ) . in fact the introduction of ssris was the beginning of a great therapeutic era in psychopharmacology ( 8) . within a relatively short period of time ssris became the most dominant prescribed antidepressant medications in us market in 2005 and 60% of the medicaid covered prescription of antidepressants contained them . however , use of ssris in the treatment of madd has not been evaluated widely . since a considerable amount of total medical expenditure is made up of pharmaceutical expenditure , recently changing from more expensive brands to their generic drugs have been widely encouraged by authorities ( 9 - 11 ) ; this is considered a way to reduce healthcare expenditure ( 11 ) . for example in the united states of america , total budget devoted to antidepressants increased in a 13 year period ( 1991 - 2004 ) from 159 $ million to 2.26 $ billion but after the entrance of cheaper generic fluoxetine and paroxetine in 2001 and 2003 , respectively , this amount decreased to 1.99 $ billion in 2005 ( 6 ) . based on an international review of the literature , simoens performed a descriptive policy analysis regarding substitution of brand name drugs with their generics and reported that switching to generic drugs may decrease public expenditure on brand name drugs by 21% ( 12 ) . saving money by using generic drugs can be dedicated to the treatment of more patients and can provide resources for other treatment modalities ( 11 ) . this study aimed to compare the efficacy of branded citalopram , cipram manufactured by lundbeck pharmaceutical company with generic citalopram made by sobhan darou for the treatment of madd . lundbeck pharmaceutical company has been known as the first manufacturer of citalopram in the world . the patent of this drug has expired as of 2003 and as a result , this drug could be manufactured by other pharmaceutical companies under the related regulatory law ( 13 ) . according to the world health organization ( who ) , a generic product is a drug that is manufactured by an authorized manufacturer under nonproprietary or approved names ( 14 ) . who also mentions that a generic product may be marketed under its generic name or brand name citalopram made by sobhan darou ( 15 ) as a generic drug was selected for comparison with cipram in this study due to the reasonable number of prescriptions filled for this medication in iran . the present study was designed to compare the efficacy of cipram made by lundbeck with its generic citalopram made by sobhan darou in the treatment of madd . this 8-week , double - blind , randomized trial ( i d : irct201405127202n8 that was registered in www.irct.ir ) . adult patients who suffered madd based on the text revision of diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv - tr ) ( 16 ) were screened at the outpatient clinic of roozbeh hospital affiliated with tehran university of medical sciences from april 2006 through september 2007 . as shown below , the sample size of 40 patients ( 20 in each group ) was calculated to detect at least a change of 7 in mean ham - a or ham - d between the two groups at ( 2-sided ) = 0.05 and with a % power of 80 ( equation 1 ) , where d = m1 - m2 = 7 : patients were between 18 and 55 years old and had hamilton rating scale for depression ( ham - d ) and hamilton rating scale for anxiety ( ham - a ) scores of less than 24 . the exclusion criteria included history of other psychiatric disorders including personality disorders , mental retardation , organic brain syndrome , neurological disorders , unstable medical situations including cardiovascular , hepatic , renal , endocrine or hematological disorders , alcohol or drug dependence , having suicidal idea , pregnancy and lactation . patients who received antidepressants within 3 weeks prior to the initiation of the study as well as those who underwent ect within six months before the start of the trial were also excluded . besides , patients on other drugs that could affect depression or anxiety were excluded from the study . all patients provided written informed consent prior to study initiation . at their entry in the study , patients were randomized by permuted - blocked method to receive either citalopram or cipram. the medications were packed and labeled as group 1 or 2 in identical small paper bags by a pharmacy technician who was not aware of the study details . then , the daily dose was increased to 20 mg or higher based on the patients responses and tolerability . patients were assessed by using standardized , 21 item ham - d and ham - a at baseline , 4 and 8 weeks after starting medication . the mean differences in ham - d and ham - a scores from baselines were the basis of the main outcome measures of response to treatment . chicago , illinois , usa ) . paired student 's t - test and one - way repeated measures anova test were used as statistical tools to evaluate the differences between groups and differences in each group at baseline , 4 and 8 weeks after beginning of the study . twenty patients received citalopram and 20 received cipram in this study ( figure 1 ) . patients in the citalopram group received a mean dosage of 22 mg / day during the first 4 weeks and a mean dosage of 33 mg / day throughout weeks 4 to 8 . in the cipram group , patients received a mean dosage of 22 mg / day during the first 4 weeks and a mean dosage of 29 mg / day throughout weeks 4 to 8 . furthermore , no significant difference was noted between the two groups for baseline ham- d ( 18.35 2.03 vs. 18.05 2.06 ; p = 0.888 ) and ham - a ( 23.20 3.92 vs. 23.55 6.03 ; p = 0.933 ) scores between citalopram and cipram groups , respectively . using paired student 's t - test mean differences of ham - d scores between baseline and weeks 4 and baseline and week 8 in the citalopram group were 4.40 ( p < 0.001 ) and 7.95 ( p < 0.001 ) , respectively and mean difference between weeks 4 to 8 was 3.55 ( p < 0.001 ) . in cipram group the mean differences of ham - d scores between baseline and weeks 4 and 8 were 6.50 ( p < 0.001 ) and 9.95 ( p < 0.001 ) , respectively and mean difference between weeks 4 to 8 was 3.45 ( p < 0.001 ) . in terms of differences of ham - a in citalopram group these data obtained : mean differences of ham - a scores between baseline and weeks 4 , between baseline and weeks 8 and between weeks 4 to 8 was 5.05 ( p < 0.001 ) , 9.00 ( p < 0.001 ) and 4.00 ( p < 0.001 ) , respectively . mean differences of ham - a in cipram group at the same intervals were 8.35 ( p < 0.001 ) and 12.40 ( p < 0.001 ) and 4.05 ( p = 0.002 ) , respectively . therefore , these results showed a significant effect of both treatments on the ham - d and ham - a scales at the end of the fourth and eighth weeks of the study which supports the effectiveness of both treatment modalities after 8 week . one - way repeated measures anova on difference between mean differences in the ham - d and ham - a scales between 4th week of treatment and baseline showed significant differences between the two treatment groups ( table 2 ) . this significant difference was in favor of cipram in terms of reducing both depression and anxiety symptoms during the first month of therapy . interestingly the mean differences in ham - d and ham - a scores between groups were not significantly different at the end of week 8 which were assessed with the same test . thus , in both groups patients showed similar improvement in mean ham - d and ham - a scores at the end of 8 week in spite of the significant difference at the end of 4th week . the trend in reduction of ham - a and ham - d in both groups are shown in figure 2 and 3 respectively . citalopram is considered to have the most selective serotonin reuptake inhibition among ssris ( 8 , 17 ) . ssris originally were developed for the treatment of depression , depression ; however , with increased knowledge about the serotonin role in psychiatric disorders has led to the broader applications of these drugs in different disorders ( 6 ) . to the authors ' knowledge , the efficacy of ssris in the treatment of madd has not been evaluated widely in the treatment of madd . as mentioned above , both treatment modalities in our study significantly reduced the ham - a and ham - d at 8 week which shows citalopram efficacy in this disorder . the outcome of our study is in accordance with the study of carrasco et al . ( 5 ) who have evaluated sertraline in the treatment of madd . in that 8-week study , 29 out of 36 patients ( 76% ) were responders to sertraline . prescribing a generic drug instead of its brand - name may be potentially cost - saving ( 6 ) , however , concerns regarding several remarkable points may affect patients and health care providers trust in generic drugs negatively ( 18 ) . theoretically , a generic drug is a pharmaceutical product that is launched with no intellectual property or other protection after expiry date of the patent or other exclusive rights of the innovator product ( 19 ) . as a general rule the generic drug must contain the same active ingredient and be available with the same pharmaceutical dosage form and dose . also demonstration of the bioequivalence of the generic drug within an acceptable range with the original brand is required ( 20 ) . despite the lack of evidence for inferiority of generic drugs to their branded counterparts , many patients may resist changing from a brand name drug to its generic equivalent ( 10 ) . even some physicians may not believe in the same efficacy of the brand name and generic drugs . for example , physicians participated in a survey in finland , doubted the equivalency of certain generic medications in terms of efficacy and safety ( 11 ) . several other studies have expressed the existence of a controversy about equivalency of generic and brand drugs in terms of effects and safety in different illnesses ( 21 - 24 ) . in a case study of six patients with depression , yu et al . ( 25 ) reported that prozac was more effective and resulted in fewer side effects when compared to its generic fluoxetine . in our study , in spite of significant differences of both ham - d and ham - a between the groups at the end of week 4 in favor of cipram , no significant differences were noted at the end of week 8 . this can be interpreted as a more rapid onset of effects with cipram. however , the same efficacy is obtained with citalopram when the duration of treatment is long enough . since the cost benefit ratio is an important issue in selecting a medication for a patient , especially , someone who suffers from a chronic disorder , our study suggests that generic citalopram may be preferred over cipram to be initiated in most patients . moreover , it should be noted that patients receiving cipram were on the lower doses of the drug when compared with those who received generic citalopram . this may suggest that cipram in lower doses is as efficacious as higher doses of its generic . one important limitation in the present study was the fact that a small number of patients with a diagnosis of madd were compared in this trial . this study suggests that the efficacy of cipram and its generic drug seems to be similar in the treatment of madd after 8 weeks . however , cipram may reduce depression and anxiety quicker than its generic , citalopram . studies with a larger number of patients and for a longer duration may be needed to confirm the results of this study .

background : patients with mixed anxiety - depressive disorder ( madd ) suffer both anxiety and depression . antidepressants , especially , selective serotonin reuptake inhibitors are among agents of choice for treating this condition.objectives:this study compared the efficacy of cipram with its generic , citalopram.patients and methods : forty adult outpatients ( between 18 to 55 years of age ) with a diagnosis of madd who met the trial criteria , entered this double - blind , randomized study . subjects were assigned to receive either generic citalopram or cipram for 8 weeks . hamilton rating scale for depression ( ham - d ) and hamilton rating scale for anxiety ( ham - a ) were utilized to assess depression and anxiety at baseline , weeks 4 and 8 of the study . statistical analysis was performed using spss 14.0.results:twenty patients received citalopram ( mean dosages of 22 mg / day during the first 4 weeks and 33 mg / day during weeks 4 to 8) and 20 received cipram ( mean dosages of 22 mg / day during the first 4 weeks and 29 mg / day during weeks 4 to 8) . both treatments were noted to be effective in improving the symptoms of madd at weeks 4 and 8 . the mean differences of ham - d and ham - a between citalopram and cipram groups were significantly different at the end of week 4 ( ham - d : p = 0.038 , ham - a : p = 0.025 ) , but not at the end of week 8 ( ham - d : p = 0.239 , ham - a : p = 0.204 ) . both medications were tolerated well by the patients.conclusions:this study suggests that the efficacy of citalopram is similar to that of cipram in the treatment of madd after 8 weeks . meanwhile , cipram may reduce depression and anxiety quicker than its generic , citalopram .

metabolic syndrome ( mets ) or syndrome of resistance to insulin involves metabolic abnormalities indicated by central obesity , hypertriglyceridemia , decreased high density lipoprotein ( hdl ) , hyperglycemia , obstructive sleep apnea , and hypertension . according to theadult treatment panel iii ( atp iii ) report , the prevalence of mets is about 22% , which is increased by age . many metabolic abnormalities such as non - alcoholic fatty liver disease ( nafld ) and steatohepatitis are observed along with mets . nafld is a hepatic manifestation of metabolic syndrome ; it is closely related to other clinical features of metabolic syndrome . nafld is an inflammatory liver disease in which fat accumulates in hepatocytes and results in increased number of inflammatory cells in liver tissue . nafld is the most common liver disease in developed countries with the incidence rate of 20 - 40% , however , its prevalence is rising in developing countries such as asian nations . most frequently , nafld is asymptomatic and is detected when a physician performs precise laboratory or ultrasound studies for check - up or increase in aminotransferases occurs . this disease was first observed among middle aged obese men with diabetes mellitus ( dm ) but recently it is believed that non - obese and non - diabetic men with iron overload could be predisposed to this disease . therefore , currently the role of serum iron , ferritin , and transferrin in this disease is more studied . also , a newly diagnosed condition of liver called insulin resistance - hepatic iron overload ir - hio is observed in patients with hyper ferritinemia and normal transferrin without mutation in gene of hemochromatosis . although patients with ir - hio suffer from a wide verity of metabolic disorders , the relationship between ir - hio and nafld is not yet definite . on the other hand , there are several hypotheses about the pathophysiology of the relationship between nafld and mets . one of the most acceptable hypotheses is insulin resistance indicated by postprandial ineffective hyperinsulinemia and subsequently postprandial hyperglycemia and increase in free fatty acid . furthermore , oxidant and antioxidant imbalance is another trigger suggested for justifying this relationship whereas ferritin is an acute phase reactant . both mechanisms could support the hypothesis on the role of iron or iron carriers in this correlation between mets and nafld . in this study we assessed clinical and para - clinical evidence for this relationship . a case - control study was conducted between 2010 and 2011 among patients with elevated aminotransferases referred to baqiyatallah clinic , tehran , iran . the diagnosis of nafld was confirmed after ruling out other causes of elevated aminotransferases such as viral hepatitis ( by testing hbs ag , hbs ab , hbc ab , and hcv ab ) , alcohol consumption , infectious diseases , and other medical conditions , which could affect liver function test . based on the following criteria ( table 1 ) , the patients were divided into two groups with mets ( mets group ) or without mets ( non - mets group ) . the clinical assessment , included demographic and anthropometric characteristics , and physical examination were done by a clinical practitioner . paraclinical studies were also performed consisting of ultrasonography and lab tests aspartate aminotransferase(ast ) , alanine transaminase(alt),low - density lipoprotein ( ldl ) , high - density lipoprotein ( hdl ) , triglyceride ( tg ) , cholesterol , fasting blood sugar ( fbs ) , ferritin , and serum iron ) , which were done in the laboratory of baqiyatallah hospital after 12 hours fasting . diagnosis and grading of nafld ( diffuse hepatic steatosis ) based on ultrasonography was determined by a radiologist according to the following guideline ; 1- increased echogenicity and beam attenuation , which is known as a diffuse hyperechoic texture ( bright liver ) 2- increased echo texture compared with kidney ( liver and renal cortex have normally a similar echogenicity ) 3- vascular blurring ( absence of the normal echogenic walls of the portal veins and hepatic veins ) . using the sample size formula shown below , the sample size was calculated as 280 cases , while d=0.05 , p=0.68 , and =0.05 . for aminotransferases was 40 mg / dl . for serum iron it was 190 g / dl for men and 175 g / dl for women . cut point for serum ferritin was 300 g / dl for men and 200 g / dl for women . chi2 ( or fisher n=(z1/2)2p(1p)d2 exact test ) , independent t test , one way anova , and pearson ( or spearman ) tests were used for univariate analysis in using spss software version 16 . finally , variables with p value less than 0.2 was entered in a model of logistic regression . a total of 299 patients ( 198 men and 101 women ) with nafld were included and were divided intomets ( n=143 ; 47.8% ) and non - mets ( n=156 ; 52.2% ) groups . there is a significant difference between mean age and sex ratio in the two groups ( p=0.001 ) . as expected , the age , systolic and diastolic blood pressure , body mass index ( bmi ) , waist / hip ratio , glucose tolerance test ( gtt ) , serum insulin , c. peptide , tg , and hemoglobin a1c ( hba1c ) were different between mets and non - mets groups ( p<0.05 ) . moreover , the history of diabetes mellitus , hypertension , and coronary artery disease was significantly different between the groups ( p<0.05 ) . there was no significant difference in grade of disease according to the ultrasound study , aminotransferases and bilirubin levels between mets and non - mets groups . after adjusting for confounder variables such as age , we found no differences in alt ( p=0.557 ) and ast level ( p=0.205 ) among the two groups . however , a significant correlation was found between serum ferritin and alt ( p=0.005 ) and also ast ( p=0.032 ) . despite adjusting the confounding role of sex on serum ferritin and iron , we could not find any significant difference in serum iron and ferritin level between the two groups ( table 4 ) . in a regression model , only sex ( p<0.001 , exp b : 3.912 , ci 95% : 1.892 - 8.088 ) , systolic blood pressure ( p=0.013 , exp b : [ 1.040 ] ci 95% : 1.008 - 1.072 ) , bmi ( p=0.001 , exp b : 1.158 , ci 95% : 1.061 - 1.264 ) , dm ( p=0.007 , exp b : 4.305 , ci 95% : 1.481 - 12.509 ) , total iron binding capacity ( tibc ) ( p=0.017 , exp b : 1.007 , ci 95% : 1.001 - 1.017 ) , hemoglobin ( p=0.017 , exp b : 1.007 , ci 95% : 1.001 - 1.017 ) , tg ( p=0.017 , exp b : 1.007 , ci 95% : 1.001 - 1.017 ) , hdl ( p=0.017 , exp b : 1.007 , ci 95% : 1.001 - 1.017 ) , alkaline phosphatase ( alp ) ( p=0.017 , exp b : 1.007 , ci 95% : 1.001 - 1.017 ) , ast ( p=0.017 , exp b : 1.007 , ci 95% : 1.001 - 1.017 ) , alt ( p=0.017 , exp b : 1.007 , ci 95% : 1.001 - 1.017 ) , and serum insulin ( p=0.017 , exp b : 1.007 , ci 95% : 1.001 - 1.017 ) could predict mets in patients with nafld . given the results of this study , no significant relationship was observed between serum iron and presence of mets in patients with nafld . also , the same results were obtained for serum ferritin . in other words , there is no prominent difference in the role of iron ( both serum iron and ferritin as a form of iron for storage ) in presence of nafld in both groups . a hypothesis has been presented on the role of iron especially iron deposit in liver in patients with nafld on resistance to insulin , however , there is much controversy in determination of definite mechanism . in late 1990s , two studies posed the hypothesis about irrespective resistance to insulin among patients with hepatic iron overload , which was indicated by hyperferritinemia and normal transferrin . patients with unexplained hepatic iron overload are characterized by a mild to moderate iron burden and the nearly constant association of an insulin resistance syndrome irrespective of liver damage . moirand and co - workers also presented this condition as a new non - hla - linked iron overload syndrome , which suggests a relationship between iron excess and an abnormal metabolic condition including obesity , hyperlipidemia , abnormal glucose metabolism , or hypertension known as mets . an epidemiological finding that the dysmetabolic iron overload syndrome is detected in about one third of patients with nafld and the mets and also a therapeutic - based approach that showed decreased metabolic alterations and liver enzymes in nafld patients undergone iron depletion by phlebotomy uphold this hypothesis . mechanisms of the relationship between iron accretion and insulin resistance , as the main pathogenesis of mets , in patients with nafld have been poorly studied . genetic factors , oxidative stress , cell toxicity , and genotoxicity can predispose iron deposits due to circulatory iron excess . these factors can induce iron storage in hepatocytes and kupffer / sinusoidal cells . in molecular and histopathological point of view , kupffer cells can accumulate iron via phagocytosis of necrotic hepatocytes , or probably erythrophagocytosis . conversely in this study , a significant correlation was obtained between serum ferritin and alt and also ast indicating for hepatocytes injuries by depositing fat . also , we found higher levels of hemoglobin and tibc in mets group compared with non - mets group . regularly , these indexes correlate with red blood cell ( rbc ) count and also erythrophagocytosis . there are some pivotal factors that induce hepatic iron uptake such as deficiency of micronutrients , inflammation , dysregulation of iron trafficking molecules , and hyperinsulinemia . insulin stimulates cellular iron uptake through increased externalization of the transferring , receptor in adipocytes . on the other hand , in the adipocyte , the stored iron can affect insulin sensitivity of the cell . both aforementioned mechanisms can cause unsuppressed lipolysis , and therefore liver is predisposed to fat storage . stimulation of intestinal iron absorption , by hyperinsulinism and insulin resistance , is the other mechanism for the increase of body iron stores while in the present study we did not find any difference between the amount of storage form of iron , ferritin , between the two groups , although there was a difference in serum insulin levels between the two groups . given the findings of the present study in keeping with previous findings , tibc ( indicator for the transferrin activity ) is the sole iron trafficking index that was different between the two groups . as expected , age , blood pressure , bmi , hip / waist ratio , prevalence of dm and coronary artery diseases ( cad ) , serum tg , and hdl were higher in mets group compared with non - mets group . it was previously clarified that patients with mets with or without other medical conditions , such as nafld , are more frequently involved in dm , cad , hypertension , obesity , and hyperlipidemia which is in line with our findings . abdominal obesity indicated by high waist / hip ratio albeit is an important risk factor for metabolic disturbances , including fatty liver . after adjusting the confounders , we could not find a significant relationship between abdominal fat levels and presence of mets . but international normalized ratio ( inr ) as a coagulation status index was different between the two groups . usually coagulation defect occur when nafld leads to cirrhosis while none of the patients suffered from cirrhosis . the sonographic grade of nafld was not significantly different between mets and non - mets group . the role of iron in coagulation was previously declared , however , we could not precisely associate these two with the difference in inr and iron level in the two groups . one of the limitations of this study was the lack of pathological and genomic studies to compare mets and non - mets groups . to verify this comparison , liver biopsies would be helpful but this is ethically unfeasible since it is unnecessary in patients with uncomplicated nafld . ferrannini demonstrated an association between hyperinsulinemia and the excess hepatic iron storage in inflammatory conditions . over transcriptions of ferritin mrna in macrophages due to inflammatory cytokine consistent with our findings , previous studies that showed a prominent relationship between the presence of mets and serum iron or ferritin in patients with nafld recommended searching for hepatic iron accumulation in biopsy samples of patients with nafld , even in cases with normal serum iron , ferritin , and transferrin . conversely , choi and colleagues , evaluated serum ferritin and aminotransferases among 994 post menaupose women . they found that women with mets had a higher level of serum ferritin compared with women without mets . many other studies indicated a probable relationship between nafld as one of the manifestations of mets and serum level of ferritin . but , consistent with our findings , freixenet and co - workers also demonstrated that iron level had no correlation with existing dm and mets . moreover , this difference between the findings of various reports can be due to sociodemographic varieties . therefore , if an adapted cut point is determined for every population , a significant relationship may be obtained . although we could not find a similar relationship , but we found that serum level of ferritin in patients with nafld and mets was above 125 - 130 . our findings did not show a significant relationship between iron , in free or storage form , and the presence of mets among patients with nafld , but serum ferritin can correlate with hepatocytes injuries indicated by raised aminotransferases . nevertheless , to clarify this relationship further molecular , genomic , and histopathological studies are required . the authors are grateful to all patients for their collaboration in this study . also , the authors thank baqiyatallah research center of gastroenterology and liver diseases for supporting this survey financially .

background a hypothesis has been presented about the role of serum iron , ferritin and transferrin saturation among patients with non - alcoholic fatty liver disease ( nafld ) and resistance to insulin ( metabolic syndrome [ mets ] ) , but there is much controversy . this study aimed at investigating the level of serum iron and demographic characteristics in patients with nafld with or without mets . methods a case - control study was conducted on patients with elevated liver enzymes referring to baqiyatallah clinic , tehran , iran during 2010 - 2011 . after ruling out other causes of increased aminotransferases and approving the diagnosis of nafld , the patients were divided into two groups of with or without mets . then , the individuals demographic , sonographic , and laboratory characteristics were recorded . results this research included 299 patients suffering from nafld who were divided into mets ( n=143 ; 47.8% ) and non - mets ( n=156 ; 52.2% ) groups . the age , systolic and diastolic blood pressure , body mass index , waist / hip ratio , glucose tolerance test , serum insulin , c. peptide , triglyceride , and hb a1c were different between mets and non - mets groups ( p<0.05 ) . there was no significant difference in serum iron and ferritin levels between the two groups , however , a significant correlation was found between serum ferritin and alanine transaminase ( p=0.005 ) and also aspartate aminotransferase ( p=0.032 ) . conclusion our findings did not show a significant relationship between iron , in free or storage form , and the presence of mets among patients with nafld , but serum ferritin can correlate with hepatocytes injuries indicated by raised aminotransferases . nevertheless , to clarify this relationship further molecular , genomic , and histopathological studies are required .

for the past few years , treatment for contusions and associated symptoms , such as hematomas , pain , and loss of function , have used instrument - based therapies.1,2 these have involved the use of lasers , electromagnetic fields , and electrical stimulation . during the acute phase of injury , bruising and pain are typically treated with the application of ice , while the intermediate phase involves topical treatments , such as painkillers and heparinoids . when loss of function is involved , rest and functional rehabilitation are often initially prescribed . upon completion of this period , treatment with physiotherapy equipment can be used to improve symptoms further , especially when residual pain and loss of function remain . in this study , application of a new technology for biostimulation is described for the treatment of post - traumatic injuries . a radioelectric asymmetric conveyor ( reac , convogliatore di radianza modulante , italy ) represents an innovative biostimulation technology creating a radiofrequency field that can be applied to the body.3,4 previously , this reac technology has been applied to several areas of medicine , including brain stimulation,511 tissue stimulation,12 and neuromuscular stimulation.1316 the reac tissue optimization ( reac - to ) protocol consists of the application of 100 radiofrequency 2.4 ghz bursts , 0.5 seconds in duration , associated with a specific absorption rate ( of 7 w / kg ) . the radiofrequency bursts are spaced 4.5 seconds apart , and are applied using a special laminar aluminum probe in proximity to the skin ( figure 1 ) . each therapy session lasts about 10 minutes , and a reac - to treatment cycle generally consists of 1218 therapy sessions . reac - to sessions have previously been shown to be effective in improving circulation , hydration , and tropism in the skin of the face in healthy subjects.12 in as yet unpublished research , use of reac was shown to modulate the expression of genes and proteins involved in the differentiation of stem cells and embryonic mouse cells , and to improve tissue regeneration.17 a radioelectric asymmetric conveyor ( reac , convogliatore di radianza modulante , italy ) represents an innovative biostimulation technology creating a radiofrequency field that can be applied to the body.3,4 previously , this reac technology has been applied to several areas of medicine , including brain stimulation,511 tissue stimulation,12 and neuromuscular stimulation.1316 the reac tissue optimization ( reac - to ) protocol consists of the application of 100 radiofrequency 2.4 ghz bursts , 0.5 seconds in duration , associated with a specific absorption rate ( of 7 w / kg ) . the radiofrequency bursts are spaced 4.5 seconds apart , and are applied using a special laminar aluminum probe in proximity to the skin ( figure 1 ) . each therapy session lasts about 10 minutes , and a reac - to treatment cycle generally consists of 1218 therapy sessions . reac - to sessions have previously been shown to be effective in improving circulation , hydration , and tropism in the skin of the face in healthy subjects.12 in as yet unpublished research , use of reac was shown to modulate the expression of genes and proteins involved in the differentiation of stem cells and embryonic mouse cells , and to improve tissue regeneration.17 a 70-year - old woman was treated with oral anticoagulants after an accidental fall while descending a flight of stairs . the fall resulted in a significant hematoma , with hemorrhagic suffusion present in the buttocks ( figure 2 ) and inguinal canal ( figure 3 ) , resulting in significant pain in the traumatized areas . immediately following the trauma , the subject started treatment with reac - to . no other therapy was locally applied while reac - to treatments were being conducted . following the first session , a rapid improvement were observed in the subject s condition , and in her level of pain . as a result , an almost full recovery was achieved within six days ( figures 4 and 5 ) . a 60-year - old man sustained an accidental trauma involving a fall on the chest , which resulted in an underarm , subfascial hematoma ( figure 6 ) . the transverse diameter was approximately 13 cm , and a conspicuous ecchymotic suffusion extended to the iliac wing ( figure 7 ) . as a result of this trauma , the subject experienced severe pain when breathing and restricted arm movement ipsilateral to the lesion . immediately following the trauma , following the first treatment , the pain experienced by the subject was sufficiently reduced to eliminate further treatment with painkillers . furthermore , while the subject underwent reac - to treatments , no other therapy was administered locally . following completion of treatment , the ecchymotic suffusion was completely resolved ( figure 8) , and the hematoma present in the underarm was almost completely resolved ( figure 9 ) . a 30-year - old male experienced a crush injury to his right leg , with a conspicuous pretibial hematoma extending the length of the affected limb ( figures 10 and 11 ) . treatment with reac - to was started two days after the injury , and included 18 consecutive daily sessions . after the first treatment , a significant decrease in pain and functional recovery was reported , eliminating the need for painkillers . while reac - to treatments were underway , no additional local therapy was applied . following completion of the reac - to treatments , modest local edema and slight discoloration from hemosiderin deposition remained ( figures 12 and 13 ) . however an 18-year - old man fell accidentally on a staircase , and experienced traumatic impact to the distal third of his right leg . as a result , the subject developed a conspicuous ecchymotic suffusion that extended to the tibiotarsal joint and heel ( figures 14 and 15 ) . reac - to treatments were started immediately following the trauma , with two sessions conducted daily for 12 days . following the first treatment , a significant reduction in pain and functional recovery were reported . during reac - to treatments , after 12 days , complete functional recovery of the tibiotarsal joint was achieved , and the ecchymotic suffusion was resolved ( figures 16 and 17 ) . a 35-year - old man accidentally fell from a ladder , resulting in a conspicuous ecchymotic suffusion that affected the tibiotarsal joint , and was associated with a hematoma in the heel ( figure 18 ) . severe pain and loss of function in the traumatized limb were reported by the subject . reac - to treatments were started immediately , with two sessions conducted daily for a total of 18 sessions . following completion of the first treatment , a significant reduction in pain was reported , and sufficient functional recovery was achieved to enable the patient to walk . thirty days after the start of treatment , complete functional recovery of the tibiotarsal joint was demonstrated , and resolution of the hematoma in the heel was achieved . recovery of salient bone features in the joint was also observed ( figure 19 ) . a 28-year - old man was hit by a car , resulting in a conspicuous ecchymotic suffusion that extended throughout the entire leg ( figures 20 and 21 ) . reac - to sessions were started immediately , with two sessions conducted daily for 18 sessions . following the first session , the subject reported immediate pain relief and demonstrated early functional recovery of the leg . fourteen days after the start of treatment , functional recovery of the limb was observed and complete resolution of the suffusion was achieved ( figures 22 and 23 ) . the images presented here for subjects here clearly demonstrate the effectiveness of reac - to , with recovery achieved following post - traumatic injuries involving resolution of hematomas and hemorrhagic suffusion . in addition , almost immediate and progressive recovery of loss of function was observed , with reac - to treatments representing a rapid - acting analgesic . reac - to treatments were also associated with antiedematous , anti - inflammatory , and regenerative17 effects . the cases and results presented in this study are representative of those achieved in our clinics with the application of reac - to to post - traumatic injuries . reac - to has shown efficacy in speeding the healing time of post - traumatic injuries compared with the time usually required for similar traumas treated with prompt functional recovery and rapid - acting analgesics . furthermore , this treatment approach represents a noninvasive , painless , and safe treatment that provides functional recovery . reac - to treatments are easy to administer , associated with rapid and effective action , especially in reducing pain and loss of function , and effective at any depth of damaged tissue . as such , reac - to represents a valuable tool in the treatment of various injuries , including emergency traumatic conditions .

backgroundfor the past few years , treatment of contusions and associated symptoms , such as bruising , pain , and loss of function , has involved instrument - based therapies , ie , lasers , electromagnetic fields , and electrical stimulation . in this study , tissue optimization ( to ) sessions were applied using a radioelectric asymmetric conveyor ( reac ) for the treatment of contusions and associated symptoms.methodssix subjects were treated with 1218 sessions of reac - to applied to a traumatized anatomical area.resultsin all cases , reac - to sessions were found to be effective for the treatment of post - traumatic injuries involving hematomas , hemorrhagic suffusion , and loss of function . in addition , reac - to treatments represented a rapid - acting analgesic associated with antiedematous , anti - inflammatory , and regenerative effects . these findings are consistent with the results of previous studies , and confirm the capacity of reac - to to provide almost immediate recovery of function in traumatized areas.conclusionas previously demonstrated in vitro , reac - to is able to promote regeneration and repair processes in the human body . for six subjects experiencing local trauma , reac - to was effective in speeding the healing time of contusion symptoms and providing recovery of function .

cardiovascular diseases are the leading cause of mortality worldwide and about 17,000,000 cardiac deaths occur each year . coronary artery diseases are among the most common form of disabling cardiovascular diseases . over one - third of mortality in iran coronary bypass surgery , as a major vascular constructive surgery method , is one of most common surgical methods to treat these patients , and results in a notable improvement in these patients angina pectoris signs , and their function and activity . the goal of this surgery is to supply new and adequate circulation for cardiac muscle after the stenosis of coronary artery through transplantation of a vein or artery . these patients are directly admitted in critical care unit after surgery due to possible complications and receive coronary artery bypass specific cares . they undergo mechanical ventilation after surgery , need special and specific care , and should be constantly monitored concerning postoperative complications and problems . one of the components of postoperative nursing care is supporting these patients and their families . as the family is an important basis for patients recovery and its members affect each other 's health status and function , the patient 's family , as an addressee group of nursing , has been described as both a recipient of care and a caregiving unity . family members of the patients with coronary bypass surgery are in crisis due to their specific condition and possibility of death . this crisis affects their normal pattern of life and leads to family discomfort , especially when family crisis is resulted from hospitalization of one of its members . being involved in a disease , and consequently , a family member 's hospitalization brings about numerous physiologic and psychological problems for the patients and their families . although playing a caregiving role is associated with a divine and family reward , research shows that the extension and severity of this role also leads to caring burden . a family caregiver is a person who receives no salary and provides the patient with care and physical , emotional , financial , and other types of support . this term is used to define the complications resulting from caring , which include physical , emotional , financial , and social caring related problems . family members caring burden is defined as the problems , troubles , and unpleasant events that affect the family members of the caregiver who cares the diseased member . a few studies have been conducted on the effect of family - focused interventions on the imposed pressure to the patients family , and are more in relation with the patients with dementia , schizophrenia , cancer , and physical disabilities , which have shown such interventions reduce the burden of care . these studies have shown that the increase in the load , imposed to the caregivers , is significantly associated with poor physical and psychological recovery of the patients undergoing coronary bypass surgery . previous research also showed the families need help for the constant adaptation , and their main need is education and support , but in recent years , modern medical technology has not paid enough attention to this issue of family support , so that the families have not received adequate support . as family members play an important role in the psychological recovery of their patients through staying with them , taking care of them , and making a meaningful interaction with their patient as well as cooperating with the treatment team in administration of care , their ability to support the patient may be impaired due to the imposed tensions . therefore , with regard to the supportive role of family toward the individuals and its increasing effect on efficiency of official service systems , the caregivers should be supported by official supportive systems . since the nurses spend a lot of time with the patients and their families , they are in a good position to detect the load of work and ability of caregivers and for provision of appropriate nursing interventions for them . appropriate nursing care is defined as putting the patients at the heart of attention and care , so that the care also covers the patients family members . although the care given by the family members is out of charge , this care imposes health burden to the caregivers . the present study aimed to investigate the effect of family - focused nursing intervention on caring burden of the family members of the patients undergoing coronary bypass surgery this is a two - group , two - step clinical trial to study the effect of the independent variable of family - focused nursing interventions on the dependent variable of caregiver burden . the study objectives were to define and compare total and subscales mean scores of caring burden in two groups of study and control before and after the intervention . research environment in the present study comprised women and men surgical wards of shahid chamran hospital affiliated to isfahan university of medical sciences , where coronary bypass surgery patients were hospitalized and the patients caregiving family members attended in . inclusion criteria , in the present study , were being an immediate family member of the patient ( spouse , child , father , mother , sister , or brother ) , age over 18 years , being interested in attending the study , being able to speak , read , and write in persian ( only one family member was selected ) , not being responsible for taking care of another patient , and finally , having the direct responsibility of taking care of the patient . any problems prohibiting the family to continue with the study or the families whose patients were about to die during the study were excluded from the study . the subjects were selected through convenient sampling on the day of patients hospitalization in women and men surgical wards of the hospital from the families of the patients who were candidates for coronary bypass surgery and had met the inclusion criteria . in the present study , firstly , 25 patients were randomly selected from the subjects who met the inclusion criteria for the study group , and then 25 subjects were randomly selected and assigned to the control group . the data were collected by a questionnaire , which was completed by patients families attending the study through self - administration . the first section contained subjects demographic characteristics ( age , sex , employment status , marital status , education level , relativity status with the patient , and the length of patients involvement in cardiac disease ) . this multi - dimensional tool measures caregivers burden and assesses the imposed pressure and load to them . this inventory contains 24 items , and the subjects should declare to what extent they experience the inquired situations in a five - point likert scale . this questionnaire measures five subscales of time dependence tolerance ( 5 questions ) , developmental tolerance ( 5 question ) , physical tolerance ( 4 questions ) , social tolerance ( 5 questions ) , and emotional tolerance ( 5 questions ) . the items are scored as : zero = not at all disruptive , 1 = somehow disruptive , 2 = moderately disruptive , 3 = disruptive , and 4 = very disruptive . the scores range from 0 to 96 , and higher scores show higher caregiver burden . the cronbach 's alpha , reported in novak and guest study conducted on 107 caregivers , was 0.79 - 0.93 , and reliability of the questionnaire was calculated to be 95.8% . internal items assessment showed correlation coefficient of 0.66 among the items . in the first hours of patients admission , the researcher got their written informed consent and filled the questionnaire related to demographic information and caregiver burden . in the study group , the interventions were conducted for the qualified family members of the patients in three 30 - 45 min sessions during 3 days of stay of the patients in the hospital [ table 1 ] . the first session was held 24 h prior to the surgery , the second one during the surgery , and the third session was held 48 - 72 h after patients return from the operating room to the surgery ward . finally , on the last day of hospitalization , caregiver burden questionnaire was given to the selected family members in the study and control groups to complete . data obtained in the present study were quantitative ( discrete and continuous ) and qualitative ( nominal and ordinal ) , which were analyzed by descriptive and inferential tests ( paired t - test , independent t - test , mann whitney , fisher 's exact test , and chi - square test ) in spss version 16 . mean ( sd ) age of the subjects in the study and control groups were 40.4 ( 10 ) and 37.8 ( 8.9 ) years , respectively . results showed no significant difference between the two groups in age [ p = 0.35 ( independent t - test ) ] , sex [ p = 0.3 ( fisher 's exact test ) ] , caregivers relativity to the patient [ p = 0.35 ( chi - square test ) ] , marital status [ p = 0.24 ( chi - square test ) ] , and level of education [ p = 0.35 ( mann whitney test ) ] , so the two groups were almost statistically homogenous . independent t - test showed no significant difference in the total mean scores of patients family members burden before the intervention [ table 3 ] in the two groups ( p = 0.98 ) , but there was a significant difference in the total mean scores of family members burden after the intervention in the study and control groups ( p < 0.001 ) . paired t - test showed a significant difference in patients family members burden in the study group before and after the intervention ( p = 0.01 ) . in order to compare the total mean scores of changes in caregiver burden after the intervention in the study and control groups , independent t - test was adopted and showed a significant difference ( p < 0.001 ) . comparison of caring burden subscales mean scores before the intervention in the study and control groups , through independent t - test , showed no significant difference in the subscales of time dependence caring burden ( p = 0.28 ) , developmental caring burden ( p = 0.55 ) , physical caring burden ( p = 0.28 ) , social caring burden ( p = 0.65 ) , and emotional caring burden ( p = 0.15 ) . comparison of caring burden subscales means after the intervention in the study and control groups , through independent t - test , showed a significant difference in time dependence caring burden ( p < 0.001 ) , developmental caring burden ( p < 0.001 ) , physical caring burden ( p < 0.001 ) , social caring burden ( p = 0.012 ) , and emotional caring burden subscales ( p = 0.007 ) . comparison of caring burden scores in the study group before and after the intervention through paired t - test showed a significant difference in time dependence caring burden ( p < 0.001 ) , developmental caring burden ( p < 0.001 ) , social caring burden ( p = 0.01 ) , and emotional caring burden ( p = 0.012 ) subscales , but no significant difference in physical caring burden subscale ( p = 0.53 ) . subjects variables in caregiving family members of the patients undergoing coronary bypass surgery in the study and control groups total mean caring burden scores and subscales mean scores of patients family members burden before and after the intervention in the study and control groups in the control group before and after the intervention , the differences in mean scores of time dependence caring burden ( p = 0.02 ) , physical caring burden ( p = 0.001 ) , and emotional caring burden ( p = 0.04 ) subscales were significant , but the differences in social caring burden ( p = 0.7 ) and developmental caring burden(p = 0.06 ) subscales were not significant . independent t - test results obtained from comparison of caring burden subscales scores after the intervention in the study and control groups have been presented in table 4 . comparison of total mean caring burden and subscales scores changes of patients family members after the intervention in the study and control groups the obtained results of the present study showed a significant difference in the total mean scores of family members caring burden of the patients undergoing coronary bypass surgery . a case control study ( 2008 ) investigating the effect of social and psychological interventions on the family caregiver burden among patients with dementia showed that five sessions of intervention including subjects education and formation of discussion groups significantly decreased their caring burden and enhanced caregivers satisfaction . another study in iran ( 2009 ) investigating family education efficiency on the level of family caregiver burden of the patients hospitalized in psychiatric diseases ward showed a significant reduction in caregiver burden after four sessions of family education in the study group compared to the control group , and the intervention decreased psychological burden in the study group . in the present study , total mean scores of caregiver burden of patients family members showed a significant difference before and after the intervention in the control group ; but contrary to the study group , this difference was in the form of an increase in mean score of family members caregiver burden in the control group after study compared to before study . the results of a study ( 2009 ) on the experiences of accompanying persons ( caregivers ) of the hospitalized elderly showed that lack of support to these accompanying persons in the hospital led to increase of their tension . another research ( 2005 ) showed that during patients hospitalization the entire focus of the treatment team is on the patients , and consequently , the needs and concerns of the family members are ignored . their stress and burden is increased and lack of necessary interventions leads to incidence of a crisis among them . a study ( 2009 ) showed an increase in caring burden mean scores immediately after intervention in the control group compared to before intervention . other researchers in 2009 explained that caring burden mean scores in the control group showed a minor increase 6 months after intervention compared to before intervention . the obtained results showed the highest scores of caring burden subscales in the study and control groups before intervention were for time dependence caring burden , developmental caring burden , social caring burden , physical caring burden , and emotional caring burden subscales , respectively . in both study and control groups , time dependence caring burden and emotional caring burden subscales had the highest and lowest scores before the intervention , respectively . after the intervention , the highest caring burden scores were for time dependence , physical , developmental , social , and emotional caring burden subscales in the study group , respectively , and for time dependence , developmental , physical , social , and emotional caring burden subscales in the control group , respectively . subscales score changes after the intervention [ table 1 ] were significant in time dependence , developmental , physical , and emotional subscales , while in the subscale of social caring burden , the score changes were not significant in the study and control groups . social caring burden subscale mean the feeling of role conflict among caregivers , so that they may be ignored and not appreciated by other members . as most of the caregivers in the present study were patients children who were married and had their own families and the sort of the conducted interventions did not create the chance to interact with the caregivers family members to encourage them to support the caregivers , there was no significant change in this subscale ( social caring burden ) . some researchers ( 2005 ) concluded that patients disabilities are the best predictors for time dependence caring burden subscale , and emotional caring burden subscale is more influenced by caregivers anxiety and depression . in the present study , it seems that hospitalization period and surgery increase patients disabilities . conducting interventions for caregivers families during hospitalization had the highest effect on reduction of time dependence caring burden subscale , sothe highest score changes were observed in this caring burden subscale . bases on the findings of the present study , it is suggested to investigate the experience of family caregivers of the patients undergoing cardiac surgery concerning family - focused nursing interventions by the bed of the hospitalized patient . investigation and comparison of the effect of family - focused nursing interventions on anxiety , depression , stress , and satisfaction of the patients caregivers families , as well as comparison of family - focused nursing interventions effect on caring burden of the families with patients undergoing cardiac surgery , andwith patients hospitalized in other wards of the hospitals are also suggested .

background : family burden is defined as the problems , concerns , and unpleasant events affecting the patients undergoing coronary arteries surgery , and is associated with these patients physical and psychological improvement . nurses are in a good position to provide appropriate intervention . this study aimed to investigate the effect of family - focused nursing interventions on the burden of the family members of the patients undergoing coronary bypass surgery.materials and methods : this is a clinical trial conducted on 50 family members of the patients undergoing coronary bypass surgery in isfahan shahid chamran hospital . caregivers were selected by convenient sampling and were randomly assigned to two groups of study and control . caregivers in the study group attended a three - interventional session program during their hospitalization time , while the subjects in control group did not . data collection tool was novak and guest caring burden inventory ( cbi ) . data were analyzed by spss.results:means and sds of caring burden before and after the intervention were 30.08 ( 14.03 ) and 19.2 ( 10 ) in the study group , respectively , and 30.16 ( 12.62 ) and 35.44 ( 10.42 ) in the control group , respectively . changes of total scores of caring burden showed a significant difference after the intervention in the study and control groups ( p < 0.001 ) . score changes of subscales of time dependence ( p < 0.001 ) , developmental ( p < 0.001 ) , physical ( p < 0.001 ) , and emotional caring burden ( p = 0.007 ) were also significant.conclusions:results showed that family - focused nursing interventions were effective in reducing the family burden of the patients undergoing coronary bypass surgery . nurses can administrate family - focused nursing interventions to reduce the caregiver burden .

second line antitubercular drug ethionamide is 2-ethylpyridine-4-carbothioamide , a congener of thioisonicotinamide . the drug is a prodrug and mycobacterial etha a , a nicotinamide adenine dinucleotide phosphate - oxidase ( nadph ) -specific , flavin adenine dinucleotide ( fad)-containing monooxygenase , converts it to a sulfoxide , and then to 2-ethyl-4-aminopyridine . ethionamide inhibits mycobacterial growth by inhibiting the activity of the inha gene product , the enoyl- acyl - carrier - protein ( acp ) reductase of fatty acid synthase ii . ethionamide is a part of the world health organization ( who ) regime for multidrug resistant tuberculosis ( mdr - tb ) along with ethambutol , prothionamide , ofloxacin , pyrazinamide , aminoglycoside and capreomycin for six months followed by ethambutol , ethionamide , prothionamide , ofloxacin and pyrazinamide for further 12 to 18 months . the most common adverse effects associated with this drug are anorexia , nausea and vomiting , gastric irritation and a variety of neurologic symptoms . severe postural hypotension , mental depression , drowsiness and asthenia are common and convulsions and peripheral neuropathy are rare . most standard text books and reference books of pharmacotherapeutics have not mentioned about it , and to the best of our search , we could not find any case reports available from a search made in pubmed . in this case report , we have presented the case of unilateral painful gynecomastia , which on the who causality assessment scale is probably / likely associated with the use of ethionamide . a 43 year old male patient presented to the department of pulmonary medicine of dr . r. p. government medical college , kangra in the month of august 2010 with a history of consumption of category i antituberculosis treatment from 19.12.2008 . this was followed by category ii antituberculosis treatment from 10.03.2009 , as category i failed . the drug treatment failed again and the patient was referred to department of pulmonary medicine . culture and sensitivity testing for mycobacterium tuberculosis revealed resistance to streptomycin , isoniazid , rifampicin and ethambutol . pretreatment evaluation was done and patient was put on injection kanamycin 750 mg intramuscular ( i m ) daily 6 days a week , tablet levofloxacin 750 mg once daily , tablet ethionamide 250 mg twice daily , capsule terizidone 250 mg twice daily , gr . pas 10 g once at bed time , tablet pyrazinamide 1500 mg once daily and tablet pyridoxine 100 mg once at bed time from 28.10.2010 . at the end of one month of treatment , patient became sputum smear and culture negative . on 24.02.2011 , the patient complained of pain in the right breast due to friction by clothes since one week , and noticed a swelling of the nipple which was tender on palpation . physical examination revealed a 3 3 cm tender nodule behind the right nipple that was not fixed to underlying tissues [ figure 1 ] . ultrasonography ( usg ) revealed a hypoechoic mass of size 2.5 0.92 2.6 cm in the right breast region behind the nipple , without any infiltration to the deeper structures . patient was advised diclofenac sodium 50 mg once daily for 5 days and for another 5 days if required ; without any change in the antituberculosis regime . patient was asked to report if the pain did not subside . on the next follow up , the patient then stopped the treatment on his own on completion of one year of therapy without doctor 's consent and informing the doctor . within a week of stopping the treatment he reported that the nodule had also disappeared . the term comes from the greek word gyn ( stem gynaik ) meaning woman and masts meaning breast . breast prominence can result from hypertrophy of breast tissue , chest adipose tissue ( fat ) or skin , and is usually a combination of all . the causes of gynecomastia remain uncertain , although it has generally been attributed to an imbalance of sex hormones or lack of tissue responsiveness to them . drug - induced gynecomastia is common and might account for up to a quarter of all cases . most of these have only been implicated by means of case reports , which document a temporal association of the offending drug and occurrence of gynecomastia . the mechanisms by which many of these drugs induce gynecomastia are not yet understood ; however , an imbalance between estrogen and testosterone has been suggested . amongst the antituberculosis drugs , isoniazid was the first found to be causing gynecomastia . in 1953 , a report from france implicated this drug as a cause of gynecomastia . another report also described painless , bilateral , gynecomastia in a 52 year old man who was receiving 600 mg of isoniazid daily ( 10 mg / kg / day ) for four months . the authors hypothesized that a disturbance in vitamin b6 complex activation in liver could have caused an alteration in estrogen - androgen metabolism . it has also been postulated that isoniazid may act by means of a re - feeding mechanism in men with tuberculosis . after isoniazid , thiacetazone has been suggested as a cause of gynecomastia in a single report . a causality assessment using the who uppsala monitoring centre scale showed that the present adverse reaction is probably / likely associated with the use of ethionamide . similar reports are not available in published literature and an awareness of this possible adverse drug reaction due to ethionamide might guide the prescribing doctors in their choice of the antitubercular drugs .

a 43 year old male patient , known case of multidrug resistant tuberculosis , was prescribed antitubercular drugs : kanamycin , levofloxacin , ethionamide , terizidone , para - aminosalicylate sodium ( pas ) , pyrazinamide and pyridoxine . after 4 months of treatment , the patient developed a lump in the right breast which was approximately around 3 3 cm in size , tender on palpation , and not fixed to the underlying tissues . ultrasonography ( usg ) revealed a hypoechoic mass of size 2.5 0.92 2.6 cm in the right breast region behind the nipple without any infiltration to the deeper structures . gynecomastia due to ethionamide was suspected and the patient was advised anti - inflammatory drugs for 5 days without any change in drug therapy . the pain subsided ; however , the nodule remained . treatment was continued without any change till the patient stopped using the drugs on his own and without doctor 's consent . within a week of stopping of treatment the nodule also disappeared .

the spatial and temporal regulation of biochemical reactions in eukaryotic cells is achieved by a high degree of compartmentalization . each protein is part of a functional biochemical network and all proteins within a particular network are at least once in their lifetime localized close to each other , within ( or at ) a particular organelle or compartment . exchange of information between different organelles , and of proteins between networks , is essential for the proper function of the cell as an entity and is achieved by the active transport of material . one of the best examples of such an assembly of networks is the secretory pathway . secretory proteins move sequentially through the distinct membrane - bounded organelles of this pathway , receiving at each step specific enzymatic modifications necessary for their quality control and proper function . the communication and specific transfer of material between membrane organelles is mediated by distinct small membrane - bounded transport carrier vesicles containing a myriad of regulatory proteins . a key feature of any protein functionally involved in the secretory pathway is its permanent or transient localization to one of the appropriate transport carriers or organelles . extending this concept to the whole cell , the determination of the subcellular localization of a novel protein is one of the essential steps in resolving its function . this includes imaging not only the protein 's steady - state distribution but also the changes in localization that can occur in response to environmental conditions , during specific stages of the cell cycle or of cell differentiation . indeed , changes in localization can also be caused by the breakdown of remote but functionally related organelles and/or cellular structures , such as golgi fragmentation resulting from microtubule reorganization ( see for example figure 1c , d ) . although studies to follow these dynamic events have been a difficult task in the past , the availability of green fluorescent protein ( gfp ) and its spectral variants has now facilitated localization experiments particularly aimed at observing protein dynamics in living cells . the cdna encoding gfp was cloned several years ago and encodes a 27 kda protein that emits green fluorescence when excited with blue light , without the need for any co - factors . thus , any cdna can be fused with the coding sequence of gfp , and the localization of the expressed gfp fusion can be followed in living cells . this unique feature of gfp has led to the development of a number of ' localization screening assays ' , which can be performed in a systematic ' high - throughput ' manner as typically required for large - scale post - genome projects . most gfp - based techniques fuse either fragments of genomic libraries or individual clones from cdna libraries to the coding sequence of gfp , then express the fusions in cells or tissues and determine their subcellular localizations by microscopic inspection . subsequently , the respective cdnas or genes are rescued from the cells or tissues , cloned and sequenced . such strategies have already been conducted on a genome - wide scale in yeast and have identified the localization of so - far uncharacterized proteins , or fragments thereof . the gfp - tagged proteins can be immediately followed in living cells by time - lapse microscopy to determine their cellular dynamics , which adds a further level of information to such screens . at least 50% of the cdnas isolated in this way are already known and well characterized , however . furthermore , the same cdna clones are isolated several - fold in one screen , as the primary criterion for selection is simply localization . for example , in an attempt to isolate novel nuclear - envelope proteins , 550,000 starting cdna clones were required to identify 27 clones localizing to this compartment , of which only two proved to be novel . when tagging cdna libraries with gfp , consideration must also be given to the effect of the reporter on masking targeting signals contained within the expressed proteins . amino - terminal fusions of gfp to target proteins potentially block signal sequences associated with import into mitochondria or the endoplasmic reticulum , for example . conversely , when using either random dna fragments or even non - full - length cdnas ( of which there are significant numbers in cdna libraries ) , the expressed proteins may appear to clearly localize , but the recorded localization may be aberrant , resulting simply from exposing a peptide sequence normally hidden in the full - length protein . this was clearly demonstrated in the ' motif - trap method ' by which a large number of cryptic mitochondrial targeting signals were isolated - many corresponding to sequences derived from non - coding genomic dna . in an attempt to circumvent the problem of hidden amino - terminal targeting sequences , in one study cdnas were cloned from a library containing cdna fragments upstream of gfp , and a retrovirus - mediated expression system was used to determine the cellular localizations of the encoded fusion products . although this expression system is highly effective , the authors themselves concede that none of their cdnas was full - length , and that the interpretation of the localization results is dependent upon the targeting sequences being present in the partial cdna . thus , strategies using gfp tagging of whole cdna or genomic libraries generate significant amounts of redundant or inaccurate data , all of which are time - consuming , and therefore expensive , to eliminate . methods are therefore now being devised to focus more rapidly specifically on those localizations of interest . for example , one possibility is first to isolate gfp - positive cells from the non - fluorescent cells using fluorescence - activated cell sorting ( facs ) , which is able to sort thousands of gfp - expressing cells within minutes into individual wells of multiwell plates , and subsequently to clone them . in this way only gfp - expressing cells have to be examined microscopically , which increases the speed of analysis . an improved variant of such an approach was described recently with the aim of identifying proteins localizing to the nucleus . pichon and co - workers first mildly permeabilized intact cells with detergent , in order to remove cytosolic but not nuclear gfp - fusion proteins , and then sorted the remaining gfp - positive cells using facs . this resulted in a 70-fold enrichment of cells expressing gfp - fusion proteins in the nucleus compared to cultures that had not been treated and sorted . clearly , tagging sequenced full - length cdnas on an individual basis retains the advantages but overcomes many drawbacks of the approaches described above . one advantage is the availability of a large clone resource from genome projects , the cdna sequences of which can be prescreened for already - known genes or species variants , so that only novel cdnas need to be gfp - tagged and screened . in addition , different versions of full - length gfp fusions - tagged at either the amino or the carboxyl terminus - can be generated and compared , helping to circumvent the risk of masking targeting sequences . indeed , as expected , often only one version of a gfp - tagged protein shows proper subcellular localization . although the tagging of full - length cdnas is a relatively low - throughput process and is reliant upon the identification of novel cdnas by other means such as systematic sequencing , it has a further clear advantage that no additional cloning is required once an interesting localization has been identified . tagging of full - length cdnas suffered until recently from the problem that conventional restriction - enzyme - based cloning had to be used , which is tedious and virtually impossible to do for any large set of molecules . to overcome this problem , we have recently devised a method that uses a recombination - based cloning system to systematically tag with gfp open reading frames of full - length cdnas that have been identified and sequenced by large - scale genome projects . the whole procedure is amenable to automation , and other characterization studies ( for example , mutagenesis , protein dynamics and identification of interacting partners ) can follow the localization screen immediately without further generation of new reagents or lengthy cloning procedures to identify the full - length cdnas . several bioinformatic tools have been developed with the aim of predicting protein localization on the basis of sequence features within the respective gene or cdna . one of the early methods , psort , detects in sequences the signals required for sorting proteins to particular subcellular compartments . although psort is a well - accessed program and is widely applicable to different organisms , its overall accuracy - at best , for yeast - is still in the region of 50% . others have used phylogenetic profiles , more careful use of annotated databases such as the meta - a evaluation of swiss - prot entries , or expression levels as means to tap into the knowledge that can be gained from determining localization . more profitable , perhaps , is to concentrate on specific organelles and the sequence motifs that direct proteins to them . for example , defined signals for directing proteins to mitochondria , the secretory pathway or chloroplasts are now well characterized , and the success rate of prediction can be as high as 90% . even the correct prediction of cleavage sites for the signal sequences is possible with more than 50% success rate . certainly the speed and cost of these methods is currently unsurpassed . as a result of more genome sequencing projects being completed , more data for comparisons are available , and so the quality of results using screening algorithms based on sequence homologies rises steadily . more databases , which integrate all this information , are therefore being implemented . experimental data gathered for individual genes , and ideally proteins , also funnels into such databases information that is then accessible to in silico tools . for many novel proteins , however , these tools remain at present suggestive at best , and for these molecules there is still no alternative to actual experimental verification . in summary , a protein 's localization and its subcellular dynamics are important parameters to know when trying to determine its function . with the availability of gfp and its variants , new in vivo approaches have been made possible , and these have already identified novel proteins in various desired locations . in due course , these techniques will undoubtedly be applied and perfected on a genome - wide scale . furthermore , the reagents generated during the course of such projects ( such as gfp - tagged proteins ) are extremely useful for subsequent microscope - based functional studies with different foci - for example , the analysis of a protein 's posttranslational modifications or the dynamics of interactions with binding partners in living cells . this will ultimately allow us to identify functional networks of proteins in a morphological context and will greatly contribute to our understanding of whole - cell function . the wiemann and pepperkok laboratories are supported by grants from the bmbf numbers 01kw9987 ( german cdna consortium ) , 01kw0012 ( to s.w . ) and 01kw0013 ( to r.p ) . the vero cells in ( a ) show the normal arrangement of microtubules ( green ) radiating from the microtubule - organizing center . the golgi complex ( indicated by the arrow ) , a membrane - bounded organelle through which all secretory proteins pass en route to the cell surface , is stained with antibodies against the coat protein complex copi ( red ; where red and green staining coincide they appear yellow ) . the cell in ( b ) has been treated with the drug brefeldin a , which causes rapid removal of the copi coat from golgi membranes into a cytoplasmic pool , followed by disassembly of the golgi apparatus . ( c ) treatment of a cell with the drug nocodazole causes disassembly of the microtubules into their respective cytoplasmic tubulin monomers . this breakdown of the microtubule network , a key component of cell architecture , also results in the breakdown of the golgi complex into distinct fragments spread throughout the cell ( as indicated by the arrowheads ) . the cell in ( d ) has been transfected with a gfp - tagged novel cdna , which when expressed localizes along the entire microtubule network ( green ) . but as the expression level of this protein increases , it interferes with the microtubule network with the concomitant result that the golgi is fragmented in a similar manner to that observed in ( c ) ( as indicated by the arrowheads ) . this phenotypic effect illustrates the dynamic interdependency of organelles exemplified by golgi morphology and the microtubule network . the nuclei of all the cells have also been stained with the dna - chelating agent diamino phenylindole ( dapi ; blue ) , showing that this organelle appears not to be affected by the various treatments .

taking each coding sequence from the human genome in turn and identifying the subcellular localization of the corresponding protein would be a significant contribution to understanding the function of each of these genes and to deciphering functional networks . this article highlights current approaches aimed at achieving this goal .

lipases ( triacylglycerol acyl hydrolases ec 3.1.1.3 ) are hydrolases that act on carboxylic ester bonds . the natural physiologic role of lipases is the hydrolysis of triglycerides into fatty acids and glycerol , but they can also catalyze esterifications and interesterifications in nonaqueous media [ 15 ] . most lipases have a -helical oligopeptide structure covering their active site ( lid or flap ) and making them inaccessible to substrates . in the absence of a hydrophobic interface , the active site is secluded from the reaction medium , and the enzyme is in the so - called closed conformation . however , in the presence of a hydrophobic interface ( a drop of oil ) , the lipase changes its conformation and exposes the catalytic site to the hydrophobic phase , yielding the open conformation [ 69 ] . the limitations of the industrial use of lipases have been mainly due to their high cost , which may be overcome by immobilization techniques on solid supports . immobilization facilitates the separation of products and provides more flexibility with enzyme / substrate contact by using various reactor configurations . moreover , immobilization on solid supports may improve enzyme features , from stability to selectivity [ 1014 ] . lipases have been immobilized by using different protocols as physical adsorption on hydrophobic and ionic exchange resins , covalent attachment on highly activated supports and encapsulation in organic matrices [ 1522 ] . covalent attachment of lipases on highly activated supports ( e.g. , with epoxy or aldehyde groups ) may promote an intense rigidification of their three - dimensional structure . the relative distances among all residues involved in the covalent immobilization have to be maintained during any conformational change induced by any distorting agent , for example , solvents and temperature [ 1519 ] . lipases can be also purified , immobilized , and stabilized via interfacial activation on hydrophobic supports . these enzymes are strongly adsorbed onto hydrophobic interfaces through the lid that covers their active site , recognizing these supports as their natural substrate ( hydrophobic oil interfaces ) . this technique is easy , cheap , and allows facile recycling of the support at the end of the life of the enzyme [ 9 , 2022 ] . after inactivation , the enzymes , including lipases , can be also fully desorbed from the support , and then the support can be reused for several cycles [ 13 , 23 ] . this work deals with the selection of a suitable procedure to immobilize lipase from penicillium camembertii ( lipase g ) . in order to achieve this goal , different protocols such as physical adsorption on octyl - agarose , poly(hydroxybutyrate ) ( phb ) , and amberlite resin xad-4 ; ionic adsorption on anionic exchange resin manae - agarose and covalent attachment on glyoxyl - agarose , manae - agarose cross - linked with glutaraldehyde , manae - agarose - glutaraldehyde , and epoxy - silica - polyvinyl alcohol composite ( epoxy - sio2-pva ) were tested . lipase g is a lipolytic enzyme preparation manufactured by amano enzyme inc . by a selected strain belonging to penicillium camembertii , which has unique substrate restricted to mono- and diglycerides reacting mainly with medium - chain molecules [ 24 , 25 ] this enzyme shows no activity towards triacylglycerols such as tripropionin , tributyrin , trioctanoin , and olive oil . this lipase has a single polypeptide chain consisting of 276 amino acid residues with two short disulfide bridges ( cys36cys41 and cys103cys106 ) and molecular weight of 30 kda . the catalytic triad of asp , his , and ser , was conserved at positions 199 , 259 , and 145 , respectively . penicillium camembertii lipase has a natural trend to form bimolecular aggregates by interaction between the hydrophobic surfaces surrounding the active centers via numerous hydrogen bonds and salt bridges . this lipase has shown consistent high production of monoglyceride in the direct acylation of glycerol with fatty acids having different chain lengths . although several reports have been published using this lipase preparation [ 17 , 18 , 26 ] , data relating its immobilization and the performance of the resulting immobilized derivative is still scarce in the literature . penicillium camembertii lipase ( lipase g ) was purchased from amano enzyme ( nagoya , japan ) , having protein concentration of 10 mgg of powder and specific activity of 85.9 1.80 iumg of protein . amberlite resin xad-4 was acquired from fluka ( buchs , swiss ) and poly(hydroxybutyrate ) ( phb ) from phb industrial s.a . agarose cl-6b ( sepharose cl-6b ) and octyl - agarose cl-4b ( 40 mol of octyl groupsml of gel ) were purchased from pharmacia biotech ( uppsala , sweden ) . glyoxyl - agarose ( 95 mol aldehydeg of support ) was prepared as previously described . manae - agarose - glutaraldehyde was prepared activating manae - agarose with glutaraldehyde dimeric form as previously described . tetraethylorthosilicate ( teos ) was purchased from sigma - aldrich chemicals co. ( milwaukee , wis , usa ) . epichlorohydrin , hydrochloric acid ( minimum 36% ) , and polyethylene glycol ( peg , molecular weight 1500 ) were supplied by reagen ( rio de janeiro , rj , brazil ) . polysiloxane - polyvinyl alcohol hybrid composite was prepared by hydrolysis and polycondensation of tetraethylorthosilicate ( teos ) according to the methodology previously described . the reagents teos ( 5 ml ) , ethanol ( 5 ml ) , and polyvinyl alcohol ( pva ) solution 2% ( w / v ) ( 6 ml ) were carefully mixed and stirred for 5 min at 60c , followed by the addition of 0.1 ml of concentrated hcl in order to catalyze the reaction . after 40 min , the solution was transferred to microwells of tissue culture plates ( disc shape ) and kept at room temperature until complete gel solidification ( formation of the interpenetrated network of sio2-pva ) . then , the spheres were ground in a ball mill to attain particles with 80 mesh ( tyler standard ) . activation of sio2-pva particles was carried out with epichlorohydrin 2.5% v / v at ph 7.0 for 1 h at room temperature , followed by exhaustive washings with distilled water . 1.0 g of octyl - agarose cl-4b , amberlite resin xad-4 , or phb were soaked into 5 ml of ethanol 96% ( v / v ) for 30 min , according to the methodology described by adlercreutz . the supports were filtered and incubated with 20 ml of 5 mmoll buffer tris - hcl ph 7.0 containing 0.25 mg proteinml for 24 h. the immobilized derivatives were recovered by vacuum filtration . powder lipase preparation was dissolved in 10 ml of 2.5 mmoll buffer tris - hcl ph 7.0 and mixed with 1.0 g of manae - agarose under mild stirring for 1 h at room temperature . manae - agarose was tested by offering different protein loadings ( 5.0 to 300 mgg of support ) to determine the support saturation . was dissolved in 10 ml of 100 mmoll of bicarbonate buffer ph 10.05 and mixed with 1.0 g of glyoxyl - agarose under mild stirring for 1 h at room temperature . immobilization on manae - agarose - glutaraldehyde or sio2-pva composite previously activated with epichlorohydrin ( epoxy - sio2-pva ) was performed by incubating 1.0 g of support in 10 ml of buffer tris - hcl ( 2.5 and 100 mmoll ) ph 7.0 under mild stirring for 1 h at room temperature , offering protein loading of 5 mgg of support . immobilization by ionic adsorption on manae - agarose followed by cross - linking with glutaraldehyde was performed by incubating 1.0 g of the immobilized lipase on manae - agarose in 9 ml of 1% ( v / v ) glutaraldehyde solution in buffer tris - hcl 5 mmoll ph 7.0 at room temperature for 40 min under mild stirring . powder lipase preparation was dissolved in 10 ml of 100 mmoll of bicarbonate buffer ph 10.05 and mixed with 1.0 g of glyoxyl - agarose under mild stirring for 1 h at room temperature . immobilization on manae - agarose - glutaraldehyde or sio2-pva composite previously activated with epichlorohydrin ( epoxy - sio2-pva ) was performed by incubating 1.0 g of support in 10 ml of buffer tris - hcl ( 2.5 and 100 mmoll ) ph 7.0 under mild stirring for 1 h at room temperature , offering protein loading of 5 mgg of support . immobilization by ionic adsorption on manae - agarose followed by cross - linking with glutaraldehyde was performed by incubating 1.0 g of the immobilized lipase on manae - agarose in 9 ml of 1% ( v / v ) glutaraldehyde solution in buffer tris - hcl 5 mmoll ph 7.0 at room temperature for 40 min under mild stirring . the derivatives were then filtered and washed thoroughly with milli - q water . in organic mediumepoxy - sio2-pva composite ( 1.0 g ) was soaked into hexane under stirring ( 100 rpm ) for 1 h at room temperature . then , excess of hexane was removed , and lipase was added at a ratio of 1 : 4 gram of enzyme per gram of support ( 2.5 mg of proteing of support ) . peg-1500 was added together with the enzyme solution at a fixed amount ( 100 lg of support ) . lipase - support system was maintained in contact for 16 h at 4c under static conditions . epoxy - sio2-pva composite ( 1.0 g ) was soaked into hexane under stirring ( 100 rpm ) for 1 h at room temperature . then , excess of hexane was removed , and lipase was added at a ratio of 1 : 4 gram of enzyme per gram of support ( 2.5 mg of proteing of support ) . peg-1500 was added together with the enzyme solution at a fixed amount ( 100 lg of support ) . lipase - support system was maintained in contact for 16 h at 4c under static conditions . hydrolytic activities of soluble and immobilized lipases were assayed using vinyl propionate as substrate , according to the methodology described by chahinian et al . . one international unit of activity was defined as the amount of enzyme that releases 1 mol of propionic acid per minute ( 1 iu ) under the assay conditions . protein was determined according to the methodology described by bradford using bovine serum albumin ( bsa ) as standard . immobilized protein ( ip ) was calculated by determining the amount of protein disappeared from the supernatant and comparing to the initial protein concentration offered ( mgg of support ) . recovered activity percentage ( ra ) was calculated by determining the activity of the immobilized enzyme ( apparent hydrolytic activity ) and comparing with the number of enzyme units that disappeared from the supernatant ( theoretically immobilized ) . the effect of temperature on the activity of free and immobilized lipase was determined at temperature range from 25 to 60c . for thermal stability tests , both free and immobilized lipase preparations were incubated in buffer tris - hcl ph 7.0 at 40 or 50c for 2 h. samples were removed and assayed for residual activity as previously described ( hydrolysis of vinyl propionate ) , taking an unheated control to be 100% active . all immobilization procedures were carried out in aqueous medium , except when epoxy - sio2-pva composite was used . for this matrix , the lipase was immobilized in both aqueous and organic media . table 2 displays the immobilization parameters in terms of immobilized protein ( ip ) , hydrolytic activity ( ha ) , and recovered activity ( ra ) for each procedure evaluated . the first methodology to be tested was the physical adsorption on highly hydrophobic supports with different characteristics such as octyl - agarose , phb , and amberlite xad-4 ( table 1 ) to take advantage of the complex mechanism of lipases as a tool that allows the immobilization via hydrophobic interaction at very low ionic strength [ 9 , 20 , 21 ] . lipases recognize these surfaces similarly to those of their natural substrates ( drops of oil ) , yielding immobilized derivative with open and hyperactivated structures [ 9 , 21 ] . however , lipase g was not immobilized by selective adsorption at very low ionic strength on three different hydrophobic supports tested , in agreement with data previously reported using hydrophobic matrix polypropylene . under these conditions , the aggregates of lipase g formed by strong interaction of hydrophobic pockets surrounding the active site of lipase molecules in open conformation were not displaced to monomeric form ( dissociation of the dimmers ) . the most common and easy protocol to perform reversible immobilization of enzymes with an easy regeneration of the support is the ionic adsorption on anionic exchange resins such as manae - agarose [ 13 , 23 ] . figure 1(a ) shows the immobilization course of the lipase g on manae - agarose by ionic adsorption . the procedure was quite fast , and after 60 min of contact between support and enzyme , the lipase immobilization was completed , resulting in protein immobilization up to 87% which corresponded to 4.52 0.18 mg proteing and hydrolytic activity of 55.6 2.60 iug gel . immobilization of lipase from different sources on manae - agarose by ionic adsorption has been previously reported to decrease the activity of the enzyme during immobilization procedure . manae - agarose activated with dimmers of glutaraldehyde was used to immobilize lipase g by covalent attachment at ph 7.0 . an attempt was made to increase the activity recovered by evaluating the influence of the buffer ( tris - hcl and phosphate ) and ionic strength ( 2.5 and 100 mmoll ) on the immobilization course of lipase g on manae - agarose - glutaraldehyde . figure 1(b ) shows that for both buffer solutions similar values for protein immobilized were found ( 4.10 and 4.47 mgg of support by incubating lipase g in buffer tris - hcl and phosphate , resp . ) . in this set of experiments , no significant effect of the ionic strength tris - hcl buffer ( 2.5 and 100 mmoll ) on the kinetic profile of the lipase immobilization was also verified . although it has been shown that the use of amino compounds , such as tris - hcl buffer , decreases the immobilization rate of the lipase preparation , for lipase g this was not observed . in addition , screening for a suitable buffer to be used in the hydrolytic assay revealed that the highest hydrolytic activity of lipase g was detected when incubated in tris - hcl ( 85.9 1.80 iumg of protein ) , 6-fold higher than incubating in buffer phosphate ( 13.7 1.80 iumg of protein ) . after 30 min of incubation , approximately 80% of the enzyme activity , corresponding to approximately 4.0 mg of proteing gel , was immobilized . although high - immobilized protein was attained , using both protocols ( lipase covalent attachment on glyoxyl - agarose and manae - agarose - glutaraldehyde ) , no hydrolytic activity was detected on the resulted immobilized derivatives . covalent interaction is followed by the formation of schiff 's bases ( c = n double bond ) between aldehyde groups and lysine residues placed on the enzyme surface . this type of interaction is likely to result in undesired mobility restriction of the enzyme or even displacement of the active site which may inactivate the lipase . multipoint covalent attachment of lipase g on highly activated glyoxyl - agarose was performed which rendered a derivative with high - immobilized protein concentration ( table 2 ) . however , free and immobilized lipase g activities were completely inactivated when incubated at ph 10.05 . covalent attachment of lipase g ionically adsorbed on manae - agarose , followed by cross - linking with glutaraldehyde , was also performed . as can be seen , the hydrolytic activity of the immobilized derivative after cross - linking with glutaraldehyde at low concentration ( 1% v / v at ph 7.0 ) decreased from 55.6 2.60 iug to 31.2 4.50 iug of support which can be attributed to the distortion effect of the three - dimensional structure of the lipase after cross - linking step . lipase g was also immobilized by covalent attachment on epoxy - sio2-pva composite in aqueous medium ( buffer tris - hcl ph 7.0 ) . epoxy - sio2-pva is a composite with surface area of 461 mg , pore volume of 0.275 mlg , and particles diameter of 175 m ( table 1 ) . this composite has been used extensively as a support for lipase from several sources [ 17 , 18 , 31 , 35 ] . in this procedure , 60% of the protein initially offered was covalently attached , rendering maximum protein loading of 3.00 0.04 mgg of support and hydrolytic activity of 9.50 0.30 iug of support ( table 2 ) . under these conditions , independent of the tested support , the immobilization of lipase g in aqueous medium by covalent attachment appeared to be unsuitable for obtaining high - activity derivatives . however , a different behavior was attained when the lipase g was immobilized on epoxy - sio2-pva composite by covalent attachment using hexane as coupling medium . under this condition , high hydrolytic activity ( 128.2 8.10 iug of support ) was attained which corresponded to 60.9 5.30% of recovered activity . this may be explained by the dissociation of the dimmeric form of the lipase in the presence of a nonmiscible solvent interface . similar results have been described by several researchers , indicating a new trend in the use of organic apolar solvent as coupling medium for lipase immobilization on different support types [ 1719 , 22 , 31 , 35 ] . immobilization of lipases from several sources on activated supports using hexane as coupling medium allows high retention of the catalytic activity in biotransformation reactions . for example , lipase from burkholderia cepacia ( bcl ) immobilized on epoxy - sio2-pva prepared by this methodology was found to have high and stable activity in the synthesis of monoglycerides by glycerolysis of babassu oil in packed - bed reactor with an estimated half - life of 50 days . however , such satisfactory performance depends on the support nature and substrate polarity . in the ester hydrolysis , for instance , candida rugosa immobilized in zirconium phosphate showed low stability after successive hydrolysis batches by either desorption or solubilization of the aggregates of enzymes in aqueous medium . the immobilization of lipase g on activated supports using hexane as coupling medium can be a very attractive for further use in nonaqueous medium reactions [ 18 , 35 ] . based on these results , although the immobilization of lipase g on manae - agarose by ionic adsorption rendered lower hydrolytic activity ( 55.6 2.60 iug of support ) than the immobilized derivative on epoxy - sio2-pva ( 128.2 8.10 iug of support ) , this methodology is expected of have potential to thermal stabilization of the enzyme . to determine the maximum protein loading that could be used in the immobilization of lipase g on manae - agarose by ionic adsorption , the amount of protein offered to the support varied from 5 to 30 mgg . for the maximum protein loading ( 30 mgg ) , 9.23 0.10 mg of protein.g of support was immobilized . the highest activity ( 68.8 2.70 iug of support ) was obtained when 20 mg of proteing was offered . the value of this parameter decreased from 14.2 0.43% for the lowest lipase loading ( 5 mgg of support ) to 8.22 0.50% for the maximum offered loading ( 30 mgg of support ) . the intrinsic velocity , which would be measured in the absence of mass transfer effects , is proportional to the enzyme loading . however , when this loading increases , the rate - controlling step will shift from the intrinsic reaction to pore diffusion , and an intraparticle profile of substrate concentrations would cause a reduction of the effectiveness factor of the biocatalyst beads . in addition , the effective diffusion coefficient within the gel may decrease even more in the presence of a high amount of immobilized enzyme , due to a reduction of the porous effective diameter caused by spatial hindrances [ 15 , 16 ] . the influence of temperature on the hydrolytic activity of free and immobilized lipase g was assessed in the range from 25 to 60c on the vinyl propionate hydrolysis ( 20 mmoll buffer tris - hcl ph 7.0 ) . the optimum temperature for both free and immobilized lipases was found to be at 35c , as shown in figure 2 . although no change on the optimum temperature was verified , the immobilized lipase had a slight higher hydrolytic activity in the range from 35 to 45c , indicating better stability of the three - dimensional structure of the immobilized derivative . such increase may be explained by the change of the conformational integrity of the enzyme structure upon covalent binding to the support and can be considered as an important feature for a possible industrial application because it allows to reduce substrate viscosity , favoring high - yield process . the thermal stability of the immobilized lipase was evaluated by measuring the residual activity of lipase g exposed to 40 ( figure 3(a ) ) and 50c ( figure 3(b ) ) in 100 mmoll buffer tris - hcl at ph 7.0 for 2 h. according to figure 3(a ) , the free lipase at 40c shows a half - life ( t1/2 ) of 25.6 min , whereas the half - life of the immobilized lipase at this temperature was 43 min . these results are in agreement with the hypothesis that the conformational flexibility of the enzyme was reduced after immobilization . however , at 50c , no difference was found between the curve profile for both free and immobilized lipases ( figure 3(b ) ) . therefore , the immobilization of the lipase on epoxy - sio2-pva led to a slight increase of enzyme rigidity at 40c . different protocols such as physical adsorption , covalent attachment , and ionic adsorption were tested . in aqueous medium , only the immobilization on manae - agarose by ionic adsorption gave derivative with satisfactory hydrolytic activity . immobilization on epoxy - sio2-pva by covalent attachment in organic medium was shown to be the most promising protocol for immobilizing lipase g rendering a derivative with the highest hydrolytic activity . the replacement of buffer by hexane was able to create a microenvironment favorable to the immobilization of the lipase and that enhanced its thermal stability . the immobilization of lipase g on epoxy - sio2-pva composite was shown to be a promising strategy for obtaining an active and stable biocatalyst .

the objective of this work was to select the most suitable procedure to immobilize lipase from penicillium camembertii ( lipase g ) . different techniques and supports were evaluated , including physical adsorption on hydrophobic supports octyl - agarose , poly(hydroxybutyrate ) and amberlite resin xad-4 ; ionic adsorption on the anionic exchange resin manae - agarose and covalent attachment on glyoxyl - agarose , manae - agarose cross - linked with glutaraldehyde , manae - agarose - glutaraldehyde , and epoxy - silica - polyvinyl alcohol composite . among the tested protocols , the highest hydrolytic activity ( 128.2 8.10 iug1 of support ) was achieved when the lipase was immobilized on epoxy - sio2-pva using hexane as coupling medium . lipase immobilized by ionic adsorption on manae - agarose also gave satisfactory result , attaining 55.6 2.60 iug1 of support . in this procedure , the maximum loading of immobilized enzyme was 9.3 mgg1 of gel , and the highest activity ( 68.8 2.70 iug1 of support ) was obtained when 20 mg of proteing1 was offered . immobilization carried out in aqueous medium by physical adsorption on hydrophobic supports and covalent attachment on manae - agarose - glutaraldehyde and glyoxyl - agarose was shown to be unfeasible for lipase g. thermal stability tests revealed that the immobilized derivative on epoxy - sio2-pva composite using hexane as coupling medium had a slight higher thermal stability than the free lipase .

a 59-year - old womon presented with an abnormal mass on chest x - ray that was discovered during a routine check - up . we obtained a biopsy though endobronchial ultrasound and pathologically diagnosed a thymoma ( type a ) . contrast - enhanced computed tomography showed a smooth , solitary homogeneously enhanced mass measuring 33.52 cm in the right paratracheal area , which had no calcification ( fig . the resected specimen was a firm light - gray tumor with a smooth capsule that measured 4.532.5 cm . postoperative follow - up proceeded without any problems , and the patient was discharged after 5 days . microscopy revealed that the tumor was a thymoma ( world health organization type a+b2 , masaoka staging i ) ( fig . the majority of thymomas are found in the anterior mediastinum . only a few thymic masses arising out of the anterior mediastinum have been described in the literature , and these have been found in an ectopic thymus location such as the neck , pulmonary hilus , or posterior mediastinum . the thymus arises embryologically from the third pharyngeal pouch and branchail cleft on each side . the thymic masses from each side then move toward each other and migrate from the midline to the anterior mediastinum and their final position . the incidence of ectopic thymic tissue is 3% to 5% in the retroinnomiate vein ( i.e. , a paratracheal site ) . surgical resection has been used for both a firm diagnosis and treatment in previously reported cases of a middle mediastinum thymoma . sakurai et al . reported that 18f - fluorodeoxyglucose positron emission tomography ( pet ) scan and 11c - acetate pet are useful for diagnosing a thymoma from the middle mediastinum as ectopic thymic tissue . castleman disease is an atypical lymphoproliferative disorder , and masses are commonly located in the chest . most patients are asymptomatic and lesions are accidentally found on chest x - ray as rounded mediastinal masses , often mistaken for a thymoma . thymomas rarely arise in the middle mediastinum , and thymoma is not considered in the differential diagnosis of middle mediastinum masses . but thymomas appear to have malignant potential , and the overall rate of thymoma recurrence is approximately 20% .

thymoma is a common anterior mediastinal mass , although thymomas have occasionally been found in the neck , pulmonary hillus , or posterior mediastinum . but a thymoma within the middle mediastinum has rarely been reported . we report a thymoma arising in the middle mediastinum with a review of the literature .

daptomycin is licensed in the usa and europe for the treatment of complicated skin and soft tissue infections caused by gram - positive organisms , including both susceptible and resistant strains of staphylococcus aureus , at a dose of 4 mg / kg daily . additionally , it had been licensed for the treatment of various infections due to susceptible organisms , including serious and life - threatening gram - positive infections , vancomycin - resistant enterococcal ( vre ) infections and endocarditis with associated bacteraemia at 6 mg / kg once daily . several studies also established dosing recommendations in patients undergoing various modes of renal replacement therapy [ 15 ] . daptomycin is not only primarily ( 78% ) excreted unchanged in the urine but also shows a favourable in vitro activity against gram - positive uropathogens , making it an ideal candidate to treat severe urinary tract infection ( uti ) . despite the rising prevalence of vancomycin - resistant enterococci in patients with complicated uti , there is a paucity of clinical data on daptomycin in this clinical situation . here , we now report the first case of successful uti treatment caused by vre using daptomycin in a renal transplant recipient with a complex medical history . a 68-year old caucasian female was admitted to the emergency room of our tertiary care hospital with rapidly progressing fever and hypotension . upon arrival the malnourished patient ( height 158 cm ; weight , 46 kg ; body mass index 18.4 kg / m ) had a blood pressure of 88/56 mmhg and a heart rate of 110/min . she presented with nausea and dizziness , but was conscious ( glasgow coma scale 13 ) . her past medical history was significant for kidney transplantation about 6 months prior to the admission due to underlying hypertensive kidney disease . she suffered from leucoencephalopathy as well as liver function impairment due to cirrhosis after longstanding alcohol abuse until 6 years prior to admission . laboratory analysis was remarkable for increased inflammatory parameters [ white blood count 22 000/l , c reactive protein ( crp ) 356 mg / l ] . mol / l when compared with the last available outpatient creatinine of 99 mol / l 7 days before . liver function test showed an increase in aspartate aminotransferase ( 143 u / l , upper limit 31 u / l ) and alanine aminotransferase ( 124 urinary sediment was positive for leucocytes ( > 20/view field ) and erythrocytes ( 1120/view field ) without the presence of any casts . after transfer to our unit the initial antibiotic therapy was switched from meropenem to daptomycin ( first dose 10 mg / kg body weight followed by 7.7 mg / kg doses ) . this was deemed to be prudent as the patient 's last uti , 4 months prior to this admission , was caused by a vancomycin - resistant enterococcus faecium , tested to be susceptible only to gentamycin and linezolid . although we wanted to avoid the former one due to its nephrotoxicity , especially in the state of acute kidney injury , the latter one was deemed inappropriate due to the impaired liver function , as the liver plays an important role in the elimination of the drug . in another culture , persistence of a vancomycin - resistant e. faecium was confirmed ( minimum inhibitory concentration : vancomycin 8.0 mg / l ; linezolid 0.5 mg / l ) . unfortunately , daptomycin was not tested in this resistogram as , at that time , it was not part of the routine test panel . the peak crp declined rapidly and function of the renal graft improved over the 5-day therapy ( figure 1 ) . 1.serum creatinine and crp levels of a renal transplant patient at last outpatient visit as well as during the hospital course / treatment of severe uti with daptomycin . serum creatinine and crp levels of a renal transplant patient at last outpatient visit as well as during the hospital course / treatment of severe uti with daptomycin . uti is the most common infection following renal transplantation , accounting for about half of all infectious complications in this patient population . in the first month after transplantation resistance to multiple antibiotics , including vancomycin , has increased in prevalence , particularly in infections involving e. faecium , where the rate of vancomycin - resistance can be as high 10% in north america and 7% in europe , varying in european countries . especially in patients with impaired renal function and concomitant hepatic dysfunction the management of utis caused by enterococcus spp . has become challenging because of the limited therapeutic options available that almost exclusively consist of nephrotoxic or hepatically eliminated drugs . our case as well as previous anecdotal reports suggest that daptomycin might be an effective alternative for uti caused by vancomycin - resistant enterococci as it is neither harmful for the kidney nor cleared by the liver . j.t.k . has received funds for speaking at symposia organized on behalf of novartis germany and has also received funds for research from novartis germany .

there is an increasing prevalence of urinary tract infection ( uti ) caused by multiresistant gram - negative enteric bacilli such as extended - spectrum beta - lactamase as well as gram - positive enterococci whose vancomycin - resistance can be as high as 25% . we report on a 68-year - old caucasian female with a uti caused by a vancomycin - resistant enterococcus faecium , only tested to be susceptible to gentamycin , linezolid and daptomycin . within a day after administration of the bactericidal daptomycin clinical and laboratory signs of infection regressed and graft function recovered . our case suggests that daptomycin might be an effective alternative for uti caused by vancomycin - resistant enterococci .

their unique amphiphilic properties have been exploited in a wide range of industrial and consumer applications . pfaas are exceptionally stable chemicals that have a very long degradation half - life in the environment . they can also be formed in the environment from the transformation of other industrially produced precursor compounds . , perfluorooctanesulfonic acid ( pfos ) and perfluorooctanoic acid ( pfoa ) have been associated with a wide range of adverse effects on both mammalian and aquatic organisms . the baltic sea is one of the world s largest brackish water systems with a highly populated and industrialized catchment . the long water residence time of 20 years makes the baltic sea particularly susceptible to pollution , and high levels of a range of persistent organic pollutants such as polychlorinated biphenyls , dibenzo - p - dioxins , and dibenzofurans have been found in baltic sea sediments and food webs . in recent years pfos concentrations in the eggs of baltic sea guillemots are among the highest ever reported in birds , and they are close to the levels that have been shown to cause adverse effects in other bird species . furthermore , temporal trend monitoring in baltic sea herring ( 19802010 ) and sea eagle eggs ( 19662010 ) showed increasing concentrations of pfos and long - chain perfluoroalkylcarboxylic acids ( pfcas , c8c15 ) ( personal communication , anders bignert ) . there is clearly a need to control pfaa levels in the baltic sea environment . in order to develop effective management strategies , the major sources ( both emissions to the environment and transport pathways ) of pfaas to the baltic sea must be identified . different conclusions have been drawn about the major transport pathways of pfaa contamination to surface waters . in a study of several small rivers in germany , it was concluded that the major part of pfaas entered the rivers via municipal wastewater treatment plants ( wwtps ) . in the first attempt at a pfaa mass balance of a large lake , boulanger et al . concluded that wwtp discharges represented a minor input pathway of pfoa to lake ontario compared to inflow from the other great lakes . scott et al . did a similar study for lake superior , a large lake with a much lower population density in the watershed and no known pfaa manufacturing sites . in contrast to boulanger et al . , this study included even precipitation , and it was concluded that wet deposition and riverine discharges represented the dominant pfaa inputs to the lake . to identify the major input pathways of pfaas to the baltic sea , a pfaa mass balance was assembled . available monitoring data were used to estimate pfaa inputs ( from river inflow , atmospheric deposition , wastewater discharges directly to the baltic sea , and inflow from the north sea via the danish straits ) and outputs ( to sediment burial , transformation of the chemical , and outflow via the danish straits to the north sea ) as well as the pfaa inventory in the baltic sea . in addition , a pfaa mass balance was conducted for the oder river watershed that compared the atmospheric deposition to the watershed with the inputs via wwtps throughout the watershed and the output from the watershed via oder river s discharge to the baltic sea . mass balances were conducted for four pfaas : perfluorohexanoic acid ( pfhxa ) , pfoa , perfluorodecanoic acid ( pfda ) and pfos ( see abbreviation list in the supporting information for further frequently used abbreviations and table s1 in supporting information for structures of the target chemicals ) . the data used were reported after 2006 . some of the data sets contained data points that were below the method detection limit ( mdl ; see table s2 in the supporting information ) . this introduced uncertainty into the calculation of the chemical fluxes and inventories . to set bounds on the uncertainty , two estimates were calculated : high - bound estimate ( hbe ) , for which all of the data points reported as nondetected were set to the mdl ; and low - bound estimate ( lbe ) , for which all of the data points reported as nondetected were set to 0 . calculated pfaa fluxes and inventories are given as ranges ( lbe hbe ) throughout the paper and the supporting information . despite this and other uncertainties , the fluxes and inventories are reported with three significant digits due to the need for aggregation for the overall mass balance . two mass balances were conducted , one for the baltic sea and one for the oder river catchment area . the rivers for which pfaa data were available are marked in the figure , and the oder river is highlighted . the baltic sea catchment has a population of 85 million , whereby approximately 15 million live within 10 km of the baltic sea coast . sweden , germany , denmark , and finland have high per capita gross domestic products ( gdp ) ( > u.s . $ 37 000 ) compared to russia , poland , latvia , estonia , and lithuania ( < u.s . there are no pfaa manufacturing sites in the baltic sea catchment to our knowledge . the five basins of the baltic sea are shown separated by gray lines ( bb , bothnian bay ; bs , bothnian sea ; gof , gulf of finland ; gor , gulf of riga ; bp , baltic proper ) . the colored landmasses represent the watersheds of the basins . the black dots are coastal cities with population > 35 000 , and the blue lines represent the rivers for which measurements of pfaa concentrations were available . the oder river is highlighted within the red box . the properties of the baltic sea of most relevance for the mass balance models are summarized in table 1 . although a one - box model was used for the mass balance of the baltic sea , it was divided into five basins for interpolation of the riverine input ( see figure 1 and table s3 in supporting information ) . each of the basins contained rivers for which pfaa concentration data were available : vindellven and kalixlven in the bothnian bay ( bb ) , kokemen and dallven in the bothnian sea ( bs ) , narva , purtse , and vantaa in the gulf of finland ( gof ) , daugava in the gulf of riga ( gor ) , and vistula , oder , eman , nemunas , norrstrm , and motala in the baltic proper ( bp ) . the processes considered in the mass balances for the baltic sea and the oder river catchment are illustrated in figure 2 . the system boundary for the baltic sea mass balance enclosed water and surface sediment . the input pathways ( hereafter also called sources ) treated were river inflow , atmospheric deposition ( which also includes pfaas that were formed from precursors in the atmosphere ) , coastal wastewater discharges , and inflow from the north sea via the danish straits , while the loss processes considered were sediment burial , transformation of the pfaas , and outflow via the danish straits to the north sea . the system boundary for the oder catchment mass balance enclosed the nonatmospheric portions of the catchment ( i.e. , land , surface water , groundwater , and associated solids ) . the input processes treated were atmospheric deposition and wastewater discharges , while the outflow from the oder to the baltic sea was the only loss process considered . schematic illustration of the processes included in pfaa mass balances of the baltic sea and the oder river catchment . the riverine input of pfaas , nriver ( kilograms per year ) , was calculated according to1where criver is the pfaa concentration in river water ( kilograms per cubic meter ) and qriver is the river discharge rate ( cubic meters per year ) . criver was compiled from two studies that analyzed water samples collected close to the mouths of major european rivers during autumn 2005 ( three rivers ) and 2007 ( 11 rivers ) . the detection frequencies of pfhxa , pfoa , pfda , and pfos in the rivers were 14% , 71% , 14% , and 71% , respectively . the data were scaled up from the river to the basin level by use of the river discharge weighted average concentration ( see section 2.1 in the supporting information for details ) . the input of pfaas via atmospheric deposition , ndeposition ( kilograms per year ) , was calculated according to2where cprecip is the pfaa concentration in precipitation ( kilograms per cubic meter of water ) and qprecip is the amount of precipitation deposited directly on the baltic sea ( cubic meters of water per year ) . cprecip was estimated from the mean pfaa concentrations ( see section 2.2 in the supporting information ) measured in 20 bulk deposition samples that were collected continuously between october 1 , 2007 , and may 8 , 2008 , at a site close to the southwestern corner of the baltic sea . concentrations in a similar range have been reported in wet deposition from northern finland , the swedish west coast , the united states , and asia.qprecip was taken from table 1 . the pfaa input from wwtp discharges directly into the baltic sea , nwwtp ( kilograms per year ) , was estimated according to3where cwwtp is the pfaa concentration in the wwtp effluent ( kilograms per cubic meter ) , qwwtp is the amount of wastewater discharged annually per population equivalent [ cubic meters per year per population equivalent ( pe ) ] , and pequiv is the number of population equivalents connected to wwtps discharging directly into the baltic sea . cwwtp was estimated from recent measurements of pfaa concentrations in effluents from wwtps discharging directly to the baltic sea . two to four wwtps were studied for six of the nine countries bordering on the baltic sea . two to six samples were collected from each wwtp between october 9 , 2009 , and august 10 , 2010 . the values of qwwtp were taken from the literature , while pequiv was estimated by selecting coastal cities with populations greater than 35 000 inhabitants ( which serve > 80% of the population in the coastal region ) . input of pfaas from the north sea through the danish straits , nns ( kilograms per year ) , was estimated as4where cns is the pfaa concentration in north sea water ( kilograms per cubic meter ) and qns is the annual inflow of water from the north sea through the danish straits ( cubic meters per year ) . cns was estimated from pfaa concentrations measured in surface water samples collected at three stations along the southern coast of norway in 2007 ( table s11 in supporting information ) . for annual water inflow qns , an average value of 475 10 m / year was used ( table 1 ) . the lower limit for the phototransformation half - life of pfoa in coastal oceans was recently estimated to be 25 600 years . we are not aware of any evidence showing pfaa transformation in water via other mechanisms . hence the transformation half - life t0.5 of pfoa in baltic sea water was assumed to be 25 600 years and the loss due to transformation , ntran ( kilograms per year ) , was calculated according to5where vbaltic is the volume of water in the baltic sea ( cubic kilometers ) and cbaltic is the pfaa concentration in the baltic sea ( kilograms of pfaa per cubic kilometer ) . vbaltic is given in table 1 and cbaltic is given in table s16 ( supporting information ) . in the absence of information on the transformation of other pfaas besides pfoa , t0.5 was assumed to be 25 600 years for all four chemicals . outflow of pfaas through the danish straits , nds ( kilograms per year ) , was determined according to6where cbp is the pfaa concentration in water in the baltic proper ( kilograms per cubic meter ) and qds is the annual outflow of water from the baltic sea through the danish straits ( cubic meters per year ) . the estimation of cbp is described in section 2.4.1 , and qds is given in table 1 . cbp and nds are listed in table s14 ( supporting information ) . the rate of loss of pfaa due to sediment burial , nburial ( kilograms per year ) , was calculated according to7where qburial is the rate at which sediment is buried in the baltic sea ( kilograms of sediment dry weight per year ; see table 1 ) and csed is the pfaa concentration in the sediment being buried ( kilograms of pfaa per kilogram of sediment dry weight ) . the estimation of csed is made from pfaa concentrations measured in baltic sea water and kd values taken from the literature as described in section 2.4.2 . kd , csed , and nburial are listed in table s15 ( supporting information ) . the pfaa inventory in baltic sea water , mwater ( kilograms ) , was calculated according to8where cwater , basin is the pfaa concentration in water in the basin ( kilograms per cubic meter ) and vbasin is the volume of water in the basin ( cubic meters ) . the basins and their water volumes are listed in table s3 ( supporting information ) . cwater , basin was estimated from pfaa concentrations measured in 62 water samples collected at depths of 23 and 5 m on two cruises in the baltic sea during the summer of 2008 . the number of samples collected , detection frequency of the pfaas , average pfaa concentrations , and pfaa inventories are given for each basin in tables s16 and s17 ( supporting information ) . the lack of strong spatial gradients supports the use of the simple box model to assess the chemical mass balance . the pfaa inventory in baltic sea sediment , msed ( kilograms ) , was calculated according to9where csed , basin is the pfaa concentration in the surface sediment of the basin ( kilograms of pfaa per kilogram of sediment dry weight ) , abasin is the surface area of the basin ( square meters ) , dsed is the average depth of the surface sediment ( meters ) , sed is the porosity of the sediment ( cubic meters of nonsolids per cubic meter of bulk sediment ) , and sed is the density of the dry sediment ( kilograms per cubic meter of solids ) . sed was set to 0.89 , while sed was assumed to equal 2500 kg / m . the pfaa concentration in sediment , csed , basin ( kilograms of pfaa per kilogram of sediment dry weight ) , was calculated from the pfaa concentration in water , cwater , basin , with the assumption of equilibrium partitioning:10where kd is the equilibrium partition coefficient ( cubic meters per kilogram of sediment dry weight ) . cwater , basin ( kilograms of pfaa per cubic meter ) was determined as in section 2.4.1 , and kd values measured for baltic sea sediments ( 168 , 423 , 4795 , and 1185 m / kgsediment dry weight for pfhxa , pfoa , pfda , and pfos , respectively ) were used . the pfaa inventories in sediment are given in table s18 ( supporting information ) . the mass balance of the oder catchment considered pfaa inputs from wwtps and atmospheric deposition , while riverine discharge was the only output included ( transformation and sedimentation were assumed to be negligible ) . input from wwtps was calculated by multiplying the annual pfaa input per population equivalent for poland ( see section 2.2.3 ) by the total population within the catchment . atmospheric deposition was calculated from eq 2 , where qprecip was the amount of precipitation to the oder catchment ( cubic meters per year ) , which was taken from the data supporting the nest decision support system ( erik smedberg , personal communication ) . the riverine discharge was equal to the riverine input of the oder to the baltic sea ( see table s4 in supporting information ) . as with the baltic sea model , this was an input / output mass balance that made no assumptions about how the chemicals behaved within the model domain . the results of the mass balance for the baltic sea are summarized in table 2 . detailed results per basin for the lbe and hbe input scenarios are given in tables s12 and s13 , respectively ( supporting information ) . ranges are delineated by low - bound estimates ( lbe ) and high - bound estimates ( hbe ) . rivers were a major source of the four pfaas to the baltic sea ( table 2 ) . they accounted for 1073% of the total input of pfhxa , 4859% of pfoa , 2867% of pfda , and 77% of pfos ( tables s12 and s13 , supporting information ) . it accounted for 1137% of the total input of pfhxa , 3443% of pfoa , 3172% of pfda , and 2021% of pfos . the north sea made a significant contribution to the lbe scenario for pfhxa ( 49% ) , but otherwise its contribution to the mass balance was insignificant . wwtp discharges directly to the baltic sea made a negligible contribution to the overall mass balance . they accounted for 4% of the lbe of the pfhxa mass balance ; otherwise their contribution was 2% . the mean concentrations of pfhxa , pfoa , and pfos in effluent waters were significantly higher for the group of countries with higher per capita gdp ( > u.s . $ 37 000 ) ( i.e. , 4.97 , 8.98 , and 8.45 ng / l , respectively ) in comparison to the group with lower per capita gdp ( < u.s . $ 20 500 ) ( i.e. , 1.07 , 5.33 , and 1.67 ng / l , respectively ) ( p < 0.05 , t - test ) . in tables s12 and s13 ( supporting information ) , the inputs from rivers , atmospheric deposition , and wwtps are compared on a basin basis . the lbe estimates suggest that wwtps could make a significant contribution to the total input of pfhxa , pfoa , and pfos to the gulf of finland ( 20% , 15% , and 13% , respectively ) . the differences between lbe and hbe in table 2 show that a large fraction of nonquantifiable data points imparts considerable uncertainty to some of the input estimates . this is particularly true for the riverine inputs of pfhxa and pfda and the north sea inputs of pfda and pfos . however , this uncertainty does not affect the major observation that rivers and atmospheric deposition are much more important sources of pfaas to the baltic sea than wwtps . outflow through the danish straits is the most important output pathway for pfaas in the baltic sea ( table 2 ) . it accounts for 2432% of the total output of pfda and 9% for pfos , while it is an insignificant sink for pfhxa and pfoa ( 1% and 3% , respectively ) . the inventory of most of the pfaas is largely stored in the water column , not in the sediment . water was estimated to contain 96% , 91% , 46% , and 78% of the baltic sea inventory of pfhxa , pfoa , pfda , and pfos , respectively . the results of the pfaa mass balance of the oder catchment are presented in table 3 . wwtps are an insignificant source of all four pfaas except for pfhxa , for which they contribute 9% . the total inputs and the total outputs are similar for pfhxa and pfos . for pfoa and pfda , the inputs are 3.7 and > 2.7 times greater , respectively , than the outputs . ranges are delineated by low - bound estimates ( lbe ) and high - bound estimates ( hbe ) . a major observation in this study is that wwtps make a minor contribution to the total pfaa input to the baltic sea . the results for the oder catchment mass balance show that this is also true when the indirect inputs of wwtp discharges to rivers flowing into the baltic sea are considered . cohiba , a recent project on the control of hazardous substances in the baltic sea region , estimated the total discharges of pfoa and pfos via wwtps to the baltic sea catchment to be 200 and 100 kg / year , respectively . these are similar to our estimates when they are scaled up to the whole baltic sea catchment . the small contribution of pfaas from wwtp effluents is also consistent with the observations of boulanger et al . , who estimated wwtp discharges of pfoa to lake ontario to be considerably smaller than riverine input via the niagara river . it is also in agreement with the findings of scott et al . , who found that wwtps contributed just 6% and 8% of the pfoa and pfos input , respectively , to lake superior . a second major observation is that atmospheric deposition is a dominant source of pfaas to the baltic sea . this conclusion is reinforced by the indirect contribution of atmospheric deposition through riverine input as indicated by the oder catchment mass balance . other emissions from the technosphere may contribute to pfaas at the catchment level . for instance , the cohiba project estimated that other sources besides wwtp effluent ( largely the use of firefighting foams on land ) result in emissions of 160 kg / year pfos and 330 kg / year pfoa to the baltic sea watershed . this is < 25% of our estimates of the total input to the baltic sea and < 25% of the atmospheric deposition to the baltic sea catchment ( scaled up from the oder catchment ) . the dominant impact of atmospheric deposition is consistent with the work of scott et al . , who concluded that this is the dominant source of pfaas to lake superior . the fact that atmospheric deposition also dominates in the highly populated baltic sea watershed provides stronger evidence that atmospheric deposition is currently a more important source of pfaa contamination of the environment than known anthropogenic emissions to land and water . the importance of atmospheric deposition observed in this study is consistent with the results of a mass balance conducted on a smaller spatial scale . a study of two rain events in a 10 km watershed in switzerland showed that rain , wwtp effluent , and surface runoff in stormwater all contributed significantly to the fluxes of a range of pfaas . an explanation for the greater importance of wwtp effluent in the swiss study is the higher population density of 2100 persons / km compared with 49 and 136 persons / km for the baltic sea and oder catchments , respectively . the dominance of atmospheric deposition as a pfaa source to a highly developed region such as the baltic sea has consequences for the environmental risk management of pfaas . focusing management efforts on reducing municipal wwtp emissions of pfaas will not lead to marked reductions of pfaa inputs to the baltic sea . this can only be achieved by measures that lead to a reduction of atmospheric deposition of pfaas . it is currently not clear what the sources of the pfaas in the atmosphere are . one explanation is direct emissions of the chemicals . for instance , emissions from fluoropolymer production facilities have been proposed as a major source of pfoa to the atmosphere . a third possibility is that pfaas are being transferred via sea spray to the atmosphere , and that the levels in atmospheric deposition are thus coming ( at least partly ) from environmental recirculation and not from primary emissions . armitage et al . used multimedia models and available data to assess the contributions of different sources to pfoa levels in the atmosphere , but they were unable to clearly identify the dominant source(s ) due to large uncertainties in key parameters . the understanding of the sources of pfos in the atmosphere is also incomplete , whereby a major contributor is believed to be the transformation of precursor compounds emitted from production facilities and fluorochemical products . a third major observation of the present study was that the input of the pfaas to the baltic sea exceeds the output . this was the case for all four chemicals , regardless of whether the lbe or hbe results were used . this mass balance excess indicates that the concentrations of all chemicals are increasing in the baltic sea . when the difference between pfaa input and output is compared with the pfaa inventory , the doubling time for the concentration in the baltic sea can be estimated . this amounts to 894 years for pfhxa , 1216 years for pfoa , 35 years for pfda , and 4 years for pfos . general trends of increasing concentrations of pfoa , pfda , and pfos have been observed in biomonitoring data for baltic sea herring up to 2010 ( anders bignert , personal communication ) . although the year - to - year variability is considerable , these biomonitoring data suggest doubling times on the order of 1015 years for pfoa , 48 years for pfda , and 510 years for pfos during the first decade of the millennium . a positive mass balance for the baltic sea suggests that inputs during the period when the samples were collected ( 20052011 ) must have been higher than the average input during the previous 20 years ( the water residence time in the baltic sea ) . it is notable that the contribution of direct atmospheric deposition to the total input to the baltic sea was smaller for pfos than for the other substances ; the dominant source was the rivers ( table 2 ) . there are significant nonatmospheric sources of pfos to river water , such as the use of firefighting foam . firefighting foam is known to have been a major source of pfos to the norrstrm river , which has elevated pfos concentrations compared to the bulk of the rivers ( see table s4 in supporting information ) . the input from such sources could have increased over time . after firefighting training exercises , pfos is known to be transferred into groundwater , from which it will eventually be discharged to surface water . the transfer of pfos from training sites to groundwater has been shown to continue for years after pfos release has ceased . this can result in the peak in pfos release to surface water being delayed compared to the peak in firefighting foam usage . another factor that could have caused an increase in riverine inputs of pfos and other pfaas during the 2000s is release of residues stored in the watershed . the median pfos concentration in the world s background soils was recently estimated to be 0.47 ng / g dry weight , whereby one - sixth of the soil samples included in the international survey were from norway . assuming that the baltic sea watershed is covered with a 10 cm deep layer of soil with this pfos concentration , this soil would contain 60 000 kg of pfos . this is more than an order of magnitude greater than the pfos inventory in the baltic sea ( see table 2 ) . this illustrates that soil potentially is a large reservoir of pfos that will buffer pfos inputs from atmospheric deposition , delaying and modulating their transfer via surface runoff and groundwater to surface water . research is needed to overcome this knowledge gap if we are to be able to develop effective strategies for reducing pfos levels in surface waters and to predict how pfos concentrations in surface waters will change as a result of management strategies . in 2012 the european commission proposed that concentrations of pfos should not exceed 0.13 ng / l in marine waters . there is clearly a need to reduce the inputs of pfos and other pfaas to the baltic sea . this will require identifying and controlling the sources of pfaas in the atmosphere and obtaining a better understanding of how they travel through the terrestrial environment to surface water .

a mass balance was assembled for perfluorohexanoic acid ( pfhxa ) , perfluorooctanoic acid ( pfoa ) , perfluorodecanoic acid ( pfda ) , and perfluorooctanesulfonic acid ( pfos ) in the baltic sea . inputs ( from riverine discharge , atmospheric deposition , coastal wastewater discharges , and the north sea ) and outputs ( to sediment burial , transformation of the chemical , and the north sea ) , as well as the inventory in the baltic sea , were estimated from recently published monitoring data . formation of the chemicals in the water column from precursors was not considered . river inflow and atmospheric deposition were the dominant inputs , while wastewater treatment plant ( wwtp ) effluents made a minor contribution ( < 5% ) . a mass balance of the oder river watershed was assembled to explore the sources of the perfluoroalkyl acids ( pfaas ) in the river inflow . it indicated that wwtp effluents made only a moderate contribution to riverine discharge ( 21% for pfoa , 6% for pfos ) , while atmospheric deposition to the watershed was 12 orders of magnitude greater than wwtp discharges . the input to the baltic sea exceeded the output for all four pfaas , suggesting that inputs were higher during 20052010 than during the previous 20 years despite efforts to reduce emissions of pfaas . one possible explanation is the retention and delayed release of pfaas from atmospheric deposition in the soils and groundwater of the watershed .

partial nephrectomy ( pn ) represents the current standard of care for t1 renal tumors that are 4 cm or less in diameter ( 123 ) . for larger t1b tumors , several retrospective studies have reported that elective pn yields equivalent oncological , but superior renal functional outcomes compared with radical nephrectomy ( rn ) ( 45 ) . by reducing surgery - induced chronic kidney disease ( ckd ) , pn for these patients has been suggested to be associated with reduced cardiovascular morbidity and overall mortality ( 46 ) . however , the only randomized study to date conducted by the european organization for the research and treatment of cancer ( eortc ) on this subject could not demonstrate benefit in overall survival , despite a significant reduction in surgery - induced ckd ( 7 ) . surgery for renal tumors is selected based on various patient and tumor characteristics , and anatomical tumor characteristics are among the most important determinants . although many indices have been studied to objectively describe renal tumors and quantify relationships between tumor characteristics and measurements of perioperative outcomes , the renal nephrometry score ( ns ) is becoming increasingly accepted ( 891011 ) . the ns has been demonstrated to correlate with various perioperative outcomes , including ischemia time and postoperative complications following open , laparoscopic , and robot - assisted pn ( 12131415 ) . furthermore , several researchers have suggested that this score can predict renal cell carcinoma ( rcc ) grades and survival outcomes after radical surgery ( 1617 ) . in the current study , we aimed to examine if there was a subgroup among patients with t1b renal tumors who could functionally benefit from pn and develop methods to objectively identify such patients preoperatively using the ns . this study was performed by reviewing medical records of all patients with pathological t1b rcc who had undergone nephrectomy from 1998 to 2010 . patients with a single kidney , multiple renal tumors , or follow - up without evidence of recurrence for less than 1 year were excluded . finally , 483 rn - treated patients and 40 pn - treated patients with a normal contralateral kidney were included for analysis . a 1:2 propensity score analysis without replacement was performed in our current patient cohort to define groups with comparable variables that indicated the potential to influence progression to postoperative ckd , including age , past medical history ( diabetes mellitus or hypertension ) , preoperative serum creatinine levels , and tumor size ( 11819 ) . the matchit package within r was used to perform matching according to propensity scores . serum creatinine levels , which were used to calculate the estimated glomerular filtration rate ( egfr ) that is based on the modification of diet in renal disease ( mdrd ) equation , were measured before surgery , at 3 , 6 , and 12 months postoperatively , and then annually for 5 years . at each time point , the probability of egfr < 60 ml / min/1.73 m and the 95% confidence interval ( ci ) were calculated . in our present analysis , postoperative ckd was defined as an egfr that declined to < 60 ml / min/1.73 m and then remained below this threshold . the ns and kidney volume change before and after pn were based on computed tomography performed before surgery and at 3 months postoperatively , as described previously ( 20 ) . the affected - side kidney volume was measured before and after pn in 34 ( 85.0% ) patients using cross - sectional imaging studies . in 6 ( 15.0% ) of the study patients , the kidney volume reduction after pn could not be calculated because the pre- or / and post - operative cross - sectional imaging studies had not been digitized . patients and tumor characteristics were compared between patients who underwent rn and pn using the pearson 's test and student 's t - test . the probability of developing 5-year postoperative ckd according to operative methods ( pn vs. rn ) and the risk factors for ckd were evaluated using kaplan - meier analysis , in which the continuous variables were dichotomized using median values . generation of a cox regression proportional hazards model with and without interactions and tests of the model that assessed the area under the curve ( auc ) of the receiver - operating characteristics ( roc ) curve were carried out to identify independent prognostic variables for ckd at 5 years . additional analyses that stratified patients according to the ns ( 8 vs. 9 ) were performed within the propensity - adjusted analyses . recurrence - free survival , cancer - specific survival , and overall survival according to the ns were calculated and compared using kaplan - meier analyses and the log - rank test . the mean follow - up duration was 105 months ( median , 106 months ; interquartile range [ iqr ] , 66139 ) . all statistical comparisons were performed using spss software , version 21 ( spss inc . , chicago , il , usa ) and r version 3.0.2 ( http://www.r-project.com ) . a threshold for statistically significant differences was set at p < 0.05 . the present study protocol was reviewed and approved by the institutional review board of asan medical center ( irb no . the present study protocol was reviewed and approved by the institutional review board of asan medical center ( irb no . the patient and tumor characteristics for the entire study cohort are presented in table 1 . prior to matching , the rates of ckd at 3 and 6 months postoperatively were 62.9% ( 95% ci , 58.967.2 ) and 62.7% ( 95% ci , 58.267.4 ) respectively , which was significantly reduced by 5 years postoperatively ( 50.0% ; 95% ci , 43.057.0 ) . after matching , there were no significant differences between the 2 groups except for the ns ( p < 0.001 ) . 1a ) , and was 40.7% after rn and 13.5% after pn ( p = 0.005 ) . a reduction in the rate of incidence of ckd by pn was more pronounced in patients < 50 years old , without a past medical history and with a preoperative egfr < 80 ml / min/1.73 m ; however , compared to rn , pn reduced the risk irrespective of these characteristics ( fig . additionally , the ckd probability was significantly lower following pn compared with rn in patients with an ns 8 ( 3.6% vs. 61.9% ; p < 0.001 ) , but not in patients with an ns 9 ( 33.0% vs. 38.3% ; p = 0.746 ) ( fig . rn = radical nephrectomy , pn = partial nephrectomy , gfr = glomerular filtration rate , ns = nephrometry score . solid line , all patients ; dotted line , rn ; dashed line , pn . ( a ) entire cohort ( p = 0.005 ) ; ( b ) patients aged < 50 years ( p = 0.013 ) and 50 years ( p = 0.063 ) ; ( c ) patients with a past medical history ( htn or dm ; p = 0.132 ) and without a past medical history ( p = 0.008 ) ; ( d ) patients with a preoperative estimated gfr < 80 ml / min/1.73 m ( p = 0.014 ) and 80 ml / min/1.73 m ( p = 0.073 ) ; ( e ) patients with a renal ns 8 ( p < 0.001 ) and 9 ( p = 0.746 ) . ckd = chronic kidney disease , rn = radical nephrectomy , pn = partial nephrectomy , htn = hypertension , dm = diabetes mellitus , gfr = glomerular filtration rate , ns = nephrometry score . the pre- and post - operative operated - side kidney volumes were 224.7 42.6 ml and 136.2 34.3 ml , respectively , in patients who underwent pn . the absolute kidney volume reduction was 88.6 47.7 ml and the percent volume reduction was 38.0% 15.9% . preoperative kidney volumes were similar between patients with an ns 9 and 8 ( 234.3 vs. 222.2 ml ; p = 0.510 ) . the percent volume reduction was slightly greater in patients with an ns 9 compared to 8 , but this difference was not statistically significant ( 48.1% vs. 35.4% ; p = 0.060 ) . ischemia time was recorded in 31 ( 77.5% ) patients who underwent pn ; among these patients , cold ischemia was performed in 7 ( 22.6% ) patients . there were no significant differences in the ischemia time between patients with an ns 9 and 8 ( 24.3 vs. 21.2 minutes ; p = 0.363 ) . an older age at operation ( p < 0.001 ) increased the risk of ckd , whereas a higher preoperative egfr ( p < 0.001 ) and pn ( p = 0.008 ) reduced this risk . we observed a significant interaction between the ns and the operative methods ( hazard ratio [ hr ] , 17.65 ; p = 0.015 ) , and we found that the model was significantly more robust after accounting for this interaction ( auc , 0.878 vs. 0.825 ; p = 0.030 ) . therefore , in the cox regression analysis for postoperative ckd progression at 5 years post - surgery , we stratified patients according to the surgical methods rn or pn . in our present analysis , pn significantly reduced the ckd probability in patients with an ns 8 ( hr , 0.054 ; 95% ci , 0.0070.411 ) , but not in patients with an ns 9 ( hr , 0.996 ; 95% ci , 0.3332.981 ; table 2 ) . ckd = chronic kidney disease , pn = partial nephrectomy , rn = radical nephrectomy , hr = hazard ratio , ci = confidence interval , ns = nephrometry score . recurrence - free survival was poorer in patients with an ns 9 compared to ns 8 ( p = 0.047 ; fig . 2 ) . however , overall survival ( p = 0.697 ) and cancer - specific survival ( p = 0.272 ) were comparable between these 2 groups . there were no differences in recurrence - free survival , cancer specific survival , or overall survival in patients with an ns 8 vs. 9 according to the operative methods , respectively . solid line , renal ns 9 ; dotted line , renal ns 8 . ( a ) recurrence - free survival ( p = 0.047 ) ; ( b ) overall survival ( p = 0.697 ) ; ( c ) cancer - specific survival ( p = 0.272 ) . each line has a different meaning ( solid line , renal ns 9 ; dotted line , renal ns 8) . for elective cases of t1b renal tumors , the recommendation of pn over rn is derived from the benefits obtained by preserving renal function without compromising oncological outcomes ( 21 ) . however , we often observe that despite nephron - sparing surgery , some patients still progress to ckd . on the other hand , although current treatment guidelines suggest pn whenever it is technically feasible ( 322 ) , we found that not all spared nephrons remain functional and that further differentiation in the selection criteria was necessary . the usefulness of the tools for preoperatively describing tumor complexity , such as the ns , has been investigated and consistently shown to be applicable for selecting operative methods and patient counseling ( 10 ) . in our present study , we showed that ns can be used to identify a subgroup of patients who can benefit from pn . reduction of risk for ckd progression by nephron - sparing surgery was observed only in tumors with ns 8 , but not in tumors with ns 9 . similar progression to ckd was observed following pn or rn for tumors with ns 9 . the ns numerically represents tumor anatomical detail in relation to renal structures . this score can generally be divided into 3 categories ( low , 46 ; intermediate , 79 ; and high , 1012 ) . in our present study , the proportion of patients undergoing pn markedly reduced with advancing ns , and that less than 5% of renal masses with high ns underwent pn , which is similar to the findings of a previous study ( 11 ) . similar to our present study , all previous studies that reported benefits of pn for t1b tumors were based on non - randomized retrospective series . therefore , patients in the previous studies may have been heavily selected , resulting in a consistent detection of an advantageous role for pn over rn . based on our results , we suggest that a ns of 9 may be a clinically useful cut - off . for a t1b tumor to be assigned a ns 9 , it should be entirely endophytic , renal hilum - invasive , and/or cross the midline of the kidney . compared to tumors at more polar locations , excision of these central tumors involves severing vascular structures and suture - hemostasis at a more proximal level . this can lead to loss of function due to devascularization , even if the parenchymal volume is spared . our findings of similar percent volume reductions after similar ischemia times for ns 8 and 9 patients , but significantly greater progression to ckd in patients with an ns 9 supports this hypothesis . the decision to conduct pn is generally made based on various tumor and patient characteristics , as well as the preferences of the surgeon . compared to rn , pn inherently involves a higher risk of perioperative complications ( 23 ) . although minimally invasive pn approaches are becoming more popular , they are associated with a higher rate of complications , even for the most experienced hands ( 24 ) . furthermore , methods to achieve cold ischemia during minimally invasive pn are not yet available . t1b tumors are frequently complex , as was indicated by the ns distribution in our present patient cohort , so the conventional open method with cold ischemia over a minimally invasive approach may be preferred when nephron - sparing options are considered . however , if the nephron - sparing approach can not preserve as much function as expected , the merits and limitations of open pn and minimally invasive rn should be compared before operative modalities are selected . while cancer control and renal function preservation are the primary goals of surgery for these patients , quality of life also needs to be considered if these primary objectives can be equally achieved ( 21 ) . considering the similar functional outcomes after rn and pn found in our current study in patients with ns 9 , we propose that minimally invasive rn could be a better choice for these patients . moreover , such patients could be spared the risk of developing potential complications of pn or undergoing the hardships of open surgery and instead be offered minimally invasive rn . however , the selection of operative methods should remain highly individualized after consideration of the overall status of the patient . pn has been recommended for t1b tumors based on evidence of equivalent oncological outcomes compared with rn ( 5 ) . however , we previously reported that hilar - located tumors are associated with poorer recurrence - free survival ( 25 ) . in this present study , patients with a ns 9 had more aggressive tumors and showed a lower recurrence - free survival rate , consistent with the findings of previous studies ( 1626 ) . for patients with a ns 9 tumor and a normal contralateral kidney , minimally invasive rn can be expected to achieve better oncological outcome and similar functional outcome compared to pn . in patients with an ns 8 , although these results need to be validated , our present findings support the use of rn rather than pn for complex , centrally located tumors . because of compensatory changes in renal function , a relatively long follow - up period is thought to be essential for assessing the probability of ckd development . therefore , patients who had been recently operated on could not be included in our cohort . another limitation was that the probability of pathological upstaging was ignored because patients were selected based on pathological staging , rather than clinical staging , to compare oncological outcomes . however , the probability of pathological upstaging in clinical t1b rcc was equivalent between our patients who underwent rn and pn in our rcc registry ( 7.3% vs. 3.9% ; p = 0.289 ) . our present study is of value because we could minimize the differences between the rn and pn groups and arrive at some reliable conclusions using propensity score - matched analysis . moreover , to the best of our knowledge , our current study is the first to suggest a cut - off ns for rn in t1b rcc without increasing the probability of developing ckd over pn . clinicians could therefore be assisted by our findings in the future when selecting optimal operative methods for patients with t1b rcc . although there may be real benefits to elective pn for t1b renal tumors , it would be prudent to proceed with caution after considering tumor complexity . additional studies of the roles of pn in complex t1b renal masses with a normal contralateral kidney are needed to consider the results of our present study and those of similar previous reports ( 27 ) . in conclusion , among patients with t1b renal tumors , the ns can effectively identify cases who could benefit from nephron - sparing surgery . compared to rn , the risk of progression to surgery - induced ckd is not reduced following pn in renal tumors with a ns 9 . considering the potential complications of pn , minimally invasive rn could be considered as a viable alternative approach for this subgroup of patients .

this study aimed to determine patients with t1b renal cell carcinoma ( rcc ) who could benefit from partial nephrectomy ( pn ) and method to identify them preoperatively using nephrometry score ( ns ) . from a total of 483 radical nephrectomy ( rn)-treated patients and 40 pn - treated patients who received treatment for t1b rcc between 1995 and 2010 , 120 patients identified through 1:2 propensity - score matching were included for analysis . probability of chronic kidney disease ( ckd ) until postoperative 5-years was calculated and regressed with respect to the surgical method and ns . median follow - up was 106 months . ckd - probability at 5-years was 40.7% and 13.5% after radical and pn , respectively ( p = 0.005 ) . while pn was associated with lower risk of ckd regardless of age , comorbidity , preoperative estimated renal function , the effect was observed only among patients with ns 8 ( p < 0.001 ) but not in patients with ns 9 ( p = 0.746 ) . percent operated - kidney volume reduction and ischemia time were similar between the patients with ns 9 and 8 . in the stratified cox regression accounting for the interaction observed between the surgical method and the ns , pn reduced ckd - risk only in patients with ns 8 ( hazard ratio [ hr ] , 0.054 ; p = 0.005 ) but not in 9 ( hr , 0.996 ; p = 0.994 ) . in t1b rcc with ns 9 , the risk of postoperative ckd was not reduced following pn compared to rn . considering the potential complications of pn , minimally invasive rn could be considered with priority in this subgroup of patients .

surgical defects of the midface resulting from malignant disease pose a challenge to patient rehabilitation . basal cell carcinoma is a cancer that arises in the basal cell layer of the epidermis . basal cell carcinoma of the nasal vestibule is common in caucasians but rare in blacks and subcontinent indians . in contrast to one - third of malignancies of non melanoma skin cancer in whites , among indians , only 12% of these cancers occur in the skin.1 basal cell carcinoma has a particular predilection for the upper central part of the face as an occurrence site.2 about 8890% of basal cell carcinomas may be seen mainly in sun exposed areas like the face and neck.3 basal cell carcinoma of the nasal area has a high cure rate of more than 95% but a delay in seeking treatment can allow the cancer to enlarge , causing possible disability.4 treatment of basal cell carcinoma of the nasal vestibule varies , depending on the size , depth , and location of the cancer . treatment options are surgical removal , chemotherapy , and radiation.5,6 in addition to the conventional treatment methods , other options such as cryosurgery , mohs micrographically controlled surgery , electrodessication , and photodynamic treatment are also available for head and neck cancers.7 prosthetic rehabilitation of nasal defects after trauma or surgery has been well documented . the sequence of fabrication of an extraoral prosthesis includes a surgical , a provisional , and a definitive prosthesis.8 since an immediate surgical repair of a midface defect is usually not feasible , an interim provisional prosthesis may be considered . this prosthesis can be placed 2 to 3 weeks after the surgery , to provide a cosmetically acceptable appearance . this clinical report describes the use of an interim nasal prosthesis in a patient who underwent partial rhinectomy for basal cell carcinoma . the usage of such an interim or provisional nasal prosthesis permitted the patient to resume social interaction more comfortably and confidently during the healing period and till the definitive prosthesis was fabricated . a 58-year - old male patient diagnosed with basal cell carcinoma of the nasal vestibule , had undergone partial rhinectomy , and was referred to the department of prosthodontics , sdm college of dental sciences , dharwad , india . examination revealed that the entire cartilage of the nose , ala , and part of the nasal septum had been resected ( figure 1 ) . being a bank employee who regularly addressed customers , the patient expressed deep concern regarding his esthetic appearance . due to his facial disfigurement , the patient was seeking a solution for his problem soon after the surgery . the patient was not aware of any of such prosthetic rehabilitations ; however , when the procedure of provisional nasal prosthesis and its use was explained in detail , he chose to proceed with the treatment . rolled modeling wax was used to confine the impression material ( hindustan dental products , hyderabad , india ) . care was taken not to distort the nasal remnants / tissues by blocking out the deep undercuts in the defect with moist gauze . the facial moulage was prepared using an irreversible hydrocolloid material ( algitex , dental products of india , mumbai ) ( figure 2 ) . the irreversible hydrocolloid was reinforced with gauze and dental plaster ( everest brand , panade industries pvt . the impression was poured into a type - iii dental stone ( kala stone , kala bhai pvt . a nose was sculpted in wax on the resultant cast , using the preoperative photographs . the whole morphology and the anatomic contours of the nose were developed according to normal contours , the patient s own descriptions of his preoperative appearance , as well as the references given by his close relatives . the trial wax prosthesis was completed and the nostril holes were cut open for air exchange.9 the margins of the wax prosthesis were finished to create an illusion of continuity with skin . an eyeglass frame was also worn with the wax tryon , anticipating its need for the retention of the final prosthesis . eyeglasses are a good means of providing retention since they additionally serve to conceal the borders of the prosthesis.10 wax up of the interim nasal prosthesis was invested and the wax boiled out . poly(methyl methacrylate ) resin has been recommended as a possible material for use in fabricating a provisional prosthesis.11 intrinsic coloring was incorporated in the clear acrylic resin to match the basic skin tone , using an acrylic - based paint ( fevicryl , pidilite industries ltd , mumbai , india ) . the prosthesis was finished to thin the borders and to blend with the surface of the skin . the eyeglass frame and the prosthesis were aligned properly on the bridge of the nose . a cyanoacrylate adhesive ( laborfix ; bracon ltd , sussex , england ) was used to attach the eyeglass frame to the prosthesis ( figure 4 ) . the patient had small , pigmented dots on the surface of the skin , which was matched by extrinsic coloring using acrylic colors ( fevicryl ) . this enhanced the esthetics , and the acrylic resin prosthesis resulted in a life - like appearance ( figures 5 and 6 ) . after delivering the prosthesis , home - care instructions were given . four months later the patient felt that the fit of the prosthesis was not the same as compared to that of the initial placement . it was evident that the fit of the prosthesis had changed accordingly because of the tissue changes occurring during the healing phase . in addition , at this stage , the preparation of a definitive prosthesis was discussed with the patient . an implant - retained silicone prosthesis was suggested to the patient and the approximate estimation of the treatment time and costs was given . after 6 months of follow - up , the patient is waiting to start using a definitive prosthesis with the option of an implant - retained silicone nose , depending on financial arrangements being made . among facial defects , nasal defects produce severe cosmetic impairment , since the nose is a prominent feature of the human face.12 retentive media constitute an important factor for the satisfactory rehabilitation of these defects . in the past , most nasal prostheses were retained with strings or straps anchored behind the head,13 intraoral or intranasal extensions,1315 and gold strings or leaves.16,17 spectacle frames have been popular for anchoring nasal prostheses , and preferred even today , when patients express a desire for an economical treatment solution . today , prosthetic replacements are secured with adhesives that are readily available , easily applied , and provide satisfactory retention for limited periods of time.18 however , for an interim nasal prosthesis , spectacle frame retention may be preferred , as was performed in the presented clinical situation . acrylic resin nasal prosthesis with spectacle retention was a viable treatment provided to the patient . although resins have shortcomings of being inflexible and having esthetic limitations , for an interim nasal prosthesis , it is an ideal material since it is inexpensive .

surgical defects often have adverse effects on patient perception of esthetics and self - esteem . rehabilitation of such surgical defects poses a challenge to the clinician . presented here is a clinical report of an interim prosthetic rehabilitation of a patient who underwent partial rhinectomy for basal cell carcinoma . nasal resection included part of the nasal septum , the entire cartilage , and the ala . an interim nasal prosthesis was fabricated for this patient 3 weeks after surgery , to provide early rehabilitation . this prosthesis provided a sociopsychological benefit to the patient , and the prosthesis was well tolerated . the spectacle glasses retained the prosthetic nose .

ureteral stones account for 20% of urolithiasis , and 70% of ureteral stones are located in the lower third of the ureter . it is generally believed that conservative medical treatment for ureteral stones should be applied first ( which is also the wish of most patients ) . if conservative treatment is unsuccessful , shock wave lithotripsy ( swl ) or ureteroscopy ( urs ) can then be utilized . the most important factors in predicting the likelihood of spontaneous stone passage are stone location and stone size . for distal ureteral stones of 5 and 10 mm diameter , the simple watchful waiting approach can result in complications , however , such as infection of the urinary tract , hydronephrosis , and renal function effects . therefore , the watchful waiting approach is extended by using pharmacologic therapy , which can reduce symptoms and facilitate stone expulsion . one possible pathway for medical treatment is anti - inflammatory and anti - edematous treatment by glucocorticoids . another option is the relaxation of ureteral smooth muscle , e.g. , by 1-adrenoceptor antagonists ( -blockers ) or calcium channel blockers . a number of randomized clinical trials have tested these drugs , and the resulting findings have almost always been interpreted as proof of efficacy . the rationale behind the use of alpha blockers is that stimulation of the 1 receptors in the ureter increases the force of ureteral contraction and the frequency of ureteral peristalsis . thus , blockade of 1 receptors inhibits basal tone , reduces peristaltic amplitude and frequency , and decreases intra - luminal pressure while increasing the rate of fluid transport . alpha-1 blockers also induce an increase in the intra - ureteral pressure gradient around the stone that helps in stone expulsion . three subtypes of 1 receptor have been described , namely , 1a , 1b , and 1d . among these , tamsulosin is the most commonly used -blocker for the medical treatment of ureteric stones because of its excellent tolerability ; the lack of need for dose titration upon initiation of treatment , which allows a fully effective dose to be administered right away ; and its uroselectivity for 1a and 1d , resulting in relaxation of the smooth muscles of the lower ureter , facilitation of stone passage , and relieving of pain . however , limited direct comparative data indicate that other -blockers such as alfuzosin , doxazosin , and terazosin can be similarly effective . the main aim of this prospective study was to present our experience with the efficacy of tamsulosin and alfuzosin in the medical treatment of symptomatic , uncomplicated distal ureteral stones . patients presenting at the emergency department or urology clinic at our institution with acute renal colic were evaluated for study participation in a prospective manner between march 2008 and november 2009 . distal ureteral stones were diagnosed on the basis of plain abdominal x - rays , urinary ultrasonography , and helical computed tomography when necessary . additionally , the patients underwent a series of measurements , including case history , physical examination , complete blood cell count , routine urinalysis , and serum creatinine measurement . the lower ureter was defined as the segment from the lower border of the sacroiliac joint to the vesico - ureteric junction . patients 18 years of age with a single , unilateral ureteral stone of 10 mm were eligible for the study . patients were excluded if they met any of the following criteria : ( 1 ) age less than 18 years , ( 2 ) pregnant or lactating women , ( 3 ) history of previous surgery on the ipsilateral ureter , ( 4 ) stone more than 10 mm , ( 5 ) multiple stones , ( 6 ) bilateral ureteric stones , ( 7 ) solitary kidney , ( 8) urinary tract infection , ( 9 ) moderate or severe hydronephrosis , ( 10 ) currently on -blocker therapy , ( 11 ) known allergy to tamsulosin or alfuzosin , ( 12 ) contraindications for nonsteroidal anti - inflammatory agents ( e.g. , gastritis ) , or ( 13 ) renal insufficiency . all patients received a first treatment of diclofenac 75 mg by intramuscular injection , with a second dose after 30 minutes if necessary . if diclofenac gave inadequate pain relief , tramal hydrochloride 100 mg by intramuscular injection was given . if the pain was resolved , the patient was dismissed and automatically enrolled in the study after providing informed written consent . a total of 90 patients with distal ureteral stones 10 mm in diameter were randomly divided into 3 equal groups and given medications for 30 days . all patients in the 3 groups received diclofenac sodium ( 50 mg , tablet ) every 12 hours for 1 week and then diclofenac sodium injection ( 75 mg , amp ) as needed , up to a maximum of 2 times per day . patients in group i ( n=30 ) received a daily oral dose of tamsulosin ( 0.4 mg ) , patients in group ii ( n=30 ) received a daily oral dose of alfuzosin ( 10 mg ) , and patients in group iii ( n=30 ) received diclofenac sodium only . the study medications were discontinued after spontaneous stone expulsion , intervention , or at the end of the study period . absences of stone expulsion at the end of the study or intervention before the end of the study as the result of uncontrollable pain or adverse events were considered failed therapy . follow - up visits were performed on a weekly basis . at the follow - up visit , every patient underwent urine analysis , serum creatinine measurement , a plain x - ray kub , and abdominal ultrasonography . abdominal ct was performed for patients with radiolucent stones if the stone was not expulsed by the end of study . for patients with a stone - free ureter on the last imaging study but unnoticed stone expulsion , the date of last positive stone status was recorded . the efficacy of treatment was evaluated in terms of rate and time of stone passage , frequency of pain attacks , and complications of medications . statistical analyses were performed with student 's t - test , anova , chi - square , and fisher 's exact test by using the parameters of stone size , expulsion rate , time to expulsion , pain attacks , and side effects . statistical analyses were performed with student 's t - test , anova , chi - square , and fisher 's exact test by using the parameters of stone size , expulsion rate , time to expulsion , pain attacks , and side effects . a total of 90 patients were enrolled in the study , and 87 patients completed the study ( 1 patient from group i and 2 patients from group iii dropped out ) . group i ( 29 patients ) consisted of 19 men and 10 women ( mean age : 40.714.8 years ) , group ii ( 30 patients ) consisted of 18 men and 12 women ( mean age : 41.115.2 years ) , and group iii ( 28 patients ) consisted of 19 men and 9 women ( mean age : 38.913.3 years ) . the mean stone size was 4.972.24 mm for group i , 5.472.13 mm for group ii , and 5.391.81 mm for group iii . there were no statistically significant differences between the 3 groups in terms of sex , age , or stone size ( p>0.05 ) . the results of the data analysis showed that 25 of 29 cases in group i ( 86.2% ) , 23 of 30 in group ii ( 76.7% ) , and 14 of 28 in group iii ( 50% ) expelled the stones by the end of the study . a significant statistical difference was noted between groups i and iii ( p=0.0028 ) and between groups ii and iii ( p=0.035 ) , whereas no significant difference was recorded between groups i and ii ( p=0.36 ) . the mean size of the expulsed stones after the medical therapies was 4.762.31 mm in group i , 5.041.92 mm in group ii , and 4.431.22 mm in group iii . no statistical difference was observed between the mean sizes of the expulsed stones in the 3 groups ( p>0.05 ) . for stones 5 mm size , the expulsion rate was 89.5% of cases in group i , 88.2% in group ii , and 73.3% in group iii . no statistically significant differences were observed between the 3 groups ( p>0.05 ) . for stones > 5 mm size , the expulsion rate was 70% of cases in group i , 61.5% in group ii , and 23.1% in group iii . a significant statistical difference was noted between groups i and iii ( p=0.024 ) and between groups ii and iii ( p=0.049 ) , whereas no significant difference was recorded between groups i and ii ( p=0.69 ) . the mean time to expulsion was 7.527.06 days ( range , 3 - 26 days ) in group i , 8.267.34 days ( range , 3 - 27 days ) in group ii , and 13.96.99 days ( range , 5 - 27 days ) in group iii . a significant statistical difference was noted between groups i and iii ( p=0.0097 ) and between groups ii and iii ( p=0.026 ) , whereas no significant difference was recorded between groups i and ii ( p=0.72 ) . patients who did not subsequently expel the stone were scheduled for ureteroscopy or extracorporeal shock wave lithotripsy ( eswl ) . while awaiting intervention , 2 patients in group i and 1 patient in group ii expelled their stones spontaneously ( 3 , 9 , and 7 days after therapy , respectively ) , whereas no spontaneous expulsion of the stone was recorded in group iii . patients taking tamsulosin had fewer pain attacks than did patients in the other 2 groups ( the mean number of pain attacks was 1.240.57 for group i patients , 1.430.67 for group ii patients , and 1.751.17 for group iii patients ) . a significant statistical difference was registered only between groups i and group iii ( p=0.042 ) . there was no significant difference in the number of pain attacks between patients in group i and group ii ( p=0.25 ) or between patients in group ii and group iii ( p=0.21 ) . two patients ( 6.9% ) in group i recorded retrograde ejaculation and 1 patient ( 3.3% ) in group ii recorded an episode of hypotension , which did not require suspension of the therapy . hospital readmissions with consecutive intervention and discontinuation of the medication due to uncontrollable pain occurred in 7 patients : 1 patient ( 3.4% ) in group i , 2 patients ( 6.6% ) in group ii , and 4 patients ( 14.3% ) in group iii . a variety of treatment options are available for the management of distal ureteral stones , including open ureterolithotomy , ureteroscopic stone extraction , and shock wave lithotripsy . however , some argue that the patient should simply be observed to see if the stone will pass without treatment . ueno et al evaluated more than 500 patients and reported a spontaneous stone expulsion rate of 57% for 5 mm calculi . kinder et al reported a 94% spontaneous expulsion rate for stones 5 mm and a 45% rate for calculi greater than that size . the decision for conservative medical treatment or active interventional treatment is not based only on the overall probability of stone expulsion . for many patients , factors such as time for convalescence or reexposure to dreaded colics during conservative treatment make a considerable impact on the decision to opt for an interventional treatment . there is currently a great deal of enthusiasm for adjuvant pharmacologic intervention to increase the expulsion rate and to reduce pain attacks and analgesic consumption when a conservative therapy is considered . the drugs generally used in medical expulsive therapies for lower ureteric stones are calcium channel blockers , -blockers , and corticosteroids [ 11 - 14 ] . most studies demonstrated a favorable benefit to tamsulosin and alfuzosin in facilitating stone passage , increasing the rate of stone expulsion , and decreasing pain and analgesic use , with only a few studies failing to find statistically significant differences between patients using and not using these drugs . cervenakov et al in a randomized study registered a significant statistical difference in the stone expulsion rate between the group treated with tamsulosin and the control group . de sio et al published a study of 96 patients with distal ureteral stones to test the efficacy of tamsulosin as a medical expulsive therapy and found that patients taking tamsulosin achieved significantly higher rates of stone passage ( 90% ) over a shorter time period ( 4.4 days ) . they also had lower analgesic use and fewer hospitalizations . in a double - blinded placebo - controlled trial conducted by pedro et al on 76 patients to test the efficacy of alfuzosin as a medical expulsive therapy for distal ureteral stones , the authors concluded that alfuzosin improves the patient discomfort associated with stone passage and decreases the time to distal ureteral stone passage but does not increase the rate of spontaneous stone passage ( 77.1% for placebo and 73.5% for alfuzosin , p=0.83 ) . in contrast , agrawal et al recently published a placebo - controlled study of 102 patients with distal ureteral stones to compare the efficacy of alfuzosin and tamsulosin in the management of lower ureteral stones . group 1 patients ( n=34 ) received 0.4 mg tamsulosin daily , group 2 patients ( n=34 ) received 10 mg alfuzosin daily , and group 3 patients ( n=34 ) received placebo ( control group ) . stone expulsion was observed in 82.3% in group 1 , 70.5% in group 2 , and 35.2% in group 3 . the average expulsion time for groups 1 , 2 , and 3 was 12.3 , 14.5 , and 24.5 days , respectively . the results of both study groups ( groups 1 and 2 ) were superior to those of the placebo group ( p=0.003 and p=0.001 , respectively ) . the study failed to show any statistically significant differences between tamsulosin and alfuzosin regarding stone expulsion rate , expulsion time , or need for analgesic therapy . in trials investigating the effecacy of -blockers on ureteral stone expulsion with mean stone sizes < 5 mm , only a few studies demonstrated a significantly higher expulsion rate in the treatment group . in contrast , regarding -blocker trials with stone sizes 5 mm , most of the studies demonstrated a significant benefit in stone expulsion rates . the present study was designed to compare and test the effectiveness of tamsulosin and alfuzosin on the management of distal ureteric stones . patients receiving tamsulosin or alfuzosin were compared with patients receiving analgesic only as a control . the study was limited to patients with stone sizes of 10 mm . a maximum observation period of 30 days was chosen because a longer period can increase the complication rate by 20% . a total of 86.2% of patients taking tamsulosin and 76.7% of patients taking alfuzosin were able to expel their stones at the end of study compared with 50% of patients taking only analgesic . 5 mm in size , the expulsion rate was 89.5 of cases in group i , 88.2% in group ii , and 73.3% in group iii . no statistically significant differences were observed between the 3 groups ( p>0.05 ) . for stones > 5 mm in size , the expulsion rate was 70% of cases in group i , 61.5% in group ii , and 23.1% in group iii . a significant statistical difference was noted between groups i and iii ( p=0.024 ) and between groups ii and iii ( p=0.049 ) , whereas no significant difference was recorded between groups i and ii ( p=0.69 ) . regarding the expulsion rate , we hypothesize that tamsulosin and alfuzosin are of more value in the treatment of distal ureteric stones > 5 mm size than in the treatment of stones 5 mm in size . we believe that further studies using larger groups are needed to confirm these findings and to evaluate the effect on the stone expulsion rate of different variables such as age , sex , body mass index , laterality , location of the stone , and size of the stone . no significant difference in adverse events was noted between tamsulosin 0.4 mg and 0.2 mg . pedro et al reported 12% adverse events in the alfuzosin group compared with 0% in the placebo group , whereas yilmaz et al and liatsikos et al reported no serious adverse events . in the present study , minor therapy - related side effects were observed in 3 patients ( 2 patients taking tamsulosin developed retrograde ejaculation and 1 patient taking alfuzosin developed an episode of hypotension ) . the use of tamsulosin and alfuzosin as a medical expulsive therapy for distal ureteric stones proved to be safe and effective as demonstrated by the increased stone expulsion rate , decreased expulsion time , and reduced pain attacks . moreover , patients taking tamsulosin did not have any significant benefits over patients taking alfuzosin . these drugs can be safely used for the management of uncomplicated distal ureteral stones before undertaking any invasive intervention .

purposewe evaluated and compared the efficacy of tamsulosin and alfuzosin in the medical treatment of symptomatic , uncomplicated distal ureteral stones.materials and methodsa total of 87 patients with distal ureteral stones of 10 mm were randomly divided into 3 groups . group i patients ( n=29 ) received 0.4 mg tamsulosin daily , group ii patients ( n=30 ) received 10 mg alfuzosin daily , and group iii patients ( n=28 ) were not given tamsulosin or alfuzosin . patients in all groups received diclofenac sodium regularly for 1 week and then on demand . follow - up was done on a weekly basis for 30 days.resultsthe mean stone size was comparable in the 3 groups ( 4.972.24 , 5.472.13 , and 5.391.81 mm , respectively ) . the stone expulsion rate was 86.2% , 76.6% , and 50% in groups i , ii , and iii , respectively . the difference in groups i and ii with respect to group iii was significant ( p=0.0028 and 0.035 ) . the mean expulsion time for groups i to iii was 7.527.06 , 8.267.34 , and 13.906.99 days , respectively . the expulsion time was significantly shorter in groups i and ii than in group iii ( p=0.0097 and 0.026 ) . patients taking tamsulosin and alfuzosin had fewer pain attacks than did group iii patients ( 1.240.57 vs. 1.430.67 vs. 1.751.17 ) . only 3 cases of drug side effects , 2 in group i and 1 in group ii , were recorded.conclusionsthe use of tamsulosin or alfuzosin for the medical treatment of lower ureteric stones proved to be safe and effective . moreover , tamsulosin did not have any significant benefits over alfuzosin .

in addition to the well - known capacity of neutrophils to phagocytose and kill invading microorganisms intracellularly , neutrophils can capture and kill pathogens extracellularly through the release of neutrophil extracellular traps ( nets ) . these complex three - dimensional structures contain several antimicrobial neutrophil granule proteins which are attached to a dna backbone . the novel cell death mechanism netosis has been described as the mechanism leading to the formation of nets [ 3 , 4 ] . studies with neutrophils from patients with chronic granulomatous disease ( cgd ) indicated an essential role of nadph oxidase activity in pma - induced net release . although the oxidant dependence of pma - induced net formation has been established , no comprehensive studies have been carried out so far to assess the role of individual reactive oxygen species ( ros ) and/or the enzymatic pathways involved in their generation . patients completely deficient in myeloperoxidase ( mpo ) fail to form neutrophil extracellular traps upon exposure to pma . the observation that singlet oxygen is essential for net formation further substantiates the involvement of mpo and mpo - derived hypochlorous acid ( hocl ) in net formation . in addition to nadph oxidase , the mitochondrial electron transport chain is another source of intracellular ros . the contribution of mitochondria - derived ros regarding its contribution to net formation , however , has not been addressed so far . in the present study we aimed to investigate in a systematic and comprehensive manner the contribution of various reactive oxygen species and ros - generating pathways to the pma - induced net release . by using specific inhibitors , the impact of both the nadph- and mitochondria - derived ros as well as the contribution of superoxide dismutase ( sod ) and myeloperoxidase ( mpo ) on the net release was assessed . the results confirm previous findings that nadph oxidase function is crucial for the formation of nets . in addition , we could clearly show the involvement of oxidative mpo functions in net release . however , according to our results , neither the mitochondria - derived ros nor sod play a major role in net formation . the blood collection was conducted with the understanding and the consent of each participant and was approved by the ethical committee of the medical faculty of the university of lbeck ( 05 - 124 ) . the cell preparations contained > 99.9% granulocytes as determined by morphological examination of giemsa - stained cytocentrifuged slides ( shandon , pittsburgh , pa ) . neutrophils were cultured using complete medium ( rpmi 1640 medium supplemented with 50 m 2-mercaptoethanol , 10 mm hepes , 10% heat inactivated fetal bovine serum ( all from sigma - aldrich , steinheim , germany ) , 4 mm l - glutamine , 100 u / ml penicillin , 100 g / ml streptomycin ( all from biochrom , berlin , germany ) ) at 37c in a humidified air atmosphere containing 5% co2 . to inhibit the nadph oxidase ( nox ) diphenyleneiodonium chloride ( 20 m inhibitors of myeloperoxidase ( mpo ) were dipyrone hydrate ( 200 m , dipyrone ) or 4-dimethylaminoantipyrine ( 200 m , aminopyrine , both sigma - aldrich ) . inhibitors of superoxide dismutase ( sod ) were diethyldithiocarbamic acid ( 10 m , detc , alexis , lrrach , germany ) or aroclor 1242 ( 38 m , aroclor , supelco analytical , bellefonte , usa ) . to inhibit ros production by the mitochondria the electron transport inhibitor rotenone ( 10 m , calbiochem , merck , darmstadt , germany ) and the uncoupling chain reagents 2 , 4-dinitrophenol ( 10 m , dinitrophenol , supelco analytical ) or carbonyl cyanide p-[trifluoromethoxy]-phenyl - hydrozone ( 500 nm fccp , sigma - aldrich ) were used ( figure 1 ) . for all experiments , freshly isolated human neutrophils were preincubated for 30 min at 37c with the inhibitors listed above . as control freshly isolated human neutrophils ( 5 10/ml in complete medium ) were incubated with or without inhibitors for 4 h at 37c . the solvents dmso ( 0.01% , sigma - aldrich ) and methanol ( 1% , th . the samples were analyzed by staining with annexin v - fitc ( promokine , heidelberg , germany ) and propidium iodide ( sigma - aldrich ) . annexin v exhibits calcium - dependent binding to phosphatidylserine ( ps ) expressed in the outer membrane leaflet of apoptotic pmn . labeling of apoptotic cells with annexin v - fitc and counterstaining with propidium iodide ( pi ) for necrotic cells were performed as recommended by the manufacturers . the labeled cells were analyzed immediately by flow cytometry using a facs calibur flow cytometer and the cellquest pro software ( bd biosciences , san diego , usa ) . three assays were used to measure production of intracellular , extracellular , or intracellular and extracellular reactive oxygen species by human neutrophils , respectively . the intracellular production of ros was assayed by flow cytometry using the substrate dihydrorhodamine 123 ( dhr 123 , invitrogen , eugene , usa ) that diffuses into the cells and is oxidized by ros to the fluorescent rhodamine 123 . with this method freshly isolated human neutrophils ( 5 10/ml in complete medium ) were preincubated with the previously described inhibitors for 30 min at 37c . subsequently , 2 m dhr 123 were added , and cells were stimulated with 4 m phorbol myristate acetate ( pma , sigma - aldrich ) for 5 min at 37c . the reaction was stopped on ice , and the fluorescence intensity of the cells was analyzed immediately by flow cytometry using a facs calibur flow cytometer and the cellquest pro software . the sum of intra- and extracellular ros was measured by using a luminol - amplified chemiluminescence assay . due to the fact that mpo - derived metabolites are responsible for the excitation of luminol ( 5-amino-2,3-dihydro-1,4-phthalazindione ) and because neutrophils release mpo from azurophil granules ( degranulation ) during their activation , not only intracellular but also extracellular ros can be detected by this technique . 4 10 freshly isolated human neutrophils ( 2 10/ml ) in cl medium ( a custom - made rpmi - modified medium without phenol red and sodium hydrogen carbonate containing 20 mm hepes ( biochrom , berlin , germany ) ) were seeded in a flat bottom white 96-well plate ( nunclon delta surface , nunc , langenselbold , germany ) and preincubated with specific inhibitors for 30 min at 37c . subsequently 0.06 mm luminol ( sigma - aldrich ) was added , and cells were stimulated with 20 nm pma ( sigma - aldrich ) . the chemiluminescence resulting from ros production was analyzed immediately using an infinite 200 reader and the tecan i - control 1.7 software ( tecan , crailsheim , germany ) . ros release was monitored every 2 minutes for a period of 1 h at 37c . the lucigenin - enhanced chemiluminescence assay was used to study the kinetic of superoxide production by neutrophils . lucigenin specifically emits light upon reaction with superoxide , but is not being excited by mpo - derived ros [ 12 , 13 ] . furthermore lucigenin detects only extracellular but not intracellular ros because it can not penetrate the cell membrane . for the lucigenin assay neutrophils were treated as described above in the luminol assay , but with 0.2 mm lucigenin ( alexis , loerrach , germany ) instead of luminol . staining with the non - cell - permeable dna dye sytoxgreen ( invitrogen ) was used to study the kinetics of net formation by neutrophils incubated with or without specific inhibitors . per sample 2 10 neutrophils in net medium ( cl medium supplemented with 0.5% human serum albumin ( behring , marburg , germany ) and 10 mm hepes buffer ( paa , pasching , austria ) ) were seeded to a cellstar 96-well plate ( greiner bio - one , frickenhausen , germany ) and preincubated with the specific inhibitors for 30 min at 37c . to detect the extracellular dna of neutrophil extracellular traps , 5 m sytoxgreen was added , and the neutrophils were stimulated with 20 nm pma . the fluorescence of net - bound sytoxgreen ( excitation : 488 nm , emission : 510 nm ) was analyzed for a period of 4 h every 5 min at 37c using an infinite 200 reader and tecan i - control 1.7 software ( tecan ) . to visualize nets , fluorescence microscopy and scanning electron microscopy ( sem ) were performed . for these techniques freshly isolated human neutrophils were centrifuged for 10 min , 1045 g , and resuspended in net medium ( 1 10/ml ) . 5 10 neutrophils with inhibitors or in medium alone were settled on poly - l - lysine - coated coverslips ( bd biocoat cellware , bedford , usa ) for fluorescence microscopy or on thermanox slides ( thermanox coverslips , nunc ) for sem . after incubation for 30 min at 37c net formation was induced with 20 nm pma for 4 h. samples without pma were used as control . at this point the samples were fixed with 4% paraformaldehyde ( sigma - aldrich ) for 10 min at room temperature . subsequently , the supernatant was removed , and the air - dried coverslips were rehydrated in pbs and stained with 100 nm sytoxgreen for 30 min in the dark at room temperature . after washing three times with nuclease free water ( sigma - aldrich ) , the samples were mounted with prolong gold antifade reagent ( invitrogen ) and analyzed under an axioskop 40 fluorescence microscope using the axio vision rel . 4.8-software ( both carl zeiss , jena , germany ) . for staining of neutrophil elastase , after rehydration with pbs , samples were blocked overnight with 10% normal goat serum ( jackson immuno research , newmarket , uk ) , 5% cold water fish gelatine ( sigma - aldrich ) , 1% bovine serum albumin ( roth , karlsruhe , germany ) , and 0.05% tween 20 ( serva , heidelberg , germany ) diluted in pbs . afterwards the samples were washed with pbs and incubated with anti - neutrophil elastase rabbit pab ( 1 : 200 ; calbiochem , merck , darmstadt , germany ) for 1 h at 37c . after washing three times with pbs , the primary antibody was detected with cy3-affinipure anti - rabbit igg ( 1 : 100 ; jackson immuno research , newmarket , uk ) for 1 h and dna was stained with 100 nm sytoxgreen . samples for scanning electron microscopy were fixed in a monti - graziadei solution ( 2% glutaraldehyde , 0.6% paraformaldehyde in 0.1 m cacodylate buffer , at ph 7.2 ) for 2 days and then dehydrated in a rising alcohol series ( 30 , 40 , 50 , 60 , 70 , 80 , 90 , and 100% for 15 min each ) . after critical - point drying , the samples were placed on aluminium slides and subsequently sputtered with gold . for the inhibitors acting on various steps of intracellular ros production ( figure 1 ) effective concentrations were chosen either based on previous reports [ 5 , 1519 ] or by our own preliminary studies ( data not shown ) . to exclude a toxic effect of the inhibitors , all inhibitors were tested for their toxicity ( necrosis ) and apoptosis - inducing effect on primary human neutrophils . by using flow cytometry analysis of a double staining with annexin v - fitc and propidium iodide , none of the applied inhibitors exerted a toxic or apoptosis - inducing effect after 4 h ( figure 2 ) . necrosis or apoptosis induction was also not seen after longer ( 18 h ) incubation ( data not shown ) . prior to testing their effects on net release , all inhibitors were tested for their efficacy to inhibit pma - induced ros production . three widely used ros detection methods were tested for their applicability for our project . as a first approach , the intracellular ros production in neutrophils loaded with dhr 123 was measured by using flow cytometry . h2o2 rather than o2 although the dhr oxidation is promoted by h2o2 , this assay can also be used to detect o2 , because the dismutation of o2 to h2o2 and oxygen is rapid even in the absence of sod . dpi , an inhibitor of nox and complex i of the mitochondrial electron transport chain , exerted a strong inhibitory effect on intracellular ros production measured in this assay ( figure 3 ) . the mpo inhibitors , dipyrone and aminopyrine , also decreased the fluorescence intensity ( figure 3(a ) ) . although the dhr 123-based technique is simple and rapid , this method is not very sensitive . this could possibly be the reason why high pma concentrations were needed to detect a burst and no clear results were obtained for the mitochondrial inhibitors ( figure 3(a ) ) . in subsequent experiments the lucigenin - amplified chemiluminescence assay is a sensitive technique to quantify extracellular ros , mainly superoxide anions ( o2 ) [ 12 , 13 ] . by using this technique a strong inhibitory effect was observed for dpi ( figure 4 ) , which completely abolishes superoxide production . in addition , the uncoupling mitochondrial chain reagents fccp and dinitrophenol exerted significant inhibitory effects ( figure 4(b ) ) . the other inhibitors did not exert a marked effect by using the lucigenin - amplified chemiluminescence assay ( figure 4 ) . as a third technique the luminol - amplified chemiluminescence assay was applied to assess the effects of various inhibitors on ros production . in contrast to lucigenin , which is mainly oxidized by o2 , luminol can be oxidized by several ros , such as h2o2 , hocl , and ho [ 22 , 23 ] . experiments using this technique revealed that dpi nearly completely abolished ros production ( figure 5 ) . the mpo - inhibitors dipyrone and aminopyrine prevented the mpo - induced oxidation of luminol with high efficiency ( figure 5 ) , but had no inhibitory effect in the lucigenin assay ( figure 4 ) , indicating that aminopyrine und dipyrone have no inhibitory effect on nox . the mitochondrial uncoupling reagents fccp and dinitrophenol exerted significant inhibitory effects as well ( figure 5(b ) ) . rotenone , however , did not inhibit pma - induced ros production . from the two tested sod inhibitors aroclor exerted a significant inhibitory effect . major sources of ros in neutrophils are the enzymatic reactions mediated by nadph oxidase and mpo [ 19 , 24 ] . in addition , ros are produced in mitochondria through the function of the mitochondrial electron transport chain . since pma - induced net release was shown to depend on ros it was to expect that inhibition of pathways involved in ros generation leads to reduction of net formation . the above - described assays confirmed the inhibitory effect of dpi , dipyrone , aminopyrine , fccp , dinitrophenol , and aroclor on the ros production and in part on ros release by human neutrophils . the effect of these inhibitors on the pma - induced net release by neutrophils was assessed . in these experiments only those substances were tested that showed an inhibitory effect on ros production in any of the above - described ros production tests . the panel of inhibitors contained substances targeting the nox - mediated and/or mitochondrial ros production , as well as sod- or mpo - derived ros ( figure 1 ) . human neutrophils were preincubated for 30 min with the inhibitors prior to net induction with pma . the net release was quantified by measuring the fluorescence of sytoxgreen over a period of 4 h. inhibition of nadph oxidase with the inhibitor dpi abolished net release ( figure 6 ) . dpi , however , in addition to nadph oxidase inhibits also the mitochondrial electron transport chain . therefore , the observed net - inhibiting effect of dpi can be a result of its known inhibitory effect on nadph oxidase or on mitochondrial ros production or both . in order to dissect the two possible targets of dpi the studies using mitochondrial inhibitors aimed also to decipher the contribution of mitochondrial ros production on the net formation . to inhibit mitochondrial ros production , we used fccp and dinitrophenol , two substances that uncouple the mitochondrial oxidative phosphorylation . uncoupler agents dissipate the mitochondrial membrane potential which is generated for the production of atp by transporting protons across the membrane . consequently , the electron transport chain functions more efficiently to reestablish the proton gradient that results into less leakage of electrons , and therefore less ros are generated [ 2628 ] . both fccp and dinitrophenol were shown previously to inhibit the production of ros in pma - stimulated neutrophils [ 29 , 30 ] . in addition , the fccp - mediated reduction in ros release is due to the mitochondrial uncoupling . an unspecific inhibition of oxidative burst could be excluded at concentrations below 1 m . although the mitochondrial inhibitors fccp and dinitrophenol significantly reduced ros generation in neutrophils ( figures 4(b ) and 5(b ) ) , no inhibitory effect on net release was observed ( figure 6 ) . these findings indicate that mitochondrial ros do not play a major role in the pma - induced net release . our experiments with the mitochondrial inhibitors also indicate that the inhibitory effect of dpi on net release is associated with the effect of dpi on nadph oxidase . as described previously , mpo is required for pma - induced net release . to further elucidate the role of mpo - derived ros , experiments with aminopyrine and dipyrone were carried out to assess the contribution of mpo to the net release . it has been shown previously that these inhibitors prevent pma - induced ros production in human neutrophils . this effect is due to the scavenging of hypochlorite and hydroxyl radicals by aminopyrine and dipyrone and to the inhibition of mpo by aminopyrine . our data show that aminopyrine and dipyrone prevent the mpo - induced oxidation of dhr 123 and luminol ( figures 3 and 5 ) but failed to inhibit the superoxide - dependent oxidation of lucigenin ( figure 4 ) . in line with previous findings , these results indicate that aminopyrine and dipyrone have no scavenging effect against superoxide and no inhibitory effect on nox . these results provide experimental evidence that mpo enzymatic activity and mpo - derived ros are required for net release . hypochlorite ( ocl ) is the likely mpo - derived ros involved in the process of net formation . the interaction of hypochlorite with hydrogen peroxide ( h2o2 ) leads to the generation of singlet oxygen . singlet oxygen has been reported to be essential for net formation . as inhibitor of sod we used aroclor , a mixture of polychlorinated biphenyls . in a previous study it was shown that preincubation of human neutrophils with aroclor impaired the pma - induced ros release by inhibiting sod , which converts o2 to h2o2 and oxygen . in line with this finding we observed a significant downregulation of h2o2 by using the luminol assay ( figure 5 ) . exposure of neutrophils to the sod inhibitor aroclor did not significantly affect pma - induced net release ( figure 6 ) . apparently this finding contradicts the observations regarding the involvement of mpo - derived ros and singlet oxygen in net release . however , in a previous study sod was also not required for pma - induced hypochlorite ( ocl ) production . sod appears to be not essential for the production of hydrogen peroxide ( h2o2 ) . indeed superoxide can be dismutated to hydrogen peroxide spontaneously , without the need for enzymatic dismutase activity . this spontaneous dismutase reaction increases with decreasing ph value and can convert significant levels of superoxide to hydrogen peroxide at neutral ph with a rate of 2 10 ms . interestingly , although hydrogen peroxide release was significantly downregulated by aroclor ( figure 5 ) , aroclor had no significant effect on the net release . neutrophils from some of the donors , however , exhibited an increased net formation ( figure 6(a ) ) . this could be due to the fact that inhibition of sod leads to an imbalance between production of free radicals and antioxidant defense mechanism . it has been shown previously that in parallel to a decrease in h2o2 production , o2 production increases by use of aroclor . we observed a minor , but statistically not significant aroclor - induced increase in superoxide production by using the dhr 123 assay ( figure 3 ) . this effect could be responsible for the slightly enhanced net release observed in some of the experiments . fluorescent microscopy and scanning electron microscopy ( sem ) were used to verify the effects observed by using the quantitative net release technique . net formation was visualized at 4 h after pma stimulation . as examples for the effect of various inhibitors , figures 7(e ) and 7(g ) the microscopical analysis also confirmed that the sod - inhibitor aroclor does not inhibit pma - induced net release ( figure 7(f ) ) . however , nets can be harmful if they are released in the absence of microbial infections , such as in autoinflammatory or autoimmune disorders . a dysregulation of nets has been shown , for example , in small - vessel vasculitis and systemic lupus erythematosus . increased knowledge of the mechanisms involved in net release would lead to better understanding regarding the pathophysiology of autoinflammatory and autoimmune diseases and may lead to the development of novel therapeutic strategies . our study indicates that nox- and mpo - derived ros , but not mitochondrial ros are important for the release of nets . in addition , we could show that ros scavengers such as aminopyrine and dipyrone effectively inhibit net release . therefore , ros scavengers could be potential therapeutic agents for the suppression of net release . the presented data indicate the importance of nadph oxidase- and myeloperoxidase-(mpo- ) derived ros for the pma - induced formation of neutrophil extracellular traps ( nets ) . mitochondria - derived ros as well as the contribution of superoxide dismutase ( sod ) are , however , not essential for the release of nets .

the formation of neutrophil extracellular traps ( nets ) depends on the generation of reactive oxygen species ( ros ) . previous studies revealed that both nadph oxidase and myeloperoxidase ( mpo ) are required for net release . however , the contribution of various ros as well as the role of mitochondria - derived ros has not been addressed so far . in the present study we aimed to investigate in a systematic and comprehensive manner the contribution of various ros and ros - generating pathways to the pma - induced net release . by using specific inhibitors , the role of both nadph oxidase- and mitochondria - derived ros as well as the contribution of superoxide dismutase ( sod ) and mpo on the net release was assessed . we could demonstrate that nadph oxidase function is crucial for the formation of nets . in addition , we could clearly show the involvement of mpo - derived ros in net release . our results , however , did not provide evidence for the role of sod- or mitochondria - derived ros in net formation .

albuminuria ( i.e. , urinary albumin , or ua ) is defined as an abnormally high amount of albumin in the urine and is a strong sign of early renal damage [ 14 ] . in type 2 diabetes and nondiabetic subjects , albuminuria is also associated with early- and long - term cardiovascular mortality [ 5 , 6 ] . elevated ua reflects a general state of widespread endothelial dysfunction and vascular damage [ 710 ] . inflammation and endothelial dysfunction may be key mechanisms in the development of albuminuria [ 1113 ] . however , evidence of an association between markers of inflammation and albuminuria is limited and controversial . in diabetic subjects with albuminuria , no differences in c - reactive protein levels ( a marker of inflammation ) were observed compared with healthy controls . yet in another study , serum levels of sialic acid , another marker of inflammation , correlated with increasing albumin excretion . absolute neutrophil count ( anc ) is also a sensitive marker of inflammation , and the test for it is simple and inexpensive . recently , clinical studies have shown a link between neutrophils and the development of diabetic retinopathy [ 1618 ] . although albuminuria is an accepted sign of early renal injury , it is not known whether the anc is related . we hypothesized an association between anc and ua levels . like the world 's human population in general , china 's is aging and we chose to study the elderly . here , the ua creatinine ratio ( uacr ) was used as a measure of albumin excretion . since overnight uacr correlates well with ua excretion , this study specifically investigated an association between systemic anc and uacr in an elderly chinese population . this community - based , cross - sectional study focused on the clinical risk factors of albuminuria . we performed the study with outpatients of our hospital in shanghai , from march to august of 2010 . all community - dwelling participants aged 60 years , including those residing in private residences and personal care homes , were recruited to a platform of chronic disease ( pcd ) prevention program for a routine medical checkup . participants who could not come to the prevention center were interviewed in their place of residence by trained personnel . all questionnaires and procedures were approved by the institutional review board in our hospital for research with human subjects . the identification of diabetes was based on the diagnostic criteria recommended by the american diabetes association in 1997 . potential subjects included those with a history of past diabetes or who had newly received a diagnosis by oral glucose tolerance test . in total , 3053 subjects aged between 60 and 91 years ( median age : 70 y ) were considered for the study . the following subjects were excluded : 28 subjects presenting with painful urination , fever , cough , or skin damage ; 5 subjects who were incontinent and not capable of caring for themselves ; and 12 subjects with white blood cell ( wbc ) counts 10 10/l or serum creatinine ( scr ) 141 further 738 subjects had missing ua data , because they did not collect morning urine samples . therefore the subjects underwent a glucose tolerance test with a 75 g oral glucose overload . the blood samples were collected by edta tube before and at 2 h after the tolerance test . glucose , cholesterol , triglycerides , scr , and alanine aminotransferase ( alt ) levels were measured using a dimension vista analyzer ( siemens ag ) . wbc , anc , and anc / wbc ratio values were measured using an automated 5-category hematology analyzer ( japanese sysmex xs1000i ) . participants were asked to collect a random morning spot urine sample in a clean , lidded container . all urine samples were assessed centrally in a single reference laboratory at fifth hospital , shanghai , china . samples were centrifuged at 1500 g for 10 min and then stored at 80c prior to analysis . test results were considered positive for albuminuria ( ua ) at an albumin - to - creatinine ratio ( acr ) > 0 mg / g ; otherwise the results were accepted as negative ( ua ; acr = 0 mg / g ) . microalbuminuria , or a moderate increase in ua , was identified as an acr from 30 to 299 mg / g . blood pressure was measured twice at about 8:00 a.m. , with the subject seated and with an interval of 5 min between measurements . blood pressure measurements were taken on the right arm , which was relaxed and supported by a table , at an angle of 45 from the trunk ( sphygmomanometer , yutu , shanghai , china ) . hypertension was defined as systolic blood pressure ( sbp ) 140 mmhg or diastolic blood pressure ( dbp ) 90 mmhg . the following measurements were recorded for all subjects : height , weight , waist circumference ( horizontal position of the anterior superior iliac crest and twelfth rib edge midpoint ) , and hip measurement ( measuring horizontally from the front of the pubic symphysis to the most convex point behind the gluteus maximus ) by experienced nurses in the pcd program . body mass index ( bmi ) was calculated as weight / height ( kg / m ) . mann - whitney u tests and chi - squared tests were used for analysis of continuous variables and categorical variables , respectively . the anc levels of the following subgroups of patients were calculated and compared by analysis of variance : nondiabetic ; diabetic without albuminuria ; diabetic with low - level albuminuria ( 0 < ua < 30 mg / g ) ; diabetic with microalbuminuria ( ua 30299 mg / g ) ; and diabetic with macroalbuminuria ( ua 300 mg / g ) . all subjects were categorized into 5 groups according to the quintile of anc levels ( i v ) . multivariate logistic regression analysis was used to investigate an independent association between anc and ua . areas under the roc ( auc ) curve 0.5 were considered statistically significant ( spss software version 17.0 ; spss , chicago , il , usa ) . the data analysis included 2265 participants aged between 60 and 91 years ( median : 70 y ) with a male - to - female ratio of 56.8 to 43.1 ( table 1 ) . compared with the 1011 participants who were free of diabetes , the 1254 participants with diabetes were older , with a higher prevalence of hypertension and increased sbp , anc , wbc , anc / wbc , and fasting blood glucose ( fbg ) . the 641 participants testing positive for uacr ( ua ) were older , with higher bmi and waist - to - hip ratio , sbp , dbp , scr , anc , wbc , and anc / wbc compared with the 1624 persons testing negative for uacr ( ua ) . as described in subjects and methods , all subjects were classified as follows : nondiabetic ; diabetic without albuminuria ; diabetic with low - level albuminuria ; diabetic with microalbuminuria ; or diabetic with macroalbuminuria ( figure 1 ) . anc levels and anc / wbc increased with the severity of ua ( p < 0.0001 ) . patients with macroalbuminuria had significantly higher anc and anc / wbc counts than did the patients in the other 4 groups ( p < 0.001 ) regarding the results of the multivariate logistic regression analyses , after adjustments for age , bmi , gender , sbp , dbp , and scr , the odds ratios ( ors ) indicated that anc levels significantly correlated with risk of macroalbuminuria ( p < 0.0001 ) . compared with quintile i of anc , quintile v of anc had the highest or value ( 2.311 , 95% confidence interval [ ci ] : 1.6083.321 ; table 2 ) . roc curves were plotted to evaluate the diagnostic value of age , bmi , waist - to - hip ratio , gender , sbp , dbp , alt , scr , total cholesterol , triglycerides , fbg , 2-hour glucose , and anc for macroalbuminuria . anc was the strongest predictive factor for macroalbuminuria ( auc = 0.6001 ) followed closely by fbg ( auc = 0.5876 ) and sbp ( auc = 0.5767 ; table 3 ) . to investigate interactions among anc , fbg , sbp , and scr , fbg sbp ( model 2 ; variables are multiplied ) and anc fbg sbp scr ( model 3 ) indicated 1.67% and 3.12% increase , respectively , in the predictive value for macroalbuminuria , compared with model 1 ( anc fbg ) , but these increases were not statistically significant ( p = 0.5188 and 0.5338 ) . thus anc and fbg were the most meaningful diagnostic indices for macroalbuminuria . we found that ancs significantly increased in diabetes with macroalbuminuria , and anc was the strongest factor predicting macroalbuminuria . these results indicate that neutrophil - mediated inflammation may be involved in the exacerbation of albuminuria . to the best of our knowledge , this is the first report describing an association between ua and anc levels in a population - based study . it is perplexing that the systemic neutrophil count , a very simple and inexpensive laboratory parameter , has not been reported previously in association with ua , although data from a study of 30 793 people conducted in korea showed an association between anc and diabetic retinopathy , after adjusting for the effects of blood pressure , blood glucose , and scr . in our present study , patients with albuminuria or those with diabetes had higher anc levels . to study further the association between diabetes , ua , and anc , subjects were stratified into a nondiabetic group and 4 groups with diabetes at different levels of severity of albuminuria . we found that patients with diabetes with macroalbuminuria had a notably higher mean anc than did the other 4 groups . in addition , anc was an independent indicator of macroalbuminuria , but it was not an independent indicator of ua . thus , anc might have an important role in accelerating the progression of albuminuria but not the formation of urinary protein . although establishing a causal mechanism for the association between anc and albuminuria was beyond the scope of this study , the underlying link may concern vascular damage . in clinical and laboratory studies , elevated neutrophil counts were found associated with increased levels of tumor necrosis factor- ( tnf- ) , cytokine - induced neutrophil chemotactic factor 2 alpha / beta ( cinc-2/ ) , interleukin- ( il- ) 1 , il-6 , and c - reactive protein , as well as excessive production of superoxide and reactive oxygen species [ 2023 ] . based on the results of the present study and past investigations , we hypothesize that the systemic neutrophil count reflects the local number of neutrophils in renal vessels [ 24 , 25 ] . under the influence of proinflammatory cytokines , neutrophils in renal vessels are activated and their adhesion is intensified . these responses cause abnormal leukocyte - endothelial interactions and ultimately vascular damage . in the present study , compared with the other 4 quintile anc groups , the highest level of the anc group had the highest or for the risk of macroalbuminuria and not quintiles ii or iii . this shows that the higher the anc level , the more likely the presence of macroalbuminuria , reflecting an overtly inflammatory status in patients with macroalbuminuria [ 24 , 27 ] . the exact mechanism is not clear , but whether changes in the function or shape of neutrophils are involved warrants further research . first , the study design was cross - sectional and therefore we were not able to confirm a causal link between anc and macroalbuminuria . second , the inclusion of participants attending a routine health checkup in one community represents a potential source of selection bias , which should be considered when interpreting the results . third , information regarding other traditional risk factors for albuminuria , such as heavy exercise , could not be obtained and analyzed in this study . despite these limitations , our study involved many clinical and laboratory parameters in a large number of subjects and showed a new clinical risk factor for albuminuria in individuals , 60 years of age and older . the potential effect of neutrophil - mediated inflammation in the progression of macroalbuminuria warrants further research .

background . this study investigated an association between systemic absolute neutrophil count ( anc ) and albuminuria in elderly chinese people . methods . a cross - sectional study was conducted on 2265 participants attending a routine medical examination in minhang district as part of a platform of chronic disease program . their drug history , waist circumference , height , blood pressure , fasting blood glucose , anc , and urine albumin levels were recorded . this study conformed to the requirements of the strobe statement . results . of the 2265 subjects , 1254 ( 55.4% ) were diabetic and 641 ( 28.3% ) had albuminuria . the mean anc of patients with diabetes comorbid with macroalbuminuria was significantly higher than that of both the nondiabetic patients and patients with diabetes with lower levels of albuminuria ; the latter 2 groups had statistically similar anc . anc significantly and positively correlated with levels of urine albumin . based on multivariate analysis , with each 109/l increase in anc , the increase in rates of macroalbuminuria was significant but not in rates of albuminuria positivity . based on areas under the receiver operating characteristic curve , anc was the strongest factor predicting macroalbuminuria . conclusions . elevated anc was associated with macroalbuminuria in diabetes , indicating that neutrophil - mediated inflammation may be involved in the exacerbation of albuminuria .

it is even much higher in newborns admitted to neonatal intensive care unit ( nicu ) reported to be ranging from 18% to 35% . from 22 weeks ' gestation onward , the platelets count reaches and maintains a level above 150 10 /l and only 2% of term newborns have platelets counts below this level at birth , thereby a platelets count below 150 10 /l has been used to define thrombocytopenia . severe thrombocytopenia ( platelets < 50 10 /l ) occurs in fewer than three per 1000 term newborns ; the most important cause being alloimmune thrombocytopenia . in contrast , approximately 70% of newborns born at a weight < 1000 g has thrombocytopenia at some point during their nicu stay and up to 20% of sick preterm newborns can develop severe thrombocytopenia . however , the most common explanations for severe thrombocytopenia were acquired varieties of consumptive thrombocytopenia , especially in septicemic preterm newborns . thrombocytopenia has been independently related to mortality and major morbidities as intraventricular hemorrhage ( ivh ) , disseminated intravascular coagulopathy , and necrotizing enterocolitis ( nec ) . on the other hand , the role of thrombocytopenia in some serious morbidities as ivh is difficult to establish , especially when ivh occurs in preterm newborns with normal platelets counts . in adults and pediatric icu patients , the drop in platelets numbers and not only thrombocytopenia was shown to be a good predictor of clinical outcome . in critically ill adults , 30% drop in the absolute platelets numbers , without thrombocytopenia a drop in platelets counts > 27% and thrombocytopenia were independently related to mortality . in preterm newborns , despite that the drop in absolute platelets count , without thrombocytopenia , was suggestive of fungal more than bacterial sepsis ; the association of morbidity and mortality with this drop of platelets counts , especially without thrombocytopenia , is poorly understood . platelets drop in preterm newborns can be transient , or it may progress to severe thrombocytopenia . most studies investigating platelets count changes in preterm infants , and its prognostic significance focused on outcome in newborns with platelets < 50100 10 /l . using a cut - off value similar to adult studies ( 30% platelets drop ) , a single study was published in newborns that investigated the significance of platelets drop at 7 and 28 days of life in extremely preterm newborns . the authors demonstrated significant associations of platelets drop with mortality and major morbidities in extremely preterm newborns . since our local nicu population and setting might be different we aimed in this study to use a similar approach to check the reproducibility of such presumed prognostic value of platelets drop during the first 7 days of life as calculated from the initial platelets count immediately after birth , with or without later thrombocytopenia in our preterm newborns . we hypothesized that in our local setting the rate of early platelets count decline in preterm newborns could predict final nicu outcome and the severity of later thrombocytopenia . in a retrospective cohort study design , an analysis of the medical records of all preterm newborns admitted to nicu in ohud hospital in madina monawara , saudi arabia from november 2012 to december 2013 was conducted . the criteria for inclusion of charts reviewed in this study were newborns who : ( i ) have gestational age ( ga ) below 32 weeks ; ( ii ) were admitted on the 1 day of life ; and ( iii ) survived for more than 7 days . exclusion criteria included newborns who : ( i ) were transferred before completing their treatment ; ( ii ) had thrombocytopenia on admission ; ( iii ) did not have platelets count taken on 1 day of admission ( iv ) had thrombocytopenia with or without decline in platelets count before day 7 of life ; ( v ) received blood product transfusion in the first 7 days of life . the study was approved by ohud hospital review administration and the university research review board . as this is a retrospective chart review study patient approval was waived . in keeping with the guidelines of helsinki needed data were extracted by examining the hospital patient database , medical files , laboratory system , and electronic records . the following data were collected : ( 1 ) demographic and antenatal data ( ga , birth weight , sex , use of antenatal steroids [ completed course ] , and method of deliver ) ; and ( 2 ) clinical data and outcome ( intrauterine growth retardation , diagnosis on admission , mortality , morbidities such as ivh [ grades 3 and 4 using head ultrasound by a radiologist ] , other major hemorrhage such as pulmonary hemorrhage [ defined as hemorrhage requiring prompt medical intensive action as blood product transfusion and sustained medical care ] , nec [ presence of pneumatosis intestinalis in abdominal radiograph read by a radiologist ] , sepsis [ blood culture proven ] , and length of stay [ los ] among survivors ) . platelets count recorded on the 1 day of admission was taken as the base to which subsequent platelets numbers were compared . all subsequent counts in the first 7 days of life were recorded to define the lowest count in the first 7 days . drop in the platelets counts was defined as a decrease of a 30% from the first day platelets count . thrombocytopenia in the study was defined as platelets count < 150 10 /l that was proven in two consecutive measurements . secondary outcome included ivh ( grade 34 ) , rop ( grade 34 ) , nec , and culture proven sepsis ( gram - positive and gram - negative fungus ) data were analyzed using spss software ( spss for windows , version 16.0 , spss inc . , chicago , il , usa ) . to analyze the prognostic value of platelets decline with and without thrombocytopenia included newborns were classified into four groups ; group 1 : no thrombocytopenia with no platelets decline ; group 2 : no thrombocytopenia with platelets decline , group 3 : thrombocytopenia with no platelets decline , group 4 : thrombocytopenia with platelets decline . continuous variable were expressed as mean standard deviation ( sd ) and categorical variables as number ( percentage ) . descriptive analysis was performed on demographic and baseline clinical characteristics ; as well as the age of platelets count nadir , and magnitude of platelets declines in the first 7 days . comparisons between the four groups were performed using analysis of variance and chi - square for categorical variables . logistic regression was used to examine for the odds of mortality and morbidities in the four groups . variables that reached a significance level of 0.15 in univariate analysis were included in logistic regression analysis , using the group 1 ( no thrombocytopenia no drop ) as reference . in a retrospective cohort study design , an analysis of the medical records of all preterm newborns admitted to nicu in ohud hospital in madina monawara , saudi arabia from november 2012 to december 2013 was conducted . the criteria for inclusion of charts reviewed in this study were newborns who : ( i ) have gestational age ( ga ) below 32 weeks ; ( ii ) were admitted on the 1 day of life ; and ( iii ) survived for more than 7 days . exclusion criteria included newborns who : ( i ) were transferred before completing their treatment ; ( ii ) had thrombocytopenia on admission ; ( iii ) did not have platelets count taken on 1 day of admission ( iv ) had thrombocytopenia with or without decline in platelets count before day 7 of life ; ( v ) received blood product transfusion in the first 7 days of life . the study was approved by ohud hospital review administration and the university research review board . as this is a retrospective chart review study patient approval was waived . in keeping with the guidelines of helsinki needed data were extracted by examining the hospital patient database , medical files , laboratory system , and electronic records . the following data were collected : ( 1 ) demographic and antenatal data ( ga , birth weight , sex , use of antenatal steroids [ completed course ] , and method of deliver ) ; and ( 2 ) clinical data and outcome ( intrauterine growth retardation , diagnosis on admission , mortality , morbidities such as ivh [ grades 3 and 4 using head ultrasound by a radiologist ] , other major hemorrhage such as pulmonary hemorrhage [ defined as hemorrhage requiring prompt medical intensive action as blood product transfusion and sustained medical care ] , nec [ presence of pneumatosis intestinalis in abdominal radiograph read by a radiologist ] , sepsis [ blood culture proven ] , and length of stay [ los ] among survivors ) . platelets count recorded on the 1 day of admission was taken as the base to which subsequent platelets numbers were compared . all subsequent counts in the first 7 days of life were recorded to define the lowest count in the first 7 days . drop in the platelets counts was defined as a decrease of a 30% from the first day platelets count . thrombocytopenia in the study was defined as platelets count < 150 10 /l that was proven in two consecutive measurements . secondary outcome included ivh ( grade 34 ) , rop ( grade 34 ) , nec , and culture proven sepsis ( gram - positive and gram - negative fungus ) data were analyzed using spss software ( spss for windows , version 16.0 , spss inc . , chicago , il , usa ) . to analyze the prognostic value of platelets decline with and without thrombocytopenia included newborns were classified into four groups ; group 1 : no thrombocytopenia with no platelets decline ; group 2 : no thrombocytopenia with platelets decline , group 3 : thrombocytopenia with no platelets decline , group 4 : thrombocytopenia with platelets decline . continuous variable were expressed as mean standard deviation ( sd ) and categorical variables as number ( percentage ) . descriptive analysis was performed on demographic and baseline clinical characteristics ; as well as the age of platelets count nadir , and magnitude of platelets declines in the first 7 days . comparisons between the four groups were performed using analysis of variance and chi - square for categorical variables . logistic regression was used to examine for the odds of mortality and morbidities in the four groups . variables that reached a significance level of 0.15 in univariate analysis were included in logistic regression analysis , using the group 1 ( no thrombocytopenia no drop ) as reference . in a retrospective cohort study design , an analysis of the medical records of all preterm newborns admitted to nicu in ohud hospital in madina monawara , saudi arabia from november 2012 to december 2013 was conducted . the criteria for inclusion of charts reviewed in this study were newborns who : ( i ) have gestational age ( ga ) below 32 weeks ; ( ii ) were admitted on the 1 day of life ; and ( iii ) survived for more than 7 days . exclusion criteria included newborns who : ( i ) were transferred before completing their treatment ; ( ii ) had thrombocytopenia on admission ; ( iii ) did not have platelets count taken on 1 day of admission ( iv ) had thrombocytopenia with or without decline in platelets count before day 7 of life ; ( v ) received blood product transfusion in the first 7 days of life . the study was approved by ohud hospital review administration and the university research review board . as this is a retrospective chart review study patient approval was waived . in keeping with the guidelines of helsinki needed data were extracted by examining the hospital patient database , medical files , laboratory system , and electronic records . the following data were collected : ( 1 ) demographic and antenatal data ( ga , birth weight , sex , use of antenatal steroids [ completed course ] , and method of deliver ) ; and ( 2 ) clinical data and outcome ( intrauterine growth retardation , diagnosis on admission , mortality , morbidities such as ivh [ grades 3 and 4 using head ultrasound by a radiologist ] , other major hemorrhage such as pulmonary hemorrhage [ defined as hemorrhage requiring prompt medical intensive action as blood product transfusion and sustained medical care ] , nec [ presence of pneumatosis intestinalis in abdominal radiograph read by a radiologist ] , sepsis [ blood culture proven ] , and length of stay [ los ] among survivors ) . platelets count recorded on the 1 day of admission was taken as the base to which subsequent platelets numbers were compared . all subsequent counts in the first 7 days of life were recorded to define the lowest count in the first 7 days . drop in the platelets counts was defined as a decrease of a 30% from the first day platelets count . thrombocytopenia in the study was defined as platelets count < 150 10 /l that was proven in two consecutive measurements . secondary outcome included ivh ( grade 34 ) , rop ( grade 34 ) , nec , and culture proven sepsis ( gram - positive and gram - negative fungus ) data were analyzed using spss software ( spss for windows , version 16.0 , spss inc . , chicago , il , usa ) . to analyze the prognostic value of platelets decline with and without thrombocytopenia included newborns were classified into four groups ; group 1 : no thrombocytopenia with no platelets decline ; group 2 : no thrombocytopenia with platelets decline , group 3 : thrombocytopenia with no platelets decline , group 4 : thrombocytopenia with platelets decline . continuous variable were expressed as mean standard deviation ( sd ) and categorical variables as number ( percentage ) . descriptive analysis was performed on demographic and baseline clinical characteristics ; as well as the age of platelets count nadir , and magnitude of platelets declines in the first 7 days . comparisons between the four groups were performed using analysis of variance and chi - square for categorical variables . logistic regression was used to examine for the odds of mortality and morbidities in the four groups . variables that reached a significance level of 0.15 in univariate analysis were included in logistic regression analysis , using the group 1 ( no thrombocytopenia no drop ) as reference . of 620 neonate admitted to the hospital in the study period , 188 preterm newborns ( 91 males , 97 females ) were included in our study . the mean ( sd ) ga for our sample was 28.3 ( 1.6 ) ( range , 2632 ) weeks ; and mean ( sd ) birth weight was 1025 ( 385 ) ( range , 6102400 ) grams . clinical characteristics of all preterm newborns involved in the study based on study group are shown in table 1 . preterm newborns in group 4 had significantly lower ga and birth weight than the other groups . platelets drop occurred at an earlier age in preterm newborns , who developed thrombocytopenia . on the other hand , thrombocytopenia occurred earlier in children who demonstrated platelets drop in the first 7 days of life . comparison of patients characteristics between study groups the overall incidence of thrombocytopenia was 31.4% in our sample with 61.7% had 30% drop in platelets counts before the age of 7 days . the mortality rates were higher in preterm newborns with 30% drop in platelets count being highest in group 4 ( both thrombocytopenia and 30% drop in platelets count ) . preterm newborns without thrombocytopenia and 30% drop in platelets count ( group 2 ) had mortality rate higher than group 1 ( no thrombocytopenia with no platelets decline ) and group 3 ( thrombocytopenia without platelets drop ) . significance was reached only when group 4 was compared to group 1 ( p < 0.05 ) . mortality rates in study groups nineteen newborns died before discharge with an overall mortality rate in the study group of 10.1% . table 2 shows the odds of mortality in various groups of the study . after controlling for other demographic and clinical factors , 30% drop in platelets counts was associated with significantly increased odds of mortality when it was associated with thrombocytopenia in preterm newborns . when taken together preterm newborns with 30% drop in platelets showed an increased mortality odds , ( 1.84 [ 0.635.34 ] , p > 0.05 ) when compared to children with no platelets drop ; however , this did not reach statistical significance . in those preterm newborns who died before discharge , mean sd ages of death were 33.0 ( 9.9 ) , 12.7 ( 7.4 ) , 20.1 ( 6.3 ) , and 15.6 ( 7.6 ) days in group 1 , 2 , 3 , and 4 , respectively . probability of death in various study groups in relation to group 1 from the 188 studied preterm newborns , 29 ( 15.4% ) showed evidence of grade 3 or 4 ivh , 10 ( 5.3% ) had other major bleedings , 29 ( 15.4% ) showed evidences suggestive of nec , 46 ( 24.5% ) had gram - positive bacterial infection , 38 ( 20.2% ) had gram - negative bacterial infection , and 30 ( 16.0% ) had fungal infection . the odds of having major morbidities in each study group are shown in table 3 . the odds of having ivh and nec were significant ( p < 0.05 and < 0.01 , respectively ) in both group 2 and group 4 ( those preterm newborns who had 30% drop in platelets either without or with thrombocytopenia ) . preterm newborns in group 3 ( thrombocytopenia with no platelets decline ) did not have ivh or nec cases . drop of platelet count on day 7 and odds of morbidities while the odds of having gram - positive infection was significant ( p < 0.05 ) only in preterm newborns with 30% drop of platelets with thrombocytopenia ( group 4 ) , it was not significant in both group 2 and group 3 . the odds of having gram - negative or fungal infection were significant in preterm newborns with 30% drop in platelets count either without thrombocytopenia ( group 2 ) or with thrombocytopenia ( group 4 ) . the odds of having gram - negative infection were not significant in preterm newborns with only thrombocytopenia without platelets drop ( group 3 ) and there were no cases of fungal infection among preterm newborns in this group . there was significant increase in the los in preterm newborns with 30% drop of platelets count either without thrombocytopenia ( group 2 ; p < 0.01 ) or with thrombocytopenia ( group 4 ; p < 0.01 ) when compared to the normal preterm newborns ( group 1 ) while los of group 3 was not significantly different from those of normal preterm newborns ( group 1 ; p > 0.05 ) . there was no significant difference in los between group 2 and group 4 ( p > 0.05 ) . although drop in the platelets count without thrombocytopenia is a common observation in preterm newborns ; usually , it neither trigger action nor used to draw conclusions on expected clinical coarse or prognosis except after reaching the threshold of thrombocytopenia or even severe thrombocytopenia . our study confirmed the significant association between drop of platelets with or without thrombocytopenia and poor outcomes . our findings agree with the results of rastogi et al . , who demonstrated a significant association of mortality and major morbidities in preterm newborns below 28 weeks gestation and platelets drop in the first 7 days of life . the rate of thrombocytopenia in our study ( 31.4% ) was much lower than that reported previously in preterm newborns . this is mostly a reflection of excluding thrombocytopenia occurring in the first 7 days of life that is mostly caused by maternal causes . using same criteria , the incidence of thrombocytopenia in extremely preterm neonates below 28 weeks gestation was found to be 48.6% . the authors believed that this incidence of thrombocytopenia in their study was more likely to be reflective of primary neonatal causes . however , other authors have published thrombocytopenia rates similar to ours when calculated for all babies admitted to nicus . the platelets drop and thrombocytopenia in newborns have traditionally been attributed to a combined process ; impaired platelets production and increased platelets consumption and sequestration . impaired platelet production usually results in low platelet count that is either present at birth or develops within 72 h of life . in our study , it is reasonable to assume that the decreased production play a little role as we excluded all newborns with early thrombocytopenia . hence , the most plausible explanation for the platelets drop and thrombocytopenia in our study is increased consumption and sequestration . it was shown that late onset thrombocytopenia in newborns is almost exclusively caused by sepsis or nec . thrombosis and platelet activation / immobilization at sites of inflammation ( as in the gut during nec ) were suggested as the processes behind platelets consumption in such conditions . such affected neonates were often profoundly sick , required intensive care , and had 1015% mortality . in our study nec , gram - negative bacterial and fungal infections were associated with platelets drop even in the absence of thrombocytopenia . platelets drop occurred several days before reaching the level of thrombocytopenia and mostly before other signs of illness appeared . as such , platelets drop in the first 7 days of life represents a strong indicator of the later development of these two problems ( infections and nec ) . another group found that such prognostic value of platelets drop remained valid in predicting mortality and serious morbidities at 28 days of life . many authors have expressed doubts regarding whether thrombocytopenia itself directly contributes to adverse outcome or is simply a marker of the severity of precipitating complications , which themselves carry a poor prognosis . our results would lend evidence to the latter reasoning and extend this reasoning to platelets drop not only thrombocytopenia . indeed the early use of platelet concentrates to prevent moderate thrombocytopenia ( platelets , 50150 10 /l ) failed to reduce hemorrhage , reflecting the difficulty clinicians face to assess the clinical impact of thrombocytopenia in newborns . as regards type of infection , our results suggest a strong correlation between platelets drop with or without later thrombocytopenia in preterm newborns and both gram - negative bacterial and fungal infections . gram - positive bacterial infection odds increased only in newborns that had shown thrombocytopenia after early platelets drop . thrombocytopenia happening without prior early platelets drop did not show any association with any type of infection . , who reported gram - negative bacterial or fungal infections happening only in newborns with platelets drop with or without thrombocytopenia . in our study , we still see children with gram - negative bacterial infection in the other two groups ( no drop , no thrombocytopenia and thrombocytopenia without a drop ) . on the contrary to our findings , they reported significant associations between platelets drop with or without thrombocytopenia and gram - positive bacterial infections . these differences might be attributed to the differences in the local nicu environments as rates of nosocomial infections and predominant environmental pathogens ; as well as clinical and demographic backgrounds of newborns included in the study . actually , our reported rates of various types of infections are higher than those reported in other units . however , although infections have been recognized as a factor that enhances platelets destruction , the role of specific type of infection or organism is controversial . there were no ivh cases in the group that developed thrombocytopenia without prior observed platelets drop . in previous works association between ivh in preterm newborns and thrombocytopenia was questioned . in patients with severe thrombocytopenia and in contrast to cutaneous and gastrointestinal hemorrhage no relationship between the lowest platelet count recorded , and the presence of ivh or pulmonary hemorrhage were found . furthermore , it was not clear how to interpret the association seen in some studies between lower platelets counts and higher prevalence of ivh . two possible explanations have been propagated ; thrombocytopenia might have caused the ivh , or it was a result of ivh through a consumptive process . our results illustrate that probably thrombocytopenia is not the main trigger for ivh and other factors contribute to its pathogenesis . being a retrospective study might have influenced several key variables validity resulting in both selection and information biases . the collection of samples in our study was part of routine investigations that were not scheduled on similar timing for all patients , which may have resulted in missing some newborns with a drop of platelets or thrombocytopenia . furthermore , definitions of morbidities such as ivh , infections , and nec ; as well as investigating newborns for them , were largely dependent on the treating physician . newborns with thrombocytopenia were subjected to investigations as head ultrasound , blood cultures , and abdominal x - rays more than newborns without thrombocytopenia . our study highlights , the need to consider not only thrombocytopenia but also platelets drop when predicting the outcome and major morbidities in preterm newborns . the early platelets drop even without the later development of thrombocytopenia is an early indicator of poor outcome and major morbidities , mainly infection .

objectives : decline of platelets with or without thrombocytopenia is observed in critically ill preterm newborns . prognostic significance of platelets count in neonatal intensive care unit focused on outcome after thrombocytopenia . we aimed to estimate the changes in platelets count within the first 7 days of life in preterm newborns and its relation to final outcomes.methods:retrospectively , the platelets count during the first 7 days of life , and its association with mortality , length of stay among survivors ( los ) , and later severe morbidities were determined . appropriate regression analyses were used to examine possible relations between studied variables.results and discussion : platelets drop that did not reach thrombocytopenia level in the first 7 days of life happened in 61.7% . platelets count drop in the first 7 days of life was a predictor of mortality , los , and major morbidities such as intraventricular hemorrhage and necrotizing enterocolitis.conclusions:platelets count drop within the first 7 days of life independent of thrombocytopenia can be used to predict increased mortality , los , and the development of later severe morbidities in critically ill preterm neonates .

developmental dysplasia of the hip ( ddh ) is a disorder of the acetabulum and proximal femur that can cause a persistent steep acetabulum , possibly leading to an unstable position of the femoral head with subluxation . early diagnosis and treatment during childhood can restore a normal relationship of acetabulum and femoral head , preventing pain and osteoarthritis in adult years . although ultrasound has become popular as a diagnostic tool for ddh during the last decades , sensitivity and specificity are yet to be determined [ 8 , 14 ] . therefore , radiographic imaging still is used frequently for diagnosis , especially in children with doubtful sonographic findings and in older children to monitor hip development after treatment when ultrasound no longer is possible [ 1 , 6 ] . radiographic diagnosis of ddh or followup studies traditionally are performed by measuring the acetabular index ( ai ) , defined as the angle of inclination of the ossified acetabular roof measured on radiographs . a commonly used method to measure ai the ai is defined as the angle between hilgenreiner s line and the line joining the superolateral margin of the ossified acetabulum to the superolateral margin of the triradiate cartilage . if the ai values exceed 30 for neonates up to 4 months and 25 for children up to 24 months , ddh is suspected [ 12 , 13 ] . the difficulty in consistent ai measurement is precise orientation of the pelvis during radiographic imaging because different orientations of the pelvis will lead to different ai measurements . to obtain a reliable ai measurement using hilgenreiner s method the influence of pelvic rotation ( rotation of the pelvis around the craniocaudal axis ) and of pelvic tilt ( rotation of the pelvis around the left - right axis , sometimes also referred to as flexion / extension or inclination ) on measurements performed on pelvic radiographs has been investigated . to quantify the quality of the radiograph in terms of pelvic alignment , some parameters have been proposed that are measured on the radiographs . to evaluate pelvic rotation , the ratio between both horizontal diameters of the obturator foramen and the horizontal distance between the symphysis and the sacrococcygeal joint was proposed . for pelvic tilt , these include the angle between the highest medial points of the ischium and the symphysis , the vertical distance between the symphysis and the sacrococcygeal joint , the vertical distance between the upper edge of the symphysis and a line connecting the femoral head centers , the vertical distance between the symphysis and the line connecting the sacroiliac joints , the ratio between the vertical and horizontal diameter of the pelvic foramen , the ratio between the vertical and horizontal points of the obturator foramen , and the ratio between the vertical point of the obturator foramen and the distance between the teardrops [ 913 ] . from these studies , it was concluded the horizontal and vertical distance between the upper border of the symphysis and the center of the sacrococcygeal joint showed the strongest correlation with pelvic rotation and tilt , respectively . however , the reliability of measuring of these parameters were evaluated on single radiographs obtained from multiple subjects or by varying only the amount of pelvic rotation or pelvic tilt . the effect of pelvic rotation and tilt simultaneously , which is likely to occur in clinical practice , on these parameters is unclear . we asked whether ( 1 ) combinations of pelvic rotation and tilt introduced systematic error in acetabular index measurement in a reproducible way and ( 2 ) ratios proposed to evaluate either pelvic rotation or pelvic tilt are influenced by pelvic tilt and rotation , respectively . digitally reconstructed radiographs ( drrs ) are simulated radiographic images generated by a computer algorithm from a three - dimensional ( 3-d ) ct dataset . their use is widely accepted in the field of medical image registration [ 4 , 5 ] . by using drrs instead of real radiographs , we were able to vary orientation of the pelvis in a highly controllable fashion by varying the orientation of the 3-d ct dataset while keeping all other imaging parameters fixed . these other parameters include the distance between the center of rotation and the point source ( 1145 mm ) , the distance between the center of rotation and the detector ( 100 mm ) , the detector size ( 240 180 mm ) , and the pixel size ( 0.1 0.1 mm ) , and were taken from the radiographic imaging protocol for radiographic diagnosis of ddh . our retrospective investigation was approved by the institutional ethical board of university medical center utrecht and informed consent was waived . we used one high - resolution abdominal ct dataset ( in - plane : 0.41 mm 0.41 mm ; through - plane : 0.70 mm ) of a deceased 3-month - old infant acquired for forensic purposes . the infant had slight hip dysplasia on the left side , which was diagnosed by an experienced pediatric radiologist ( fjb ) from observation of the ct data in the coronal plane . pelvic rotation was mimicked by rotating the ct volume around the longitudinal axis of the volume . positive rotation was defined as rotation toward the patient s left acetabulum and negative rotation was defined as rotation toward the patient s right acetabulum . pelvic tilt was mimicked by rotation of the ct volume around the axis intersecting the volume from left to right , where positive tilt corresponded to displacement of the symphysis in the caudal direction and negative tilt to displacement of the symphysis in the cephalic direction ( fig . 1 ) . the magnitude of pelvic rotation and tilt was determined by the angular offset in degrees relative to the projection axis ( fig . 1 ) . pelvic rotation and tilt were varied from 12 to 12 in steps of 4 , leading to a total of 49 drrs . the center of rotation was placed in the center of the pelvis and the center of the detector was in perfect alignment with the center of rotation and the point source.fig . 1a schematic representation shows the generation of drrs and the rotational degrees of freedom of the ct volume . a schematic representation shows the generation of drrs and the rotational degrees of freedom of the ct volume . two pediatric radiologists ( fjb and meg ) made all 49 measurements of the ai and ratios using in - house developed software ( fig . the parameter evaluating pelvic rotation ( rrotation ) was defined as the horizontal diameter of the largest obturator foramen divided by the horizontal diameter of the smallest obturator foramen , leading to ratios of 1 and greater . the parameter evaluating pelvic tilt ( rtilt ) was calculated by the vertical distance between the ossified sacrococcygeal joint and the upper edge of the symphysis , divided by the vertical diameter of the obturator foramen , or vice versa . as with the rrotation , the largest vertical distance was divided by the smaller . 2a screenshot from our in - house - developed software used for the acetabular angle measurements is shown . the acetabular angles between the dragable lines were calculated automatically and displayed in the user interface . a screenshot from our in - house - developed software used for the acetabular angle measurements is shown . the acetabular angles between the dragable lines were calculated automatically and displayed in the user interface . during a measurement session , the observer was allowed to enlarge the drr and to use window leveling and width to improve observation . one of the two experts ( fjb ) performed a second series of ai and ratio measurements on all 49 drrs more than a month after the first for intraobserver analysis . the mean , sd , and 95% confidence interval of the interobserver and intraobserver differences of the ai measurements were determined using bland - altman analysis . the mean intraobserver difference was 0.3 and the sd was 2.1. the mean interobserver difference for the ai measurements was 0.1 and the sd was 2.3. this resulted in a 95% confidence interval of 4.5 , calculated as 1.96 sd . the drr generated with the pelvis in optimal alignment with the point source and the radiograph was chosen by the observers by visual examination . this ideal pelvic orientation with 0 rotation and 0 tilt was defined by an rrotation of unity and a position of the sacrococcygeal junction on 2/3 of a line between the symphysis pubis and the caudal extension of the sacrococcygeal joint . systematic errors in ai measurements caused by nonideal pelvic orientation were determined by the difference between the gold standard index and the measured index . the average systematic error and the average ratios were evaluated as functions of the pelvic orientation . some examples of drrs are shown , including the average ai and ratios measured by the observers ( fig . b(a ) some examples of ai measurements performed on drrs with various pelvic orientations are shown . the drrs in the top and bottom rows are generated with pelvic 4 negative and positive tilts , respectively . the drrs in the left and right columns are generated with 4 pelvic rotation in the right and left directions , respectively . the average rotation and tilt ratios and the average systematic errors of ai measurements in degrees are indicated in the images . ( b ) some examples of drrs generated with 12 rotation and tilt ( left ) , 0 rotation and tilt ( center ) , and 12 rotation and tilt ( right ) are shown . ( a ) some examples of ai measurements performed on drrs with various pelvic orientations are shown . the drrs in the top and bottom rows are generated with pelvic 4 negative and positive tilts , respectively . the drrs in the left and right columns are generated with 4 pelvic rotation in the right and left directions , respectively . the average rotation and tilt ratios and the average systematic errors of ai measurements in degrees are indicated in the images . ( b ) some examples of drrs generated with 12 rotation and tilt ( left ) , 0 rotation and tilt ( center ) , and 12 rotation and tilt ( right ) are shown . the systematic errors induced by rotation and tilt accumulate and can cause either an amplification or compensation of the measurement errors . underestimation of the ai , corresponding to a negative error , of a pelvis rotated toward the acetabulum under consideration is amplified in the case of an additional positive tilt of the pelvis . in contrast , overestimation of the ai , corresponding to a positive error , of a pelvis rotated toward the opposite direction of the acetabulum under consideration is amplified in the case of an additional positive tilt of the pelvis , whereas an additional negative tilt will reduce the magnitude of overestimation . the average systematic errors in ai measurements introduced by combinations of pelvic rotation and tilt ranged from 8.8 to 3.6 for the right nondysplastic acetabulum ( fig . 4 ) and from 8.6 to 4.5 for the left acetabulum , which was diagnosed with slight dysplasia ( fig . 5 ) the average systematic errors as a function of pelvic rotation and pelvic tilt are given in a color matrix . each cell within these matrices represents a combination of pelvic rotation , along the horizontal axis , and tilt , along the vertical axis . the average systematic error corresponding to a combination of rotation and tilt is indicated by a color , of which the magnitude can be derived from the color bar next to the figure . for example , for the right hip , a combination of 0 rotation and 0 tilt resulted in an average error of 0 ( orange ) , and 8 rotation and 12 tilt gave an error greater than 8 ( dark blue ) . the average systematic error in the ai measurements performed on the right acetabulum with pelvic rotations ranging from 12 to 12 and no tilt varied from 1.3 to 2.9. errors in ai measurements caused solely by pelvic tilt ranged from 5.3 to 2.7. for the left acetabulum , the error caused solely by pelvic rotation and by pelvic tilt varied from 3.1 to 2.6 and from 5.5 to 4.5 , respectively.fig . 4the average systematic error of the right ai versus pelvic rotation and tilt is shown . 5the average systematic error of the left ai versus pelvic rotation and tilt is shown . the average systematic error of the right ai versus pelvic rotation and tilt is shown . the average systematic error of the left ai versus pelvic rotation and tilt is shown . the average rotation ratio ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{r}_{\rm rotation } $ $ \end{document } ) and average tilt ratio ( \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{r}_{\rm tilt } $ $ \end{document } ) were influenced by changes in pelvic tilt and rotation , respectively . varying pelvic tilt from 12 to 12 and keeping pelvic rotation fixed at 0 resulted in \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{r}_{\rm rotation } $ $ \end{document } ranging from 1.1 to 1.6 ( fig . 6 ) and even larger deviations of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{r}_{\rm rotation } $ $ \end{document } were observed for nonzero pelvic rotations . the variance of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{r}_{\rm rotation } $ $ \end{document } measured for 0 rotation and variable pelvic tilt most likely is caused by small asymmetries between the two obturator foramen . similarly , \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \overline{r}_{\rm tilt } $ $ \end{document } ranged from 1.1 to 1.17 for a fixed pelvic tilt of 0 and pelvic rotation varying from 12 to 12 ( fig . 7).fig . 6a graph shows the average rotation ratio as a function of pelvic rotation and constant values of pelvic tilt . rotation ratio was calculated by the horizontal diameter of the largest obturator foramen divided by the horizontal diameter of the smallest obturator foramen.fig . 7a graph shows the average tilt ratio as a function of pelvic tilt and constant values of pelvic rotation . tilt ratio was calculated by dividing the vertical distance between the ossified sacrococcygeal joint and the upper edge of the symphysis by the vertical diameter of the obturator foramen , or vice versa . a graph shows the average rotation ratio as a function of pelvic rotation and constant values of pelvic tilt . rotation ratio was calculated by the horizontal diameter of the largest obturator foramen divided by the horizontal diameter of the smallest obturator foramen . a graph shows the average tilt ratio as a function of pelvic tilt and constant values of pelvic rotation . tilt ratio was calculated by dividing the vertical distance between the ossified sacrococcygeal joint and the upper edge of the symphysis by the vertical diameter of the obturator foramen , or vice versa . studies have shown different pelvic orientations lead to different ai measurements [ 7 , 12 ] and have proposed various parameters to assess the amount of pelvic rotation and tilt [ 911 ] . however , in these studies , analysis was performed by varying only pelvic rotation or tilt separately and their simultaneous effect was not examined . in this study , we investigated whether ( 1 ) systematic errors are induced by combinations of pelvic rotation and pelvic tilt , and ( 2 ) rrotation , proposed to evaluate the amount of pelvic rotation , is influenced by pelvic tilt and rtilt , proposed to evaluate the amount of pelvic tilt , is influenced by rotation of the pelvis . as we analyzed the systematic error in ai measurements caused by pelvic rotation and tilt using one subject , the influence of anatomic variations was not included . the goal of our research , however , was to investigate whether combinations of pelvic rotation and tilt induce systematic errors and not to provide absolute error values that will hold in general . by using drrs generated from a high - resolution ct dataset , we were able to study the influence of rotation and tilt on ai , rrotation , and rtilt in a highly reproducible fashion . another limitation is that the accuracies of the radiographic measurements are subject to the degree of ossification of the patient s pelvis . however , this has not endangered our findings , as ossification was sufficient to assess the anatomies of interest . the literature comprises various studies analyzing the effect of pelvic rotation and tilt on ai measurements . tnnis observed , for rotation , the ai decreases on the side toward which the rotation takes place , and the ai on the opposite side increases . in addition , he observed a decreased ai when inclination was increased and an increased ai when inclination was decreased . investigated the influence of pelvic rotation and tilt on ai measurements by rotating an xray beam around a postmortem pelvis . they found ai increased when the xray beam was rotated toward the acetabulum that was assessed ( simulating rotation of the pelvis toward the opposite acetabulum ) and decreased on the opposite side . cephalic rotation of the xray beam ( simulating an extension of the pelvis , corresponding to positive tilt in our study ) caused an increment of the ai , and caudal rotation of the xray beam ( simulating flexion of the pelvis , corresponding to negative tilt in our study ) caused a decrement of the ai . our observations with respect to pelvic tilt were in agreement with those of tnnis , but opposite those reported by portinaro et al . . in our study , positive tilt ( which corresponds to cephalic rotation of the xray source ) led to decreased ai and negative tilt ( corresponding to caudal rotation of the xray source ) increased ai . furthermore , portinaro et al . concluded errors in the ai measurements caused by pelvic rotation within 5 and pelvic tilt within 10 were only 1 and therefore could be ignored . however , in their study , the influence of only one parameter ( either rotation or tilt ) at a time was considered . in reality , it is more likely pelvic misalignment during acquisition of the radiograph is caused by a combination of rotation and tilt . in our study , a combination of 4 rotation and 8 tilt led to underestimation of the ai of as much as 8.7. to quantify the quality of the radiograph , various parameters were proposed that evaluate pelvic rotation or pelvic tilt [ 913 ] . studied the obturator foramen ratio ( corresponding to rrotation ) as a function of pelvic rotation . they showed the ratio increases as pelvic rotation is increased and ratios between 0.5 and 2 correspond to pelvic rotations within a range of 5. tannast et al . analyzed various parameters estimating pelvic tilt as a function of pelvic tilt only and concluded the vertical distance between the upper edge of the symphysis and the midpoint of the sacrococcygeal joint showed the strongest correlation with pelvic tilt . we showed rrotation was not only dependent on rotation but also was influenced by pelvic tilt . similarly , rtilt was not only affected by pelvic tilt but also by the amount of rotation induced . these effects should be taken into consideration when the quality of a radiograph is evaluated using these and similar parameters . based on our results , we believe pelvic rotation and tilt should be considered simultaneously during diagnosis of ddh using hilgenreiner s method . changing pelvic orientation by inducing rotation and tilt simultaneously can cause systematic errors in the ai that are larger than when only rotation or tilt is considered . to obtain consistent ai measurements , we advise limiting the systematic errors caused by pelvic misalignment to the size of the 95% confidence interval of the interobserver error . in our study , this results in a maximal acceptable systematic error of 4.5. this means radiographs acquired with approximately 4 rotation and 4 tilt should be considered acceptable , which corresponds to rrotation values between 1.0 and 2.0 and rtilt values between 1.1 and 1.8 .

backgroundradiographic diagnosis and followup studies of developmental dysplasia of the hip are commonly performed by measuring the acetabular index on radiographs using hilgenreiner s method . the outcome of the measurement , however , depends on the orientation of the subject s pelvis relative to the xray source . the influence of pelvic rotation and tilt on the measurement error has been evaluated separately but not in combination.questions/purposeswe asked whether ( 1 ) combinations of pelvic rotation and tilt introduced systematic error in acetabular index measurement in a reproducible way , and ( 2 ) ratios proposed to evaluate either pelvic rotation ( rrotation ) or pelvic tilt ( rtilt ) are influenced by pelvic tilt and rotation , respectively.methodsradiographic measurements of the acetabular index , rrotation , and rtilt were performed on digitally reconstructed radiographs of one high - resolution three - dimensional ct dataset with various combinations of pelvic rotation and tilt.resultsfor rotations and tilt up to 12 , the average systematic errors in the acetabular index varied from 8.8 to 4.5. negative and positive error values can be interpreted as underestimations and overestimations of the acetabular index , respectively . errors in acetabular index measurements were acceptable for rrotation values between 1.0 and 2.0 and rtilt values between 1.1 and 1.8.conclusionsto limit the systematic error in assessing the acetabular index caused by pelvic misalignment , we recommend only radiographs acquired with 4 rotation and 4 tilt be considered acceptable .

poly(n - alkyl methacrylates ) ( pnma ) constitute a versatile class of polymers that are produced on a very large scale . upon varying the number of carbon units in the alkyl side groups ( n ) , physical properties such as the glass - transition temperature ( tg ) can be tailored to range from 65 c ( p12ma ) up to 133 c ( pmma ) . grafted from a surface and in the presence of a good , viscous solvent , p12ma ( containing a 12-carbon side group ) swells to a brush conformation that enables significant reduction of friction and wear in the boundary - lubrication regime . traditionally , techniques that have been applied to study the swelling and collapse of polymer brushes include the surface forces apparatus ( sfa ) , atomic force microscopy ( afm ) , liquid - cell ellipsometry , quartz - crystal microbalance ( qcm ) and neutron reflectometry . although all these techniques provide valuable information about the combined behavior of polymer and solvent , they fail to distinguish between the brush and solvent contributions to the resulting physicomechanical properties . to better understand the lubrication properties of p12ma , espinosa et al . and bielecki et al . their results indicate that solvent - quality - dependent swelling and consequent solvent confinement within the brush structure plays a critical role in the tribological and mechanical properties , although the exact solvent - brush interaction is not yet fully understood . we have measured the spectroscopic characteristics of the polymer brush and the solvent independently , via in situ liquid - cell atr - ir . although , in the past , atr - ir has been used to study the uptake of water and butanol in silicate-1 films , interactions of immobilized human serum or proteins , and the thermoresponsiveness of poly - n - isopropylacryl ( pnipaam ) in water ; to our knowledge , it has never been applied to study solvent mixture interactions with grafted - from polymer brushes . by monitoring the spectroscopic features of the brush and the solvent individually , we can detect solvent - partitioning and preferential solvent uptake upon changing temperature . vis , afm , and lateral force microscopy ( lfm ) measurements complement the study to provide further insights into the bulk and surface - property changes . our findings reveal a temperature - induced swelling of p12ma in ethanol , which is a poor solvent at room temperature . additionally , in situ probing of the surface showed changes in both the adhesive and tribological behavior of the brush . we describe an approach to studying brush - solvent interactions and the study sheds new light on the temperature - dependent properties of p12ma . dimethylchlorosilane ( sigma - aldrich , germany , 98% ) , 10-undecen-1-ol ( sigma - aldrich , 98% ) , 2-bromo-2-methylpropionyl bromide ( sigma - aldrich , 98% ) , and chloroplatinic acid hexahydrate ( abcr , germany , 99.9% ) were used as received . lauryl methacrylate ( lma ) ( acros organics , 96% ) was purified from hydroquinone monomethyl ether ( mehq ) inhibitor by passing it through a basic alumina column . 4,4-dinonyl-2,2-bipyridine ( dnbpy ) and copper(ii ) bromide ( cubr2 , sigma - aldrich , 99% ) were used as received . copper(i ) bromide ( cubr , sigma - aldrich ) was purified by stirring in glacial acetic acid overnight , followed by filtration and washing with methanol and diethyl ether . poly(lauryl methacrylate ) ( plma / p12ma ) ( mw 570 000 , mn 290 000 , sigma - aldrich ) in a 25 wt % solution in toluene was used as received . toluene ( fluka analytics , germany , 99.7% ) , ethanol ( fluka analytics , 99.8% ) , and hexadecane ( sigma - aldrich , 99% ) were used as received from the manufacturers . ultrapure water was used as dispensed from a tka genpure ( tka gmbh , germany ) . for uv vis measurements , p12ma in toluene was used as received from sigma - aldrich . toluene ethanol mixtures , containing 10 wt % of p12ma , with 34 , 37 , 38 , and 41 wt % of ethanol were prepared by gravimetry . the final solutions were analyzed by nuclear magnetic resonance ( nmr ) spectroscopy to determine the precise concentrations . for atr - ir measurements , two 6 mm thick , light - guiding silicon crystals , of dimensions 72 mm 10 mm at the top sensing surface and a 45 angle of incidence toward the bottom surface , were piranha cleaned , rinsed with ultrapure milli - q water and dried under a nitrogen stream prior to use . one crystal was maintained in a pristine state and used to collect background measurements . a p12ma polymer brush was grafted onto the second atr - ir silicon crystal using surface - initiated atom transfer radical polymerization ( si - atrp ) . in brief , the sensing surface of the piranha - cleaned and plasma - treated crystal ( harrick plasma cleaner / sterilizer , ossining , ny ) was functionalized via a previously described surface - deposition protocol , using a solution of 11-(2-bromo-2-methyl - propionyl)-dimethylchlorosilane ( bpcs ) initiator . subsequently , si - atrp was carried out under a nitrogen atmosphere . in detail , the dodecyl methacrylate monomer ( 12ma ) was mixed with anisole in the ratio of 9:1 v / v . the solution was degassed by three freeze thaw cycles and subsequently transferred though a cannula into a second flask containing copper(i ) bromide and copper(ii ) bromide ( reactant ratio monomer / dnbpy / cubr / cubr2 = 150:1.5:1:0.01 ) . the mixture was subsequently heated to 90 c and maintained under stirring until a homogeneous dark - brown solution was formed . finally , the solution was transferred via a cannula to a flask containing the bpcs - functionalized crystal and si - atrp was carried out for the necessary time at 110 c . exposing the flask to air the synthesized film was washed extensively with toluene and chloroform , and finally dried under a stream of nitrogen . a dry thickness of the p12ma brush of 68 nm was measured by means of spectroscopic ellipsometry ( m200-f j.a . an approximate swollen thickness can be estimated from the swelling ratios reported for p12ma , prepared using the same synthesis method . the estimated swelling ratios are 15 and 1 for toluene and ethanol , respectively . thus , swollen brush thicknesses of about 1000 nm in toluene and 68 nm in ethanol were assumed . uniformity of p12ma films produced with this synthesis method was confirmed in earlier studies by bielecki et al . for afm and lfm measurements , p12ma brushes of 80 nm dry thickness were grafted from initiator - functionalized silicon oxide substrates ( p / b 100 , si - mat silicon wafers , germany ) following the same protocol reported above for the atr - ir sample functionalization . the turbidity of four different toluene - ethanol solutions of p12ma was measured at a wavelength of 410 nm using a temperature - controlled uv visible spectrophotometer ( v670 uv visible spectrophotometer , jasco inc . ) to study the temperature - dependent solubility in varying solvent environments . using a peltier unit , the samples were exposed to increasing and decreasing temperatures from 0 to 35 c with a heating and cooling rate of 0.5 c / min . measurements were made every 0.5 c and a resting period of 30 s was held at each measurement point to allow equilibration of the solution . infrared spectra were collected using an attenuated total reflection ( atr ) setup ( portman instruments ag , biel - benken , switzerland ) with a nicolet 5700 fourier transform infrared spectrometer ( thermo electron corporation , madison , wi ) . after inserting the light - guiding crystal in a graseby - specac advanced overhead specaflow atr system ( p / n 1401 series ) , see the setup schematics in figure 1 below , a peristaltic pump was used to feed fresh solvent at a constant rate . the temperature of the setup was controlled through a heatable top - plate for atr units and measured via a pt-100 resistance element ( fcs-23a , shinko technos co. , ltd japan ) . additionally to controlling the thermostat temperature , a thermometer ( e910 - 650 , amarell gmbh , germany ) with a pt 100 class a probe located at the top - plate of the thermostat measured the temperature close to the sample . schematic of the temperature - controlled , liquid - cell atr - ir setup . a p12ma - brush ( green)-coated atr - ir crystal is topped by a liquid cell , allowing solvent ( orange ) to flow over the sensing surface . a thermostat controls the temperature of the setup while the ir - signal is collected by the detector . it is important to note that the penetration depth of the infrared signal decays exponentially away from the surface of the silicon crystal , making atr - ir a very surface - sensitive technique the penetration depth , d , is described by eq 1 , where n1 and n2 are the refractive indices of crystal and solvent , respectively , is the wavelength , and is the angle between the walls and top surface of the prism.1 for a si - crystal ( n1 = 3.4 ) , with = 45 , and for a solvent n2 = 1.4 , the penetration depth d is about 200550 nm over a transmission range between 4000 and 1500 cm . knowing the characteristic values of d , the dry thickness of the p12ma coating was adjusted during synthesis to fall largely within the probed range in all solvent environments and for all temperatures . to account for the temperature - dependent absorption of the light - guiding silicon crystal , background measurements were conducted using the pristine crystal for each solvent at the relevant temperatures of 25 , 30 , 45 , and 60 c . the measurements carried out in the presence of the coatings were compared to those from the bare configuration with corresponding solvent type and temperature . to eliminate any time - dependent behavior , reversibility was evaluated by cycling the temperature applied from 25 to 60 c and back to 25 c with appropriate resting periods to allow equilibration of the sample . the experiment was repeated by an additional heating and cooling cycle , in order to guarantee reproducibility of any temperature - dependent changes in the system studied . hydrocarbon stretches in the ir spectrum are present for all solvents used in this study as well as for the polymer brush investigated . however , the carbonyl groups in the polymer brush allowed us to identify the brush from the c = o stretches in the spectra . in the case of ethanol , ethanol has a boiling point of 78 c and can therefore be used for tests up to 60 c to assess solvent - dependent changes in the spectra upon changing temperature . to study the temperature effects on the adhesive and lubricious properties of p12ma , atomic force microscopy ( afm ) was used for indentation experiments and lateral force microscopy ( lfm ) for tribological characterization , using a mfp-3d atomic force microscope ( asylum research , santa barbara , ca ) . the adhesion and tribological properties of both bare and brush - coated silicon surfaces were performed using a micrometer - scale colloidal silica probe and a dedicated temperature - controlled liquid - cell setup at temperatures ranging from 25 to 60 c , i.e. , well above the polymer s bulk tg of 65 c . for all measurements , afm colloidal probes were produced by gluing silica spheres ( kromasil , brewster , ny ) of 9 m radius onto cantilevers ( masch , san jose , ca ) with a spring constant of 0.3 n / m using a home - built micromanipulator . the normal sensitivity of each probe was determined by indentation on a bare silica surface and by measuring the slope of the deflection curve . lateral - force calibration was performed by pressing a silica sphere of 80 m diameter mounted on a reference cantilever of the same batch against a vertical wall . the deflection upon contact with the wall provides the sensitivity value of the probe - cantilever combination , which is necessary to convert the voltage recorded during lateral motion into a lateral force . the adhesion between the colloidal probes and the samples was measured by recording the pull - off force with a consequent retraction of the probe at a constant rate of 1 m / s , following indentation at forces up to 17 nn . between 24 and 59 force distance measurements were performed for each sample . upon moving the probe 20 m laterally across the surface , the torsion of the cantilever indicates the friction experienced during the motion . the frictional force corresponding to a lateral sliding velocity of 10 m / s was calculated according to eq 2 , where f(trace ) is the lateral force in one direction and f(retrace ) in the opposite sliding direction.2 by varying the normal load exerted by the probe , its effect on the friction force between the probe and the surface can be evaluated this procedure was carried out for bare as well as p12ma - coated silicon wafers , and was repeated for more than eight friction loops for every measurement point , for three different positions on each sample per temperature . p12ma is readily soluble in nonpolar solvents , such as toluene , at room temperature . due to a polarity mismatch , ethanol is considered a poor solvent and does not solubilize the polymer at ambient temperatures . we studied the solubility of p12ma in binary solvent mixtures of toluene and ethanol as a function of temperature , in order to identify the conditions under which it can be solubilized in the presence of ethanol . we also investigated the impact that surface grafting has on solubility by means of atr - ir . this novel approach was crucial , because , although optical ( ellipsometry , neutron reflectometry , tinas ) and mechanical ( afm , qcm ) techniques provide information on the combined solvent - brush properties , atr - ir can provide invaluable information on chemical interactions and can separate the contributions of each individual component . toluene mixture ( 40:60 ) showed a transition from a translucent suspension of polymer aggregates to a clear solution upon heating from room temperature to temperatures above 35 c , indicating a change in polymer solvent interactions . these qualitative observations are quantitatively confirmed by the uv vis spectrophotometry results shown in figure 2 . the data shows the suspension transmittance at 410 nm as a function of temperature for p12ma in toluene with ethanol contents ranging from 34 wt % to 41 wt % . for all suspensions there is a transition temperature at which the suspension becomes a clear solution ( i.e. , the cloud - point ) , indicating full solubilization of the polymer . it can be seen that increasing ethanol concentration increases the temperature required to achieve solvation of p12ma in the solvent mixture , both upon heating and cooling . ethanol mixtures ( ethanol content in the legend ) as a function of temperature . increasing transition temperatures are observed with increasing ethanol content , upon both heating ( filled symbols ) and cooling ( empty symbols ) . post - experimental nmr analysis provided the exact composition of the solvent mixtures , enabling us to establish an accurate correlation between the transition temperature ( 50% transmittance ) and the solvent composition . figure 3 shows a linear relation between the transition temperature and the ethanol concentration in the range of solvent mixtures tested , upon both heating and cooling . a similar linear trend for a narrow concentration range and a minor hysteresis between heating and cooling curves is expected , as previously reported for pmma solutions . ethanol mixtures for both heating and cooling cycles , showing a minor hysteresis and a linear trend ( r = 0.99 ) . in order to investigate in more detail the microscopic origin of the transition for p12ma in the mixtures and to examine whether surface tethering within a brush assembly modifies the solvent- and temperature - dependent solubility behavior of the polymer , we carried out atr - ir investigations on p12ma brushes grafted on silicon wafers , as described in the methods section . we focused on a mixture of 40 wt % ethanol in toluene , and on the pure ethanol and pure toluene cases as controls . we recorded ir spectra at 25 , 30 , 45 , and 60 c , cycling the temperature range . to correct for the background , we first collected spectra of the bare silicon crystal in each of the solvents or solvent mixtures and used these to correct spectra of the p12ma - coated crystal in the corresponding solvents . the absorbance ( absi ) was determined from sample and background intensities according to eq 3 below.3where i corresponds to each of the selected temperatures . the following relevant ir - spectroscopic features were tracked in the collected spectra : the hydrocarbon ch2 and ch3 stretches between 2950 and 2850 cm , a distinct carbonyl stretch at 1730 cm , and a broad hydroxyl stretch at 3350 cm , which allowed interactions involving ethanol to be followed unambiguously . the hydroxyl stretch at 3350 cm , which appears negative due to the pure - ethanol background , recorded while flowing a solvent mixture of 40 wt % ethanol in toluene over the p12ma - coated atr - ir crystal ( figure 4 ) , reveals a significant absorbance increase upon increasing temperature . a decrease of the peak intensity upon cooling back to 25 c demonstrated that the effect was completely reversible . upon repeated heating and cooling cycles , the intensity changes were reproducible and the peak positions overlapped upon reaching the same temperature during both heating and cooling procedures . this increased oh - absorbance results from an increased ethanol concentration at the sensing surface ( i.e. , within the range of the evanescent field ) . the peak - intensity change suggests that ethanol penetrates and swells the p12ma layer to a greater extent with increasing temperature , and upon cooling retreats from the collapsing brush structure . similar swelling phenomena have also been observed when studying thickness and mass changes in temperature - responsive pnipam brushes by means of ellipsometry , but atr - ir yields additional information on composition close to the surface . pure - solvent - background - corrected atr - ir spectra for a p12ma brush grafted onto a silicon crystal in a 40 wt % ethanol in toluene mixture collected upon heating and cooling . to confirm the swelling of the brush , the carbonyl peak at 1730 cm , a signal that is solely due to the presence of p12ma at the sensing surface , was measured . ethanol penetration also leads to an intensity reduction in signals from the swelling brush structure , as can be seen in a reproducible reduction in carbonyl peak intensity ( figure 5 ) . carbonyl peak of a p12ma polymer brush in a 40 wt % ethanol in toluene mixture shows a noticeable decrease in intensity upon increasing temperature . changes in peak intensity from brush ( c = o ) and the ethanol - containing solvent ( oh ) can be used individually to investigate solvent partitioning and preferential solvation effects normally a nontrivial task for surface - bound polymers . the schematic in figure 6a shows p12ma in 100% ethanol , a poor solvent at room temperature , in a collapsed state.figure 6b shows how the addition of toluene , a good solvent , can improve the solvent environment and allow the brush to swell , as measured for a p12ma in solution using uv vis . assuming that toluene preferentially solvates the brush in a solvent mixture such a semistretched brush structure is expected for binary solvent - mixtures of varying quality from theoretical thermodynamic calculations . upon heating the pure ethanol environment , depicted in figure 6c , changes in the hydroxyl peak clearly indicate ingress of ethanol into the brush structure in a pure ethanol environment . as mentioned earlier , the carbonyl peak intensity gradually decreases , indicative of swelling and reduction of brush presence at the sensing surface . studies on pnipam using neutron reflectometry and liquid - cell ellipsometry have shown that temperature - induced solvent - quality - dependent swelling initially occurs in the outermost layers , swelling the collapsed layer from the outside inward . schematic of different brush solvent interactions as measured via in situ atr - ir . at room temperature , the solvent composition determines whether a brush is ( a ) fully collapsed or ( b ) partially solvated by the good solvent ( star symbols ) . upon heating , ethanol ( black dots ) becomes a better solvent and penetrates the brush structure ( c ) . in the case ( d ) of a partially stretched brush , ethanol can readily access the structure . however , compared to the pure ethanol environment , when heating the brush in an ethanol toluene mixture the changes in peak intensity for the oh signal are more pronounced than the changes in the c = o signal . such divergent behavior is an indication of solvent partitioning and preferential solvent uptake , as has been reported for brushes in solvent mixtures using small - angle neutron reflectometry . the carbonyl peak - intensity change upon heating is smaller in a solvent mixture , as the already partially stretched brush only undergoes minor swelling . the black dots in figure 6d depict the increased presence of ethanol upon heating for the mixed solvent environment , as indicated by the stronger hydroxyl peak intensity change . with increasing temperature ethanol is also able to access the already swollen structure of the brush , thereby reaching closer to the sensing surface . to provide a more quantitative illustration of the solvation effects , we integrated both the hydroxyl and carbonyl peaks , from 3050 to 3554 cm and from 1714 to 1747 cm , respectively , at each temperature in each solvent mixture used , as shown in figure 7 . for the hydroxyl peak , the integrated values are reported relative to the recorded value at 25 c , which equals 0 assuming no ethanol penetrating the polymer brush at room temperature , as shown in eq 4 below . the normalized intensity change ( nicoh ) for the hydroxyl peak was calculated as follows:4 temperature - dependent normalized peak intensity changes for p12ma in an ethanol toluene mixture and pure ethanol . the c = o decrease indicative of the brush stretching away from the surface with increasing temperature is normalized to 1 , which is the maximum intensity measured at 25 c . ethanol as a poor solvent is assumed not to be present at room temperature and gradually increases with improving solvent quality for increasing temperatures . vis measurements of free polymer chains , we assume that in the case of a pure ethanol environment , the brush is in a collapsed state at 25 c , while a solvent mixture of ethanol and toluene ( 40 and 60 wt % , respectively ) leads to a partially stretched brush configuration at the same temperature due to the toluene being a good solvent . therefore , the carbonyl peak intensity value at 25 c is assumed to be 1 , representing a maximum intensity obtained from measuring the brush layer being either collapsed in ethanol or partially stretched in the presence of toluene . consequently , eq 5 describes the normalized peak intensity changes ( nicc = o ) for the carbonyl peak.5 afm and lfm experiments were carried out in order to study the effects of temperature - induced solvent interactions on adhesion and friction properties of a p12ma coating . the interaction between a spherical probe and the surface - bound polymer in pure ethanol was studied upon changes in temperature , via afm nanoindentation . upon retraction of the probe , force indentation curves , shown in figure 8 , show increased adhesion with increasing temperature . not only does the maximum pull - off force increase with increasing temperature ( figure 8) , but also the distance to full detachment increases from about 120 nm to nearly 400 nm . experiments in ethanol - toluene solvent mixtures could not be carried out due to incompatibility of the sample cell with toluene . afm - nanoindentation retraction curves of p12ma in ethanol at 25 , 30 , 45 , and 60 c . an increase in pull - off force as well as an increased distance to full detachment is observed . the adhesion energy has been quantified by integration over the area below the zero line , shown as a histogram of the probability distribution in figure 9 . the increase in adhesion energy can be explained through an increased contact area , a mechanism that has been previously observed for comparable polymer - brush structures . the inset displays an increase in the mean adhesion with increasing temperature , which appears to follow a linear trend . increasing mobility and flexibility of the polymer can in fact lead to the probe experiencing a larger contact area , i.e. , an increase in the number of chain - probe contacts . with increasing temperature and improved solvent quality , the polymer chains are more flexible and histogram of adhesion energy for a p12ma coating in ethanol at different temperatures . the inset shows the mean adhesion energy and the standard deviation with increasing temperature . the probability distributions have been calculated for 24 , 39 , 36 , and 59 measurements collected at 25 , 30 , 45 , and 60 c , respectively . consistent with the atr - ir findings , pull - off measurements suggest that p12ma in ethanol transitions from a collapsed state to a more adhesive , ethanol - containing swollen brush upon increasing temperature from 25 to 60 c . changes in brush conformation and adhesion also affect the frictional properties of a polymer brush , which was measured by lfm on p12ma brushes in ethanol at increasing temperatures . on the one hand , figure 10 shows increased lateral forces at low normal forces for increasing temperatures , behavior characteristic of increased adhesion . on the other hand , measuring lateral forces as a function of increasing normal loads shows a reduced slope with increasing temperature . via a two - term equation ( eq 6 ) , one can describe both the adhesion - dependent ( f0 ) and the load - dependent contributions to the friction force experienced by the probe upon sliding.6the adhesive contribution ( fadh = f0 ) is defined by the intersection of the slope of the load - dependent friction trend ( ) with the vertical axis . with increasing temperature , fadh increased , comparable to the slope of the load - dependent friction term at 25 c is in line with values reported for lfm experiments on p12ma in ethanol at room temperature . for increasing temperatures , decreased , and upon extrapolation to higher normal forces an intersection is expected at about 110 nn . atr - ir and afm - nanoindentation measurements suggest that the initially collapsed brush gradually swells in ethanol upon increasing temperature . solvent interaction is responsible for the observed decrease in the two - term sliding friction coefficient with temperature . lateral versus normal force as a function of temperature for a p12ma coating in ethanol . the dotted lines are linear fits to highlight the change in slope of the two - term friction equation . the change in intersection with the vertical axis indicates an increase in adhesion with temperature . we have studied the temperature - dependent properties of p12ma in ethanol , toluene , and their mixtures , with an emphasis on the solvent interactions of surface - bound brushes . atr - ir was employed to investigate the effects of partitioning solvents and preferential solvation within the brush upon swelling and deswelling caused by temperature changes . toluene mixtures could be improved upon increasing temperature , atr - ir in liquid allowed measuring specific solvent brush interactions in situ , enabling a more detailed analysis in the case of p12ma brushes . specifically , improved solvent quality at higher temperatures led to ethanol uptake and swelling of p12ma . the clear transition temperature measured via uv vis for p12ma in solution could not be identified for surface - bound brushes . however , preferential solvation and solvent partitioning was identified via the changes in normalized peak intensity . mechanical characterization of the brushes via afm and lfm showed increased adhesion but also reduced load - dependent friction , deduced from the two - term equation , upon temperature - induced swelling of the brush . our current results show that atr - ir studies can provide new insights into the interaction of surface - tethered polymers with their environment to help develop tailored polymer solvent combinations for application as stimuli - responsive materials for controlled - friction behavior and switchable adhesion .

solvent interactions with bulk and surface - bound polymer brushes are crucial for functionalities such as controlled friction and thermoresponsive adhesion . to study such interactions , the temperature - induced solvent - quality changes and the effect of surface tethering on the mechanical and tribological properties of poly(dodecyl methacrylate ) ( p12ma ) brushes have been investigated by means of attenuated total reflection infrared spectroscopy ( atr - ir ) , as well as atomic force microscopy ( afm ) and lateral force microscopy ( lfm ) . these results have been compared with temperature - dependent uv visible spectrophotometry ( uv vis ) data for the corresponding bulk polymer solutions . the atr - ir results clearly show that increasing temperature enhances ethanol uptake in p12ma , which results in film swelling . this is accompanied by a marked increase in both adhesion and friction . we have also shown that a combination of solvents , such as toluene and ethanol , can lead to a temperature - dependent solvent partitioning within the polymer brush . to our knowledge this is the first time preferential solvent uptake in a grafted - from brush has been monitored via in situ atr - ir . moreover , we have observed remarkably different behavior for polymer chains in solution compared to the behavior of similar chains bound to a surface . the presented findings on the temperature - dependent solvent interactions of surface - grafted p12ma reveal previously unknown solvation phenomena and open up a range of possible applications in the area of stimuli - responsive materials .

estimates of future total health care costs for diabetes must take into account two dynamic processes . new people are diagnosed and added to the population ; contemporaneously , other individuals with existing diabetes die and leave this subpopulation . with the balance of these two processes , the prevalence of diabetes in the total population changes on an annual basis . the pace of change differs over time depending on factors such as the rate of obesity and age of those at risk . for instance , the aging of the large baby boom generation will bring large numbers of new people into age categories that are at higher risk of developing the disease . complications take time to develop and inflict damage to the eyes , kidneys , and circulatory and nervous systems . therefore , robust projection models must include estimates of the expected natural history of the disease based on alternative levels of disease management . in developing our forecasting model , we account for two types of cohorts a prevalent and an incident cohort . it reflects the distribution of different ages and different years with diabetes of the subpopulation in 2008 . this group represents the new people with diabetes entering the diagnosed population each year after the base year of 2008 . the number of people with diabetes in any year is the sum of the population in the previous year ( in 2008 , it is the prevalent cohort ) and the incident cohort , minus deaths from all causes in the previous year 's population with diabetes . to account for the costs of both cohorts , we tracked costs using two timelines : 1 ) the chronological timeline during which we will report our total cost estimates and 2 ) the age timeline for various heterogeneous subgroups within the prevalent and incident cohorts . for example , different patients may start with diabetes at different ages in the same calendar year . this involves accounting for all health care costs incurred for the prevalent groups of people with diabetes , after the annual incident cohort for that year joins the prevalent cohort ( illustrated by a dotted box in fig . we take the prevalent cohort of patients in 2008 and lay out their lifetime cost profiles throughout the calendar time starting from 2008 . similarly , we take the incident cohort of patients in 2009 and lay out their lifetime cost profiles throughout the calendar time starting from 2009 . there are three components that are central to estimating this accumulation of costs : 1 ) defining the prevalent cohort and its heterogeneity , 2 ) the diabetes incidence model , and 3 ) the lifetime simulation model for diabetes progression . we assume that the prevalent cohort of adult patients living with diabetes has the demographic and clinical characteristics of adult individuals reporting that they have diabetes in the national health and nutrition examination survey ( nhanes ) ( 20052006 ) . to create the prevalent cohort , we used self - reported disease to identify individuals with diabetes . population with diagnosed diabetes , undiagnosed diabetes , and no diabetes , categorized by sex , race / ethnicity , and age from 24 to 85 years . because few clinical trial results include populations under 24 or over 85 years , this age range allows the model to estimate the effects of clinical trial results on the entire study population . lifetime diabetes - related costs for the prevalent cohort are estimated using the lifetime simulation model for diabetes progression described below . the main purpose of the incidence model is to account for new cases of undiagnosed and diagnosed diabetes in the population over time . once new subjects are diagnosed , their lifetime costs are calculated using the cost estimates arising out of the lifetime model of diabetes progression . s1a ( available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-0459/dc1 ) displays the basic structure of the markov model that traces the transition of the u.s . these transition probabilities determine the distribution of bmi categories at any point in time , which in turn affects the transition to diabetes . s1b displays the basic structure of the markov model that tracks the movement of the population between four main states : 1 ) no diabetes , 2 ) undiagnosed diabetes , 3 ) diagnosed diabetes , and 4 ) death . . a fraction of the population without diabetes , conditional on their survival ( death rate is denoted by d ) to the next period , may progress to have diabetes . annual progression rates are denoted by the parameter r. these people transition to become diagnosed or to remain undiagnosed with diabetes depending on whether they are screened . annual screening rates are denoted by the parameter s. similarly , depending on whether they are screened , those with currently undiagnosed diabetes transition to become diagnosed or remain undiagnosed . as mentioned above , the group with diagnosed diabetes then is removed from this model and fed into the lifetime simulation model described below . yearly transitions across bmi categories are estimated using the 20042005 longitudinal data on the panel 9 cohort from the medical expenditure panel survey . finally , estimates of r are obtained by fitting the markov model to published incidence rates from the centers for disease control and prevention ( using the national health interview survey ) ( 5 ) . all parameters are allowed to vary by sex , race , and ethnicity and smoothed over ages 2485 years . estimates of r are separately smoothed for age - groups < 45 , 4564 , and > 64 years due to substantial heterogeneity across these age ranges . age - specific annual hazard of progression to diabetes for people without diabetes for different sexes and bmi categories are calculated based on observed incidence of people with diagnosed diabetes and current screening rates . the progression hazards increase monotonically with age in all categories and are highest for the obese category followed by overweight and normal at all ages . within a 1-year cycle , patients move from one disease state to another or stay in the current disease state until death or age 95 years . hypothetical patients move through the model from left to right for each cycle length ( 1 year ) . based on initial patient clinical characteristics , patients are subject to the risk of various complications related to diabetes as well as mortality . data on demographic characteristics ( sex and race / ethnicity ) as well as relevant clinical characteristics ( blood pressure levels , cholesterol levels , ghb levels , and duration of diabetes ) are obtained from nhanes and used as data inputs for the simulation models . for each clinical risk factor , we use age- , sex- , and race / ethnicity - specific distributions of these factors within the models . the diabetes complication models in this analysis prediction models for all major diabetes - related complications have been developed by the ukpds study group ( 7,8 ) . these models have been internally and externally validated with cardiovascular trial data ( 9 ) . the ukpds model does not include glucose control as a predictor , making it unsuitable for evaluating the impact of improved diabetes care on end - stage renal disease . instead , we modeled the development of microalbuminuria and proteinuria , which are linked to the intensity of glucose control ( 10 ) . we used prediction models for these intermediate complications using optimization procedures to fit observations from the ukpds control arm to a functional form used in the original national institutes of health model ( 11 ) . for the transition between proteinuria to end - stage renal disease , we used probabilities from an observational study ( 12 ) . for background mortality rates , we used race / ethnicity- and sex - specific background mortality rates reported in u.s . life table statistics from 1999 ( 13 ) . to calculate background mortality rates for individuals with diabetes , we subtracted cardiovascular mortality rates for the general population from the overall mortality rates found in life tables . we multiplied these rates by 2.75 as previously done to reflect higher background mortality rates for patients with diabetes ( 11 ) . when patients developed specific complications , such as coronary heart disease , stroke , end - stage renal disease , and amputation , we assumed that patients had higher mortality rates attributable to these complications ( 14,15 ) . within the model the benefits of ace inhibitors were based on the findings from the heart outcomes prevention evaluation ( hope ) study ( 16 ) . aspirin was assumed to reduce the probability of coronary heart disease but to increase the probability of gastrointestinal bleed ( 17 ) . we assumed that the joint effect of aspirin and an ace inhibitor on cardiovascular effects was multiplicative . we did not assume that simply the processes of care such as foot examination or routine laboratory tests independently produced clinical benefits ( 18 ) . we assumed that the use of medications reflects the current distribution of use of insulin , oral agents , insulin plus oral agents , and diet therapy as observed in national studies of diabetes care ( 19 ) . distribution of use of different oral glucose - lowering agents was assumed to be the observed distribution in national studies ( 20 ) . use of ace inhibitors and aspirin therapy was based on recent national reports of diabetes care ( 21 ) . frequency of office visits and laboratory tests was assumed to be that observed in a recent national study ( 22 ) . we estimated drug costs based on the average type and frequency of drug prescriptions , dosage of medications , and wholesale drug prices . annual costs of microvascular and cardiovascular complications were obtained from recent studies in the literature ( please see the online appendix table for details ) . for this analysis , we used the complication model to predict the average annual costs of living with diabetes by different ages , sexes , racial groups , and major durations of diabetes . a total of 10,000 monte - carlo iterations ( each iteration representing a patient life ) were used to generate average estimates . we assume that the prevalent cohort of adult patients living with diabetes has the demographic and clinical characteristics of adult individuals reporting that they have diabetes in the national health and nutrition examination survey ( nhanes ) ( 20052006 ) . to create the prevalent cohort , we used self - reported disease to identify individuals with diabetes . population with diagnosed diabetes , undiagnosed diabetes , and no diabetes , categorized by sex , race / ethnicity , and age from 24 to 85 years . because few clinical trial results include populations under 24 or over 85 years , this age range allows the model to estimate the effects of clinical trial results on the entire study population . lifetime diabetes - related costs for the prevalent cohort are estimated using the lifetime simulation model for diabetes progression described below . the main purpose of the incidence model is to account for new cases of undiagnosed and diagnosed diabetes in the population over time . once new subjects are diagnosed , their lifetime costs are calculated using the cost estimates arising out of the lifetime model of diabetes progression . s1a ( available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-0459/dc1 ) displays the basic structure of the markov model that traces the transition of the u.s . these transition probabilities determine the distribution of bmi categories at any point in time , which in turn affects the transition to diabetes . s1b displays the basic structure of the markov model that tracks the movement of the population between four main states : 1 ) no diabetes , 2 ) undiagnosed diabetes , 3 ) diagnosed diabetes , and 4 ) death . a fraction of the population without diabetes , conditional on their survival ( death rate is denoted by d ) to the next period , may progress to have diabetes . annual progression rates are denoted by the parameter r. these people transition to become diagnosed or to remain undiagnosed with diabetes depending on whether they are screened . annual screening rates are denoted by the parameter s. similarly , depending on whether they are screened , those with currently undiagnosed diabetes transition to become diagnosed or remain undiagnosed . as mentioned above , the group with diagnosed diabetes then is removed from this model and fed into the lifetime simulation model described below . the others continue . initial distribution of bmi categories are obtained from nhanes data ( 20052006 ) . yearly transitions across bmi categories are estimated using the 20042005 longitudinal data on the panel 9 cohort from the medical expenditure panel survey . finally , estimates of r are obtained by fitting the markov model to published incidence rates from the centers for disease control and prevention ( using the national health interview survey ) ( 5 ) . all parameters are allowed to vary by sex , race , and ethnicity and smoothed over ages 2485 years . estimates of r are separately smoothed for age - groups < 45 , 4564 , and > 64 years due to substantial heterogeneity across these age ranges . age - specific annual hazard of progression to diabetes for people without diabetes for different sexes and bmi categories are calculated based on observed incidence of people with diagnosed diabetes and current screening rates . the progression hazards increase monotonically with age in all categories and are highest for the obese category followed by overweight and normal at all ages . within a 1-year cycle , patients move from one disease state to another or stay in the current disease state until death or age 95 years . online appendix fig . hypothetical patients move through the model from left to right for each cycle length ( 1 year ) . based on initial patient clinical characteristics , patients are subject to the risk of various complications related to diabetes as well as mortality . data on demographic characteristics ( sex and race / ethnicity ) as well as relevant clinical characteristics ( blood pressure levels , cholesterol levels , ghb levels , and duration of diabetes ) are obtained from nhanes and used as data inputs for the simulation models . for each clinical risk factor , we use age- , sex- , and race / ethnicity - specific distributions of these factors within the models . prediction models for all major diabetes - related complications have been developed by the ukpds study group ( 7,8 ) . these models have been internally and externally validated with cardiovascular trial data ( 9 ) . the ukpds model does not include glucose control as a predictor , making it unsuitable for evaluating the impact of improved diabetes care on end - stage renal disease . instead , we modeled the development of microalbuminuria and proteinuria , which are linked to the intensity of glucose control ( 10 ) . we used prediction models for these intermediate complications using optimization procedures to fit observations from the ukpds control arm to a functional form used in the original national institutes of health model ( 11 ) . for the transition between proteinuria to end - stage renal disease , we used probabilities from an observational study ( 12 ) . for background mortality rates , we used race / ethnicity- and sex - specific background mortality rates reported in u.s . life table statistics from 1999 ( 13 ) . to calculate background mortality rates for individuals with diabetes , we subtracted cardiovascular mortality rates for the general population from the overall mortality rates found in life tables . we multiplied these rates by 2.75 as previously done to reflect higher background mortality rates for patients with diabetes ( 11 ) . when patients developed specific complications , such as coronary heart disease , stroke , end - stage renal disease , and amputation , we assumed that patients had higher mortality rates attributable to these complications ( 14,15 ) . within the model the benefits of ace inhibitors were based on the findings from the heart outcomes prevention evaluation ( hope ) study ( 16 ) . aspirin was assumed to reduce the probability of coronary heart disease but to increase the probability of gastrointestinal bleed ( 17 ) . we assumed that the joint effect of aspirin and an ace inhibitor on cardiovascular effects was multiplicative . we did not assume that simply the processes of care such as foot examination or routine laboratory tests independently produced clinical benefits ( 18 ) . we assumed that the use of medications reflects the current distribution of use of insulin , oral agents , insulin plus oral agents , and diet therapy as observed in national studies of diabetes care ( 19 ) . distribution of use of different oral glucose - lowering agents was assumed to be the observed distribution in national studies ( 20 ) . use of ace inhibitors and aspirin therapy was based on recent national reports of diabetes care ( 21 ) . frequency of office visits and laboratory tests was assumed to be that observed in a recent national study ( 22 ) . we estimated drug costs based on the average type and frequency of drug prescriptions , dosage of medications , and wholesale drug prices . annual costs of microvascular and cardiovascular complications were obtained from recent studies in the literature ( please see the online appendix table for details ) . for this analysis , we used the complication model to predict the average annual costs of living with diabetes by different ages , sexes , racial groups , and major durations of diabetes . a total of 10,000 monte - carlo iterations ( each iteration representing a patient life ) were used to generate average estimates . the results of our model regarding overall population changes in obesity , future population size , and health care spending have been briefly described in a related publication ( 23 ) . because our model predicts the progression from non - diabetes to diabetes , we estimate changes in percentage of obese , overweight , and normal - weight individuals in the population living without diabetes . overall obesity distribution in the non - diabetes population remains fairly stable over time , with 65% of the population being overweight or obese . the percentage categorized as overweight in the non - diabetes population the percent categorized as obese is expected to drop slightly from 30% in 2009 to 27% in 2033 . this same leveling of the obesity trend is found in projections produced by the centers for disease control and prevention for the u.s . we found that in 2009 , there will be 19.5 million diagnosed and 4.25 million undiagnosed diabetes cases in the population ages 2485 years . over the next 12 years the distribution of diagnosed and undiagnosed individuals will be shaped by the rate of arrival of new cases and continued screening for diabetes by the medical system . the combined effect is that the cohort of established diagnosed diabetes will grow , while the cohort of undiagnosed diabetes steadily declines and stabilizes at around 3.7 million by 2020 . after 2020 , the size of the cohort of people with undiagnosed diabetes is estimated to decline . projected distribution of newly diagnosed , undiagnosed , and established cases of diabetes , 20092034 . the growth of the medicare population follows many of the same trends for the overall population with diabetes . for 2009 , the model projects 6.5 million medicare - eligible beneficiaries with prevalent diagnosed diabetes . during 2009 , 0.9 million will be newly diagnosed with diabetes , while another 0.9 million will remain undiagnosed . by 2034 , the number of individuals with diagnosed diabetes eligible for medicare will rise to 14.1 million , while the size of the annual cohort with undiagnosed diabetes will decrease to 440,000 . for this analysis , we projected direct spending on diabetes and its complications for the next 25 years ( fig . 3 ) . the sum of spending for the cohort that currently has diabetes ( the prevalent cohort ) and the spending for the populations expected to be diagnosed during the next 25 years ( the incident cohorts ) determines the total costs of diabetes in future years . in the next 25 years , annual spending is expected to increase steeply to approximately $ 336 billion ( in constant 2007 usd ) , mainly because of the increasing size of the incident cohorts . the annual costs should stabilize from that point on as the size of the incident cohort plateaus . similarly , medicare spending on diabetes care is estimated to rise from $ 45 billion in 2009 to $ 171 billion in 2034 . based on these estimates , medicare spending alone will represent just over 50% of direct spending on diabetes in 2034 . because our model predicts the progression from non - diabetes to diabetes , we estimate changes in percentage of obese , overweight , and normal - weight individuals in the population living without diabetes . overall obesity distribution in the non - diabetes population remains fairly stable over time , with 65% of the population being overweight or obese . the percentage categorized as overweight in the non - diabetes population the percent categorized as obese is expected to drop slightly from 30% in 2009 to 27% in 2033 . this same leveling of the obesity trend is found in projections produced by the centers for disease control and prevention for the u.s . we found that in 2009 , there will be 19.5 million diagnosed and 4.25 million undiagnosed diabetes cases in the population ages 2485 years . over the next 12 years the distribution of diagnosed and undiagnosed individuals will be shaped by the rate of arrival of new cases and continued screening for diabetes by the medical system . the combined effect is that the cohort of established diagnosed diabetes will grow , while the cohort of undiagnosed diabetes steadily declines and stabilizes at around 3.7 million by 2020 . after 2020 , the size of the cohort of people with undiagnosed diabetes is estimated to decline . projected distribution of newly diagnosed , undiagnosed , and established cases of diabetes , 20092034 . the growth of the medicare population follows many of the same trends for the overall population with diabetes . for 2009 , the model projects 6.5 million medicare - eligible beneficiaries with prevalent diagnosed diabetes . during 2009 , 0.9 million will be newly diagnosed with diabetes , while another 0.9 million will remain undiagnosed . by 2034 , the number of individuals with diagnosed diabetes eligible for medicare will rise to 14.1 million , while the size of the annual cohort with undiagnosed diabetes will decrease to 440,000 . for this analysis , we projected direct spending on diabetes and its complications for the next 25 years ( fig . the sum of spending for the cohort that currently has diabetes ( the prevalent cohort ) and the spending for the populations expected to be diagnosed during the next 25 years ( the incident cohorts ) determines the total costs of diabetes in future years . in the next 25 years , annual spending is expected to increase steeply to approximately $ 336 billion ( in constant 2007 usd ) , mainly because of the increasing size of the incident cohorts . the annual costs should stabilize from that point on as the size of the incident cohort plateaus . similarly , medicare spending on diabetes care is estimated to rise from $ 45 billion in 2009 to $ 171 billion in 2034 . based on these estimates , medicare spending alone will represent just over 50% of direct spending on diabetes in 2034 . we project that over the next 25 years , the number of americans with diagnosed and undiagnosed diabetes will increase from 23.7 million to 44.1 million . during the same time period , annual spending related to diabetes is expected to increase from $ 113 billion to $ 336 billion ( in constant 2007 usd ) . these changes are driven more by the size of incoming age cohorts than by changes in obesity and overweight rates . for medicare , the project growth in diabetes care spending exceeds current projections of spending by medicare and for the growth domestic product . our analysis is distinct from prior efforts to forecast the future size of the diabetes population . prior studies have accounted for the changing size and age composition of the overall population and assumed fixed age - specific and sex - specific prevalence rates ( 2,3 ) . more recently , boyle et al . ( 4 ) demonstrated the important impact of changes in the ethnic composition of the population on the projected burden of diabetes . our study is distinct in its accounting for the evolving nature of the distribution of body weight categories in the population . our analysis is also unique in its accounting for the natural history of diabetes complications . we built this model to improve the budgetary and health outcome information available to federal policymakers . the model provides a rigorous assessment of the future burden of diabetes that accounts for the natural history of the disease and recent advances in treatment . more importantly , the model can also be used to provide estimates of the impact of alternative policy scenarios . current practices by federal scorekeeping agencies do not approach cost estimating in this manner , nor do they generally provide estimates beyond 10 years . this diabetes model is also meant to serve as an example of the type of forecasting model that can be used by policymakers when considering policies for other chronic diseases . such models are appropriate when abundant epidemiological data are available to forecast the natural history of disease incidence and progression , as is the case with type 2 diabetes . first , attempts to forecast future costs and utilizations are conditional on current rates of utilization . for example , we have used the most current estimates of screening rates for diabetes from nhanes . our model also does not account for individuals under 24 years of age who enter the population . this limitation may be particularly relevant for accurately incorporating diabetes prevalence and incidence in the immigrant population , who may experience heterogeneous rates of developing the disease ( 25 ) . lastly , during our analysis of transitions across bmi categories , we grouped all individuals who had bmis 30 kg / m . we did this because of a lack of available medical expenditure panel survey data to model transitions across finer bmi categories . many of these limitations may lead to more conservative estimates of the future size of the diabetes populations and their costs . despite these limitations , our study strongly suggests that diabetes will grow in the coming decades , both in population size and costs , and will have significant impacts on the lives of americans and the financial viability of programs like medicare . forecasting models like this can help policymakers anticipate future burdens of chronic diseases and design targeted policies that fight these diseases in the most effective ways possible , both in terms of clinical effectiveness and cost - effectiveness .

objectivewe developed a novel population - level model for projecting future direct spending on diabetes . the model can be used in the federal budget process to estimate the cost implications of alternative policies.research design and methodswe constructed a markov model simulating individuals ' movement across different bmi categories , the incidence of diabetes and screening , and the natural history of diabetes and its complications over the next 25 years . prevalence and incidence of obesity and diabetes and the direct spending on diabetes care and complications are projected . the study population is 24- to 85-year - old patients characterized by the centers for disease control and prevention 's national health and nutrition examination survey and national health interview survey.resultsbetween 2009 and 2034 , the number of people with diagnosed and undiagnosed diabetes will increase from 23.7 million to 44.1 million . the obesity distribution in the population without diabetes will remain stable over time with 65% of individuals of the population being overweight or obese . during the same period , annual diabetes - related spending is expected to increase from $ 113 billion to $ 336 billion ( 2007 dollars ) . for the medicare - eligible population , the diabetes population is expected to rise from 8.2 million in 2009 to 14.6 million in 2034 ; associated spending is estimated to rise from $ 45 billion to $ 171 billion.conclusionsthe diabetes population and the related costs are expected to at least double in the next 25 years . without significant changes in public or private strategies , this population and cost growth are expected to add a significant strain to an overburdened health care system .

between august 1992 and june 2005 , 1,008 ldlts were performed and followed in our institution ; patients who died within three months of the procedure were excluded from this study . pathologic examination of extracted cirrhotic liver revealed hccs in 252 patients ( 25.0% ) . during the follow - up period after ldlt , 42 of these 252 patients ( 16.7% ) were diagnosed with recurrent hcc in the transplanted liver as well as in extrahepatic organs such as lung or bone . tace was indicated after ldlt for r - hcc with intrahepatic or extrahepatic locations with feeding arteries from the celiac trunk or right inferior phrenic artery or intercostal artery . contraindications were child - pugh class c liver profile ( n = 8) , hyperbilirubinemia > 3 ng / ml ( n = 6 ) , and complete obstruction of the main portal vein ( n = 3 ) . all 28 patients had unresectable r - hcc ( n = 26 ) or refused repeat surgery for resection of r - hcc ( n = 2 ) . there were two female patients and 26 male patients , with a mean age of 53.4 years ( range , 38 - 65 years ) . ldlt was performed in 28 patients as left lobe ( n = 6 ) , right lobe ( n = 18 ) , and dual ldlt from different donors ( n = 4 ) . radiological diagnostic imaging studies and elevation of the alpha fetoprotein ( afp ) values were used to establish the r - hcc diagnosis ; diagnostic imaging studies included ultrasound ( us ) , computed tomography ( ct ) , and angiography . ct of the chest , abdomen , and pelvis was performed in each patient before tace treatment to detect extrahepatic disease . tumors exceeded the milan criteria in the explanted liver in 153 of the 252 patients ( 60.7% ) diagnosed with hcc before ldlt and in 29 of the 42 patients ( 69.0% ) with recurrent hcc ( 12 ) . tumors in the explanted liver of 19 of the 28 study patients ( 67.9% ) also exceeded the milan criteria . the median time from liver transplantation to detection of r - hcc was 15 months ( range , 2 - 57 months ) . tace was performed within one year , between one and three years , between two and three years , or more than three years after ldlt in 16 ( 57.1% ) , seven ( 25.0% ) , four ( 14.3% ) , or one ( 3.6% ) patient , respectively . nine of 26 patients with intrahepatic recurrence had solitary nodular r - hcc ( fig . 1 ) , while the remaining 17 patients had multiple r - hcc ( fig . 2 ) . eighteen study patients ( 64.3% ) were initially diagnosed with r - hcc extrahepatic metastasis , of which lung metastasis was the most common followed by bone and peritoneal metastases ( table 2 ) . afp values were greater than 400 ng / ml in 18 of 28 patients ( 64.3% ) . the tumor size and number , the feeding arteries , and the degree of portal venous thrombosis were evaluated by celiac and superior mesenteric angiography . tace was performed after a 3 fr microcatheter ( microferret , cook inc , bloomington , in ) was advanced into the feeding artery . in the first procedure , cisplatin ( cisplan , dong - a , seosan , korea ) was infused into the hepatic artery for 15 minutes without embolic particle administration . a mixture of iodized oil ( lipiodol , laboratoire guerbet , cedex , france ) and cisplatin was then injected into the feeding arteries followed by embolization with gelatin sponge ( spongostan , pharmacia and upjohn , kalamazoo , mi ) ; the infused dose of cisplatin was 2 mg / kg of the patient 's weight . the injected dose of iodized oil depended on the tumor size , ranging from 1 to 10 ml ( mean : 4.6 ml ) , and the gelatin sponge consisted of cubes measuring 1 - 2 mm . transcatheter arterial chemoembolization was performed in a lobar artery or a segmental artery in 26 patients with intrahepatic recurrence . tace was performed in the left gastric artery and in the right inferior phrenic and right intercostal arteries in two patients with extrahepatic recurrence . one of these two patients had an extrahepatic r - hcc attached to the posterior portion of the transplanted liver that was supplied by right inferior phrenic and right intercostal arteries ( fig . 3 ) . the other patient had r - hcc in the posterior portion of the left lateral segment of the transplanted liver that was supplied by left gastric artery . the included patients underwent 1 - 5 cycles of tace ( mean , 2.5 cycles per patient ) during the follow - up period . tumor response was evaluated based on ct studies performed 1 - 3 months after tace and was classified into five grades as follows : complete response ( cr ) , total disappearance of the tumor ( figs . 1 , 3 ) ; partial response ( pr ) , reduction of 50% or more in maximum tumor size on ct images ; minimal response ( mr ) , reduction of 25 - 50% ; stable disease ( sd ) , change of < 25% in tumor size ; and progressive disease ( pd ) , increase of 25% or more in tumor size ( fig . tumor size was measured by electronic calipers as the maximum perpendicular diameters of each tumor ( a , b ) . the following formula was used to calculate the change in total tumor size : percentage change in tumor size = 100 * (a*b - a'*b')/(a*b ) where a*b represents the product of the longest perpendicular diameters of each tumor before treatment , and a'*b ' is the product of the tumor diameters after treatment . changes in afp values one month after tace were also evaluated in patients with abnormal afp values at the time of tace . between august 1992 and june 2005 , 1,008 ldlts were performed and followed in our institution ; patients who died within three months of the procedure were excluded from this study . pathologic examination of extracted cirrhotic liver revealed hccs in 252 patients ( 25.0% ) . during the follow - up period after ldlt , 42 of these 252 patients ( 16.7% ) were diagnosed with recurrent hcc in the transplanted liver as well as in extrahepatic organs such as lung or bone . tace was indicated after ldlt for r - hcc with intrahepatic or extrahepatic locations with feeding arteries from the celiac trunk or right inferior phrenic artery or intercostal artery . contraindications were child - pugh class c liver profile ( n = 8) , hyperbilirubinemia > 3 ng / ml ( n = 6 ) , and complete obstruction of the main portal vein ( n = 3 ) . all 28 patients had unresectable r - hcc ( n = 26 ) or refused repeat surgery for resection of r - hcc ( n = 2 ) . there were two female patients and 26 male patients , with a mean age of 53.4 years ( range , 38 - 65 years ) . ldlt was performed in 28 patients as left lobe ( n = 6 ) , right lobe ( n = 18 ) , and dual ldlt from different donors ( n = 4 ) . radiological diagnostic imaging studies and elevation of the alpha fetoprotein ( afp ) values were used to establish the r - hcc diagnosis ; diagnostic imaging studies included ultrasound ( us ) , computed tomography ( ct ) , and angiography . ct of the chest , abdomen , and pelvis was performed in each patient before tace treatment to detect extrahepatic disease . tumors exceeded the milan criteria in the explanted liver in 153 of the 252 patients ( 60.7% ) diagnosed with hcc before ldlt and in 29 of the 42 patients ( 69.0% ) with recurrent hcc ( 12 ) . tumors in the explanted liver of 19 of the 28 study patients ( 67.9% ) also exceeded the milan criteria . the median time from liver transplantation to detection of r - hcc was 15 months ( range , 2 - 57 months ) . tace was performed within one year , between one and three years , between two and three years , or more than three years after ldlt in 16 ( 57.1% ) , seven ( 25.0% ) , four ( 14.3% ) , or one ( 3.6% ) patient , respectively . nine of 26 patients with intrahepatic recurrence had solitary nodular r - hcc ( fig . 1 ) , while the remaining 17 patients had multiple r - hcc ( fig . 2 ) . eighteen study patients ( 64.3% ) were initially diagnosed with r - hcc extrahepatic metastasis , of which lung metastasis was the most common followed by bone and peritoneal metastases ( table 2 ) . afp values were greater than 400 ng / ml in 18 of 28 patients ( 64.3% ) . the tumor size and number , the feeding arteries , and the degree of portal venous thrombosis were evaluated by celiac and superior mesenteric angiography . tace was performed after a 3 fr microcatheter ( microferret , cook inc , bloomington , in ) was advanced into the feeding artery . in the first procedure , cisplatin ( cisplan , dong - a , seosan , korea ) was infused into the hepatic artery for 15 minutes without embolic particle administration . a mixture of iodized oil ( lipiodol , laboratoire guerbet , cedex , france ) and cisplatin was then injected into the feeding arteries followed by embolization with gelatin sponge ( spongostan , pharmacia and upjohn , kalamazoo , mi ) ; the infused dose of cisplatin was 2 mg / kg of the patient 's weight . the injected dose of iodized oil depended on the tumor size , ranging from 1 to 10 ml ( mean : 4.6 ml ) , and the gelatin sponge consisted of cubes measuring 1 - 2 mm . transcatheter arterial chemoembolization was performed in a lobar artery or a segmental artery in 26 patients with intrahepatic recurrence . tace was performed in the left gastric artery and in the right inferior phrenic and right intercostal arteries in two patients with extrahepatic recurrence . one of these two patients had an extrahepatic r - hcc attached to the posterior portion of the transplanted liver that was supplied by right inferior phrenic and right intercostal arteries ( fig . 3 ) . the other patient had r - hcc in the posterior portion of the left lateral segment of the transplanted liver that was supplied by left gastric artery . the included patients underwent 1 - 5 cycles of tace ( mean , 2.5 cycles per patient ) during the follow - up period . tumor response was evaluated based on ct studies performed 1 - 3 months after tace and was classified into five grades as follows : complete response ( cr ) , total disappearance of the tumor ( figs . 1 , 3 ) ; partial response ( pr ) , reduction of 50% or more in maximum tumor size on ct images ; minimal response ( mr ) , reduction of 25 - 50% ; stable disease ( sd ) , change of < 25% in tumor size ; and progressive disease ( pd ) , increase of 25% or more in tumor size ( fig . tumor size was measured by electronic calipers as the maximum perpendicular diameters of each tumor ( a , b ) . the following formula was used to calculate the change in total tumor size : percentage change in tumor size = 100 * (a*b - a'*b')/(a*b ) where a*b represents the product of the longest perpendicular diameters of each tumor before treatment , and a'*b ' is the product of the tumor diameters after treatment . changes in afp values one month after tace were also evaluated in patients with abnormal afp values at the time of tace . iodized oil accumulated in the main tumor in all patients , but complete response corresponding to total disappearance of the tumor was only observed in three patients on follow - up ct ( figs . 1 , 3 ) . although complete or partial response of the targeted lesions to tace was observed in 14 of 28 patients ( 50.0% ) , 21 of these 28 patients ( 75.0% ) had another r - hcc during the 3-month follow - up period , and 26 of the 28 patients ( 92.9% ) manifested another r - hcc in an intrahepatic or extrahepatic location during the 6-month follow - up period . six of 28 patients experienced progressive disease ( increased tumor size ) despite tace treatment . two of three patients still living at the time of writing have been in complete remission for 22 and eight months , respectively , since the initial tace therapy ( figs . 1 , 3 ) . the afp levels of eight of 18 patients with abnormal baseline afp levels ( > 400 ng / ml ) had decreased one month after tace . ten of the 18 patients with elevated afp levels had another intrahepatic recurrence or progressive extrahepatic recurrence . overall , the tace procedure was well tolerated by all patients , and no major complications developed during follow - up period . five patients ( 17.9% ) experienced some immediate side effects after tace , including transient nausea , vomiting , diarrhea , hypertension , tachycardia , and right upper quadrant pain , but these effects resolved within a few days of the procedure . survival was measured from the date of ldlt , r - hcc diagnosis after ldlt , or tace treatment until death or until december 2005 . at the time of this writing , the causes of deaths were pneumonia and sepsis ( n = 18 ) , hepatic failure ( n = 5 ) , and organ failure due to extensive metastasis ( n = 2 ) . the actual 1- , 3- , and 5-year survival rates after ldlt were 71.4% , 31.5% , and 6.0% , respectively ( fig . the estimated median survival after ldlt in the included patients was 28 months ( 95% ci , 12.4 - 43.5 months ) . the actual 1- , 3- , and 5-year survival rates after tace for r - hcc were 47.9% , 6.0% , and 0% , respectively ( fig . iodized oil accumulated in the main tumor in all patients , but complete response corresponding to total disappearance of the tumor was only observed in three patients on follow - up ct ( figs . 1 , 3 ) . although complete or partial response of the targeted lesions to tace was observed in 14 of 28 patients ( 50.0% ) , 21 of these 28 patients ( 75.0% ) had another r - hcc during the 3-month follow - up period , and 26 of the 28 patients ( 92.9% ) manifested another r - hcc in an intrahepatic or extrahepatic location during the 6-month follow - up period . six of 28 patients experienced progressive disease ( increased tumor size ) despite tace treatment . two of three patients still living at the time of writing have been in complete remission for 22 and eight months , respectively , since the initial tace therapy ( figs . 1 , 3 ) . the afp levels of eight of 18 patients with abnormal baseline afp levels ( > 400 ng / ml ) had decreased one month after tace . ten of the 18 patients with elevated afp levels had another intrahepatic recurrence or progressive extrahepatic recurrence . overall , the tace procedure was well tolerated by all patients , and no major complications developed during follow - up period . five patients ( 17.9% ) experienced some immediate side effects after tace , including transient nausea , vomiting , diarrhea , hypertension , tachycardia , and right upper quadrant pain , but these effects resolved within a few days of the procedure . survival was measured from the date of ldlt , r - hcc diagnosis after ldlt , or tace treatment until death or until december 2005 . at the time of this writing , the causes of deaths were pneumonia and sepsis ( n = 18 ) , hepatic failure ( n = 5 ) , and organ failure due to extensive metastasis ( n = 2 ) . the actual 1- , 3- , and 5-year survival rates after ldlt were 71.4% , 31.5% , and 6.0% , respectively ( fig . the estimated median survival after ldlt in the included patients was 28 months ( 95% ci , 12.4 - 43.5 months ) . the actual 1- , 3- , and 5-year survival rates after tace for r - hcc were 47.9% , 6.0% , and 0% , respectively ( fig . systemic chemotherapy , surgical resection and nonsurgical treatments , such as tace and ablation , are performed to treat r - hcc after ldlt ( 10 ) . few previous studies have evaluated the tumor responses to various treatment modalities in r - hcc after liver transplantation . in particular , to our knowledge , there were no reports regarding tace treatment of r - hcc after ldlt . however , the targeted lesion tumor response in the present study was the same or more favorable compared with other studies on hcc before transplantation . in many previous studies , tace achieved a partial response or better in 15%-55% of patients with hcc before transplantation ( 14 - 17 ) . studied 72 patients with biopsy - proven , unresectable hcc and focused on 186 individual tumor masses . the patients were classified as responders or non - responders based on ct evidence of altered tumor size and tumor necrosis . in the present study , 28 patients with r - hcc underwent tace . a favorable tumor response in the targeted lesion ( partial response or better ) was observed in 50% of patients after tace . nevertheless , favorable tumor response in the targeted lesion did not reflect favorable survival , and the survival rate in the present study was similar to other reports . recurrence of hcc after liver transplantation clearly has a major impact on outcome . the five - year survival was reported to be significantly lower for patients with recurrence ( 22% ) than for patients without recurrence ( 64% ) ( p < 0.0001 ) ( 18 ) ; the median survival was around nine months after the diagnosis of recurrence . shorter time to recurrence and the presence of bone metastases were the main factors significantly associated with poorer prognosis once recurrence manifested ( 18 ) . in another series , however , 18 of 57 patients with r - hcc underwent potentially curative treatments such as surgical resection or radiofrequency ablation . the five - year post - transplant survival among these patients was 47% ( 10 ) . this is consistent with the 57% survival at four years reported elsewhere for similar patients ( 9 ) . however , it is impossible to determine from these studies whether surgical treatment of recurrence prolongs survival or whether patients who are amenable to surgical treatment are a more favorable group . in the present study , the mean survival periods were 28 months overall and nine months after diagnosis of r - hcc . and the actual 1- , 3- , and 5-year survival rates after ldlt were 71.4% , 31.5% , and 6.0% , respectively , in this study . these mean survival values were similar to or lower than those of the studies mentioned previously . we believe that this resulted from the inclusion of patients with advanced and unresectable r - hcc at the time of r - hcc diagnosis , as mentioned above . the small benefit to survival afforded by tace , in spite of favorable tumor response to targeted r - hcc , may be caused by the aggressiveness of the tumor , which is indicated by the high rate of extrahepatic recurrence and rapid tumor recurrence in the remaining liver after initial tace treatment . early reports suggested that the course of recurrent hcc after transplant is more aggressive than that of recurrence after hepatic resection , presumably due to immune suppression ( 19 ) . nevertheless , the drugs used to prevent transplant rejection have a variety of effects that go beyond immune suppression ( 10 ) . in this study , extrahepatic metastasis were observed in 18 of 28 ( 64.3% ) included patients . in another study , 48 of 57 patients ( 84.2% ) with r - hcc after liver transplantation had extrahepatic metastases ( 18 ) . these patterns of metastases in patients with r - hcc after liver transplantation differ from those in patients with primary hcc without liver transplantation . in one study , for example 65 patients ( 13.5% ) had extrahepatic metastases among 482 patients who were diagnosed with hcc ( 14 ) . there is no standard treatment for extrahepatic metastases , and few previous reports exist regarding its treatment ( 21 ) . in the study by chung et al . , 68 hcc patients with major portal vein thrombosis ( n = 47 ) or distant metastasis ( n = 27 ) were randomly allocated to groups with or without intra - arterial cisplatin infusion . the group receiving intra - arterial cisplatin infusion had a significantly higher 1-year survival rate than the other group ( 22 ) . we also performed intra - arterial cisplatin infusion before embolization with iodized oil and gelatin sponge to treat intrahepatic r - hcc as well as extrahepatic metastasis . most of the included patients had extrahepatic recurrence as well as intrahepatic recurrence , and systemic chemotherapy was not controlled . a controlled study is needed for further evaluation of tace with regard to its effect on the survival of patients with r - hcc after ldlt . in conclusion , tace appears to produce an effective tumor response in targeted r - hcc after ldlt . however , survival of patients with r - hcc after ldlt is poor due to extrahepatic metastasis and additional intrahepatic recurrence .

objectiveto evaluate the tumor response and patient survival rate following transcatheter arterial chemoembolization ( tace ) in recurrent hepatocellular carcinoma ( r - hcc ) after living donor liver transplantation ( ldlt).materials and methodstwenty - eight patients with r - hcc underwent one or more cycles of tace after ldlt ( mean , 2.5 cycles ) . after a mixture of iodized oil and anti - cancer drugs was injected via the arteries feeding the tumors , these vessels were embolized with a gelatin sponge . tumor response was determined by follow - up ct imaging on all patients four weeks after each tace procedure . patient survival was calculated using the kaplan - meier survival curve.resultsafter tace , targeted tumor reduced in size by 25% or more in 19 of the 28 study patients ( 67.9% ) . however , intrahepatic recurrence or extrahepatic metastasis occurred in 21 of the 28 patients ( 75.0% ) during the 3-month follow - up period and in 26 of the 28 patients ( 92.9% ) during the 6-month period following tace . extrahepatic metastasis was noted in 18 of the 28 patients ( 64.3% ) . the 1- , 3- and 5-year survival rates following tace were 47.9 , 6.0 and 0% , respectively , with a mean survival of nine months in all patients . there were no significant complications related to tace.conclusiontace produces an effective tumor response for targeted r - hcc after ldlt . however , the survival rate of patients with r - hcc after ldlt is poor due to extrahepatic metastasis and intrahepatic recurrence .

barrett s esophagus ( be ) is an acquired condition in which a metaplastic columnar lining with intestinal differentiation replaces the stratified squamous epithelium in the distal esophagus . the metaplastic epithelium comprises three different cell types : atrophic gastric - fundic - type epithelium containing parietal and chief cells ; a transitional - type epithelium with cardiac mucous - secreting glands ; and specialized columnar epithelium with intestinal - type goblet cells.1 while american gastroenterological societies consider the specialized epithelium with goblet cells a requirement for the diagnosis of be,2 british guidelines consider the possibility of including be with gastric metaplasia only.3 the true prevalence of be is still unclear . in recent years italian and swedish researchers were able to show a prevalence of 1.3% and 1.6% , respectively , although in both studies a selection bias may have led to an overestimate.4,5 be generally develops in the context of chronic gastroesophageal reflux disease ( gerd ) and it is about 10 times more frequent in individuals who complain of reflux symptoms.57 be is the only known precursor to esophageal adenocarcinoma ( eac ) , with an annual conversion rate of approximately 0.3%.810 in recent u.k . statistics , the esophagus was rated as the 7th most common cancer site among males and 14th among females . however esophageal malignancy was the fourth most common cause of cancer - related death in men and sixth in women in this geographical area . although these data related to both of the most common histologic types , adenocarcinoma and squamous cell carcinoma ( scc ) , it is known that the overall prognosis of these two types of cancer is similar.11 the discrepancy between incidence and mortality rates stems from the fact that esophageal cancer is aggressive in nature and relatively asymptomatic at early stages leading to a low overall 5-year survival rate ( < 15%).12,13 there is a large geographical variation in the incidence of esophageal cancer ( fig . notably , the incidence of esophageal adenocarcinoma has been worryingly increasing over the last 3 to 4 decades in the western world ( fig . 1b),15,16 where it has become the most common esophageal malignancy.17,18 in keeping with this , gerd is also increasing in incidence in the western population19,20 and has been found to be the most common gatrointestinal ( gi ) diagnosis in an outpatient setting in the united states.21 this epidemiological picture has led to the question of whether screening programs for be are justified.22 since the gold standard for a diagnosis of be is endoscopy with biopsies , this screening method would be too costly and invasive to be applied to the general population . all of the most recently published guidelines do not recommend screening of the unselected population , but do suggest to target the population at higher risk of be.2,3 here we review the current knowledge on clinical and molecular factors associated to the risk of be and eac and analyse how an improved understanding of this condition can influence clinical algorithms for the management of this disease . there are numerous risk factors for be and they are generally shared with eac . gastroesophageal acid reflux is considered the most important factor . in a population - based case - control study , gastroesophageal reflux was associated with be and eac , with an odd ratio ( or ) of 12.0 ( 95% confidence interval [ ci ] , 7.64 to 18.7 ) and 3.48 ( 95% ci , 2.25 to 5.41 ) , respectively.23 a recent meta - analysis showed that gerd symptoms increased the odds of long segment be by fivefold.24 the prevalence of be in patients with gerd varies between 3% and 15% depending on the study.6,7,22,23 this large range mostly relates to the stringency of criteria used for the selection of patients with reflux disease . obesity is the second strongest risk factor for the development of be and eac.23,25 obesity and gerd have synergistic effects according to a population - based case - control study , which demonstrated that obese individuals with symptoms of acid reflux had markedly higher risks of be ( or , 34.4 ; 95% ci , 6.3 to 188 ) than people with reflux alone ( or , 9.3 ; 95% ci , 1.4 to 62.2 ) or obesity alone ( or , 0.7 ; 95% ci , 0.2 to 2.4).26 the distribution of fat also has a role in determining the risk in that large amount of visceral abdominal fat relative to subcutaneous fat is associated with a significant increase in the risk of be.27,28 smokers and ex - smokers are also at increased risk of eac.23 a meta - analysis demonstrated a strong association between cigarette smoking and eac with a dose - response relation to disease outcome . in addition longer smoking cessation was associated with a decreased risk of adenocarcinoma.29 however , the association of smoking with be remains controversial according to different studies.30,31 other risk factors include male sex , white race , low vegetables intake and high red meat consumption , whereas data have showed an inverse correlation with helicobacter pylori infection.8,16,3235 be has also been shown to occur in familial clusters . studies in different populations of patients with be and eac confirmed that about 7% of cases are familial.36,37 juhasz and collaborators38 studied 47 first degree relatives of patients with eac and be - related high - grade dysplasia from 23 families and confirmed be in 13 relatives ( 27.7% ) . a genetic background to this disease is supported by recent genome - wide association studies ( gwas ) . a first gwas report demonstrated that variants at two loci were associated with disease risk ; chromosome 6p21 ( or , 1.21 ; 95% ci , 1.13 to 1.28 ) , within the major histocompatibility complex locus , and chromosome 16q24 ( or , 1.14 ; 95% ci , 1.10 to 1.19 ) , in close proximity to foxf1 gene , which is implicated in esophageal development and structure.39 in a second gwas study levine and coworkers40 compared eac cases ( n=2,390 ) and individuals with be ( n=3,175 ) with 10,120 controls . three new association loci were identified ; 19p13 within crtc1 , whose activation has been associated with oncogenic activity , 9q22 within barx1 , which encodes a transcription factor involved in esophageal specification and 3p14 near the transcription factor foxp1 , which regulates esophageal development . recent evidence in mice - models showed that be may originate from progenitor cells present within the gastric cardia in close proximity with the gastroesophageal junction . two models have been proposed to recapitulate the origin of be . in p63-deficient mice , it was shown that the normal squamous re - epithelisation of the esophagus during embryogenesis is impaired and this gives rise to upward migration of embryonic columnar remnant cells located at the level of the squa - mocolumnar junction ( scj ) , generating a columnar epithelium reminiscent of be.41 in a different study , quante and coworkers42 were able to show that mice overexpressing interleukin-1 have an inflammatory response at the scj , which leads to a columnar lined esophagus that is molecularly similar to be . in these mice , increased esophageal exposure to bile and acid triggered a sustained inflammatory response that reinforces barrett s like carcinogenesis in a notch - dependent fashion . overall , these mouse models provide support to the theory that be may originates from progenitor cells located at the scj and would explain why be is generally in anatomical continuity with the cardia epithelium . however , the different anatomy of the murine esophagus warrant further studies to translate these models into the human pathology . an alternative theory is that be may originate through a process of transdifferentiation of squamous cells or reprogramming of esophageal stem cell towards a different phenotype . is the evidence that genes normally involved in differentiation and gut axial specification are modulated in be . increased expression of the caudal - related gene cdx2 and cdx1 , which are normally highly expressed in colon , has been shown in be and related to the acquisition of the intestinal phenotype.43 this gene regulation has recently been linked to change in the methylation status of the promoter44 and associated to the acid / bile induced inflammation through the activation of nuclear factor b , a crucial transcription factor in the inflammatory response.45 in addition , acquired deregulation of hox genes during adulthood has been linked to carcinogenesis . we have recently showed that three hoxb genes ( hoxb5 , hoxb6 , and hoxb7 ) are activated in be through an epigenetic mechanism involving histone posttranslational modifications . alterations to the hox gene expression in esophageal cells was associated with the induction of genes linked to an intestinal - phenotype.46 the cell target of the epigenetic reprogramming of differentiation genes remain to be established , especially after the recent evidence of lack of bona fide stem cells in the human esophagus.47 chronic reflux of acid and bile into the esophagus normally results in an acute and chronic inflammatory process . in vivo and ex vivo exposure of esophageal cells to acid and bile salts can induce the production of reactive oxygen species and nitric oxide,48,49 which are related to oxidative dna damage and double - strand breaks.50,51 these events have been linked in general to carcinogenesis and more recently to the metaplasia , dysplasia to cancer sequence in be.50 in addition , oxidative dna damage in be causes telomerase activation and telomere instability , which are known to result in mutation of cancer - related genes and promotion of cancer.52 inflammation is also related to recruitment of immune cells . naive t cells , macrophages and dendritic cells are enriched in both nondysplastic and dysplastic be , as well as in eac.5355 these cells could contribute to tumorigenesis through production of cytokines , chemokines and growth factors , which are released as part of the inflammatory response and can promote proliferation and angiogenesis.56 exposure to acid and bile salts has also been related to deregulation of micrornas ( mirna),57,58 a class of short noncoding rna involved in a variety of cellular processes . in particular mirna-145 was linked to the activation of bmp4 pathway,59 which has been previously implicated in the development of be through the activation of the hedgehog pathway.60 be and eac present a distinct mirna expression profile,61,62 which could be potentially useful for diagnostic purposes due to the fact that mirnas are stable and detectable in blood.63 another class of noncoding rna , long noncoding rna ( ln - crna ) , which have diverse cellular properties including gene regulation and control of cell growth and migration,64 has recently also been implicated in barrett s carcinogenesis . wu and collaborators65 showed that the lncrna afap1-as1 is hypo - methylated and overexpressed in be and eac and its silencing in vitro inhibited invasion and promoted apoptosis . until recently the only clinical factor with practical implications in the management of be was the histological diagnosis of dysplasia . the two largest population studies in the northern irish and danish cohorts confirmed that the cancer risk in patients with low grade dysplasia ( lgd ) is approximately 5 times higher than nondysplastic patients.8,10 it is standard practice to monitor patient with lgd at closer intervals . unfortunately a histopathological diagnosis of dysplasia is often associated to a high degree of interobserver variability even among expert gi pathologists , hence doubts have been shed on the exact clinical usefulness of this marker for patient stratification.66,67 there are additional clinical factors that have been shown to influence the risk of progression of be to cancer . these clinical elements have the potential to inform the physician about the surveillance and management of patients with be . several studies have shown that increasing be length is associated with higher risk of progression to high grade dysplasia ( hgd ) and malignancy.8,9,6870 the most common cutoff used in the literature for the definition of long segment of be is 3 cm or more ; however there is high variability in the literature in the cutoffs used . the 2013 british society of gastroenterology ( bsg ) guidelines for the management of be recommend to tailor surveillance interval on basis of the length of the be.3 the large northern irish population study has also found that the presence of intestinal metaplasia ( i m ) was associated with a hazard ratio for progression to cancer of 3.54 ( 95% ci , 2.09 to 6.00).8 however , the issue of whether i m confers increased cancer risk conceptually applies only to countries , such as united kingdom , where i m is not required for a diagnosis of be.2,3 visible endoscopic lesions including ulcers are also associated with a high risk of hgd and early cancer and warrant close monitoring,71 but it must be recognized that the absence of dysplasia in the presence of visible lesions is often due to sampling error . overall , it is clear that there is a paucity of clinical factors which can inform the physician about individual cancer risk and those that are currently used are affected by a significant degree of subjectivity either in the diagnosis , i.e. , dysplasia , or in the definition , i.e. , length . hence there is the need for more objective risk stratification tools to inform patient management . molecular biomarkers have been investigated over the last 20 years in the field of be with the aim of providing the physician with predictors of disease behaviour and hence aiding clinical management . the advantage of biomarkers over the current standard , i.e. , dysplasia , relies on the possibility to provide an objective measure of the molecular changes in tissue , which are known to correlate with progression of disease . in addition , since molecular abnormalities can extend within the be over larger epithelial surface than cellular dysplasia , they could be less subject to sampling error.72 gain or more rarely loss of individual chromosomes ( aneuploidy ) or duplication of the entire genome ( tetraploidy ) are common events in eac and can precede the development of cancer or even dysplasia ( fig . 2a).73 gross abnormalities in the dna content are tumorigenic since these can lead to altered expression of cancer - related genes . in particular loss of heterozygosity at tumor suppressor genes , such as p16 and p53 , have been linked to acquisition of dysplasia in be.74,75 reid and collaborators76 have contributed significantly to the understanding of the timing and distribution of these molecular changes and have conducted large retrospective studies on prospectively collected samples to evaluate the usefulness of these biomarkers as cancer predictors . for example they have showed that among patients with nondysplastic be or at most lgd , those without aneuploidy had a 0% 5-year cumulative cancer incidence compared with 28% for those with aneuploidy . in another study , the prevalence of 17p ( p53 ) loss of heterozygosity ( loh ) at baseline increased from 6% in nondysplastic patients to 57% in patients with hgd . using baseline 17p ( p53 ) loh as a predictor of progression in 325 patients with be , those with this marker had increased risk of hgd and cancer with a relative risk ( rr ) of 3.6 ( 95% ci , 1.3 to 10 ) and 16 ( 95% ci , 6.2 to 39 ) , respectively.77 in a follow - up study three biomarkers ( abnormal dna content , p53 loh , and p16 loh ) were evaluated as a panel in a cohort of 243 patients , and a step - wise increase in the cancer progression risk was found with increasing number of positive biomarkers . this showed a rr for cancer of 38.7 ( 95% ci , 10.8 to 138.5 ) at 10 years of follow up when all three biomarkers were positive.78 the main limitation of these studies was that assessment of aneuploidy was performed with a complex methodology involving flow - cytometric analysis on snap - frozen biopsies . however , it is now possible to assess aneuploidy with alternative techniques , which are potentially more applicable to clinical setting . one of them is image cytometry ( ic ) , which can be performed on thick sections from paraffin - embedded specimens . ic was showed to be comparable to flow - cytometry for the assessment of aneuploidy in be tissue.79 a retrospective case - control study confirmed that a panel consisting of lgd and two molecular biomarkers ( aneuploidy by ic and immunohistochemistry [ ihc ] for aspergillus oryzae lectin ) effectively separated progressors from nonprogressors.80 each individual positive marker was associated with an or of 3.74 ( 95% ci , 2.43 to 5.79 ) for progression to hgd / eac . an alternative method for assessment of aneuploidy is fluorescent in situ hybridization ( fish ) , which employs fluorescent probes to target specific dna sequences . fish has been studied in be in combination with cytological brushings , which has the advantage over biopsies to sample larger epithelial areas . in particular it was found that fish for chromosome 7 and 17 was more accurate that ic for detection of aneuploidy on cytological preparations and could detect hgd / eac with a sensitivity and a specificity of 85% and 84% , respectively.81 the same group used fish to detect copy changes of cancer - related genes , such as c - myc , egfr , and 20q13 locus , which were found to be amplified in up to 14% and 50% of cases with hgd and eac , respectively.82 similarly , a different group of authors found that fish for four cancer - related loci ( c - myc , her2 , 20q13 , and p16 ) on brushing samples had better accuracy than conventional cytology or ic on brushings for the diagnosis of dysplasia.83 a case - control study with fish markers is currently being undertaken to predict disease progression in a dutch cohort of patients with be . mutation in the tumor suppressor gene p53 is the most recurrent genetic hit in eac.84 p53 function is associated with g1 arrest during cell cycle and apoptosis ; as a result , mutation of the p53 gene will adversely affect control of cell proliferation and impair activation of apoptosis , promoting carcinogenesis.52,85 mutation of p53 leads to either stabilization of an inactive product or complete absence of the protein . both events can be efficiently detected by ihc , which is a cost - effective test applicable to clinical setting ( fig . 2b).86 a case - control study by murray and coworkers87 found that abnormal p53 protein expression was associated with progression to eac at follow - up , with an or of 11.7 ( 95% ci , 1.93 to 71.7 ) . it was proposed that p53 expression can be used as biomarker of malignant expression in be , however due to the low sensitivity it was also suggested that additional biomarkers would have needed as adjunct . these results have been confirmed in a more recent and larger case controlled study on 720 patients with be , where p53 protein expression was associated with an increased risk of neoplastic progression ( rr , 5.6 ; 95% ci , 3.1 to 10.3 ) and proved to be a more powerful predictor of neoplastic progression than histological diagnosis of lgd.88 p53 ihc has also been shown to be a useful adjunct to the histopathological diagnosis of dysplasia , assisting the pathologist in interpreting less straightforward pathological patterns.89 in keeping with this , the 2013 bsg guidelines recommend the use of p53 ihc as adjunct to conventional histopathology.3 promoter hypermethylation can lead to silencing of gene expression and cancer and has been shown to be associated with widespread epigenetic changes involving global dna hypomethylation and targeted hypermethylation of tumor suppressor genes.90 kaz and collaborators91 used a microarray - based approach on 96 esophageal samples to determine the methylation profiles of normal esophagus , nondysplastic be , be with hgd and eac , and they found increasing methylation levels at gene promoters along the pathological progression . hence , similarly to p53 , methylation markers could represent a useful adjunct to histopathology . in a different study , a four - gene ( slc22a18 , pigr , gja12 , and rin2 ) methylation panel was found to stratify patients with different stages of be into three risk groups based on the number of genes methylated , with potential clinical utility ( low risk : < 2 genes , intermediate : 2 , and high : > 2).92 hypermethylation of p16 and apc was also found to associate with dysplasia at a biopsy level and correlate with cancer risk at a patient level , with an or for combined hgd / eac of 14.97 ( 95% ci , 1.7-inf ) when both genes were methylated.93 in a different study methylation of 10 genes ( hpp1 , runx3 , riz1 , crbp1 , 3-ost-2 , apc , timp3 , p16 , mgmt , p14 ) were analysed in a large cohort of eac cases ( n=77 ) , be ( n=93 ) , and normal esophageal specimens ( n=64 ) . three of them , p16 , runx3 , and hpp1 , showed the most significant hypermethylation levels in cancer and in a case control cohort were associated with the risk of histological progression of be to cancer at 2-year follow - up with an or of 1.74 ( 95% ci , 1.33 to 2.2 ) , 1.8 ( 95% ci , 1.08 to 2.81 ) , and 1.77 ( 95% ci , 1.06 to 2.81 ) , respectively.94 cyclin a is a protein that is involved in the regulation of progression through the cell cycle . in normal columnar gastrointestinal tissue , including nondysplastic be , the expression of cyclin a is confined to the base of the crypts . with increasing grades of dysplasia , the expression of cyclin a moves towards the upper third of the crypts and the surface epithelium ( fig . 2c ) . in a study including 16 cases of be that progressed to cancer and twice as many nonprogressor controls , surface expression of cyclin a correlated with the risk of progression with an or for cancer of 7.5 ( 95% ci , 1.8 to 30.7).95 despite the large number of molecular biomarkers studied , there is generally a lack of large prospective studies that have validated these and this has made introduction into clinical practice problematic . the biomarker with the largest data available is p53 ihc , which , due to the ample validation in independent cohorts and simplicity of the methodology , is likely closer than other biomarkers to clinical application . aneuploidy is also very promising , but validation with the use of cost - effective techniques is needed to make it compatible with a clinical setting . this review will focus on those published in the last 3 years , as these have taken into account the most recent data on epidemiological aspects of be.2,3,96 recent data have not provided strong evidence to support screening programs . the american society of gastrointestinal endoscopy ( asge ) guidelines concluded that endoscopic screening for be is controversial due to lack of randomized controlled trials ( rct ) , hence it can not be recommended.96 on the other hand , the american gastroenterology association ( aga ) states that the practice of screening in the united states remains widespread among physicians . the current aga guidelines suggest that patients with multiple risk factors associated with be and eac should be screened . risk factors were defined as age 50 years or older , male sex , white race , chronic gerd , hiatus hernia , elevated body mass index , and intra - abdominal distribution of body fat , but the threshold of risk factors that should trigger intervention remained undefined.2 this recommendation is in agreement with that issued by the bsg , which however is more practical with concern to the definition of the population at risk when considering multiple risk factors . these guidelines state that endoscopic screening should be taken into account in a selected population with gastroesophageal reflux symptoms and multiple risk factors ( at least three of age 50 years or older , white race , male sex , obesity).3 it is also advised that for individuals with a positive family history of be and eac the threshold for screening should be lowered . the aga working group decided that screening should not be directed only to individuals with reflux , as this is extremely common in the general population,21 yet approximately 40% of patients with eac do not report a symptomatic history of gastroesophageal reflux.97 on the other hand , gerd is the strongest risk factor for be and eac , and included as generic risk factor among other may result in justifying screening in a large population of individual ( e.g. , every white male over 50 years of age ) , with significant burden on the health care system . clearly there is a need to tailor recommendations for screening interventions in order to target the largest proportion of patients with prevalent disease , without exposing an unjustified number of individuals to procedures which may generate psychological morbidity , reduce the quality of life and increase insurance premiums in places where health provision is mainly insurance based . in addition , screening performed with conventional endoscopy and tissue biopsies is expensive and would have significant bearing on the health care budget . hence there is a need for less invasive and cost - effective devices for be screening , ideally applicable to primary care . non - endoscopic cell collection devices like the cytosponge , office - based transnasal esophagoscopy and tethered or untethered capsule endoscopy are the most promising tools but more studies are required to make conclusions regarding their diagnostic accuracy and feasibility on a larger scale.22 surveillance in be is also a controversial issue . while it is generally accepted that patients with be should be monitored over time , definitive evidence that systematic endoscopic surveillance improves survival is still lacking . several retrospective studies have showed that eac and junctional adenocarcinomas diagnosed within a previous background of known be have an earlier stage and improved survival compared to cancers presenting de novo.98100 however these studies are limited by lead time bias . by contrast , a more recent case - control study from corley and collaborators101 has suggested that previous endoscopic surveillance has no significant impact on mortality from eac . the authors , however , found an unusually high prevalence of advanced stage cancers in patients undergoing surveillance , suggesting that in this cohort of patients endoscopic surveillance did not efficiently achieve the expected goal of detecting early disease . also in this study , there was a higher proportion of dysplasia in previous biopsies of cases that died of eac compared to controls that did not die of this disease . hence , there may be methodological problems with surveillance protocols in routine practice outside of specialist centers . nevertheless the practice of surveillance is generally accepted and recommended by all gastroenterology societies ; the aga working group indeed commented on the fact that it remains unclear whether endoscopic surveillance is beneficial , hence it was not possible to make meaningful recommendations regarding the optimal intervals between endoscopic procedures.102 the surveillance programs recommended by the bsg , the asge , and the aga are summarized in table 1 . overall , while we wait for convincing evidence that endoscopic surveillance is beneficial , in view of the well - established association between be and eac and the very poor outcomes from this cancer , it seems clinically sensible to survey be patients over time . a multicenter u.k . based rct ( boss trial ) is currently being undertaken to address the long - term clinical impact of endoscopic surveillance.103 in this study , patients with be without dysplasia are being randomized into surveillance versus no surveillance ( with ogd on demand if needed ) . one of the main implications of widespread surveillance is that the current gold standard is endoscopy with biopsies , which is invasive and expensive . as discussed above , one is the development of biomarkers to risk stratify patients into low and high risk individuals . the rationale is to provide a more objective assessment of the individual cancer risk to overcome the shortfalls of a pathological assessment of dysplasia . this would allow stretching out intervals for surveillance in low risk patients with the potential to discharge them and on the other hand anticipate ablation treatment in high risk patients . the second research goal is to devise a less invasive and more cost - effective technologies for surveillance . differently from screening devices , those applicable to surveillance setting would need some form of tissue collection either for pathological analysis or biomarker assessment . currently little progress has been made with regards to chemoprevention , and this remains a key area for investigation . there are retrospective data that suggest that proton pump inhibitors ( ppi ) correlate with decreased risk of hgd and eac,104 but definitive proof is lacking due to difficulties in designing rcts with a placebo arm . the only drug that has made its way to an rct is aspirin ( aspect study ) . aspirin inhibits cyclo - oxygenase 1 and 2 ( cox-1 and cox-2 ) , regulator enzymes of prostaglandin e2 production , which has been shown to be involved in angiogenesis and invasiveness in eac and other gi malignancy.105107 the results of the aspect study are awaited to conclude whether aspirin in combination to ppi can be part of the management algorithm of patients with be . since this trial is also randomizing patients between two different doses of esomeprazole , some information on the chemopreventive effect of ppi will transpire . there has been a great deal of research over the last years in an attempt to develop novel endoscopic techniques to enhance detection of inconspicuous dysplasia ( table 2 ) . this would have the potential advantage to enable biopsies to be targeted towards areas containing histological dysplasia and eliminate the need of multiple random sampling . the benefit would be twofold : 1 ) better cost - effectiveness due to shorter endoscopies and reduced work - load for the pathologist ; and 2 ) improved patient tolerance . three main fields have been explored so far ; i.e. , dye chromoendoscopy , light filtering , and electronic image reprocessing . chromoendoscopy is a technique by which a chemical agent is sprayed on the barrett s mucosa in an attempt to enhance the detection of dysplasia . several different agents have been studied including methylene blue ( mb ) , lugol s solution , indigo carmine ( ic ) , and acetic acid ( aa ) . mb is a vital agent that is avidly incorporated by cells with intestinal differentiation and has been the first dye investigated in the field of be . there are conflicting results on the utility of mb in dysplasia detection . a recent meta - analysis by ngamruengphong et al . concluded that mb does not provide a clinical advantage compared to the seattle protocol ( random quadrantic biopsies every 2 cm).108 ic is a contrast agent which helps highlight areas of subtle mucosal irregularity which are otherwise very difficult to identify on conventional white light endoscopy . ic has been studied by kara and collaborators109 in a small randomized crossover study , which compared high resolution endoscopy ( hre ) , ic chromoendoscopy and narrow band imaging ( nbi ) . in this study , hre had equal yield of dysplasia compared to advanced imaging techniques . aa at the concentration of 2% to 3% is an inexpensive and safe imaging adjunct that when in contact with surface epithelium causes protein denaturation and induces a typical whitening effect on be mucosa . increased vascularisation of areas of early neoplasia results in enhanced and rapid loss of aceto - whitening , which appears as area of redness on a white background . despite two early randomized studies which failed to show increased detection rate of dysplasia by aa chromoendoscopy,110,111 a more recent large single - center retrospective study has found a higher histological yield in patients which received aa enhanced chromoendoscopy.112 more studies are needed to ascertain whether aa is a useful adjunct for dysplasia detection . nbi is based on optical filters controlled by a button switch , which allows one to isolate narrow wave - lengths corresponding to the green and blue spectra of light . in the blue - green range light has reduced penetration into tissues and therefore this helps visualization of superficial vessels and mucosal pits.113 nbi can be less time consuming and easier to perform in comparison to white light endoscopy , but it is still subject to interobserver variability . in a prospective study with a tandem design , wolfsen and collaborators114 found that nbi was superior to standard - resolution white light endoscopy with random biopsies for the detection of higher grades of dysplasia . a more recent multicenter randomized crossover study which compared nbi with high - resolution white light endoscopy only found a higher histological yield on the per - location analysis but not in the per - patient analysis , suggesting that the clinical overall value of nbi may be limited.115 nbi however required fewer biopsies per patient compared with the standard approach , which may lead to cost savings . a meta - analysis by mannath et al.116 included 446 patients with 2,194 lesions and they reported that nbi with magnification shows high diagnostic precision in detecting high - grade dysplasia , with a sensitivity of 96% and specificity 94% . autofluorescence imaging ( afi ) utilizes high frequency blue light , which has the property to excite endogenous fluorophores to emit green fluorescence . in the presence of be with early neoplasia , architectural and molecular changes in the columnar mucosa lead to reduction of green fluorescence . dysplastic lesions therefore can be flagged - up as purple - red areas on a green background . despite early enthusiasm for the utility of afi in dysplasia detection,117119 two crossover studies and a recent analysis of available clinical trials have showed a very limited diagnostic value in this technology for be endoscopic surveillance.120,121 this is partly due to the high false positive rate of afi , which in some studies has reached 80% . a multicenter study has been conducted by our institution with european collaborators , where biopsies directed by afi were processed for a large panel of molecular biomarkers and the outcome of the biomarker analysis was compared with that of the seattle protocol . this study found that afi positivity correlated with molecular abnormalities of the barrett s tissue and even if that area was not dysplastic on a focal biopsy there was a very high correlation between the molecular read - out from these areas and the overall dysplasia status of the patient.122 in the per - patient analysis , a small panel of three biomarkers ( p53 ihc , cyclin a , and aneuploidy ) assessed on afi positive areas had equal diagnostic accuracy to the seattle protocol . afi could therefore be a useful tool to direct biopsies for the detection of biomarkers and hence more objectively determine the risk status of the patient . in the future the combination of advanced imaging and molecular biomarkers could represent an improved strategy for improved stratification of be patients.123 other imaging technologies include confocal laser endomicroscopy , optical coherence tomography , diffuse reflectance spectroscopy and light scattering spectroscopy . confocal laser endomicroscopy ( cle ) allows for high resolution assessment of the mucosa using endoscopically delivered laser light with magnification beyond 1,000 allowing for imaging of cellular and subcellular structures and capillaries.124 an international multicenter , prospective , randomized , controlled trial by sharma et al.125 showed that probe - based cle used as part of a multimodal imaging approach in combination with high - definition white - light endoscopy ( hd - wle ) and nbi improved the sensitivity for dysplasia detection compared with hd - wle alone . another rct on 192 patients compared hd - wle with seattle protocol versus hd - wle plus endoscope - integrated cle ( ecle ) and targeted biopsies.126 this study found that the addition of ecle increased the diagnostic yield for neoplasia from 6% to 22% , with a 4.8-fold reduction in the number of total biopsies required . however , the main issue of cle is the narrow field of view and the best flagging technique to direct the operator as to which regions to analyse with the cle probe remains to be established . optical coherence tomography ( oct ) relies on the backscattering of light to obtain cross - sectional images of the tissue . the technique is similar to endosonography , but the image formation in oct depends on variations in the reflectance of light from different tissue layers . oct imaging has demonstrated anatomic structures such as crypts and glands that could potentially permit endoscopists to diagnose mucosal abnormalities such as be , including dysplastic changes.127,128 intrinsic fluorescence , reflectance , and light - scattering spectroscopy provide complementary data on biochemical and morphologic changes that occur during the development of dysplasia.129,130 however convincing data are still lacking on the clinical applicability of these techniques , neither as single modality or in combination.131 in conclusion , currently there is insufficient evidence to recommend advanced imaging modalities for routine barrett s surveillance . high - resolution endoscopy should be the minimum standard and the addition of more complex imaging modalities should be reserved to tertiary referral centers with a high volume of dysplastic cases . in the future multi - modal imaging , in combination with molecular information has the potential to overcome many of the limitations of the current clinical standard . it is now increasingly clear that be is a multifactorial disease , where a genetic predisposition interacts with the environment . only very recently gwas studies have started to provide the first insights into the genetic variants that predispose to the development of be and eac , but we are still far from being able to draw a risk profile based on the inherited genetic factors . since there are multiple risk loci , each conferring a low increased risk , it may be difficult to make a clinical - risk tool from this information . in the absence of practical ways to identify individuals at high risk based on their genetic profile , for the time being it seems logical to look for clinical risk factor . presently , clinical factors , such as reflux symptoms , age > 50 years , white race , male sex and obesity , are the key elements that trigger referral for endoscopic screening . however , there is uncertainty about how many factors should be present to define a high risk population . for example , reflux is regarded as the strongest risk factor for be ; however , more than 1/3 of patients with eac deny previous history of heartburn and the prevalence of be among reflux sufferers is only about 10% . hence , the population that needs to be screened to diagnose enough cases of be or cancer to impact on the overall mortality , is very large . as a consequence , it is mandatory to identify a minimally invasive screening test , with low cost and wide applicability to primary care . the current surveillance algorithm heavily relies on the histological assessment of dysplasia based on random biopsies . it is still debated whether endoscopic surveillance is an effective measure to improve survival in patients with be , due to controversial published data . this likely depends on the fact that dysplasia is difficult to detect endoscopically , as well as the fact that endoscopists adhere poorly to recommended protocols and pathologist struggle to agree on the diagnosis of dysplasia.66,67,132 flagging endoscopic techniques have been investigated to inform biopsy sampling , however up to now single modalities have not been proven to be superior to the current gold standard . a multimodal approach might represent an attractive possibility which has not been intensively studied so far . meanwhile , the minimum standard seems to be high - resolution endoscopy , allowing for sufficient time for careful inspection and targeted biopsies on suspicious mucosal areas.3,133 controversial data have been published on the cancer risk associated with a diagnosis of dysplasia , likely due to high interobserver variability and possibly also a different threshold used for the diagnosis of dysplasia in different countries or practices.66,67 more objective measures of cancer risk are needed to inform clinical decisions . biomarkers are natural candidates as molecular changes not only correlate with dysplasia , but can precede it and are often more objective . even though several biomarkers have been showed to correlate with prevalent dysplasia and cancer risk , it is clear that panels of biomarkers provide the most accurate measure.78,80 biomarkers need to be cheap , easy to interpret and applicable to the clinical setting . p53 ihc is an example of such biomarker , which couple low costs with good clinical performance . more studies within prospective case - control cohort are needed to validate existing and novel biomarkers . the emerging sequencing technology needs also to be explored as it is becoming increasingly affordable and can provide large scale information potentially able to uncover unexplored areas of the genome associated with cancer risk . multicenter studies are the ideal setting to test biomarkers in order to provide large enough cohorts of patients to achieve meaningful conclusions . in the future , it is possible to envisage a scenario where inexpensive and minimally invasive screening techniques will help diagnose a large proportion of unknown be . coupled with the objective assessment of an individual s risk for cancer , this will allow tailoring patient management with choosing between early ablation in high risk be ( nondysplastic with aberrant molecular profile as well as frankly dysplastic cases ) and prolonged endoscopic surveillance intervals or monitoring with minimally invasive devices in patients with low risk be .

barrett s esophagus ( be ) is the only known precursor to esophageal adenocarcinoma ( eac ) , whose incidence has increased sharply in the last 4 decades . the annual conversion rate of be to cancer is significant , but small . the identification of patients at a higher risk of cancer therefore poses a clinical conundrum . currently , endoscopic surveillance is recommended in be patients , with the aim of diagnosing either dysplasia or cancer at early stages , both of which are curable with minimally invasive endoscopic techniques . there is a large variation in clinical practice for endoscopic surveillance , and dysplasia as a marker of increased risk is affected by sampling error and high interobserver variability . screening programs have not yet been formally accepted , mainly due to the economic burden that would be generated by upper gastrointestinal endoscopy . screening programs have not yet been formally accepted , mainly due to the economic burden that would be generated by widespread indication to upper gastrointestinal endoscopy . in fact , it is currently difficult to formulate an accurate algorithm to confidently target the population at risk , based on the known clinical risk factors for be and eac . this review will focus on the clinical and molecular factors that are involved in the development of be and its conversion to cancer and on how increased knowledge in these areas can improve the clinical management of the disease .

total knee arthroplasty ( tka ) is a successful treatment for knee pain due to osteoarthritis . common complaints include less than desired range of motion ( rom ) , an unnatural feeling knee , instability and difficulty performing daily activities like ascending or descending stairs . reduced function has been attributed to laxity in the knee [ 1 , 22 ] , and a recent review of us and norwegian registries found that between 16 and 20 % of revisions are due to instability . laxity and functional kinematics have been published in both the intact and implanted knee [ 1 , 5 , 8 , 9 , 12 , 14 , 15 , 24 , 25 , 35 ] ; however , the effect of downsizing the femoral component and polyethylene insert on the knee s laxity envelope is not well reported . surgeons strive to restore function and feel of the unimplanted , healthy knee by matching native boney and soft tissue anatomy with the tka component options available [ 19 , 26 ] . the challenge for the surgeon is to create a stable and functional joint that is not too tight or loose [ 21 , 33 ] . there are several techniques to tune the knee to the desired laxity including adjusting tibial slope , femoral orientation and soft tissue releases [ 1 , 3 ] . choosing the correct component size is part of this process and offers another variable for the surgeon to adjust . if the knee is tight in extension , the surgeon may downsize the tibial insert . if the native femoral anterior posterior ( ap ) dimension lies somewhere between available sizes , or the knee is tight in flexion , the surgeon may downsize to a smaller femoral component [ 13 , 21 ] . although it is understood that both of these adjustments increase the laxity , the magnitude of this increase has not been investigated in detail and the clinical consequences of this increased laxity are still not well understood [ 1 , 30 ] . is there a way to make this balancing act of tuning joint laxity easier for the surgeon and better for the patients ? a traditional tka system has 3 or 4 mm increments in the ap dimension between femoral sizes and 2 mm between tibial insert thicknesses . to better match the native anatomy and offer more options to better balance the knee , others have increased the number of component sizes available , decreasing the increments between sizes . some may question whether the costs associated with the extra instrumentation , manufacturing and inventory of these designs outweigh the benefits . the testing system utilized in this current study applies repeatable forces and moments to the implanted joint that are meant to replicate the manual laxity tests surgeons use to judge the stability of the knee during tka surgery . this is important as it quantifies the laxity a surgeon would feel during their intraoperative qualitative evaluation of the knee . techniques such as adjusting bone cuts to change the tibial slope and femoral orientation , or pie crusting to release ligaments are used to balance the extension and flexion gaps of the knee [ 21 , 26 , 28 ] . component sizing is also used to tune the knee for optimum stability [ 13 , 21 ] . this study will investigate the effects of a 1 mm decrease in tibial polyethylene insert thickness or a 2 mm decrease in the femoral component ap dimension . understanding the effects of component sizing will improve the decision algorithm surgeons use during tka . we hypothesize that downsizing the femoral or tibial insert sizes 2 and 1 mm , respectively , will affect measured tka laxity in four degrees of freedom ( dof ) throughout the arc of flexion . the robotic testing method utilized in this study quantified the knee joint laxity by applying repeatable forces and moments in a physiologically defined coordinate system and accurately recording the resulting movement ( fig . 1 ) . the system consisted of a six dof robot arm ( kr500 , kuka robotics , ausberg , germany ) and an integrated six dof load cell ( omega 160 ip65 , amti , waltham , ma , usa ) ( fig . this system applied forces and moments to the knee joint in four physiological directions : anterior posterior ( ap ) translation , medial lateral ( ml ) translation , varus valgus ( vv ) rotation and internal / external ( ie ) rotation . the overall motion of the femur with respect to the tibia in each physiological direction , which constitutes the laxity envelope , was recorded.fig . * robotic testing is performed after original tka , downsized insert and downsized femur implanted states . the tibia is secured to the robot arm , and the femur is secured to the pedestal which is fixed to the lab floor flow chart describing the study methodology for each specimen . * robotic testing is performed after original tka , downsized insert and downsized femur implanted states . the tibia is secured to the robot arm , and the femur is secured to the pedestal which is fixed to the lab floor five fresh - frozen cadaver legs were used in this study . three - dimensional computer models were constructed ( amira , fei , hillsboro , or , usa ) using computed - tomography ( ct ) scans ( ge vct 64 slice , ge healthcare , wauwatosa , wi , usa ) and analyzed to determine an anatomically based coordinate frame . the specimens were prepared by disarticulating the foot and removing tissue to secure aluminum fixtures using bone cement . the fixtures were used to attach the tibia to the robot and secure the femur in a fixed position for testing ( fig . 2 ) . the skin and relevant soft tissues around the knee were kept intact throughout robot testing . a second set of post - fixturing ct scans were registered to the first set of scans ( 3d slicer , www.3dslicer.org ) to determine the location of the fixtures relative to the anatomic axis of the knee . the robotic testing system incorporated this information to apply forces and manipulate the specimen relative to the anatomic axis of the knee . the specimens were implanted with a modern cruciate retaining tka ( zimmer persona knee , zimmer , inc , warsaw , in , usa ) by an experienced board - certified orthopedic surgeon . a traditional medial arthrotomy was performed splitting the fibers of the distal quad at the interval between the medial 1/3 and the central 1/3 . the incision was carried distal along the medial border of the patellae to the medial border of the patellae tendon . the acl was removed , and the femoral component was implanted using an anterior referencing method . the proximal tibia was cut using an extra medullary guide and confirmed with a plum line from a spacer block . femoral and tibial components were selected that best matched the native anatomy , and a tibia insert thickness was chosen to obtain acceptable balancing throughout flexion . the surgeon tested the laxity of the knee by hand with varus valgus stress at 0 , 30 , 60 and 90 of flexion to ensure a balanced knee throughout flexion . post - implantation x - rays were taken to confirm that the implants were placed in the proper alignment . this initial implant state , which would be considered clinically acceptable , was used as the reference condition for the measurements made in this study . the original knee incision was opened exposing the implanted knee joint while avoiding disruption to existing soft tissue . the original polyethylene insert was removed and replaced with a 1 mm thinner polyethylene insert using instruments specific to this knee system . the capsule and skin were sutured closed , and the knee was manually tested for stability before testing . as the tka was implanted using an anterior referencing approach , the anterior and distal cuts of the original femoral component implantation were used as reference . modifications to the posterior cuts and posterior - distal chamfer cuts were made to accommodate the smaller box of the smaller femur ( fig . once satisfactory cuts were made , the downsized femoral component was secured using bone cement . the capsule and skin incisions were closed with sutures , and the knee was manually manipulated to ensure stability before testing.fig . 3change in femoral ap dimension from the original tka to a downsized femur change in femoral ap dimension from the original tka to a downsized femur the position of the femur with respect to the tibia with low compressive load and no other loads applied to the joint throughout flexion is referred to in this study as the passive flexion path . this is the path the knee would travel guided only by the articulating geometry and soft tissue structures without the influence of large outside forces or moments . the passive flexion path was found using our robotic testing system by applying a 44 n compression force to move the specimen through the rom while zeroing out all other external forces and moments , except the flexion zero degrees flexion was used as full extension unless an extension moment threshold of 10 nm was met before 0. the passive path was determined from full extension to maximum flexion . the passive flexion tests and subsequent laxity tests were performed on each specimen in all three implanted states described above . for ie laxity evaluations , the knee was initially placed in the passive flexion position of the implanted state at full extension . a torque of 6 nm was applied about the ie axis in the internal direction and then in the external direction while under 44 n tibiofemoral compressive load . a 44 n load was used to ensure that the articulating geometry remains in contact , but the constraint of the knee is mostly dictated by soft tissue structures . the overall movement from the most internally rotated position to the most externally rotated position constituted the ie laxity envelope at full extension ( fig . 4 ) . the midpoint of the ie laxity envelope was the starting position for the rest of the laxity evaluations at this flexion angle . valgus ( vv ) rotational direction with 12 nm torque and the anterior posterior ( ap ) and medial lateral ( ml ) translational directions with 100 n applied force . 4visual representation of the average internal / external laxity envelope for original tka at full extension ( a , b ) and 90 flexion ( c , d ) visual representation of the average internal / external laxity envelope for original tka at full extension ( a , b ) and 90 flexion ( c , d ) three different laxity metrics were calculated . the average laxity is the average from all specimens in an implanted state at a specific flexion angle . the laxity increase is the average change in laxity from one implant state to another at a specific flexion angle . the percent change is a calculation of the change in laxity at a specific flexion angle from the original tka to either of the downsized states using the following formula.\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\% \,{\text{change } } = \frac{{{\text{downsized } } \,{\text{laxity } } - { \text{original tka } } \,{\text{laxity}}}}{{{\text{original } } \,{\text{tka } } \,{\text{laxity } } } } \times 100$$\end{document } a positive percent change indicates an increase in laxity from the original tka to the downsized state . in this study , original tka , which was the reference condition , a two - way paired student s t test was used for each flexion increment to test the null hypothesis that changing the implant state has no effect on laxity and to also test the null hypothesis that the change resulting from each downsized state from the original tka was not the same . a power analysis revealed five specimens achieve a power of at least 0.8 using sample translational and rotational laxity data at full extension and 90 flexion , except for vv at full extension ( power = 0.4 ) and ie at 90 flexion ( power = 0.7 ) . a p value < 0.05 was deemed statistically significant . statistical calculations and analyses were performed using excel ( microsoft , redmond , wa , usa ) and matlab ( the mathworks , natick , ma , usa ) . the specimens were implanted with a modern cruciate retaining tka ( zimmer persona knee , zimmer , inc , warsaw , in , usa ) by an experienced board - certified orthopedic surgeon . a traditional medial arthrotomy was performed splitting the fibers of the distal quad at the interval between the medial 1/3 and the central 1/3 . the incision was carried distal along the medial border of the patellae to the medial border of the patellae tendon . the acl was removed , and the femoral component was implanted using an anterior referencing method . the proximal tibia was cut using an extra medullary guide and confirmed with a plum line from a spacer block . femoral and tibial components were selected that best matched the native anatomy , and a tibia insert thickness was chosen to obtain acceptable balancing throughout flexion . the surgeon tested the laxity of the knee by hand with varus valgus stress at 0 , 30 , 60 and 90 of flexion to ensure a balanced knee throughout flexion . post - implantation x - rays were taken to confirm that the implants were placed in the proper alignment . this initial implant state , which would be considered clinically acceptable , was used as the reference condition for the measurements made in this study . the original knee incision was opened exposing the implanted knee joint while avoiding disruption to existing soft tissue . the original polyethylene insert was removed and replaced with a 1 mm thinner polyethylene insert using instruments specific to this knee system . the capsule and skin were sutured closed , and the knee was manually tested for stability before testing . the original knee incision was opened . the tibial insert from the original tka was reinserted , and the femoral component was downsized . in this implant system , as the tka was implanted using an anterior referencing approach , the anterior and distal cuts of the original femoral component implantation were used as reference . modifications to the posterior cuts and posterior - distal chamfer cuts were made to accommodate the smaller box of the smaller femur ( fig . once satisfactory cuts were made , the downsized femoral component was secured using bone cement . the capsule and skin incisions were closed with sutures , and the knee was manually manipulated to ensure stability before testing.fig . 3change in femoral ap dimension from the original tka to a downsized femur change in femoral ap dimension from the original tka to a downsized femur the position of the femur with respect to the tibia with low compressive load and no other loads applied to the joint throughout flexion is referred to in this study as the passive flexion path . this is the path the knee would travel guided only by the articulating geometry and soft tissue structures without the influence of large outside forces or moments . the passive flexion path was found using our robotic testing system by applying a 44 n compression force to move the specimen through the rom while zeroing out all other external forces and moments , except the flexion zero degrees flexion was used as full extension unless an extension moment threshold of 10 nm was met before 0. the passive path was determined from full extension to maximum flexion . the passive flexion tests and subsequent laxity tests were performed on each specimen in all three implanted states described above . for ie laxity evaluations , the knee was initially placed in the passive flexion position of the implanted state at full extension . a torque of 6 nm was applied about the ie axis in the internal direction and then in the external direction while under 44 n tibiofemoral compressive load . a 44 n load was used to ensure that the articulating geometry remains in contact , but the constraint of the knee is mostly dictated by soft tissue structures . the overall movement from the most internally rotated position to the most externally rotated position constituted the ie laxity envelope at full extension ( fig . 4 ) . the midpoint of the ie laxity envelope was the starting position for the rest of the laxity evaluations at this flexion angle . valgus ( vv ) rotational direction with 12 nm torque and the anterior posterior ( ap ) and medial lateral ( ml ) translational directions with 100 n applied force . 4visual representation of the average internal / external laxity envelope for original tka at full extension ( a , b ) and 90 flexion ( c , d ) visual representation of the average internal / external laxity envelope for original tka at full extension ( a , b ) and 90 flexion ( c , d ) three different laxity metrics were calculated . the average laxity is the average from all specimens in an implanted state at a specific flexion angle . the laxity increase is the average change in laxity from one implant state to another at a specific flexion angle . the percent change is a calculation of the change in laxity at a specific flexion angle from the original tka to either of the downsized states using the following formula.\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$\% \,{\text{change } } = \frac{{{\text{downsized } } \,{\text{laxity } } - { \text{original tka } } \,{\text{laxity}}}}{{{\text{original } } \,{\text{tka } } \,{\text{laxity } } } } \times 100$$\end{document } a positive percent change indicates an increase in laxity from the original tka to the downsized state . in this study , original tka , which was the reference condition , a two - way paired student s t test was used for each flexion increment to test the null hypothesis that changing the implant state has no effect on laxity and to also test the null hypothesis that the change resulting from each downsized state from the original tka was not the same . a power analysis revealed five specimens achieve a power of at least 0.8 using sample translational and rotational laxity data at full extension and 90 flexion , except for vv at full extension ( power = 0.4 ) and ie at 90 flexion ( power = 0.7 ) . statistical calculations and analyses were performed using excel ( microsoft , redmond , wa , usa ) and matlab ( the mathworks , natick , ma , usa ) . downsizing the insert and downsizing the femur both increased the measured laxity of the implanted tka . all three states averaged the least amount of laxity at full extension and the greatest amount of laxity at 120 flexion in all four dof tested ( figs . 5 , 6 ) . the laxity curves as a result of downsizing the tibial insert 1 mm were similar in shape to the original tka ( fig . 6 ) as there was a consistent increase in laxity through the whole arc of flexion . the 2 mm change in femoral ap dimension had a minimal effect in extension but increased laxity compared to the original tka as the knee progressed into flexion.fig . 5average envelope of motion for each laxity degree of freedom through flexion for each of the original tka , downsized insert and downsized femur states . * significant difference ( p < 0.05 ) between downsized insert and original tka . significant difference ( p < 0.05 ) between downsized femur and original tka . ^significant difference ( p < 0.05 ) between downsized insert and downsized femur fig * significant difference ( p < 0.05 ) between downsized insert and originial tka . significant difference ( p < 0.05 ) between downsized femur and original tka . ^significant difference ( p < 0.05 ) between downsized insert and downsized femur average envelope of motion for each laxity degree of freedom through flexion for each of the original tka , downsized insert and downsized femur states . * significant difference ( p < 0.05 ) between downsized insert and original tka . significant difference ( p < 0.05 ) between downsized femur and original tka . ^significant difference ( p < 0.05 ) between downsized insert and downsized femur laxity plots for each degree of freedom through flexion . significant difference ( p < 0.05 ) between downsized insert and originial tka . significant difference ( p < 0.05 ) between downsized femur and original tka . ( p < 0.05 ) between downsized insert and downsized femur four of five specimens in the original tka state reached the 0 limit for full extension . one specimen was flexed 6 in the original tka but after conversion to the downsized insert was flexed 3 at the 10 nm extension moment , achieving three additional degrees of extension . the laxities more than doubled from full extension to 30 flexion over most dof for the original tka and both downsized states ( figs . 5 , 6 ) . the downsized insert was significantly more lax than the original tka in all four laxity directions throughout early flexion ( p < 0.05 ) . there were significant differences between the downsized femur and original tka in early flexion ; however , the downsized femur was tighter than the downsized insert in all four dof ( p < 0.05 ) as would be expected ( fig . 6 ) . downsizing the tibial insert 1 mm resulted in a greater increase in average laxity compared to downsizing the femur , but this was only significant at 15 flexion across all dof ( ap p = 0.017 , ml p = 0.016 , ie p = 0.016 , vv p = 0.023 ) . in the ap direction at full extension , there was a 2.0 mm ( 43.8 % ) and 0.7 mm ( 15.9 % ) increase in laxity after converting to downsized insert and downsized femur , respectively ( p = 0.045 ) ( figs . 6 , 7 ) . at 15 flexion in vv , there was a 1.2 ( 35.9 % ) and 0.4 ( 12.9 % ) increase in laxity from the original tka to downsized insert and downsized femur , respectively ( p = 0.023).fig . 7plot of percent change in laxity from the original tka to the respective downsized states . ^a difference in percent change between the downsized states ( p < 0.05 ) plot of percent change in laxity from the original tka to the respective downsized states . ^a difference in percent change between the downsized states ( p < 0.05 ) the laxity changes within the three implanted states from the start to end of mid - flexion were relatively small compared to early flexion ( figs . 5 , 6 ) . the two downsized states were significantly different than the original tka at 30 , 45 and 60 flexion in all laxity directions ( p < 0.05 ) ( fig . for example , the average vv laxity at 45 flexion was 5.7 , 7.0 and 7.3 for the original tka , downsized insert and downsized femur , respectively . this represents a 31.7 and 37.7 % change from the original tka ( fig . the downsized insert saw an average percent change of 31.9 % and the downsized femur of 28.7 % compared to the original tka in the ap direction at 45 flexion ( p = 0.730 ) ( fig . 7 ) . the similarity in laxity values and laxity change indicates downsizing the femoral component by 2 mm has a similar effect in mid - flexion as decreasing the tibial insert thickness 1 mm . there was a relatively large laxity increase into deeper flexion in the original and downsized states ( figs . 5 , 6 ) . the average laxities of the two downsized states were significantly different from the original tka in all laxity modes through most of later flexion ( p < 0.05 ) ( fig . the ap laxity for the original tka was 8.5 mm and the vv laxity was 8.1 , compared to the downsized insert at 12.4 mm ( p = 0.0005 ) and 9.9 ( p = 0.0004 ) and the downsized femur at 14.5 mm ( p = 0.012 ) and 11.6 ( p = 0.020 ) , respectively ( figs . 5 , 6 ) . the downsized insert percent increase from the original tka ranged from 16.5 % in ie to 41.6 % in ml at 90 flexion ( fig . the average percent increase in laxity from original tka to downsized femur at 90 ranged from 25.6 % in ie to 73.9 % in ap . although not reflected in the percent change calculations and not a significant difference ( n.s . ) , the change in laxity from the original tka to a 2 mm smaller femur nearly doubled the increase in laxity from the original tka to the 1 mm thinner insert at 120 flexion in all dof except ie . four of five specimens in the original tka state reached the 0 limit for full extension . one specimen was flexed 6 in the original tka but after conversion to the downsized insert was flexed 3 at the 10 nm extension moment , achieving three additional degrees of extension . the laxities more than doubled from full extension to 30 flexion over most dof for the original tka and both downsized states ( figs . 5 , 6 ) . the downsized insert was significantly more lax than the original tka in all four laxity directions throughout early flexion ( p < 0.05 ) . there were significant differences between the downsized femur and original tka in early flexion ; however , the downsized femur was tighter than the downsized insert in all four dof ( p < 0.05 ) as would be expected ( fig . 6 ) . downsizing the tibial insert 1 mm resulted in a greater increase in average laxity compared to downsizing the femur , but this was only significant at 15 flexion across all dof ( ap p = 0.017 , ml p = 0.016 , ie p = 0.016 , vv p = 0.023 ) . in the ap direction at full extension , there was a 2.0 mm ( 43.8 % ) and 0.7 mm ( 15.9 % ) increase in laxity after converting to downsized insert and downsized femur , respectively ( p = 0.045 ) ( figs . 6 , 7 ) . at 15 flexion in vv , there was a 1.2 ( 35.9 % ) and 0.4 ( 12.9 % ) increase in laxity from the original tka to downsized insert and downsized femur , respectively ( p = 0.023).fig . 7plot of percent change in laxity from the original tka to the respective downsized states . ^a difference in percent change between the downsized states ( p < 0.05 ) plot of percent change in laxity from the original tka to the respective downsized states . ^a difference in percent change between the downsized states ( p < 0.05 ) the laxity changes within the three implanted states from the start to end of mid - flexion were relatively small compared to early flexion ( figs . 5 , 6 ) . the two downsized states were significantly different than the original tka at 30 , 45 and 60 flexion in all laxity directions ( p < 0.05 ) ( fig . 6 ) . for example , the average vv laxity at 45 flexion was 5.7 , 7.0 and 7.3 for the original tka , downsized insert and downsized femur , respectively . this represents a 31.7 and 37.7 % change from the original tka ( fig . the downsized insert saw an average percent change of 31.9 % and the downsized femur of 28.7 % compared to the original tka in the ap direction at 45 flexion ( p = 0.730 ) ( fig . the similarity in laxity values and laxity change indicates downsizing the femoral component by 2 mm has a similar effect in mid - flexion as decreasing the tibial insert thickness 1 mm . there was a relatively large laxity increase into deeper flexion in the original and downsized states ( figs . 5 , 6 ) . the average laxities of the two downsized states were significantly different from the original tka in all laxity modes through most of later flexion ( p < 0.05 ) ( fig . the ap laxity for the original tka was 8.5 mm and the vv laxity was 8.1 , compared to the downsized insert at 12.4 mm ( p = 0.0005 ) and 9.9 ( p = 0.0004 ) and the downsized femur at 14.5 mm ( p = 0.012 ) and 11.6 ( p = 0.020 ) , respectively ( figs . 5 , 6 ) . the downsized insert percent increase from the original tka ranged from 16.5 % in ie to 41.6 % in ml at 90 flexion ( fig . 7 ) . the average percent increase in laxity from original tka to downsized femur at 90 ranged from 25.6 % in ie to 73.9 % in ap . although not reflected in the percent change calculations and not a significant difference ( n.s . ) , the change in laxity from the original tka to a 2 mm smaller femur nearly doubled the increase in laxity from the original tka to the 1 mm thinner insert at 120 flexion in all dof except ie . the most important finding in this study is the significant effect relatively small changes in tka dimensions have on the laxity of the knee in four dof throughout the arc of flexion . the main stabilizers in these low compressive load tests are the tibiofemoral articulating geometry and ligamentous soft tissues . changes in tka component geometry or placement have been shown to change the length or tension of ligaments [ 9 , 28 ] . slight reductions in ligament length can significantly reduce ligament tension and in turn increase the laxity of the joint . this is supported by walker et al . in a study of knee balancing using instrumented tibial trials . downsizing the femoral component had minimal effect on laxity in full extension as the distal resection did not change ; therefore , the joint space in extension was not affected . however , there was a significant laxity increase in flexion up to 73.9 % . since this was an anterior referencing technique , a significant laxity increase at 90 would be expected as the ap dimension of the femur is aligned with the direction of the collateral ligaments . the clinical effects of decreasing the pco are still controversial [ 2 , 10 , 17 , 30 , 33 ] . it is not surprising based on the linear nature of ligament stiffness how much laxity increases in later flexion after changing 2 mm compared to 1 mm . a revealing finding is that the laxities of the downsized femur and downsized insert were similar in mid - flexion . this study shows that reducing the ap dimension of the femoral component by 2 mm had a similar or greater effect throughout flexion as downsizing the tibial insert thickness by 1 mm . although the femoral change is in the ap direction , this change affects the joint space earlier than 90 flexion . these findings indicate undersizing components may contribute to instability in mid - flexion and could be added to the list of possible causes [ 24 , 27 , 31 , 34 ] . laxity evaluations are clinically relevant in that surgeons use this intraoperative assessment to guide their implantation technique . cadaveric laxity evaluations have been shown to correlate well with laxity evaluations performed on live subjects . an additional level of downsizing or upsizing the components would provide a trend of the effect of adjusting component size on laxity . also , cadaveric models only represent surgery immediately post - operatively . however , these are matched comparisons , the study was well powered in most dof and the number compares to similar cadaveric studies [ 5 , 14 , 15 , 28 ] . the vv direction at full extension and ie at 90 is lower in power than the other dof , and this should be noted . another limitation is that the experiments were carried out under a small compressive load . while this does not represent functional load - bearing conditions , it does represent the situation at the time of tka surgery during the balancing process . increases in knee joint laxity can contribute to the feeling of instability , joint pain , increased implant wear and affect daily activities . in a cruciate retaining design , downsizing will affect the engagement of the pcl and potentially limit posterior rollback during flexion [ 5 , 23 ] . increased varus / valgus laxity would allow femoral condylar lift - off [ 6 , 7 ] , which is unnatural for the patient and increases stress on the polyethylene insert . larger motion in the joint could lead to synovial impingement or retinacular strain resulting in pain , and potentially inflammation and joint effusion . in a stable knee joint , the ligaments keep the femur in an appropriate position relative to the tibia . if the femur moves to an unnatural position while unloaded , a correction is needed during initiation of stance phase of walking , descending stairs or more strenuous activities requiring change of direction . although subtle , the patient could sense a delayed response time or instability contributing to the unnatural feeling knee . surgeons have several techniques during tka to restore satisfactory knee function , stability and feeling to the patient , one of which is component sizing . this study shows the importance of choosing the appropriate implant component size , having the appropriate size available and the effect of downsizing . a relatively small decrease in insert and femoral component size increases laxity throughout the arc of flexion up to 43.8 % and 72.9 % , respectively , compared to the original component implantation . these findings also reveal that a 2 mm downsizing of the femoral ap dimension increases laxity not only in flexion , but were shown to increase laxity in the mid - flexion range equivalent to downsizing the polyethylene insert by 1 mm .

purposethis study examines the effect of component downsizing in a modern total knee arthroplasty ( tka ) system on the laxity envelope of the knee throughout flexion.methodsa robotic testing system was utilized to measure laxity envelopes in the implanted knee by in the anterior posterior ( ap ) , medial lateral ( ml ) , internal external ( ie ) and varus valgus ( vv ) directions . five fresh - frozen cadavers were tested with a modern cruciate retaining tka implantation , a 1-mm thinner polyethylene insert and a femoral component 2 mm smaller in the ap dimension.resultsthe downsized tibial insert was more lax throughout the flexion arc with up to 2.0 mm more laxity in the ap direction at full extension , a 43.8 % increase over the original implantation . a thinner insert consistently increased laxity throughout the arc of flexion in all degrees of freedom . downsizing the femoral component resulted in 8.5 mm increase in ap laxity at 90 , a 73.9 % increase . in mid - flexion , downsizing the femur produced similar laxity values to the downsized insert in ap , ml , ie and vv directions.conclusiondownsizing the tka components had significant effects on laxity throughout flexion . downsizing a femoral component 2 mm had an equivalent increase in laxity in mid - flexion as downsizing the tibial insert 1 mm . this study quantifies the importance of choosing the appropriate implant component size , having the appropriate size available and the effect of downsizing . the laxity of the implanted knee contributes to how the implant feels to the patient and ultimately the patient s satisfaction with their new knee .

an fgf2 hpc formulation containing 0.3% fgf2 was prepared by dissolving freezedried human recombinant fgf2 ( kaken pharmaceutical co. ltd . , tokyo , japan ) in 3% hpc solution . either vehicle alone or 0.3% fgf2 solution was administered to the control and fgf2 groups , respectively . seven male beagle dogs ( age : 37 months ; weight : 8.813.8 kg ) for study 1 and six female dogs ( age : 7887 months ; weight : 11.917.0 kg ) for study 2 were used . the dogs were housed individually and allowed to move freely in stainless steel cages under conditions of 1826c temperature , 3070% humidity , and 12h lighting ( 07:0019:00 ) . all animals were provided with 230 g of solid food ( labo d stock ; nihon nosan kogyo co. , yokohama , japan ) per day and filtered tap water ad libitum . this study was approved by the animal experiments ethics committee of kaken pharmaceutical co. ltd . and the ethical review board of dentistry , osaka university . follows inhouse regulations that comply with japan 's act on welfare and management of animals as well as international and domestic guidelines . in addition , kaken pharmaceutical co. ltd . has been certified as a qualified institution for laboratory animal care and use by the japan health sciences foundation ( tokyo , japan ) . the purpose of study 1 was to examine the effect of fgf2 on the boneforming ability around the implants at 4 , 8 , and 12 weeks after installation . to reduce contact with the existing bone and quantify the amount of bone formation , customized titanium implants with measurement regions were prepared ( fig . 1a ; diameter : 3.2 mm ; length : 6 mm ; kyocera medical corporation , osaka , japan ) . after the dogs were anesthetized subcutaneously with xylazine ( 20 mg / dog ; celactal ; bayer yakuhin ltd . , tokyo , japan ) , intravenously with pentobarbital ( 10 mg / kg ) , and intragingivally with 2% lidocaine with 0.00125% adrenaline ( xylocaine ; dentsplysankin k.k . , tokyo , japan ) , the third and fourth premolars on both sides in the mandible were removed . after the wounds had healed , a mucoperiosteal flap was raised , and two bone sockets ( diameter : 3.2 mm ; depth : 6 mm ) on each side were surgically prepared using a twist drill ( implantor neo bright ; kyocera medical corporation , osaka , japan ) under anesthesia as described above . to degrade the primary stability of the implants , the diameters of the sockets were spread to 3.7 mm with a depth of 4 mm using a taper drill ( fig . four implants per animal were installed after the test solutions ( 20 l / site ) were administered into the sockets ( fig . , the 0.3% fgf2 solution was administered into the two sockets on one side and the vehicle solution was administered into the two sockets on the other side . the gingival flaps were sutured , and penicillin ( 40,000 u / dog ) and streptomycin ( 200 mg / dog ) were administered subcutaneously to prevent infection after surgery . the animals were given about 400 g of soft food ( pedigree ; mars japan ltd . , schematic drawings of the customized implants , postoperative views , and methods for histomorphometric analysis . ( a ) design , size , and measurement region of the customized titanium implant in study 1 . ( d ) schematic drawing of the measurement regions for the histomorphometric analysis in study 1 . ( e ) ( f ) customized transducer attached to the installed implant for measurement of the isq value in study 2 . in study 1 , three dogs each were euthanized by exsanguination under general anesthesia at 4 and 8 weeks after installation . tissues containing the implants ( n = 6 per group at each time point ) were extracted and fixed with neutralbuffered 10% formalin . nondecalcified histological sections were prepared by grinding after the tissues were embedded with resin , and mesiodistal sections of the specimens were stained with villanueva goldner stain . the new bone area and length of new bonetoimplant contact ( bic ) in the measurement regions ( fig . 1a ) were determined with winroof image analysis software ( ver.5.03 ; mitani co. , tokyo , japan ) . to examine the relationship between bone formation and distance from the existing bone , the new bone area was measured in two regions , comprising an area near the existing bone ( area 1 ) and an area further from the existing bone ( area 2 ) , and the length of bic was measured on each side ( side a , side b , side c , side d ) ( fig . the individual values of each implant were calculated as the means in two measurement regions because of mesiodistal sections of the specimens ( fig . the new bone area and length of bic were shown as percentages calculated as follows : new bone area / area of measurement region 100 or length of bic / entire length of each side 100 . under general anesthesia the sections were coated with platinum using a plasma multicoater ( pmc5000 ; meiwafosis co. ltd . , tokyo , japan ) and observed under a scanning electron microscope ( jsm6390lv ; jeol ltd . , tokyo , japan ) . the purpose of study 2 was to determine whether fgf2 enhanced the stability of the implants . the total implant stability was evaluated by the implant stability quotient ( isq ) value derived from the resonance frequency given by an osstell system ( osstell ab , gothenburg , sweden ) . six beagle dogs were implanted with customized titanium implants that allowed measurements by the osstell system ( fig . 1e , f ) . the implantation was performed as described above with the exception of the bone socket number . in study 2 , only the fourth premolars on both sides were removed and one bone socket on each side was created ( fig . the isq values were recorded at the time of implant placement ( 0 weeks ) and at 4 , 6 , 8 , 12 , and 16 weeks after installation by attaching a customized transducer ( kyocera medical corporation , osaka , japan ) to the implant ( fig . the isq values at 0 weeks in both groups were confirmed to be 60 or less , because isq values of 60 or less are considered to reflect low stability ( rodrigo et al . 2010 ) . to estimate the relationship between the isq value and the histology , the tissues containing the implants ( n = 6 per group at each time point ) were extracted at 16 weeks and the sections were stained with villanueva goldner stain as described above . the final data were shown as the percentages of new bone area and length of bic in the entire measurement region with winroof image analysis software . the mean , standard deviation ( sd ) and median were calculated for each measurement , and the differences between treatments were analyzed by a wilcoxon signedrank test . an fgf2 hpc formulation containing 0.3% fgf2 was prepared by dissolving freezedried human recombinant fgf2 ( kaken pharmaceutical co. ltd . , tokyo , japan ) in 3% hpc solution . either vehicle alone or 0.3% fgf2 solution was administered to the control and fgf2 groups , respectively . seven male beagle dogs ( age : 37 months ; weight : 8.813.8 kg ) for study 1 and six female dogs ( age : 7887 months ; weight : 11.917.0 kg ) for study 2 were used . the dogs were housed individually and allowed to move freely in stainless steel cages under conditions of 1826c temperature , 3070% humidity , and 12h lighting ( 07:0019:00 ) . all animals were provided with 230 g of solid food ( labo d stock ; nihon nosan kogyo co. , yokohama , japan ) per day and filtered tap water ad libitum . this study was approved by the animal experiments ethics committee of kaken pharmaceutical co. ltd . and the ethical review board of dentistry , osaka university . follows inhouse regulations that comply with japan 's act on welfare and management of animals as well as international and domestic guidelines . in addition , kaken pharmaceutical co. ltd . has been certified as a qualified institution for laboratory animal care and use by the japan health sciences foundation ( tokyo , japan ) . the purpose of study 1 was to examine the effect of fgf2 on the boneforming ability around the implants at 4 , 8 , and 12 weeks after installation . to reduce contact with the existing bone and quantify the amount of bone formation , customized titanium implants with measurement regions were prepared ( fig . 1a ; diameter : 3.2 mm ; length : 6 mm ; kyocera medical corporation , osaka , japan ) . after the dogs were anesthetized subcutaneously with xylazine ( 20 mg / dog ; celactal ; bayer yakuhin ltd . , tokyo , japan ) , intravenously with pentobarbital ( 10 mg / kg ) , and intragingivally with 2% lidocaine with 0.00125% adrenaline ( xylocaine ; dentsplysankin k.k . , tokyo , japan ) , the third and fourth premolars on both sides in the mandible were removed . after the wounds had healed , a mucoperiosteal flap was raised , and two bone sockets ( diameter : 3.2 mm ; depth : 6 mm ) on each side were surgically prepared using a twist drill ( implantor neo bright ; kyocera medical corporation , osaka , japan ) under anesthesia as described above . to degrade the primary stability of the implants , the diameters of the sockets were spread to 3.7 mm with a depth of 4 mm using a taper drill ( fig . four implants per animal were installed after the test solutions ( 20 l / site ) were administered into the sockets ( fig . , the 0.3% fgf2 solution was administered into the two sockets on one side and the vehicle solution was administered into the two sockets on the other side . the gingival flaps were sutured , and penicillin ( 40,000 u / dog ) and streptomycin ( 200 mg / dog ) were administered subcutaneously to prevent infection after surgery . the animals were given about 400 g of soft food ( pedigree ; mars japan ltd . , tokyo , japan ) per day schematic drawings of the customized implants , postoperative views , and methods for histomorphometric analysis . ( a ) design , size , and measurement region of the customized titanium implant in study 1 . ( d ) schematic drawing of the measurement regions for the histomorphometric analysis in study 1 . ( e ) ( f ) customized transducer attached to the installed implant for measurement of the isq value in study 2 . in study 1 , three dogs each were euthanized by exsanguination under general anesthesia at 4 and 8 weeks after installation . tissues containing the implants ( n = 6 per group at each time point ) were extracted and fixed with neutralbuffered 10% formalin . nondecalcified histological sections were prepared by grinding after the tissues were embedded with resin , and mesiodistal sections of the specimens were stained with villanueva goldner stain . the new bone area and length of new bonetoimplant contact ( bic ) in the measurement regions ( fig . 1a ) were determined with winroof image analysis software ( ver.5.03 ; mitani co. , tokyo , japan ) . to examine the relationship between bone formation and distance from the existing bone , the new bone area was measured in two regions , comprising an area near the existing bone ( area 1 ) and an area further from the existing bone ( area 2 ) , and the length of bic was measured on each side ( side a , side b , side c , side d ) ( fig . the individual values of each implant were calculated as the means in two measurement regions because of mesiodistal sections of the specimens ( fig . the new bone area and length of bic were shown as percentages calculated as follows : new bone area / area of measurement region 100 or length of bic / entire length of each side 100 . under general anesthesia , one dog was euthanized by exsanguination at 12 weeks in study 1 . the sections were coated with platinum using a plasma multicoater ( pmc5000 ; meiwafosis co. ltd . , tokyo , japan ) and observed under a scanning electron microscope ( jsm6390lv ; jeol ltd . , tokyo , japan ) . the purpose of study 2 was to determine whether fgf2 enhanced the stability of the implants . the total implant stability was evaluated by the implant stability quotient ( isq ) value derived from the resonance frequency given by an osstell system ( osstell ab , gothenburg , sweden ) . six beagle dogs were implanted with customized titanium implants that allowed measurements by the osstell system ( fig . 1e , f ) . the implantation was performed as described above with the exception of the bone socket number . in study 2 , only the fourth premolars on both sides were removed and one bone socket on each side was created ( fig . the isq values were recorded at the time of implant placement ( 0 weeks ) and at 4 , 6 , 8 , 12 , and 16 weeks after installation by attaching a customized transducer ( kyocera medical corporation , osaka , japan ) to the implant ( fig . the isq values at 0 weeks in both groups were confirmed to be 60 or less , because isq values of 60 or less are considered to reflect low stability ( rodrigo et al . the tissues containing the implants ( n = 6 per group at each time point ) were extracted at 16 weeks and the sections were stained with villanueva goldner stain as described above . the final data were shown as the percentages of new bone area and length of bic in the entire measurement region with winroof image analysis software . the mean , standard deviation ( sd ) and median were calculated for each measurement , and the differences between treatments were analyzed by a wilcoxon signedrank test . histologic images of the measurement regions at 4 and 8 weeks are shown in fig . villanueva goldner staining distinguishes between uncalcified osteoid ( red ) and calcified bone ( green ) . in the control group , new bone including osteoid and calcified bone was formed in the measurement region at 4 weeks , and the trabeculae of the new bone were thin and immature ( fig . 2a ) . from 4 to 8 weeks , the area of new bone expanded , the thickness of the new bone trabeculae increased , and the new bone matured into calcified bone at 8 weeks ( fig . 2c ) . in the fgf2 group , the maturity of the new bone was similar to that in the control group at 4 and 8 weeks ( fig . the amount of new bone in the fgf2 group was larger than that in the control group at each time point . ( a d ) representative histologic overview of the measurement region of the implants . specimens were harvested 4 ( a , b ) and 8 ( c , d ) weeks after installation in the control ( a , c ) and fgf2 ( b , d ) groups . ( e ) histomorphometric analysis of the rate of new bone area in the measurement regions . the area of new bone was measured in two areas , comprising an area near the existing bone side ( area 1 ) and an area further from the existing bone ( area 2 ) . the data are shown as percentages calculated as new bone area / area of measurement region 100 . the results are presented as means ( column ) sd ( bar ) and median ( open circle ) . ( n = 6 ; * p < 0.05 , vs. the control group by a wilcoxon signedrank test ) . ( f ) histomorphometric analysis of the rate of contact between the new bone and the implant in the measurement regions . the length of bic was measured on each side ( side a , side b , side c , and side d ) . the data are shown as percentages calculated as length of bic / entire length of each side 100 . the results are presented as means ( column ) sd ( bar ) and median ( open circle ) ( n = 6 ; * p < 0.05 , vs. the control group by a wilcoxon signedrank test ) . to ascertain the boneforming ability of fgf2 , we first evaluated the area of new bone including osteoid and calcified bone in the measurement regions ( fig . the new bone area in area 2 was smaller than that in area 1 at 4 and 8 weeks in the control group , indicating that bone formation was delayed in the area further from the existing bone . in the fgf2 group , the new bone area was significantly larger than that in the control group in both area 1 and area 2 at 4 weeks . in particular , in the region further from the existing bone ( area 2 ) , there was a large difference between the fgf2 group and the control group . these data indicated that fgf2 was effective for bone formation around the implants where bone formation was delayed . from 4 to 8 weeks the new bone area in the fgf2 group at 4 weeks was similar to that in the control group at 8 weeks . to examine the effect of fgf2 on osseointegration the lengths of bic were in the order of side a > side b > side c > side d at 4 weeks in the control group . the length of bic on side d was very low even at 8 weeks . these results suggested that the contact appeared to proceed from the side near the existing bone ( side a ) to the far side ( side d ) and that the far side was slow to acquire contact . in the fgf2 group , the total contact length ( side a + side b + side c + side d ) was significantly greater than that in the control group at 4 and 8 weeks . in particular , the length on side d in the fgf2 group was higher than that in the control group . the contact conditions between the new bone and the implants were observed at 12 weeks after installation ( fig . osseous matrix adhered to the implant surfaces , and no connective tissue between the bone and the implant surfaces was observed on any side in both groups . ( a f ) electron microscopic photomicrographs of bic in the control ( a , c , e ) and fgf2 ( b , d , f ) groups at 12 weeks . the isq values of around 50 at 0 weeks ( low implant stability ) increased to 80 at 4 weeks in both groups . from 4 to 8 weeks , the isq values in both groups gradually increased . the isq values in the fgf2 group were significantly higher than those in the control group at 6 and 8 weeks . the isq values in both groups barely changed after 8 weeks , and the difference between the two groups was maintained . at 16 weeks , the new bone area in the entire measurement regions in the fgf2 group was higher compared with those in the control group ( fig . interestingly , the length of bic in the entire measurement regions in the fgf2 group was significantly higher compared with those in the control group ( fig . the results are presented as means sd ( n = 6 ; * p < 0.05 , vs. the control group by a wilcoxon signedrank test ) . ( b ) histomorphometric analysis of the rate of new bone area in the entire measurement regions at 16 weeks after installation . the data are shown as percentages calculated as new bone area / area of measurement region 100 . the results are presented as means ( column ) sd ( bar ) and median ( open circle ) ( n = 6 ; not significant , vs. the control group by a wilcoxon signedrank test ) . ( c ) histomorphometric analysis of the rate of contact between the new bone and the implant in the entire measurement regions at 16 weeks after installation . the data are shown as percentages calculated as length of bic / entire length of each side 100 . the results are presented as means ( column ) sd ( bar ) and median ( open circle ) ( n = 6 ; * p < 0.05 , vs. the control group by a wilcoxon signedrank test ) . histologic images of the measurement regions at 4 and 8 weeks are shown in fig . villanueva goldner staining distinguishes between uncalcified osteoid ( red ) and calcified bone ( green ) . in the control group , new bone including osteoid and calcified bone was formed in the measurement region at 4 weeks , and the trabeculae of the new bone were thin and immature ( fig . 2a ) . from 4 to 8 weeks , the area of new bone expanded , the thickness of the new bone trabeculae increased , and the new bone matured into calcified bone at 8 weeks ( fig . 2c ) . in the fgf2 group , the maturity of the new bone was similar to that in the control group at 4 and 8 weeks ( fig . the amount of new bone in the fgf2 group was larger than that in the control group at each time point . ( a d ) representative histologic overview of the measurement region of the implants . specimens were harvested 4 ( a , b ) and 8 ( c , d ) weeks after installation in the control ( a , c ) and fgf2 ( b , d ) groups . ( e ) histomorphometric analysis of the rate of new bone area in the measurement regions . the area of new bone was measured in two areas , comprising an area near the existing bone side ( area 1 ) and an area further from the existing bone ( area 2 ) . the data are shown as percentages calculated as new bone area / area of measurement region 100 . the results are presented as means ( column ) sd ( bar ) and median ( open circle ) . ( n = 6 ; * p < 0.05 , vs. the control group by a wilcoxon signedrank test ) . ( f ) histomorphometric analysis of the rate of contact between the new bone and the implant in the measurement regions . the length of bic was measured on each side ( side a , side b , side c , and side d ) . the data are shown as percentages calculated as length of bic / entire length of each side 100 . the results are presented as means ( column ) sd ( bar ) and median ( open circle ) ( n = 6 ; * p < 0.05 , vs. the control group by a wilcoxon signedrank test ) . to ascertain the boneforming ability of fgf2 , we first evaluated the area of new bone including osteoid and calcified bone in the measurement regions ( fig . the new bone area in area 2 was smaller than that in area 1 at 4 and 8 weeks in the control group , indicating that bone formation was delayed in the area further from the existing bone . in the fgf2 group , the new bone area was significantly larger than that in the control group in both area 1 and area 2 at 4 weeks . in particular , in the region further from the existing bone ( area 2 ) , there was a large difference between the fgf2 group and the control group . these data indicated that fgf2 was effective for bone formation around the implants where bone formation was delayed . from 4 to 8 weeks the new bone area in the fgf2 group at 4 weeks was similar to that in the control group at 8 weeks . to examine the effect of fgf2 on osseointegration the lengths of bic were in the order of side a > side b > side c > side d at 4 weeks in the control group . the length of bic on side d was very low even at 8 weeks . these results suggested that the contact appeared to proceed from the side near the existing bone ( side a ) to the far side ( side d ) and that the far side was slow to acquire contact . in the fgf2 group , the total contact length ( side a + side b + side c + side d ) was significantly greater than that in the control group at 4 and 8 weeks . in particular , the length on side d in the fgf2 group was higher than that in the control group . the contact conditions between the new bone and the implants were observed at 12 weeks after installation ( fig . osseous matrix adhered to the implant surfaces , and no connective tissue between the bone and the implant surfaces was observed on any side in both groups . therefore , successful osseointegration was visualized at the ultrastructural level . ( a f ) electron microscopic photomicrographs of bic in the control ( a , c , e ) and fgf2 ( b , d , f ) groups at 12 weeks . to examine the effect of fgf2 on implant stability , we evaluated the isq values derived from the resonance frequencies ( fig . the isq values of around 50 at 0 weeks ( low implant stability ) increased to 80 at 4 weeks in both groups . from 4 to 8 weeks , the isq values in both groups gradually increased . the isq values in the fgf2 group were significantly higher than those in the control group at 6 and 8 weeks . the isq values in both groups barely changed after 8 weeks , and the difference between the two groups was maintained . at 16 weeks , the new bone area in the entire measurement regions in the fgf2 group was higher compared with those in the control group ( fig . interestingly , the length of bic in the entire measurement regions in the fgf2 group was significantly higher compared with those in the control group ( fig . 4c ) . thus , fgf2 was considered to enhance the implant stability . the results are presented as means sd ( n = 6 ; * p < 0.05 , vs. the control group by a wilcoxon signedrank test ) . ( b ) histomorphometric analysis of the rate of new bone area in the entire measurement regions at 16 weeks after installation . the data are shown as percentages calculated as new bone area / area of measurement region 100 . the results are presented as means ( column ) sd ( bar ) and median ( open circle ) ( n = 6 ; not significant , vs. the control group by a wilcoxon signedrank test ) . ( c ) histomorphometric analysis of the rate of contact between the new bone and the implant in the entire measurement regions at 16 weeks after installation . the data are shown as percentages calculated as length of bic / entire length of each side 100 . the results are presented as means ( column ) sd ( bar ) and median ( open circle ) ( n = 6 ; * p < 0.05 , vs. the control group by a wilcoxon signedrank test ) . we previously clarified that the fgf2 hpc formulation is efficacious for periodontal regeneration accompanied by neogenesis of alveolar bone and cementum ( murakami et al . 1999 , 2003 ; , we demonstrated that fgf2 alone promoted the acquisition of osseointegration and enhanced the stability of implants with low primary stability ( isq values of about 50 ) . notably , even in the region far from the existing bone , there was a large difference between the fgf2 group and the control group . we also showed that fgf2 markedly promoted the acquisition of osseointegration even on the furthest side . these data indicated that fgf2 was effective for bone formation and osseointegration around implants with low primary stability and that the promotional effect of fgf2 was remarkable in the region where bone formation was delayed by gaps between the implant and the existing bone . furthermore , the new bone area in the fgf2 group at 4 weeks was similar to that in the control group at 8 weeks . a covering of the implant surface with bone at the early phase is thought to play an important role in preventing the penetration of soft tissue , because the soft tissues forming at the bic interface have a negative influence on the fixation ( soballe et al . the facilitatory effects of fgf2 on the new bone formation are considered to be attributable to its strong mitogenic activity toward undifferentiated cells of the osteoblast lineage in bone marrow martin et al . 2006 ) as well as endothelial cells ( gospodarowicz et al . 1987 ) , fibroblasts , and osteoblasts ( rodan et al . these effects can be exerted even on the titanium surface of implants , because fgf2 was reported to effectively enhance the proliferation of mesenchymal stem cells on titanium particles ( jeong et al . we showed the promotional effect of fgf2 on implant stability by resonance frequency analysis , which was introduced for monitoring of implant stability ( meredith 1998 ) . the isq values in the fgf2 group from 6 to 16 weeks were significantly higher than those in the control group , indicating that fgf2 enhanced the acquisition of stability . however , the isq values were similar between the two groups at 4 weeks , although the new bone area in the fgf2 group was significantly larger than that in the control group at the same time point . the reason for this might be that the stability was not fully correlated with the amount of new bone formation , because the new bone was immature at 4 weeks . from 4 to 8 weeks , as the new bone matured , the stability of the implants increased in accordance with the amount of new bone . at 16 weeks , the length of bic in the entire measurement regions in the fgf2 group furthermore , the length of bic all around the implants in the fgf2 group was significantly higher than those in the control group at 16 weeks ( data not shown ) . these findings suggest that the bone induced by fgf2 was maintained all around the implants , thus contributing to the enhancement of implant stability . therefore , we considered that the enhanced formation of osseointegration and acquisition of high stability of the implants by fgf2 were supported by the histomorphometric analysis as well as the resonance frequency analysis . the acquisition of primary stability depends on the surrounding bone quality and quantity ( oue et al . 2015 ) . as the surrounding bone quality was lowered , the resonance frequency decreased ( huang et al . rodrigo et al . ( 2010 ) reported that 19% of implants with isq<60 failed and that even if the implants did not fail , the unstable implants did not reach the same isq values compared with the stable implants at the time of the placement of the prosthetic restoration ( 24 months after the installation ) . to improve these issues , local administration of fgf2 would shorten the treatment period and reduce the failure of implant with low primary stability based on the results in this study that fgf2 accelerated bone formation and enhanced the implant stability . furthermore , osteoporosis and diabetes mellitus may have insufficient of the primary stability and impairment for bone healing adjacent to dental implants ( nevins et al . isq value of the glucocorticoidinduced osteoporotic animals was lower than normal at the installation in the distal epiphysis of the rabbit femur ( oue et al . osseointegration measured by bic was significantly reduced for diabetic compared to control rats ( nevins et al . several previous studies have reported that fgf2 enhanced bone formation in animals with impaired ability of bone formation such as streptozotocininduced diabetic rats ( kawaguchi et al . 1994 ) and ovariectomized osteoporotic rabbits and rats ( nakamura et al . 1997 ; gao et al . based on these reports , even in patients with low bone mass and/or low boneforming activity , fgf2 is more likely to promote the acquisition of osseointegration . the present study revealed that fgf2 alone increased and accelerated bone formation and promoted the osseointegration of implants with low primary stability , and resulted in the acquisition of high stability . these findings suggest that application of fgf2 would increase the success rate in cases with a high probability of implant failure . interestingly , we previously found that combined usage of fgf2 with tcp significantly stimulated periodontal regeneration at 1walled periodontal defects in the beagle dog model ( anzai et al . thus , it would be possible to achieve osseointegration with a higher probability by topically applying fgf2 with various osteoconductive materials .

abstractobjectivesthe aim of this study was to examine the effect of basic fibroblast growth factor ( fgf2 ) on osseointegration of dental implants with low primary stability in a beagle dog model.materials and methodscustomized titanium implants that were designed to have low contact with the existing bone were installed into the edentulous mandible of beagle dogs . to degrade the primary stability of the implants , the diameters of the bone sockets exceeded the implant diameters . fgf2 ( 0.3% ) plus vehicle ( hydroxypropyl cellulose ) or vehicle alone was topically applied to the sockets in the fgf2 and control groups , respectively . in study 1 , the new bone area and length of new bonetoimplant contact ( bic ) were evaluated at 4 , 8 , and 12 weeks after installation using histomorphometry and scanning electron microscopy . in study 2 , the implant stability quotient ( isq ) values were sequentially measured for 16 weeks using an osstell system.resultsthe histomorphometric analysis revealed that the new bone area and length of bic in the fgf2 group were significantly larger than those in the control group at 4 weeks . electron microscopic observation showed intimate contact between the mature lamellar bone and the implant surfaces , osseointegration , in both groups . the isq values in the fgf2 group were significantly increased from 6 to 16 weeks compared with those in the control group.conclusionstaken together , our study demonstrates that fgf2 promoted new bone formation around the dental implants and subsequent osseointegration , resulting in promotion of stability of implants with low primary stability .

western disorders has increased dramatically worldwide over the past half - century , including obesity , diabetes , colorectal cancer , and inflammatory bowel diseases ( ibd ) [ 14 ] . the centers for disease control and prevention reports that , in the united states alone , 1/3 of adults are obese while 1.4 million adults suffer from ibd [ 4 , 5 ] . the battle over why these diseases are on the rise continues to be a topic of debate , but in the advent of new technological advances to probe these questions , recent studies are emphasizing the complexity of these disorders while also bringing to light new avenues to treat them from both a prophylactic and therapeutic perspective . inflammatory bowel diseases , both crohn s disease ( cd ) and ulcerative colitis ( uc ) are complex immune disorders that clearly exhibit a genetic basis [ 6 , 7 ] . genome - wide association studies ( gwas ) have shown that many genes correlate with the development of cd and uc , however , not every individual presenting with genetic abnormalities will develop disease . this prevents gwas to predict development and also emphasizes that genetics alone can not account for the propensity of an individual to develop cd or uc . other factors , such as environmental triggers ( i.e. , nsaids , smoking , and diet ) must play a role . indeed , dietary intake in western populations has dramatically shifted to a high - fat , high carbohydrate diet over the past - half century , nearly in concordance with the development of disease . these dietary alterations have resulted in a shift in the composite gut microbiota , from both a structure ( taxonomy ) and function ( metagenomic ) perspective , that have been shown to play a role in complex disorders such as ibd in both human and animal studies [ 1016 ] . gut bacteria outnumber human cells by nearly 10-fold and contain an estimated 1,000,000 + genes ( whereas humans contain only 23,000 ) [ 17 , 18 ] . this highlights that while genetic mutations in the human genome can be associated with ibd development , gut bacteria and their functions can not be ignored as major players in disease . the combination of genetic predisposition coupled with environmental factors that shift the gut microbiota can result in the perfect storm leading to ibd development clinical observations of patients presenting with cd or uc suggest that genetics play a role in development of disease . prevalence of either cd or uc varies among different populations , while a positive family history is exhibited amongst first - degree relatives in 622 % of affected patients . a greater concordance of ibd has been identified among monozygotic rather than dizygotic twins and syndromes resembling ibd co - segregate in families with rare genetic disorders . lastly , concordance is exhibited in the type and site of disease among families with multiple affected members [ 6 , 7 ] . however , genome - wide searches for ibd susceptibility loci have provided the most convincing evidence of a genetic link , identifying 47 risk alleles in uc and 71 in cd . one gene for which snp s have consistently been associated with cd risk is the nucleotide - binding oligomerization domain containing 2 ( nod2 also called card15 ) gene located on chromosome 16 . the gene is expressed as a cytoplasmic protein that recognizes muramyl dipeptide , a component of bacterial cell wall peptidoglycan . thus , the nod2 protein is important in the discrimination between normal intestinal flora and pathogenic bacteria . pattern recognition by nod2 initiates the signal transduction that leads to translocation of nfb to the nucleus , transcription of specific genes and activation of appropriate innate and adaptive immune responses . the most common susceptibility allele is 3020insc , which encodes a truncated nod2 protein lacking the last 33 amino acids , and shows association with cd risk both by itself and in combination with snps in other genes [ 23 , 24 ] . while heterozygote individuals are also at increased risk , nod2 homozygous individuals may have a 20-fold or more increase in susceptibility to cd , with a particular susceptibility for ileal disease . however , fewer than 20 % of patients with cd are homozygous for nod2 variants . since the discovery of nod2 , several additional susceptibility loci have been implicated in ibd : ibd5 , il23r and atg16l1 [ 2628 ] . while gwas have provided important insight into the pathogenesis of ibd , nod2 mutations , for example , only account for 25 % of cd cases in caucasians , and is not implicated in the pathogenesis of uc . furthermore , these genetic discoveries do not explain the variation in incidence between different populations or the rising incidence of disease in industrialized countries over the past 50 years . these clues suggest environmental , and perhaps even epigenetic factors , are playing an increasing role in the pathogenesis of ibd . multiple - hit hypothesis in which a genetically susceptible individual encounters a single or series of environmental triggers , which tip the scale of a compensated immune response in favor of dysregulated inflammation . evolution , acting through natural selection , represents an ongoing interaction between a species genome and its environment over the course of multiple generations . when the environment remains relatively constant , stabilizing selection tends to maintain genetic traits that represent the optimal average for a population . however , as environmental conditions change , evolutionary discordance arises between a species genome and its environment . stabilizing selection is replaced by directional selection , moving the average population genome to a new set point [ 29 , 30 ] . initially , when environmental changes occur in a population , individuals possessing the previous average genome experience evolutionary discordance . in the affected genotype , this discordance manifests itself phenotypically as disease , increased morbidity and mortality , and reduced reproductive success . there is now growing awareness and evidence that the profound environmental changes in diet that began with the introduction of agriculture and animal husbandry 10,000 years ago occurred too recently on an evolutionary time scale for the human genome to adapt [ 32 , 33 ] . in conjunction with this discordance between our ancient , genetically determined biology and the nutritional patterns in contemporary western populations , particularly of the last 50 years , many of the so - called diseases of civilization have emerged [ 33 , 34 ] . our human physiology is not the only entity that has been challenged by changes in dietary practices- the trillions of microbes that live within our intestinal bioreactor have also been forced to adapt . in many cases , these adaptations have not been favorable , and provide yet an additional hit in the multi - hit theory influencing the incidence of ibd in genetically susceptible individuals and populations ( fig . 1intake of western high fat - high carbohydrate diet promotes expansion of pathobionts in the gi tract , resulting in decreased abundance of commensals . metabolism of the emerging pathobionts leads to increased host exposure to detrimental bacterial products ( i.e. , h2s ) and reduced exposure to beneficial products , such as short chain fatty acids ( scfas ) . this results in increased immunogenic antigen exposure , prompting inflammatory cytokine production of both antigen - presenting cells ( i.e. , il-12p40 ) and t cells ( i.e. , ifn - gamma ) that increase intestinal inflammation intake of western high fat - high carbohydrate diet promotes expansion of pathobionts in the gi tract , resulting in decreased abundance of commensals . metabolism of the emerging pathobionts leads to increased host exposure to detrimental bacterial products ( i.e. , h2s ) and reduced exposure to beneficial products , such as short chain fatty acids ( scfas ) . this results in increased immunogenic antigen exposure , prompting inflammatory cytokine production of both antigen - presenting cells ( i.e. , il-12p40 ) and t cells ( i.e. , ifn - gamma ) that increase intestinal inflammation our enteric microflora interacts intimately with our intestinal mucosa and thus is both essential for metabolizing nutrients that we have not evolved to digest on our own , as well as for maturation and education of intestinal immune cells . the metabolic mutualism between host and microbe , when chronically disrupted , can result in aberrant immune responses leading to disease . as adjuvants they activate innate immune responses , including dendritic cells and other apcs , and as antigens they stimulate the clonal expansion of t cells that selectively recognize the antigen through their t cell receptor . for example , genetically susceptible hosts , including ibd patients , and genetically engineered mice with spontaneous mutations have aggressive t cell responses to luminal commensal bacteria [ 37 , 38 ] . although b cell responses to enteric microbial constituents are exaggerated in cd , uc , as well as in experimental intestinal inflammation , antibodies are not necessary to transmit disease in experimental colitis , and b - lymphocytes seem to be regulatory rather than pathogenic [ 39 , 40 ] . antibodies to bacteria have , therefore , been primarily useful as part of diagnostic tests and could potentially identify clinically important subsets of ibd patients who have selective responses to therapeutic agents and have predictable natural histories . studies of antigen specificity in ibd patientsare lacking , yet several mouse models of disease have provided great insight into the interplay between genetics and environmental factors that contribute to the development of ibd . experiments in animal models have shown that disease can be transferred to immunodeficient hosts ( such as t cell - deficient severe , combined immunodeficient ( scid ) , rag mice , as well as nude rats ) via t cells that respond to commensal enteric bacteria . . demonstrated that t cell clones that respond to cecal bacterial lysates transfer colitis to scid mice , but that nonspecifically activated t cells do not . since then , they have also demonstrated that flagellin - specific t cell clones can transfer colitis to scid mice . in over 12 different animal models , colitis and immune activation additional studies have demonstrated both bacterial species and host specificity for the induction of experimental colitis . studies utilizing the il-10 deficient mouse ( il-10 ) , regardless of background strain , have shown that development and severity of spontaneous colitis is dependent upon the milieu of the enteric gut microbiota [ 43 , 44 ] . penetrance of colitis rises to nearly 100 % in these mice when the enteric microbiota contains helicobacter hepaticus and is defined by a t - helper 1 ( th1 ) ifn - gamma response . however , when il-10 mice are maintained under germ - free conditions , this mouse does not develop spontaneous colitis [ 36 , 43 ] . even in this spontaneous model of colitis , disease can manifest differentially based on the gut bacteria present . monoassociation of germ - free il-10 mice with the commensal bacteria bilophila wadsworthia or e. coli induces phenotypically distinct forms of colitis . b. wadsworthia induces an intermediate onset of colitis ( 35 weeks after bacterial colonization ) and involves the distal colon , with low - grade colitis accompanied by an exclusively th1-mediated immune response . interestingly , the colitis is much more severe when this bacterium blooms in the presence of other bacteria ( i.e. , specific pathogen free il-10 mice ) . in contrast , e. coli monoassociation leads to relatively early ( 3 weeks ) onset of a mild - to - moderate inflammation that is most severe in the cecum . preliminary studies show that klebsiella monoassociation induces moderate pan - colitis and bifidobacterium animalis monoassociation leads to distal colonic and duodenal inflammation [ 46 , 47 ] . these results demonstrate that even a traditionally probiotic bacterial species can induce inflammation in a susceptible host , raising concern over the safety of probiotic therapy in some patients . the requirement for host specificity is demonstrated by the variable responses to three unique bacterial species in three different models of colitis : b. wadsworthia and e. coli both increase the incidence of colitis in monoassociated il-10 mice , but bacteroides vulgatus , for example , does not . in contrast , b. vulgatus , but not e. coli , induces colonic inflammation in hla - b27 transgenic rats , and neither causes disease in bone - marrow - transplanted cd3 transgenic mice . similarly , various probiotic species elicit varying results in the same host , while different hosts respond variably to the same probiotic species . these studies suggest that the disease risk and phenotypes in a single host are highly dependent on the composition of microbiota in the context of different genetic backgrounds . implied from these observations is the likelihood that personalized therapies for individuals will have to be designed , based on host genetics , biological responses , and gut microbial functional profiles . in addition , dietary components may become a complementary element of personalized therapies . we know that particular dietary components can alter the composition and virulence of commensals ; as stressed earlier , this may provide one potential explanation for the marked increase in the incidence of ibd ( and other new age disorders ) in western countries over the last 50 years , and more recently in eastern countries , as they adopt western dietary practices . increased fat consumption is a hallmark of western dietary practices and has been linked to increased prevalence of ibd . however , many of these studies have only examined the total amount of fat in the diet rather than the fat source . demonstrated that the type of dietary fats can dramatically reshape the gut microbiota , which can shift the balance of host - microbe interactions in ways that perturb immune homeostasis in genetically - prone individuals and trigger the onset of colitis . the study showed that only the milk fat - based saturated fat diet precipitated disease in genetically susceptible il-10 mice by inducing a bloom of the pathobiont b. wadsworthia . however , this finding should not be taken out of this rigorously defined experimental context to suggest that high dietary consumption of milk fat precipitates disease in every individual . the caveat is that environmental and dietary triggers for individuals are highly variable and depend on convergence of numerous factors . a diet high in milk fat in one person may not be the triggering factor for another . the recognition that new age disorders come about by multiple - hit events underscores the importance of personalized medicine in the future where combinatorial factors can be used to assess risk in genetically susceptible individuals . similarly , studies have shown that non - absorbed carbohydrates ( prebiotics ) such as inulin and fructooligosaccharides enhance the growth of beneficial bifidobacterium and lactobacillus species providing a substrate for the production of short - chain fatty acids ( scfas ) by these bacterial species . the scfa s , especially butyrate , are the preferred metabolic substrates of colonocytes , and can stimulate various mucosal barrier functions . indeed , a study examining twin pairs , with one healthy twin and one with cd showed that metagenomic and metaproteomic potential was altered in the afflicted twins . here , reduced diversity was coupled with a reduction in several functional pathways , including carbohydrate metabolism . more specifically , those enzymatic pathways involved in complex carbohydrate metabolism that would result in scfa production were diminished . in addition , pathways involved in mucin degradation were also decreased in cd patients , indicating that the potential to breakdown oligosaccarhides is diminished during cd . additionally , a study using methods to predict function via 16s rrna analyses and validated by shotgun metagenomics on a subset of samples also noted a reduction in pathways involved in scfas in cd patients when compared to healthy controls . morgan et al . , correlated their predicted bacterial function analyses to recorded environmental metadata ( including smoking and antibiotic / anti - inflammatory drug usage ) , in patients versus controls , however , neither of these studies tracked dietary intake of these patients and their respective controls . therefore , interpretation of the effects of cd versus dietary intake or their interaction is difficult . regardless of the lack of dietary correlations , it would seem that cd patients might benefit from a re - shaping of their gut microbiota to promote metabolic pathways that would increase scfas . however , these types of therapies may not benefit all individuals , and clinicians must begin to think about treating ibd at the individual level rather than at a one - size - fits - all level in order to specifically tailor their recommendations . there is now compelling data to suggest genetically susceptible hosts who are unable to clear an invading pathogen and/or generate tolerogenic immune responses to commensal microbial agents proceed to chronic , relapsing intestinal inflammation . resistance to t cell apoptosis , lack of response to downregulatory signals , as well as continuous exposure to luminal antigens and adjuvants help sustain this inflammatory response . it is very likely that environmental factors such as diet may , in turn , profoundly affect mucosal immune responses and enteric bacterial populations . in addition , in an experimental setting utilizing mouse models of intestinal inflammation , dietary variation can be carefully controlled , and generally , only one aspect of dietary intake ( fat , carbohydrate , or protein ) will be modified in a given experiment . many interactions between dietary components can be missed , especially in the context of the gut microbiota . it is therefore unlikely that one dietary modification will alleviate all symptoms of ibd , and other factors ( i.e. , lifestyle , medications , etc . ) should also be considered . however , once these interactions have been clearly defined and mechanistically described using a variety of human and mouse models of intestinal inflammation , these concepts can be utilized in the clinic as alternative and complementary approaches to prevent / treat ibd , even in the face of western diets that negatively shift gut bacteria in the genetically susceptible host ( fig . 2microbiota - centric therapeutic strategies , including prebiotics , probiotics , or dietary modulation can promote an increase in short chain fatty acid ( scfa ) production even in the context of a western diet . the therapeutic strategies may restore immune balance , promoting anti - inflammatory properties ( such as t - regulatory cell function ) leading to a decrease of intestinal inflammation in the genetically - susceptible host microbiota - centric therapeutic strategies , including prebiotics , probiotics , or dietary modulation can promote an increase in short chain fatty acid ( scfa ) production even in the context of a western diet . the therapeutic strategies may restore immune balance , promoting anti - inflammatory properties ( such as t - regulatory cell function ) leading to a decrease of intestinal inflammation in the genetically - susceptible host the impact of western diets on gut microbiota and disease outcomes has become increasingly recognized and may account for the observed rising trends in disorders , such as ibd , over the past half century . in the advent of non - culture based techniques to study the gut microbiota , the intricate interplay between host genetics and the metagenomic / functional potential of the bacteria can be both explored and exploited . the knowledge gained through further inquiry into the interactions between the host , the environment , and the gut bacteria will help us understand the importance of environmental factors , particularly dietary trends , on human health as they pertain to ibd patients . these concepts can serve as a basis for formulating both prophylactic and therapeutic approaches that are feasible and acceptable to the general population in the era of personalized medicine .

the incidence of inflammatory bowel diseases ( ibd ) , as well as other inflammatory conditions , has dramatically increased over the past half century . while many studies have shown that ibd exhibits a genetic component via genome - wide association studies , genetic drift alone can not account for this increase , and other factors , such as those found in the environment must play a role , suggesting a multiple hit phenomenon that precipitates disease . one major environmental factor , dietary intake , has shifted to a high fat , high carbohydrate western - type diet in developing nations , nearly in direct correlation with the increasing incidence of ibd . recent evidence suggests that specific changes in dietary intake have led to a shift in the composite human gut microbiota , resulting in the emergence of pathobionts that can thrive under specific conditions . in the genetically susceptible host , the emerging pathobionts can lead to increasing incidence and severity of ibd and other inflammatory disorders . since the gut microbiota is plastic and responds to dietary modulations , the use of probiotics , prebiotics , and/or dietary alterations are all intriguing complementary therapeutic approaches to alleviate ibd symptoms . however , the interactions are complex and it is unlikely that a one - size - fits all approach can be utilized across all populations affected by ibd . exploration into and thoroughly understanding the interactions between host and microbes , primarily in the genetically susceptible host , will help define strategies that can be tailored to an individual as we move towards an era of personalized medicine to treat ibd .

during malignant transformation , cells undergo stages of gene expression reprogramming and mutagenesis that alter their metabolic phenotype(s ) [ 15 ] . initial stimuli ( not all known ) dysregulate information signaling and activate oncogenes and/or cancer stem cells , resulting in a partial glycolytic warburg phenotype [ 15 ] in which pyruvate is diverted , at least to a certain extent , from oxidative phosphorylation ( oxphos ) . high proliferation and impaired angiogenesis subsequently cause hypoxia in certain regions within a growing tumor , and then hypoxia - mediated metabolic reprogramming ( such as that promoted by hypoxia - induced factor , hif [ 68 ] ) further intensifies the glycolytic phenotype and may nearly completely divert pyruvate from pyruvate dehydrogenase ( pdh ) , that is , from oxphos . the sustained high rate of cell proliferation , however , results in aglycemia , initiating the revival of oxphos in conjunction with the promotion of glutaminolysis [ 1 , 2 , 9 , 10 ] . the overall glutaminolysis provides cytosolic pyruvate / lactate and also yields nadph via citrate export from mitochondria and subsequent atp - citrate lyase and malic enzyme reactions . this compensates for the reduced net energy production by the glycolytic pathway and pentose phosphate pathway ( ppp ) . pyruvate imported into mitochondria is the precursor of not only acetyl - coa but also citrate , which is required for fatty acid synthesis and hence for phospholipid synthesis , so it is essential for cell growth [ 15 ] . the final established phenotype is exemplified by human glioblastoma cells , which , despite their low respiration , maintain a constant pyruvate flux through pdh and hence partial oxphos . for the purpose of this paper , we shall use the term glutaminolysis in a more general way than just the transformation of glutamine to 2-oxoglutarate ( 2og ) . if 2og resulting from glutamine acts in the forward krebs cycle ( despite possible ongoing citrate extrusion and truncation of the cycle so that aconitase and classic nad - dependent isocitrate dehydrogenase ( idh3 ) reactions are not required ) , we define the system of metabolic reactions involved as oxphos glutaminolysis . this term points out to its essential dependence on succinate dehydrogenase ( complex ii ) and hence on respiration and oxphos . in contrast , when the reductive carboxylation of 2og by isocitrate dehydrogenase 2 ( idh2 ) ( in the counter krebs cycle direction ) consuming nadph follows glutaminolysis of glutamine to 2og and when the reverse aconitase reaction and citrate efflux are added , we define that system as reductive carboxylation glutaminolysis ( rcg ) , also referred to as the latter term denotes the absolute independence of oxygen ( respiration ) . in general although it acts frequently in broad cancer types , glutaminolysis is not universal for all cancers [ 35 ] . in cancer cells employing oxphos glutaminolysis , glutamine can fully compensate for the lack of glucose in terms of energy generation and syntheses of precursors for anabolic pathways [ 35 ] . thus , to survive under conditions of limited glucose , highly glycolytic cancer cells may adapt to glutaminolysis , which in its oxphos mode restores oxphos and may restore also at least partial pdh function [ 1 , 3 , 1214 ] . in normal cells , mitochondrial glutaminase catabolizes glutamine to produce ammonia and glutamate , which is further transaminated by glutamate dehydrogenase into 2og to feed the krebs cycle . in malignant tumors , negative allosteric effectors , such as gtp , inhibit glutamate dehydrogenase , resulting in a move toward glutaminolysis , where glutamate and pyruvate are reactants in a transamination reaction that produces , for example , alanine and 2og by alanine aminotransferase ( transaminase ) . in cancer cells , 2og usually feeds the forward - running krebs cycle truncated after citrate synthase during citrate extrusion , so that aconitase and classic nad - dependent idh3 reactions are not required [ 1 , 5 ] . this oxphos glutaminolytic mode is strictly dependent on oxaloacetate and acetyl - coa , that is , on the citrate synthase reaction ; hence , it proceeds only in cells in which oxaloacetate is provided by malate dehydrogenase fed by the krebs cycle as well as by malate import from the cytosol , where malate originates from atp - citrate lyase reaction . likewise incomplete inhibition of pdh restores acetyl - coa in mitochondria ( the pyruvate pool is split between the pdh and transaminase reactions ) . also , the mitochondrial malic enzyme may contribute to this pool by producing pyruvate from malate . citrate is extruded from mitochondria and converted to oxaloacetate and acetyl - coa by atp citrate lyase . acetyl - coa is then used to produce fatty acids by fatty acid synthase and cholesterol for general lipid synthesis , which is essential for cancer cell proliferation [ 18 , 19 ] . in glioblastoma , if there is excess nadh in the cytoplasm ( produced by aerobic glycolysis ) , the cytosolic oxaloacetate is converted first to malate by malate dehydrogenase and then to pyruvate by the cytosolic malic enzyme , thus may also contribute to lactate production [ 9 , 20 ] . moreover , alanine that is released by transaminase is used for cytosolic amino acid transformations and protein synthesis [ 1 , 4 , 5 ] . hypothetically , malignant tumors may survive on intermittent oxphos - independent rcg ( also termed anoxic glutaminolysis ) in parallel with intermittent glycolytic periods [ 1 , 2 ] . rcg utilizes reductive carboxylation of 2og by the reverse reaction of mitochondrial idh2 at the expense of nadph , followed by the reverse aconitase reaction and citrate efflux from the matrix [ 13 , 2123 ] . nadph is provided by the malic enzyme converting malate to pyruvate and might also be provided by the mitochondrial transhydrogenase . the oxphos independence of this mode means that it may proceed at any level of hypoxia and even at anoxia , thus increasing malignancy [ 1 , 3 ] . the reductive carboxylation involves idh2 , which converts 2og to isocitrate , from which the reverse aconitase reaction produces citrate , which is again exported from the mitochondrial matrix to the cytosol for fatty acid and lipid synthesis . note that acetyl - coa , and hence the pdh reaction , is not required in this mode . idh3 encodes a mitochondrial matrix nad - dependent octameric idh3 ( 422 subunits ) that acts in the krebs cycle . idh3 is allosterically positively regulated by ca , adp , and citrate and negatively regulated by atp , nadh , and nadph . the two other idh genes , idh1 and idh2 , encode cytosolic and mitochondrial matrix nadp - dependent ( or nadph - dependent ) idh1 and idh2 , respectively , which are structurally and genetically unrelated to idh3 ( table 1 ) . idh3 irreversibly decarboxylates isocitrate to yield 2og while reducing nad to nadh , whereas idh1 and idh2 catalyze reversible reactions , either decarboxylating isocitrate to 2og while reducing nadp to nadph or acting in the reductive carboxylation reaction to convert 2og to isocitrate while oxidizing nadph to nadp . heterozygous mutations in idh2 at arg172 and at the analogous residue arg132 in idh1 are frequently found in grade 2 and 3 gliomas , secondary glioblastomas , and acute myeloid leukemia ( aml ) , but they occur less frequently in primary glioblastomas and other cancers [ 2837 ] . no homozygous deletions of idh1 and idh2 have been found , as has been observed for classic tumor suppressors . nevertheless , mutated idh1 and idh2 exhibit a neomorphic enzyme activity , reducing 2og to d-2-hydroxyglutarate while converting nadph to nadp[23 , 29 , 36 , 3840 ] . interestingly , the d-2-hydroxyglutarate thus formed further promotes neoplasia by competitive inhibition of histone demethylation and 5-methyl - cytosine hydroxylation , leading to genome - wide alternations in the methylation of histones and dna . it has also been reported that glioblastoma sf188 cells produce d-2-hydroxyglutarate , in spite of lacking the above - described mutations . moreover , idh2 , like ~20% of other mitochondrial enzymes [ 42 , 43 ] , is acetylated at lysines , which inactivates the enzymatic activity . in turn , deacetylation of idh2 by the mitochondrial matrix deacetylase sirtuin 3 ( sirt3 ) activates the enzyme to produce more nadph . in nonmalignant cells , the cytosolic idh1 is involved in lipid metabolism and glucose sensing . idh2 was traditionally considered to be involved in the regulation of oxphos and redox homeostasis ( see section 4 ) , and its involvement in reductive carboxylation has been recognized only recently ( sections 2.4 and 3 ) . nadp - dependent oxidative decarboxylation of isocitrate to 2og , as the major function of idh2 in nonmalignant cells , contributes substantially to the control of mitochondrial redox balance and the prevention of oxidative damage [ 45 , 46 ] . idh2 contains an n - terminal mitochondrial addressing sequence and hence is imported to the mitochondrial matrix , although localization to nuclei has also been reported . idh2 expression in heart , skeletal muscle , and lymphocytes is quite substantial ; lower levels are found in liver , kidney , and lung [ 45 , 47 ] . idh2 has also been found in cultured rat neurons , astrocytes , oligodendrocytes , and microglia . unlike idh1 , the 94-kda idh2 ( ec 1.1.1.42 ) is a homodimeric enzyme of two 413-amino acid subunits , each 47 kda [ 50 , 51 ] ( figure 1 ) . idh2 function requires a divalent metal ion , and bound mn yields the maximum activity . the structure of the mn - isocitrate binding site was mapped from the solved crystal structure of porcine idh2 . within the site , thr78 , ser95 , and asn97 ( of the porcine sequence ) donate a hydrogen bond to the c3 carboxyl , whereas asp252 and asp275 coordinate mn . the nadp binding site was originally predicted from the e. coli idh structures , positioning the 2-hydroxyl - bound phosphate to interact with his315 and lys374 of porcine idh2 . porcine arg83 enhances nadp affinity by hydrogen bonding with the 3-oh of the nicotinamide ribose , and asn328 provides a hydrogen bond to the n1 of adenine . for efficient coenzyme site function , a hydroxyl group must be present at position 373 ( thr373 of the porcine sequence ) , whereas asp375 and lys260 contribute to coenzyme affinity and catalysis [ 54 , 55 ] . within the numbering of the human idh2 sequence , mutations in arg172 ( an analog of frequently mutated arg132 of cytosolic idh1 ) are detected in gliomas [ 23 , 36 , 37 ] , and mutations in arg172 and arg140 ( which is adjacent in the active site to arg172 ) are found in aml . mutations are apparent after the transition from a normal cell to a clinically evident tumor . arg172 ( as well as arg132 of idh1 ) provides hydrogen bonds to the and carboxyls of isocitrate and may be important in the transition from an open to closed state of the active site . the porcine arg residue mutated to asn in a position analogous to human arg172 displays a twofold reduction in specific activity and a km for isocitrate that is two orders of magnitude higher ( table 1 ) . likewise , in lysates of cells overexpressing idh2 , activity is reduced when arg172 is substituted with gly , lys , or met . nevertheless , the existence of exclusively heterozygous idh2 ( and idh1 ) mutations in gliomas and aml and the small possibility of dominant - negative mutations ( minor mutant fractions existing could not exert this role ) have led to the search for other consequences of idh1 and idh2 mutations . arg132 mutants of cytosolic idh1 ( table 1 ) and arg172 mutants of mitochondrial idh2 [ 23 , 36 , 38 , 39 ] possess the ability to reduce 2og to d-2-hydroxyglutarate while converting nadph to nadp . this is because the active closed state of the enzyme exhibits a higher affinity for nadph . mutant idh2 and idh1 are not supposed to allow the reductive carboxylation reaction of 2og to isocitrate . initially , the production of d-2-hydroxyglutarate in gliomas , secondary glioblastomas , and aml by mutant idh2 results in a decrease of 2og and hence depletion of succinate , fumarate , and malate from the rest of the krebs cycle [ 23 , 36 , 39 ] . interestingly , idh2 mutations also lead to increases in amino acid levels as would be expected for ongoing glutaminolysis . thus , the formed d-2-hydroxyglutarate strengthens the neoplastic phenotype by competitive inhibition of histone demethylation and 5-methyl - cytosine hydroxylation , leading to genome - wide alternations in histone and dna methylation . moreover , prolyl hydroxylase domain enzymes , which employ 2og as a cofactor for marking hypoxia - induced factor-1 ( hif1 ) by proline hydroxylation , are inhibited by d-2-hydroxyglutarate as well as by the lack of 2og . as a result , hif1 is stabilized ( if its inhibitor , aspartyl hydroxylase factor inhibiting hif , is not active ) even at normoxia and thus can elicit the otherwise hypoxic reprogramming of gene expression . glutathionylation of proteins by the reversible glutaredoxin ( thioltransferase ) reaction serves to protect against irreversible oxidation of cysteines . such protection has been demonstrated for idh2 in that oxidized glutathione can inactivate idh2 by forming a mixed disulfide bond with cys269 . the inactivated idh2 is reactivated by glutaredoxin 2 in the presence of reduced glutathione . also , idh2 in mouse heart may exist in complex with calcineurin , containing as well aconitase , malate dehydrogenase , and mnsod . posttranslational modifications of numerous mitochondrial proteins frequently occur via acetylation / deacetylation of lysine residues [ 42 , 43 , 60 , 61 ] . among seven sirtuin family members , sirt3 , sirt4 , and sirt5 are enriched in mitochondria , such as exemplified and well described for sirt3 up to date [ 42 , 43 , 62 ] . caloric restriction prevents age - related hearing loss by reducing oxidative dna damage , but such is not the case for mice lacking sirt3 . sirt3 directly deacetylates the idh2 lysines and thus activates idh2 , which in its forward mode could result in increased nadph levels and thereby maintain reduced glutathione levels in mitochondria . indeed , overexpression of sirt3 and/or idh2 leads to increased nadph levels and is protective against oxidative stress - induced cell death . lys212 , lys374 , and lys260 ( porcine sequence ) may be the prime candidates for acetylation / inactivation . it remains to be shown that sirt3 can deacetylate these residues , however , and it should be investigated which reaction modes are active and possible before and after such activation , specifically , whether the reverse , nadph - dependent , reaction and rcg could be activated . as predicted in 1994 by sazanov and jackson ( see also ) , the reductive carboxylation reaction by native idh2 converts 2og to isocitrate while oxidizing nadph to nadp . the arg172 and arg140 mutants of idh2 [ 23 , 36 , 38 , 39 ] and glioblastoma sf188 cells under hypoxia convert 2og to d-2-hydroxy - glutarate in this reverse - reaction mode . this reductive carboxylation would proceed better in vivo when followed by the reverse aconitase reaction and subsequent citrate export from the mitochondrial matrix . reductive carboxylation was demonstrated for idh2 in 2002 and was indicated for cancer cells in transformed brown adipocytes , pediatric glioma sf188 cells [ 23 , 41 ] , and uok262 cells ( derived from a renal tumor in a patient with hereditary leiomyomatosis , these cells are defective in respiration and devoid of fumarate hydratase activity ) . reductive carboxylation accompanied by citrate efflux has also been found in quiescent fibroblasts and is enhanced in contact - inhibited fibroblasts . idh2 silencing in sf188 cells results in diminished conversion of glutamine to citrate [ 23 , 41 ] . recently , reductive carboxylation was detected in human osteosarcoma 143b cells in which the mitochondrial dna encoded a loss - of - function mutation in respiratory chain complex iii ( cytb 143b cells ) . because only low - level reductive carboxylation was detected in wild - type 143b cells , the authors suggested that the impairment of oxphos , such as given by mutant mitochondrial dna , induces rcg . silencing of either idh1 or idh2 reduces the growth of both wild - type and cytb 143b cells . moreover , unlike in wild - type 143b cells , de novo fatty acid synthesis from glutamine as a precursor is prevalent in cytb 143b cells . reductive carboxylation in fumarate hydratase devoid uok262 cells , which are defective in respiration , has also been identified in parallel with oxphos glutaminolysis . interestingly , inhibition of respiration in mouse embryonic fibroblasts via administration of antimycin , rotenone , or metformin induces a switch towards rcg . thus , these data provide additional support for the authors ' hypothesis that rcg is a common cellular response to impaired mitochondrial metabolism . the reverse idh2 reaction was also considered such that idh2 acts together with the forward reaction of idh3 in a dissipative isocitrate/2og cycle ( see section 4.2 ) . the reductive carboxylation reaction and the overall rcg may indeed proceed together with the forward decarboxylation reaction [ 2 , 22 ] . the best evidence was obtained by tracking the metabolites of c - labeled glutamine , such as the appearance of c - label in citrate [ 2 , 22 , 23 , 41 ] . the first demonstrations of rcg in cancer cells [ 22 , 23 , 41 ] are consistent with the recent findings that mutant idh2 in gliomas and aml also produce d-2-hydroxyglutarate from 2og by alternate reduction . because these mutants are heterozygous , both rcg and the production of d-2-hydroxyglutarate might occur . the former reaction involves the nonmutant nadph - dependent idh2 reverse reaction followed by isocitrate conversion to citrate and by citrate export . the mutant idh2 ( but maybe also wild - type idh2 , see ) acting in a reverse mode also produces d-2-hydroxyglutarate , which can not be transformed by aconitase ; however , it further enhances the malignant phenotype . the importance of this neomorphic idh2 activity for the cancer phenotype is valid even without consideration of d-2-hydroxyglutarate interference with epigenetics and the hif pathway , because idh2 depletes 2og from the krebs cycle . the consumption of nadph in the matrix is a consequence of the altered homeostasis of reactive oxygen species ( ros ) in cancer cells ( see section 4.2 ) and is also possible due to nadph production by the mitochondrial malic enzyme [ 1 , 5 ] and transhydrogenase [ 24 , 63 , 67 ] . it is not known whether sirt3-based activation also affects this reverse ( nadph - dependent ) idh2 reaction . although nadh , rather than nad , accumulates in the mitochondrial matrix of highly glycolytic cancer cells in which oxphos is dormant ( figure 2(a ) ) , nad might be produced by the inner membrane h transhydrogenase from nadh with the simultaneous formation of nadph from nadp in the matrix , thereby activating sirt3-mediated idh2 deacetylation . moreover , the usual acetylation of proteins may be retarded in highly glycolytic cancer cells ; hence , no sirt3-mediated deacetylation would be required . unlike glycolysis , rcg does not form atp . hence , either rcg coexistence with glycolysis or intermittent glycolysis is expected under hypoxic and deep hypoxic conditions ; that is , rcg may help cancer cells survive aglycemia and hypoxia in malignant cells . as clearly demonstrated by the examples of gliomas and aml with the oncogenic metabolite d-2-hydroxyglutarate , the establishment of rcg , even concomitantly with oxphos glutaminolysis ( note that this mode does not require idh2 and aconitase reactions ) , helps to accelerate the malignant phenotype . recently , it has been demonstrated that hypoxia elevates rcg in sf188 cells in a hif - dependent manner . sf188 cells were able to proliferate at 0.5% o2 even if such hypoxic conditions substantially diminished glucose - dependent production of citrate , that is , oxphos and forward krebs cycle participation . a major function of idh2 in nonmalignant cells , when acting within the forward krebs cycle , is likely maintaining an adequate pool of reduced glutathione and peroxiredoxin by providing nadph . this function improves the mitochondrial redox balance and prevents oxidative damage [ 45 , 46 , 69 ] , including heat - shock - induced oxidative damage and numerous consequent events of oxidative stress , such as ros - induced apoptosis [ 71 , 72 ] , apoptosis induced by ionizing radiation and cadmium , and staurosporine - induced cell death . the lack of idh2 or its activity elevates cytosolic ros , lipid peroxidation , and oxidative dna damage and shortens cell survival after oxidant exposure [ 69 , 7173 ] . also , susceptibility to curcumin - induced apoptosis has been demonstrated upon idh2 silencing in hct116 cells . cardiac hypertrophy development is attributed to a decrease in idh2 activity owing to the lipoperoxidation product 4-hydroxynonenal and oxidative stress . idh2 is also protective for paraquat - mediated oxidative inactivation of aconitase in heart mitochondria . inactivation of idh2 activity by various ros insults is an important factor that has to be accounted for in any consideration of oxidative stress in cells . the forward krebs cycle activity of idh2 is inactivated by 4-hydroxynonenal , singlet oxygen , hypochlorous acid , aluminum , nitric oxide , and peroxynitrite . peroxynitrite forms s - nitrosothiol adducts on cys305 and cys387 of idh2 under nitrosative stress , such as that established in the liver of ethanol - fed rats . idh2 activity first increases and then decreases with age in fibroblasts and liver , kidney , and testes tissues of rats fed ad libitum but not of those fed a calorie - restricted diet . recently , caloric restriction has been proven to act via idh2 deacetylation through sirt3 and thus promote an antioxidant role for idh2-produced nadph . it is not known whether sirt3-mediated deacetylation also activates the nadph - dependent reverse reaction , that is , reductive carboxylation . the dissipative isocitrate/2og cycle has been suggested based on the reductive carboxylation reaction of idh2 ( counter krebs cycle reaction direction , nadph dependent ) in conjunction with the forward idh3 reaction in the canonical krebs cycle . the cycle may manifests itself in the absence of citrate export from mitochondria , as normally occurs in non - malignant cells , since cycling is impossible when reversed aconitase reaction depletes isocitrate . isocitrate formed by the reductive carboxylation reaction of idh2 is processed back to 2og by idh3 . although in non - malignant cells complex i regenerates nadh to nad and nadp could be regenerated to nadph by , for example , mitochondrial malic enzyme , with increasing malignancy ( more dormant state of mitochondria and hence decreasing respiration ) , the mitochondrial inner membrane h transhydrogenase [ 24 , 63 , 67 ] may alternatively transfer electrons from nadh and nadp to nadand nadph at the expense of the proton - motive force . however , it remains to be determined , whether this cycle is possible with d-2-hydroxyglutarate . if d-2-hydroxyglutarate was metabolized by idh3 in the canonical krebs cycle , then the cycle would be automatically induced by the appearance of d-2-hydroxyglutarate at simultaneously active h transhydrogenase . nevertheless oxphos can not be completely dormant , since proton - motive force would be required for this normal forward transhydrogenase reaction . consider the situation in highly malignant cells in which energy is derived primarily from glycolysis disconnected from oxphos ( warburg phenotype ) and high reductive carboxylation glutaminolysis takes place ( figure 2(a ) ) . presumably , oxphos impairment or deep hypoxia may set up this metabolic pattern . in this case , higher glucose-6-phosphate dehydrogenase activity ( the first ppp enzyme ) produces more nadph . it may be erroneously considered as antioxidant action ; however , because the constitutively expressed nadph oxidase isoform-4 , nox4 [ 89 , 90 ] , can consume a major portion of the excess nadph and produce more superoxide and consequently release more h2o2 into the cytosol , the overall reaction scheme may be prooxidant ( figure 2(a ) ) . recently , nox4 was also suggested to have mitochondrial localization . probably , nox4 has km in the same order of magnitude as idh enzymes . the nox4 consumption of nadph leaves fewer redox equivalents for the reduction of cellular glutathione and other redox systems [ 9294 ] . the cytosolic oxidative stress is further intensified by the slow electron transport in low respiring ( dormant ) mitochondria of highly malignant cancer cells [ 15 , 68 ] , resulting in more superoxide release to the cytosol as well as the mitochondrial matrix from the respiratory chain . the ongoing maximum reductive carboxylation reaction further contributes to the oxidative stress by consuming nadph , thus leaving less nadph for maintenance of the reduced glutathione pool . moreover , as mentioned above , the accumulated nadh at slow respiration may lead to nad formation in the reversed h transhydrogenase reaction by concomitant nadph formation from nadp to further feed the nadph pool and hence reductive carboxylation . simultaneously , nad may lead to sirt3-mediated activation of idh2 , at least of its forward mode , but it is not known whether reductive carboxylation is also activated by deacetylation of idh2 . we next consider an intermediate warburg phenotype , characterized by the mixed use of sole glycolysis , that is , aerobic glycolysis producing lactate , and oxphos ( figure 2(b ) ) . the latter may be represented either by oxphos pyruvate metabolism and/or by oxphos glutaminolysis . under these conditions , considerable cytosolic oxidative stress is expected because of the elevated nox4 activity , as described above . however , a lower mitochondrial contribution to the cytosolic oxidative stress exists owing to an intermediate level of respiration and hence lower superoxide release from mitochondria to both the cytosolic and matrix compartments . there is also lower oxidative stress expected in the matrix owing to the possible ongoing dissipative isocitrate/2og cycle , which by decreasing the proton - motive force decreases mitochondrial superoxide formation . this can be considered , however , only when citrate efflux from mitochondria is not dominant or when d-2-hydroxyglutarate would be cycling instead of isocitrate/2og . if this is the case , nad rather than nadh would accumulate , further feeding the isocitrate/2og cycle by simultaneous action of the forward idh3 reaction and reverse ( reductive carboxylation ) reaction of idh2 . the accumulated nad would also promote sirt3-mediated idh2 deacetylation , consequently accelerating the idh2 branch of the reaction cycle ( figure 2(b ) ) . finally , we consider the situation in non - malignant cells , in which oxphos predominates and the sole glycolysis and ppp activities are low ( figure 2(c ) ) . in this case , low oxidative stress in the cytosol is a consequence of the negligible nox4 activity and the low contribution of mitochondria to the cytosolic ros pool . under these normal conditions , we assume that the forward idh2 reaction generates nadph , which further improves the reduced state of the mitochondrial matrix glutathione and peroxiredoxin systems . indeed , ample evidence suggests that in cells with unattenuated oxphos , idh2 plays an important antioxidant role that is further strengthened by nad accumulation in highly respiring cells . nad then induces sirt3-mediated idh2 deacetylation , thus increasing its protective function in nadph formation for the maintenance of the reduced glutathione and peroxiredoxin systems and for self - maintenance by the reactivation of cystine - inactivated idh2 by glutaredoxin-2 . ( a ) situation in cancer cells with a prevalent warburg phenotype and high reductive carboxylation . in the cytosol , higher glucose-6-phosphate dehydrogenase activity ( g6pdh ) produces higher nadph within the pentose phosphate pathway ( ppp ) . nadph - oxidase isoform-4 ( nox4 ) thus produces more superoxide and consequently contributes to high levels of reactive oxygen species ( ros ) in the cytosol . the cytosolic oxidative stress is further intensified by the slow electron transport in low - respiring ( dormant ) mitochondria , leading to higher superoxide release to the cytosol and matrix compartments . the ongoing maximum reductive carboxylation reaction further contributes to oxidative stress by consuming nadph , thus leaving less for maintenance of the reduced glutathione pool . the accumulated nadh at slow respiration may lead to nad formation in the reverse h transhydrogenase ( th ) reaction ( due to low proton / motive force ) with concomitant nadph formation from nadp to further feed the nadph pool and hence reductive carboxylation . hypothetically , nad may lead to sirtuin 3 ( sirt3)-mediated deacetylation / activation ( + ) of idh2 , but it is not known whether reductive carboxylation is also activated by deacetylation of idh2 . ( b ) situation in cancer cells with an intermediate warburg phenotype and possible oxphos glutaminolysis . the major contribution to however , a lower mitochondrial contribution to cytosolic ros leads to intermediate oxidative stress under these conditions . indeed , an intermediate or high respiration leads to much lower superoxide production and release from the mitochondria to both the cytosolic and matrix compartments ( dashed arrows ) . lower oxidative stress is also expected in the matrix owing to the ongoing dissipative isocitrate/2og cycle , which decreases further mitochondrial superoxide formation by decreasing the proton - motive force . oxphos glutaminolysis may predominate under these conditions ; hence , rcg might not be completed and the isocitrate/2og cycle with forward h transhydrogenase reaction may be initiated . aerobic glycolysis and ppp activity are low ; consequently , low oxidative stress in the cytosol also results from the negligible nox4 activity and the low contribution of mitochondria to the cytosolic ros . the forward idh2 reaction thus forms nadph , which further improves the reduced state in the mitochondrial matrix glutathione and peroxiredoxin systems . as in ( b ) , the nad accumulation in highly respiring cells then induces sirt3-mediated deacetylation / activation of idh2 . as briefly described above , mutant idh2 as well as idh1 [ 96100 ] produce d-2-hydroxy - glutarate , which can initiate an hif - mediated hypoxic type of gene reprogramming even at normoxia . nevertheless , detail investigations of d-2-hydroxyglutarate effects on hif signaling are required , since recently an opposite effect , diminishing hif levels by inhibition of egln prolyl 4-hydroxylases , has been reported . also , non - mutated idh2 acting in the 2og / isocitrate cycle together with h transhydrogenase could contribute to the modulation of the ros pool by initiating an impulse originating from complex iii to dissipate the proton - motive force , which reduces superoxide formation in the mitochondrial respiratory chain . in contrast to mutant idh2 activity , the ongoing dissipative 2og / isocitrate cycle in the absence of citrate efflux from mitochondria would retard hif signaling . the discovery of mutant idh2 and idh1 in certain gliomas and aml and their production of the oncogenic metabolite d-2-hydroxyglutarate have unraveled a fascinating story of cancer self - acceleration via intermittent episodes of genome instability and metabolic remodeling and namely via epigenomic alterations [ 98 , 100 ] . however , there are additional aspects to be clarified . first , the exact role of d-2-hydroxy - glutarate must be further investigated to determine whether it promotes the reverse carboxylation mode of glutaminolysis and whether it acts in the dissipative 2og / isocitrate cycle , which would then become the 2og / d-2-hydroxyglutarate cycle , as we can now only speculate . also , conditions under which d-2-hydroxyglutarate might be formed in non - mutant idh2 should be defined . second , the role of sirt3 has to be established to determine whether it prevents or accelerates malignancy via idh2 . finally , the role of idh2 in other cancer types distinct from aml , gliomas , and renal tumors of hereditary leiomyomatosis should be investigated .

isocitrate dehydrogenase 2 ( idh2 ) is located in the mitochondrial matrix . idh2 acts in the forward krebs cycle as an nadp+-consuming enzyme , providing nadph for maintenance of the reduced glutathione and peroxiredoxin systems and for self - maintenance by reactivation of cystine - inactivated idh2 by glutaredoxin 2 . in highly respiring cells , the resulting nad+ accumulation then induces sirtuin-3-mediated activating idh2 deacetylation , thus increasing its protective function . reductive carboxylation of 2-oxoglutarate by idh2 ( in the reverse krebs cycle direction ) , which consumes nadph , may follow glutaminolysis of glutamine to 2-oxoglutarate in cancer cells . when the reverse aconitase reaction and citrate efflux are added , this overall anoxic glutaminolysis mode may help highly malignant tumors survive aglycemia during hypoxia . intermittent glycolysis would hypothetically be required to provide atp . when oxidative phosphorylation is dormant , this mode causes substantial oxidative stress . arg172 mutants of human idh2frequently found with similar mutants of cytosolic idh1 in grade 2 and 3 gliomas , secondary glioblastomas , and acute myeloid leukemia catalyze reductive carboxylation of 2-oxoglutarate and reduction to d-2-hydroxyglutarate , which strengthens the neoplastic phenotype by competitive inhibition of histone demethylation and 5-methylcytosine hydroxylation , leading to genome - wide histone and dna methylation alternations . d-2-hydroxyglutarate also interferes with proline hydroxylation and thus may stabilize hypoxia - induced factor .

worldwide 9.6 million people are estimated to have developed tb in 2014 , and china accounted for 10% of the total tb cases . pulmonary tb is given the most attention for its public health relevance , however , extrapulmonary tuberculosis ( eptb ) such as articular tb is also important . approximately , 2.2% to 4.7% of all tuberculous cases involve the skeletal system . if osteoarticular tb is diagnosed and treated at an early stage , approximately 90% to 95% of patients can achieve full recovery with near normal function . therefore , timely diagnosing is important . in articular tb , since the clinical specimens obtained from relatively inaccessible sites are often paucibacillary , interferon- ( ifn-)-releasing assays ( igras ) have recently shown promising results in diagnosing active pulmonary or eptb . t-spot.tb on serous effusion and cerebral spinal fluid have a higher diagnostic value for tuberculous serositis and tuberculous meningitis . however , the diagnostic value of t-spot.tb for articular tb was rarely reported , and most of the reports were about t-spot.tb on peripheral blood . only one case report was about t-spot.tb on synovial fluid for the diagnosis of articular tb up to now . patients with clinical suspected articular tb at our institution were consecutively recruited between august 2011 and december 2015 . this study was reviewed and approved by the institutional review board at our institution and waiver of consent was granted because this was a retrospective study . all the patients enrolled in the study were given t-spot.tb test on synovial fluid , and all patients were given t-spot.tb test on peripheral blood except one . clinical information was extracted from patients ' medical recordings by two researchers , who also reviewed patients ' treatment and discharge diagnosis . the diagnosis was made independent of the t-spot.tb results , if the two researchers have different opinions of the diagnosis , a third researcher was referred to for confirmation . synovial fluid was obtained by joint cavity puncture and the following tests were performed : routine cell counting , microscopy ( gram - stain , acid - fast bacilli stain ) , bacterial culture , mycobacterium tuberculosis ( mtb ) culture ( liquid culture method , bd mgit960 ) , fungal culture , and tb polymerase chain reaction ( pcr ) ( roche amplicor ) . heparinized samples of venous blood ( 4 ml ) and of synovial fluid ( 4 ml ) were obtained and processed for detecting specific t - cell responses to rd1 encoded antigens by t-spot.tb ( oxford immunotec . , , patients were classified as having confirmed tb if clinical specimens were positive for mtb on culture or by a pcr assay . patients were classified as having probable tb if they responded to anti - tb therapy and histologic examination of biopsy samples showed caseating granulomas associated with radiographic findings consistent with osteoarticular tb . patients were classified as having not active tb if another diagnosis was made or if there was a clinical improvement without anti - tb therapy . patients were classified as having possible tb if they did not fulfill the above criteria but active tb could not be excluded . four ml of synovial fluid was collected from each patient and was performed within 6 h after collection by laboratory staff blinded to patients ' clinical data . t-spot.tb utilized aim - v ( gibco aim - v medium liquid , invitrogen , usa ) as a negative control , phytohaemagglutinin ( pha ) as positive control , and esat-6 and cfp-10 as specific antigens , respectively . synovial fluid mononuclear cells ( sfmcs ) were separated by ficoll - hypaque gradient centrifugation and plated ( 2.5 10 per well ) on a plate pre - coated with an antibody against ifn-. after incubation 1618 h at 37c in 5% carbon dioxide , plate wells were washed and incubated with a conjugate against the antibody used and an enzyme substrate . spot - forming cells ( sfcs ) that represented antigen - specific t - cells secreting ifn- were counted with an automated enzyme - linked immunospot ( elispot ) reader ( aid - ispot , strassberg , germany ) . the background number of spots in the negative control well for sfmcs should be less than ten spots . when the cell counts in synovial fluid could not harvest 2.5 10 cells per well , we used the ratio between 2.5 10 , the target number and the actual number to adjust the result . four ml of peripheral blood was also collected from each patient except one and rd-1 elispot assay protocol for peripheral blood mononuclear cells ( pbmcs ) was same with that for sfmcs . sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value ( npv ) , likelihood ratio positive ( lr ) , and likelihood ratio negative ( lr ) were calculated to evaluate the diagnostic performance of t-spot.tb on sfmcs and pbmcs . means were used for data of normal distribution , while median and interquartile range ( iqr ) were used for data that were not normally distributed . means and medians were compared using student 's t - test or wilcoxon test as appropriate . significance was inferred for p < 0.05 and statistical analysis was performed by spss 16.0 ( spss inc . , chicago , il , usa ) . patients with clinical suspected articular tb at our institution were consecutively recruited between august 2011 and december 2015 . this study was reviewed and approved by the institutional review board at our institution and waiver of consent was granted because this was a retrospective study . all the patients enrolled in the study were given t-spot.tb test on synovial fluid , and all patients were given t-spot.tb test on peripheral blood except one . clinical information was extracted from patients ' medical recordings by two researchers , who also reviewed patients ' treatment and discharge diagnosis . the diagnosis was made independent of the t-spot.tb results , if the two researchers have different opinions of the diagnosis , a third researcher was referred to for confirmation . synovial fluid was obtained by joint cavity puncture and the following tests were performed : routine cell counting , microscopy ( gram - stain , acid - fast bacilli stain ) , bacterial culture , mycobacterium tuberculosis ( mtb ) culture ( liquid culture method , bd mgit960 ) , fungal culture , and tb polymerase chain reaction ( pcr ) ( roche amplicor ) . heparinized samples of venous blood ( 4 ml ) and of synovial fluid ( 4 ml ) were obtained and processed for detecting specific t - cell responses to rd1 encoded antigens by t-spot.tb ( oxford immunotec . , based on previous publications , patients were classified as having confirmed tb if clinical specimens were positive for mtb on culture or by a pcr assay . patients were classified as having probable tb if they responded to anti - tb therapy and histologic examination of biopsy samples showed caseating granulomas associated with radiographic findings consistent with osteoarticular tb . patients were classified as having not active tb if another diagnosis was made or if there was a clinical improvement without anti - tb therapy . patients were classified as having possible tb if they did not fulfill the above criteria but active tb could not be excluded . four ml of synovial fluid was collected from each patient and was performed within 6 h after collection by laboratory staff blinded to patients ' clinical data . t-spot.tb utilized aim - v ( gibco aim - v medium liquid , invitrogen , usa ) as a negative control , phytohaemagglutinin ( pha ) as positive control , and esat-6 and cfp-10 as specific antigens , respectively . synovial fluid mononuclear cells ( sfmcs ) were separated by ficoll - hypaque gradient centrifugation and plated ( 2.5 10 per well ) on a plate pre - coated with an antibody against ifn-. after incubation 1618 h at 37c in 5% carbon dioxide , plate wells were washed and incubated with a conjugate against the antibody used and an enzyme substrate . spot - forming cells ( sfcs ) that represented antigen - specific t - cells secreting ifn- were counted with an automated enzyme - linked immunospot ( elispot ) reader ( aid - ispot , strassberg , germany ) . the background number of spots in the negative control well for sfmcs should be less than ten spots . when the cell counts in synovial fluid could not harvest 2.5 10 cells per well , we used the ratio between 2.5 10 , the target number and the actual number to adjust the result . four ml of peripheral blood was also collected from each patient except one and rd-1 elispot assay protocol for peripheral blood mononuclear cells ( pbmcs ) was same with that for sfmcs . sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value ( npv ) , likelihood ratio positive ( lr ) , and likelihood ratio negative ( lr ) were calculated to evaluate the diagnostic performance of t-spot.tb on sfmcs and pbmcs . means were used for data of normal distribution , while median and interquartile range ( iqr ) were used for data that were not normally distributed . means and medians were compared using student 's t - test or wilcoxon test as appropriate . significance was inferred for p < 0.05 and statistical analysis was performed by spss 16.0 ( spss inc . , six patients were diagnosed with articular tb , including one patient with confirmed articular tb ( positive for an mtb pcr assay ) , one patient with probable articular tb , and four patients with possible articular tb . fourteen patients were diagnosed with non - tb arthritis , including three patients with common bacterial infection , two patients with synovitis , two patients with spondyloarthropathy ( ankylosing spondylitis and undifferentiated spondyloarthropathy ) , and one each patient with undifferentiated arthritis , reactive arthritis , gout , femoral head necrosis , juvenile idiopathic arthritis , behcet disease , and sarcoidosis [ tables 13 ] . all the six patients with articular tb had single joint involved ( knee joint ) , among the 14 patients with non - tb arthritis , seven had single joint involved ( knee and hip joint ) , and seven had more than one joint involved . thirteen patients ( five with tb and eight with non - tb ) had acid - fast bacilli stain of synovial fluid and all were negative . nine patients ( three with tb and six with non - tb ) had mtb culture and all were negative . twenty patients had t-spot.tb on synovial fluid , 19 patients had t-spot.tb on peripheral blood at the same time . all the six patients with articular tb received anti - tb drugs ; five patients also had arthroscopy operations . the median follow - up time was 2 months ( iqr 233 months ) with significant improvement in all cases . demographic and clinical characteristics of the patients duration : the course of the disease before definitive diagnosis was made . esr : erythrocyte sediment rate , normal range : male > 15 mm / h , female > 20 mm / h ; hscrp : hypersensitive c - reactive protein , normal range : > 3 mg / l ; iqr : interquartile range ; tb : tuberculosis . clinical characteristics of articular tuberculosis ( n = 6 ) sle : systemic lupus erythematosus ; ra : rheumatic arthritis ; hpf : high power field ; : not available ; mc : mononuclear cells ; mri : magnetic resonance imaging ; ct : computed tomography ; tb : tuberculosis ; sfcs : spotforming cells . clinical characteristics of non - tb arthritis ( n = 14 ) uspa : undifferentiated spondyloarthropathy ; as : ankylosing spondylitis ; mc : mononuclear cells ; hpf : high power field ; sle : systemic lupus erythematosus ; sfcs : spot - forming cells ; mri : magnetic resonance imaging ; ct : computed tomography ; tb : tuberculosis ; pbmc : peripheral blood mononuclear cell ; / : not available . among the six patients with articular tb , t-spot.tb on sfmcs was positive in five patients , giving a sensitivity of 83% ( 95% ci : 0.621.00 ) , and t-spot.tb on pbmcs was positive in four patients , giving a sensitivity of 67% ( 95% ci : 0.240.94 ) . t-spot.tb was negative on both sfmcs and pbmcs in one patient who was diagnosed as possible tb ( the patients did not fulfill the criteria of confirmed and probable tb , but active tb could not be excluded ) [ table 4 ] . single and combined diagnostic parameters of t-spot.tb on sfmcs and pbmcs ppv : positive predictive value ; npv : negative predictive value ; lr : likelihood ratio positive ; lr : likelihood ratio negative ; sfmcs : synovial fluid mononuclear cells ; pbmcs : peripheral blood mononuclear cells ; tb : tuberculosis ; ci : confidence interval . among the 14 patients with non - tb arthritis , t-spot.tb on sfmcs was negative in 12 patients , giving a specificity of 86% ( 95% ci:0.560.97 ) , and t-spot.tb on pbmcs ( performed in 13 patients ) was negative in nine patients , giving a specificity of 69% ( 95% ci:0.390.90 ) . four patients with non - tb arthritis , who had a previous history of tb , behcet disease , gout , and synovitis , respectively , had positive results with t-spot.tb on sfmcs and/or pbmcs . among the seven patients with positive t-spot.tb on sfmcs , five were diagnosed with articular tb , giving the ppv of 71% . among the eight patients with positive t-spot.tb on pbmcs , four were diagnosed with articular tb , giving the ppv of 50% . among the 13 patients with negative t-spot.tb on sfmcs , 12 were diagnosed with non - tb arthritis , giving the npv of 92% . among the 11 patients with negative t-spot.tb on pbmcs , the positive likelihood ratio ( plr ) and negative likelihood ratio ( nlr ) of t-spot.tb on sfmcs were 5.80 ( 95% ci:1.5422.10 ) and 0.19 ( 95% ci : 0.031.19 ) , respectively . the plr and nlr of t-spot.tb on pbmcs were 2.17 ( 95% ci:0.805.84 ) and 0.48 ( 95% ci : 0.151.60 ) , respectively [ table 4 ] . compared with t-spot.tb on synovial fluid alone , the combination of t-spot.tb on synovial fluid and pbmcs appeared to have higher specificity , ppv , and lr but have no advantage on sensitivity , npv , or lr . the frequencies of cells responding to esat-6 and cfp-10 in synovial fluid for articular tb patients were not statistically different from those observed in peripheral blood . among the six patients with articular tb , t-spot.tb on sfmcs was positive in five patients , giving a sensitivity of 83% ( 95% ci : 0.621.00 ) , and t-spot.tb on pbmcs was positive in four patients , giving a sensitivity of 67% ( 95% ci : 0.240.94 ) . t-spot.tb was negative on both sfmcs and pbmcs in one patient who was diagnosed as possible tb ( the patients did not fulfill the criteria of confirmed and probable tb , but active tb could not be excluded ) [ table 4 ] . single and combined diagnostic parameters of t-spot.tb on sfmcs and pbmcs ppv : positive predictive value ; npv : negative predictive value ; lr : likelihood ratio positive ; lr : likelihood ratio negative ; sfmcs : synovial fluid mononuclear cells ; pbmcs : peripheral blood mononuclear cells ; tb : tuberculosis ; ci : confidence interval . among the 14 patients with non - tb arthritis , t-spot.tb on sfmcs was negative in 12 patients , giving a specificity of 86% ( 95% ci:0.560.97 ) , and t-spot.tb on pbmcs ( performed in 13 patients ) was negative in nine patients , giving a specificity of 69% ( 95% ci:0.390.90 ) . four patients with non - tb arthritis , who had a previous history of tb , behcet disease , gout , and synovitis , respectively , had positive results with t-spot.tb on sfmcs and/or pbmcs . among the seven patients with positive t-spot.tb on sfmcs , five were diagnosed with articular tb , giving the ppv of 71% . among the eight patients with positive t-spot.tb on pbmcs , four were diagnosed with articular tb , giving the ppv of 50% . among the 13 patients with negative t-spot.tb on sfmcs , 12 were diagnosed with non - tb arthritis , giving the npv of 92% . among the 11 patients with negative t-spot.tb on pbmcs , the positive likelihood ratio ( plr ) and negative likelihood ratio ( nlr ) of t-spot.tb on sfmcs were 5.80 ( 95% ci:1.5422.10 ) and 0.19 ( 95% ci : 0.031.19 ) , respectively . the plr and nlr of t-spot.tb on pbmcs were 2.17 ( 95% ci:0.805.84 ) and 0.48 ( 95% ci : 0.151.60 ) , respectively [ table 4 ] . compared with t-spot.tb on synovial fluid alone , the combination of t-spot.tb on synovial fluid and pbmcs appeared to have higher specificity , ppv , and lr but have no advantage on sensitivity , npv , or lr . the frequencies of cells responding to esat-6 and cfp-10 in synovial fluid for articular tb patients were not statistically different from those observed in peripheral blood . our data showed that it had higher sensitivity ( 83% ) , specificity ( 86% ) , and npv ( 92% ) compared to commonly used tests . mycobacterial osteomyelitis and arthritis are the third most common infection of eptb after pleural and lymphatic tb worldwide . in china , eptb accounts for about 1020% of all cases of active tb with 19.9% being bone and joint tb . spine , hip and sacroiliac joint , knees , ribs , and shoulder are the sites commonly involved . consistent with this pattern , our study showed tb of the knee joint was the most often involved sites . given that difficulty in identifying the organism and the fact that the clinical symptoms are nonspecific with an insidious onset that can mimic other joint diseases like rheumatoid arthritis and osteoarthritis , the diagnosis of osteoarticular tb is often delayed . in the previous study among chinese patients , the mean time from symptom onset to diagnosis of bone and joint tb was 13.16 months ( range from 0.5 to 96 months , median delay was 7 months ) . in our study , the median duration from onset of articular symptoms to definite diagnosis was 17 months ( iqr 863 months ) , suggesting a huge need for improvement . traditional diagnostic methods such as acid - fast stains of the joint fluid are positive in only 20% to 25% of those examined . despite that fact that 90% to 95% of cases would achieve full recovery with a nearly full joint function if diagnosed and treated early . igras became a new diagnostic method in recent years , sensitivity and specificity of t-spot.tb on peripheral blood varied from different studies . in our study , the sensitivity and specificity of t-spot.tb on peripheral blood for articular tb was 67% and 69% , respectively . in a study by fan et al . , 92 patients with confirmed osteoarticular tb and 64 patients without active osteoarticular tb were analyzed , the sensitivity and specificity for t - spot . tb assay on peripheral blood were 93.5% ( 86/92 ) and 78.1% ( 50/64 ) , respectively . in another study of 28 patients with confirmed osteoarticular tb and 38 patients with non - tb arthritis , the sensitivity and specificity of t-spot.tb on peripheral blood was 100% ( 95% ci:0.881.00 ) and 55% ( 95% ci:0.400.70 ) , respectively . our study showed that the ppv and npv of t-spot.tb on peripheral blood for articular tb were 50% and 82% , respectively . according to cho et al . , the ppv and npv of t-spot.tb on peripheral blood for articular tb were 62% and 100% , respectively . multivariate analysis revealed that chronic forms of eptb were independently associated with higher sensitivity of blood t-spot.tb test ( p = 0.007 ) . in the report about t-spot.tb on synovial fluid for the diagnosis of articular tb , the numbers of mtb specific t - cells , as determined by elispot , were 2-fold to 6-fold higher in synovial fluid than in blood . our patients with confirmed and probable articular tb also had higher frequencies of t - cells in synovial fluid than in blood , which may due to the accumulation of mtb - specific t - cell in synovial fluid results from selectin - mediated migration and a local proliferation . among the four patients who had positive t-spot.tb on sfmcs and/or pbmcs but with non - tb arthritis , one had previous tb , which may have led to latent tb . one had behcet disease , which was reported to have some associations with tb , pervin et al . showed that mapped t - cell epitopes of heat shock protein ( hsp ) in patients with bd by stimulating t cells with overlapping synthetic peptides derived from gene sequences of mtbhsp . mtbhsp displayed molecular mimicry to human hsp , resulting in an immunologic cross - reaction and the subsequent development of bd . as china is an area with relatively high tb prevalence , many people may have latent tb infection ( ltbi ) that could result in positive t-spot.tb . therefore , compared to peripheral blood , the diagnostic value of t-spot.tb on synovial fluid without the influence of ltbi is of great importance . one patient with possible articular tb had negative t-spot.tb on both sfmcs and pbmcs , he had no underlying diseases and normal leukocytes and lymphocytes , the negative t-spot.tb result on both may be due to the failed lymphocyte compartmentalization , migration , and activation to rd1 peptides . all the six patients with articular tb took anti - tb drugs , and three patients also had operations . the mainstay treatment of articular tb is multidrug antituberculous chemotherapy ( for 1218 months ) and active - assisted nonweight bearing exercises of the involved joint throughout the period of healing . operative intervention is required when the patient is not responding after 45 months of chemotherapy ( synovectomy and debridement ) , or if the therapeutic outcome is not satisfactory , such as excisional arthroplasty for the hip or the elbow . joint replacement may be considered if the disease has remained inactive for 10 years or more . first , the sample size was small and only a few patients had confirmed tb , and this was a retrospective study , which might overestimate or underestimate the diagnostic value of t-spot.tb on synovial fluid . however , examination of t-spot.tb on synovial fluid has not been previously reported and rarely performed in clinical settings . our data during the past 5 years indicated the potential that t-spot.tb on synovial fluid can improve the diagnosis of articular tb and call for a larger study to verify this finding . second , this study was done in a single center ; therefore , the results in this group of patients might not be representative for other areas . in summary , this study showed that t-spot.tb on synovial fluid can potentially improve the diagnosis of articular tb . patients may have t-spot.tb on synovial fluid together with clinical findings and other tests if possible to assist diagnosis of articular tb . this work was supported by grants from the national major science and technology research projects for the control and prevention of major infectious diseases in china ( no . first , the sample size was small and only a few patients had confirmed tb , and this was a retrospective study , which might overestimate or underestimate the diagnostic value of t-spot.tb on synovial fluid . however , examination of t-spot.tb on synovial fluid has not been previously reported and rarely performed in clinical settings . our data during the past 5 years indicated the potential that t-spot.tb on synovial fluid can improve the diagnosis of articular tb and call for a larger study to verify this finding . second , this study was done in a single center ; therefore , the results in this group of patients might not be representative for other areas . in summary , this study showed that t-spot.tb on synovial fluid can potentially improve the diagnosis of articular tb . patients may have t-spot.tb on synovial fluid together with clinical findings and other tests if possible to assist diagnosis of articular tb . this work was supported by grants from the national major science and technology research projects for the control and prevention of major infectious diseases in china ( no .

background : tuberculosis ( tb ) remains a major global public health challenge . articular tb is an important form of extrapulmonary tuberculosis , and its diagnosis is difficult because of the low sensitivity of traditional methods . the aim of this study was to analyze the diagnostic value of t-spot.tb on synovial fluid for the diagnosis of articular tb.methods:patients with suspected articular tb were enrolled consecutively between august 2011 and december 2015 . t-spot.tb was performed on both synovial fluid mononuclear cells ( sfmcs ) and peripheral blood mononuclear cells ( pbmcs ) . the final diagnosis of articular tb was independent of the t-spot.tb result . the diagnostic sensitivity , specificity , predictive value , and likelihood ratio of t-spot.tb on sfmcs and pbmcs were analyzed.results:twenty patients with suspected articular tb were enrolled . six were diagnosed with articular tb , and 14 patients were diagnosed with other diseases . sensitivity and specificity were 83% and 86% for t-spot.tb on sfmcs , and 67% and 69% for t-spot.tb on pbmcs , respectively . the positive predictive value ( ppv ) and negative predictive value ( npv ) of t-spot.tb on sfmcs were 71% and 92% , respectively . the ppv and npv were 50% and 82% for t-spot.tb on pbmcs.conclusion:sensitivity , specificity , and npv of t-spot.tb on sfmcs appeared higher than that on pbmcs , indicating that t-spot.tb on sfmcs might be a rapid and accurate diagnostic test for articular tb .

adenoid cystic carcinomas ( accs ) are rare salivary gland tumors that predominantly occur in women , between the fifth and sixth decades of life . on computed tomography ( ct ) and magnetic resonance imaging ( mri ) , accs may present as large irregular masses with bone destruction and heterogeneous density or high signal intensity . a 51-year - old male presented with right facial pain of 2-years duration with no significant medical history . atfirst , it was treated as a dental condition and multiple maxillary tooth extractions were performed to relive the pain . after dental treatment , the pain persisted and the patient was then diagnosed as having trigeminal neuralgia . the patient developed nocturnal right epistaxis of 6 months duration and , consequently , was referred to the ear nose and throat ( ent ) clinic for consultation . nasofibroscopy was performed , which revealed a purple tumor occupying almost the entire right nostril . ct imaging revealed a large expansive and infiltrative process involving the right nasal cavity , maxillary , sphenoidal , and ethmoidal sinuses [ figure 1 ] . the lesion also involved the inferior orbital fissure and oval foramen , reaching the ipsilateral parasellar region . at its largest diameter , the lesion measured 6 cm . 51-year - old male presented with right facial pain of 2 years duration with no significant medical history and was later diagnosed with sinonasal adenoid cystic carcinoma . ( a ) ct bone window reveals a large expansive and infiltrative process involving the right nasal cavity , maxillary , and pterygomaxillary fossa ( with arrows ) . ( b ) ct soft tissue window post intravenous contrast injection demonstrates moderate enhancement and , intracranial invasion involving sphenoidal sinuses and the right parasellar region ( red arrows ) . post intravenous contrast administration , mri revealed a hyperintense soft tissue expansive process and intracranial invasion of the middle temporal fossa involving the cavernous sinuses [ figure 2 ] . the mass covered the major sphenoidal fissure involving the eyeball muscles , infiltrating the extra - conal orbital floor and showed pns through maxillary nerve ( cn v2 ) in the infraorbital foramen . 51-year - old male presented with right facial pain of 2 years duration with no significant medical history and was later diagnosed with sinonasal adenoid cystic carcinoma . fat - saturated t1-weighted and gadolinium - weighted mri images : ( a ) axial view shows perineural spread through cn v2 in the infraorbital foramen ( red arrow ) ; ( b ) coronal view shows the mass involving the eyeball muscles , infiltrating the extraconal orbital floor ( yellow arrow ) ; and ( c ) coronal view shows intracranial invasion to the middle temporal fossa involving the cavernous sinuses ( green arrow ) . following the results of the imaging studies , [ figure 3 ] . based on the size and intracranial invasion of the tumor , the head and neck tumor board ( hntb ) recommended palliative chemo - radiation therapy . 51-year - old male presented with right facial pain of 2 years duration with no significant medical history and was later diagnosed with sinonasal adenoid cystic carcinoma . biopsy tissue stained with hematoxylin and eosin , magnification 20 , shows ( a ) classic cribiform pattern , epithelial cells nests that form cylindrical patterns ( red arrows ) and ( b ) bone tissue infiltration by carcinoma ( yellow arrows ) . acc is a rare malignant neoplasm that accounts for 1 - 2% of all head and neck malignancies and approximately 10% of all salivary gland neoplasms . thefirst case of acc was described by robin , lorain , and laboulbene in two articles published in 1853 and 1854 . peak incidence occurs predominantly among women , between the fifth and sixth decades of life . adenocarcinomas of the sinonasal tract mainly arise from the respiratory epithelium or the underlying mucoserous glands ( 60% ) . specifically , acc is thought to arise from the minor mucoserous glands which lie within the mucosa , below the respiratory - type epithelium of the nasal cavity and paranasal sinuses . these tumors are made up of basaloid cells with primarily myoepithelial / basal cell differentiation . the tubular- and cribriform - type accs are lower - grade tumors , whereas solid - type acc is a higher - grade tumor . these tumors show slow but relentless growth , and are typically diagnosed late by their proximity to vital structures ( e.g. , dura , brain , orbit , and central nerves ) which makes adequate oncological resection less likely . another characteristic of acc of the paranasal sinuses is pns , with a reported incidence of over 50% . the overall frequency of intracranial invasion of acc has been reported to be between 4 and 22% . the maxillary , mandibular , and vidian nerves are the most frequently involved and allow pns of sinonasal acc through the foramina rotundum , ovale , and the vidian canal . this probably reflects the more frequent occurrence of acc in the palate and sinonasal region . detection is critical in planning the proper surgical approach , so that complete resection may be achieved . for this , the mri is more sensitive and specific than ct ( 100% and 85% , and 88% and 89% , respectively ) . however , the extensive local infiltration and pns related to this malignancy often cause difficulty to achieve high tumor control . the effect of adjuvant radiation therapy on survival in patients with acc is much debated . the overall 5- , 10- , and 15-year survival rates for head and neck patients suffering from acc have been reported to be relatively high : 90.3% , 79.9% , and 62.2% , respectively . however , accs of the skull base and paranasal sinuses represent a disease with distinct clinical implications , where the status of surgical margins , the presence of perineural invasion , and the histologic grade of the tumor do not demonstrate correlation with recurrence , metastases , or survival . one the most important characteristics is pns . they occur predominantly among women , with the highest incidence occurring between the fifth and sixth decades of life . imaging features include irregular masses with bone destruction and heterogeneous density or high signal intensity . the treatment of choice is complete surgical excision and adjuvant radiation therapy for the extensive local infiltration and pns related to this malignancy .

we present the case of a 51-year - old patient with sinonasal adenoid cystic carcinoma ( sacc ) . computed tomography ( ct ) and magnetic resonance imaging ( mri ) exams revealed an expansive process in the right nostril accompanied with perineural spread and invasion to the floor of the middle cranial fossa . due to the size of the tumor and brain involvement , the head and neck tumor board ( hntb ) recommended radiochemotherapy treatment to decrease the size of the lesion . presently , the patient is undergoing treatment without major complications .

foot ulceration secondary to diabetes occurs in up to one - quarter of people with diabetes and is the commonest cause of lower limb amputation , accounting for 5070% of nontraumatic cases . diabetes increases the risk of lower extremity amputation by 10 to 20 times [ 3 , 4 ] . the estimated cost to the us healthcare system of diabetic foot ulceration and related amputations is more than $ 109 billion . wounds in diabetic patients typically show abnormal healing , characterized by chronicity , persistent inflammation , copious exudate , hypergranulation , increased bacterial load , and reduced ability to heal . this delayed healing is thought to be due to a combination of factors including macro- and microvascular disease , neuropathy , bacterial infection , local pressure due to foot deformity , and the adverse local metabolic environment caused by diabetes . furthermore , pathogenic factors lead to suboptimal extracellular matrix ( ecm ) composition : it has been hypothesized that a cytokine / chemokine mediated imbalance between synthetic and degradative matrix pathways is responsible for the reduced amount and quality of ecm . indeed , human diabetic wounds exhibit an excess of proinflammatory cytokines such as tnf- , which contribute to an environment of increased protease activity in diabetic wounds . ctgf is a 3238 kda member of the ccn family , a group of proteins which share a common modular structure . also known as ccn2 , ctgf is able to stimulate fibroblast proliferation and differentiation in sites including in skin , thus enhancing ecm production . ctgf is able to promote cell adhesion and is chemotactic for inflammatory cells especially macrophages ; it is mitogenic and also assists in cell differentiation [ 11 , 12 ] . in vivo , ctgf application accelerated wound healing in a monkey burns model . changes in ctgf gene expression and protein levels have been reported in some tissues and biological fluids of diabetic subjects , especially where fibrosis occurs to relative excess . this includes diabetic nephropathy , diabetic cardiomyopathy , and retinopathy where ctgf is elevated . in contrast , in skin , in nonhuman primate ( baboon ) studies we have recently shown that intact ctgf protein is deficient in diabetic wound tissue compared with wound tissue in nondiabetic animals . in that study the wound inflammatory and protease environment was also increased in diabetes and ctgf protein accumulation in wounds was delayed . to date however , ctgf regulation in human diabetic wounds has not yet been reported and the effect of topical application of ctgf to diabetic wounds has not been described in any animal model . the aims of this study were to ( i ) examine if topical rhctgf improves wound healing in a well defined model of diabetic rodent cutaneous wounding and ( ii ) determine whether ctgf increase in wound fluid from human diabetic foot ulcers demonstrates a relationship with wound healing rate . recombinant human ctgf ( rhctgf ) was expressed utilizing adenovirus in 911 cells and purified and quantitated in house exactly as previously described , with confirmation of its ecm inducing bioactivity . male sprague - dawley rats ( n = 52 ) purchased from australian laboratory supply ( perth , australia ) , aged between 6 and 7 weeks , were used in these studies . ethics approval for induction of diabetes in animals and creation of wounds was obtained from the animal research ethics committee , sydney south western area health service ( sswahs ) . type 1 diabetes was induced in 23 animals using streptozotocin ( stz : 65 mg / kg , calbiochem , sydney , australia ) and animals were maintained on 24 iu of insulin ( mixtard , novo - nordisk ) every second day to prevent weight loss and ketoacidosis . after 7 weeks , diabetic ( n = 23 ) and control ( n = 29 ) animals were anesthetized using ketamine ( 85 mg / kg pfizer , sydney , australia ) and xylazine ( 5 mg / kg , bayer , leverkusen , germany ) . the dorsal skin was prepared for wounding by shaving with clippers and depilation ( nads , baulkham hills , australia ) and swabbing with antiseptic ( betadine , symbion , melbourne , australia ) . as we previously described , 4 full thickness dorsally placed excisional wounds per rat were then created using an 8 mm punch biopsy ( stieffel laboratories , nsw , australia ) . the wounds included the panniculus carnosus and exposed the underlying dorsolateral skeletal muscle fascia . at the time of wounding all animals were treated with a single dose of parenteral antibiotic ( ampicillin : 50 mg / kg ) . rhctgf as 1 g in 20 l of sterile phosphate buffered saline ( pbs ) was applied topically to two of the ulcers in each animal and 20 l pbs was applied topically to the remaining two wounds . ulcers were each occluded using a transparent dressing ( tegaderm , 3 m , nsw , australia ) which was secured peripherally using hypafix tape ( smith and nephew , victoria , australia ) . at an interval of 24 h animals were anaesthetized in the manner already described and treated with a second dose of rhctgf , or pbs to the same wounds , as before . wounds were again occluded using tegaderm and hypafix . in one series of experiments , the effect of rhctgf on wound closure was determined by tracing the circumference of the wounds onto transparencies on the day of wounding and then at regular intervals thereafter ( tegaderm dressing packaging ) . in a parallel series , rats from each group were terminated at days 7 and 14 and the tissue containing the wound was excised and either ( i ) fixed in paraformaldehyde ( 4% in pbs ) for later immunohistochemical analysis or ( ii ) snap - frozen in liquid nitrogen for determination of wound breaking strength . wound circumference tracings were translated into computer images using pen - tablet software ( bamboo , wacom , usa ) for quantification of wound area using image j ( research services branch , nimh , usa ) . wound closure was then calculated and results are expressed as a percentage of original wound size . wounds that had been excised on day 14 were removed from frozen storage and cut into shape using an aluminum template . tissue ends were securely mounted on a 2 mm balsa wood sandwich coupling using cyanoacrylate and placed in the jaws of an elf3400 tensiometer ( bose enduratec , minnetonka , mn , usa ) . load and displacement until the time of skin rupture at the healed wound site were obtained using a 45 n load at a cross - head speed of 10 mm / min . cross - sectional area was determined from original skin thickness measurements and values were used to calculate stress and strain and young 's modulus ( tensile strength ) . the excised paraformaldehyde embedded wounds were sectioned ( 5 m / section ) perpendicular to the wound surface . macrophages from sections obtained at days 7 and 14 were identified by immunohistochemical staining with cd68 ( abcam , cambridge , ma ) as described previously . in brief , following antigen retrieval , nonspecific binding was blocked by incubation in 10% v / v goat serum and , after washing with pbs , the sections were incubated for 60 min . in cd68 , ( 1 : 200 ) mouse igg1 . a further pbs wash was carried out before incubation with 1 : 400 dilution of secondary antibody , ( biotinylated anti - mouse ) . cells were visualized using peroxidase - conjugated secondary antibodies and 3,3-diaminobenzidine chromogen ( vector laboratories , burlingame , ca ) . the number of macrophages in 20 sequential fields was determined ( at 1000 magnification ) by a single observer blinded to animal grouping and treatment status . fibroblast and endothelial cells from sections obtained at days 7 and 14 were identified by immunohistochemical staining using anti--smooth muscle actin ( -sma ) primary antibody 1 : 200 ( -sma , abcam , burlingame , ca ) and their characteristic morphology . detection then involved secondary antibody and the abc method as described for cd68 staining above and as per . the -sma positive fibroblasts and endothelial staining intensity within each wound section was scored by two independent observers , each blinded to animal grouping and treatment status . as previously described , the scoring was based on a grade of 03 where zero was for no staining , up to three for intense staining , and any background staining in the isotype control section was subtracted from the overall staining score [ 18 , 21 ] . immunohistochemical staining for collagen iv was performed as previously described using the goat generated anti - collagen iv polyclonal antibody abcam ( ab86042 ) at 1 : 200 titer as the primary antibody . the subsequent staining and detection method was that previously used in diabetic preclinical studies [ 18 , 21 ] , with the same scoring method as described for -sma quantitation above . in a separate series of experiments relative ctgf levels in postdebridement wound fluid in diabetic wounds were determined in patients managed at the multidisciplinary high risk foot service , where all aspects of diabetic foot care had been optimized [ 22 , 23 ] ( table 3 ) . there were 32 serial subjects with type 2 diabetes and each had dense peripheral neuropathy , and some were also ischemic ulcers ( table 1 ) . ethics approval for this study was obtained from the human research ethics committee , sydney south western area health service . wound fluid was obtained following debridement using a sterile 1 cm whatman 4 mm filter paper as previously described [ 22 , 23 ] . the protein concentration of the wound fluid was determined using the biorad protein assay ( biorad , sydney australia ) and a sample containing a standard amount of total protein ( 30 g ) was applied to a 12.5% sds - page under reducing conditions , as previously described [ 18 , 24 ] . western immunoblot analysis using an in - house generated anti - ctgf polyclonal primary antibody ( 196 ) at 1 : 1,000 titer and subsequent goat anti - rabbit secondary antibody was undertaken using standard methods . data determined by densitometry was then analyzed and presented as % change in immunoreactive ctgf in the wound fluid compared with % ulcer healing rate , across the same time interval . in most cases , each wound had 3 ctgf measures , spread in total across 45 or more days . wound data is expressed as mean sd or mean sem , each as indicated . analysis was performed by one way anova , with post hoc correction by bonferoni 's multiple comparison test , or by unpaired t - test , each as indicated . simple linear correlation analysis was performed for the human ctgf % change in postdebridement wound fluid data in relation to time . group data for macroscopic wound closure measurement , expressed as a percentage change from the initial wound area at respective time points , is shown in table 1 . diabetic animals ( d + pbs ) were found to have wound closure rates that were slower than those in control ( nondiabetic ) animals ( c + pbs ) , with this being significant on day 7 . in addition , macroscopic wound closure was significantly enhanced on days 7 , 10 , and 14 in the ctgf treated diabetic group compared with the nonactively treated diabetic group with vehicle alone ( d + pbs ) , table 1 . in contrast to ctgf effects in diabetic wounds , nondiabetic wounds treated with ctgf ( c + ctgf ) did not show improved closure rates relative to controls alone ( c + pbs ) . the effect of ctgf on the wound breaking strength at the wound site was also measured . analysis by anova showed that untreated diabetic wounds elongate less well before breaking than either treated or untreated control wounds ( p < 0.05 ) ( average 2.20 mpa compared with 3.08 and 3.45 mpa , resp . ) , indicating that diabetic wounds are functionally less flexible ( table 2 ) . ctgf treated diabetic wounds had a slightly higher mean final strain ( 2.32 mpa ) than the untreated diabetic wounds ( 2.20 mpa ) ; however this did not reach statistical significance . young 's modulus which measures stress in relation to strain and thus wound elasticity was not significantly different between groups in this model . macrophage cell counts in cd68 stained sections ( figure 1 ) were lower in pbs alone treated animals compared with ctgf treated animals at day 7 . macrophage cell count declined in both treated and untreated groups by day 14 , compared with day 7 . interestingly the macrophages appeared to persist in the ctgf treated diabetic animals ( n = 107 macrophages/20 fields ) compared with the nontreated diabetic animals ( n = 73 macrophages/20 fields ) at day 14 , although this did not reach statistical significance . intensity of staining by -sma , a marker of activated fibroblasts and mature vascular blood vessel cells , was measured at days 7 and 14 . the fibroblast -sma in the nondiabetic rat wounds was higher ( figures 2(a ) and 2(b ) ) than both the treated and untreated diabetic animals , indicating a relative lack of activated fibroblasts in the diabetic wounds by anova ( p < 0.05 ) . increased -sma staining in endothelial cells was observed at day 7 in control compared with diabetic animals , regardless of treatment ( p < 0.05 ) ( figures 2(c ) and 2(d ) ) . the ctgf topical treatment of diabetic mice trended at day 7 to higher -sma staining score in fibroblasts ( figure 2(a ) ) and endothelial cells ( figure 2(c ) ) compared with scores in untreated diabetic mouse although on each occasion this did not reach statistical significance . collagen iv staining was lower in untreated diabetic wounds at day 7 and was increased by rhctgf ( p < 0.05 ) ( figure 3(a ) ) . at day 14 ctgf treated diabetic wounds showed significant increases in wound collagen iv compared with untreated diabetic wounds ( p < 0.005 ) ( figure 3(b ) ) . representative collagen iv images for days 7 and 14 from rats within respective groups are shown in figure 4 . postdebridement wound fluid samples obtained from people with type 2 diabetes who had foot ulcers were analyzed for ctgf by western immunoblot analysis , and wound area was determined at each visit based on acetate tracings . figure 5(a ) shows a typical cutaneous wound area profile in a patient with a neuropathic hallux plantar ulcer , with times ( arrows ) when ulcer fluid was collected and then analyzed the following serial debridements . the respective western immunoblot analysis for ctgf in the ulcer fluid ctgf was detected as a predominant intact ~3638 kda series of molecular mass bands , typical of known intact ctgf glycoforms . in some immunoblots , there was also lower molecular mass signal at ~26 kda ( figure 5(b ) ) as previously observed in biological fluids . the group data ( n = 32 study subjects ) relating ulcer healing rate to rate of change in ctgf in ulcer fluid across an average time period of 10 days showed that an increase in ctgf levels correlates highly significantly with wound healing rate , indicated as percentage reduction in ulcer area per 10 days ( figure 5(c ) ) ; r = 0.406 ; p < 0.001 . while there was quite marked interindividual variation in the data , on average a 10% increase in ctgf levels in wound fluid across 10 days correlated with ~17.6% improvement ( i.e. , a reduction ) in ulcer area ( figure 5(c ) ) . in diabetic wounds , healing is known to be impaired by several abnormalities including prolonged inflammation , impaired neovascularisation , decreased synthesis of collagen , and defective macrophage functions . ctgf has been shown in vitro to be important in wound healing and to accelerate healing rate of burns in rhesus monkeys . the current study shows that topical application of ctgf improves wound healing in a diabetic rodent model of full thickness cutaneous wound healing . the main end point , rate of epithelial closure as a percentage of original wound size , was accelerated in the group of diabetic rats that were treated with ctgf . tegaderm further validates this model as occlusion enabled more accurate visualisation of the wound as no scab or foreign matter was able to distort or contaminate the wound . furthermore , it has been shown that , in diabetic rodent models , the film dressing exerts a splinting effect to the wound margins and contraction , thus promoting healing through reepithelialization which better approximates human wound healing , rather than through contraction which predominates in nonsplinted rodent wounds . a lack of detectable effect of ctgf on control wounds indicates that ctgf is able to normalise certain deficits found within diabetic wounds without affecting healing in normal wounds . it is possible that ctgf is able to improve wound healing through augmentation of cellular chemotaxis and mitosis and/or through upregulation of related mediators of ctgf such as tgf-. these actions may attenuate the persistent inflammation which is detrimental within the diabetic wound . the monkey cutaneous burns model previously published that also responded to rhctgf topically with ulcer closure also has a proinflammatory environment , suggesting that rhctgf may be working through such mechanism in cutaneous wounds . the beneficial effect of the rhctgf therapy in terms of epithelial closure appeared to occur quite early in wound healing . a ctgf effect was observed in diabetic wounds , which was statistically significant by day 7 after wounding . in this context in addition , application of macrophages or stem cells onto diabetic rodent wounds has been shown to accelerate wound healing and epithelial closure . in the current work while it appears that macrophage number was increased in wounds treated with ctgf , this was not statistically significant . it may be that some of the ctgf effect was through induction of macrophage presence in diabetic wounds : increased macrophage infiltration observed within the ctgf treated diabetic wounds at day 7 cosegregated with accelerated healing of these wounds . in turn , macrophages upregulate healing through their inflammatory and reparative phenotypes and the balance between inflammatory and repair macrophages is crucial for successful healing . inflammatory macrophages synthesize a plethora of growth factors which in turn attract fibroblasts and endothelial cells and promote their proliferation . the finding that young 's modulus was lower in the diabetic animals than the controls is in keeping with recent literature . interestingly young 's modulus was increased by t - test ( p < 0.05 ) in animals that were treated with ctgf compared to untreated animals , regardless of diabetes status . it is likely that the observed increase in collagen iv seen in earlier experiments after ctgf treatment is contributing to the greater stiffness of the wound sites . collagen is known to contribute to wound strength and therefore increased stiffness and strain in ctgf treated wounds is probably attributable to increased collagen iv in these tissues . these observations are consistent with similar findings for other growth factors such as pdgf , where treatment induced collagen iv and increased strength in corneal tissue and in preclinical models of diabetic ulceration . collagen iv was markedly increased in ctgf treated diabetic ulcers compared with both untreated diabetic ulcers and controls . collagen iv peptides have been shown to promote cell adhesion and migration in corneal epithelial cells . the overall collagen protein content of a wound is determined by the balance between collagen production and absorption , and mmp 9 is a key regulator of collagen iv . however recently we reported that ctgf upregulates the expression of timp-1 , an mmp inhibitor , in mesangial cells , and wang et al . it is therefore possible that increased collagen content in the diabetic wound is attributable to ctgf mediated upregulation of timps and corresponding inhibition of mmp 9 . this finding is similar to the enhanced expression of -sma seen in subcutaneous rat fibroblasts following treatment with transforming growth factor-1 [ 36 , 37 ] . both endothelial cell and fibroblast expression of -sma are robust predictors of healing . increased -sma in these cells is indicative that the wound is progressing from the inflammatory phase and that contraction : remodeling and closure are occurring at an accelerated rate . while some recent reports have implicated ctgf / ccn2 in postwound scar formation [ 39 , 40 ] , we did not observe macroscopic excessive scarring in the treated ctgf / ccn2 wounds , although the planned limited study duration may have prevented optimal detection of such a change . as the wound breaking strength data show no marked change in final strain after ctgf treatment of wounds it is likely that fibrosis is not induced significantly in this model by rhctgf . however future studies in diabetic cutaneous wounding will be required to formally address that issue of any potential late histological fibrosis induction by rhctgf , which was not the primary focus of the current research . this is the first time that changes in endogenous ctgf / ccn2 have been reported in human diabetic foot ulcers or related ulcer fluid . across a series of samples in 32 study subjects we have found that as immunoreactive ctgf increases in the postdebridement ulcer fluid , the ulcer demonstrates signs of healing . ctgf is known to be induced during wounding of human skin [ 41 , 42 ] . this data supports the concept that ctgf may have a role in ulcer healing in diabetes , and combined with the rodent data described in this paper and our previous data in a primate non - human ( baboon ) model of diabetic wounding , it provides greater rationale for studying ctgf as therapy in diabetic foot ulcers . the correct dosing and timing schedule as well as whether ctgf should be used alone , in combination with other growth factors such as in matrix or protease inhibitors , or in expression vectors , remains to be defined .

aims / hypothesis . topical application of ctgf / ccn2 to rodent diabetic and control wounds was examined . in parallel research , correlation of ctgf wound fluid levels with healing rate in human diabetic foot ulcers was undertaken . methods . full thickness cutaneous wounds in diabetic and nondiabetic control rats were treated topically with 1 g rhctgf or vehicle alone , on 2 consecutive days . wound healing rate was observed on day 14 and wound sites were examined for breaking strength and granulation tissue . in the human study across 32 subjects , serial ctgf regulation was analyzed longitudinally in postdebridement diabetic wound fluid . results . ctgf treated diabetic wounds had an accelerated closure rate compared with vehicle treated diabetic wounds . healed skin withstood more strain before breaking in ctgf treated rat wounds . granulation tissue from ctgf treatment in diabetic wounds showed collagen iv accumulation compared with nondiabetic animals . wound -smooth muscle actin was increased in ctgf treated diabetic wounds compared with untreated diabetic wounds , as was macrophage infiltration . endogenous wound fluid ctgf protein rate of increase in human diabetic foot ulcers correlated positively with foot ulcer healing rate ( r = 0.406 ; p < 0.001 ) . conclusions / interpretation . these data collectively increasingly substantiate a functional role for ctgf in human diabetic foot ulcers .

panic attacks are defined as sudden and shortlived anxiety spells with various somatic and cognitive symptoms . according to dsm - iv , these discrete periods of intense fear or discomfort furthermore , at least four of the following thirteen symptoms evolve : palpitations or accelerated heart rate ; sweating , trembling , or shaking ; sensations of shortness of breath or smothering ; feeling of choking , chest pain , or discomfort ; nausea or abdominal distress ; feeling dizzy , unsteady , lightheaded , or faint ; derealization or depersonalization ; fear of losing control or going crazy ; fear of dying ; paresthesias ; chills or hot flashes . panic attacks can occur sporadically in healthy man , but also in the context of anxiety disorders ( if the panic attacks are not due to the direct physiological effect of a substance or a general medical condition ) . diagnostically , recurrent panic attacks are the hallmark of panic disorder , which is a disabling anxiety disorder that has a lifetime prevalence of about 5% . the interest in the neurobiology of panic attacks has considerably been stimulated by the discovery that these spontaneous anxiety paroxysms can be provoked experimentally in susceptible subjects in the laboratory under controlled conditions . the seminal report about neurochemical provocation of panic attacks in man was published by pitts and mcclure in 1967 . based on the observation that patients with anxiety neurosis were exercise - intolerant and developed high blood levels of lactic acid during standardized workload , these researchers developed the idea that the lactate molecule might be the elicitor of anxiety attacks in vulnerable individuals . in a double - blind study with intravenous infusion of 10 ml / kg body weight of 0.5 molar sodium lactate over a maximum of 20 minutes , 13 out of 14 patients with anxiety neurosis ( all of them with a history of spontaneous anxiety spells ) , but only 2 out of 10 healthy controls , developed typical anxiety attacks . this observation laid the foundation for extensive research efforts on the experimental psychopathology of panic , which offers a unique opportunity in the field of psychiatry . the scientific and clinical promises of such symptom provocation studies for the pathophysiology and psychopharmacology of psychiatric disorders have been drafted as follows : in this paradigm investigators administer a psychopharmacologic agent or psychological challenge procedure to patients under controlled conditions to probe psychiatric symptoms and other neurobiological responses . the principal scientific rationale behind this approach is to learn more about the underlying pathophysiological mechanisms responsible for the symptomatic expression of psychiatric illnesses . in addition , the knowledge gained from this type of study might lead to better predictors of treatment response or identification of novel therapeutic interventions . a quintessential ethical framework of challenge studies includes preserved decision - making capacity , informed consent , potential scientific and future clinical benefits , consent of an ethical committee , a favorable or acceptable risk : benefit ratio , absence of severe or long - lasting effects of the challenge agent , and follow - up studies on the effects of participation in symptom - provoking studies . in addition to lactate infusion , several further methods to provoke experimental panic attacks in patients with panic disorder by pharmacological means have been developed during the past decades ( overview in ref 4 ) . they include other agents that influence respiration , such as carbon dioxide inhalation or doxapram infusion . further established panicogens act specifically on neurotransmission , such as the noradrenergic substances yohimbine and isoprenaline , the serotonergic agents metachlorophenylpiperazine ( mcpp ) and fenfluramine , benzodiazepine - receptor agents , such as the inverse agonist fg 7142 and the antagonist flumazenil , agonists at the cck-2 ( formerly type b ) receptor , such as cholecystokinin tetrapeptide ( ckk-4 ) and pentagastrin , and the adenosine receptor antagonist caffeine . the following criteria for an ideal panicogen for human use have been proposed ( compiled according to gutmacher et al and gorman et al ) : it should mimic naturally occurring panic attacks it should foster both central and peripheral manifestations of panic it should be replicable the phenomena should be either short - lived or readily reversible it should differentiate between healthy subjects and those with pathology it should reflect the potential for a state response ; those who have been successfully treated clinically should not respond or respond far less than those who have had no treatment the effects should not be blocked by drugs , which do not work against spontaneous panic . concerning the claimed potential for a state response in patients after successful anti - panic treatment , the further discourse of this paper will be restricted to drug treatment ( and will not address findings after psychotherapeutic treatment or spontaneous remission ) . the use of experimental panic provocation by panicogens after psychopharmacological anti - panic treatment may be a more advantageous means to assess drug effects than just waiting for days and weeks for spontaneous panic attacks to occur , and having the patients keep panic diaries to characterize panic frequency and severity . in some regard , this procedure resembles the role of the well - known exercise stress test in diagnosis and treatment of angina pectoris in internal medicine . several studies , mostly with lactate , carbon dioxide , or cck-4 , have demonstrated that the established antipanic drug treatments with nonselective serotonin reuptake inhibitors ( the tricylic antidepressants imipramine and clomipramine ) , various selective serotonin reuptake inhibitors ( ssris ) and benzodiazepines ( particularly alprazolam ) indeed diminish experimentally induced panic in patients with panic disorder . in detail , in studies with sodium lactate infusions prior medication with the benzodiazepines diazepam and alprazolam as well as with the tricyclic antidepressant imipramine significantly decreased induction of panic anxiety in panic patients and thus appeared to increase the threshold for lactate - induced panic attacks . carbon dioxide ( 35%)-induced panic was attenuated in panic disorder patients after treatment with the benzodiazepines clonazepam and alprazolam , with imipramine or clomipramine , paroxetine , sertraline , or fluvoxamine . cck-4-elicited panic was decreased in panic patients after imipramine treatment and after citalopram or fluvoxamine . the response to the further panicogens after treatment with standard anti - panic drugs are less intensively studied in patients alprazolam blocked the panic symptoms provoked by mcpp ( piperazine ) and yohimbine , long - term imipramine did not alter yohimbine - induced increases in ratings of anxiety - nervousness , but fluvoxamine reduced yohimbine - induced anxiety . for some investigational drugs experimental panic provocation has been used in patients with panic disorder ( without prior testing in panic models in healthy man , as described in the following paragraphs ) . the emerging data might give valuable information for decision making as to whether further study on their action on spontaneous attacks is worthwhile . however , a definite evaluation of the informative value of this approach at this stage is not yet possible due to the paucity of studies . a single oral dose of 50 mg of l-365,260 , a central cck receptor antagonist , had shown a differential action on cck-4- and lactate - induced panic attacks in patients with panic disorder . in a double - blind , placebo - controlled , crossover study in 29 patients , cck-4 90 minutes after l-365,260 significantly reduced the number and sum intensity of provoked panic symptoms . in contrast , a double - blind , placebo - controlled parallel - group study in 24 patients with sodium lactate infusion given after the same dosage of the compound and in the identical time frame failed to reveal statistical differences on these panic attack parameters . in a multicenter , placebo - controlled , double - blind trial with l-365,260 30 mg qid for 6 weeks no clinically significant treatment effects in panic attack frequency or intensity were found and testing higher doses was suggested , but has not been performed so far . in a double - blind , placebo - controlled , crossover design , nine panic patients were given an intravenous infusion of 150 g of atrial natriuretic peptide ( anp ) followed by experimental panic induction using cck-4 . the rationale was derived from observations that anp is released during panic attacks in humans and has anxiolytic - like effects in preclinical studies . the cck-4 response as per acute panic inventory ( api ) ratings was significantly reduced after anp versus placebo pre treatment . these findings of anti - panic activity of anp were replicated in another study in ten panic patients under comparable experimental conditions with a lower dose of cck-4 . unfortunately , until now no study about the action of anp ( or another agonist at the type a natriuretic peptide receptor ) on spontaneous panic attacks in patients with panic disorder has been reported . an early study in outpatients suffering from panic disorder using the panic response to cck-4 challenge as the primary outcome parameter was conducted with the novel neurokinin-3 ( nk-3 ) receptor antagonist sr142801 ( osanetant ) . fifty - two patients who had developed a panic attack with cck-4 were randomized to 4 weeks of treatment ( 200 mg / d orally ) in a double - blind , placebo - controlled design and then a second cck-4 challenge was performed . however , with regard to the primary efficacy end point , ie , the increase of api total score , osanetant was not significantly different from placebo . on the panic and agoraphobia scale no significant treatment effects of this compound were detected during these 4 weeks . for many panic patients it is quite aversive and frightening to undergo an experimental panic challenge and to be treated with an investigational product due to catastrophizing disorder - immanent cognitions , fears of side effects , and the possibility of being randomized to placebo treatment . to bridge the gap between preclinical panic models and studies in patients , experimental panic provocation in healthy human subjects might serve as a valuable tool for assessment of novel anti - panic compounds during the early phase of drug development in proof - of - concept studies . healthy volunteer translational studies might deliver valuable information on whether it is worthwhile to consider further , more thorough studies in patients . however , standard sodium lactate panic is not an apt panic model in healthy subjects , because , as already mentioned , in contrast to patients with panic disorder , only a small percentage of healthy humans develop panic symptoms to it . interestingly , sinha et al investigated , in a single - blind pilot study , whether additional pretreatment with naloxone , an opioid receptor antagonist , could render healthy controls who are nonresponsive to panic induction by lactate infusion sensitive to the latter panicogen . indeed , substantial increases in the api scores were displayed by 8 out of 12 subjects during such treatment ; naloxone alone did not result in panic symptoms . in a following more sophisticated investigation in 25 volunteers ( using a crossover , randomized design ) further evidence was shown that impairment of the endogenous opioid system by naloxone accentuates symptomatic response to lactate , but no significant differences in api ratings were detected . notwithstanding , the authors suggest testing the specificity of the naloxone - lactate model in healthy man comparing specific anti - panic medications with ineffective anti - panic agents , and furthermore screening for putative anti - panic agents with this method . further studies will demonstrate whether this complex model is applicable for translational panic research in healthy humans . the further discourse will be restricted to these two panicogens , because we are not aware of any published studies testing anti - panic drugs in normal volunteer challenge studies using other substances . although patients with panic disorder show an enhanced sensitivity to intravenous bolus injection of cck-4 , increasing its dose brings about a substantial panic - like reaction also in normal controls . while the panic rate after injection of 25 g was 91% for patients and only 17% for controls , 50 g of cck-4 induced a fullblown panic attack in 100% of patients and in a sizable 47% of controls . among healthy volunteers significant dose - related differences were also found for the number of panic symptoms and their sum intensity , which makes cck-4 a useful research model for dimensional aspects of panic also in the nonclinical subjects who do not develop a full - blown panic attack . also , with a single breath of 35% carbon dioxide inhalation panic patients show significantly stronger symptoms of panic anxiety than normal controls . the induced cluster of symptoms in healthy volunteers is , however , similar to those elicited in panic attacks naturally occurring in patients affected by panic disorder ; but the panic signal obtained with one breath of 35% carbon dioxide seems to be weaker than with injection of 50 g of cck-4 in healthy subjects : direct comparison of only 25 g of cck-4 and 35% carbon dioxide revealed significantly more intense symptoms with cck-4 , but not a significantly greater number of symptoms ; the incidence of panic attacks was similar : 21% for co2 and 17% for 25 mg of cck-4 . a methodological problem is that psychometric assessment of induced panic does not follow consistent rules different panic rating scales , such as the api and the dsm - derived panic symptom scale ( pss ) are used and different criteria to divide panickers from non - panickers . to provide a basis for the use of the cck-4 model in proof of concept studies in healthy volunteers , the psychometric , cardiovascular , and neuroendocrine responses to 50 g of cck-4 were studied in 85 healthy men . the api - derived panic rate was 78.8% and thus 10.6% higher than that derived from the pss ratings ( 68.2% ) . this should be taken into account when comparing studies and when choosing a categorical instead of a dimensional outcome parameter of panic provocation . another result of this study was that cardiovascular and hormonal alterations to cck-4 challenge are not valuable as an objective readout of panic . we must bear in mind to depend on relatively weak data from self - report when assessing panic anxiety . because the vast majority of studies on pharmacological modulation of experimental panic in healthy volunteers was performed using cck-4 , the focus here will be on this panicogen ( for synopsis of results , please see table i ) . in the 35% carbon dioxide model of panic in healthy volunteers an acute dose of 1 mg alprazolam 2 hours before inhalation resulted in significant anti - panic effects in a double - blind , placebo - controlled , three - way crossover study in 12 healthy subjects . with an ssri , only one study in healthy man using the 35% co , challenge has been published . in this 2-week double - blind , placebo - controlled trial in 24 subjects , who were at high risk for panic disorder because of a personal history of panic attacks or a family history of treated panic disorder , and who had reacted with a panic attack to prior carbon dioxide testing however , the caveat must be applied that time of treatment with an ssri of only 14 days might not be long enough to manifest anti - panic action , because clinical benefits for ssri in panic disorder typically take longer . further studies must clarify , whether the 35% carbon dioxide panic model is sensitive to modulation with serotonergic antidepressants and other anti - panic drugs in healthy man . the acute inhibitory effect of benzodiazepines on cck4 panic in normal man has been demonstrated in two studies . in an early , small exploratory open - label study de montigny showed that pretreatment with lorazepam ( 1 mg at 4 pm and 2 mg at bedtime on the preceeding day , 1 mg at 8 am 1 hour before cck-4 challenge ) prevented the psychic effects of cck-4 ( doses between 75 and 150 g ) in four subjects who had experienced a panic - like attack with the same dose of this peptide before . in a double - blind , placebo - controlled , parallel - group study in 30 healthy volunteers treated with 1 mg alprazolam 1 hour prior to a 50-g cck-4 challenge , a significant reduction of api and pss scores and of the number of reported symptoms compared to placebo pretreatment were found . a recent study ( following an unbalanced , three - arm , two - period , crossover , double - blind , placebo - controlled design ) in 21 male volunteers who received 1 mg of lorazepam 2 hours before cck-4 did not show an attenuated panic signal in any pss parameter . however , this dose of lorazepam was considerably lower than in the two previous studies reported above . concerning anti - panic non - selective serotonin reuptake inhibitors ( imipramine or clomipramine ) no study on cck-4 panic in healthy volunteers has been published . with an ssri , kellner et al could not demonstrate an inhibitory effect of escitalopram ( 6 weeks of 10 mg / d ) on a 50-g cck-4 challenge in a double - blind , placebo - controlled , randomized , within - subject crossover design in 30 healthy young men . induced panic under escitalopram was even significantly more pronounced in the subgroup of subjects with the short / short genotype for the serotonin transporter linked polymorphic region in this study . another investigation with an identical dose and duration of escitalopram pretreatment also failed to show a significant inhibitory effect on cck-4 panic in healthy man ( i. tru , personal communication ) . to test the effectiveness of a single oral 100 mg dose of the cholecystokinin b antagonist ci-988 in attenuating panic symptoms induced by cck-4 a randomized , placebo - controlled , double - blind , three - way crossover design was used in 30 healthy men . a small ( 14% ) , but significant decrease of sum intensity scores of panic symptoms was observed under ci-988 . in contrast , a subsequent study in 14 patients with panic disorder who were given 50 or 100 mg of ci-988 in a double - blind , two - period incomplete block design 2 hours before injection of cck-4 failed to show a statistically significant treatment effect on the total intensity score on the pss ( the primary efficacy parameter ) , as well as on the number of panic symptoms , time to and occurrence of the first panic symptoms , duration of symptoms , intensity of apprehension , and the percentage of patients who did not have a panic attack . in a randomized , double - blind , placebo - controlled trial with 100 mg tid of ci-988 in panic patients no superiority to placebo in reducing panic attacks could be shown . after the metabotropic glutamate 2/3 receptor agonist ly544344/ly354740 had shown acute anxiolytic - like action in preclinical studies , a pilot study on panic anxiety induced by cck-4 was performed in healthy humans . twelve male volunteers were treated with 80 mg bid ly544344 orally for 1 week in a randomized placebo - controlled double - blind crossover design . while no significant treatment effect for the number of cck-4-induced panic symptoms and subjective anxiety ratings emerged in the entire sample , the ten subjects who showed an endocrine response to the test substance displayed a significant reduction on these two measures . unfortunately , due to emerging problems in long - term preclinical safety , no subsequent clinical studies were performed with this compound . the finding of a significant anti - panic effect of atrial natriuretic peptide ( anp ) in patients with panic disorder has already been mentioned above . in this double - blind , placebo - controlled , crossover study also nine healthy control subjects matched for sex and age were included and they were given an intravenous infusion of 150 g of anp followed by cck-4 panic induction . however , no significant treatment effect of anp on api ratings was observed in healthy man . the -blocker propranolol ( 0.2 mg / kg given intravenously over 20 minutes ) has been observed to significantly decrease the cck-4 response ( sum intensity and number of panic symptoms ) in a study in 30 healthy male volunteers who were randomly assigned to propranolol or placebo . in panic patients no study with a -blocker has been reported using the cck-4 model and in a 5-week double - blind placebo - controlled study , no efficacy of propranolol on spontaneous attacks was detected . interestingly , using the cck - b receptor agonist pentagastrin for panic provocation in a double - blind , randomized , placebo - controlled study with identical dose and application of propranolol as above in a predominantly female group of 16 healthy adult subjects , no significant effect on total symptom intensity as per the api was observed . regarding gaba ( -aminobutyric)-ergic drugs other than benzodiazepines both the gaba reuptake inhibitor tiagabine and the gaba transaminase inhibitor vigabatrin have been studied in this experimental panic paradigm . fifteen healthy volunteers received 15 mg tiagabine daily for 1 week in an open study . both api - and pss - scores showed a significant reduction to a cck4 stimulus that was performed before and after treatment . in a following double - blind placebo - controlled pilot study with 4 weeks of tiagabine in 19 patients with panic disorder a subset of seven patients ( three treated with tiagabine , four treated with placebo ) was challenged with 25 g of cck-4 at baseline and after 14 and 28 days . patients of the tiagabine vs the placebo group showed considerably decreased sensitivity to cck-4 ( as per api ratings ) . however , clinical benefits of tiagabine on the panic and agoraphobia scale were not detected . also a 10-week open study suggested that tiagabine maybe of little benefit on this measure . vigabatrine ( 2 mg / d ) was given for 7 days to ten healthy volunteers in an open - label study after placebo - controlled administration of cck-4 and a second cck-4 challenge followed after the treatment period . a marked and significant attenuation of cck-4 induced panic symptoms ( as per api and pss scores ) and of anxiety was observed with vigabatrine . however , no placebo - controlled and double - blind study has followed so far and the effect of vigabatrine has not been investigated in the cck-4 paradigm in panic patients . recently , the translocator protein ( 18 kd ) ligand xbd173 , which enhances gabaergic neurotransmission via induction of neurosteroidogenesis , was tested in 71 healthy male volunteers who had shown a clear panic response to an initial cck-4 challenge . in this double - blind study the subjects were randomized to 7 days of treatment with placebo , 10 , 30 , or 90 mg / day of xbd173 or 2 mg / d alprazolam as active control condition . a significant difference from placebo in the difference of the api ratings between the first and the second challenge ( on day 7 ) with cck-4 the acute inhibitory effect of benzodiazepines on cck4 panic in normal man has been demonstrated in two studies . in an early , small exploratory open - label study de montigny showed that pretreatment with lorazepam ( 1 mg at 4 pm and 2 mg at bedtime on the preceeding day , 1 mg at 8 am 1 hour before cck-4 challenge ) prevented the psychic effects of cck-4 ( doses between 75 and 150 g ) in four subjects who had experienced a panic - like attack with the same dose of this peptide before . in a double - blind , placebo - controlled , parallel - group study in 30 healthy volunteers treated with 1 mg alprazolam 1 hour prior to a 50-g cck-4 challenge , a significant reduction of api and pss scores and of the number of reported symptoms compared to placebo pretreatment were found . a recent study ( following an unbalanced , three - arm , two - period , crossover , double - blind , placebo - controlled design ) in 21 male volunteers who received 1 mg of lorazepam 2 hours before cck-4 did not show an attenuated panic signal in any pss parameter . however , this dose of lorazepam was considerably lower than in the two previous studies reported above . concerning anti - panic non - selective serotonin reuptake inhibitors ( imipramine or clomipramine ) no study on cck-4 panic in healthy volunteers has been published . with an ssri , kellner et al could not demonstrate an inhibitory effect of escitalopram ( 6 weeks of 10 mg / d ) on a 50-g cck-4 challenge in a double - blind , placebo - controlled , randomized , within - subject crossover design in 30 healthy young men . induced panic under escitalopram was even significantly more pronounced in the subgroup of subjects with the short / short genotype for the serotonin transporter linked polymorphic region in this study . another investigation with an identical dose and duration of escitalopram pretreatment also failed to show a significant inhibitory effect on cck-4 panic in healthy man ( i. tru , personal communication ) . to test the effectiveness of a single oral 100 mg dose of the cholecystokinin b antagonist ci-988 in attenuating panic symptoms induced by cck-4 a randomized , placebo - controlled , double - blind , three - way crossover design was used in 30 healthy men . a small ( 14% ) , but significant decrease of sum intensity scores of panic symptoms in contrast , a subsequent study in 14 patients with panic disorder who were given 50 or 100 mg of ci-988 in a double - blind , two - period incomplete block design 2 hours before injection of cck-4 failed to show a statistically significant treatment effect on the total intensity score on the pss ( the primary efficacy parameter ) , as well as on the number of panic symptoms , time to and occurrence of the first panic symptoms , duration of symptoms , intensity of apprehension , and the percentage of patients who did not have a panic attack . in a randomized , double - blind , placebo - controlled trial with 100 mg tid of ci-988 in panic patients no superiority to placebo in reducing panic attacks could be shown . after the metabotropic glutamate 2/3 receptor agonist ly544344/ly354740 had shown acute anxiolytic - like action in preclinical studies , a pilot study on panic anxiety induced by cck-4 was performed in healthy humans . twelve male volunteers were treated with 80 mg bid ly544344 orally for 1 week in a randomized placebo - controlled double - blind crossover design . while no significant treatment effect for the number of cck-4-induced panic symptoms and subjective anxiety ratings emerged in the entire sample , the ten subjects who showed an endocrine response to the test substance displayed a significant reduction on these two measures . unfortunately , due to emerging problems in long - term preclinical safety , no subsequent clinical studies were performed with this compound . the finding of a significant anti - panic effect of atrial natriuretic peptide ( anp ) in patients with panic disorder has already been mentioned above . in this double - blind , placebo - controlled , crossover study also nine healthy control subjects matched for sex and age were included and they were given an intravenous infusion of 150 g of anp followed by cck-4 panic induction . however , no significant treatment effect of anp on api ratings was observed in healthy man . the -blocker propranolol ( 0.2 mg / kg given intravenously over 20 minutes ) has been observed to significantly decrease the cck-4 response ( sum intensity and number of panic symptoms ) in a study in 30 healthy male volunteers who were randomly assigned to propranolol or placebo . in panic patients no study with a -blocker has been reported using the cck-4 model and in a 5-week double - blind placebo - controlled study , no efficacy of propranolol on spontaneous attacks was detected . interestingly , using the cck - b receptor agonist pentagastrin for panic provocation in a double - blind , randomized , placebo - controlled study with identical dose and application of propranolol as above in a predominantly female group of 16 healthy adult subjects , no significant effect on total symptom intensity as per the api was observed . regarding gaba ( -aminobutyric)-ergic drugs other than benzodiazepines both the gaba reuptake inhibitor tiagabine and the gaba transaminase inhibitor vigabatrin have been studied in this experimental panic paradigm . fifteen healthy volunteers received 15 mg tiagabine daily for 1 week in an open study . both api - and pss - scores showed a significant reduction to a cck4 stimulus that was performed before and after treatment . in a following double - blind placebo - controlled pilot study with 4 weeks of tiagabine in 19 patients with panic disorder a subset of seven patients ( three treated with tiagabine , four treated with placebo ) was challenged with 25 g of cck-4 at baseline and after 14 and 28 days . patients of the tiagabine vs the placebo group showed considerably decreased sensitivity to cck-4 ( as per api ratings ) . however , clinical benefits of tiagabine on the panic and agoraphobia scale were not detected . also a 10-week open study suggested that tiagabine maybe of little benefit on this measure . vigabatrine ( 2 mg / d ) was given for 7 days to ten healthy volunteers in an open - label study after placebo - controlled administration of cck-4 and a second cck-4 challenge followed after the treatment period . a marked and significant attenuation of cck-4 induced panic symptoms ( as per api and pss scores ) and of anxiety was observed with vigabatrine . however , no placebo - controlled and double - blind study has followed so far and the effect of vigabatrine has not been investigated in the cck-4 paradigm in panic patients . recently , the translocator protein ( 18 kd ) ligand xbd173 , which enhances gabaergic neurotransmission via induction of neurosteroidogenesis , was tested in 71 healthy male volunteers who had shown a clear panic response to an initial cck-4 challenge . in this double - blind study the subjects were randomized to 7 days of treatment with placebo , 10 , 30 , or 90 mg / day of xbd173 or 2 mg / d alprazolam as active control condition . a significant difference from placebo in the difference of the api ratings between the first and the second challenge ( on day 7 ) with cck-4 despite ample exciting research efforts , we are still far from having reliable information on model validity of experimental panic provocation paradigms in healthy man as tools to test novel anti - panic drugs . a few false - negative or false - positive findings question the usefulness of this approach . existing preliminary data need replication using exclusively double - blind , placebo - controlled designs . especially for multicenter trials , standardization of the test environment and subjects ' instruction need careful attention . many findings were obtained with relatively small samples and few studies had included women . rarely have dose - response aspects been investigated . challenge studies with genetically precharacterized and homogenized samples are worth considering and may achieve clearer results . another problem is that our growing understanding of the complex pathophysiology of panic suggests that there may be no unitary model but possibly different phenocopies , leading to a similar pathophysiological phenomenon . hopefully , further research will eventually lead us to more definite knowledge on which panicogens in healthy man are capable of predicting the usefulness of various anti - panic drugs for treatment in panic disorder .

experimental neurochemical provocation of panic attacks in susceptible human subjects has considerably expanded our knowledge of the pathophysiology and psychopharmacology of panic disorder . some panicogens also elicit short - lived panic - like states in healthy man . this offers the opportunity to assess the anti - panic action of drugs in proof - of - concept studies . however , from current data it is still unclear whether experimental panic in healthy man is a valid translational model . most such studies in healthy volunteers have been performed using a cholecystokinin tetrapeptide ( cck-4 ) challenge . while cck-4 panic was blocked by alprazolam pretreatment , escitalopram showed negative results in healthy man . preliminary findings on novel investigational drugs and a few problematic results will be reviewed . small sample sizes in many panic provocation studies , lack of dose - response aspects , and still - insufficient knowledge about the biological underpinning of experimental and spontaneous panic limit the interpretation of existing findings and should inspire further research .

irritable bowel syndrome ( ibs ) is a common gastrointestinal disorder in which bowel function is altered ( diarrhoea or constipation ) in association with abdominal pain or discomfort . the age at onset varies , with the peak in the third and fourth decades of life . the disorder has a female predominance ( 2:1 ratio ) . according to the commonly accepted definition , no mechanical , biochemical , or overt inflammatory condition explains the presence of symptoms . therefore , the diagnosis of the irritable bowel syndrome is based solely on individual complaints in the absence of alarm symptoms ( pain or diarrhoea that awakens / interferes with sleep , visible or occult blood in stool , weight loss , fever , abnormal physical examination ) and exclusion of obvious organic diseases and structural alterations [ 46 ] . the pathogenesis of the irritable bowel syndrome remains unsolved since mechanisms leading to alteration of the gut function related to particular symptoms are unclear . the main gastrointestinal sensory - motor dysfunction in irritable bowel syndrome is consistent with an up - regulation in neural processing between the gut and the brain ( brain - gut axis ) and results in alterations in gut motility , secretion , and visceral sensation . there is also an increasing acceptance that the central nervous system , an important component of the brain - gut axis , plays an important role in development of symptoms in the response to stress as an effect underlying affective disorder . serotonin , a key mediator of gut motility , secretion , and sensation , has been found to mediate this bi - directional brain - gut communication , but studies have shown that cholecystokinin and ghrelin are also involved in gut - brain signalling . since 1928 , when bockus suggested that imbalance of the autonomic nervous system was responsible for ibs , attention has been focused on the dysfunction of the autonomic nervous system ( ans ) [ 1116 ] . the aim of this study was to evaluate changes in ans activity and its correlation with gastric myoelectric activity in constipation - predominant ibs patients . thirty patients ( 18 women , 12 men ; 42.214 yrs ) with constipation - predominant ibs ( ibs - c ) and 30 healthy volunteers ( 19 women , 11 men , 38.911.6 yrs ) were included in the study ( table 1 ) . to diagnose patients with the constipation - predominant form of ibs , rome iii criteria were used . we excluded patients with diabetes mellitus , obesity ( defined according to who as bmi > 30 kg / m ) , alcoholism , cardiovascular ( hypertension , coronary artery disease , valvular heart disease , cardiac arrhythmias ) and neurological diseases , medications possibly interfering with heart rate variability measurement , gastrointestinal pathology ( e.g. , inflammatory bowel disease ) or surgery , renal , or gynecological pathology that might have resulted in ibs symptoms ( e.g. , bowel resection , endometriosis ) . we also excluded patients taking specific medications for ibs on a regular basis ( e.g. , antidiarrheals , laxatives , antispasmodic agents , tricyclic antidepressants , serotonin-3-receptor antagonists or serotonin-4-receptor agonists , 3 or more times a week ) . all participants involved in the study were informed about examinations to be carried out and they all gave their consent in writing to all examinations . after overnight fasting , autonomic activity assessed by hrv with a task force monitor 3041 ( cnsystems , austria ) and gastric myoelectric activity recorded using a 4-channel electrogastrography ( egg ) recorder ( medtronic , usa ) in basal conditions and after a standard meal 30 minutes each ( nutridrink 300 kcal , nutricia , poland ) were measured simultaneously in both groups . in the hrv recording , the frequency domain analysis parameters : lf power of spectra of low 0.040.15hz frequency ; hf power of spectra of high 0.150.4hz frequency ; based on the fast fourier transformation ( fft ) were calculated . in the electrogastrography analysis the following parameters were evaluated : dominant frequency ( df ) ; dominant power of dominant frequency ( dp ) ; percentage of normo- , brady- and tachygastria ( 0.52 cpm bradygastria ; 24 cpm normogastria ; 4.09.0 cpm tachygastria ) , percentage of dysrhythmia and arrhythmia time ; and percentage of slow - wave coupling between channels 34 ( % swc ) . hrv recording in resting conditions was followed by the deep breathing test ( dbt ) , which lasted 5 minutes . apart from registering hrv , e / i ( ratio of the longest and the shortest rr period during the test ) , dbd ( deep breathing difference , the difference between the maximum and minimal heart rate during the test ) and rsa amplitude ( respiratory sinus arrhythmia , the difference in the heart rate at the end of exhalation and at the end of the inhalation ) values were determined . the tilt test was conducted by picking a patient up passively on a bed equipped with a electro - hydraulic servomotor with a 60 slope , in which position the patient stayed in through 5 minutes , and afterwards he returned to the horizontal position . a bisectional electro - hydraulic tilt table ( manumed , enraf nonius , netherlands ) was used . during the valsalva manoeuvre , the patient being examined , after the previous rest , exhaled air into the mouthpiece of the manometer for 15 seconds , causing the pylon of mercury to reach the value of 40 mmhg . during the entire attempt , the hand grip test performed for 5 minutes , in which an examined person was gripping the dynamometer with a power of 30% of maximum strength of the contraction of the hand achieved before the attempt . we determine the difference between the value of the diastolic blood pressure after finishing the contraction , and value before beginning the test , using a manual hydraulic dynamometer ( jamar , preston , usa ) . blood samples were stored at 28c until centrifuged to separate the plasma within 2 hours after blood collection ( at 3800 g at 8c for 10 minutes ) . the supernatant was aspirated and stored from 6 h to 1 month at 20c until analysis . analyses of plasma adrenaline and noradrenaline concentrations were performed with adrenaline and noradrenaline elisa kit ( catcombi elisa , ibl , germany , test sensitivity 20 pg / ml ) for automated systems . analysis of plasma ghrelin concentration was performed with human unacylated ghrelin elisa ( biovendor , usa , test sensitivity 0.2 pg / ml ) for automated systems . analysis of plasma insulin concentration was performed with the ins - easia kit ( biosource europe s.a . analysis of cholecystokinin ( cck ) was performed with the elisa kit ( bender medsystems , austria , test sensitivity 1.65 ng / ml ) for automated systems . absorption readout was done using a powerwave elx800 reader ( biotek , usa ) with a 450 nm wave length . substance concentration value was read off from the curve delineated for hormone concentration standards expressed in appropriate units . numerical data are given as the arithmetic means and standard deviations ( x sd ) . statistical analysis was carried out with the help of the statistical package statistica 8.0 for windows ( statsoft inc . , a parametric test was applied for comparing value of average findings for patients and persons from the control group . we used model iv , which is a test in which statistics ( test function ) z have normal distribution , and critical values were read off from boards . in case of lack of normal distribution , the iii model of the same test , with cochran - cox c statistics , was used , for which critical values were enumerated , not read out from boards . the hypotheses in this case had the form : null hypothesis h0 : m 1=m 2 , against the alternative hypothesis h1 : m 1 m 2 . the correlation between hrv parameters , egg parameters and plasma catecholamine was evaluated by analyzing the relationship between hrv power spectral parameters ( lf , ln lf , hf , ln hf ) and plasma catecholamine levels ( adrenaline , noradrenaline ) , as well as egg parameters ( percent of dysrhythmias , df , dp , swc ) and plasma catecholamine levels . resting hrv parameters were lower in ibs patients in comparison with the control group : lf 833.2849.6 vs. 1176.7790.6 ms ; hf 716.1769.1 vs. 1535.31359.5 ms ; yet lf / hf - rri ratio was higher in patient group : 2.21.8 vs. 1.31.1 ; p<0.05 , respectively ( table 2 ) . in db test hf value was lower than in resting conditions with autonomic balance shifted towards lf value . analyses of ans activity indices revealed abnormal value of 30/15 ratio in the patient group ( p<0.05 ) indicating parasympathetic dysfunction ( table 4 ) . nmol / l , p<0.05 , respectively ( table 5 ) . in ibs - c patients lower ghrelin ( 187.39104.02 vs. 257.4988.04 pg / ml ) and cholecystokinin ( 0.230.13 vs. 3.281.79 ng / ml ) plasma concentrations were observed . insulin concentration was substantially higher in patients ( 14.8713.7 vs. 7.872.6 iu / ml ) , p<0.05 , respectively ( table 6 ) . fasting ibs patients showed higher gastric arrhythmia recording time ( 28.8213.45% vs. 8.58.47% ) , and dominant power ( dp ) was lower ( 60675.68109922.77 vs. 108857.5130405.6 v ) ( table 7 ) . feeding improved arrhythmia to 20.0511.03% vs. 5.215.93% and 55.999.46% in ibs patients vs. 77.4411.89% in the control group in the fasting period and 62.4612.63 vs. 82.6510.78% , respectively , in the postprandial period ( table 9 ) ( p<0.05 in all cases ) . we did not observe statistically significant correlation between hrv parameters and the plasma concentration of determined hormones . a presence of a very strong correlation ( 0.92 ) between the percentage of arrhythmia in the fasting egg recording and ghrelin concentration was demonstrated . in the postprandial egg recording , the correlation concerned ghrelin concentration and the tachygastria percentage ( 0.73 ) . both in the fasting and postprandial recording , a strong negative correlation was observed between plasma noradrenaline concentration and the average swc percentage ( 0.72 ) . irritable bowel syndrome is characterized by pain in the abdominal cavity and irregularities in defecation . at present the main mechanism behind ibs is considered to be dysfunction of the brain - gut axis associated with disturbed motor activity of the digestive tract , visceral hypersensitivity and disturbed neuroimmunologic response of the intestines . in 1928 a hypothesis was proposed that dysfunction of the autonomic nervous system could contribute to the manifestations observed in the course of ibs . the ans mediates communication between the brain and the digestive tract , and modulates and coordinates motor , secretory and immunologic functions of the digestive tract . increased sympathetic and decreased parasympathetic activity is an essential element of the body s response to stress . showed that activation of the sympathetic nervous system increased perception of intestinal wall stretching , which could explain the frequent complaints of pain and feeling of inflating intestines reported by ibs patients . in recent years examinations estimating relations between the ans activity and myoelectric activity of the stomach in ibs patients have not been conducted . hrv measurements and functional tests allowed us to demonstrate increased activation of the sympathetic part of the ans and disturbed parasympathetic function in ibs - c patients , which is confirmed by aggarwal et al , who described the presence parasympathetic dysfunction in ibs - c patients . in our own examinations , hrv analysis in the db test pointed to the dysfunction of the parasympathetic part of the ans . other researchers have observed low parasympathetic activity in the db test , weakened sympathetic reply in the tilt test and reduced parasympathetic response to stimulation with deep breathing in ibs - c patients . sympathetic predominance in the tilt test in ibs patients was also described in other studies . increased sympathetic activity was observed in women with ibs - c , and the diarrheal variant was associated with the opposite effect . in a more recent survey , increased parasympathetic influences and reduced sympathetic / parasympathetic balance were observed in the diarrheal ibs form compared to constipation - predominant ibs . however , a study done by robert et al showed no difference in the autonomic activity between constipation- and diarrhoea - predominant ibs forms ; therefore , the authors proposed the hypothesis that there is a continuum of autonomous dysfunction in particular ibs subgroups . recently , the degree of ans dysfunction in ibs patients in terms of amount of increased sympathetic activity was confirmed by estimating blood flow in the finger tip by means of laser doppler flowmetry . in all examinations mentioned above , esler and goulston demonstrated an increased urine adrenaline concentration in patients with diarrheal - form ibs , and heitkemper et al showed increased level of catecholamines and cortisol in urine in the course of ibs , but in this latter study only women were examined . in ibs , disorders of the motor activity are observed on different levels of the gut , from the stomach to the colon . regulatory peptides such as vip , cck or motilin influence the motor activity of the digestive tract . cck participates in signal transduction in the brain - gut axis through the primary afferent fibres of the vagal nerve , and the same fibres probably demonstrate the expression of receptors for ghrelin . ghrelin stimulates the motor activity of the digestive tract , triggering mmc and fastening stomach emptying . apart from the vagal nerve , receptors for ghrelin can be found in the digestive tract muscular layer and in the cns . depending on the place of release , regulatory peptides can act as hormones , neurotransmitters or neuromodulators , and therefore they can play an important role in the pathogenesis of ibs manifestations such as abdominal pain , diarrhoea and constipation . in meanwhile , sjolund et al observed abnormally prolonged cholecystokinin secretion in response to the fat - rich test meal in ibs patients . mangel et al stated that the cck application in healthy people can weaken colon motor activity , but it does not trigger the same effect in ibs - c patients . the role of ghrelin in ibs pathology was studied by el - salhy et al . , who did not observe differences in the plasma ghrelin activity in comparison to the control group , but examining the density of cells having receptors for ghrelin in the stomach and the duodenum they stated that it was reduced in constipation - predominant ibs , and increased in the diarrheal form . researchers explained that in order to compensate for increased or reduced density of ghrelin cells , the synthesis and release of ghrelin may be reduced in the diarrheal form and increased in the constipation form . with time this mechanism can run out , with subsequent increase in the synthesis and release of ghrelin in the diarrheal form and reduction in the constipation form , and it is responsible for manifestations dominating in particular ibs subtypes . abnormal , reduced plasma cck and ghrelin concentration in ibs - c patients may impair functioning of the brain - gut axis and underlie disorders of the motor activity of the stomach , confirmed in the electrogastrography recordings . ibs is associated with behavioural factors , and stress is an element in the pathogenesis of ibs manifestations . ibs patient subgroups differ in the awareness and intensity of somatic and psychological manifestations , with greater intensity of concerns appearing in constipation - predominant ibs . stress is associated with increased cortisol concentration , which results in insulin resistance with hyperinsulinemia [ 4143 ] , and insulin is a crucial factor activating the sympathetic part of the ans . eriksson et al measured c peptide concentration , which is known to correspond with the concentration of secreted insulin . concentration of c peptide was slightly lower compared to the diarrheal form , yet higher than in the control group . in the same study patients had increased concentration of cortisol compared to the diarrheal form and the control group , which shows the role of stress in triggering hyperinsulinemia and sympathetic activation . hyperinsulinemia in ibs - c patients not only can explain sympathetic overactivity , it may also explain the decrease in the motor activity of the stomach and intestines . finding a link between potential myoelectrical activity disorders and ans dysfunction was the basic aim of this work . egg can vicariously detect disorders of the motor activity of the stomach in ibs patients . in some examinations an increased tachygastria percentage egg recording disturbances were observed in patients with coexisting functional dyspepsia , but in a 24-hour recording other researchers were able to register reduced tachygastria percentage . a characteristic reduction of the dominant power was also observed , suggesting that electrogastrography could be an additional diagnostic method in distinguishing ibs and functional dyspepsia . our own results clearly show smaller normogastria percentage in the patients group in fasting conditions , not increasing significantly after a meal . fasting dp value was lower in the patients group , but it increased in the postprandial period . van de vort et al observed the lack of postprandial egg amplitude increase highly correlating with delayed emptying of the stomach . in our own work , patients had significantly lower percentage of slow wave coupling ( swc ) , both in average value as well as for individual pairs of channels , which attests to the disturbed propagation of slow waves in the stomach . moreover , the swc percentage stayed in the opposite relation with the plasma catecholamines concentrations . low swc values may be associated with delayed stomach emptying and gastroparesis in ibs patients is associated with disorders of small intestine motor activity . observations carried out prove dp value and%swc to be measurable indicators of stomach motor activity disorders . disorders of the gma described in our study may result from the lack of the sympathetic - parasympathetic balance . increased plasma catecholamines and insulin concentrations confirm the existence of the dysfunction of the ans . current pathophysiological ibs models combine the influence of the central nervous system with the activity of the intestinal and autonomous nervous systems . disorders of the ans can influence myoelectrical activity , motor activity of the digestive tract , resting muscle tone and pain conducting . within the brain - gut axis , the central sympathetic influence is most probably responsible for disorders of the stomach myoelectrical activity in ibs patients , both in fasting and postprandial conditions , causing delayed emptying of the stomach and dyspeptic complaints . based on results of different examinations conducted in our study , it appears that sympathetic overactivity and parasympathetic dysfunction are associated with constipation - predominant ibs . ans activity measurement with hrv and functional tests was a valuable method of autonomic balance assessment . however , further research on the association of the heart and gastro - enteric autonomic activity is necessary ; examinations of the autonomic nervous system activity can not be treated as the only diagnostic tool in patients with irritable bowel syndrome .

summarybackgroundthe main mechanism underlying irritable bowel syndrome is currently believed to be a dysfunction of the brain - gut axis . autonomic nervous system dysfunction can contribute to development of irritable bowel syndrome symptoms by disturbing visceral sensations.material/methodsthirty patients with a diagnosis of constipation - predominant irritable bowel syndrome and 30 healthy volunteers were included in the study . resting and functional autonomic nervous system tests and percutaneous electrogastrography were performed . plasma adrenalin , noradrenalin , insulin , ghrelin and cholecystokinin activity was analyzed.resultsincreased sympathetic activation with disturbed parasympathetic function was demonstrated . patients had substantially higher plasma catecholamine concentration , which confirms sympathetic overbalance . hyperinsulinemia may explain sympathetic predominance followed by gastric and intestinal motility deceleration . abnormal , reduced ghrelin and cholecystokinin titre may disturb brain - gut axis functioning and may be responsible for gastric motility deceleration . in electrogastrography , distinctly lower values of fasting normogastria percentage and dominant power were observed . patients had substantially lower slow wave coupling percentage both in fasting and postprandial periods , which negatively correlated with plasma catecholamines level . gastric myoelectrical activity disturbances may result from lack of sympatho - parasympathetic equilibrium.conclusionscentral sympathetic influence within the brain - gut axis is most probably responsible for myoelectrical activity disturbances in irritable bowel syndrome patients .

the incidence of trocar site hernia is reported to be 0.11~0.84% after laparoscopic cholecystectomy.(1,2 ) fear(3 ) first reported a trocar site hernia in his large series on laparoscopic surgery . maio and ruchman(4 ) reported a trocar site hernia with small - bowel obstruction immediately after cholecystectomy ; this was the first report of a trocar site hernia in digestive surgery . since then many reports have been published on cholecystectomy , and more recently on gastrointestinal surgery . we report a patient who had an abdominal wall mass at a previous trocar site after laparoscopic distal gastrectomy . a 50 year - old women visited the hospital after a mass was detected in her right flank area . six months previously she had undergone laparoscopic - assisted subtotal gastrectomy for an early gastric cancer located in her gastric antrum . we found a 4.53.5 cm mass at the previous right lower 12 mm trocar site on computed tomography ( ct ) scan . the mass showed fat density on the ct scan and it was located between the external and the internal oblique muscle of the abdominal wall ( fig . the post - operative findings showed that the mass was located between the external oblique muscle and the internal oblique muscle and that it was oval shaped with a size of 4.53.3 cm ( fig . although the incidence of gastric cancer and the mortality associated with this disease have decreased gradually in east asia , it remains the second most frequent cause of death in korea . recently , the inclusion criteria for laparoscopic assisted gastrectomy have been enlarged , which has led to an increase in the number of publications describing laparoscopic treatment of advanced gastric cancer.(5,6 ) we previous reported trocar site recurrence after laparoscopic gastrectomy in advanced gastric cancer patients.(7 ) so , when a mass at a trocar site is uncovered , it is worth considering trocar site recurrence after a previous cancer operation . however , the density of the mass on the ct scan in the present case corresponded to fat density , and the mass was located between the external oblique and the internal oblique muscle . we concluded the mass had herniated from the abdominal omentum , because it was located between the external and the internal muscle , and the fascia of the internal oblique and the transversalis muscle had defects . most tracar - site hernias involve trocars of at least 10 mm , but a few cases of not only 5 mm trocars but also 3-mm trocars have been reported.(8,9 ) in the survey of the american association of gynecologic laparoscopists,(10 ) of 840 trocar site hernias , 725 ( 86.3% ) occurred in sites where the diameter was at least 10 mm . only 92 hernias ( 10.9% ) occurred at the site of insertion of trocars with a diameter of more than 8 mm but less than 10 mm , with 23 ( 2.7% ) occurring in sites where the trocars were smaller than 8 mm ( they estimated that 41.3% of all trocars were at least 10 mm . ) . the risk of a trocar site hernia is no different than a veress needle , open access or blunt and cutting trocars . a slowly absorbable or non - absorbable suture is recommended for the prevention of hernias . the fascia should be sutured in all trocar sites 10 mm , but all port sites should be sutured regardless of trocar size in children ( age<6 years ) . diabetes and smoking are possible risk factors , but not obesity . we conclude that patients with trocar site masses exhibiting fat density on a ct scan could be followed up without surgery , and that fascial defects located at 10-mm or larger trocar sites should be closed whenever possible to prevent hernia formation .

a trocar site hernia is a rare complication . we report a patient who had an abdominal wall mass at a previous trocar site after laparoscopic distal gastrectomy . it was diagnosed as omental herniation and fat necrosis . we conclude that patients with trocar site masses exhibiting fat density on a computed tomography scan could be followed up without surgery , and that fascial defects located at 10-mm or larger trocar sites should be closed whenever possible to prevent hernia formation .

the term epigenetics usually refers to changes in gene expression taking place without a change in the dna sequence [ 13 ] . today , the concept implies two main mechanisms : dna methylation of cytosine bases and histone modification via acetylation and phosphorylation , which cause changes in gene activity . with chromosome duplication , such changes childhood abuse , for example , has been shown to cause epigenetic changes in the expression of glucocorticoid receptors in the adult brain [ 4 , 5 ] . as a result , stress can be defined as any condition which seriously perturbs the physiological or psychological homeostasis of an organism . stress caused by childhood events is usually by nature psychosocial . in such situations , the interpretation of what is experienced as stressful takes place in the brain . we now know that traumatic childhood events affect the brain and thus an earlier experience may trigger a stress response later in life . the significance of stress in the development of diseases has been described by , among others , the allostasis model . allostasis refers to the homeostasis of stress or the regulation of stress in the body , enabling the individual to adapt to the stress factor . when the body experiences long - lasting and too frequently recurring situations activating the stress response , a disease state may develop . this overload has long - lasting effects on the body 's metabolic systems : endocrinological , immunological , and neurological . studies have shown that these three systems are anatomically and functionally interlinked [ 1113 ] . in consequence of this overload , the body is predisposed to a number of diseases common in the world today , one of them being diabetes type 2 . for example , data from one longitudinal clinical study show that the prevalence of cardiovascular disease and diabetes is higher in later life among individuals separated from their families in early childhood during the second world war . cortisol is an important hormone , which mediates the effects of stress in the endocrinological system . hypothalamus , pituitary gland , and adrenal gland , that is , the hpa axis , regulate its secretion . several brain areas , for example , the amygdala and hippocampus , which are activated during psychosocial stress , influence the hypothalamus . cortisol functions as an antagonist to insulin and alleviates the immune response [ 9 , 16 ] . epigenetic regulation of the receptor gene nr3c1 leads to a decrease in glucocorticoid receptors , which in turn reduces the feedback from the hpa axis and thus increases cortisol secretion [ 4 , 5 ] . when the immune system is activated , inflammation - mediating cytokines are secreted in the stress response . by inhibiting these cytokines , cortisol acts to restore the homeostasis of the organism after the stressful condition has subsided . without this effect , the inflammatory state would continue to destroy the organism . measured by crp levels , as a result of earlier adverse childhood events the immune defence is more active in adulthood . chronic stress exposure may lead to lower cortisol levels , hypocortisolism , with increased th1-mediated immune defence and an elevated risk of th1-mediated autoimmune disease . as the neurologic system is activated as the most immediate response to a stressful event , sympathetic activation induces the secretion of catecholamines in the cortex of the adrenal glands ( the fight - or - flight response , that is , the acute stress response ) . neurons also secrete neuropeptides and thus speed up recovery from the stress response and enhance adaptation to it [ 21 , 22 ] . to plan the best quality of care , the general practitioner needs to understand an individual 's health problems in physical , social , and psychological dimensions . today , nearly half a million finns are estimated to have diabetes and the number is still steadily increasing . there are only few high quality population studies on the state of diabetes care in finland . the management of the diabetes is emerging . during childhood , stress factors may influence the developing hormonal , neurological , and immunological systems and hence also their functioning in adulthood . recent research findings suggest that stressful events can increase the risk of developing the difficult - to - manage form of diabetes , type 1 . the aim was to establish whether there is a connection between stressful events during childhood and diabetes . the study hypothesis was that childhood adversities increase the prevalence of diabetes and come up in diabetes care . the health and social support study ( hessup ) was a prospective follow - up study of the psychosocial health of the finnish working - aged population [ 27 , 28 ] . the subjects belonged to a random sample drawn from the finnish population register in four age groups : 2024 , 3034 , 4044 , and 5054 . completed questionnaires were returned by 25 898 individuals , giving a response rate of 40.0% . the compatibility of the hessup sample with the finnish general population was tested using official statistics , and the conclusion was that the differences in physical health between participants and the general population were small [ 27 , 28 ] . a follow - up questionnaire ( response rate 80.2% ) was sent in 2003 to all who had responded in 1998 . the social insurance institution of finland ( sii ) maintains a nationwide database on all purchases of diabetes medication in finland . for the purposes of this study , data on reimbursed diabetes medication in the period 19982006 were drawn from the registers of the sii and combined with the 1998 hessup data . the combined sample size was 24057 , the number of drop - outs being 1841 . these latter were individuals who did not grant us permission to combine their data with national registers or such as had dropped out because of death or had moved abroad . medication purchases were encoded with atc codes a10a ( insulin ) and a10b ( oral diabetes medicine ) . in the structured questionnaire , the participants were asked a diabetes - related survey question : has a doctor ever told you that you have or have had diabetes ? alternative replies were yes or no . those who answered yes in 1998 or 2003 and those who had purchased diabetes medicine between the years 19982006 were classified as patients with diabetes . with the help of data from both the survey questionnaire and the sii registers , patients with diabetes were classified into five study groups ( figure 1 ) , each patient with diabetes belonging to one group only . those using only insulin medication ( atc code a10a ) were classified into the insulin group ( n = 190 ) . it is likely that this group would be strongly weighted among those having diabetes type 1 . people using oral diabetes medicine ( atc code a10b ) were classified into the tablet group ( n = 508 ) and consisted mostly of type 2 patients with diabetes . the third study group comprised those using both insulin ( a10a ) and tablet - form treatment ( a10b ) and was named as the combination therapy group ( n = 188 ) . the fourth study group comprised those participants who in the 1998 survey reported having been diagnosed with diabetes by a doctor ( n = 296 ) . in a more detailed classification , we transferred a number of cases from this group into other groups based on their medication purchases . this group was termed the drug - naive group , and it included individuals who had reported themselves as patients with diabetes either a result of a misunderstanding with their doctor or whose condition was such that it could be treated with lifestyle and dietary changes without medication . it is also probable that this group included individuals who were not receiving any treatment at all and were managing their diabetes poorly as well as neglecting their medicine . the control group ( n = 22875 ) comprised individuals who were healthy with respect to diabetes and did not belong to any of the above - described four groups . in addition , they had no sii - registered diabetes - related entries nor subjectively reported diabetes in either of the surveys . the subjects were asked to recall their childhood adversities in terms of the following structured questions : did your parents divorce ? , did your family have long - lasting financial difficulties ? were you often afraid of some member of your family ? , was someone in the family seriously or chronically ill ? , did someone in the family have problems with alcohol ? the alternatives were yes , no , or i do not know . only the first two options were included in statistical analyses . the overall impact of these variables was estimated by the number of affirmative answers . to confirm the reliability of responses regarding childhood adversities , the cohen 's kappa coefficient ( ) was used to assess associations between the 1998 and 2003 questionnaires . the statistical significance of differences between the diabetes groups and the controls was tested by test . odds ratios ( or ) with 95% confidence intervals ( ci ) were calculated by separate multivariate logistic regression analyses to measure the risk of belonging to a certain diabetes group . associations between childhood adversities and diabetes study groups compared to controls were analysed with logistic regression methods as well . each childhood adversity variable was analysed individually with each diabetes group as an outcome variable . confounding factors , age , sex , beck 's depression inventory ( bdi ) , body mass index ( bmi ) , and alcohol usage , were changed into dichotomised variables for logistic regression and taken into account in the analyses ( table 1 ) . the two youngest age groups ( 2025 and 3035 ) were merged into a group and the two oldest age groups ( 4045 and 5055 ) into another group . weekly alcohol usage was likewise dichotomised into two groups : the usage of 022 g group and the usage of over 22 g group . the accumulation variable of childhood adversities was made by dichotomizing respondents into the 0 - 1 adversities and the 26 adversities groups . respondents ' demographic characteristics , age , sex , bmi , maximum bmi , bdi , smoking , and alcohol usage , are presented in table 1 as frequency distributions . the concurrent joint ethics committee of the university of turku and turku university central hospital considered approval not necessary for a normal cohort study , but all participants were requested to sign a consent form containing information on the study and to grant permission to allow subsequent studies with the same data set and the possibility to link up with national health registries . the prevalence of childhood adversities varied among the study subjects ( table 2 ) . compared to the control group , the drug - naive group reported most childhood adversities . among the insulin - purchasing group ( insulin group ) , only a family member 's serious illness was more prevalent than among controls ( 9.7 percent units ) . the incidence of family members ' serious illness was also statistically significant and 8.912.5 percent more prevalent in other study groups compared to the control population . the insulin - purchasing group reported no long - lasting financial difficulties in childhood , whereas in other study groups financial difficulties were statistically significantly more prevalent than in the control group . differences varied between 6.411.3 percent units . among the groups using oral diabetes medicine , there had been fewer divorces than in the control population ( 5.16.7 percent units ) . a family member 's serious illness was the only childhood adversity which statistically significantly increased the risk of belonging to the insulin - managed diabetes group even when confounding factors were included ( or 1.89 , 95% ci 1.173.04 ) ( table 3 ) . other childhood adversities and their accumulation were not connected with later - life insulin usage . a family member 's serious illness statistically significantly increased the risk of tablet - treated diabetes in adult life ( or 1.55 , 95% ci 1.162.06 ) . however , when confounding factors were taken into account in logistic regression analysis , the increase was no longer statistically significant ( or 1.24 , 95% ci 0.921.67 ) ( table 3 ) . a family member 's serious or chronic illness , long - lasting financial difficulties , and having been afraid of a family member statistically significantly increased the risk of having combination therapy , that is , a tablet- and insulin - treated form of diabetes later in life without controlling the confounding factors ( or 2.18 , 95% ci 1.393.43 , or 2.29 , 95% ci 1.453.62 , and or 1.92 , 95% ci 1.083.40 ) , respectively . when they were controlled , the risks were 1.70 ( 1.072.71 ) , 1.90 ( 1.193.04 ) , and 1.65 ( 0.913.00 ) , respectively ( table 3 ) . the connection remained statistically significant between childhood adversities and combination therapy diabetes , excluding the adversity of having been afraid of a family member . an accumulation of childhood adversities increased the risk of combination therapy diabetes ( or 1.86 , 95% ci 1.033.38 ) . having been afraid of a family member statistically significantly increased the risk of belonging to the drug - naive group ( or 1.64 , 95% ci 1.102.45 ) . however , when confounding factors in regression analysis were controlled , the connection was no longer statistically significant ( table 3 ) . childhood adversities are connected to diabetes , but in different ways depending on the etiology of the disorder . a family member 's serious illness showed the most marked association with later life onset of diabetes , whereas an accumulation of childhood adversities was not markedly connected with the occurrence of diabetes . a major strength of this study was that linkage to the sii data was successful for virtually all individuals in the original sample . furthermore , the registry data on medicine purchases in finland can be considered reliable and the data also verifies the diagnosis of diabetes . the large sample size ensured that conclusions drawn from the statistical analyses can not be attributed to random effects . to obtain reliable information regarding an individual 's exposure status , we analysed the kappa coefficient for every childhood adversity and , based on the results , our conclusion was that answers concerning childhood adversities can be considered reliable . two analyses of respondents and nonrespondents of the hessup study were carried out to ensure better generalizability of the results [ 27 , 28 ] . in previous diabetes research , childhood adversities have been connected with diabetes type 1 [ 19 , 29 , 30 ] . in this study , however , no clear connection between a childhood adversity and diabetes type 1 was found . the only clear risk factor for diabetes type 1 ( the insulin group ) seemed to be a family member 's serious or chronic illness , which may point to the hereditary nature of the illness in the finnish population . on the other hand , childhood adversities would appear to be connected to the occurrence of diabetes type 2 ( tablet group , combination therapy group , and drug - naive group ) . childhood adversities increased the risk of having a more advanced form of diabetes requiring combination therapy . a longer period of having diabetes , a poorly managed lifestyle , tablet - treated diabetes type 2 , and metabolic syndrome in type 1 patients with diabetes are factors possibly leading to combination therapy treatment . in the drug - naive group , all occurrences of childhood adversities except parental divorce were statistically significantly prevalent compared to controls . drug - naive patients with diabetes had no entries of reimbursed diabetes medication purchases in the sii registers . there is thus no objective certainty that these participants do in fact have diabetes . presumably in some members of this group the diabetes is managed by lifestyle and dietary changes only , while another part presumably neglects to take care of their diabetes and thus may not even have started the medication recommended by a doctor , or they are outside the health care system ( i.e. , unemployed and socially excluded ) . it is also possible that the drug - naive group includes individuals who recall negative life experiences better than other participants in the study . at least , according to the bdi questionnaire , compared to the other groups this group contained the greatest number of depressed participants , and , as is known , people when depressed tend to overemphasise negative life experiences in their past . it has been shown that the effects of childhood adversities can be alleviated or even inhibited . as they seem to increase the later life risk of developing the difficult - to - manage form of diabetes , it would be advisable to take childhood adversities into account in considering preventive health care , since the difficult - to - manage diabetes is expensive to treat for both society and the individual . for a general practitioner , to have a comprehensive approach to the care of an individual and a community , it is important to understand health problems in the individual 's physical , psychological , social , cultural , and existential dimensions . the emphasis should be , among the other support measures , on reducing the stress , that is , the allostatic overload caused by childhood adversities . in efforts to motivate those having the difficult - to - manage form of diabetes to avail themselves of treatment , health - care professionals might be better to concentrate on highlighting successes rather than adversities as people belonging to this group have already encountered an abundance of negative life experiences . it is also possible that the aetiology underlying the condition varies within and between diabetes groups . allostatic overload may complicate the progress of emerging diabetes by epigenetically activating or inhibiting genes . one possibility might be that the childhood adversities may be more markedly associated with challenging diabetes management than with the occurrence of diabetes . the combination therapy group may be weighted among those having more advanced or poorly managed diabetes . according to recent research , childhood adversities are connected to poor self - care and diabetes , type 1 , management as measured by haemoglobin a1 c concentrations . as a conclusion , the meaning of the relationship is not clear and is a subject for further research . more research is warranted from the viewpoint of patients , from patients with problems and limitations . successful care is the goal for both the family doctor and the patient with history and life experience .

backgrounds . research findings suggest that the mind can cause physical disease . to plan the best quality of care , general practitioner needs to understand an individual 's health problems in physical , social , and psychological dimensions . this study sought to establish whether adverse life events occurring in childhood and adolescence are associated with diabetes . methods . the cohort was collected from the health and social support ( hessup ) study a postal follow - up survey of randomized working - aged finns initiated in 1998 . the response rate was 40.0% and the final cohort size 24057 . data on reimbursed diabetes medication during the years 19982006 were obtained from the social insurance institute of finland registers . subjects were divided into insulin , tablet , combination therapy , and drug - naive groups together with a control group without diabetes . the prevalence of childhood adversities was assessed based on answers to six survey questions . results . childhood adversities showed predominant linkage to diabetes type 2 groups , especially to the combination therapy group requiring combined insulin and tablet treatment . no connection was found between childhood adversities and insulin use . cumulative adversities did not markedly increase the association . conclusions . stressful events in childhood are associated with diabetes combination therapy in working age . the meaning of the relationship remains unsolved .

adaptive reorganization of cortical maps after brain damage is referred to as plasticity and is regarded as relevant during recovery and compensation by reflecting changes of neural circuit architecture and synaptic connectivity . the connectivity of these neuronal networks is , however , also being continuously modified by use - dependent mechanisms independent of any injury or recovery . when studying changes of cortical map plasticity during disease progression or therapeutic interventions , it is therefore necessary to disentangle stable and variable map parameters . in this context , brain stimulation techniques are particularly suitable for monitoring the cortical maps , for example , to probe effective corticospinal connectivity by measuring time - locked motor evoked potentials ( mep ) at target muscles . the techniques applied in animal research and human studies , for example , intracortical microstimulation or epicortical electrical stimulation , differ with regard to their level of invasiveness and spatial accuracy [ 27 ] . transcranial magnetic stimulation ( tms)albeit with significantly less spatial resolution than surgical mapping techniques has been established as a powerful alternative mapping tool for clinical and research application . when applied , for example , in the context of stroke patients , tms mapping revealed a reduced excitability and a decreased cortical representation of the impaired movement [ 9 , 10 ] . after short - term therapy , the cortical motor map and the manual dexterity increased at least temporarily . following longer interventions , clinical gains were paralleled by the recruitment of cortical motor representation in the affected hemisphere outside the primary motor cortex [ 9 , 12 , 13 ] . however , more recent studies have challenged these previous findings by revealing corticospinal connectivity outside the primary motor cortex in healthy subjects as well as by demonstrating relevant variability of the spatial extent of motor maps independent of any intervention . this ambiguity might be related to methodological differences ; in recent years , individual magnetic resonance images ( mris ) have been used in conjunction with navigated tms ( ntms ) . this technique monitors the coil position , direction , and tilting , thus increasing the repeatability of both coil placement [ 16 , 17 ] and orientation . when the tms coil was aligned on the basis of the individual shape of the central sulcus , the somatotopy in the primary motor hand area could be captured . navigated tms might thus be more precise than standard tms , for example , in capturing nonprimary motor cortex corticospinal connectivity , but is perhaps still not precise enough to distinguish between the natural daily or weekly fluctuations of the motor map extent and lasting cortical plasticity in the course of a disease or intervention . such a differentiation would necessitate stable cortical map parameters that are resistant to such natural fluctuations . in this context , simulation studies have indicated that the individual gyral anatomy has a major impact on tms - induced electrical field distributions [ 2025 ] . the reliability of motor maps might thus be improved when accounting for interindividual differences in brain anatomy . combining ntms maps with individual mris facilitated as a first step on the way the analysis of group data in normalized space [ 15 , 26 , 27 ] . previous ntms approaches , however , still projected the tms coil positions as a grid of target points on the brain surface , resembling a plane that covered both gyri and sulci , and did not account for differences in cortex morphology [ 15 , 1719 , 2830 ] . to overcome this limitation , we recently proposed a novel projection , interpolation , and coregistration technique for estimating ntms sites onto the individual anatomy , namely , by following the surface curvature of gyri . the novelty of this approach was thus not related to the application of neuronavigation to the tms mapping procedure itself , as was the case in previous ntms studies , but instead consisted in the application of the stereotactic information provided by ntms to visualize the stimulation findings in relation to the specific anatomy . the specific visualization of the stimulation sites , obtained by nestling them to the gyral curvature , was complemented by a mathematical interpolation which considered all neighboring stimulation results in a distance - weighted fashion . this technique achieved a lower variability of cortical motor maps between subjects in normalized space than standard tms mapping . in the present study , we reasoned that this refined tms technique would also provide high test - retest reliability of cortical motor maps , although the inherent variability of tms metrics , like other metrics representing human physiology , may be related to many biological reasons . we tested the long - term stability of ntms in healthy subjects , not for days and weeks as tested previously but for several months , and with six instead of only two or three different measurement time points . revealed low retest reliability even for these short observation periods , a repetition of this standard procedure for longer follow - up periods will not provide any further insight . we therefore focused our long - term examination on the novel approach which was recently introduced . notably , the limited reliability observed in previous studies was not related to focal mapping parameters such as centre of gravity or hotspot but to mapping parameters that capture the extent of the cortical motor map , such as the map area . we therefore addressed these classical parameters and also applied complementary measures to describe the cortical extent of the cortical motor map , such as motor maps of the mean spatial overlap , the mean mep amplitude , and the intraclass correlations of the mep amplitude in the present study . we detected extended sensorimotor areas with high functional overlap between subjects and in the course of the mapping sessions . therefore , long - term stable map areas could be disentangled from the more fluctuating ones by which they were surrounded . at each stimulation site , intraclass correlations of the mep amplitudes revealed mosaic - like clusters of consistent corticospinal excitability spanning over distributed areas in the sensorimotor cortex . moreover , and somewhat unexpectedly , relevant interhemispheric differences with more stable corticospinal connectivity in the nonprimary motor areas of the dominant hemisphere were unraveled , reflecting use - dependent plasticity . twelve right - handed subjects ( mean age 24 years , range 1928 , 8 males ) with verified right - handedness ( ehs > 70 ) according to the edinburgh handedness inventory were studied in the course of six experiments with a mean of 14.7 days between experiments . in all subjects , cortical motor maps of the nondominant , right hemisphere were captured ; in six of the participants , additional motor maps of the dominant , that is , left , hemisphere could be acquired . in three of the subjects , we thereby hoped to emulate real - life conditions of clinical practice as closely as possible . all participants gave written informed consent and had no contraindication to tms or a history of any neurological or psychiatric disease . the studies were approved by the local ethics committee and were in accordance with the declaration of helsinki . the cortical mapping was performed by the same person in all experiments ( dk ) as described previously : we used a navigated tms stimulator ( eximia , nexstim , helsinki , finland ) and a biphasic figure-8 coil ( nexstim , helsinki , finland ) with a mean diameter of 50 mm and an estimated focality of 0.68 cm ( eximia focal bipulse , helsinki , finland ) . the neuronavigation system controlled the position , orientation , and tilt angle of the tms coil . prior to the mapping , individual anatomical t1-weighted magnetic resonance images were acquired by a 3-tesla siemens tim trio mri system ( siemens ag , erlangen , germany ) using the t1-mprage gradient echo , a field of view ( fov ) of 256 mm and 176 sagittal slices , a voxel size of 1 1 1 mm , a repetition time ( tr ) of 2300 ms , and an echo time ( te ) of 2.98 ms . individual mris were loaded into the eximia system for coregistration with the subject 's head using three anatomical landmarks ( nasion + both crux helix ) and nine additional points on the scalp ( registration error < 2 mm ) . the electromyography ( emg ) signal of the extensor digitorum communis ( edc ) of both arms was recorded with the integrated emg device of the eximia system ( 3 khz sampling rate , band - pass filter of 10500 hz ) using ag / agcl ambuneuroline 720 wet gel surface electrodes ( ambu gmbh , germany ) . the edc was chosen for this study , since this muscle is the main target during brain - robot interface - based interventions [ 3436 ] designed for stroke rehabilitation [ 37 , 38 ] . the electrodes were placed 2 cm apart from each other on the muscle belly of the forearm , differently from the procedure usually applied for hand muscles . for each subject , the cortical representation of the edc muscle was determined using 40% of maximum stimulator output at the anatomically defined hand knob of the primary motor cortex ( m1 ) as the starting position . if the initial stimulator output was not sufficient to elicit meps , it was increased in steps of 5% . the orientation of the induced current in the brain was posterior - anterior for the first phase and anterior - posterior for the second phase of the stimulus as stipulated by the manufacturer . the orientation of the electric field , calculated on the basis of the individual mri of each subject by the eximia software , was kept perpendicular to the central sulcus , and the location with the highest mep response was selected as the stimulation point . having determined the hotspot with about 30 stimuli by moving the coil around the hand knob , we varied the orientation of the coil within an angle of approximately 90 in steps of roughly 10 and with 3 stimuli at each angle , around the original orientation . using this method , we were able to ascertain the orientation with the highest response in this spot . this orientation was posterior - anterior in all cases with only slight ( 20 ) interindividual differences . the resting motor threshold ( rmt ) was determined using the relative frequency method , that is , selecting the minimum stimulus intensity ( by changing the stimulator output in 2% steps of maximum stimulator output ( mso ) ) that resulted in meps > 50 v in the peak - to - peak amplitude in at least 5 out of 10 consecutive trials [ 40 , 41 ] . the cortical map representation was acquired at 110% rmt with the same coil orientation as was applied at the hotspot . this map was extended in random order around the hotspot with evenly distributed stimuli until meps could no longer be evoked in the edc . despite some interindividual variability , this procedure was sufficient to cover the entire cortical representation of the edc in all subjects . a visual grid ( 5 mm 5 mm 5 mm ) , predefined in the navigation software , was used for guidance during the mapping procedure , applying 2 - 3 stimuli per cell and resulting in an average of 10 stimuli per 1 cm . specifically , two stimuli were applied per cell ; when one of them did not result in a response , a third stimulus was applied . the actual navigation coordinates of each stimulus were then used for data analysis , resulting in a spacing of approximately 3 mm , due to the small variability of the stimulation sites within each cell . stimulation sites were visualized on the surface at a depth of 20 mm to ensure that the stimuli were located within the cortex in all subjects ( range of scalp to cortex distance : 1318.5 mm ) . this procedure was chosen due to the fact that the manufacturer allows adjustments to be made in steps of 5 mm only , that is , at 15 mm , 20 mm , and 25 mm . this tms protocol thus resulted in stimulation sites 20 mm below the scalp and spaced approximately 3 mm apart with their coordinates located in individual mri space . data were analyzed using matlab r2010b ( mathworks gmbh , ismaning , germany ) with a custom - built code , the toolbox spm8 ( wellcome trust centre for neuroimaging , london , uk ) , the freesurfer software suite ( martinos centre for biomedical imaging , charlestown , usa ) , and spss v21 ( ibm gmbh , ehningen , germany ) . for data analyses , we then used the actual navigation coordinates ( i.e. , the mri coordinates within the reference frame of the eximia system ) of each stimulus , resulting in an interstimulus spacing of approximately 3 mm . finally , these spots were interpolated for visualization , sampled on a 1 1 1 mm grid to close the gap between stimulation sites , and then projected onto the gyral anatomy following the procedure described below . importantly , this interpolation technique increased the reliability of every single stimulus by considering all its neighboring stimulation results in a distance - weighted way . this technique also provides a higher level of focality than the conventional approach of treating each stimulus as a discrete event . the level of focality is thus higher than the actual area activated by the stimulation pulse . please note that this interpolation procedure resulted formally in a volume ( mm ) instead of the conventional surface ( mm ) to describe the extension of the cortical map . since the calculated value ( mm ) was proportional to the real surface area ( mm ) and was always calculated in the same way for all sessions , it provided a suitable measure for determining the test - retest reliability . during the mapping , about 100 stimuli were applied , with some subject - to - subject variability due to the individual cortical representation of the edc . recent findings indicate that reliable motor maps could be created with around 60 stimuli . during this study , the respective map could also be captured with less than 100 stimuli in subjects who had a small cortical representation of the edc , while in others , more stimuli were required . the procedure lasted for ~15 minutes and the subjects were instructed to keep their muscles relaxed during this time . during offline analysis , the emg data were visually inspected and any trials in which muscle preactivation was detected were discarded ( < 1% of all trials had to be removed due to emg activation ) . since the stereotactic information provided by the ntms ( eximia , nexstim , helsinki , finland ) refers to the coil position outside the head only , additional calculations are necessary to translate this information beyond the coil and onto the brain . we therefore used the coordinates of the tms coil to project all stimulation points of the map onto the cortex in the direction of the magnetic field between the two coil windings . the coil coordinates acquired via the navigation system were thereby transferred to the individual mr image of each subject at a depth of ~20 mm ( see previous section ) . thereafter , the mean mep amplitude and the centre of gravity ( cog ) of each map were determined . due to the uncertainty of the exact stimulation depth using tms , the cog is usually calculated in two dimensions only . moreover , we applied individual space ( and not normalized space ) to analyze the reliability of the cog so as to enable us to compare it with the literature . the maximum amplitude - weighted stimulation point was calculated using the following formula : ( 1)cog=aixia,aiyiawith ai as the mep amplitude at positions xi ( medial - lateral ) and yi ( anterior - posterior ) and a as the sum of all mep amplitudes . the mep amplitudes of all stimuli were then projected onto a 1 1 1 mm grid and interpolated by taking all neighboring stimulation results into account in a distance - weighted way . this resulted in a three - dimensional map area with mean mep amplitude for each grid cell . the sum of active grid cells ( with meps > 50 v ) subsequently resulted in the map area and the map volume ( area mean map mep ) , that is , the mep amplitude - weighted area , for each measurement . please note that this mean mep amplitude is different from the mean map mep amplitude ( table 2 ) which captures all the noninterpolated stimulation amplitudes of one session . the individual mri volumes and coregistered mep maps were spatially normalized to mni space , using spm8 for further group analysis . the mni normalized mri images were then imported into the freesurfer software , which aligned the individual central sulci , and a cortical surface structure was reconstructed using the inbuilt functions . an average brain surface with > 160k mesh points was then created by coregistration of the cortical surface structures . the coregistered mep maps were first projected onto the individual surface structures with the inbuilt function mri_vol2surf of freesurfer and then transferred onto the average surface structure with mri_surf2surf . as a result , all maps were projected onto the same surface coordinate system , enabling us to gain further statistics for each mesh point of the cortical surface . this procedure enabled us to calculate the mean mep amplitude over all measurements and subjects , the mean overlap of all subjects in the course of the experiments ( in percent ) , and the intraclass correlation ( icc ) values for the mep amplitudes at each mesh point . a repeated measure anova ( rmanova ) with greenhouse - geisser correction was performed to determine differences in tms parameters between sessions . intraclass correlation was applied to compute the test - retest reliability for mean map mep , map area , map volume , rmt , coordinates of the cog , and the mep amplitudes at each stimulation site , that is , surface mesh point . a two - way random average measure ( icc(2 , k ) ) in addition , we calculated an icc(1 , k ) value for each surface mesh point using the mep amplitude in that coordinate . icc values usually range from 0 to 1 but can become negative if the variance in the subject is higher than the group variance . values above 0.75 , between 0.5 and 0.75 , and below 0.5 are regarded as reflecting high , moderate , and poor test - retest reliability , respectively . the data of all experimental sessions was acquired and analyzed without any drop - outs and no significant mean differences of tms parameters between sessions were revealed in the rmanova . the original tms parameters of each hemisphere are summarized on the group level in tables 1 and 2 and on the single subject level in figures 1 and 2 , respectively . in the nondominant , right hemisphere , icc values over six sessions showed high reliability for the rmt ( icc = 0.989 ; 95% confidence interval ci : 0.975 to 0.996 , figure 1(a ) ) , the medial - lateral ( icc = 0.947 ; 95% ci : 0.882 to 0.983 , figure 1(b ) ) and anterior - posterior cog ( icc = 0.98 : 95% ci : 0.955 to 0.933 , figure 1(c ) ) , and the mean map mep amplitude , that is , the average of all mep amplitudes of the cortical map ( icc = 0.869 ; 95% ci : 0.711 to 0.956 , figure 1(d ) ) . the map volume ( icc = 0.695 ; 95% ci : 0.32 to 0.899 , figure 1(f ) ) and map area ( icc = 0.178 ; 95% ci : 0.879 to 0.73 , figure 1(e ) ) showed moderate and poor reliability , respectively . in the dominant , left hemisphere , icc values over six sessions revealed high reliability for the rmt ( icc = 0.990 ; 95% ci : 0.970 to 0.998 , figure 2(a ) ) , the medial - lateral ( icc = 0.979 ; 95% ci : 0.927 to 0.997 , figure 2(b ) ) and anterior - posterior cog ( icc = 0.972 ; 95% ci : 0.914 to 0.996 , figure 2(c ) ) , and the mean map mep amplitude ( icc = 0.855 ; 95% ci : 0.566 to 0.977 , figure 2(d ) ) . the map volume ( icc = 0.152 ; 95% ci : 0.130 to 0.535 , figure 2(f ) ) and map area ( icc = 0.056 ; 95% : 0.173 to 0.403 , figure 2(e ) ) revealed poor reliability . in three subjects , a seventh session ( highlighted in red , supplementary figure 1 ( a f ) in supplementary material available online at http://dx.doi.org/10.1155/2016/7365609 ) the high reliability of the rmt ( icc = 0.995 ; 95% ci : 0.976 to 1 ) , medial - lateral cog ( icc = 0.973 ; 95% ci : 0.878 to 0.999 ) and anterior - posterior cog ( icc = 0.892 ; 95% ci : 0.537 to 0.997 ) , and the mean map mep amplitude ( icc = 0.928 ; 95% ci : 0.664 to 0.998 ) in the previous six sessions could be preserved in the seventh measurement , that is , ~1.5 years after the sixth session . the mean overlap percentage revealed a high spatial overlap over the hand area of m1 and the corresponding somatotopic sensory ( s1 ) area of both hemispheres ; that is , in these regions ( indicated in yellow ) at least 75% of the subjects presented with meps > 50 v . this core area was surrounded by a fringe area ( indicated in red ) extending medially and laterally on m1 and s1 and anteriorly on the premotor ( pm ) cortex . in this fringe area , less than 75% of the subjects presented with meps the mean mep amplitude depicted a smaller activation area than the previous overlap map ; that is , activation was confined to those cortical areas in which all subjects had mean meps > 100 v ( indicated in yellow ) and > 50 v ( indicated in red ) ( figure 4 ) . notably , this area covered a large part of m1 and s1 and extended towards the pm cortex in the left , dominant hemisphere , while it remained fairly restricted to the hand knob of m1 and the corresponding s1 in the right , nondominant hemisphere . these interhemispheric differences remained stable , even when the right cortical map was restricted to the very same six subjects who were analyzed for the left cortical map ( supplementary figure 2 ) . the intraclass correlation ( icc ) values for the mep amplitudes at each mesh point confirmed the previous cortical maps ( of the mean mep amplitude ) , showing the same interhemispheric differences and revealing moderate to high reliability ( up to > 0.75 ) of the mep amplitude in the course of the six experiments ( figure 5 ) . interestingly , these long - term correlations of the mep amplitude at each stimulation site presented mosaic - like clusters of consistent corticospinal excitability spanning over distributed areas in the sensorimotor cortex . this study introduces complementary and highly consistent measures for capturing the extent of the cortical motor map with transcranial magnetic stimulation ( tms ) and demonstrates the high test - retest reliability of these maps for long observation periods by considering the individual gyral anatomy . we examined motor - evoked potentials ( meps ) of the extensor digitorum communis muscle of healthy subjects over a period of twelve weeks with six biweekly acquired tms motor maps , whereas previous studies on tms test - retest reliability spanned observation periods of one to six weeks with a total of two to three measurements only [ 15 , 4854 ] . the demonstrated consistency of the acquired motor map parameters over several months qualifies them as biomarkers for monitoring disease progression or the effects of therapeutic interventions , for example , in the context of neurorehabilitation . however , these results need to be extrapolated carefully to individuals with brain damage since patients might have more variable cortical physiology . particular attention should be paid to the specific tms parameters chosen for long - term monitoring . like previous studies , but for longer observation periods , we were able to disentangle the highly stable tms parameters , that is , the resting motor threshold ( rmt ) , centre of gravity ( cog ) , and mean meps across all tms sites , from the more variable ones , that is , the map area . we , therefore , suggest not transferring the classical motor map parameters , map area and volume , to patients but rather the complementary ones introduced and tested in this study , that is , motor maps of the mean spatial overlap , the mean mep amplitude , and the intraclass correlations of the mep amplitude ( see paragraphs below ) . more specifically , the high reliability , captured by the intraclass correlation ( icc ) , of the rmt and mean map mep amplitude confirmed previous findings following shorter observation periods [ 4953 ] . former findings on the consistency of the cog were more variable [ 15 , 48 , 51 , 53 ] than the high reliability in the present study for observation periods of up to 1.5 years . when it came to the cortical representation area of corticospinal connectivity , the findings were more variable . with regard to the classical parameter map area , this study demonstrated poor reliability in the course of six sessions . this finding agrees with previous observations of decreasing reliability of the map area from moderate / high [ 51 , 52 ] to poor / moderate when increasing the length of the observation period and the number of measurements from two to three . these findings are probably related to the individual conditions of the subjects over time , that is , reflecting the natural daily or weekly fluctuations of the motor map extent . to differentiate them from lasting cortical plasticity in the course of a disease or intervention , more stable cortical map parameters that are resistant to such natural fluctuations accordingly , complementary measures for capturing the extent of the cortical motor map were suggested in the present study and revealed spatially specific areas of high reliability throughout the whole observation period of twelve weeks : motor maps of the mean spatial overlap , the mean mep amplitude , and the icc of the mep amplitude enabled us to disentangle a highly reliable core from the surrounding fringe areas of corticospinal connectivity . future studies may test whether the demonstrated reliability of these complementary motor map parameters will persist when acquired with fixed coil positions ( e.g. , lateromedial , posteroanterior ) or monophasic stimulation . the overlap map of the present study revealed a core over the hand area of m1 and s1 , surrounded by less consistent findings that extended medially and laterally on the sensorimotor cortex and anteriorly on the premotor cortex ( figure 3 ) . these observations were confirmed by the two other motor maps , that is , maps of the mean mep amplitude and the icc of the mep amplitude . notably , the maps of the mean ( figure 4 ) and icc ( figure 5 ) of the mep amplitude in particular revealed relevant interhemispheric differences . in the left , dominant hemisphere , these maps covered a large area of m1 and s1 and extended towards the pm cortex , whereas they remained fairly restricted to the hand knob of m1 and the corresponding s1 in the right , nondominant hemisphere . moreover , the icc map unraveled mosaic - like clusters of consistent corticospinal excitability spanning over distributed areas in the sensorimotor cortex and intermingling with spots of decreased reliability . we interpret the spatial differences between the overlap maps and the mean mep amplitude maps as a reflection of the high variability of the classical tms parameter map area . more specifically , we propose that the map area represents the instantaneous cortical representation , that is , the natural daily or weekly fluctuations of the motor map extent , and that the mean mep amplitude map ( figure 4 ) reflects a stable motor map that is more resistant to this variability . rapid functional plasticity of the map area has already been described during different learning processes . comparing implicit versus explicit motor learning could show an increase of the motor map during the implicit learning period , which was reversed to baseline as soon as explicit knowledge was gained . in another study with braille readers , the cortical map area varied with the activity of the hand , that is , showing a larger map area during working days than at weekends . by contrast , the stable interhemispheric differences of the mean mep amplitude map and the icc map in this study were very probably related to the right - handedness of the participants . this implied a lifelong higher use of the right hand in activities of daily living and therefore a persistent use - dependent reorganization and more extended ( towards premotor and somatosensory areas ) cortical representation area of this hand in the left , dominant hemisphere [ 54 , 57 ] the present study confirmed earlier animal experiments [ 5861 ] and human studies [ 14 , 39 , 6264 ] , which indicated that corticospinal connections are not limited to the primary motor cortex but extend to different regions of the sensorimotor system . approximately half of the primate brain 's pyramidal tract neurons are located in postcentral areas , for example , the primary somatosensory cortex , sharing functional properties with regard to movement - related activity and discharge patterns as a function of muscle strength with precentral pyramidal tract neurons [ 31 , 6567 ] . in the present study , we confirmed this extended corticospinal connectivity of the somatosensory cortex and demonstrated marked interhemispheric differences , that is , highly reliable meps elicited from the left s1 of the dominant hemisphere , in healthy subjects . however , due to the rather nonfocal nature of tms , a complementary explanation of these findings might be possible . even if the centre of the tms coil is over the primary somatosensory cortex it could mean that neurons located rather posterior in the motor cortex , but still anterior to the somatosensory cortex , are activated by the magnetic stimulation delivered to s1 . therefore , we clearly acknowledge that it is not possible for this type of study to draw conclusions regarding the precise site of cortical stimulation . on the other hand , intraoperative electrical stimulation in humans with both mono- and bipolar focal stimulation of the premotor and somatosensory cortex also elicited meps [ 39 , 63 ] , supporting the hypothesis of direct corticospinal connectivity of nonprimary motor cortex areas . despite the fact that they have considerably less spatial resolution than surgical mapping techniques , the tms maps unraveled mosaic - like clusters of consistent corticospinal excitability . this is consistent with the findings of intracortical microstimulation in nonhuman primates which demonstrated that identical movements are elicited by the stimulation of multiple and noncontiguous sites [ 39 , 60 ] . although previous studies have already suggested that tms maps are suitable for reproducing these experimental microstimulation findings in humans [ 15 , 52 ] , the present examination is the first to demonstrate the long - term reliability of this specific cortical pattern and to characterize the extended topographic distribution in the sensorimotor cortex intermingled with spots of decreased reliability . we consider this pattern to be evidence of the specific activation of neuronal pools in the respective cortical areas , for example , s1 or pm , thus rendering the alternative explanation , that is , the current spread to distant areas such as to m1 and the pyramidal tract , rather unlikely . these findings therefore underline the tms technique presented here as a powerful and precise mapping tool for clinical and research application . interestingly , this study is the first to demonstrate the long - term retest reliability of corticospinal connectivity of the premotor cortex , for the left , dominant hemisphere in particular . the right , nondominant hemisphere showed a larger fluctuation of the pm corticospinal connectivity , suggesting that this pathway is a dormant reserve for compensatory activation , for example , when the nondominant hand is used more frequently or when lesions of the m1 corticospinal connections , for example , after stroke , necessitate alternative pathways . along the same lines , recent neurofeedback interventions have explored the plasticity of the nondominant , right hemisphere in the healthy and lesioned brain [ 37 , 68 ] . these findings indicate that combining motor imagery - related -band event - related desynchronization with proprioceptive feedback in a brain - robot interface environment [ 69 , 70 ] might be sufficient to unmask latent corticospinal connectivity , redistribute sensorimotor connectivity patterns , and enhance corticospinal pathways of both the s1 and pm cortex [ 39 , 71 ] . moreover , pilot data applying this concept demonstrated operant conditioning of the targeted brain state and provided a direct brain - behavior relationship with functional gains after stroke , which were specific for the trained task . we demonstrated the high test - retest reliability of the applied tms mapping technique for long observation periods . this study revealed the long - term reliability of motor maps with relevant interhemispheric differences , that is , more extended and stable corticospinal connectivity in the sensorimotor cortex and nonprimary motor areas of the left , dominant hemisphere . different cortical maps allowed the disentangling of stable cortical reorganization from more rapid plastic fluctuations . mosaic - like clusters of consistent corticospinal excitability spanning over distributed areas in the sensorimotor cortex indicated functionally specific and spatially precise activation of neuronal pools by tms .

motor maps acquired with transcranial magnetic stimulation ( tms ) are evolving as a biomarker for monitoring disease progression or the effects of therapeutic interventions . high test - retest reliability of this technique for long observation periods is therefore required to differentiate daily or weekly fluctuations from stable plastic reorganization of corticospinal connectivity . in this study , a novel projection , interpolation , and coregistration technique , which considers the individual gyral anatomy , was applied in healthy subjects for biweekly acquired tms motor maps over a period of twelve weeks . the intraclass correlation coefficient revealed long - term reliability of motor maps with relevant interhemispheric differences . the sensorimotor cortex and nonprimary motor areas of the dominant hemisphere showed more extended and more stable corticospinal connectivity . long - term correlations of the mep amplitudes at each stimulation site revealed mosaic - like clusters of consistent corticospinal excitability . the resting motor threshold , centre of gravity , and mean meps across all tms sites , as highly reliable cortical map parameters , could be disentangled from more variable parameters such as mep area and volume . cortical tms motor maps provide high test - retest reliability for long - term monitoring when analyzed with refined techniques . they may guide restorative interventions which target dormant corticospinal connectivity for neurorehabilitation .

by the term cardiac metastases , we define distant spread of a tumor to any of the structures composing the heart and also tumors affecting the heart cavities or producing actual intracavitary neoplastic thrombi . any malignant neoplasm , in particularly melanoma , and lung and breast carcinoma can spread to the heart through four alternative paths : by direct extension , through the bloodstream , through the lymphatic system and by intracavitary diffusion through either the inferior vena cava or the pulmonary veins . we report a case of an elderly man with a lung cancer discovered after a metastatic diffusion to heart and brain . a 79-year - old male presented to the emergency department with a confusional state characterized by clouded consciousness , disorientation in time and space , difficulty in speech and gait and mouth deviation to the right . he also showed dysarthria , right hemiparesis , hemi - hypoesthesia and babinski sign , bilateral grasping - sign and a positive epstein sign . he was a former heavy smoker , hypertensive and diabetic patient with a previous history of ischemic cardiomyopathy and prior vascular and cardiac surgery due to aneurysm of the abdominal aorta and myocardial infarction , respectively . a reduced breath sound on the right hemi - thorax was found at the chest examination while cardiac objectivity was unremarkable . the electrocardiogram showed sinus rhythm with a heart rate of 65 beats / m , some premature ventricular complex and left atrial enlargement . chest x - ray revealed two nodular opacities on the right lung , the largest of which of 2.0 cm . owing to the neurological status , patient was immediately submitted to a noncontrast - enhanced computed tomography ( ct ) head scan demonstrating a large , but nonspecific cerebral edema in the right frontal , temporal and parietal lobe and then , referred to the neurological department of our institution . a brain magnetic resonance imaging ( mri ) , a chest ct scan and a transthoracic echocardiogram ( tte ) were quickly scheduled . this last identified a large , round - shaped mass , in the left atrium ( la ) , mobile during the cardiac cycle suspected to arise from left superior pulmonary vein . however , this approach failed to provide a full characterization of the lesion , comprehensive of size , morphology and spatial relationships with surrounding structures . therefore , patient was immediately submitted to transesophageal echocardiogram ( tee ) . through this examination we were able to : confirm that the mass came from the left superior pulmonary vein [ figure 1],evaluate its size ( linear dimensions = 3.5 3.6 cm with a largest planimetric area of about 10 cm ) and morphology ( inhomogeneous texture for the presence of anechogenic areas in the context of a hyperechogenic tissue [ figure 1 ] andrule out any hemodynamic consequence into the left cavities by color doppler flow analysis . confirm that the mass came from the left superior pulmonary vein [ figure 1 ] , evaluate its size ( linear dimensions = 3.5 3.6 cm with a largest planimetric area of about 10 cm ) and morphology ( inhomogeneous texture for the presence of anechogenic areas in the context of a hyperechogenic tissue [ figure 1 ] and rule out any hemodynamic consequence into the left cavities by color doppler flow analysis . multiplanar transesophageal echocardiogram shows the mass ( a ) coming from the left superior pulmonary vein ( b and c ) and prolapsing into the left atrium ( d ) on the 2 day , after admission , the prearranged brain mri showed one heterogeneous , hypointense lesion , at the frontal right lobe , with perilesional vasogenic edema and partial compression of right lateral ventricle . finger - like appearance in the right cerebellar hemisphere , compatible with neoplastic edema was also identified [ figure 2a and b ] . ( a and b ) brain magnetic resonance imaging t2-weighted axial images ( for explanations , please see the text ) . ( c ) axial unenhanced computed tomography scan shows a left inferior pulmonary lobe solid mass that infiltrates left pulmonary veins and left atrium ( white arrows ) due to the above - mentioned imaging findings from cerebral and cardiac evaluation and in relation to the presence of nodular opacities on chest x - ray , a metastatic lung cancer was suspected . accordingly , patient underwent chest ct scan showing a solid mass in the left inferior pulmonary lobe , infiltrating the left pulmonary veins and left atrium [ figure 2c ] . focal thickening of adjacent pleura was also seen and on parenchymal window , a pulmonary mass with maximum axial diameter of 57 mm was identified . therefore , a starting diagnosis of lung cancer with brain metastases and intracavitary heart dissemination through the left superior pulmonary vein was made . however , to achieve a definitive diagnosis from histology , patient was scheduled for a biopsy of pulmonary lesions but , unfortunately , he suddenly died before we can conclude the diagnostic procedures . the heart can be metastasized by any malignant neoplasm able to spread to distant sites , in particularly melanoma , lung tumors , breast carcinoma and linfoma . lung tumors are the leading metastatic cancers that spread to the heart through direct invasion , and rarely extend into the chambers of the left side of the heart via pulmonary veins . neoplastic thrombi can also be produced in the la , after tumor embolism through the venous circulation of the lungs , mostly in patients with lung carcinoma . large thrombi can even involve the mitral valve , and more commonly facilitate distant metastases . although , extension from the pulmonary veins into the la is rare , this circumstance has been reported in limited case reports . in lung carcinomas , rate of metastasis adenocarcinoma spread to the heart in 26% of cases , squamous cell carcinoma in 23.4% , and undifferentiated carcinoma in 21.2% . intra - pulmonary veins and intra - atrial masses can induce widespread emboli and circulatory impairment via outflow obstruction . in fact , sudden severe complications , including cerebral infarction , peripheral arterial occlusion and syncopal attacks have been reported in patients with this type of extension . echocardiography , the first - choice modality , provides essential information with regard mass size , location , mobility , anatomical relationships , hemodynamic consequences and response to the treatment . especially , tee adds important information , and it should always be considered when the transthoracic images are inappropriate , and in all the cases in which embolic sources are researched . particularly , echocardiography is helpful for la masses differential diagnosis , including primary or secondary cardiac tumors , infective endocarditis ( ie ) and thrombi . despite , ie may be excluded on the basis of medical history and clinical data , echocardiography is anyway an important tool providing unique diagnostic elements . in general , infective vegetation presents as an oscillating mass attached to a valvular structure , with a motion independent to that of the valve , however it may also present as non oscillating masses with atypical location . tee enhances the sensitivity of tte to about 85 - 90% for the diagnosis of vegetations , while more than 90% specificity has been reported for both tte and tee . on echocardiography , myxomas appear as mobile masses attached to the endocardial surface through a stalk , usually arising from the interatrial septum in the region of fossa ovalis . however , 25% of myxomas may originate away from the atrial septum . in this case , the observed origin of the la mass from pulmonary vein , by tee , effectively allowed excluding a myxoma . however , in case the stalk is not clearly visible on echo , the diagnosis can not be made by echocardiography and requires further imaging techniques , like mri or ct . , the thrombus usually lies on the wall of la through a large base of implantation and can involve any segment , more often the la appendage in patients with atrial fibrillation ( af ) . in some cases , a diagnosis of thrombus should be highly suspected if an la mass is associated with af , dilated la , mitral stenosis , low ejection fraction , prosthetic mitral valves or spontaneous atrial contrast echoes . nevertheless , as a general rule , nonseptal origin and pulmonary vein extension of the tumor strongly indicate the possibility of a secondary tumor . briefly , tte and tee have been fundamental tools for differential diagnosis in this case . however , it remains unclear whether the cerebral embolism presenting as an acute neurological syndrome was due to metastasis of the presumed primary lung cancer via bloodstream or to embolization of the la mass .

metastatic cardiac malignancies are significantly more common than primary cardiac tumors . primary lung cancers often invade the heart locally and they can also spread to the heart via the blood , lymphatic system or both ; in contrast , an extension to the left atrium from the pulmonary vein is very rare . here , we report a case of a 79-year - old man with an acute neurological syndrome , in which an integrated multimodality imaging approach has allowed to discovery a lung cancer with cerebral embolism and intracavitary heart dissemination through the left superior pulmonary vein .

although effective therapies and evidencebased processes that can improve stroke diagnosis and treatment have been identified , gaps remain in their use . to address these gaps , the american heart association / american stroke association recommends establishing coordinated care systems that integrate best practices in prevention , diagnosis , treatment , and access . in 2004 , the joint commission ( jc ) launched the primary stroke center ( psc ) hospital certification program that includes assessments of compliance with consensusbased national standards , adherence to clinical practice guidelines , and collection of standardized performance measure ( pm ) data . although there is considerable support for the psc concept as of january 1 , 2011 , there were > 800 pscs in 49 states limited data exist comparing the quality of acute stroke care at pscs versus nonpscs over time . the statebased registry of the north carolina stroke care collaborative ( ncscc ) collects data on pms identical to those required of psc hospitals in a variety of hospitals , including those that are neither capable of nor interested in becoming a psc . we compared compliance with the jc 's 10 pms based on data collected between january 2005 and february 2010 in psc and nonpsc hospitals , as well as in those preparing for certification . the ncscc is part of the centers for disease control and prevention funded paul coverdell national acute stroke registry program . the prospective registry includes patients 18 years of age or older who present to north carolina ( nc ) hospital emergency departments ( eds ) with signs or symptoms of stroke or transient ischemic attack . hospitals eligible for participation include all non veterans affairs , nc acute care hospitals with a dedicated ed , including criticalaccess hospitals . all 110 eligible hospitals were invited to participate . a detailed description of hospital characteristics has been published . as previously described , trained hospital staff collect data on demographics , initial presentation , qualityofcare indicators , inhospital outcomes , and discharge disposition using a standardized , internetbased data collection tool . whenever possible , data are collected concurrent with care . a random sample of cases was reabstracted to assess data quality ( agreement 95.7% , statistic .94 ) . patients directly admitted to the hospital with a stroke are included ; those with a stroke during hospitalization are excluded . hospitals were grouped into 3 categories : hospitals certified before registry enrollment ( psc ) , hospitals certified after enrollment ( preparing for certification ) , or hospitals that remained uncertified by january 2011 ( nonpsc ) . quality measures include the 10 items in the jc stroke measure set , used as part of the psc certification process . we also measured 2 additional , related measures of quality of care : ( 1 ) received tissue plasminogen activator ( tpa ) within 3 hours of symptom onset and ( 2 ) received statin therapy as indicated defectfree care , a summary variable reflecting whether a patient received all of the pms for which he or she was eligible . the tests were used to compare baseline categorical variables , and anova was used for age in years . the overall , unadjusted association between psc group and each pm and defectfree care was evaluated using pearson statistics and 23 contingency tables . odds ratios ( ors ) and 95% cis for unadjusted models were calculated using logistic regression , with nonpscs as the referent . models adjusted for patientlevel variables included age in years , sex , race ( black , white , and/or other ) , and stroke type ( hemorrhagic , ischemic , transient ischemic attack , or stroke not otherwise specified ) and used logistic regression . to investigate the effect of psc status while controlling for both patientlevel factors and the hospital size ( < 100 , 100 to 349 , or 350 beds ) , as well as accounting for clustering of patients within hospitals , a generalized estimating equations ( gee ) approach was used . change in the percentage of cases in compliance with each pm was averaged for each year between 2005 and 2010 , and absolute annual percent change was calculated and compared using 2sided f tests , with nonpsc hospitals as the reference group . trend lines in the plots of compliance with pms over time were created using simple linear regression and 3month time intervals . this study was approved by the university of north carolina at chapel hill institutional review board and individual hospitals ' institutional review boards as required . the tests were used to compare baseline categorical variables , and anova was used for age in years . the overall , unadjusted association between psc group and each pm and defectfree care was evaluated using pearson statistics and 23 contingency tables . odds ratios ( ors ) and 95% cis for unadjusted models were calculated using logistic regression , with nonpscs as the referent . models adjusted for patientlevel variables included age in years , sex , race ( black , white , and/or other ) , and stroke type ( hemorrhagic , ischemic , transient ischemic attack , or stroke not otherwise specified ) and used logistic regression . to investigate the effect of psc status while controlling for both patientlevel factors and the hospital size ( < 100 , 100 to 349 , or 350 beds ) , as well as accounting for clustering of patients within hospitals , a generalized estimating equations ( gee ) approach was used . change in the percentage of cases in compliance with each pm was averaged for each year between 2005 and 2010 , and absolute annual percent change was calculated and compared using 2sided f tests , with nonpsc hospitals as the reference group . trend lines in the plots of compliance with pms over time were created using simple linear regression and 3month time intervals . this study was approved by the university of north carolina at chapel hill institutional review board and individual hospitals ' institutional review boards as required . between january 1 , 2005 , and february 15 , 2010 , we enrolled 38 983 patients from 53 hospitals in ncscc for whom we had complete data ( figure 1 ) . cases at the 6 hospitals that collected < 6 months of data were excluded ( n=291 ) as were cases discharged as no stroke ( n=2389 ) . cases entered during the first 2 months of data collection were excluded ( n=1346 ) to minimize the learning curve effect , leaving 47 hospitals and 29 654 cases for analysis . during the study period , there were 10 pscs ( n=14 885 ) , 8 hospitals preparing for certification ( n=6974 ) , and 29 nonpscs ( n=7795 ) in the ncscc . one third ( n=17 ) of hospitals included in analyses were located in nonmetropolitan counties , whereas nearly half ( n=23 ) were located in metropolitan areas with a population of 250 000 . the median number of beds for hospitals in the study population was 162 ( interquartile range 113 to 457 ) in 2012 . north carolina counties with a north carolina stroke care collaborative ( ncscc ) hospital , 20052012 . * compared with nonpscs , pscs and hospitals preparing for certification tended to be larger ( p<0.01 ) , teaching hospitals ( p<0.01 ) , and urban hospitals ( p=0.03 ) ( table 1 ) . they were also more likely to have an intravenous ( iv ) tpa protocol ( p=0.04 ) , an ed stroke protocol ( p=0.02 ) , a stroke unit ( p<0.01 ) , and a neurosurgeon on staff ( p<0.01 ) . cases at pscs tended to be younger ( p<0.01 ) , male ( p<0.01 ) , and nonwhite ( p<0.01 ) ( table 2 ) . characteristics of hospitals participating in the north carolina stroke care collaborative , 20052010 , by psc certification status psc indicates primary stroke center ; tpa , tissue plasminogen activator ; ems , emergency medical services . characteristics of cases enrolled in the north carolina stroke care collaborative , 20052010 , by psc certification status psc indicates primary stroke center . pscs and hospitals preparing for certification had higher compliance with all but 2 pms ( smoking cessation counseling and treatment of cases with atrial fibrillation with anticoagulant therapy ) compared with nonpscs ( p<0.01 ) ( table 3 ) . pscs were the most likely to provide deep vein thrombosis prophylaxis , antithrombotic agents , and iv tpa . hospitals preparing for certification were the most likely to measure lipids during hospitalization , screen for dysphagia , provide stroke education , and provide smoking cessation counseling . defectfree care was most common at hospitals preparing for psc certification ( 52.8% ) , followed by pscs ( 45.0% ) and nonpscs ( 21.9% ) . percentage of cases in compliance with joint commission performance measures , north carolina stroke care collaborative , 20052010 , by psc certification status denominators vary based on exclusion / inclusion criteria . psc indicates primary stroke center ; iv tpa , intravenous tissue plasminogen activator . as shown in table 4 , psc hospitals and those preparing for certification had higher odds of complying with all measured stroke performance indicators ( including defectfree care ) with the exception of providing anticoagulants to patients with atrial fibrillation ( no statistical difference ) and providing smoking cessation counseling ( pscs had lower compliance than nonpscs ) . adjustment for age , sex , race , and stroke type altered ors only modestly . further adjustment for hospital bed size and accounting for clustering of patients within hospitals modestly attenuated some , but not all , ors but did widen cis . with regard to hospitals preparing for certification , cis were widened to the point of nonsignificance for discharge on antithrombotic , receipt of iv tpa , measurement of lipids , and consideration for a rehabilitation plan . odds ratio and 95% cis of compliance with joint commission performance measures among cases enrolled in the north carolina stroke care collaborative , 20052010 , by psc certification status ( referent = nonpsc ) psc indicates primary stroke center ; iv tpa , intravenous tissue plasminogen activator . adjusted for age , sex , race , and stroke type . adjusted for age , sex , race , stroke type , and hospital bed size and accounting for clustering of patients within hospitals . there were substantial improvements in the quality of acute stroke care from 2005 to 2010 ( table 5 ) . overall , pm compliance increased for all measures and for all 3 hospital groups ( figure 2 ) , with the exception of discharge on antithrombotic medication , which remained high throughout the study period in all 3 groups . pscs and hospitals in the process of certification had consistently higher pm compliance . compared with nonpscs , pscs had a higher average annual percent increase in smoking cessation counseling ( p<0.01 ) , and those preparing for certification had the greatest increases in the percent of patients for whom iv tpa was considered ( p<0.01 ) and in the percentage of eligible cases who received iv tpa ( p=0.04 ) , those who had a lipid profile measured during hospitalization ( p<0.01 ) , and those who were discharged on a statin ( p=0.04 ) . pscs and those preparing for certification had a higher average annual percent increase in the provision of defectfree care ( p=0.01 and 0.04 , respectively ) than nonpscs . compared with hospitals preparing for certification , nonpscs had a higher average annual percent increase in the provision of dvt prophylaxis ( p=0.04 ) , and compared with pscs , nonpscs had a higher average annual percent increase in cases administered iv tpa ( p=0.01 ) and in cases discharged on a statin ( p=0.01 ) . average annual absolute percentage change in compliance with joint commission performance measures among cases enrolled in the north carolina stroke care collaborative , 20052010 , by psc * status ( referent = nonpsc ) denominators vary based on exclusion / inclusion criteria . percentage of cases enrolled in the north carolina stroke care collaborative meeting joint commission performance measures , 20052010 , by primary stroke center certification status over time ( months ) . we found that the quality of strokerelated care improved in hospitals participating in the ncscc registry 2005 through 2010 , but pscs and hospitals preparing for certification had higher compliance with most pms . moreover , pscs and hospitals preparing for certification had greater improvements over time on a number of measures . in unadjusted analyses , hospitals preparing for certification had higher compliance than established pscs for lipids measured during hospitalization , dysphagia screening , stroke education , smoking cessation counseling , consideration for a rehabilitation plan , and overall defectfree care . these differences initially suggested support for the theory that when preparing for certification , hospital personnel must devote a great deal of time effort and commitment to improving stroke care ; however , thereafter , there may be a tendency toward complacency with past improvements and a diminishment in the urgency for continued quality improvement or a ceiling effect with further improvements having relatively less impact . however , after adjustment for patientlevel factors and hospital bed size and after accounting for the clustering of patients within hospitals , these differences were removed , suggesting pscs continue to improve quality of stroke care , even after certification . our finding that nonpscs had a higher average annual percent increase in cases administered iv tpa and in cases discharged on a statin is likely due to the fact that baseline iv tpa rates were much lower at baseline at nonpscs ( table 3 ) , allowing for greater improvements in response to secular trends . rate of discharge on a statin was high for all 3 groups ( table 3 ) but lowest for nonpscs , again allowing for greater improvement over time . certification requires hospitals to have stroke teams and stroke units and to use standardized stroke care pathways to guide evaluation and treatment of stroke . the quality of stroke care has improved in recent years , both nationally and in nc . these trends are reflected in our data , as even nonpscs , which include primarily small , rural , nonteaching hospitals , showed improvements . a 2010 statewide survey of hospitalbased stroke services in nc reported that the introduction of the jc 's psc certification process occurred concurrent with significant improvements in a number of important organizational features in nc hospitals , including the use of stroke care maps , iv tpa protocols , stroke teams , prewritten stroke orders , and diagnostic tests that were not seen in the period preceding the psc certification program . organizational and procedural changes such as these are likely important drivers of improved compliance with stroke treatment recommendations . for example , one study found that patients admitted to pscs were more likely to receive iv tpa . another reported that in new york state , patients cared for at pscs had shorter median doortophysician times , a higher probability of appropriate iv tpa administration , and a higher probability of stroke unit admission . shorter time to computed tomography scan at pscs compared with nonpscs has been reported in a previous ncscc study . psclike programs in other countries have reported similar improvements in acute stroke care . in japan , investigators reported an increase from 1.2% to 2.8% in iv tpa administration among eligible patients and a significant decrease in response time following psc establishment . studies of the effect of psc certification on mortality and discharge destination suggest a survival benefit . stroke mortality rates at pscs were lower than nonpscs in new york state ( ie , 30day mortality , 10.1% versus 12.5% ; p<0.001 ) . studies based on us national data also found lower riskadjusted mortality rates for psc patients with both ischemic and hemorrhagic stroke . similarly , a finnish study reported lower 1year stroke case fatality at certified stroke centers . in contrast , an aha get with the guidelines stroke study reported that while the hospitals ' geographical region and academic status were independently associated with riskadjusted mortality and morbidity , psc designation was not . all of the hospitals , however , were participating in a performance improvement program including all psc pms , which may have reduced the potential effect of psc designation . a study evaluating the impact of the get with the guidelines stroke program reported that , independent of secular trends , time of participation in the program was associated with increased adherence to all stroke pms . still , the greatest improvements were noted among hospitals that received psc certification . the similarity in percent change in compliance with pms among pscs and those preparing for certification suggests a continuum of quality improvement and a benefit in the process of attaining certification certain hospital characteristics such as bed size and academic status have been associated with stroke care quality , and hospitals with greater resources may have provided highquality care before the certification process began . although many key acute stroke care processes ( eg , stroke teams , stroke units , neurosurgery on staff , and treatment protocols ) may have been developed or improved during certification , precertification differences in hospital characteristics including more physicians , specialists , equipment , and other resources may have facilitated their implementation . though pscs tend to have different characteristics than nonpscs , pscs do not have uniform access , resources , capacity , and quality . further , although certain characteristics ( eg , larger size , teaching status , and urban setting ) are associated with higherquality care , highquality care can still be provided in a dedicated center that provides a coordinated system of care . strategies such as telemedicine to access stroke teams , ambulance rerouting , and transfer agreements make process measures attainable even by small rural hospitals . multilevel modeling to include the effect of hospital bed size was conducted to address this concern . stroke patients treated at pscs were generally younger , male , and nonwhite and more likely to have hemorrhagic strokes . pscs treated a more severe patient population , as suggested by the higher proportion of hemorrhagic stroke cases . hemorrhagic stroke cases are less likely to receive smoking cessation education and stroke education than were patients with ischemic stroke or transient ischemic attack but are more likely to receive care compliant with other pms . although few age differences have been reported , women were less likely to receive iv tpa treatment and lipid testing , and black patients were more likely to have longer ed waiting times and receive fewer evidencebased care processes than were white or hispanic patients . participation in the ncscc is voluntary , and participating hospitals are more likely to have an interest in stroke quality improvement . our study included hospitals from all regions of nc and included a mix of academic and nonacademic , rural and urban , and small and large hospitals . because the ncscc requires no fee for participation in fact , it assists hospitals with the costs associated with participation barriers to participation are low , and the ncscc is more likely to include a diverse population of hospitals . approximately 62% of the nearly 27 000 stroke hospitalizations in nc each year are at hospitals participating in the ncscc . hospitals were encouraged to include all acute stroke admissions ; however , bias may occur if hospitals do not follow instructions consistently . periodic quality control studies found that 83.7% of all acute strokes discharged from participating hospitals were enrolled . this high case ascertainment rate may be attributed to the use of both prospective and retrospective case capture methods and no requirements to obtain written consent . because the ncscc is a quality improvement registry and patient consent is not required , the lack of consent precludes obtaining postdischarge outcomes data . psc certification is associated with an overall improvement in the quality of stroke care in nc . still , considerable room for improvement remains , even among certified hospitals . additional organizational and policy changes and provider and community education are needed for continued progress . improved public knowledge about stroke symptoms and the proper response is particularly critical if patients are to be eligible for the most effective acute stroke care options . nearly onefifth of nc 's population resides in a county without a psc or a facility with telemedicine or a standing transfer plan , underscoring the importance of identifying facilities appropriate for psc certification or , where unable , using alternative quality improvement strategies . assessment of compliance with pms allows for the monitoring of changes and improvements in systems , operations , and organization within hospitals . continuous monitoring of care measures in both pscs and nonpscs particularly in a realtime , prospective manner as done in the ncscc is critical if quality improvement is to continue . linking compliance levels with outcomes will also be an important measure of the true value of these systemlevel changes and must be addressed in future studies .

backgroundorganized stroke care is associated with improved outcomes . data are limited on differences in changes in the quality of acute stroke care at the joint commission certified primary stroke centers ( pscs ) versus nonpscs over time.methods and resultswe compared compliance with the joint commission 's 10 acute stroke care performance measures and defectfree care in pscs and nonpscs participating in the registry of the north carolina stroke care collaborative from january 2005 through february 2010 . we included 29 654 cases presenting at 47 hospitals10 pscs , 8 preparing for certification , and 29 nonpscs representing 43% of north carolina 's non veterans affairs , acute care hospitals . using a nonpsc referent , odds ratios and 95% cis were calculated using logistic regression and generalized estimating equations accounting for clustering of cases within hospitals . time trends were presented graphically using simple linear regression . performance measure compliance increased for all measures for all 3 groups in 20052010 , with the exception of discharge on antithrombotics , which remained consistently high . pscs and hospitals preparing for certification had better compliance with all but 2 performance measures compared with nonpscs ( each p<0.01 ) . defectfree care was delivered most consistently at hospitals preparing for certification ( 52.8% ) , followed by pscs ( 45.0% ) and nonpscs ( 21.9% ) . between 2005 and 2010 , pscs and hospitals preparing for certification had a higher average annual percent increase in the provision of defectfree care ( p=0.01 and 0.04 , respectively ) compared with nonpscs.conclusionspsc certification is associated with an overall improvement in the quality of stroke care in north carolina ; however , room for improvement remains .

necrotizing fasciitis ( nf ) is a serious life - threatening , progressive , rapidly spreading inflammatory infection located in the deep fascia that rapidly destroys the skin and soft tissue beneath it,1,2 and is most commonly caused by a rapidly spreading infection of streptococcus pyogenes in the subcutaneous plane.3 the overall mortality rate is 25%30% , more than 70% of cases are associated with toxic shock syndrome , and nearly 100% of cases are fatal without surgical intervention.1,2,4 nf usually affects the extremities , abdomen , or perineum , and facial involvement is rare owing to the excellent blood supply of this region.4,5 the organisms most closely linked to nf are group a beta - hemolytic streptococci ( type ii nf ) , with or without a coexisting staphylococcal infection , although these bacteria are isolated in only a minority of the cases.24 type ii nf typically occurs in healthy young immunocompetent individuals.2,4 the rarer form ( type i nf ) predominantly affects immunocompromised or debilitated patients and is caused by polymicrobial infections and the usual pathogens are obligate and facultative anaerobes.24 the periorbital infection is mainly caused by beta - hemolytic streptococci alone ( 50% ) , occasionally in combination with staphylococcus aureus ( 18%).4 periocular nf is characterized by acute onset of a painful edematous , erythematous , nonspecific rash . as the infection spreads subcutaneously along the facial planes , the pain becomes severe , whereas the skin is often anesthetic.4,5 the patient feels sick and develops a low to medium grade fever associated with hypotension and tachycardia out of proportion to the temperature elevation.4,5 this is true in most cases , but patients can appear systemically quite well , at least initially.6 within the next 48 hours the lid skin assumes a violaceous hue which may progress to fluid - filled bullae and later to black necrotic patches . within 45 days , frank cutaneous gangrene develops , and by 810 days , the skin sloughs and becomes gangrenous.4 to our knowledge , there are no case reports of periocular nf after retrobulbar injection and/or canthotomy . here we report the first case of periocular nf preceded by local retrobulbar anesthesia injection for cataract extraction , to highlight the importance of a high index of suspicion for early recognition and prompt intervention in this potentially vision - threatening and life - threatening disease . a 33-year - old female patient presented to the eye clinic at jimma university hospital with bilateral painless progressive loss of vision , and on examination was found to have bilateral presenile cataract , so was admitted to the eye ward to have left eye cataract extraction . on the following day , she underwent standard preoperative preparation of the left eye and was taken to the operating theater . the left eyelid and periorbital area were cleaned with 70% alcohol . during retrobulbar injection of 4 ml of lidocaine hydrochloride 2% and epinephrine 1:100,000 , she developed moderate retrobulbar hemorrhage which warranted cancellation of the planned cataract surgery . tubicort ( tubilux pharma s.p.a , rome , italy ) ( hydrocortisone 0.5% + oxytetracycline 0.9% ) eye suspension was instilled and the eye was patched . she was given a 500 mg oral loading dose of acetazolamide and a maintenance dose of 250 mg qid , and sent to the eye ward for bed rest and follow - up . on the next day , she had diffuse , warm , tense , and tender reddish blistering eye lid swelling associated with headache and periorbital pain , but her body temperature was normal . with the impression of severe retrobulbar hemorrhage , lateral canthotomy and cantholysis were done to relieve the pressure , and she was given paracetamol 1 g tablets as required and continued acetazolamide . hence , surgical evacuation of orbital hematoma through anterior orbitotomy was attempted but no significant hematoma was found . post - orbitotomy , intravenous cloxacillin 500 mg qid and ceftriaxone 1 g twice daily was started . vital signs were stable ( pulse rate 90 per minute , respiratory rate 16 per minute , temperature 36.5c , blood pressure 90/70 mmhg ) . on subsequent days ( 3 and 4 ) , the upper and lower eyelids of the left eye and the surrounding face became blue - gray and necrotic , with loss of touch and pain sensation over the swelling and around it ( figure 1 ) . the patient was unable to open the lid , so visual acuity was not measured . at this stage , surgical debridement was done and necrotic foul - smelling tissues over the upper lid , lower lid , and deep orbital tissue under the lateral canthus were removed ( figure 2 ) . other hematological and serological tests ( for fasting blood sugar , white blood cell count with differential , erythrocyte sedimentation rate , and venereal disease research laboratory and human immunodeficiency virus ) were unrevealing . intravenous cloxacillin , ceftriaxone , and metronidazole , as well as daily wound care and dressing with furacin ( universal twin labs , mumbai , india ) ointment was continued but there was no improvement . on day 13 , redebridement was done ; at this time , the bulbar conjunctiva , sclera , and orbital tissue were necrotic and vision was no light perception . the clinical decision for orbital exenteration was taken and discussed with the patient and her family , but she declined and self - discharged against medical advice and repeated counseling , and did not return for further follow - up . the patient had no previous or current nasal discharge , history of trauma , previous facial / nasal / ocular wound , known drug allergy , history of drug usage , or personal or family history of known systemic diseases ( diabetes mellitus , hypertension , or cardiac , renal , or liver disease ) . periocular nf or primary involvement of the eyelids is a rare but well known entity1,7 and is seen mainly in adults with a female predominance ( 54% ) ; about half ( 47% ) of the patients are previously healthy.4 this is in agreement with our case involving a healthy adult female patient . the infection may follow local blunt trauma ( 17% ) , as well as penetrating injuries ( 22% ) and face surgery ( 11% ) , whereas no cause is identified in about one third of cases ( 28% ) . it may also be secondary to immunosuppression , diabetes , alcoholism , and other factors.2,3,7,8 in our case , retrobulbar anesthesia injection was identified as a risk factor . the evolution of the lesion seen in our patient is in line with the clinical description of nf in the literature410 and hence supports the diagnosis of periocular nf . the clinical diagnosis of necrotizing fasciitis is further substantiated by the operative findings , which included the presence of grayish necrotic fascia , lack of resistance of normally adherent superficial fascia to blunt dissection , lack of bleeding of the fascia during dissection , and the presence of foul - smelling dishwater pus.5 this was seen in our case , further supporting the diagnosis . however , other possible and serious differentials of periocular necrotizing fasciitis , including preseptal cellulitis , orbital cellulitis , cavernous sinus thrombosis , and rhino - orbital mucormycosis should be considered and ruled out . although it is quite difficult to distinguish periocular nf from preseptal cellulitis and orbital cellulitis , rapid progression and eventual cyanosis of the involved tissue and formation of serous fluid - filled bullae are clues to common non - necrotizing preseptal cellulitis , while the presence of dusky erythema in an area of cellulitis helps to differentiate orbital cellulitis from periorbital nf.11 in underdeveloped countries like africa , latin america , asia , and eastern europe,12 periocular cutaneous anthrax should also be considered in the differential diagnosis , and physicians must be vigilant about inquiring for a history of contact with anthrax - infected animals or animal products . moreover , the presence of severe pain and loss of sensation over the affected area , which are features suggestive of necrotizing fasciitis,1,13 will enable it to be distinguished , and cutaneous anthrax has characteristic black eschar formation , but at a later stage.8,13 management of periorbital nf is centered on early recognition of clinical signs and symptoms and this mandates aggressive multidisciplinary treatment to avoid severe and permanent disfigurement , and loss of vision and mortality is linked to misdiagnosis or delay in diagnosis.4 if prompt diagnosis is established , treatment by extensive surgical debridement and systemic antibiotics ( with or without the use of hyperbaric oxygen therapy ) can prevent a fulminant course with a fatal outcome.2,4,1416 an optimal antibiotic regimen for methicillin - susceptible s. aureus skin and soft tissue infection is a higher dose of oxacillin ( 12 g intravenously , every 4 hours ) with clindamycin ( 600 mg / kg intravenously , every 8 hours or 300450 mg orally three times daily)17 because of oxacillin s excellent diffusion in soft tissue and its antitoxin properties . our patient was given cloxacillin , ceftriaxone , and metronidazole because oxacillin and clindamycin were not available . use of hyperbaric oxygen therapy can reduce the extent of hypoxic leukocyte dysfunction occurring within an area of hypoxia and infection , and provide oxygenation to otherwise ischemic areas , thus blocking the progression of nf18 and perhaps saving more of the eyelid and orbital tissue . some survivors might need extensive surgical intervention like orbital exenteration as reported by lazzeri et al4 in their review of the published literature . our patient also developed deep orbital tissue necrosis with eye involvement ; exenteration was planned but the patient declined and self - discharged against medical advice and did not come back for follow - up . in conclusion , periocular necrotizing fasciitis remains principally a clinical diagnosis , and is often missed early in its presentation because of the paucity of specific cutaneous signs early in its evolution , and the difficulty in differentiating it from other common soft tissue infections , especially in the presence of a surgical wound and retrobulbar hemorrhage . the rarity of the disease may also result in misdiagnosis due to lack of experience on the part of the clinician involved . a high index of suspicion , early recognition , and prompt therapeutic intervention are essential for an optimal visual outcome , cosmetic result , and patient survival . it is essential that physicians are aware of the clinical presentation of this disease and its possible risk factors , including minor surgical trauma with a needle .

necrotizing fasciitis is a rare , rapidly progressive severe bacterial soft tissue infection with a high mortality rate . while necrotizing fasciitis classically involves the trunk , groin / perineum , lower limbs , and postoperative wound sites , primary involvement of the eyelids is a rare but well known entity . we present a 33-year - old female patient who developed periocular necrotizing fasciitis after local retrobulbar anesthesia injection and facial block for cataract surgery in the left eye and canthotomy / cantholysis for treatment of moderate retrobulbar hemorrhage in the same eye . surgical debridement was done and necrotic foul - smelling eyelid and deep orbital tissues were removed , and culture grew staphylococcus aureus . despite initial surgical debridement and intravenous antibiotic therapy , the disease progressed rapidly ; orbital exenteration was considered , but the patient declined the surgery and self - discharged . periocular necrotizing fasciitis remains predominantly a clinical diagnosis , and is often missed early in its presentation because of the difficulty in distinguishing it from other common soft tissue infections , especially in the presence of surgical wounds and retrobulbar hemorrhage . a high index of suspicion , early recognition , and prompt therapeutic interventions are indispensable for optimal visual outcome and patient survival .

systolic anterior motion ( sam ) of the mitral valve has been described after mitral repair in patients with mitral regurgitation ( mr ) [ 1 , 2 ] . the occurrence of sam leads to left ventricular outflow obstruction ( lvoto ) , mitral regurgitation , and severe hemodynamic instability . several studies have revealed the morphological characteristics of sam by intraoperative transesophageal echocardiography ( tee ) . landiolol is an ultra - short - acting 1 selective adrenoceptor antagonist , with a short plasma half - life of 4 min , and decreases heart rate during cardiac surgery . the landiolol concentration reaches a rapid steady state level , and rapidly decreases after complete administration . a population pharmacokinetic model of landiolol has been developed in healthy subjects . using those parameters , we obtained plasma landiolol concentrations during perioperative anesthetic management using the stanpump software . we here describe three patients with sam who were treated with landiolol , and analyzed sam morphological characteristics by tee and predicted landiolol plasma concentration with the disappearance of sam . a 65-year - old woman had fever and visual deficit , and thorough testing confirmed the presence of endocarditis , including mr and cerebral infarction . preoperative echocardiography confirmed moderate mr due to prolapse of the posterior leaflet and vegetation ( 9 4 mm ) ( fig . the ejection fraction was 65 % ; thus , mvp was indicated.fig . 1 a preoperative 3d - tee and 2d - tee mid - esophageal long - axis view at the appearance of sam in case 1 . b preoperative 3d - tee and 2d - tee mid - esophageal long - axis view at the appearance of sam in case 2 . c preoperative 3d - tee and 2d - tee mid - esophageal long - axis view at the appearance of sam in case 3 . 3d - tee indicated prolapse of posterior leaflet a preoperative 3d - tee and 2d - tee mid - esophageal long - axis view at the appearance of sam in case 1 . b preoperative 3d - tee and 2d - tee mid - esophageal long - axis view at the appearance of sam in case 2 . c preoperative 3d - tee and 2d - tee mid - esophageal long - axis view at the appearance of sam in case 3 . 3d - tee indicated prolapse of posterior leaflet anesthesia was induced with target controlled infusion ( tci ) of 3 g / ml propofol , 0.3 g / kg / min remifentanil , and 40 mg rocuronium , with timely administration of phenylephrine . preoperative transesophageal echocardiography ( tee ) was performed for sam ( table 1 ) . the distance from the septum to the mitral valve coaptation point ( c - sept ) was 2.2 cm . low dose landiolol ( 3 g / kg / min ) was administered at the start of surgery . quadrangular resection , suturing of the posterior mitral valve leaflet ( pml ) , and vegetation resection were performed . the patient was weaned from cardiopulmonary bypass ( cpb ) with 5 g / kg / min dopamine , and 5 g / kg / min dobutamine.table 1 preoperative morphological risk factor of samrisk factorcase 1case 2case 3al / pl ratio < 1.31.31.1*0.8*pml > 15 mm10 mm16 mm*27 mm*aml > 27 mm13 mm18 mm23 mmdistance between coaptation and interventricular septum ( c - sept ) < 25 mm22 mm*23 mm*18 mm*small angle between the aortic and mitral annular planes ( < 120)143123124small ventricle ( < 36 mm)44 mm48 mm45 mmthickening of interventricular septum()()()small angle between aml and outflow272520small distance between coaptation and outflow10 mm8 mm5 mmasterisk indicates the risk factor of sam preoperative morphological risk factor of sam asterisk indicates the risk factor of sam after separation from cpb , blood pressure suddenly became unstable at 74/34 mmhg . a bolus of 6 mg landiolol was initiated at 10 g / kg / min . tee confirmed the disappearance of sam , and hemodynamics improved . upon disappearance of sam , the predicted plasma landiolol concentration was 0.28 g / ml according to the stanpump software . a 53-year - old woman had no complaint , but exhibited cardiac murmur ; thorough testing confirmed mr . severe mr due to prolapse of the posterior leaflet was confirmed by preoperative echocardiography ( fig . anesthesia was induced with tci of 3 g / ml propofol , 0.3 g / kg / min remifentanil , and 40 mg rocuronium , with timely administration of phenylephrine . the patient was weaned from cpb with 3 g / kg / min dopamine and 3 g / kg / min dobutamine . after separation from cpb , we decreased the dose of catecholamines , and injected two boluses of 5 mg landiolol at 10 g / kg / min . then sam continued , so the landiolol dose was increased to 20 g / kg / min . the predicted plasma landiolol concentration was 0.40 g / ml , according to the stanpump software . a 55-year - old man had no complaint , but exhibited cardiac murmur ; thorough testing confirmed mr . preoperative echocardiography was confirmed to be severe mr due to prolapse of the posterior leaflet and rupture of the chordae tendineae ( fig . anesthesia was induced at 4 g / ml tci of propofol , 0.4 g / kg / min remifentanil , and 50 mg rocuronium , with timely administration of phenylephrine . the c - sept was 1.8 cm , the al / pl ratio was 0.8 , and the length of pml was 27 mm . a quadrangular resection and suturing of the pml was performed . the patient was weaned from cpb with 2 g / kg / min dopamine and 4 g / kg / min dobutamine . it showed real time 3d - tee when sam was occurring ( fig . 2 ) . we decreased the catecholamine dose , started noradrenaline and administered two boluses of 3 mg landiolol at 7 g / kg / min . tee confirmed the disappearance of sam , and hemodynamics improved . upon the disappearance of sam , the predicted plasma landiolol concentration was 0.22 g / ml according to the stanpump software.fig . 2it showed real time 3d - tee when sam is occurring in case 3 it showed real time 3d - tee when sam is occurring in case 3 the mechanism of sam has been reported as a venturi or drag effect by cape et al . and sherrid et al . the appearance of sam is a major complication following mvp and is reported to occur in from 5 to 10 % of cases . maslow et al . indicated that the pre - repair al / pl ratio in sam cases was < 1.3 and c - sept was < 2.5 cm . reported that the angle between the aortic and mitral annular planes was < 120in sam cases . orihashi indicated the distance between the outflow and coaptation was small and that the angle between the anterior mitral leaflet ( aml ) and outflow also was small in sam cases . reported that the aml was > 27 mm , and that the pml should be 15 mm in sam cases . in our cases , measurements were performed in all three cases of sam ( table 1 ) . as a result , however , these morphology related reports are based on upper and lower limits , means , and experiences , without clearly setting cut - off values ; it may be necessary to consider these values as references , rather than absolute standards , and combine them for the prediction of onset of sam . figure 2 shows real time 3d - tee when sam is occurring in case 3 . with the use of 3d - tee , when mitral valve prolapse was investigated , in all three cases treatment for sam increases preload and afterload , specifically transfusion , and using an -adrenergic agent decreases heart rate , while stopping dopamine and dobutamine . however , transfusions , starting a continuous infusion of noradrenaline , and limiting dopamine and dobutamine were insufficient in all three of our cases . this drug is hydrolyzed to an inactive form by both carboxyesterase in the liver and pseudocholinesterase in plasma . it has a shorter plasma half - life of approximately 4 min compared with that of esmolol ( 9 min ) . landiolol has much higher cardioselectivity ( 1/2 = 255 ) than that of esmolol ( 1/2 = 33 ) . when patients are weaned from cpb , drugs that strictly control these effects are more desirable . the predicted plasma landiolol concentrations in cases 13 were 0.28 , 0.4 , and 0.22 g / ml , respectively . the cause of improvement in sam is not only landiolol ; a variety of factors have influence . we would be pleased , however , if the concentrations in our paper could serve as reference values into the future .

we report three cases with systolic anterior motion ( sam ) after mitral valve plasty . preoperative mitral valve morphology is a risk factor for sam . the morphological characteristics of sam have been revealed in several studies . we found a small distance between coaptation and the interventricular septum in all cases , and cases 2 , and 3 had a low al / pl ratio , whereas case 3 had a large pml , which was revealed by transesophageal echocardiography . with the use of 3d transesophageal echocardiography , when mitral valve prolapse was investigated , in all three cases , it was easy to specify lesions . the issue for the future is 3d analysis when sam is occurring .

as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors

unique -hemiaminal ether gold carbene intermediates were accessed by a gold - catalysed 1,1-carboalkoxylation strategy and evolved through a highly selective 1,2-n - migration . this skeletal rearrangement gave functionalised indenes , and isotopic labelling confirmed the rare c n bond cleavage of the ynamide moiety . the effect of substituents on the migration has been explored , and a model is proposed to rationalise the observed selectivity .

avian trichomonosis is a disease caused by a protozoan parasite , most commonly trichomonas gallinae . avian trichomonosis has been reported most frequently in pigeons and doves ( stabler and herman , 1951 ) ; however , infections recently have been documented in several species of songbirds ( anderson et al . , 2009 , forzan et al . , 2010 , robinson et al . , 2010 ) . the emergence of avian trichomonosis in these species has invigorated work to advance understanding of parasite diversity , pathogenicity , and host range . genetic typing of the protozoan parasites is accomplished using pcr , identifying 15 different internal transcribed spacer ( its ) subtypes of t. gallinae isolated from a diversity of avian species , with some subtypes more commonly found in certain species ( gerhold et al . , 2008 , these subtypes have been further classified by sequencing the hydrogenosomal fe - hydrogenase gene , of which two predominant subtypes exist , delineated a1 and a2 ( girard et al . generally , subtype a1 is isolated from songbirds , columbids , and raptors in europe while a2 is less commonly isolated and was recently found to be the predominant subtype isolated from pacific coast band - tailed pigeons ( patagioenas fasciata monolis ) in california , usa ( girard et al . , 2014b ) . genetic evaluation of the parasite gives us insight into the ecology and epidemiology of avian trichomonosis and refines our understanding of host associations , cross - species transmission , and spillover events . trophic transmission of t. gallinae has been documented in raptors that feed heavily on infected prey such as mourning doves ( zenaida macroura ) and rock pigeons ( columba livia ) in mostly suburban and urban environments . nestlings may then become infected with trichomonads directly from infected parents or indirectly when parents feed their young infected prey ( forrester and foster , 2008 ) . for example , avian trichomonosis was the cause of death for approximately 80% of cooper 's hawk ( accipiter cooperii ) nestlings in urban locations in arizona while none of the nestlings in rural locations died of avian trichomonosis ; although few dead nestlings were detected in rural areas ( boal , 1997 ) . the diet of urban cooper 's hawk pairs was comprised of 83% doves versus 10% for rural pairs . in northeastern germany , 65% of northern goshawk ( a. gentilis ) nestlings were positive for trichomonads ( krone et al . , 2005 ) while 39% of northern goshawk nestling mortality was attributed to avian trichomonosis in great britain ( cooper and petty , 1988 ) . in both cases , a large portion of the nestlings ' diet included rock pigeons and wood pigeons ( c. palumbus ) . in spain , approximately 36% of endangered bonelli 's eagle ( hieraaetus fasciatus ) nestlings were infected with trichomonads while avian trichomonosis accounted for 22% of total nestling mortality ; the nestlings ' diet consisted of rock pigeons and wood pigeons ( real et al . , 2000 ) . . however , avian trichomonosis affecting raptors in rural and remote areas is more likely to go undetected . an equally important , but often overlooked , source of infection in raptors may occur during avian trichomonosis epidemics , or mortality events , in prey species in which there may be hundreds to thousands of birds dying of the disease in a localized geographic area . in california , avian trichomonosis mortality events have been documented in mourning doves and band - tailed pigeons ( cole , 1999 , girard et al . , 2014b , rogers et al . , 2016 , stromberg et al . , 2008 ) . events in mourning doves typically occur during the spring and summer and are frequently associated with artificial feeding sources in urban and suburban areas ( stabler and herman , 1951 ) which may result in infection in both adult raptors and their young when feeding on infected doves in these areas . events in band - tailed pigeons occur most commonly in winter when almost the entire population of pacific coast band - tailed pigeons is over - wintering from central to southern california , forming large flocks enabling the disease to more easily spread between individual birds at communal watering sites in mostly rural areas ( rogers et al . , 2016 ) . avian trichomonosis mortality events have been documented in band - tailed pigeons since the mid-1940s and are an important factor in their decline ( rogers et al . , 2016 ) . band - tailed pigeons inhabit oak woodland and coniferous forests of the coastal and sierra nevada mountain ranges ( keppie and braun , 2000 ) ; therefore , trichomonosis outbreaks in band - tailed pigeons may provide an opportunistic source of prey and subsequent infection among raptor species in these habitats . given their range overlap with band - tailed pigeons , spotted owls ( strix occidentalis ) are at risk of exposure to t. gallinae during trichomonosis epidemics . northern spotted owls ( s. o. caurina ) were listed as threatened under the endangered species act in 1990 and are currently under review for listing in california . in california , northern spotted owls occur primarily in the klamath and coastal mountain ranges from del norte to marin counties ( gutierrez et al . , 1995 ) . california spotted owls ( s. o. occidentalis ) were identified as a species of special concern in california in 2008 ( davis and gould , 2008 ) and are currently under status review by the u.s . fish and wildlife service ( federal register vol . california spotted owls inhabit coniferous forests of the sierra nevada and tehachapi mountain ranges and the southern extent of the coastal mountain range from monterey to santa barbara counties ( gutierrez et al . , 1995 ) . spotted owls are habitat specialists whose populations have declined primarily due to loss and alteration of preferred habitat . spotted owls are non - migratory although individuals may make seasonal elevational movements in response to weather and prey availability ( gutierrez et al . , 1995 ) . small mammals including leporids , squirrels , voles , gophers , and rodents make up the majority of the diet of spotted owls with dusky - footed woodrats ( neotoma fuscipes ) and northern flying squirrels ( glaucomys sabrinus ) being important to both northern and california spotted owls ( smith et al . 1998 ) . during an avian trichomonosis mortality event , slow - moving , sick or dying birds are increasingly available to predators such as owls poor detection of sick and dead owls in more remote habitats makes this risk difficult to assess . we hypothesized that avian trichomonosis may be a locally important source of mortality in owls , particularly during epidemics in band - tailed pigeons . in this study , we identify spillover infections in a sensitive raptor species coinciding with mortality events in band - tailed pigeons detected in california between 2011 and 2015 . we describe the epidemiology of trichomonosis in spotted owls examined post - mortem and genetically identify the infecting trichomonads . the california department of fish and wildlife ( cdfw ) wildlife investigations laboratory ( wil ) investigates causes of mortality in the state 's wildlife . incidents of sick and dead wildlife are reported to wil by cdfw regional staff , other agencies , wildlife rehabilitation centers , and the public . when available , carcasses are collected and submitted to wil ( rancho cordova , ca ) or the california animal health and food safety laboratory ( cahfs ; davis , ca ) for post - mortem examination . avian trichomonosis mortality events ( defined as 5 birds dying in the same geographic location over several days to weeks ) occurring in band - tailed pigeons in california between 1945 and 2014 have recently been summarized by rogers et al . a subset of carcasses was collected from outbreak locations for post - mortem examination and sampling for trichomonad isolation . a cotton - tipped applicator moistened with sterile saline was used to swab the oral cavity of recently dead pigeons as previously described ( girard et al . , 2014a ) . the swabs were placed into inpouch tf culture devices ( biomed diagnostics , white city , or ) and kept at 25 c during transport to the laboratory . the inpouch cultures were incubated at 37 c and examined once a day for 5 days for the presence of trichomonads under light microscopy . positive cultures were subcultured for cryopreservation and dna extraction and molecular characterization as previously described ( girard et al . , 2014a ) . if birds could not be sampled within 24 h after death , the carcass was stored in a freezer ( 20 c ) until submitted for exam . frozen carcasses were thawed at 4 c for 2448 h. lesion tissues were sampled by excision , placed in a cryovial , and stored at 80 c until molecular analysis . dna was amplified and sequenced using primers targeting the its1/5.8s rrna / its2 and fe - hydrogenase loci and sequence analysis was performed by alignment to published trichomonad sequences in genbank ( girard et al . , 2014a ) . amplicons whose sequences were difficult to interpret using geneious pro v. 5.34 sequence analysis software ( biomatters ltd . , auckland , nz ) were cloned using the topo ta cloning kit ( thermo fisher scientific , waltham , ma ) , and 10 colonies per dna isolate were chosen for further sequence analysis . band - tailed pigeon mortality events were categorized by season based on the band - tailed pigeons annual cycle ( keppie and braun , 2000 ) . however , due to the annual variation in the timing of these activities as well as the temporal overlap of these activities by individual pigeons , the seasons were simplified into summer ( may through october ) which primarily includes breeding and early fall migration and winter ( november through april ) which includes over - wintering and spring migration in california . when an avian trichomonosis mortality event was detected in band - tailed pigeons , wil notified wildlife rehabilitation centers and asked them to report infections in raptor species . raptors admitted into rehabilitation centers with oral lesions typically died shortly after admission , or were euthanized due to poor prognosis . carcasses were stored in a freezer until the post - mortem examination and lesion sample collection as previously described ( girard et al . , 2014a ) . for one california spotted owl ( ca015768 ) , the carcass was submitted to wil within 48 h after death and an oral swab was collected and inoculated into an inpouch for culturing of trichomonads . immunohistochemistry ( ihc ) was performed on lesion tissue from this owl at cahfs as previously described ( girard et al . dna was amplified and sequenced as described for band - tailed pigeons at the one health institute , university of california , davis . avian trichomonosis mortality events in band - tailed pigeons with spatial and temporal overlap with trichomonosis cases in spotted owls occurred during the winter of 20112012 ( fig . 1a c shows the locations of spotted owls with avian trichomonosis in relation to counties with band - tailed pigeon mortality events reported here and previously investigated ( girard et al . trichomonad dna was isolated from 25 band - tailed pigeons during the mortality event in monterey county from january through march 2012 ( fig . fourteen pigeons were infected with t. gallinae subtype a2 , 7 were infected with an un - typed t. gallinae , 3 were infected with t. stableri , and 1 was co - infected with t. gallinae a2 and t. stableri ( table 1 ) . band - tailed pigeon mortality also was detected in madera , amador , nevada , and butte counties between january and march 2012 ( fig . trichomonad dna was isolated from 20 pigeons collected from madera county ( girard et al . , 2014b ) . nineteen pigeons were infected with t. gallinae subtype a2 and 1 was co - infected with t. gallinae a2 and t. stableri ( table 1 ) . fewer band - tailed pigeons were collected for post - mortem examination from amador , nevada , and butte counties and the parasites isolated from dead pigeons were exclusively t. gallinae subtype a2 ( girard et al . , 2014b ) . mortality events were documented in marin , sonoma , and los angeles counties in summer , 2014 between may and october ( fig . during these events , 4 band - tailed pigeon carcasses were collected from sonoma county , 16 from marin county , and 6 from los angeles county . of these , 6 were infected with t. gallinae subtype a2 and 2 with t. gallinae that could not be fine - typed ( table 1 ) . mortality events were identified again during the winter in multiple counties from late november 2014 through april 2015 ( fig . seven band - tailed pigeon carcasses collected during this period were selected for trichomonad isolation from marin county and 1 from bordering sonoma county . six of the marin county pigeons and the 1 sonoma county pigeon were infected with t. gallinae subtype a2 and 1 marin county pigeon was co - infected with an un - typed t. gallinae and t. stableri ( table 1 ) . in total , five individual spotted owls were detected with avian trichomonosis between 2011 and 2015 . two were california spotted owls admitted into wildlife rehabilitation centers with suspected trichomonosis during winter 20112012 ( fig . owl ca015768 was found in tuolumne county and admitted to rose wolf rehabilitation center ( sonora , ca ) on 21 february 2012 ( fig . , tuolumne county is located in the sierra nevada mountain range , to the north of madera county and south of amador county , where trichomonosis outbreaks in band - tailed pigeons were ongoing at the time of the owl carcass collection . the owl died on 23 february 2012 and was submitted to wil within 48 h ; an oral swab was collected and used to inoculate an inpouch device . caseonecrotic lesions were noted across the hard palate from the caudal portion of the cloanal slit to the anterior pharynx . lesions extended through the oral mucosa into the underlying muscle as well as into the choana and sinuses . the left and right inner ears had unilateral necrosis and florid inflammation with heterophils in the internal ear . owl ca012007 was found in monterey county and admitted to the spca for monterey county ( salinas , ca ) on 24 april 2012 ( fig . this adult male owl was in thin body condition with caseonecrotic lesions extending across the upper palate . avian trichomonosis was confirmed in both owls by pcr and also by ihc ( in ca015768 ; fig . trichomonads infecting both owls were identified as the same genotype most commonly found in band - tailed pigeons dying in the respective region : t. gallinae subtype a2 ( table 1 ) . two northern spotted owls were found in marin county with suspected avian trichomonosis and were admitted to wildcare ( san rafael , ca ) during summer 2014 . owl ca005579 was an adult in thin body condition found on 12 october 2014 ( fig . caseonecrotic lesions of the oropharynx and tongue were noted during the intake exam by wildcare staff . the owl died on 15 october 2014 and the carcass was disposed of before a post - mortem examination could be performed and lesion samples collected for genetic analysis ; the sex of the owl was undetermined . owl ca005578 was an adult male in thin body condition with severe caseonecrotic lesions that extended across the upper palate and oral mucosa into the underlying muscle ( fig . 3 ) . additionally , ca005578 had lesions extending into the choana , sinuses , and inner ears as well as the bone at the base of the skull . avian trichomonosis was confirmed by pcr in ca005578 and trichomonads were identified as t. gallinae subtype a2 , the primary genotype causing mortality in band - tailed pigeons sampled in marin county in summer 2014 ( table 1 ) . lastly , one northern spotted owl was found in marin county with suspected avian trichomonosis and was admitted to wildcare ( san rafael , ca ) during winter 20142015 . 1c ) and was euthanized 5 days after admission due to the severity of infection . owl ca013335 was an adult male in thin body condition with caseonecrotic lesions that extended across the upper palate and oral mucosa into the underlying muscle . avian trichomonosis was confirmed by pcr in ca013335 and trichomonads were identified as t. gallinae subtype a2 , the predominant genotype causing mortality in band - tailed pigeons sampled in marin and sonoma counties in winter 20142015 ( table 1 ) . investigation of five cases of avian trichomonosis in california spotted owls and northern spotted owls between 2011 and 2015 revealed that t. gallinae infections coincided in space and time with epidemic mortality events in band - tailed pigeons at three different time periods and geographic locations within northern central california . furthermore , the genotype responsible for mortality in spotted owls was t. gallinae subtype a2 , the same genotype responsible for concurrent epidemics in band - tailed pigeons . taken together , these data provide evidence that trichomonosis in spotted owls was likely a result of disease spillover from a columbid species , and that we have detected multiple pathogen spillover events in these sensitive predatory birds in recent years . trichomonas gallinae subtype a2 , the predominant trichomonad detected in this study , is frequently isolated in pacific coast band - tailed pigeons , and is the only t. gallinae genotype isolated during epidemics in this species ( girard et al . , 2014b ) . although t. gallinae subtype a1 is commonly isolated in passerines , columbids , and raptors in europe ( chi et al . , 2013 , lawson et al . , 2011 , robinson et al . , 2010 ) , it only has been isolated from band - tailed pigeons during non - epidemic infections ( girard et al . , 2014b ) . although t. stableri was detected in a few band - tailed pigeons during two of the epidemics discussed in this study , it was not isolated in diseased owls , presumably because the prevalence was low in the potential prey species compared to t. gallinae . further molecular and phenotypic characterization of the diverse avian trichomonads that have already been identified in california and beyond ( gerhold et al . 2014a , girard et al . , 2014b ) is needed to understand the risk of transmission between raptors and their potential prey during epidemics . although spotted owls primarily prey on small mammals ( thrailkill and bias , 1989 , ward et al . , 1998 ) , the documentation of avian trichomonosis in these owls suggests that they might opportunistically feed on birds and subsequently be exposed to diseases or contaminants found in avian prey . the remains of avian prey have been observed in spotted owl pellets , although the avian remains are rarely identified to species ( bond et al . , 2013 , smith et al . , 1999 , ward et al . , 1998 ) ; however , forsman et al . ( 2011 ) did identify band - tailed pigeon remains in pellets from northern spotted owls in washington . during epidemics in band - tailed pigeons there is a relative abundance of moribund pigeons available to predators and/or recently dead pigeons available for scavengers , both of which may be a source of infection for these owls . while not documented in spotted owls , scavenging does occur in other owl species ( allen and taylor , 2013 , kostecke et al . , 2001 ) . parasites can remain viable in avian carcasses for at least 8 h after death and up to 24 h under appropriate environmental conditions allowing ample time for transmission ( erwin et al . similar to columbid species , spotted owls with trichomonosis developed severe caseonecrotic lesions affecting the upper palate , and occasionally the ears and sinuses , leading to emaciation and death . the significance of avian trichomonosis in either northern or california spotted owls is currently unknown but has the potential to be a locally important cause of mortality , particularly during epidemics in band - tailed pigeons . avian trichomonosis epidemics in band - tailed pigeons have been documented in california since the mid-1940s and have been reported with increasing frequency in recent years with nearly annual winter events contributing to long - term population decline ( rogers et al . , 2016 ) . in some cases , epidemics in band - tailed pigeons may go undetected when occurring in relatively remote areas or when smaller numbers of pigeons are involved . similarly , an individual owl in this environment is even less likely to be encountered and reported , leading to under - detection of this disease threat . northern and california spotted owls have been designated as sensitive species both federally and within california , with populations declining primarily in response to habitat loss and alteration ( gutierrez et al . , 1995 ) , although disease threats for these owls remain generally unknown . significant impacts to raptor populations from avian trichomonosis have not yet been documented ; however , certain raptor species that provision chicks with doves and pigeons have experienced high infection rates and mortality ( boal , 1997 , cooper and petty , 1988 , real et al . , 2000 ) . interestingly , raptors that opportunistically feed on birds may be at a higher risk of developing upper digestive tract lesions than raptors that regularly eat birds ( martinez - herrero et al . , 2014 ) . since band - tailed pigeon mortality events typically occur in the winter , the risk of infection is highest for adult spotted owls during this time , and potentially even the california threatened great gray owl ( s. nebulosa ) given their range overlap with band - tailed pigeons . however , during this study , avian trichomonosis mortality events in band - tailed pigeons were documented for the first time during the summer in 2014 indicating that adult owls as well as their chicks are at risk of trichomonas spp . the unusual occurrence of a summer trichomonosis mortality event may have been related to the historic drought occurring in california at the time . by the end of july 2014 , california was entering a third year of drought and over 58% of the state was classified as being in exceptional drought according to the national drought mitigation center ( http://droughtmonitor.unl.edu ) . avian trichomonosis outbreaks in band - tailed pigeons tend to occur during winters with warmer and drier conditions ( rogers et al . , 2016 ) possibly related to enhanced parasite viability or transmission opportunities . during summer , band - tailed pigeons are more dispersed for breeding and flock sizes are generally smaller than in the winter ( keppie and braun , 2000 ) . the extremely dry conditions during summer 2014 may have driven pigeons to congregate at available water sources , allowing for increased transmission among susceptible birds and subsequent detection by foraging owls . if weather extremes in california become more common as a result of climate change ( bell et al . , 2004 ) , avian trichomonosis has the potential to further impact both prey and predator species . additionally , avian trichomonosis has recently emerged in several non - columbid species ( anderson et al . , 2009 , robinson et al . , 2010 , lehikoinen et al . , 2013 ) , suggesting increased risk of exposure in raptors that consume birds either regularly , or opportunistically , as infection spreads to more avian species ( chi et al . , 2013 ) . infection in spotted owls and other susceptible raptors , especially during epidemics in band - tailed pigeons and other prey , will improve our ability to evaluate the population health impact of avian trichomonosis in predatory species . equally important is the continued efforts to genetically type trichomonad parasites isolated in raptors and their potential prey in order to elucidate transmission routes . monitoring these owls only during the breeding season , as often occurs in demographic studies , would underestimate the importance of this disease during other times of the year . ultimately , if infection risk is to be mitigated in these sensitive owl species , management considerations for band - tailed pigeons must find ways to minimize infection , especially during dry years , which will thereby reduce spillover into susceptible species .

avian trichomonosis , caused by the flagellated protozoan parasite trichomonas gallinae , has variable pathogenicity among bird species ranging from asymptomatic infections to severe disease periodically manifesting in epidemic mortality . traditionally , columbids are identified as highly susceptible to infection with occasional spillover into raptors that prey on infected birds . we identified avian trichomonosis in two dead california spotted owls ( strix occidentalis occidentalis ) and three dead northern spotted owls ( s. o. caurina ) in california during 20112015 ; infection was confirmed in four owls by pcr . pathologic lesions associated with trichomonosis in the owls included caseonecrotic lesions of the upper palate accompanied by oropharyngitis , cellulitis , myositis , and/or sinusitis . spotted owls are known to mainly feed on small mammals ; therefore , the source of infection as well as the significance of the disease in spotted owls is unclear . these owl trichomonosis cases coincided temporally and spatially with three trichomonosis epidemics in band - tailed pigeons ( patagioenas fasciata monilis ) . the same parasite , t. gallinae subtype a2 , was isolated from the spotted owls and band - tailed pigeons , suggesting the owls became infected when opportunistically feeding on pigeons during mortality events . avian trichomonosis is an important factor in the decline of the pacific coast band - tailed pigeon population with near - annual mortality events during the last 10 years and could have conservation implications for raptor species at risk , particularly those that are facing multiple threats .

helicobacter pylori is a gram - negative and microaerophilic bacterium that is recognized as a major cause of chronic gastritis , peptic ulcer , and gastric cancer [ 1 , 2 ] . the chemistry and biology of h. pylori lipopolysaccharides ( lps ) have been extensively studied . determined the structures of the o - polysaccharides of h. pylori lps and found them to be the same as the lewis x ( le ) and lewis y ( le ) determinants of human cell - surface glycoconjugates . suggested that the mimicry of lewis antigens by this bacterium raised titers of autoantibodies to lewis antigens in infected individuals . however , we find no significant titers of anti - lewis antigen antibodies in the sera of h. pylori - positive humans . on the other hand , we have observed that all h. pylori smooth - type lps possess either one of two antigenic epitopes ( the highly antigenic and the weakly antigenic epitopes ) in their polysaccharide regions [ 79 ] . most h. pylori - infected individuals have high titers of antibody to one of these antigenic epitope ( the highly antigenic epitope ) . so we proposed that an lps possessing this antigenic epitope would be a strong candidate for an antibody diagnosis of h. pylori infection . monteiro et al . compared the structures between h. pylori lps isolated from asian and western patients and found that the asian strains showed a stronger tendency to produce type 1 blood groups . in this paper , we compared the reactivity of h. pylori lps from japanese and western strains to the sera of h. pylori - positive humans . japanese h. pylori strains ( gu2 , du1 , ca2 , ca4 , and ca5 ) were isolated from biopsy specimens of lesions obtained from patients with gastric ulcer ( gu ) , duodenal ulcer ( du ) , or gastric cancer ( ca ) in the sapporo medical university hospital ( sapporo , japan ) as described previously . isolation of western h. pylori strains [ nctc11637 , sydney ( ss1 ) , 26695 , and o:2 ] and purification of lps were as described by monteiro et al . . sera from h. pylori - positive patients were donated by the sapporo medical university hospital as previously described . the h. pylori infection status of each individual was determined with the determinar h. pylori antibody enzyme immunoassay kit ( kyowa medicus , tokyo , japan ) . murine monoclonal antibodies ( mabs ) against lewis antigens used in the study were as follows : clone 73 - 30 [ anti - le immunoglobulin m ( igm ) ( seikagaku kogyo , tokyo , japan ) ] , bg8 and bg6 [ anti - le igm and anti - le igm , respectively ( signet laboratories , dedham , mass , usa ) ] , and mab2108 [ anti - le igg1 ( chemicon , temecula , calif , usa ) ] . sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) and immunoblotting were performed as described previously . the molecular sizes and microheterogeneity of h. pylori lps from japanese and western strains were compared on an sds - page gel after silver staining ( figure 1 ) . lps from all strains except nctc11637 showed ladder bands , which are one of the characteristics of smooth - type lps , in the high molecular weight area , and some bands characteristic of rough - type lps in the low - molecular - weight area . lps from nctc11637 showed only one faint band in the fast migration zone of the gel but no ladder bands . the specificity of anti - lewis antigen mabs for h. pylori lps was tested by immunoblotting ( table 1 ) . lps from the western strains nctc11637 and o:2 did not react with any of the mabs . the former lost the o - polysaccharide chain , but the latter showed o - polysaccharide - containing lps on sds - page ( figure 1 ) . lps from the sydney strain reacted only with le mab , and lps from 26695 reacted with the le and le mabs . among the japanese strains , lps from gu2 reacted with the le and le mabs ; lps from du1 reacted with the le , le and le mabs ; lps from ca4 reacted with the le and le mabs ; lps from ca5 reacted with the le and le mabs ; and lps from ca2 reacted only with the le mab . we examined the reactivities of sera from humans with h. pylori infection to h. pylori lps by immunoblot analysis . we previously proposed in [ 79 ] the presence of two distinct epitopes , termed the highly antigenic and the weakly antigenic epitopes , on the o - polysaccharide chains , based on data from the immunoblotting of lps with sera from h. pylori - positive humans . furthermore , we also proposed the classification of h. pylori - positive human sera into three groups on the basis of immunoblot reactivity to the polysaccharide region of lps [ 79 ] . type a sera only react with lps containing the highly antigenic epitope , type b sera only react with lps containing the weakly antigenic epitope , and type c sera react with both types of lps . among the lps from western strains , lps from the sydney strain reacted with type a sera but not type b sera ( figure 2 and table 1 ) . the o - polysaccharides from the nctc11637 , 26695 , and o:2 strains did not react with any of the human sera , while lps from japanese strains reacted with either type a sera or type b sera . the o - polysaccharide regions of lps are commonly used for typing gram - negative bacteria into o - serotype because of their high antigenicity , which is specific for each strain . in the case of h. pylori lps , it has been demonstrated chemically and immunogenically that the o - polysaccharide portions of h. pylori lps contain structures that mimic the lewis blood antigens [ 3 , 4 , 6 , 13 , 14 ] . heneghan et al . proposed that anti - lewis antibodies were present in most patients with h. pylori infection and that this response is independent from the host lewis phenotype but is related to the bacterial lewis phenotype . however , appelmelk et al . suggested that the molecular similarity of the h. pylori lps to the lewis antigens did not promote immune evasion , nor does it lead to induction of autoantibodies . we also reported that , although high titers of antibodies to h. pylori lps were found in the sera of infected patients , these antibodies were not autoreactive and were not directed against the lewis antigens . this discrepancy is interpreted to be due to differences in the lewis antigen analogues used in the immunoanalysis . on the other hand , our earlier studies suggest that highly and weakly antigenic epitopes reacting with human sera are unlikely to be immunogenically related to the structures mimicking the lewis antigens [ 79 ] . interestingly , the expression of the two epitopes seems to be mutually exclusive ; no strain expressing both epitopes was identified , but all smooth type strains isolated in japan expressed one or the other . in this study , we observed no reaction of type a or type b japanese sera with smooth type lps from the western strains 26695 and o:2 , while all lps from japanese strains and the sydney strain reacted with the sera belonging to the type a or b. the sydney strain seems to be close to the asian strains , because this strain was isolated from long - term adapted mice after they were inoculated with a fresh homogenate of gastric biopsy specimen derived from an individual in sydney , australia . the lines of evidence indicated that the lps in the western strains lacked the highly antigenic and the weakly antigenic epitopes that are shared by the japanese strains . the two western h. pylori strains shared neither the highly antigenic epitope nor weakly - antigenic epitope , which are shared by all japanese strains , in the o - polysaccharide region of lps .

we compared the serological reactivity of lipopolysaccharides ( lps ) isolated from japanese and western strains of helicobacter pylori against anti - lewis antigen monoclonal antibodies and h. pylori - positive japanese sera . the two lps from western strains ( 26695 and o:2 ) did not react with any sera from japanese patients , while all lps from japanese strains and the sydney strain reacted with these sera . we propose that lps of all japanese smooth strains share either one of two epitopes , which are termed highly antigenic and weakly antigenic epitopes , present in the o - polysaccharide portion , and these epitopes are independent the lewis antigens . the present findings indicated that the two western strains lacked the two epitopes , which are shared by all japanese strains .

gateway - compatible yeast one - hybrid ( y1h ) assays provide a convenient gene - centered ( dna - to - protein ) approach to identify the repertoire of transcription factors that can bind a dna sequence of interest . we present a set of y1h resources , including clones for 988 of 1,434 ( 69% ) predicted human transcription factors , for the interrogation of interactions using either low or high - throughput settings . these approaches detect both known and novel interactions between human dna regions and transcription factors .

the trochanteric femoral fracture is common in elderly patients ; with societies growing continuously older , the incidence has increased markedly in recent years.1 due to their poor bone quality , it is very difficult to achieve and maintain a stable fixation in elderly patients.2 the aim of surgery is to achieve early mobilization and the prompt return to prefracture activity levels . the treatment of this fracture remains a challenge to the surgeon . numerous variations of intramedullary nails have been devised to achieve a stable fixation and early mobilization of pertrochanteric fractures ; among these , the proximal femoral nail ( pfn ) , devised by the ao / asif group in 1996 , has proven to be a promising implant in per- , inter- , or subtrochanteric femoral fractures.3 these intramedullary devices are more stable under loading with a shorter lever arm , so the distance between the hip joint and the nail is reduced compared with that for a plate , thus diminishing the deforming forces across the implant.4 furthermore , these devices minimize soft - tissue dissection and thereby reduce surgical trauma , blood loss , infection , and wound complications.4 in this study , we aimed to report the results of a retrospective study carried out at our institute on 100 consecutive cases who had suffered proximal femoral fractures between january 2002 and february 2007 , and who were treated with a pfn . this retrospective study was approved by the local institutional ethics board in accordance with the standards of the declaration of helsinki , and informed written consent forms were obtained from all the participants . from january 2002february 2007 , we treated 100 consecutive cases of proximal femoral fractures with a pfn ( synthes gmbh , oberdorf , switzerland ) . a case documentation form was used to obtain intraoperative data , including age , sex , mechanism of injury , type of fracture according to ao / asif classification , and the american society of anesthesiologists ( asa ) physical status classification ( asa grade ) . all patients were operated in the supine position under image intensifier control by either consultants or registrars using standard techniques and a protocol.3 implantation of the pfn can be done with or without a fracture table . using the fracture table , the hip should be placed in a slight adduction position to facilitate the insertion of the nail . about 5 cm cranial to the tip of the greater trochanter , the skin is incised for about 5 cm . after passing the fascia and muscles , a 2.8 mm threaded k - wire is inserted at the tip of the greater trochanter under c - arm control . the k - wire is advanced into the femoral shaft in such a way that it is located in the middle of the shaft in both directions . the proximal part of the femoral shaft is reamed manually with a 17 mm reamer . after mounting the nail on the radiolucent insertion device , the nail can be introduced manually into the femoral shaft . via the aiming arm , which is attached to the insertion device , the guide wire for the neck screw is first introduced into the femoral neck in such a way that the screw will be placed into the lower half of the neck on the anteroposterior view and centrally on a lateral view . the hip pin is introduced first with the tip just about 25 mm medial to the fracture line ; then , the neck screw is inserted . afterwards , depending on the type of fracture , distal interlocking is either statically or dynamically achieved via the same aiming arm . in all cases antithrombotic prophylaxis was given using low molecular weight heparin ( fraxiparine ; glaxosmithkline , brentford , uk ) , and antibiotic prophylaxis was provided ( cefazolin ) . anteroposterior and lateral radiographs were obtained 2472 hours postoperatively , and analyzed for reduction and position of the implant . the rehabilitation protocol was demonstrated , and the patients were mobilized on the first postoperative day . partial weight bearing as tolerated or restricted weight bearing was allowed according to the surgeon s recommendation on the day following surgery . clinical and radiographic examinations were performed at the time of admission and at the 6th week ; subsequent visits were organized on the 3rd month , 6th month , and 12th month , and patients with longer follow - up and annually postoperatively ( figures 1a , b , 2a and b ) . clinical evaluation was made using the harris hip scoring system , which considers pain , walking capacity , and physical examination findings.5 radiographic evaluations included union , calcification in the greater trochanter , cortical thickening at the distal locking site , cut - out of the helical screw in the femoral head , lateral migration of the helical screw ( telescoping ) , and shortening of the femoral neck length . all of the data were processed by spss 14.0 software ( spss inc . , il , usa ) . differences in the continuous variables between the two groups were compared using student s t - test for normally distributed data , or the wilcoxon rank - sum test for data not normally distributed . this retrospective study was approved by the local institutional ethics board in accordance with the standards of the declaration of helsinki , and informed written consent forms were obtained from all the participants . from january 2002february 2007 , we treated 100 consecutive cases of proximal femoral fractures with a pfn ( synthes gmbh , oberdorf , switzerland ) . a case documentation form was used to obtain intraoperative data , including age , sex , mechanism of injury , type of fracture according to ao / asif classification , and the american society of anesthesiologists ( asa ) physical status classification ( asa grade ) . all patients were operated in the supine position under image intensifier control by either consultants or registrars using standard techniques and a protocol.3 implantation of the pfn can be done with or without a fracture table . using the fracture table , the hip should be placed in a slight adduction position to facilitate the insertion of the nail . about 5 cm cranial to the tip of the greater trochanter , the skin is incised for about 5 cm . after passing the fascia and muscles , a 2.8 mm threaded k - wire is inserted at the tip of the greater trochanter under c - arm control . the k - wire is advanced into the femoral shaft in such a way that it is located in the middle of the shaft in both directions . the proximal part of the femoral shaft is reamed manually with a 17 mm reamer . after mounting the nail on the radiolucent insertion device , the nail can be introduced manually into the femoral shaft . via the aiming arm , which is attached to the insertion device , the guide wire for the neck screw is first introduced into the femoral neck in such a way that the screw will be placed into the lower half of the neck on the anteroposterior view and centrally on a lateral view . the hip pin is introduced first with the tip just about 25 mm medial to the fracture line ; then , the neck screw is inserted . afterwards , depending on the type of fracture , distal interlocking is either statically or dynamically achieved via the same aiming arm . in all cases antithrombotic prophylaxis was given using low molecular weight heparin ( fraxiparine ; glaxosmithkline , brentford , uk ) , and antibiotic prophylaxis was provided ( cefazolin ) . anteroposterior and lateral radiographs were obtained 2472 hours postoperatively , and analyzed for reduction and position of the implant . the rehabilitation protocol was demonstrated , and the patients were mobilized on the first postoperative day . partial weight bearing as tolerated or restricted weight bearing was allowed according to the surgeon s recommendation on the day following surgery . clinical and radiographic examinations were performed at the time of admission and at the 6th week ; subsequent visits were organized on the 3rd month , 6th month , and 12th month , and patients with longer follow - up and annually postoperatively ( figures 1a , b , 2a and b ) . clinical evaluation was made using the harris hip scoring system , which considers pain , walking capacity , and physical examination findings.5 radiographic evaluations included union , calcification in the greater trochanter , cortical thickening at the distal locking site , cut - out of the helical screw in the femoral head , lateral migration of the helical screw ( telescoping ) , and shortening of the femoral neck length . all of the data were processed by spss 14.0 software ( spss inc . , il , usa ) . differences in the continuous variables between the two groups were compared using student s t - test for normally distributed data , or the wilcoxon rank - sum test for data not normally distributed . the mean age of the patients was 77.66 years ( range : 3798 years ) and the sex distribution was 32 males and 68 females . the mean time from injury to surgery was 1.83 days ( range : 017 days ) . eighty - five patients were operated on under combined general and epidural anesthesia five under spinal and epidural anesthesia , eight under spinal anesthesia , and two under epidural anesthesia . seventy - three fractures were reduced by closed means , whereas 27 needed limited open reduction . intraoperative femoral fracture occurred in one patient and was managed with dall miles wires . the mean duration of the operation was 87.9 minutes ( range : 30300 minutes ) . the mean follow - up for the study group was 31.3 months ( range : 1275 months ) . changes in the hip score in relation to the type of fractures , asa score , and patient age were shown in table 2 . the data were analyzed to see whether there was an association between the harris hip score ( hhs ) and fracture classification , asa score , and age . the results revealed that hhs was negatively correlated with asa score and patient s age . hematomata of the surgical wound resolved satisfactorily in six patients ; migration of the screws was not observed . in three patients , there was ectopic new bone formation at the insertion point of the stabilizing and compression screw , but this did not affect the patient s condition . three patients died before discharge ( one due to pulmonary embolism , two due to cardiac arrest ) , and five patients died due to unrelated medical conditions within the first 3 months of follow - up . advances in the treatment of chronic diseases and improvements in living standards have resulted in a considerable increase in the life expectancy of individuals.6 however , as the quality of bone decreases with age , the prevalence of hip fractures increases.7 the stability of fixation for intertrochanteric fractures depends on many factors : the age of the patient ; the patient s general health ; the time from fracture to treatment ; the adequacy of treatment ; concurrent medical treatment ; and the stability of fixation . which appropriate method and ideal implant to use are topics that are still open to debate , with proponents of the various approaches each claiming advantages over the other methods . dynamic hip screws are accepted as the gold standard in the surgical treatment of stable intertrochanteric fractures.7 the advantages of making dynamic hip screws the first choice in the treatment of stable fractures do not show similar success rates in unstable fractures . wolfgang et al8 reported mechanical complication rates of 9% for stable fractures and 19% for unstable fractures in intertrochanteric fractures treated with sliding screw plates . simpson et al9 listed the causes of fixation failure in intertrochanteric fractures in the following order : cut - out of the screw from the femoral head ; pull - out of the plate from the lateral cortex together with the screws ; and plate break . failure of dynamic hip screws in unstable fractures may be as high as 56% in special conditions such as reverse obliquity fractures.10 intramedullary devices , such as the gamma nail ( stryker , kalamazoo , mi , usa ) , have some theoretical advantages over the dynamic hip screws , as they do not depend on screw fixation of a plate to the lateral cortex , which can be a problem in very osteoporotic bone . in addition , they have a shorter moment arm , because the load is transmitted to the femur along a more medial axis . on the other hand , the gamma nail has a significantly increased risk of fracture at the tip of the nail , which had reached up to 18% in various studies , and other technical failures ( 8%15% of the cases ) , resulting in a high risk of reoperation.11 in terms of complications , cut - out of the screw , pull - out of the nail , or nail break were not observed in our study . gotfried12 reported that the fractures , which were preoperatively classified as type 3.1.a.2 , might turn to type 3.2.a.3 fractures postoperatively due to lateral cortex fracture . he attributed fracture of the lateral cortex to weakening of the bone during the use of a lateral cortex drill with a 16 mm diameter for the placement of the sliding screw . the stabilizing and compression screws of the pfn adequately compress the fracture , leaving between them a bone block for further revision , should the need arise . in our study , fracture of the greater trochanter with lateral extension did not occur in any patients during surgery . we concluded that this complication could be avoided by careful determination of the insertion site and sufficient drilling . femoral shaft fracture is a complication associated with the use of intramedullary hip nails , and is more frequent with the use of the gamma nail.13 fogagnolo et al14 reported one case ( 1/47 ) and banan et al15 reported two cases ( 2/46 ) of femoral diaphyseal fractures that occurred distal to the nail . so far , the exact reason for the shaft fractures at the tip of the gamma nail has not yet been found . friedl et al16 suggested that the necessary over - reaming of the shaft ( 3 mm more than the nail diameter ) weakens the entire shaft . frequent drilling for a proper distal interlocking because of malalignment of the aiming device torque of the nail when jammed in an unsatisfactorily reamed shaft is also seen as a cause.17 the pfn has been shown to prevent fractures in the femoral shaft , as it has a smaller distal shaft diameter , which reduces the stress concentration at the tip ( a 4.9 mm pfn compared with a 6.28 mm regular gamma nail).18 due to its position close to the weight - bearing axis , the stress generated on the intramedullary implants is negligible.18 in our study , only one case had intraoperative femoral fracture and was managed with dall miles wires . the pfn system , developed by ao / asif , offers some major biomechanical innovations that can overcome the known limitations of the gamma nail . first , the addition of the 6.5 mm antirotation hip pin reduces the incidence of implant cut - out and the rotation of the cervicocephalic fragment.18 second , the smaller diameter and fluting of the tip of the nail is specially designed to reduce stress forces below the implant and , therefore , reduces the incidence of low - energy fracture at the tip.18 third , the pfn has a greater implant length , a smaller valgus angle , and this angle is set at a higher level . fourth , the more proximal positioning of the distal locking helps to avoid abrupt changes in the stiffness of the construct.18 although the rates of failure of fixation and femoral shaft fracture are low with the pfn , other problems , such as persisting thigh pain and the need for hardware removal because of iliotibial tract irritation , are of concern . extension of the nail to the distal femoral cortex was not associated with fracture occurrence , but it presented as pain at the medial aspect of the femur.18 this condition was not encountered in our study . in the series of 295 patients with trochanteric fractures treated with the pfn by domingo et al,4 the authors emphasized that the surgical technique is not complex , the number of complications recorded was acceptable , and the overall results obtained were comparable with those of other fracture systems . in our study , the intraoperative variables and the systemic complications were similar to those encountered by other authors.3,19 most patients ( 78% ) showed a near - anatomical fracture reduction , and fracture healing occurred in all patients at the final follow - up . there were few postoperative complications associated with mechanical failure . no cases of implant breakage and fatigue were seen during the follow - up period . the high incidence of open reduction in our study was mainly due to the complexity of the fractures , and not due to delayed operations . in pfn fixations , proper alignment between the two main fragments and proper placement of the lag screws in the femoral head should be ensured . in accordance with similar reports , systemic and local complications , as well as the death rate observed in our study were not different.20,21 the number of reoperations due to technical or mechanical failures was quite high , as was the incidence of intraoperative difficulties in pfn implantation . we also believe that variables such as the duration of hospitalization , commencement of the sitting posture , and early weight - bearing in unstable fractures are related to the pathology , which is associated with advanced age , general health status , and type of fracture , rather than with the surgical technique itself . at present , we consider that the pfn is an acceptable and minimally invasive implant for unstable proximal femoral fractures . various studies concerning the functional outcomes of operative treatments of hip fractures have been performed.20,21 for an elderly patient with a femoral neck fracture , the ability to mobilize in their own home and in their community would determine their ability to live independently.22 before surgical treatment of a femoral neck fracture , the patients and their relatives have to be informed of what should be expected concerning the effect of pre - and perioperative risk factors on the outcome of surgery , postoperative rehabilitation , daily care , and other social issues . quality of life and function are usually measures that are important for patients and health care providers . the hhs was developed to evaluate outcomes following orthopedic surgery of the hip joint . in our study , the hhs was negatively correlated with the asa score and patient age . our study showed that pfn is a reliable fixation method with good fracture union and no major complications noted across all types of trochanteric femoral fractures .

purposein this study , we aimed to report the results of a retrospective study carried out at our institute regarding cases of patients who had suffered proximal femoral fractures between january 2002 and february 2007 , and who were treated with a proximal femoral nail.materials and methodsone hundred consecutive cases were included in the study . a case documentation form was used to obtain intraoperative data including age , sex , mechanism of injury , type of fracture according to association for osteosynthesis / association for the study of internal fixation ( ao / asif ) classification and the american society of anesthesiologists ( asa ) physical status classification ( asa grade ) . clinical and radiographic examinations were performed at the time of admission and at the 6th week ; subsequent visits were organized on the 3rd month , 6th month , and 12th month , and in patients with longer follow - up and annually postoperatively . the harris score of hip function was used , and any change in the position of the implants and the progress of the fracture union , which was determined radiologically , was noted.resultsthe mean age of the patients was 77.66 years ( range : 3798 years ) , and the sex distribution was 32 males and 68 females . seventy - three fractures were reduced by closed means , whereas 27 needed limited open reduction . the mean follow - up time for the study group was 31.3 months ( range : 1275 months ) . postoperative radiographs showed a near - anatomical fracture reduction in 78% of patients . the harris hip score was negatively correlated with the asa score and patient age . no cases of implant failure were observed . three patients died before discharge ( one due to pulmonary embolism , two due to cardiac arrest ) , and five patients died due to unrelated medical conditions within the first 3 months of the follow-up.conclusionour study showed that proximal femoral nail is a reliable fixation with good fracture union , and it is not associated with major complications in any type of trochanteric femoral fracture .

cancer incidence trends uses by health officials in order to program evaluations and development of cancer control strategies . trend analysis is a technique that aims to identify a pattern of changes , or trend , in a series of observations . it is therefore , important to evaluate trends in incidence within various time segments , to identify changes in trends , and to determine the most recent trends in rates and counts . breast cancer is less prevalent in the age of 30 , among white women in developed countries , and urban communities is more than other regions . the risk of developing breast cancer in women life time is 12.5% ( that is one of eight ) and risk of dying from breast cancer is 3.6% ( that is one of 28 ) . isfahan is located in the first ranking of cancer in the country , and the breast cancer among women has been assigned the first place to itself . based on the statistics of 2004 , about 10% of breast cancer cases in the country have been reported in isfahan . is composed of a few continuous linear phases , which are often useful to describe changes in incidence and mortality rate trends . joinpoint regression due to the assess of the response variable ( breast cancer incidence ) behavior at different intervals explanatory variables ( time ) is used in abundance in cancer data analysis . in a study conducted in 2010 by burrows , et al . in the field of incidence of treatment for end the last stage renal disease among individuals with diabetes in the us continues to decline was used a joinpoint regression to estimate the model parameters , and the value of parameter regression were estimated for each piece . la torre , et al . considered a joinpoint analysis in the field an assessment of the effect of hepatitis b vaccine in decreasing the amount of hepatitis b disease in italy . silva , et al . used a joinpoint regression to evaluation trends in the epidemiologic paradox of low birth weight in brazil . women are an important part of community and their health is deeply linked with the health of others ; hence , considering the high prevalence of breast cancer in iran and given the fact that iranian women compared with developed countries at least a decade earlier the disease can be caught , the present study was conducted to determine the pattern of breast cancer incidence rates by age and tumor characteristics in women using joinpoint regression model . this research was a descriptive - analytical of the type cross - sectional time series study . data on breast cancer incidence for the years 2001 through 2010 were obtained among women residing in the city of isfahan , referring to cancer treatment centers ; the study was based on 3640 patients and restricted to women in the age of 30 - 69 . this information includes personal details and all information related to the tumor cancer including such as age at diagnosis categorized in 5-year intervals groups , tumor size ( 2 cm , 2.1 - 5 cm , and > 5 cm ) , grade ( well - differentiated , moderately differentiated , and poorly differentiated ) , estrogen / progesterone receptor status ( positive vs. negative ) and proportion of positive lymph nodes to lymph node surgery ( < 25% vs. 25% ) . standardization was performed using the direct method ( isfahan province female population of the census in 2006 as a standard population ) . the joinpoint regression analysis was used to identify points where a statistically significant change over time in linear slope of the trend occurred . the analysis starts with the minimum number of joinpoints , and tests , whether one or more joinpoints are statistically significant and should be added to the model . the tests of significance use a monte carlo permutation tests method with 4499 replicates . in the final model , each joinpoint indicates a statistically significant change in trend , and estimated annual percentage change and estimated average annual percentage change are computed for each of those trends by means of least squares method assuming a normal distribution ( the dependent variable was the age - standardized rate ) . a maximum number of one joinpoint was allowed for estimations because the number of years of available data was 10 . we used hudson method for estimating joinpoints because it is more realistic that the joinpoints take any value within the observed data range [ appendix ] . joinpoint software , version 3.5.2 and statistical analysis in social science ( spss ) software , version 18 were used . statistically significant changes in breast cancer incidence rates were associated with increasing in the age groups 40 - 44 , 45 - 49 , and 55 - 59 years from 2001 to 2010 . the annual percentage change in this period for the above categories was estimated 6.2% , 5.3% , and 3.5% , respectively . breast cancer incidence rates in the age group of 40 - 44 years changed during the study from 17.6/100000 to 25/100000 in 2010 . joinpoint analysis of trends by age at diagnosis did nt indicate any break during the whole period [ table 1 ] . age - specific breast cancer incidence rates in esfahan city , 2001 - 2010 breast cancer incidence rates and joinpoint analysis by age ( 2001 - 2010 ) results of the joinpoint analysis of trends by hormone receptors status ( estrogen receptor [ er ] and progesterone receptor [ pr ] ) are shown in [ table 2 ] . the largest increase in the incidence of breast cancer by er and pr status was in positive group and the statistically significant change was seen in the year 2003 by pr tumors . the average annual percentage change for recent five , 6.9% and for 10 years , 11% was estimated . breast cancer incidence rates and joinpoint analysis by tumor characteristic ( 2001 - 2010 ) the largest increase of breast cancer by tumor size was in size of 2 cm with an estimated annual increase of 18.2% . furthermore in 2006.7 , a statistically significant change was seen in the breast cancer increase by tumor size of > 5 cm [ table 2 ] . the joinpoint analysis in the two periods showed an increase by 6.3% per year in the first period and a nonsignificant decline in the second period [ figure 2 ] . age - standardized ( per 100000 ) breast cancer incidence rates by tumor size in esfahan city , 2001 - 2010 results of the joinpoint analysis of trends by grade of tumor are shown in table 2 . in the well - differentiated grade , a steady increase was observed over the whole period ( 8% ) . in the moderately differentiated grade , incidence increased by 16.6% per year from 2001 to 2007.7 then declined by 15.1% per year from 2007.7 to 2010 . in the poorly differentiated grade , incidence increased by 17% per year from 2001 to 2007.8 then declined by 26.1% per year from 2007.8 to 2010 [ figure 3 ] . age - standardized ( per 100000 ) breast cancer incidence rates by tumor size in esfahan city , 2001 - 2010 . + : poorly difference , : moderately difference the highest increase in the incidence of breast cancer by proportion of positive lymph nodes to lymph node surgery was showed in group of 25% , although this increase was not significant and joinpoint analysis of trends by this tumor characteristic did nt indicate any break during the whole period [ table 2 ] . recent reports have documented sudden , unprecedented declines in the incidence of breast cancer , particularly for invasive , er - positive tumors diagnosis in women 50 years and older . thus far , substantial drops have been observed in the us , new zealand , and canada but not in the netherlands , norway , and sweden . in population reporting a decrease , gradual incidence declines began as early as 1999 but accelerated in 2002 after the early and widely publicized termination of the women 's health initiative . jemal , et al . study ( 2003 - 1975 ) on 4,54,728 patient data in united states showed the largest percentage decreases from 2002 to 2003 that occurred in women 55 - 59 years old ( 11.3% ) , 60 - 64 years old ( 10.6% ) , and 65 - 69 years old ( 14.3% ) . the downturn in incidence rate from 2002 to 2003 in women 50 - 69 years old may reflect early consequences of the reduced use of hormone replacement therapy ( hrt ) . study ( 2007 - 1990 ) on 19,239 patient data in french showed an increase in incidence rates in the 20 - 49 and the 75 age groups , with a mean annual increase of 1.6% and 0.9% , respectively . in the age group of 50 - 74 years , incidence increased by 1.5% per year from 1990 to 1999 and by 6% per year from 1999 to 2003 . from 2003 , there was a 3.4% annual drop in incidence . study ( 2006 - 1999 ) in belgium showed a stable incidence rate in the group of 35 - 49 years in flemish region , an increase from 1999 to 2003 ( 5.4% ) and then a sharp decrease from 2003 to 2006 ( 4% ) . in the oldest age group , a steady increase study ( 2007 - 1998 ) among women aged from 50 to 69 years in germany showed the age - standardized incidence rates in breast cancer virtually constant were over the entire period in all regions and no substantial changes over time occurred within the age analyses . the lack of temporal changes in breast cancer incidence may be explained by introduction of opportunistic and organized mammography screening and low absolute levels of hrt prescription in germany . study ( 1992 - 2004 ) on 3,87,231 patient data in us showed the number of breast cancers increased among younger women during 1992 - 2004 , but this increase largely reflected population growth rather than rising rates of invasive disease . study ( 1993 - 2002 ) on 1,61,800 patient data among eastern and southeastern asian women more than 20 years old showed the incidence rates increased gradually in all countries . incidence rates increased significantly in korea during the 10-year period in all age groups except the > 70 group . the philippines had the lowest annual percentage change ( apc ) in most age groups . women aged 50 - 69 years had significantly higher apc in most countries and registries , but not in japan , rural china , or the philippines . the number and mean age of breast cancer cases is expected to increase as the female asian population ages , the prevalence of certain risk factors change ( early menarche , late menopause , low parity , late age at first live birth , and low prevalence of breastfeeding ) , and as asian countries introduce mass screening programs . unfortunately , the incidence of breast cancer in iranian women occurs 10 - 15 years lower than western countries and the average age of the most cases at age 40 - 49 are reported . the incidence of cancer in women 55 years and older is high and power of the immune system in this age is low ; the results of this study showed that breast cancer incidence has increased in all age categories . the increase in incidence rates were in the 40 - 44 , 45 - 49 , and 55 - 59 age groups , with a mean annual increase of categories 6.2% , 3.5% , and 5.3% , respectively . the results of this study were consistent with the incidence in east asia . study by 5-year age interval showed that the decrease in the incidence rates from 2002 to 2003 was much larger in women 50 - 69 years old for er and pr than for er and pr tumors from 2002 to 2003 , the incidence rate in women 65 - 69 years old decreased by 20% for er and pr tumors compared to an increase of 2% for er tumors and a decrease of 9% for pr tumors . kerlikowske , et al . prospectively collected data from 1997 to 2003 for 6,03,411 screening mammography examinations performed on women aged 50 - 69 years in us of these women , 3238 were diagnosed with breast cancer within 12 months of a screening examination . between 2001 and 2003 , annual rates of er invasive breast cancer declined by 13% while this rates were stable during until 2001 . in the first quarter of 2003 increased slightly ( not significant ) was observed in patients with er tumors . study ( 1992 - 2004 ) among women aged more than 20 years in asian / pacific islander , hispanic , and african - american women in the us showed in asian / pacific islander women , perceptible , but statistically nonsignificant decreases were observed for hormone receptor - positive . rates of hormone receptor - negative tumors increased among african - americans ( 26.1% ) and hispanics ( 26.9% ) during 2001 - 2004 . the data presented in these analyses provide further evidence that population - level hormone therapy ( ht ) use is a major influence on population - level rates of particular breast cancer subtypes , especially receptor - positive tumors . study showed that despite the declining use of hormone therapy , from 1999 to 2004 , the age - standardized incidence of breast cancer was stable in the all - time interval by hormone receptors and the highest incidence ( 21.7 ) was observed at the age of 30 - 39 years . since about 60% breast cancer cases of er is positive and the role of estrogen and progesterone ca nt be separated in breast carcinogenesis ; hence , the prognosis of patients in this regard will be very important . results showed the highest increase in the incidence of breast cancer according to er and pr status was positive . the average annual percentage change for recent five , 6.9% and for 10 years , 11% was estimated . studies showed breast cancer incidence rates was confined to small tumors ( 2 cm ) in joinpoint analysis by tumor size . saturation in mammographic screening would theoretically maximum lead time so as to increase the diagnosis of small and in situ tumors . study showed the highest incidence rate by tumor size occurred in small tumors ( 2 cm ) . results of this study showed the largest increase of breast cancer by tumor size was in size of 2 cm . furthermore , a significant change - point was seen in the breast cancer tumor size > 5 cm in 2006.7 . the joinpoint analysis in the two periods showed a significant increase in the first period and an insignificant decline in the second period . study showed the highest incidence rate by grade occurred in high grade ( 24.8 ) . results of this study showed according effect of exact tumor size and histological cancer cells at diagnosis on choice of surgery and complementary therapies , awareness preaching classes of women with symptoms of cancer , screening and identifying patients in 2008 caused significant changes in the trend of reducing the incidence of breast cancer this year with the grade of poorly differentiated . study showed the highest incidence rate by lymph nodes status occurred in negative lymph node ( 21.6 ) . since the probability of relapse in patients with lymph nodes in cancer patients is 75% more than the other , the results of this study showed the highest increase in the incidence of breast cancer by proportion of positive lymph nodes to lymph node surgery was in < 25% , group , although this increase was not significant . awareness preaching classes of women with symptoms of cancer , screening and identifying patients in 2008 caused significant changes in the trend of reducing the incidence of breast cancer this year with the grade of poorly differentiated . increase of breast cancer by tumor size of < 2 cm and decline the incidence of > 5 cm , reduce proportion of positive lymph nodes to lymph node surgery in 25% can be attributed mainly to enhance women 's awareness regarding breast self - examination and physical examination , and greater use of mammography . definitely , women 's knowledge regarding the breast cancer symptoms and screening behaviors is a significant factor to detection of less advanced stage .

background : cancer incidence trends use by health officials in order to program evaluations and development of cancer control strategies . the trends of cancer incidence have used to evaluate programs and develop the cancer control strategies . the aim of this study is to analyze changes of breast cancer incidence trends in isfahan city using joinpoint regression models.materials and methods : the study was based on all cases of breast cancer reported among women residing in the city of isfahan for the period 2001 - 2010 . age - standardized rates were calculated for each tumor characteristics , using the direct method . joinpoint regression was used to provide estimated annual percentage change.results:a plot of the age - specific rates of breast cancer showed an increase in all age groups from 30 to 69 years and sharp increase in the incidence of breast cancer confined to estrogen receptor - positive and progesterone receptor - positive tumors and the significant change ( 2003 ) by progesterone receptor tumors . the analysis by tumor size and grade , incidence rates decreased for tumors > 5 cm by 10.6% since 2006.7 and for poorly differentiated tumor by 26.1% since 2007.8 . no decrease in incidence was observed for group of proportion of positive lymph nodes to lymph node surgery 25% . the proportion of positive lymph node to surgery node 25% ( nonsignificant ) was upward.conclusion:the trend of incidence rates with tumor size 2 , well - differentiated tumor grade , moderately differentiated tumor grade , positive estrogen and progesterone hormone receptors was upward . the pattern of breast cancer can help to cancer prevention and prognosis , selecting the best type of surgery .

... the aim of oxygen therapy should be to increase the delivery of oxygen rather than to reach any arbitrary concentration in the arterial blood . is administration of oxygen , the most widely prescribed drug in the formulary , free of risks to nonhypoxemic patients with regional ischemia ? hyperoxia marginally increases the arterial blood oxygen content ( cao2 ) , theoretically increasing tissue oxygen delivery ( do2 ) assuming no reduction in tissue blood flow . however , oxygen causes constriction of the coronary , cerebral , renal and other key vasculatures - and if regional perfusion decreases concomitantly with blood hyperoxygenation , one would have a seemingly paradoxical situation in which the administration of oxygen may place tissues at increased risk of hypoxic stress . any tissue damage in the course of oxygen administration would plausibly be attributed to the underlying disease process . ascribing hypoxic damage to oxygen administration is counter - intuitive and is difficult to accept without a receptive mindset . considering the ubiquity of oxygen therapy , the continued low threshold for its administration , and the widespread belief that its use is justified and safe , we believe it is important to revisit the arguments made to justify the status quo . owing to the vasoconstrictor effects on the coronary , cerebral , renal and other key vasculatures , there are many scenarios in which administration of oxygen decreases the perfusion to vital organs to a greater extent than the small increase in cao2 , thereby actually reducing do2 . the calculated cao2 increases with normobaric hyperoxia ( assuming all hemoglobin is already saturated ) by only 0.03 ml / l per mmhg . with increases in alveolar pao2 from 100 to 600 mmhg , cao2 increases by 15 ml / l , or about ~7.5% assuming a hemoglobin concentration of 150 g / l . in healthy adults , administration of high oxygen concentrations is therefore likely to decrease brain do2 . despite this known effect of hyperoxia on cerebral blood flow , and the published recommendations , patients with stroke - even those with satisfactory arterial saturations - although singhal and colleagues reported transient improvement in patients with ischemic strokes , survival at 7 months for patients with mild or moderate strokes is significantly greater in those administered air than in those given 100% oxygen for the first 24 hours after the event . normobaric hyperoxia reduces coronary blood flow by 8 to 29% in normal subjects and in patients with coronary artery disease or chronic heart failure . the reduction in coronary artery flow as early as 1950 russek and colleagues reported that supplemental oxygen failed to reduce electrocardiographic signs of ischemia or reduce anginal pain in patients with myocardial infarction . in 1969 bourassa and colleagues proposed that hyperoxia - induced decreases in coronary blood flow provoke myocardial ischemia in patients with severe coronary artery disease . then in 1976 , in a double - blind randomized controlled trial , rawles and kenmure reported greater serum aspartate aminotransferase levels , indicating increased infarct size , in patients with acute myocardial infarction receiving high - flow oxygen compared with room air . they also observed a nonsignificant tripling of the death rate in those patients . given these concerns , the emergency oxygen guideline group of the british thoracic society called for ' large randomised trials of oxygen therapy for non - hypoxaemic patients with acute cardiac and cerebral ischaemia ' . conti , in a recent editorial , reminded readers that that there is only level c evidence for the administration of supplemental oxygen to patients with uncomplicated st elevation in myocardial infarction during the first 6 hours . based on currently available evidence , the uk national institute for health and clinical excellence guidelines have recently emphasized that ' supplementary oxygen should not be routinely administered to patients with acute chest pain of suspected cardiac origin , but that oxygen saturation levels should be monitored and used to guide its administration ' . similar cautions have been expressed about the use of oxygen for the treatment of traumatic brain injury . the mechanisms by which hyperoxia causes systemic vasoconstriction remain uncertain . recent work focuses on the inhibition of vasodilators ( prostaglandins , nitric oxide ) by reactive oxygen species generated as a result of the hyperoxia [ 19 - 23 ] . other work suggests that reactive oxygen species activate brainstem respiratory neurons , but this suggestion needs to be established as occurring under normobaric conditions . the role of hyperoxia - induced hypocapnia ( that is , the reverse haldane effect ) remains contentious . regardless of the underlying mechanism(s ) , the importance of considering the effects of both pao2 and paco2 on vascular tone is evident in a study in which both hyperoxia and hypocapnia independently increased cerebrovascular resistance and reduced cerebral blood flow . indeed , in some situations , the vasoconstrictive effects of hyperoxia may be predominantly due to the concomitant hypocapnia . positron emission tomography provides similar results : the reduction of cerebral blood flow and the increase in oxygen extraction during inhalation of 100% oxygen is completely reversed when subjects breathe carbogen ( 5% carbon dioxide , 95% oxygen ) . these observations emphasize the importance of independent control of arterial pco2 and po2 - possibly using dynamic forcing of alveolar gases ( for example ) or sequential gas delivery ( for example ) - when studying the independent effects of po2 and pco2 on regional perfusions . these observations also suggest that adding carbon dioxide to oxygen may offset the vasoconstriction due to hyperoxia or hypoxia - induced hypocapnia . there are other clinical situations in which the routine administration of high - concentration oxygen may lead to worse outcomes , although primarily through mechanisms other than changes in regional perfusion . austin and colleagues recently reported in a randomized controlled trial that patients with acute exacerbations of chronic obstructive pulmonary disease have a twofold to fourfold increased mortality when treated with high - flow oxygen compared with oxygen titrated to result in an arterial oxygen saturation between 88 and 92% . although several mechanisms may account for these findings , worsening respiratory failure is probably the predominant mechanism . of the patients whose arterial blood gases were measured within 30 minutes of presentation to hospital , those who received high - concentration oxygen were more likely to have hypercapnia ( mean difference paco2 34 mmhg ) or respiratory acidosis ( mean difference ph 0.12 ) . adverse outcomes with hyperoxia have also been reported in critically ill patients admitted to the intensive care unit ; a high pao2 in the first 24 hours after admission is independently associated with in - hospital mortality . in this study a u - shaped curve of mortality with pao2 was observed , illustrating the risks of both hypoxia and hyperoxia . kilgannon and colleagues recently reported that patients administered high - concentration oxygen resulting in hyperoxia ( pao2 > 300 mmhg ) following cardiac arrest have increased in - hospital mortality , a finding they attributed to increased oxidative stress associated with hyperoxia . however , because a subsequent study was unable to replicate these findings , randomized controlled trials will be required to resolve the clinical uncertainty . neonatal resuscitation is the clinical situation in which administration of 100% oxygen has most clearly been demonstrated to increase the risk of death . this has resulted in a radical change in practice whereby room air rather than oxygen is now the recommended resuscitation regime . considering the ubiquity of the administration of supplemental oxygen , there are surprisingly few randomized clinical trials that demonstrate its beneficial role when hypoxemia is absent . this may reflect the fact that its usage is so embedded in clinical practice that it is accepted as safe . nevertheless , there are some situations in which supplemental oxygen administration is useful : treatment of cluster headache , reducing the oxidative stress associated with colon surgery , and the prevention of desaturation during endoscopy . supplemental oxygen administration can , however , have the unintended side effect of delaying recognition by oximetry of hypoventilation . until recently many studies had indicated that supplementary oxygen reduced postoperative nausea and vomiting , but the current status is ambiguous ( for example [ 43 - 46 ] ) . similarly , oxygen was thought to reduce postsurgical infections - but more recent studies ( see for a partial summary ) have cast doubt on the original findings . moreover , ventilation with high inspired oxygen concentrations during surgery leads to subsequent impairment of pulmonary gas exchange [ 48 - 50 ] that may be of clinical significance . traumatic injury and compartment syndrome may appear to be obvious applications for supplementary oxygen - an increased po2 would help overcome the reductions in perfusion - but hyperbaric rather than normobaric oxygen is the treatment of choice [ 51 - 53 ] . oxygen is used for the treatment of carbon monoxide poisoning , but this is probably less effective than it should be if the accompanying hypocapnia is not prevented . in the case of breathlessness , which has long been treated with supplementary oxygen , a recent randomized double - blind controlled trial established that nasal oxygen was no better than air in relieving breathlessness and improving quality of life in palliative care patients with refractory breathlessness . in conclusion , nasa managers demanded in 1986 that their counterparts at martin - thiokol prove that it was not safe to launch the space shuttle challenger despite concerns expressed by engineers about the integrity at low temperatures of the o - rings joining the segments of the solid rocket boosters . in the case of supplementary oxygen , failure to ask the right question reinforces complacency about its use in patients who may have regional hypoxia or ischemia but are not hypoxemic . cao2 : arterial blood oxygen content ; do2 : oxygen delivery ; paco2 : arterial partial pressure of carbon dioxide ; pao2 : arterial partial pressure of oxygen ; pco2 : partial pressure of carbon dioxide ; po2 : partial pressure of oxygen . si and jaf have participated in the development of devices suitable for increasing the efficiency of oxygen delivery . the protection of the related intellectual property and distribution of income from sales ( if any ) follow the guidelines set by the university health network .

supplementary oxygen is routinely administered to patients , even those with adequate oxygen saturations , in the belief that it increases oxygen delivery . but oxygen delivery depends not just on arterial oxygen content but also on perfusion . it is not widely recognized that hyperoxia causes vasoconstriction , either directly or through hyperoxia - induced hypocapnia . if perfusion decreases more than arterial oxygen content increases during hyperoxia , then regional oxygen delivery decreases . this mechanism , and not ( just ) that attributed to reactive oxygen species , is likely to contribute to the worse outcomes in patients given high - concentration oxygen in the treatment of myocardial infarction , in postcardiac arrest , in stroke , in neonatal resuscitation and in the critically ill . the mechanism may also contribute to the increased risk of mortality in acute exacerbations of chronic obstructive pulmonary disease , in which worsening respiratory failure plays a predominant role . to avoid these effects , hyperoxia and hypocapnia should be avoided , with oxygen administered only to patients with evidence of hypoxemia and at a dose that relieves hypoxemia without causing hyperoxia .

bilateral acute angle closure glaucoma ( aacg ) after general anesthesia with the administration of either antimuscurinic ( scopolamine and atropine ) or sympathomimetic ( ephedrine ) agents is a rarely reported event in the literature.14 other precipitating factors include aids , herpes zoster , myelodisplastic syndrome , congenital anomalies , belpharoplasty , emotional stress , and drug sensitivity reactions.59 bilateral aacg after cervical spine surgery under general anesthesia in a hypermetropic patient has been reported secondary to ephedrine administration.1 we report a case of bilateral aacg with a plateau iris syndrome after the use of glycopyrrolate during general anesthesia for cervical spine surgery . we present a case of a 59-year - old male with hepatitis b , hypertension , and benign prostatic hypertrophy treated by 5-reductase inhibitor . he was diagnosed with cervical disc disease involving c4-c5 , c5-c6 , and c6-c7 causing severe neck pain and paresthesia radiating to both upper and lower limbs . his past surgical history included surgical excision of multiple lipomas under general anesthesia with no reported complications . ophthalmic history was significant for mild bilateral hyperopia ( + 1.50d ) . on the day of surgery the patient was not premedicated . the vital signs upon induction were as follows : blood pressure 110/70 mmhg ; heart rate 80 beats / min ; o2 saturation 97% on room air . intravenous midazolam ( dormicom ; hameln pharmaceutical , germany ) 2 mg iv and ( fentanyl ; hameln pharmaceutical , germany ) intravenous fentanyl 50 mcg were administered . while awake , nasal intubation was performed after bilateral superior laryngeal nerve block , transtracheal block , and topical anesthesia . after preoxygenation , intravenous induction was administered with propofol ( diprivan ; frenius kabi , germany ) 200 mg , rocuronium ( esmeron ; organo , netherland ) 50 mg , fentanyl 250 g , midazolam 1 mg , and xylocaine ( lidocaine hydrochloride ; hameln pharmaceutical , germany ) 100 mg . dexamethasone ( dexamed ; medochemie lts , cyprus ) 16 mg was given intravenously after induction . the head was stabilized with a horseshoe head rest and the anesthesiologist made sure that no pressure was applied on the eyes or forehead . remifentanil ( ultiva ; gsk , italy ) and cisatracurium ( nimbex ; gsk , italy ) intravenous infusions were started . throughout the procedure , vital signs were maintained within the following limits : systolic blood pressure 100130 mmhg ; diastolic blood pressure 5080 mmhg ; heart rate 5070 beats/ min ; o2 saturation 99100% ; temperature 35.736.7c . four liters of lactated ringers were infused intraoperatively that lasted 5 h and 30 min . after the laminectomy was performed , the patient was reversed back to the supine position . muscle relaxants were reversed with neostigmine ( prostigmine ; valeant , switzerland ) 0.05 mg / kg ( 4.5 mg ) and glycopyrrolate ( robinul ; american regent inc , usa ) 0.01 mg / kg ( 0.9 mg ) . the patient was extubated fully awake and cooperative and was transferred to the recovery room in stable condition . in the early postoperative period , approximately 12 h following recovery from general anesthesia he developed progressive bilateral frontal headache associated with nausea that persisted despite analgesics . twenty - four hours postoperatively , he started complaining of bilateral blurring of vision along with headache at which time the ophthalmology service was consulted . there was corneal edema bilaterally with an intraocular pressure of 65 mmhg in each eye . the anterior chambers were shallow and gonioscopy revealed bilateral plateau iris occluding the trabecular meshwork 360. both irises were pigmented dark - brown . acetazolamide ( diamox ; sigma pharmaceuticals ltd , new zealand ) 500 mg po and intravenous mannitol ( 500 cc over 40 min ) were administered and the patient was instructed to instill topical antiglaucoma drops including dorzolamide hydrochloride timolol maleate ( cosopt ; merck , usa ) and bimatoprost ( lumigan ; allergan , usa ) ophthalmic solution . on follow up over the next 12 h , visual acuity improved to 20/35 bilaterally with significant decrease in corneal edema . the intraocular pressure decreased to 21 mmhg in the right eye and 14 mmhg in the left eye , respectively . the anterior chambers remained shallow , hence peripheral iridotomies at 10 and 12 oclock were performed on both eyes . the patient was returned for 1 month follow - up and his vision was 20/20 in both eyes with an iop of 13 mmhg and 15 mmhg in the right and left eyes , respectively . aacg occurs in females four times greater than in males due to the anatomically more compact anterior chamber.10 other risk factors include genetic predisposition , shallow anterior chamber depth , high hypermetropia , increased lens thickness , small corneal diameter , and increased age.1112 aacg a rare postoperative complication of ( nonophthalmic ) surgeries performed under general anesthesia . large doses of antimuscarinic agents are often administered intravenously during general anesthesia to prevent the side effects of neostigmine methylsulfate , which is used to reverse the effect of nondepolarizing muscle relaxants . this causes mydriasis that can predispose patients with shallow anterior chambers to progress to aacg especially in lightly pigmented irides.413 we postulate that two factors contributed to the formation of plateau iris - like acute angle closure and obliteration of the trabecular meshwork in our patient . first the gravitational effect , induced by the prone position during surgery is a well documented cause of increased intraocular pressure.1415 this promoted the forward shift of the lens / iris apparatus . second the tangential effect , created by the movement of the iris dilator muscles due to the mydriatic effect of glycopyrrolate toward the angle enhancing iris apposition against the irido - corneal angle [ figure 1 ] . although neostigmine has a miotic effect and could have aborted the attack , its duration of action is significantly shorter than the anticholinergic effect of glycopyrrolate.1617 glycopyrrolate is a synthetic anticholinergic muscarinic competitive antagonist with a quaternary ammonium structure of the phenyacetate drug class . glycopyrrolate is used as an adjunct to acetylcholine esterase inhibitors to antagonize their cholinergic effects . the anticholinergic effect of glycopyrrolate lasts for 812 h. in our case , the patient experienced ocular pain approximately 24 h postoperatively . this was likely due to the masking effect of the analgesics and sedatives that the patient received during the early postoperative period . schematic drawing of the summation of vector forces that lead to angle closure during mydriasis and the prone position in conclusion , this is the first case of bilateral aacg induced by glycopyrrolate ( pubmed search : bilateral angle closure glaucoma , glycopyrrolate ) . we recommend that an assessment of the anterior chamber depth should be included in the preoperative checklist of every patient undergoing surgeries in the prone position under general anesthesia . this can be easily done using a penlight illumination test for anterior chamber depth by the anesthesiologist . also , the use of topical pilocarpine administered at the end of the surgery should be considered for patients at risk in order to prevent an aacg attack .

to report a case of bilateral acute angle closure glaucoma ( aacg ) that occurred after cervical spine surgery with the use of glycopyrolate . a 59-year - old male who presented with severe bilateral bifrontal headache and eye pain that started 12 h postextubation from a cervical spine surgery . neostigmine 0.05 mg / kg ( 4.5 mg ) and glycopyrrolate 0.01 mg / kg ( 0.9 mg ) were used as muscle relaxant reversals at the end of the surgery . ophthalmic examination revealed he had bilateral aacg with plateau iris syndrome that was treated medically along with laser iridotomies . thorough examination of anterior chamber should be performed preoperatively on all patients undergoing surgeries in the prone position and receiving mydriatic agents under general anesthesia .

transdermal delivery of nonsteroidal anti - inflammatory drugs is a topical treatment routinely used in physiotherapy to reduce pain and inflammation in musculoskeletal disorders.14 in order to weaken the skin barrier and to achieve a clinically effective drug concentration in the target tissues , various transdermal enhancement techniques , such as sonophoresis , iontophoresis , and occlusion , are used.511 however , little information is available concerning the efficacy of the treatment protocol and the penetration profiles of the substances used in the physiotherapy setting . indeed , most clinical studies have complex treatment protocols , and are unable to relate clinical outcome with drug penetration . a recent meta - analysis ( 2012 ) suggested a better clinical outcome for iontophoretically delivered substances.12 despite methodological flaws ( eg , combined therapies , lack of control for passive diffusion and occlusion ) , definite conclusions regarding the possible penetration enhancement of electrically assisted delivery can not be inferred.12 the building up of a stratum corneum ( sc ) reservoir is an important component of the pharmacodynamics of topically applied substances . rougier et al used the reservoir effect of the sc after 30 minutes of application to predict the total amount absorbed.13 moreover , the human sc has the capacity to store topically applied substances through a prolonged time.14 the existence of a reservoir within the sc has been documented for several topically applied solutes such as corticosteroids,1418 caffeine,19,20 nicotine,21 diclofenac ( df),22 and chemical ultraviolet filters.23 roberts et al emphasized that reservoir properties can also be attributed to the viable epidermis and dermis . specifically , df - binding capacities in dermal tissue have been reported.24 lambrecht et al estimated df skin bioavailability by quantifying the reduction of methyl nicotinate ( mn)-induced vasodilatation using chromametry and laser doppler flowmetry . they detected a significant reduction in mn response 90 minutes after different application modalities of df . open application resulted in a 32% reduction in mn response , application under occlusion accounted for a reduction of 66% , and the iontophoretic application resulted in a 65% reduction.11 at that time , one could not discriminate between the occlusive and electrically assisted delivered df . to obtain more insight into the pharmacodynamics and reservoir properties of df , the aim of the present study was to evaluate the bioavailability in the skin of df at longer time intervals after df application using different application modalities . therefore , three different forms of application ( passive , occlusive , iontophoretic ) were examined in order to detect the anti - inflammatory effect and thereby get a better understanding of the skin - penetrating and reservoir - building behavior of df as a function of time . mn responses were quantified by skin colorimetry at different time points ( 1.5 , 6 , 24 , 32 , 48 , 72 , 96 , and 120 hours ) after initial df application . five different groups , ( group 1 , n=13 [ 1.5 hours ] ; group 2 , n=12 [ 6 hours ] ; group 3 , n=12 [ 24 , 32 hours ] ; group 4 , n=14 [ 48 , 72 hours ] and group 5 , n=9 [ 96 , 120 hours ] ) of healthy volunteers ( n=60 , 23 male and 37 female ) not treated with any drugs participated in this study . approval by the ethical committee of the vrije universiteit brussel was obtained for this study ( 2002/136 ) . before testing , all subjects were informed of the research protocol and signed an informed consent . during the duration of the experiments , the volunteers were asked to maintain their daily activities , but to abstain from swimming and extensive showering . the measurements were performed under standardized temperature ( 20c2c ) and relative humidity ( 45%5% ) conditions . before every df application and each measurement session , the volunteers participated in a 30-minute acclimatization period . for each time interval tested , five randomized circular skin areas ( 7 cm ) were demarcated on the subjects volar forearms , for the following treatment and/or control modes : 1 ) open application ( without occlusion ) , 2 ) passive diffusion under a semiocclusive humid sponge , 3 ) iontophoretic application , 4 ) standard mn response , and 5 ) untreated skin side . this meant that either five skin areas for groups 1 and 2 or ten skin areas for groups 3 , 4 , and 5 ( testing two time intervals ) were randomly demarcated on both arms . this procedure enabled a single application of mn on every skin site at different time intervals , avoiding the occurrence of tachyphylaxis . df skin bioavailability was assessed by quantifying the reduction of the mn response , as proposed by lambrecht et al.11 topical application of mn provokes an increase of local cutaneous blood flow ( erythema).25 when df is present in the skin , the nicotinate response is depressed in a concentration - dependent way.26 treffel and gabard demonstrated a good correlation between the in vivo inhibition of the mn - induced inflammation and the in vitro determination ( chromatographic analysis ) of nonsteroidal anti - inflammatory drug - concentration levels in the sc.27 lambrecht et al evaluated the inhibition of mn - induced erythema with both laser doppler flowmetry and the colorimetric method , which resulted in equivalent conclusions . therefore it was decided that the chromametric evaluation be used.11,28 in the present study , the inhibition of the mn response with sum of the a * parameter ( a * ) was evaluated up to 50 minutes post - mn application , making the protocol more feasible and bearable for the subjects . skin - surface colorimetric measurements were performed with a minolta cr 200 chromameter operating in the international commission on illumination l*a*b * color space . for the quantification of skin - surface color and erythema , the a * parameter is especially useful , as it represents the chromaticity between red / magenta and green ( negative values indicate green , while positive values indicate magenta).29,30 chromameter measurements were carried out before df application , prior to mn application , and every 5 minutes until 50 minutes post - mn application for the different reservoir - estimation time points . since different groups of subjects were involved , an untreated skin area was included in order to be able to correct for blank values . for treatment modes 1 , 2 , and 3 , a commercially available 1% df ( voltaren emulgel ; novartis pharma , bern , switzerland ) formulation ( 12 mg ) the mn test was applied using paper - filter disks that were saturated in a 0.005 m aqueous mn solution and applied on the circular demarcated skin areas for 30 seconds . after removal of the filter disk , excess solution was gently wiped away using a tissue paper . df was applied for 20 minutes under three different conditions : 1 ) open application ( without occlusion ) , 2 ) passive diffusion under a semiocclusive humid sponge , and 3 ) iontophoretic application ( direct current , 0.2 ma / cm , cathode ) . to reproduce physiotherapeutic conditions , two marked skin areas were not treated with df : the application side for the standard mn - induced response and the blank untreated skin side . the bioavailability of df in the sc under the three conditions was assessed by quantification of mn induced erythema at 1.5 , 6 , 24 , 48 , 72 , 96 , and 120 hours post - df application . to estimate the presence of df in the skin , mn responses at the different time periods following initial df application ( 1.5 , 6 , 24 , 32 , 48 , 72 , 96 , and 120 hours ) were compared . the a * corrected for blank values ( untreated skin ) up to 50 minutes post - mn application was used as an indicator for the magnitude of the mn response . smirnov goodness - of - fit test . at the different time periods following initial df application , the skin response to the different application modalities statistical significance between any application mode and the standard mn response was used as an indication for the presence of df in the skin at that particular time point following initial df application . five different groups , ( group 1 , n=13 [ 1.5 hours ] ; group 2 , n=12 [ 6 hours ] ; group 3 , n=12 [ 24 , 32 hours ] ; group 4 , n=14 [ 48 , 72 hours ] and group 5 , n=9 [ 96 , 120 hours ] ) of healthy volunteers ( n=60 , 23 male and 37 female ) not treated with any drugs participated in this study . approval by the ethical committee of the vrije universiteit brussel was obtained for this study ( 2002/136 ) . before testing , all subjects were informed of the research protocol and signed an informed consent . during the duration of the experiments , the volunteers were asked to maintain their daily activities , but to abstain from swimming and extensive showering . the measurements were performed under standardized temperature ( 20c2c ) and relative humidity ( 45%5% ) conditions . before every df application and each measurement session , the volunteers participated in a 30-minute acclimatization period . for each time interval tested , five randomized circular skin areas ( 7 cm ) were demarcated on the subjects volar forearms , for the following treatment and/or control modes : 1 ) open application ( without occlusion ) , 2 ) passive diffusion under a semiocclusive humid sponge , 3 ) iontophoretic application , 4 ) standard mn response , and 5 ) untreated skin side . this meant that either five skin areas for groups 1 and 2 or ten skin areas for groups 3 , 4 , and 5 ( testing two time intervals ) were randomly demarcated on both arms . this procedure enabled a single application of mn on every skin site at different time intervals , avoiding the occurrence of tachyphylaxis . df skin bioavailability was assessed by quantifying the reduction of the mn response , as proposed by lambrecht et al.11 topical application of mn provokes an increase of local cutaneous blood flow ( erythema).25 when df is present in the skin , the nicotinate response is depressed in a concentration - dependent way.26 treffel and gabard demonstrated a good correlation between the in vivo inhibition of the mn - induced inflammation and the in vitro determination ( chromatographic analysis ) of nonsteroidal anti - inflammatory drug - concentration levels in the sc.27 lambrecht et al evaluated the inhibition of mn - induced erythema with both laser doppler flowmetry and the colorimetric method , which resulted in equivalent conclusions . therefore it was decided that the chromametric evaluation be used.11,28 in the present study , the inhibition of the mn response with sum of the a * parameter ( a * ) was evaluated up to 50 minutes post - mn application , making the protocol more feasible and bearable for the subjects . skin - surface colorimetric measurements were performed with a minolta cr 200 chromameter operating in the international commission on illumination l*a*b * color space . for the quantification of skin - surface color and erythema , the a * parameter is especially useful , as it represents the chromaticity between red / magenta and green ( negative values indicate green , while positive values indicate magenta).29,30 chromameter measurements were carried out before df application , prior to mn application , and every 5 minutes until 50 minutes post - mn application for the different reservoir - estimation time points . since different groups of subjects were involved , an untreated skin area was included in order to be able to correct for blank values . for treatment modes 1 , 2 , and 3 , a commercially available 1% df ( voltaren emulgel ; novartis pharma , bern , switzerland ) formulation ( 12 mg ) was applied . the mn test was applied using paper - filter disks that were saturated in a 0.005 m aqueous mn solution and applied on the circular demarcated skin areas for 30 seconds . after removal of the filter disk , excess solution was gently wiped away using a tissue paper . df was applied for 20 minutes under three different conditions : 1 ) open application ( without occlusion ) , 2 ) passive diffusion under a semiocclusive humid sponge , and 3 ) iontophoretic application ( direct current , 0.2 ma / cm , cathode ) . to reproduce physiotherapeutic conditions , two marked skin areas were not treated with df : the application side for the standard mn - induced response and the blank untreated skin side . the bioavailability of df in the sc under the three conditions was assessed by quantification of mn induced erythema at 1.5 , 6 , 24 , 48 , 72 , 96 , and 120 hours post - df application . to estimate the presence of df in the skin , mn responses at the different time periods following initial df application ( 1.5 , 6 , 24 , 32 , 48 , 72 , 96 , and 120 hours ) were compared . the a * corrected for blank values ( untreated skin ) up to 50 minutes post - mn application was used as an indicator for the magnitude of the mn response . smirnov goodness - of - fit test . at the different time periods following initial df application , the skin response to the different application modalities statistical significance between any application mode and the standard mn response was used as an indication for the presence of df in the skin at that particular time point following initial df application . analysis of the skin color ( a * parameter ) after mn application for the different application modes ( open application , occlusion , and iontophoresis ) and at the different reservoir - estimation times ( 1.5 , 6 , 24 , 32 , 48 , 72 , 96 , and 120 hours ) clearly showed changes in mn response as a function of the application mode and reservoir - estimation time . as an example , kinetics of the skin - color parameters are given in figures 1 and 2 . at 1.5 hours post - df application , a clear inhibition was visible for application under occlusion and under iontophoresis , while open df application did not provoke an inhibition in mn response ( figure 1 ) . at 96 hours post - df application , inhibition of the mn response was no longer perceived ( figure 2 ) . differences between application modes at the different reservoir - estimation times were assessed using the a * values calculated from the different kinetics ( table 1 ) . at 1.5 hours after the initial df application , a significantly decreased response was detected for the occluded and iontophoretically delivered df only . from 6 hours up to 32 hours post - df application , a significantly reduced mn response was detected at all df - pretreated skin sites . at 48 hours post - df application , only the passive and occluded applications resulted in a significant reduction . at 72 hours post - df application , only the response after the passively delivered df remained significant . from 96 hours on , the applied method inhibition of a physiological reaction ( mn ) due to the presence of the inhibitor ( df ) in the skin reservoir enabled us to estimate penetration kinetics , df skin - reservoir building , and emptying properties of three different application conditions up to 120 hours after initial df application . in contrast with other reservoir protocols , an active substance - liberating action , such as occlusion or increased hydration , was not required.24 this may be a confirmation of the presence of df in the viable tissue ( dermal compound ) , since mn - induced vasodilatation is inhibited immediately.24 the application modality influenced the formation and the emptying of the reservoir . penetration - enhancing factors , such as occlusion and current , induced faster formation and emptying of the reservoir compared to an open ( passive ) df application . the presence of the reservoir for the passive df application after 6 hours only is in contrast with earlier findings from our laboratory.11 lambrecht et al11 presented the data of the mn response as calculated areas under the curve , relating the inhibition of mn response throughout a 65-minute time period . they found a 32% reduction of the mn response 1.5 hours after application , reaching borderline significance ( p=0.04 ) . consequently , the weaker inhibition potential at 1.5 hours post - df application noticed in both studies indicates lower bioavailability at that moment , due to a slower percutaneous penetration compared to the other application modes . according to the literature , the formation of a skin reservoir for topically applied substances is determined by a variety of factors ( eg , lipid / water - solubility , protein - binding capacity , percutaneous absorption , compound concentration , clearance , application time , and application mode).11,1416,23,24 our results support the previous findings of vickers , showing that increased drug diffusivity in the sc provoked by penetration enhancers results in faster formation of the reservoir.14 more specifically , takahashi et al suggested increased diffusivity of df into the sc from vehicles containing urea compared to vehicles without urea . the latter was explained by the hydration - enhancement effect of urea on the sc.31 the results concerning the penetration - enhancement effect of iontophoresis are in line with the results of curdy et al on the in vivo uptake of piroxicam after passive , occlusive , and iontophoretic administration . only after iontophoresis were enhanced drug uptakes found at 30 , 60 , and 125 minutes following the initial application at different depths in the sc . in contrast with our results , curdy et al found no significant difference between passive delivery and the application under occlusion . a possible explanation could be the low lipophilicity of piroxicam resulting in a low passive uptake into the sc.32 fang et al postulated that the route and mechanism for the iontophoretic delivery of df through the skin might be different compared to passive delivery . therefore , the importance of the sc as a rate - limiting barrier is reduced for iontophoretic delivery of df.33 our results indicate that the emptying of the reservoir is influenced by the application mode . after iontophoretic delivery , the df reservoir was present up to 32 hours following initial application . however , after occlusive and passive delivery of df , the reservoir was present up to 48 and 72 hours , respectively . it is well established that diffusivity influences clearance from the reservoir , with faster emptying as a function of increasing diffusivity . increasing sc hydration as well as iontophoresis have been shown to be effective methods for enhancing the percutaneous penetration of df.33 the present data fit in the model proposed by roberts et al with a shorter lag time resulting in a faster reservoir emptying.24 equally , based on the results of rougier et al13 one can assume that the application with the fastest reservoir - buildup conditions may result in a greater delivery of active substances to the viable tissues , which may have an effect on the clinical outcomes of the physiotherapeutic treatment . within the limitations of our experimental design , we can hypothesize that the faster emptying of the reservoir after iontophoretic delivery compared to application under occlusion may be an indication for a higher diffusivity during the current - assisted application , leading to a superior delivery under iontophoretic circumstances . limitations of the present study are the lack of information on absolute df quantities entering the viable skin and the fact that the methods used did not allow differentiation between an epidermal reservoir and a dermal reservoir . further research estimating in vivo tissue concentrations after different modes of application are required for further elaboration of the pharmacodynamics of topical applied substances in physiotherapeutic practice . this study measured the penetration kinetics and reservoir properties of df after a single topical passive , occlusive , and electrical assisted application in a realistic physiotherapeutic setting . the results indicate that the contribution of occlusive and passive penetration in the iontophoretic delivery can be substantial . the prompt inhibition of the vasoactive reaction may be an indication for a dermal df reservoir . the formation and emptying of the reservoir was found to be dependent on the application mode .

aimthere is scarce information concerning the pharmacodynamic behavior of topical substances used in the physiotherapy setting . the aim of the present study was to estimate the formation and emptying of the diclofenac ( df ) skin reservoir after passive , semiocclusive , and electrically assisted applications of df.subjects and methodsfive different groups of healthy volunteers ( ntotal=60 , 23 male and 37 female ) , participated in this study . a 1% df ( voltaren emulgel ) formulation ( 12 mg ) was applied on the volar forearms on randomized defined circular skin areas of 7 cm2 . df was applied for 20 minutes under three different conditions at the same time . the presence of df in the skin results in a reduction of the methyl nicotinate ( mn ) response . to estimate the bioavailability of df in the skin , mn responses at different times following initial df application ( 1.5 , 6 , 24 , 32 , 48 , 72 , 96 , and 120 hours ) were analyzed.resultsat 1.5 hours after the initial df application , a significant decrease in mn response was detected for the occluded and iontophoretic delivery . passive application resulted in a decrease of the mn response from 6 hours post - df application . the inhibition remained up to 32 hours post - df application for the iontophoretic delivery , 48 hours for the occluded application , and 72 hours for the passive delivery . at 96 and 120 hours post - df application none of the mn responses was inhibited.conclusionthe formation and emptying of a df skin reservoir was found to be dependent on the df - application mode . penetration - enhanced delivery resulted in a faster emptying of the reservoir .

walking for exercise is promoted by the arthritis foundation and the american college of rheumatology for people with knee osteoarthritis ( oa ) in order to promote healthy living [ 1 , 2 ] . walking , among other types of physical activity , results in a reduction in knee pain and improvement in functional ability [ 3 , 4 ] . moreover , meeting physical activity guidelines through activities like walking can reduce the risk of death . this is particularly noteworthy given that knee oa is associated with an increased risk of all - cause death and given the rising prevalence of knee oa , this mortality risk poses significant public health implications . for older adults with knee oa , knee pain is associated with difficulty walking , and often considered the primary culprit for low levels of physical activity and walking . obesity is also associated with difficulty walking and low levels of physical activity , and it is a primary risk factor for knee oa [ 10 , 11 ] . about 1/3 of the united states population is obese with a bmi of at least 30 . . however , the association of obesity independent of knee pain with walking is not known . this is an important association to understand since weight loss is rarely prescribed to patients in practice and instead clinicians typically focus on pharmacologic therapies for knee pain . while such practice is in contrast to treatment guidelines for oa , which recommend both weight loss intervention and pain management , evidence supporting these guidelines for an outcome of walking is sparse hence , the purpose of our study is to examine the association of obesity with walking independent of knee pain . the cross - sectional study sample consisted of participants in the multicenter osteoarthritis ( most ) study , a large multicenter longitudinal cohort study of community - dwelling subjects who have or are at high risk of knee oa . the most sample included adults aged 50 to 79 years were recruited from the communities in and surrounding birmingham , alabama and iowa city , iowa . oa , included the presence of known risk factors , including being age over 50 years , female gender , previous knee injury or operation , and body weight in excess of the median weight for each age- and sex - specific group based on data from the framingham oa study . the most study protocol was approved by the institutional review boards at the university of iowa in iowa city , university of california san francisco , university of alabama in birmingham , and boston university medical center . information on walking , pain , and obesity were collected at the 60-month most follow - up exam between june of 2009 and january of 2011 . we restricted the analysis sample to those participants who had a minimum of 3 days of walking data since previous studies have found this to be the minimum number of days needed for a reliable estimate of physical activity . of the 2330 most participants attending the 60-month follow - up visit , 16% ( 377 ) did not agree to wear the stepwatch , and 2% ( 58 ) had monitor malfunctions . of the remaining 1895 participants who wore the stepwatch , 94% ( 1788/1895 ) wore it for at least 3 valid days and represent the study sample . the stepwatch was worn for 3 , 4 , 5 , 6 , and 7 days by 3% , 4% , 7% , 12% , and 74% of participants , respectively . in general , participants included in this analysis were more likely to have better health status ( e.g. , lower bmi , depressive symptoms , less muscular weakness , and fewer comorbidities ) compared with those not included in the analysis ( data not shown ) . following collection of clinic data where pain and body mass index ( bmi ) were collected , trained research assistants followed a written protocol to fit the stepwatch to the ankle of each study participant , and provided written and verbal instructions for putting on the device each morning and taking off the device at bedtime for the next 7 days . the stepwatch is a small ( 70 50 20 mm ; 38 g ) , waterproof , self - contained device that is worn on the ankle and records the number of steps taken every minute while providing no feedback to the user . the stepwatch has high concurrent validity in comparison with several reference standard measures of step frequency in older adults , high convergent validity in comparison with sf-36 scores among subjects with oa , and high test - retest reliability in adults [ 19 , 20 ] . to determine if subjects wore the monitor long enough to be counted as a full day , we adopted a published method for processing accelerometry data , and defined ten hours of monitoring as the minimum amount of time needed to define a full day the ten hour threshold represents more than 66% of waking hours and has been utilized as a threshold in studies of physical activity in the general adult population and people with knee oa . time in use was counted from the first step recorded in the morning to the last step recorded in the evening . to exclude times subjects may have taken off the stepwatch during the day , we omitted times where the monitor registered no steps for 180 consecutive minutes during the day ( see the appendix ) . we quantified walking as the total number of steps taken per day on average as a continuous outcome . we calculated steps / day by totaling the number of steps taken each valid day of monitoring divided by the number of valid days . we measured knee pain severity as the average pain in the past 30 days on visual analogue scale ( vas ) ranging from 0 to 100 . subjects with two painful knees were categorized according to the vas pain score of the more painful knee . we defined obesity using from bmi computed from standardized weight and height assessments . for analyses , we treated bmi as a continuous factor and a categorical factor by classified according to world health organization ( who ) categories . the following factors were treated as covariates based on existing literature linking them to function or physical activity [ 16 , 2427 ] : age , sex , living situation ( alone or with someone ) , education ( < college , college ) , race ( white , nonwhite ) , radiographic knee osteoarthritis ( roa ) defined as a kellgren and lawrence score of 2 in the tibiofemoral joint , pain in the hip , ankle , or foot ( present versus absent ) , comorbidities ( 0 versus 1 ) estimated with the modified charlson comorbidity index , depressive symptoms ( < 16 , 16 ) measured with the center for epidemiologic studies depression scale ( ces - d ) , as well as knee strength in tertiles from the mean of four isokinetic knee extensor torque repetitions at 60 deg / sec measured in newton - meters ( cybex inc . all covariates were collected at the 60 month clinic visit except for living situation , which was collected at the baseline clinic visit . we examined levels of walking by employing descriptive statistics and plotted a histogram of the distribution of walking across our sample . we first examined the independent effects of pain and bmi by calculating effects estimates and 95% confidence intervals ( ci ) using multiple linear regression adjusting for both pain and bmi ( categorically ) as well as for covariates . we also adjusted for study site ( alabama or iowa ) , to account for differences in data collection of stepwatch data and other study variables . we also examined the relative effect of pain and bmi with walking from partial correlation coefficients and standardized beta coefficients . the mean age the 1788 subjects included was 67.2 ( sd = 7.7 ) years . most participants ' ( 36% ) were overweight with a bmi 25 and < 30 followed by 29% being obese with a bmi 30 and < 35 . the majority of subjects were women ( 60% ) and white ( 90% ) . the average number of steps taken per day was 8872.9 ( sd = 3543.4 ) . more pain and higher bmi were associated with fewer steps taken per day ( see table 2 ) . each increase of 10 points on the vas for pain was associated with taking 167 fewer steps per day . subjects who were overweight ( bmi 25 and < 30 ) , in obese class i ( bmi 30 and < 35 ) , and in obese class ii ( bmi 35 ) took 989 , 2069 , and 3355 fewer steps per day compared with those with a healthy weight ( bmi < 25 ) . mutually adjusting for pain and bmi along with covariates explained 28% of the variability of walking . pain accounted for 2.9% of the variability while bmi accounted for 9.7% of the variability of walking . similarly , a one standard deviation increase in pain accounted for a decrease of 0.07 of a standard deviation of walking , while a one standard deviation increase in bmi accounted for a decrease of 0.28 of a standard deviation of walking ( see table 3 ) . in particular , we found bmi to account for 9.7% of the variability of walking in comparison to only 2.9% for pain . these findings suggest that obesity has an important association with low levels of walking in people with or at high risk of knee oa independent of knee pain . knee pain accounted for little of the variability of walking when considered along with the effect of obesity . to put the relative effect of pain into perspective , knee pain accounted for only 10% of the total variability accounted by our model ( pain , bmi , and all covariates ) . in contrast , obesity accounted for 35% of the total variability of the same model . we found a similar trend from the standardized beta coefficients with a one standard deviation increase in bmi accounting for more change in walking than the same increase in pain . this difference is notable given that knee pain is a major cause of functional limitation in people with knee oa [ 3033 ] . however , from a conceptual perspective , the performance of physical function , such as walking speed , is distinctly different than how much physical activity one performs on a daily basis . furthermore , previous studies have reported a weak association between knee pain and physical activity [ 3436 ] . one possible reason for this is that people may have avoided walking for different reasons . those with low levels of knee pain did not walk for fear of increasing their knee pain , while those with high knee pain were unable to walk due to current pain levels . disentangling these associations we found obesity to have a strong association with walking , which has been reported previously in adults who are normal weight and obese and general population studies [ 37 , 38 ] . subjects in the highest bmi category walked over 3000 steps less per day than those in the lowest bmi category . the magnitude of this difference is clinically meaningful as it approaches a one standard deviation difference for walking in our sample . given that our study is cross - sectional , we can not infer causal direction , and association between obesity and walking is likely bidirectional . similarly , people who are obese could have difficulty walking and hence have low levels of walking . irrespective of the directionality , we found obesity to be strongly associated with walking independent of pain , which underscores the obesity epidemic in the united states and the importance of addressing obesity to avoid future poor health outcomes . step counts collected in our study can not be compared with previous studies utilizing pedometers . pedometers are known underestimate the number of steps taken by older adults up to 33% compared with a stepwatch , hence step counts in our study are higher than pedometer based studies . however , the average step counts in our study are comparable with smaller studies that employed the stepwatch in people with knee or hip oa and older adults [ 40 , 41 ] . for instance , winter et al . reported 30 people with radiographic knee oa walked 9350 steps / day , which is similar to our finding of 9194 and 8598 steps / day for men and women , respectively . first , we report daily walking from a large cohort of people with or at high risk of knee oa who wore a validated walking monitor . second , this is the first study to report the association of obesity with walking independent of knee pain in people with or at high risk of knee oa using a well - validated objective monitor . first , subjects may have changed walking habits with the knowledge that their habitual walking was being recorded . testing effect is greatest when subjects wear an unsealed monitor , that is , when subjects are aware of how many steps are being recorded [ 4244 ] . we believe any increases in walking due to a testing effect were minimized since study participants did not know the number of steps that were recorded . second , we acknowledge we employed few psychological measures as covariates in our analyses . we were limited to measures already collected in the most study and were not able to add measures of self efficacy or fear avoidance , which are likely associated with walking . lastly , our sample consisted of people both with and at high risk of knee osteoarthritis , therefore , it is not clear if our findings are directly generalizable to those with knee oa . we performed a sensitivity analysis stratifying our sample by those with and without roa and found similar effects for pain and obesity within each strata compared with our main findings . we found bmi to be associated with walking independent of pain in the studied sample of people with or at high risk of knee oa . these findings support clinical practice guidelines that obesity is an important modifiable factor to intervene upon and particularly relevant for walking among people with or at high risk of knee oa . future research should investigate the longitudinal association of bmi and knee pain with walking in order to better understand the temporal relationships between these factors .

practice guidelines recommend addressing obesity for people with knee oa , however , the association of obesity with walking independent of pain is not known . we investigated this association within the multicenter osteoarthritis study , a cohort of older adults who have or are at high risk of knee oa . subjects wore a stepwatch to record steps taken over 7 days . we measured knee pain from a visual analogue scale and obesity by bmi . we examined the association of obesity with walking using linear regression adjusting for pain and covariates . of 1788 subjects , the mean steps / day taken was 8872.9 3543.4 . subjects with a bmi 35 took 3355 fewer steps per day independent of knee pain compared with those with a bmi 25 ( 95% ci 3899 , 2811 ) . bmi accounted for 9.7% of the variability of walking while knee pain accounted for 2.9% . bmi was associated with walking independent of knee pain .

a 75-year - old female presented to the chest clinic of our hospital with a history of a cough with mucoid expectoration , episodic dyspnea with wheeze of 1 month duration . she did not have any symptoms of chest pain , hemoptysis , recurrent fever , weight loss , reflux , or symptoms of postnasal drip . she did not give any past history of atopy or asthma , and her family history was also negative for same . general examination revealed that she had pallor . her chest x - ray is shown in figure 1 . what is the abnormality seen ? chest x - ray posteroanterior view showing elevated hemidiaphragm on the right , with a retrocardiac opacity on the left side diaphragmatic eventration is congenital in nature and is due to incomplete muscularization of the diaphragm with a thin membranous sheet replacing normal diaphragmatic muscle . over a period of time , this region stretches and thins out , and on inspiration does not contract normally . radiologically , elevation of the affected portion of the diaphragm is usually seen as a smooth hump , while the remainder of the hemidiaphragm contour is normal . hiatus hernias occur when there is a herniation of abdominal contents through the esophageal hiatus of the diaphragm into the thoracic cavity . usually , both these defects are seen in isolation . however , combination of both an eventration and hiatus hernia occurring together is a very rare entity , and a thorough literature search showed only three previous such cases . the coronal reconstructed 64 slice computerized tomogram showed eventration of right hemidiaphragm with liver occupying the right lower hemithorax . widening of the esophageal diaphragmatic hiatus with herniation of stomach and perigastric fat was also seen [ figure 2 ] . coronal reconstructed 64 slice computed tomography image showing eventration of right hemidiaphragm with liver occupying the right lower hemithorax . widening of the esophageal diaphragmatic hiatus with herniation of stomach and perigastric fat is also seen her spirometry showed a mild reversible airflow obstruction . she was managed conservatively considering her age and her respiratory symptoms resolved significantly after the institution of inhaled corticosteroids .

although diaphragmatic anomalies such as an eventration and hiatus hernia are commonly encountered in incidental chest x - ray imaging , the presence of concomitant multiple anomalies is extremely rare . this is all the more true in adults . herein , we present the case of a 75-year - old female , while undergoing a routine chest x - ray imaging , was found to have eventration of right hemidiaphragm along with a hiatus hernia as well .

subacute cutaneous lupus erythematosus is a type of lupus erythematosus having distinct characteristic clinical , serologic , and genetic features . subacute cutaneous lupus erythematosus ( scle ) is a type of lupus erythematosus having distinct characteristic clinical , serologic , and genetic features . it has intermittent recurrence of skin disease activity over long periods of time without significant progression to systemic involvement . antibodies to the ro / ss - a antigen is closely associated with this group . among the various clinical presentations a 58-year - old male presented with scaly lesions all over the body since 1 year . the lesions , which were scaly and itchy , were initially present over the face . later , the scaling progressed to involve the extremities , trunk and back over a period of 2 - 3 months . patient was a known case of diabetes on treatment for over 1 year . on examination , diffuse scaling was present all over the body , more pronounced over the scalp , chest and back , fine scales were present over the face . sparing of certain areas of abdomen was noted . punched out ecthymatous lesions were present over abdomen , lower limb , which were tenders to touch [ figure 1 ] . diffuse scaling over the back with areas of normal skin over the lower back , echthymatous ulcers also seen haematological investigations were within normal limits . culture sensitivity revealed staphylococcus aureus , sensitive to amoxicillin and ceftriaxone . on histopathology , the epidermis showed loss of rete pattern , and brisk mononuclear infiltrate present at dermo - epidermo junction with vacuolization of the basal keratinocyte with formation of clefts in certain areas . the epidermis showed loss of rete pattern and brisk mononuclear infiltrate present at dermo - epidermo junction with vacuolization of the basal keratinocyte . focal pigment incontinence also seen ( h and e , 10 ) immunofluorescence assay revealed anti nuclear antibody positive in 1:320 titre with speckled nucleoli , suggestive of anti - ss - a / ro pattern . other investigations like skin scrapping for koh , scabies mite , blood for human immunodeficiency virus and venereal disease research laboratory was negative . though there was no apparent cause of erythroderma in our patient , the photoexacerbation of skin lesions , histopathological picture of interface dermatitis and immunofluorescence findings of a positive anti - ss - a / ro pattern helped us in confirming scle as the cause of erythroderma . furthermore , topical betamethasone lotion and moisturisers were advised over the scaly lesions [ figure 3 ] . first described scle as a specific subset of lupus erythematosus , which differed from later based on clinical , histological , and immunological parameters . this subset , which comprises approximately 10% of the patients with lupus erythematosus , have either non - scarring papulosquamous ( two - third ) or annular polycyclic ( one - third ) lesion . approximately 50% of patients with scle have four or more american rheumatologic association criteria for systemic lupus erythematosus of which arthritis is the most common manifestation . erythematous macules or plaques over photo exposed sites like upper back , shoulder , extensor aspect of the arms , v areas of the neck are the first presentation in scle . these lesions later evolve into hyperkeratotic papulosquamous or annular / polycyclic plaques , which resolve leaving a grey white hypopigmentation and telangiectasia . when the face is involved , it is most often the lateral face with sparing of central and malar area . scle can also be associated with diffuse non - scaring alopecia , mouth ulceration , ( especially of the palate ) reticular livedo , periungual telangiectasia , and raynaud 's phenomenon . scle may occur in the course of puva treatment of psoriasis , radiation therapy , interferon therapy and also associated with breast cancer , meningioma , hepatocellular carcinoma , hodgkin 's disease , lung cancer , prostate cancer , and squamous cell carcinoma of head and neck . very rarely it is present as erythema multiforme , toxic epidermal necrolysis like lesion ( rowell syndrome ) , erythroderma and generalized poikiloderma . therefore , a diagnosis of scle should be suspected in those cases of erythroderma in whom there is no apparent cause , if the history suggests a relation to uv light exposure and if the histologic findings reveal interface dermatitis . in our case , extensive scaling probably indicates exacerbation of pre - existing papulosquamous type of scle following sun exposure . histopathologically scle frequently presents as interface dermatitis , with foci of vacuolar alteration of basal keratinocytes alternating with areas of lichenoid dermatitis . dermal changes include oedema , prominent mucin deposition and sparse mononuclear cell infiltration usually limited to the area around blood vessel and peri - adnexal structure in upper one - third of the dermis . most cases of scle are positive for antibodies to the ro / ss - a antigen . in conclusion , scle should be one of the differential diagnosis in patients with erythroderma associated with exacerbation following sun exposure .

subacute cutaneous lupus erythematosus ( scle ) is a type of lupus erythematosus having distinct characteristic clinical , serologic , and genetic features . other than the commonly occurring papulosquamous and annular polycyclic lesion , rarely it may present as erythema multiformae , toxic epidermo necrolysis like lesion ( rowell syndrome ) , erythroderma , and generalized poikiloderma . herein , we report a case of scle presenting as erythroderma .

however the prognosis of gist has been changed dramatically after the introduction of imatinib mesylate ( glivec , previously called sti571 ) . imatinib inhibits not only bcr - abl tyrosine kinase and platelet - derive growth factor ( pdgf ) , but also c - kit kinase which is constitutively activated in gists . by this reason , imatinib becomes to be wide use for the treatment of gist as well as chronic myeloid leukemia . common adverse events were usually mild and included nausea , edema , cramps , diarrhea , vomiting , rash , headache , fatigue , and arthralgia ( 1 - 5 ) . in addition , severe or rare adverse events of imatinib have been reported , including severe skin rash , hair repigmentation , splenic rupture , bone marrow necrosis , and male gynecomastia . we report here a case of male gynecomastia coincident with testicular hydrocele in a patient treated with imatinib for metastatic gist . gynecomastia and testicular hydrocele are thought to be induced by imatinib through inhibition of c - kit and pdgf . two years earlier , he had undergone small bowel resection for removal of a 20 cm - sized mass , later shown to be a gist . following resection , he received postoperative adjuvant radiation therapy , at a total dose of 5,040 cgy . upon presentation , the tumor cells were immunohistochemically positive for c - kit and focally positive for sma , but negative for cd34 and s100 , supporting the original diagnosis of gist of interstitial cells of cajal origin . he was prescribed oral imatinib mesylate 400 mg daily . just after starting drug treatment , three months later , the hepatic lesions improved , showing a partial response , and nine months after his first visit to our hospital , ct scan and positron - emission tomography showed no evidence of disease . treatment was discontinued after a further 5 months of imatinib mesylate , but a ct scan performed 3 months after finishing imatinib showed disease progression . a second period of imatinib treatment was started , at the same dose of 400 mg / day . a precise medical history was taken , at which point it was learned that left painful gynecomastia and scrotal swelling had developed during the first period of imatinib treatment , but that both had improved after stopping imatinib . pain in the right breast began on the 20th day of the second period of imatinib treatment . decreased libido and impotence were noted . a testicular ultrasonogram showed a large amount of fluid in the right scrotal sac and his right testis was displaced downward ( fig . his serum thyroid stimulating hormone level was 1.1 u / ml , his free t4 concentration was 1.3 ng / dl , his serum luteinising hormone level was 6.8 pathologic examination of the hydrocele specimen showed it to be fibroadipose tissue without lining mesothelium . the most common adverse events of imatinib mesylate include edema , diarrhea , myelosupression , muscle cramps , skin rash , and conjunctival inflammation , most of which are mild ( 3 , 6 ) . in addition , rare or severe adverse events were reported . there have been case reports of severe skin rash , stevens - johnson syndrome , and an acute generalized exanthematous pustulosis in patients treated with imatinib ( 7 , 8) , and 9 patients ( 5 men and 4 women ) with gray hair before treatment had progressive repigmentation during imatinib treatment ( 9 ) . in contrast to the repigmentation , imatinib mesylate - induced hypopigmentation was also reported ( 10 - 12 ) . among the more than 10,000 chronic myeloid leukemia ( cml ) patients treated with imatinib , there have been 3 reported cases of splenic rupture ( 13 ) , and bone marrow necrosis ( 14 ) , possibly due to increased apoptosis and the release of prothrombotic cellular material , has been reported . however it is known that imatinib can also inhibit c - kit tyrosine kinase and platelet - derived growth factor receptor ( pdgfr ) tyrosine kinase . the inhibition of c - kit or pdgf is thought to be responsive for some of these adverse events . a recent report has described seven cases of gynaecomastia ( one grade 1 and six grade 2 ) in 38 cml patients treated with imatinib ( 15 ) . also , pdgf - a is obligatory for adult leydig cell recruitment and spermatogenesis ( 17 ) . c - kit activity is modulated by stem cell factor which in combination with insulin - like growth factor had effect on leuteinizing hormone receptor and increased the expression of star , cyp11a , cyp17 , and 3-hydroxysteroid dehydrogenase mrna expression ( 18 ) . therefore , imatinib can reduce testosterone biosynthesis by inhibiting c - kit and pdgfr in the testis , and male gynecomastia can result from decreased testosterone ( 19 , 20 ) . in previous report , rise of progesterone and 17-hydroxyprogesterone could represent the accumulation of testosterone precursors as a consequence of impairment of key enzymes in the steroidogenic cascade ( 15 ) . in our report , decreased testosterone was detected during gynecomastia , and testosterone supply improved gynecomastia and libido . in our patient , the relationship between imatinib therapy and testicular hydrocele is evident by the fact that testicular hydrocele was repeatedly developed during imatinib therapy and improved after ceasing imatinib . the mechanism by which imatinib induces testicular hydrocele , however , is not clear , although it may arise through same mechanism of edema or fluid retention . edema is the one of the most frequently reported adverse events , most of which are well tolerated . unusual or severe cases of edema after imatinib such as cerebral edema , pleural effusion and severe periorbital edema were also reported ( 21 - 23 ) . signaling through pdgf- receptors increases interstitial fluid pressure in the dermis ( 24 , 25 ) . on the contrary , inhibition of pdgf these studies suggested that the inhibition of pdgfr by imatinib is the possible mechanism of localized edema . further investigation of the ability of imatinib to induce testicular hydrocele is warranted . to our knowledge , this is the first report of male gynecomastia and concurrent testicular hydrocele following imatinib treatment of a patient with gist .

we report a gastrointestinal stromal tumor ( gist ) patient with male gynecomastia and testicular hydrocele after treatment with imatinib mesylate . a 42 yr - old male patient presented for management of hepatic masses . two years earlier , he had undergone a small bowel resection to remove an intraabdominal mass later shown to be a gist , followed by adjuvant radiation therapy . at presentation , ct scan revealed multiple hepatic masses , which were compatible with metastatic gist , and he was prescribed imatinib 400 mg / day . during treatment , he experienced painful enlargement of the left breast and scrotal swelling . three months after cessation of imatinib treatment , the tumors recurred , and , upon recommencing imatinib , he experienced painful enlargement of the right breast and scrotal swelling . he was diagnosed with male gynecomastia caused by decreased testosterone and non - communicative testicular hydrocele . he was given androgen support and a hydrocelectomy , which improved his gynecomastia . the mechanism by which imatinib induces gynecomastia and hydrocele is thought to be associated with an inhibition of c - kit and platelet - derive growth factor . this is the first report , to our knowledge , describing concurrent male gynecomastia and testicular hydrocele after imatinib treatment of a patient with gist .

it is frequently present in tailings , waste rock dumps , many valuable mineral raw materials , and coal . the oxidation of pyrite results in sulfuric acid and toxic trace metals formation in acid mine drainage ( amd ) , which is one of the most serious environmental problems facing the mining industry . that is why many studies have been carried out on the mechanism of pyrite 's oxidation during the last six decades by investigators from different areas , such as metallurgy and environment science [ 39 ] . now researchers have found that the oxygen and ferric iron play a very important role for the pyrite 's oxidation [ 10 , 11 ] and that some acidophilic microorganisms , for example , acidithiobacillus ferrooxidans and leptospirillum ferrooxidans , can accelerate the oxidation of pyrite greatly . according to the knowledge of people for the mechanism of pyrite decomposition , if it is no contact between pyrite and oxidants ( e.g. , o2 and fe ) , the rate of pyrite oxidation could be suppressed . for years , several techniques have been developed to reduce the oxidation of sulfide minerals , including bactericides , neutralization [ 15 , 16 ] , and cover treatment [ 1719 ] . however , most of these technologies are costly , short - term solutions , and difficult to apply . in parallel , many researchers have used certain chemical reagents that can create effective oxygen barriers to protect the surface of iron sulfide from oxidation . for example , both iron phosphate precipitates and silica precipitates have been shown to suppress pyrite oxidation efficiently . however , these treatments require initial surface oxidation with hydrogen peroxide , which is difficult to handle in a real application [ 20 , 21 ] . similarly , although some passivating agents such as acetyl acetone , humic acids , ammonium lignosulfonates , oxalic acid , and sodium silicate also have the capability to inhibit pyrite from oxidation , these treatments also need peroxidation , and the coating with oxalic acid requires a temperature control at 65c . in addition , elsetinow et al . have concluded that the formation of a passivating layer on the pyrite surface after exposure to the lipid could suppress pyrite oxidation by either interrupting the advection of aqueous oxidants or the electron transfer between oxidants and the pyrite . using the property of formation of strong insoluble chelating complex with fe , lan et al . have investigated the possibility of using 8-hydroxyquinoline as a passivating agent , and they demonstrated that the oxidation rates of pyrite could be reduced remarkably . in recent years , our laboratory has also developed a new passivating agent : triethylenetetramine ( teta ) . compared to the coating agents mentioned above , teta is currently used in the floatation process of sulfide minerals in inco limited as depressant ; therefore , it does not represent any extra cost . on the other hand , teta is a base which can neutralize protons produced in the oxidation of the sulphide minerals . teta has already been proved that it could retard the oxidation of pyrrhotite and need not initial oxidation [ 25 , 26 ] . however , there is not date on the capability of teta to passivate pyrite . in addition , all the studies cited above were carried out by the method of extraction using hydrogen peroxide or atmospheric oxygen as oxidant to test the coating effectiveness of different passivating agents . these processes usually require long times , and , moreover , the operation is complicated as the quantity of dissolved metal ions need to be monitored by techniques such as spectrophotometer . as the simplicity , efficacy , and low cost of these methods , electrochemical techniques are used extensively to investigate the corrosion of steel [ 2730 ] . nowadays , electrochemical techniques have been becoming essential measurements to evaluate the effect of inhibitors on the corrosion inhibition of steel . although pyrite is not a very good electrical conductor , its oxidation is usually described in terms of electrochemical corrosion mechanisms developed for metals [ 31 , 32 ] . therefore , electrochemical methods can be chosen to study the corrosion inhibition behavior of passivating agents on pyrite . the main aim of this study is to test the coating effectiveness of triethylenetetramine ( teta ) on pyrite using the open - circuit potential ( ocp ) , cyclic voltammetry ( cv ) , potentiodynamic polarization , and electrochemical impedance spectroscopy ( eis ) . natural pyrite was obtained from the dabaoshan sulfur - polymetallic mines in the north of guangdong province , china . its chemical composition analysis by x - ray fluorescence ( xrf ) is listed in table 1 . the xrd pattern ( figure 1 ) of the crushed sample is typical that was expected for pyrite and showed that it was including trace of quartz . the material was ground with an agate mortar and then sieved to isolate particles with a diameter of less than 75 m and stored in a vacuum desiccator before usage . 1 g of the pyrite powder was precisely weighed in a 50 ml glass beaker , and then 1 ml of coating solution was added . samples were rinsed well with the coating solution and dried overnight in a vacuum desiccator . these electrodes were consisted of 1.0 g graphite , 0.4 ml paraffin oil , and 0.5 g pristine or coated pyrite . the method of the construction of c paste electrode was described by arce and gonzlez , a total of 1.0 g of graphite was pulverized together with 0.5 g of pristine or coated pyrite in an agate mortar , then 0.4 ml of silicon oil was added in the powder and mixed to obtain a homogeneous paste . this paste was placed in a 7 cm long and 0.5 cm diameter glass tube . the electrode surface was compacted on a plate glass to make it flat , and its apparent active area was around 0.196 cm . from the other end of the tube , a copper wire with diameter of 1.5 mm was immersed in the paste as the conductor . prior to the electrochemical study , the surface of these c paste electrodes was sequentially polished with 300 , 600 , and 1200 grade silicon carbide paper . and then these electrodes were rinsed with distilled water and quickly transferred to the cell . the electrochemical measurements were performed in a typical electrochemical cell ( 200 ml ) with three electrodes : the working electrode ( carbon paste electrode with pristine or coated pyrite ) , the counter electrode ( a platinum foil electrode with 1 cm area ) , and the reference electrode ( kcl - saturated calomel electrode ) . the electrochemical measurements were performed by an electrochemical workstation ( 2273 , parstart ) , and the experimental data was recorded on a personal computer with suitable software . cyclic voltammetry ( cv ) experiments were conducted , starting from open - circuit potentials ( ocps ) , at a sweep rate of 100 mv s , and the scan range was from 0.6 v / sce to + 0.8 v / sce . polarization curves were measured over the range of ocp 200 mv at a constant rate of potential change of 1 mv s. from these polarization curves , corrosion current densities ( jcorr ) of different pyrite electrodes were obtained . then , the inhibition efficiency of teta on pyrite can be calculated by using the following equation : ( 1a)(%)=jcorrjcorr(inh)jcorr , where jcorr and jcorr(inh ) were the corrosion current density of pristine and coated pyrite samples , respectively . the impedance spectra were obtained by applying a signal on the ocp with a frequency range from 5 10 to 1 10hz with a sinusoidal excitation signal of 10 mv . the equivalent circuit rs(q1(r1q2 ) ) , as shown in figure 2 , was used to fit these impedance data . as bevilaqua et al . suggested , this equivalent circuit was simplified from the circuit of rs(r1q2(r2q2 ) ) , and it described a response of the corrosion process occurring at the open - circuit potential due to parallel anodic and cathodic reactions . in the circuit of rs(q1(r1q2 ) ) , rs represented the solution resistance , r1 was the charge transfer resistance in the initial stage of pyrite oxidation , q1 was the constant phase element which was associated with the capacitor of the double layer of the electrode / electrolyte interface with passive film , and q2 represented the diffusion impedance component , a reaction limited by the diffusion of oxygen . according to the values of charge transfer resistance , the inhibition efficiency ( ie ) was obtained by using the following equation : ( 1b)ie = r11r1(inh)1r11,where r1 and r1(inh ) were the charge transfer resistance values of pristine and coated pyrite samples , respectively . all potentials quoted in this paper are referenced to the saturated calomel electrode ( sce ) . figure 3 shows the ocps of the pyrite electrodes coated by different concentrations of teta . the ocp of the uncoated sample ( denoted as control ) was 362.8 mv , and the ocps of pyrite samples coated by 1% teta , 2% teta , 3% teta , and 5% teta were 304.8 mv , 279.2 mv , 261.7 mv , and 187.0 mv , respectively . it is obvious that the ocps of coated samples were lower than that of uncoated pyrite . the cv curves of the pristine and coated pyrite electrodes in 0.5 mol l h2so4 solution obtained by sweeping the potential from ocp towards negative direction are shown in figure 4 . the shape of the voltammetric curve was not significantly influenced by the presence of teta , indicating that the inhibitor does not change the mechanism of pyrite oxidation . these curves were similar to the other reported results [ 35 , 36 ] , in which the reduction peaks between 0.4 v and 0.2 v can be interpreted as two possible reactions : ( 1 ) the reduction of s formed during the handling and preparation of samples and ( 2 ) the reduction of fes2(s ) to form fes(s ) and h2s . the reversal of potential scan produces three anodic current peaks : a1 , a2 , and a3 . a1 is attributed to the oxidation of the h2s formed electrochemically during the oxidation scan . a2 results from the oxidation of pyrite , via two steps [ 37 , 38 ] . the first step is ( 2)fes2fe2++2s0 + 2e the second step is : ( 3)fe2++3h2ofe(oh)3 + 3h++e at high potentials , the oxidation of sulfur to sulfate is expected to occur , contributing to the appearance of the anodic current peak a3 . figure 5 shows the cv curves of the pristine and coated pyrite electrode when the potentials were initially swept from ocp towards the positive direction . in addition to the anodic and cathodic current peaks mentioned above , another cathodic current peak between 0.3 v and 0.4 v appeared when the potential scan was reversed . the evidence of pyrite passivation by teta can be made by measuring its electrochemical activity . comparing the cv curves of the pyrite samples coated by various concentrations of teta , all of the anodic and cathodic current peaks are decreased with an increase in teta . when 5% of teta was adopted in the coating treatment , the anodic and cathodic current peaks almost could not be detected . this proves that less - electrochemical activity takes place on the surface of pyrite after being coated by teta . the decrease of electrochemical activity should be attributed to the formation of a protective layer of teta on the surface of pyrite samples . as we know , there are several amine molecules in the structure of teta , consequently , teta can be absorbed on the pyrite surface through coordination bond formation between the iron in pyrite and to the electron pair on the nitrogen atom . the inhibition efficiencies therefore depend on the coverage area of the adsorbed molecule . with an increase of the concentration of teta , there is much larger surface area of pyrite coated by teta , so the inhibition efficiency increases . the tafel polarization curves for the pristine and coated pyrite electrodes in 0.5 mol l h2so4 solution are shown in figure 6 . it was clear that the addition of teta caused more negative shift in corrosion potential ( ecorr ) especially in high concentrations . it should be pointed out that the value of the corrosion potential of the same electrode in the same electrolyte was different from the value of the open - circuit potential . this phenomenon was due to the concentrations of reductive products at the interface of the electrode being higher than in a real solution when the applied potential was swept from negative to positive potentials , so the corrosion potential obtained by the polarization curve is lower than the open - circuit potential . from the tafel polarization curves , some electrochemical corrosion kinetic parameters can be obtained , such as the corrosion potential ( ecorr ) , cathodic and anodic tafel slopes ( c , a ) , and corrosion current density ( jcorr ) , which are listed in table 2 . from the values of cathodic and anodic tafel slopes , both cathodic and anodic processes were found that are inhibited by the coating of teta . the cathodic tafel slopes were slightly decreased from 9.59 dec / v to 7.70 dec / v when the concentration of teta increasing from 0% to 5% . this indicated that the cathodic reaction ( the reduction of fes2 ) is slightly inhibited by teta . when the pyrite samples were coated by teta , the anodic slopes decreased remarkably , which indicates that the inhibition of pyrite dissolution by teta is mainly controlled by the anodic process . therefore , teta can be classified as inhibitors of relatively mixed effect ( anodic / cathodic inhibition ) in acid solution . the inhibition efficiencies ( % ) have been calculated by using ( 1a ) , which shows that the inhibition efficiency increases and the corrosion current density decreases with the increase of the teta concentration . an increase from 42.08% to 80.98% was found when the concentration of teta increased from 1% to 5% . this could be explained that there is a larger surface area of pyrite sample coated by teta with the increase of teta concentration . the experimental and simulated impedance diagrams for pyrite samples coated by different concentrations of teta are presented in figure 7 . table 3 shows the quantitative results for impedance which fitted using the equivalent circuit rs(q1(r1q2 ) ) as mentioned above . the fact of a low value of x , which represents the sum of quadratic deviations between experimental and calculated data suggested that the proposed circuit is suitable for explaining the eis spectra . because all of the experiments were carried out in the same electrolyte , the values of the solution resistance ( rs ) were almost no change r1 increased from the value of 43.7 cm for the pristine pyrite to 283.6 cm for the pyrite coated by highest concentration of teta , which indicates that the corrosion of pyrite is obviously inhibited in the presence of teta . according to ( 1b ) , the inhibition efficiencies ( ie ) have been calculated . the obtained results show that the inhibition efficiency increases , while the charge transfer resistance increased when the concentration of the teta increased . the results obtained from the eis method were in good agreement with those obtained from the polarization measurements . the feasibility of using teta as a protecting agent to reduce the oxidation of pyrite had been studied using electrochemical technique . the results show that teta is an efficient coating agent in preventing the oxidation of pyrite , and the inhibition efficiency was more pronounced with teta concentration . the cv measurements reveal that teta possessed strong capability to be used as passivation agent for amd control . the potentiodynamic polarization curves indicate that teta inhibited both anodic pyrite dissolution and also cathodic hydrogen evolution reactions , and it acted as mixed type inhibitor in acid solution . the values of inhibition efficiency obtained from the eis method are in good agreement with the results of polarization measurement .

the potential of triethylenetetramine ( teta ) to inhibit the oxidation of pyrite in h2so4 solution had been investigated by using the open - circuit potential ( ocp ) , cyclic voltammetry ( cv ) , potentiodynamic polarization , and electrochemical impedance ( eis ) , respectively . experimental results indicate that teta is an efficient coating agent in preventing the oxidation of pyrite and that the inhibition efficiency is more pronounced with the increase of teta . the data from potentiodynamic polarization show that the inhibition efficiency ( % ) increases from 42.08% to 80.98% with the concentration of teta increasing from 1% to 5% . these results are consistent with the measurement of eis ( 43.09% to 82.55% ) . the information obtained from potentiodynamic polarization also displays that the teta is a kind of mixed type inhibitor .

the dpp was a randomized , controlled clinical trial from 1996 to 2001 at 27 sites in the u.s . , comparing the effects of intensive lifestyle intervention , metformin , or placebo on the development of diabetes in adults at high risk for the disease . the eligibility criteria , design , and methods of the dpp have been described in detail elsewhere ( 2 ) . in brief , inclusion criteria included age 25 years , bmi 24 kg / m ( 22 kg / m in asian americans ) , fasting plasma glucose between 5.3 and 6.9 mmol / l ( 95125 mg / dl ) ( 6.9 mmol / l for american indian sites ) , and plasma glucose between 7.8 and 11 mmol / l ( 140199 mg / dl ) after a 75-g oral glucose tolerance test . the institutional review board at each site approved the protocol , and all participants gave written informed consent . all participants were given standard advice on healthy diet and physical activity before randomization to one of three arms : intensive program of lifestyle modification ( aiming to achieve a weight reduction of at least 7% of initial body weight ) , standard lifestyle recommendations plus metformin , or standard lifestyle recommendations plus placebo ( 2 ) . the present observational study was conducted among participants randomized to two arms , the intensive lifestyle ( n = 1,079 ) and placebo ( standard lifestyle , n = 1,082 ) . the metformin arm was excluded to minimize the cost associated with measurement of 25-hydroxyvitamin d. also , 122 participants were excluded because of lack of consent for ancillary studies ( n = 120 ) , or no available specimen for measurement of 25-hydroxyvitamin d at baseline or 6-month follow - up visits ( n = 2 ) . after exclusions , 2,039 participants were included in the initial multivariate analyses that included age , sex , and bmi as covariates , and 2,002 participants with complete data for all covariates were included in the additional multivariate analyses . plasma 25-hydroxyvitamin d concentration was measured in samples stored at 70c from the baseline , 6-month , 1-year , 2-year , 3-year , and 4-year follow - up visits . stability of vitamin d metabolites during transport and long - term freezing has been documented previously ( 25,26 ) . plasma 25-hydroxyvitamin d was measured at the metabolic laboratory at tufts medical center by liquid chromatography , tandem mass spectrometry ( lc / ms / ms ) ( waters acquity uplc with tqd triple quadrupole mass spectrometer ) , certified through the national institute of standards and technology ( nist ) vitamin d quality assurance program ( 27 ) . in the most recent testing , correlation with the nist external standard for total 25-hydroxyvitamin d was 0.994 . the primary dpp outcome , development of diabetes , was assessed using strict laboratory criteria , according to the protocol based on oral glucose ( 75-g ) tolerance testing performed annually and fasting plasma glucose performed semiannually or when symptoms consistent with hyperglycemia occurred ( 2,28 ) . if a participant was started on a diabetes medication by their physician , they were asked to stop the medication and return for glucose testing to confirm the diagnosis of diabetes . the self - reported level of leisure physical activity was assessed annually with the modifiable activity questionnaire and expressed as the average metabolic equivalent ( met - hours ) per week for the previous year ( 2 ) . usual daily nutrient intake during the previous year was assessed at baseline and at the 1-year follow - up visits with the use of a modified version of the block food - frequency questionnaire , and calcium intake was estimated as described previously ( 29 ) . standardized interviewer - administered questionnaires were used annually to obtain self - reported data on personal medical history , smoking , medications , alcohol use , and family medical history . weight was measured using a standard calibrated scale , height was measured with a standard stadiometer , and bmi was calculated ( kg / m ) . measurement methods for hemoglobin a1c , glucose , c - reactive protein , and creatinine have been described previously ( 2 ) . to adjust for sun exposure variability at each dpp study site , we constructed an ultraviolet index for each site based on the national weather service data on the monthly means of ultraviolet index for each geographic location in 1997 ( 30 ) . discrete - time proportional hazards models were used to assess the association between plasma 25-hydroxvitamin d ( in tertiles ) and incident diabetes to account for interval - censored data ( data for diabetes status and other variables were available at 6-month intervals ) and time - dependent covariates ( 25-hydroxyvitamin d , bmi , and physical activity ) . in multivariate models , we adjusted for potential confounders including dpp clinical site location ( categorical variable , 127 ) , age ( years ) , sex ( male or female ) , bmi ( kg / m ) , race ( white , black , or other ) , family history of diabetes ( yes or no ) , history of hypertension at baseline ( yes or no ) , smoking status at baseline ( never , past , or currently smoking ) , alcohol and calcium consumption ( average of values self - reported at baseline and 1-year follow - up visits [ g / day and mg / day , respectively ] ) , plasma c - reactive protein ( average of values at baseline , 6-month , and 1-year follow - up visits [ mg / dl ] ) , glomerular filtration rate using the modification of diet in renal disease estimation ( 31 ) ( average of values at baseline , 6-month , and 1-year follow - up visits [ ml / min/1.73 m ] ) , and physical activity ( met - hours per week ) . we also adjusted for ultraviolet radiation index at the participant s study site ( mean annual in 1997 , 90 j / m / h ) . although adjustment for bmi and physical activity reflect the main effects of the intensive lifestyle intervention , to account for additional unmeasured effects of intervention , all analyses were adjusted for treatment assignment ( lifestyle intervention , yes or no ) . the predictor ( 25-hydroxyvitamin d ) and other variables ( bmi and physical activity ) , whose value was measured at multiple time points , entered the analyses as time - varying lagged covariates . at each successive 6-month time point when the outcome ( diabetes ) was assessed , the value of these variables was calculated as the mean of the current and most recent available value prior to that visit . for the time - varying variables , if either the current or most recent value was missing , we imputed values using the nonmissing observation ( current or most recent ) . if both current and most recent values were missing , then no value was imputed . plasma 25-hydroxyvitamin d exhibited a normal distribution and entered the multivariate models on a continuous scale . for ease of interpretation , we present results after participants were categorized into three groups using tertiles ( 33.3rd and 66.7th percentiles ) of plasma 25-hydroxyvitamin d concentration , as the mean of the values obtained at baseline and 6-month visits , to account for season differences . the hazard ratio ( hr ) of diabetes in each of the two highest tertiles was compared with the lowest tertile by extrapolating the per - unit change in estimated hazard from the multivariate model . we repeated analyses using the cut points for plasma 25-hydroxyvitamin d ( as the mean of the values obtained at baseline and 6-month visits ) , recommended for skeletal outcomes by the 2011 iom report , as follows : < 12 ng / ml ( at risk for deficiency , reference group ) , 1219.9 ng / ml ( at risk for inadequacy ) , 2029.9 ng / ml ( adequacy ) , 3049.9 ng / ml ( potentially beneficial ) , and 50 ng / ml ( potentially harmful ) ( 32 ) . results are presented for categories of plasma 25-hydroxyvitamin d concentration as the mean of the values obtained at baseline and 6-month visits , based on cut points suggested by the iom dietary reference intakes for calcium and vitamin d report ( 24 ) . the results of the hr of diabetes in each of the higher groups were compared with the lowest group by extrapolating the per - unit change in estimated hazard from the multivariate model . we also conducted secondary analyses by tertiles and iom cut points using data only from the baseline visit to compare with the repeated measures analyses ( 33 ) . we performed subgroup analyses to examine potential effect modification by the following covariates : treatment arm ( intensive lifestyle or placebo ) , baseline age ( median cohort value , < 50 or 50 years ) , sex ( male or female ) , race / ethnicity ( white or nonwhite ) , baseline bmi ( overweight , < 30 k / m , or obese , 30 k / m ) , and baseline total calcium intake ( median cohort value , < 921 or 921 mg / day ) . we checked for the statistical significance of the interaction by using wald tests ( 34 ) . regression assumptions of proportional hazards and linearity were assessed for violations , and all p values were based on two - sided tests . statistical analyses were performed using sas version 9.2 ( sas , cary , nc ) . the dpp was a randomized , controlled clinical trial from 1996 to 2001 at 27 sites in the u.s . , comparing the effects of intensive lifestyle intervention , metformin , or placebo on the development of diabetes in adults at high risk for the disease . the eligibility criteria , design , and methods of the dpp have been described in detail elsewhere ( 2 ) . in brief , inclusion criteria included age 25 years , bmi 24 kg / m ( 22 kg / m in asian americans ) , fasting plasma glucose between 5.3 and 6.9 mmol / l ( 95125 mg / dl ) ( 6.9 mmol / l for american indian sites ) , and plasma glucose between 7.8 and 11 mmol / l ( 140199 mg / dl ) after a 75-g oral glucose tolerance test . the institutional review board at each site approved the protocol , and all participants gave written informed consent . all participants were given standard advice on healthy diet and physical activity before randomization to one of three arms : intensive program of lifestyle modification ( aiming to achieve a weight reduction of at least 7% of initial body weight ) , standard lifestyle recommendations plus metformin , or standard lifestyle recommendations plus placebo ( 2 ) . the present observational study was conducted among participants randomized to two arms , the intensive lifestyle ( n = 1,079 ) and placebo ( standard lifestyle , n = 1,082 ) . the metformin arm was excluded to minimize the cost associated with measurement of 25-hydroxyvitamin d. also , 122 participants were excluded because of lack of consent for ancillary studies ( n = 120 ) , or no available specimen for measurement of 25-hydroxyvitamin d at baseline or 6-month follow - up visits ( n = 2 ) . after exclusions , 2,039 participants were included in the initial multivariate analyses that included age , sex , and bmi as covariates , and 2,002 participants with complete data for all covariates were included in the additional multivariate analyses . plasma 25-hydroxyvitamin d concentration was measured in samples stored at 70c from the baseline , 6-month , 1-year , 2-year , 3-year , and 4-year follow - up visits . stability of vitamin d metabolites during transport and long - term freezing has been documented previously ( 25,26 ) . plasma 25-hydroxyvitamin d was measured at the metabolic laboratory at tufts medical center by liquid chromatography , tandem mass spectrometry ( lc / ms / ms ) ( waters acquity uplc with tqd triple quadrupole mass spectrometer ) , certified through the national institute of standards and technology ( nist ) vitamin d quality assurance program ( 27 ) . in the most recent testing , correlation with the nist external standard for total 25-hydroxyvitamin d was 0.994 . the primary dpp outcome , development of diabetes , was assessed using strict laboratory criteria , according to the protocol based on oral glucose ( 75-g ) tolerance testing performed annually and fasting plasma glucose performed semiannually or when symptoms consistent with hyperglycemia occurred ( 2,28 ) . if a participant was started on a diabetes medication by their physician , they were asked to stop the medication and return for glucose testing to confirm the diagnosis of diabetes . the self - reported level of leisure physical activity was assessed annually with the modifiable activity questionnaire and expressed as the average metabolic equivalent ( met - hours ) per week for the previous year ( 2 ) . usual daily nutrient intake during the previous year was assessed at baseline and at the 1-year follow - up visits with the use of a modified version of the block food - frequency questionnaire , and calcium intake was estimated as described previously ( 29 ) . standardized interviewer - administered questionnaires were used annually to obtain self - reported data on personal medical history , smoking , medications , alcohol use , and family medical history . weight was measured using a standard calibrated scale , height was measured with a standard stadiometer , and bmi was calculated ( kg / m ) . measurement methods for hemoglobin a1c , glucose , c - reactive protein , and creatinine have been described previously ( 2 ) . to adjust for sun exposure variability at each dpp study site , we constructed an ultraviolet index for each site based on the national weather service data on the monthly means of ultraviolet index for each geographic location in 1997 ( 30 ) . discrete - time proportional hazards models were used to assess the association between plasma 25-hydroxvitamin d ( in tertiles ) and incident diabetes to account for interval - censored data ( data for diabetes status and other variables were available at 6-month intervals ) and time - dependent covariates ( 25-hydroxyvitamin d , bmi , and physical activity ) . in multivariate models , we adjusted for potential confounders including dpp clinical site location ( categorical variable , 127 ) , age ( years ) , sex ( male or female ) , bmi ( kg / m ) , race ( white , black , or other ) , family history of diabetes ( yes or no ) , history of hypertension at baseline ( yes or no ) , smoking status at baseline ( never , past , or currently smoking ) , alcohol and calcium consumption ( average of values self - reported at baseline and 1-year follow - up visits [ g / day and mg / day , respectively ] ) , plasma c - reactive protein ( average of values at baseline , 6-month , and 1-year follow - up visits [ mg / dl ] ) , glomerular filtration rate using the modification of diet in renal disease estimation ( 31 ) ( average of values at baseline , 6-month , and 1-year follow - up visits [ ml / min/1.73 m ] ) , and physical activity ( met - hours per week ) . we also adjusted for ultraviolet radiation index at the participant s study site ( mean annual in 1997 , 90 j / m / h ) . although adjustment for bmi and physical activity reflect the main effects of the intensive lifestyle intervention , to account for additional unmeasured effects of intervention , all analyses were adjusted for treatment assignment ( lifestyle intervention , yes or no ) . the predictor ( 25-hydroxyvitamin d ) and other variables ( bmi and physical activity ) , whose value was measured at multiple time points , entered the analyses as time - varying lagged covariates . at each successive 6-month time point when the outcome ( diabetes ) was assessed , the value of these variables was calculated as the mean of the current and most recent available value prior to that visit . for the time - varying variables , if either the current or most recent value was missing , we imputed values using the nonmissing observation ( current or most recent ) . if both current and most recent values were missing , then no value was imputed . plasma 25-hydroxyvitamin d exhibited a normal distribution and entered the multivariate models on a continuous scale . for ease of interpretation , we present results after participants were categorized into three groups using tertiles ( 33.3rd and 66.7th percentiles ) of plasma 25-hydroxyvitamin d concentration , as the mean of the values obtained at baseline and 6-month visits , to account for season differences . the hazard ratio ( hr ) of diabetes in each of the two highest tertiles was compared with the lowest tertile by extrapolating the per - unit change in estimated hazard from the multivariate model . we repeated analyses using the cut points for plasma 25-hydroxyvitamin d ( as the mean of the values obtained at baseline and 6-month visits ) , recommended for skeletal outcomes by the 2011 iom report , as follows : < 12 ng / ml ( at risk for deficiency , reference group ) , 1219.9 ng / ml ( at risk for inadequacy ) , 2029.9 ng / ml ( adequacy ) , 3049.9 ng / ml ( potentially beneficial ) , and 50 ng / ml ( potentially harmful ) ( 32 ) . results are presented for categories of plasma 25-hydroxyvitamin d concentration as the mean of the values obtained at baseline and 6-month visits , based on cut points suggested by the iom dietary reference intakes for calcium and vitamin d report ( 24 ) . the results of the hr of diabetes in each of the higher groups were compared with the lowest group by extrapolating the per - unit change in estimated hazard from the multivariate model . we also conducted secondary analyses by tertiles and iom cut points using data only from the baseline visit to compare with the repeated measures analyses ( 33 ) . we performed subgroup analyses to examine potential effect modification by the following covariates : treatment arm ( intensive lifestyle or placebo ) , baseline age ( median cohort value , < 50 or 50 years ) , sex ( male or female ) , race / ethnicity ( white or nonwhite ) , baseline bmi ( overweight , < 30 k / m , or obese , 30 k / m ) , and baseline total calcium intake ( median cohort value , < 921 or 921 mg / day ) . we checked for the statistical significance of the interaction by using wald tests ( 34 ) . regression assumptions of proportional hazards and linearity were assessed for violations , and all p values were based on two - sided tests . statistical analyses were performed using sas version 9.2 ( sas , cary , nc ) . at baseline , the average age of the cohort was 51 years and average bmi was 34 kg / m ( table 1 ) . the racial distribution was diverse : 57% caucasian and 21% african american , and the remaining participants were hispanic american , asian american or pacific islander , or native american . the mean self - reported calcium intake was 1,106 mg / dl and plasma 25-hydroxyvitamin d concentration was 21.6 ng / ml . based on the 2011 iom report ( 24 ) , 45% of the cohort had inadequate calcium intake at baseline and approximately half ( 49% ) were at risk for deficiency or inadequacy for vitamin d ( defined as 25-hydroxyvitamin d < 20 ng / ml ) . participants in the highest tertile of plasma 25-hydroxyvitamin d concentration were more likely to be older , male , caucasian , and less overweight . they also had lower fasting plasma glucose , hemoglobin a1c , c - reactive protein , and kidney function ; reported higher physical activity and alcohol and calcium intake ; and were more likely to reside in areas with higher annual ultraviolet index . baseline characteristics of the dpp cohort included in the current study participants were followed for an average of 2.7 years ( range 0.54.5 ) . on a continuous scale , for every 5 ng / ml increase in 25-hydroxyvitamin d , there was a 13% decrease in the risk of progression to diabetes ( hr 0.87 [ 95% ci 0.820.92 ] ; p value < 0.0001 for every 5-unit increase in 25-hydroxyvitamin d ) . when we categorized participants into tertiles , there was a 39% lower risk among those in the highest tertile ( median [ iqr ] 25-hydroxyvitamin d , 30.1 [ 27.034.5 ] ng / ml ) compared with those in the lowest tertile ( 12.8 [ 10.414.9 ] ng / ml ) after adjustment for age and sex ( table 2 ) . further multivariate adjustment for a variety of diabetes risk factors , including change in physical activity and bmi during the study duration , and randomization to the dpp intervention ( lifestyle or placebo ) attenuated the association , but it remained statistically significant ( hr 0.72 [ 95% ci 0.560.90 ] , comparing the third and first tertile ) . additionally adjusting for ultraviolet radiation index did not change the association ( data not shown ) . using data from the baseline visit only , the association between 25-hydroxyvitamin d and diabetes was in the same direction but was not statistically significant ( 0.94 [ 0.751.17 ] , comparing the third and first tertile ) . risk for incident diabetes by tertiles of continuous plasma 25-hydroxyvitamin d concentration in the lifestyle and placebo arms of the dpp in analyses by categories of plasma 25-hydroxyvitamin d using cut points recommended for skeletal outcomes by the 2011 iom report ( 24 ) , participants with 25-hydroxyvitamin d concentration > 30 ng / ml had a lower risk compared with those < 30 ng / ml , whereas those in the highest category had a 60% lower risk of developing diabetes compared with participants in the lowest category ( hr 0.40 [ 95% ci 0.200.81 ] , for 25-hydroxyvitamin d 50 however , there were very few participants and diabetes cases in the highest category . additionally adjusting for ultraviolet radiation index did not change the association ( data not shown ) . using data from the baseline visit only , the association between 25-hydroxyvitamin d by iom cut points and diabetes was also the same direction but was not statistically significant ( 0.89 [ 0.471.65 ] , for 25-hydroxyvitamin d 50 risk for incident diabetes by categorical cut points of plasma 25-hydroxyvitamin d concentration in the lifestyle and placebo arms of the dpp the inverse associations between plasma 25-hydroxyvitamin d and incident diabetes were generally consistent across all subgroups ( table 4 ) . the association between 25-hydroxyvitamin d and diabetes appeared to be stronger among participants randomized to placebo compared with lifestyle ( hr 0.70 [ 95% ci 0.520.94 ] vs. 0.80 [ 0.541.17 ] , respectively ) ; among those older than 50 years compared with those younger than 50 years ( 0.64 [ 0.460.90 ] vs. 0.81 [ 0.571.12 ] ) ; among women versus men ( 0.68 [ 0.500.91 ] vs. 0.82 [ 0.551.19 ] ) ; among obese versus nonobese ( 0.70 [ 0.520.93 ] vs. 0.78 [ 0.501.18 ] , and among those with self - reported calcium intake 921 mg / dl versus < 921 mg / dl ( 0.59 [ 0.420.82 ] vs. 0.84 [ 0.591.16 ] ) . however , the study had inadequate power to assess the significance of the association within subgroups , and the tests for interaction were not statistically significant in any of the strata analyzed ( p for interactions > 0.40 ) ( table 4 ) . risk for incident diabetes by tertiles of plasma 25-hydroxyvitamin d concentration in the lifestyle and placebo arms of the dpp by subgroups at baseline , the average age of the cohort was 51 years and average bmi was 34 kg / m ( table 1 ) . the racial distribution was diverse : 57% caucasian and 21% african american , and the remaining participants were hispanic american , asian american or pacific islander , or native american . the mean self - reported calcium intake was 1,106 mg / dl and plasma 25-hydroxyvitamin d concentration was 21.6 ng / ml . based on the 2011 iom report ( 24 ) , 45% of the cohort had inadequate calcium intake at baseline and approximately half ( 49% ) were at risk for deficiency or inadequacy for vitamin d ( defined as 25-hydroxyvitamin d < 20 ng / ml ) . participants in the highest tertile of plasma 25-hydroxyvitamin d concentration were more likely to be older , male , caucasian , and less overweight . they also had lower fasting plasma glucose , hemoglobin a1c , c - reactive protein , and kidney function ; reported higher physical activity and alcohol and calcium intake ; and were more likely to reside in areas with higher annual ultraviolet index . participants were followed for an average of 2.7 years ( range 0.54.5 ) . on a continuous scale , for every 5 ng / ml increase in 25-hydroxyvitamin d , there was a 13% decrease in the risk of progression to diabetes ( hr 0.87 [ 95% ci 0.820.92 ] ; p value < 0.0001 for every 5-unit increase in 25-hydroxyvitamin d ) . when we categorized participants into tertiles , there was a 39% lower risk among those in the highest tertile ( median [ iqr ] 25-hydroxyvitamin d , 30.1 [ 27.034.5 ] ng / ml ) compared with those in the lowest tertile ( 12.8 [ 10.414.9 ] ng / ml ) after adjustment for age and sex ( table 2 ) . further multivariate adjustment for a variety of diabetes risk factors , including change in physical activity and bmi during the study duration , and randomization to the dpp intervention ( lifestyle or placebo ) attenuated the association , but it remained statistically significant ( hr 0.72 [ 95% ci 0.560.90 ] , comparing the third and first tertile ) . additionally adjusting for ultraviolet radiation index did not change the association ( data not shown ) . using data from the baseline visit only , the association between 25-hydroxyvitamin d and diabetes was in the same direction but was not statistically significant ( 0.94 [ 0.751.17 ] , comparing the third and first tertile ) . risk for incident diabetes by tertiles of continuous plasma 25-hydroxyvitamin d concentration in the lifestyle and placebo arms of the dpp in analyses by categories of plasma 25-hydroxyvitamin d using cut points recommended for skeletal outcomes by the 2011 iom report ( 24 ) , participants with 25-hydroxyvitamin d concentration > 30 ng / ml had a lower risk compared with those < 30 ng / ml , whereas those in the highest category had a 60% lower risk of developing diabetes compared with participants in the lowest category ( hr 0.40 [ 95% ci 0.200.81 ] , for 25-hydroxyvitamin d 50 however , there were very few participants and diabetes cases in the highest category . additionally adjusting for ultraviolet radiation index did not change the association ( data not shown ) . using data from the baseline visit only , the association between 25-hydroxyvitamin d by iom cut points and diabetes was also the same direction but was not statistically significant ( 0.89 [ 0.471.65 ] , for 25-hydroxyvitamin d 50 risk for incident diabetes by categorical cut points of plasma 25-hydroxyvitamin d concentration in the lifestyle and placebo arms of the dpp the inverse associations between plasma 25-hydroxyvitamin d and incident diabetes were generally consistent across all subgroups ( table 4 ) . the association between 25-hydroxyvitamin d and diabetes appeared to be stronger among participants randomized to placebo compared with lifestyle ( hr 0.70 [ 95% ci 0.520.94 ] vs. 0.80 [ 0.541.17 ] , respectively ) ; among those older than 50 years compared with those younger than 50 years ( 0.64 [ 0.460.90 ] vs. 0.81 [ 0.571.12 ] ) ; among women versus men ( 0.68 [ 0.500.91 ] vs. 0.82 [ 0.551.19 ] ) ; among obese versus nonobese ( 0.70 [ 0.520.93 ] vs. 0.78 [ 0.501.18 ] , and among those with self - reported calcium intake 921 mg / dl versus < 921 mg / dl ( 0.59 [ 0.420.82 ] vs. 0.84 [ 0.591.16 ] ) . however , the study had inadequate power to assess the significance of the association within subgroups , and the tests for interaction were not statistically significant in any of the strata analyzed ( p for interactions > 0.40 ) ( table 4 ) . risk for incident diabetes by tertiles of plasma 25-hydroxyvitamin d concentration in the lifestyle and placebo arms of the dpp by subgroups in this unique cohort of u.s . adults at high risk for diabetes , higher plasma 25-hydroxyvitamin d concentrations , assessed repeatedly during the follow - up period , were associated with lower risk of diabetes , even after adjusting for weight loss and lifestyle interventions ( dietary changes and increased physical activity ) known to decrease diabetes risk . our results are consistent with those from other observational longitudinal studies that have reported on the association between vitamin d status and risk of developing type 2 diabetes ( 79,1115,35,36 ) . the association between higher vitamin d levels and lower risk of type 2 diabetes was statistically significant in seven published cohorts ( 7,9,1113,15,36 ) and was in the same direction , albeit not statistically significant , in three other cohorts ( 8,9,35 ) . in one cohort among older postmenopausal women , lower serum 25-hydroxyvitamin d was not associated with increased risk of developing type 2 diabetes ( 14 ) . our study offers a methodological advantage over previous studies , which assessed vitamin d status ( either by self - reported total vitamin d intake , predicted 25-hydroxyvitamin d score , or blood 25-hydroxyvitamin d concentration [ 9,1214,36 ] ) based on a single baseline measurement , which may not reflect long - term vitamin d status . use of repeated measurements and cumulative averages of dietary variables has been shown to yield stronger associations than use of a single baseline measurement ( 33 ) , and this was the case in our study . the need for repeated measurements is especially true with vitamin d , as single measurements of 25-hydroxyvitamin d may not reflect vitamin d status over time , owing to changes in dietary and other lifestyle changes , weight changes , sun exposure , and other relevant factors that may change during follow - up . measuring 25-hydroxyvitamin d at multiple time points during follow - up allowed us to reduce measurement error and obtain an integrated measure that reflects long - term vitamin d status for each participant , which may be more relevant etiologically than the most remote ( baseline ) value ( 33 ) . an alternative explanation of our results may be that plasma 25-hydroxyvitamin d is a marker of the dpp treatment effects from increased physical activity and weight loss ; however , the association remained after we adjusted for the main effects of the dpp intervention ( changes in physical activity and weight ) during the study period . although the analyses adjusted for these factors , residual confounding can not be excluded . our study has additional strengths , such as the inclusion of a large clinically relevant population at high risk for diabetes with a substantial proportion of nonwhite participants , which improves the external validity of our results because they are directly applicable to people at risk for diabetes who are in need for effective interventions to delay progression to diabetes . also , the diagnosis of diabetes was rigorously evaluated and confirmed based on repeated laboratory measures , which is in contrast with other observational studies that ascertained diabetes by validated self - report ( 7,8,12,14,35 ) , combination of self - report and laboratory measurement ( 11 ) , or registry - based data ( 9,36 ) . furthermore , the method we used to measure 25-hydroxyvitamin d has been validated through the nist vitamin d quality assurance program ( 27 ) . the results from small clinical trials and post hoc analyses of larger trials on the effect of vitamin d supplementation on glycemia or incident diabetes have been inconsistent ( 1623,3739 ) . in these studies , vitamin d appears to have beneficial effects only in people at risk for diabetes ( 17,20,23 ) , which is consistent with the findings of the current study . in contrast , vitamin d supplementation appears to have no effect among those with normal glucose tolerance , or a very small effect that would require a very large sample population to detect ( 17,18,22,37,39 ) . the studies that have reported on the effect of vitamin d supplementation on glycemia in patients with established type 2 diabetes were underpowered to draw any firm conclusions . the hypothesis that vitamin d may be relevant to prevention of type 2 diabetes is biologically plausible . both insulin resistance and impaired pancreatic -cell function have been reported with vitamin d insufficiency ( 4 ) . vitamin d may have a direct effect mediated by binding of the active form , 1,25(oh)2d , to the vitamin d receptor expressed in pancreatic -cells . the presence of the vitamin d response element in the human insulin gene promoter and transcriptional activation of the human insulin gene caused by 1,25(oh)2d further support a direct effect of vitamin d on insulin synthesis and secretion . finally , activation of vitamin d may occur within the -cell by 25-ohd-1-hydroxylase ( cyp27b1 ) , which is expressed in -cells . although 25-hydroxyvitamin d is a well - established biomarker of exposure for vitamin d due to intake or biosynthesis , there is a lack of clarity regarding the validity of 25-hydroxyvitamin d as a marker of biological effects ( 24 ) . the 2011 iom dietary reference intakes for calcium and vitamin d report concluded that adequate evidence for setting dietary reference intakes for vitamin d exists only in relation to skeletal outcomes and recommended a 25-hydroxyvitamin d level > 20 ng / ml as sufficient . for nonskeletal outcomes , including diabetes , the iom report concluded that available data are inconclusive and therefore not sufficient for dietary reference intakes development . the report also noted that levels > 30 ng / ml are not consistently associated with increased benefit , whereas a level > 50 ng / ml may be a reason for concern . our results support the hypothesis that higher blood 25-hydroxyvitamin d ( > 30 ng / ml ) is associated with lower risk of diabetes , and the observed inverse association was linear at all levels of 25-hydroxyvitamin d. although our study included very few participants with very high ( 50 ng / ml ) 25-hydroxyvitamin d levels , potentially limiting interpretation , this group appeared to have the lowest risk of progressing to diabetes , and our modeling of vitamin d levels as a continuous linear variable supports a benefit for this upper tail of the distribution . in subgroup analyses , the inverse associations between plasma 25-hydroxyvitamin d and incident diabetes were consistent , across all subgroups . the association appeared to be stronger among participants randomized to placebo , those older than 50 years , obese people , women , and those with higher calcium intake . it is important to note that the tests for interaction were not statistically significant ; therefore , no firm conclusions can be drawn from these subgroup analyses . of note , the observed inverse association between vitamin d status and incident diabetes did not appear to be affected by race ( as a proxy for the altered vitamin d homeostasis in people with dark skin ) . these data suggest that although there are well - recognized differences in vitamin d metabolism among different race / ethnic groups ( 40 ) , higher vitamin d status is associated with lower risk of diabetes among all people regardless of skin color . in conclusion , higher vitamin d status , assessed by plasma 25-hydroxyvitamin d concentration measured repeatedly during follow - up , was associated with a lower risk of incident diabetes among people at high risk for the disease . if these results are confirmed in ongoing and planned randomized trials of vitamin d , they will have important public health implications because both of these interventions can be implemented easily and inexpensively to prevent progression of type 2 diabetes among those at high risk .

objectiveto investigate the association between vitamin d status , assessed by plasma 25-hydroxyvitamin d , and risk of incident diabetes.research design and methodsprospective observational study with a mean follow - up of 2.7 years in the diabetes prevention program ( dpp ) , a multicenter trial comparing different strategies for prevention of diabetes in patients with prediabetes . we assessed the association between plasma 25-hydroxyvitamin d , measured repeatedly during follow - up , and incident diabetes in the combined placebo ( n = 1,022 ) and intensive lifestyle ( n = 1,017 ) randomized arms of the dpp . variables measured at multiple study time points ( 25-hydroxyvitamin d , bmi , and physical activity ) entered the analyses as time - varying lagged covariates , as the mean of the previous and current visits at which diabetes status was assessed.resultsafter multivariate adjustment , including for the dpp intervention , participants in the highest tertile of 25-hydroxyvitamin d ( median concentration , 30.1 ng / ml ) had a hazard ratio of 0.72 ( 95% ci 0.560.90 ) for developing diabetes compared with participants in the lowest tertile ( median concentration , 12.8 ng / ml ) . the association was in the same direction in placebo ( 0.70 ; 0.520.94 ) versus lifestyle arm ( 0.80 ; 0.541.17).conclusionshigher plasma 25-hydroxyvitamin d , assessed repeatedly , was associated with lower risk of incident diabetes in high - risk patients , after adjusting for lifestyle interventions ( dietary changes , increased physical activity , and weight loss ) known to decrease diabetes risk . because of the observational nature of the study , the potential association between vitamin d and diabetes needs to be confirmed in intervention studies .

in recent years , scientists and clinicians have become increasingly aware of the role of cognition in successful management of hearing loss , particularly in older adults . while it is often said that we hear with our brain , not just with our ears , the focus of the typical hearing aid fitting continues to be one of providing audibility . despite evidence of age - related deficits in temporal processing [ 16 ] , abilities beyond the cochlea when auditory processing is assessed , behavioral measures may be affected by reduced cognitive abilities in the domains of attention and memory [ 7 , 8 ] ; for example , an individual with poor memory will struggle to repeat back long sentences in noise . the assessment and management of hearing loss in older adults would be enhanced by an objective measure of speech processing . the auditory brainstem response ( abr ) provides such an objective measure of auditory function ; its uses have included evaluation of hearing thresholds in infants , children , and individuals who are difficult to test , assessment of auditory neuropathy , and screening for retrocochlear function . traditionally , the abr has used short , simple stimuli , such as pure tones and tone bursts , but the abr has also been recorded to complex tones , speech , and music for more than three decades , with the abr 's frequency following response ( ffr ) reflecting the temporal discharge of auditory neurons in the upper midbrain [ 10 , 11 ] . here , we review the role of the abr to complex sounds ( cabr ) in assessment and documentation of treatment outcomes , and we suggest a potential role of the cabr in hearing aid fitting . the cabr provides an objective measure of subcortical speech processing [ 12 , 13 ] . it arises largely from the inferior colliculus of the upper midbrain , functioning as part of a circuit that interacts with cognitive , top - down influences . unlike the click - evoked response , which bears no resemblance to the click waveform , the cabr waveform is remarkably similar to its complex stimulus waveform , whether a speech syllable or a musical chord , allowing for fine - grained evaluations of timing , pitch , and timbre representation . the click is short , nearly instantaneous , or approximately 0.1 ms , but the cabr may be elicited by complex stimuli that can persist for several seconds . the cabr 's response waveform can be analyzed to determine how robustly it represents different segments of the speech stimulus . for example , in response to the syllable /da/ , the onset of the cabr occurs at approximately 9 ms after stimulus onset , which would be expected when taking into account neural conduction time . the cabr onset is analogous to wave v of the brainstem 's response to a click stimulus , but the cabr has potentially greater diagnostic sensitivity for certain clinical populations . for example , in a comparison between children with learning impairments versus children who are typically developing , significant differences were found for the cabr but not for responses to click stimuli . the ffr comprises two regions : the transition region corresponding to the consonant - vowel ( cv ) formant transition and the steady - state region corresponding to the relatively unchanging vowel . the cv transition is perceptually vulnerable , particularly in noise , and the transition may be more degraded in noise than the steady state , especially in individuals with poorer speech - in - noise ( sin ) perception . the cabr is recorded to alternating polarities , and the average response to these polarities is added to minimize the cochlear microphonic and stimulus artifact [ 18 , 19 ] . phase locking to the stimulus envelope , which is noninverting , enhances representation of the envelope and biases the response towards the low frequency components of the response . on the other hand , phase locking to the spectral energy in the stimulus follows the inverting phase of the stimulus ; therefore , adding responses to alternating polarities cancels out much of the spectral energy [ 13 , 20 ] . subtracting responses to alternating polarities , however , enhances the representation of spectral energy while minimizing the response to the envelope . one might choose to use added or subtracted polarities , or both , depending on the hypothetical question . for example , differences between good and poor readers are most prominent in the spectral region corresponding to the first formant of speech and are therefore more evident in subtracted polarities . in contrast , the neural signature of good speech - in - noise perception is in the low frequency component of the response , which is most evident with added polarities . the average response waveform of 17 normal hearing older adults ( ages 60 to 67 ) and its evoking stimulus and stimulus and response spectra ( to added and subtracted polarities ) are displayed in figure 1 . the cabr is acoustically similar to the stimulus . that is , after the cabr waveform has been converted to a .wav file , untrained listeners are able to recognize monosyllabic words from brainstem responses evoked by those words . the fidelity of the response to the stimulus permits evaluation of the strength of subcortical encoding of multiple acoustic aspects of complex sounds , including timing ( onsets , offsets ) , pitch ( the fundamental frequency , f0 ) , and timbre ( the integer harmonics of the f0 ) . analyses of the cabr include measurement of latency and amplitude in the time domain and magnitude of the f0 and individual harmonics in the frequency domain . because of the cabr 's remarkable stimulus fidelity , cross - correlation between the stimulus and the response also provides a meaningful measure . in addition , responses between two conditions can be cross - correlated to determine the effects of a specific condition such as noise on a response . latency analysis has traditionally relied on picking individual peaks , a subjective task that is prone to error . because the brainstem represents stimulus frequency differences occurring above 2000 hz ( the upper limits of brainstem phase locking ) through timing and phase representation [ 27 , 28 ] , the phase difference between two waveforms ( in radians ) can be converted to timing differences and represented in a phaseogram . this analysis provides an objective measure of the response timing on a frequency - specific basis . for example , the brainstem 's ability to encode phase differences in the formant trajectories between syllables such as /ba/ and /ga/ can be assessed and compared to a normal standard or between groups in a way that would not be feasible if the analysis was limited to peak picking ( figure 2 ) . although the response peaks corresponding to the f0 are discernible , the peaks in the higher frequency formant transition region such as in figure 2 would be difficult to identify , even for the trained eye . in natural speech , frequency components change rapidly , and a pitch tracking analysis can be used to evaluate the ability of the brainstem to encode the changing fundamental frequency over time . from this analysis , a measure of pitch strength can be computed using short - term autocorrelation , a method which determines signal periodicity as the signal is compared to a time - shifted copy of itself . pitch - tracking error is determined by comparing the stimulus f0 with the response f0 for successive periods of the response [ 29 , 30 ] . these and other measures produced by the pitch - tracking analysis reveal that the ffr is malleable and experience dependent , with better pitch tracking in individuals who have heard changing vowel contours or frequency sweeps in meaningful contexts , such as in tonal languages or music [ 24 , 31 ] . other automated analyses which could potentially be incorporated into a clinical protocol include the assessment of response consistency and phase locking . response consistency provides a way of evaluating trial - to - trial within - subject variability , perhaps representing the degree of temporal jitter or asynchronous neural firing that might be seen in an impaired or aging auditory system . auditory neuropathy spectrum disorder would be an extreme example of dyssynchronous neural firing , affecting even the response to the click [ 3234 ] . a mild form of dyssynchrony , however , may not be evident in the results of the typical audiologic or abr protocol but might be observed in a cabr with poor response consistency . the phase - locking factor is another measure of response consistency , providing a measure of trial - to - trial phase coherence [ 35 , 36 ] . while response consistency is determined largely by the stimulus envelope , the phase - locking factor is a measure of consistency of the stimulus - evoked oscillatory activity . the cabr may potentially play an important role in assessment of hearing loss and hearing in noise . it has good test - retest reliability [ 39 , 40 ] , a necessity for clinical comparisons and for documentation of treatment outcomes . just as latency differences of 0.2 ms for brainstem responses to click stimuli can be considered clinically significant when screening for vestibular schwannomas , similar differences on the order of fractions of milliseconds in the cabr have been found to reliably separate clinical populations [ 41 , 42 ] . . found that the onset and other peaks in the cabr are delayed 0.2 to 0.3 ms in children who are good readers compared to poor readers . in older adults , the offset latency is a strong predictor of self - assessed sin perception in older adults , with latencies ranging from 47 to 51 ms in responses to a 40 ms /da/ temporal processing deficits are also seen in children with specific language impairment , who have decreased ability to track frequency changes in tonal sweeps , especially at faster rates . because of the influence of central and cognitive factors on speech - in - noise perception , the pure - tone audiogram , a largely peripheral measure , does not adequately predict the ability to hear in background noise , especially in older adults [ 4547 ] . due to the convergence of afferent and efferent transmission in the inferior colliculus ( ic ) [ 48 , 49 ] , we propose that the cabr is an effective method for assessing the effects of sensory processing and higher auditory function on the ic . while the cabr does not directly assess cognitive function , it is influenced by higher - level processing ( e.g. , selective attention , auditory training ) . the cabr is elicited passively without the patient 's input or cooperation beyond maintaining a relaxed state , yet it provides in essence a snapshot in time of auditory processing that reflects both cognitive ( auditory memory and attention ) and sensory influences . in a study of hearing- , age- , and sex - matched older adults ( ages 6073 ) with clinically normal hearing , the older adults with good speech - in - noise perception had more robust subcortical stimulus representation , with higher root - mean - square ( rms ) and f0 amplitudes compared to older adults with poor speech - in - noise perception ( figure 3 ) . perception of the f0 is important for object identification and stream segregation , allowing us to attend to a single voice from a background of voices ; therefore , greater representation of the f0 in subcortical responses may enhance one 's ability to hear in noise . when we added noise ( six - talker babble ) to the presentation of the syllable , we found that the responses of individuals in the top speech - in - noise group were less degraded than in the bottom speech - in - noise group ( figure 3 ) . these results are consistent with research from more than two decades documenting suprathreshold deficits that can not be identified by threshold testing [ 46 , 47 , 5158 ] . even in normal - hearing young adults , better speech - in - noise perception is related to more robust encoding of the f0 in the cabr . . found that spatial selective auditory attention performance correlates with the phase locking of the ffr to the speech syllable /da/. furthermore , they found that selective attention correlates with the ability to detect frequency modulation but is not related to age , reading span , or hearing threshold . the cabr provides evidence of age - related declines in temporal and spectral precision , providing a neural basis for speech - in - noise perception difficulties . in older adults , delayed neural timing is found in the region corresponding to the cv formant transition [ 59 , 60 ] , but timing in the steady - state region remains unchanged . importantly , age - related differences are seen in middle - aged adults as young as 45 , indicating that declines in temporal resolution are not limited to the elderly population . robustness of frequency representation also decreases with age , with the amplitude of the fundamental frequency declining in middle- and in older - aged adults . these results provide neural evidence for the finding of adults having trouble hearing in noise as soon as the middle - aged years . the cabr can be collected in as little as 20 minutes , including electrode application . nevertheless , even an additional twenty minutes would be hard to add to a busy practice . to be efficacious , the additional required time must yield information not currently provided by the existing protocol . one of the purposes of an audiological evaluation is to determine the factors that contribute to the patient 's self - perception of hearing ability . to evaluate the effectiveness of possible factors , we used multiple linear regression modeling to predict scores on the speech subtest of the speech , spatial , and qualities hearing scale . pure - tone thresholds , speech - in - noise perception , age , and timing measures of the cabr served as meaningful predictors . behavioral assessments predicted 15% of the variance in the ssq score , but adding brainstem variables ( specifically the onset slope , offset latency , and overall morphology ) predicted an additional 16% of the variance in the ssq ( figure 4 ) . therefore , the cabr can provide the clinician with unique information about biological processing of speech . as the site of intersecting afferent and efferent pathways , the inferior colliculus plays a key role in auditory learning . indeed , animals models have demonstrated that the corticocollicular pathway is essential for auditory learning [ 63 , 64 ] . therefore , it is reasonable to expect that the cabr reflects evidence of auditory training ; in fact , the cabr shows influences of both life - long and short - term training . for example , native speakers of tonal languages have better brainstem pitch tracking to changing vowel contours than speakers of nontonal languages . bilingualism is associated with enhanced cognitive skills , such as language processing and executive function , and it also promotes experience - dependent plasticity in subcortical processing . bilingual adolescents , who reported high english and spanish proficiency , had more robust subcortical encoding of the f0 to a target sound presented in a noisy background than their age- , sex- , and iq - matched monolingual peers . within the bilingual group , a measure of sustained attention was related to the strength of the f0 ; this relation between attention and the f0 was not seen in the monolingual group . proposed that diverse language experience heightens directed attention toward linguistic inputs ; in turn , this attention becomes increasingly focused on features important for speaker identification and stream segregation in noise , such as the f0 . musicianship , another form of auditory expertise , also extends to benefits of speech processing ; musicians who are nontonal language speakers have enhanced pitch tracking to linguistically relevant vowel contours , similar to that of tonal language speakers . ample evidence now exits for the effects of musical training on the cabr [ 28 , 60 , 6773 ] . the opera ( overlap , precision , emotion , repetition , and attention ) hypothesis has been proposed as the mechanism by which music engenders auditory system plasticity . for example , there is overlap in the auditory pathways for speech and music , explaining in part the musician 's superior abilities for neural speech - in - noise processing . the focused attention required for musical practice and performance results in strengthened sound - to - meaning connections , enhancing top - down cognitive ( e.g. , auditory attention and memory ) influences on subcortical processing . musicians ' responses to the cabr are more resistant to the degradative effects of noise compared to nonmusicians [ 68 , 73 ] . background noise delays and reduces the amplitude of the cabr ; however , musicianship mitigates the effects of six - talker babble noise on cabr responses in young adults , with earlier peak timing of the onset and the transition in musicians compared to nonmusicians . bidelman and krishnan evaluated the effects of reverberation on the ffr and found that reverberation had no effect on the neural encoding of pitch but significantly degraded the representation of the harmonics . in addition , they found that young musicians had more robust responses in quiet and in most reverberation conditions . benefits of musicianship have also been seen in older adults ; when comparing effects of aging in musicians and nonmusicians , the musicians did not have the expected age - related neural timing delays in the cv transition indicating that musical experience offsets the effects of aging . these neural benefits in older musicians are accompanied by better sin perception , temporal resolution , and auditory memory . but , what about the rest of us who are not able to devote ourselves full time to music practice can musical training improve our auditory processing as well ? years of musical training in childhood are associated with more robust responses in adults , in that young adults with zero years of musical training had responses closer to the noise floor compared to groups of adults with one to five or six to eleven years of training who had progressively larger signal - to - noise ratios . in a structural equation model of the factors predicting speech - in - noise perception in older adults , two subsets were compared a group who had no history of musical training and another group who had at least one year of musical training ( range 1 year to 45 years ) . cognitive factors ( memory and attention ) played a bigger role in speech - in - noise perception in the group with musical training , but life experience factors ( physical activity and socioeconomic status ) played a bigger role in the group with no experience . subcortical processing ( pitch encoding , harmonic encoding , and cross - correlations between responses in quiet and noise ) accounted for a substantial amount of the variance in both groups . carcagno and plack found changes in the ffr after ten sessions of pitch discrimination training that took place over the course of approximately four weeks . four groups participated in the experiment : three experimental groups ( static tone , rising tone , and falling tone ) and one control group . perceptual learning occurred for the three experimental groups , with effects somewhat specific to the stimulus used in training . these behavioral improvements were accompanied by changes in the ffr , with stronger phase locking to the f0 of the stimulus , and changes in phase locking were related to changes in behavioral thresholds . just as long - term exposure to tonal language leads to better pitch tracking to changing vowel contours , just eight days of vocabulary training on words with linguistically relevant contours resulted in stronger encoding of the f0 and decreases in the number of pitch - tracking errors . the participants in this study were young adults with no prior exposure to a tonal language . although the english language uses rising and falling pitch to signal intonation , the use of dipping tone would be unfamiliar to a native english speaker , and , interestingly , the cabr to the dipping tone showed the greatest reduction in pitch - tracking errors . training that targets speech - in - noise perception has also shown benefits at the level of the brainstem . young adults were trained to discriminate between cv syllables embedded in a continuous broad - band noise at a + 10 db signal - to - noise ratio . activation of the medial olivocochlear bundle ( mocb ) was monitored during the five days of training through the use of contralateral suppression of evoked otoacoustic emissions . training improved performance on the cv discrimination task , with the greatest improvement occurring over the first three training days . a significant increase in mocb activation was found , but only in the participants who showed robust improvement ( learners ) . the learners showed much weaker suppression than the nonlearners on the first day ; in fact , the level of mocb activation was predictive of learning . this last finding would be particularly important for clinical purposes a measure predicting benefit would be useful for determining treatment candidacy . there is renewed clinical interest in auditory training for the management of adults with hearing loss . historically , attempts at auditory training had somewhat limited success , partly due to constraints on the clinician 's ability to produce perceptually salient training stimuli . with the advent of computer technology and consumer - friendly software , auditory training has been revisited . computer technology permits adaptive expansion and contraction of difficult - to - perceive contrasts and/or unfavorable signal - to - noise ratios . , redwood city , ca ) is an example of an adaptive auditory training program that employs top - down and bottom - up strategies to improve hearing in noise . older adults with hearing loss who underwent lace training scored better on the quick speech in noise test ( quicksin ) and the hearing - in - noise test ( hint ) ; they also reported better hearing on self - assessment measures the hearing handicap inventory for the elderly / adults and the client oriented scale of improvement [ 84 , 85 ] . the benefits on the hint and quicksin were replicated in young adults by song et al . . after completing 20 hours of lace training over a period of four weeks , the participants improved not only on speech - in - noise performance but also had more robust speech - in - noise representation in the cabr ( figure 5 ) . they had training - related increases in the subcortical representation of the f0 in response to speech sounds presented in noise but not in quiet . importantly , the amplitude of the f0 at pretest predicted training - induced change in speech - in - noise perception . the advantages of computer - based auditory training for improved speech - in - noise perception and neural processing have also been observed in older adults . based on this evidence , the cabr may be efficacious for documenting treatment outcomes , an important component of evidence - based service . any clinician who has experience with fitting hearing aids has encountered the patient who continues to report hearing difficulties , no matter which particular hearing aid or algorithm is tried . although we have not yet obtained empirical evidence on the role of the cabr in the hearing aid fitting , we suggest that implementation of the cabr may enhance hearing aid fittings , especially in these difficult - to - fit cases . the clinician might be guided in the selection of hearing aid algorithms through knowledge of how well the brainstem encodes temporal and spectral information . for example , an individual who has impaired subcortical timing may benefit from slowly changing compression parameters in response to environmental changes . cortical - evoked potentials have been used for verifying auditory system development after hearing aid or cochlear implant fitting in children [ 8789 ] . in adults , however , no difference is noted in the cortical response between unaided and aided conditions , indicating that the cortical response may reflect signal - to - noise ratio rather than increased gain from amplification . therefore , cortical potentials may have limited utility for making direct comparisons between unaided and aided conditions in adults . we recently recorded the cabr in sound field and compared aided and unaided conditions and different algorithms in the aided condition . there is a marked difference in the amplitude of the waveform in response to an aided compared to an unaided condition . by performing stimulus - to - response correlations , it is possible to demonstrate that certain hearing aid algorithms resulted in a better representation of the stimulus than others ( figure 6 ) . with improvements in digital hearing aid technology , we are able to have greater expectations for hearing aid performance than ever before , even in noisy situations . these improvements , however , do not address the problems we continue to encounter in challenging hearing aid fittings that leave us at a loss for solutions . the cabr provides an opportunity to evaluate and manage an often neglected part of hearing the central auditory system as well as the biological processing of key elements of sound . we envision future uses of the cabr to include assessment of central auditory function , prediction of treatment or hearing aid benefit , monitoring treatment or hearing aid outcomes , and assisting in hearing aid fitting . because the cabr reflects both sensory and cognitive processes , we can begin to move beyond treating the ear to treating the person with a hearing loss .

hearing aid technology has improved dramatically in the last decade , especially in the ability to adaptively respond to dynamic aspects of background noise . despite these advancements , however , hearing aid users continue to report difficulty hearing in background noise and having trouble adjusting to amplified sound quality . these difficulties may arise in part from current approaches to hearing aid fittings , which largely focus on increased audibility and management of environmental noise . these approaches do not take into account the fact that sound is processed all along the auditory system from the cochlea to the auditory cortex . older adults represent the largest group of hearing aid wearers ; yet older adults are known to have deficits in temporal resolution in the central auditory system . here we review evidence that supports the use of the auditory brainstem response to complex sounds ( cabr ) in the assessment of hearing - in - noise difficulties and auditory training efficacy in older adults .

food allergy is an immunological reaction to the protein in food which causes rapid symptoms such as swelling and tingling of lips and tongue , rash , vomiting , and in some cases breathing difficulty and anaphylactic shock . approximately 68% of children have a medically diagnosed food allergy and the united kingdom has one of the highest incidences of allergy in the world . rona et al . found levels of self - diagnosed food allergy to be as high as 35% although a large proportion of self - diagnosed or parentally diagnosed food allergy can not be confirmed when participants are brought in for clinical tests such as food challenges . research on food allergy demonstrates that those caring for children with food allergies report a poorer quality of life for themselves and their children compared to both healthy controls and children with other long - term conditions [ 58 ] . the unpredictable and potentially life - threatening nature of food allergy in young children has been associated with anxiety and stress in caregivers [ 7 , 9 , 10 ] . bollinger et al . found that 41% of parents indicated an increase in stress levels since the diagnosis of their child . activities such as family social events and parties are often affected and many parents try to minimise the anxiety caused by such activities by avoiding them [ 11 , 12 ] . research suggests that health professionals are underprepared to address the needs of parents who have children with severe food allergies due to a lack of knowledge concerning this phenomenon . there is little research on the quality of life of parents who have diagnosed food allergy in their child themselves , rather than seeking a medical diagnosis , although it is suggested that these parents may suffer from similar issues . marklund et al . asked parents of children with parent - reported food hypersensitivity to complete generic quality of life questionnaires and found that parental emotions , time , and familial activities were significantly affected ; the younger the child , the greater the impact on family life . by not accessing healthcare for food allergy , families do not have the opportunity to receive guidance and support and it is possible that food allergy could then have a greater impact on quality of life of these families . the aim of this study was to explore the relationship between quality of life , stress , anxiety , and depression in parents of children with parent - diagnosed food allergy and medically diagnosed food allergy and parents of healthy children . this quantitative study was cross - sectional using validated questionnaires measuring quality of life , anxiety , depression , and stress in parents . ethical approval was gained from the school of life and health sciences research ethics committee at the university where the study took place , prior to commencing data collection and analysis . all participants were parents , with at least one child aged 011 years , recruited from either a local nursery or local primary school . questionnaires were also provided online and further parents were recruited through social media such as facebook and twitter . after completing written or online consent , parents completed a demographic questionnaire and validated psychometric scales to measure general quality of life ( whoqol - bref ) , stress ( pss ) , anxiety , and depression ( hads ) . all parents were asked if their child experienced symptoms after eating food ( which was not due to food poisoning , stomach bug , or viral infection ) . those who answered yes were asked to state whether the cause of their child 's symptoms had been medically diagnosed , who had made the diagnosis , and the type of test used and the results of the test . if there was no medical diagnosis , the parent was asked if they had made a diagnosis themselves and what that was . these parents were also asked to complete questions on the food and symptoms involved and completed a food allergy specific quality of life scale ( faql - pb ) . parents who stated that their child 's food allergy had been diagnosed by a clinician using skin prick tests , blood test , or food challenge were allocated to the medical - diagnosed group in line with criteria used in previously published research . perceived stress scale ( pss ) is a measure of the degree to which situations in one 's life are appraised as being stressful . items are designed to determine how unpredictable , uncontrollable , and overloaded respondents perceive their lives . the questions ask about feelings and thoughts during the past month and scores range from 0 to 5 with the highest rating indicative of higher perceived stress . the pss is a reliable measure with cronbach 's alpha reported as = 0.84 . hospital anxiety and depression scale ( hads ) is a 14-item scale ; 7 relate to anxiety and 7 to depression . each item has a 4-point rating scale , scored from 0 to 3 ; total scores range from 0 to 42 with a higher score indicative of higher levels of anxiety or depression . the scale has good internal consistency with alphas of 0.93 for anxiety and 0.90 for depression and the scale has good construct validity . the whoqol - bref is a 26-item general qol scale and measures physical , psychological , social , and environmental aspects of an individual 's life over the last two weeks , using a 5-point likert scale . there are also two one - item questions , which look at overall quality of life and satisfaction with health and have a score range of 1 to 5 on each . analyses of internal consistency , item - total correlations , discriminant validity , and construct validity carried out via confirmatory factor analysis confirm the excellent psychometric properties of the scale , with an overall = 0.88 . the faql - pb is a 17-item scale that uses a 7-point likert scale ranging from 1 ( not troubled ) to 7 ( extremely troubled ) . items concern issues such as going on vacation , social activities , worries , and anxieties over the previous week . further questions were completed by any parent stating their child had a medical diagnosis or parental diagnosis of food allergy or intolerance ; this included foods and symptoms involved , age at onset of the condition , and details of any diagnostic tests undertaken . participants were also asked to indicate whether their child had other major illnesses or conditions ( e.g. , cancer , diabetes ) . statistical analyses were conducted using spss for windows ( version 22 , spss , chicago , il , usa ) . tests were carried out to explore distribution of the data and three normality indicators were used : shapiro - wilk test , kurtosis and skewness , and box plots which indicated there were 21 outliers in the data which were removed . post hoc power calculations with alpha set at 0.05 were computed and showed the study to have 96% power to detect differences with medium effect sizes and 99% power to detect differences with large effect sizes between the no - allergy and allergy groups ; 61% power to detect differences with medium effect sizes ; and 86% power to detect differences with large effect sizes between the medically diagnosed and self - diagnosed groups . differences in measures between the no - allergy and allergy groups were analysed using ancovas in order to control for differences in demographics across groups . relationships across all variables were analysed using pearson 's correlations for continuous data and chi - squares for categorical data ; predictors of quality of life were analysed using multiple regression . all tests carried out were two - tailed and significance levels were set at p < 0.05 . a total of 7 parents stated that their child had only intolerance to milk or egg rather than an allergy ; 6 of these had been diagnosed by a doctor , and one had been diagnosed by a homeopath . these were removed from the dataset leaving a total of 150 in the final analysis . of these , 66 ( 44% ) identified their children as having no food allergy and 84 ( 56% ) parents reported they had at least one child with a food allergy . a total of 25 parents stated they had made this diagnosis themselves ( parent - diagnosed group ) and 59 parents stated their child had a medical diagnosis ( medical diagnosis group ) . the majority ( n = 104 , 69.3% ) of participants were from white / caucasian backgrounds , 26 ( 17.3% ) were of indian or asian ethnicity ; 8 ( 5.3% ) were black / african and 5 ( 3.3% ) hispanic / latino . most participants were female ( n = 135 , 90.0% ) ; 98 ( 65.8% ) had been educated to university level ; 110 ( 73.4% ) were in full- or part - time work ; 106 ( 70.7% ) were married . there were no significant differences across the three groups for education level , work , or marital status . there were slightly more participants in the medical diagnosis group who were mothers ( 96.6% ) compared to the parental diagnosis group ( 80.0% ) or the control group ( 87.9% ) , (2 ) = 5.97 , p = 0.05 . there were also significantly more white / caucasian participants in the medical diagnosis group ( 88.1% ) compared to the parental diagnosis group ( 52.0% ) and the control group ( 59.1% ) , (2 ) = 16.60 , p < 0.001 . therefore , all analyses comparing groups controlled for parent status and ethnicity . foods and symptoms reported by parents with a parental or medical diagnosis of food allergy in their child can be seen in table 1 . the most commonly reported allergy in the medically diagnosed group was cow 's milk compared to peanuts for the parentally diagnosed group . in addition to food allergies , other long - term conditions reported were eczema ( n = 54 ) , hay fever ( n = 30 ) , asthma ( n = 32 ) , atopic dermatitis ( n = 31 ) , gastrooesophageal reflux disease ( n = 1 ) , glue ear ( n = 1 ) , dislocation of the hip ( n = 1 ) , adhd ( n = 1 ) , and ocd ( n = 1 ) . the first set of analyses looked at differences between the healthy control group and the food allergy group , with the parentally and medically diagnosed groups combined . there were no significant differences between parents of children with food allergy and healthy controls for general qol ( overall qol or subdomain scores ) ( table 2 ) . parents of children with food allergy did report significantly higher stress levels than parents of children without food allergy ( f(1,146 ) = 9.99 , p = 0.002 , p = .064 ) , significantly higher anxiety levels than parents of children without food allergy ( f(1,146 ) = 7.83 , p = 0.006 , and p = .051 ) , and significantly higher depression levels ( f(1,146 ) = 8.28 , p = 0.005 , and p = .054 ) ( table 2 ) . when comparing parentally and medically diagnosed groups , parents of children who were medically diagnosed with food allergy experienced poorer food allergy specific quality of life compared to parents whose children were parentally diagnosed f(1,80 ) = 5.17 , p = 0.026 , and p = .061 ( table 3 ) . there were no significant differences between the parent - diagnosed and medically diagnosed group for any of the subdomains of general qol . there was , however , a statistically significant difference for overall general qol with parents who diagnosed food allergy in their child reporting poorer general qol than parents of children with a medical diagnosis ( f(1,80 ) = 4.27 , p = 0.042 , and p = .051 ) . there were no significant differences for stress , depression , or anxiety ( table 3 ) . in comparing across all three groups , there were no significant differences between parental - diagnosed , medically diagnosed food allergy , and healthy control groups for overall qol or any of the subdomains of qol . there was a statistically significant difference regarding perceived stress between the three groups ( f(2,145 ) = 5.88 , p = 0.004 , and p = .075 ) . post hoc tukey 's test demonstrated significantly higher stress levels in the parental - diagnosed group ( m = 29.8 , sd = 7.52 ) compared to the no - allergy group ( m = 24.6 , sd = 7.09 , and p = 0.005 ) . there was no significant difference between parental- and medically diagnosed groups ( p > 0.05 ) . there was a significant difference between the three groups for anxiety levels ( f(2,145 ) = 5.70 , p = 0.004 , and p = .073 ) . post hoc analysis revealed significantly higher anxiety in the parental - diagnosed group ( m = 11.96 , sd = 4.59 ) compared to the no - allergy group ( m = 8.37 , sd = 4.71 , and p = 0.004 ) . there was also a significant difference between the three groups for depression levels ( f(2,145 ) = 4.13 , p = 0.018 , and p = .054 ) . tukey 's post hoc test revealed that the medically diagnosed group reported higher levels of depressive symptoms ( m = 8.80 , sd = 5.31 ) compared to the no - allergy group ( m = 6.42 , sd = 4.85 , and p = 0.027 ) . in parents of children with a medical diagnosis of food allergy for their child , poorer overall qol and health related qol , physical , psychological , social , and environmental qol , and greater stress levels were related to poorer food allergy specific qol ( table 4 ) . quality of life and mental health predictors were entered into a multiple regression model to explore whether variables could predict faql - pb scores . the model explained 38.1% ( r = 0.38 ; adj r = 0.30 ) of the variance in parental burden scores f(7,58 ) = 4.49 , p = 0.001 ; however , only stress significantly predicted faql - pb scores ( table 5 ) . for parents who diagnosed food allergy in their child , only health related qol significantly correlated with food allergy specific qol ( table 4 ) ; the regression model was not significant and no variables significantly predicted faql - pb scores . parents of male children with food allergy ( n = 52 ) reported poorer food allergy related quality of life ( m = 80.40 , sd = 22.77 ) compared to parents of females with food allergy ( n = 32 ) ( m = 62.28 , sd = 27.20 ) ( f(1,83 ) = 8.66 , p = 0.004 , and p = .098 ) . those parents whose children had not been to hospital with a food reaction ( n = 46 ) reported higher anxiety levels ( m = 11.54 , sd = 4.25 ) compared to parents whose children had been to hospital with a food reaction ( n = 38 ) ( m = 9.16 , sd = 5.03 ) ( f(1,83 ) = 5.11 , p = 0.027 , and p = .060 ) and reported higher levels of depression ( m = 10.00 , sd = 4.70 ) compared to parents whose children had visited hospital with a food reaction ( m = 7.32 , sd = 5.51 ) ( f(1,83 ) = 5.24 , p = 0.025 , and p = .061 ) . parents of children who had asthma ( n = 32 ) reported higher stress levels ( m = 30.22 , sd = 7.43 ) compared to those whose child did not have asthma ( n = 52 ) ( m = 26.88 , sd = 6.43 ) ( f(1,83 ) = 4.61 , p = 0.035 , and p = .055 ) . there were no significant differences between parents of children with atopic dermatitis , eczema , or hay fever and parents of children without these conditions . out of those parents who reported that their child had a food allergy , there were no significant differences in stress , anxiety , depression , or food allergy specific quality of life ( faql - pb scores ) between parents who had food allergy themselves and those who did not . parents without food allergy reported better physical qol ( m = 26.52 , sd = 4.47 ) than parents with food allergy ( m = 23.94 , sd = 6.62 ) ( t(57.98 ) = 2.02 , p = 0.05 ) and better psychological qol ( m = 21.44 , sd = 3.86 ) than those with food allergy ( m = 19.42 , sd = 4.07 ) ( t(82 ) = 2.32 , p = 0.02 ) . there were no significant differences between those parents with food allergy and those without for environmental qol and social qol . a pearson 's chi - squared test showed that there was no significant association between the type of diagnosis received by the parent ( medical versus self - diagnosis ) and the type of diagnosis received by the child ( = 0.013 , p > 0.05 ) . this study found that food allergy in the child is related to poorer mental health of parents compared to parents of children with no food allergy . poorer mental health was present irrespective of whether the food allergy diagnosis was by a clinician or by the parent and was not due to the parent having food allergy themselves . parents of children with a food allergy reported higher stress , anxiety , and depression compared to parents of children with no food allergy . this supports previous literature showing that caring for a child with food allergy is associated with poorer mental health [ 7 , 2527 ] . interestingly , parents who diagnosed the condition in their child reported higher levels of stress and anxiety than parents of children with no food allergy and parents whose children were medically diagnosed reported higher depression than parents of children with no food allergy . some of the stress and anxiety in the parents who had diagnosed allergy themselves may be due to the uncertainty of not having a medical diagnosis or a lack of information from healthcare professionals . vargas et al . found that parents of children with recently diagnosed food allergy have reduced stress and anxiety levels if they are provided access to materials and sources of information which are accurate and easy to understand . akeson et al . reported that parents felt greater anxiety and worry if they did not have information about food allergy and how to treat a serious reaction . higher levels of depression may come from having more knowledge from medical sources about the potential life - threatening nature of food allergy , for which there is currently no cure . the mental health measures in the current study were general and questions were not specific to food allergy and so reasons for the increased levels of stress , anxiety , and depression warrant further investigation . this study also found differences in the type of qol affected in parents of children with a medical diagnosis compared to parents who made a diagnosis themselves , which has not before been reported in the literature . parents of medically diagnosed children reported poorer food allergy specific qol and parents who diagnosed the condition in their child themselves reported poorer general qol . these findings are surprising as caregivers whose children have a medical diagnosis would be expected to have more information regarding the food allergy and its management , as well as more support from the healthcare system and appropriate medication . however , it could be that parents who diagnose the condition themselves may perceive their child 's allergy as less serious or less of a burden and something they are able to manage , resulting in them reporting much better levels of food allergy specific qol . this may be one reason why they have not sought a medical diagnosis for their child or felt the need for a prescription for an adrenaline autoinjector . the finding that parents of children with parental - diagnosed food allergy reported poorer general qol than the medically diagnosed group needs further exploration . it could be due to better education or socioeconomic status in parents who access healthcare and seek medical support , although in this study there were no significant differences in level of education or work status between the two groups . there were no significant differences in general qol between the allergy groups and the group of parents whose children had no allergy , a finding which is consistent with past research where parents of children with nut allergy have reported the same or better qol than the norm scores derived from a healthy uk population . king et al . used a group of medically diagnosed children and parents and so further research is needed on parents who do not seek a medical diagnosis for their child to see if this finding can be replicated . a number of food allergy and demographic variables were associated with food allergy specific quality of life . parents of children with asthma reported higher stress levels compared to parents of children without asthma . this result is also in keeping with some previous studies of children with atopic comorbidities [ 9 , 29 ] . the increased stress may be due to the fear of consequences or to the distress resulting from having to witness episodes of breathlessness . interestingly , in this study , parents of males reported higher food allergy related parental burden levels than parents of females . some reasons for gender differences have been highlighted in the literature such as biological vulnerability , risk evaluation , processing of information , and role expectations . marklund et al . also found that parents of children with food hypersensitivity reported boys as having poorer qol than girls . the current study adds to this literature , showing that not only is this seen in the patient , but also is reflected in parental burden . ninety percent of the participants were female , with significantly more mothers in the group with a medical diagnosis for their child . research has highlighted gender differences in experiences of parenting a child with food allergy ( e.g. , ) and so we do not know if the relationships found in this study would be seen in fathers . it is difficult to recruit fathers to this type of research and much of the literature in this area reports data from mothers ( e.g. , [ 8 , 9 , 14 , 24 , 25 ] ) . research that specifically targets fathers is needed . further , the study sample consisted primarily of females with a caucasian ethnicity , again particularly in the group with a medical diagnosis for their child ; this may be partly due to recruitment techniques such as using an internet - based method , which may be more accessible and used by caucasian ethnicities , but the predominance of these characteristics in the medically diagnosed group does reflect the demographic of parent seen in secondary care allergy clinics in the uk . although this study controlled for parental and ethnic status , a more ethnically diverse participant sample would be useful to explore . the study had a smaller number in the parental diagnosis groups compared to the other groups , meaning that the study was underpowered to detect differences with small effect sizes . this is due to the difficulty in recruiting this type of participant who does not access healthcare . recruitment methods such as social media may facilitate recruitment of participants such as this but this only reaches people who are computer literate and have access to social media , which needs to be taken into account . a further limitation with this study was the reliance on parental report of allergy ; there was no verification of the medically diagnosed allergy having been received by a healthcare professional . recruiting all groups from a general population ensured parity across recruitment methods across the three groups and there is no reason for parents to falsely report the type of diagnosis for their child given the anonymous nature of the study ; nevertheless , it would be useful to recruit a medical diagnosed group from an allergy clinic in order to ascertain whether self - reporting has affected these results . finally this study is cross - sectional and can not make any inferences regarding cause and effect . longitudinal data for food allergy is almost nonexistent and is needed in order to further delineate causal pathways , particularly for stress and anxiety . this study highlights the significant relationships between food allergy and caregivers ' qol and mental health irrespective of whether they have sought a medical diagnosis for their child or made the diagnosis themselves . parents who diagnose food allergy in their child should be encouraged to seek a medical diagnosis . there are large discrepancies between self - diagnosed food allergy and medically confirmed food allergy and knibb and semper found that 50% of parents taking their child to an allergy clinic for testing had a negative result , so at least some of the parents in the present study may have got the diagnosis wrong and may be restricting food for their child unnecessarily . a medical diagnosis , alongside appropriate information and support from healthcare professionals , may help reduce the burden of food allergy for these parents . paediatricians should be aware of the psychological impact of food allergy and recognise and refer caregivers for psychological support if needed .

background . food allergy is related to poorer quality of life ( qol ) and mental health of caregivers . many parents diagnose food allergy in their child without seeking medical care and there is limited research on this group . this study investigated parental qol and mental health in parents of children with parent - diagnosed food allergy ( pa ) , medically diagnosed food allergy ( ma ) , and a control group with no allergy ( na ) . methods . one hundred and fifty parents from a general population completed validated measures of qol , anxiety , depression , and stress . results . parents of children with food allergy ( pa or ma ) reported higher stress , anxiety , and depression than the control group ( all p < 0.05 ) . parents of children with ma reported poorer food allergy related qol compared to parents of children with pa ( p < 0.05 ) ; parents of children with pa reported poorer general qol compared to parents of children with ma ( p < 0.05 ) . conclusion . parents of children with food allergy have significantly poorer mental health compared to healthy controls , irrespective of whether food allergy is medically diagnosed or not . it is important to encourage parents to have their child medically tested for food allergy and to recognise and refer for psychological support where needed .

details concerning the design of nhanes i and nhefs have been published previously ( 5,13 ) . nhanes i was a national probability sample of the noninstitutionalized u.s . population aged 174 years , conducted during 19711974 . nhefs is a longitudinal study including all individuals initially aged 2574 years who completed a medical examination in nhanes i ( n = 14,407 ) . the nhefs comprises four longitudinal follow - up studies in 19821984 , 1986 , 1987 , and 1992 . the 1986 , 1987 , and 1992 follow - ups used the same design and data collection procedures developed in the 19821984 nhefs , with the exceptions that a 30-min computer - assisted telephone interview was administered rather than a personal interview , and no physical measurements were taken during the 19861992 examinations . the 1986 nhefs was conducted for members of the nhefs cohort who were aged 5574 years at their baseline examination and not known to be deceased at the 19821984 nhefs ( n = 3,980 ) . the 1987 ( n = 11,750 ) and 1992 ( n = 11,195 ) follow - ups were conducted for the entire surviving cohort . ninety - six percent of the study population was successfully traced at some point through the 1992 follow - up . tracing rates for each completed wave ranged from 90 to 94% , and interview rates ranged from 91 to 96% of those traced . of these participants , 658 were lost to follow - up ( 94% follow - up rate ) . an additional 1,421 participants were excluded because of 1 ) prevalent diabetes ( n = 570 ) , 2 ) incident diabetes reported within 1 year of baseline ( n = 82 ) to minimize the prevalence of undiagnosed baseline diabetes , or 3 ) missing covariate data ( n = 769 ) for smoking , physical activity , and/or education , yielding a final sample of 9,296 . all 9,296 participants included were traced ( vital status confirmed ) at least once during follow - up and 96% were traced at each of four follow - up cycles . at the 10- and 20-year follow - ups , 15% ( n = 1,363 ) and 34% dental examiners were trained to follow a written set of objective standards to minimize examiner variability by eliminating conditions known to be sources of disagreement ( 14 ) . the periodontal index ( 15 ) was used to assess the presence / absence of periodontal disease for each tooth by assigning scores based on gingival inflammation extent , the presence or absence of periodontal pockets , and tooth mobility as follows : 1 ) no periodontal disease ( score = 0 ) : neither overt inflammation in the investing tissues nor loss of function due to supporting tissue destruction ; 2 ) mild gingivitis ( score = 1 ) : an overt area of inflammation in the free gingivae , not circumscribing the tooth ; 3 ) gingivitis ( score = 2 ) : inflammation completely circumscribing the tooth with no apparent break in the epithelial attachment ; 4 ) gingivitis with pocket formation ( score = 6 ) : epithelial attachment had been broken and there was a pocket ( not merely a deepened gingival crevice due to swelling in the free gingivae ) , there was no interference with normal masticator function , and the tooth was firm in its socket and had not drifted ; and 5 ) advanced destruction with loss of masticator function ( score = 8) : the tooth was either loose , had drifted , or sounded dull on percussion with a metallic instrument . if the examiner was equivocal regarding the appropriate score , the lesser score was assigned . the periodontal index reflects the within - mouth arithmetic average of scores for all teeth ( periodontal index range is continuous from 0 to 8.0 ) . for dentate participants , each potential tooth in the dentition was classified as being decayed ( d ) , missing due to caries ( m ) , or filled without decay ( f ) . these values were summed per person to create an index ( dmf ) reflective of historical caries experience . incident diabetes was defined by 1 ) death certificate ( icd-9 code in the range of 250.0 to 250.9 or diabetes otherwise listed on the death certificate ) , 2 ) self - reported physician diagnosis requiring pharmacological treatment ( participants reporting physician - diagnosed diabetes and dietary intervention but not pharmacological intervention were not considered to have developed incident diabetes to enhance outcome specificity ) , or 3 ) health care facility stay with a discharge diagnosis of diabetes . potential confounding variables related to diabetes risk and/or indicative of healthy lifestyle were collected during the baseline evaluation and included age , sex , race ( african american , caucasian , or other ) , poverty index ( total household income in the numerator and total income necessary to maintain the family on a nutritionally adequate food plan in the denominator ; values > 1 indicate incomes above poverty ) , education level ( completed 8th grade , 9th12th grade , or some college or college graduate ) , bmi ( weight in kilograms divided by height in meters squared ) , subscapular and triceps skinfold , physical activity as described previously ( 15 ) , total cholesterol , systolic blood pressure , diastolic blood pressure , and hypertension ( systolic blood pressure 140 or diastolic blood pressure 90 or self - reported medication for high blood pressure ) . detailed cigarette smoking history information was collected for 3,420 participants at baseline and for the remaining 5,876 participants during the 19821984 follow - up . the primary definition classified participants into six categories using the periodontal index as follows . of dentate participants , 47% ( n = 3,372 ) had periodontal index = 0 and were classified as periodontally healthy , and the remaining dentate participants were further classified into quintiles ( n = 760/quintile ) of continuous periodontal index values . edentulous participants ( n = 2,127 ) were retained in a seventh category . in the second definition , participants were classified as either 1 ) being periodontally healthy ( n = 3,372 ) , 2 ) having gingivitis ( n = 2,135 ) , or 3 ) having periodontitis ( n = 1,662 ) as described previously ( 4,15 ) . in a third approach , tooth loss was considered as a surrogate definition of periodontal disease as it is often a consequence of periodontal disease ( 17 ) . participants were categorized as follows : 1 ) 2432 teeth ( reference group ) , 2 ) 1823 teeth , 3 ) 817 teeth , or 4 ) 17 teeth . logistic regression analysis was used to assess the association between baseline periodontal disease and the cumulative incidence of diabetes . the surveylogistic procedure in sas ( version 9.1 ; sas institute , cary , nc ) was used to appropriately account for the stratification , clustering , and sample weights of nhanes i. incidence density of diabetes was not considered because of uncertainty in diabetes onset timing , as discussed previously ( 18 ) . multiple models with various degrees of covariate adjustment are presented to provide clarity regarding confounding by design variables ( age , sex , and race ) , socioeconomic status ( education and poverty index ) , health behaviors ( smoking status , physical activity , and diet ) , general vascular health status ( hypertension and total cholesterol ) , and/or obesity ( bmi and skinfold ) . for the present analysis , smoking was defined in four categories : 1 ) current , 2 ) former , 3 ) never , or 4 ) reported history of smoking , current status unknown . the creation of the fourth smoking category avoids the elimination of those participants from the analysis and prevents biasing parameter estimates for current ( underestimation of smoking risk ) or former ( overestimation of smoking risk ) smokers . a control analysis was performed to assess the association between caries ( dmf ) and cumulative incidence of diabetes . we hypothesized a priori that periodontal index but not dmf would be positively associated with incident diabetes . if these dual hypotheses were confirmed , it would add specificity of the findings to periodontal disease as opposed to general oral health . dental examiners were trained to follow a written set of objective standards to minimize examiner variability by eliminating conditions known to be sources of disagreement ( 14 ) . the periodontal index ( 15 ) was used to assess the presence / absence of periodontal disease for each tooth by assigning scores based on gingival inflammation extent , the presence or absence of periodontal pockets , and tooth mobility as follows : 1 ) no periodontal disease ( score = 0 ) : neither overt inflammation in the investing tissues nor loss of function due to supporting tissue destruction ; 2 ) mild gingivitis ( score = 1 ) : an overt area of inflammation in the free gingivae , not circumscribing the tooth ; 3 ) gingivitis ( score = 2 ) : inflammation completely circumscribing the tooth with no apparent break in the epithelial attachment ; 4 ) gingivitis with pocket formation ( score = 6 ) : epithelial attachment had been broken and there was a pocket ( not merely a deepened gingival crevice due to swelling in the free gingivae ) , there was no interference with normal masticator function , and the tooth was firm in its socket and had not drifted ; and 5 ) advanced destruction with loss of masticator function ( score = 8) : the tooth was either loose , had drifted , or sounded dull on percussion with a metallic instrument . if the examiner was equivocal regarding the appropriate score , the lesser score was assigned . the periodontal index reflects the within - mouth arithmetic average of scores for all teeth ( periodontal index range is continuous from 0 to 8.0 ) . for dentate participants , each potential tooth in the dentition was classified as being decayed ( d ) , missing due to caries ( m ) , or filled without decay ( f ) . these values were summed per person to create an index ( dmf ) reflective of historical caries experience . incident diabetes was defined by 1 ) death certificate ( icd-9 code in the range of 250.0 to 250.9 or diabetes otherwise listed on the death certificate ) , 2 ) self - reported physician diagnosis requiring pharmacological treatment ( participants reporting physician - diagnosed diabetes and dietary intervention but not pharmacological intervention were not considered to have developed incident diabetes to enhance outcome specificity ) , or 3 ) health care facility stay with a discharge diagnosis of diabetes . potential confounding variables related to diabetes risk and/or indicative of healthy lifestyle were collected during the baseline evaluation and included age , sex , race ( african american , caucasian , or other ) , poverty index ( total household income in the numerator and total income necessary to maintain the family on a nutritionally adequate food plan in the denominator ; values > 1 indicate incomes above poverty ) , education level ( completed 8th grade , 9th12th grade , or some college or college graduate ) , bmi ( weight in kilograms divided by height in meters squared ) , subscapular and triceps skinfold , physical activity as described previously ( 15 ) , total cholesterol , systolic blood pressure , diastolic blood pressure , and hypertension ( systolic blood pressure 140 or diastolic blood pressure 90 or self - reported medication for high blood pressure ) . detailed cigarette smoking history information was collected for 3,420 participants at baseline and for the remaining 5,876 participants during the 19821984 follow - up . periodontal disease was defined in three ways . the primary definition classified participants into six categories using the periodontal index as follows . of dentate participants , 47% ( n = 3,372 ) had periodontal index = 0 and were classified as periodontally healthy , and the remaining dentate participants were further classified into quintiles ( n = 760/quintile ) of continuous periodontal index values . edentulous participants ( n = 2,127 ) were retained in a seventh category . in the second definition , participants were classified as either 1 ) being periodontally healthy ( n = 3,372 ) , 2 ) having gingivitis ( n = 2,135 ) , or 3 ) having periodontitis ( n = 1,662 ) as described previously ( 4,15 ) . in a third approach , tooth loss was considered as a surrogate definition of periodontal disease as it is often a consequence of periodontal disease ( 17 ) . participants were categorized as follows : 1 ) 2432 teeth ( reference group ) , 2 ) 1823 teeth , 3 ) 817 teeth , or 4 ) 17 teeth . logistic regression analysis was used to assess the association between baseline periodontal disease and the cumulative incidence of diabetes . the surveylogistic procedure in sas ( version 9.1 ; sas institute , cary , nc ) was used to appropriately account for the stratification , clustering , and sample weights of nhanes i. incidence density of diabetes was not considered because of uncertainty in diabetes onset timing , as discussed previously ( 18 ) . multiple models with various degrees of covariate adjustment are presented to provide clarity regarding confounding by design variables ( age , sex , and race ) , socioeconomic status ( education and poverty index ) , health behaviors ( smoking status , physical activity , and diet ) , general vascular health status ( hypertension and total cholesterol ) , and/or obesity ( bmi and skinfold ) . for the present analysis , smoking was defined in four categories : 1 ) current , 2 ) former , 3 ) never , or 4 ) reported history of smoking , current status unknown . the creation of the fourth smoking category avoids the elimination of those participants from the analysis and prevents biasing parameter estimates for current ( underestimation of smoking risk ) or former ( overestimation of smoking risk ) smokers . a control analysis was performed to assess the association between caries ( dmf ) and cumulative incidence of diabetes . we hypothesized a priori that periodontal index but not dmf would be positively associated with incident diabetes . if these dual hypotheses were confirmed , it would add specificity of the findings to periodontal disease as opposed to general oral health . the mean sd age of participants was 50 19 years , and at entry 60% were women , 84% were white , 15% were black , and 1% were other . those with periodontal disease tended to be older , male , nonwhite , smokers , and of lower socioeconomic status as reported previously ( 15 ) ( table a1 of the online appendix available at http://dx.doi.org/10.2337/dc08-0026 ) . there was a wide range of mean periodontal index values among participants defined as having either gingivitis ( periodontal index range = 0.068.00 ) or periodontitis ( periodontal index range = 0.888.00 ) . therefore , the primary exposure definition categorizing participants into six categories based on periodontal index values is more nuanced . during a follow - up period of 17 4 years ( range 122 years ) , 817 incident diabetes cases were reported ( cumulative incidence = 9% ) . of the incident cases , 77% were identified or confirmed via either death certificate or health care facility discharge diagnosis codes ; only 4% of cases ( n = 30 ) were from death certificate only . a physician diagnosis was self - reported by 55% ( table a2 of the online appendix ) . among nonperiodontal characteristics , age , sex , education , bmi , subscapular skinfold , and hypertension an approximate 2-sd increase in either bmi or subscapular skinfold was associated with a twofold increase in the odds of incident diabetes ( p < 0.0001 for both comparisons ) . odds were increased by 30% for a 10-year age increase ( p < 0.0001 ) , 50% for men ( p < 0.001 ) , and 40% for being hypertensive ( p < 0.01 ) . current and former smokers experienced non statistically significant 33% ( p = 0.08 ) and 26% ( p = 0.14 ) increased odds of type 2 diabetes , respectively . in multivariable models , incident diabetes odds varied across periodontal index categories ( table 1 ) . relative to participants with periodontal index ( pi ) = 0.0 ( pi0 ) , participants in the pi1 or pi2 categories did not experience an increased odds of developing diabetes , whereas the odds increased sharply in the pi3 category ( or 2.08 ; p < 0.0001 ) . the ors in pi4 ( 1.71 ; p = 0.003 ) and pi5 ( 1.50 ; p = 0.06 ) categories abated but remained elevated and were not statistically significantly different from the odds for those in the pi3 category . edentulous participants experienced a 30% increase in diabetes odds relative to those in the pi0 category ( p = 0.05 ) , but a 37% decrease in odds relative to those in the pi3 category ( p = 0.01 ) . the findings were unchanged when the analysis was restricted to incident diabetes cases occurring 10 years after baseline ( table 2 ) . participants in the pi3 category again demonstrated the highest or of 2.26 ( p < 0.0001 ) . supplemental analyses adjusting further for pack - years of smoking did not change the results ( data not shown ) . a twofold increase in diabetes odds was observed among participants in the pi3 category even among subgroups of never smokers or participants with bmi < 25 kg / m ( table 3 ) . women in the pi3 category had an or of 2.84 ( 95% ci 1.874.32 ) compared with 1.50 ( 95% ci 0.892.55 ) among men ( pinteraction = 0.12 ) . the highest diabetes or of 1.65 ( 95% ci 1.012.70 ) was observed for men in the pi4 category ( table 3 ) . no diabetes risk gradient across periodontal disease categories was apparent in blacks ( pinteraction = 0.07 ) . using the second periodontal disease definition , after multivariable adjustment , incident diabetes odds were increased by 40% among participants with gingivitis ( p < 0.05 ) and by 50% among participants with periodontitis ( p < 0.05 ) compared with periodontally healthy participants . participants missing 2531 teeth at baseline had an incident diabetes or of 1.70 relative to participants missing 08 teeth ( p < 0.05 ) . finally , in the control analysis , there was no association between the dmf index and incident diabetes . the pattern of ors across increasing sextiles of dmf was flat , with ors ranging from 0.82 ( 95% ci 0.511.34 ) in the second sextile to 0.92 ( 0.571.49 ) in the sixth sextile . we report a positive nonlinear association between baseline periodontal disease and incident type 2 diabetes in the nhanes i and nhefs . this association persisted regardless of the periodontal disease definition . when compared with healthy participants , participants with intermediate levels of periodontal disease had a twofold increased odds of incident diabetes , and the odds remained elevated among participants with the highest levels of periodontal disease . relative to periodontally healthy participants , edentulous participants experienced an intermediate 30% increased odds of diabetes . findings remained after extensive multivariable adjustment for potential confounders , including both bmi and subscapular skinfold , and in a subgroup analysis restricted to participants with bmi < 25 kg / m . the association remained strong after adjustment for smoking status or pack - years of smoking , as well as among never smokers . dietary factors such as fat , protein , or carbohydrate intake , as well as total caloric intake , did not attenuate the findings , although we caution that dietary data based on a single 24-h recall leave considerable room for residual confounding . finally , the observation that the dmf index ( an index related to oral hygiene practices ) was unrelated to incident diabetes adds specificity to the periodontal disease hypothesis . this might be a consequence of periodontal disease underestimation , in which examiners assigned the lesser of two periodontal index values when periodontal findings were equivocal . alternatively , lower thresholds of periodontal disease , as opposed to definitions requiring evidence of clinical periodontitis , might be necessary to fully capture subclinical infectious exposures relevant for systemic disease risk ( 19,20 ) . after an abrupt type 2 diabetes risk increase in the pi3 category , the risk leveled off in periodontal index categories 35 , indicating a possible threshold effect , although survivor bias should also be considered because participants with an advanced periodontal index were older at baseline and more likely to die before new - onset diabetes could be diagnosed and reported to the study . alternatively , a relatively increased prevalence of undiagnosed incident diabetes among individuals in the highest periodontal index categories could also explain the leveling of odds in these groups . the observed intermediate type 2 diabetes risk for edentulous participants is consistent with the broader body of literature concerning periodontal disease and systemic disease . associations between tooth loss and systemic disease from both the nhefs and other populations tend to be positive ( 6 ) , and intermediate risk is often reported among edentulous participants . tooth loss might play an epidemiologically confusing role in evaluation of systemic disease hypotheses ( 6,21 ) . tooth loss often acts concurrently as both a consequence of chronic periodontal disease and a preventive measure for future infectious exposure , therefore representing a mixture of risk and protection . data from the oral infections and vascular disease epidemiology study ( invest ) show the highest prevalence of carotid artery plaque among participants with intermediate tooth loss , whereas carotid plaque prevalence remained elevated yet attenuated among edentulous participants ( 21 ) . in contrast , participants in the study of health in pomerania ( ship ) became edentulous later in life than invest participants ( 22 ) , and the greatest extent of carotid atherosclerosis in ship was also observed among edentulous participants ( 23 ) . taken together , these findings suggest that edentulism occurring earlier in life might confer some protection against atherosclerotic development by minimizing lifetime oral infectious exposure . if confirmed , the present results might have implications for ongoing research regarding periodontal disease and cardiovascular disease . specifically , type 2 diabetes might also be considered as a mediator , in addition to a confounder , of these associations . the observed 50100% increased incident type 2 diabetes odds associated with periodontal disease is clinically relevant as it is comparable to the risk associated with other type 2 diabetes risk factors . for example , in agreement with previous research ( 18 ) we report that a 2-sd increase in either bmi or subscapular skinfold is associated with an approximate 100% increase in incident diabetes odds , whereas being hypertensive or having 10 additional years of age increased diabetes odds by 40 and 30% , respectively . although the sex interaction in this study did not reach statistical significance ( p = 0.12 ) , the observation that periodontal disease was apparently more strongly associated with incident type 2 diabetes among women may be worthy of note , given recent findings that inflammation was a stronger predictor of type 2 diabetes in women than in men ( 23 ) . whether the current sex differences in periodontal disease related diabetes risk have biological underpinnings or are merely contextual or an artifact merits further study . nhanes i is limited by the lack of fasting glucose measures to exclude undiagnosed baseline diabetes . because of the high prevalence of undiagnosed diabetes in the general population ( 24 ) , the potential for reverse causality ( undiagnosed diabetes at baseline causes periodontitis , but the diabetes is later discovered and thought to be incident ) exists . this possibility was minimized by 1 ) removing incident diabetes cases occurring within 1 year of baseline from all analyses and 2 ) conducting a subgroup analysis restricted to incident diabetes occurring 10 years after baseline , because most individuals with diabetes would probably become symptomatic within 10 years . similarly , the potential for diagnostic bias during follow - up to explain these findings is unlikely . for this bias to remove our finding , the rate of undiagnosed diabetes would have to be substantially higher among periodontally healthy ( our reference group ) individuals relative to those with advanced periodontal disease , thus artificially reducing diabetes incidence among individuals without periodontal disease . although not impossible , this possibility seems unlikely because the probability of undiagnosed diabetes in nhanes iii has been reported to be higher among individuals with as opposed to those without periodontitis ( 25 ) . further , according to previously published nhanes data , the probability of undiagnosed diabetes is highest among groups with elevated type 2 diabetes risk factors ( 24 ) . in the present report therefore , it is more likely that participants with periodontal disease experienced a higher rate of undiagnosed diabetes during follow - up than periodontally healthy participants . an adverse family history or common genetic susceptibility underlying both periodontal disease and type 2 diabetes also remains as a possible explanation for our findings . we were unable to account for this potential as neither genetic data nor information regarding a family history of periodontal disease and diabetes were collected in nhanes i. studies with more precise measures of infectious exposure can increase our understanding of the association between bacteria - induced periodontal disease and diabetes , as was recently done for cardiovascular disease outcomes ( 26 ) . nevertheless , the observations that both clinical periodontal disease and tooth loss , but not the dmf index , were associated with incident type 2 diabetes bolster the chronic periodontal infection hypothesis . we have found baseline periodontal disease to be a clinically relevant and novel predictor of incident type 2 diabetes in a large , population - based sample representative of u.s . the prediction of type 2 diabetes from periodontal disease was not explained by confounding related to known diabetes risk factors and could reflect a shared biological pathway , such as chronic low - grade inflammation . nevertheless , these findings require confirmation in populations with fasting glucose or a1c measurements to definitively rule out diagnostic bias . if confirmed , a contributory role of periodontal disease in the development of type 2 diabetes is potentially of public health importance because of the prevalence of treatable periodontal diseases in the population ( 27 ) and the pervasiveness of diabetes - associated morbidity and mortality .

objective type 2 diabetes and periodontal disease are known to be associated , but the temporality of this relationship has not been firmly established . we investigated whether baseline periodontal disease independently predicts incident diabetes over two decades of follow-up.research design and methods a total of 9,296 nondiabetic male and female national health and nutrition examination survey ( nhanes i ) participants aged 2574 years who completed a baseline dental examination ( 19711976 ) and had at least one follow - up evaluation ( 19821992 ) were studied . we defined six categories of baseline periodontal disease using the periodontal index . of 7,168 dentate participants , 47% had periodontal index = 0 ( periodontally healthy ) ; the remaining were classified into periodontal index quintiles . incident diabetes was defined by 1 ) death certificate ( icd-9 code 250 ) , 2 ) self - report of diabetes requiring pharmacological treatment , or 3 ) health care facility stay with diabetes discharge code . multivariable logistic regression models assessed incident diabetes odds across increasing levels of periodontal index in comparison with periodontally healthy participants.resultsthe adjusted odds ratios ( ors ) for incident diabetes in periodontal index categories 1 and 2 were not elevated , whereas the ors in periodontal index categories 3 through 5 were 2.26 ( 95% ci 1.563.27 ) , 1.71 ( 1.02.69 ) , and 1.50 ( 0.992.27 ) , respectively . the or in edentulous participants was 1.30 ( 1.001.70 ) . dentate participants with advanced tooth loss had an or of 1.70 ( p < 0.05 ) relative to those with minimal tooth loss.conclusionsbaseline periodontal disease is an independent predictor of incident diabetes in the nationally representative sample of nhanes i.

in the current issue of critical care , friesenecker and colleagues present a well - designed comparative study on the microvascular effects of arginine vasopressin ( avp ) and norepinephrine ( ne ) in awake hamsters under physiological conditions . the authors used the dorsal skinfold window chamber technique to measure vascular diameter , cross - sectional area and blood flow of five different sizes ( a0 to a4 ) of subcutaneous arterioles . whereas continuous infusion of both drugs resulted in similar macrohemodynamic changes , avp led to a more pronounced reduction in vessel diameter and blood flow of the proximal , large ( a0 ) arterioles than ne . interestingly , both vasopressors had similar effects on the skin microvasculature in more distal , smaller ( a1 to a4 ) arterioles . from these results the authors conclude that the strong vasoconstrictive effect of avp on large arterioles accounts for its strong vasopressive potency and may explain its efficacy in catecholamine - refractory vasodilatory shock . to the best of our knowledge , friesenecker and colleagues are the first to have compared the effects of avp and ne on different subcutaneous vessel calibers . first of all , the conclusion that especially the vasoconstrictive effect of avp on large ( a0 ) arterioles accounts for its strong vasopressor effect can not be drawn from the presented data . in this context it is especially noteworthy that the authors observed differences in neither macrohemodynamics ( i.e. mean arterial pressure ( map ) ) nor microcirculatory effects on a1 to a4 arterioles between both study groups . the fact that the stronger vasoconstrictive effect of avp on a0 arterioles was the only difference between groups suggests that the constriction of large arterioles had ( almost ) no impact on total peripheral resistance . this thesis is supported by poiseuille 's law implying that resistance is inversely correlated to the fourth power of the vessel radius . accordingly , the small vessels primarily account for changes in vascular resistance rather than the large ones . using the same animal model , gerstberger and colleagues compared the effects of either 10 pmoles / kg of avp orthe same dose of angiotensin ( ang ) ii on the hamster subcutaneous microcirculation . these authors reported that the vasoconstrictive effects of both drugs on small ( a3 ) arterioles were comparable , whereas ang ii , but not avp , contributed to a marked constriction of greater ( a1 ) arterioles . this vasoconstriction of a1 arterioles by ang ii was associated with a much greater vasopressor effect ( i.e. change in map ) than avp . notably , the avp plasma levels measured in the study by gerstberger and colleagues were about 100 pg / ml , thus representing the upper therapeutic range during avp infusion in patients with hyperdynamic septic shock . the contradictory results of friesenecker and colleagues and gerstberger and colleagues emphasize that the effects of vasoactive agents on the microcirculation are still not fully understood . therefore , the study of friesenecker and colleagues gives another important and interesting insight into the diversity of the microvascular response to vasoconstrictor agents . with respect to the second conclusion , the study by friesenecker and colleagues would have certainly profited from studying groups suffering from vasodilatory shock secondary to systemic inflammation . this holds especially true , since clinical and experimental research has clearly shown that distribution abnormalities in vasodilatory shock states contribute to significant changes in microvascular hemodynamics . therefore , interventions in the physiological state may not necessarily be suitable to predict the response of the same intervention under pathological conditions , such as sepsis . finally , although redistribution of blood flow away from non - vital organs ( e.g. the skin ) to vital organs represents one of the primary therapeutic aims of vasopressor therapy ( especially in septic shock patients ) , it should be kept in mind that this approach may result in severe hypoperfusion of non - vital organs . whereas it is well known that avp infusion ( especially when applied in higher doses ) increases the risk of gut mucosal ischemia , skin hypoperfusion appears to be another clinically relevant complication . in this regard , the study group of friesenecker and dunser recently reported on the incidence and risk factors of ischemic skin lesions in patients with catecholamine - resistant vasodilatory shock . importantly , the authors found that ischemic skin lesions are common among patients with vasodilatory shock treated with avp and that the combination of sepsis and treatment with avp may especially be a risk factor for the development of ischemic skin lesions . in conclusion , friesenecker and colleagues correctly state that avp has a stronger vasoconstrictive effect on large arterioles of the subcutaneous vasculature in healthy hamsters compared to ne . unfortunately , the very interesting question of whether or not the stronger vasoconstrictive effect on large vessels is also maintained in vasodilatory shock remains unresolved . the fact that avp infusion may impair gut mucosal microcirculation and skin perfusion suggests that the stronger one may not necessarily be the better one . ang = angiotensin ; avp = arginine vasopressin ; map = mean arterial pressure ; ne = norepinephrine .

in the current issue of critical care , friesenecker and colleagues present a well - designed comparative study on the microvascular effects of arginine vasopressin ( avp ) and norepinephrine ( ne ) in a physiological , unanesthetized hamster model . the authors clearly demonstrate that avp , but not ne , has marked vasoconstrictive effects on large arterioles , whereas the impact on small arterioles is comparable for both vasopressors . however , it remains unclear if these results , per se , reflect a stronger vasopressive potential of avp versus ne , as macrohemodynamic variables were not different between study groups . since the authors did not investigate the effects of avp and ne in vasodilatory shock states , the microcirculatory response in sepsis or systemic inflammatory response syndrome remains inconclusive . the same authors previously reported that avp infusion in patients suffering from vasodilatory shock carries the risk for ischemic skin lesions . this in turn raises the question whether the quality of vasopressors should be judged by their potency .

discovered by berzelius in 1817 , selenium ( se ) belongs to the 16 group ( formerly group 6a ) in the periodic table , together with oxygen , sulfur , tellurium , and polonium ( nogueira and rocha 2011 ) . initially , se was considered only as a toxic element , but for several decades it has been known as an essential trace element associated with significant health benefits in humans and mammals ( schwarz and foltz 1958 ) . the basic role of se activity is its presence in catalytic sites of various selenoproteins . in eukaryotic cells , se can be incorporated into 25 human and 24 rodent selenoproteins during translation , as selenocysteine ( sec ) , 21st aminoacid , which is unique for essential trace elements incorporation ( hesketh 2008 ) . selenoproteins may perform various functions in humans , including antioxidant action ( e.g. , glutathione peroxidases ) , transport and storage of se ( selenoprotein p ) , redox signaling ( thioredoxin reductases ) , thyroid hormone metabolism ( iodothyronine deiodinases ) , protein folding ( e.g. , selenoprotein 15 kda ) , and others ( table 1).table 1human selenoproteinsfunctionabbreviationsselenoproteincellular ; tissue localizationantioxidant enzymesgpx1cytosolic glutathione peroxidase ( gpx)cytosol , mitochondria ; widely expressedgpx2gastrointestinal gpxcytosol , er ; gastrointestinal tissue , livergpx3plasma gpxsecreted ; plasma , extracellular fluid , liver , kidney , heart , lung , thyroid , gastrointestinal tissue , breastgpx4phospholipid hydroperoxide gpxcytosol , mitochondria , nucleus ; widely expressed , testesgpx6olfactory gpxunknown ; embryo and oilfactory epitheliumselkselenoprotein ker , membrane proteinselrselenoprotein r ; methionine sulfoxide reductase b1cytosol , nucleus ; widely expressedselwselenoprotein wcytosol ; widely expressed , brain , colon , heart , skeletal muscle , prostatetransport and storage of sesepp1selenoprotein psecreted , cytosol ; plasma , widely expressed , brain , liver , testesredox signalingtrxr1thioredoxin reductase , type icytosol , nucleus ; widely distributedtrxr2thioredoxin reductase , type iimitochondria ; widely distributedtrxr3thioredoxin reductase , type iiicytosol , er , nucleus ; testis - specificthyroid hormone metabolismdio1iodothyronine deiodinase , type imembrane protein ; kidney , liver , thyroid , brown adipose tissuedio2iodothyronine deiodinase , type iier , membrane protein ; thyroid , central nervous system , brown adipose tissue , skeletal muscledio3iodothyronine deiodinase , type iiimembrane protein ; placenta , central nervous system , fetusprotein foldingsep15selenoprotein 15 kdaer lumenselnselenoprotein ner membrane ; widely expressedselmselenoprotein mer lumenselsselenoprotein ser , membrane protein ; widely expressedsec synthesissps2selenophosphate synthetasecytosolunknownselhselenoprotein hnucleus ; widely expressedseliselenoprotein itransmembraneseloselenoprotein ounknownseltselenoprotein ter membraneselvselenoprotein vtestesadapted from papp et al . ( 2010 ) genetic polymorphism associated with cancer the role of se and selenoproteins in human health and diseases has been intensively studied with special attention on the determination of relevant biomarkers of se status . , se is largely found in animal foods , and to a lesser extent also in plants , which indicates large individual differences in se intake , associated with dietary menu composition , but also with the origin of food , which can be grown ( plants ) or bred ( animals ) on soils with different se content ( gromadzinska et al . 2008 ) . in humans , dietary se intakes also vary geographically from low to high se areas . well documented se deficiency health effects keshan and kashin - beck ( kbd ) diseases , associated with muscle disorders , were found in a broad zone running from northeast to southwest china , from the border of heilongjiang to the yunnan province , where concentration of se in the soil was very low ( oldfield 1999 ) . in european countries , dietary se intake is lower than that observed in usa , mainly due to low se soils . recommended dietary intake ( rdi ) value of se for adults in usa and europe is 55 g / day . tolerable upper intake level determined by the us food and nutrition board ( nas 2000 ) is 400 g / day , while that determined by the scientific committee on food in europe is 300 g / day ( efsa 2008 ) . average intake of se by european population ranges from 27 to 70 g per day ( efsa 2008 ) , which is insufficient to meet the daily requirement . clinical signs of marginal se deficiency in europe have not been observed or documented yet . however , it should be noted that several groups of healthy individuals may be specially prone to se deficiency , which includes breast - fed neonates , pregnant women , and elderly people ( bellinger et al . the relationship between se level and health effects is represented by a u - shaped curve that suggests health pathologies associated with se deficiency as well as its excess ( ip 1998 ; jablonska et al . the altered se status resulting from insufficient se intake is very often associated with different diseases , including immune diseases , cardiological diseases , and cancer . on the other hand , recent studies have indicated that long - term high dietary se supply seems to be related to the risk of type 2 diabetes , amyotrophic lateral sclerosis , and some types of cancer ( bellinger et al . although se levels in blood and blood compartments are easily accessible markers of human se nutritional status , se level itself does not reflect its functional significance . plasma or serum se , very often used in various se investigations , reflects rather short - term se status , while platelet , leukocyte , and erythrocyte se reflects its longer - term status . two best known selenoprotein biomarkers that have been widely used in discriminating of se status are as follows : plasma selenoprotein p ( sepp1 ) level and plasma glutathione peroxidase ( gpx3 ) activity . in healthy humans , plasma se is incorporated as sec in two selenoproteins : sepp1 ( 4070% ) , gpx3 ( 2040% ) , while 610% of se is bound to albumin in the form of selenomethionine , through the replacement of methionine . free se accounts for less than 1% of total plasma se ( vincent and forceville 2008 ) . these biomarkers generally reflect the major sources of human body se , because gpx3 and sepp1 are the unique secreted selenoproteins . gpx3 is mainly synthesized in kidney , where it is produced by the cells of proximal tubular ephitelium and by parietal cells of bowman s capsule and then it is released into the plasma ( gromadzinska et al . mammalian sepp1 that contains multiple sec residues ( 10 sec residues in humans and rodents ) is synthesized in liver and then secreted into the blood and transported to other tissues . recently , specific apolipoprotein e receptor-2 ( apoer2 ) for sepp1 uptake in brain and testis and apoer2 homolog megalin for sepp1 uptake in kidney proximal tubule epithelial cells were found , suggesting receptor - mediated uptake of se in these organs ( burk and hill 2009 ) . there is a growing interest in the use of transcripts level as a molecular biomarker with special regard to whole blood . since early 1990s , research on this new molecular biomarker of se status has been extended to se studies in rodents , showing prioritization of preservation and degradation of specific selenoprotein mrna under se deficiency and under conditions of adequate and enhanced supply ( bermano et al . 1995 ) . the observed hierarchy of the expression of selenoprotein mrna in response to dietary se supply has indicated the order of selenoproteins , some of them dramatically affected under se deficiency or its excess , and others only marginally . selenoprotein transcripts analysis in the blood gives an opportunity to obtain genomic fingerprints , in response to se status , but also reflect an impact of genetic polymorphism of selenoproteins . in a few recent human studies , selenoprotein gene expression level in circulating human blood leukocytes was used as a longer term se status indicator . some other studies have been focused on the role of se incorporation during selenoprotein synthesis under different se dietary status in humans ( pagmantidis et al . 2008 ; ravn - haren et al . 2008a , b ; reszka et al . 2009 ; sunde et al . 2008 ) . levels of se for optimization of sepp1 concentration and gpx3 activity in plasma have been determined in people living in se - adequate areas . however , these biomarkers may be unsuitable under conditions of high se status , because of plateau levels obtained at such concentrations . on the other hand , se levels in blood of individuals living in low se areas with low se intake may be insufficient to ensure maximal activity and/or concentration of selenoproteins gpx3 and sepp1 ( thomson 2004 ) . therefore , determination of se intake and se status in humans with variable se supply seems to be important in assessing the most sensitive se status biomarkers . in this review , we present recent findings regarding molecular se biomarkers , based on rodent and human studies . se status measured by serum / plasma se , plasma sepp1 concentration and plasma gpx3 activity may differently respond to se supplementation , which can give information about low , adequate , and high se dietary intake . since several years , it has been generally accepted that selenoprotein level and/or activity may be more useful in determining se status than se itself . two human selenoproteins , gpx3 , and sepp1 are believed to be good nutritional se biomarkers in humans . studies on se - deficient populations showed that full expression of sepp1 required larger intake of se than did gpx3 activity ( xia et al . therefore , setting rdi values for se intake was based on their assessment of the amount of se required to achieve optimal activity or two - thirds optimal activity of gpx3 in plasma to meet the requirements of people living in low , adequate , and high se areas ( rayman 2004 ) . different chemical forms of dietary se from animal foods and plants , such as selenite , selenocysteine , and selenomethionine , are involved in metabolic pathways to form selenide . selenide is then transformed into sec for selenoprotein biosynthesis or may be methylated to the main metabolite selenomethionine is a major form of organic selenium in plant foods , similarly like selenium - enriched yeast in se supplements . because of different metabolism of se compounds in organism , absorption of se from different organic and inorganic se food sources , and se supplements , their incorporation in selenoprotein and urinary se excretion may vary in humans . 2005 ) clearly indicate that se in the form of selenomethionine is more easily absorbed than selenite . absorption of se from yeast was greater than this inorganic form but less than selenomethionine . interestingly , plasma se seemed to reflect selenomethionine content of yeast but not the other yeast se forms , indicating its effective bioavailability ( burk et al . in several populations in suboptimal se areas in europe , china , new zealand , concentration of sepp1 could not reach the plateau because of low se daily intake , suggesting that se nutritional requirements had not been achieved ( xia et al . different plateaus reached by plasma gpx3 activity and plasma sepp1 level indicates that the latter is a better indicator of se status in humans , because a larger intake of se has been required for optimized sepp1 concentration than did gpx3 activity ( xia et al . in addition to gpx3 activity , plasma sepp1 level may be a suitable se status and se intake biomarker in individuals from low se populations with additional supply of se . in populations living in high se areas , e.g. , australia ( queensland ) , usa , and canada ( central states and provinces ) ( oldfield 1999 ) , where gpx3 activity and sepp1 level in plasma can be optimized by dietary se supply , plasma se seems to reflect se status and se intake ( burk et al . the unique conserved stem - loop sec insertion sequence ( secis ) in the 3-untranslated region of mammalian selenoprotein mrna is essential for the recognition of uga as a codon for sec . sec may be synthesised from different se dietary sources : selenomethionine , selenocysteine or selenite , se compounds which are further metabolized to selenide and then in the presence of selenophosphate synthetase 2 to selenophosphate this process requires specific sec trna[ser]sec , several translation factors like sbp2 , efsec , and others that serve to distinguish between uga codons designated for sec from those terminating translation . sec synthesis occurs directly on its sec trna[ser]sec , initially carrying a serine residue , which serves as an acceptor for selenophosphate . maturation of sec trna[ser]sec requires methylation , and two isoforms of methylated and unmethylated sec trna[ser]sec are observed . se supplementation is known to modulate the relative ratio between these two isoforms and promote the methylation of sec trna[ser]sec . ( hatfield and gladyshev 2002 ; hesketh and villette 2002 ; jameson and diamond 2004 ; schomburg and schweizer 2009 ; small - howard and berry 2005 ) . it has been observed that the alterations in selenoprotein activity and concentration during se depletion and repletion are accompanied by changes in the mrna level . under severe se deficiency , this microelement is accumulated mainly in the brain and endocrine tissues , where elevated expression and activity of phospholipid glutathione peroxidase ( gpx4 ) and thyroxine deiodinase ( dio ) were observed , indicating the biological importance of these selenoproteins ( schomburg and schweizer 2009 ) . according to rodent studies , the main selenoproteins that are resistant to dietary se changes are gpx4 and dio ; thioredoxine reductases ( trxr ) and sepp1 are moderately sensitive , while gpx1 , selw , selh are very sensitive to low se supply ( reeves and hoffmann 2009 ; sunde 2010 ) . several in vitro and in vivo studies have shown that , under se deficiency , the degradation of selenoprotein mrna occurs through nmd ( nonsense codon - mediated mrna decay ) ( moriarty et al . 1998 ; weiss and sunde 1998 ) . due to specific nucleotide sequences and preferential binding of sbp2 translation factor , 14 of 25 human selenoprotein mrnas may be sensitive to nmd - based degradation under low se supply ( squires et al . however , a study on rodents , suggesting regulation of selenoprotein expression , irrespective of this hypothetical preference , indicates that also other mechanisms concerning differences in the expression efficiency of some selenoproteins under se deficiency must exist ( sunde et al . 2009 ) . in addition , methylated sec trna[ser]sec supports the biosynthesis of selenoproteins gpx1 , gpx3 , selr , selt , sensitive to low se supply , while other selenoproteins , like trxr1 and gpx4 , moderately sensitive and resistant to low se supply , require unmethylated isoform ( schomburg and schweizer 2009 ) . an attempt to answer the question whether selenoprotein gene expression may be used as a biomarker of se status was presented for the first time by roger a. sunde s team . sepp1 mrna shows the highest expression in rat testes and liver , while gpx3 mrna expression is highest in rat kidney ( evenson et al . 2004 ) , which is in agreement with observed selenoprotein activity and protein expression in these organs . therefore , these molecular biomarkers may be also useful for the determination of se status as well as for establishing physiological requirements of se for adequate selenoprotein gene expression . these authors found also that , in rodents , gpx1 , selh , and selw mrna levels were highly regulated by se status ( sunde 2010 ) . analysis of hierarchical regulation of different selenoprotein mrnas by se status indicates that gpx1 transcripts level is the best and adequate molecular biomarker in rats , because dietary se deficiency similarly decreased gpx1 mrna in blood and liver . by way of comparison , decrease in se supply in diet gpx1 mrna expression in rat liver was the highest , while in blood , expression of this selenoprotein was at 4th place in tissue rank , comparable with the expression in heart and kidney . interestingly , other investigated selenoprotein transcripts also presented distinct expression pattern across the tissues and it was found that gpx1 , gpx3 , gpx4 , sepp1 , trxr1 expression in blood were comparable with those observed in the major organs ( evenson et al . regulation of selenoprotein mrna under se dietary deficiency presents diversity , from dramatic decrease in gpx1 mrna to lack of changes for gpx4 mrna . low selenoprotein mrna observed in rodents reflect depletion of se supply in the diet , and adequate se supply regulates expression level very efficiently . it has been found that at least half of the dietary se necessary to provide plateau for enzymatic activity or protein expression is adequate to provide plateau for mrna expression in liver , muscle , and kidney of rats ( barnes et al . , selenoprotein mrna level is expressed as hyperbolic curve presenting plateau breakpoints at low se supply for majority of selenoproteins . minimal se requirement for growing rats was 0.1 g se / g diet based on liver se , liver , and rbc gpx1 activity . slightly lower dietary se requirements based on plasma gpx3 activity , liver trxr activity , and liver and kidney gpx3 activity were observed . based on dose response curves for selenoprotein mrna indifferent tissues , the minimum dietary requirements were lower than for physiological se biomarkers , ranging between 0.04 and 0.06 g se / g diet in liver and kidney and was between 0.03 and 0.05 g se / g diet in muscles . besides , it has been assumed that it is not feasible to use selenoprotein mrna in rat tissues as a biomarker for super - nutritional se level ( up to 0.8 g se / g diet ) . these experiments evidently suggest that marginal level of se in diet is able to increase selenoprotein mrna to adequate level in rats and mice , what may suggest common mechanism in regulation of selenoprotein mrna expression by dietary se supply ( barnes et al . recently , sunde ( 2010 ) proposed the panel of molecular biomarkers , which could be useful for the assessment of selenium status in rats and might be effective as the traditional biomarker panel in rat tissues . gpx1 , gpx3 , selt , and selw mrna panel of transcripts level was significantly correlated with liver se concentration , gpx1 and selk mrna were associated with liver gpx1 activity , while sepw and selk mrna reflected kidney selenium status , and gpx1 , sepw , txnrd1 transcripts level correlated with gpx1 kidney activity . interestingly , recent studies suggest that regulation of selenoprotein mrna by se dietary status is not a general phenomenon in rodents . it was found that in mice , majority of analyzed selenoprotein transcripts in liver and kidney were not significantly regulated by se deficiency ( sunde et al . it has been found that minimum se requirement of the turkey is higher than for rodents ( sunde and hadley 2010 ) . dietary requirement was decreased at least 50% in old rats as compared to requirements of young animals ( sunde and thompson 2009 ) . expression of the majority of selenoprotein mrna in testis , except for gpx1 , sepp1 , sepw , and also apoer2 , was not regulated by dietary se status ( schriever et al . 2009 ) . the mrna abundances of the 12 selenoprotein genes in thyroid and pituitary of young pigs were resistant to increasing se dietary supply in diet and also se deficiency , but not in liver , where nmd under se deficiency was observed for gpx1 , sepw , sepn , txrd1 . the testicular mrna of txnrd1 and sep15 were decreased by increasing dietary se supply , indicating that high se status may be associated with a decrease in selenoprotein mrna transcripts level ( zhou et al . differences in dietary minimal se supply required for maximal mrna expression and/or selenoenzyme activity suggest differential regulation depending on the type of selenoprotein as well as tissue . therefore , findings regarding ranking of different selenoproteins synthesis within tissue and also different distribution of selenoproteins in various tissues should be considered in establishing a universal se status biomarker ( sunde 2010 ) . in 2003 , the panel of experts in uk food standards agency has issued specific research recommendations after evaluation of current knowledge regarding the assessment of se status , including further development of functional biomarkers ( elsom et al . recently , a special emphasis is laid on the application of population of circulating white blood cells ( wbc ) transcriptome patterns in nutritional studies . transcriptomics studies suggest that genes with various functional annotations can be significantly expressed in wbc ( visvikis - siest et al . gene expression patterns may be also useful to define biological processes associated with human health and disease . however , only a few studies assessing selenoprotein gene expression in various populations of circulating wbc in humans have been conducted so far ( table 2).table 2human studies on selenoprotein molecular biomarkersstudybaseline daily se intake ( g)mean sdbaseline plasma se level ( ng / ml)mean sdselenoprotein gene expression in wbcuk , selgen study , n = 39 , both sexes , 6 week . se intervention ( pagmantidis et al . 2008)not presented93.9 1.7lymphocyteup - regulation : sps11.15 ( 1.061.23)selk1.11 ( 1.041.19)sep151.11 ( 1.021.20)denmark , n = 20 , 1840 years . . 2008a)49.8 13.6113.2 12.2leukocyteno effect : gpx1 , trxr1 sepp1denmark , precise pilot study , n = 105 , both sexes , up to 5 years . 2008b)49.8 13.693 11.2leukocyteno effect : gpx1uk , n = 39 , both sexes , 28 week . se intervention ( sunde et al . 2008)48 1489.2 12.5whole bloodno effect and no association between se status and gpx1,gpx3 , gpx4 , sepp1 , sepw , sephpoland , n = 47 healthy men ( reszka et al . 2009)24.2 17.4 ( unpublished data)54.3 14.6leukocyteno association between se status and gpx1 , gpx3 , sepp1 , sep15 human studies on selenoprotein molecular biomarkers human studies have not confirmed the hypothesis that selenoprotein transcript level in circulating leukocytes and in whole blood may be the reliable biomarker of se status in population with adequate ( sunde et al . 2008 ) and suboptimal ( reszka et al . 2009 ) baseline se level in plasma ( fig . 1 ) . after short - term 100 g sodium selenite supplementation , healthy subjects from the selgen population were chosen at random for microarray analysis of rna isolated from lymphocytes . the greatest changes after se supplementation were observed for genes that encode proteins functioning in protein biosynthesis . up - regulation of selenoprotein k ( selk ) and selenoprotein 15 kda ( sep15 ) after se supplementation was observed , indicating that only a small number of selenoprotein encoding genes was altered by different se dietary supply ( pagmantidis et al . ( 2008a , b ) also indicated lack of se impact on selenoprotein mrna expression in wbc after short- and long - term se supplementation . after 1 week of supplementation with nonorganic se or organic form among healthy young danish men , there were no differences in mrna expression of gpx1 , trr1 , and sep1 in leukocytes ( ravn - haren et al . similarly , after 5 years of se - enriched yeast supplementation of the precise danish subjects , there were no differences in the expression of gpx1 in circulating wbc ( ravn - haren et al . moreover , selenoprotein expression level in whole blood was not significantly associated with se status measured in the blood and se supply measured according to dietary questionnaire in uk population ( sunde et al . the baseline se level in uk and danish populations was relatively high as compared to other european populations and it approximately averaged 100 ng / ml in plasma ( table 2 ) . lack of changes in selenoprotein mrna levels after se supplementation indicates that protein synthesis may already be saturated in leukocytes at such sufficient se concentration . in the small group of 47 healthy polish individuals , plasma se levels were below the level required to optimize plasma gpx3 activity ( 54.3 14.6 ng / ml ) . however , no relationship between serum se and gpx1 , gpx3 , sepp1 , and sep15 mrna transcripts level , as well as gpx1 and gpx3 activities and selenoprotein mrna expression was found ( reszka et al . daily se intake in studied european groups was lower than rdi ( 55 g / day ) for adults in europe and us . the observed hyperbolic curve describing the relationship between selenoprotein mrna expression and dietary supply in rodents suggests that suboptimal se status in humans may be sufficient for selenome transcription machinery . interestingly , gpx1 , gpx3 , sepp1 , and sep15 selenoprotein mrna expression in circulating blood leukocytes was significantly positively correlated , indicating similar regulation of expression in circulating blood leukocytes . although significant correlations were found between several selenoprotein mrnas in the circulating blood leukocytes of healthy individuals , no correlation was found in the blood of bladder cancer patients , which may suggest an alteration of selenoprotein synthesis during carcinogenesis ( reszka et al . british ( whole blood ) ( sunde et al . 2008 ) ( a ) and suboptimal polish ( leukocyte ) ( reszka et al . 2009 ) ( c ) se level and correlation between plasma se level and sepp1 transcripts level in population with adequate british ( whole blood ) ( b ) and suboptimal polish ( leukocyte ) ( d ) se level a and b reproduced with permission from sunde et al . ( 2008 ) correlation between plasma se and gpx3 transcripts level in population with adequate british ( whole blood ) ( sunde et al . 2008 ) ( a ) and suboptimal polish ( leukocyte ) ( reszka et al . 2009 ) ( c ) se level and correlation between plasma se level and sepp1 transcripts level in population with adequate ( d ) se level a and b reproduced with permission from sunde et al . functional significance of blood se status is mainly related to selenoprotein activity in specific tissues . therefore , both traditional and molecular biomarkers of se status measured in different human tissues , except for controlled se intake , may depend on additional major modifiers , like health status ( e.g. , endocrine and immunological status ) , inter - individual variations ( age , sex , genetic polymorphism ) , environmental exposure , diet , medication , etc . therefore , establishing the se status and intake which would be optimal for human health seems to be very difficult , especially in many populations experiencing suboptimal se supply , including europe . epidemiological and animal studies clearly indicate that biological effects of se are sex - specific , which may be associated with endocrine regulation and also immunological status . it has been suggested that cancer risk in men is more profoundly influenced by se status than in women ( waters et al . selenoprotein gene expression displays sexual dimorphism in various organs of females and males , e.g. , se status was linked to male fertility due to gpx4 function during spermatogenesis ( schomburg and schweizer 2009 ) . sex - specific selenoprotein expression pattern may vary or be sustained with age . in the selgen study , an effect of se supplementation was associated with gpx4 genetic polymorphism in a sex - specific manner ( meplan et al . plasma se level is not likely to accurately reflect tissue se status or selenoenzyme activity and level . 2006 ) . se metabolism may be altered in different health pathologies , e.g. , in patients with inflammatory diseases . during critical illness , like sepsis , acute phase response , and other immunological disturbances , serum se status may be lower and insufficient to support organ function . in systemic inflammatory response syndrome patients , serum se concentration was significantly lower ( vincent and forceville 2008 ) . tobacco smoking or occupational exposure can also increase dietary requirement of se . it is generally agreed that smoking can decrease the activity of antioxidative selenoproteins , probably due to formation of complexes of se with cadmium ( ellingsen et al . a scheme of traditional and molecular biomarkers measurements with the impact of potential modifiers ( physiological , environmental , genetic ) . the optimal selenium biomarker should reflect all putative egzo- and endogenous factors which can modulate selenium bioavailability , metabolism and selenoprotein transcription , biosynthesis , transport , activity and function . a type of measurement used for the determination of selenium status should be also considered biomarkers of selenium status in humans . a scheme of traditional and molecular biomarkers measurements with the impact of potential modifiers ( physiological , environmental , genetic ) . the optimal selenium biomarker should reflect all putative egzo- and endogenous factors which can modulate selenium bioavailability , metabolism and selenoprotein transcription , biosynthesis , transport , activity and function . a type of measurement used for the determination of selenium status should be also considered in human population , there is a large individual variation in response to se supplementation , appearing to be unrelated with the baseline se status ( brown et al . recent human studies indicate that selenium status , measured as body se , as well as sepp1 plasma level and gpx activity , may be significantly influenced by genetic polymorphism of specific selenoproteins , including gpx1 ( rs1050450 ) ( jablonska et al . 2007 , 2009 ) , gpx4 ( rs713041 ) ( meplan et al . 2008 ) . the impact of sepp1 variations in codon 234 , associated with ala to thr change ( rs3877899 ) and g to a transition within 3 untranslated region ( utr ) of sepp1 mrna ( rs7579 ) , resulted in the alteration of se status before as well as after se supplementation ( meplan et al . . these polymorphisms also influence proportion of two sepp1 50 and 60 kda isoforms in plasma , which was proposed as the modulation factor of se incorporation during selenoprotein synthesis ( meplan et al . 2009 ) . se availability modulated by sepp1 variants , resulting in difference in isoform pattern was restricted just to males . interestingly , a possible impact of gender was observed for functional significance of gpx4 genetic polymorphism . single nucleotide polymorphism in 3-utr of gpx4 mrna , associated with c to t change ( rs713041 ) influenced the level of gpx4 in lymphocytes , and also other selenoproteins ; however , this effect was more evident in females ( meplan et al . one may hypothesize that separate molecular mechanisms for gpx4 synthesis in testes and high dietary se requirements in males override genetic polymorphism in gpx4 and sepp1 . recent findings suggest also that the association between gpx1 activity and se concentration , analyzed separately for each gpx1 pro198leu ( rs1050450 ) genotype group , was the highest for pro / pro and the lowest for leu / leu genotype , suggesting different response of gpx1 activity to se . this also points to the importance of the genetic background in the assessment of the se status with the use of selenoprotein biomarkers such as gpx1 activity ( jablonska et al . adaptation of humans to suboptimal dietary se supply with low se level was observed by finley et al . ( 1999 ) in healthy study participants living in new zealand , where people consume less se than suggested by the rdi of 55 g / day . se level in blood of individuals living in low se areas and with low se intake may be insufficient for maximal activity of gpx3 and level of sepp1 in plasma . however , supplementation had no effect on se status in platelets and erythrocytes , which can be regarded as indicative of long - term se intake . interestingly , high retention of stable se isotope in placebo individuals was observed as compared to individuals supplemented with 30 g se daily for 5 months , suggesting maintenance of critical se pool in the human body and adaptation to low se status by adjusting of its secretion . therefore , physiological requirements of se are lower than recommended in humans , but enabling selenoprotein synthesis . besides , in patients with diseases like kbd and cancer , where low se level in blood is observed , down - regulation of specific selenoprotein gene expression was found to occur in circulating wbc . significant down - regulation of sepp1 mrna level was observed in han chinese with kbd ( sun et al . 2010 ) . in caucasian bladder cancer male patients , sepp1 , gpx1 , gpx3 , sep15 mrna levels were lower than in the control group ( reszka et al . preferential incorporation of sec into selenoprotein mrna in circulating blood leukocytes under relatively low se supply merits investigations intended to identify potential sensitive and resistant selenoproteins under se deficiency in humans . while the levels of se required for optimization of sepp1 and gpx3 activities in plasma are well known , estimating se level that is required for maximal selenoprotein gene expression in humans requires further research . according to rodents studies and studies among humans , which have been discussed in this review , it appears that suboptimal se intake may be sufficient to achieve selenoprotein mrna expression and molecular requirements of se are lower than the established recommended dietary intake in humans55 g / day ( efsa 2008 ; nas 2000 ) . it should be noted that the expression of individual selenoprotein mrna may be not always linked with protein expression . therefore , since we have not understood the transcriptional and translational link of selenoprotein under different se supply in different human tissues , biological functionality of selenoprotein could be recognized only at protein level . preferential incorporation of se into selenoproteins in rodents was observed even at suboptimal dietary se level . in rats , minimum se requirements for achieving a plateau of selenoprotein mrna expression have been low , reached plateau at half of the dietary se concentration required for maximal activity of gpx1 , gpx3 , and maximal level of sepp1 in different tissues ( barnes et al . therefore , in rodents , selenoprotein mrna expression does not seem to be a good indicator for se status . hypothetically , in almost all populations , even in those with low and moderate se intake and se level in blood compartments , selenoprotein encoding gene expression might reach the plateau levels and serve as a sensitive functional biomarker of se status . however , it should be noted that regulation of selenoprotein gene expression , metabolic pathways , and responses to se interventions in animals may differ from those in humans . none of the human studies conducted so far has indicated that selenoprotein mrna in the whole blood and blood cells may be a good indicator of se status in humans ( pagmantidis et al . . low se status may be adequate for proper regulation of selenoprotein transcription , but not for proper physiological activity of selenoproteins . preferential incorporation of se into selenoprotein and its optimal saturation at low dietary se level does not provide adequate activities and selenoprotein expression in different tissues . therefore , it may be suggested that functional rather than molecular biomarkers of se are optimal indicators of its supply . it seems reasonable to conclude that sepp1 concentration in plasma may clearly indicate sub - optimal to optimal se supply , because it can reflects functional significance of se activity in organism . in over - optimal se supply , where sepp1 level is optimized , plasma se seems to reflect se intake and achieved se status . all possible modifiers of se status determined by means of biochemical and molecular techniques , including smoking , occupational exposure , diet , health parameters , sex , age , endocrine and immunological status , should be included , as these factors can potentially modulate selenoprotein gene expression . impact of polymorphism of selenoproteins should be also included in complete analysis of se requirements of individuals with different genotypes and haplotypes . therefore , comprehensive intervention studies of circulating leukocyte selenoprotein transcript levels in a population with suboptimal and with adequate compared to over - optimal selenium status should be conducted .

the most commonly used methods for assessing the selenium ( se ) status in humans involve analysis of se concentration , selenoprotein activity , and concentration in the blood and its compartments . recently , it has been suggested that the expression of selenoprotein mrna in circulating blood leukocytes could differently reflect se status , due to prioritization of specific selenoprotein synthesis in response to dietary se supply . whereas the se levels required for optimization of selenoprotein p level and plasma glutathione peroxidise activity are well known , estimation of se level that is required for maximal mrna expression of selenoprotein in humans is the subject of current investigations . studies on rats suggest that whole blood selenoprotein mrna level can be used as the relevant molecular biomarker for assessing se status , and suboptimal se intake may be sufficient to achieve effective expression . human studies , however , did not confirm this hypothesis . according to studies on rodents and humans discussed in this review , it appears that suboptimal se intake may be sufficient to satisfy molecular requirements of se and it is lower than current recommended dietary intake in humans . the use of selenoprotein transcripts as a molecular biomarker of se status requires further studies on a large group of healthy individuals with different baseline se , including data regarding genetic polymorphism of selenoproteins and data regarding potential modifiers of se metabolism .

recently , high priority is being given to regular evaluation of scientific outputs of research groups , institutions , universities , and research institutes and centers to know about their current status ( 1 , 2 ) . scientometric analysis of scientific publications has become a challenging and inevitable necessity for many research institutes and organizations ( 1 ) . scientometric results are often used for decision making on budget , and appointment and promotion of the researchers ( 3 ) . moreover , these studies can provide policy makers and planners with important evidence of the results and effects of research programs ( 4 ) . scientometric indicators are also used for grading research centers ( 5 , 6 ) and universities ( 7 , 8) . so far , scientometric studies have been mostly performed on the scientific products of the research s fields ( 9 - 14 ) , laboratory groups ( 15 ) , universities and scientific institutes ( 6 , 8,16 ) , and even countries . although few studies have evaluated the scientific output of research centers and institutes ( 2 , 17 ) , they have not compared the centers with each other . due to the confidentiality of the findings of such studies , different studies have employed different scientometric indicators ( 18 ) . though few / no studies have used , the research performance of medical universities and their affiliated research centers has been annually evaluated under the supervision of the deputy for research of iranian ministry of health and medical education ( mohme ) since 2000 . paper publication , which is a major part of knowledge production , is one of the most important aspects of these evaluations ( 19 ) . based on the objectives of these evaluations , modernand important scientometric indicators are not used and the performance of the research centers is not analyzed . tehran university of medical sciences ( tums ) is the oldest center of modern higher education in iran and has ranked first in the annual evaluations of research outputs of medical universities for twelve consecutive years . based on the scimago institutions rankings , tums ranked 306 among 4851 institutions in 2014 . it has the largest number of students , faculty members , and research centers among all iranian medical universities . since scientometric indicators provide a comprehensive insight to the scientific output of research centers , this study was designed and conducted to analyze the performance of tums research centers and identify the factors affecting the their scientific output through scientometric indices . this cross - sectional scientometricstudy was conducted on the research centers of tums whose approval dated back to 3 years before the study implementationand included in the annual evaluation reports of mohme . data were collected using the following method : a ) an author - made questionnaire which was completed in the centers : the questionnaire had four sections . section one included basic data , such as the mandate of the center , years of activity , and budget . section three and four were about partner institutions and research fields , respectively . for validity and reliability issues , the questionnaire was piloted in three research centers ( addiction , aids , and mental health research centers ) and necessary modifications were made accordingly. b ) data of scientific products of research centers including , papers ( published in journals indexed in valid databases , and non - indexed papers published in foreign scientific journals and domestic scientific research journals ) , books and patents registered in the name of the research centers between 2007 and 2011 were derived from the reports of the annual evaluations of mohme through the website of the mohme deputy for research. c ) to calculate hybrid scientometric indicators , the number of each centers papers ( original articles , brief articles , reviews , editorials , and letters to the editor ) indexed in scopus database and the number of their citations from the time of establishment to the year 2012 were collected . to make sure of including all affiliations of research centers , isi web of science was used in addition to scopus , as well. d ) research personnel performance ( i.e. their participation in scientific media ) was derived from scopus database . the 5-year performance ( 2007 - 2011 ) of each research center was based on scientific activities of researchers with the affiliation of that center. the following scientometric indicators were calculated after data collection : a ) h - index , as the most common and popular scientometric indicator , which is used to evaluate the quality and impact of the scientific products of researchers ( 20 ) and research institutes ( 21 ) , b ) g - index , introduced by egghe to improve h index , which in contrast to h - index increases with citations instead ofthe threshold and gives more weight to publications that have a better quality and are more frequently cited ( 21 ) , c ) hg - index , the geometric mean of h and g index , which increases their advantages and reduces their errors ( 1 ) , d ) a - index which shows mean citations in the h - core ( 22 ) , e ) the r - index measures the h - core s citation intensity ( 22 ) , f ) e - index which was introduced by zhang and includes excess citations to papers in h - core ( 22 ) , g ) impact index which shows high impact papers of the center relative to all papers published by the same center ( 16 ) , h ) citation per paper , which makes it possible to compare researchers and research institutes with different research background ( 24 ) , and i ) the ratio of the number of papers to the number of researchers . it should be mentioned that to observe confidentiality regarding the information of the centers , the name of the research centers is not reported and their determinants were reported using random numbers assigned to each center . using spss 20 , data were first analyzed descriptively and the trend of the publications during the 5-year was shown as a line chart . factors affecting the scientific productions of the research centers between 2007 and 2012 were also studied : the age of the center ( years from establishment to 2012 ) , mean of funds allocated to research contracts in each center , type of budget ( having or not having a separate budget line ) , the mandate of the center ( clinical / basic science ) , the area of the center ( square meter ) , real property ( the center was categorized as low , intermediate , or high based on having a clinic , inpatient ward , library , laboratory , workshop , conference hall and salon , and type of ownership ( complete , mutual , no ownership ) ) , non - real property ( the center was categorized as low , intermediate , or high based on having workshop , laboratory and audiovisual equipment ) , research fields ( the environments in which the research center implements its research activities ) , partner organizations ( foreign or domestic institutes , centers , or universities with which the research center had financial , research , educational , or intellectual ties ) , number of joint projects with partner organizations , and the number of research council sessions . univariate linear regression followed by multiple linear regressions were used to determine the factors affecting the scientific productions of the research centers . of 36 eligible centers , 30 agreed to participate in the study ( response rate=83.3% ) . the major scientific output of the research centers was papers ( n=4867 ) , of which 94.4% ( n=4593 ) were indexed in isi web of science , medline / pubmed , biological abstracts , scopus , embase , and chemical abstracts . moreover , 58.04% ( n=2825 ) of the papers were indexed in isi web of science . the median number of the 5-year papers of the evaluated research centers was 150.5 and the median number of 5-year indexed papers was 142 . in addition , we evaluated the papers indexed in scopus and their citations since the establishment of each center to the end of 2012 and the results showed that the median number of the papers was 127 , the median citation was 515 , and the median number of non - cited papers was 38.50 ( table 1 - 3 ) . the total number of published papers and the total number of indexed papers had an increasing trend until 2009 but there was a decrease in 2010 and 2011 . moreover , there was a decrease in the publication of books in 2011 ( fig . the trend of the total papers and indexed papers the median number of published books was 2.5 with standard deviation ( sd ) of 2.8 , and the median number of patents was zero with a sd of 2.3 ( only 9 centers had patents ) during 2007 - 2011 . moreover , the median of the number of papers to the number of researchers between 2007 and 2011 was 2.26 ( table 2 ) . the median citation per paper was 3.7 ; h - index which shows the quality and impact of scientific productions had a median of 11 . the median g - index , hg - index , and a - index were 17.5 , 14.3 , and 22.9 respectively and the median r - index , e - index , and impact index were 16.5 , 11.2 , and 1.6 , respectively ( table 4 and 5 ) . * citation per paper of the 30 centers , 22 ( 73.4% ) did not have a separate budget line and 20 centers ( 66.7% ) had clinical activity . regarding real property , 43.3% ( n=13 ) , 33.4% ( n=10 ) , and 23.3% ( n=7 ) of the centers were high , medium , and low , respectively . as for non - real property , 33.4% ( n=10 ) , 33.3% ( n=10 ) , and 33.3% ( n=10 ) of the centers were high , medium , and low , respectively . the meansd age of the centers was 9.83.5 years , and the meansd number of researchers was 64.346.5 . the meansd number of partner organizations was 7.710.4 and the meansd number of the sessions of the research council was 33.719.5 . the variables of budget ( having or not having a separate line ) , the mandate of the center ( clinical/ basic science ) , number of research personnel , real property ( high , medium , low ) , non - real property ( high , medium , low ) , area , age , mean budget of the research contracts , number of foreign and domestic partner organizations , number of joint projects , number of research fields , and the number of the sessions of research council were investigated with a univariate linear regression model and the results showed that the number of research personnel ( r=0.72 , p<0.01 ) and the number of foreign partner organizations ( r=0.25 , p=0.007 ) had a significant direct relationship with the publication of papers ( table 5 ) . based on the multiple model , younger age of the center ( p=0.001 ) , number of research personnel ( p<0.001 ) , and having a separate budget line ( p=0.016 ) had a significant direct correlation while real property ( p=0.004 ) ; number of joint projects ( p=0.001 ) had a significant inverse correlation with the number of published papers ( table 6 ) . in this study , we used scientometric indicators to evaluate the 5-year performance of the research centers of tums and identify the factors affecting their performance . our study showed that the median number of the papers in the 5 years was 150.5 and the median number of papers indexed in isi web of science was 74 . the total number of published papers and the total number of indexed papers of the evaluated centers had an increasing trend until 2009 but decreased slightly in 2010 and 2011 , which could be due to the special attention of tums to research activities and publication of scientific papers in recent years . moreover , the results showed that the majority of the papers ( 58.04% ) were indexed in isi web of science , indicating that attention was paid to quality of the papers besides the increase in their number . in iran , studies performed by sotoudeh ( 25 ) and hayati ( 26 ) showed that the number of the iranian papers published in international journals was the highest in recent years . moreover , a study by eskrootchi ( 27 ) showed that iranian scientific papers had an increasing trend during 30 years . no similar investigation has been performed on evaluation of scientific output of several research centers but a study on the 36-year scientific products of pasteur institute of iran in the web of science revealed that 823 papers were published by the institute until the end of 2009 , indicating the high speed of science production between 2005 and 2009 ( 28 ) . publication of papers in different scientific fields has had an increasing trend in recent decades worldwide ( 29 - 34 ) . the mean citation was 850.9 with a standard deviation of 1221.1 in the present study , the median of the citations per paper was 3.7 , and the mean number of papers without citation was 49.7 . in a study by bazrafshan , the total number of citations to the papers published by pasteur institute of iran until the end of 2009 was 4397 and the indicator of citations per paper was 5.2 ( 28 ) , indicating that the scientific impact of the papers of pasteur institute was more than the evaluated research centers . hybrid metrics are a subset of qualitative indicators which are calculated to express both the productivity and effectiveness in a numeral ( 35 ) . in scientometric studies , h - index is usually calculated for researchers , research fields and groups , universities , and even countries , and a limited number of studies have used h - based indicators worldwide . for example , in the 10 best medical universities of the us , the mean h index was 52.5 between 2000 and 2002 , 50 between 2003 and 2005 , 35.5 between 2006 and 2008 , and 15.5 between 2009 and 2011 ( 36 ) . in a study by wang in national taiwan university , h index of the groups of optics , pharmacology , oncology , and general and internal medicine was 25 , 35 , 42 , and 25 , respectively ( 37 ) . hendrix evaluated medical universities of the us in terms of scientometric indicators and reported that the median impact index , an h - based indicator , was 3.16 ( 16 ) while the h index and g - index of tums were 46 and 66 until 2010 , respectively ( 38 ) . on the other hand , a study by bornmann et al ( 39 ) showed that hybrid metrics in post doc researchers of biomedicine were lower ; the median of h , g , a , and r indices were 2 , 3 , 23.5 , and 8.09 , respectively . moreover , the scientific performance of the research centers and institutes were not evaluated using these indices . the median of h index , as the most common scientometric indicator , was 11 and the median of g , e , a , hg , indices and impact index were 17.5 , 11.2 , 22.9 , 14.3 , 16.5 , and 1.6 , respectively . since these indices are affected by both the number of papers and citations , research centers should not only focus on the quantity of the papers but should regard their quality , as well . in our research , the factors affecting the paper publication of research centers were also evaluated . the research centers in our study were divided to clinical and basic sciences . based on the results of multiple logistic regression , there was no significant difference between paper publication and the mandate of the center . moreover , there was an inverse significant correlation between the age of the centers and the number of published papers . the age of the research centers and their scientific performance showed an inverse negative correlation ; in line with a study by bonaccorsi ( 40 ) . the reason could be that the younger centers find themselves in competition with older centers and try more . moreover , younger centers may have better research and publication capabilities . however , a scientometric study performed by daz - morn et al in different psychiatry and legal medicine in the university of barcelona showed that the h - index of researchers in newly founded groups was lower ( 11 ) . in recent years , the share of the governmental and non - governmental research budgets has increased substantially in iran ( 41 ) . in our research , although the relationship between the mean budget of the research contracts and the number of papers in 5 years was not significant , there was a significant correlation between the number of papers and budget line . having a separate budget line showed a significant linear relationship with paper publication . moreover , findings showed a significant positive relationship between the number of research personnel and the number of papers in 5 years . hendrix also reported that the annual budget and number of faculty members had a significant positive effect on the number of papers published by us medical schools and their citations , and also stated that budget affected the quantity of research more than its quality ( 16 ) . moreover , rey - rocha et al found that organized and integrated research teams had higher productivity ( 42 ) . in our study , the average of the number of papers in 5 years to the number of researchers was 2.9 , while hendrix reported that the average of the number of papers to the number of faculty members in us medical schools was 10.2 ( 37 ) and bonaccorsi et al found that the average of the number of patients to the researchers of italian national research council ( cnr ) was 5.7 ( 40 ) , indicating a lower rate of paper production per researcher in our study . the results showed that the area and non - real properties of research centers like laboratory and audiovisual equipment had no significant relationship with the number of papers while the correlation of real properties with the number of papers was significant and inverse . bonaccorsi also found a negative significant correlation between the dimensions of the research center and its scientific production , i.e. smaller research institutes had more scientific production ( 40 ) . however , lissoni et al found that an optimal work environment had a great effect on scientific productivity ( 13 ) . in our study , the correlation of the number of papers with foreign and domestic partner organizations , number of research fields , and number of research council sessions was not significant while a significant negative relationship was observed between the number of papers and the number of joint projects . the reason could be that the results of a number of joint projects were not published in the form of a paper . on the other hand , since partner organizations may be scientifically weak , unknown , or invalid , joint projects may have little effect on the quantity and quality of the scientific products of the research centers while a study by lissoni et al showed that partnership in big or international projects had a strong positive effect on the quality and quantity of publications ( 13 ) . moreover , zhou et al performed a study on scientific publications in china and found that international collaborations in china increased substantially in a period of seven years which could positively affect the quality and quantity of scientific products ( 43 ) . the results of our study showed the increasing trend of the publication of papers in tums research centers . continuation of this increasing trend depends on different factors such as improving research infrastructures like the number of specialized researchers , increasing the budget of research activities and projects , and holding educational courses on scientific writing . it should be mentioned that although tehran university of medical sciences has many prestigious research centers that are active in different areas but the results of this study can not be generalized to all research centers in iran . since scientometric studies are important to evaluate the quality and effectiveness of the scientific productions of research centers , the results of this study can be employed for improving the current situations , optimal allocation of the resources , persuasion of strong research centers , and supporting weaker centers . therefore , it is necessary that managers and policy makers pay more attention to the results and findings of this studies at university and national levels and make grounds for scientometric studies through providing access to credible databases such as isi web of science and scopus . advanced indicators should be employed to evaluate the scientific output and performance of the research centers in order to provide the grounds for improving the quality and quantity of their performance . it is also suggested that researchers in the field of scientometrics use hybrid metrics in addition to scientometric and productivity indicators to better evaluate the quality and impact of the scientific output of researchers , research centers , scientific groups , and universities . this study was part of a registered thesis conducted in tums ( registration number : 20332 - 102 - 04 - 91 ) . the authors would like to extend their gratitude to research centers who participated in this study and all the people who helped us during this research . the researchers were students and faculty members of tehran university of medical sciences and the project was partly funded by the vice - chancellor for education and partly by the vice - chancellor for research . it should be mentioned that at the time of the study , dr . the rest of the research team had no conflicts of interest with the centers .

background : since tehran university of medical sciences ( tums ) has the oldest and highest number of research centers among all iranian medical universities , this study was conducted to evaluate scientific output of research centers affiliated to tehran university of medical sciences ( tums ) using scientometric indices and the affecting factors . moreover , a number of scientometric indicators were introduced . methods : this cross - sectional study was performed to evaluate a 5-year scientific performance of research centers of tums . data were collected through questionnaires , annual evaluation reports of the ministry of health , and also from scopus database . we used appropriate measures of central tendency and variation for descriptive analyses . moreover , uni - and multi - variable linear regression were used to evaluate the effect of independent factors on the scientific output of the centers . results : the medians of the numbers of papers and books during a 5-year period were 150.5 and 2.5 respectively . the median of the " articles per researcher " was 19.1 . based on multiple linear regression , younger age centers ( p=0.001 ) , having a separate budget line ( p=0.016 ) , and number of research personnel ( p<0.001 ) had a direct significant correlation with the number of articles while real properties had a reverse significant correlation with it ( p=0.004 ) . conclusion : the results can help policy makers and research managers to allocate sufficient resources to improve current situation of the centers . newly adopted and effective scientometric indices are is suggested to be used to evaluate scientific outputs and functions of these centers .

governments across the developed world are concerned with enabling older people to maintain their active contribution to society , and thereby their quality of life ( qol).1 qol has become a commonly used end point in the evaluation of multisector public policy , including health , social , community and environmental policy actions . for policy outcomes to be measured with any validity , measures of qol need to have social , as well as policy , relevance , to be meaningful to people 's lives , and to be carefully conceptualised and constructed . lawton26 developed a popularly cited quadripartite concept of qol , proposing that the good life ( qol ) may be represented by behavioural and social competence ( health , cognition , time use , social behaviour ) , perceptions of qol ( subjective evaluation of each domain of life ) , psychological well - being ( mental health , cognitive judgements of life satisfaction , positive - negative emotions ) and the external , objective , physical environment ( housing , economic indicators ) . however , there is no consensus about its conceptual definition or measurement,7 and most investigators have based their concepts on expert opinions rather than the perspectives of lay people . this has the consequence that there are few empirical data on the extent to which the items included in measurement scales have any relevance to people . thus , it is increasingly important to develop a multidimensional model and measure of quality of life , for use in descriptive and evaluative multisector policy research , which reflects the views of the population concerned , with cross - sectional and longitudinal applicability . elicitation of people 's own views of qol in this process is particularly important because qol is a subjective concept . survey and qualitative research with people aged 65 + , living at home in britain , reported that the central planks of qol emphasised by respondents were psychological well - being and positive outlook , having health and functioning , social relationships , leisure activities , neighbourhood resources , adequate financial circumstances and independence.710 this research led to the development of the older people 's quality of life questionnaire ( opqol ) , which is unique in being derived from the views of a representative sample of older people , cross - checked against theoretical models for assessment comprehensiveness . the aim here is to compare the psychometric properties of the opqol , with the casp-19 and whoqol - old among people 65 + participating in three national surveys of older people living at home in britain . two of these three surveys were cross - sectional , and the third was longitudinal ( see supplementary appendix 1 ) : ethnibus survey of people aged 65 + responding to two waves of the national ethni surveys ( http://www.ethnicfocus.com ) in 2008 . this is a rolling face - to - face interview survey with adults aged 16 + , living at home , based on focused enumeration , stratified random sampling of postcodes in britain , and statistically robust sampling of people in common ethnic minority groups in britain ; the response rate was 70% ( n=400 ) . ons survey of people aged 65 + responding to two waves of the office for national statistics ( ons ) national omnibus survey ( http://www.statistics.gov.uk ) in 2008 . this is a rolling face - to - face interview survey with adults aged 16 + , living at home , based on a stratified random sample of postcodes across britain ; the response rate was 61% ( n=589 ) . qol follow - up survey in 20072008 , of people living at home in britain , aged 65 + at baseline , who had responded to four ons national omnibus interview surveys . these were based on stratified random samples of postcodes across britain during 1999/2000 ; response was 77% ( n=999 ) at baseline and 58% among survivors ( n=287 ) at 20072008 follow - up . the qol follow - up survey is included here as the longitudinal design provided the opportunity to test the causal model of the opqol , as well as a willing sample for test - retest reliability assessment . the opqol was administered in all three surveys . prior to administration in the surveys reported here , the items in the opqol were pretested with 179 older people and three focus groups , reduced to 32-item and 35-item versions , and statistical tests of reliability and validity were applied . the casp-1911 and the whoqol - old12 13 were administered in the two face - to - face interview surveys only ; it would have been too cognitively burdensome to have included all three scales in the postal , self - administration mode . supplementary appendix 2 displays the opqol , summarises its development and briefly summarises the casp-19 and whoqol - old . independent self - ratings of global qol , and of its domains , were included in the questionnaire in order to distinguish between the constituents of , and influences on , qol.14 also included were standard sociodemographic items , self - rated active ageing , items measuring health and psychosocial circumstances.7 ethnic status was measured using a standard item about ethnic identity in the uk . this would not necessarily be applicable to populations in other countries , because it reflects close connections between new commonwealth countries and ethnic minority groups in the uk.15 descriptive analyses included frequencies , tests , and spearman 's r correlations . tests of scale reliability were applied in order to assess the extent to which scale items measure the same construct , with freedom from random error ( internal consistency ) . this is the strength of the association between each scale item and the full scale , item - item and item - total correlations . test - retest reliability of the stability of the newly developed opqol was assessed by mailing a second copy of the questionnaire to a random subsample of 50 follow - up qol survey respondents , 4 weeks after return of the first questionnaire ( response rate : 76%/38 ) . criterion ( concurrent ) validity is the independent corroboration that the scale is measuring what it intends to measure . this can only be measured by proxy with subjective measures , as there is no gold standard . proxy variables used here included independent self - ratings of qol overall and of qol domains ( health , social relationships , independence / control over life / freedom , home and neighbourhood , psychological / emotional well - being , financial circumstances , social and leisure activities ) . construct ( convergent and discriminant ) validity requires corroboration that scales measure the underlying construct they purport to measure . this was tested by assessing spearman 's r correlations between the qol scales and similar variables ( for convergent validity that the scale should correlate with similar or hypothesised variables ) and dissimilar variables ( for discriminant validity that there should be low correlations between scales and variables not expected to be associated ) . multiple regression was used to assess validity further by examining the ability of theoretically relevant variables to predict total qol scores . a hierarchical approach was used , with independent variables entered in their theoretical order of importance . statistical significance was set at p<0.05 . the variables entered did not correlate by more than 0.732 ; tests for multicollinearity were satisfied . the opqol was administered in all three surveys . prior to administration in the surveys reported here , the items in the opqol were pretested with 179 older people and three focus groups , reduced to 32-item and 35-item versions , and statistical tests of reliability and validity were applied . the casp-1911 and the whoqol - old12 13 were administered in the two face - to - face interview surveys only ; it would have been too cognitively burdensome to have included all three scales in the postal , self - administration mode . supplementary appendix 2 displays the opqol , summarises its development and briefly summarises the casp-19 and whoqol - old . independent self - ratings of global qol , and of its domains , were included in the questionnaire in order to distinguish between the constituents of , and influences on , qol.14 also included were standard sociodemographic items , self - rated active ageing , items measuring health and psychosocial circumstances.7 ethnic status was measured using a standard item about ethnic identity in the uk . this would not necessarily be applicable to populations in other countries , because it reflects close connections between new commonwealth countries and ethnic minority groups in the uk.15 tests of scale reliability were applied in order to assess the extent to which scale items measure the same construct , with freedom from random error ( internal consistency ) . this is the strength of the association between each scale item and the full scale , item - item and item - total correlations . test - retest reliability of the stability of the newly developed opqol was assessed by mailing a second copy of the questionnaire to a random subsample of 50 follow - up qol survey respondents , 4 weeks after return of the first questionnaire ( response rate : 76%/38 ) . criterion ( concurrent ) validity is the independent corroboration that the scale is measuring what it intends to measure . this can only be measured by proxy with subjective measures , as there is no gold standard . proxy variables used here included independent self - ratings of qol overall and of qol domains ( health , social relationships , independence / control over life / freedom , home and neighbourhood , psychological / emotional well - being , financial circumstances , social and leisure activities ) . construct ( convergent and discriminant ) validity requires corroboration that scales measure the underlying construct they purport to measure . this was tested by assessing spearman 's r correlations between the qol scales and similar variables ( for convergent validity that the scale should correlate with similar or hypothesised variables ) and dissimilar variables ( for discriminant validity that there should be low correlations between scales and variables not expected to be associated ) . multiple regression was used to assess validity further by examining the ability of theoretically relevant variables to predict total qol scores . a hierarchical approach was used , with independent variables entered in their theoretical order of importance . the variables entered did not correlate by more than 0.732 ; tests for multicollinearity were satisfied . just over half of each sample comprised women ( 52%/207 ethnibus , 55%/324 ons , 54%/154 qol follow - up ) . whereas most ethnibus respondents were aged 65<75 ( 91%/363 ) , just over half of ons omnibus ( 55%/326 ) , and less than a fifth of qol follow - up respondents ( 17%/47 ) , were aged 65<75 . thirty - eight per cent ( 152 ) of the ethnibus sample were indian , 29% ( 117 ) were pakistani , 22% ( 86 ) were black caribbean and 11% ( 45 ) were chinese . most , 94% ( 555 ) of the ons omnibus sample were white british ; all qol follow - up respondents were white british . in reflection of their younger age , more of the ethnibus than other respondents were married or cohabiting ( 58%/230 , 49%/285 , 49%/138 respectively ) . fewer ethnibus than other respondents were home - owners ( 532%/208 , 73%/429 , 85%/239 respectively ) and fewer lived alone ( 5%/19 , 48%/286 , 49%/137 respectively ) ( all differences were statistically significant at least at p<0.01 . ) for detailed characteristics of the samples , see supplementary table 1 . few , 12%/70 , of the ons omnibus sample , compared with more , 45%/113 of the older qol follow - up sample , and 73%/290 of the ethnibus sample were in the lowest two opqol categories ( < 119 ) , indicating worse qol ( see supplementary table 2 ) . the ethnibus and ons cross - sectional samples only were administered the casp-19 and whoqol - old . consistent with the opqol findings , 23%/94 of ethnibus respondents were in the worst two casp-19 categories ( < 29 ) , compared with 8%/43 of ons respondents ; 25%/100 of the ethnibus sample fell in the worst two whoqol - old categories , compared with 15%/80 of the ons respondents ( see supplementary tables 3 and 4 ) . further analyses by total qol scores and ethnicity in the ethnibus sample showed that 58% ( 26 ) of chinese people scored a good qol with the opqol , compared with 28% ( 33 ) of pakistani , 20% ( 31 ) of indian and 23% ( 31 ) of black caribbean people ( test 28.064 , 2 degrees of freedom , differences by ethnicity were not analysed in the other samples due to their low numbers in ethnic minority groups . the reliability criterion for item - total correlations ( the correlation of the item with the scale total with that item omitted ) is that the item should correlate with the total scale by at least 0.20 . with three exceptions , the 35 full opqol items met this criterion for all three samples ( the exceptions were in the ethnibus sample with items 10 , 12 and 32 ; but as cronbach 's was not improved by their removal , and they performed well in validity tests , they were retained ) . six of the 19 casp items failed to meet this criterion ( ethnibus : items 1 , 2 , 5 , 17 , 18 ; ons : item 6 ) . fourteen of the 24 whoqol - old items failed this criterion in the ethnibus sample only . as expected , all items correlated more highly with similar , than dissimilar , items in the scales . cronbach 's for the opqol in all three samples satisfied the 0.70<0.90 threshold for internal consistency : 0.748 ( ethnibus survey ) , 0.876 ( ons omnibus survey ) , 0.901 ( qol follow - up survey ) . the casp-19 and the whoqol - old satisfied the threshold for cronbach 's in the ons sample ( 0.866 and 0.849 respectively ) , but neither met this in ethnibus ( 0.553 and 0.415 respectively ) ( see earlier , neither were administered in the qol follow - up sample ) . the 4 week test - retest correlations , assessed among qol follow - up survey respondents , ranged from moderate to high ( r 0.4030.782 ) . lower correlations were explained by reported life changes in the intervening month , demonstrating the difficulties of test - retest exercises in older populations . respondents ' comments at follow - up about life changes in the last 4 weeks illustrate this:about 4 days ago the plaster was taken off my left hand so now i can go on buses again - my only means of regular transport apart from volunteer drivers , a few friends and taxis . anyway it means i am free;my husband of nearly 60 years was told he has lung cancer so it has changed very much how i feel . we are trying to be as normal as possible but it 's very hard;my daughter and her young son have now left our home and acquired her own house . we miss them a lot;my husband has just come home after spending another 2 weeks in hospital ( suspected heart attack). about 4 days ago the plaster was taken off my left hand so now i can go on buses again - my only means of regular transport apart from volunteer drivers , a few friends and taxis . anyway it means i am free ; my husband of nearly 60 years was told he has lung cancer so it has changed very much how i feel . we are trying to be as normal as possible but it 's very hard ; my daughter and her young son have now left our home and acquired her own house . we miss them a lot ; my husband has just come home after spending another 2 weeks in hospital ( suspected heart attack). in order to test the criterion ( also known as concurrent ) validity of the qol scales , all respondents were asked to rate the qol of their lives overall and by area of life ( qol domain ) , using five - point scales from very good to very bad. the criterion validity of all three qol scales was indicated by their moderate to strong , significant correlations with global self - rated qol : the spearman 's r correlations for the opqol by self - rated qol overall in each sample were ethnibus 0.347 , ons 0.602 and qol follow - up 0.659 . for the casp , in the two cross - sectional samples , they were ethnibus 0.273 , ons 0.577 , and for the whoqol - old , in the two cross - sectional samples , they were ethnibus 0.128 and ons 0.466 . all correlations were significant at least at p<0.01 , with the exception of whoqol - old in the ethnibus sample which was p<0.05 . the validity of the opqol was further supported by significant correlations between its subscales and the independent qol domain ratings , in theoretically expected , similar directions7 ( eg , opqol health and functioning subscale correlated with self - rated health : spearman 's r ethnibus 0.122 ( p<0.05 ) , ons omnibus 0.679 ( p<0.01 ) and qol follow - up 0.713 ( p<0.01 ) . there were no significant correlations with dissimilar pairs ( eg , health and religion ) , again as expected . the casp-19 control and autonomy subscales and the whoqol - old autonomy subscale also correlated significantly , as expected in similar directions , with self - rated independence , control over life and freedom in the ons sample ( r 0.472 , p<0.01 ; r 0.466 , p<0.01 respectively ) , but not in the ethnibus sample . the whoqol - old sensory abilities subscale correlated significantly , again as expected , with self - rated health in the ons ( r 0.322 , p<0.01 ) , but not the ethnibus sample . the whoqol - old intimacy subscale correlated significantly , also as expected , with the social relationships domain in the ons sample ( r 0.330 , p<0.01 ) , but not in the ethnibus sample . in support of construct ( convergent ) validity , the opqol correlated moderately strongly in the same direction , as hypothesised,7 with self - rated health status ( compared with others of same age ) in each sample : opqol ethnibus 0.364 , ons 0.543 and qol follow - up 0.628 . the casp-19 and whoqol - old correlations in the two cross - sectional samples were also in the same direction and significant , although slightly weaker ( casp-19 ethnibus 0.238 , ons 0.530 ; whoqol - old ethnibus 0.138 , ons 0.465 ; all p<0.01 ) . multivariable analyses were conducted with each sample in order to examine independent predictors of the opqol , casp-19 and whoqol - old . for comparability , the same independent variables were entered into each model . on the basis of the literature,7 optimum scores on each measure were hypothesised to be associated with optimum qol : self - rated active ageing , independent self - ratings of qol domains , social activities and help from social network members , self - rated health status and physical functioning ( adl ) , age , sex , marital status and housing tenure . the qol follow - up sample also provided an opportunity to test the causal model underpinning the opqol . the cross - sectional model for the qol follow - up sample was highly significant ( see table 1 ) . perceptions of ageing more actively , having optimal self - ratings of health , independence , home and neighbourhood , psychological well - being and finances , more social activities and female sex significantly , and independently , predicted optimal opqol scores . the amount of explained variance of opqol scores in the model was high at 77% ( adjusted r 0.774 ) . multiple regression of predictors of opqol : qol follow - up sample ( final model ) adl , activities of daily living ; ns , not significant ; opqol , older people 's quality of life ; qol , quality of life . the opqol models in the ons and ethnibus samples were also highly significant . again , optimal ratings of active ageing , most self - rated qol domains and also self - rated health status were significant in both samples . the model explained 65% of the variance in opqol scores ( adjusted r 0.653 ) in the ons sample and 43% ( adjusted r 0.430 ) in the ethnibus sample ( table 2 ) . multiple regression of predictors of opqol : ons omnibus and ethnibus samples ( final models ) adl , activities of daily living ; ns , not significant ; qol , quality of life . the variables included in the test of the causal model underpinning the opqol , in the qol follow - up sample , were the baseline indicators that reflected the components chosen for the opqol domains ( health and functional status , practical help received , social support and activities , perceived quality of neighbourhood , psychological outlook , gap score for social comparisons and expectations and self - efficacy ) , plus standard sociodemographic indications to control for their effects . this model explained 56% of the variance in opqol scores ( adjusted r : 0.563 ) . as number of different social activities was not significant in the model , a reduced model was conducted excluding this variable . health status and number of diagnosed medical conditions , help and social support , perceptions of neighbourhood and feeling safe , social comparisons ( comparing one 's financial and living circumstances with others who are worse off ) , feelings of self - efficacy and control , then explained 48% of the variance in opqol scores in expected directions ( adjusted r 0.481 ) . the overall model was highly significant in general support of the opqol ( see table 3 ) . causal model underpinning opqol adl , activities of daily living ; ns , not statistically significant at least the 0.05 level ; opqol , older people 's quality of life . multiple regression of baseline ( 1999/2000 ) predictors of opqol at follow - up ( 2007/2008 ) : qol follow - up sample ( final model ) . the amount of explained variance in casp-19 scores in the ons sample explained by the model was 57% ( adjusted r 0.568 ) ; the model was highly significant , and in expected directions . the variables that retained significance in the model were five of the domain ratings , health and functioning . in contrast , the casp-19 model for the ethnibus sample was weak : the amount of explained variance in casp-19 scores was just 14% ( adjusted r 0.141 ) , although the model was still significant . the variables that were significant were self - rated active ageing , and three of the seven qol domain self - ratings , health status , but not physical functioning ( see table 4 ) . multiple regression of predictors of casp-19:ons omnibus and ethnibus ( final models ) adl , activities of daily living ; ns , not significant ; qol , quality of life . the whoqol - old was assessed in the ons and ethnibus samples the amount of explained variance in whoqol - old scores in the ons omnibus survey was 45% ( adjusted r 0.448 ) ; the model was highly significant , again in expected directions . the significant variables were self - rated active ageing , three of the seven qol domain ratings and the number of social activities and helpers , health status and housing tenure . however , the whoqol - old model for the ethnibus sample was weak , although significant : the amount of explained variance in whoqol - old scores was just 5% ( adjusted r 0.048 ) . the significant variables were three of the seven domain ratings , and number of social activities ( see table 5 ) . multiple regression of predictors of whoqol - old : ons omnibus and ethnibus ( final model ) adl , activities of daily living ; ns , not significant ; qol , quality of life . just over half of each sample comprised women ( 52%/207 ethnibus , 55%/324 ons , 54%/154 qol follow - up ) . whereas most ethnibus respondents were aged 65<75 ( 91%/363 ) , just over half of ons omnibus ( 55%/326 ) , and less than a fifth of qol follow - up respondents ( 17%/47 ) , were aged 65<75 . thirty - eight per cent ( 152 ) of the ethnibus sample were indian , 29% ( 117 ) were pakistani , 22% ( 86 ) were black caribbean and 11% ( 45 ) were chinese . most , 94% ( 555 ) of the ons omnibus sample were white british ; all qol follow - up respondents were white british . in reflection of their younger age , more of the ethnibus than other respondents were married or cohabiting ( 58%/230 , 49%/285 , 49%/138 respectively ) . fewer ethnibus than other respondents were home - owners ( 532%/208 , 73%/429 , 85%/239 respectively ) and fewer lived alone ( 5%/19 , 48%/286 , 49%/137 respectively ) ( all differences were statistically significant at least at p<0.01 . ) for detailed characteristics of the samples , see supplementary table 1 . few , 12%/70 , of the ons omnibus sample , compared with more , 45%/113 of the older qol follow - up sample , and 73%/290 of the ethnibus sample were in the lowest two opqol categories ( < 119 ) , indicating worse qol ( see supplementary table 2 ) . the ethnibus and ons cross - sectional samples only were administered the casp-19 and whoqol - old . consistent with the opqol findings , 23%/94 of ethnibus respondents were in the worst two casp-19 categories ( < 29 ) , compared with 8%/43 of ons respondents ; 25%/100 of the ethnibus sample fell in the worst two whoqol - old categories , compared with 15%/80 of the ons respondents ( see supplementary tables 3 and 4 ) . further analyses by total qol scores and ethnicity in the ethnibus sample showed that 58% ( 26 ) of chinese people scored a good qol with the opqol , compared with 28% ( 33 ) of pakistani , 20% ( 31 ) of indian and 23% ( 31 ) of black caribbean people ( test 28.064 , 2 degrees of freedom , differences by ethnicity were not analysed in the other samples due to their low numbers in ethnic minority groups . the reliability criterion for item - total correlations ( the correlation of the item with the scale total with that item omitted ) is that the item should correlate with the total scale by at least 0.20 . with three exceptions , the 35 full opqol items met this criterion for all three samples ( the exceptions were in the ethnibus sample with items 10 , 12 and 32 ; but as cronbach 's was not improved by their removal , and they performed well in validity tests , they were retained ) . six of the 19 casp items failed to meet this criterion ( ethnibus : items 1 , 2 , 5 , 17 , 18 ; ons : item 6 ) . fourteen of the 24 whoqol - old items failed this criterion in the ethnibus sample only . as expected , all items correlated more highly with similar , than dissimilar , items in the scales . cronbach 's for the opqol in all three samples satisfied the 0.70<0.90 threshold for internal consistency : 0.748 ( ethnibus survey ) , 0.876 ( ons omnibus survey ) , 0.901 ( qol follow - up survey ) . the casp-19 and the whoqol - old satisfied the threshold for cronbach 's in the ons sample ( 0.866 and 0.849 respectively ) , but neither met this in ethnibus ( 0.553 and 0.415 respectively ) ( see earlier , neither were administered in the qol follow - up sample ) . the 4 week test - retest correlations , assessed among qol follow - up survey respondents , ranged from moderate to high ( r 0.4030.782 ) . lower correlations were explained by reported life changes in the intervening month , demonstrating the difficulties of test - retest exercises in older populations . respondents ' comments at follow - up about life changes in the last 4 weeks illustrate this:about 4 days ago the plaster was taken off my left hand so now i can go on buses again - my only means of regular transport apart from volunteer drivers , a few friends and taxis . anyway it means i am free;my husband of nearly 60 years was told he has lung cancer so it has changed very much how i feel . we are trying to be as normal as possible but it 's very hard;my daughter and her young son have now left our home and acquired her own house . we miss them a lot;my husband has just come home after spending another 2 weeks in hospital ( suspected heart attack). about 4 days ago the plaster was taken off my left hand so now i can go on buses again - my only means of regular transport apart from volunteer drivers , a few friends and taxis . anyway it means i am free ; my husband of nearly 60 years was told he has lung cancer so it has changed very much how i feel . we are trying to be as normal as possible but it 's very hard ; my daughter and her young son have now left our home and acquired her own house . we miss them a lot ; my husband has just come home after spending another 2 weeks in hospital ( suspected heart attack). in order to test the criterion ( also known as concurrent ) validity of the qol scales , all respondents were asked to rate the qol of their lives overall and by area of life ( qol domain ) , using five - point scales from very good to very bad. the criterion validity of all three qol scales was indicated by their moderate to strong , significant correlations with global self - rated qol : the spearman 's r correlations for the opqol by self - rated qol overall in each sample were ethnibus 0.347 , ons 0.602 and qol follow - up 0.659 . for the casp , in the two cross - sectional samples , they were ethnibus 0.273 , ons 0.577 , and for the whoqol - old , in the two cross - sectional samples , they were ethnibus 0.128 and ons 0.466 . all correlations were significant at least at p<0.01 , with the exception of whoqol - old in the ethnibus sample which was p<0.05 . the validity of the opqol was further supported by significant correlations between its subscales and the independent qol domain ratings , in theoretically expected , similar directions7 ( eg , opqol health and functioning subscale correlated with self - rated health : spearman 's r ethnibus 0.122 ( p<0.05 ) , ons omnibus 0.679 ( p<0.01 ) and qol follow - up 0.713 ( p<0.01 ) . there were no significant correlations with dissimilar pairs ( eg , health and religion ) , again as expected . the casp-19 control and autonomy subscales and the whoqol - old autonomy subscale also correlated significantly , as expected in similar directions , with self - rated independence , control over life and freedom in the ons sample ( r 0.472 , p<0.01 ; r 0.466 , p<0.01 respectively ) , but not in the ethnibus sample . the whoqol - old sensory abilities subscale correlated significantly , again as expected , with self - rated health in the ons ( r 0.322 , p<0.01 ) , but not the ethnibus sample . the whoqol - old intimacy subscale correlated significantly , also as expected , with the social relationships domain in the ons sample ( r 0.330 , p<0.01 ) , but not in the ethnibus sample . in support of construct ( convergent ) validity , the opqol correlated moderately strongly in the same direction , as hypothesised,7 with self - rated health status ( compared with others of same age ) in each sample : opqol ethnibus 0.364 , ons 0.543 and qol follow - up 0.628 . the casp-19 and whoqol - old correlations in the two cross - sectional samples were also in the same direction and significant , although slightly weaker ( casp-19 ethnibus 0.238 , ons 0.530 ; whoqol - old ethnibus 0.138 , ons 0.465 ; all p<0.01 ) . multivariable analyses were conducted with each sample in order to examine independent predictors of the opqol , casp-19 and whoqol - old . for comparability , the same independent variables were entered into each model . on the basis of the literature,7 optimum scores on each measure were hypothesised to be associated with optimum qol : self - rated active ageing , independent self - ratings of qol domains , social activities and help from social network members , self - rated health status and physical functioning ( adl ) , age , sex , marital status and housing tenure . the qol follow - up sample also provided an opportunity to test the causal model underpinning the opqol . the cross - sectional model for the qol follow - up sample was highly significant ( see table 1 ) . perceptions of ageing more actively , having optimal self - ratings of health , independence , home and neighbourhood , psychological well - being and finances , more social activities and female sex significantly , and independently , predicted optimal opqol scores . the amount of explained variance of opqol scores in the model was high at 77% ( adjusted r 0.774 ) . multiple regression of predictors of opqol : qol follow - up sample ( final model ) adl , activities of daily living ; ns , not significant ; opqol , older people 's quality of life ; qol , quality of life . the opqol models in the ons and ethnibus samples were also highly significant . again , optimal ratings of active ageing , most self - rated qol domains and also self - rated health status were significant in both samples . the model explained 65% of the variance in opqol scores ( adjusted r 0.653 ) in the ons sample and 43% ( adjusted r 0.430 ) in the ethnibus sample ( table 2 ) . multiple regression of predictors of opqol : ons omnibus and ethnibus samples ( final models ) adl , activities of daily living ; ns , not significant ; qol , quality of life . the variables included in the test of the causal model underpinning the opqol , in the qol follow - up sample , were the baseline indicators that reflected the components chosen for the opqol domains ( health and functional status , practical help received , social support and activities , perceived quality of neighbourhood , psychological outlook , gap score for social comparisons and expectations and self - efficacy ) , plus standard sociodemographic indications to control for their effects . this model explained 56% of the variance in opqol scores ( adjusted r : 0.563 ) . as number of different social activities was not significant in the model , a reduced model was conducted excluding this variable . health status and number of diagnosed medical conditions , help and social support , perceptions of neighbourhood and feeling safe , social comparisons ( comparing one 's financial and living circumstances with others who are worse off ) , feelings of self - efficacy and control , then explained 48% of the variance in opqol scores in expected directions ( adjusted r 0.481 ) . the overall model was highly significant in general support of the opqol ( see table 3 ) . causal model underpinning opqol adl , activities of daily living ; ns , not statistically significant at least the 0.05 level ; opqol , older people 's quality of life . multiple regression of baseline ( 1999/2000 ) predictors of opqol at follow - up ( 2007/2008 ) : qol follow - up sample ( final model ) . the amount of explained variance in casp-19 scores in the ons sample explained by the model was 57% ( adjusted r 0.568 ) ; the model was highly significant , and in expected directions . the variables that retained significance in the model were five of the domain ratings , health and functioning . in contrast , the casp-19 model for the ethnibus sample was weak : the amount of explained variance in casp-19 scores was just 14% ( adjusted r 0.141 ) , although the model was still significant . the variables that were significant were self - rated active ageing , and three of the seven qol domain self - ratings , health status , but not physical functioning ( see table 4 ) . multiple regression of predictors of casp-19:ons omnibus and ethnibus ( final models ) adl , activities of daily living ; ns , not significant ; qol , quality of life . the whoqol - old was assessed in the ons and ethnibus samples the amount of explained variance in whoqol - old scores in the ons omnibus survey was 45% ( adjusted r 0.448 ) ; the model was highly significant , again in expected directions . the significant variables were self - rated active ageing , three of the seven qol domain ratings and the number of social activities and helpers , health status and housing tenure . however , the whoqol - old model for the ethnibus sample was weak , although significant : the amount of explained variance in whoqol - old scores was just 5% ( adjusted r 0.048 ) . the significant variables were three of the seven domain ratings , and number of social activities ( see table 5 ) . multiple regression of predictors of whoqol - old : ons omnibus and ethnibus ( final model ) adl , activities of daily living ; ns , not significant ; qol , quality of life . the cross - sectional model for the qol follow - up sample was highly significant ( see table 1 ) . perceptions of ageing more actively , having optimal self - ratings of health , independence , home and neighbourhood , psychological well - being and finances , more social activities and female sex significantly , and independently , predicted optimal opqol scores . the amount of explained variance of opqol scores in the model was high at 77% ( adjusted r 0.774 ) . multiple regression of predictors of opqol : qol follow - up sample ( final model ) adl , activities of daily living ; ns , not significant ; opqol , older people 's quality of life ; qol , quality of life . the opqol models in the ons and ethnibus samples were also highly significant . again , optimal ratings of active ageing , most self - rated qol domains and also self - rated health status were significant in both samples . the model explained 65% of the variance in opqol scores ( adjusted r 0.653 ) in the ons sample and 43% ( adjusted r 0.430 ) in the ethnibus sample ( table 2 ) . multiple regression of predictors of opqol : ons omnibus and ethnibus samples ( final models ) adl , activities of daily living ; ns , not significant ; qol , quality of life . the variables included in the test of the causal model underpinning the opqol , in the qol follow - up sample , were the baseline indicators that reflected the components chosen for the opqol domains ( health and functional status , practical help received , social support and activities , perceived quality of neighbourhood , psychological outlook , gap score for social comparisons and expectations and self - efficacy ) , plus standard sociodemographic indications to control for their effects . this model explained 56% of the variance in opqol scores ( adjusted r : 0.563 ) . as number of different social activities was not significant in the model , a reduced model was conducted excluding this variable . health status and number of diagnosed medical conditions , help and social support , perceptions of neighbourhood and feeling safe , social comparisons ( comparing one 's financial and living circumstances with others who are worse off ) , feelings of self - efficacy and control , then explained 48% of the variance in opqol scores in expected directions ( adjusted r 0.481 ) . the overall model was highly significant in general support of the opqol ( see table 3 ) . causal model underpinning opqol adl , activities of daily living ; ns , not statistically significant at least the 0.05 level ; opqol , older people 's quality of life . multiple regression of baseline ( 1999/2000 ) predictors of opqol at follow - up ( 2007/2008 ) : qol follow - up sample ( final model ) . the amount of explained variance in casp-19 scores in the ons sample explained by the model was 57% ( adjusted r 0.568 ) ; the model was highly significant , and in expected directions . the variables that retained significance in the model were five of the domain ratings , health and functioning . in contrast , the casp-19 model for the ethnibus sample was weak : the amount of explained variance in casp-19 scores was just 14% ( adjusted r 0.141 ) , although the model was still significant . the variables that were significant were self - rated active ageing , and three of the seven qol domain self - ratings , health status , but not physical functioning ( see table 4 ) . multiple regression of predictors of casp-19:ons omnibus and ethnibus ( final models ) adl , activities of daily living ; ns , not significant ; qol , quality of life . the whoqol - old was assessed in the ons and ethnibus samples the amount of explained variance in whoqol - old scores in the ons omnibus survey was 45% ( adjusted r 0.448 ) ; the model was highly significant , again in expected directions . the significant variables were self - rated active ageing , three of the seven qol domain ratings and the number of social activities and helpers , health status and housing tenure . however , the whoqol - old model for the ethnibus sample was weak , although significant : the amount of explained variance in whoqol - old scores was just 5% ( adjusted r 0.048 ) . the significant variables were three of the seven domain ratings , and number of social activities ( see table 5 ) . multiple regression of predictors of whoqol - old : ons omnibus and ethnibus ( final model ) adl , activities of daily living ; ns , not significant ; qol , quality of life . this study describes the psychometric performance of a qol questionnaire , developed from the perspectives of older people themselves : the opqol . it was tested in two cross - sectional , and one longitudinal , surveys of older people across britain . the longitudinal survey enabled the opqol to be tested in a dynamic , ageing population and an assessment of its underlying model , although its self - administration mode necessitated the assessment of the opqol only ( and not the casp-19 or whoqol ) in this older sample . the surveys used statistically robust sampling methods , and the response rates were fairly to very good . the characteristics of respondents to the ons omnibus and ethnibus surveys ( and the qol survey at baseline ) were comparable with population estimates from the last census . the qol follow - up sample , by its longitudinal design , reflected the healthy survivors . also , although the sampling approach of the ethnibus survey was statistically robust , it used focused enumeration . there is no other practical methodology for attempting to obtain representative samples of people in ethnic minority groups in national samples . this study reported that ethnibus respondents obtained poorer ( worse ) qol scores than the other sample respondents , with the opqol , casp-19 and whoqol - old . this is not unexpected given that people in ethnic minority groups are often more economically disadvantaged than the wider population.15 further research is needed to examine whether differences in qol reflect real variations , methodology , and cultural variations in expectations or in reporting . ethnic minority groups in britain live in a wide range of different communities , and their diversity may also have affected responses in some way . it should also be noted that the standard question for ethnic status used , largely reflected britain 's new commonwealth groups , and may not be appropriate for use in other countries . multiple regression models supported its validity and underlying constructs . despite the ethnibus sample 's consistently worse qol scores , compared with the other samples , the casp-19 and whoqol - old did not meet all criteria for internal consistency ( reliability ) in the ethnically diverse ethnibus sample . the casp-19 and whoqol - old also had relatively large numbers of items that failed to meet the reliability criterion for item - total scale correlations ; they frequently failed correlation tests for validity in the ethnibus sample . this may have been due to this sample 's ethnic diversity , or because the casp-19 and whoqol - old were not sufficiently sensitive . the opqol is currently being tested with older people living in italy ; initial results for cultural equivalence and understanding are positive ( personal communication , dr claudio bilotta , university of milan).what is already known on this subjectincreasing numbers of older people , higher expectations for a good life , and demands for health and social care , have led to international interest in the enhancement , and measurement , of quality of life ( qol ) in older age.qol is a subjective concept , yet most measures of qol are based primarily or partly on expert opinions.what this study addsthis study focuses on the testing of a new measure of qol , the older people 's qol questionnaire ( opqol ) , which was derived entirely from the views of older people in britain , cross - checked against theoretical models for comprehensiveness.the opqol performed well in three samples of older people in britain , one of which comprised people from ethnic minority groups . it is of potential value in the outcome assessment of health and social interventions , which can have a multidimensional impact on people 's lives . increasing numbers of older people , higher expectations for a good life , and demands for health and social care , have led to international interest in the enhancement , and measurement , of quality of life ( qol ) in older age . qol is a subjective concept , yet most measures of qol are based primarily or partly on expert opinions . this study focuses on the testing of a new measure of qol , the older people 's qol questionnaire ( opqol ) , which was derived entirely from the views of older people in britain , cross - checked against theoretical models for comprehensiveness . the opqol performed well in three samples of older people in britain , one of which comprised people from ethnic minority groups . it is of potential value in the outcome assessment of health and social interventions , which can have a multidimensional impact on people 's lives .

backgroundmost measures of quality of life ( qol ) are based on expert opinions . this study describes a new measure of qol in older age , the older people 's qol questionnaire ( opqol ) , which is unique in being derived from the views of lay people , cross - checked against theoretical models for assessment of comprehensiveness . its performance was assessed cross - sectionally and longitudinally . it was compared with two existing qol measures in the cross - sectional studies in order to identify the optimal measure for use with older populations.methodsdata were taken from three surveys of older people living at home in britain in 20072008 : one population survey of people aged 65 + , one focused enumeration survey of ethnically diverse older people aged 65 + , one follow - up of a population survey of people aged 65 + at baseline in 1999/2000 . measures were qol ( using opqol , control , autonomy , satisfaction , pleasure - 19 items ( casp-19 ) , world health organization quality of life questionnaire - version for older people ( whoqol - old ) ) , health , social and socioeconomic circumstances . the casp-19 and whoqol - old were not administered to the longitudinal sample in order to reduce respondent burden.resultspsychometric tests were applied to each qol measure . the opqol , casp-19 and whoqol - old performed well with the cross - sectional samples ; however , only the opqol met criteria for internal consistency in the ethnibus samples.conclusionthe opqol is of potential value in the outcome assessment of health and social interventions , which can have a multidimensional impact on people 's lives . further research is needed to examine whether differences by ethnicity reflect real differences in qol , methodological issues , variations in expectations or cultural differences in reporting .

supplementary material is available for this article at 10.1007/s13659 - 013 - 0053 - 4 and is accessible for authorized users .

phytochemical investigation of the aerial parts of dodonaea viscosa led to the isolation of six new compounds including four isoprenylated flavonoids , dodovisones a - d ( 14 ) , and two clerodane diterpenoids , dodovislactones a and b ( 5 and 6 ) . their structures were established by extensive spectroscopic analysis . electronic supplementary materialsupplementary material is available for this article at 10.1007/s13659 - 013 - 0053 - 4 and is accessible for authorized users .

subarachnoid hemorrhage ( sah ) resulting from a ruptured intracranial aneurysm affects approximately 30,000 individuals in usa each year . while many of these patients die before reaching a hospital , the majority are admitted to an intensive care unit where their clinical status can be closely monitored . therefore , treatment of sah patients is focused on preventing secondary injury in an effort to minimize morbidity and mortality . the most devastating injury is also among the most common : delayed cerebral ischemia ( dci ) . delayed cerebral ischemia affects approximately 30% of all sah patients and is correlated with a poor outcome as measured by long - term disability and mortality [ 2 , 3 ] . there have been inconsistencies in the literature regarding the definition of dci and its frequent precursor , vasospasm . as not all dci is preceded by vasospasm , this has led to recent efforts to standardize terminology . in general , vasospasm is the result of vasoconstriction or vascular endothelial swelling resulting in a narrowing of the intracranial arteries . on the other hand , dci is characterized by a new focal neurological deficit , a decrease in the level of consciousness , or radiographic evidence of new infarct . vasospasm is a radiographic diagnosis that does not necessarily correlate with functional outcome whereas dci is directly related to morbidity and mortality but may occur in the presence or absence of vasospasm . the diagnosis of vasospasm carries significant importance , as therapy to counteract its deleterious effects can be instituted to protect patients from dci . an ideal surveillance method would provide early recognition of vasospasm and allow opportunity to initiate proper therapy prior to the development of symptoms . it would also demonstrate a high positive predictive value so as not to unnecessarily expose patients to the risks of triple - h therapy ( hemodilution , hypertension , and hypervolemia ) , which carries its own inherent risks . this is especially important in patients with particularly severe sah in whom clinical deterioration is more difficult to detect on the basis of a neurologic exam . this paper will explore the current armamentarium designed for detection of vasospasm recognizing that early intervention decreases the risk of dci and improves overall survival [ 7 , 8 ] . below , the authors review multiple monitoring techniques including transcranial doppler ultrasonography ( tcd ) , various ct modalities , digital subtraction angiography ( dsa ) , brain tissue oxygenation monitoring ( bto ) , microdialysis , thermal diffusion monitoring , jugular bulb oximetry , and near infrared spectroscopy ( nirs ) and compare their relative sensitivity and specificity as they apply to the clinical setting . a diagnostic instrument that provides immediate bedside clinical information in a noninvasive fashion is of obvious utility in sah patients whose clinical condition is already tenuous . the transcranial doppler ultrasound ( tcd ) is a portable and efficient tool for determining cerebral blood flow and has become the most widely used technique for evaluating cerebral vasospasm in the neurocritical care unit . in a meta - analysis by lysakowski et al . , tcd reliably predicted proximal middle cerebral artery ( mca ) spasm in 97% of sah patients . though specificity was an encouraging 99% , the sensitivity of tcd was found to be 67% . tcd is limited in its ability to obtain consistent measurements in centrally located skull base arteries and several studies have revealed relatively poor sensitivity and specificity in evaluating the anterior cerebral artery and posterior cerebral territories [ 11 , 12 ] . despite these shortcomings , gonzalez et al . combined the lindegaard ratio ( middle cerebral artery flow velocity / internal carotid artery flow velocity ) and spasm index ( tcd velocity / hemispheric cerebral blood flow ( cbf ) ) in a retrospective mathematical model , which increased the sensitivity to 85% , compared to 6976% for measurements analyzed in isolation . a separate study found that the sensitivity could be increased to 77% by using the ratio of ipsilateral to contralateral mca mean blood flow volume ( mbfv ) . despite its shortfalls when used appropriately , tcd remains a useful screening tool for vasospasm , though providers must exercise caution when using its results to rule out patients with vasospasm . dsa remains the gold standard for diagnosis of cerebral vasospasm and has the added benefit of therapeutic capability . however , dsa is among the most invasive modalities available for vasospasm diagnosis , and leaves much to be desired in the hunt for a low - risk , efficient , and rapid surveillance tool . ct angiography ( cta ) has been validated as a first - line tool to recognize and diagnose vasospasm for several years ; however , more recently the development of ct perfusion ( ctp ) scans has been proven to have more diagnostic utility . the appearance of vasospasm on cta is highly reproducible ; however , the quality of images depends on the technique of dye administration and the limitation of motion artifact . additionally , cta tends to overestimate the size of larger blood vessels , thereby creating a more severe appearance of vasospasm than is actually present . this can potentially lead to detrimental effects if patients are inappropriately subjected to triple - h therapy . additionally , it is important to recall that angiographic vasospasm is not directly correlated with dci and may occur in isolation without any adverse clinical effects . therefore it remains important to identify patients in whom dci and vasospasm are simultaneously present , indicating they could benefit from triple - h therapy . retrospective analysis of radiographs obtained 68 days after hemorrhage reveals similar sensitivity ( 80% and 73% ) , specificity ( 67% and 75% ) , and positive predictive value ( 90% and 92% ) for ctp and dsa , respectively . these results have been validated in a prospective trial in which analysis of cbf and mean transit time ( mtt ) on ctp were 93% and 88% accurate , respectively , in diagnosing dci . additionally , a meta - analysis found similar sensitivity and specificity when comparing cta and ctp . however , it has also been noted that the accuracy of both cta and dsa decreases when evaluating smaller caliber vessels . additionally , a decrease in cbf and prolongation of mtt on baseline ctp performed as a baseline within 3 days following sah have been found to be > 90% specific for the development of vasospasm . similarly , early results suggest that ctp may be a reliable predictor of dci . in a recent study involving 96 patients with sah , further prospective studies are needed , but this is a promising , relatively new technique to identify and potentially treat the subset of patients at highest risk for vasospasm early in their hospital course . while ctp is perhaps the most commonly employed modality , several other methods are quickly gaining rapport among cerebrovascular surgeons for prediction of vasospasm . perfusion - weighted magnetic resonance imaging ( mri ) has been demonstrated to reveal small regions of early ischemic injury , indicating territories suffering vasospasm . decreases in relative cerebral blood volume ( cbv ) and mean transit time on diffusion - weighted mri assist in the selection of patients who benefit from triple - h therapy . several older modalities , including positron emission tomography ( pet ) , xenon - enhanced ct ( xe - ct ) , and single - photon emission computed tomography ( spect ) are available for evaluation of brain tissue distal to vessels undergoing vasospasm . pet provides physiologic data by demonstrating the brain 's effort to maintain an adequate cerebral metabolic rate in the setting of sah . evidence established by pet shows increase oxygen extraction and increased blood volume , seemingly related to microarterial dilatation in the days following aneurysm rupture . spect utilizes a glial and neuronal - metabolized radioisotope to detect areas of relatively high tissue oxygen demand . importantly , the spect technique is not a quantitative measure , but rather one that relies on the relative differences in cerebral blood flow between two or more regions . thus , diffuse or bihemispheric hypoperfusion could be misinterpreted as a normal perfusion study , as analyzed by spect . furthermore , while regions of hypoperfusion correlate well with ischemic deficits , the resource - burden and low resolution relative to other technologies limit its widespread and routine use . another surveillance modality relying on ct technology , xenon - enhanced ct , may not only identify ischemic tissue , but also has been shown to confirm areas salvaged by medical or endovascular intervention . upon its introduction , the primary advantage of xe - ct relative to its contemporary counterparts was the ability to detect very early flow derangements ( within two hours or less ) . today , the widespread availability of and familiarity with ctp has rendered xe - ct largely obsolete . continuous eeg ( ceeg ) monitoring is an attractive surveillance method owing to its sensitivity in detecting cerebral ischemia and the fact that it is currently the only widely available continuous monitor other than the physical exam . continuous eeg has the added benefit of diagnosing subclinical seizures in patients whose neurologic exam can not reliably distinguish seizure activity from ischemia - related global cerebral insult . one prospective study of relative alpha wave activity demonstrated that a decrease in such activity detected cerebral vasospasm with 100% sensitivity in an average of 2.9 days earlier than tcd or angiography . it was not , however , able to differentiate decreased activity due to vasospasm from that due to increased intracranial pressure yielding a specificity of only 50% . therefore , eeg may represent a reliable screening tool , but its initial findings must be validated by additional measures . in the absence of confirmation of vasospasm via tcd or cta , the low positive predictive value leads to a therapeutic dilemma in the case where one must decide if the elevation is an early precursor to vasospasm that should be proactively treated or a false positive . utilizing quantitative analysis with ceeg allows differentiation of vasospasm from seizure activity with variable reliability , but generally earlier than imaging modalities such as ct or mri . however , the labor intensive process of applying electrodes which must be removed and reapplied for ct or mri and the difficulty of analyzing the data in real time without an electroencephalographer at all times have limited the widespread use of this technique . nevertheless , ceeg is an ideal instrument for those patients with high - grade sah and poor neurologic exam in whom there is clinical suspicion for both seizure activity and ischemia . both brain tissue oxygen ( ptio2 ) monitoring and microdialysis require implantation of a probe in a region of interest and provide data regarding changes in the surrounding microenvironment at frequent time intervals . in 2000 , the first ptio2 monitoring in sah demonstrated lower cerebral tissue ph and higher pco2 compared to controls , and a subsequent investigation indicated a strong correlation between ptio2 and vasospasm . a separate study suggests that ptio2 pressure reactivity is a reliable indicator of impaired autoregulation and , by proxy , vasospasm effect . these studies , and similar investigations involving ptio2 , are plagued by a small sample size not to mention the innate invasiveness of ptio2limiting their universal adoption . moreover , exploration by some of the relationship between pressure- and oxygen - related indices of vasospasm and clinical outcome has revealed a discordant relationship , calling into question the utility and reliability of ptio2 . cerebral microdialysis is capable of measuring local levels of a variety of metabolic markers including glutamate [ 3840 ] , lactate [ 38 , 41 ] , and glucose and relating values to areas of ischemia and clinical outcome . in one study , microdialysis has been shown to be 89% specific for ischemia , detecting dramatic changes in concentrations of lactate , glucose , and glutamate levels before a patient becomes symptomatic . higher levels of lactate , nitrite , and taurine , all measured via microdialysis , are predictive of poor neurologic outcome after sah . despite these results , the practical limitations of this technique have curtailed its more widespread use . it is an invasive monitor that must be placed in a region of brain with viable tissue near the site of rupture . the growing popularity of endovascular treatments obviating the dependence upon open craniotomies necessitates that the majority of monitors be placed at the bedside where proper placement is considerably more difficult and dangerous . additionally , the probe is only able to monitor a small region of interest thus decreasing the sensitivity and limiting its utility in monitoring a condition that can have patchy or global effects . continuous monitoring of cerebral blood flow is another means to detect vasospasm and its effects on tissue [ 44 , 45 ] . while tcd can monitor this at a discrete moment in time , reliable continuous monitors may play a crucial role in vasospasm detection and management as well as predicting which patients will suffer from dci . this can be achieved locally via thermal diffusion probes and globally via jugular bulb oximetry . much like in microdialysis , a thermal diffusion probe may be inserted into the brain via a burr hole into the white matter of a region of interest thought to be at risk for ischemia . the probe contains 2 gold sensors ; one receives the heat emitted by the other . this data can be gathered continuously in real time . although the literature on this technique is sparse , vajkoczy et al . found that cbf continues to decrease after posthemorrhage day four in patients with vasospasm even as the cpp rises during that time . in their small series , a regional cbf of 15 mg/100 g / min had 90% sensitivity and 75% specificity for vasospasm when using a single probe . this was more reliable than tcd and detected symptomatic vasospasm on average three days earlier than conventional methods . despite these promising preliminary results , additionally , like in microdialysis , a thermal diffusion probe is able to monitor only a single region of brain and therefore its efficacy is predicated upon appropriate selection of a region of interest . this technique involves the insertion of an oxygen saturation probe high into the jugular vein above the facial vein , allowing sampling from intracranial circulation . the resulting venous oxygen saturation can then be subtracted from the arterial oxygen saturation to yield the cerebral oxygen extraction ( ceo2 or avdo2 ) . results from a small sample suggest that this value increases significantly more than 24 hours prior to the onset of symptomatic vasospasm . these levels normalized after institution of triple - h therapy and corresponded to symptomatic improvement in patients . additionally , subjects who experienced clinical vasospasm had significantly higher avdo2 at baseline than those who did not . the technique is relatively simple but does expose patients to the risk of thrombus from the catheter , and the literature remains inconclusive on whether or not laterality catheter placement affects the integrity of the results . the most recent advancement in the evaluation of cerebral blood flow dynamics , nirs , utilizes near - infrared light to penetrate the skull and provide a quantitative measurement of hemoglobin concentration and cortical oxygen saturation ( coso2 ) in the underlying cortex . nirs has been shown to reliably assess cerebral autoregulation in sah patients in a continuous , real - time fashion [ 4850 ] . in a small study by yokose et al . , a 3.96.4% decrease in coso2 in the mca region detected by daily measurements was found to be 100% sensitive and 85.7% specific for vasospasm confirmed with cta . this was considerably more accurate than the results obtained via tcd leading to the conclusion that this is a promising new technique that could replace tcd as the standard noninvasive monitoring of sah patients . moreover , unlike tcd , nirs is continuous , requires little clinical attention , and is optimal for patients who may be agitated or otherwise uncooperative . despite these favorable attributes and encouraging initial results , larger , prospective studies are necessary to validate this technique before it can safely be adopted into widespread use . overall , vasospasm and dci remain a challenge to detect in patients with a poor neurologic exam . the logistical difficulties encountered in critically ill patients are compounded by a body of the literature which has been plagued by inconsistent definitions of clinical entities which make interpreting and comparing data difficult . older modalities such as spect and xe - ct may be impractical in today 's clinical setting ; however , their contribution to our understanding of cerebral blood flow and metabolism can not be overlooked . similarly , while ptio2 and microdialysis are rarely employed clinically , they continue to play an important role in the laboratory and promise to provide answers to remaining questions about the cerebral microenvironment following sah . continuous eeg has demonstrated sensitivity in detecting ischemia , though must be partnered with other surveillance modalities to achieve reliable clinical utility . both eeg and tcd may be combined with clinical exam and increasingly with ct perfusion imaging to identify patients who are likely to have adverse effects related to vasospasm . future prospective analysis should focus on the utility of early ctp and the development of nirs to provide early , noninvasive detection of ischemic injury .

subarachnoid hemorrhage related to aneurysmal rupture ( asah ) carries significant morbidity and mortality , and its treatment is focused on preventing secondary injury . the most common and devastating complication is delayed cerebral ischemia resulting from vasospasm . in this paper , the authors review the various surveillance technologies available to detect cerebral vasospasm in the days following asah . first , evidence related to the most common modalities , including transcranial doppler ultrasonography and computed tomography , are reviewed . continuous electroencephalography and older instruments such as positron emission tomography , xenon - enhanced ct , and single - photon emission computed tomography are also discussed . invasive strategies including brain tissue oxygen monitoring , microdialysis , thermal diffusion , and jugular bulb oximetry are examined . lastly , near - infrared spectroscopy , a recent addition to the field , is briefly reviewed . each surveillance tool carries its own set of advantages and limitations , and the concomitant use of multiple modalities serves to improve diagnostic sensitivity and specificity .

a 20-year - old female patient was referred to our hospital due to a sudden decrease in visual acuity in the left eye after heavy alcohol consumption . previous medical records reported that the patient had a history of severe vomiting following heavy drinking . in the left eye , the best - corrected visual acuity ( bcva ) was hand motion . fundus examination was normal in the right eye but revealed a well - circumscribed premacular hemorrhage about 4 dds in size beneath a transparent membrane with glistening reflexes extending over the macula in the left eye . time - domain oct ( td - oct ) revealed an intact foveal contour and two membranes of differing optical reflectivity , identified as the internal limiting membrane ( ilm ) and the posterior hyaloid , respectively , with blood beneath the hyperreflective membrane ( fig . the premacular hemorrhage resolved spontaneously , and the bcva in the left eye returned to 20 / 100 . yellowish residual sub - ilm deposits , however , were present , and a thick preretinal membrane was visible over the fovea ( fig . after full explanation of the expected effects and possible complications of vitrectomy , the patient provided informed consent . pvd was created using triamcinolone acetonide and a vitreous cutter only around the posterior pole . the ilm was peeled off using 23-gauge microforceps after staining the ilm with indocyanine green ( diagnogreen ; daiichi pharmaceutical , tokyo , japan ) . the thick preretinal membrane and the ilm were removed , but the residual foveal deposits could not be extracted because they had adhered to the fovea . the surgeon expected the deposits to absorb spontaneously , so fluid - air exchange was not performed . two weeks after the first vitrectomy , the foveal deposits had resolved , but a full thickness mh was observed . postoperative sd - oct , which was used to analyze the cross - sectional image almost every day ( fig . a second vitrectomy was performed using standard techniques to create a total pvd and to remove the remnant peripheral vitreous with fluid - air exchange through an extrusion cannula . the eye was flushed with a 15% perfluoropropane gas - air mixture to ensure complete exchange . after the second surgery , the patient was instructed to maintain a strict face - down position for three days in the hospital until mh closure was confirmed . six months after the second surgery to close the mh , the bcva in the left eye had improved to 20 / 25 . sd - oct showed that the mh had closed with only slight scarring of the photoreceptor inner segment / outer segment junction ( fig . reported causes of valsalva retinopathy include straining and physical activities , most commonly coughing , weight lifting , vomiting , aerobic exercise , sexual activity , colonoscopy procedures , and congenital retinal macroaneurysm [ 3 - 6 ] . although in the present case , the patient did not remember the exact situation due to heavy drinking , according to the previous medical records , severe vomiting could have been a possible cause of valsalva retinopathy . the presentation of valsalva retinopathy varies depending on the size of the vessel involved and the location of the hemorrhage , which can be subretinal , intraretinal and/or subhyaloid . the exact location of premacular hemorrhage ( whether sub - hyaloid or sub - ilm ) has been disputed in the literature . hemorrhage following valsalva retinopathy is more commonly sub - ilm than sub - hyaloid ; rarely , it may be a combination of both . in the present case , premacular hemorrhage manifested as a small dome - shaped , sub - ilm hemorrhage that was characterized by a glistening light reflex , fine striae on the surface of the hemorrhage , and a large dome - shaped sub - hyaloid hemorrhage located anterior and inferior to the sub - ilm hemorrhage , as determined by color fundus photographs and sd - oct ( fig . 1 ) . to the best of our knowledge , development of an mh after vitrectomy to remove the thick preretinal membrane following spontaneous resolution of the premacular hemorrhage has not been previously reported in the literature . first , the mh could be iatrogenic ( caused by ilm peeling ) . before the first procedure , a thick preretinal membrane and sub - ilm deposits over the foveal area were observed by sd - oct . if the mh had been iatrogenic , we would have been able to observe it immediately after surgery using sd - oct . however , post - surgical sd - oct images did not reveal a mh , which could be due to the sticky nature of foveal deposits ( fig . second , the thick preretinal membrane observed after resolution of the premacular hemorrhage was considered to create a tangential tractional force over the fovea . due to this tangential force , the increased volume of the sub - ilm deposits under the thick preretinal membrane was likely to provide an additional outward expanding force into the fovea . after the residual foveal deposit was absorbed , the mh occurred with a fading holding effect of a sticky deposit , which sustained the margin of the mh . the prognosis of valsalva retinopathy is generally good , and the condition in most patients resolves spontaneously over several months . in the majority of cases , therapeutic options in valsalva retinopathy include conservative management , vitrectomy , laser membranotomy , intravitreal tissue plasminogen activator , and tamponade gas injection . if sub - ilm and sub - hyaloid hemorrhage were present in the macular area in the presented case , we would have considered yttrium - aluminum - garnet(yag ) laser and tissue plasminogen activator as a treatment option . the sub - ilm and sub - hyaloid hemorrhages , however , were absorbed completely , and only the yellowish sub - ilm deposits remained . accordingly , we did not choose yag laser and tissue plasminogen activator as a treatment option . in the present case , the mh seemed to be a possible complication after vitrectomy to remove the thick preretinal membrane associated with valsalva retinopathy . the residual sub - ilm deposits in the fovea were not absorbed spontaneously before the first vitrectomy ; therefore , the patient 's visual acuity did not improve . after ilm peeling following the first vitrectomy , the surgeon waited for spontaneous absorption of the deposits . two weeks after the first procedure , the residual sub - ilm deposits had completely resolved , and the mh could be clearly diagnosed . the ilm peeling that occurred during the first surgery , however , likely accelerated the spontaneous absorption of the residual foveal deposits and might have contributed to the closing of the mh . delaying the first operation may have led to a prolonged time for absorption of the deposits , thus worsening the prognosis due to the presence of composites such as iron in the deposits or organizing scar tissue , and the mh would have continued to be masked by the deposits . in conclusion , patients should be monitored carefully for the development of a mh after vitrectomy for valsalva retinopathy with residual sub - ilm deposits , as described in the present case .

we report a case of complete surgical resolution of valsalva retinopathy that manifested as a premacular hemorrhage involving a membrane followed by a macular hole ( mh ) resulting from the first vitrectomy . a 20-year - old female patient was referred to our hospital due to sudden vision loss in the left eye . her best - corrected visual acuity ( bcva ) in the left eye was hand motion . fundus photographs and optical coherence tomography ( oct ) revealed a premacular hemorrhage . nine weeks later , the bcva in the left eye had returned to 20 / 100 and the premacular hemorrhage had completely resolved , but residual sub - internal limiting membrane deposits and a preretinal membrane were present . the preretinal membrane was removed by core vitrectomy and preretinal membrane peeling , but the foveal deposits could not be excised . two weeks after the first vitrectomy , the deposits resolved spontaneously , but a full - thickness mh was present . six months after a second vitrectomy with fluid - gas exchange , the bcva in the left eye had improved to 20 / 25 and oct showed that the mh had closed . this case illustrates the possibility of mh formation following vitrectomy for valsalva retinopathy .

carcinoid tumors develop from stem cells of the bronchial epithelium known as kulchitsky cells , which have neuroendocrine activity . these neuroendocrine cells can develop tumors in many different organs with most common being the lungs , the appendix , the small intestine ( duodenum ) , the rectum and the pancreas.1 the most recent classification system from the world health organisation categorized neuroendocrine pulmonary tumors in four types : typical carcinoid ; atypical carcinoid ( atc ) ; large cell neuroendocrine carcinoma ; and small cell lung cancer.2 carcinoid bronchopulmonary tumors represent approximately 25% of all carcinoid tumors and 1%2% of all lung neoplasms.3 approximately 70% of these tumors are located centrally in the large bronchial tubes leading to the lung , while 10%20% , known as peripheral carcinoids , develop in the pulmonary periphery.4 typical carcinoid pulmonary tumors manifest nine to ten times more often than atc tumors . typical carcinoid tumors are seen in younger patients more often than atcs and appear to be the most frequent pulmonary neoplasms during childhood and puberty.5,6 atc lung tumors have a more aggressive histologic appearance and a greater tendency to metastasize than typical carcinoid lung tumors . these tumors are more frequent in males , and the average age of onset is 46 years.7 unlike most lung cancers , the development of carcinoid pulmonary tumors is not related to smoking or other environmental causes ( eg , tobacco smoke , air pollution , or asbestos ) . the detection of carcinoid tumorlets in lung biopsies led to speculation that carcinoid tumors may grow from these cells.1 however , further research needs to be conducted as this association has not been yet determined . a 26-year - old female presented with wheezing episodes , cough and mild dyspnea . after a chest x - ray revealed normal findings and spirometry showed mild restriction ( table 1 ) , she was commenced on bronchodilators and inhaled corticosteroids . two years later , the symptoms were not entirely relieved and she had developed hemoptysis of approximately 10 ml/24 hours . therefore , she was referred to the pulmonary department for further examinations . during clinical examination the patient had reduced respiratory whistling and mild wheezing in the upper left pulmonary field . the results of the exams revealed normal blood tests , a mild restrictive spirometry ( table 1 ) , a negative mantoux and a left perihilar shadow in the chest radiograph ( figure 1a and b ) . a chest high resolution computed tomography was performed showing a nodule in the left primary bronchus causing its partial obstruction ( figure 2 ) . the suspicion of malignancy was established and the patient underwent a bronchoscopy ( olympus bf - p240 ; 6 mm insertion tube , biopsy channel 2.6 mm , 55 cm working length , [ olympus corp , tokyo , japan ] ) . the findings showed exophytic damage with increased vascularization in the left primary bronchus 5 cm from the carina . the biopsy demonstrated a typical carcinoid and the patient underwent pelvic and cerebral computed tomography , which both showed normal findings . in an effort to avoid pneumonectomy , and to produce rapid palliation of hemoptysis and immediate tumor debulking , a rigid bronchoscopy was inserted into the trachea under general anesthesia using a 7.5 mm storz rigid bronchoscope ( karl storz gmbh and co , tuttlingen , germany ) . electrocautery ( power setting of 40 watts , blend mode , normal coagulation , electrosurgical monopolar unit psd-20 , with foot switch , flexible monopolar electrocautery blunt probe olympus cd-6c-1 , loop snare , [ olympus , tokyo , japan ] ) was performed on the exophytic tumor tissue followed by mechanical removal . this intervention fully re - opened the obstructed left main bronchus and the upper subsegment of the left upper lobe . the remaining tissue in the obstructed lower subsegment of the left upper lobe was treated by surgical resection , performing a lobectomy to remove the tissue entirely . during this procedure , the final report stated that there was no expanding malignancy affecting the pleural cavity or the lymph nodes . the patient was not given chemotherapy but was followed up with regular medical monitoring combined with imaging studies ( ie , chest x - ray , chest computed tomography ) . five years after surgical treatment , the patient was asymptomatic with normal chest radiographs and normal spirometry ( table 1 ; figure 1c ) . 8 the severity and variety of symptoms depend on the size of the carcinoid pulmonary tumor and the production of hormones . in symptomatic patients with central carcinoids , the most common symptoms are : persistent cough , asthma - like wheezing , chest pain , dyspnea , hemoptysis and obstructive pneumonitis.9 a number of studies have reported that a mistaken diagnosis of asthma is frequent in these cases , delaying early diagnosis . occasionally , carcinoid pulmonary tumors may initiate an excessive hormonal secretion causing various neuroendocrine syndromes such as carcinoid syndrome and cushing syndrome.9,10 the most common symptoms of carcinoid syndrome are : facial flushing , sweating , diarrhea , rapid cardiac beats and wheezing . even more rarely , patients with cushing syndrome caused by the abnormal overproduction of cortisol can develop muscle weakness , obesity in the upper body , high blood pressure , high blood sugar and increased body and facial hair . almost 90% of typical carcinoid tumors are diagnosed at an early stage while more than 50% of atc tumors are diagnosed at stage ii or iii.11 the diagnosis of carcinoid pulmonary tumor is established on the basis of the patient s symptoms combined with imaging examination such as chest radiography , computed tomography and magnetic resonance imaging.12 to verify the histologic type of the pulmonary tumor detected , there are several biopsy options including bronchoscopic biopsy , needle biopsies and surgical biopsies ( eg , thoracotomy).13 however , it has been reported that bronchoscopic biopsy has a risk of hemorrhage , especially in cases of partial or total removal of vascular tumors.14 the primary and most effective treatment for all pulmonary carcinoid tumors is surgical resection as long as no contraindications to surgery exist ( eg , widespread metastatic disease).15 chemotherapy and radiotherapy have no therapeutic contribution and there is no verified optimal therapy for unresectable carcinoid lung tumors.16 there are a variety of resection techniques that treat lung carcinoids effectively.13 presently , the most commonly utilized resection procedure is lobectomy . for smaller tumors located in the periphery or within a pulmonary segment , surgeons may perform segmental resection or wedge resection . , a bilobectomy or pneumonectomy may be required due to the size or the location of the tumor . postoperatively , the most common complications are excessive bleeding , atelectasis and prolonged air leak.13 interventional therapeutic bronchoscopies such as laser bronchoscopy , electrocautery therapy , cryotherapy , endobronchial brachytherapy , photodynamic therapy and airway stents may also be performed in certain cases.17,18 nd - yag lasers and electrocautery , together with mechanical tumor removal , are more appropriate for rapid palliation and immediate tumor debulking.19 in particular , electrocautery therapy , as applied in our case , can achieve immediate relief of the symptoms resulting from obstructed airways in 55%75% of patients . its advantages over laser treatment include cost effectiveness , higher availability , and faster removal of tumors and components resistant to laser coagulation . 18 moreover , in a study evaluating the degree of damage and bronchial wall healing after photodynamic , nd - yag laser , and electrocautery therapy , electrocautery produced the least amount of airway scarring and subepithelial fibrosis.19 in another study , the amount of mucosal damage visualized after electrocautery was correlated with histologic tissue damage . the investigators concluded that this is a potential advantage of electrocautery compared to other therapies , where the real histologic damage may be more severe than what is visualized after the therapy.20 side effects of electrocautery therapy include burn , haemorrhage , and inadvertent electrical shock to the endoscopist or the patient , but there are no reports of treatment - related deaths or respiratory failure episodes.18,21 these bronchoscopic techniques are usually used for palliative management of bronchial obstruction , for mass reduction prior to surgery , or for patients unsuitable for formal surgery.18 a number of studies of endobronchial resection have confirmed that bronchoscopic techniques are successful modalities of treatment.22 several therapeutic modalities used in conjunction may be essential to achieve the best management of the disease , rather than a single invasive approach.23 in a recent review , even though 50% of patients underwent a lung resection after a single bronchoscopic resection , the authors reported that the inability to remove the remaining tumor was entirely due to the inaccessibility of the tumor.2426 some experts believe that tumor reduction by this method may result in a more conservative surgical resection.15 our study confirms these findings as the use of bronchoscopic electrocautery followed by surgical lobectomy not only removed the tumor entirely but also avoided pneumonectomy . among pulmonary malignancies , carcinoid tumors have the highest prognostic rates . the 5-year survival rate reaches 92%100% for typical lung carcinoids and only 61%88% for atcs.27 previous studies have shown that lymph node involvement as well as the presence of tumorlets , have significant negative effects on prognoses.28 early suspicion , combined with imaging examination and biopsy , is the key to diagnosis . improved surgical techniques allow smaller incisions resulting in shorter hospitalization and less postoperative pain.19 many studies suggest that the use of endobronchial management techniques not only improve clinical symptoms and quality of life , but also increase overall survival.21,23 therefore , performing less invasive procedures should be considered throughout the management of lung cancer patients , provided no poor prognostic factors exist.29 series utilizing this mode of therapy must be reported in order to determine long - term outcomes . it is very important that scientists continue to investigate and publish results from such cases so that new information about the etiology and treatment of the disease can be made available .

carcinoid bronchopulmonary tumors represent approximately 25% of all carcinoid tumors and 1%2% of all lung neoplasms . the most common symptoms are : persistent cough , asthma - like wheezing , chest pain , dyspnea , hemoptysis and obstructive pneumonitis . we present a case of a young adult diagnosed with a typical carcinoid tumor . the diagnosis was established on the basis of imaging examination and bronchoscopic biopsy . the patient was treated with bronchoscopic electrocautery therapy to relieve the obstructed airway , followed by surgical lobectomy in order to entirely remove the exophytic damage . this approach was not only a palliative management to bronchial obstruction but also avoided pneumonectomy . recent studies support the use of such interventional resection methods , as they may result in a more conservative surgical resection .

the single most important prognostic indicator in breast cancer patients is the presence of metastatic dissemination to axillary lymph nodes . the sentinel lymph node ( sln ) is the lymph node that primarily drains the tumour site and sln biopsy ( slnb ) is considered the standard of care for clinically node - negative disease . however , the role and utility of high throughput evaluation of slns and the finding of minimal metastases continue to fuel debate . the pathological assessment of the slns with multilevel evaluation and immunohistochemistry ( ihc ) is common practice and isolated tumour cells ( itcs ) have been separated from micrometastases in international staging manuals for breast cancer . however , recent studies with up to 6 years of follow - up have demonstrated that both patients with negative sln and patients with sln micrometastases had low recurrence of axillary metastases and they report no statistical differences in overall survival between patients with negative sln and sln micrometastases [ 5 , 6 ] . the upstaging potential of slnb and the workload imposed by a systematic search for low - volume sln involvement has stimulated pathologists to move toward establishing alternative procedures such as rt - pcr to detect minimal amounts of mrnas of specific breast cancer markers [ 713 ] . the majority of the studies [ 7 , 10 , 12 , 13 ] have compared rt - pcr analysis of fresh nodal tissues with h&e and ihc analysis of formalin - fixed paraffin embedded slns . few studies [ 14 , 15 ] have directly compared rt - pcr and step - sectioning and ihc results on frozen sections . most mrna extracted for rt - pcr is obtained from fresh sln tissues for the purpose of determining sln involvement and of guiding an immediate formal axillary dissection . a recent study by langer et al . demonstrated that with intraoperative frozen sections at three levels with a cutting interval of 150 m , nearly all macrometastases can be detected and as a consequence , the number of second operations for axillary dissection was low . in our breast unit , we use ultrasonographically guided fine needle aspiration of suspect lymph nodes as a pre - operatory staging procedure . using this procedure , the percentage of metastatic sln is markedly reduced and metastatic slns are confined to micrometastases and itcs . therefore , we use a protocol for management of patients that includes day surgery for breast cancer and sln excision ( without any examination of intraoperatory frozen sections ) , followed by step - sectioning of sln on formalin - fixed tissue . however , formalin , a cross - linking agent , induces rna chemical changes and fragmentation , impairing quantification of gene expression . recently , new tissue fixatives providing preservation of both tissue morphology and rna / dna / proteins have been proposed [ 1921 ] . methacarn is a non - cross - linking organic solvent consisting of a solution of methanol , chloroform and acetic acid . it not only preserves optimal morphology and antigenicity for ihc , but it also allows for the analysis of mrna and protein expression levels and the mutational analysis of target genes from microdissected tissue samples of paraffin embedded tissues , with yields close to those achievable using unfixed frozen tissues . thus , in the present study , we fixed a series of slns in methacarn with the aim to evaluate and compare the reliability of conventional histopathology or ihc versus rt - pcr to detect nodal metastatic foci on the same sln . as a pre - operatory staging procedure , all patients with invasive breast cancer are submitted to ultrasound ( us ) examination of the axilla followed by ultrasonographically guided fine needle aspiration ( us - fna ) of suspect lymph nodes . patients with negative us or negative fna of axillary lymph node proceed to sln biopsy and cancer excision in day surgery without any intraoperatory frozen section examination . the criterion for sln biopsy was early - stage ( t12 n0 m0 ) invasive breast cancer ( table 1 ) . using the pre - operatory staging procedure and the sln biopsy criterion , from march 2006 to december 2006 , a total of 74 sln biopsies were performed in 62 patients out of 137 breast cancer cases treated in our institution . characteristics of the 58 breast cancer patients 9 cases with macro- and micro - metastases in sln , 2 cases with itc and in 2 cases with negative sln ( pn0(i ) ) . during the study period , all slns were immediately fixed in methacarn ( 60% methanol , 30% chloroform and 10% glacial acetic acid ) . this regional guideline was developed to help ensure that none of the macro or micrometastases are missed during tissue processing , since in the local surgical protocol , an axillary dissection is performed only in the presence of metastases larger than 2 mm . however , each patient s management was discussed at multidisciplinary meetings and therapeutic decisions could be modified depending on other clinical and pathological parameters such as presence or absence of lymphovascular invasion . after 6 hrs of fixation gross sections were placed in one or two blocks depending on the size of the sln and kept in their correct position with the aid of a sponge . during embedding in paraffin wax , care was taken to preserve the original sequence of slices ; the top cut - surface of a gross section and the bottom surface of the next section represented contiguous areas of the sln ( fig . ( a ) sentinel nodes gross sectioning at 2 mm and ( b ) sentinel node haematoxylin and eosin stained slides of case 10 . sections of level 13 without metastases , 14 and 20 with metastases ( circled ) are shown at higher magnification ( 20 ) ( arrows ) ; ( c ) rt - pcr : mrna for ck19 , cea and mammaglobin ( mmg ) not detected on sections from levels 4 to 5 and ( d ) detected on sections from levels 17 to 20 corresponding to the site of metastases . each sln was step - sectioned at 100 m intervals with a standard microtome until the extinction of the wax blocks . the first two consecutive sections ( 4 m thickness ) of each level were used for h&e staining and for ihc analysis . six sections ( 7 m thickness ) were cut from between levels 4 and 5 and were collected in an rnase - free tube for molecular analysis . to reduce the risk of contamination , new blades were used for sln cutting during both gross and microscopic sectioning . similar to the slns , the non - slns were isolated from the fat tissue of the axillary dissection specimen and grossly sliced at 2 mm intervals if larger than 0.5 cm . if the sln was found to be negative on h&e staining , the sections collected for ihc analysis were stained using an automated immunostainer ( benchmark autostainer , ventana medical systems , tucson , az , usa ) using ae1/ae3 cytokeratin antibodies ( clones ae1/ae3 & pck26 , pre - diluted , ventana - diapath , tucson , az , usa ) . metastatic deposits were measured in two dimensions and categorized according to the new american joint committee on cancer staging system as isolated tumour cells / clusters ( itcs ; pn0(i+ ) ) when they were 0.2 mm or less in the larger dimension and as micrometastases ( pn1mi ) when they measured more than 0.2 mm , but not greater than 2.0 mm ; sln metastases larger than 2 mm were categorized as having pn1a category nodal involvement . mrna was extracted from the six sections collected from between step - sectioning levels 4 and 5 . in one case , the tissue for rt - pcr was also obtained from seven 4-m - thick sections previously collected for ihc . rna was isolated using the masterpure purification kit ( epicentre , madison , wi , usa ) ; a dnase i treatment step was included . rna concentration was measured with a spectrophotometer ( biophotomer eppendorf ag , hamburg , germany ) . one microgram of each sample rna was reverse transcribed to cdna with superscript ii enzyme ( invitrogen corporation , carlsbad , ca , usa ) using oligo - dt according to the manufacturer s instructions . cdna samples were subsequently amplified for the target sequences by using published primers for cea ( ceacam5 , nm_004363.2 ) and mammaglobin ( scgb2a2 , nm_002411.2 ) and semi - nested and single step pcr , respectively . to optimize ck19 ( krt19 , nm_002276.4 ) mrna detection in methacarn - fixed tissue , we developed a semi - nested rt - pcr with a first round pcr using primers previously reported , followed by a second pcr using an inner primer designed with the primer 3 program ( http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ) from the sequence of the human ck19 gene . mrna for beta-2 microglobulin ( b2 m , nm_004048.2 ) was amplified for each sample for quality control of rna integrity and absence of dna polymerase inhibitors . the cea gene was amplified with a touchdown ( td ) pcr program . in selected cases , rt - pcr for mammaglobin was performed on rna extracted from six sections ( 7-m thick ) of the corresponding primary tumour , using the same extraction protocol and the same quality and quantity controls reported above . in this case , the histological tissues were formalin fixed and paraffin embedded ( ffpe ) ; therefore , we optimized mammaglobin molecular analysis by targeting a smaller amplicon with primers designed with the primer 3 program ( http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ) on the same human mammaglobin gene sequence . forward and reverse primer sequences , the size of the corresponding amplicon and the annealing temperature are reported in table 2 . every reaction included 5 l cdna ( corresponding to 100 ng ) , 1.5 mm mgcl2 , 0.2 mm each dntp , 1 u of taq dna polymerase , 5 pmoles of each primer and pcr buffer 1x . for mammaglobin expression analysis on cdna from ffpe primary tumours , 25 pmoles of each primer and 300 ng of cdna were used . nested and semi - nested pcrs were performed with 5 l of the first step pcr product in 50 l of final volume with the same starting conditions . sentinel nodes of six patients with cutaneous melanoma who underwent lymphadenectomy ( reactive lymph nodes by histology without evidence of malignancy ) were used as negative controls . both mrna extracted from a pool of mcf-7 and skbr3 breast cancer cell lines and from a primary breast cancer fixed in methacarn and embedded in paraffin served as positive controls . all pcr products were visualized by electrophoresis on 2% agarose gels , containing 0.5 g / ml ethidium bromide . forward and reverse primer sequences , corresponding amplicons and annealing temperature of cea , ck19 , mammaglobin and 2 microglobulin for mammaglobin rt - pcr analysis using rna from methacarn - fixed paraffin embedded tissues . for mammaglobin rt - pcr analysis using rna from formalin - fixed paraffin embedded tissues . to reduce the risk of contamination from previously amplified products , separate areas were used for rna isolation , amplification and electrophoresis . as a pre - operatory staging procedure , all patients with invasive breast cancer are submitted to ultrasound ( us ) examination of the axilla followed by ultrasonographically guided fine needle aspiration ( us - fna ) of suspect lymph nodes . patients with negative us or negative fna of axillary lymph node proceed to sln biopsy and cancer excision in day surgery without any intraoperatory frozen section examination . the criterion for sln biopsy was early - stage ( t12 n0 m0 ) invasive breast cancer ( table 1 ) . using the pre - operatory staging procedure and the sln biopsy criterion , from march 2006 to december 2006 , a total of 74 sln biopsies were performed in 62 patients out of 137 breast cancer cases treated in our institution . characteristics of the 58 breast cancer patients 9 cases with macro- and micro - metastases in sln , 2 cases with itc and in 2 cases with negative sln ( pn0(i ) ) . during the study period , all slns were immediately fixed in methacarn ( 60% methanol , 30% chloroform and 10% glacial acetic acid ) . this regional guideline was developed to help ensure that none of the macro or micrometastases are missed during tissue processing , since in the local surgical protocol , an axillary dissection is performed only in the presence of metastases larger than 2 mm . however , each patient s management was discussed at multidisciplinary meetings and therapeutic decisions could be modified depending on other clinical and pathological parameters such as presence or absence of lymphovascular invasion . after 6 hrs of fixation gross sections were placed in one or two blocks depending on the size of the sln and kept in their correct position with the aid of a sponge . during embedding in paraffin wax , care was taken to preserve the original sequence of slices ; the top cut - surface of a gross section and the bottom surface of the next section represented contiguous areas of the sln ( fig . ( a ) sentinel nodes gross sectioning at 2 mm and ( b ) sentinel node haematoxylin and eosin stained slides of case 10 . sections of level 13 without metastases , 14 and 20 with metastases ( circled ) are shown at higher magnification ( 20 ) ( arrows ) ; ( c ) rt - pcr : mrna for ck19 , cea and mammaglobin ( mmg ) not detected on sections from levels 4 to 5 and ( d ) detected on sections from levels 17 to 20 corresponding to the site of metastases . each sln was step - sectioned at 100 m intervals with a standard microtome until the extinction of the wax blocks . the first two consecutive sections ( 4 m thickness ) of each level were used for h&e staining and for ihc analysis . six sections ( 7 m thickness ) were cut from between levels 4 and 5 and were collected in an rnase - free tube for molecular analysis . to reduce the risk of contamination , new blades were used for sln cutting during both gross and microscopic sectioning . similar to the slns , the non - slns were isolated from the fat tissue of the axillary dissection specimen and grossly sliced at 2 mm intervals if larger than 0.5 cm . if the sln was found to be negative on h&e staining , the sections collected for ihc analysis were stained using an automated immunostainer ( benchmark autostainer , ventana medical systems , tucson , az , usa ) using ae1/ae3 cytokeratin antibodies ( clones ae1/ae3 & pck26 , pre - diluted , ventana - diapath , tucson , az , usa ) . metastatic deposits were measured in two dimensions and categorized according to the new american joint committee on cancer staging system as isolated tumour cells / clusters ( itcs ; pn0(i+ ) ) when they were 0.2 mm or less in the larger dimension and as micrometastases ( pn1mi ) when they measured more than 0.2 mm , but not greater than 2.0 mm ; sln metastases larger than 2 mm were categorized as having pn1a category nodal involvement . mrna was extracted from the six sections collected from between step - sectioning levels 4 and 5 . in one case , the tissue for rt - pcr was also obtained from seven 4-m - thick sections previously collected for ihc . rna was isolated using the masterpure purification kit ( epicentre , madison , wi , usa ) ; a dnase i treatment step was included . rna concentration was measured with a spectrophotometer ( biophotomer eppendorf ag , hamburg , germany ) . one microgram of each sample rna was reverse transcribed to cdna with superscript ii enzyme ( invitrogen corporation , carlsbad , ca , usa ) using oligo - dt according to the manufacturer s instructions . cdna samples were subsequently amplified for the target sequences by using published primers for cea ( ceacam5 , nm_004363.2 ) and mammaglobin ( scgb2a2 , nm_002411.2 ) and semi - nested and single step pcr , respectively . to optimize ck19 ( krt19 , nm_002276.4 ) mrna detection in methacarn - fixed tissue , we developed a semi - nested rt - pcr with a first round pcr using primers previously reported , followed by a second pcr using an inner primer designed with the primer 3 program ( http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ) from the sequence of the human ck19 gene . mrna for beta-2 microglobulin ( b2 m , nm_004048.2 ) was amplified for each sample for quality control of rna integrity and absence of dna polymerase inhibitors . the cea gene was amplified with a touchdown ( td ) pcr program . in selected cases , rt - pcr for mammaglobin was performed on rna extracted from six sections ( 7-m thick ) of the corresponding primary tumour , using the same extraction protocol and the same quality and quantity controls reported above . in this case , the histological tissues were formalin fixed and paraffin embedded ( ffpe ) ; therefore , we optimized mammaglobin molecular analysis by targeting a smaller amplicon with primers designed with the primer 3 program ( http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ) on the same human mammaglobin gene sequence . forward and reverse primer sequences , the size of the corresponding amplicon and the annealing temperature are reported in table 2 . every reaction included 5 l cdna ( corresponding to 100 ng ) , 1.5 mm mgcl2 , 0.2 mm each dntp , 1 u of taq dna polymerase , 5 pmoles of each primer and pcr buffer 1x . for mammaglobin expression analysis on cdna from ffpe primary tumours , 25 pmoles of each primer and 300 ng of cdna were used . nested and semi - nested pcrs were performed with 5 l of the first step pcr product in 50 l of final volume with the same starting conditions . sentinel nodes of six patients with cutaneous melanoma who underwent lymphadenectomy ( reactive lymph nodes by histology without evidence of malignancy ) were used as negative controls . both mrna extracted from a pool of mcf-7 and skbr3 breast cancer cell lines and from a primary breast cancer fixed in methacarn and embedded in paraffin served as positive controls . all pcr products were visualized by electrophoresis on 2% agarose gels , containing 0.5 g / ml ethidium bromide . forward and reverse primer sequences , corresponding amplicons and annealing temperature of cea , ck19 , mammaglobin and 2 microglobulin for mammaglobin rt - pcr analysis using rna from methacarn - fixed paraffin embedded tissues . for mammaglobin rt - pcr analysis using rna from formalin - fixed paraffin embedded tissues . to reduce the risk of contamination from previously amplified products , separate areas were used for rna isolation , amplification and electrophoresis . the mrna extraction from fixed tissue was successful only in 93% of cases , corresponding to 69 slns from 58 patients . the total rna extracted from each sln varied from 4 to 140 g ( see fig . clinical - pathological characteristics of these 58 patients are detailed in table 1 distribution of the amount of total rna ( g ) extracted from the 69 slns studied by rt - pcr . by h&e , seven of these cases were classified as macrometastases and two as micrometastases . in one sln , a macrometastasis of 3.3 mm infiltrating the capsule and the pericapsular fat tissue was observed only in the sections cut from the last seven consecutive levels ( fig . itcs were detected by ihc staining and in three of these , the results were confirmed by retrospective examination of h&e stained slides . cell line mrna and/or mrna from the primary methacarn - fixed breast cancer used as positive controls showed strong combined expression of cea , ck19 and mammaglobin . none of the slns from the 6 melanoma patients used as negative controls were amplified by rt - pcr using the 3 breast cancer mrna markers . overall , 33 out of 69 ( 47.8% ) slns were positive for at least one gene with rt - pcr performed on sections obtained from between levels 4 and 5 ( table 3 ) . specifically , 6 out of 7 cases positive for metastases and 1 out of 2 micrometastases were rt - pcr positive with all three markers . the specificity of this kind of positivity was indirectly shown by the negative results of rt - pcr performed on sections obtained in early levels of the sln affected by macrometastases in the last 7 levels of sectioning ( table 4 , case 10 , fig . the sections collected for ihc analysis of these last levels were thus used for rt - pcr and this time the tissue was positive for all 3 markers ( fig . analogously , rt - pcr performed on tissue obtained between levels 4 and 5 was negative for 3 markers in one sln affected by a micrometastases detected by h&e staining of sections from levels 1 through 4 ( table 4 , case 9 ) . in this same case , none of the slns affected by itc were positive for mammaglobin by rt - pcr . in the set of itcs , one sln was positive for cea alone ( table 4 , case 4 ) and two were positive for ck19 and cea ( table 4 , case 5 and 7 ) . of the 23 slns negative by both h&e and ihc , 8 were both ck19- and cea - positive ; 8 were only cea - positive and 7 were ck19-positive only . results of rt - pcr markers in rt - pcr positive slns mapping of the results obtained by h&e / ihc and rt - pcr in consecutive levels of 16 sln with isolated tumour cells ( itc ) ( 0.2 mm ) , micrometastases ( > 0.2 2 mm ) and macrometastases ( < 2 mm ) . rt - pcr was performed on sections obtained from levels 4 to 5 to assess the sensitivity of the procedure , we selected the 8 cases with slns affected by itc or micrometastases that resulted negative for mammaglobin in rt - pcr and performed the rt - pcr study of mammaglobin in the ffpe primary tumour . rt - pcr analysis of mammaglobin in ffpe primary tumours corresponding to slns with itc ( cases 1 , 2 , 3 , 4 , 6 , 7 , 8) and with micrometastases ( case 5 ) not detected by mammaglobin in rt - pcr . axillary dissection was completed in the 9 cases of slns with macro and micro - metastases and in 2 cases with slns with itc . axillary dissection was performed also in 2 cases with negative sln due to the high - grade of the primary tumour in one case and to the presence of lymphovascular invasion in the other . the histological analysis of the axillary dissection suggested a correlation of non - sln metastases with the presence of lymphovascular invasion ; the positive results of the rt - pcr are shown in table 5 . correlation of h&e / ihc diagnosis of sln with non - sln status in 13 cases with axillary dissection ( ad ) . effect of rt - pcr sln results and lymphovascular invasion ( lvi ) status rt - pcr+ for at least one marker . it is commonly reported that the discrepancy between the results of rt - pcr and immuno - morphological analysis in the study of sln from breast cancer depends on the gross sampling procedure . the majority of protocols use half of the unfixed lymph node for molecular analysis and the other half as fixed samples for traditional immuno - morphology [ 12 , 13 , 26 ] . using methacarn for fixation to preserve both morphology and high quality mrna [ 21 , 22 ] , we demonstrated that the step - sectioning procedures may also impair the results of h&e , ihc and rt - pcr to detect metastatic involvement of slns . first of all , our data confirmed that the examination of the whole tissue block might be necessary even to detect all metastases measuring > 2 mm , using either morphological or molecular procedures . in a previous geometrical model , cserni showed that incomplete sectioning of the slns in extreme situations would almost completely miss metastases > 2 mm , which would be identified at best as itc . a step - sectioning protocol with levels of 250 m or 200 m would be adequate for detecting nearly all micrometastases as defined by the current tnm definitions ( i.e. metastases > 0.2 mm ) . in the present study , using a step - sectioning protocol with intervals of 100 m , we demonstrated that both ihc and rt - pcr are of limited value to detect all itcs . in particular , we confirmed that itcs are randomly distributed in the lymph node and that some of them may be missed regardless , or alternately , that they might be found by chance . these data should be taken into account when dealing with studies considering the predictive and prognostic value of itcs , such as a recent study that concluded that nanometastases ( defined identically to itcs ; i.e. as tumour cell deposits 0.2 mm ) detected by ihc in axillary lymph nodes predict a worse survival than larger micrometastases which do not influence the outcome . in addition , recent data suggest that patients with occult micrometastases in axillary lymph nodes not receiving adjuvant systemic therapy have a prognosis similar to that of patients without micrometastases . ideally , for comparing different methodologies , sections obtained from all cutting levels should be analysed by rt - pcr , but the labour - intensive nature of the process makes this prohibitive . using the protocol described herein , we could precisely map the distribution of metastases and indirectly prove that rt - pcr analysis using mammaglobin would be specific enough to find all metastases and micrometastases , but that it is relatively insensitive for submicroscopic disease . the expression of mammaglobin in the primary tumours that gave rise to itc in mammaglobin negative slns reinforces this hypothesis . on the contrary , a recent study that tested both mammaglobin a and b isoforms in sln using rt - pcr reported a high sensitivity for these markers . on the other hand , the expression by rt - pcr of ck19 and/or cea in morphologically negative sln could be more effective just in detecting itcs considering that the thickness of the tissue analysed by rt - pcr in our study was 0.042 mm ( 6 sections of 7 microns ) . however , one case with lympho - vascular invasion and sln negative at histology , but positive for cea by rt - pcr , had non - sln metastases , suggesting that sporadic itc could have been missed in the histological examination but recognized by rt - pcr . previous studies utilizing epithelial mrna markers to detect breast cancer micrometastases by rt - pcr [ 711 , 14 , 26 ] have outlined the risk of false - positive results , whereas tumour mrna markers are more specific , but are not uniformly expressed in all cancers causing the risk of false - negative results . thus , a combination of both epithelial and tumour markers could potentially yield the most reliable results . recently , new assays for quantitative measurement of mammoglobin and/or ck19 expression [ 3335 ] have been described and proposed for rapid molecular diagnosis on sln . in addition , one of these assays indicates specific cut - off values for ck19 mrna to distinguish micrometastatic from metastatic slns and to define pn0 sln ( including itcs ) with an overall concordance rate between the molecular assay and histopathology of 98.2% . however , in the sixth edition of the ajcc cancer staging manual , metastatic lesions identified only by rt - pcr are classified as pn0(mol+ ) because there are insufficient data to determine whether such lesions are clinically significant . prospective studies that would analyse the whole sln using quantitative mrna measurement and a pool of markers would probably validate molecular procedures in substituting the high - throughput histopathological analysis of the sln . in conclusion , the main goal of our study was to show that the sampling procedures of the tissue to be submitted to rt - pcr or conventional histopathological processes are the main reason for discrepancies between molecular and morphological analysis .

the optimal pathological assessment of sentinel nodes ( slns ) in breast cancer is a matter of debate . currently , multilevel histological evaluation and immunohistochemistry ( ihc ) are recommended , but alternative rt - pcr procedures have been developed . to assess the reliability of these different procedures , we devised a step - sectioning protocol at 100 micron - intervals of 74 slns using methacarn fixation . mrna was extracted from sections collected from levels 4 to 5 . mammaglobin , cea and ck19 were used for rt - pcr . mrna extraction was successful in 69 slns . of these , 7 showed macrometastases ( > 2 mm ) , 2 showed micrometastases ( < 2 mm ) and 7 showed isolated tumour cells ( itc ) by ihc . rt - pcr was positive for the three markers in 6 of 7 macrometastases and in 1 of 2 micrometastases . in the 2 rt - pcr negative cases , metastases were detected only on sections distant from those analysed by rt - pcr . cea and/or ck19 were positive by rt - pcr in 3 of 7 itc and in 23 morphologically negative slns . in conclusion , the main goal of our study was to show that the use of alternate sections of the same sample for different procedures is the key reason for the discrepancies between molecular and morphological analyses of sln . we believe that only prospective studies with quantitative mrna analysis of specific metastatic markers on the whole lymph node can elucidate the utility of molecular assessments of sln .

subarachnoid hemorrhage ( sah ) produced by a ruptured intracranial aneurysm ( ia ) affects about 10/100,000 persons annually ( 1 ) . and , although significant advances have been made in the treatment of aneurismal sah and vasospasm ( 2 ) , sah is currently a significant healthcare problem ; moreover , delayed ischemic neurological deterioration ( dind ) due to vasospasm remains the greatest cause of morbidity and mortality after sah ( 3 ) . the catastrophic consequences of a ruptured ia and the high frequency of ia in the general population demand intensive efforts to define a multifactorial risk model for the identification of those at risk of developing an ia , of rupture of an existing ia , and those at risk of dind after sah . it is known that smoking , alcohol consumption , and hypertension are common risk factors of aneurismal sah ( 4 ) . in addition , to these environmental risk factors , genetic factors also play an important role in the pathogenesis of sah and ias , as the first degree relatives of patients with the disorder have up to a seven times greater risk than the general population ( 5 ) , and about 10% of patients with an aneurismal sah have first or second degree relatives with sah or unruptured ias ( 6 ) . as this familial predisposition is the strongest risk factor for the development of ia ( 4 ) , the detection of genetic risk factors could provide further diagnostic capabilities . disruption of the extracellular matrix is likely to be a factor in the pathophysiology of ia , because ias are associated with heritable connective tissue and extracellular matrix disorders ( 7 ) . in this context , the genes involved in maintaining the integrity of the extracellular matrix have been proposed to be the most likely candidates for predisposing an individual to ia development . however , variations in these genes only explain a small proportion of the genetic factors involved in ia ( 8) . therefore , further studies are needed to identify candidate genes and to help unravel the pathophysiology of this disorder . given mounting evidence that genetic factors play a role in ia formation and rupture ( 1 , 9 - 11 ) , the endothelial nitric oxide synthase gene ( enos ) is being considered as a potential candidate gene that contributes to ia formation and vasospasm after sah , based on its normal physiologic effects on the cerebral arteries . in the arterial endothelium of animals and humans , the synthesis of nitric oxide ( no ) from l - arginine is catalyzed by the enzyme enos ( 12 ) , and the continuously generated no serves to maintain basal vascular tone and cerebral blood flow ( cbf ) ( 13 - 15 ) . in addition , when one considers that the preferential location of ias is at the bifurcation of the conductive cerebral arteries in the subarachnoid space ( 16 ) , it can be hypothesized that hemodynamic change in cbf induced by defective enos metabolism may affect the cerebral arterial walls lacking or with disrupted internal elastic lamina , and that this facilitates aneurysm formation ( 16 , 17 ) . in the present study , the authors aimed to elucidate both whether the enos t-786c mutant allele is implicated in susceptibility to sah , and dind after sah , and additionally , to determine whether this mutant allele is differentially expressed in those with a small or large ruptured aneurysm . a total of 249 human subjects were enrolled in this prospective case - control study . of 136 consecutive patients ( cases ) diagnosed with aneurismal sah based on clinical and radiological findings ( including cerebral angiography in all cases ) , 3 were excluded from analysis because of a previous history of cerebral infarction or myocardial ischemia . during same period , 113 controls were recruited from among out - patient clinic patients with various clinical diagnoses . the control inclusion criteria were as follows ; no cerebral vascular abnormality , including aneurysm or thrombosis on ct or mr angiography , no history of a vascular headache or myocardial ischemia , and no definite brain lesion on mr imaging . the maximal diameters of ruptured aneurysms were measured by neuroradiologists and the patients were divided by size into 3 groups in - line with the findings of aneurysm natural history studies ( 18 , 19 ) , i.e. , small ( 5 mm ) , medium ( 6 to 9 mm ) , and large ( 10 mm ) . sah severity on admission was classified based on ct scan findings according to the grading system described by fisher ( fisher grades 1 to 4 ) ( 20 ) . clinical sah severity on admission was scored using the glasgow coma scale ( gcs ) ( 21 ) . the outcomes of patients with sah were classified according to the glasgow outcome scale ( gos ) ( 22 ) ; favorable outcome group ( gos 1 ) , good recovery ; gos 2 , moderate disability ; and an unfavorable outcome group gos 3 , severe disability ; gos 4 , persistent vegetative state ; gos 5 , death . the study protocol was approved by our institutional review board and all subjects enrolled in the study gave informed consent . polymerase chain reaction ( pcr ) primers for enos t-7896c snp were designed based on genbank sequences ( accession number : nm_000603 ) ; 5'-gca tgc act ctg gcc tga agt-3'(forward ) and 5'-cag gaa gct gcc ttc cag tgc-3'(reverse ) . pcr assays were carried out using 1.25 u of amplitaq polymerase gold ( applied biosystem , nj , u.s.a . ) , 100 ng genomic dna , 2.0 mm of mgcl2 , and 10 m of primer . amplification conditions were as follows : an initial denaturing cycle at 95 for 7 min , followed by 35 amplification cycles ( denaturation at 94 for 30 sec , annealing at 61 for 45 sec , and extension at 72 for 1 min ) , and a final extension step of 72 for 5 min . pcr products were electrophoresed in a 1.2% agarose gel , and the amplified genomic dna fragments were extracted from the gel and purified using a qiaquick gel extraction kit ( quiagen , hilden , germany ) according to the manufacturer 's instructions . direct sequencing of both strands was performed using bigdye terminator kits ( pe biosystems , ca , u.s.a . ) to determine individual genotypes . when the clinical characteristics of the study participants were considered , hypertension was defined as blood pressures > 140/95 mmhg , and diabetes mellitus as a fasting blood glucose level of > 126 mg / dl or a random blood glucose concentration of > 200 mg / dl . multiple logistic regression analysis with forward stepwise selection was performed to identify predictors of sah occurrence , ruptured aneurysm size , sah outcome , and the occurrence of dind after sah . data were analyzed with spss ( release 11.5 ; spss , chicago , il , u.s.a . ) and differences were considered significant for p values of 0.05 . conformance with the hardy - weinberg equilibrium was tested by comparing the observed and expected genotype frequencies of the controls using the test . a total of 249 human subjects were enrolled in this prospective case - control study . of 136 consecutive patients ( cases ) diagnosed with aneurismal sah based on clinical and radiological findings ( including cerebral angiography in all cases ) , 3 were excluded from analysis because of a previous history of cerebral infarction or myocardial ischemia . during same period , 113 controls were recruited from among out - patient clinic patients with various clinical diagnoses . the control inclusion criteria were as follows ; no cerebral vascular abnormality , including aneurysm or thrombosis on ct or mr angiography , no history of a vascular headache or myocardial ischemia , and no definite brain lesion on mr imaging . the maximal diameters of ruptured aneurysms were measured by neuroradiologists and the patients were divided by size into 3 groups in - line with the findings of aneurysm natural history studies ( 18 , 19 ) , i.e. , small ( 5 mm ) , medium ( 6 to 9 mm ) , and large ( 10 mm ) . sah severity on admission was classified based on ct scan findings according to the grading system described by fisher ( fisher grades 1 to 4 ) ( 20 ) . clinical sah severity on admission was scored using the glasgow coma scale ( gcs ) ( 21 ) . the outcomes of patients with sah were classified according to the glasgow outcome scale ( gos ) ( 22 ) ; favorable outcome group ( gos 1 ) , good recovery ; gos 2 , moderate disability ; and an unfavorable outcome group gos 3 , severe disability ; gos 4 , persistent vegetative state ; gos 5 , death . the study protocol was approved by our institutional review board and all subjects enrolled in the study gave informed consent . polymerase chain reaction ( pcr ) primers for enos t-7896c snp were designed based on genbank sequences ( accession number : nm_000603 ) ; 5'-gca tgc act ctg gcc tga agt-3'(forward ) and 5'-cag gaa gct gcc ttc cag tgc-3'(reverse ) . pcr assays were carried out using 1.25 u of amplitaq polymerase gold ( applied biosystem , nj , u.s.a . ) , 100 ng genomic dna , 2.0 mm of mgcl2 , and 10 m of primer . amplification conditions were as follows : an initial denaturing cycle at 95 for 7 min , followed by 35 amplification cycles ( denaturation at 94 for 30 sec , annealing at 61 for 45 sec , and extension at 72 for 1 min ) , and a final extension step of 72 for 5 min . pcr products were electrophoresed in a 1.2% agarose gel , and the amplified genomic dna fragments were extracted from the gel and purified using a qiaquick gel extraction kit ( quiagen , hilden , germany ) according to the manufacturer 's instructions . direct sequencing of both strands was performed using bigdye terminator kits ( pe biosystems , ca , u.s.a . ) to determine individual genotypes . when the clinical characteristics of the study participants were considered , hypertension was defined as blood pressures > 140/95 mmhg , and diabetes mellitus as a fasting blood glucose level of > 126 mg / dl or a random blood glucose concentration of > 200 mg / dl . multiple logistic regression analysis with forward stepwise selection was performed to identify predictors of sah occurrence , ruptured aneurysm size , sah outcome , and the occurrence of dind after sah . data were analyzed with spss ( release 11.5 ; spss , chicago , il , u.s.a . ) and differences were considered significant for p values of 0.05 . conformance with the hardy - weinberg equilibrium was tested by comparing the observed and expected genotype frequencies of the controls using the test . compared with controls , sah cases were significantly younger with a preponderance of non - diabetics and smokers ( table 1 ) . more than 90% of patients presented with fisher grade 3 or more , and the mean diameter of ruptured aneurysms was 6.642.74 mm . dind after sah occurred in 17 patients ( 12.8% ) and more than 80% patients had a favorable outcome ( gos grade 1 or 2 ) ( table 2 ) . among the controls , the frequency of wild type homozygotes ( t / t ) was 88.5% and of mutant heterozygotes ( t / c ) , 11.5% . no patient or control harbored the mutant c / c homozygote ( table 1 ) . the frequencies of the enos t-786c snp genotypes concurred with the hardy - weinberg equilibrium ( p=0.516 ) . no significant difference was observed between cases and controls in the distributions of the enos t-786c single nucleotide polymorphism ( snp ) genotypes ( table 1 ) . with regard to ruptured aneurysm size and the occurrence of dind after sah , no significant differences were found in the distributions of the enos t-786c snp genotypes ( table 3 ) . the mean ( sd ) ruptured aneurysm diameter of wild - type homozygotes ( t / t ; 6.752.85 mm ) was similar to that of mutant heterozygotes ( t / c ; 6.192.23 mm ) ( p=0.29 , t - test ) . multiple logistic regression analysis after controlling for age and sex showed the enos t-786c snp t / c genotype was independently associated with unfavorable outcome of sah ( gos grade 3 - 5 ) ( exp ( )=4.27 , 95% ci 1.131 - 16.108 , p=0.032 ) . much attention has been focused on the contribution made by enos snps to the development and progression of various systemic vascular diseases ( 23 - 26 ) , because of the role played by no in the regulations of vascular tone and hemodynamic changes . with regard to the cardiovascular system , it has been reported that high numbers of ca repeats in intron 13 and the g894 t snp in exon 7 of the enos gene are associated with the risk of coronary artery disease ( 24 , 27 ) , and that the enos t-786c mutation is strongly associated with a history of coronary spasm ( 23 ) . of enos polymorphisms that have been linked with coronary artery disease , the enos t-786c mutation is the only one of which functional role has been elucidated . according to the luciferase reporter gene assays performed by nakayama et al . ( 23 ) , this mutation reduces enos promoter activity and finally causes a reduction in no levels . therefore , an association between the enos gene variants and coronary artery disease suggests that the enos gene could be associated with aneurismal sah , in which unique changes in cerebral no levels have been reported immediately after sah ( 28 ) . despite the potential link between the enos gene and aneurismal sah , no definite evidence confirming such an association has been found . the enos t-786c snp is one of the most frequently investigated mutations because it is located in the enos promoter region as thus potentially affects enos expression . in a prospective study involving 141 participants ( 29 ) , it was suggested that the enos t-786c mutant allele does not predict susceptibility to sah or intracranial aneurysm rupture but rather predicts susceptibility to post - sah vasospasm . however , in the present study , the authors failed to find any relationship between enos t-786c snp and the susceptibility to sah or to dind after sah as did previous studies ( 29 - 31 ) . given the available evidence and the results of the present study , it is evident that the enos t-786c snp is not a major risk factor for ia formation or sah . however , whether the enos t-786c snp contributes to vasospasm after sah remains to be determined because the sample sizes of the vasospasm groups subjected to analysis in the studies above were too small to determine the contribution made by this snp to vasospasm after sah . to date , a large blood burden is the only consistently demonstrated risk factor predicting cerebral vasospasm after sah ( 32 ) . according to the stepwise multiple logistic regression analysis performed in the present study , the presence of the enos t-786c snp t / c genotype should be considered as significant risk factors of outcome in cases of sah . interestingly , the odds ratio for an unfavorable outcome ( gos grade 3 - 5 ) after sah for individuals with the enos t-786c snp t / c genotype was 4.27 ( 95% ci 1.13 - 16.11 , p=0.032 ) . this result suggests that the enos -786c allele causing a reduction of no level should be associated with an unfavorable outcome of sah . however , the exact explanation for the unfavorable outcome of sah in patients presenting the enos -786c allele is out of the scope of the present study . nevertheless , if the result is confirmed by a larger scale study , the enos t-786c snp t / c genotype could be used as a prognostic marker in individuals with sah . another controversy concerning aneurysms and the enos gene involves the critical size of aneurysm beyond which rupture risk increases appreciably . in the international study of unruptured ias ( isuia ) ( 19 ) , the rupture rate of aneurysms of 10 mm was approximately 20 times that of aneurysms < 10 mm among patients without a prior sah . this result suggests that aneurysm size at the time of diagnosis is an independent predictor of rupture risk . however , the fact that the vast majority of ruptured aneurysms are < 10 mm in diameter at the time of diagnosis and treatment ( 33 , 34 ) reinforces the notion that aneurysm size should not be used as the sole criterion for treatment decision - making . explanations for this apparent discrepancy include the possibility that there are two distinct subpopulations of ias ; one that develops rapidly and ruptures when < 10 mm in diameter and another that enlarges slowly and ruptures when > 10 mm in diameter . ( 30 ) suggested that among caucasian patients with known ias that the enos t-786c genotype influence aneurismal size at rupture . they found that the mean ( sd ) ruptured aneurysm diameter for all heterozygotes ( t / c ; 8.55.2 mm ) was significantly greater than that for the c / c ( 6.02.3 mm ) or t / t ( 4.71.8 mm ) homozygotes ( p=0.04 ) . if this finding is reproduced by larger scale study , genotypes could be used to predict the risk of rupture in individuals presenting with unruptured ias . however , their suggestion is also not free of criticism due to the relatively small size studied ( n=52 ) . in addition , according to their suggestion , it should be stated that both the mutant homozygote ( c / c ) and the wild type homozygote ( t / t ) influence aneurysm development , which is difficult to rationalize . in the present study of 133 individuals with sah , no significant differences in the distribution of the enos t-786c genotypes were found among the 3 groups defined on the basis of aneurysm size ( table 3 ) . this negative finding is entirely consistent with the result of a recent larger scale multicenter study ( n=527 ) which was performed in east - asian population that presented with sah ( 31 ) . considering that the distributions of the enos t-786c genotypes in normal controls are quite different in these populations ( table 4 ) , discrepancies between caucasians and east - asians in terms of enos t-786c genotype distributions and their relations with aneurysm size may be attributed to ethnic differences . taken together , the enos t-786c mutation was not found to be associated with either a susceptibility to sah , or with aneurysm size in korean population . and the enos t-786c snp t / c genotype could be used as a prognostic marker in individuals with sah .

we aimed to elucidate whether the enos t-786c mutant allele is implicated in subarachnoid hemorrhage ( sah ) susceptibility or vasospasm after sah , and whether the mutant allele is differentially expressed in those with small and large ruptured aneurysms in korean population . 136 consecutive patients diagnosed with aneurismal sah and 113 controls were recruited . polymerase chain reaction and direct sequencing of both strands were performed to determine genotypes with respect to the enos t-786c mutation . no significant difference was found between cases and controls with respect to the distributions of the two enos t-786c single nucleotide polymorphism ( snp ) genotypes . no significant differences in the distributions of the enos t-786c snp genotypes were found with regard to the sizes of ruptured aneurysms or the occurrence of vasospasm after sah . multiple logistic regression analysis after controlling for age and sex showed the enos t-786c snp t / c genotype was independently associated with an unfavorable outcome ( gos grade 3 - 5 ) of sah ( exp ( )=4.27 , 95% ci 1.131 - 16.108 , p=0.032 ) . in conclusion , the enos t-786c mutation was not found to be associated with either a susceptibility to sah or vasospasm after sah , or with aneurysm size in korean population . the enos t-786c snp t / c genotype could be used as a prognostic marker in individuals with sah .

patients appearing in hospital records as having diagnosis of om between january 1 , 2007 and december 31 , 2010 were reviewed . the clinical records and radiographs of every patient were retrospectively studied using a predefined protocol , which included age , sex , site of infection , and response to treatment . diagnosis of om was based on the assessment of the infectious disease department of the hospital , taking into account both clinical assessment and physical examination , along with wound or blood cultures , histology , and radiographic examinations . during the studied period isolated microorganisms were identified by common biochemical tests ( coagulase and oxidase ) and commercial identification kits ( api system , biomrieux , marcy l'etoile , france ) . susceptibility testing was performed using a disc - plate assay according to the eucast protocols.18 ) the study was approved by the ethics research committee of the hospital . for the statistical study , frequency analysis was used to obtain a distribution of age and treatment for acute or chronic om . fisher exact test was used to examine the significance of the association ( contingency ) between patient outcomes ( favorable or unfavorable ) and treatment ( antimicrobial , surgical , and combined therapy ) . ( centers for disease control and prevention , atlanta , ga , usa ) was used in order to perform the statistical studies . for the statistical study , frequency analysis was used to obtain a distribution of age and treatment for acute or chronic om . fisher exact test was used to examine the significance of the association ( contingency ) between patient outcomes ( favorable or unfavorable ) and treatment ( antimicrobial , surgical , and combined therapy ) . ( centers for disease control and prevention , atlanta , ga , usa ) was used in order to perform the statistical studies . acute om was common in the 1st-2nd decades of life whereas chronic om frequency increased with age , as is shown in fig . 1 . both phalanxes and long bones of the lower extremities were the most commonly involved sites ( 55.6% each ) . chronic om occurred more frequently than acute om in the metatarsus , calcaneus , and hip ( fig . 2 ) . no significant differences were found in other bones regarding acute and chronic conditions of the disease . other bones included the talus , scaphoid , clavicle , occipital , ribs , frontal , ischium , and radius . fifty - five patients ( 87.3% ) had recent history of trauma or skin lesions that were considered the source of the infection . twenty - eight patients ( 44.4% ) had 1 positive sample whereas 14 patients ( 22.2% ) had 2 or more positive samples . a summary of microbiological data is shown in table 2 . among the 20 patients with past history of trauma , 13 patients ( 65.0% ) had a positive culture , and among the 35 patients with previous history of a skin lesion , 23 patients ( 65.7% ) had a positive culture . fourteen patients ( 22.2% ) received antimicrobial therapy alone , 5 patients ( 7.9% ) received surgical therapy alone , whereas 44 patients ( 69.84% ) were given a combination of antimicrobial and surgical therapy . twenty - four patients ( 92.31% ) were initially managed with antibiotics , and 14 of these cases ( 53.84% ) were treated with surgery as well . every other case was treated with surgery alone . among patients who received medical treatment , antibiotics were given over a minimum of 4 weeks in 13 cases ( 54.17% ) . a combination of antibiotics was administered in 14 cases ( 58.33% ) , whereas monotherapy was used in 9 cases ( 37.5% ) . ciprofloxacin was given in combination with other antibiotics in 7 cases ( 50% ) and amoxicillin / clavulanic acid , cloxacillin , or ciprofloxacin was used as a single - agent antimicrobial in 6 cases ( 25.0% ) . complications developed in 4 cases , including amputation of the toe phalanx in two of them . the distribution according to treatment with antimicrobial therapy alone , using frequency analysis , was 27.8% for a favorable outcome ( 95% confidence interval [ ci ] , 9.7 to 53.59 ) and 25% for an unfavorable outcome ( 95% ci , 0.6 to 80.6 ) . for surgical therapy , rates were 11.1% ( 95% ci , 1.4 to 34.7 ) and 0% ( 95% ci , 0.0 to 60.2 ) ; finally , for combined therapy 61.1% ( 95% ci , 35.7 to 82.7 ) and 75% ( 95% ci , 19.4 to 99.4 ) , respectively . no statistical differences in outcomes were found between antimicrobial , surgery , or combined therapy ( p = 0.53 , fisher exact test ) . these patients were initially managed with antibiotics in 34 cases ( 91.9% ) ; 30 cases ( 81.1% ) also required surgery , while the remaining 2 patients were treated with surgery alone . antimicrobial therapy was administered for a minimum of 4 weeks in 21 cases ( 61.8% ) . a combination of antibiotics was used in 19 cases ( 55.9% ) , with ciprofloxacin the antibiotic most frequently used in these combinations ( 10 cases , 52.6% ) . monotherapy was used in 14 cases ( 41.2% ) and amoxicillin / clavulanic acid , cloxacillin , or ciprofloxacin were used in 9 cases ( 26.5% ) . complications were reported in 13 cases ( 35.1% ) , and amputation was performed in 7 cases ( 18.9% ) . the frequency distribution according to treatment , using frequency analysis , was 6.7% for antimicrobial therapy alone in patients who had a favorable outcome ( 95% ci , 0.2 to 31.9 ) and 7.7% in patients with an unfavorable outcome ( 95% ci , 0.2 to 36.0 ) . for surgical therapy , rates were 13.3% ( 95% ci , 1.7 to 40.5 ) and 7.7% ( 95% ci , 0.2 to 36.0 ) . for combined treatment , they were 80.01% ( 95% ci , 51.9 to 95.7 ) and 84.6% ( 95% ci , 54.6 to 98.1 ) , respectively . there were no statistical differences in outcome between antimicrobial , surgical , or combined therapy ( p = 0.50 , fisher exact test ) . both phalanxes and long bones of the lower extremities were the most commonly involved sites ( 55.6% each ) . chronic om occurred more frequently than acute om in the metatarsus , calcaneus , and hip ( fig . 2 ) . no significant differences were found in other bones regarding acute and chronic conditions of the disease . other bones included the talus , scaphoid , clavicle , occipital , ribs , frontal , ischium , and radius . fifty - five patients ( 87.3% ) had recent history of trauma or skin lesions that were considered the source of the infection . twenty - eight patients ( 44.4% ) had 1 positive sample whereas 14 patients ( 22.2% ) had 2 or more positive samples . a summary of microbiological data is shown in table 2 . among the 20 patients with past history of trauma , 13 patients ( 65.0% ) had a positive culture , and among the 35 patients with previous history of a skin lesion , 23 patients ( 65.7% ) had a positive culture . fourteen patients ( 22.2% ) received antimicrobial therapy alone , 5 patients ( 7.9% ) received surgical therapy alone , whereas 44 patients ( 69.84% ) were given a combination of antimicrobial and surgical therapy . twenty - four patients ( 92.31% ) were initially managed with antibiotics , and 14 of these cases ( 53.84% ) were treated with surgery as well . every other case was treated with surgery alone . among patients who received medical treatment , antibiotics were given over a minimum of 4 weeks in 13 cases ( 54.17% ) . a combination of antibiotics was administered in 14 cases ( 58.33% ) , whereas monotherapy was used in 9 cases ( 37.5% ) . ciprofloxacin was given in combination with other antibiotics in 7 cases ( 50% ) and amoxicillin / clavulanic acid , cloxacillin , or ciprofloxacin was used as a single - agent antimicrobial in 6 cases ( 25.0% ) . complications developed in 4 cases , including amputation of the toe phalanx in two of them . the distribution according to treatment with antimicrobial therapy alone , using frequency analysis , was 27.8% for a favorable outcome ( 95% confidence interval [ ci ] , 9.7 to 53.59 ) and 25% for an unfavorable outcome ( 95% ci , 0.6 to 80.6 ) . for surgical therapy , rates were 11.1% ( 95% ci , 1.4 to 34.7 ) and 0% ( 95% ci , 0.0 to 60.2 ) ; finally , for combined therapy 61.1% ( 95% ci , 35.7 to 82.7 ) and 75% ( 95% ci , 19.4 to 99.4 ) , respectively . no statistical differences in outcomes were found between antimicrobial , surgery , or combined therapy ( p = 0.53 , fisher exact test ) . these patients were initially managed with antibiotics in 34 cases ( 91.9% ) ; 30 cases ( 81.1% ) also required surgery , while the remaining 2 patients were treated with surgery alone . antimicrobial therapy was administered for a minimum of 4 weeks in 21 cases ( 61.8% ) . a combination of antibiotics was used in 19 cases ( 55.9% ) , with ciprofloxacin the antibiotic most frequently used in these combinations ( 10 cases , 52.6% ) . monotherapy was used in 14 cases ( 41.2% ) and amoxicillin / clavulanic acid , cloxacillin , or ciprofloxacin were used in 9 cases ( 26.5% ) . complications were reported in 13 cases ( 35.1% ) , and amputation was performed in 7 cases ( 18.9% ) . the frequency distribution according to treatment , using frequency analysis , was 6.7% for antimicrobial therapy alone in patients who had a favorable outcome ( 95% ci , 0.2 to 31.9 ) and 7.7% in patients with an unfavorable outcome ( 95% ci , 0.2 to 36.0 ) . for surgical therapy , rates were 13.3% ( 95% ci , 1.7 to 40.5 ) and 7.7% ( 95% ci , 0.2 to 36.0 ) . for combined treatment , they were 80.01% ( 95% ci , 51.9 to 95.7 ) and 84.6% ( 95% ci , 54.6 to 98.1 ) , respectively . there were no statistical differences in outcome between antimicrobial , surgical , or combined therapy ( p = 0.50 , fisher exact test ) . twenty - four patients ( 92.31% ) were initially managed with antibiotics , and 14 of these cases ( 53.84% ) were treated with surgery as well . every other case was treated with surgery alone . among patients who received medical treatment , antibiotics were given over a minimum of 4 weeks in 13 cases ( 54.17% ) . a combination of antibiotics was administered in 14 cases ( 58.33% ) , whereas monotherapy was used in 9 cases ( 37.5% ) . ciprofloxacin was given in combination with other antibiotics in 7 cases ( 50% ) and amoxicillin / clavulanic acid , cloxacillin , or ciprofloxacin was used as a single - agent antimicrobial in 6 cases ( 25.0% ) . complications developed in 4 cases , including amputation of the toe phalanx in two of them . the distribution according to treatment with antimicrobial therapy alone , using frequency analysis , was 27.8% for a favorable outcome ( 95% confidence interval [ ci ] , 9.7 to 53.59 ) and 25% for an unfavorable outcome ( 95% ci , 0.6 to 80.6 ) . for surgical therapy , rates were 11.1% ( 95% ci , 1.4 to 34.7 ) and 0% ( 95% ci , 0.0 to 60.2 ) ; finally , for combined therapy 61.1% ( 95% ci , 35.7 to 82.7 ) and 75% ( 95% ci , 19.4 to 99.4 ) , respectively . no statistical differences in outcomes were found between antimicrobial , surgery , or combined therapy ( p = 0.53 , fisher exact test ) . these patients were initially managed with antibiotics in 34 cases ( 91.9% ) ; 30 cases ( 81.1% ) also required surgery , while the remaining 2 patients were treated with surgery alone . antimicrobial therapy was administered for a minimum of 4 weeks in 21 cases ( 61.8% ) . a combination of antibiotics was used in 19 cases ( 55.9% ) , with ciprofloxacin the antibiotic most frequently used in these combinations ( 10 cases , 52.6% ) . monotherapy was used in 14 cases ( 41.2% ) and amoxicillin / clavulanic acid , cloxacillin , or ciprofloxacin were used in 9 cases ( 26.5% ) . complications were reported in 13 cases ( 35.1% ) , and amputation was performed in 7 cases ( 18.9% ) . the frequency distribution according to treatment , using frequency analysis , was 6.7% for antimicrobial therapy alone in patients who had a favorable outcome ( 95% ci , 0.2 to 31.9 ) and 7.7% in patients with an unfavorable outcome ( 95% ci , 0.2 to 36.0 ) . for surgical therapy , rates were 13.3% ( 95% ci , 1.7 to 40.5 ) and 7.7% ( 95% ci , 0.2 to 36.0 ) . for combined treatment , they were 80.01% ( 95% ci , 51.9 to 95.7 ) and 84.6% ( 95% ci , 54.6 to 98.1 ) , respectively . there were no statistical differences in outcome between antimicrobial , surgical , or combined therapy ( p = 0.50 , fisher exact test ) . traditionally , chronic om has been considered a condition that follows a hematogenous spread of microorganisms.19 ) in this series , as in recent reports , this category has been considerably substituted by posttrauma and device - related chronic om , as well as contiguous disease from diabetic foot infections and skin lesions.20 ) during childhood , hematogenous om is more commonly found than contiguous seeding , and it is characterized by an acute febrile illness in addition to pain and immobility of the affected limb.3,21,22 ) in this study , every patient under 18 years had hematogenous om ( 6 patients ) . in contrast , bacteremia in adults rarely results in om , and secondary spread from a contiguous focus of infection , such as from a surgical wound , is more common.9,21 ) in hematogenous om in childhood , shorter courses of parenteral antibiotics followed by oral therapy for several weeks obtain a good success rate ; provided that the organism is known and adherence with treatment is good , the clinical signs subside rapidly.1,2 ) there were no statistical differences in outcome regarding the metatarsus , found between antimicrobial , surgical , or combined therapy , probably because of the use of antibiotics with high activity against the causative microorganisms . however , the relatively low number of cases included must be considered as a possible cause of these results . the high proportion of patients with an unfavorable outcome following combined therapy ( 82.4% ) might be explained by this therapy since it was the treatment chosen in the majority of the studied cases ( 69.9% ) . treatment of acute om usually requires adequate debridement , drainage of pus , and prolonged courses of antimicrobial therapy . in the presence of acute infection there are no evidence - based guidelines to dictate whether hardware should be removed or retained . single - agent antimicrobial therapy is generally adequate for the treatment of om except for infections of prosthetic joints ( for which an antimicrobial combination including rifampicin is commonly used ) and chronic om . as a general principle , these antibiotics should be given for 4 - 6 weeks and , if possible , endovenously . where quinolones are used , an early switch to oral administration is appropriate.2 ) treatment requires isolation of the causative pathogen or pathogens as well as significant debridement for removal of all infective and necrotic material , both originating in the bone origin and in soft tissue.15,23 ) one of the reasons why results for chronic om were worse in this study could be the increased rate of positive polymicrobial cultures compared to acute om , and the elevated use of monotherapy . fifty - five patients ( 87.30% ) had previous history of trauma or skin infection , a significant risk factor for bone and joint infections caused by s. aureus . the seriousness of this risk factor is presumably because of the high frequency with which this bacteria causes skin and soft - tissue infections.21,22 ) amputation is an accepted form of treatment for some cases of om . in our series , 4 out of the 9 patients who required amputation ( 44.4% ) had vascular disease or diabetes mellitus . these factors become a substantial risk of failure for a single course of antimicrobial therapy in cases of om which are complicated by vascular disease or diabetes ; indeed , signs of recurrence in these patients may call for earlier amputation or for excision of infected bone.10,17 ) in our series , 5 patients were amputees of foot phalanxes ; surgery is more likely to be appropriate and cost - effective when infection involves a bone that is not essential to the foot 's architecture.24 ) limited limb - saving surgery and prolonged antibiotic therapy directed toward the definitive causative bacteria constitute a more appropriate approach for all other cases . this may decrease limb loss through amputations.10,23 )

backgroundto analyze the incidence and clinical - microbiological characteristics of osteomyelitis ( om ) in a tertiary spanish hospital.methodsall cases diagnosed with om between january 2007 and december 2010 were retrospectively reviewed . the variables examined include epidemiological characteristics , risk factors , affected bone , radiographic changes , histology , microbiological culture results , antibiotic treatment , and the need for surgery.resultssixty-three cases of om were diagnosed . twenty - six patients ( 41.3% ) had acute om whereas 37 patients ( 58.7% ) were classified as chronic om . om may result from haematogenous or contiguous microbial seeding . in this group , 49 patients ( 77.8% ) presented with om secondary to a contiguous source of infection and 14 patients had hematogenous om ( 22.2% ) . staphylococcus aureus was the most commonly found microorganism.conclusionsom mainly affected patients with risk factors related to the presence of vascular diseases . antibiotic treatment must be guided by susceptibility patterns of individual microorganisms , although it must be performed together with surgery in most of the cases .

the incidence of intracranial neoplasm in 25 - 34 years aged parturients is reported as 6.9/100,000 . a parturient with 8 months amenorrhea aged 25 years , weighing 50 kg , presented with complaints of headache , vomiting , restlessness and loss of appetite of 2 month duration . obstetric examination and ultrasound revealed a single live fetus of 33 weeks gestation . neurological examination and brain magnetic resonance imaging revealed a mass lesion of 5.4 cm 2.74 cm 3.75 cm in size over the left temporo - parietal region suggestive of high grade glioma with dense perilesional edema [ figure 1 ] . mri brain showing left temporo parietal glioma the patient was started on conservative therapy by the neurosurgeons with injection phenytoin , levicitram , mannitol , lasix and dexamethasone to enable her to carry her pregnancy to term . however , at 36 weeks gestation , she started to develop blurring of vision and drowsiness with marked irritability and had a glasgow coma scale ( gcs ) score of 11/15 . neurological examination revealed rising intracranial pressures ( icp ) with possibility of optic nerve compression . after due deliberations with the neurosurgeons and obstetricians , it was decided to take her up for an immediate cesarean section followed by craniotomy in the same sitting . routine pre - operative preparation was performed and acid aspiration prophylaxis accomplished with intravenous injection ranitidine 50 mg and injection metoclopramide 10 mg . in the operation theatre , standard monitors were applied , table tilt given and pre - oxygenation carried out . narcotics were omitted . rapid sequence induction was carried out with injection thiopentone sodium 300 mg and injection rocuronium 50 mg injection lignocaine 80 mg was administered for blunting the stress response . endotracheal intubation was achieved with 7.0 mm cuffed flexometallic tube with soft atraumatic silicone tip . there was minimal post - intubation response with post - intubation vitals of 74/min and 130/77 mm hg . end tidal carbon dioxide ( etco2 ) was maintained around 30 - 32 mm hg . an intra - arterial catheter was placed in the left radial artery and central venous catheter in the right subclavian vein post - induction . intraoperative vitals were normal . a healthy baby with an apgar score of 9 , 9 , 8 at 1 , 5 and 10 min was delivered . thereafter , injection fentanyl 100 g and midazolam 1 mg was administered . at this time , uterus was found to be relaxed resulting in excessive bleeding . isoflurane was stopped and propofol infusion started 100 g / kg / min to control the depth of anesthesia . after the cesarean section , anesthesia was continued with injection morphine , propofol infusion and top ups of rocuronium . estimated time for tumor excision was 4 - 6 h , neurosurgeons did nt want to assess the patient soon after surgery and elective ventilation for 24 - 36 h post - operatively was planned so morphine was used . intra - operatively injection mannitol , dexamethasone , lasix , phenytoin were given as cerebroprotective measures . total surgery lasted 8 h with estimated blood loss of 2200 ml which was adequately replaced . after surgery , patient was electively ventilated in intensive care unit to reduce the icp and was reversed and extubated after 36 h. her gcs score at this time was 15/15 and she had no neurological deficit . the management of such a case requires multidisciplinary approach and needs to be individualized according to various factors , of which , neurological status of the mother and gestational age of fetus are most important . for such a case , the clinical goals of neuro and obstetric anesthesia needed to be modified . aspiration prophylaxis , pre - oxygenation , hemodynamic stability and vigilant monitoring are desirable in both . table 1 outlines the contrasting anesthetic considerations for obstetric and neuroanesthesia . contrasting anesthetic considerations for obstetric anesthesia and neuroanesthesia traditionally , spinal anesthesia is the preferred technique of choice for a cesarean section , but in our patient general anesthesia was indicated since she had raised icp and needed to undergo both surgeries in the same sitting . opioids were omitted as neonatal respiratory depression , apnea and chest wall rigidity are known . nitroglycerine causes cerebral vasodilatation and rise in icp ; esmolol causes fetal bradycardia so are better avoided . lignocaine hydrochloride pre - medication , liberal dose of thiopentone sodium , endotracheal tube with soft atraumatic silicone tip were used to blunt the rise in icp during laryngoscopy and intubation . it has no adverse maternal and fetal effects and is a preferred relaxant for craniotomy . furthermore , our patient had been receiving cerebroprotective measures since admission therefore no cardiovascular stress response was seen . an et co2 between 25 and 30 mm hg is advocated by some authors . keeping fetal safety in mind we initially maintained et co2 around 32 mm hg which was later reduced to 30 mm hg after delivery of baby . postpartum hemorrhage ( pph ) from uterine atony is a known risk under general anesthesia as was seen in our case . syntocinon is the drug of choice for pph and has been safely used in patients with space occupying lesion . manual methods such as uterine massage and intra - myometrial prostaglandin can also be used in such cases . uterine stimulant methyl ergotamine , being a potent venoconstrictor causes rise in blood pressure and icp . methyl ergotamine should be used only after consultation with neurosurgeons and was thus avoided in this case . pph is an immediate life threatening complication so intra - myometrial prostaglandin ( carboprost ) was administered by the obstetrician along with syntocinon in our patient . . similar switch over to an intravenous technique for caesarean delivery has been reported by other workers . we followed a balanced approach and were able to provide smooth hemodynamics and uneventful anesthesia with favorable maternal and fetal outcome .

the anesthetic management of a parturient with an intracranial tumor can be quite challenging for the anesthetist as it requires a fine balance of both maternal and fetal safety . the literature pertaining to anesthetic management of such cases is limited . we describe the anesthetic management and peri - operative concerns of this unusual case of a parturient aged 25 years with 8 months amenorrhea and a high grade glioma in the left temporo - parietal region who underwent cesarean section under general anesthesia immediately followed by craniotomy . anesthetic management was tailored keeping in mind maternal safety and fetal considerations .

production of acute inflammatory cytokines by cells of the innate immune system , including macrophages and mast cells , plays an essential role in inflammation - driven tumor development . cytokines such as tnf , interleukin ( il)-6 , and il-1 have myriad effects in the tumor microenvironment , promoting cell growth and survival as well as angiogenesis and the recruitment of immune effector cells ( 2 ) . which cytokines are required for tumor development depends largely on the model being examined . tnf plays an essential role in several models of cancer , and is a critical inflammatory mediator in many autoimmune diseases of both mice and humans , primarily acting via induction of nf-b ( 2 ) . il-6 acts both as a mitogen and an angiogenic factor and has been implicated in many of the same processes as tnf . il-6 plays an important role in carcinogen - driven liver cancer , and has recently been identified as an important driving factor in non smoking - related lung cancer in humans ( 810 ) . il-1 can activate nf-b in a manner similar to tnf , and polymorphisms in il-1 have been linked to gastric cancer ( 11 ) . not surprisingly , tumor - promoting inflammation can be induced by the same pathways that respond to microbial infections , suggesting that tumors may be aberrant consequences of initially physiological immune responses . recent work has positioned myeloid differentiation factor 88 ( myd88 ) , which is a critical downstream signaling molecule for both the toll - like receptor ( tlr ) family of microbial pattern recognition receptors and the il-1 and -18 receptors ( il-1r and -18r ) , as a central player in inflammation - driven tumorigenesis . in the diethylnitrosamine model of liver cancer , myd88-dependent myd88-deficient mice treated with the topical carcinogen 7,12-dimethylbenz[a]anthracene ( dmba ) , followed by treatment with the proinflammatory phorbol - ester tpa , developed fewer epithelial tumors than did wild - type mice ( 13 ) . surprisingly , 3-methylcholanthrene ( mca)induced sarcomas were also reduced in myd88-deficient mice , despite the lack of an obvious role for inflammation in this model ( 13 ) . myd88-dependent signaling is also required in some genetic tumor models . in the apc model of human fap , myd88 deficiency was associated with decreased inflammatory cytokine production within the tumor microenvironment ( 14 ) . this reduction correlated with a decrease in both the number and size of spontaneously arising polyps . although these findings bring us one step closer to understanding the nature of the signals driving tumor - promoting inflammation , the factors responsible for engaging myd88-dependent pathways are still obscure . tlrs can recognize a wide range of highly conserved microbial products , potentially implicating occult infections or normal flora in tumor - associated inflammation . myd88 may also facilitate so - called sterile inflammation , either through tlr - dependent recognition of endogenous adjuvants or through il-1r signaling . il-1r signaling is important for the initiation of neutrophil infiltration in response to necrotic cells ( 15 ) , and it may also have important tumor - intrinsic effects . il-1 was recently shown to be required for mca - induced tumor formation , suggesting that , in this system , myd88 may function through the il-1r ( 16 ) . consistent with the importance of sterile inflammation in tumor promotion , the findings of gebhart et al . ( 7 ) in this issue implicate endogenous proteins released during cell necrosis in inciting carcinogenic inflammation . rage activation can occur through the recognition of at least three self - proteins released from cells during necrosis : the dna - binding protein hmgb1 and the two calcium - binding cytokines s100a8 and s100a9 . intriguingly , rage - dependent recognition of hmgb1 has been shown to act in a costimulatory capacity for tlr - mediated responses to dna , potentially providing a link between rage and myd88 ( 17 ) . failure of normal antiinflammatory mechanisms is thus an essential feature of tumor - promoting inflammation . although in many cases , such as infection or autoimmunity , the mechanisms that prevent the resolution of inflammation are still unclear , genetic defects in key regulatory proteins can enhance tumor formation . loss of tir8 , which is a negative regulator of il-1r / tlr signaling , exacerbates inflammation in the dextran sulfate sodium model of colitis , leading to a substantially increased risk of colon cancer ( 1819 ) . similarly , loss of il-1 receptor antagonist , a secreted protein that blocks il-1 function , accelerates tumor onset and increases tumor aggressiveness in the dmba / tpa model ( 16 ) . infusion of regulatory t ( t reg ) cell depleted t cells into apc mice increases polyp formation and leads to the development of spontaneous mammary tumors ( 20 ) . one of the more intriguing elements of rage - dependent inflammation is the ability of rage to up - regulate its own ligands . ( 7 ) demonstrate that rage signaling in the dmba / tpa model induces s100a8 and s100a9 synthesis in epithelial cells , likely leading to a feed - forward loop that further aggravates the inflammatory environment . regulatory circuits limiting rage - mediated inflammation undoubtedly exist , but these as yet uncharacterized pathways are clearly not sufficient to prevent tumor onset in the time frame of these experiments . interestingly , the requirement for rage can be bypassed by more frequent application of tpa , suggesting that other , more rapidly self - limiting inflammatory pathways can substitute for rage if the inflammation - inciting agent is allowed to persist . in contrast to the tumor - promoting effects of chronic inflammation , increasing evidence suggests that adaptive immunity is responsible for recognizing and rejecting malignant cells ( for review see reference 21 ) . the protective effect of adaptive immunity is most obvious in the case of tumors with viral etiologies , but immunodeficiencies in both mice and humans have also been associated with an increased incidence of many tumors without a clear viral etiology ( 21 ) . consistent with a role for adaptive immunity in regulating tumor growth , spontaneous lymphocytic infiltrates can be observed in a variety of different human cancers and , in some , these infiltrates correlate with a favorable prognosis ( 2122 ) . once a tumor is established , immunosuppression is a common feature of the microenvironment , with most tumors infiltrated by immunosuppressive myeloid and lymphoid cells ( 21 ) . the expression of antiinflammatory factors is also common in tumors , suggesting that overcoming an antitumor immune response is an important step in tumorigenesis . the mechanism by which adaptive immune cells can control tumor growth has been studied extensively using the mca tumor model . in this system , mice with defects in t cell immunity exhibit an increased incidence of tumor formation after mca application , and the tumors that arise in these mice are more easily rejected when transferred into immunocompetent animals than are similar tumors that arise in wild - type mice ( 21 ) . these findings provide the most direct evidence to date that the immune system can restrict tumor formation . recent evidence also indicates that many immunocompetent animals treated with mca harbor occult tumors that are kept in check by continuous immune surveillance ( 23 ) . although direct evidence for spontaneous , immune - mediated tumor control in humans is lacking , rare cases of tumor recurrence decades after the disappearance of the primary tumors suggest that similar mechanisms may be in play in humans as well ( 21 ) . in most models used to study tumor - promoting inflammation , cytokines produced by cells of the innate immune system play an indispensable role . protective antitumor effects , in contrast , derive largely from adaptive immune cells , particularly t cells . yet , dividing the immune response to cancer into this innate - adaptive dichotomy is too simplistic . inflammatory cytokines can restrict the growth of certain tumors , and adaptive immunity can drive tumor - promoting inflammation in chronic infections and in autoimmunity . recent work has started to explain the dual role for adaptive immune cells in tumor development . overexpression of the cytokine il-23 , for example , is highly correlated with an increased risk of tumor development ( 24 ) . il-23 expands a subset of cd4 t cells that secrete the proinflammatory cytokine il-17 , which promotes angiogenesis , as well as the production of a range of other inflammatory factors from epithelial cells ( for review see reference 25 ) . at the same time , however , il-23 expression in the tumor microenvironment reduces cytotoxic t cell infiltrates , potentially blocking antitumor immunity ( 24 ) . il-17secreting t cells are found in many chronic inflammatory diseases , and may provide an important link between chronic inflammation and cancer ( 25 ) . ultimately , the consequences of the interaction between the immune system and tumors will likely depend on the context in which the immune system is engaged . feed - forward signals such as those initiated by rage lead to uncontrolled , chronic immune activation . in this setting , any potentially protective effect from the immune system is overwhelmed by tumor - promoting inflammation ( fig . we can hope to circumvent these responses , thus opening the door to novel approaches to cancer treatment and prevention . signals through innate immune receptors such as rage maintain chronic inflammation in the tumor microenvironment . chronic inflammatory responses can be initiated by microbial or endogenous tlr ligands , or by rage ligands ( s100a8 , s100a9 , and hmgb1 ) released from necrotic cells . these signals drive the expression of nf-b activating cytokines , such as tnf , il-1 , and il-6 , which act as growth factors for the tumor . il-17 produced by cd4 t cells may also promote angiogenesis . at the same time , the tumor microenvironment disables potentially protective immune responses mediated by ifn-secreting cd4 and cd8 t cells .

mechanisms of innate and adaptive immunity play a pivotal role in the development of cancer . chronic inflammation can drive tumor development , but antitumor immunity can also restrict or even prevent tumor growth . new data show that feed - forward signals downstream of the receptor for advanced glycation end - products ( rage ) can fuel chronic inflammation , creating a microenvironment that is ideal for tumor formation .

although the incidence of vvd is below 1% in overall hysterectomies , recent data have indicated that the incidence may be as high as 4% after conventional laparoscopic and robotic laparoscopic surgery [ 2 , 3 ] . patient characteristics like smoking , diabetes , chronic lung disease increasing intra - abdominal pressure by coughing and constipation , malignity , vaginal atrophy , advanced age , chronic steroid therapy , postoperative radiation therapy and additional risk factors like early sexual intercourse , postoperative cuff infection and hematoma are associated with vvd [ 4 , 5 ] . here , a case of vvd associated with intra - abdominal hematoma after postpartum hysterectomy repaired by vaginal suturing technique g8 p2 a5 , 39 weeks of gestation was referred to obstetric clinic of adnan menderes university , school of medicine with complaint of vaginal bleeding . placenta could not be removed completely as it invaded in right - posterior wall of lower segment of uterus . the estimated blood loss was over 2 l. she was administered 4 u of packed cells , fresh frozen plasma , and she was observed on the intensive care unit in the postoperative period for two days . postoperative recovery was uneventful , and she was discharged 5 days after the operation . on day 21 , she applied to emergency clinic by heavy vaginal bleeding and watery discharge . an intra - abdominal hematoma of approximately 16 10 9 cm in diameter was observed in ultrasonography and mri . in pelvic examination , intra - abdominal hematoma was located between these dense adhesions of bowel , on vaginal vault which could be hardly evaluated . it was impossible to explore vaginal vault by abdominal surgery because of the dense adhesions . although rare , vvd can represent an extremely rare serious postoperative complication of hysterectomy and may cause morbidity for patients . although it is more commonly seen in laparoscopic and robotic hysterectomy , it can be also seen in abdominal and vaginal route as in the current case . it is mostly seen in three months after hysterectomy , occurring earlier in endoscopic route . interestingly , it occurred on day 21 of operation in our case and risk factors are blamed for early development of vvd . nick et al . conducted a study to determine the vaginal cuff separation and associated risk factors in patients undergoing laparoscopic and robotic hysterectomy . they reported that , sexual intercourse in 848% and defecation or valsalva testing ( cough or sneeze ) in 1630% of cases as the precipitating event . however , spontaneous vaginal cuff dehiscence was reported to represent up to 70% of the cases . increased age , increased number of vaginal surgeries , vaginal atrophy , factors that are associated with poor wound healing ( including malignancy , chronic steroid use , malnutrition , tissue radiation ) , and postoperative vaginal cuff infection or hematoma may be other risk factors . in the current case , postoperative hematoma was main risk factor . in addition , our patient was a heavy smoker and had chronic cough due to it . moreover , technique of colpotomy at hysterectomy has been associated with cuff breakdown . in laparoscopic surgery , vaginal tissue damage attributable to monopolar energy used in colpotomy and bipolar cauterization for hemostasis is blamed . it was speculated that the cauterization with consequent cell necrosis and tissue damage associated with the use of monopolar knife could have a negative effect on the healing of the vaginal cuff . so , monopolar energy modality with low voltage causing minimal tissue damage is advised for reducing vvd . in this patient , cold knife colpotomy was performed as used in most abdominal and vaginal hysterectomies . in the present case , it is more likely that a vvd occur secondary to an underlying factor such as a hematoma or a primary healing defect as a result of excessive coagulation . therefore , as soon as the suture loses most of its tensile strength , a ( partial ) separation of the vaginal cuff occurs . this hypothesis is supported association of intra - abdominal hematoma and vvd , as we found in the present case . hematoma increases the intra - abdominal pressure by its mechanical effect , and also causes pressure necrosis on tissue . best comment for vvd is to prevent its occurrence . besides all known risk factors about it all precautions should be taken to prevent complications especially hematoma . in conclusion , we advice to drain intra - abdominal hematoma as early as possible as it seems to be a major risk factor for vaginal cuff dehiscence .

vaginal vault dehiscence ( vvd ) may occur rarely after hysterectomy . although mostly , a vaginal cuff dehiscence is seen after robotic or laparoscopic hysterectomy , it may also be observed as a complication of abdominal or vaginal hysterectomy . vaginal repair is one of the techniques used for vvd . here , we will describe a case of vaginally repaired vvd , associated with intra - abdominal hematoma after postpartum hysterectomy .

ca 72 - 4 is a glycoprotein found on the surface of tumor cells , with a weight of 200420 kda . the tumor spectrum in which it is grown includes , besides gastric cancer , pancreatic , ovarian , breast and colorectal tumors . normal value ( depending on the laboratory technique ) : < 6.9 u / ml . the overall sensitivity of this test is estimated to be of 40% in gastric cancer ( as in colorectal cancer ; it is of 50% in ovarian cancer ) , with an overall specificity of 95% . this marker is assayed in peripheral blood , but there are studies that compared serum levels to peritoneal lavage fluid levels . it appears that the surge in serum levels best correlates with the stage of lymph node involvement ( n category ) , whereas peritoneal fluid levels correlate with the n stage and t stage as well ( serum involvement ) , characterizing more accurately the advanced locoregional stage of the gastric tumor , as well as prognosis . other studies outlined the role of ca 72 - 4 in the selection of operable patients , the correlation between serum levels and tumor resectability being statistically significant . chen s meta - analysis , which included 33 published studies , found an overall accuracy of 77% for ca 72 - 4 , much higher than the accuracy of the other markers under scrutiny . cea is a glycoprotein attached to the surface of enterocytes , with a weight of 200 kda and a role in programmed cell death and cell adhesion . normal values are of <3 ng / ml in nonsmokers or of < 5 ng / ml in smokers . its half - life is , on average , 3 days , which makes it possible to repeat the marker every 7 days . high pre - therapeutic levels of cea are correlated with the stage of the disease , especially in patients with peritoneal serous carcinoma . like for ca 72 - 4 , the sensitivity of cea was studied both in peripheral blood and in peritoneal fluid . in mandorwski s study , ca 72 - 4 is the most sensitive marker in the serum , whereas in the peritoneal fluid the marker that correlates best with the stage of the disease ( especially in the case of peritoneal serous carcinoma ) is cea . in some studies , the cut - off value for cea in the peritoneal lavage fluid was of 100 ng / ml . xiao s meta - analysis proved that high cea levels in the peritoneal fluid statistically correlate significantly better with the diagnosis of peritoneal recurrence of gastric cancer than standard cytology . some of the studies proved that the correlation between cea and locoregional relapse is statistically significant , being a predictive factor in gastric cancer . in the case of liver metastasis relapse , the cea level may increase approximately 3 months prior to the radiological confirmation of the disease . normal pre - therapeutic levels can be a positive predictive factor correlated with better survival , in particular in patients receiving perioperative chemotherapy . normal postoperative levels for a period that does not exceed 2 months also correlate with a better overall survival . an interesting clinical particularity consists in the occurrence of gastric cancer in young patients aged between 18 and 30 years old , for whom the secretion of cea by the tumor is statistically significant far more often , serum levels are much higher this being a predictive factor for overall survival measuring the level of ca 19 - 9 in peritoneal fluid appears to have higher accuracy in terms of preoperative predictability of the stage of the disease . at the end of the surgical treatment , it statistically correlated with lymph node involvement , but did not contribute as much as cea in the identification of operable patients . in the monitoring of patients with gastric cancer , the regular assessment of ca 19 - 9 serum levels confirms relapse approximately 2 months earlier than the radiological method . ca 19 - 9 appears to be an independent predictive factor in the case of metastatic or recurrent patients and possibly for those undergoing curative surgery as well . bagaria assessed these markers in different tumor sites : esophagus , stomach , and colon . in gastric cancer , the sensitivity of cea is of approximately 30% , with a negative predictive value ( npv ) of 58.82% , by comparison with colorectal cancer , in which its sensitivity is of 74% and the npv of 79.36% . the sensitivity of ca 19 - 9 in gastric cancer is higher than that of cea , being of 42% , with a npv of 63.29% . by contrast , in colorectal cancer , ca 19 - 9 is less effective , its sensitivity being of only 26% , with an npv of 57.47% . if cases are assessed by associating the two markers , sensitivity increases to 58% , with an npv value of 70.42% . cea appears to be the marker to be preferred in colorectal cancer , whereas ca 19 - 9 seems to be more sensitive in gastric cancer . ishigami s study compared cea to ca 19 - 9 in preoperative assessment . by considering the cut - off value of the statistical analysis to be twice the normal value ( 10 ng / ml for cea and 74 u / ml for ca 19 - 9 ) , cea was found to be more valuable in making a prognosis concerning the success of the surgical curative resection , lymph node involvement and the t stage in these patients . in these patients , surges in both markers contribute to a much better assessment of the positivity of their metastatic status . a more recent study identified a predictive role of the pre - therapeutic values of cea and ca 19 - 9 , which were correlated with the tnm stage , lymph node invasion and the t category . neoadjuvant chemotherapy reduces the amount of cea and ca 19 - 9 secreted by the primitive tumor , quantified by immunohistochemical staining with unclear significance . as far as perioperative assessment is concerned , a korean study on patients who underwent curative surgery showed that cea appears to be the marker with the highest sensitivity both in early gastric cancer and in more advanced stages of the disease : 40% and 100% respectively , by comparison with ca 19 - 9 ( 5.6% and 68.2% ) and ca 72 - 4 ( 2.8% and 51.3% ) . the postoperative level of cea is a predictive factor for recurrence . in other studies , ca 72 - 4 is credited with an accuracy of 77% , higher than for other tumor markers . the use of tests for all the enumerated markers increases sensitivity to 74% without however increasing specificity . a japanese meta - analysis has studied the role of tumor markers in gastric cancer . over 4900 articles were selected from the available publications . out of these articles , only 187 had references to cea and ca 19 - 9 and only 19 to all three markers . the overall true positive rate was of 21% for cea , of 27.8% for ca 19 - 9 and of 30% for ca 72 - 4 . available data suggest a statistically significant correlation between serum level on the one hand and tumor stage and survival on the other hand . monitoring patients using tumor markers allows the early diagnosis of metastases or of relapse , despite the fact that the esmo guidelines underline that early diagnosis does not improve survival . the data concerning 1500 patients with gastric cancer who underwent radical surgical procedures revealed the fact that a significant statistical correlation existed between cea and the risk of lymph node involvement , whereas ca 19 - 9 and ca 72 - 4 were negative predictive factors for the overall survival in the n1n2 stages ( up to 6 invaded lymph nodes ) . in metastatic patients with lesions that are undetectable through ct , the assessment of the effectiveness of oncologic treatment and , implicitly , the therapeutic decision , can be made based on the evolution of the tumor markers , with a positive statistically significant effect on overall survival . the detection of high levels in the peritoneal fluid can mean that the case is inoperable or that there is a risk of tumor residue after resection ( r1 ) . this is very useful in primary assessment or at the end of neoadjuvant chemotherapy , the risk of an early relapse at peritoneal level being high in this category of patients . an increase of the marker after one cycle or during inter - treatment can not be automatically labeled as tumor progression the increase may also be triggered by tumor destruction , as proven in kim s study , this depends on the pharmacokinetics of the markers . for cea , it may take 2.8 weeks to reach the peak and it may last 9.1 weeks in total . for ca 19 - 9 , high cea and ca 19 - 9 values at the end of adjuvant chemotherapy may suggest a high risk of early relapse . there are studies which compared the sensitivity and specificity of the markers used in gastric cancer in the follow - up period . among them , ca 72 - 4 appears to have the highest sensitivity and specificity ( se= 50% , sp=100% ) , by comparison with cea ( se= 16% , sp=100% ) and ca 19 - 9 ( se= 33,3% , sp= 93,3% ) . some authors consider cea to be of greater interest , to the detriment of ca 72 - 4 . the cut - off values for cea and ca 19 - 9 during follow - up seem to be 5 ng / ml and 100 ui / ml respectively . bagaria assessed these markers in different tumor sites : esophagus , stomach , and colon . in gastric cancer , the sensitivity of cea is of approximately 30% , with a negative predictive value ( npv ) of 58.82% , by comparison with colorectal cancer , in which its sensitivity is of 74% and the npv of 79.36% . the sensitivity of ca 19 - 9 in gastric cancer is higher than that of cea , being of 42% , with a npv of 63.29% . by contrast , in colorectal cancer , ca 19 - 9 is less effective , its sensitivity being of only 26% , with an npv of 57.47% . if cases are assessed by associating the two markers , sensitivity increases to 58% , with an npv value of 70.42% . cea appears to be the marker to be preferred in colorectal cancer , whereas ca 19 - 9 seems to be more sensitive in gastric cancer . ishigami s study compared cea to ca 19 - 9 in preoperative assessment . by considering the cut - off value of the statistical analysis to be twice the normal value ( 10 ng / ml for cea and 74 u / ml for ca 19 - 9 ) , cea was found to be more valuable in making a prognosis concerning the success of the surgical curative resection , lymph node involvement and the t stage in these patients . in these patients , surges in both markers contribute to a much better assessment of the positivity of their metastatic status . a more recent study identified a predictive role of the pre - therapeutic values of cea and ca 19 - 9 , which were correlated with the tnm stage , lymph node invasion and the t category . neoadjuvant chemotherapy reduces the amount of cea and ca 19 - 9 secreted by the primitive tumor , quantified by immunohistochemical staining with unclear significance . as far as perioperative assessment is concerned , a korean study on patients who underwent curative surgery showed that cea appears to be the marker with the highest sensitivity both in early gastric cancer and in more advanced stages of the disease : 40% and 100% respectively , by comparison with ca 19 - 9 ( 5.6% and 68.2% ) and ca 72 - 4 ( 2.8% and 51.3% ) . the postoperative level of cea is a predictive factor for recurrence . in other studies , ca 72 - 4 is credited with an accuracy of 77% , higher than for other tumor markers . the use of tests for all the enumerated markers increases sensitivity to 74% without however increasing specificity . a japanese meta - analysis has studied the role of tumor markers in gastric cancer . over 4900 articles were selected from the available publications . out of these articles , only 187 had references to cea and ca 19 - 9 and only 19 to all three markers . the overall true positive rate was of 21% for cea , of 27.8% for ca 19 - 9 and of 30% for ca 72 - 4 . available data suggest a statistically significant correlation between serum level on the one hand and tumor stage and survival on the other hand . monitoring patients using tumor markers allows the early diagnosis of metastases or of relapse , despite the fact that the esmo guidelines underline that early diagnosis does not improve survival . the data concerning 1500 patients with gastric cancer who underwent radical surgical procedures revealed the fact that a significant statistical correlation existed between cea and the risk of lymph node involvement , whereas ca 19 - 9 and ca 72 - 4 were negative predictive factors for the overall survival in the n1n2 stages ( up to 6 invaded lymph nodes ) . in metastatic patients with lesions that are undetectable through ct , the assessment of the effectiveness of oncologic treatment and , implicitly , the therapeutic decision , can be made based on the evolution of the tumor markers , with a positive statistically significant effect on overall survival . the detection of high levels in the peritoneal fluid can mean that the case is inoperable or that there is a risk of tumor residue after resection ( r1 ) . this is very useful in primary assessment or at the end of neoadjuvant chemotherapy , the risk of an early relapse at peritoneal level being high in this category of patients . an increase of the marker after one cycle or during inter - treatment can not be automatically labeled as tumor progression the increase may also be triggered by tumor destruction , as proven in kim s study , this depends on the pharmacokinetics of the markers . for cea , it may take 2.8 weeks to reach the peak and it may last 9.1 weeks in total . for ca 19 - 9 , high cea and ca 19 - 9 values at the end of adjuvant chemotherapy may suggest a high risk of early relapse . there are studies which compared the sensitivity and specificity of the markers used in gastric cancer in the follow - up period . among them , ca 72 - 4 appears to have the highest sensitivity and specificity ( se= 50% , sp=100% ) , by comparison with cea ( se= 16% , sp=100% ) and ca 19 - 9 ( se= 33,3% , sp= 93,3% ) . some authors consider cea to be of greater interest , to the detriment of ca 72 - 4 . the cut - off values for cea and ca 19 - 9 during follow - up seem to be 5 ng / ml and 100 ui / ml respectively . the usefulness of tumor markers , as well as their indications , is currently under debate . they may play a role in the selection of the patients who benefit the most from their use during follow - up or in the assessment of treatment in case of relapse or metastasis . current data are mostly provided by retrospective studies which included a small number of patients and which do not allow us to draw clear - cut conclusions , for now .

the progress made in the last few years made available a large amount of information that needs to be integrated and ordered by oncologists . tumor markers are one of the pieces that physicians need to fit into the bigger puzzle . this article will detail the most frequent etiologies for the surges in the carcinoembryonic antigen ( cea ) , cancer - related antigen 72 - 4 ( ca 72 - 4 ) , cancer - related antigen 19 - 9 ( ca 19 - 9 ) serum levels and their indications.although tumor markers are an invaluable asset to medical practice , their role in screening , diagnosis and oncologic treatment remains poorly standardized . ongoing or future clinical trials will shed light on pending problems .

this is a retrospective study of consecutive patients with saccular unruptured ias in the anterior circulation that were treated with the ped ( covidien vascular therapies , mansfield , ma , usa ) from september 2008 to december 2011 . 26 of the patients had been included in a previous study that reported on 178 ias treated at seven neurosurgical centers in this locality . this earlier report , however , did not include risk factor analysis for treatment failure , which would be the focus of the present study . patients received oral clopidogrel ( 75 mg / day ) and aspirin ( 100 mg / day ) for three days before ped placement . clopidogrel and aspirin were continued after surgery for at least three and six months , respectively . adjuvant coiling and additional ped placement were used at the discretion of the interventionists when there was significant persistent contrast - filling within the aneurysm sac . follow - up imaging studies with computerized tomography angiography ( cta ) , magnetic resonance angiography ( mra ) or digital subtraction angiogram ( dsa ) were performed at 6- and 18-months . successful flow diverter treatment was defined as total exclusion of the aneurysm from the circulation with no residual neck on angiogram . secondary outcome measures included periprocedural complications , such as ischemic infarction , transient ischemic attack ( tia ) , intracerebral hemorrhage ( ich ) as well as stent migration or thrombosis . we analyzed the following potential predictors for treatment failure : gender , ia location , size ( the largest dome diameter ) , height , aspect ratio ( the ratio of aneurysm height to neck width ) , wideneck lesions ( defined as neck width > 4 mm ) , prior endovascular treatment , and the number of ped used . these variables were studied using binary logistic regression against ia occlusion with spss software ( version 20 , ibm , new york , usa ) . this is a retrospective study of consecutive patients with saccular unruptured ias in the anterior circulation that were treated with the ped ( covidien vascular therapies , mansfield , ma , usa ) from september 2008 to december 2011 . 26 of the patients had been included in a previous study that reported on 178 ias treated at seven neurosurgical centers in this locality . this earlier report , however , did not include risk factor analysis for treatment failure , which would be the focus of the present study . patients received oral clopidogrel ( 75 mg / day ) and aspirin ( 100 mg / day ) for three days before ped placement . clopidogrel and aspirin were continued after surgery for at least three and six months , respectively . adjuvant coiling and additional ped placement were used at the discretion of the interventionists when there was significant persistent contrast - filling within the aneurysm sac . follow - up imaging studies with computerized tomography angiography ( cta ) , magnetic resonance angiography ( mra ) or digital subtraction angiogram ( dsa ) were performed at 6- and 18-months . successful flow diverter treatment was defined as total exclusion of the aneurysm from the circulation with no residual neck on angiogram . secondary outcome measures included periprocedural complications , such as ischemic infarction , transient ischemic attack ( tia ) , intracerebral hemorrhage ( ich ) as well as stent migration or thrombosis . we analyzed the following potential predictors for treatment failure : gender , ia location , size ( the largest dome diameter ) , height , aspect ratio ( the ratio of aneurysm height to neck width ) , wideneck lesions ( defined as neck width > 4 mm ) , prior endovascular treatment , and the number of ped used . these variables were studied using binary logistic regression against ia occlusion with spss software ( version 20 , ibm , new york , usa ) . table 1 shows their characteristics . there were 23 small and six large ias , with a mean size of 6.99 mm ( range : 2.1 to 22 mm ) . wide - neck ias accounted for 48.2% ( n=14 ) , and 55.1% ( n=16 ) of the ias had an aspect ratio of less than 1.5 . four ias arose from the fetal - type posterior communicating artery ( pcoma ) origin , three from other segments of the supraclinoid internal carotid artery ( ica ) , five from the cavernous ica and 17 from the paraclinoid ica . one ia had previous stent - assisted coiling , while three others received previous coiling only . out of 29 aneurysms , six did not occlude , yielding an overall occlusion rate of 79.3% ( n=23 ) . these included all four ias that were arising at the pcoma origin with persistent fetal - type circulations . curve reformation angiography showed that the residual aneurysm necks in these lesions were all incorporating a portion of the fetal - type pcoma after ped placement . the mean follow - up duration was 270 days ( range : 150 to 800 ) . lower occlusion rates were found with wide - neck lesions ( 64.2% ) , ias with aspect ratios of 1.5 ( 75.0% ) , and those with prior treatment ( 50% ) , but these did not reach statistical significance . only gender was found to have a significant correlation , female patients had a higher occlusion rate compared to men ( 87.5% vs. 40% , p = 0.033 ) ( table 2 ) . the overall symptomatic complication rate was 10.3% ( n = 3 ) , including two tias . one patient suffered from left frontal parenchymal hemorrhage one day after operation , secondary to rupture of an underlying arterio - venous malformation , which was an incidental finding . craniotomy and clot evacuation were performed , and he subsequently recovered to functional independence ( modif ied rankin scale 2 ) . a 60-year - old woman had a 7.6 mm wide - neck right pcoma ia . it received feeding from both the ica and the fetal - type pcoma ( fig . one ped was placed initially , but the aneurysm received persistent inflow from the fetal - type pcoma . follow - up angiography showed a persistent aneurysm despite flow diverters at 18 months after the second ped ( fig . 1b ) . a 73-year - old man had a 4.4 mm right pcoma lesion that reconstituted after initial coil embolization . cta and dsa again showed the presence of persistent fetal - type circulation , and the ia was fed by both the ica and the pcoma ( fig . a 68-year - old man had an 11 mm left pcoma lesion supplied from both the ica and the fetal - type pcoma ( fig . there was reconstitution despite three sessions of coil embolization , the last being stent - assisted . table 1 shows their characteristics . there were 23 small and six large ias , with a mean size of 6.99 mm ( range : 2.1 to 22 mm ) . wide - neck ias accounted for 48.2% ( n=14 ) , and 55.1% ( n=16 ) of the ias had an aspect ratio of less than 1.5 . four ias arose from the fetal - type posterior communicating artery ( pcoma ) origin , three from other segments of the supraclinoid internal carotid artery ( ica ) , five from the cavernous ica and 17 from the paraclinoid ica . one ia had previous stent - assisted coiling , while three others received previous coiling only . , six did not occlude , yielding an overall occlusion rate of 79.3% ( n=23 ) . these included all four ias that were arising at the pcoma origin with persistent fetal - type circulations . curve reformation angiography showed that the residual aneurysm necks in these lesions were all incorporating a portion of the fetal - type pcoma after ped placement . the mean follow - up duration was 270 days ( range : 150 to 800 ) . lower occlusion rates were found with wide - neck lesions ( 64.2% ) , ias with aspect ratios of 1.5 ( 75.0% ) , and those with prior treatment ( 50% ) , but these did not reach statistical significance . only gender was found to have a significant correlation , female patients had a higher occlusion rate compared to men ( 87.5% vs. 40% , p = 0.033 ) ( table 2 ) . the overall symptomatic complication rate was 10.3% ( n = 3 ) , including two tias . one patient suffered from left frontal parenchymal hemorrhage one day after operation , secondary to rupture of an underlying arterio - venous malformation , which was an incidental finding . craniotomy and clot evacuation were performed , and he subsequently recovered to functional independence ( modif ied rankin scale 2 ) . a 60-year - old woman had a 7.6 mm wide - neck right pcoma ia . it received feeding from both the ica and the fetal - type pcoma ( fig . one ped was placed initially , but the aneurysm received persistent inflow from the fetal - type pcoma . a second ped was placed 15 months later . follow - up angiography showed a persistent aneurysm despite flow diverters at 18 months after the second ped ( fig . 1b ) . a 73-year - old man had a 4.4 mm right pcoma lesion that reconstituted after initial coil embolization . cta and dsa again showed the presence of persistent fetal - type circulation , and the ia was fed by both the ica and the pcoma ( fig . a 68-year - old man had an 11 mm left pcoma lesion supplied from both the ica and the fetal - type pcoma ( fig . there was reconstitution despite three sessions of coil embolization , the last being stent - assisted . a 60-year - old woman had a 7.6 mm wide - neck right pcoma ia . it received feeding from both the ica and the fetal - type pcoma ( fig . one ped was placed initially , but the aneurysm received persistent inflow from the fetal - type pcoma . a second ped was placed 15 months later . follow - up angiography showed a persistent aneurysm despite flow diverters at 18 months after the second ped ( fig . a 73-year - old man had a 4.4 mm right pcoma lesion that reconstituted after initial coil embolization . cta and dsa again showed the presence of persistent fetal - type circulation , and the ia was fed by both the ica and the pcoma ( fig . a 68-year - old man had an 11 mm left pcoma lesion supplied from both the ica and the fetal - type pcoma ( fig . there was reconstitution despite three sessions of coil embolization , the last being stent - assisted . the ped was approved by the united states food and drug administration ( fda ) in 2011 for the treatment of a selected group of anterior circulation ias . a multi - center study involving 178 ias treated in our locality reported occlusion rates of 81% at 12 months , and 84% at 18 months . currently , only a limited number of studies have investigated predisposing factors for incomplete occlusion after ped placement . the female gender ( or = 0.52 , p = 0.03 ) and prior treatment ( or = 0.36 , p = 0.002 ) were associated with lower success rates . in mcauliffe 's series of 57 ias , those without prior treatment attained an occlusion rate of 92.5% , compared with 80% in those previously treated with coiling or clipping , and 50% in those with previous stenting or stent - assisted coiling . the authors postulated that the presence of a prior stent may compromise the apposition of the ped to the arterial wall , thus creating endoleak and persistent filling of the aneurysm . we found a similar trend , though it did not reach statistical significance possibly due to the small number of patients with prior treatments in our cohort . notably , we found that fetal - type pcoma ias were associated with a particularly poor occlusion rate in our series . pcoma ias are the second most common aneurysms overall , accounting for 25% of all ias and 50% of all ica ias . the most common type is the one in which the neck of the ia originates from the ica and partially incorporates the pcoma . a pcoma with persistent fetal pattern has the same caliber as the p2 segment of the posterior cerebral artery ( pca ) , and is associated with an atrophic p1 segment . their incidence rates range from 4 to 29% for unilateral , and 1 to 9% for bilateral fetal pcoma . this was not due to case selection bias , as we did not treat any other unruptured pcoma lesions by other means during the study period . pcoma ias are potentially difficult lesions to treat . in the international subarachnoid hemorrhage trial ( isat ) , on reviewing the outcome of coil - embolized pcomas , songsaeng et al found five morphological factors that were predictive of initial aneurysm occlusion and long - term stability . they were small ia size , dome - to - neck ratio < 2 , small size of the pcoma , ica - fundus angle of 160 to 180 degrees , and posteroinferior dome orientation . , lesions associated with fetal - type circulation may pose difficulties , in that backflow from a large pcoma may persistently fill the ia even after a temporary clip was in place . it is critical but not always possible to preserve adequate flow in these large pcomas during clipping . zada et al described a patient who underwent clipping of an ia with fetal variant . the fetal - type pcoma was sacrificed resulting in an occipital infarction . in the context of treatment with the ped , all four of our fetal - type pcoma ias persisted and accounted for two - thirds of all failures . we surmised that while a ped placed within the ica would protect the ia from ica inflow , the dominant and large caliber fetal pcoma will continuously sump blood from the ica across the stent , resulting in diminished flow - diverting effect and therefore persistent aneurysm flow . backflow from the pca territory through the fetal - type pcoma may also contribute to persistent aneurysm perfusion . on the other hand , in the presence of fetal pcoma , increasing flow diversion by using multiple ped across the pcoma ostium may jeopardize the perfusion to the pca territory and may lead to ischemic complications . therefore , based on our limited experiences , we do not find the ped a suitable treatment for pcoma ias with persistent fetal - type circulation , especially when an ia incorporates a significant portion of the pcoma . adjuvant coiling may help but can be technically difficult for a wide - neck lesion located at bifurcations . the use of multiple peds and adjuvant coiling in our treatment was not protocol - driven . incomplete occlusion was observed in all cases of pcoma ias associated with persistent fetal - type circulation treated with flow diverters .

purposethe pipeline embolization device ( ped ) is a flow diverter that has shown promise in the treatment of intracranial aneurysms . close to one - fifth of aneurysms , however , fail to occlude after ped placement . this study aims to identify anatomical features and clinicopathologic factors that may predispose failed aneurysm occlusion with the ped.materials and methodswe retrospectively reviewed all anterior circulation unruptured saccular aneurysms treated with the ped in a single - center . the primary outcome measure was angiographic occlusion . anatomical features and potential predictors , including gender , aneurysm location , size , height , aspect ratio , neck width , prior treatment and the number of ped , were studied using binary logistic regression.results29 anterior circulation unruptured saccular aneurysms with a mean size of 6.99 mm treated with the ped in a single center were retrospectively studied . the overall occlusion rate was 79.3% after a mean follow - up of 9.2 months . four aneurysms were related to the fetal - type posterior communicating artery ( pcoma ) , and all were refractory to flow diverter treatment . female gender was significantly associated with a higher occlusion rate . we present the anatomical features and propose possible pathophysiological mechanisms of these pcoma aneurysms that failed flow diverter treatment.conclusiona pcoma aneurysm with persistent fetal - type circulation appears to be particularly refractory to flow diverter treatment , especially when the aneurysm incorporates a significant portion of the pcoma . our experience suggested that flow diverting stents alone may not be the ideal treatment for this subgroup of aneurysms , and alternative modalities should be considered . female patients were found to have a significantly higher rate of treatment success .

malaria is caused by protozoan parasites of the genus plasmodium , namely , p. falciparum , p. vivax , p. malariae , p. ovale , and p. knowlesi . patients with p. falciparum infection are prone to develop severe malaria in 30% of cases , which resulted in case fatality rate of 20% . in southeast asia , acute renal failure ( arf ) is one of the most common complications in adults with falciparum malaria [ 3 , 4 ] . the incidence of arf in patients with severe malaria varies widely ranging from 15% to 48% [ 511 ] which resulted in a high fatality rate of over 70% in untreated patients . the availability of renal replacement therapy ( rrt ) and appropriate antimalarial chemotherapy has been shown to reduce case fatality rate as well as enhance the recovery of renal function [ 13 , 14 ] . recently , a few observational studies demonstrated that there was an increased risk for mortality with small increments in serum creatinine ; this finding made the case for the adoption of more sensitive creatinine - based criteria for acute kidney injury ( aki ) [ 15 , 16 ] . the term arf was replaced by aki which was classified as the risk , injury , failure , loss , and end - stage renal failure criteria ( rifle criteria ) proposed by the acute dialysis quality initiative ( adqi ) group . in addition , severity of aki by the rifle criteria can be used for predicting both requirements for rrt and mortality rates particularly in critically ill patients . however , data on diagnosing aki using the rifle criteria among patients with severe malaria are limited due to the commonly used who criteria in this field . this study aimed to determine the incidence of arf by the who 2006 criteria and aki by the rifle criteria as well as their association with requirement for rrt and in - hospital mortality this study was approved by the ethics committee of the faculty of tropical medicine , mahidol university , bangkok , thailand . a retrospective study was conducted at the mae sot general hospital , tak province , thailand . medical records of hospitalized patients with severe falciparum malaria classified according to who 2006 criteria between 2004 and 2008 were reviewed . inclusion criteria were ( 1 ) aged 15 years or above , ( 2 ) confirmed diagnosis of falciparum malaria by peripheral blood smear microscopy , and ( 3 ) had clinical and laboratory features of severe malaria as defined by the who 2006 criteria . exclusion criteria were ( 1 ) patients with previous history of chronic kidney disease or ( 2 ) patients with mixed infection . patients ' data comprising demographic , clinical features , laboratory data , and outcomes including death and requirement for rrt were reviewed and extracted from medical records and discharge summaries according to the eligible criteria . these data were then transferred into a predefined case record form for further analysis . in our study , the who 2006 criteria for severe malaria were used with slight modification due to the availability of data . these included ( 1 ) impaired consciousness defined as glasgow coma scale ( gcs ) score 10 , ( 2 ) multiple convulsions defined as patients who developed convulsion 2 times within 24 hours , ( 3 ) shock defined as a systolic blood pressure 80 mmhg or required inotropic drugs , ( 4 ) pulmonary edema or acute respiratory distress syndrome ( ards ) assessed by clinical and abnormal chest roentgenography specific for these syndromes , ( 5 ) hyperbilirubinemia defined as total bilirubin 3 mg / dl , ( 6 ) hypoglycemia defined as blood sugar < 40 mg / dl , ( 7 ) severe anemia defined as hematocrit < 15% or hemoglobin < 5 g / dl , ( 8) spontaneous bleeding , ( 9 ) evidence of disseminated intravascular coagulation , ( 10 ) severe metabolic acidosis defined as arterial blood ph < 7.35 or bicarbonate level < 15 mmol / l , and ( 11 ) hemoglobinuria defined as dark colored urine or heme positive with < 2 red blood cells per high - power field in urine . patients with arf were classified according to the who 2006 criteria defined as serum creatinine > 3 mg / dl and adequate volume status . patients with aki were classified according to the rifle criteria using decrement in the estimated glomerular filtration rate ( gfr ) , but not serum creatinine increment and urine output in our study . patients with aki were classified as no aki ( decrease of estimated gfr 25% ) , rifle - r ( decrease of estimated gfr > 2550% ) , rifle - i ( decrease of estimated gfr > 5075% ) and rifle - f ( decrease of estimated gfr the categories of rifle including loss ( rifle - l ) and end - stage kidney disease ( rifle - e ) were not evaluated . estimated gfr was calculated using the chronic kidney disease epidemiology collaboration ( ckd - epi ) equation as recommended by the adqi group . the incidence of arf in adults with severe malaria was approximately 30% to 50% by the reports from south and southeast asia [ 8 , 9 , 11 ] . data from the hospital registry of the mae sot general hospital showed that 25% of adult patients with severe malaria had arf ; thus , we estimated the incidence of arf in our study to be 25% with the desired statistical power of 80% and the type i error ( alpha = 0.05 ) to detect a 10% difference in incidence of aki between the who 2006 criteria and the rifle criteria . the required sample size of at least 231 medical records of hospitalized patients with severe falciparum malaria was needed in our study . the demographic , clinical , and laboratory data collected in this study were analyzed using the statistical package for the social sciences version 18.0 ( spss , chicago , il , usa ) . quantitative data were tested for normality using the kolmogorov - smirnov test and summarized as median ( interquartile , iqr ) for nonnormally distributed data . qualitative data were summarized as frequency ( percentage ) and then analysed by chi square test or fisher 's exact test as appropriate . the chi square for linear trend was used to determine a linear trend of in - hospital mortality in relation to severity of aki . univariate analysis was performed to determine the possible risk factors for in - hospital mortality among severe falciparum malaria patients with aki . any variable with p 0.2 in the univariate logistic regression analysis was included in the stepwise multivariate logistic regression analysis using a backward selection method for determining the independent associated factors for in - hospital mortality among severe falciparum malaria patients with aki . all tests of significance were 2 sided , with a p < 0.05 indicating statistical significance . a total of 373 medical records of hospitalized patients with severe falciparum malaria were reviewed . of these , 257 medical records fulfilled the eligible criteria and the rest were excluded as 86 patients had insufficient data and 30 patients had mixed infection . the median ( iqr ) age of patients with severe falciparum malaria was 31.0 ( 22.040.0 ) years and the majority of the patients were males ( 191/257 , 74.3% ) . the common clinical presentations on admission were fever ( 245/247 , 99.2% ) with the median ( iqr ) temperature of 38.7 ( 37.739.5)c and rigors ( 102/109 , 93.6% ) . regarding laboratory parameters on admission , hematological findings were hemoglobin ( median ( iqr ) , 10.6 ( 8.312.9 ) g / dl ) , white blood cell count ( 8.3 ( 5.412.3 ) 10/l ) , and platelet count ( 32.0 ( 17.064.0 ) 10/l ) . blood chemistries showed blood sugar ( median ( iqr ) , 123 ( 98146 ) mg / dl ) , blood urea nitrogen ( 44.0 ( 22.072.8 ) mg / dl ) , creatinine ( 1.8 ( 1.24.1 ) mg / dl ) , total bilirubin ( 5.0 ( 2.211.1 ) mg / dl ) , direct bilirubin ( 1.5 ( 0.73.8 ) mg / dl ) , aspartate aminotransferase ( 124 ( 59232 ) u / l ) . according to the who 2006 criteria , most of the patients had complications of hyperbilirubinemia ( 139 , 54.1% ) followed by arf ( 115 , 44.7% ) , impaired consciousness ( 110 , 42.8% ) , severe metabolic acidosis ( 109 , 42.4% ) , shock ( 86 , 33.5% ) , multiple convulsions ( 30 , 11.7% ) , pulmonary edema or ards ( 23 , 8.9% ) , severe anemia ( 16 , 6.2% ) , hypoglycemia ( 13 , 5.1% ) and spontaneous bleeding ( 7 , 2.7% ) . the incidence of arf using the who 2006 and rifle criteria are shown in table 1 . for the who 2006 criteria , arf occurred in 115 patients ( 44.7% ) during admission . using the rifle criteria , aki was observed in 190 patients ( 73.9% ) including rifle - r ( 40/257 , 15.6% ) , rifle - i ( 43/257 , 16.7% ) , and rifle - f ( 107/257 , 41.6% ) . regarding the who 2006 criteria , 53 of 257 ( 20.6% ) patients underwent dialysis ( 31 patients by hemodialysis and 22 patients by peritoneal dialysis ) with median ( iqr ) duration for dialysis of 4.5 ( 2.010.0 ) days . of 53 patients , 52 patients were classified as a group with arf and only one patient as a group with no arf . the requirement for rrt was significantly higher in the group with arf compared to that with no arf ( p < 0.001 ) . using the rifle criteria , none of the patients with no aki and rifle - r received rrt whereas 53 patients ( 27.9% ) including rifle - i ( 5/43 , 11.6% ) and rifle - f ( 48/107 , 44.9% ) received rrt . the requirement for rrt in a group with any rifle criteria was significantly higher than that with no aki ( p < 0.001 ) ( table 2 ) . the most common indication for rrt in patients with rifle - i was severe metabolic acidosis ( 4 , 80.0% ) followed by pulmonary edema ( 2 , 40.0% ) and severe hyperkalemia ( 2 , 40.0% ) . among patients with rifle - f , the most common indication for rrt was severe metabolic acidosis ( 25 , 52.1% ) followed by pulmonary edema ( 9 , 18.6% ) , severe hyperkalemia ( 6 , 12.5% ) , fluid management for nutrition support ( 2 , 4.2% ) , and uremia ( 1 , 2.1% ) . using the who 2006 criteria , in - hospital mortality of patients with arf was significantly higher than that with no arf ( 36/113 ( 31.9% ) versus 19/136 ( 14.0% ) ; p = 0.001 ) . when patients were classified by the rifle criteria , in - hospital mortality was significantly higher in the group of patients with any rifle criteria compared to that with no aki ( 49/187 ( 26.2% ) versus 6/62 ( 9.7% ) ; p = 0.002 ) . the results showed that in - hospital mortality increased with severity of aki including rifle - r ( 4/39 , 10.3% ) , rifle - i ( 13/43 , 30.2% ) , and rifle - f ( 32/105 , 30.5% ) ( table 2 ) , and there was strong evidence of a linear trend in - hospital mortality in relation to severity of aki ( chi square for linear trend = 12.693 , p < 0.001 ) . patients with rifle - r , rifle - i , and rifle - f were 1.07 , 4.04 , and 4.09 times at risk for in - hospital mortality as compared to those with no aki , respectively . the clinical , laboratory parameters and the type of rrt were subsequently analyzed for independent factors associated with in - hospital mortality among severe falciparum malaria patients with aki ( table 3 ) . univariate analysis showed that gcs 10 ( odds ratio ( 95% confidence interval ) ; or ( 95% ci ) , 8.477 ( 3.85218.654 ) , p < 0.001 ) ; number of who criteria 4 ( 22.500 ( 7.62566.396 ) , p < 0.001 ) , dopamine infusion ( 17.185 ( 5.94549.679 ) , p < 0.001 ) , need for mechanical ventilator ( 37.266 ( 12.450111.546 ) , p < 0.001 ) , white blood cell count > 12.0 10/l ( 5.286 ( 2.60210.736 ) , p < 0.001 ) , serum potassium > 5.5 mmol / l ( 10.427 ( 2.73139.808 ) , p = 0.001 ) , bicarbonate level < 15 mmol / l ( 6.195 ( 2.50915.295 ) , p < 0.001 ) , blood sugar < 60 mg / dl ( 12.000 ( 1.379104.410 ) , p = 0.024 ) , aspartate aminotransferase > 500 u / l ( 7.429 ( 2.64620.858 ) , p < 0.001 ) , alanine aminotransferase > 500 u / l ( 13.875 ( 1.497128.561 ) , p = 0.021 ) and albumin < 2.5 g / dl ( 2.597 ( 1.2055.597 ) , p = 0.015 ) were significantly associated with in - hospital mortality at p 0.2 . these parameters were further analyzed by stepwise multivariate logistic regression analysis using backward selection method . the parameters including dopamine infusion ( or ( 95% ci ) , 7.172 ( 1.82728.145 ) , p = 0.005 ) , adrenaline infusion ( 14.502 ( 2.87473.166 ) , p = 0.001 ) , need for mechanical ventilator ( 10.806 ( 2.56945.459 ) , p = 0.001 ) , and white blood cell count > 12.0 10/l ( 3.982 ( 1.14613.836 ) , p = 0.030 ) were independently associated with in - hospital mortality . p. falciparum infection is the most common cause of arf in patients with severe malaria [ 3 , 4 ] . it appears that several factors contribute to arf in falciparum malaria which includes parasitized erythrocytes inducing microvascular obstruction and/or causing hemolysis . apart from parasites , glycosyl - phosphatidyl - inositol which is a receptor on monocytes covalently bound to the surface antigens of falciparum malaria parasites . the monocytes are then stimulated to release the tumor necrosis factor , which in turn enhances synthesis of various cytokine cascades and mediators . these mediators also cause changes in blood volume status , vasodilatation , and increase vascular permeability resulting in hypovolemia which contributes to ischemic renal failure . we conducted a retrospective study by reviewing 257 medical records of patients with severe falciparum malaria at the mae sot general hospital , tak province , thailand , in order to determine the incidence of arf using the who 2006 criteria and aki using the rifle criteria as well as their association with rrt requirement and in - hospital mortality . serum creatinine was used to calculate estimated gfr as serum creatinine criteria seemed to show a worse rifle category and provided a better predictor for mortality rate than urine output criteria . however , calculation of estimated gfr has several limitations particularly in aki patients with nonsteady state of serum creatinine . the lack of steady state in serum creatinine in aki patients might lead to an overestimation of gfr in patients with rising serum creatinine and underestimation of gfr in patients with declining gfr . regarding the who 2006 criteria , the incidence of arf in our study ( 44.7% ) was similar to the reports in previous studies ( 3050% ) [ 8 , 9 , 11 ] . overall in - hospital mortality of patients with severe falciparum malaria was 22.1% and as high as 31.9% in the group of patients with arf in our study . this figure showed significantly higher in - hospital mortality in the group of patients with arf compared to that with no arf ( 14% ) . the cause of death was multiorgan failure , which included shock , cerebral malaria , and metabolic acidosis in most cases . these findings were similar to reports in other referral centers showing that arf occurred in approximately 2550% , and the numbers of organ failures were associated with case fatality rate [ 7 , 8 , 11 , 14 ] . when rrt requirement was observed , indications for initiation of rrt in patients with severe malaria were similar to the timing for initiation of rrt in critically ill patients and dependent on treating nephrologists . however , the indication for initiation of rrt included severe metabolic acidosis , pulmonary edema , and severe hyperkalemia in our hospital . however , the proportion for the requirement of rrt in our study was lower than those reports in other studies ( 6080% ) [ 7 , 8 , 11 , 14 ] . these criteria have been shown in hospitalized patients to be quite sensitive in predicting the case fatality rate [ 1517 , 21 ] . there were several reports showing the ability of rifle criteria in predicting hospital mortality of critically ill patients [ 2225 ] . these criteria have been widely used for diagnosing aki in western countries , but they are rarely used in tropical areas , of which infection is one of the most common causes of aki . infectious diseases in these tropical countries including malaria , leptospirosis , scrub typhus , and salmonellosis are commonly found in association with aki . there has been only one report from india showing that aki diagnosed using the rifle criteria was associated with the requirement for rrt and case fatality rate in patients with tropical acute febrile illnesses such as scrub typhus , falciparum malaria , enteric fever , dengue , and leptospirosis . however , these rifle criteria have never been evaluated among a cohort of patients with severe malaria . in our study , aki was evaluated using the rifle criteria in a large group of patients with severe malaria . we demonstrated that the requirement for rrt and in - hospital mortality increased significantly with severity of aki . severe malaria patients with rifle - i or rifle - f were 4 times at risk for in - hospital mortality compared to those with no aki . risk factors for in - hospital mortality among severe falciparum malaria patients with aki were dopamine ( or = 7.172 , 95% ci = 1.82728.145 ) or adrenaline infusion ( or = 14.502 , 95% ci = 2.87473.166 ) , need for mechanical ventilator ( or = 10.806 , 95% ci = 2.56945.459 ) , and white blood cell count > 12.0 10/l ( or = 3.982 , 95% ci = 1.14613.836 ) in our study . previous studies showed that in - hospital mortality among patients with severe malaria was higher in those with multi - organ failure . furthermore , leucocytosis was associated with mortality among patients with falciparum malaria but not associated with bacteremia . early detection of aki may help in the proper management of cases resulting in better outcomes . other conditions such as cerebral malaria , disseminated intravascular coagulation , and metabolic acidosis may contribute to poor outcomes in patients with severe falciparum malaria [ 5 , 8 ] . in our study , there were several limitations due to the study design which was retrospective in nature and some baseline data of the patients were missing . therefore , further prospective evaluations are needed to properly standardize the rifle criteria for diagnosing aki in malaria patients . in conclusion , rifle criteria could be used in diagnosing aki and predicting both requirements for rrt and in - hospital mortality in patients with severe falciparum malaria similar to who 2006 criteria . early diagnosis and early management of aki may help to improve the outcomes of severe malaria patients in future .

there are limited data on the application of the rifle criteria among patients with severe malaria . this retrospective study was conducted by reviewing 257 medical records of adult hospitalized patients with severe falciparum malaria at the mae sot general hospital , tak province in the northern part of thailand . the aims of this study were to determine the incidence of acute renal failure ( arf ) in patients with severe falciparum malaria and its association with rrt as well as in - hospital mortality . using the who 2006 criteria , arf was the second most common complication with incidence of 44.7% ( 115 patients ) . the requirement for rrt was 45.2% ( 52 patients ) and the in - hospital mortality was 31.9% ( 36 patients ) . using the rifle criteria , 73.9% ( 190 patients ) had acute kidney injury ( aki ) . the requirement for rrt was 11.6% ( 5 patients ) in patients with rifle - i and 44.9% ( 48 patients ) in patients with rifle - f . the in - hospital mortality gradually increased with the severity of aki . the requirement for rrt ( p < 0.05 ) and the in - hospital mortality ( p < 0.05 ) were significantly higher in arf patients with severe falciparum malaria using both criteria . in conclusion , the rifle criteria could be used for diagnosing aki and predicting outcomes in patients with severe malaria similar to the who 2006 criteria .

implant therapy based on the principle of osseointegration has seen a remarkable expansion of its application in dentistry , in recent years . in the last decade , dental implants have become a reliable procedure for the treatment of partially or completely edentulous jaws . bony defect and several techniques have been proposed to promote defect fill with newly formed bone . one of the most popular procedures is guided bone regeneration ( gbr ) , which involves placing a membrane over the defect to create a secluded space into which osteogenic cells can migrate and remain undisturbed over the exposed part of the implant . a challenge in the reconstruction of periodontal structures is the targeted delivery of growth promoting molecules to the tooth root surface . polypeptide growth factors are molecules identified in the periodontal tissues that have been implicated in the growth and differentiation of cells from the periodontal tissues . platelet rich fibrin , which is a second generation platelet concentrate , offers the surgeon an access to growth factors with a simple and available technology . these growth factors which are autologous , nontoxic and non immunogenic , enhance and accelerate the normal bone regeneration pathways . this article presents a case report in which a fenestration defect around an implant was treated by gbr with platelet rich fibrin ( prf)-enhanced bone graft and the prf smeared barrier membrane for guided bone regeneration . a 30-year - old male patient reported with the chief complaint of his discolored cantilever bridge in the upper front tooth region . intra oral examination revealed missing 21 and a cantilever bridge , with 11 as an abutment [ figures 1 and 2 ] . history revealed that the tooth was extracted two years back due to trauma . the treatment planned was to give delayed loading implant replacement and metal ceramic crown for the patient in the region 21 , and a separate metal ceramic crown for 11 . preparation of the patient included scaling and root planing of the entire dentition and oral hygiene instructions . a two piece implant ( zimmer ) of diameter 4.25 mm and length 13 mm was placed in the region , 21 and the flap was sutured . after suture removal , the cantilever bridge was modified and given as temporary restoration [ figures 35 ] . implant with cover screw post - operative radiograph when the patient was reviewed after one month , there was a concavity in the buccal aspect of the region , 21 [ figure 6 ] . the region was examined with a bone meter , which revealed a buccolingual width of 5 mm . treatment was planned to treat the fenestration defect with a combination of bone graft , prf and guided tissue regeneration ( gtr ) membrane . one month after implant placement a full thick mucoperiosteal flap was raised with two vertical releasing incisions , beyond the mucogingival junction , which revealed a class i fenestration defect [ figure 7 ] . fenestration defect around an implant the fenestration defect was planned to be treated by placement of bone graft and prf mixture and resorbable gtr and prf membrane over the defect . the patient 's blood samples were taken in the operating room during the surgery . immediately after the blood draw , the dried monovettes ( without anticoagulant ) were centrifuged at 2700 rpm for 12 minutes in a tabletop centrifuge [ remy laboratories ] . the resultant product consists of the following three layers [ figure 8 ] : the topmost layer consisting of acellular platelet poor plasmaprf clot in the middlered blood cells ( rbcs ) at the bottom . the topmost layer consisting of acellular platelet poor plasma prf clot in the middle red blood cells ( rbcs ) at the bottom . because of the absence of an anticoagulant , blood begins to coagulate as soon as it comes in contact with the glass surface . therefore , for successful preparation of prf , speedy blood collection and immediate centrifugation , before the clotting cascade is initiated is absolutely essential . the prf clots were recovered and used in two ways : some were placed in sterile cups and cut in few millimeter fragments . the mixture obtained constituted an easy- to - use homogeneous graft material [ figures 911]others were packed tightly in two sterile compresses inorder to obtain resistant fibrin membranes which could be placed on the grafting material along with the resorbable membrane before wound closure [ figure 12 ] . the mixture obtained constituted an easy- to - use homogeneous graft material [ figures 911 ] others were packed tightly in two sterile compresses inorder to obtain resistant fibrin membranes which could be placed on the grafting material along with the resorbable membrane before wound closure [ figure 12 ] . bone graft mixed with prf bone graft and prf mixture placed over defect prf and gtr membrane placed over defect care was taken that the membrane extended 3 - 4 mm apically and mesiodistally . the patient was given antibiotics ( amoxycillin 500 mg tid for five days ) and analgesics ( ibuprofen 400 mg and paracetamol 500 mg twice daily for three days ) and post - operative instructions were given . the sutures were removed 10 days after the procedure . the surgical site was examined for uneventful healing . six months after the gbr treatment , intra - oral examination with the bone meter revealed adequate buccolingual width of the ridge of 7 mm . in order not to disturb the minimal amount of bone that would have formed over the fenestration defect , the implant was uncovered and a healing abutment was connected to allow emergence of the implant through the soft tissues , thus facilitating access to the implant from the oral cavity and final restoration was placed [ figure 14 ] . preparation of the patient included scaling and root planing of the entire dentition and oral hygiene instructions . a two piece implant ( zimmer ) of diameter 4.25 mm and length 13 mm was placed in the region , 21 and the flap was sutured . after suture removal , implant with cover screw post - operative radiograph when the patient was reviewed after one month , there was a concavity in the buccal aspect of the region , 21 [ figure 6 ] . the region was examined with a bone meter , which revealed a buccolingual width of 5 mm . treatment was planned to treat the fenestration defect with a combination of bone graft , prf and guided tissue regeneration ( gtr ) membrane . one month after implant placement a full thick mucoperiosteal flap was raised with two vertical releasing incisions , beyond the mucogingival junction , which revealed a class i fenestration defect [ figure 7 ] . fenestration defect around an implant the fenestration defect was planned to be treated by placement of bone graft and prf mixture and resorbable gtr and prf membrane over the defect . the patient 's blood samples were taken in the operating room during the surgery . immediately after the blood draw , the dried monovettes ( without anticoagulant ) were centrifuged at 2700 rpm for 12 minutes in a tabletop centrifuge [ remy laboratories ] . the resultant product consists of the following three layers [ figure 8 ] : the topmost layer consisting of acellular platelet poor plasmaprf clot in the middlered blood cells ( rbcs ) at the bottom . the topmost layer consisting of acellular platelet poor plasma prf clot in the middle red blood cells ( rbcs ) at the bottom . because of the absence of an anticoagulant , blood begins to coagulate as soon as it comes in contact with the glass surface . therefore , for successful preparation of prf , speedy blood collection and immediate centrifugation , before the clotting cascade is initiated is absolutely essential . the prf clots were recovered and used in two ways : some were placed in sterile cups and cut in few millimeter fragments . the mixture obtained constituted an easy- to - use homogeneous graft material [ figures 911]others were packed tightly in two sterile compresses inorder to obtain resistant fibrin membranes which could be placed on the grafting material along with the resorbable membrane before wound closure [ figure 12 ] . the mixture obtained constituted an easy- to - use homogeneous graft material [ figures 911 ] others were packed tightly in two sterile compresses inorder to obtain resistant fibrin membranes which could be placed on the grafting material along with the resorbable membrane before wound closure [ figure 12 ] . bone graft mixed with prf bone graft and prf mixture placed over defect prf and gtr membrane placed over defect care was taken that the membrane extended 3 - 4 mm apically and mesiodistally . the patient was given antibiotics ( amoxycillin 500 mg tid for five days ) and analgesics ( ibuprofen 400 mg and paracetamol 500 mg twice daily for three days ) and post - operative instructions were given . six months after the gbr treatment , intra - oral examination with the bone meter revealed adequate buccolingual width of the ridge of 7 mm . in order not to disturb the minimal amount of bone that would have formed over the fenestration defect , the implant was uncovered and a healing abutment was connected to allow emergence of the implant through the soft tissues , thus facilitating access to the implant from the oral cavity and final restoration was placed [ figure 14 ] . gbr is based on the principle of guided tissue regeneration , and was first performed in an experimental dog study . improvements in this technique have led to its wide - scale clinical applications to augment deficient alveolar ridges , treat implant fenestration or dehiscences , and permit immediate implant placement in large alveolar sockets . a minimum buccolingual width of 6 mm is recommended for placement of implants without undesirable complications . the most common complication associated with the placement of implants in narrow alveolar ridges or in an ideal position for esthetics is a dehiscence or fenestration defect . a fenestration is a vestibular or linguopalatal defect as an expression of a bone thickness deficiency that creates partial exposure of an implant that is completely surrounded by bone . in class i fenestrations , the implant surface penetrates the wall of bone by an insignificant amount and is located within the envelope of bone . in class ii fenestrations , there is a convexity and a significant portion of the implant is exposed outside the envelope of bone for reasons of restorability . in this case - report , there was class i fenestration defect around the implant and to group ii of the classification given by daniel buser , 1994 , in which the prosthetically guided placement of an implant results in exposure of the buccal implant surface . at present , it can be stated that biodegradable membranes have the potential to support bone formation if they are supported by bone graft material to resist collapse and if they are long - lasting enough to maintain their barrier function for extended periods in small to moderate bone defects . the degradation and resorption kinetics of a membrane for use in gbr should be set such that it remains intact for at least 6 - 9 months in large volume defects and then should be completely metabolized after 12 - 15 months . in a recent systematic review , a reasonable comparison between bioresorbable and non - resorbable membranes could not be drawn due to lack of well designed studies . in this case report , we used gtr membrane ( healiguide ) , which is made of collagen and prf to treat the defect . this is a significant benefit to the patient and represents an important step in the development of gbr procedures . for successful outcomes with gbr , the factors as outlined by mellonig et al . recent clinical and histologic findings suggest that the use of platelet concentrates have technical benefits and may enhance bone regeneration when used in conjunction with bone grafts . the amplification of platelet derived growth factor ( pdgf ) and transforming growth factor ( tgf ) beta is seen as an available and practical tool for enhancing the rate of bone formation and the final quality of bone formed . it eliminates the redundant process of adding anticoagulant as well as the need to neutralize it . it has been shown from the literature that it increases the rate of clinical graft consolidation , and prf- enhanced grafts produce more mature and dense bone than do grafts without prf . prf is in the form of a platelet gel and can be used in conjunction with bone grafts , which offers several advantages including promoting wound healing , bone growth and maturation , graft stabilization , wound sealing and hemostasis and improving the handling properties of graft materials . in an experimental study which used osteoblast cell cultures to investigate the influence of prp and prf on proliferation and differentiation of osteoblasts , it was found that prf had a superior influence over prp . also , bone augmentation grafts may act as space - maintaining devices to allow coronal migration of periodontal progenitor cells . the technique of applying biomaterials to support bioresorbable membranes avoid the risks associated with harvesting autogenic bone . bioglass is preferred for its high bioactivity , because of which the reaction layers appear to form within minutes of its implantation , and the osteogenic cells freed by the surgery rapidly colonize the particles . use of bioactive glass results in more rapid filling of the defects , which may result from more rapid accumulation of bone morphogenic proteins and other growth factors on the surface of bioactive particles , due to its high bioactive index . however , the bioactive glass in this case has no role beyond a scaffold and its absence of use would have produced the same result . the development of biomaterials , ideally coupled with the incorporation of bone growth factors and bioactive peptides , represents an important line of research in this direction . recent systematic reviews regarding the survival rate of implants into sites with regenerated / augmented bone using barrier membranes varied between 79% and 100% with the majority of studies indicating more than 90% after at least one year of function . thus , in this case report , a fenestration defect was effectively treated by the application of growth factors both to the bone graft and gtr membrane . at present , large bone defects are regularly augmented with autogenous block grafts and membranes . the use of synthetic materials would result in lower surgical risks and lower morbidity in the augmentation procedure and would represent an important step forward in simplifying bone regeneration techniques . although a meta - analysis of studies in the regeneration of intrabony defects with bone grafts has been reported , no such analysis has been made till date in evaluating the use of platelet concentrates alone or with bone grafts in the treatment of bony defects . we hope that this case - report would become a part of meta - analysis in the future to help plan an evidence - based treatment .

guided bone regeneration ( gbr ) in implant therapy is especially useful for implant placement with dehiscence defects or fenestration defects . in alveolar ridges with marked facial / buccal depressions or in knifeedge alveolar crests , the position and direction of fixture placement is restricted . improvement of alveolar ridge morphology becomes possible with gbr . this article describes a case in which the fenestration defect around an implant was treated by the application of platelet rich fibrin , a second generation platelet concentrate along with bone graft , and guided tissue regeneration membrane .

blood brain barrier ( bbb ) is a vasculature of the central nervous system ( cns ) that is formed by capillary endothelial cells . this is not a fixed structure but its function depends on the complex interplay between the different cell types such as the endothelial cells , astrocytes , pericytes , and the extracellular matrix of the brain and blood flow maintained in the microvessels or brain capillaries . bbb is physically located in endothelium of blood vessels ( capillaries ) and acts as a physical barrier due to formation of complex tight junctions between adjacent endothelial cells . thus , bbb facilitates most molecular traffic to transcellular route and maintain influx and outflux of important nutrients and metabolic substances . it acts as a rate limiting structure , which obstructs transcapillary movement of substrates in the peripheral circulation into the brain . this is a dynamic barrier which acts as a firewall of a computer , which permits transient flow of nutrients , gases , and smaller molecules into the brain and keeps out harmful metabolites such as drugs ions , toxins which potentially circulate in the blood stream . it also protects the brain from sudden rising blood pressure and transcapillary movement of substrates in the peripheral circulation into the brain . thus , association of astrocytes with the brain endothelial cells provides a modular organization that allows precise control over the substances that enter or leave the brain . it includes endothelial cells , astrocytes , and blood capillaries in the brain , which form the major structural component of the blood brain barrier . these are quite different from other capillaries found in the body as their endothelial wall possesses tight junctions which obstruct transport between cells . more often , only small molecules that can diffuse through these cells can cross the barrier . more specifically , the endothelial cells also possess transporters which show permeability characteristics and allow transport of oxygen and co2 across the bbb , bu these selectively prevent other substances from crossing . in addition , blood capillaries in the brain are enclosed by the flattened end - feet of astrocytic cells , which also act as a partial , active barrier . these are highly specialized glial cells which have star like shape due to presence of long branches . these respond to cns in a reactive process that is known as astrogliosis which is recognized as a pathological marker of neuropathologies and cns disorders . these cells wrap themselves around the capillaries , like insulation on a wire , and display graded changes that result in specific signaling events . these cells show vast molecular arsenals at the disposal and show reactive astrogliosis and glial scar formation . there are two different types of astrocytes , that is , protoplasmic astrocytes and fibrous astrocytes . first type of astrocytes occurs in gray matter or specially areas rich in cell bodies , while second type occurs in white matter , that is , area formed mainly of axons . these cells also possess long dendrite like processes that overlap all the brain vessels and surround many synapses . these cells play primary role in synaptic transmission and information exchanges [ 2 , 3 ] by operating through certain gradations , mechanisms , and transcellular functions both in healthy tissues [ 4 , 5 ] and in the state of pathologies like ischemic injury [ 69 ] . transmitters and modulators released by neurons , astrocytes , and endothelium allow complex signaling between cells in the neurovascular unit , and many features of the bbb phenotype are subject to modulation under physiological or pathological conditions . for example , opening of the bbb 's tight junctions may occur under normal conditions to allow the passage of growth factors and antibodies into the brain and in inflammation and can contribute to brain oedema . the blood brain barrier provides a layer of protection for the brain from harmful or foreign substances that may injure the brain . it also protects the brain from action of metals , toxicants , poisons , hormones , neurotransmitters , drugs , and other foreign or xenobiotic substances mainly noxious agents . it regulates the movement of ions and molecules between the blood and cns ( figure 1 ) . the barrier is also crucial and provides appropriate environment for proper neural functions as well as for protection of cns from injury and diseases . therefore , before targeting the neurovascular unit , protection of the bbb is essential instead of a classical neuron - centric approach that only roads development of neuroprotective drugs that may result in improved clinical outcomes after neural diseases ( figure 1 ) . hence , for healthy functioning of the brain easy passage of molecules and ions pass through brain barrier ( bbb ) is highly needful . more often , all essential vital metabolites are to be passed through the bbb to protect the neurocompartments from potential disruptive and damaging xenobiotic agents . moreover , role of bbb is more important for maintaining normal physiology of brain and for safety of neuronal tissues from toxic substances by restricting its entry into the neurocompartment ( figure 1 ) . bbb acts as a transport barrier that allows passage of selective molecules into the brain and mediating solute flux . it also acts as a dynamic interface which separates the brain from the circulatory system . it limits the entry of biomolecules , serves as a metabolic barrier , and allows passage of intracellular and extracellular enzymes and neutral amino acids . it facilitates the entry of metabolically , required nutrients into the brain , and excludes or effluxes potentially harmful compounds or lipid - soluble molecules mainly toxicants . it functions as a perfect barricade to check the permeability of unspecified and unwanted molecules from entering the brain . but , it allows transport of most essential molecules across the membrane and maintains the homeostasis in the most vital organs of the human body . normally , it allows transport of water , carbon dioxide , oxygen , and most lipid soluble substances such as alcohol , aesthetics but it is impermeable to plasma proteins and non - lipid soluble substances in both cerebrospinal fluid and parenchyma of brain ( figure 2 ) . capillary wall possesses three classes of specialized efflux pumps which bind to three broad classes of molecules , that is , water - soluble , lipid soluble , and gaseous compounds . inversely , bbb transports back essential molecules into the blood and transports them to the brain . therefore , it is highly important and essential that water - soluble compounds including the fuel molecules such as glucose for energy production and amino acids for protein synthesis must cross the bbb ( figure 1 ) . the blood brain barrier ( bbb ) and blood cerebrospinal fluid barrier ( bcsf ) possess a variety of carrier - mediated transfer systems to support and protect brain function . but , for major function of homeostasis , brain vessels have special carriers on both sides of the cells forming the capillary walls , which transport these substances from blood to brain . in addition , low pore size disallows entry of biomolecules into the brain ( figure 3 ) . more often , endothelial capillaries in the brain lack endothelial transport , and disallow large molecules to pass but smaller molecules can pass through it . only glucose and other low molecular fat - soluble molecules are also disallowed but few lipid soluble molecules such as barbiturate drugs rapidly cross through into the brain . more specifically , endothelial light junctions obstruct the movement of polar molecules , but most of the lipophilic substances such as oxygen , carbon dioxide diffuse across the brain or molecules having smaller size or by passive diffusion . thus , endothelial cells directly or indirectly protect the brain by disallowing the harmful toxic substances and catabolize harmful drugs by using drug metabolizing enzyme system . bbb accomplishes vital functions by maintaining in- and outflow of certain biomolecules ( figure 4 ) . the bbb is semipermeable and allows only few molecules to cross but prevents xenobiotics from entry into the brain and protects it from noxious agents . thus , bbb plays important role in management of endogenous and xenobiotic compounds by the brain and provides a layer of protection for the brain from harmful or foreign substances that may injure the brain . it also protects the brain from action of metals , toxicants , poisons , hormones , and neurotransmitters ( figure 1 ) . meanwhile , excess or entry of harmful compound is denied by special mechanisms and structures ; possibly , these can diffuse straight through capillary walls into the brain . these are stopped to move through the tight junctions , found between membranes of adjacent endothelial cells . more specifically , three different barrier layers limit and regulate molecular exchange at the interfaces between the blood and the neural tissue or its fluid spaces : the bbb between the blood and brain interstitial fluid , the choroid plexus epithelium between the blood and ventricular cerebrospinal fluid ( csf ) , and the arachnoid epithelium between the blood and subarachnoid csf . these are used for substances with a high lipid solubility and may move across the blood brain barrier by simple diffusion . more specifically , morphologically , the polar distribution of transport proteins mediates amino acid homeostasis in the brain . furthermore , endothelial cells that line cerebral microvessels also maintain microenvironment for reliable neuronal signaling and regulate transport of essential molecules . it also regulates influx and outfluxes of important ions and maintains immediate microenvironment of brain cells ( figure 1 ) . in brain capillary endothelium contains tight junctions which are tighter and more complex in comparison to endothelium found in other tissues . it is polarized into luminal and brain facing plasma membrane and transduces signals from the vascular system and from the brain . this allows molecules to pass through the cell membranes of endothelial cells and reach the brain . more specifically , lipid soluble molecules or micelles could pass through this varying structure , while lipid insoluble molecules are restricted from transport . more exceptionally , few molecules like glucose , oxygen , and carbon dioxide also actively transported across the barrier . these molecules perform various cellular functions mainly cell signaling and communication in the brain . in this mechanism bbb also limits the transfer of virus from blood to brain and protects the invasion of virus . thus , it acts as an anatomical barrier and avoids invasion of various pathogenic infections , toxic effects of drugs , and harmful wastes . indirectly , bbb assists in maintaining immune responses and protective functions . bbb greatly limits the efficacy of many neuroprotective drugs , but it allows the permeability of arsenicals , molybdate and methyl mercury , and toxic metals . it is only possible due to presence of an elaborate and dense network of capillary vessels that feeds the brain and removes waste products [ 21 , 22 ] . nevertheless , several disorders and diseases can affect the brain leading to some loss of bbb integrity . therefore , in a state of neuropathological diseases or virus pathogenesis , neural protection can be made by altered bbb functions for drug delivery . moreover , slight changes by loosening the tight junction could provide good delivery of drugs . hence , in present review article , endothelial transport and its important role in drug delivery for therapeutics and clinical care of cns related diseases have been widely elucidated in detail . due to selective and controlled transport of molecules , there occurs a concentration difference in several important constituents in cerebrospinal fluid from ecf ( extracellular fluid ) that occurs in the body parts . this is due to few cellular associations glued together to form physical obstructions which separate the blood components from ecf and isf . normally , concentration difference on both sides is physically controlled by certain physical barriers which prohibit large molecules from coming across the endothelial capillaries or from blood into the cerebrospinal fluid or into the interstitial fluid occuring in the brain . these barriers are blood cerebrospinal fluid barrier and the blood brain barrier that exist between blood and the cerebrospinal fluid and brain fluid , respectively . . meanwhile , in the capillary beds of most of the organs , rapid passage of molecules takes place from the blood through the endothelial wall of the capillaries into the interstitial fluid . it plays important role in maintaining composition of interstitial fluid much like that of blood . further , permeability of important molecules also keeps plasma membrane receptors and transporters of the cells bathed into the interstitial fluid and allows direct interactions with amino acids , vitamins , hormones , proteins , or other compounds of the blood . under normal conditions , the bbb acts as a barrier to toxic agents and safeguards the integrity of the brain . it is highly selective for transport of nutrients , gases , few peptide , neurotransmitters , and other ions of physiological use and is less toxic or nonharmful to the brain . most molecules can not diffuse across the bbb or through a pure phospholipid bilayer at rates sufficient to meet cellular needs , except two gases like co2 and o2 , and small hydrophobic molecules . bbb functions as a semipermeable membrane and disallows passage of large molecular substances from the blood into the cerebrospinal fluid or into the interstitial fluids of the brain , even though these same substances are readily transfered into the interstitial fluids of the body . hence , barriers exist both at the choroid plexus and at the tissue capillary membranes essentially in all areas of the brain parenchyma except in some areas of the hypothalamus , pineal gland , and area postrema where substances diffuse with ease into the tissue space . more specifically , simple diffusion occurs in these areas that are quite important because most of sensory receptors are attached to these regions which quickly respond to specific changes in the body fluids ; mainly , changes occur in osmolality and glucose concentration . further , these responses provide the signals for nervous and hormonal feedback regulation of each of the factors . in general , the blood cerebrospinal fluid and blood brain barriers are highly permeable to water carbon dioxide oxygen and most lipid soluble substances such as alcohol and aesthetics . these are slightly permeable to the electrolytes such as sodium chloride and potassium and impermeable to plasma proteins and most nonlipid soluble large organic molecules . therefore , the blood cerebrospinal fluid and blood brain barriers often make it impossible to achieve effective concentrations of therapeutic drugs such as protein antibodies and nonlipid soluble drugs in the cerebrospinal fluid or parenchyma of brain . more specifically , all essential molecules are transported across the barrier , while harmful molecules are denied entry , and bbb performs a very effective job of maintaining homeostasis for the most vital organ of the human body . in addition , there are few drugs / compounds which increase the permeability of the blood brain barrier temporarily by increasing the osmotic pressure in the blood which loosens the tight junctions between the endothelial cells . by loosening the tight junctions , restrictiveness of the barrier could decrease and makes it easier to allow a molecule to pass through it . but , this should be done in a very controlled environment because of the risk associated with these drugs . first , the brain can be flooded with molecules that are floating through the blood stream usually blocked by the barrier . secondly , when the tight junctions loosen , the homeostasis of the brain can also be thrown off , which can result in seizures and the compromised function of the brain . but , rate of entry of compounds that diffuse into the brain depends on their lipid solubility . moreover , substances with high lipid solubility may move across the blood brain barrier by simple diffusion , while lipid insoluble compounds are denied . for example , the permeability of lipid - soluble compounds , such as ethanol , nicotine , iodoantipyrine , and diazepam , is very high ; hence , their uptake by the brain is limited only by blood flow . in contrast , polar molecules , such as glycine and catecholamines , enter the brain very slowly , thereby isolating the brain from neurotransmitters in the plasma . more specifically , transport proteins are transmembrane proteins which contain multiple membrane spanning segments and are generally helix . these proteins lined the membrane and allow movement of hydrophilic substances without coming into contact with the hydrophobic interior of the membrane . meanwhile , few gases like o2 and co2 and small unchanged polar molecules such as urea and ethanol can move by simple diffusion across the membrane ( figure 3 ) . no metabolic energy is required for diffusion because these molecules simply move from a high to a low concentration in a gradient manner . thus , plasma membrane regulates the transport of molecules into and out of the cell by simple diffusion and active transport ( figure 4 ) . brain capillary endothelial cells contain three classes of transmembrane proteins which mediate transport of molecules , ions , sugars , amino acids , and other metabolites across cell membranes . most of these transport proteins are integral membrane proteins , which remain embedded in the plasma membrane and other membranes . these contain multiple transmembrane domains which permit the controlled and selective transport of molecules and ions across the membrane . these transmembrane proteins couple the energy released by hydrolysis of atp with the energy required for transport of substances against their concentration gradient . different classes of pumps belong to transmembrane protein family , exhibit characteristic structural and functional properties , and act as atp powered pumps or cassettes , channels , and transporters . these also work as atp - dependent efflux pump and are member of intrinsic membrane proteins like p - glycoprotein ( p - gp ) [ 26 , 27 ] . this pump also occurs in the luminal plasma membrane of bmec and prevents the intracellular accumulation of an extensive variety of chemotherapeutic agents and hydrophobic compounds . cytoplasmic matrix contains various kinds of ions which assist in maintaining osmotic pressure and acid base balance in the cells . retentions of ions in the matrix produce an increase in osmotic pressure that allows entrance of water in the cell . hence , a high order of difference exists between intracellular k and extracellular na in nerve and muscle cells . therefore , free calcium ions may occur in cells or circulating blood , while free ions of phosphate ( hpo4 and h2po4 ) occur in the matrix and blood . these ions maintain buffering system and tend to stabilize ph of blood and cellular fluids . thus , electrolytes play a vital role in the maintenance of osmotic pressure and acid base equilibrium in the matrix . electrolytes like na and cl move across by specific channels and transport proteins ( table 1 ) . more exceptionally , few important minerals occuring in matrix in nonionizing state are na , k , ca , cu , i , fe , mn , mo , cl , zn , co , ni , and so forth because of their much essential physiological need . thus , the composition of interstitial fluid resembles that of blood , and specific receptors or transporters in the plasma membrane of the cells being bathed by the interstitial fluid may interact directly with amino acids , hormones , or other compounds from the blood ( table 1 ) . more often , barrier limits the accessibility of blood - borne toxins and other potentially harmful compounds to the neurons of the cns because of restriction imposed by transcapillary movement of substrates in the peripheral circulation into the brain . this maintains major metabolic functions and physiology of neuronal network present inside brain and its regular supply is essentially required . interestingly , glucose transport occurs through both endothelial cells by facilitated diffusion and by glut 1 and glut 3 transporters [ 44 , 45 ] present on the surface of neurons and endothelial cells . normally , brain capillary endothelial cells possess insulin - independent , glut-1 glucose transporters which mediate the facilitated diffusion of glucose through the blood brain barrier [ 44 , 46 ] . moreover , rate of glucose transport through endothelium depends on energy metabolism occurring inside brain or depends on glucose utilization . thus , glucose itself functions as a rate limiting ligand or metabolite and it is transferred from ecf to neurons when its concentration falls in blood lower than the normal glucose level . when cellular concentration of glucose becomes high , its transport is obstructed automatically . further , transporters found on the surface of neuronal and endothelial cells differ in their activity . in fact , same transporters also occur on other cell membranes which transport two to three times more glucose than normally it is metabolized by the brain . thus glucose utilization depends on concentration resides with the cell that also determines its transport . but among all most common syndromes glucose transporter type 1 deficiency syndrome is important because it more severely effect glucose transport in children . thus , impairment of glut-1 results in a low glucose concentration in the csf and causes hypoglycorrhachia with clinical symptoms like seizures , mental retardation , and compromised brain development in children . moreover , most mammalian cells express glut1 uniporter transporter that transports blood glucose to fulfill cellular energy needs . this uniporter ( glut1 ) transporter traverses between two conformational sites or posses two phases one a glucose binding site faces the outside of membrane while glucose binding site faces inside ( table 2 ) , during the unidirectional transport of glucose from the cell exterior inward to the cytosol . hence , in a state when glucose concentration becomes higher inside the cellular outside , glut1 catalyze the net export of glucose from the cytosol to the extracellular medium . more specifically , it is the stereo specificity of the glucose transport system that permits transport of d - glucose , rather than l - glucose , to enter the brain . similarly , hexoses , such as mannose and maltose , are rapidly transported into the brain , while the galactose uptake takes place intermediately , and fructose uptake occurs very slowly . interestingly , uptake of 2-deoxyglucose occurs so fast that it competitively inhibits the transport of glucose . further , soon after glucose uptake and its transport into the cells , it is rapidly phosphorylated to form glucose 6 phosphate which can not be transported out of the cell . further , even if intracellular glucose level is low , then glucose is imported from the medium . sometime , the rate of glucose transport into the ecf normally exceeds the rate required for energy metabolism by the brain . thus , glucose transport becomes rate limiting if blood glucose levels fall lower than the normal range . in such hypoglycemic condition , glucose level lowers approximately to 60 mg / d which also reduced the km values of the glut-1 transporters found in the endothelial cells ( table 2 ) . moreover , monosaccharide transport proteins play important role in carbohydrate assimilation , distribution , metabolism , and homeostasis ( figures 3 and 4 ) . monocarboxylate transporters play important role in the maintenance of the glycolytic metabolism through proton linked transport of monocarboxylic acid ( figure 2 ) . these are transported by a separate stereospecific system that is slower than the transport system for glucose . in the cerebrovascular endothelium , monocarboxylic acid transporter 1 ( mct1 ) controls blood - brain transport of short chain monocarboxylic acids such as l - lactate , acetate , pyruvate , ketone bodies , acetoacetate and -hydroxybutyrate monocarboxylic and ketoacids to support energy metabolism and play potential role in treating brain diseases ( table 2 ) . monocarboxylate transporter ( mct ) isoforms 14 catalyze the proton - linked transport of monocarboxylates such as l - lactate across the plasma membrane , whereas mct8 and mct10 transporters transport thyroid hormone and aromatic amino acids . furthermore , mcts 14 also play important metabolic roles including energy metabolism in the brain , skeletal muscle , heart , tumor cells , t - lymphocyte activation , gluconeogenesis in the liver and kidney , spermatogenesis , bowel metabolism of short - chain fatty acids , and drug transport . these transporters showed their distinct properties , expression profile , and subcellular localization matching the particular metabolic needs of a tissue ( table 2 ) . mct1 function is acutely decreased in rat brain cerebrovascular endothelial cells by -adrenergic signaling through cyclic adenosine monophosphate ( camp ) . it constitutively cycles through clathrin vesicles and recycling endosomes in a pathway that is not dependent on camp signaling in endothelial cells . thus , regulated and unregulated vesicular trafficking of mct1 in cerebrovascular endothelial cells are highly significant for understanding normal brain energy metabolism , etiology , and potential of therapeutic approaches to treating brain strokes / diseases . normally , during fasting or starvation , level of ketone bodies in the blood gets elevated , and mct1 transporter gets upregulated . moreover in adults and neonates during prolonged starvation ketone bodies serve as important fuels for the brain . this results in an elevation rate and capacity of monocarboxylic acid transport substantially in suckling neonates . therefore , due to increased metabolic requirements of the developing brain in adults , higher concentrations of monocarboxylic acids are supplied in breast milk that fulfill energy needs of neonates . in addition , metabolism of short - chain fatty acids ( scfa ) , mainly acetate , appears to occur mainly in astrocytes and its transport in the brain is performed by monocarboxylic acid transporter family ( table 2 ) . it is inhibited by phloretin , a high - affinity inhibitor that binds to mct1 and slows down physiological activities . more often , potent and specific mct1 inhibitors can prevent proliferation of t - lymphocytes that may help to achieve promising pharmacological targets including cancer chemotherapy . brain and other tissue organs possess various structural barriers that are made up of cellular vasculature monolayer of endothelial cells . these cells form elaborate tight junction complexes that efficiently limit the paracellular transport of solutes . the bbb has a number of highly selective mechanisms for transport of nutrients into the brain . second is facilitated diffusion , a form of carrier - mediated endocytosis , in which solute molecules bind to specific membrane protein carriers . third is simple diffusion which occurs through an aqueous channel , formed within the membrane . fourth is active transport through a protein carrier with a specific binding site that undergoes a change in affinity . . moreover , movement between cells is paracellular diffusion , while diffusion across the cells is called transcellular diffusion . both types of diffusion mechanism are found in the brain , both of which are nonsaturable and noncompetitive . it occurs due to free - energy change of a solute diffusing across a membrane that directly depends on the magnitude of the concentration gradient . moreover , para cellular diffusion does not occur to any great extent at the bbb , due to presence of tight junctions or structural barriers . moreover , para cellular diffusion does not occur to any great extent at the bbb , due to presence of tight junctions or structural barriers but in transcellular diffusion , the general rule is followed that is higher the lipophilicity of a substance ; greater will be its diffusion into the brain . more specifically , biogenic amines are transported through bbb by diffusion and it never occurs by carrier - mediated transport . contrary to this , for uptake of other substances , uptake1 carrier involves that occuring at the luminal surface of bbb . more specifically , if two substances are similar , but vary in molecular weight , the smaller substance will penetrate more rapidly ; consequently , small inorganic molecules ( i.e. , o2 , co2 , no , and h2o ) are highly permeable . additionally , hydrogen bond reduction of a compound will enhance its membrane permeability . removal or masking of hydrogen bonding donor group from a compound will effectively decrease the transfer energy from water into the cell membrane . more specifically , capillary endothelial cells also possess wide range of transporters that selectively transport solutes and xenobiotics . these transporters are found at the luminal ( blood ) side of membranes in vivo and maintain specific transport mechanisms for transport of various biomaterials . the capillary beds most of organs , allow rapid passage of molecules from blood through the endothelial wall of the capillaries into the interstitial fluid . therefore , diffusion or transport of biomolecules across the membrane is operated with the help of integral and transmembrane proteins and receptors . meanwhile , transported molecules and ions interact to specific receptors or transporters in the plasma membrane of the cells . these receptors remain embedded or bathed by the interstitial fluid and may interact directly with amino acids , hormones , or other compounds from the transported or transferred from blood . due to semipermeable nature of bbb , many nonpolar substances , such as drugs and inert gases , directly diffuse through the endothelial cell membranes , while a large number of other compounds are transported through the endothelial capillaries by facilitative transport . contrary to this , nonessential fatty acids can not come across the blood brain barrier but essential fatty acids are transported across the barrier . further , metabolic fuels , monocarboxylic acids , ethanol , vitamins and neurotransmitters are carried by carrier - mediated transport because low lipid soluble biomolecules can traverse the blood brain barrier . but , water and gases like o2 , co2 , and no2 diffuse directly across the endothelial wall ( table 2 ) . the spaces between cells can be likened to the water phase of foam and many substances move within this complicated region . diffusion in this interstitial space quantified from measurements based on novel microtechniques . besides delivering glucose and oxygen from the vascular system to brain cells , therefore , diffusion is also found essential to many therapies that deliver drugs to the brain . the diffusion - generated concentration distributions of well - chosen molecules also reveal or image the structure of brain tissue . these concepts and methods are highly applicable for making therapeutic measures for improvement of neurodegenerative diseases . in state of any infection , therefore , patients under different physiological and pathological conditions show nonrespiratory acidosis and a decrease in pao2 induced an increase of cbf when the oxygen tension in cerebral venous blood fell below 3540 mm hg . at the same time , the cerebral glucose uptake , the cerebral lactate output , and the lactate - pyruvate ratio in cerebral venous blood increased . critical conditions occurred for the oxygen supply of the brain when cerebral venous po2 fell below approximately 30 mm hg . disease state and invasion of infection largely affect hematocrit , vascular diameter , blood viscosity , blood flow , metabolic rate , nonlinear oxygen dissociation curve , arterial po2 , p50 ( oxygen tension at 50% hemoglobin saturation with o2 ) , and carbon monoxide concentration . finally , the various types of hypoxia such as hypoxic , anemic , and carbon monoxide hypoxia arise . more often , systemic and myocardial oxygen transport shows responses to brain death in pigs . both svr and eo(2 ) decreased after brain death ( p < .01 ) and remained low , while lactate level remains unchanged . moreover , profound metabolic alterations occur in condition of brain death and major complications are related to oxygen transport and its supply . it is clear that capillary blood flow played an important role in the transport of gases and extra vascular vasomotor action . the exchange of gases such as co2 , o2 , n2o , and xe and volatile anesthetics in cerebral tissues takes place rapidly by simple diffusion ( table 2 ) . this depends on cerebral blood flow and cerebral metabolic rate of oxygen consumption in the cortical capillary levels . direct external application of oxygen to cerebral cortex causes cerebral vasoconstriction , while carbon dioxide resulted in dilation of cerebral vessels . further , concentration of these gases in the brain comes into equilibrium with the plasma which is primarily limited by the cerebral blood flow rate . in addition , gaseous exchange brain also depends on pure ventilation and neurological , physiological , and pathological state . moreover , end tidal carbon dioxide acts as a marker of stress response in patients , while inert gases , like n2o and xe , can be used as markers to measure cerebral blood flow . an interesting contrast is observed between co2 and h with regard to their effects on brain ph . as the permeability of co2 greatly exceeds in bbb than the h , the ph of the brain interstitial fluid reflects blood pco2 rather than blood ph . interestingly , central respiratory chemoreceptors sense the changes that occur after alteration in co2 concentration and ph in the brain tissue . consequently , patients which facing metabolic acidosis show compensatory respiratory alkalosis , and their brain contain high ph and become alkalotic . besides these gases , ammonia is believed to play key role in the development of hepatic encephalopathy with increased formation of glutamine playing a central role . ammonia passes through bbb by passive diffusion , while nitric oxide donor induces long - term survival in rats . water rapidly enters the brain passing through capillary membranes via the intercellular gaps between or pores in the endothelial cells or special areas where the cytoplasm is very thin . normally , due to high permeability , water moves freely into or out of the brain as the osmolality of the plasma changes . in addition , cell membrane possesses specific channels or pores through which diffusion of water occurs in association of certain proteins . these proteins allow water and few other small uncharged molecules such as glycerol to cross biomembrane . these proteins are found in all living organisms and at least 6 different water channel proteins have been identified in various cell membranes in humans . these aquaporin proteins form complexes that span the membrane and water moves through these channels passively in response to osmotic gradients ( table 2 ) . these channel proteins are present in highest concentrations in tissues where rapid transmembrane water movement occurs , for example , in renal tubules . moreover , aquaporin 0 found in the lens in the eye has a role in maintaining lens clarity . while aquaporin 1 occurs on the red cell membrane , and proximal convoluted tubule , thin descending limb of the loop of henle in the kidney , choroid plexus , smooth muscle , unfenestrated capillary endothelium , exocrine sweat glands , hepatic bile ducts and gallbladder epithelium where it perform water diffusion moreover , aquaporin 2 is adh - responsive water channel specifically found in the collecting duct in the inner medulla . furthermore , insertion of the channel into the apical membrane also occurs following adh stimulation . aquaporins 3 and 4 normally are found in the basolateral membrane in the collecting duct but they are not altered by adh levels . recently , aquaporin 4 has also been identified in the adh - secreting neurons of the supraoptic and paraventricular nuclei in the hypothalamus that functions as a hypothalamic osmoreceptor and regulates body water balance . thus , aquaporins increase the water permeability of cell membranes , while other membranes of aquaporins family transport hydroxyl - containing molecules such as glycerol rather than water . aquaporins or water channel proteins are also found in insects the western tarnished plant bug , lygus hesperus ( table 2 ) and plants . these gaps function as flap valves and promote forward lymph flow when the capillaries are compressed . in other areas of the body , the water permeability of capillary membranes is quite low , because pores or slits are lacking in the blood brain barrier and it greatly limits water movement by the intercellular pathway . but , lipid composition of different cell membranes varies , which determines rate of fluid flow across cell membranes that greatly varies . in some membranes , the water flux is very high and can not be accounted for water diffusion across lipid barriers . therefore , it is possible and operative that membranes possess some proteins that form aqueous channel through which water can pass . this is inferred in artificial lipid bilayers ; water does not cross membrane easily , and the same process occurs in natural membranes . in addition , substances , which are water - soluble typically , do not cross lipid membranes easily unless specific transport mechanisms are present . nevertheless , paradoxically , water crosses nearly all the membranes in the body with ease . moreover , water permeability and transport are regulated by the capillary endothelium and rate of cerebral blood flow . in fact , in normal condition permeability , constant of the cerebral capillary wall to the diffusion of water is about the same as that required for its diffusion across lipid membranes . thus , osmotic pressure allows water to move across membranes and its unavailability produces deficiencies known as fenestrations and diffusion across the lipid cell membranes of the endothelial cells . fenestrations are found only in capillaries in special areas where very high water permeability is necessary for the function of these areas . these fenestrated capillaries and vascular sinusoids permit rapid exchange of water and solute between the plasma and extracellular fluid and supply the choroid plexus ( table 2 ) . high water permeability is maintained in glomerular capillaries found in kidney than in muscle capillaries . other areas with fenestrations are the capillaries in the intestinal villi and in ductless glands . once alcohol is consumed , it leaves the gastrointestinal ( gi ) tract and enters into the bloodstream through blood capillaries . it is carried to the heart by streaming blood , from where alcohol is sent to the lungs and also come back to the heart with the oxygenated blood . alcohol is pumped through the arterial system and distributed in all organs of the body . unfortunately , in the brain , there is no barrier for ethanol and it crosses the blood brain barrier very easily . it is a polar solvent , lipophilic in nature that mixes easily with the fat in the membrane . it makes it easy for ethanol to cross the blood brain barrier . in the case of other biological membranes , ethanol moves across by filtration moving through water spaces because it dissolves in water , where it is absorbed by passive diffusion and moves with the concentration gradient through the membrane . similarly , in the brain capillaries , due to lipophilic property , ethanol allows moving by passive diffusion across the endothelial cell membrane and through the astrocyte layers . similarly , small lipophilic drugs diffuse passively across the blood brain barrier including nicotine , marijuana , and heroin that cause intoxication in the brain ( table 2 ) . contrary to this , water - soluble nutrients such as glucose and large water - soluble molecules such as vitamins need specific transporters to be transported across the bbb . increased uptake of alcohol increases neurobiological effects and alters basal extracellular glutamate concentrations and clearance in the mesolimbic system of alcohol - preferring . alcohol - induced oxidative / nitrosative stress alters brain mitochondrial membrane properties in experimental animals ( table 2 ) . vitamins are indispensable dietary compounds which require in small amounts few micrograms to milligrams per day to be present in our food . they are low molecular weight compounds and their insufficient intake causes malnutrition and multiple metabolic defects and diseases . vitamin deficiency causes certain physiological and biochemical abnormalities which affect body metabolism , growth , and development . vitamins can not be synthesized inside body and are required in small amounts to support normal metabolism . they are needed for normal function , growth , and maintenance of body tissues and for regulation of chemical reactions in the body . vitamin d affects brain development and function and its low levels cause neuropsychiatric diseases like autistic spectrum disorder and schizophrenia . vitamin d deficiency in early life affects neuronal differentiation , axonal connectivity , dopamine ontogeny , and brain structure and function ( table 3 ) . deficiency of vitamin e may cause neurological dysfunction , myopathies , and diminished erythrocyte life span . chemically , vitamins belong to diverse classes of compounds and are classified according to their solubility into water and fat . since vitamins can not be synthesized by the brain , they must be obtained from the blood . thus , specific transport systems are required for carrying vitamins across blood brain barrier ( table 3 ) . generally , these transport systems possess a low capacity since the brain requires only small amounts of the vitamins and efficient homeostatic mechanisms preserve brain vitamin content without the need for a rapid influx from the blood . how vitamins are transferred across the mammalian blood brain barrier and choroid plexus into brain and csf and how vitamin homeostasis in brain is achieved is an important issue ( table 3 ) . the majority of vitamins are water - soluble but a few vital vitamins such as a , d , e , and k are fat - soluble . they are absorbed in the lymph and are transported in the blood with carrier proteins , from which these are delivered to the brain . both fat - soluble and water - soluble vitamins have different mechanism of absorption and transport . the water - soluble vitamins are b and c which are absorbed easily through diffusion ( table 3 ) . the b vitamins include thiamin , riboflavin , niacin , folate , pyridoxine , and b12 . the water - soluble vitamins are easily dissolved and can be excreted in the urine . transport and metabolism of vitamin b6 forms are transported across brain and choroid plexus in nonphosphorylated b form and have separate carriers ( table 3 ) . moreover , after transport , vitamins are accumulated by brain cells by separate , specialized systems . more often , both cofactor and noncofactor vitamins ( e.g. , of b(1 ) , b(3 ) , b(6 ) , and e ) have potential role in the therapy of brain disorders . in bacteria , e. coli vitamin b12 permease is abc protein transporter that imparts a variety of molecules form the environment . these transport proteins contain two transmembrane domains ( t ) and two cytosolic atp binding domains . in mammals , nearly 50 different abc transporter proteins are known these are mostly expressed in the liver , intestine , kidney , and brain sites where natural toxic and waste products are removed by the body . the main substrates of these abc transporter proteins are sugar amino acids , cholesterol , bile acids , phospholipids , peptides , proteins , toxins and foreign substances ( table 3 ) . more specifically , some abc proteins flip phospholipids and other lipid soluble substrates from one membrane leaflet to the opposite leaflet ( table 3 ) . vitamin c crosses the blood brain barrier in the oxidized form through the glucose transporters . in contrast , the oxidized form of vitamin c , dehydroascorbic acid ( oxidized ascorbic acid ) , readily enters the brain and is retained in the brain tissue in the form of ascorbic acid . more specifically , glucose glut1 also transports dehydroascorbic acid into the brain and its transport is inhibited by d - glucose , but not by l - glucose ( table 3 ) . the facilitative glucose transporter , glut1 , is expressed on endothelial cells at the blood brain barrier and is responsible for glucose entry into the brain . it is an important mechanism by which the brain acquires vitamin c. further , oxidation of ascorbic acid is an important regulatory step in accumulation of the vitamin by the brain . vitamin c concentrations in the brain exceed those in blood by 10-fold . in both tissues , fat - soluble vitamins such as a , d , e , and k are absorbed in the lymph and are transported in the blood with the help of specific carrier proteins , from which these are delivered to the brain .. transport of vitamins a ( retinol , retinoic acid ) and d ( 1,25-dihydroxyvitamin d3 [ 1,25-(oh)2d3 ] and 25-hydroxyvitamin d3 [ 25-(oh)d3 ] ) derivatives through the rat brain capillary endothelial wall , that is , the blood brain barrier ( bbb ) , occurs in two forms ( table 3 ) : first , after binding to albumin and a plasma transport protein to which these vitamins bind with specific high - affinity . moreover , vitamin d and its hydroxylated metabolites are transported in the blood , bound to a transport protein dbp that is also very important in the placental transfer of 25-hydroxy - vitamin dl . moreover , during absorption from the intestine , vitamin a and -carotene become finely dispersed in the intestinal fluid in mixed lipid micelles formed with the aid of bile salts , lysolecithin , lower glycerides , and cholesterol . these facilitate the transfer of the vitamin and other lipid components across the mucosal cell membrane . more specifically , physiologically active vitamin a alcohol on the other hand is attached to a specific protein carrier with properties very similar to ceruloplasmin in the 2-globulin fraction ( table 3 ) . vitamin e includes eight naturally occurring fat - soluble nutrients called tocopherols and dietary intake of vitamin e activity is essential in many species ( table 3 ) . -tocopherol is absorbed via the lymphatic pathway and transported in association with chylomicrons . in plasma , alpha - tocopherol is found in all lipoprotein fractions but mostly associated with apo - b - containing lipoproteins in man . in rats , approximately 50% of alpha - tocopherol after intestinal absorption and transport with chylomicrons , alpha - tocopherol is mostly transferred to parenchymal cells of the liver where most of the fat - soluble vitamin is stored . very small amount of vitamin e is stored in the nonparenchymal cells ( endothelial , stellate , and kupffer cells ) . -tocopherol is secreted in association with very low density lipoprotein ( vldl ) from the liver . in the rat , about 90% of total body mass of alpha - tocopherol is recovered in the liver , skeletal muscle , and adipose tissue . most -tocopherol is located in the mitochondrial fractions and in the endoplasmic reticulum , whereas little is found in cytosol and peroxisomes ( table 3 ) . normally , vitamin e derived from food is absorbed in the intestine and then transported into the liver on molecules called chylomicrons . after a meal , chylomicrons are formed to transport fat - soluble vitamins ( such as vitamin e ) , dietary fats , and cholesterol from the intestine to the liver . once in the liver , ttp transfers vitamin e from chylomicrons to very low - density lipoproteins ( vldls ) , which carry fat , fat - soluble vitamins , and cholesterol from the liver to other tissues throughout the body . the vldls are then released into the bloodstream so the accompanying vitamin e can be used in the body . the ttp protein is also thought to transport vitamin e to nerve cells ( neurons ) in the brain . vitamins or their derivatives perform important roles as catalysts of enzymatic reactions ; hence , they are also known as coenzymes . biotin , pyridoxal - phosphate , and riboflavin can be covalently bound to the apoenzymes and are called prosthetic groups . the ttpa gene provides instructions for making the -tocopherol transfer protein ( ttp ) , which is found in the liver and brain . this protein controls the distribution of vitamin e obtained from the diet ( also called -tocopherol ) to cells and tissues throughout the body . vitamin e is an antioxidant that protects cells in the body from the damaging effects of unstable molecules called free radicals ( table 3 ) . quinone compounds act as membrane resident carriers of electrons between components of the electron transport chain in the periplasmic space of prokaryotes and in the mitochondria of eukaryotes . vitamin k is a quinone compound in the human body in a storage form as menaquinone ( mk ) ; distribution includes regulated amounts in mitochondrial membranes . the human brain , which has low amounts of typical vitamin k dependent function ( e.g. , gamma carboxylase ) , has relatively high levels of mk , and different regions of brain have different amounts . coenzyme q is a quinone which synthesizes de novo , and its levels of synthesis decline with age . a newly recognized fumarate cycle has been identified in brain astrocytes ( table 3 ) . slc23a1 is ascorbic - acid transporter that is essential for vitamin c transport into the brain , many tissues ( table 3 ) . vitamin c crosses the placenta and is essentially required in the perinatal period ( sotiriou et al , 2002 ) . it is used to prevent scurvy and works as a cofactor for hydroxylases required for posttranslational modifications that stabilize collagen . moreover , few specific nonoverlapping transport proteins mediate the transport of the oxidized form of vitamin c , dehydroascorbic acid , and the reduced form , l - ascorbic acid , across biological membranes . vitamin c also crosses the blood - brain barrier in the oxidized form through the glucose transporters ( table 3 ) . dehydroascorbic acid uptake occurs by facilitated - diffusion glucose transporters , glut 1 , 3 , and 4 , but under physiological conditions . these transporters are unlikely to play a major role in the uptake of vitamin c due to the high concentrations of glucose that effectively block its influx . in addition , l - ascorbic acid enters cells via na - dependent systems that have two isoforms svct1 and svct2v transporters . transport by both isoforms is stereospecific , with a ph optimum of approximately 7.5 and a na and ascorbic acid stoichiometry of 2 : 1 . svct2 may exhibit a higher affinity for ascorbic acid than svct1 but with a lower maximum velocity . the two isoforms also differ in their tissue distribution : svct1 is present in epithelial tissues , whereas svct2 is vitamin c transport systems of mammalian cells occuring in most tissues with the exception of lung and skeletal muscle and mammalian cells ( table 3 ) . neurotransmitters are small , water - soluble molecules which are diffused across the membrane of presynaptic and post synaptic neuron fiber first category is amino acids such as glutamic acid , gaba , aspartic acid , and glycine ; second category is of peptides such as vasopressin , somatostatin , and neurotensin ; third category is of monoamines like norepinephrine , dopamine , serotonin , and acetylcholine . among all neurotransmitters , glutamic acid ( = glutamate ) and gaba are major neurotransmitters of the brain but monoamines and acetylcholine perform specialized modulating functions , often confined to specific structures . the peptides neurotransmitters perform specialized functions in the hypothalamus and act as cofactors elsewhere in the brain . based on chemical nature and receptor binding brain , for example , glutamate performs excitatory function , whereas others ( like gaba ) are primarily inhibitory ( table 4 ) . these are receptors which determine whether a transmitter acts rapidly by direct action on an ion channel ( e.g. , nicotinic acetylcholine receptors ) or slowly by a second - messenger system that allows for synaptic plasticity ( e.g. , muscarinic acetylcholine receptors ) . interestingly , both speed and mechanism of transmitter inactivation after the signal also act as a factor . in addition , different neurotransmitters such as acetylcholine , serotonin , and catecholamine are synthesized , released , transported , inactivate , and signal in different manner . these widely differ in delivery in neuronal circuits located in the brain ( table 4 ) . more often , cns contains many neurotransmitters but peripheral nervous system contains acetylcholine and norepinephrine neurotransmitters . it is usually but not always an excitatory neurotransmitter in contrast to the monoamine neurotransmitters , which are nearly always with a few exceptions inhibitory . acetylcholine is synthesized in the brain from acetyl - coa and formed in glucose metabolism and is in association with choline , which is actively transported across the blood brain barrier . the acetyl - coa and choline are independently synthesized in the neuron cell body ( motor neurons ) . most dietary choline comes from phosphatidyl choline ( table 4 ) , the major phospholipid in the membranes of plants and animals , but it does not occur in bacteria . acetylcholine is independently transported along the axon to the synapse where they are conjugated into acetylcholine . acetylcholine receptors are located on the surface of post synaptic cell membrane of nerve cells of brain as well as outside the brain on muscle cell surface where it controls excitation . acetylcholine is transported through receptor - mediated transport either by ligand gated channels or by g protein coupled receptor receptors . acetylcholine is largely inhibited by certain molecules such as dimethyl aminoethanol , hemicholinium , and tetraethyl ammonium chloride . as it is true that the brain and its blood brain barrier can not synthesize choline , its transport occurs by transporters which regulate the formation of acetylcholine in the central nervous system ( table 4 ) . moreover , binding of neurotransmitters to a g protein coupled receptor induces the opening and closing of a separate ion channel protein over a period of seconds or minutes . more exceptionally , neurotransmitters , mainly opioids , are directly released from the brain to the blood through saturable glycoproteins ( pgp ) transport system . it is also true that all neurotransmitters are released by exocytosis , which involves certain molecular events and protein complexes . moreover , bisazaaromatic quaternary ammonium salts act as ligands for the blood brain barrier choline transporter , by exploiting nutrient transporters at the blood brain barrier , and can improve brain distribution of small molecules , while stress induces choline transport across blood barrier ( table 4 ) . , it is released into a synapse and binds to a receptor which makes the postsynaptic membrane more permeable to cl ions . aspartate is neurotransmitter that is primarily localized to the ventral spinal cord and opens an ion channel . aspartate is an excitatory neurotransmitter , which increases the likelihood of depolarization in the postsynaptic membrane . moreover , both glutamic acid and aspartic acid are the two acidic amino acids found in proteins which possess 2 carboxyl groups . interestingly , both of these form an excitatory / inhibitory pair in the ventral spinal cord comparable to the excitatory / inhibitory pair formed by glutamate and gaba in the brain . it is always excitatory , because of simple receptors that increase the flow of positive ions by opening ion channels . glutamate stimulation is terminated by a ( chloride - independent ) membrane transport system that is only used for reabsorbing glutamate and aspartate across the presynaptic membrane . glutamate and aspartate reenter the cell by a transporter driven by the high extracellular concentrations of na and the high intracellular concentrations of k. sodium enters the cell along with the amino acids , while potassium leaves the cell in similar proportion . thus , entry of both glutamate and asparate is indirectly powered by the atp - driven na - k - ase ( sodium pump ) which creates the high ion concentration gradients ( table 4 ) . hence , it is either supplemented in the diet as synthetic chemical or supplied by any exogenous source . aspartate binds specifically to the nmda glutamate receptor which is regulated both by a glutamate molecule and by voltage . nmda receptors interact with ligand repeatedly and develop capacity for an activity - dependent increase in synaptic efficiency that work as long - term potentiation or ltp , which plays important role in learning and memory . nmda receptors are found densely concentrated in the cerebral cortex mainly in hippocampus ( ca1 region ) amygdala and basal ganglia . these are highly vulnerable to glutamic acid that makes damaging effects due to excessive excitatory neurotransmitter release . similarly , excitotoxicity due to glutamic acid is a major destructive process seen in stokes and other forms of brain ischemia . moreover , granule cells of the dentate gyrus of the hippocampus are rich in nitric oxide synthetase . glutamate stimulation of nmda receptors results in nitric oxide synthesis and enhancing neurotransmitter release from adjacent synapses . similarly , monosodium glutamate ( msg ) occurs as a major component of soya sauce and destroys nerve cells when fed to young animals . normally it does not cross the blood - brain barrier but functions as a neurotransmitter is an important question . increased alertness ( or anxiety ) due to caffeine may be mainly due to blockage of adenosine receptors which normally inhibit glutamate release . in turn , glutamate released into synapses is either reabsorbed directly into neurons by the ion - exchange transport system or is soaked up by astrocytes or glial cells which convert the glutamate into glutamine a molecule which can not cause excitotoxicity . one of the damaging effects of mercury poisoning is swelling of astrocytes , which are rendered unable to soak up glutamine from synapses contributing to excitotoxicity ( table 4 ) . gaba is the major inhibitory neurotransmitter of the brain , occurring in 3040% of all synapses . its concentration in the brain is 2001000 times greater than that of the monoamines or acetylcholine . it occurs highly concentrated in the substantia nigra and globus pallidus nuclei of the basal ganglia , followed by the hypothalamus , the periaqueductal grey matter , and the hippocampus . gaba receptor is connected to a chloride ion channel that allows more chloride ions to enter inside the cell and make the membrane less likely to depolarize . gaba is synthesized in the brain from the krebs citric acid molecule , that is , keto glutarate ( table 4 ) . gaba is commonly inactivated after release into the synapse by active transport into the astrocyte glial cells that are closely associated with synapses . gaba is synthesized from glutamic acid and is catabolized back into the citric acid cycle . it imposes inhibitory effects on the brain neurons that show protective role during hypoxia or ischemia . in fact , potentiation of chloride influx into neurons is a major mechanism in the effect of ethanol on the brain ( table 4 ) . both dopamine and epinephrine are primarily inhibitory neurotransmitters and make postsynaptic cells inhibitory for catecholamines . there are 3 - 4 times more dopaminergic cells in the cns than adrenergic cells . dopamine in the caudate nucleus facilitates posture , whereas dopamine in the nucleus is found associated with animal 's speed and pleasure . there are two primary dopamine receptor types : d1 ( stimulatory ) and d2 ( inhibitory ) ; both act through g - proteins d2 receptors ( table 4 ) . moreover , amino acid tyrosine is converted into dihydroxyphenylalanine ( dopa ) by the tyrosine hydroxylase enzyme using oxygen , iron , and tetrahydrobiopterin ( thb ) that act as cofactors . high concentrations of dopamine inhibit tyrosine hydroxylase activity through an influence on the thb cofactor . there are four main dopaminergic tracts in the brain the nigrostriatal tract , tuberoinfundibular tract , mesolimbic tract , and mesocortical tract . dopamine is also responsible for induction of vomiting by stimulation of d2 cells in the chemoreceptor trigger zone , stimulation of growth hormone release by d2 receptors , and increased exploration and locomotion . interestingly , in the males , sexual behavior is increased by dopamine agonists , whereas sexual behavior in females is increased by dopamine antagonists . moreover , for treatment of parkinsonian patients dopa , treatment is given but it develops psychotic symptoms resembling schizophrenia ( table 4 ) . it is synthesized from dopamine means of the enzyme dopamine beta - hydroxylase ( dbh ) , with oxygen , copper , and vitamin c as cofactors inside adrenal medulla . dopamine synthesis occurs in the cytoplasm , but norepinephrine is synthesized in the neurotransmitter storage vesicles . cells which utilize norepinephrine for formation of epinephrine use s - adenyl methionine ( same ) as a methyl group donor , an elevated level of cortisol in the medulla , induce phenylethanolamine n methyltransferase ( pnmt ) , an enzyme which catalyzes the conversion of norepinephrine to epinephrine . the most prominent norepinephrine - containing ( noradrenergic ) nucleus identified is locus ceruleus located in the pons , which accounts for over 40% of noradrenergic neurons in the rat brain . other noradrenergic neurons are clustered in lateral tegmental area , neocortex , hippocampus , and cerebellum that receive noradrenergic stimulation exclusively from the locus ceruleus ( table 4 ) . epinephrine plays important role in short - term and long - term regulator of stress and development of illness . similarly , imipramine and amitriptyline are inhibitors of norepinephrine and serotonin reuptake by the presynaptic terminals but are more potent for serotonin . beta - noradrenergic receptors also apparently inhibit feeding , whereas alpha - receptors seem to stimulate feeding . moreover , mao inhibitors reduce metabolism of all catecholamines ; it is believed that the antidepressant effect is more related to norepinephrine than to dopamine . more specifically , tricyclic antidepressants such as amitriptyline 3-ring structure increase appetite that is considered as a side effect that is induced in weight gain . contrary to this , both cocaine and amphetamine reduce appetite . but , cocaine acts as a potent inhibitor of catecholamine reuptake , but it does not act as an antidepressant . however , excessive cortisol secretion causes depression and is associated with diminished noradrenergic inhibition of corticotropin - releasing hormone secretion in the hypothalamus which induces anxiety in experimental animals . similarly , triple reuptake inhibitors ( tris ) inhibit serotonin - norepinephrine - dopamine reuptake , enhance monoaminergic neurotransmission by blocking the action of the monoamine transporters , and raise extracellular concentrations of these neurotransmitters in baboons and humans ( table 4 ) . similarly , it is also well confirmed that catecholaminergic and serotonergic neurotransmitter systems are implicated in the pathophysiology of attention - deficit / hyperactivity disorder ( adhd ) . the amino acid tyrosine is the precursor for synthesis of the catecholamines dopamine and norepinephrine , while tryptophan is the precursor of serotonin . similarly , a disturbed transport of tyrosine , as well as other amino acids , generates number of psychiatric disorders , such as schizophrenia and bipolar disorders . moreover , an altered tryptophan and alanine transport in fibroblasts causes attention - deficit / hyperactivity disorder in growing juveniles ( adhd . in addition , natural antioxidant compounds , which pass through bbb , are better neuroprotective agents and show novel approach towards excitotoxicity protection and oxidative stress associated with excess amyloid ( a ) preservation in ad . both gsh and ( r)--lipoic acid ( la ) get covalently linked with the nmda receptor antagonists memantine ( mem ) and are used in treatments of alzheimer 's disease ( ad ) . it is a symptomatic approach based on the use of cholinesterase inhibitors or n - methyl - d - aspartate ( nmda ) receptor antagonists . norepinephrine transporter ( net ) plays important role in pathophysiology of many neurodegenerative diseases such as alzheimer 's disease and hyperactivity disorders . dopamine , norepinephrine , and serotonin excess and their respective amino acid precursors have also been associated with brain dysfunction . furthermore , decreased availability of acetylcholine during critical illness leads to decreased counter - regulatory activity in response to inflammatory disease states that causes additional injury and neurotransmitter imbalances ( table 4 ) . serotonin is a neurotransmitter which is independently synthesized from tryptophan transported across the blood brain barrier . normally , its 1 - 2% concentration is found in the brain but highest concentration occurs in the pineal body . serotonin synthesis is a 2-step process , the first step of which requires the enzyme tryptophan hydroxylase with oxygen , iron , and thb as cofactors . neither the enzyme nor the cofactors are rate limiting for either step of these reactions . serotonin concentration in the brain is far more sensitive to the effects of diet than any other monoamine neurotransmitter . hence , consumption of a meal rich in carbohydrate , branch - chained amino acids , and tryptophan has a particularly dramatic effect because both glucose from carbohydrate and branch - chained amino acids ( especially leucine ) increase insulin secretion . insulin facilitates the transport of the branch - chained amino acids into muscle cells , thereby reducing the competition tryptophan faces for the large neutral amino acid transporter that takes it across the blood brain barrier . in mammals , norepinephrine stimulation of pineal cells causes the release of cyclic amp second - messenger , which activates ( phosphorylates ) the n - acetyl transferase enzyme which catalyzes acetylation of serotonin ( table 4 ) . melatonin ( mel ) is an endogenous neurohormone that performs many biological functions and shows powerful antioxidant effect . it is synthesized from serotonin in a 2-step process that takes an acetyl group from acetyl - coa and a methyl group from by same ( sadenosyl methionine ) . melatonin induces pigment lightening in cells and acts as a neurotransmitter that regulates diurnal ( circadian ) and seasonal behavior and physiology in mammals . melatonin ameliorates neural function by promoting endogenous neurogenesis through the mt2 melatonin receptor in ischemic - stroke mice . this results in preservation of bbb integrity and enhances endogenous neurogenesis by upregulating neurodevelopmental gene / protein expression . circulating melatonin can modulate baroreceptor reflex control of hr , thus resetting it toward lower hr values . the modulatory effects of melatonin may be mediated via melatonin receptors in the area postrema , located outside the blood brain barrier ( table 4 ) . mel protects the brain tissue from the oxidative stress induced hypobaric hypoxia ( hh ) and prohibit loss of pericellular haloes , shrunken neurons with scanty cytoplasm and hyperchromatic , pyknotic or absent nuclei ; reactive gliosis and edema . melatonin counteracts the deleterious effects of oxidative stress and defies neuronal death , reactive astrogliosis , memory impairment , and cognitive dysfunctions . therefore , all dietary supplements containing melatonin are proved highly useful because of their neuroprotective activities for the therapy of hypoxia - induced consequences . melatonin in humans acts as an inhibitor of sexual activity and also stimulates production of brown adipose tissue , a special form of fat which ( when burned ) only produces heat , not atp . similar to melatonin , insulin in the brain also regulates the metabolism , molecular composition , and cognitive performance of microcircuits and reduces food intake ; cerebral insulin levels are altered in diabetes , aging , obesity , and alzheimer 's disease . . local application of glucose or glibenclamide to neurogliaform cells mimics the excitation suppressing effect of external insulin on local microcircuits via insulin receptors . there is an increase in vascular disorders such as hypertension and alzheimer 's disease ( ad ) . there is association between hypertension and an increased risk of developing ad in population and antihypertensive medications in the management of cognitive disorders which improve independent blood pressure lowering effects and lead to better treatment and/or prevention options for ad ( table 4 ) . they are all synthesized on ribosomes and are inactivated by hydrolysis at the synapse rather than by reuptake . peptides are far more potent than other neurotransmitters , requiring only very small amounts to produce a profound effect . the highest concentration of opioid receptors is found in the sensory , limbic , and hypothalamic regions of the brain and is particularly high in the amygdala and periaqueductal grey area . opioids tend to be released as slower - acting cotransmitters which modulate the action of the associated neurotransmitter ( such as glutamate ) which is being released from the same synapse . although opioids are generally inhibitory , they have an excitatory effect on hippocampal pyramidal neurons mediated by inhibition of gaba release ( table 4 ) . neuropeptides play a crucial role in the normal function of the central nervous system and peptide receptors hold great promise as therapeutic targets for the treatment of several cns disorders . but , it is very difficult to harness drug - like properties of peptides to transform them into marketable therapeutic molecules because of their poor stability , solubility , and incompatibility . moreover , recent technical advances have broken these limitations and so many therapeutic peptide drugs are developed to treat a wide range of diseases such as diabetes , cancer , and pain . further , the same is favored and practiced by clinicians for potential utility of agonists at central neurotensin , cholecystokinin , neuropeptide y , and oxytocin receptors . moreover , successful approaches have been developed to increase the stability and longevity of peptides in vivo ( table 4 ) . it leads to the improvement in delivery because of easy penetration across the blood brain barrier , . further , therapeutic potential of peptide agonists is also harnessed for the treatment of major cns disorders such as schizophrenia , anxiety , depression , and autism . neuropeptides are signaling molecules which participate in the modulation of synaptic transmission and are stored in dense core synaptic vesicles . these are released after profound excitation . only in the extracellular space , neuropeptides act on g - protein coupled receptors to exert a relatively slow action both pre- and postsynaptically .therefore , neuropeptide modulators are considered ideal candidates to influence epileptic tissue overexcited during seizures . many of these peptides are considered to participate in endogenous neuroprotective actions because they bind to their own receptors that implicate them in epilepsy and other cns disorders . mainly , neuropeptide receptors occur in the hippocampus and are widely concerned to temporal lobe epilepsy . similarly , receptors of other neuropeptides like somatostatin , neuropeptide y , galanin , dynorphin , enkephalin , substance p , cholecystokinin , vasoactive intestinal polypeptide , hormones such as ghrelin , angiotensins , corticotropin - releasing hormone , adrenocorticotropin , thyrotropin - releasing hormone , oxytocin , and vasopressin involved in epilepsy . therefore , activation and inhibition of receptors by oral application of peptides as drugs are typically not efficient because of low bioavailability , rapid degradation , and insufficient penetration of peptides through the blood brain barrier . further , development of nonpeptide agonists and antagonists of neuropeptide receptors as well as gene therapeutic approaches leads to the local production of agonists and antagonists within the central nervous system ( table 4 ) . similarly , neuropeptide substance p ( sp ) has been implicated in inflammation , pain , depression , and breast cancer cell ( bcc ) growth . sp plays role in trafficking of bccs ( human mda - mb-231 and mda - mb-231brm2 cells ) across the blood brain barrier ( bbb ) and brain microvascular endothelial cells ( bmecs ) using in vitro and in vivo models . the proinflammatory peptide substance p promotes blood brain barrier breaching by breast cancer cells through changes in microvascular endothelial cell tight junctions . sp secreted from bccs induces transmigration of bccs across the bbb , leading to activation of bmecs and secretion of tnf- and ang-2 , resulting in bbb impairment and colonization of tumor cells in brain ( table 4 ) . therefore , therapies based on sp inhibition in combination with other therapies may prevent breaching of the bbb by bccs and their colonization in brain ( table 4 ) . similarly , gastrointestinal hormones act in the central regulation of energy metabolism and show potential sensory roles for the circumventricular organs . these generate a variety of circulating signals which provide essential information to the central nervous system ( cns ) regarding nutritional status . the gastrointestinal system produces many of such molecules that show profound effects on feeding behavior and the control of metabolism as a consequence of their ability to regulate the neural circuitry involved in metabolic homeostasis . many of these substances show lipophobic characteristics which could be used for therapeutics diseases neurosensory organs . more often , sensory circumventricular organs ( cvos ) , found in the brain , are not protected by the normal blood brain barrier . these possess receptors for and functional actions of gastrointestinal hormones such as amylin , cholecystokinin , ghrelin , and peptide yy in the area postrema and subfornical organ . these play significant roles for the sensory cvos in the regulation of energy balance ( table 4 ) . cholecystokinin ( cck ) seems to function in the production of satiety ; administration of small quantities of this peptide into the ventricles or the paraventricular nucleus inhibits feeding . it is associated with dopamine synapses in some limbic areas and appears to modulate dopamine release . these neuropeptides show synergy as gaba is found associated with somatostatin and serotonin with substance p. similarly , low doses of the peptide vasopressin can enhance learning in laboratory animals , but humans with vasopressin deficiency show no signs of memory impairment . similarly , leptin regulates energy expenditure and body weight by acting both on the hypothalamus and on peripheral targets and central actions of leptin are enhanced by cholecystokinin ( cck ) . the interaction between leptin and cck causes physiological alterations in animals experimental after infusion of more leptin into the cns . similarly , apolipoprotein aiv ( apo - aiv ) and cholecystokinin ( cck ) concentration generate gastrointestinal satiation signals that are stimulated by fat consumption .therefore , peripheral apo - aiv requires an intact cck system and vagal afferents to activate neurons in the hindbrain to reduce food intake . the trafficking of neurotransmitters within the brain depends greatly on the so - called uptake1 and uptake2 carrier - mediated processes , which maintain the balance between neurotransmitters in the intracellular and extracellular fluids of the nervous parenchyma . both uptake systems regulate the neurotransmitter concentration and modulate / terminate receptor - mediated effects within the neurovascular unit ( nvu ) . uptake2 ( oct1 - 3/slc22a1 - 3 , pmat / slc29a4 ) and mate1/slc47a1 transporters are also involved in the transport of xenobiotics . these heterogeneous transport properties of the brain and retina nvus suggest that the bbb helps protect the brain against biogenic amine neurotransmitters in the plasma , while the brb has more of a metabolic / endocrine role ( table 4 ) . more specifically , both transporters uptake1 and uptake2 play important role in the clearance of dopamine , serotonin , and norepinephrine at the synaptic cleft [ 94 , 97 ] . these are classified based on their affinity / capacity for substrates / inhibitors and sensitivity to ions . more specifically , uptake1 transporter binds with high - affinity to na / cl - dependent unidirectional symporters such as net ( slc6a2 ) , dat ( slc6a3 ) , and sert ( slc6a4 ) , while uptake2 transporters show lower affinity . uptake1 transporter assists in transportation of some biogenic amine neurotransmitters and xenobiotics in both directions that depends on their concentration gradient . among all symporters , best known are oct1 - 3 ( slc22a1 - 3 ) and pmat [ 95 , 96 , 115 ] . it is also true that trafficking of biogenic amine neurotransmitters is not restricted to neurons but it might also occur at the blood - nerve barriers and in some peripheral tissues [ 116118 ] . therefore , it is much possible that both uptake1/2 transporters could modulate the local availability of biogenic amine neurotransmitters by luminal ( blood ) and/or abluminal ( nerve side ) carrier systems . more exceptionally , uptake2 carriers could also transport many drugs and xenobiotics like 1-methyl-4-phenylpyridinium ( mpp ) ( table 4 ) . capillaries in the brain possess an impermeable barrier to some solutes and regulate the movement of substances between blood and brain . moreover , for sodium and potassium transport , endothelial cell contains distinct types of ion transport systems on the two sides of the capillary wall , that is , the luminal and antiluminal membranes of the endothelial cell ( table 5 ) . therefore , highly specific solutes can be pumped across the capillary against an electrochemical gradient . these transport systems play important role in the active secretion of fluid from blood to brain and in maintaining a constant concentration of ions in the brain 's interstitial fluid . further , to perform major physiological functions , exchange of important metal ions such as k and na takes place very fast from blood to tissues , but it shows slow rate when entered into the brain [ 41 , 121 ] . more specifically , na exchange across the blood brain barrier takes place by carrier - mediated transport , mainly by brain capillary na , katpase system . this is located primarily on the antiluminal membrane of the endothelial cell that may also mediate removal of interstitial fluid k from the brain and maintain a constant brain k concentration in the face of fluctuating plasma concentrations . thus , antiluminal location of na , k - atpase may have important role in secretion of interstitial fluid , an extrachoroidal source of csf ( table 5 ) . more specifically , plasma membrane of metazoan cells possesses multiple transport proteins , na / k pump , kchannel , na lysine symporter channel , and sodium - lysine transporter which transport metal ions and amino acids from the extracellular medium into the cell . there occur three different types of transport proteins ; first type is the uniport transport pass , a single type of molecule down its concentration gradient , while symporters are cotransport proteins which allow the movement of both types of ions in the same direction outside to inside . an antiporter allows movement of one molecule against its concentration gradient and never allows other molecules to go inside . more specifically , pumps utilize the energy released by atp hydrolyzed by nakatpase for active transport of specific ions or small molecules against their chemical gradient . contrarily , these channels permit movement of specific ions or water down their electrochemical gradient . third type of ionic movement is performed by membrane transporter proteins such as abc transport proteins ( table 5 ) . further , it is also true that brain lacks some metal transporters , and blood brain barrier stops excess transport of metallic ions . bbb restricts entry of neurotoxic metals into the central nervous system ( cns ) that may cause neurodegenerative diseases . though it is a hard fact that excess of metals ( cu , fe , mn , and zn ) contributes to neurodegenerative diseases , but in trace amount these are essential for human health . pb , tin , and hg requirement is not very clear ; hence , its transport occurs very scarely . moreover , plasma membrane of rat brain neuronal cells also contains zinc transporters ( table 5 ) . few hydrophilic proteins like transferrin carry metal species , such as the free metal ion and complexes of the metal with an amino acid or protein . but , these would not be expected to be able to distribute metal ions across the blood brain barrier ( bbb ) at a rate that is sufficient to meet the requirements of the brain as bbb limits the diffusion of non - lipophilic substances into brain . an example of metal species specific transport at the bbb involves me hg , which forms a complex with l - cysteine that is transported into the brain and perhaps into and out of astrocytes . cu is delivered to the cns but it must be transported across either the blood brain barrier or the csf barrier and it accumulates within brain capillaries of experimental mice [ 2830 ] . atp 7a catalyzes the stepwise transport of cu across brain endothelial cells and astrocytes to supply neurons with a regulated supply of cu [ 31 , 32 ] that is quite similar of brain fe metabolism . fe uptake occurs across the cerebelar vascular endothelium after which it associates with glial cells and neurons for take - up . choroid plexus actively produces and secretes csf and has pivotal role in maintaining the homeostasis , but it may also provide a pathway for metal transport mainly for cu . . androstane causes receptor - mediated upregulation of atp - driven xenobiotic efflux transporters at the blood brain barrier , while blood brain barrier flux of aluminum , manganese , iron , and other metals is suspected to contribute to metal - induced neurodegeneration ( tables 1 and 5 ) . certain metal transporters maintain metal flux across the blood brain barrier , choroid plexuses as well as in sensory nerves , and this metal uptake occurs from the nasal cavity . thus , for maintaining homeostasis and normal body health , physiological amounts of useful metals are transported by protein transporters . but , blood brain barrier flux of aluminum , manganese , iron , and other metals is suspected to contribute to metal - induced neurodegeneration and causes dyshomeostasis . aluminium uptake takes place by transferrin - receptor - mediated endocytosis and of aluminum citrate by system xc and an organic anion transporter . contrary to this , manganese uptake takes place by transferrin- and non - transferrin - dependent mechanisms , which may include store - operated calcium channels and the lack of transporter - mediated manganese brain efflux . iron uptake takes place by both transferrin - dependent and independent mechanisms of brain , while copper is delivered to the brain by copper transporters , atp7a , and atp7b . , the divalent metal transporter ( dmt1 , dct1 , and nramp2 ) transports divalent metals , but not metals in other valence states . another example of substrate specificity is greater binding affinity of transferrin for fe than fe [ 36 , 38 , 39 ] ( tables 1 and 5 ) . as a result , transferrin - receptor - mediated endocytosis ( tfr - me ) for fe occurs more than for fe [ 36 , 38 , 39 ] . furthermore , the affinity of the transferring receptor for halo transferrin ( diferric transferrin ) is considerably greater than for monoferric transferring . tfr - me is also believed to play a role in the transport of other trivalent metals into the brain , such as al and mn . similarly , there seems to be a putative role of zinc transporters , znt and zip , in regulating brain zinc concentration by uptake mechanisms . brain uptake of metals may involve a non - energy - dependent process , store - operated calcium channels , and/or an atp - dependent calcium pump . methyl mercury can form a complex with l - cysteine that mimics methionine , enabling its transport by the l system ( tables 1 and 5 ) . the transport of essential metals and other nutrients across tight membrane barriers such as the gastrointestinal tract and blood brain barrier is mediated by specific transport mechanisms . these transporters take up metals at the apical surface and export them at the basolateral surface and are involved in their intracellular distribution . transporters for each of the major essential metals , calcium , iron , and zinc are separate and are divalent metal transporter 1 that mediate the transport of nonessential metals across tight membrane barriers . for example , the intestinal iron transporter divalent metal transporter 1 mediates the uptake of lead and cadmium . thus , levels of essential metals are strictly regulated by transporters . when dietary levels of essential metals become low , levels of the corresponding transporters increase in the intestine , after which there is a greater potential for increased transport of toxic metals . in the brain , the strict regulation of metals prevents injury that would potentially result from oxidative damage induced by the essential metals iron , copper , and zinc . indeed , the oxidative damage found in neurodegenerative diseases is likely to be due to higher levels of these metals . involvement of intracellular transporters raises the levels of iron , zinc , and copper that might be due to a disruption in the activity of transporters in alzheimer 's disease . similarly , exposure to toxicants also affects the activity of transporters that potentially could contribute to the aetiology / progression of neurodegenerative diseases ( tables 1 and 5 ) . the regulation of metal ion transport within neurons is critical for normal brain function . moreover , for regulation of redox , metals such as iron become essential ( fe ) , because excess levels of these metals can contribute to oxidative stress and protein aggregation leading to neuronal death . more importantly , divalent metal transporter 1 ( dmt1 ) plays a central role in the regulation of fe as well as other metals ; hence , failure of dmt1 regulation is linked to human brain pathology . dmt1 is regulated by ndfip1 ( nedd4 family - interacting protein 1 ) an adaptor protein that recruits e3 ligases to ubiquitinate target proteins . in human neurons , ndfip1 is upregulated and binds to dmt1 in response to fe and cobalt ( co ) exposure . this interaction results in the ubiquitination and degradation of dmt1 , resulting in reduced metal entry , while induction of ndfip1 expression protects neurons from metal toxicity , and removal of ndfip1 by shrnai results in hypersensitivity to metals . more specifically , nedd4 - 2 as an e3 ligase is recruited by ndfip1 for the ubiquitination of dmt1 within human neurons and ndfip1(/ ) brains accumulate fe within neurons and suggest a critical role for ndfip1 in regulating metal transport in human neurons ( tables 1 and 5 ) . dmt1 possesses four or more isoforms that transport eight different metals , for multiple purposes . two mrna isoforms differ in the 3 utr ; + ire dmt1 has ire ( iron responsive element ) but ire dmt1 lacks this feature . the + /ire proteins differ in the distal 18 or 25 amino acid residues after shared identity for the proximal 543 residues . the + /ire proteins as the apical iron transporter in the lumen specifically , ire form participate in metal detoxification and remove out metal toxicity . it plays important role in management of toxic challenges and metal homeostasis in body tissues and is involved in endosomal exit of iron . furthermore , divalent metal - ion transporter 1 ( dmt1 ) is iron - preferring membrane transport protein that plays indispensable roles in intestinal nonheme - iron absorption and iron acquisition by erythroid precursor cells . an iron responsive element ( ire ) in the mrna 3-untranslated region permits the regulation of some isoforms by iron status . more specifically , natural resistance associated with macrophage protein 1 ( nramp1 ) is the only member of the mammalian slc11 gene family which contributes to antimicrobial function by extruding from the phagolysosome divalent metal ions ( e.g. , mn ) . slc11 gene also encodes proteins like divalent cation transporter 1 ( dct1 ) and solute carrier family 11 [ 136 , 137 ] . possibly , it may be essential cofactors for bacteria - derived enzymes or required for bacterial growth . an intestinal nonheme - iron transporter , dmt1 , is a validated therapeutic target in hereditary hemochromatosis ( hhc ) and other iron - overload disorders . dmt1 represents a large family of orthologous metal ion transporter proteins that are highly conserved from bacteria to humans . as its name suggests , dmt1 binds a variety of divalent metals including cadmium ( cd ) and copper ( cu ) . dmt1 is best known for its role in transporting ferrous iron ( fe ) and its expression is regulated by body iron stores to maintain iron homeostasis ( tables 1 and 5 ) . more specifically , during brain injury , the homeostasis of transition metal ions ( e.g. , fe , co2 ) is grossly unbalanced . this renders the brain environment toxic due to unwelcomed and uncontrolled metal entry into stressed neurons , precipitating in their premature death . ndfip1 protects neurons against excess transition metal exposure . in the presence of excess co2 or fe ions moreover , ndfip1 binds to dmt1 , leading to dmt1 ubiquitination and degradation , inhibits metal entry , and allows neuronal recovery . ndfip1 has larger relation to brain diseases ( e.g. , parkinson 's disease ) arising from metal accumulation . ndfip1 protects human neurons from death by ubiquitination and degradation of metal transporter dmt1.dmt1 may be the major transporter of manganese across the blood brain barrier and expression of this protein in the nasal epithelium provides a route for direct absorption of metals into the brain . dmt1 expression is found to be increased in the substantia nigra of parkinson 's patients and in the ventral mesencephalon of animal models . its expression in the brain increases with the age that also increases the susceptibility to metal induced pathologies . moreover , the dmt1 encoding gene slc11a2 occurs on the long arm of chromosome 12 ( 12q13 ) close to susceptibility regions for alzheimer 's disease and restless legs syndrome . similarly , c allele of snp rs407135 on the dmt1 encoding gene slc11a2 is associated with shorter disease duration in cases of spinal onset amyotrophic lateral sclerosis . moreover , cc haplotype for snps 1254t / c ivs34 + 44c / a is associated with parkinson 's disease susceptibility , while variant alleles on several slc11a2 snps are associated with iron anemia ( tables 1 and 5 ) . these are also found as a risk factor for manganese intoxication and restless legs syndrome . therefore , it is true that the lack or overexpression of transporters causes toxic accumulation of divalent metals , especially iron and/or manganese . moreover , lack of metal transporters works as important aetiological factors in a variety of neurodegenerative diseases , including alzheimer 's disease , parkinson 's disease , amyotrophic lateral sclerosis , and multiple sclerosis . brain capillary endothelial cells are connected by extensive tight junctions and are polarized into luminal ( blood - facing ) and abluminal ( brain - facing ) plasma membrane domains . this affects polar distribution of transport proteins and mediates amino acid ( aa ) homeostasis in the brain . the existence of two facilitative transporters for neutral amino acids ( naas ) on both membranes provides the brain access to essential aas . more specifically , there occurs a common carrier / transport system for large amino acids across the blood brain barrier which regulates concentration of amino acid and takes out excess or elevated level of amino acids . more often , carrier / transport system can lower down the transport of amino acids by competitive inhibition or may convert into the required amino acids . but , distinct transport systems facilitate the uptake of basic , acidic , and beta amino acids . in case of phenylketonuria and maple syrup urine disease , few amino acids like phenylalanine accumulated in excess in the blood stop uptake of other essential amino acids . further , excess of amino acids affects the lnaa carrier and allows transfer of more amino acids beyond damaging level into the cns . thus , large amino acids like phenylalanine , leucine , tyrosine , isoleucine , valine , tryptophan , methionine , and histidine enter the cerebrospinal fluid rapidly like glucose through the common carrier system or a single amino acid transporter system . on the other hand , entry of small amino acid such as alanine , glycine , proline , and -aminobutyric acid ( gaba ) is restricted or controlled because higher influx of these amino acids may enhance the control of neurotransmitters . these amino acids are required for syntheses of neurotransmitters in the brain and are selectively transported out of the cns into the blood through amino acid carrier system or alanine - preferring transporter and 1-dihydroxy - phenylalanine ( 1-dopa ) . in addition , few smaller neutral amino acids synthesized in the brain and several of them act as putative neurotransmitters . but , all these neutral l - amino acids show variable transport into the brain by different transport systems [ 123 , 124 ] . neutral l - amino acids transport depends on amino acid concentration and its utilization because excess amount of it may stop the transport . more specifically , amino acid that can not be synthesized by brain and are metabolically essential require its regular supply . contrarily , both transport and uptake of large amino acids into the brain are inhibited by the synthesis of 2 aminonorbornane-2-carboxylic acids but not by 2-(methyl - isobutyric acid ( meaib ) [ 123 , 124 ] . this is the main reason that supply of neutral amino acids , such as alanine , glycine , proline , and -aminobutyric acid ( gaba ) , is restricted into the brain by these inhibitors . this carrier system is not found on the luminal surface of the blood brain barrier but may occur on antiluminal surface of the brain capillary . there is a contrast in its transportation because distinct transport systems facilitate the brain uptake of basic , acidic , and -amino acids . lysine and arginine are essential amino acids which are provided from the blood after dietary assimilation . the acidic amino acids glutamate and aspartate are both important metabolic intermediates as well as neurotransmitters [ 127 , 128 ] , while the brain content of these amino acids is maintained primarily by de novo synthesis . they also can be transported into the brain at a slow rate across the blood brain barrier . the -amino acid taurine is present at high concentrations in the brain and is involved in volume regulation . absorption surface in gi tract contains brush boarder membrane that possess a novel system which mediate na / neutral amino acids and show na - gradient - dependent transport of l - proline . more specifically , transport of cationic and zwitterionic amino acids and methyl mercury transport across the blood brain barrier occurs by an amino acid carrier . delivery of therapeutic peptides and proteins to the central nervous system is the biggest challenge for development of more effective neuropharmaceuticals . many plasma proteins are not able to cross the endothelial tissue barrier because of their large size and hydrophilicity . this is the main reason why concentrations of certain proteins , such as insulin and transferrin , vary with the change in plasma concentrations . due to controlled uptake of some proteins , brain becomes saturable and their further uptake is stopped . receptor - mediated transcytosis across the blood brain barrier may be useful way to transport protein and peptide therapeutics into the brain . moreover , proteins like insulin , transferrin , insulin - like growth factors , and vasopressin cross the bbb by receptor - mediated transcytosis ( table 4 ) . interestingly , protein receptors occur in outnumber in brain capillary endothelial cells which bind to transporting protein and form a receptor complex . this complex is endocytosed into the endothelial cell to form a vesicle which assists in eventual release of intact protein on the other side of the endothelial cells that is still not fully known . contrary to this , blood brain barrier is impermeable to most molecules and only amphiphilic derivative of a peptide could make it possible to deliver into the brain . for this purpose , a drug peptide is suitable and designed to self - assemble into nanofiber and its active epitope is tightly wrapped around the nanofiber core . thus , a novel drug delivery system could maintain high brain permeability through receptor - mediated endocytosis ( table 5 ) . moreover , mechanism of nanoparticle mediated drug transport across the bbb appears to be receptor - mediated endocytosis . thus , transport of nanoparticles / nanomolecules across the blood brain barrier requires both specific and nonspecific interactions with proteins expressed on the luminal and or abluminal surface of the brain endothelium cells . more specifically , a high - affinity iron chelator is conjugated to lactoferrin molecules by carbon dioxide mediated coupling reaction . similarly , tf - fmms transferring - conjugated fluorescein loaded magnetic nanoparticles are also delivered by receptor - mediated transcytosis , while antitransferrin receptor antibodies with a fab cargo are delivered across the bbb by receptor - mediated endocytosis . in another method , polycationic proteins and lectins are allowed to cross the blood brain barrier by a similar but nonspecific process called absorptive - mediated transcytosis . in this process , peptide binding to specific receptors in the membrane is not mandatory and proteins are directly absorbed to the endothelial cell membrane based on charge or affinity for sugar moieties of membrane glycoproteins . it is also important that transport capacity of absorptive - mediated transcytosis is greater because the number of receptors present in the membrane does not limit it . in addition , cationization may provide a mechanism for enhancing brain uptake of almost any protein but both endocytosis and transcytosis mechanisms play important role in the distribution of macromolecules . the degree of passage of small peptides across the blood brain barrier significantly exceeds that of the vascular markers , while peptide transport across the membrane barriers shows either saturable or facilitated transport and transmembrane diffusion or passive diffusion . more specifically , low molecular weight small peptides are transported in and out of the central nervous system by carrier - mediated transcytosis across the blood brain barrier which acts as a saturable mechanism ( table 4 ) . bbb is impermeable to proteins , drugs , and other biomolecules as these are not able to cross the blood brain barrier because of their size and hydrophilicity . but , few peptide hormones which regulate body metabolism and normal functions are transported easily . similarly , both insulin and transferring across bbb and their concentration vary in plasma because its uptake in the brain is greater due to their size and lipid solubility . these are carried to the brain by specific transport processes mainly membrane bound efflux pumps and channels . the major transport mechanism which carries important proteins and hormones is receptor - mediated transcytosis . contrary to this , bbb restricts entry of most of the biomolecules mainly proteins , peptides , carbohydrates , and vaccines . hence , delivery of therapeutic peptides and proteins to the central nervous system is the biggest challenge for development of more effective neuropharmaceuticals . the brain capillary endothelial cell is highly enriched in receptors for these proteins , and following binding of protein to the receptor , a portion of the membrane containing the protein - receptor complex is endocytosed into the endothelial cell to form a vesicle . although the subsequent route of passage of the protein through the endothelial cell is not known , there is eventual release of intact protein on the other side of the endothelial cell . the blood brain barrier is impermeable to most molecules but during trafficking of biomolecules a portion of compound is lost due to ineffective partitioning across the membrane . this partitioning across the membrane is widely concerned to polarity , lipophilicity of molecules that attribute easy passage across the membrane . it was designed to self - assemble into nanofiber which in the active peptide epitope is tightly wrapped around the nanofiber core . recently , several neuroprotective proteins and peptides of potential therapeutic value have been designed and used to fulfill the crucial need for effective and safe transcapillary delivery methods to the brain . hence , most promising drug delivery through brain capillaries is possible by augmentation of pinocytotic vesicles . this is a cellular mechanism in which large molecules of neurotherapeutic potential are conjugated to peptidomimetic ligands for delivery . later on , these molecules bind to selected peptide receptors , which internalize and transported it in small vesicles across the cytoplasmic brain capillary barrier . similarly , neurotrophin , a brain - derived neurotrophic factor , easily passes through bbb and has great therapeutic value . interestingly , all short peptides with hydrophilic nature showed favorable safety profiles in brain after coming across the bbb found neuroprotective . exogenous recombinant human erythropoietin was proved beneficial in treating global and focal cerebral ischemia and reducing nervous system inflammation in experimental animals . moreover , other than neuroprotective compounds monoclonal antibodies are also used to pass through bbb by receptor - mediated endocytosis mechanism . similarly , metallothioneins a superfamily of highly conserved amino acids contains low molecular weight polypeptides play significant role in the regulation of essential metals which are also internalized by receptor mediated endocytosis . thus , variable efficiencies of endocytosis mechanisms , such as intracellular trafficking , aiding in the release of therapeutic agents into the cytoplasm are important aspects in drug delivery and therapeutic potency . there are possibilities that after diffusion and translocation of the therapeutic agents these remain susceptible targets of certain catalytic enzymes or physically partition into the nucleus or in any other suborganelles that may also alter its actual activity . further , excess delivery of therapeutic agents may create competitive problem to some other biomolecules that may hinder normal functions of cells , cellular organelles , enzymes , and signaling molecules as well . in addition , metabolic wastes may also overburden the cell cytoplasm that inhibit so many normal cellular functions and give rise to drug induced adverse effects . use of nanoparticles may solve this problem due to controlled release of drugs in required quantity . these can easily cut down concentration of metabolic waste materials by masking the therapeutic agents from their biological environment . nanoparticles allow controlled ( sustained ) drug release from the matrix , determine required bioavailability , and show reduction of the dosing frequency . these are proved the most successful drug carriers due to their high stability , high carrier capacity , and feasibility of incorporation of both hydrophilic and hydrophobic substances into brain or inside cells . these also show feasibility to deliver drugs by following variable routes of administration , including oral application and inhalation . normally , two mechanisms are employed to ascertain that the internalization of biomolecules mainly liquids is liquids are seep in by pinocytosis and solids by phagocytosis . but , carrier - mediated delivery of drugs by nanoparticles is also developed in which nanoparticles are ingested by cells from the medium or from any microenvironment surrounding the cell . more often , nanoparticles are pouring in by receptor - mediated endocytosis that operates by membrane manipulation to envelope and allows materials to absorb inside . moreover , nanoparticles get inside the cells by three different mechanisms , that is , phagocytosis , pinocytosis , and receptor - mediated endocytosis . phagocytosis is associated with few cells types such as macrophages , neutrophils , and dendritic cells that can absorb materials of micrometer in size , that is , 10 m in diameter . similarly , pinocytosis is a universal mechanism which occurs in all cell types and it delivers different types of liquids having a submicron size and substances in solution inside the cell . more specifically , larger sized nanoparticles are taken up by the cell by phagocytosis , while smaller ones are absorbed by pinocytosis and almost ingested by all cell types . furthermore , there is another mechanism which is known as absorptive - mediated transcytosis that is especially used to traverse polycationic proteins and lectins . this is a nonspecific process in which biomaterials rather than binding to specific receptors in the membrane , proteins absorb the endothelial cell membrane based on charge or affinity for sugar moieties of membrane glycoproteins . hence , overall capacity of absorptive - mediated transcytosis is far greater than that of receptor - mediated endocytosis because the number of receptors present in the membrane does not limit it . thus , cationization may provide a mechanism for enhancing brain uptake of almost any protein . in case of facilitated diffusion ( a form of carrier - mediated endocytosis ) binding of a ligand occur to a transporter on one side of the membrane that triggers a conformational change in the protein receptor . facilitated diffusion is passive ( i.e. , energy independent ) and contributes to transport at the bbb of substances such as monocarboxylates , hexoses amines , amino acids , nucleoside , glutathione , and small peptide . . carrier - mediated transport can also be divided into a number of different mechanisms dependent on energy and/or cotransport of another substance . cotransport may be in the same direction ( symport ) or in the opposite direction ( antiport ) . this process proceeds from a region of high concentration to a region of low concentration . endocytosis can be segregated into bulk - phase , also known as fluid phase , endocytosis , and mediated endocytosis ( receptor and absorptive - mediated ) . bulk - phase endocytosis ( pinocytosis ) is the nonspecific uptake of extracellular fluids and occurs at a constitutive level within the cell via mechanisms , which are independent of ligand binding . bulk - phase endocytosis occurs to a very limited degree in the endothelial cells of the cerebral microvasculature . receptor - mediated endocytosis ( rme ) provides a means for selective uptake of macromolecules . cells have receptors for the uptake of many different types of ligands , including hormones , growth factors , enzymes , and plasma proteins . rme occurs at the brain for substances , such as transferrin , insulin , leptin , and igf - i and igf - ii , and is a highly specific type of energy dependent transport . substances that enter a cell by means of rme become bound to receptors that collect in specialized areas of the plasma membrane known as coated pits . the coated pits contain the electron dense clathrin protein and other proteins . when these bound to ligand , pits invaginate into the cytoplasm and then pinch free of the plasma membrane form coated vesicles . the clathrin vesicle coat is rapidly removed to form smooth - coated endosomes that form a compartment of uncoupling receptor and ligand ( curl ) . the endosomal membrane contains proton atpases that result in acidification of the endosome interior and dissociation of the ligand from the receptor within the curl . absorptive - mediated transport ( ame ) is triggered by an electrostatic interaction between a positively charged substance , usually a charge moiety of a peptide , and the negatively charged plasma membrane surface ( i.e. , glycocalyx ) . this mechanism is involved in extruding drugs from the brain and is a major obstacle for many pharmacological agents . abc ( atp binding cassette ) transporter p - glycoprotein is the principle efflux mechanism of these agents . there also exist efflux transporters for organic anions , via multidrug resistance associated protein ( mrp ) , and anionic and cationic cyclic peptide . additionally , the peptide transport system- ( pts- ) 1 shows efflux transport of synthetic opioid peptide tyr - mif-1 . they are all synthesized on ribosomes and are all inactivated by hydrolysis at the synapse ( rather than by reuptake ) . peptides are far more potent than other neurotransmitters , requiring only very small amounts to produce a profound effect . drug delivery to the brain is a challenging task because presence of blood brain barrier ( bbb ) complicates the delivery of drugs to the brain . it is a physiological barrier which imposes major obstacle for a large number of drugs , including antibiotics , antineoplastic agents , and neuropeptides , to pass through the endothelial capillaries to brain . there are some other reasons ; that is , drug may bind to nontransporters in larger amount that render the drug ineffective or seem theoretically active . but , it is true that drug might show inability to pass through the barrier with the adhered protein . besides , enzyme action may also make the drug inactive or in a nontherapeutic intermediate compound . all these circumstances with the drug and its delivery must be accounted for making effective drug formulations to treat the cns disease . though , several methods , ways , and strategies have been developed for drug delivery to the brain but most of them are proved invasive and lack the target specificity . therefore , for active transfer of drug to the brain , safer disruption of bbb or its loosening is highly important . further , for successful delivery of drugs to the cns , blood brain barrier disruption or opening with intra - arterial infusion therapy allows both the chemotherapeutic agents and antibodies to enter through blood brain barrier . thus , bbb dysfunction could be of great therapeutic value in conditions in which neuronal damage is secondary or exacerbated by bbb damage . more exceptionally , for delivery of drugs or any therapeutic agent , bbb is disrupted by ultrasonic sound waves or it may forcibly break down by sudden raised high blood pressure due to hypertension , trauma , ischemia , neural inflammation , and very high concentration of substances , microwave , radiation , and exposure to infectious agents that can open the bbb . in addition , reducing , halting , or reversing the structure and function of bbb might open new ways to deliver chemotherapeutic agents in case of brain tumor . but , forced opening or structural damage to the bbb allows the uncontrolled passage of drugs . further , there are several areas of the brain where bbb is very thin or supposed to be loose or weak ; from here , drug can allow pass to the brain . these areas of brain are identified as circumventricular regions ; these are pineal body , neurohypophysis , and area postrema . further , drug delivery strategies have been improved for safe delivery of different types of drugs to cns . these improved strategies include liposomes , colloidal drug carriers , micelles , chimeric peptide technology , intranasal and olfactory route of administration , and nanotechnology . moreover , disruption or damage of endothelium could allow expression of endothelial receptors which are normally downregulated , opening new communication loops between endothelium , pericytes , astrocytes , and microglia . moreover , infectious pathogenic viruses affect different tissue and organs , but cns diseases are severely caused by virus invade various regions of brain . therefore , drug delivery methods that could target virus present in these areas may play important role in modern drug development mainly for cns protection . furthermore , nanoenabled delivery systems have been made that offer more promising solution to enhance the targeted delivery of the drugs into the brain . therefore , drugs which are loaded with nanocarriers can easily target virus multiplication inside brain because they could easily pass through bbb . in addition , few drug carriers are proteins and its deficiency ( p - glycoprotein ) at the bbb inhibits the efflux activity of certain biomolecules at the blood brain barrier . more often , most of the drug delivery methods are based on structure activity relationships , drug - to - drug receptor interactions , and structure transport relationships mainly membrane permeation . in addition , drugs which are selected based on throughput screening may show higher binding in silico , but in reality in vivo systems invariably show poor membrane permeation because of low binding by target receptor . therefore , it seems very difficult to pass on drug more simply through the blood barrier in theoretically relevant concentration and underlying experimental aspect of drug targeting . more often , drugs undergo insignificant transport through the brain capillary endothelium that makes up the blood brain barrier ( bbb ) in vitro . but , in vivo system drug must bind to some specific receptor ; if binding occurs partially , it will affect drug delivery . further , in vivo condition absorption of drug in neuronal and other brain cells seems to be difficult after drug delivery , because its route is obstructed in many ways . second , drug may convert into noninteracting metabolite or a portion of it might show higher binding to other ligand / s mainly proteins . though , therapeutically , drug seems to be more appropriate by biological system but it becomes ineffective or attains some highly reactive active molecular when it reaches inside brain cells . if drug becomes able to pass through the barrier , it might adhere to the unwanted protein . another problem is created by presence of some catabolic enzymes in the brain tissues , which could change the native or active form of the drug or cleave it into an inactive molecule or slow acting pharmaceutical that may be deconstructed once it is inside the brain tissue rendering it useless . therefore , accumulated therapeutic biomaterials in the brain play a crucial role in the pathogenesis of neuronal diseases . hence , an active penetration of drug through blood brain barrier is highly needful for its delivery at the target area in the brain for treatment of cns disorders and diseases as well . bbb is nonselective to pass drugs by diffusion or by active transport and is major hurdle for successful cns drug development . but , it is true that molecules like glucose and fat / lipid soluble drugs can rapidly cross into the brain . contrary to this , delivery of many of the drug types is very difficult to carry them into the brain because of fat insoluble . therefore , such drugs can not be made available to the brain because of nondelivery across the blood brain barrier . there are so many factors , which influence the drug delivery or its ability to traverse the blood brain barrier . it is true that the membrane barrier disallows larger molecules , while smaller molecules are carrying over to the brain . therefore , lipophilicity does not seem to be necessary or the only factor that may assist the drug for safe passage to brain . there seems to be a role of multiple factors or complex molecular properties that make drug able to pass through the bbb . more exceptionally , barrier permeability is also related to membrane or luminal surface of brain capillary , composition of csf or isf , functional groups , change on molecular and ionic surfaces , or presence of charged residues of the molecules . in addition , surface activity of the molecules , their relative size and specific binding of transporter proteins , energy driven cassettes , and opening and closing of channels due to ionic concentration are noted as important factors . further , it is true that all traditional drug delivery methods are based on trial - and - errors . these are applied invariably for few selected drugs that had appropriate structure - activity relationships or drug - receptor interactions , and structure - transport relationships are intact . moreover , all modern methods concerned with drug development are based on rational drug design and almost all new drugs require use of receptor - based high throughput screening methods to find appropriateness of the drug among thousands of new compounds . but , it is not true that drugs that are selected with high throughput screening solely on the basis of structure - activity relationships may show target receptor binding in animal system because they behave differently . such drugs will undergo insignificant transport through the brain capillary endothelium , which makes up the blood brain barrier ( bbb ) in vivo . however , several approaches for direct drug delivery or direct convection enhanced delivery are used to inject the drug into brain or cerebrospinal fluid or intranasal delivery . these techniques are highly unsafe , local , invasive , metabolizable , or short lasting . contrary to this , drugs that are delivered through vascular route through bbb in physiologically required amount first infused and spread in larger portion of the brain . more specifically , neurosurgical , pharmacological , and physiological strategies include bbb disruption by osmotic imbalance or by using vasoactive compounds , intraventricular drug infusion , and intracerebral implants . in pharmacological methods , lipid carrier or liposomes physiological strategies are followed by applying endogenous transport mechanisms by using either carrier - mediated transport of nutrients or receptor - mediated transport of peptides . from clinical investigations , physiological strategies are proved better and potential delivery methods , because of wider safety cover provided by drug transport . similar to blood brain barrier , blood tumor barrier also imposes so many obstacles to drug delivery in the cns . more often , brain tumor microvessels / capillaries limit drug delivery to tumors by forming a blood brain barrier . even though the blood brain tumor barrier is more permeable than the blood brain barrier [ 173 , 174 ] , it significantly restricts the delivery of anticancer drugs and limits systematic chemotherapeutics of brain tumors . this causes failure of drug target and made the delivery process extremely difficult to treat solid tumors in the brain . this is the main casue of clinical failures of many potential antitumor drugs , that is usually not due to lack of potency but rather it occurs due to nondelivery of drug to the brain and into the tumors . in addition , pharmaceuticals used in tumor specific therapies are found insufficient to check aberrant signaling pathways in brain tumors . it makes the chemotherapeutic treatment of brain tumors ineffective and required amount of drug could not be delivered into the brain . further , due to very high toxicity of antitumor chemotherapeutic drugs , these can not be administered in sufficient concentration by conventional delivery methods . therefore , such methods are not much helpful to ascertain long - term survival of the patients with brain tumors and most of clinical cases of brain tumors are proving fatal . however , new well - designed therapeutic strategies that could make an easy and successful drug delivery should be developed to save the life of patients . drug delivery should be more responsive for delivering an appropriate therapeutic concentration of antitumor drug by applying safer drug delivery systems or methods by beaching any physical and physiological obstacles . therefore , potential techniques are to be developed for treatment of brain tumors . there are common approaches which have been followed in the past by clinicians , that is , high dose intravenous chemotherapy , intra - arterial drug delivery , local drug delivery via implanted polymers or catheters , and disruption of bbb and biochemical modulation of drug . few other drug delivery methods are intracerebro ventricular , convection enhanced delivery bbb / btb disruption , and btb permeability modulation . further , to enhance the btb permeability , accelerated therapeutic molecules are allowed to pass through it by cellular vasomodulator - mediated transportation mechanism . in addition , k ( ca ) channels are potential target for biochemical modulation of btb permeability to increase antineoplastic drug delivery selectively to brain tumors . further , btb permeability is also enhanced with accelerated formation of pinocytic vesicles which could transport drugs across the btb with the help of some channel activators . for example , infused minoxidil sulphate ( ms ) is a selective k ( atp ) channel activator that comes across the btb , reaches the brain tumor and facilitates delivery of certain macromolecules mainly her-2 antibody adenoviral - green florescent protein and carboplatin to brain tumors . hence , rat brain tumor models are designed to enhance drug delivery to brain tumor following intracarotid infusion of bradykinin ( bk ) , nitric oxide ( no ) donors or agonists of soluble guanylate cyclase ( sgc ) , and calcium dependent potassium k ( ca ) channels . further , modulation of these channels by specific agonists and agents that produce no and cgmp in situ is essentially required . contrary to this , water - soluble compounds are limited by the surface area / permeability of the tumor capillaries . therefore , in new methods , bbb manipulations are being performed for safe delivery of drug to the brain , but these should be noninvasive , physiological , and pharmacological . no doubt , drug delivery into solid tumors can assist in development of novel targeted molecular based therapies for treatment of patients . it could also be possible by selective opening of blood tumor barrier by a nitric oxide donor and infusion required amount of drug into it . certainly , safe drug delivery will increase survival and life expectancy in tumor patients [ 50 , 181 ] . the blood brain barrier provides a layer of protection for the brain from harmful or foreign substances that may injure the brain . it also protects the brain from action of metals , toxicants , poisons , hormones , and neurotransmitters . the blood brain barrier ( bbb ) and blood cerebrospinal fluid barrier ( bcsf ) possess a variety of carrier - mediated transport systems to support and protect brain functions . these transport mechanisms are used for management of level of various substances including xenobiotic compounds by the brain . substances with high lipid solubility may move across the blood brain barrier by simple diffusion but non lipid soluble substances are prohibited from diffusion . bbb is a very tightly packed endothelial construction that disallows large molecules to pass through it but allows smaller molecules to pass through tight junctions . more often , glucose and other low molecular fat - soluble molecules are also disallowed but few lipid soluble molecules such as barbiturate drugs rapidly cross the bbb and reach the brain . morphologically , the polar distribution of transport proteins mediates amino acid homeostasis in the brain . furthermore , endothelial cells that line cerebral microvessels also maintain microenvironment for reliable neuronal signaling and regulate transport of essential molecules . similarly , bbb exerts the greatest control over the immediate microenvironment of brain cells . no doubt , bbb like other barriers protects organs from harmful substances ( e.g. , xenobiotics ) including drugs and foreign compounds and from xenobiotics and noxious agents . it regulates the movement of ions , molecules , and cells between the blood and cns . it plays a crucial role in maintaining the appropriate environment for proper neural function as well as protecting the brain from injury and disease . bbb separates the pools of neurotransmitters and neuroactive agents that act centrally and peripherally and regulates the ionic microenvironment present inside neurons . bbb assists in healthy functioning of the brain and makes possible , easy and uninterrupted supply of various molecules and ions . these molecules and ions maintain life support system and physiologically protect the neurocompartments from potential disruptive and damaging effects of xenobiotic agents . moreover , bbb protects the brain from toxic substances and restricts its entry into the neurocompartment . thus , most of the neuroprotective drugs should improve the brain function only by toning up bbb and cns rather than targeting neurovascular units . these drugs may open the bbb 's tight junctions and allow the passage of growth factors and antibodies into the brain and reduce inflammation which causes oedema . therefore , for therapeutic purposes and protection of cns , integrity of blood brain barrier is highly important for having better clinical outcomes in case of neural diseases . further , molecular events and protein complexes involved in release of neurotransmitters by exocytosis should be known because involvement of neurotransmitters may also induce modulatory functions in many neuronal circuits . furthermore , physiological stress response to gases such as co2 and clustered nursing intervention can minimize chances of strokes and brain ischemia . more specifically , neuronal cells require both electrolytes and nonelectrolytes for performing nerve transmission but electrolytes play a vital role in the maintenance of osmotic pressure and acid base equilibrium in matrix . mainly , mg ions and phosphates maintain this property . contrary to this , nonelectrolytes normally occuring in ionizing state are na , k , mg , cu , i , fe , mn , fl , mo , cl , zn , co , ni , and so forth . these perform various cellular functions and act as important cofactors for certain catabolic enzymes or associating apoenzymatic parts of many vitamins . metal ions are also component part of some hormones , lipids , proteins , nucleic acids , sugar phosphates , and nucleoside phosphates . the iron as an important metal ion occurs in the hemoglobin , ferritin , cytochromes , and some enzymes as catalase and cytochrome oxidase , while calcium ions occur in the blood , matrix and bone . the copper ( cu ) , manganese ( mn ) , molybdenum ( mo ) , and zinc ( zn ) are useful as cofactors for enzyme actions , while iodine and fluorine are essential for the thyroid and the enamel metabolism . these are highly essential for maintaining osmotic pressure and acid base balance in the cells . however , retention of ions in the matrix produces an increase in osmotic pressure and allows the entrance of water in the cell . further , monocarboxylate transporters ( mcts ) play a major role in the maintenance of the glycolytic metabolism through the proton - linked transmembrane transport of lactate . in addition , carrier - mediated transfer systems , that is , atp powered pumps ( atp ) cassettes channels and molecular drug transporters , are used to support transport of drugs and nourishments to protect and maintain vital brain function . moreover , role of p - glycoproteins or transmembranous proteins , atp - dependent pumps , transporters , and permeablitizers in transportation of various nutrients and other essential elements is well defined . hence , atp - dependent efflux drug transporter such as bcrp ( breast cancer resistance protein ) with diverse spectrum of hydrophilic and hydrophobic substrates ranging from anticancer , antiviral , and antihypertensive drugs should be used . further , therapeutic impact of mct transporters and its expression in plasma membrane of glioblastomas should be confirmed because monocarboxylic acid transporters control the transport of short chain monocarboxylic and keto acids , including pyruvate and lactate to support brain energy metabolism . therefore , for developing novel therapeutic approaches for treating brain diseases such as stroke neuronal functions , both mct and its inhibitors should be known . these mct inhibitors have a role in prevention of proliferation of t lymphocytes that confirms and work as promising pharmacological targets including cancer therapy . further , alternative methods such as disruption or loosening of bbb may assist in diffusion of most essential nutrients and biomaterials into the brain . similarly , delivery of drugs and other substances could be possible by different carriers and drug transporters but seems to be a challenging task in clinical research . moreover , k ( ca ) channel modulation also assists in enhanced permeability of macromolecules into the brain . these are considered as promising target for biochemical modulation of btb permeability and increase the antineoplastic drug delivery selectively to brain tumors . moreover , k ( ca ) channel are also used to deliver her-2 monoclonal antibody and green fluorescent protein - adenoviral vectors selectively to brain for curing neoplastic , neurogenerative , and viral diseases . further , for an enhanced drug delivery to the brain , tumor intracarotid infusion of bradykinin ( bk ) , nitric oxide ( no ) donors , or agonists of soluble guanylate cyclase ( sgc ) and calcium - dependent potassium ( k ( ca ) ) channels were found more effective and safer . interestingly , nitric oxide ( no ) is implicated in the regulation of vascular permeability and blood flow . bcrp is an integral protein in cancer and normal cells are a major component of the bbb located on the endothelial cells near tight junctions . similarly , multidrug resistant protein 4 shows low permeability across the bbb resulting in low distribution to the brain . therefore , brain to blood efflux transport systems also play important role in the cerebral clearance of endogenous neurotoxic compounds such as prostaglandins and beta amyloid that can reduce the physiological effects of cns related disorders . further , by management of endogenous and xenobiotic compounds by the brain permeability , functions of bbb are to be reexplored . further , regulation of oxygen metabolism , plasminogen activator , thrombolytic drugs after stroke , peroxisome - proliferator - activated receptors , and inhibitors of kinase pathways could also assist in drug delivery . in addition , after use of drugs or other metabolites or cns , formed neurotoxicants vesicles play important role in its release . interestingly , vesicles protect cells from accumulation of wastes or drugs and show many clinical applications ranging from biomarkers to anticancer therapy . therefore , alternate methods of drugs delivery and substance transport should be practiced to find an appropriate solution of cns related pathogenicity and neurodegenerating diseases . hence , to fulfill drug delivery tasks , better understanding is required among clinicians and immunologists for starting new research initiatives to make landmark innovations in the field of pharmacology , drug delivery , and clinical therapeutics of cns related diseases in addition , molecular interactions with biological barriers should be properly investigated in experimental animals as well as in vitro systems to develop highly efficient drug delivery systems . moreover , advanced methods are essentially required for easy delivery of healers , peptides , proteins , growth factors , vaccines , and antibodies for neuroprotection against cns diseases . therefore , collaborative research efforts should be made by clinicians and molecular biologists to develop / explore new innovative methods of drug delivery . further , there seems an instant need of new smaller pharmaceuticals having target specific designs to protect the cns from various pathological impairments . hence , use of natural transporters such as abc cassettes , aquaporins , cationic pumps , and substance specific ionic channels should favor to support transport of drugs and nourishments to maintain vital brain functions . moreover , drugs that can enhance permeability functions of nerve cell plasma membrane should be promoted . it will not only help to deliver the pharmaceuticals but also assist in finding new signaling pathways for transport of substances mainly fuel materials and drugs for successful treatment of infectious viral diseases . further , normal supply of substances could maintain integration of cns functions such as learning , memory , sleep cycle , movement , hormone regulation , vision , hearing , and many other functions . more often , after exploring transcellular signaling pathways generated by beneficial drug candidates , its action and authenticating behavior could be assessed much easily . hence , strong recommendations are being made to upgrade pharmaceutical technologies by combining them with the recent advances in membrane biology and clinical sciences to extend the therapeutic use of pharmaceuticals for treatment of neurological diseases and cns impairments . further , biomedical researchers should increase the spectrum of pharmaceuticals by carrying them to targeted locations . thus , by developing new endothelial transporters / carriers and new drug candidates , a rapid solution of neurodegenerative and neuropathological disease and cns protection could be achieved . further , in vitro high throughput screens and computational bbb tools together with understanding of brain penetration may enable the drug discovery community to minimize the access of drug candidate into the cns compartment . therefore , compounds which can reduce apoptosis , oxidative stress , induce neuritis , outgrowth , synaptic plasticity , and memory loss due to detrimental effects imposed by xenobiotics and pathogens should be of greater use . no doubt , new upgraded drug delivery systems and therapeutic candidates will provide novel treatment for different types of cns and neurodegenerative diseases .

present review paper highlights role of bbb in endothelial transport of various substances into the brain . more specifically , permeability functions of bbb in transendothelial transport of various substances such as metabolic fuels , ethanol , amino acids , proteins , peptides , lipids , vitamins , neurotransmitters , monocarbxylic acids , gases , water , and minerals in the peripheral circulation and into the brain have been widely explained . in addition , roles of various receptors , atp powered pumps , channels , and transporters in transport of vital molecules in maintenance of homeostasis and normal body functions have been described in detail . major role of integral membrane proteins , carriers , or transporters in drug transport is highlighted . both diffusion and carrier mediated transport mechanisms which facilitate molecular trafficking through transcellular route to maintain influx and outflux of important nutrients and metabolic substances are elucidated . present review paper aims to emphasize role of important transport systems with their recent advancements in cns protection mainly for providing a rapid clinical aid to patients . this review also suggests requirement of new well - designed therapeutic strategies mainly potential techniques , appropriate drug formulations , and new transport systems for quick , easy , and safe delivery of drugs across blood brain barrier to save the life of tumor and virus infected patients .

in patients undergoing percutaneous coronary intervention ( pci ) for the treatment of acute coronary syndrome , administration of glycoprotein ( gp ) iib / iiia receptor antagonists has been shown to improve their clinical outcomes . however , the associated hemorrhagic risk may evoke serious complications , such as acute profound thrombocytopenia.1 ) we present a successfully managed case of a rare complication of acute profound thrombocytopenia after the use abciximab , an intra - aortic balloon pump ( iabp ) for the treatment of no - reflow phenomenon , and consecutive cardiogenic shock during primary pci in a patient with st - segment elevated myocardial infarction ( stemi ) . a 65 year - old man with hypertension visited the local hospital with resting chest pain for 3 hours . he was transferred to our hospital due to the abnormal electrocardiogram ( ecg ) findings showing an elevated st - segment in the inferior wall territory with a reciprocal change , which was suspicious of stemi . in the emergency room , blood pressure was 140/80 mm hg and chest radiography showed no definite abnormal findings , which was graded as killip class 1 . it was decided to have the patient undergo primary pci for the treatment of stemi . conventional medical treatments that include a bolus injection of 5000 iu of heparin , a loading dose of aspirin ( 300 mg ) , and clopidogrel ( 300 mg ) was applied before primary pci . coronary angiography ( cag ) showed a totally occluded lesion of the proximal right coronary artery ( rca ) with collateral flow grade 1 from the left anterior descending artery ( fig . after predilatation with a 2.020 mm conventional balloon , a bare metal stent 5.024 mm liberte ( boston scientific , natick , ma , usa ) was implanted in the proximal rca lesion ( fig . 1e ) and blood pressure decreased with findings of a complete atrioventricular - block and re - elevation of the st - segment on ecg monitoring . the patient was treated with intracoronary injection of nitrate and adenosine , and intravenous bolus consecutive injection of abciximab with maintenance ( intravenous bolus of 0.25 mg / kg , 10 to 60 minutes during the procedure , followed by 0.125 g / kg / min infusion for 12 hours ) . although an improvement was observed in the thrombolysis in myocardial infarction flow grade from grade 0 to grade 3 ( fig . the patient was moved to the coronary care unit for intensive monitoring with maintenance of abciximab and iabp . although the baseline platelet count was 167000/l before pci , a routine check determined a complete blood count showing a decreased platelet count of 6000/l at 22 hours after bolus administration of abciximab , followed by a platelet count of 3000/l 4 hours later . it was considered that the patient had acute , profound thrombocytopenia as a complication of abciximab . heparin induced thrombocytopenia ( hit ) was excluded because hit typically develops after 6 to 10 days of heparin use with no previous exposure to heparin . in this case , the patient had no history of exposure to heparin . therefore , the patient was started on clopidogrel 75 mg / day and aspirin 100 mg / day were started to prevent stent thrombosis . the patient was withdrawn from heparin treatment in consideration of additional hemorrhagic risk , but not hit . the next followed count of platelet increased to 24000/l without clinical evidence of stent thrombosis , such as chest pain and a change of st - segment on ecg . vital signs were stabilized the next day and iabp was removed successfully using the closing device , perclose ( abbott , redwood city , ca , usa ) due to the hemorrhagic risk of the access site and a decreased platelet count of 26000/l . after additional transfusions of 4 units of platelet concentrates , the platelet count increased to 49000/l without complications . a 1-year follow up of cag showed good flow of rca without chest pain or thrombocytopenia . the benefit of platelet inhibition by gp iib / iiia inhibitors , as adjunctive treatment in patients undergoing pci , is well established . abciximab , a potent antiplatelet agent that blocks the final pathways to platelet aggregation,2 ) improves the outcomes of high risk procedures and decreases the incidence of major adverse cardiac events . however , the associated hemorrhagic risk may be a major safety concern . according to previous studies , the incidence of thrombocytopenia ( platelet count of < 100000/mm ) is 0.5% to 5.6%.3 - 5 ) in particular , acute profound thrombocytopenia , defined as a platelet count of < 20000/mm , is a rare and serious complication , since it increases the risk for significant bleeding . however , an increased risk of stent thrombosis , due to the need for antithrombotic drugs discontinuation and platelet transfusion should be considered to determine the proper therapeutic approach . although little is known about the pathophysiological mechanisms that lead to thrombocytopenia induced by gp iib / iiia antagonists , preexisting platelet surface antibodies and gp iib / iiia antagonists may induce the immune response of platelets by conformational changes in the gp iib / iiia receptors on the platelet surface and the expression of new epitopes recognized by the antibodies.6 ) the platelet count is necessary to detect thrombocytopenia , and should be done before starting treatment with abciximab , 1 - 4 hours later and , if it decreases , once a day until resolution ( for platelet count < 20000/mm it should be checked twice a day until the count rises to 50000/mm ) . several drugs , such as heparin and clopidogrel , could induce thrombocytopenia , thus should also be considered as possible causative factors . it is important to exclude hit , because both heparin and abciximab are frequently infused.7 ) there is no test that can distinguish this syndrome from hit . however , abciximab induced thrombocytopenia occurs rapidly after the administration of abciximab , while hit develops over a period of days in patients without previous exposure to heparin . hit is not acute and it may be associated with bleeding and thrombosis.8 ) in this case , thrombocytopenia was identified the next day after administration of abciximab and heparin without a previous exposure history of heparin . acute profound thrombocytopenia as a complication of abciximab is a more problematic situation in this case . it can create hemorrhagic complications . however , the following should be considered : microvascular thromboembolic condition of no - reflow phenomenon with poor clinical outcomes , such as a lack of recovery of the left ventricular function of affected myocardial segments , increased in - hospital mortality , a poor long - term prognosis,9 - 11 ) and the need for additional usage of heparin for the maintenance of iabp . in addition , the management of abciximab - induced profound thrombocytopenia is controversial , since there is no previous evidence of this in the medical literature . therefore , clopidogrel 75 mg / day and aspirin 100 mg / day were started and only heparin was withdrawn . in addition , it was difficult to expect a value of transfusion of platelet concentrates in the condition of no - reflow phenomenon . transfusion of platelet concentrates was decided based on the operator 's experience in the present case . in summary , we report a case of a 65-year - old man with a rare complication of acute profound thrombocytopenia after administration of abciximab for the treatment of no - reflow phenomenon during primary pci . although hit should be differentiated and the removal of iabp was an issue due to the risk of increased bleeding , our patient was managed successfully with transfusion of platelet

glycoprotein iib / iiia antagonists are well established for their effectiveness in improving clinical outcomes in acute coronary syndrome patients undergoing percutaneous coronary intervention . acute profound thrombocytopenia is a rare complication of abciximab . we present a case which was managed successfully for the rare complication of acute profound thrombocytopenia after using abciximab and an intra - aortic balloon pump for the treatment of a no - reflow phenomenon and consecutive cardiogenic shock during primary percutaneous coronary intervention .

current situation is the result of the increasing number of cases of patients being diagnosed in an extended state of the disease ( ca 70% of cases local extent ) and its frequent occurrence in elderly people ( 50% above 65 years old , 30% 70 years old ) , who are usually stressed with coexisting diseases . in these cases an important element of cancer treatment is palliative treatment , which mainly aims at improving the quality of life by mitigating the symptoms associated with the disease . the endobronchial location of the cancer can cause hemoptysis , atelectasis , and many other related symptoms , such as dyspnoea , cough , and chronic inflammation . the removal of the endobronchial obstruction often significantly improves the health status of the patient , which in turn affects the quality of the patient 's life . high - dose - rate ( hdr ) brachytherapy is one of the most effective methods used in palliative treatment [ 27 ] . in the application of treatment for endobronchial brachytherapy , the most commonly used orthogonal images are recorded using x - rays , which provide good visualization of the catheter and the bone tissue . in cases where one catheter is used , in order to illustrate the distribution of the isodoses around the guide , the dose can be defined by the reference points . these points are located at a constant distance from the guide or can be designated at different distances from the catheter . if many guides are used , the dose in the area of the envelope is calculated . the envelope is the area containing the catheters , in which the dose is specified at the same depth . the aim of this method is to choose a calculation point located between all of the guides , as well as those farthest from the nearest guide . the selection of such a point allows for the inclusion of the minimal dose within the area of interest . during the treatment plans , the use of a larger number of guides and handling these guides with different reference points allows for the reduction or increase of the dose in the area of the tumor , simultaneously with the least possible coverage of critical organs [ 8 , 9 ] . the paper present comparison of treatment plans made by using 2d and 3d methods in the oncentra planning system 4.1 sp2 version , brachy planning module ( nucletron , an elekta company , elekta ab , stockholm , sweden ) , as well as to assess the quality of treatment plans using the 2d and 3d methods . as such , the study is based on a group of patients treated in the brachytherapy department of the subcarpathian cancer center in brzozw . the studies involved a group of 31 patients with advanced lung cancer treated in the brachytherapy department of the subcarpathian cancer center in brzozw from 2011 to 2013 . in total , 31 patients and 76 treatment plans were analyzed . patients were treated with a microselectron unit ( nucletron , an elekta company , elekta ab , stockholm , sweden ) with an ir source , with a nominal activity of 10 ci . the treatment was applied using the oncentra masterplan brachy 4.0 system ( nucletron , an elekta company , elekta ab , stockholm , sweden ) . in brachytherapy , the lumencath applicator set was used ( nucletron , an elekta company , elekta ab , stockholm , sweden ) . all patient treatment was based on computed tomography of the thorax ( ct ge brightspeed , milwaukee , wi , usa ) . the endobronchial brachytherapy procedures were performed using local anesthesia under the control of a bronchovideoscope . during the bronchoscopy , guides were inserted in the bronchial tree and in the area of or near the tumor 's location . in the 3d method of treatment , three - dimensional images from computer tomography were used , so the physician could contour the volume of the tumor and critical structures . the physicist reconstructed the catheter or catheters in the treatment plan system , activated the source position near the ptv area and then carried out the optimization of the treatment plan . in this method , performed using the 2d method , images from the simulix oldelft simulator were used ( nucletron , an elekta company , elekta ab , stockholm , sweden ) . the dwell time was calculated in a different way : the catheter was created via virtual tomography , the length of the catheter , and the location of the source in it were the same as those in the 3d method , but the dose was specified to 1 cm from the catheter . the dwell time calculated in the 2d method was transferred to the treatment plan performed based on the 3d imaging method . after changing the dwell time , a comparison was made of the reference dose coverage of the target ( ptv ) by the isodose of 100% and 85% , and the calculation of the dose at 2 cm to the critical organ ( spinal cord ) was performer . comparison of ptv coverage in the 3d method to the 2d method highlighted the significant differences between these two methods . reference dose coverage of the target ( ptv ) by isodose of 100% and 85% , as well as the dose to the critical organ received at 2 cm ( in this case , the spinal cord ) , were compared . for the comparison of the variables in the 3d and the 2d methods , tests from two independent trials the tests assumed unequal variances , which were most suitable for comparing quantitative variables in the two groups . in the case of 100% ptv , the p value was 0.0001 , indicating that the statistical differences between the 3d and the 2d methods are significant . figure 1 depicts that the average method for the 3d and 2d was 75.82% and 45.05% , respectively . the standard deviation for the 3d method was 22.72% , and for the 2d method 25.63% , meaning there was a greater variation among the 2d results within the trial . however , the maximal values did not differ significantly between the 3d method and the 2d method ( the maximal value in the 2d method was 0.33% higher than the maximal value in the 3d method ) . the reverse was observed for the minimal values ; for the 3d method , the minimal value was 20.26% , and for the 2d method it was 8.16% . basic measures of outcomes : ptv100 in the 3d and the 2d methods in cases where ptv was 85% ( just as when ptv was 100% ) , the p value was 0.0001 , which means that the statistical differences between the 3d method and the 2d method are significant . figure 2 presents that the average in the 3d method is 36.31% higher than in the 2d method , and the median in the 3d method is 30.58% higher than in the 2d method . the minimal value in the 3d method was 36.1% and in the 2d method it was 14.82% . however , the maximal values did not differ significantly between the 3d and 2d methods . basic measures of outcomes : ptv85 in the 3d and 2d methods when the dose was used on the spinal cord every 2 cm , the p value was 0.009 , implying significant statistical differences between the 3d method and the 2d method . figure 3 shows that the average value of the results for the 3d method are 0.17 gy higher than in the 2d method . in the case of maximal values , the results for the 2d method are 0.44 gy higher than for the 3d method . the standard deviation is not significantly higher ( about 0.02 gy ) for the 2d method than for the 3d method , when the dose was used on the spinal cord every 2 cm . basic measures of outcomes : dose used on the spinal cord every 2 cm in the 3d and 2d methods for the comparison of the variables in the 3d and the 2d methods , tests from two independent trials were used . the tests assumed unequal variances , which were most suitable for comparing quantitative variables in the two groups . in the case of 100% ptv , the p value was 0.0001 , indicating that the statistical differences between the 3d and the 2d methods are significant . figure 1 depicts that the average method for the 3d and 2d was 75.82% and 45.05% , respectively . the standard deviation for the 3d method was 22.72% , and for the 2d method 25.63% , meaning there was a greater variation among the 2d results within the trial . however , the maximal values did not differ significantly between the 3d method and the 2d method ( the maximal value in the 2d method was 0.33% higher than the maximal value in the 3d method ) . the reverse was observed for the minimal values ; for the 3d method , the minimal value was 20.26% , and for the 2d method it was 8.16% . in cases where ptv was 85% ( just as when ptv was 100% ) , the p value was 0.0001 , which means that the statistical differences between the 3d method and the 2d method are significant . figure 2 presents that the average in the 3d method is 36.31% higher than in the 2d method , and the median in the 3d method is 30.58% higher than in the 2d method . the minimal value in the 3d method was 36.1% and in the 2d method it was 14.82% . however , the maximal values did not differ significantly between the 3d and 2d methods . when the dose was used on the spinal cord every 2 cm , the p value was 0.009 , implying significant statistical differences between the 3d method and the 2d method . figure 3 shows that the average value of the results for the 3d method are 0.17 gy higher than in the 2d method . in the case of maximal values , the results for the 2d method are 0.44 gy higher than for the 3d method . the standard deviation is not significantly higher ( about 0.02 gy ) for the 2d method than for the 3d method , when the dose was used on the spinal cord every 2 cm . basic measures of outcomes : dose used on the spinal cord every 2 cm in the 3d and 2d methods complications that can occur after endobronchial brachytherapy such as hemorrhages , shunts , radiation - induced pneumonia or bronchitis and radiation - induced stenosis have justified the search for new and better solutions that can reduce these side effects [ 10 , 11 ] . the planning of treatment with the use of two - dimensional images can not precisely determine where to find the area of the tumor . specifying the dose of the points that are located at a distance of 1 cm from the applicator , we have no possibility to optimize the treatment plan while considering critical organs . with the 2d method , the dose to critical organs often exceeds the limit values and simultaneously disqualifies the treatment plan . in the 3d method , we can precisely determine the position of the tumor and critical organs , which allows us to optimize the treatment and limit the dose to critical organs . figure 4 provides a comparison between the dvh for both methods , where it can be seen that a much better coverage of ptv dose is required in the 3d method than the 2d . at the same time , we can notice that the dose the critical organs receive is slightly different in the two methods . we can clearly state that a plan using 3d images gives better results in terms of treatment planning . technological progress and the utilization of computed tomography increases the possibility for treatment and reduces its toxicity . applying treatment with the 3d method , there is a possibility for dose optimization , decreasing the dose for the critical organs , and as a result , reducing the toxic effects of treatment on healthy tissue [ 6 , 12 , 13 ] . comparison of dvh for treatment plans in 3d ( purple line ) and 2d ( brown line ) methods and the spinal cord ( 3d green line , 2d blue line ) the main advantages of hdr brachytherapy include the simplicity of the procedure , short duration of treatment , and the possibility for patient to undergo the therapy in an outpatient setting . computed tomography allows for precise determination of the size of the tumor before the procedure , as well as determination of the changes in the bronchial tree that have occurred during therapy . in facilities that are ct - equipped , the 3d method should be routinely used in applying treatment in different localizations of tumors . the 3d method based on dynamic imaging the conclusions from the analysis and interpretation of the results of the research are as follows : reference doses with 100% coverage of the ptv in treatment applied with the 3d method are 31% higher than when applied with the 2d method.determination of the target area and the area of critical tissues is possible to a far greater extent by the application of the 3d method than is the case with the 2d method . the former method allows for the administration of high therapeutic doses , while minimizing any impact on critical organs.in the 2d method , application of dose is specified 1 cm from the catheter . hot points are those areas where the dose is much higher than specified . such problems do not occur in the 3d method , which allows for uniformity of high doses . reference doses with 100% coverage of the ptv in treatment applied with the 3d method are 31% higher than when applied with the 2d method . determination of the target area and the area of critical tissues is possible to a far greater extent by the application of the 3d method than is the case with the 2d method . the former method allows for the administration of high therapeutic doses , while minimizing any impact on critical organs . in the 2d method , such problems do not occur in the 3d method , which allows for uniformity of high doses .

purposeto present comparison of treatment plans made by using 2d and 3d methods in the planning system , as well as to assess the quality of treatment plans using the 2d and 3d methods.material and methodsthe studies involved a group of 31 patients with advanced lung cancer treated in the brachytherapy department of the subcarpathian cancer center in brzozw from 2011 to 2013 . in total , 31 patients and 76 treatment plans were analyzed . we compared coverage of ptv planned in 3d and 2d . in the 3d method of treatment , three - dimensional images from computer tomography were used . in treatment plans performed using the 2d method , images from the simulator were used.resultsthe comparison of treatment plans made by using 2d and 3d methods is described . this comparison highlighted the significant differences between these two methods assessing reference dose coverage of the ptv by 100% and 85% isodose.conclusionsreference doses with 100% coverage of the ptv in treatment applied with the 3d method are 31% higher than when applied with the 2d method .

metastatic involvement of axillary lymph node is the single most important prognostic factor in breast cancer . the presence of axillary involvement in breast cancer determines the patient 's survival and staging of the disease and plays an important part in local control . until recently , axillary lymph node ( alnd ) dissection was considered as the reference method for detecting lymph node involvement . however the rate of axillary lymph node metastasis is very low in patients diagnosed at an early stage [ 1 , 2 ] . hence studies in the last decade discourage the use of alnd because of significant associated morbidities such as lymphedema , paresthesias , infection , and decreased range of movement of shoulder . to avoid these unnecessary morbidities studies have proved that the drainage of breast lymphatics is in an orderly manner through initial node(s)the sentinel lymph node ( sln ) and almost 100% of breast cancer drain to axilla irrespective of the primary tumor 's location . studies have proved that slnd alone is sufficient for management of axilla in early cancers if sln is negative [ 4 , 5 ] . however high setup and operating costs and complex techniques have limited the widespread application of this methodology . ultrasound has found an increasingly important place in the preoperative evaluation of clinically negative axilla . if usg detects axillary metastasis , the slnb can be omitted and alnd can be performed directly . the sensitivity of usg in detecting metastatic involvement of axillary nodes has been reported to vary between 35% and 82% , while the specificity is between 73% and 98% [ 6 , 7 ] . some investigators reported that combined use of us and fine needle aspiration cytology ( fnac ) could provide a highly accurate preoperative lymph node screening [ 8 , 9 ] . however , fnac is subject to sampling errors with reported false positive rate of 1.4% to 1.6% [ 10 , 11 ] and also requires the cooperation of a highly experienced ultrasonologist and a cytopathologist . the wide variation in reported sensitivity and specificity of axillary usg apparently results from the use of a number of descriptors defining nodal involvement by metastasis . however there has not been any attempt to assess the accuracy of individual descriptors so far . hence we planned this study to evaluate the accuracy of individual descriptors ( sensitivity , specificity , positive predictive value and negative predictive value , and diagnostic accuracy ) when present alone as well as in combination . as a second objective of the study , we tried to grade the nodal involvement based on sensitivity and specificity of various descriptors present either alone or in combination to enhance the accuracy of preoperative usg assessment of the axilla . this grading system can help the investigator to assess the axilla more accurately and also guide in choosing the most suspicious nodes for fnac / core bx . usg guided localization of most suspicious nodes can also help the surgeons in sampling the axilla and provide a substitute for sentinel node biopsy in low resource settings . this prospective study was conducted on 34 consecutive patients of biopsy - proven breast cancer with clinically negative axillae in the department of surgery and department of radiology at ucms & gtb hospital , delhi , india . all of these patients were planned to undergo definitive surgery , conservative or modified radical mastectomy with axillary clearance . approval by the institutional ethics committee was obtained for the conduct of the study and patients were entered prospectively into the protocol of the study after signing an informed consent . the patients underwent a detailed clinical examination followed by examinations for baseline haematological and biochemical parameters including full blood count , blood urea , blood sugar , and complete liver function tests . they were subjected to other investigations for staging and metastatic workup as indicated , including mammography , chest x - ray , usg abdomen , bone scan , and ct scan . all these patients were subjected to preoperative usg of the axilla to determine the presence of nodes which were sonographically suspicious of malignancy . the descriptors which were considered suspicious were a : size more than 10 mm ; b : absence of fatty hilum ; c : hypoechoic internal echo ; d : circular shape ; e : sharply demarcated border compared with surrounding fatty tissue ; f : cortical thickening with eccentric lobulation of hypoechoic cortical rim [ 1214 ] . the nodes which showed cortex more than 2 - 3 mm , but otherwise uniformly widened with a central echogenic hilum , were marked as benign nodes with reactive adenopathy . the details of descriptors characterizing findings of suspicious nodes in each case were also noted . these nodes were marked on the skin with an indelible marker and depth from the skin surface was also noted ( figure 1 ) . at the time of surgery , after mobilisation of the axillary tail of breast , these nodes were taken out from the axillary fat pad separately , their localisation being guided by skin marking ( figure 2 ) . in obese patients with abundant axillary fat it was difficult initially to locate the node , but with experience we overcame the problem . after the sampling of these suspicious nodes , axillary dissection was completed along with surgery for the primary lesion . lymph nodes dissected out of the axilla were subjected to histopathological examination for metastatic disease . based on the correlation of usg and histopathologic ( hpe ) findings , sensitivity , specificity , positive predictive value ( ppv ) , negative predictive value ( npv ) , and diagnostic accuracy were calculated for each descriptor alone and in combination . based on these calculations , a grading system of ultrasonographic assessment of axillary lymph nodes was formulated . thirty - four patients with biopsy - proven breast cancer with clinically negative axilla were included in the study . the youngest patient in this study was 27 years old and the oldest was 60 years old . upper outer quadrant was the most common location ( 70.6% ) for primary lesion in the breast . as regards the tumor size , 8.8% had t1 tumor , 67.6% had t2 tumor , and 23.5% had t3 tumor . around 87.5% of patients with lump size exceeding 5 cm were detected to have axillary metastasis on biopsy as compared to 33% in the group with lump size < 2 cm . lymph nodes were demonstrated in 31 patients with preoperative ultrasonography of the axilla . in 3 patients no nodes could be identified . since the cortices of normal nodes are isoechoic with the axillary fat , they may not be conspicuous with ultrasound unless the nodes can be identified by more echogenic hilar fat . in these 3 patients hpe was negative for axillary metastasis . in 13 patients nodes were radiologically benign with uniform widening of the cortex and echogenic hilum positioned symmetrically in the centre of the node . metastatic criteria were demonstrated in 62 lymph nodes in 18 patients . in 6 of these patients , despite the presence of criteria for metastatic lymph nodes on ultrasonography , histopathological examination did not reveal any lymph node metastases . thus , ultrasonographic evaluation of the axilla in our study had a sensitivity of 100% , specificity of 72.7% , ppv of 66.7% , npv of 100% , and a diagnostic accuracy of 85% . the size of nodes ranged from 0.4 cm to 2 cm ( mean 0.97 ) . thirty - five nodes were marked with benign findings ( size 0.4 to 1.6 mm , mean 0.75 ) . sixty - two nodes were marked for suspicion of metastasis ( size 0.84 to 2 cm , mean 1.04 ) . of these , forty - four were positive for metastasis and 18 were negative . on further analysis of this data regarding the efficacy of individual predictors in predicting axillary nodal metastasis alone as well as in combinations , descriptor a had the highest sensitivity ( 81.8% ) but lowest specificity ( 16.6% ) . descriptor b and c almost always occurred together and thus had identical values and were most specific ( 83.3% ) of all , with highest ppv ( 91.6% ) . descriptor f had the lowest sensitivity and diagnostic accuracy and was also the least frequent finding on imaging . when we looked at the combinations , the most accurate assessment was made when round lymph nodes were seen with loss of fatty hilum and hypoechoic internal architecture ( descriptors b + c + d ) with specificity and positive predictive value of 100% each . least specific combination was enlargement of the lymph node with asymmetric cortical thickening with specificity of 44.4% and ppv of 54.5% . the rest of the combinations had intermediate ranges of sensitivity and specificity as shown in table 2 . a wide range of sensitivity and specificity figures for axillary usg , using different descriptors , have been reported by various authors . for example sousa et al . reported a 100% positive predictive value on finding of cortical thickness and nonhilar cortical vascular flow . reported a sensitivity of 92% and specificity of 95% when using criteria of round or oval hypoechoic lesions with a diameter of 5 mm or more . oz et al . used the criteria of cortical thickening > 3 mm , increased size of lymph node , an increase in sphericity index , increased cortical hypoechogenicity , and non hilar cortical flow and reported a sensitivity and specificity of 88.5% and 100% , respectively , and positive predictive value of 100% and negative predictive value of 66.6% . used criteria of loss of fatty hilum from central position , rounding of lymph node , decrease in echogenicity , and presence of eccentric cortical hypertrophy . they reported figures of specificity of 98.3% , sensitivity of 47.5% , positive predictive value of 95% , and negative predictive value of 73.7% . analysis of these reports shows that most commonly used descriptors of loss of fatty hilum , decrease in echogenecity and round lymph node have shown high sensitivity and specificity rates . other less commonly used criteria have been cortical thickening , non hilar cortical vascular flow , increased size of lymph node , eccentric cortical hypertrophy , and sharply demarcated border . in our study too , we found results on parallel lines . our overall ultrasonographic evaluation of the axilla had a sensitivity of 100% , specificity of 72.7% , ppv of 66.7% , npv of 100% , and a diagnostic accuracy of 85% . the high sensitivity rates in our study could be explained by the use of a wider range of descriptors compared to most of the other studies . as regards our findings about the accuracy of individual criteria , descriptor a ( size more than 10 mm ) was an unreliable predictor of malignancy and had high sensitivity ( 81.8% ) but low specificity ( 16.6% ) rates . benign reactive enlargement of the lymph nodes can be seen in response to fibrocystic changes , infections , and any process such as a recent biopsy which may activate the reticuloendothelial system . in one large series , an average diameter of 6.5 mm was determined for uninvolved lymph nodes and 9.7 for metastatic nodes with a range from 1.8 to 40.6 mm . thus while larger lymph nodes tend to correlate with metastasis , even small lymph nodes , a few mm in diameter , may contain metastasis . descriptors b and c showed high specificity ( 83.3% ) and ppv ( 91.61% ) rates . they indicate the process of advanced nodal involvement and can be easily detected with usg . on invasion of the hilum , although the nodes ' hilar fat may remain for some time , it gradually decreases over time . most of the studies using these descriptors too have reported high rates of diagnostic accuracy [ 16 , 18 ] . descriptor d ( round shape ) also showed high specificity ( 83.3% ) and ppv ( 87.5% ) rates , though lower sensitivity , which apparently is due to the fact that change from normal oval to round shape happens only with advanced nodal involvement . descriptors e and f showed lower rates of specificity and ppv and probably indicate intermediate patterns of metastatic involvement of the lymph node . many metastatic nodes have smooth , sharp margins , as at times lymph node metastasis may grow quite large before they penetrate the capsule . metastatic involvement may also displace the hilum to an asymmetric peripheral position with additional changes of asymmetric thickening of the cortical zone , seen on usg as hypoechoic or hyperechoic structural changes within the thickened , involved nodal cortex . when we analyzed these descriptors occurring in combination , the descriptors of round shape with loss of hilar fat and hypoechoic internal echoes had 100% specificity and ppv . the next most predictive combination was enlargement of node with loss of fatty hilum and hypoechoic internal echos ( specificity 88.8% and ppv 93.3% ) . other less accurate combinations were enlargement of nodes with sharply demarcated borders or enlarged node with asymmetric cortical thickening and at best can suggest suspicion of metastatic involvement of the nodes . taking a cue from the bi - rads - system for breast lesions based on analysis of combined features of different descriptors on breast ultrasound , different grades have been proposed , giving the highest level of suspicion for malignancy for a group of findings ; the following grading system can be formulated for axillary nodal sonographic findings . benign findings : reactive lymph nodes with maintained anatomical feature of the node ( figure 3 ) . suspicious : enlarged lymph nodes with asymmetric cortical thickening , cortical lobulations , sharply demarcated borders ( figures 4 and 5 ) . grade iv . highly suspicious for malignancy : asymmetric cortical thickening , hypoechoic internal echos , displacement of fatty hilum ( figure 6 ) . grade v. involved : hypoechoic internal echos , loss of fatty hilum , round shape ( figure 7 ) . benign findings : reactive lymph nodes with maintained anatomical feature of the node ( figure 3 ) . suspicious : enlarged lymph nodes with asymmetric cortical thickening , cortical lobulations , sharply demarcated borders ( figures 4 and 5 ) . highly suspicious for malignancy : asymmetric cortical thickening , hypoechoic internal echos , displacement of fatty hilum ( figure 6 ) . grade v. involved : hypoechoic internal echos , loss of fatty hilum , round shape ( figure 7 ) . this grading system can be further refined by prospective application in a larger sample of patients and by evaluation of newer parameters such as non hilar cortical vascular flow as seen on color doppler , which has recently been reported to be a very sensitive descriptor . sonoelastography and further improvement in imaging quality may identify newer descriptors which may further enhance the accuracy of axillary usg . this grading system can prove to be useful in selecting the appropriate lymph nodes for fnac / core biopsy for preoperative assessment of the axilla . nodes which show features of grade v or grade iv involvement should be targeted for sampling first over nodes of category iii , if they are identified on sonogram . four - node axillary sampling ( 4nas ) which is a cheaper alternative to sentinel node dissection relies on the surgeons ability to find abnormal palpable nodes in the axilla . to improve accuracy of 4nas , an ultrasound guided 4nas where suspicious nodes can be identified for sampling based on their sonographic features may still prove to be a more cost - effective technique in the future .

background . four - node sampling is a useful substitute for sentinel node biopsy in low resource settings . usg is being increasingly used as a preoperative tool to evaluate axilla . we conducted this study to assess the accuracy of different descriptors of axillary ultrasound and to formulate a model on grading of axillary involvement . material and methods . thirty - four patients with clinically negative axilla underwent preoperative axillary ultrasound . the suspicious nodes were marked and details of various descriptors were noted . these nodes were sampled during axillary dissection and correlation of ultrasonographic findings with histopathological report was done to calculate accuracy of different descriptors . based on this , a grading system of axillary lymph nodes involvement was formulated . results . based on the presence of various descriptors , five grades of nodal involvement could be defined . the most accurate descriptors to indicate nodal involvement were loss of hilar fat and hypoechoic internal echoes with specificity of 83% and positive predictive value of 92% each . the combination of descriptors of round shape with loss of hilar fat and hypoechoic internal echos had 100% specificity and positive predictive value . conclusions . grading of nodal involvement on axillary usg can be useful for selecting the most suspicious nodes for sampling during axillary dissection .

the results of imaging studies are negatively affected by patients movements ; hence , patient s cooperation is required during imaging . children s movements and lack of cooperation are common indications for pediatric procedural sedation during imaging studies such as computed tomography ( ct ) scans ( 1 ) . different rates of success have been achieved by various sedation regimens such as diphenhydramine , propofol , ketamine , midazolam ( 2 ) , chloral hydrate ( 3 ) , pentobarbital ( 4 ) , and dexmedetomidine ( 5 ) ; therefore , the efforts to find an ideal regimen are continued . the selected sedative should have a rapid onset of action , few adverse effects , short and sufficient duration of action , self - maintenance of a patent airway , minimal effects on respiration or hemodynamics , and rapid recovery ( 6 ) . over the last few years , researchers have shown a special interest in finding effective , nonparenteral , sedative agents that do not have injection problems ( 3 ) . ketamine is a noncompetitive antagonist of the n - methyl - d - aspartate receptor ( nmdar ) , which is used for premedication , sedation , and induction as well as maintenance of general anesthesia . quick onset , short duration of action , and maintenance of laryngeal reflexes have made it a popular sedative choice for pediatric patients in the emergency department ( 7 ) . although ketamine is known as a parenteral agent , some researchers have successfully used it as an oral sedative drug ( 8 , 9 ) . midazolam is a potent benzodiazepine with rapid onset and offset effects as well as anxiolytic and amnestic properties , which can be administered through different routes ( i.e. oral , intravenous , intramuscular , rectal , sublingual , and intranasal ) . oral midazolam ( om ) is a safe and effective choice for sedation in children ( 10 ) . in previous studies , the authors have used a combination of oral midazolam and ketamine ( omk ) as premedication and sedative regimens ; besides , some studies reported that combination therapy has higher efficacy without any additional adverse effects in comparison to the methods using each drug alone ( 11 , 12 ) . to the best of our knowledge , limited number of studies have reported the use of om during imaging , which had reported lower effectiveness rate in comparison with chloral hydrate ( 13 , 14 ) ; however , omk has not been used for this purpose , yet . therefore , this study was conducted to compare the effects of omk with om as procedural sedatives in pediatric patients undergoing ct imaging . study design and setting this randomized , double - blinded , clinical trial was conducted from november 2012 to november 2013 in two teaching hospitals ( ayatollah kashani hospital and alzahara hospital ) affiliated to isfahan university of medical sciences , isfahan , iran . the study protocol was approved by ethics committee of the isfahan university of medical sciences . all parents or guardians were informed of the study 's protocol , risks , and benefits and were asked to sign an informed written consent . we included six - month to six - year old children with medium - risk minor head trauma who were scheduled to undergo brain ct scan ( 15 ) . medium - risk minor head trauma was defined as initial glasgow coma scale score of 15 with any history of brief loss of consciousness , posttraumatic amnesia , vomiting , headache , or intoxication . all of these patients were classified as status i or ii according to american society of anesthesiologists ( asa ) physical status classification . children with neurological disorders , anomalies of the cardiovascular system , known allergy to midazolam , gastritis , any serious systemic diseases , those on long - term treatment with hepatic enzyme - inducing drugs or those receiving erythromycin concurrently ( due to drug interaction ) , and patients who had received medication within the preceding 48 hours were excluded . patients were randomly allocated to two groups ; om group received 0.5 mg / kg midazolam ( produced by ; tehran shimi , tehran , iran ) orally and omk group received 0.2 mg / kg midazolam and 5 mg / kg ketamine ( produced by ; rotexmedica , trittau , germany ) orally . demographic and basic characteristics such as age , height , gender , weight , body mass index ( bmi ) , and history of any medical condition were recorded before administration of study drugs . then a nurse , who was blinded to the study , mixed both of the medications with 5 ml of sugar syrup to make it palatable . pulse rate and oxygen saturation ( sao2 ) were continuously monitored by a portable pulse oximeter . blood pressure , heart rate , respiratory rate , and sao2 were recorded at baseline ( just before drug administration ) and every 30 minutes until the patient was discharged from the radiology department . the level of sedation of patients after drug administration was assessed using ramsay sedation scale ( rss ) ( 16 ) . patients who did not show satisfactory response to the sedative drugs within 40 minutes and those who were awakened or moved during the imaging were excluded from further analysis . the interval between administration of sedative drugs and achieving rss of four was considered as the time to achieve adequate sedation . once the patients achieved adequate sedation , they were transferred to a scanner room and the imaging was performed according to the protocol . after the scan , the patients were transferred to another room in the radiology department to monitor and observe their conditions . the time to discharge from radiology department was defined as the interval between the start of sedative administration and return to the baseline alertness and spontaneous breathing . statistical analyses all statistical analyses were performed using the spss 19.0 ( spss inc . , two - way anova was used to compare changes of vital signs during 180 minutes after drug administration between two groups . consort flow diagram of study inter - group differences of vital signs at baseline and at various time points after administration of midazolam and combination of midazolam - ketamine ( df : 18 , p > 0.05 for all comparisons ) . demographic characteristics of the participants a , data are presented as mean standard deviation . the outcomes of patients in midazolam and midazolam - ketamine groups om : oral midazolam ; omk : combination of oral midazolam - ketamine ; rd : radiology department . the mean age of participants was 2.8 1.6 years ( range : 6 months to 6 years ) and 54.5% of the participants were male . table 1 shows the basic characteristics of patients . there was no significant difference between the two groups in age , height , weight , and male to female ratio ( table 1 ) . adequate sedation ( rss of 4 ) was achieved in five patients ( 15.2% ) in the om group and 15 patients ( 45.5% ) in the omk group , which showed a statistically significant difference ( p = 0.015 ) . no significant difference was found between the groups in time of achieving adequate sedation ( p = 0.854 ) and the time of discharging from radiology department ( p = 0.223 ) . adverse effects observed in two patients ( one with nausea and another with vomiting ) in the om group and three patients ( two with nausea and one patient with vomiting ) in the omk group . complications were minor and transient and did not differ between study groups ( p > 0.05 ) . systolic blood pressure , sao2 level , pulse rate , and respiratory rate showed no significant inter - group differences at baseline and at various time points after administration of the drugs ( for all analysis : df = 18 , p > 0.05 , figure 2 ) . our investigation showed that in comparison to om , omk successfully induced sedation in 45% of the patients . om failed to sedate the patient in 85% of the cases and led to administration of additional medication and longer time to obtain the scan . ketamine is used for premedication , sedation , and induction as well as maintenance of general anesthesia with minimal effect on respiration and tendency to preserve autonomic reflexes ( 7 ) . it has been reported that 10 mg / kg of ketamine provides effective sedation and analgesia in young children undergoing wound repair processes ( 9 ) . moreover , 6 mg / kg of ok was reported to be effective in sedation for outpatient pediatric dental surgeries ( 10 ) . om is the most commonly used premedication in the united states ( 18 ) , which has been used as a safe and effective sedative in pediatrics , mainly in pediatric dentistry ( 10 , 17 ) ; however , intravenous midazolam has been found to induce more sedation ( 18 ) . intravenous or nasal midazolam has gained widespread popularity as a sedative for children undergoing radiographic studies such as ct scan ( - ) . the omk and om alone are safe , effective , and practical approach to manage children for minor dental procedures ( 22 , 23 ) . the efficacy of om and ketamine , alone or in combination has been studied in pediatric dentistry sedation and premedication ( - ) . reported better sedative effects during suturing lacerations with ok ( 10 mg / kg ) in comparison to om ( 0.7 mg / kg ) ( 27 ) . although our study was consistent with the previous studies regarding the higher efficacy of omk in comparison to om , most of the previous studies reported success rates of 60% to 90% for om ( 11 , 17 , 28 ) and 46% to 95% for omk ( 11 , 22 ) . showed that the combination of oral midazolam ( 0.5 mg / kg ) and ketamine ( 5 mg / kg ) led to deeper sedation in comparison with om ( 0.5 mg / kg ) alone in children requiring laceration repair . in addition , 27% of patients in the om group and 6% in the omk group needed further intravenous sedation ( 11 ) . ( 12 ) compared the efficacy of om ( 1 mg / kg ) and the omk ( midazolam , 0.5 mg / kg ; and ketamine , 3 mg / kg ) for guiding the behavior of children undergoing dental treatment and reported higher efficacy of omk . on the other hand , there are several studies reporting lower success rate , which are similar to our findings . ( 6 ) compared the sedative effects of intravenous midazolam with pentobarbital during brain ct imaging in children aged six months to six years . they administered pentobarbital to 29 patients ( 53% ) and midazolam ( mean dose , 0.2 0.03 mg / kg ) to 26 patients ( 47% ) . in the midazolam group , only five patients ( 19% ) were successfully scanned with midazolam alone and the remaining 21 patients ( 81% ) required additional medication and took a longer time to scan . another investigation reported a failure rate of 60% in administrating intranasal midazolam ( 0.2 mg / kg ) for sedation of children undergoing ct scan ( 3 ) . ( 29 ) used 0.4 mg / kg of om 20 minutes before the induction of general anesthesia and reported a mild or no sedative effect in 76% to 84% of patients . in this study , the onset time of adequate sedation was 33 minutes in om group and 32 minutes in omk group . ( 27 ) reported an onset time of 20 minutes for ok and 43 minutes for om . other studies reported that the time to reach optimal sedation level would be 15 minutes for om ( 10 , 17 ) . studies , which used om ( 0.5 - 1 mg / kg ) as premedication reported that the best time for optimal preoperative sedation would be 30 to 45 minutes before scan ( 30 ) . barkan observed that the needed time to achieve adequate sedation was 17 minutes for om and 14 minutes for omk . the patients ' blood pressure , respiratory rate , pulse rate , and sao2 levels did not show any significant changes during the sedation . although ketamine and midazolam affect the respiratory and hemodynamics responses ( 11 ) , our results were in line with the findings of previous studies that reported minimal effects of low - dose om and ok on these parameters ( 17 , 31 ) . although further studies are needed to confirm or refute our results and attention to the pharmacological aspects is necessary , lower efficacy of om in this study could be explained as follows : first , we used these drugs for ct imaging that needs a deeper level of sedation in comparison with some other studies that used those drugs in other settings as premedication . second , in the previous studies , intravenous forms of these drugs were used , which might bring about unexpected results ; the same drugs in different studies should be compared with caution . third , the ethnic differences in response to these sedative agents might affect the results . a major cause of variations in drug responses is hepatic cytochrome p450 oxidase ( cyp450)-mediated drug metabolism ( 29 ) . midazolam is almost exclusively metabolized by cyp450 3a ( cyp3a ) isoenzymes ( 32 ) . although previous studies have shown that these parenteral forms can be used orally , the oral form of drugs might bring about results that are more precise . second , the number of participants who were included in the final analysis ( as sedated patients ) was small . this study demonstrated that in comparison with om , omk was more effective in producing a satisfactory level of sedation in children undergoing ct examinations without additional complications ; however , none of these two regimens fulfilled clinical needs for procedural sedation . all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors .

introduction : motion artifacts are a common problem in pediatric radiographic studies and are a common indication for pediatric procedural sedation . this study aimed to compare the combination of oral midazolam and ketamine ( omk ) with oral midazolam alone ( om ) as procedural sedatives among children undergoing computed tomography ( ct ) imaging . methods : the study population was comprised of six - month to six - year old patients with medium - risk minor head trauma , who were scheduled to undergo brain ct imaging . patients were randomly allocated to two groups : one group received 0.5 mg / kg midazolam ( om group ; n = 33 ) orally and the other one received 0.2 mg / kg midazolam and 5 mg / kg ketamine orally ( omk group ; n=33 ) . the vital signs were monitored and recorded at regular intervals . the primary outcome measure was the success rate of each drug in achieving adequate sedation . secondary outcome measures were the time to achieve adequate sedation , time to discharge from radiology department , and the incidence of adverse events . results : adequate sedation was achieved in five patients ( 15.2% ) in om group and 15 patients ( 45.5% ) in omk group , which showed a statistically significant difference between the groups ( p = 0.015 ) . no significant difference was noted between om and omk groups with respect to the time of achieving adequate sedation ( 33.80 7.56 and 32.87 10.18 minutes , respectively ; p = 0.854 ) and the time of discharging from radiology department ( 89.60 30.22 and 105.27 21.98 minutes , respectively ; p=0.223 ) . the complications were minor and similar among patients of both groups . conclusion : this study demonstrated that in comparison with om , omk was more effective in producing a satisfactory level of sedation in children undergoing ct examinations without additional complications ; however , none of these two regimens fulfilled clinical needs for procedural sedation .

highly chemoselective direct reduction of primary , secondary , and tertiary amides to alcohols using smi2/amine / h2o is reported . the reaction proceeds with c n bond cleavage in the carbinolamine intermediate , shows excellent functional group tolerance , and delivers the alcohol products in very high yields . the expected c o cleavage products are not formed under the reaction conditions . the observed reactivity is opposite to the electrophilicity of polar carbonyl groups resulting from the nx *c = o ( x = o , n ) conjugation . mechanistic studies suggest that coordination of sm to the carbonyl and then to lewis basic nitrogen in the tetrahedral intermediate facilitate electron transfer and control the selectivity of the c n / c o cleavage . notably , the method provides direct access to acyl - type radicals from unactivated amides under mild electron transfer conditions .

patient 1 was a previously healthy , 51-year - old woman . during july 2004 , she visited family residing in rural ohio and participated in a variety of outdoor activities . although she saw many wild animals , including deer , she did not report tick attachment or insect bites . within 24 hours of her return home to north carolina , a nonpuritic , slightly raised , circular red lesion , approximately the size of a quarter , was noted on the medial aspect of her thigh . within 3 days , two weeks later , she exhibited a dry cough , fatigue , muscle pain in the upper body , severe chills , and extreme pain in both feet . during the next 2 years , these symptoms persisted , along with exertional chest pains , a previously undiagnosed ausculted ii to iii / vi holosystolic murmur , headaches , difficulty speaking , difficulty sleeping , weakness involving the arms , joint pain , and facial tremors . an echocardiogram identified mildly thickened aortic and mitral valve leaflets , mild aortic insufficiency , and mild mitral regurgitation . after the acute illness , the woman reported cycles of illness every 3 to 4 weeks . results of numerous complete blood counts were normal , with the exception of persistently low neutrophil counts of 2,0002,500 neutrophils/l . borrelia burgdorferi c6 peptide and immunoglobulin ( ig ) m and igg antibodies to babesia microti were not detected . results of pcrs specific for anaplasma phagocytophilum , b. microti , and b. burgdorferi were negative . oral antimicrobial drugs resulted in transient improvement ; however , symptoms returned within days after the use of these drugs was stopped . blood culture resulted in the detection of candidatus b. melophagi and isolation of b. henselae . treatment with rifampin and azithromycin , started in january 2006 , resulted in some overall improvement in symptoms . cefuroxime was added in february , and the combination resulted in substantial improvement , after which the drugs were selectively withdrawn . for 15 years before the onset of illness , this person had worked as an animal shelter manager in west virginia and as a veterinary office manager in virginia . patient 2 was a 65-year - old woman whose condition had been diagnosed as pericarditis of undetermined etiology in september 2004 . six months later , because of residual fatigue and muscle weakness in the arms and legs , mostly on her right side , a blood sample was cultured in bartonella alpha proteobacteria growth medium ( bapgm ) . the woman lived on a farm in southern california with her husband and managed a large animal sanctuary that also housed 100 cats and 100 dogs . she had resided in southern california for 50 years but occasionally traveled to the southeastern united states and other countries . she was directly involved in daily care of animals and had exposure to pet cattle and sheep , wolf hybrids , lamas , emus , pigs , horses , and numerous pet bird species . bites and scratches were a daily occurrence , and exposure to cattle and sheep occurred at least weekly . in addition , the woman reported daily exposure to biting flies , occasional exposure to ticks and mosquitoes , and infrequent exposure to fleas or lice . serum was reactive at a titer of 64 to b. henselae , b. vinsonii subsp . we used bapgm and other published blood culture methods to test blood samples from both women ( 2,8,9 ) . candidatus b. melophagi dna was amplified directly from blood of patient 2 , and from the respective bapgm enrichment cultures and 14-day subculture colonies from both patients . sequence analysis of respective colony isolates showed b. henselae ( internal transcribed spacer [ its ] sequence identical to houston 1 strain , data not shown ) and candidatus b. melophagi from patient 1 and candidatus b. melophagi ( isolate 05-ho-1 ) from patient 2 . both isolates were composed of extremely small gram - negative bacilli consistent with bartonella spp . unfortunately , attempts to separate b. henselae and candidatus b. melophagi colonies from the sample of patient 1 by serial passage were unsuccessful . dna was not amplified from an uninoculated bapgm control culture or from sheep blood used as a supplement . flagella , as visualized in the candidatus b. melophagi strain k-2c isolated from sheep blood ( figure ) , were not visualized in the human 05-ho-2 strain by transmission electron microscopy . * its , internal transcribed spacer ; glta , citrate synthase ; rpob , rna polymerase b ; na , not available . candidatus b. melophagi strain k-2c isolated from a sheep ked ( m. kosoy , unpub . data ) . candidatus b. melophagi strains k-9b and k-2c isolated from sheep ked ( genbank accession nos . ay724769 and ay724769 ) . x89110 ) . candidatus b. melophagi strain k-2c isolated from a sheep ked ( genbank accession no . transmission electron micrographs of candidatus bartonella melophagi like isolate 05-ho-1 from a human ( a ) ( image provided by the north carolina state university college of veterinary medicine electron microscopy facility , raleigh , nc , usa ) and candidatus b. melophagi isolate from a sheep ked ( b ) ( image provided by v. popov , university of texas medical branch , galveston , tx , usa ) . based on 16s rrna , citrate synthase and rna polymerase b genes , and the 16s23s its region , the bacteria detected in these woman was most likely candidatus b. melophagi , which was recently isolated from sheep blood and sheep keds ( 10 ; m. kosoy , unpub . its sequences were nearly identical to those of wolbachia melophagi detected in a tick removed from sheep in peru ( 11 ) . similar to electron micrographs of the bartonella sp . isolated from sheep blood ( 1 ) , no flagella were observed by transmission electron microscopy of the 05-ho-1 human isolate , whereas the sheep ked isolate contains flagella . because both women had had frequent contact with numerous domestic and wild animals and potential insect vectors , the route of transmission is unknown . the clinical relevance of candidatus b. melophagi infection in these women remains to be established . nonspecific abnormalities , including difficulty sleeping , muscle weakness , joint pain , and facial tremors , have been reported in association with isolation of b. henselae and b. vinsonii subsp . pericardial or pleural effusions are infrequent complications of b. henselae infection in association with classical cat - scratch disease ( 13,14 ) . before the report of candidatus b. melophagi in commercial sheep blood sources in 2007 ( 10 ) , sheep blood was used as a bapgm supplement in our laboratory . with the exception of these 2 patients , candidatus b. melophagi was never detected by pcr in > 2,250 bapgm enrichment blood cultures or subculture isolates obtained from animals or humans . in addition , candidatus b. melophagi dna was never amplified from > 250 bapgm uninoculated bapgm enrichment control cultures , and bacterial colonies were never observed after subculture . beginning in 2007 , we also found that some batches of commercial sheep blood contained candidatus b. melophagi dna . , bapgm was used to facilitate isolation of b. tamiae from human patients in thailand ( 7 ) , and another laboratory has published data supporting the utility of insect cell culture media for growing bartonella spp .

candidatus bartonella melophagi was isolated by blood culture from 2 women , 1 of whom was co - infected with b. henselae . partial 16s rrna , rna polymerase b , and citrate synthase genes and 16s23s internal transcribed spacer sequences indicated that human isolates were similar to candidatus b. melophagi .

jugular foramen paragangliomas are rare , slow - growing , encapsulated , hypervascular tumors that arise from jugular foramen of temporal bone ( 1 ) . jugular foramen paraganglioma are known to occur predominantly in the age of 50 to 60 , and female to male ratio is reported to be 5:1 ( 1 , 2 ) . incidence of multiple lesion is reported to be between 25 to 50% in familial cases , compared with less than 10% in sporadic cases ( 1 ) . jugular foramen paragangliomas are locally invasive , expanding within the temporal bone via pathways of least resistance , such as air cells , vascular lumens , skull base foramina , and eustachian tube ( 3 , 4 ) . significant intracranial and extracranial extension may occur , as well as extension within the sigmoid sinus and inferior petrosal sinuses ( 3 - 5 ) . clinical course of jugular foramen paragangliomas reflects their slow growth and paucity of symptoms , which often results in a significant delay in diagnosis ( 1 , 3 , 6 ) . the most common presenting symptom is known to be pulsatile tinnitus , followed by hearing loss ( 2 , 7 ) . complete surgical resection is the ideal management of most jugular foramen paragangliomas ( 2 , 5 , 7 - 9 ) . radiation therapy can be utilized as an alternative treatment modality for certain candidates including elderly and medically inoperable patients , and is also indicated in recurred tumor after surgical resection and in residual tumors when gross total removal of extensive tumor could not be carried out ( 10 ) . gamma knife surgery is recently introduced and can be used as a primary tool in cases without significant cervical extension or in patients with recurrent tumors in intracranial area ( 10 ) . to identify the clinical characteristics and most effective surgical approach , the authors have made a retrospective analysis of the patterns of clinical presentation , surgical approaches and treatment outcomes in 9 patients with jugular foramen paraganglioma who underwent surgical treatment . the patient group consisted of 4 men and 5 women who underwent surgery by a single surgeon between 1986 and 2005 . mean age at the time of diagnosis was 40.8 yr , ranging from 26 to 60 yr . follow up period was 29 month to 264 months , with mean follow up period of 93 months . five cases occurred on the right side and remaining 4 cases on the left , and there was one case where bilateral lesion was detected . review of clinical records was performed , analyzing initial clinical symptoms and signs , audiological examinations and neurological deficits , radiological features , surgical approaches , extent of resection , treatment outcomes and postoperative complications . the extent of jugular foramen paraganglioma was classified according to fisch classification , based on radiological findings . most common initial symptom at the time of first outpatient visit was hoarseness which was observed in 4 patients , followed by pulsatile tinnitus which was noted in 3 cases ( table 1 ) . sudden sensorineuronal hearing loss in 2 patients , facial palsy in 2 patients and neck mass in 1 patient were also reported . all patients except for 2 cases had at least one low cranial nerve palsy on evaluation . most common neurologic deficit on presentation was 10th nerve palsy , followed by 9th nerve , 12th nerve , and 7th nerve in order . the extent of jugular foramen paragangliomas were classified according to fisch classification with radiologic findings of mri . seven patients were classified as type c ( fig . 1 ) and remainnig 2 patients were type d ( fig . size of the tumor varied from as small as 1.51 cm to as large as 4.59 cm . on angiography , all tumors had at least one main feeding vessel . ascending pharyngeal artery was the most common feeding vessel , and successful embolization of the feeding vessel was achieved in all cases ( fig . complete resection was achieved in 6 patients , and all of them is under regular outpatient follow - up without any sign of recurrence . all type d tumors resulted in partial resection and 1 out of 7 type c tumors was partially resected . the residual tumor in the 2 cases of type d jugular foramen gangliomas was the portion of intracranial extension . in one type d tumor case ( case 5 ) , 1 cm sized residual tumor was suspected in postoperative mri after first operation in 1999 . the patient received gamma knife radiosurgery ( gks ) on the remnant tumor and was continuously observed with mri at the outpatient . however , the patient had to undergo revision operation in cooperation with neurosurgery department in 2006 because the tumor mass grew as large as 4 cm . tumor still remained after the second operation and revision operation by neurosurgery department was performed in 2007 , still resulting in small portion of residual tumor . the remaining tumor is under observation currently . in the remaining two partial resection cases , however , the patients refused to undergo the burden of major surgery twice after the first operation ( infratemporal approach ) , and gamma knife surgery had to be performed as an alternative to planned staged operation by neurosurgery department . tumor was completely shrunken in one case , and tumor was stabilized without growing in the other case . no mortality was encountered during the follow - up period , ranging from 17 to 275 months ( mean , 71 months ) . in all 4 cases , patient showed h - b grade iv palsy which returned to h - b grade ii palsy in a few months . since infratemporal fossa approach inevitably encounters facial palsy due to transposition of facial nerve , facial palsy of grade better than h - b grade ii three patients received arytenoid adduction , 2 cases due to unilateral vocal cord palsy , and one case due to decreased vocal cord mobility . in other case , left vocal cord palsy developed , but the patient did not undergo arytenoid adduction since symptom due to vocal cord palsy was not prominent . most common initial symptom at the time of first outpatient visit was hoarseness which was observed in 4 patients , followed by pulsatile tinnitus which was noted in 3 cases ( table 1 ) . sudden sensorineuronal hearing loss in 2 patients , facial palsy in 2 patients and neck mass in 1 patient were also reported . all patients except for 2 cases had at least one low cranial nerve palsy on evaluation . most common neurologic deficit on presentation was 10th nerve palsy , followed by 9th nerve , 12th nerve , and 7th nerve in order . the extent of jugular foramen paragangliomas were classified according to fisch classification with radiologic findings of mri . seven patients were classified as type c ( fig . 1 ) and remainnig 2 patients were type d ( fig . size of the tumor varied from as small as 1.51 cm to as large as 4.59 cm . on angiography , all tumors had at least one main feeding vessel . ascending pharyngeal artery was the most common feeding vessel , and successful embolization of the feeding vessel was achieved in all cases ( fig . complete resection was achieved in 6 patients , and all of them is under regular outpatient follow - up without any sign of recurrence . all type d tumors resulted in partial resection and 1 out of 7 type c tumors was partially resected . the residual tumor in the 2 cases of type d jugular foramen gangliomas was the portion of intracranial extension . in one type d tumor case ( case 5 ) , 1 cm sized residual tumor was suspected in postoperative mri after first operation in 1999 . the patient received gamma knife radiosurgery ( gks ) on the remnant tumor and was continuously observed with mri at the outpatient . however , the patient had to undergo revision operation in cooperation with neurosurgery department in 2006 because the tumor mass grew as large as 4 cm . tumor still remained after the second operation and revision operation by neurosurgery department was performed in 2007 , still resulting in small portion of residual tumor . the remaining tumor is under observation currently . in the remaining two partial resection cases , however , the patients refused to undergo the burden of major surgery twice after the first operation ( infratemporal approach ) , and gamma knife surgery had to be performed as an alternative to planned staged operation by neurosurgery department . tumor was completely shrunken in one case , and tumor was stabilized without growing in the other case . no mortality was encountered during the follow - up period , ranging from 17 to 275 months ( mean , 71 months ) . in all 4 cases , patient showed h - b grade iv palsy which returned to h - b grade ii palsy in a few months . since infratemporal fossa approach inevitably encounters facial palsy due to transposition of facial nerve , facial palsy of grade better than h - b grade ii three patients received arytenoid adduction , 2 cases due to unilateral vocal cord palsy , and one case due to decreased vocal cord mobility . in other case , left vocal cord palsy developed , but the patient did not undergo arytenoid adduction since symptom due to vocal cord palsy was not prominent . our collected data showed some differences from the previous reports on jugular foramen paraganglioma . in previous reports , jugular foramen paraganglioma is known to occur predominantly in the age of 50 to 60 , and female to male ratio is reported to be 5:1 ( 1 , 2 ) . however , the female to male ratio was 5:4 , and tumors were detected at the mean age of 40.8 yr in our data , even though the age of detection was distributed widely , not being focused to certain age group . our data showed no significant preference to certain sex , age and site , in terms of incidence . most common initial presenting symptom at the time of first visit to the outpatient was hoarseness , whereas the most common presenting symptom is known to be pulsatile tinnitus , followed by hearing loss in the previous reports ( 2 , 7 ) . lower cranial nerve dysfunction is relatively common with glomus jugulare tumors and includes dysphagia , hoarseness , aspiration , tongue paralysis , shoulder drop , and voice weakness ( 3 , 5 , 7 ) . our result was consistent with that , and 7 out of 9 patients showed at least one low cranial nerve palsy , emphasizing the importance of neurologic evaluation of low cranial palsy at the time of first visit . emphasis should also be given on the fact that patients without pulsatile tinnitus should not be excluded from the suspicion of jugular foramen paraganglioma . facial nerve paralysis is known to occur less commonly , but it signals advanced disease and is related with poor facial nerve prognosis outcome ( 3 , 5 , 7 ) . facial palsy was present in 2 cases in our data and both cases were advanced jugular foramen paragangliomas . facial nerve function was not restored from the initial facial nerve palsy after the operation in both cases . on imaging evaluation with mri , 7 patients were type c tumors and remaining 2 cases were type d tumors . it correlates with the fact that jugular foramen paragangliomas are slow growing and lack symptoms which results in the late diagnosis of the tumor ( 1 , 3 , 6 ) . successful embolization and surgical removal of tumor without massive bleeding were achieved in all cases . ascending pharyngeal artery was the most common feeding vessel , as reported previously ( 11 ) . since the tumor is hypervascular in nature , angiography is crucial to identify main feeding vessels and embolize them prior to surgery which decreases the chance of massive bleeding intraoperatively ( 11 ) . complete surgical resection is the ideal management of most jugular foramen paragangliomas ( 2 , 5 , 7 - 9 ) . in our cases , 6 out of 7 type c tumors were resected completely and are under observation without any sign of recurrence . all type d tumors resulted in partial resection and 1 out of 7 type c tumors was partially resected . gks after partial resection of the tumor was reported to be effective ( 10 ) , but recurrence was observed in 1 out of 3 cases in our data . we recommend that combined approach in cooperation with the neurosurgery department should be implemented in the first place in cases of jugular foramen ganglioma with intracranial extension , rather than planning a staged operation . showed that a single - stage resection and reconstruction offered the greatest likelihood of complete tumor removal while preserving local tissue for use in reconstruction ( 12 ) . combined approach can include infratemporal fossa , suboccipital , middle fossa , anterior craniofacial , translabrynthine approach , and more . these approaches can be combined depending on the location of the tumor ( 12 , 13 ) . combined approach can expose the tumor better than single approach since better operative view of the tumor can be obtained from two different angles , which should result in better chance of complete removal of the tumor ( 13 ) . the widened view also prevents excessive effort to remove unvisualized portion of the tumor , which might cause injuries to the nerves . there is a problem to seal a larger defect in combined approach compared with a single approach , but advances in reconstruction technique of the defect has decreased concerns to this problem ( 12 , 13 ) . combined approach is also much better to maintain compliance of the patient for the treatment . in our cases , all patients in whom staged operation was planned refused to undergo the secondary operation due to decreased compliance after the first operation . in our cases , infratemporal approach was sufficient in complete resection of the tumor in most cases when intracranial extension was not present , with the aid of embolization . no mortality was encountered and permanent postoperative complications occurred in few cases , as observed in the results . with skilled surgical technique , infratemporal fossa approach can be considered as a safe and effective approach for removal of jugular foramen paraganglioma without intracranial extension . low cranial involvement was present in most of the cases , suggesting that neurologic examination of the low cranial nerve is crucial . in the surgical aspect , it can be concluded that infratemporal fossa approach provides safe , satisfactory way to remove jugular foramen paraganglioma , but combined approaches is strongly recommended instead of staged operation when treating jugular foramen paraganglioma with intracranial extension .

objectivesjugular foramen paraganglioma is a locally invasive , benign tumor , which grow slowly and causes various symptoms such as pulsatile tinnitus and low cranial nerve palsy . complete surgical resection is regarded as the ideal management of these tumors . the goal of this study is to identify the clinical characteristics and most effective surgical approach for jugular foramen paraganglioma.methodsretrospective analysis of 9 jugular foramen paraganglioma patients who underwent surgical resection between 1986 and 2005 was performed . clinical records were reviewed for analysis of initial clinical symptoms and signs , audiological examinations , neurological deficits , radiological features , surgical approaches , extent of resection , treatment outcomes and complications.resultsmost common initial symptom was hoarseness , followed by pulsatile tinnitus . seven out of 9 patients had at least one low cranial nerve palsy . seven patients were classified as fisch type c tumor and remaining 2 as fisch type d tumor on radiologic examination . total of 11 operations took place in 9 patients . total resection was achieved in 6 cases , when partial resection was done in 3 cases . two patients with partial resection received gamma knife radiosurgery ( gks ) , when remaining 1 case received both gks and two times of revision operation . no mortality was encountered and there were few postoperative complications.conclusionneurologic examination of low cranial nerve palsy is crucial since most patients had at least one low cranial nerve palsy . all tumors were detected in advanced stage due to slow growing nature and lack of symptom . angiography with embolization is crucial for successful tumor removal without massive bleeding . infratemporal fossa approach can be considered as a safe , satisfactory approach for removal of jugular foramen paragangliomas . in tumors with intracranial extension , combined approach is recommended in that it provides better surgical view and can maintain the compliance of the patients .

hypertension is a frequently encountered clinical condition that , if left untreated , leads to heart or kidney failure , stroke and even death . although the underlying molecular mechanisms of hypertension have been extensively studied , the interactions between vasodilators and vasoconstrictors have not been fully revealed . adrenomedullin ( adm ) has been recognized as a vascular dilating polypeptide that could decrease blood pressure . the adm precursor comprises 185 amino acid residues that can be digested into four fragments by proteolytic cleavage . the n - terminal fragment is the functional proadrenomedullin n - terminal 20 amino acid peptide , known as pamp . increased levels of both adm and pamp have been clinically detected in the plasma of hypertensive patients , as well as in the spontaneously hypertensive rat ( shr ) model . while it is hypothesized that adm and pamp are involved in blood pressure elevation , their precise contributions remain largely undefined ( 1 ) . the vasoconstrictor angiotensin ii ( angii ) is a key regulator of the hypertensive process and plays an important role in atherosclerosis . mechanistically , angii stimulates protein kinase c ( pkc ) activity and promotes the proliferation and hypertrophy of vascular smooth muscle cells ( vsmc ) . angii can also activate phospholipase c by coupling with g protein , causing hydrolysis of phosphatidyl inositol bisphosphate and generating inositol trisphosphate and diglyceride . the inositol trisphosphate then promotes an increase in intracellular ca and cell constriction , while the diglyceride increases intracellular protein synthesis and cell body enlargement by activation of protein kinase c , thereby promoting cell proliferation ( 1 ) . in the normal human circulatory system , vasodilators and vasoconstrictors act in concert to maintain the appropriate blood pressure , and perturbed expression of each may lead to life - threatening events . in this study , we sought to determine whether the vasodilators adm and pamp were functionally related to the vasoconstrictor angii . in addition , the potential effects of adm and pamp on angii - stimulated vsmc proliferation was investigated using in vitro cultured rat aortic vsmcs . four male wistar rats , weighing 180 to 200 g , were obtained from the animal center at peking medical university , china . all procedures involving animals were conducted in accordance with guidelines for the care and use of laboratory animals published by the national institute of health ( usa ) and with pre - approval by the local ethics committee . blood was gently rinsed using normal saline chilled to 4 c before removing the attached extravascular connective tissue . the aorta was then cut into 2 - 3 mm long slices , divided equally into six tubes and prepared for incubation . then , cells were subcultured in rpmi-1640 containing 20% fetal bovine serum ( fbs ) ( sigma - aldrich co. , usa ) according to the method of hirata ( 2 ) . microscopic examination revealed that cells underwent the proper peak and valley kinetic pattern of growth . six tubes of aortic slices were separately incubated in a solution of 118 mmol / l nacl , and 4.7 mmol / l each of kcl , cacl2 , mgso4 , kh2po4 , nahco3 , and d - glucose at 37c in a dry atmosphere of 95% o2 and 5% co2 . for experiments , angii , pamp , or adm ( usa ) were added at various concentrations ( described below ) and incubated for 4 hr at 37 c in a water bath with tremor oscillations . internal atmosphere following incubation , the solution was gently removed from the tissue samples , discarded and replaced with 1 ml acetic acid 1 n. the tissue samples were then boiled for 15 min before weighing . after that , the tissues were homogenized in 2 mol / l acetic acid ( 1:10 w / v ) and centrifuged at 10000 rpm for 20 min . the individual supernatants were collected and filtered through sep - pakc18 chromatography columns ( perkin - elmer , co. , usa ) . following elution and freeze - drying , pamp , adm and angii concentrations in the incubation medium and tissues were determined using radioimmunoassay and standard protein quantification . there were no cross - responses observed among the adm-(1 - 52 ) antibody and the human adm-(13 - 52 ) , rat adm-(1 - 52 ) , human calcitonin gene - related peptide ( cgrp ) , human et-1 , alpha human atrial natriuretic petide ( anp)-(1 - 28 ) , bnp-32 , or cnp-22 antibodies . the ranges of standard curves of pamp and ang ii were 1 to 128 pg / tube and 5 to 160 pg / ml , respectively . no cross - immune responses were found between antibody and adm . for vsmc experiments , the following reagents and concentrations were added directly into the culture medium : 10 mol / l adm ( adm group ) ; 10 mol / l pamp ( pamp group ) ; 10 mol / l ang ii(ang ii group ) ; 10 mol / l ang ii with various concentrations ( 10 , 10 , 10 mol / l ) of adm ( adm + ang ii group ) ; 10 mol / l ang ii with various concentrations ( 10 , 10 , 10 mol / l ) of pamp ( pamp + ang ii group ) . the concentrations of pamp and adm used here are similar to the serum levels but different from the tissue levels of pamp and adm in vivo , which is more convenient for us to observe the functions of pamp and adm . the assays were repeated in six wells . for experiments on incubated aortic sections , 10 - 9 , 10 - 8 or 10 - 7 mol / l of angii or pamp reagent were respectively added to the incubation medium . in the control group , vsmc suspensions ( 510 cells / ml ) were inoculated in 24-well plates , and incubated for 24 hr , then shifted to low serum ( 0.5% fbs ) rpmi-1640 and incubated for another 12 hr . various concentrations and combinations of angii , pamp or adm were then added to each well according to the above - mentioned treatment groups . after 6 hr of incubation , 0.5 cih - thymidine ( h - tdr ) was added to each well . the cells were collected using a micropore film ( millipore , usa ) and treated with 10% trichloroacetic acid ( tca ) . scintillation liquid was added and h - radioactivity was measured by a liquid scintillation counting instrument ( lkb1209 ; beckman , sweden)(3 ) . vsmc suspensions ( 110 cells / ml ) were inoculated in 24-well plates and shifted to low serum culture media for 24 hr . after that , cells were shifted to low serum ( 0.5% fbs ) rpmi-1640 ) and incubated for an additional 24 hr . various concentrations and combinations of angii , pamp , or adm were added according to the above treatment groups and allowed to incubate for one hour . cells were collected by centrifugation and resuspended in a reaction solution of 5.2 mmol / l mgcl2 , 94 mmol / l kcl , 12.5 mmol / l hepes , 12.5 mmol / l egta , and 8.2 mmol / l cacl2 , ( ph 7.4 ) . then , 0.2 mmol / l pkc substrate peptide and 0.3 l streptolysin o were added to make a final volume of 150 l . after 10 min of incubation at 37 c , -p - atp ( sigma - aldrich ) was added at 37 kbq / well ( containing 0.2 mmol / l atp - na2 ) to initiate the reaction . after 10 min , 100 l of stop solution ( 2.5% tca dissolved in 2 mol / l acetic acid ) was added to terminate the reaction , followed by incubation on ice for 10 min . aliquots of 120 l supernatant were spotted on p81 ion - exchange chromatography filter paper ( whatman , usa ) and dried in open - air . then , the filters were washed two times with the eluent solution ( 30% acetic acid ( v / v ) and 1% phosphoric acid ( v / v ) ) , and once with anhydrous alcohol . the filter paper was then placed into a scintillation vial following desiccation , and scintillation liquid was added in order to measure the p radioactivity using a liquid scintillation counter ( lkb1209 ; beckman , sweden ) . relative pkc activity was determined by calculating the difference in radioactivity between the experimental and control samples , and was expressed as pmol pi/10 cell ( 3 ) . each experiment was performed as parallel - well experiments , and was repeated at least six times . four male wistar rats , weighing 180 to 200 g , were obtained from the animal center at peking medical university , china . all procedures involving animals were conducted in accordance with guidelines for the care and use of laboratory animals published by the national institute of health ( usa ) and with pre - approval by the local ethics committee . blood was gently rinsed using normal saline chilled to 4 c before removing the attached extravascular connective tissue . the aorta was then cut into 2 - 3 mm long slices , divided equally into six tubes and prepared for incubation . then , cells were subcultured in rpmi-1640 containing 20% fetal bovine serum ( fbs ) ( sigma - aldrich co. , usa ) according to the method of hirata ( 2 ) . microscopic examination revealed that cells underwent the proper peak and valley kinetic pattern of growth . six tubes of aortic slices were separately incubated in a solution of 118 mmol / l nacl , and 4.7 mmol / l each of kcl , cacl2 , mgso4 , kh2po4 , nahco3 , and d - glucose at 37c in a dry atmosphere of 95% o2 and 5% co2 . for experiments , angii , pamp , or adm ( usa ) were added at various concentrations ( described below ) and incubated for 4 hr at 37 c in a water bath with tremor oscillations . internal atmosphere following incubation , the solution was gently removed from the tissue samples , discarded and replaced with 1 ml acetic acid 1 n. the tissue samples were then boiled for 15 min before weighing . after that , the tissues were homogenized in 2 mol / l acetic acid ( 1:10 w / v ) and centrifuged at 10000 rpm for 20 min . the individual supernatants were collected and filtered through sep - pakc18 chromatography columns ( perkin - elmer , co. , usa ) . following elution and freeze - drying , samples were stored at -70 c until further use . pamp , adm and angii concentrations in the incubation medium and tissues were determined using radioimmunoassay and standard protein quantification . there were no cross - responses observed among the adm-(1 - 52 ) antibody and the human adm-(13 - 52 ) , rat adm-(1 - 52 ) , human calcitonin gene - related peptide ( cgrp ) , human et-1 , alpha human atrial natriuretic petide ( anp)-(1 - 28 ) , bnp-32 , or cnp-22 antibodies . the ranges of standard curves of pamp and ang ii were 1 to 128 pg / tube and 5 to 160 pg / ml , respectively . the total binding rate was 40.9% and nsb was 8.52% . the mean within - assay variability was 4.1% . for vsmc experiments , the following reagents and concentrations were added directly into the culture medium : 10 mol / l adm ( adm group ) ; 10 mol / l pamp ( pamp group ) ; 10 mol / l ang ii(ang ii group ) ; 10 mol / l ang ii with various concentrations ( 10 , 10 , 10 mol / l ) of adm ( adm + ang ii group ) ; 10 mol / l ang ii with various concentrations ( 10 , 10 , 10 mol / l ) of pamp ( pamp + ang ii group ) . the concentrations of pamp and adm used here are similar to the serum levels but different from the tissue levels of pamp and adm in vivo , which is more convenient for us to observe the functions of pamp and adm . the assays were repeated in six wells . for experiments on incubated aortic sections , 10 - 9 , 10 - 8 or 10 - 7 mol / l of angii or pamp reagent were respectively added to the incubation medium . in the control group , vsmc suspensions ( 510 cells / ml ) were inoculated in 24-well plates , and incubated for 24 hr , then shifted to low serum ( 0.5% fbs ) rpmi-1640 and incubated for another 12 hr . various concentrations and combinations of angii , pamp or adm were then added to each well according to the above - mentioned treatment groups . after 6 hr of incubation , 0.5 cih - thymidine ( h - tdr ) was added to each well . the cells were collected using a micropore film ( millipore , usa ) and treated with 10% trichloroacetic acid ( tca ) . scintillation liquid was added and h - radioactivity was measured by a liquid scintillation counting instrument ( lkb1209 ; beckman , sweden)(3 ) . vsmc suspensions ( 110 cells / ml ) were inoculated in 24-well plates and shifted to low serum culture media for 24 hr . after that , cells were shifted to low serum ( 0.5% fbs ) rpmi-1640 ) and incubated for an additional 24 hr . various concentrations and combinations of angii , pamp , or adm were added according to the above treatment groups and allowed to incubate for one hour . cells were collected by centrifugation and resuspended in a reaction solution of 5.2 mmol / l mgcl2 , 94 mmol / l kcl , 12.5 mmol / l hepes , 12.5 mmol / l egta , and 8.2 mmol / l cacl2 , ( ph 7.4 ) . then , 0.2 mmol / l pkc substrate peptide and 0.3 l streptolysin o were added to make a final volume of 150 l . after 10 min of incubation at 37 c , -p - atp ( sigma - aldrich ) was added at 37 kbq / well ( containing 0.2 mmol / l atp - na2 ) to initiate the reaction . after 10 min , 100 l of stop solution ( 2.5% tca dissolved in 2 mol / l acetic acid ) was added to terminate the reaction , followed by incubation on ice for 10 min . aliquots of 120 l supernatant were spotted on p81 ion - exchange chromatography filter paper ( whatman , usa ) and dried in open - air . then , the filters were washed two times with the eluent solution ( 30% acetic acid ( v / v ) and 1% phosphoric acid ( v / v ) ) , and once with anhydrous alcohol . the filter paper was then placed into a scintillation vial following desiccation , and scintillation liquid was added in order to measure the p radioactivity using a liquid scintillation counter ( lkb1209 ; beckman , sweden ) . relative pkc activity was determined by calculating the difference in radioactivity between the experimental and control samples , and was expressed as pmol pi/10 cell ( 3 ) . each experiment was performed as parallel - well experiments , and was repeated at least six times . since ang ii plays significant role in the development of hypertension through promoting cellular proliferation and pkc activity , we examined the effects of pamp and adm on these ang ii - induced features in the vsmcs . in the control group , the vsmc h - tdr incorporation was 2159.64483.25 cpm / well and the pkc activity was 486.06126.18 pmol pi / mg protein . the vsmc h - tdr incorporation and pkc activity after pamp or adm treatment ( 10 mol / l ) were not significantly different compared with the control group ( both p>0.05 ) ( table 1 ) . effects of adrenomedullin ( adm ) and proadrenomedullin n- terminal 20 peptide ( pamp ) ( 10 mol / l ) on h - tdr incorporation and protein kinase c ( pkc ) activity in cultured rat aorta vascular smooth muscle cells ( vsmcs ) results are presented as x sem n=6 cpm , counts per million ang ii ( 10 mol / l ) increased vsmc h - tdr incorporation and pkc activity by 2.68- and 1.02-fold , respectively ( p<0.01 vs. control ) ( table 2 ) . effects of various doses of adrenomedullin ( adm ) on angiotensin ii ( angii)-induced h - tdr incorporation and protein kinase c ( pkc ) activityin vascular smooth muscle cells ( vsmcs ) results are presented as x se n=6 p<0.01vs . angii 10mol / l group cpm , counts per million adm and pamp inhibited ang ii - induced vsmc h - tdr incorporation and pkc activation in a dose - dependent manner . adm treatment at 10 , 10 , and 10 mol / l suppressed the ang ii - induced vsmc h - tdr incorporation by 48% , 52% , and 59% , respectively ( all p<0.05 vs. the ang ii group ) . similarly , ang ii - induced pkc activation was inhibited after adm treatment by 8% , 25% , and 27% , respectively ( all p<0.05 vs. the ang ii group ) . ( table 2 ) . meanwhile , pamp treatment at 10 , 10 , and 10 mol / l led to significant inhibition of the vsmc h - tdr incorporation ( by 52% , 58% , and 62% , respectively ) and pkc activity ( by 16% , 25% , and 36% , respectively ) ( p<0.01 ) ( table 3 ) . effects of various doses of proadrenomedullin n- terminal 20 peptide ( pamp ) on angiotensin ii ( angii)-induced h - tdr incorporation and protein kinase c ( pkc ) activity in vascular smooth muscle cells ( vsmcs ) results are presented as xsem , n=6 p<0.01vs . angii 10mol / l group cpm , counts per million the effect of ang ii on pamp and adm secretion from rat aorta tissues was examined in the incubation medium and the tissue , respectively . in the control group , pamp and adm concentrations detected by radioimmunoassay in the incubation medium of the rat aorta slices were 0.0480.006 and 0.0520.011 fmol / mg protein tissue , respectively . angii treatment led to a concentration - dependent increase in secreted pamp and adm from rat aortic slices , as compared to the control group . specifically , the pamp concentration increased by 0.63- , 1.04- , and 1.46-fold in response to angii at concentrations of 10 , 10 and 10 mol / l , respectively ( all p<0.05 vs. control ) . the release of adm was significantly higher than that of the control group , increasing by 0.58- , 1.35- , and 1.92-fold , respectively ( all p<0.05 vs. control ) ( figure 1a ) . in addition , secreted pamp / adm values also decreased gradually in response to the increasing levels of angii treatment ( p<0.01 vs. control ) . there were significant differences among all three concentrations of agents ( all p<0.05 ) ( figure 1c ) . a. the effect of different doses of angiotensin ii ( ang ii ) on secreted proadrenomedullin n- terminal 20 peptide ( pamp ) levels in the intubation medium . b. the effect of ang ii on the tissue concentrations of pamp and adrenomedullin ( adm ) . c. the effect of angii on the tissue and incubation concentrations of pamp and adm ( pamp / adm ) * p<0.01 vs. control in the control group , radioimmunoassay - detected intracellular pamp and adm levels were 0.2030.027 and 0.2350.025 fmol / mg protein tissue , respectively . angii treatment led to a dose - dependent increase in both pamp and adm peptide levels , in which pamp was increased by 0.15- , 0.3- , and 0.49-fold , respectively ( all p<0.01 vs. control ) . the levels of adm were significantly increased by 0.09- , 0.55- , and 0.81-fold , respectively ( all p<0.01 vs. control ) ( figure 1b ) . pamp / adm ratio was also significantly decreased along with the increase of concentrations ( p<0.01 vs. control ) ( figure 1c ) . to determine whether pamp could affect the levels of secreted angii , aorta tissues were treated with 10 , 10 or 10 mol / l of pamp and the incubation medium and tissues were then analyzed by radioimmunoassay . the angii concentration detected in the control group was 9.9351.32 fmol / mg protein tissue . following the pamp treatment , angii levels in the culture medium were not significantly increased regardless of the pamp concentration ( all p>0.05 vs. control ) . mol / l ) did not lead to a dose - dependent increase in secreted angii ( all p>0.05 vs. control ) ( figure 2 ) . the effect of proadrenomedullin n- terminal 20 peptide ( pamp ) on the tissue and incubation concentrations of angiotensin ii ( ang ii ) . since ang ii plays significant role in the development of hypertension through promoting cellular proliferation and pkc activity , we examined the effects of pamp and adm on these ang ii - induced features in the vsmcs . in the control group , the vsmc h - tdr incorporation was 2159.64483.25 cpm / well and the pkc activity was 486.06126.18 pmol pi / mg protein . the vsmc h - tdr incorporation and pkc activity after pamp or adm treatment ( 10 mol / l ) were not significantly different compared with the control group ( both p>0.05 ) ( table 1 ) . effects of adrenomedullin ( adm ) and proadrenomedullin n- terminal 20 peptide ( pamp ) ( 10 mol / l ) on h - tdr incorporation and protein kinase c ( pkc ) activity in cultured rat aorta vascular smooth muscle cells ( vsmcs ) results are presented as x sem n=6 cpm , counts per million ang ii ( 10 mol / l ) increased vsmc h - tdr incorporation and pkc activity by 2.68- and 1.02-fold , respectively ( p<0.01 vs. control ) ( table 2 ) . effects of various doses of adrenomedullin ( adm ) on angiotensin ii ( angii)-induced h - tdr incorporation and protein kinase c ( pkc ) activityin vascular smooth muscle cells ( vsmcs ) results are presented as x se n=6 p<0.01vs . angii 10mol / l group cpm , counts per million adm and pamp inhibited ang ii - induced vsmc h - tdr incorporation and pkc activation in a dose - dependent manner . adm treatment at 10 , 10 , and 10 mol / l suppressed the ang ii - induced vsmc h - tdr incorporation by 48% , 52% , and 59% , respectively ( all p<0.05 vs. the ang ii group ) . similarly , ang ii - induced pkc activation was inhibited after adm treatment by 8% , 25% , and 27% , respectively ( all p<0.05 vs. the ang ii group ) . ( table 2 ) . meanwhile , pamp treatment at 10 , 10 , and 10 mol / l led to significant inhibition of the vsmc h - tdr incorporation ( by 52% , 58% , and 62% , respectively ) and pkc activity ( by 16% , 25% , and 36% , respectively ) ( p<0.01 ) ( table 3 ) . effects of various doses of proadrenomedullin n- terminal 20 peptide ( pamp ) on angiotensin ii ( angii)-induced h - tdr incorporation and protein kinase c ( pkc ) activity in vascular smooth muscle cells ( vsmcs ) results are presented as xsem , n=6 p<0.01vs . the effect of ang ii on pamp and adm secretion from rat aorta tissues was examined in the incubation medium and the tissue , respectively . in the control group , pamp and adm concentrations detected by radioimmunoassay in the incubation medium of the rat aorta slices were 0.0480.006 and 0.0520.011 fmol / mg protein tissue , respectively . angii treatment led to a concentration - dependent increase in secreted pamp and adm from rat aortic slices , as compared to the control group . specifically , the pamp concentration increased by 0.63- , 1.04- , and 1.46-fold in response to angii at concentrations of 10 , 10 and 10 the release of adm was significantly higher than that of the control group , increasing by 0.58- , 1.35- , and 1.92-fold , respectively ( all p<0.05 vs. control ) ( figure 1a ) . in addition , secreted pamp / adm values also decreased gradually in response to the increasing levels of angii treatment ( p<0.01 vs. control ) . there were significant differences among all three concentrations of agents ( all p<0.05 ) ( figure 1c ) . a. the effect of different doses of angiotensin ii ( ang ii ) on secreted proadrenomedullin n- terminal 20 peptide ( pamp ) levels in the intubation medium . b. the effect of ang ii on the tissue concentrations of pamp and adrenomedullin ( adm ) . c. the effect of angii on the tissue and incubation concentrations of pamp and adm ( pamp / adm ) . * p<0.01 vs. control in the control group , radioimmunoassay - detected intracellular pamp and adm levels were 0.2030.027 and 0.2350.025 fmol / mg protein tissue , respectively . angii treatment led to a dose - dependent increase in both pamp and adm peptide levels , in which pamp was increased by 0.15- , 0.3- , and 0.49-fold , respectively ( all p<0.01 vs. control ) . the levels of adm were significantly increased by 0.09- , 0.55- , and 0.81-fold , respectively ( all p<0.01 vs. control ) ( figure 1b ) . pamp / adm ratio was also significantly decreased along with the increase of concentrations ( p<0.01 vs. control ) ( figure 1c ) . to determine whether pamp could affect the levels of secreted angii , aorta tissues were treated with 10 , 10 or 10 mol / l of pamp and the incubation medium and tissues were then analyzed by radioimmunoassay . the angii concentration detected in the control group was 9.9351.32 fmol / mg protein tissue . following the pamp treatment , angii levels in the culture medium were not significantly increased regardless of the pamp concentration ( all p>0.05 vs. control ) . mol / l ) did not lead to a dose - dependent increase in secreted angii ( all p>0.05 vs. control ) ( figure 2 ) . the effect of proadrenomedullin n- terminal 20 peptide ( pamp ) on the tissue and incubation concentrations of angiotensin ii ( ang ii ) . in the present study , we used h - tdr incorporation as an indicator of dna synthesis , and thus were able to monitor cell proliferation in cultured rat vsmcs in response to various treatments . in contrast , pamp or adm alone had no effect on either vsmc h - tdr incorporation or pkc activity , suggesting that neither peptides contributed to the proliferation of quiescent vsmcs . however , both adm and pamp were able to inhibit angii - stimulated vsmc proliferation and pkc activity in dose - dependent manners . the same concentrations of either pamp or adm produced similar inhibitory effects on angii - induced vsmc h - tdr incorporation and pkc activity . adm and pamp , clinically detectable in plasma , are secreted into the bloodstream by vascular endothelial cells through paracrine mechanisms ( 6 ) . previous studies reported that both adm and pamp mediated dose - dependent antihypertensive effects when administrated separately via intravenous injections in conscious rats . although pamp caused less reflex tachycardia compared with adm , the effects of pamp were 100 times weaker than those of adm ( 4 , 5 ) . it has been determined that adm and pamp employ different molecular mechanisms to achieve vasodilation . to date , three distinct pathways have been characterized for adm - induced relaxation of blood vessels : ( 1 ) binding of adm to specific receptors on the vsmc and involving the camp signaling pathway ; ( 2 ) binding of adm to specific receptors on the endothelial cell surface and involving the nitric oxide - cgmp signaling pathway ; ( 3 ) adm binding the cgrp receptor , leading to increased camp through the g protein signaling pathway . in contrast , pamp exerts its blood pressure lowering functions through g protein - mediated inhibition of the n - type ca ion channels , thus inhibiting the release of renin from peripheral sympathetic nerve terminals ( 7 , 8) . intriguingly , both hypertensive rats and hypertensive patients , suggesting that both are important in the pathophysiology of hypertension despite their distinct mechanisms of action . it has been proposed that adm and pamp can serve as clinical indicators of the severity of hypertension and its associated complications ( 9 ) . yet , the complete scope of adm and pamp in hypertension remains to be understood , and no studies have reported the effects of adm or pamp on proliferation of vsmcs and vascular remodeling . it not only has a strong vasoconstrictory effect , but also has important modulatory effects on the proliferation and differentiation of vsmcs and vascular remodeling . it has been reported that adm antagonized the vasoconstrictory effects of angii . in the present study , adm and pamp were found to inhibit angii - stimulated vsmc proliferation . upon binding with the angiotensin ii type 1 ( at1 ) specific receptor on the cell membrane , angii activates phospholipase c by coupling with a g protein , thus causing the hydrolysis of phosphatidyl inositol bisphosphate and generating inositol trisphosphate and diglyceride . inositol trisphosphate is then able to promote an increase in intracellular ca and cell constriction , while diglyceride causes increases in intracellular protein synthesis and cell body enlargement by activation of protein kinase c , thereby promoting cell proliferation ( 10 ) . adm and pamp were also able to inhibit angii - induced activation of pkc activity , indicating that the action of adm and pamp in the cellular signaling process located upstream of pkc ( 11 ) . in this respect , both peptides are similar in intensity . however , whether the precise mode of action and mechanisms are similar requires further study . it was reported that the expression of the adm gene may rely on pkc activity and camp feedback ( 12 ) . it is known , however , that angii can induce the expression of many diverse genes by acting on the at1 receptor of vascular endothelial cell or smooth muscle cells . in particular , angii / at1 binding induces g protein coupling , which then leads to increases in the intracellular ca concentration and stimulates pkc activity . therefore , induction of synthesis and release of adm / pamp by angii in vascular endothelial cells and smooth muscle cells may be related to changes in intracellular ca2 + concentrations ( 13 ) , pkc activity or other signaling messengers . as previously stated , the vasodilatory effect of adm is 100-fold more intense than that of pamp . thus , if adm is produced and released more rapidly in the tissue , the resistance effect to vasocontraction of angii would be more effective . although pamp and adm share the same precursor and are synergetic in physical function , they still can mutually regulate the production of each other and release under the same stimulus . such an event of mutual regulation among different segments of the same molecule is known as intramolecular regulation . it is believed that this type of regulation is common in cardiovascular peptides and plays important roles in their physiological and pathophysiological effects . in this study , however , adm has been previously demonstrated to reduce the release of angii in vitro ( 14 ) . the regulatory mechanisms of the cardiovascular system are very complicated , with mutual effects of the vasoactive substances playing important roles . cooperation and antagonism of the vasoactive peptides are not only mediated by biological effects , but also by secretion and metabolism of other paracrine and non - paracrine factors . the pathogenesis of primary hypertension is primarily related to changes in the renin - angiotensin system and , particularly , elevation of angii . the results of this study have led us to speculate that an increase in pamp / adm may be caused by general systemic processes leading towards hypertension ( 15 ) and by vasoactive substances such as angii that promote the synthesis and release of pamp / adm . as a result , the combination of pamp , adm , and angii may play an important role in the pathophysiology of hypertension . it is likely that pamp , adm and their interaction with angii coordinate vascular tone and proliferation of smooth muscle cells in order to maintain circulatory homeostasis .

objective(s):the study aimed to investigate the effects of adrenomedullin ( adm ) and proadrenomedullin n- terminal 20 peptide ( pamp ) on angiotensin ( angii)-stimulated proliferation in vascular smooth muscle cells ( vsmcs).materials and methods : thoracic aorta was obtained from wistar rats and vsmcs were isolated from aorta tissues and then cultured . in vitro cultured vsmcs were stimulated with ang ii ( 10 - 8 mol / l ) followed by various doses of pamp or adm ( 10 - 9 , 10 - 8 , or 10 - 7 mol / l ) . cell proliferation as assessed by 3h - tdr incorporation . protein kinase c ( pkc ) activity was measured by counting -32p radioactivity with liquid scintillation . in a separate cohort , in vitro cultured rat aortic vessels were treated with different doses of ang ii or pamp ( 10 - 9 , 10 - 8 , or 10 - 7 mol / l ) . cellular and secreted levels of pamp , adm and ang ii were measured using radioimmunoassay in the tissues and intubation mediums , respectively.results:ang ii ( 10 - 8 mol / l ) treatment significantly increased both 3h - tdr incorporation and pkc activity in vsmcs ( by 2.68 and 1.02-fold , respectively ; both p<0.01 vs. the control ) . however , ang ii - induced elevation of 3h - tdr incorporation , and pkc activity was significantly inhibited by various doses of adm and pamp ( all p<0.01 vs. the ang ii group ) . in rat aortic vascular tissues or intubation media , ang ii treatments stimulated the expression and secretion of pamp and adm in a dose - dependent manner , while pamp treatments had no significant effects on ang ii levels.conclusion:adm and pamp inhibit ang ii - induced vsmcs proliferation . the interaction of ang ii , adm and pamp may regulate vsmcs and cardiovascular function .

seminomas and dysgerminomas are epizootic in softshell clams , mya arenaria , from three maine estuaries contaminated with herbicides . the first epizootic was discovered in 22% of clams collected as searsport near long cove brook and three culverts that conveyed heating oil and jet fuel spilled from a tank farm in 1971 . data from subsequent epizootiological studies and a series of long - term experimental exposures of softshell clams to no . 2 fuel oil , jp-4 , and jp-5 jet fuel at the u.s . epa , environmental research laboratory in narragansett , rhode island , and in the field did not support an etiology by these petroleum products . in the two recent epizootics reported here , the germinomas have been observed in 3% of the softshell clams collected from roque bluffs near machiasport and from 35% of softshell clams collected from dennysville . mya collected at dennysville had pericardial mesotheliomas and teratoid siphon anomalies in addition to gonadal neoplasms . estuaries at dennysville had been contaminated by herbicides in a 1979 accidental spray overdrift during aerial application of tordon 101 to adjacent forests . further investigation determined widespread use of the herbicides tordon 101 , 2,4-d,2,4,5-t , and other agrochemicals in an extensive forestry and blueberry industry in both the roque bluffs and the dennysville areas . herbicide applications at searsport were confirmed for railroad property bordering long cove estuary and for long cove brook adjacent to the estuary where a highway department reportedly cleans its spray equipment . herbicide contamination is the only common denominator identified at all three sites where mya have been found with gonadal neoplasms.(abstract truncated at 250 words)imagesfigure 5.figure 6 .

head immobilization during cranial surgeries by devices using pin fixation is a common neurosurgical practice . scalp vessel injury , air embolism , pneumocephalus , pin - site infection , shunt tube damage , parenchymal injury , and skull fracture with epidural hematoma are all reported as complications of the same . potentially , catastrophic , pin - site hematoma has been reported as having an incidence of < 0.65% ( five patients in a series of 766 cases by vitali and steinbok ) . a 12-year - old girl presented with holocranial headache , blurring of vision , vomiting , and ataxia of gait of 3 months duration . magnetic resonance imaging of brain revealed a 4 ventricular mass of mixed intensity on t1 and t2 sequences with solid and cystic components enhancing nonuniformly on contrast , with hydrocephalus and periventricular lucency [ figure 1 ] . the patient underwent suboccipital craniectomy in the prone position after her head was stabilized with pins on a three pin fixator . prior to opening of the dura , the ventricle was tapped through a right parietal burr hole and some cerebrospinal fluid ( csf ) was let out . a telovelar approach was attempted , but during the course of the surgery , there was inadequate cerebellar relaxation , and hence , a transvermian approach was done . gross total tumor resection was achieved microscopically and the 4 ventricular floor was visible , but even after this , the cerebellum was bulging through the craniotomy margins . there were no obvious retraction injuries on the cerebellar surface . the ventricular drain was completely opened in an endeavor to slacken the cerebellum for closure , but it resulted in further herniation of posterior fossa structures . c1 and c2 laminectomy was done , and muscle and skin were closed with no attempt at dural closure . when the patient was turned around , both her pupils were fixed and dilated . the skull under the pin site at the left temporal region was found to be depressed , but there was no active bleeding . an urgent computed tomography ( ct ) scan revealed a very large left - sided extradural hematoma with midline shift and effaced cisterns . the cerebellum was bulging out of the craniectomy site , but there was no cerebellar hematoma [ figure 2 ] . the patient was taken back to the operating room , the left temporoparietal craniotomy was done , extradural hematoma was evacuated , and depressed fracture fragment was removed . she underwent a tracheostomy and over the next 2 months , she had multiple episodes of respiratory and urinary tract infections . she developed a large posterior fossa pseudomeningocele , also had an episode of meningitis , following which she developed hydrocephalus [ figure 3 ] . she underwent right ventriculoperitoneal shunt . over time , she had slow neurological improvement , and at discharge 3 months following surgery , she was verbalizing , accepting orally , was continent , ambulant with support of residual ataxia , and cerebellar signs . axial magnetic resonance images of the brain showing ( a and b ) mixed intensity partly solid and partly cystic intra - axial midline posterior fossa tumor ; ( c ) hydrocephalus with periventricular lucency on fluid attenuation inversion recovery images ; and ( d ) heterogeneous enhancement of the lesion on contrast immediate postoperative computed tomography scan showing ( a and b ) large hyperacute extradural hematoma on the left side with depressed fracture of the parietal bone driven inward ( green arrows ) and an external ventricular drain placed on the right side ; ( c ) midline shift of 1.62 cm with effaced cisterns ; and ( d ) cerebellum bulging out through the craniotomy defect ( blue arrows ) with small amount of operative site bleed axial computed tomography cuts 2 weeks after surgery ( a and b ) showing no residual clot , collapsed ventricles and bilateral subdural hygromas ( green arrows ) ; 6 weeks after surgery showing ( c ) dilated lateral and third ventricles , and ( d ) large occipitocervical pseudomeningocele ( blue star ) ; and 6 weeks after ventriculoperitoneal shunt and prior to discharge ( e and f ) showing regression of ventricular size and shunt tube in situ a review of literature showing the patient characteristics , pathology for which the surgery was done , and time when this complication was detected of previously reported cases is summarized in table 1 . the majority of such cases , like in ours , occurred in children with posterior fossa tumors . however , this complication has been reported even in adults and also following surgery for supratentorial and cervical spinal pathology . the patient characteristics , pathology for which surgery was performed , and time of detection of pin - site epidural hematoma reported by various authors in literature several authors hold that preexisting hydrocephalus , as in this case , may contribute to thinning of the skull , making it fracture easily on pin pressure and have advised scrutiny of calvarial thickness preoperatively to reduce this complication . although it has been mentioned that there is no safe area for pin positioning in the pediatric skull , some state that it is important to avoid pin placement in the thin squamous part of the temporal bone . the source of hematoma is bleeding either from the margins of the fracture or injured branches of the middle meningeal artery . in our case too , the bone was fractured and driven in , but no obvious source of bleeding was encountered . the external ventricular drain , in our case , by collapsing the brain probably prevented any natural tamponade that might have otherwise occurred . notes that there are no clear - cut guidelines for the application of cranial fixation using pins in pediatric patients despite significant complications that may arise from these devices . pin fixation is generally contraindicated in children below the age of three , and the integra lifescience corporation ( makers of the mayfield skull clamp ) states that skull pins are not recommended for use in children < 5 years of age and suggests that child pins can be used in children above this age . however , as our experience shows , even this may not be a failsafe technique . other authors have recommended measures such as avoidance of pushing the pins , decreased clamp pressure , steering clear of pin placement in the temporal region , use of conic pins , and use of an intermediary piece and pressure adjusting springs in the clamp to prevent this occurrence . intraoperatively , we had noted that the cerebellum was bulging , but we tried to rectify this by draining more csf since we did not suspect a supratentorial extradural hematoma . other reports in literature too have described encountering the unexplained fullness of the brain resulting from this event . in one case , however , in most of the cases , the hematoma was discovered either following ct scan done immediately after surgery ( one exception being a case in vitali and steinbok 's series where it was detected at the time of pin application ) or later when the patient showed signs of neurological deterioration . in light of our experience , we feel that if other factors such as retraction injury and increased airway pressure can be ruled out , it would be wiser to get a scan done intraoperatively after closing the wound temporarily which would help to detect hematoma early and prevent tentorial herniation . our delay in doing the same was contributory for the extremely protracted and stormy course of the patient . although our patient had a late detection ( at the end of surgery , 6 h after onset of pin application ) and had bilateral papillary dilatation , the eventual result after hematoma evacuation was gratifying . other authors have also reported detecting this complication after anisocoria and have had equally good results . as extradural hematomas usually have a good outcome , there should be no hesitation in subjecting the patient to immediate re - surgery on detecting this event . surgeries in the posterior fossa in children can be done after placing the head in a horseshoe head rest , but as these can cause pressure sores during prolonged surgeries and since immobilization is not rigid , pin fixation devices will continue to remain the mainstay of cranial fixation in a vast majority of children . careful pin application , under optimal pressure , in an appropriate location , with prior knowledge of calvarial thinning , early imaging in the setting of unexpected intraoperative brain herniation , and urgent surgery even in the presence of papillary dilatation will help to prevent and treat this mishap .

cranial fixation with pins is a routine adjunct in neurosurgery and is usually considered safe . a rarely reported complication is skull fracture at the pin site and consequent epidural hematoma . usually , these are picked up only postoperatively and rarely , intraoperatively if there is unexplained brain bulge in which case the operation should be terminated and urgent imaging has to be done . we describe such a complication that occurred while operating on a 12-year - old child with a posterior fossa tumor and review the available literature dealing with such events .

the extensive use of polychlorinated biphenyl ( pcb ) mixtures from 1929 to the 1970s and their release in the environment has led to ubiquitous and persistent distribution of these toxic compounds , even three decades after their manufacture was banned in the usa and other countries . they are found in air , water , sediment , and soil and bioaccumulate in organisms . these compounds can be degraded by microbial communities naturally present in the environment through the combination of two processes : anaerobic reductive dechlorination ( organohalide respiration ) of higher chlorinated congeners and aerobic oxidative degradation of lower chlorinated congeners . natural attenuation of pcbs by reductive dechlorination is observed in the environment , but the process is slow and factors affecting rates are not well understood . since many commercial pcb mixtures such as aroclors are highly chlorinated , microbial reductive dechlorination is often a rate - limiting step for pcb degradation in the environment . there have been several efforts to identify factors affecting dechlorination and degradation activities in laboratory microcosms with the goal of accelerating the natural processes in the environment . enhanced dechlorination activity has been observed after biostimulation of indigenous populations by addition of electrons donors or electrons acceptors and/or bioaugmentation with isolates or enriched microbial consortia . the first in situ stimulation of pcb degradation was reported almost 20 years ago , and sequential anaerobic aerobic bioaugmentation has been successfully applied at the laboratory scale . more recent characterization and isolation of anaerobic dechlorinators has led to successful anaerobic dechlorination of pcbs by bioaugmentation in microcosms and mesocosms . inoculation of sediment mesocosms with an organohalide respiring bacteria dehalobium chlorocoercia df-1 showed that bioaugmentation not only stimulated pcb dechlorination of weathered aroclor but also had an apparent synergistic effect on the indigenous organohalide respiring community . these results support the feasibility of using in situ bioremediation to treat pcb - contaminated sediments , but the time required for a pcb - contaminated site to recover can not yet be predicted due in part to lack of quantitative information on rates of dechlorination , threshold pcb concentrations for dechlorination , and extrapolation of laboratory measured rates to field conditions . although rates of dechlorination in sediments depend upon the specific activities and abundance of organohalide respiring microbes , in situ activity will also be influenced by the freely dissolved concentration of the pcbs . in previous studies , attempts to estimate dechlorination rates and the minimal threshold concentrations for organohalide respiration of pcbs involved adding high concentrations of aroclors in the mg kg range to sediment microcosms and assaying the rates of reductive dechlorination . results from these studies were not consistent as some reported a minimum concentration threshold of 40 mg kg sediment , which contrasts with recent reports that demonstrated dechlorination of 1.3 mg kg weathered pcbs in sediments . most published evidence suggested that substrates in nonaqueous phase solids or liquids are unavailable for direct microbial uptake . therefore , one major challenge with relating dechlorination rate to pcb concentration in sediment is accounting for bioavailability differences caused by the association of pcbs to different organic matter types . recent studies have indicated the freely dissolved concentration of pcbs in the porewater may be a more appropriate metric that accounts for bioavailability to organisms . thus , a more relevant approach to understand the impact of chemical availability on dechlorination would be to measure dechlorination rates within a range of freely dissolved pcb concentrations typically observed in the environment . accurate measurement and steady - state dosing of low aqueous concentrations of hydrophobic pcbs at ng l levels has been challenging in the past . however , with recent advances in the use of polymer - phase passive samplers for measurement and for passive dosing of compounds , it is now possible to measure dechlorination rates for low , environmentally relevant aqueous concentrations . in this study , we measured the dechlorination rate of the tetrachlorobiphenyl congener 2,3,4,5-tetrachlorobiphenyl ( pcb 61 ) in the ng l range , which is less than the aqueous solubility of 20 g l. the range of concentrations in this study is lower than the average aqueous solubility range of 2.43000 g l reported for hepta- through monochlorinated homologue groups and is within the range that would be observed typically in contaminated sediment porewater . polyoxymethylene ( pom ) sheets were used as the passive dosing medium to deliver a known starting dissolved aqueous concentration of the congener and also as a passive sampling device to measure the concentration of the pcb dechlorination product as it was formed over time . the use of a well - characterized polymer with high pcb partitioning similar to that of sediment organic matter enabled us to work at very low concentrations that are difficult to detect directly in the aqueous phase . a similar principle was used previously with silicon o - rings to measure biotransformation rates of pahs . here , we tested pom as a delivery polymer with the dehalobium chlorocoercia df-1 , an anaerobic dechlorinator grown in sediment - free medium . pcb 61 , which was only dechlorinated to 2,3,5-trichlorobiphenyl ( pcb 23 ) , was tested to simplify the development and validation of the system . the dechlorination rate over a wide range of pcb concentrations ( 1.15493 ng l or 41689 pmol l ) was measured in order to determine the lower dechlorination limits for this bacterial model . dehalobium chlorocoercia df-1 was grown anaerobically in mineral medium ( e - cl ) as described previously with modifications described below . sodium formate ( 10 mm ) was added as the electron donor , and 2,3,4,5-tetrachlorobiphenyl ( pcb 61 , purity > 99% , accustandard ) or perchloroethene ( pce , purity > 99% , fluka ) was diluted in acetone and added to medium ( 0.1% vol / vol ) as the electron acceptor at final concentrations of 173 and 100 m , respectively . extract ( 1% vol / vol ) was added as a growth factor , titanium(iii ) nitrilotriacetate ( 0.5 mm ) was added as a reductant , and the sodium sulfide concentration was reduced to 0.01 mm . cultures prepared for inoculum were grown statically at 30 c in 160 ml serum bottles containing 50 ml medium sealed under n2:co2 ( 80%:20% ) with 20 mm teflon - coated butyl stoppers ( west pharmceutical , inc . ) pce cultures were periodically purged ( 20 days ) with n2/co2 for 23 s per ml headspace and replenished with pce between transfers . growth was monitored by sampling 100 l of headspace with a gastight glass syringe ( sge , inc . ) every 10 days to measure the reductive dechlorination of pce to trichloroethene ( tce ) and dichloroethene ( dce ) . the headspace was analyzed on a hp6890 gc - fid ( agilent technologies ) equipped with a hp-5ms capillary column ( 30 m 0.320 mm 0.25 m , agilent technologies ) . chloroethene ( ce ) congeners were quantified using a 6-point calibration curve ( 0.4 to 200 mm ) composed of pce , tce , trans - dce , cis - dce , and 1,1- dce . polyoxymethylene ( pom , 77 m ; cs hyde co. ) was cut into 50 mg strips ( 50.0 0.6 mg , 3.5 cm 1.4 cm ) or punched into disks of 3 mg ( 3.3 0.1 mg , diameter 6.23 mm ) . all pom was cleaned by sequential soxhlet extraction with hexane followed by methanol , air - dried , and sterilized by autoclaving before use . to prepare pcb - free inoculum for kinetic experiments , df-1 grown with pcb 61 was serially transferred twice ( 4% vol / vol ) in medium containing pce , which could be purged from the culture prior to harvesting due to its high vapor pressure . one pom strip of 2050 mg was added to absorb any residual pcb transferred with the inoculum . the culture was then inoculated into 500 ml ( 10% vol / vol ) and periodically replenished with pce as described above to an estimated cell density of 1.8 10 ml ( n = 3 , sd = 7.8 10 ml ) based on enumeration of 16s rrna gene copy number as described below . the culture was purged with n2/co2 using a sterile gassing cannula to remove pce and transferred to a sterile 250 ml oakridge centrifuge bottle inside an anaerobic glovebox . the bottle was sealed under n2/co2 prior to centrifugation at 26000 g for 20 min . in an anaerobic glovebox , the supernatant was partially decanted and cells were resuspended in approximately 70 ml of supernatant . this pcb - free inoculum contained 5.9 10 ( n = 4 , sd = 3.9 10 ) 16s rrna gene copies ml . six concentrations of pcb 61pom were tested in triplicate : 1.8 10 , 1.8 10 , 4.5 10 , 1.8 10 , 4.5 10 , and 1.8 10 mol kg pom to achieve calculated aqueous concentrations of 2.9 , 2.9 10 , 7.2 10 , 2.9 10 , 7.2 10 , and 2.9 10 nmol l , respectively . a negative control without pcb was also included . pom strips were first pre - equilibrated in 50 ml of modified e - cl medium in separate vials , each containing pcb 61 levels required for the six equilibrium aqueous concentrations described above . for each culture , two 50 mg pom strips each cut into 14 3.6 mg rectangular pieces and four 3 mg pom disks were added to 50 ml of sterile medium . after 30 days on an orbital shaker at 150 rpm and 30 c to achieve equilibrium of pcb 61 between pom and medium , the pom strips were transferred to 50 ml sterile medium without pcb 61 . after equilibration for 30 days , 1 ml of df-1 pcb - free culture was inoculated into each bottle containing the pom . the cultures were incubated in the dark at 30 c on an orbital shaker at 150 rpm . during 60 days of incubation , a pom strip was removed every 10 days for pcb extraction and analysis ( supporting information ) , a pom disk was removed every 30 days for dna extraction , and 1 ml of culture was sampled every 30 days for dna extraction . additional pom strips were removed at days 90 and 150 . at the end of the experiment , approximately 70% of pom remained ( pom : medium ( wt / vol ) ratio decreased from 2:1 to 1.4:1 ) . a 100 l portion of culture was diluted into 1 ml of water milli - q plus ( millipore ) and then centrifuged at 18000 g for 10 min at room temperature . after decanting , the cell pellet was resuspended in 100 l of instagene matrix ( bio - rad laboratories ) , and dna was purified following manufacturer s instructions . extracted dna ( 50 l ) was stored in 1.5 ml microfuge tubes at 20 c prior to enumeration by qpcr . to extract dna from the surface of pom strips , a pom disk was added directly to 100 l of instagene matrix , mixed on a vortex for 15 s , and then extracted as described above . df-1 was enumerated by qpcr with iq sybr green mix ( bio - rad laboratories ) using primers 348f/884r as described previously with the following modifications . each 25 l reaction volume contained 1x iq sybr green supermix , 400 nm forward and reverse primers , and 2 l of sample dna . a plasmid containing the 16s rrna gene of df-1 was used for the standard curve ( 6 orders of magnitude : 3.4 10 to 3.4 10 16s rrna gene copies ml ) . a pom strip and 2 ml of culture were aseptically transferred from cultures to a 5 ml crimp - neck serum glass vial and sealed with a teflon septum . the glass vial was stored at room temperature prior to processing for fluorescence in situ hybridization ( fish ) analysis . the bacterial cells present on the pom strips were fixed in 4% paraformaldehyde for 2 h , hybridized with the eub-338 probe as described previously and observed with a nikon eclips e400 epifluorescent microscope ( nikon corp . ) . the calculation of pcb dechlorination rate from a passively dosed system must take into account the sorption of pcb to the polymer phase and is described in the supporting information . in summary , the rate of change in the aqueous phase can be expressed as follows:1where vw is the volume of the aqueous phase , ms is the mass of the solid phase ( polymer or sediment ) , pcb 61aq is the water phase concentration of pcb 61 , kb is the first - order rate constant ( with respect to aqueous concentration ) , and kd ( kpom 61 ) is the partition constant between the solid phase and water . the second term in parentheses represents the buffering capacity of the solid phase that attenuates the observed rate of dechlorination by suppressing the available pcb concentration in the freely dissolved phase . previous work by zhang et al . recognized this influence of sorption on biodegradation kinetics and called it a bioavailability factor . key assumptions in the model include constant biomass concentration , and faster exchange between the polymer and water compared to dechlorination rate . to predict dechlorination rates at other cell concentrations , the dechlorination rate was assumed to scale linearly with cell concentrations . the sum of pcb 61 and 23 adsorbed to pom strips ( pcb 61pom and pcb 23pom ) remained relatively constant throughout the incubation period ( coefficient of variation < 0.4 ) , with a decrease of pcb 61pom and an increase of pcb 23pom as expected ( figure 1 and figure s1 , supporting information ) . background noise , caused by trace contaminants with retention times similar to pcb 23 , was observed in the negative control without pcb ( ( 1.16 1.2 ) 10 mol kg ) but was negligible , averaging 5% of the lowest pcb concentration tested . dechlorination activity of pcb 61 measured in pom strips at different concentrations : ( a ) log pcb 61 ( substrate ) and ( b ) log pcb 23 ( product ) concentration measurements in pom strips , data points fitted with a logarithmic trendline . pcb 61 concentration in mol kg pom : ( ) 1.0 10 , ( ) 2.0 10 , ( ) 5.6 10 , ( + ) 2.1 10 , ( ) 5.3 10 , ( ) 2.4 10 . in separate partitioning experiments ( data not shown ) , the experimental values obtained for the partition coefficient of pcb 61 between pom and media ( kpom 61 ) were similar to the predicted values obtained using eq s3 ( supporting information ) of hawthorne et al . over the range of concentrations tested . therefore , the published kpom values ( kpom 61 and kpom 23 ) were utilized in this study to estimate pcb aqueous concentration ( pcb 61aq and pcb 23aq ) from the concentration in the pom strips ( pcb 61pom and pcb 23pom ) . to test the accuracy of the estimated aqueous pcb concentration , pcbs were extracted directly from 1 ml of culture containing the highest initial pcb 61pom concentration ( 1.8 10 mol kg ) at day 90 , and the measured pcbaq concentrations were compared with the calculated pcbaq from pcbpom ( eq s2 , supporting information ) . pcb 23aq was detected at a concentration of ( 2.05 0.5 ) 10 mol l , which is equivalent to 5.40 10 mol kg of pcb 23 in pom when eq s2 ( supporting information ) is applied . the average value of pcb 23pom detected in pom was ( 6.45 1.00 ) 10 mol kg , which is within 20% of the value directly measured from the medium . the expected concentration of pcb 61aq in medium at day 90 was 4.41 10 mol l , which is beyond the detection limit for direct extraction . one milliliter of df-1 containing 5.9 10 ( n = 4 , sd = 3.9 10 ) 16s rrna gene copies ml was inoculated into each bottle . the total number of 16s rrna gene copies detected 24 h after inoculation was 4.3 10 ( n = 21 , sd = 3.2 10 , rsd = 73% , ci95% = [ 2.9 6.6 10 ] ) . for each pcb 61 concentration tested , total 16s rrna gene copies detected in medium or on pom were plotted against time ( figure 2 ) , and the slope of the linear function was recorded ( tables s1 and s2 , supporting information ) . the slope ranged from 0.0042 to + 0.0058 with a mean value of 0.00063 log 16s rrna gene copies day ( n = 7 , sd = 0.00373 ) . no growth was observed except a slight increase ( slope of 0.0058 log 16s rrna gene copies day , r = 0.77 ) at the highest pcb 61 concentration and a slight decrease ( slope of 0.0042 log 16s rrna gene copies day , r = 0.73 ) at the lowest concentration tested . however , the relative standard deviation from the mean total 16s rrna gene copies per concentration tested over time ( n = 12 , rsd = 60% for the highest , and rsd = 50% for the lowest concentration tested ) did not exceed the relative standard deviation observed from the mean total 16s rrna gene copies detected after 24 h ( mean 16s rrna gene copies for all pcb 61 concentrations , n = 21 , rsd = 73% ) . the results indicate no significant growth of df-1 over the course of each experiment . interestingly , no change in df-1 numbers was observed in the control without pcb , indicating that the microorganisms either survived without pcb or dna persisted in the medium . ( a ) monitoring over time in media and on pom strips at the intermediate pcb 61pom concentration of 4.5 10 molkg of pom . genes copies of 16s rrna gene copies were first estimated in medium and on pom by calculating the number of molecules detected , respectively , per milliliter of medium and per milligram of pom . total 16s rrna gene copies in media and on pom were then estimated by multiplying the value 16s rrna gene copiesml to the amount of medium ( ml ) or pom ( mg ) remaining at the time point . similar results have been obtained for the other concentrations tested : , aqueous phase ; , on pom . ( b ) fish image of df-1 observed on pom strips at day 150 showing no contiguous distribution of cells ( stained green ) as a biofilm . the numbers of attached cells on pom were compared to the planktonic cells in medium . total df-1 detected on pom strips was normalized to the total mass of pom in the culture and the number of planktonic cells ml was normalized to the total volume of medium . generally , greater numbers of cells were detected in medium than attached to pom strips with an average ratio media / pom of 10:1 ( n = 21 , sd = 8.8 ) at day 1 . for all concentrations tested , a decrease of df-1 on pom was observed over time that is partly attributed to pom removal ( 30% pom removal ; mean 16s rrna gene copies decrease of 74% 33% ) . attachment of df-1 to pom was also monitored by fish ( figure 2 ) . although some cell aggregation of 27 cells was observed on the pom surface , there was no evidence of contiguous biofilm formation with < 1% of the total pom surface area covered by cells . an overall estimate of df-1 population per 50 ml microcosm for the duration of the experiment was ( 5.1 3.0 ) 10 16srrna gene copies . the concentration of pcb 23pom product detected over time in pom strips was calculated as mol % following eq s1 ( supporting information ) , and mol % of pcb 23pom was plotted against time ( figure 3 ) . interestingly , the same dechlorination activity of 1.39% ( n = 18 , sd = 0.16% ) mole of pcb 23 production per day was observed for all pcb 61 concentrations . there was an apparent plateau in activity observed at day 90 for the highest pcb concentration . for the other concentrations , the rate of dechlorination started decreasing at day 70 and a plateau in activity was not observed until day 150 . for the highest pcb concentration , the maximum threshold of dechlorination did not exceed 70% . concentrations of pcb 61pom in mol of pcb 61 kg pom : ( ) 1.0 10 , ( ) 2.0 10 , ( ) 5.6 10 , ( + ) 2.1 10 , ( ) 5.3 10 ( ) 2.4 10 . the pcb 23pom values were used to calculate pcb 23aq values based on equilibrium partitioning between pom and the water phase as described above . since no lag time was observed ( figure 3 ) , the rate of accumulation of pcb 23aq ( v ) was determined as the slope of accumulation from day 1 to the beginning of the plateau phase ( figure s1 , supporting information ) . the accumulation rate decreased as the initial concentration of pcb 61 decreased ( table 1 ) . nevertheless , an accumulation of product was observed even at the lowest pcb 61 concentration tested . when rates of accumulation were plotted against the concentration of pcb 61aq substrate , a linear relation with no rate plateau was observed at the highest tested concentration of pcb 61aq in the aqueous phase . accumulation rate of product pcb 23aq plotted against concentration of the substrate pcb 61aq : ( a ) normal scale , ( b ) logarithmic scale . pcb 61aq and pcb 23aq were both calculated from pcb 61pom and pcb 23pom respectively with eqs s2 and s3 , supporting information . the rate of accumulation of pcb23aq was determined by plotting pcb 23aq against time and performing linear regression to calculate the rate . the aqueous phase dechlorination rates calculated based on eq s9 ( supporting information ) are shown in table 1 . the rate constants were within a factor of 2 for initial aqueous phase pcb 61 concentration , which ranged nearly 3 orders of magnitude . the true dechlorination rate ( at a cell concentration of 10 cells ml ) was high ( 42 day ) , indicating an average half - life of pcb 61 of 24 min when only freely dissolved pcb is present ( no solid phase ) . dynamic passive dosing has been reported recently to measure biotransformation of hydrophobic organic chemicals ( phenanthrene and fluoranthene ) at low concentrations using a silicone o - ring . here , the approach was modified to provide both passive dosing of the substrate and passive sampling of the dechlorination product for measuring the dechlorination rate in anaerobic conditions at ultralow concentrations of a pcb using the polymer pom . using this approach dechlorination of a tetrachlorobiphenyl in the aqueous phase was successfully monitored at subsaturation concentrations of 1.69 10 to 3.95 10 mol l. previous studies were conducted with a growing population of organohalide respiring microorganisms that dechlorinated a mixture of congeners ( i.e. , aroclors ) . the dechlorination rates reported were the combined rates for different pcb congeners and organolide respiring microorganisms within the indigenous population . while providing valuable information on dechlorination rates from a given environment , dechlorination rates between environments can not be compared , and simplified systems are necessary to elucidate rate of dechlorination per organohalide respirer and per congener . such simplified systems are important to understand the global / apparent rates of dechlorination measured in the environment . moreover , the prior studies were conducted with sediment particles likely to contain fractions with different partition coefficients and only the total pcb concentrations were measured . since the aqueous pcb concentration was unknown the kinetics of dechlorination for bioavailable pcbs per ( organolide respirer ) cell could not be determined . when dechlorination rates versus pcb 61 initial concentration in the current study were plotted , the relationship was linear suggesting first order kinetics as observed in previous studies , but the rates observed were higher ( up to 1000 fold ) than rates reported previously ( table s3 , supporting information ) . these rate variations can be explained in part by differences in number and types of dechlorinating microorganisms . indeed , cho et al . reported that a 5-fold difference in rates observed between two independent studies was negligible after normalizing the rates with the number of dechlorinating microorganisms . when rates were normalized to the number of microorganisms , slope variations / differences could then be attributed to the cell ( or more specifically the enzyme ) affinity for their specific substrates . however , rate differences might also be explained by large differences in buffering capacity of the associated solids . since only total pcbs were measured in these earlier studies and the aqueous pcb concentrations were unknown , the kinetics of dechlorination for bioavailable pcbs could not be determined . in the current study , the system was simplified by using pom with well - known partitioning characteristics and a single organohalide respiring strain that was maintained at a steady - state concentration throughout the incubation period . although organohalide respiration with pcbs is usually linked to growth , dechlorination by df-1 is decoupled from growth at high cell densities with no decrease in the dechlorination rate . in the current study df-1 was inoculated at a cell density of approximately 1 10 16s rrna gene copies ml , and no net population growth was observed either on the pom surfaces or in the aqueous phase throughout the incubation period . the thermodynamic cell yield of df-1 based on the estimated cell yield from oxidation of formate predicts that 2.4 10 mol of pcb 61 reduction is required to support one doubling of 6 10 df-1 in a 50 ml microcosm . at the highest pcb 61 concentration tested only 3.3 10 mol of pcb 61 was reduced , which is consistent with the lack of detectable growth . since no contiguous biofilms were observed on pom strips and the majority of cells were planktonic , the results indicate that the dechlorination activity observed in this study was the result of cells interacting directly with pcbs dissolved in the aqueous phase and were not influenced by localized activity on pom . for a fixed number of dechlorinating microorganisms , the same mol % dechlorination rate was observed at all pcb 61 concentrations tested . based on prior studies , pcb dechlorination rate would depend on cell number , since growth rate , pcb 61 concentration , and pcb dechlorination rate are tightly linked . in this study , we did not observe a net decrease of cell numbers with a decrease of pcb concentration . dna persistence of dead cells could explain the detection of constant number of dechlorinating microorganism . however , this latter explanation is unlikely since free dna is rapidly degraded after cell lysis and although it can persist if adsorbed onto surfaces ( 45 ) no increase in dna was detected on pom strips . further experiments on actively dechlorinating microorganisms would be needed to determine whether the dechlorination rate is regulated by pcb concentration on a single cell level or as a population by a mechanism such as quorum sensing . a minimum concentration threshold for pcb 61 dechlorination was not detected with the size of inoculum used . the specific dechlorination rate was not related to pcb 61 concentration by a saturation function as reported previously but was related to the aqueous pcb concentration by a linear function from the lowest to the highest pcb concentration tested . in a prior study the authors interpreted the saturation function as a rate - limiting step in dechlorination due to the pcb concentration dependent growth rate of dechlorinating microorganisms . however , the earlier study included the combined effects of unknown electron donor concentrations , a range of dechlorination rates for different congeners in aroclor 1242 and multiple desorption kinetics and aqueous concentration for different congeners and sediment fractions in the microcosms . in this study , the microcosms were sediment - free , the electron donor was not limiting ( 10 mm sodium formate ) and a high cell density was used . the only rate - limiting step for reductive dechlorination of pcb 61 by df-1 was pcb concentration in the aqueous phase , which was supplied at six starting concentrations below aqueous saturation using pom . under these conditions dechlorination activity was observed at concentrations as low as the detection limit of 1.15 ng l. this is the first confirmation of pcb dechlorination at such a low aqueous phase concentration . this freely dissolved pcb 61 value is equivalent to an estimated 0.015 mg kg sediment for this congener assuming a 3% organic carbon fraction and using a standard correlation of log(koc ) = log(kow ) 0.21 ( pcb 61 log kow = 5.9 ) . in prior kinetic studies , dechlorination activity was reduced significantly or was undetectable at aroclor 1242 or 1248 concentrations in the range of 1040 mg kg in sediment mesocosms , where > 45% of the estimated total mass most susceptible to dechlorination ( i.e. , flanked meta and para chlorines ) were composed of individual congeners at concentrations greater than the estimated minimum of 0.015 mg kg sediment tested in this study . ( 24 ) showed that inhibition of dechlorinating activity was linked to the inability of the organohalide respiring population to grow at the lowest pcb concentrations . others have reported that stimulation of pcb organohalide respiring activity is only observed in microcosms containing aroclors or other organohalides ( i.e , priming ) at concentrations above the threshold level for growth or by bioaugmenting sediment with a critical mass of pcb respiring bacteria . the combined results of these studies suggest that bioavailability was not a factor in the apparent inhibition of activity at high pcb concentrations observed in earlier studies , but rather was due to low numbers of indigenous organohalide respiring microorganisms . although dechlorination likely occurs with low cell numbers , the rates would be too low for short - term detection in many environments . higher pcb concentrations would be required for sustained growth of the organisms to reach population levels where substantial dechlorination can be observed . the results of the current study support the feasibility of in situ bioremediation by inoculation of bacteria to pcb - impacted sediments to enhance abundance of the organohalide respiring bacterial population , which has the potential to treat porewater pcb concentrations down to 1.15 ng l. major challenges in translating pcb dechlorination observations in the laboratory to potential in situ remediation scenarios in the sediment environment have been the lack of data at environmentally relevant aqueous concentrations , adequate quantification of intrinsic rates of dechlorination in the aqueous phase , and accounting for the influence of sorptive solids . this study demonstrates that by measuring the concentration of pcbs in the aqueous phase , the dechlorination rates can be determined and used in models to predict dechlorination rates in the sediment environment . assuming a typical fine grained organic sediment matrix containing 30% solids , 3% organic carbon , and koc as described earlier , the solid phase buffering capacity term in eq 1 is 8.7 10 giving an apparent dechlorination rate for pcb 61 in sediment of 3.9 10 day . this estimation assumes a cell density of 10 cells ml , and the rates can be expected to decrease with decreasing cell densities as illustrated in figure 5 . while dechlorination rates at indigenous population densities of 1010 cells ml are typically low , which reflects the apparent environmental recalcitrance of pcbs , significantly greater rates of dechlorination can be achieved by bioaugmenting with densities of 1010 cells although these predictions are based on measurements of aqueous phase dechlorination rates of a single congener performed in the absence of sediment , they are consistent with the observed stimulation of dechlorination rates after bioaugmentation of sediment mesocosms containing a low concentration of weathered pcbs . simulation of dechlorination profiles for bioavailable pcbs in sediment for different cell densities based on aqueous phase dechlorination rates for pcb 61 experimentally determined in this study . the results of this study indicate that pcb organohalide respiring bacteria are capable of dechlorinating pcb 61 at environmentally relevant concentrations if present in sufficient numbers . this approach can be used to determine the rates of respiratory reduction for other pcb congeners within all homologue groups at environmentally relevant concentrations . using passive sampling to measure the freely dissolved concentrations of pcbs in the porewater , rates of pcb desorption from the sediment matrix and distribution of pcb congeners combined with knowledge of the congener specificity of the organohalide respirer(s ) used for bioaugmentation , it will be possible finally to project the rate and threshold levels of pcb dechlorination for a specific sediment site .

the time required for a pcb - contaminated site to recover can not yet be predicted due in part to lack of quantitative information on rates of pcb dechlorination in the porewater phase . we developed a method to measure rate of dechlorination in the aqueous phase at very low pcb concentrations . this approach utilizes a polymer functioning concurrently as a passive dosing system for maintaining a steady - state pcb substrate concentration in the water phase and as a passive equilibrium sampler to monitor the dechlorination product . rates of dechlorination of 2,3,4,5-tetrachlorobiphenyl ( pcb 61 ) to 2,3,5-trichlorobiphenyl ( pcb 23 ) by an organohalide respiring bacterium , dehalobium chlorocoercia df-1 , were measured over an environmentally relevant range of 1 to 500 ng l1 in sediment - free medium using a high concentration of cells ( > 106 cells ml1 ) . the results indicate that rate of dechlorination is a linear function of pcb substrate concentration below the maximum aqueous solubility of pcb 61 and occurs at concentrations as low as 1 ng l1 . demonstration of pcb 61 dechlorination at environmentally relevant concentrations suggests that low numbers of organohalide respiring bacteria rather than bioavailability accounts for low rates of dechlorination typically observed in sediments . using passive samplers to measure the concentration of dissolved pcbs in the porewater combined with knowledge of congener - specific rates for organohalide respirer(s ) , it will be possible to project the in situ rate and final concentration of pcbs for a specific site after treatment by bioaugmentation .

posthypoxic myoclonus ( lance - adams syndrome ) , resulting from hypoxia of the central nervous system , is characterized by action myoclonus , cerebellar ataxia , and mild intellectual deficit . wijdicks et al . defined status myoclonus as spontaneous or sound - sensitive , repetitive , irregular brief jerks in both face and limb present during most of the day after a cardiorespiratory arrest . however , it is a very rare condition , with not many cases in literature . we present an adult male patient who suffered hypoxic brain injury , following which he developed severe status myoclonus unresponsive to standard anticonvulsant polytherapy . a 60-year - old male , known case of myasthenia gravis , presented with symptomatic recurrence . treatment was initiated with plasma exchange and intramuscular neostigmine , resulting in considerable clinical improvement . endotracheal intubation was not planned in view of normal arterial blood gas values and no signs of respiratory distress . on day 5 of hospital stay , in the intensive care unit ( icu ) , the patient suddenly complained of difficulty in breathing . however , after the event , the patient developed continuous , spontaneous , high amplitude , and generalized myoclonic jerks . the jerks were exaggerated with stimuli such as touch , call , tracheal suctioning , and physiotherapy . to control these myoclonic jerks , the patient was sequentially put on phenytoin ( 100 mg 8 hourly ) , levetiracetam ( 1 g 8 hourly ) , valproate ( 1 g 12 hourly ) , piracetam ( 3 g 8 hourly ) , lacosamide ( 400 mg 12 hourly ) , and clonazepam ( 5 mg / day ) over 48 h. owing to the continuous myoclonus , the neurological status of the patient could not be assessed at any time during this period . bedside electroencephalography ( eeg ) in the icu was not feasible because of persistent myoclonic jerks . as the myoclonus was still not controlled , thiopentone ( 100 mg / h ) and midazolam ( 5 mg / h ) infusions were also started , but myoclonus was still continuously present . a magnetic resonance imaging ( mri ) of the brain was obtained 72 h after the onset of status myoclonus , which surprisingly revealed no structural changes suggestive of hypoxia [ figure 1 ] . magnetic resonance imaging brain showing no structural changes interestingly , it was observed that isoflurane , which was administered during mri at a concentration of 0.6% in 50% oxygen in air , completely abolished the myoclonic jerks for the duration that it was administered . hence , it was decided to administer isoflurane in the icu to control the myoclonus . isoflurane was administered using an anesthesia machine ( fabius , drager , germany ) with air and oxygen as carrier gases . the jerks completely disappeared at a minimum alveolar concentration ( mac ) of 0.4 ( ultraview , spacelabs , usa ) . isoflurane concentration was titrated , and it was found that the jerks were suppressed at a mac of 0.3 - 0.4 . all other anticonvulsants , except midazolam and thiopentone infusions , were continued in their previous dosages . at the end of 48 h fifteen minutes after cessation of anesthetic administration , patient regained consciousness , followed commands , and there was a significant decrease in the severity of myoclonus . the jerks were absent at rest and appeared only when the patient tried to perform some action . as the patient continued to improve , most of his antiepileptics were gradually tapered and stopped . at the end of 1 month of hospital stay , he was only on oral lacosamide 400 mg / day and oral clonazepam 5 mg / day for control of myoclonus . he was transferred to a rehabilitation center with a glasgow coma scale score of e4 m6 vtracheostomy ; minimal jerks triggered by movement and none at rest . posthypoxic myoclonus is a subcortical phenomenon involving many muscle groups and is sensitive to external stimuli such as sounds . stimulus - sensitive myoclonus is extremely difficult to treat and often interferes with the nursing care of these patients . it is a relatively rare syndrome and was first described by lance and adams in 1963 . here , neuroimaging tests such as computed tomography or mri of the brain are usually unremarkable . lacunar infarcts , loss of gray - white matter distinction and selective neuronal injuries in the gray deep nuclei may be seen due to diffuse neuronal injury , but usually , it is not specific of hypoxic myoclonus . eeg may show evidence of short duration spike and polyspike discharges or may be completely normal . we could not do eeg because of persistent myoclonus which is likely to produce more movement - induced artefacts . status myoclonus with loss of consciousness following hypoxic injury is considered a bad prognostic sign . as it was persistent in our patient , surprisingly , mri did not show any structural lesions , and hence we decided to use isoflurane to treat the myoclonus aggressively as the last treatment option . posthypoxic myoclonus is notorious for being resistant to conventional anticonvulsant agents . owing to lack of literature , no standard treatment guidelines exist , and treatment is based on trial - and - error method . favorable response has been reported with clonazepam , valproic acid , piracetam and levetiracetam , zonisamide and lacosamide . however , very high doses of piracetam ( 20 - 45 g / day ) or levetiracetam ( 3000 - 3500 mg / day ) are required in the treatment of myoclonus which is not very practical . but in our patient , none of the above - mentioned medications were able to control the status myoclonus . gabaergic agents lose their efficacy in prolonged seizures , due to excess glutamate release when seizure activity lasts longer than 1 h , resulting in an altered balance of excitation versus inhibition . in addition , the benzodiazepine receptors lose their affinity for their ligands , reducing their potency . this might be the reason why thiopentone and midazolam infusions failed to control the myoclonus in our patient . although the mechanism of action of isoflurane is not well understood , the antimyoclonic effects of isoflurane are likely due to potentiation of inhibitory postsynaptic gabaa receptor - mediated currents and its effects on thalamocortical pathways . the pharmacological properties of isoflurane make it an effective and easily titratable agent in suppressing seizures . other advantages , including rapid onset of action and elimination and the reduced potential for toxic effects on organs owing to its minimal metabolism , make it an ideal choice of therapy . isoflurane can cause eeg spiking and myoclonus , but it has not been associated with frank epileptoid activity . therefore , epileptogenesis does not appear to be a clinical concern with isoflurane . while kofke et al . administered isoflurane for a period ranging from 1 to 55 h for 11 patients with refractory generalized clonic - tonic seizures , mirsattari et al . administered isoflurane for 2 - 26 days ( and supplemental desflurane for 19 days in one patient ) in 7 patients . in both these reports , although it is recommended to achieve eeg - guided burst suppression for adequate control of seizures , in our patient , we titrated isoflurane dose ( mac ) to control the patient 's clinical jerks only and found that only low concentrations of isoflurane was required to achieve this end - point . furthermore , we discontinued isoflurane administration after 48 h , while continuing the rest of the anticonvulsant medications . this helped us to avoid hypotension and the need for vasopressors , which are invariably associated with prolonged administration of high concentrations of volatile anesthetics . in comparison , report increased incidence of hypotension and vasopressor use in most patients and increased urinary fluoride concentrations in one patient and mirsattari et al . report adverse effects such as vasopressors / inotropes use , atelectasis , infections , paralytic ileus , cardiac arrhythmias , and mild renal dysfunction . moreover , isoflurane being a volatile agent and not being metabolized in the body , there was no risk of accumulation and prolonged effect when administered only for 48 h. the route of elimination being through the lungs , our patient was awake within 15 min of its termination . this is in contrast to intravenous agents like thiopentone which get accumulated after prolonged administration resulting in delayed awakening . however , owing to technical and logistical difficulties , isoflurane can not be used routinely in icus as an antiepileptic agent . the need for an anesthesia machine and specialized vaporisers to deliver the anesthetic agents and the lack of familiarity of icu personnel with both the machine and the agents make it difficult for routine use . pollution of the icu atmosphere by the isoflurane - containing exhaled gasses owing to lack of a scavenging system is another hindrant . however , with the advent of newer devices such as anaconda ( sedana medical , ireland ) , administration of volatile anesthetics in icus has become simpler . it should be remembered that the goal of management in any case of refractory status epilepticus is to achieve burst suppression on eeg . the possible limitation in our case is that eeg was not monitored and isoflurane was titrated to suppress clinical myoclonus only . however , because we continued all other antiepileptics throughout the isoflurane administration period , and because the patient had significantly improved outcome after termination of isoflurane , we speculate that the seizure activity would have decreased significantly , even if not completely abolished . as such , whether the same success is reproducible in other patients can not be commented on . isoflurane is an effective , rapidly titratable antimyoclonic agent which may serve as a useful alternative when intravenous anesthetics fail in patients with refractory status myoclonus . although isoflurane does not reverse the underlying etiology , it may rapidly control the symptoms of refractory myoclonus .

posthypoxic myoclonus ( lance adams syndrome ) is characterized by myoclonus involving multiple muscle groups which is resistant to most conventional antiepileptic drugs . we present a case of hypoxic brain injury - induced myoclonic status epilepticus successfully controlled with isoflurane . the antimyoclonic effects of isoflurane are likely due to potentiation of inhibitory postsynaptic gabaa receptor mediated currents and its effects on thalamocortical pathways . it is effective even when intravenous agents fail to control myoclonus . it may be a useful alternative to intravenous anesthetics as a third tier therapy in patients with refractory status myoclonus .

idiopathic osteosclerosis ( io ) is known as the region of enlarged bone production in the jaw , and its shape could be round , elliptical , or irregular in shape . these lesions recognized as developing intraosseous anatomic variations and should be categorized distinctly from the cases due to inflammatory source or systemic disease . these asymptomatic lesions are mostly revealed as causal results on radiographs derived for other reasons on radiographic evaluation , io may be identified in different sizes in diameter ( 2 or 3 mm to 1 or 2 cm ) or the lesions may be very large , almost the whole height of the body of the jaw . they may happen at root apexes , among the roots , or in a distinct site away from the teeth , first in the premolar / molar region and with a preference for the mandibular arch . similar radiopaque region may occur in the periapical areas of teeth with nonessential or much inflamed pulps ; these lesions most likely characterize a reaction to a low - grade inflammatory inducer . such passive region nominated as condensing osteitis ( co ) or focal chronic sclerosing osteomyelitis and should not be incorporated underdetermine of io . the aim of this study was to investigate the frequency of io and co lesions in the tabriz patient population with respect to age , sex , shape , localization , and dental relationship . this study designed as descriptive study composed of 411 panoramic radiography of patients who referred to the oral and maxillofacial radiology service of dentistry faculty , tabriz university of medical . all radiographs achieved by an orthopantomography device ( planmeca proline cc 2002 , 6080 kvp , 810 ma , 12.8 s exposure time , helsinki , finland ) by x - ray technician who had a minimum working skill of 5 years . then , 6-inch green - sensitive panoramic film ( medical , konica co. , japan ) was used to take radiography . lesions determined as co if it linked with chronic inflammation . mostly , these lesions enclosed the apex of teeth with deep caries or large restorations . but , the lesions did not display any clear link to inflammation , well determined , and were not ruled out by the cases listed above were recognized as io . the following radiopacities were specially omitted : distinctive mixed radiopaque - radiolucent areas of periapical cemented dysplasia and other benign fibro - osseous lesions of periodontal ligament originincreased thickening of the lamina dura nearby teeth that presented clear malposition or that worked as abutment for fixed bridges or partial denturesobviously recognizable remnants of deciduous or permanent teethradiopacities understood as tori or exostosessolitary radiopacities seen in edentulous areas , since these might have been excessively ossified surgical sitespatients with gardner 's syndrome , colon familial polyposis , and other diseases with the bone metabolic disorder . distinctive mixed radiopaque - radiolucent areas of periapical cemented dysplasia and other benign fibro - osseous lesions of periodontal ligament origin increased thickening of the lamina dura nearby teeth that presented clear malposition or that worked as abutment for fixed bridges or partial dentures obviously recognizable remnants of deciduous or permanent teeth radiopacities understood as tori or exostoses solitary radiopacities seen in edentulous areas , since these might have been excessively ossified surgical sites patients with gardner 's syndrome , colon familial polyposis , and other diseases with the bone metabolic disorder . the lesions are located first as mandibular or maxillary , next more by region of the jaw : incisive , canine , canine - premolar , premolar , premolar - molar , or molar . radiopaque areas which were depicted as io and co that was classified by criteria of geist and katz [ figure 1a e ] : radiographic appearance of the osteosclerotic lesions which were detected in ( a ) interradicular , ( b ) interradicular and separate , ( c ) apical interradicular , ( d ) apical , ( e ) separate localization . interradicular : if the sclerotic area was confined between the roots and interrelated with the adjacent teeths ' lamina durainterradicular and separate : if the sclerotic area was confined between the roots and not interrelated with the adjacent teeths ' lamina duraapical and interradicular : if the radiopacities were at the apices and showed significant extension between the rootsapical : if the lesions were located around the apices of the rootsseparate : if the masses were located apically and clearly separated from the teeth and lamina dura . interradicular : if the sclerotic area was confined between the roots and interrelated with the adjacent teeths ' lamina dura interradicular and separate : if the sclerotic area was confined between the roots and not interrelated with the adjacent teeths ' lamina dura apical and interradicular : if the radiopacities were at the apices and showed significant extension between the roots apical : if the lesions were located around the apices of the roots separate : if the masses were located apically and clearly separated from the teeth and lamina dura . differences between distributions of lesions were determined by the chi - squared test when ranked by gender , age , shape , localization , and relation to teeth . this study performed on panoramic radiographs of 411 patients ( 226 females , 185 males ) , aged 695 years ( mean age : 33.8 13.66 ) . there were 32 io lesions in 31 ( 7.5% ) subjects which mean age was 30.52 years , and other patients were 34.06 ( p > 0.05 ) . moreover , 32 co lesions in 32 subjects ( 7.8% ) were determined that mean age was 34.59 years and in other was 33.73 years ( p > 0.05 ) . figures 2 and 3 showed the age distribution of patient in different decades of life that had io and co lesions . according to the results , the frequency of io lesions was higher in the third , second , and fourth decades of life , respectively , than in other periods and for co lesions were more in the fourth , second , and fifth decade of life . the distributions of io and co with respect to shape and border were given in table 1 . in the io lesion , the most shape was irregular form , and pearson chi - square analysis showed this difference was statistically significant ( p = 0.006 ) . for co lesions , the most shape was irregular . from 32 lesions and difference was not statistically significant ( p = 0.078 ) . distribution of idiopathic osteosclerosis and condensing osteitis with respect to shape and border the distributions of io and co with respect to localization and relationship to teeth of lesion are showed in table 2 . for io lesions , the most involved tooth was second premolar ( 28.1% ) and first molar ( 25% ) . of the 32 io lesions , thirty subjects found in mandibular and two subjects in maxillary of fourth and sixth teeth . in addition , the most lesions were apical and from 40.6% of lesion that was separate from teeth , mean of distance was 15.64 mm ( 230 mm ) . but for co lesions , the most involved tooth was the second premolar ( 59.4% ) and the first molar ( 21.9% ) . among the 32 co lesions , 31 cases related to mandibular and only in maxillary of the first tooth . on the other hand , the most lesion was apical and then apical and interradicular . the distribution of idiopathic osteosclerosis and condensing osteitis lesions with respect to tooth and tooth relation many of earlier studies investigated the frequency of io and co lesions . in the present study , of 411 panoramic radiographic the frequency of io lesions was 7.5% and co was 7.8% . in the previous literature , geist and katz detected 5.4% frequency of io in 1921 full - mouth intraoral radiographic investigations and io frequency of 1047 panoramaric radiographs was 6.1% which was two - third of 1203 panoramaric radiographs in japanese dental outpatients . lu et al . in 2003 reported the frequency of io in south taiwan population as 9.43% that probably due to genetic factors and breeding the lesion was seen more in the east population . but this range was two times higher than other studies . on the other hand , eliasson et al . reported the frequency of co in 1149 periapical radiographs to 2% while in the other study , with little sample size , it is found 6% co. the difference between the results obtained in this study first , the study was performed on panoramic radiographs and due to the difference in image quality , especially in the anterior region , there were not comparable by results of studies on periapical radiographs . the results of other studies have reported a higher prevalence of radiopaque io and co lesions . for example , in this study radiopaque of edentulous areas was omitted because it is probably formed after tooth extraction . moreover , other factors such as differences of genetic and diet may also be effective at the difference frequency . in the present study , the frequency of io was higher in females and the incidence co had no differences between women and men . but according to the miloglu et al . , the frequency of io and co was higher in turkish women than men . in addition , geist and katz and mcdonnell , who determined women to men ratio of 1.5:1 and 2:1 , respectively . similarly , avramidou et al . identified that female patients have more radiopaque lesion than male in a sample of greek patients . however , other study showed no difference between the incidence in female and male . in the present study , the frequency of co increased with age until the fourth decade of life that related to tooth decay . but in this study , a decrease of co in fifth and higher decade of life could be due to loss of tooth decay in older age that in this study edentulous sites were not examined . on the other hand , the frequency of io was high in the third decade of life . the frequency of both radiopaque was more common in mandibular that is consistent with previous studies . this case could be the result of taking panoramic radiographs because the image of anatomic structures in mandibular was not clear than maxillary and be less superimposition . in addition , differences in the incidence of co and io were related to anatomy of jaw bone and blood flow in jaw , although the cause of the lesions is unknown . in this study , io and co the result of miloglu et al . showed that io was more in premolar and co in a molar . the reason of high frequency of io in premolar was attributed to remain of premolar root and replacement with bone sclerotic . a histological investigation by henrikson clarified the existence of bone sclerotic at the site of io . further , in this study , the most lesions were periapical which matched by geist and katz . while in another study , the most lesions had no relationship by teeth . in addition , most of the lesions were irregular and spherical radiopaque with well - defined border that was similar to other results . in the light of these findings , we could demonstrate that relative frequency of io in iranian population is 7.5% and for co , it is 7.8% . io was more prevalent in women in mandibular and in the third decade of life , but co lesion had no difference between women and men . moreover , co similar to io was more in mandibular and showed high rate in the fourth decade of life . the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article . the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article .

background : the purpose of this study was to investigate of radiographic pattern and relative frequency of idiopathic osteosclerosis ( io ) and condensing osteitis ( co ) in panoramic radiographs.materials and methods : totally 411 panoramic radiographies were randomly selected from patients referred to radiology department of faculty of dentistry , tabriz university of medical sciences . descriptive characteristics of radiopacities , including shape , border , localization , and dental relationship , were recorded . the chi - squared test was used.results:io was detected in 31 ( 7.5% ) patients and 22 ( 68.8% ) lesions had exact border while their shape was mostly irregular . about 17 ( 53.1% ) lesions were apical , and 13 ( 40.6% ) lesions had no relation to the teeth . the most involved teeth were the second premolar ( 28.1% ) and first molar ( 25% ) . moreover , co was detected in 32 ( 7.8% ) patients . 17 ( 53.1% ) lesions had an ill - defined border , and their shape was mostly irregular ( 65.6% ) with ill - defined border . around 18 ( 56.3% ) lesions were apical , and 11 ( 34.4 ) lesions were apical and interradicular . the most involved teeth were the second premolar ( 59.4% ) and the first molar ( 21.9%).conclusion : the results demonstrated that relative frequency of io in the selected population was 7.5% and for co , it was 7.8% .

helper - dependent adenoviral vectors ( hdads ) are devoid of all viral - coding sequences and have proven to be excellent vectors for many gene and cell therapy applications because they can mediate high efficiency transduction of many different cells types from many different species in vivo and in vitro independent of the cell cycle , they have an enormous cloning capacity of 36 kb , do not integrate into the host genome and , provide long - term transgene expression with reduced toxicity . because hdad do not contain any viral gene , they must be produced using a helper virus ( hv ) . the hv is an e1-deleted adenovirus whose packaging signal is flanked by loxp sites . to produce hdad , e1-complementing cells expressing cre are coinfected with the hdad and the hv wherein the packaging signal of the hv is excised by cre - mediated site - specific recombination rendering it unpackagable but still able to undergo dna replication and trans - complement hdad production . occasionally , we have found that hdads expressing certain transgenes can not be produced because the transgene product is toxic to the producer cells , especially when present in large quantities , such as during vector production . for example , 10 to 10 progeny adenoviral genomes are produced postinfection , only about 20% of which are packaged into virions . because of such high transgene copy numbers during vector production , even transgene products that may not normally be toxic , may have toxic effects when present in such overwhelming quantities . and this problem is further exacerbated by the very strong promoters / enhancers that are normally employed in gene transfer vectors . therefore , development of strategies to overcome this obstacle is important and necessary for the production of these recalcitrant hdads . adenovirus , including the hv , expressed two rna polymerase iii - dependent noncoding rnas , called virus - associated ( va ) rnai and va rnaii . va rnai functions to ensure high - level adenoviral protein synthesis by binding to and inhibiting protein kinase r ( pkr ) , part of the antiviral interferon response , while the role of va rnaii is not well known . these short rna transcripts ( ~160 nucleotides ) have a stem - loop structure similar to pre - mirna and are expressed throughout the virus life cycle , reaching very high concentrations during the late phase of infection ( 10 molecules of va rnai / cell and 10 molecules of va rnaii / cell ) . like pre - mirna , va rnai and va rnaii are exported to the cytosol by exportin 5 where they are processed by dicer into functional micrornas , called mivarnas , which are incorporated into the rna - induced silencing complex . importantly , mivarnai derived from va rnai has been shown to target the mrna from reporter transgenes engineered to contain the complementary target sequence in their 3 untranslated region ( utr ) , thereby inhibiting their expression . as well , host cellular mrnas targeted by va rnai - derived mivarnai resulting in downregulated expression have been identified . in this study , we describe a simple strategy of exploiting expression of va rnai from the hv to downregulate transgene expression from the hdad during its production . in this way piggybac ( pb ) is a transposon isolated from cabbage looper moth tichoplusia ni and encodes a transposase that catalyzes pb transposition . hyperactive pb transposase ( hypbase ) bears 7 amino acid substitutions resulting in a 17- and 9-fold increase in excision and integration , respectively , compared to wildtype . we attempted to produce a hdad expressing hypbase from the strong cag promoter ( hdad - cag - hypb ) using our well - established protocol , which entails serial coinfections ( called passages ) of the producer cells with the hdad and the hv to increase the hdad titer , followed by identification of the earliest passage containing peak hdad titer which would then be used to initiate large - scale vector production . to determine the passages which contain peak hdad titers , total cellular dna was extracted from the producer cells at each serial passage , and examined by agarose gel electrophoresis after apali digestion . serial passages with peak hdad titers can be identified by the visible presence of hdad - specific bands in the presence of the background cellular dna smear , and is typically first attained at serial passage 2 or 3 ( refs . ) . as expected , this was indeed the case for the control vector , hdad - cag - lacz , amplified in parallel with hdad - cag - hypb , in which maximum titer was first reached at serial passage 2 ( figure 1a ) . in contrast , for the four independent amplifications of hdad - cag - hypb , vector - specific bands were not visible until serial passage 5 or 6 ( figure 1b e ) . according to our established protocol , large - scale hdad production is initiated using the earliest passage containing the highest intensity vector - specific band based on agarose gel analyses . thus , the earliest passage to contain maximum vector titer was passage 2 for the control hdad - cag - lacz ( figure 1a ) , and passage 6 for the four amplifications of hdad - cag - hypb ( figure 1b e ) . accordingly , crude viral lysate from passage 2 for hdad - cag - lacz and crude viral lysate from passage 6 for hdad - hypb were used to coinfect a single 150 mm dish of producer cells along with hv to initiate large - scale vector production ( figure 2 ) . the resulting crude viral lysates from this 150 mm dish was used to coinfect 2 l of producer cells along with hv for large - scale production , and the vectors were purified by cscl centrifugation ( figure 2 ) . following cscl ultracentrifugation , a single band was observed in the gradient for hdad - cag - lacz as expected ( figure 3a ) . in contrast , multiple bands were observed in the cscl gradient for the four preparations of hdad - cag - hypb ( figure 3b e ) , which is indicative of genomic rearrangement of the hdad and/or hv . to verify genomic structure , dna was extracted from the virions obtained from the cscl gradients , digested with apali and analyzed by agarose gel electrophoresis . as expected , the dna pattern of hdad - cag - lacz was identical to the plasmid from which it was derived ( except for the expected absence of the 2.5 kb fragment containing the bacterial plasmid dna ) indicating no dna rearrangements ( figure 3j ) . in contrast , the four preparations of hdad - cag - hypb revealed different dna patterns with some bands corresponding to the hdad and some to the hv , as well as novel bands not expected of either , all of which is consistent with a mixed population of various rearranged hdad and hv dna ( figure 3k ) . because these preparations are useless for their intended purpose , their precise dna rearrangements were not investigated further . given that hdad - cag - hypb and hdad - cag - lacz are identical except for the coding sequence in the expression cassette , it was reasonable to assume that expression of hypbase was responsible for the delay in reaching peak titers during vector amplification and hdad and hv genome rearrangements . therefore , we reasoned that downregulating hypbase expression during vector amplification would result in successful vector production . the strategy to accomplish this va rnai is expressed from the hv which is processed into mivarnas by dicer and incorporated into the rna - induced silencing complex and , importantly , this has been shown to downregulate expression cassettes bearing the complementary mivarnai sequence in the 3utr . thus , downregulating transgene expression from the hdad should be achievable during vector production by simply inserting the mivarnai target sequence into the 3utr of the hdad s expression cassette . conversely , once the hdad is purified , this modification would not inhibit transgene expression by the hdad in the transduced target cell because of the absence of the hv . to evaluate this strategy , hdad - cag - hypb - vai was created which bears , within the 3 utr , nucleotides 119 to 159 from va rnai within which resides the mivarnai target sequence ( figure 5 ) . in four independent amplifications of hdad - cag - hypb - vai , passage 3 was chosen to initiate large - scale vector production ( figure 2 ) , and in all four cases , a single virus band was obtained in the cscl gradient ( figure 3f restriction analysis of the dna extracted from these four vector preparations revealed the expected pattern , indistinguishable from the plasmid from which the vector was derived ( except for the expected absence of the 2.5 kb fragment containing the bacterial plasmid dna ) indicating the absence of dna rearrangements ( figure 3l ) . to confirm that purified hdad - cag - hypb - vai expresses functional hypbase , human - induced pluriopotent stem ( ips ) cells were coinfected with hdad - cag - hypb - vai and hdad - pb - tr . hdad - pb - tr contains a 2.3 kb segment of dna flanked by pb terminal repeats ( trs ) and is thus excisable in the presence of hypbase ( figure 6a ) . as controls , the next day , total dna was extracted from the treated cells and subjected to polymerase chain reaction ( pcr ) analyses . in the absence of hypbase - mediated excision , a 4.1 kb pcr product is expected , and this is converted to a 1.8 kb pcr product following hypbase - mediated excision ( figure 6a ) . the plasmid phdad - pb - tr ( used to make hdad - pb - tr ) , was included in the pcr assay as a control and , as expected , yielded only the unexcised 4.1 kb pcr product ( figure 6b , lane 6 ) . as expected , infection with hdad - pb - tr alone does not result in excision as evident by the presence of the 4.1 kb pcr product and the absence of the 1.8 kb pcr product ( figure 6b , lane 4 ) . in contrast , the 1.8 kb pcr product , indicative of hypbase - mediated excision , is only present following coinfection of cells with hdad - cag - hypb - vai and hdad - pb - tr ( figure 6b , lane 2 ) . however , the unexcised 4.1 kb pcr product remains visible following coinfection with hdad - cag - hypb - vai and hdad - pb - tr ( figure 6b , lane 2 ) and this may be due to inaccessibility of a fraction of the hdad - pb - tr genomes to hypbase ( such as some genomes remaining encapsidated ) and/or that hypbase - mediated excision is not 100% efficient and/or some cells were infected with hdad - pb - tr only . nevertheless , these results confirm that hdad - cag - hypb - vai does indeed express functional hypbase . subsequently , we have used hdad - cag - hypb - vai to successfully excise dna segments flanked by pb trs in other applications ( not shown ) . during production , the hdad genome , along with its transgene expression cassette , is replicated to very high copy numbers in the producer cell . the extraordinarily high transgene copy numbers , exacerbated by the use of strong promoter / enhancers , result in very high quantities of transgene product in the producer cells during vector production . at such high amounts , a transgene product that is otherwise benign , may have toxic effects on the producer cells and this could lead to a selection for rearranged vectors with no or reduced transgene expression . hdad expressing hypbase from the strong cag promoter is an example of such a vector ; hybpase is not toxic to mammalian cells but our repeated attempts to produce this vector were unsuccessful resulting in hdad and hv genome rearrangements . we have overcome this obstacle by exploiting the fact that the hv expresses va rnai , a short noncoding rna that is processed in functional mirnas , called mivarna , by the endogenous cellular rnai pathway in the producer cells to downregulate transgene expression from the hdad . this was accomplished by simply inserting the mivarnai target sequence into the 3 utr of the hdad s expression cassette . this simple modification allowed for repeated and robust production of an hdad expressing the functional hypbase from the strong cag promoter . this strategy is straightforward and universal ; it does not require the use of a special producer cell line , or drugs to suppress or induce transgene expression , and no special dna expression control elements need be included in the expression cassette . once the hdad is produced and purified , transduction of the target cell results in unimpeded transgene expression from the hdad because of the absence of the hv . recently , saydaminova et al . reported a mirna - mediated method of downregulating transgene expression from a hdad during its production . in this case , by mirna expression profiling , saydaminova et al . identified two endogenous cellular mirnas , hsa - mir183 - 5p and hsa - mir218 - 5p , that were strongly expressed in the producer 293-cre cells but not in their intended human cd34 + target cells . thus by inserting the target sequence for hsa - mir183 - 5p and hsa - mir218 - 5p into the 3 utr of the expression cassette , transgene expression was suppressed during vector production by hsa - mir183 - 5p and hsa - mir218 - 5p present in the 293-cre producer cells . however , transgene expression was unimpeded following hdad transduction of cd34 + cells due to the absence of hsa - mir183 - 5p and hsa - mir218 - 5p in these cells . however , this strategy would be ineffective for target cells , unlike cd34 + cells , that expressed either hsa - mir183 - 5p or hsa - mir218 - 5p . in summary , we have developed a simple and universal strategy to downregulate transgene expression from hdad during vector production . this permits production of hdad that otherwise could not be produced because of transgene product - mediated cellular toxicity . indeed , we have subsequently used this strategy to produce other recalcitrant hdads which we could not previously produce despite multiple attempts ( not shown ) . an expression cassette containing the cag promoter , hypbase coding sequence , and the sv40 polyadenylation signal was inserted into the asci site of the hdad genomic plasmid p28e4 ( ref . ) and the resulting plasmid was used to produce hdad - cag - hypb as described below . the va rnai target sequence , created by annealing two oligonucleotide ( sequence shown in figure 5 ) , was inserted into the noti site in the 3 utr of hypbase expression cassette which was then inserted into the asci site of p28e4 and the resulting plasmid was used to produce hdad - cag - hypb - vai as described below . the expression cassette in hdad - cag - lacz is identical to the one in hdad - cag - hypb except that the hypb coding sequence was replaced with the escherichia coli -galactosidase coding sequence . briefly , 20 g of the plasmid form of the hdad was digested with pmei and transfected into a confluent 60 mm dish of 116 cells by calcium phosphate co - precipitation ( promega , madison , wi ) and then the cells were infected with the hv adng163 ( ref . ) at an moi of 2,000 vp / cell ( serial passage 0 ) . the hdad titer was increased by serial coinfections as follows ; for each serial coinfection ( called a passage ) , a confluent 60 mm dish of 116 cells was coinfected with hv ( 200 vp / cell ) and 20% of the crude viral lysate containing the hdad from the previous passage . total dna was extracted from each serial passage , digested with apali , and visualized by ethidium bromide staining following agarose gel electrophoresis . serial passages containing peak titers of hdad were identified by the visible presence of hdad - specific bands in the agarose gel . the earliest serial passage containing the most intensely visible hdad - specific bands was used to initial large - scale vector production as follows ; 20% of the crude viral lysate from the aforementioned passage was used to coinfect a single 150 mm dish of 116 cells along with adng163 . 48 hours later , 100% of the crude viral lysate from this single 150 mm dish was used to coinfect 2 l of 116 cells ( 1 10 cells total ) along with adng163 at an moi of 200 vp / cell . hdad was purified from the coinfected 116 cells 48 later by triple cscl ultracentrifugation ; one step gradient followed by two continuous gradients . hypbase - mediated dna excision was analyzed as follows ; feeder free human ips cells were maintained in mtesr 1 ( stemcell technologies , vancouver , canada ) on matrigel ( corning , tewksbury , ma ) coated plates . the ips cells were infected as follows : 2 10 cells were resuspended in 1 ml mtesr 1 supplemented with y27632 ( reagents direct , encinitas , ca ) to 10 mol / l in a 1.5 ml microfuge tube and infected with hdad at an moi of 350 vp / cell for 1 hour at 37 c with gentle rocking . following infection , cells were washed twice with 1 ml mtesr 1 supplemented with y27632 to 10 mol / l and plated in a single matrigel coated well of a six - well plate in mtesr 1 supplemented with y27632 to 10 mol / l . the next day , pcr was performed with primestar gxl ( takara - clonetech , mountain view , ca ) using primers 5 ctcagttttcctggattatgcctggcacc and 5 gcctgaccaacatggagaaaccccatctc . thermocycling conditions were as follows ; 1 min at 94c , followed by 30 cycles of 98 c for 10 seconds and 72 c for 10 minutes , and a final extension of 10 minutes at 72 c .

helper - dependent adenoviral vectors ( hdad ) that express certain transgene products are impossible to produce because the transgene product is toxic to the producer cells , especially when made in large amounts during vector production . downregulating transgene expression from the hdad during vector production is a way to solve this problem . in this report , we show that this can be accomplished by inserting the target sequence for the adenoviral va rnai into the 3 untranslated region of the expression cassette in the hdad . thus during vector production , when the producer cells are coinfected with both the helper virus ( hv ) and the hdad , the va rnai produced by the hv will target the transgene mrna from the hdad via the endogenous cellular rnai pathway . once the hdad is produced and purified , transduction of the target cells results in unimpeded transgene expression because of the absence of hv . this simple and universal strategy permits for the robust production of otherwise recalcitrant hdads .

cherubism is a familial disorder of the jaws , which was first identified by jones in 1933.1 the term cherubism has arisen from the characteristic cherubic appearance of the patients . cherubism is an autosomal dominant disease , and mutation of the exon 9 of the sh3bp2 gene has been identified in cherubism patients . 50% to 70% for females , some clinical studies have shown that mutation in this gene does not have 100% penetrance in males.24 common clinical and radiographic signs of patients with cherubism are painless bilateral expansion of the jaws , displaced and/or missing teeth or tooth germs , and multilocular well - defined radiolucent lesions . histopathologic features of the aforementioned lesions are similar to central giant cell granuloma ( cgcg ) . despite their stromal structure , cherubism lesions are spongier than cgcg lesions , and eosinophilic fibrolitic thickening has been evident.5 however , cherubism and cgcg lesions have similar findings and similar treatment options . conventional treatment of cgcg comprises local curettage and long - term follow - up . despite the high success rate of surgical interventions in the management of cgcg , conservative approaches like intralesional steroid injections,6 subcutaneous administration of -interferon following surgery,7 and systemic calcitonin therapy8 it has been reported that calcitonin therapy is a feasible treatment option in the management of cgcg , especially for larger aggressive or multiple lesions.9 however , few reports have been published with regard to successfully treated cgcg - like lesions of cherubism by calcitonin administration . in this case report , treatment of cherubism with 200 iu salmon calcitonin via nasal administration is presented . a 14-year - old boy was referred to our clinic with a complaint of painless bilateral symmetric thickening of the lower jaw and dental disharmony . extra - oral view of the patient exhibited bilateral swelling in the angular region of the mandible , which was relatively resolved with age , and bilateral exophtalmus and bulb displacement ( figures 1 and 2 ) . panoramic radiograph of the patient revealed bilateral thickening of the mandible , irregular multiple multilocular radiolucent areas and displaced teeth and tooth germs , as well as missing permanent teeth ( figure 3 ) . the boundaries of the lesions were also determined by computerized tomography ( ct ) scan ( figure 4 ) . serum levels of parathyroid hormone and alkaline phosphatase were in the range of normal values . the histopathologic characteristic of the lesion was consistent with cgcg , which displays oval - shaped fibrohistiocytic stromal cells and osteoclast - like multinuclear cells on hemorrhagic ground ( figure 5 ) . the history of the patient and younger photographs of him revealed a significant regression of swellings over the course of growth ( figure 1b ) . according to the history of the patient , clinical and laboratory findings , and radiographic and histological examinations , a final diagnosis was cherubism . the family of the patient was informed about the prognosis of the disease because the other family members were free of cherubism symptoms . calcitonin therapy was initialized with salmon calcitonin every other day by use of a nasal spray ( calcitonina hubber 200 iu , icn iberica , spain ) . periodical radiographic follow - up was performed in order to evaluate the efficacy of the treatment . after 30 months of treatment , significant radiographic improvement was observed and calcitonin therapy was ceased ( figures 6 and 7 ) . the main findings of cherubism are bilateral symmetrical swelling in the angular region of the face and intra - osseous cgcg - like lesions in the jaws . cherubism is a familial disorder , which has also been reported as a type of fibrous dysplasia of the jaws.10 a possible etiological pathway of cherubism and related cgcg lesions is related to dysregulation of mesenchymal bone subsequent to a disturbed cap stage of the second and third molar , which is induced by mutation in the sh3bp2 gene.11 although multiple family members in the same generation may be affected due to the autosomal dominant characteristic of the disease , a lack of familial background could be observed12,13 as in the present case . conventional treatment of cherubism includes jaw contouring , curettage of the lesions , and management of dental disharmony . although there are many reports concerning regression of the cherubic lesions in advanced ages,13 cgcg - like lesions in cherubism usually need to be treated , and favorable results have been obtained with calcitonin administration in the management of cgcg.2,9,14 calcitonin therapy for cgcg was first described by harris in 1993.8 the therapeutic effects of calcitonin may act on calcitonin receptors in the giant cells of the cgcg , and increased osteoclastic activity in cgcg has been thought to be antagonized via calcitonin therapy.14,15 the use of calcitonin therapy for cherubism has been rarely documented . in an in vitro study , the positive effects of calcitonin on bone resorption within cherubic lesions was proven.16 lannon and earley17 observed the therapeutic failure of 100 iu calcitonin therapy via daily subcutaneous injections for 6 months , and reported that no regression was observed . they stated that failure of calcitonin therapy is related to poor compliance by the patient , as well as the relatively short treatment period , and they concluded that improved patient compliance might be obtained by using the intranasal method . hart et al18 performed one year of calcitonin therapy for cherubism via nasal administration , but they had to stop the treatment because of nausea . in a recent report , de lange et al2 performed daily administration of 200 iu calcitonin via nasal spray for a 15-month period in a boy with cherubism and observed considerable regression of the lesion after cessation of therapy . similar to the manner of therapy used by de lange et al,2 in the present case , calcitonin was administered via the nasal passage for duration of more than two years . the severity of cherubic lesions varies case to case , and its severity has been classified by previous authors ( grades 1 , 2 and 3 , according to severity of lesions).10,19,20 the course of treatment may vary according to the size of the lesion . the present case might be considered as a grade 1 case of cherubism due to the fact that bilateral lesions occurred only in the posterior mandible , and the duration of the treatment was longer as well . no side effects were observed during the treatment period . the dose , type , and administration method of calcitonin has been documented in many reports . 2,8,9,14 since calcitonin was first used for cgcg , daily subcutaneous administration of human calcitonin has become the most common method of therapy . however , the use of salmon calcitonin has recently become more popular than using human calcitonin because of its increased potency and availability.21 the correct dose of calcitonin has been determined at 100 iu per day , which is based on the regimens previously used for paget s disease.22 on the other hand , the use of daily 200 iu salmon calcitonin via nasal spray for cherubism has been recently reported.2 in the present case , 200 iu calcitonin was administered via nasal spray every - other - day to make an equivalent daily dose of 100 iu , because a 100 iu calcitonin nasal spray dosage was not available in the country . however , it is well known that daily subcutaneous administration of 100 iu calcitonin is considerably more effective than an every - other - day nasal dose of 200 iu . as a result , the two treatment regimens are not comparable due to the lower bio - availability of nasal spray . in general , nevertheless , the absorbed amount of calcitonin might be unpredictable because of the condition of the nasal mucosa . however , systemic calcitonin dosage via nasal spray is considered the easiest method of management , especially in children . to our knowledge , the present report is the second in which cherubic lesions were treated with systemic calcitonin administration via nasal spray for duration of more than one year . after approximately three years of treatment , calcitonin therapy was discontinued since radiographic regression of the lesions and growth of the patient had ended , and the patient was scheduled for follow - up . however , regression of the lesions through the natural course of the disease , due to the relatively older age of the patient , may have contributed to the successful outcome of the treatment . the dose and application method of calcitonin therapy would be dependent on the case and patient tolerability . a dosage of 200 iu calcitonin via nasal spray may be administered every other day in order to improve patient tolerability and continuity of the treatment , especially in mild cases of cherubism . further studies will be necessary to determine the ideal regimen of calcitonin therapy for cherubic individuals .

cherubism is a familial disease of the jaws which is inherited via autosomal dominant manner . typical features of cherubism include a painless bilateral , symmetrical enlargement of the jaws , misalignment of teeth , and intra - osseous central giant cell granuloma - like lesions , which are usually evident in early childhood . treatment of cherubism consists of local curettage of the lesions , jaw contouring , intralesional steroid injections , and systemic calcitonin administration as well . calcitonin therapy for central giant cell granuloma of the jaws is well documented , and favorable results have been achieved . however , fewer reports have been presented in regard to calcitonin administration for cherubism . in the present report , a 14-year - old boy with cherubism who had intra - osseous cherubic lesions in his mandible was treated with an administration of 200 iu systemic calcitonin every other day via his nasal passage for duration of more than two years . after 30 months of calcitonin therapy , the lesions in the mandible were significantly regressed , and calcitonin application was ceased . despite some drawbacks , such as unpredictable efficient absorption and patient tolerability , nasal administration is the easiest way to use calcitonin therapy on children . in this report , every - other - day applications of calcitonin increased patient tolerability and might be considered as an effective treatment for mild cherubic lesions .

comparar a capacidade de selamento apical de quatro cimentos endodnticos . mtodos : quarenta caninos superiores humanos extrados foram instrumentados 1 mm aqum do pice anatmico e distribudos aleatoriamente em quatro grupos ( n=10 ) , de acordo com o cimento endodntico utilizado para a obturao : endofill , ah plus , endorez e epiphany . os canais radiculares foram obturados pela tcnica da condensao lateral com os cimentos e com cones de guta - percha , exceto o grupo do epiphany , no qual os cones de resina ( resilon ) foram utilizados . os dentes foram imersos em nanquim por sete dias e submetidos ao processo de diafanizao e , ento , clarificados empregando - se o salicilato de metila . a extenso de penetrao via apical do corante foi medida por meio de um microscpio de mensurao em todas as faces do tero apical . ah plus ( 0,02 mm 0,07 ) , epiphany ( 0,00 mm 0,00 ) e endorez ( 0,32 mm 0,62 ) no diferiram estatisticamente entre si ( p>0,01 ) . endofill apresentou a maior mdia de penetrao do corante ( 0,83 mm 0,73 ) e diferiu estatisticamente dos demais ( p<0,01 ) . os trs cimentos resinosos apresentaram menor microinfiltrao que o cimento base de xido de zinco e eugenol , porm , promoveram selamento apical semelhante entre si . endodontic therapy consists of cleaning and shaping the root canal system , removing organic debris and sealing the intracanal space with permanent filling materials . the obturation must seal the pulp space both apically and laterally , thus preventing further apical irritation from either incomplete elimination of bacteria and their products or communication between apical tissues and oral cavity13,18 . some authors have reported that the smear layer produced after root canal cleaning and shaping prevents the penetration of sealer into the dentinal tubules9,20 . studies have shown that smear layer acts as a passageway for microorganisms and as a medium for viable bacteria entrapped into dentinal tubules11,21 . despite the undisputable improvements , until today no material fulfills all requirements and desirable properties to hermetically seal the root canal system . apical leakage is still a frequent event in root - filled teeth , which raises concern regarding the quality of obturation provided by the currently available filling materials5,10 . there are several methods for evaluating the apical sealing of root canal sealers , such as bacterial penetration25 , fluid transport34 , clarification28 , penetration of radioisotopes4,15 , electrochemical methods6 and gas chromatography12 . dye penetration tests , however , seem to be the most widely used27,29,33 . the purpose of this in vitro study was to compare , using a dye penetration test , the sealing ability of two commonly used root canal sealers ( grossman 's sealer and ah plus ) and two recently introduced resin - based sealers ( endorez and epiphany ) . forty human maxillary canines , extracted for unknown reasons and kept in 0.1% aqueous thymol solution under refrigeration , were used in this study . the teeth were washed under tap water for 24 hours prior to the experiment to eliminate traces of thymol . canal length was established by introducing a size 10 k - file ( dentsply - maillefer , ballaigues , switzerland ) into each root canal until the tip of the instrument was visible at the apical foramen . the cervical portion of root canal was enlarged using a la axxess drill size 45/.06 ( sybronendo , glendora , ca , usa ) before instrumentation . the apical portion of all roots was enlarged at the working length up to a size 45/.06 , using k instruments ( sybronendo ) . irrigation was performed with 1 ml of 1% sodium hypochlorite alternated with the same volume of 17% edta between instruments . a final flush with 10 ml edta solution followed by the same amount of distilled and deionized water was done and the canals were dried with paper points . the teeth were randomly assigned to four groups of 10 specimens each and the root canals were filled according to the lateral condensation technique , as follows . in group 1 , the canals were obturated with endofill , a zinc oxide and eugenol sealer ( dentsply ind . ltda , petrpolis , rj , brazil ) . a size iso 45 master gutta - percha cone ( dentsply ind ltda , petrpolis , rj , brazil ) was coated with the sealer throughout its extension , including the apical portion , and placed into the root canal at the working length . ltda , petrpolis , rj , brazil ) and a size " c " finger spreader ( dentsply ind . ltda , petrpolis , rj , brazil ) was performed until the entire canal was sealed . excess gutta - percha was removed with a heated instrument and the filling mass was compacted vertically with a manual plugger . canals in group 2 were filled with endorez , a udma resin - based root canal sealer with hydrophilic properties ( ultradent products inc . , south jordan , ut , usa ) , while canals in group 3 were filled with ah plus , an epoxy resin - based sealer ( dentsply de trey gmbh , konstanz , germany ) , following the same technique used for group 1 . canals in group 4 , after application of epiphany dentin primer with a paper point , were filled with epiphany resin - based sealer ( pentron clinical technologies , wallingford , ct , usa ) in the same manner as described for the other materials . however , instead of gutta - percha points , the resin points supplied with the root canal sealer in the same sizes of the previous groups were used . teeth were stored at 37c , 100% air humidity for 72 hours to allow setting of the sealers . thereafter , three layers of nail polish were applied to the tooth surface , except for the apical 2 mm , which remained exposed , in such a way that dye could penetrate the canal only via apical region . each group was separately immersed in india ink and stored at 37c for 1 week , after which the teeth were thoroughly washed in running water and the nail polish was removed with a scalpel blade . next , the teeth were demineralized in 5% hydrochloric acid , washed in tap water for 24 hours , dehydrated in ascending concentrations of ethanol at 50% , 70% , 80% , 96% and 100% for 4 hours each , and finally transferred to methyl salicylate for diaphanization . the cleared teeth were analyzed by means of a measurement microscope ( measuroscope , nikon , japan ) . the extent of dye penetration was measured in millimeters in all aspects of the root canal by an experienced , calibrated examiner , from the apical stop to the maximum length of dye penetration . mean values and standard deviation of apical dye penetration for each root canal sealer are given in table 1 . ah plus endofill zinc oxide and eugenol sealer presented the highest dye penetration mean and was statistically different from the other groups ( p<0.01 ) . three - dimensional sealing of the root canal system is one of the main goals of endodontic treatment and is essential for prevention of canal re - infection and maintenance of healthy periapical tissues . for such purpose , several types of endodontic sealers have been developed and the evaluation of the apical sealing ability of these materials is extremely important26 . therefore , leakage studies that investigate the sealing properties of endodontic materials are still considered important and relevant7,19 . previous studies have shown the validity of using india ink penetration in cleared teeth for direct linear measurement of leakage9 . root canal microleakage is a complex subject because many variables may influence infiltration , such as root filling techniques , physical and chemical properties of sealers and presence or absence of smear layer2 . the smear layer resulting from root canal instrumentation acts as a physical barrier interfering with the adaptation and penetration of the sealer into the dentinal tubules , which might contribute for increasing microleakage occurrence20 . use of chemically active , adhesive root canal sealers may play an important role in minimizing apical leakage2 . in this study , the smear layer was removed from the specimens with 17% edta . by doing so , the surface contact between the intracanal walls and the filling material is increased and apical seal may be improved3,20 . although predictable clinical results have been reported with the use of gutta - percha points and epoxy resin - based root canal sealers3,14,19 , there is an increasing interest in the use of methacrylate resin - based sealers ( containing urethane dimethacrylate udma)7 because these materials can be used with dentin adhesives for bonding to intraradicular dentin24 . moreover , hydrophilic methacrylate resin monomers may be incorporated into root canal sealers to improve resin penetration into dentinal tubules after removal of the endodontic smear layer30 . this fact may explain the low microleakege results of endorez , which is a udma resin - based root canal sealer . epoxy resin - based root canal sealers have also shown good physicochemical properties as well as excellent apical sealing8 . studies have demonstrated that resin endodontic sealers , such as ah plus , have lasting dimensional stability and satisfactory apical sealing ability5 . the remarkably low microleakage means of ah plus in this study are consistent with these findings . in addition to 17% edta , epiphany primer was applied to the dentin walls of the root canals that were to be filled with resilon points . epiphany primer is a self - etching primer that contains sulfonic acid terminated functional monomer , hema , water and polymerization initiator . dentin preparation with the application of these chemical agents may prevent shrinkage of the resin filling away from the dentin walls and improve the sealing of the roots filled with resilon points25 . this might have contributed to the lack of apical dye penetration in the root canals obturated with epiphany . the excellent sealing ability demonstrated by this root canal sealer in this study may also be attributed to the " monoblock " design that is created by the resilon / epiphany system , i.e. , the resilon points adhere to the epiphany sealer , which , in turn , present adherence to the dentin walls25 . recent reports attest that this adhesion to the dentine walls is not flawless when examined both under sem or tem , a fact also observed with ah plus sealer 31 . in the present study , epiphany , endorez and these findings may possibly be attributed to the fact that all these sealers have resin components in their formulations , which improve their adherence to the intracanal dentin walls26 and is an important factor for leakage prevention1 . zinc oxide - eugenol - based sealers have had their use standardized in endodontics over time . they are the most widely known and clinically employed root canal sealers and have been used as controls in several in vitro investigations for comparison to other endodontic sealers16,23,32 . previous studies have reported that zinc oxide eugenol based sealers have poor adhesive properties to dentin and is highly permeable17,22 . accordingly , in this study , the zinc oxide - eugenol - based sealer had the highest microleakage means of all tested materials . 2005)35 compared the microleakage of grossman 's cement with a udma - based endodontic sealer , and found greater infiltration for the grossman 's cement . according to the methodology proposed and based on the results of this study , it may be concluded that the resin - based root canal sealers presented lesser apical microleakage than the zinc oxide - eugenol - based sealer , but promoted similar apical sealing among each other .

objectives : to compare the apical sealing ability of four root canal sealers . materials and methods : forty extracted human maxillary canines were instrumented 1 mm short of the anatomical apex and randomly assigned to four groups ( n=10 ) , according to the root canal sealer used for obturation : endofill , ah plus , endorez and epiphany . root canals were obturated with guttapercha points , except for the epiphany group , in which resin points ( resilon ) were used . the teeth were immersed in india ink for seven days and clarified using methyl salicylate . the extent of apical dye penetration was measured with a measuroscope in all aspects of the canal.results:ah plus ( 0.02 mm 0.07 ) , epiphany ( 0.00 mm 0.00 ) and endorez ( 0.32 mm 0.62 ) did not differ statistically to each other ( p>0.01 ) . endofill presented the highest dye penetration mean ( 0.83 mm 0.73 ) and was statistically different from the other sealers ( p<0.01).conclusions : the resin - based root canal sealers presented lesser apical microleakage than the zinc oxide and eugenol based sealer . no statistical differences were observed among resin based sealers .

diabetic macular oedema ( dme ) is one of the main causes for reduced visual acuity in patients with diabetes . a recent meta - analysis examined the prevalence of dme in 22,896 diabetic patients and found that 6.81% of diabetic patients had dme . several prospective , randomized studies showed that intravitreal injections of antivascular endothelial growth factor ( vegf ) drugs were effective in reducing macular thickness and improving the visual acuity in patients with dme [ 36 ] . however , the injections had to be repeated which increased the risk of postintravitreal anti - vegf endophthalmitis and the medical expenses . for example , in the pooled analysis of the resolve and the restore studies , the incidence of endophthalmitis was 1.4% at 1 year for multiple injections . growing evidence indicates an association between the intraocular inflammation induced by diabetic stress and the development and progression of dme . several basic studies demonstrated that steroids upregulate the tight junction proteins , occludin and zo-1 , tighten the retinal blood barrier , and reduce the expression of vegf [ 9 , 10 ] . posterior sub - tenon 's capsule injection of triamcinolone acetonide ( stta ) and intravitreal injections of triamcinolone acetonide ( ivta ) have been used to treat dme . ivta has a higher risk of endophthalmitis and elevation of the intraocular pressure than stta . the japanese survey of triamcinolone acetonide for ocular diseases reported that the incidence of endophthalmitis by ivta and stta was 0.12% and 0.008% , respectively , and that the incidence of glaucoma requiring filtration surgery after ivta and stta was 0.56% and 0.26% , respectively . our recent study indicated that the short - term effect of stta for dme is comparable to that of pars plana vitrectomy . thus , repeated injections or additional treatments such as laser photocoagulation are usually required for the treatment of dme . the main purpose of this study was to identify the risk factors that led to a recurrence or persistence of dme after a stta injection . the medical records of 124 eyes of 124 patients with dme that had stta between january 2010 and july 2011 at the chiba university hospital were reviewed . all of the procedures conformed to the tenets of the world medical association declaration of helsinki . a signed informed consent was obtained from all patients regarding the procedures to be performed , and approval for this study was obtained from the institutional review board of chiba university graduate school of medicine . the definition of a recurrence of dme in this study was an eye which initially had a 30% decrease of central macular thickness ( cmt ) compared with the baseline within 1 year after stta but then increased by 30% . the definition of a persistence of dme was an eye which had < 30% decrease of the cmt within 1 year after stta . seventy - four patients ( 59.7% ; 42 men , 32 women ) had a persistent dme or a recurrence within 1 year . in the eyes with a recurrence , the mean interval until the recurrence was 7.7 3.5 months . the possible risk factors for a recurrence or persistence of a dme after stta were the age , sex , glycohemoglobin a1c ( hba1c ) level , best - corrected visual acuity ( bcva ) , cmt , insulin use , pioglitazone use , systemic hypertension , serous retinal detachment ( srd ) , proteinuria , panretinal photocoagulation ( prp ) , microaneurysm photocoagulation ( mapc ) , subthreshold micropulse diode laser photocoagulation ( smdlp ) , cataract surgery , and history of vitrectomy . all possible risk factors for recurrence or persistence of dme after stta were determined by logistic regression analysis . a p < 0.05 was considered significant . the baselines clinical characteristics of the 124 patients with dme are shown in table 1 . the dme of 50 eyes ( 40.3% ) was improved after the stta injection without any additional treatments , 52 ( 41.9% ) had a recurrence of dme , and 22 eyes ( 17.7% ) had a persistence of the dme after stta injection . all of the results of multiple logistic regression analyses of the risk factors for a recurrence or persistence of dme after the stta injection are shown in table 2 . at the time of treatment , the mean age was 60.3 13.1 years bcva was 0.6 0.4logmar units , and mean cmt was 539.2 156.7 m . thirty - eight patients ( 30.6% ) used insulin , 10 used pioglitazone ( 8.1% ) , 55 ( 44.4% ) had hypertension , and 47 ( 37.9% ) had proteinuria . fifty - five patients ( 44.4% ) underwent prp and 25 patients ( 20.2% ) underwent cataract surgery . none of these factors was found to be significant risk factors ( tables 1 and 2 ) . forty - nine patients ( 39.5% ) underwent mapc and 13 patients ( 10.5% ) underwent smdlp combined with the stta injection . these procedures were found to be significantly associated with a persistence or recurrence of the dme ( p = 0.0315 , p = 0.04 , resp . ; table 2 ) . on the other hand , 17 patients ( 13.7% ) with a history of ppv had significantly fewer recurrences or persistence of dme after stta injection ( p = 0.0464 ; table 2 ) . the results indicated that 40% of patients with dme were successfully treated with a single stta injection without any additional treatments for at least 1 year . on the other hand , 60% of dme patients had a recurrence or persistence of dme after a single stta injection and repeated stta injections or other treatments were required . the specific indications for mapc and smdlp were not determined but the patients with microaneurysms at the posterior pole underwent stta combined with mapc immediately or within one month after the stta injection . the effect of the stta injection for dme is rapid , and our results indicate that the cmt was significantly reduced 1 month after the stta injection . in our hospital , thus , the refractory dme patients without microaneurysms underwent smdlp and not grid laser photocoagulation as additional treatment after stta . basically , both mapc and smdlp tended to be performed for patients with mild to moderate dme with cmt > 500 m in our hospital . therefore , patients with severe dme with cmt < 500 m underwent stta first , followed by undergoing mapc or smdlp . the results of the logistic regression analysis indicated that both mapc and smdlp were risk factors for a recurrence or persistence of dme because these patients tended to have refractory dme and needed to undergo additional treatments . although patients who underwent mapc had an enough population size , smaller number of patients underwent smdlp compared to mapc . thus , the result of the logistic regression analysis for smdlp should be interpreted with caution . recently ribeiro et al . suggested that a high microaneurysm turnover rate ( sum of the microaneurysm formation and disappearance rates ) was a higher risk for developing clinical significant macular oedema ( csme ) over a 2-year period . demonstrated that high microaneurysm formation rate was a predictive marker for progression to csme for a period of up to 5 years . taken together , microaneurysm formation is probably a sign of severe diabetic stress including oxidative stress in the macula of diabetic patients , and the requirement of mapc combined with stta injections may be necessary to treat the dme . however , these patients may increase diabetic stress including oxidative stress in the macula ; further pathological changes such as mller cell swelling , retinal pigment epithelium ( rpe ) dysfunction , or blood - retinal barrier dysfunction may be accompanied . such pathological changes may cause refractoriness of dme after stta with mapc . although the precise mechanism of the effect of smdlp is unclear , smdlp may stimulate and activate rpe and improve to draw out the excessive fluid in the retina . vitrectomized eyes had a significantly lower risk for recurrence or persistence of dme after the stta injection . another possible reason is that , in vitrectomized eyes , pathological cytokines , such as vegf or il-6 , can easily diffuse and are not in contact with the macula for a long period . thus , a stta injection may be one of the options for treatment of dme developing in vitrectomized eyes but a careful management of the steroid response is needed because glaucoma infiltration surgeries are difficult to perform in vitrectomized eyes . the hba1c level is known to be a major risk factor for developing dme [ 19 , 20 ] . however , in this study , the hba1c level was not found to be a significant risk factor for recurrence or persistence of dme after a stta injection from the logistic regression analysis . we have classified the grades of dm control as good control group ( hba1c < 6.5% ) , moderated control group ( 6.5% hba1c 8.0% ) , and poor control group ( 8.0% < hba1c ) and reevaluated whether the dm control was risk factors for recurrence or persistence of dme after stta injection . but the dm controls have not been identified as risk factors for recurrence or persistence of dme after stta injection ( p = 0.2203 ) . however , 80% of the patients with hba1c levels > 9.0% had a recurrence or persistence of the dme after the stta injection . thus , a poor glycemic control seems to increase a risk of recurrence or persistence of dme after stta injection . the results of two large cohort studies indicated that glitazone is a risk factor for developing dme [ 21 , 22 ] , and we have reported the first case of dme after pioglitazone use in japan . however , in this study , pioglitazone was not found to be a risk factor for recurrence or persistence of dme after a stta injection . from this study , we tentatively suggest the indication of stta in the clinical practice . further studies are needed to evaluate the additive effect of intravitreal injection of anti - vegf antibodies with smdlp for patients with dme . although this study has a limitation because of its retrospective nature , patients who needed to have combined mapc and smdlp with a stta injection had significantly higher refractoriness to dme . however , vitrectomized eyes may reduce the incidence of recurrence or persistent dme after a stta injection . additional prospective studies are needed to confirm the risk factors for a recurrence or persistent dme after a stta injection .

the purpose of this study is to identify the risk factors for a recurrence or persistence of diabetic macular oedema ( dme ) after a sub - tenon 's capsule triamcinolone acetonide ( stta ) injection . the medical records of 124 patients ( 124 eyes ) treated by stta were reviewed . the age , sex , hba1c level , best - corrected visual acuity , central macular thickness , insulin use , pioglitazone use , systemic hypertension , serous retinal detachment , proteinuria , panretinal photocoagulation , microaneurysm photocoagulation ( mapc ) , subthreshold micropulse diode laser photocoagulation ( smdlp ) , cataract surgery , and history of vitrectomy were examined by logistic regression analysis . procedures of mapc and smdlp were significantly associated with dme treated with stta ( p = 0.0315 , p = 0.04 , resp . ) . however , a history of vitrectomy was found to have significantly fewer recurrences or persistent dme after stta ( p = 0.0464 ) . in conclusion , patients who required combined mapc or smdlp with a stta injection had significantly higher refractoriness to stta , but postvitrectomy may prevent the recurrence or persistence of dme after stta injection .

solitary fibrous tumour ( sft ) is an uncommon mesenchymal neoplasm previously thought to only originate from the pleura . sfts can be identified using immunohistochemical staining , cd 34 and vimentin are consistently expressed in all pleura and extra - pleural sfts . malignant forms of sft have been described with histological finding of atypia , cellular necrosis , increased mitotic activity and infiltrative margins [ 24 ] . pancreatic presentation of sft is very rare , and to the best of our knowledge , there are no literature reporting metastatic sft arising from the pancreas . an 87-year - old woman presented to her general practitioner with 2 weeks history of a painless lump in her right groin and was referred to the county hospital , hereford . abdominal examination confirmed a smooth mobile lump 34 cm over the right inguinal region , which not a hernia . there were no palpable surrounding lymph nodes . biochemical and haematological tests , including full blood count , renal and liver function , were all unremarkable . she has had an episode of acute pancreatitis in january 2007 , which was treated with removal of a common bile duct stone , and later she had undergone cholecystectomy for gallstones . the procedures were uneventful . in december 2007 , she had recurrent abdominal pain with normal serum amylase level . a computed tomography ( ct ) scan done in the beginning of 2008 confirmed a 4-cm mass in the uncinate lobe of the pancreas . she was referred to the regional hpb centre for discussion in their mdt meeting , and an endoscopic ultrasound ( eus ) was carried out , which suggested a serous cyst adenoma . as there was no mucin found in the aspirates and the amylase levels were low , a ct scan was done 7 months later . and , this showed the lesion had changed somewhat , but it was believed that this could be due to the eus aspiration . the ultrasound scan carried out reported the pancreas was poorly visualized due to overlying bowel gas , and a decision was made that the lesion was benign and no further imaging was arranged . in january 2015 , the groin lump was excised intact from the right inguinal region . it measured 55 mm 42 mm and on microscopy , the mass was found to be a well - demarcated mesenchymal neoplasm , composed of interlacing fascicles of spindle cells with mild / moderate nuclear atypia ( fig . immunohistochemistry showed strong expression of vimentin , cd34 and focal expression of cd10 ( fig . in contrast , sma , desmin , mnf116 , ema , s100 , hmb45 , dog-1 , cd45 , ae1/ae3 and cd117 were all negative . overall , the histological appearances , immuno - profile and molecular studies have confirmed the diagnosis of a solitary fibrous tumour . in view of the high mitotic activity , the presence of focal necrosis and atypia , this has been regarded as a metastatic malignant solitary fibrous tumour deposit . figure 1:(a c ) photomicrograph of histologic material shows spindle cells ( haematoxylin and eosin staining , 100 200 400 , respectively ) . ( d and e ) cd34 immunohistochemical stain of the resected mass from the groin with tumour cells that have strong positivity . ( a c ) photomicrograph of histologic material shows spindle cells ( haematoxylin and eosin staining , 100 200 400 , respectively ) . ( d and e ) cd34 immunohistochemical stain of the resected mass from the groin with tumour cells that have strong positivity . following the histological findings , a ct of her thorax , abdomen and pelvis was arranged ( fig . 2 ) . the ct scan reported a large solid cystic mass in the uncinate process of the pancreas measuring 7.2 cm 4.8 cm in the axial dimension and 7.2 cm in the coronal dimension ( fig . figure 2:ct shows cystic mass in the uncinate process of pancreas measuring 4 cm in 2008 . figure 3:(a ) ct image of 2015 , a mass lesion in the head of the pancreas with solid and cystic components ( bunch of grapes appearance ) . the lesion measures 7.2 4.8 cm in the axial dimension and 7.2 cm in the coronal dimension . ( b and c ) multiple focal ground - glass density nodules in both upper lobes of the lungs , largest measuring 1 cm in the right upper lobe . ct shows cystic mass in the uncinate process of pancreas measuring 4 cm in 2008 . ( a ) ct image of 2015 , a mass lesion in the head of the pancreas with solid and cystic components ( bunch of grapes appearance ) . the lesion measures 7.2 4.8 cm in the axial dimension and 7.2 cm in the coronal dimension . ( b and c ) multiple focal ground - glass density nodules in both upper lobes of the lungs , largest measuring 1 cm in the right upper lobe . sft was first described as a spindle neoplasm arising from pleura . however , since then the tumour has been found in extra - pleural sites . positive immunohistochemical markers of cd34 and vimentin have been used to identify sft ; other stains like beta - catenin ( nuclear ) and bcl-2 have also been used in some cases [ 1 , 2 , 4 ] . so far , all previous case reports have identified benign pancreatic sft with no evidence of metastatic disease . however , sfts have the potential to metastasize , and a study has shown a metastasis rate of 5.35.4% with up to 10% recurrence rate . there has also been two case reports one from central nervous system and kidney sft which have metastasized to the pancreas [ 7 , 8 ] . histologically malignant sfts have markedly increased cellularity , mitotic activity , nuclear pleomorphism and areas of necrosis . in our case , we have identified a solitary mass excised from the groin region , which is positive for cd34 and vimentic marker with high proliferative rate ( 30% ) , nuclear atypia and cellular necrosis . hence , the inguinal mass that developed over 2 weeks is most unlikely to be the primary . the pancreatic mass that appeared as a well - defined mass with cystic portions on radiological images in 2008 measured 4 cm . over 7 years , the mass increased in size to 7 cm with evidence of metastasis to the lungs . this slow but significant increase in size suggests that the pancreas lesion is the primary . further investigation such as ct - guided fine - needle aspiration of the pancreatic mass could help to reinforce our findings . in summary , we here report the first case of primary sft of the pancreas that has metastasized to the lungs and subcutaneous tissue . unfortunately , given the patient 's age , the potential for lung metastases and the involvement of the vascular structures surgical intervention are not in the best interest of our patient .

solitary fibrous tumour is an uncommon mesenchymal neoplasm previously thought to only originate from the pleura ; it is seen only rarely in an extra - pleural location . we report the first case of pancreatic solitary fibrous tumour in an 87-year - old woman that has metastasized to the lungs and subcutaneous tissue . we have identified a solitary mass excised from the groin region , which is positive for cd34 and vimentic marker with high proliferative rate , nuclear atypia and cellular necrosis . imaging studies confirmed a slow - growing solitary mass in the uncinate lobe of the pancreas with evidence of lung metastasis .

schwannomas ( neurilemmomas ) are the most common tumors derived from schwann cells of nerve fibers . it is a relatively common tumor , approximately 5% of all benign soft tissue tumors . intraosseous schwannoma , however , is very rare , accounting for less than 1% of all benign bone tumors . radiologically , schwannomas present as well - circumscribed lytic , expansile intramedullary lesions with sclerotic borders . there is no case of intraosseous schwannoma around the wrist has been described in literature . we present the first case report of an intraosseous schwannoma of hamate bone of the wrist . physical examination showed a 22-cm firm , round and hard mass on the dorsal aspect of the right wrist . the overlying skin was intact , and there was no evidence of wamth , erythema , or induration . plain radiographs revealed a lytic lesion with well - defined sclerotic borders in the hamate bone . it was multilocular , with no inner calcifications ; the dorsal cortical part of the bone was disrupted without periosteal reaction ( figure 1a ) . computerized tomography ( ct ) scans showed the lesion was expansile with cortical break - through in its its dorsal aspect . it has sclerotic , well - defined borders with narrow transition zone ( figure 1b ) . magnetic resonance imaging ( mri ) revealed again cortical disruption of the dorsal cortex and extraosseous soft tissue extension of the lesion to the dorsal side of the hand ( figure 2a ) . the lesion was hyperintense on pd - weighted sequences , and demonstrated solid and homogenous enhancement on contrast - enhanced t1-weighted sequences . despite its soft tissue extension , it has still well - defined borders within bone and soft tissues . immunohistochemistry studies of the tissue obtained by a needle biopsy showed s-100 protein positive spindle cells , addressing a benign neurogenic tumor . then , we performed totally resection of the lesion by curettage via dorsal longitudinal incision . the gross specimen showed a solid lobular tumor with clear boundary , partly located within the bone . histologically , the tumor was composed of multiple nodules of spindled schwann cells within the bone parenchyma ( figure 3a and b ) . immunohi stochemically , tumoral cells were strongly positive for s-100 protein ( figure 3d ) . she had been followed up for seven months with no sign of recurrence and pain ( figure 2b ) . intraosseous schwannoma , however , is very rare , accounting for less than one per - cent of all benign bone tumors . in addition to the sacrum , iliac wing and mandible , intraosseous schwannomas also occur in the long bones , vertebra , fibula and frontal bone , however , there is no case in literature intraosseous schwannoma of hamate bone . schwannomas may involve bone tissue via three mechanisms : i ) they may be intramedullary , producing rarefaction of the bone ; ii ) they may be located within the nutrient canal , with the formation of a dumbbell - shaped tumor ; or iii ) they may be extraosseous , eroding into the bone . on the base of imaging , intraoperative findings of dumbbell - shaped tumor inside and outside the hamate bone and gross examination , this case demonstrates an example of intraosseous schwannoma . intraosseous schwannomas have characteristic radiographic features such as a well - defined lytic lesion , sclerotic margins , narrow transition zone , lobulated contours , cortical expansions and absence of central calcification . however , all these radiographic findings are non - spesific and does not help clinicians in differential diagnosis . on the basis of ct and direct x- ray , it is difficult to differentiate the intraosseous schwannoma from other lytic benign bone lesions of such simple bone cyst , aneurysmal bone cyst , and giant cell tumor of bone , fibrous dysplasia , enchondroma and non - ossifying fibroma . on mri , shwannomas are solid lesions contrary to simple bone cyts and aneurysmal bone cyts . giant cell tumors , fibrous dysplasia and non - ossiying fibromas are heterogenous tumors having both t2 hyper and hypointense areas . on ct , giant cell tumors have lytic borders due to its local agresiveness and fibrous dysplasias have ground - glass apperance with wide transition zone . ct and mri scans in our case showed that the lesion was expansile with cortical break - through and extra osseous extension but well defined borders within both bone and soft tissues . the sclerotic , well - defined borders have narrow transition zone on ct and plain radiography . making diagnosis of an intraosseous schwannoma pre - operatively with clinical and radiological findings , and needle biopsy was beneficial to the patient to avoid unnecessary adjuvant therapy . these tumors are generally well encapsulated without invasion of the surrounding structures , enabling complete resection possible .

intraosseous schwannoma of the hamate bone presented in this case is a very rare benign tumor , and its diagnosis combined with clinical , imaging and needle biopsy is important to guide further therapy . the diagnosis of schwannoma of the hamate was proved histologically following its surgical treatment by curettage .

actinomycetes , gram - positive bacteria , represent an important source of biologically active compounds . in fact , they synthesize one - third of the antibiotics commercially available that is , the macrolide erythromycin , the glycopeptide vancomycin , and the cyclic lipopeptide daptomycin and other drugs like neuroprotectants ( e.g. , meridamycin ) , and anticancer compounds ( e.g. , migrastatin or geldanamycin ) . most natural products possess complex structures ( figure 1 ) that are very difficult and expensive to be chemically synthesized and they are obtained at an industrial scale mainly by fermentation processes from the producer microorganism . however , industrial production requires microbial strains that produce unnaturally high yields of a secondary metabolite . in many cases , industrial fermentation yields more than 10 g / l of product ; that is , penicillin production process was steadily improved over the years to allow titres of 70 g / l . to increase production yields , classical strain improvement ( csi ) or rational genetic methods are used . csi consists of sequential random mutagenesis and screening of the mutant strains : after each cycle of csi a population of improved mutants is identified from which the single best performer is selected . csi does not give information on genes and molecular mechanisms during the improvement and it is likely that some mutations may be detrimental or neutral in term of production . rational methods consist of deleting or overexpressing specific genes that , finally , control biosynthesis of a secondary metabolite , relying on the knowledge of gene sequences and functions and on suitable protocols for the genetic manipulation of natural producers . the biosynthetic genes devoted to secondary metabolite biosynthesis are organised in clusters that can occasionally reach 100 kb in size or more [ 4 , 5 ] . since suitable protocols for the genetic manipulation of natural producers are not always available and given the size of most gene clusters , artificial chromosome - based vectors that can be maintained in streptomyces have been constructed . such vectors allow genetic information for secondary metabolite production to be transferred from the original producer to a host with well - defined genetics and physiology , where the genes can be expressed . heterologous expression of large biosynthetic pathways can also be necessary in all cases in which producing bacteria are not cultivable or to examine new metabolites produced by cryptic gene clusters , usually revealed by genome sequencing and mining . this paper deals with artificial chromosome - based vectors and related methods currently available to analyze biosynthetic genes and to express biosynthetic pathways in heterologous systems . the first step for studying and analyzing biosynthesis at the genetic level is to obtain gene sequences . the recent genomic technologies allow to sequence entire genomes and thereby to identify biosynthetic gene clusters . however , the majority of natural - product - producing microorganisms are refractory to standard gene manipulation techniques , and some are not cultivatable outside their ecological context [ 7 , 8 ] . for these reasons , the study and modification of whole pathways has greatly benefited from the possibility to manipulate them in vectors , such as cosmids , and artificial chromosomes . cosmids show high transformation efficiency , with a loading capacity up to 45 kb . many cosmid libraries of actinomycetes have been successfully constructed to clone and identify biosynthetic gene clusters [ 914 ] . however , many biosynthetic gene clusters for natural products are larger than the average insert size of common cosmid vectors . to overcome this size limitation , one strategy can be the subcloning of subsets of the biosynthetic gene cluster into compatible expression plasmids followed by their introduction and coexpression in a suitable host strain [ 15 , 16 ] . another option is the reassembly of large natural product pathways on a single transferable vector by using the recombineering ( recombination - mediated genetic engineering ) technology that employs homologous recombination mediated by phage - based recombination systems . recombineering is independent of the e. coli endogenous homologous recombination functions , of restriction sites and of dna size . recombineering using the e. coli phage red pathway , which is mediated by its exo and beta proteins , was successfully applied to reconstitute phenalinolactone and anthramycin gene clusters from two independent cosmids [ 17 , 18 ] in e. coli . for a single step cloning of inserts larger than 100 kb a more straightforward strategy uses bacterial artificial chromosome ( bac ) , based on the e. coli f factor , and the p1-derived artificial chromosome ( pac ) , which can carry large dna fragments ( about 100300 kb ) in e. coli cells . thus , vectors that can be shuttled between e. coli , where library construction and manipulation can be easily conducted , and streptomyces , where actinomycete genes can be expressed ( figure 2 ) , were developed [ 2123 ] . the features of ppac - s2 ( derived from pcypac2 ) , pstreptobac v ( derived from pbace3.6 ) , and psbac ( derived from pcc1bac ) are briefly reported in table 1 and maps are given in figure 3 . integrative vectors are maintained in the host without selection and are more stable , since metabolic burden and unwanted recombination events are reduced . integration into actinomycete chromosome is ensured by the attp - int system derived from the temperate phages c31 or bt1 , which directs the integration of the vector dna at the corresponding chromosomal attb sites of the host . the availability of two compatible integrating artificial chromosomes can increase the possibility to further manipulate the host . a detrimental effect on endogenous antibiotic production was reported in some producer strains after the integration of vectors in the c31 attb site . for example , the integration of nonrecombinant vectors of 11 kb and 48 kb caused a 90 and 59% reduced production of the endogenous glycopeptide a47934 in streptomyces toyocaensis [ 2426 ] . some antibiotic resistance cassettes , like ampicillin resistance gene , are not useful for selection in streptomyces and different resistance cassettes can be necessary for selection in the two hosts . as an example , the ppac - s2 contains kanamycin and thiostrepton resistance cassettes used for selecting e. coli and streptomyces recombinant clones , respectively . pstreptobac v and psbac contain an apramycin resistance cassette that can be used to select both e. coli and streptomyces recombinant clones . to transfer bacs or pacs from e. coli to streptomyces two main strategies can be adopted . in pstreptobac v and psbac , an orit in the vector allows intergeneric conjugation between an e. coli strain containing tra encoding genes ( carried in an helper plasmid or into the chromosome ) and streptomyces . when orit is not present ( i.e. , p - pac - s2 ) , a more laborious yet easy and well - established protocol is necessary , which comprises protoplast preparation and peg - assisted protoplast transformation . to date , several libraries have been constructed in bac or pac artificial chromosomes [ 22 , 23 , 2832 ] and relevant features of these libraries are mentioned in table 2 . using sau3ai , libraries of s. coelicolor and planobispora rosea with an average insert size of 60 kb were constructed in ppac - s2 . a partial genomic library ( two - fold coverage ) of s. coelicolor was first constructed to set up the methodologies , and using the same procedure the first pac library of an intractable actinomycete , p. rosea , with an average insert size of 60 kb and the largest insert of 150 kb was constructed . when the same methodology was applied to nonomuraea sp . atcc 39727 , it was not successful , since its dna undergoes degradation during pfge [ 29 , 37 ] . the pfge step was therefore omitted , and a high - quality , high molecular weight genomic library of 2,051 recombinant clones with inserts larger than 30 up to 155 kb with an average insert size of 57 kb was constructed in ppac - s2 . to construct genomic libraries of s. roseosporus and s. platensis , bamhi digested genomic dna was ligated to bamhi digested pstreptobac v. libraries of 2000 and 2400 clones with an average insert size of 71 and 75 kb were obtained from s. roseosporus and s. platensis [ 22 , 31 ] . bamhi , on the other hand , allows to obtain large inserts due to its less frequent restriction pattern . the bamhi - digested s. platensis dna was fractionated twice by pfge to reduce the number of small inserts . since many genome sequences are nowadays available , more specific approaches can be applied . in the case of streptomyces sp . nrrl 30748 , gene sequence analysis had already revealed that two mfei sites flanked the 90 kb gene cluster devoted to meridamycin biosynthesis and no mfei sites were present inside the gene cluster . thus , genomic dna was digested with mfei and resulting dna fragments of approximately 100 kb were ligated to ecori sites of psbac . if the biosynthetic gene cluster was cloned in a bac / pac - derived vector that does not contain the integration site for streptomyces , the vector can be provided with an integration cassette and a marker for selection in streptomyces , as in the case of the library of streptomyces fradiae nrrl 18160 constructed in pecbac . after the identification of a clone containing the gene cluster devoted to a54145 biosynthesis , the clone was modified and used to transform streptomycetes by adding the c31 attp - int cassette , the apramycin resistance cassette and orit . heterologous expression of secondary metabolic gene clusters can allow process development and molecular biological manipulation of the biosynthetic pathways in those cases of native producer strains recalcitrant to manipulation . even if this strategy appears effective and straightforward , choice of an appropriate host is always challenging . e. coli is not a good host for the expression of actinomycete genes , and heavy manipulation has to be carried out to get biosynthesis of actinomycete products . as an example , to obtain erythromycin biosynthesis , the e. coli bl21 ( de3 ) strain containing the gene for t7 rna polymerase was transformed with four plasmids : ( i ) phzt1 and ( ii ) phzt2 containing all ery genes organized in two operons under t7 promoter control ; ( iii ) phzt4 containing eryk , the last gene of one of the operons , since it was not expressed at high level ; and ( iv ) plasmid pgro7 containing the genes for the e. coli groel / es chaperone system to aid protein folding and/or association of actinomycete gene products . only the strain carrying the four plasmids produced erythromycin a , while the same e. coli strains containing only phzt1 and phzt2 did not . this very labour - intensive , time - consuming procedure was specific for erythromycin , and a similar strategy could not always be applied for the synthesis of other antibiotic compounds that may require specific precursors that e. coli can not provide . streptomyces is more amenable for strain improvement , grows more rapidly , and generally has the biosynthetic apparatus and primary precursors necessary to support natural product synthesis from exogenous pathways . among streptomycetes , s. coelicolor and s. lividans s. coelicolor is considered the model species among actinomycetes and a large array of genetic tools , including its genome sequence , is available to understand and manipulate the organism [ 7 , 39 ] . although there are many advantages of using s. coelicolor as a host , plasmid - free derivatives of s. lividans , a close relative of s. coelicolor , have often been used for heterologous production ( table 3 ) [ 40 , 41 ] . the primary reason is the absence of a strong restriction system , like in s. coelicolor , which heavily restricts methylated dna . other streptomycetes have already been used for heterologous expression of secondary metabolite gene clusters , like streptomyces albus g j1074 , and other industrial strains , such as s. avermitilis . s. albus g j1074 is a mutant defective in sali restriction and modification , readily transformable cloning host that has been used for the expression of several other secondary metabolite gene clusters . the industrial microorganism s. avermitilis , producer of the anthelmintic macrolide avermectins , has been already optimized for the efficient supply of primary metabolic precursors and biochemical energy to support multistep biosynthesis [ 43 , 44 ] . in some cases heterologous production is either absent or so low that manipulation of the host is necessary . different strategies , both genetics- and physiology - driven , can be explored in a well - defined host . fermentation - based approaches can consist of varying carbon or nitrogen sources or different phosphate levels in the medium and in feeding with a biosynthetic precursor that may be limiting during the growth phase . genomic analysis of streptomycetes has revealed that these microorganisms have large linear chromosomes that harbour over 20 gene clusters for secondary metabolites that could compete for precursors or could interfere with chemical analysis . thus , the deletion of host gene clusters devoted to biosynthesis of other endogenous metabolites can increase precursor supply and , thus , improve heterologous production [ 33 , 34 , 36 , 45 , 46 ] ; in addition , there are point mutations in rpob and rpsl genes , coding for rna polymerase beta - subunit and 30s ribosomal subunit protein s12 , respectively , known for increasing antibiotic production [ 45 , 47 ] . although the underlying molecular mechanism is not understood , these mutations have a pleiotropic effect on levels of secondary metabolite production that is achieved , at least in part , by elevated transcript levels . s. coelicolor produces at least four metabolites with antibiotic activity : the type ii polyketide actinorhodin ( act ) , the nprs / pks - derived prodiginines ( red ) , the nrps - derived calcium - dependent antibiotic ( cda ) , and the typei polyketide yellow pigment cpk . in the last two years , two groups put their efforts in the engineering of s. coelicolor in order to construct suitable production hosts [ 45 , 46 ] . in one case four of these endogenous secondary metabolite gene clusters were deleted and point mutations in rpob and rpsl genes were introduced . in the more recent case , sequential deletions of all ten polyketide synthase ( pks ) and nonribosomal peptide synthetase ( nrps ) biosynthetic gene clusters and a 900-kb subtelomeric sequence ( total ca . 1.22 mb , 14% of the genome ) from s. coelicolor chromosome were performed to construct derivative strains . in addition to lacking antibacterial activity , the engineered strains possess relatively simple extracellular metabolite profiles and they could markedly facilitate the discovery of new compounds by heterologous expression of cloned gene clusters , particularly the numerous cryptic secondary metabolic gene clusters that are prevalent within actinomycete genome sequences [ 45 , 46 ] . s. lividans has been largely used as heterologous host for its more relaxed restriction / modification system , but some strains of s. lividans under many fermentation conditions produce actinorhodin that interferes with the detection and purification of other secondary metabolites , so part of the act gene cluster was deleted in k4 - 114 , therefore providing a cleaner background for heterologous expression . the industrial microorganism s. avermitilis was manipulated by deletion of the telomeric ends of the linear chromosome , which contain nonvital genes , often antibiotic biosynthesis - related . a region of more than 1.4 mb was deleted stepwise from the 9.02 mb s. avermitilis linear chromosome to generate a series of defined deletion mutants ( i.e. , suka4 , suka5 ) , that did not produce any of the major endogenous secondary metabolites found in the parent strain . also foreign genes can be manipulated , that is , strong promoters can be added to drive transcription of genes or operons , otherwise weakly transcribed . here we discuss the successful production of daptomycin ( from dpt genes ) , meridamycin ( from mer genes ) , and migrastatin ( from mgs genes ) , pointing out the strategies applied ( figure 4 ) . firstly , artificial chromosome libraries from s. roseosporus nrrl 11379 , s. platensis nrrl18993 , and streptomyces sp . nrrl 30748 were screened by pcr or hybridization for the presence of dpt , mgs , mer , and lpt gene clusters , respectively . once sequenced , the relevant clones were used to transform various streptomyces hosts , where they were stably integrated and maintained . the daptomycin gene cluster was transferred in s. lividans tk64 and tk23 . in both cases , the recombinant strains produced the lipopeptide with a low titre and a high amount of actinorhodin [ 22 , 41 ] . to reduce the background effect of native metabolites , the s. lividans tk23 host was manipulated by inactivating actinorhodin production through replacement of a portion of the gene cluster with a resistance gene , but this did not result in a yield improvement . an improvement in daptomycin biosynthesis was obtained by increasing the levels of k2hpo4 during fermentation . it is likely that phosphate , often reported as an inhibitor of antibiotic production , inhibited host metabolite biosynthesis pathways , whose precursors could be necessary for daptomycin biosynthesis . adjusting the level of phosphate in the medium the yield of the lipopeptide was increased from 20 to 55 mg / l , corresponding to one - third of the yield of the natural producer [ 22 , 41 ] . in the case of meridamycin biosynthesis , the transfer of the 90 kb gene cluster to s. lividans tk24 and k4 - 114 did not lead to the detection of any heterologous metabolites , since pks genes were not properly transcribed , possibly due to the size of operon ( 3 genes for a 78 kb operon ) . indeed , the cloning of a strong promoter ( erme promoter ) upstream of the mer genes coding for the pks allowed the detection of approximately 100 g / l of meridamycin in the fermentation extract . to further increase the yield , a fermentation strategy based on feeding with biosynthetic precursors was applied . the supply of ethylmalonyl - coa , used as an extender unit in meridamycin biosynthesis , is a critical factor that limits the synthesis of some polyketides by heterologous hosts . in fact , when s. lividans containing mer gene cluster with pks genes under erme control , was supplemented with diethyl malonate , which is an effective precursor for ethylmalonyl - coa , the production increased about 2-fold ( 240 feeding with pipecolic acid , another unique precursor for the biosynthesis of meridamycin , did not increase production . to find the most suitable host to express the biosynthetic gene cluster for the production of the polyketide migrastatin of s. platensis nrrl18993 , five streptomyces hosts were selected : s. lividans k4 - 114 , s. coelicolor m512 , s. albus g j1074 , and the two s. avermitilis strains , suka4 and suka5 . all the five strains produced the metabolite , but the titres , in two media already optimized for the natural producer , were similar to or less than those obtained with s. platensis . the best producers were s. albus that produced approximately 46 mg / l in b2 medium ( natural producer 58 mg / l ) , and s. lividans k4 - 114 that produced 15 mg / l ( control 17 mg / l ) in r2yed medium . adjusting fermentation conditions , an improvement of the titer ( appr . in addition , feeding with nahco3 that plays a critical role in the biosynthesis of malonyl - coa , the major precursor for migrastatin biosynthesis , allowed s. albus to produce migrastatin at a titer of 213.8 mg / l , about 5-fold higher than the originally [ 31 , 48 ] . it is noteworthy that also the production of the lipopeptide a54145 from s. fradiae was obtained in streptomycetes hosts , but the vector , pecbac1 , was not an e. coli - streptomyces shuttle vector . the recombinant vector , containing the entire lpt gene cluster was modified by adding the c31 attp - int integration cassette after library construction . the lpt gene cluster of s. fradiae was transferred into s. ambofaciens and s. roseosporus strains genetically manipulated in a such way to not being anymore able to produce spiramycin and daptomycin , respectively . interestingly , both sets of heterologous strains were more efficient than wild type s. fradiae at producing the lipopeptide , but less productive than the s. fradiae high - producer control . artificial chromosomes are useful tools to exploit or to explore the genetic potential of intractable actinomycetes , by creating , for example , large - insert libraries from strains of interest , in order to isolate one or more large gene clusters [ 22 , 23 , 2832 ] , or by reconstructing gene clusters that are already available as a set of smaller fragments cloned in lower capacity vectors [ 17 , 18 , 51 , 52 ] . to be transferred in amenable hosts , bac and pac are provided with means to be maintained in manipulable streptomycetes , which can synthesize foreign complex molecules , such as antibiotics [ 2123 ] . sometimes , heterologous expression of actinomycetes biosynthetic gene clusters was successful after changing fermentation conditions , that is , feeding with a biosynthetic precursor , minimizing background endogenous activities or after cloning strong promoters upstream of production genes weakly transcribed . the examples here described can be considered as promising starting points to successfully express heterologously valuable biosynthetic products . a significant improvement in heterologous production will surely come from new technologies , like next generation sequencing and gene stitching and synthesis . indeed , the genome sequences of both the producing strains and of the hosts can help to find the minimal set of genes necessary to maintain heterologous production in a clean background and to avoid interference between foreign gene products and host that in some cases were reported [ 53 , 54 ] . a possibility could be to create artificial hosts that maintain as less endogenous genes as possible and that contain the specific genes to provide primary metabolites and all the cofactors necessary to synthesize a specific secondary metabolite . some studies in this direction have just started with the deletion of large dna fragments from s. avermitilis and s. coelicolor chromosomes [ 36 , 46 ] . more efforts are needed to obtain a universal suitable host of actinomycete gene clusters ; although s. avermitilis and s. coelicolor strains with minimized genomes have been constructed and shown to produce more metabolites than natural producers , further manipulation of their genomes followed by the improvement of the yields will hopefully occur with the help of specific experiments of gene stitching and synthesis . the genome sequencing of streptomyces species ( e.g. , s. coelicolor and s. avermitilis [ 39 , 43 ] ) has remarkably revealed that each strain has the genetic information to produce a large number ( e.g. , 23 and 32 , resp . ) of secondary metabolites . this implies that as much as 90% of the chemical potential of these organisms remains undiscovered by the conventional screening programs . genome mining offers a powerful method for tapping into these cryptic natural products . for discovery of new compounds by genome mining , heterologous expression heterologous expression through artificial chromosomes may provide the possibility to access gene clusters for the production of bioactive metabolites from the large number of uncultured bacteria present in the environment without the need to actually isolate them [ 5661 ] . growing many of these organisms at large scale for production purposes is unlikely to be practical but their biosynthetic gene clusters are particularly attractive targets for heterologous expression in a genetically amenable host . for all these cases , it will be important to develop a suite of streptomycete hosts for high - level heterologous expression of specific types of secondary metabolites , and to facilitate rapid identification and testing of novel products . given the relatively recent success of heterologous complex natural product biosynthesis , these tools are just beginning to be applied , but they appear to be very promising . such approaches , in addition to omics global characterization techniques and more traditional process engineering steps , will be of paramount importance for the maximization of natural product outputs from heterologous hosts . when the new technologies ( e.g. , gene synthesis ) will be cheap and there will be no more novel activities and genes to discover , it is likely that cloning strategy will be abandoned , but at the moment this perspective is quite far .

actinomycetes are an important source of biologically active compounds , like antibiotics , antitumor agents , and immunosuppressors . genome sequencing is revealing that this class of microorganisms has larger genomes relative to other bacteria and uses a considerable fraction of its coding capacity ( 510% ) for the production of mostly cryptic secondary metabolites . to access actinomycetes biosynthetic capabilities or to improve the pharmacokinetic properties and production yields of these chemically complex compounds , genetic manipulation of the producer strains can be performed . heterologous expression in amenable hosts can be useful to exploit and to explore the genetic potential of actinomycetes and not cultivable but interesting bacteria . artificial chromosomes that can be stably integrated into the streptomyces genome were constructed and demonstrated to be effective for transferring entire biosynthetic gene clusters from intractable actinomycetes into more suitable hosts . in this paper , the construction of several shuttle escherichia coli - streptomyces artificial chromosomes is discussed together with old and new strategies applied to improve heterologous production of secondary metabolites .

a retrospective chart review was performed on all ( consecutive ) patients from september 2006 to august 2009 diagnosed with primary rrd . the following patients were excluded : previous vitreoretinal surgery , less than 3 months follow up , and presence of proliferative vitreoretinopathy ( pvr ) higher than grade b. patients with pathologic myopia or less than 50 years of age who were treated with a scleral buckling procedure with or without ppv were also excluded from this study . data points collected included age , sex , ocular history , pre - operative visual acuity ( va ) , lens status , presence of lattice degeneration , location of break ( s ) , extent of retinal detachment , macula status , presence or absence of vitreous hemorrhage ( vh ) , final best corrected visual acuity ( bcva ) , final anatomic status of retina , and total number of procedures to reattach the retina . snellen va measurements were converted and evaluated in their logarithm of the minimum angle of resolution equivalent . the mann - whitney test was performed to compare independent groups with respect to non - categorical variables . fisher 's exact test was used if the expected frequencies were too small to permit use of the chi square test . a 0.05 significance level was used for all statistical tests and no one - sided tests were done . after written informed consent was obtained , the patient underwent the procedure either under retrobulbar anesthesia with monitored anesthesia care or general anesthesia by one surgeon . three - port 20-gauge ppv was performed using a wide - angle viewing system ( biom , insight instruments , stuart , fl ) with a carl zeiss meditec ( jena , germany ) microscope and the accurus surgical system ( alcon laboratories , inc . , the chandelier lights ( placed inferotemporally ) used for all cases were either the 27-gauge dual chandelier ( dutch ophthalmic usa , exter , new hampshire ) or 25-gauge single chandelier ( synergetics inc , st charles , missouri ) . after the core vitrectomy was performed , the surgeon confirmed that the posterior vitreous was detached . if not , the posterior vitreous was detached with a vitreous cutter . the mid - peripheral vitreous was then removed , followed by a thorough shaving of the peripheral vitreous with surgeon - assisted scleral depression . to achieve this , one sclerotomy is plugged , allowing the surgeon to use his free hand to scleral depress with illumination provided by the chandelier light . during the scleral depression , the intraocular pressure ( iop ) may be lowered to 10 - 20 mmhg ( based on scleral rigidity ) to make the scleral indentation easier . high cut rate and low suction avoids the softening of the eye . in phakic patients , the shaft of the vitreous cutter was held parallel to the surface of the retina to avoid touching the lens . after vitreous shaving , the peripheral retina was examined with scleral depression to localize the retinal breaks . the retina was flattened either with perflurocarbon liquid ( pfo ) ( perfluoron ; alcon laboratories , inc . ) or air ( 77% received pfo ) . endolaser treatment was applied with a curved , lighted laser probe from alcon or lumenis ( santa clara , ca ) . laser was applied to all retinal breaks with an additional three to four rows applied posterior to the ora serrata for 360 degrees , with surgeon - assisted scleral depression ( avoiding the 3 oclock and 9 oclock positions , if possible ) . patients were requested to maintain face - down positioning for one week post operatively independent of the location of the break . after written informed consent was obtained , the patient underwent the procedure either under retrobulbar anesthesia with monitored anesthesia care or general anesthesia by one surgeon . three - port 20-gauge ppv was performed using a wide - angle viewing system ( biom , insight instruments , stuart , fl ) with a carl zeiss meditec ( jena , germany ) microscope and the accurus surgical system ( alcon laboratories , inc . , the chandelier lights ( placed inferotemporally ) used for all cases were either the 27-gauge dual chandelier ( dutch ophthalmic usa , exter , new hampshire ) or 25-gauge single chandelier ( synergetics inc , st charles , missouri ) . after the core vitrectomy was performed , the surgeon confirmed that the posterior vitreous was detached . if not , the posterior vitreous was detached with a vitreous cutter . the mid - peripheral vitreous was then removed , followed by a thorough shaving of the peripheral vitreous with surgeon - assisted scleral depression . to achieve this , one sclerotomy is plugged , allowing the surgeon to use his free hand to scleral depress with illumination provided by the chandelier light . during the scleral depression , the intraocular pressure ( iop ) may be lowered to 10 - 20 mmhg ( based on scleral rigidity ) to make the scleral indentation easier . high cut rate and low suction avoids the softening of the eye . in phakic patients , the shaft of the vitreous cutter was held parallel to the surface of the retina to avoid touching the lens . after vitreous shaving , the peripheral retina was examined with scleral depression to localize the retinal breaks . the retina was flattened either with perflurocarbon liquid ( pfo ) ( perfluoron ; alcon laboratories , inc . ) or air ( 77% received pfo ) . endolaser treatment was applied with a curved , lighted laser probe from alcon or lumenis ( santa clara , ca ) . laser was applied to all retinal breaks with an additional three to four rows applied posterior to the ora serrata for 360 degrees , with surgeon - assisted scleral depression ( avoiding the 3 oclock and 9 oclock positions , if possible ) . patients were requested to maintain face - down positioning for one week post operatively independent of the location of the break . one hundred and thirty eyes of 130 patients were diagnosed with primary rrd without a history of previous retinal surgery or pvr higher than grade b from september 2006 to august 2009 . twenty - two eyes underwent a scleral buckling procedure with or without ppv ( all eyes were anatomically attached after one procedure at last follow up visit ) . nine eyes underwent laser demarcation as primary treatment for asymptomatic shallow rrds ( all eyes were successfully treated with one procedure at last follow up visit . five eyes underwent pneumatic retinopexy as primary treatment with 3 eyes being anatomically reattached at their last follow - up visit . a total of 94 eyes underwent ppv with surgeon assisted scleral depressed vitreous shaving , 360 degree peripheral endolaser , and 14% c3f8 gas . three eyes were excluded as a result of insufficient follow - up , with all 3 anatomically attached after one procedure at last follow - up visit . the mean age was 60.1 11.3 years ( range , 35 - 93 years ) . the mean follow - up was 13.7 9.2 months and a median of 12 months ( range , 3 - 34 months ) . there were 56% male ( 51 males ) and 44% female ( 40 females ) patients . out of 91 , 65% ( 59 eyes ) were phakic , 35% ( 32 eyes ) were pseudophakic , and 7% ( 6 eyes ) had undergone prior laser in situ keratomileusis surgery . the mean extent of the rrd was 7.3 clock hours ( range , 1.5 - 12 clock hours ) . the mean number of retinal breaks was 2.2 ( range , 1 - 9 breaks ) . among the 91 eyes , 16% ( 15 eyes ) had vitreous hemorrhage ; 62% ( 56 eyes ) had breaks located superiorly ( from 10 - 2 oclock ) ; 20% ( 18 eyes ) had breaks located nasally or temporally ( between 2 - 4 oclock or 8 - 10 oclock ) ; 18% ( 17 eyes ) had breaks located inferiorly ( from 4 - 8 oclock ) ; 36% ( 33 eyes ) had macula - on rrds with the average time from loss of vision to presentation was 9 days ( range , 1 - 60 days ) ; and 64% ( 58 eyes ) had macula - off rrds with the average duration of macula - off status ( from loss of va based on patient history until time of presentation ) was 13 days ( range , 1 - 150 days ) [ table 2 ] . retinal detachment characteristics the single surgical re - attachment rate was 95% ( 86/91 ) . this was defined as anatomically flat retina ( no subretinal fluid after a minimum of 3 months of follow up ) without the need for additional procedures ( laser , cryotherapy , or additional surgery ) . the single surgical re - attachment rate in phakic eyes was 93% ( 55/59 ) and in pseudophakic eyes was 97% ( 31/32 ) ( p = 0.442 ) . the single surgical re - attachment rate was 100% ( 56/56 ) for eyes with superior breaks , 89% ( 16/18 ) for eyes with nasal or temporal breaks , and 82% ( 14/17 ) for eyes with inferior breaks . the location of the break did not have any significant impact on the successful re - attachment of the retina ( p = 0.629 ) . the single surgical re - attachment rate was 94% ( 31/33 ) for macula - on rrds and 93% ( 55/59 ) for macula - off rrds ( p = 0.621 ) [ table 3 ] . percentage of anatomic success with a single procedure the mean pre - operative va was 20/300 ( range , 20/20-hand movements , hm ) while the mean final bcva was 20/40 ( range , 20/20 - 5/200 ) . the mean pre - operative va in macula - on rrds was 20/50 ( range , 20/20-hm ; vision was hm in those eyes with vitreous hemorrhage but were still macula - on rrds ) while the mean final bcva was 20/30 ( range , 20/20 - 5/200 ) . the mean pre - operative va in macula - off rrds was 5/200 ( range , 20/70-hm ) while the mean final bcva was 20/40 ( range , 20/20-hm ) . of the 91 eyes , 82% ( 75/91 ) achieved mean final bcva 20/60 and 75% ( 68/91 ) achieved mean final bcva 20/40 . in the macula - on rrd eyes , 97% ( 32/33 ) and 91% ( 30/33 ) achieved mean final bcva 20/60 and 20/40 , respectively . in the macula - off rrd eyes , 74% ( 43/59 ) and 66% ( 38/59 ) achieved mean final bcva 20/60 and 20/40 , respectively . in this study , 5.5% ( 5/91 ) of the eyes two eyes developed pvr grade c or higher and 3 eyes developed new rrds secondary to new retinal breaks ( posterior to laser ) . all eyes were anatomically flat after second retinal reattachment surgery at last follow - up visit . the average number of surgical procedures to reattach the rrd in our study was 1.05 . of the 91 eyes , 3.2% ( 3 eyes ) eyes had subsequent ppv for other retinal pathology . two eyes had ppv for epiretinal membrane ( erm ) ( each 4 months after initial ppv for rrd ) , and 1 eye had ppv for macular hole ( mh ) 16 months after initial ppv for rrd . all 59 phakic eyes had progression of cataract during follow up ; 66% ( 39/59 ) had uncomplicated cataract extraction as of last follow - up visit . one hundred and thirty eyes of 130 patients were diagnosed with primary rrd without a history of previous retinal surgery or pvr higher than grade b from september 2006 to august 2009 . twenty - two eyes underwent a scleral buckling procedure with or without ppv ( all eyes were anatomically attached after one procedure at last follow up visit ) . nine eyes underwent laser demarcation as primary treatment for asymptomatic shallow rrds ( all eyes were successfully treated with one procedure at last follow up visit . five eyes underwent pneumatic retinopexy as primary treatment with 3 eyes being anatomically reattached at their last follow - up visit . a total of 94 eyes underwent ppv with surgeon assisted scleral depressed vitreous shaving , 360 degree peripheral endolaser , and 14% c3f8 gas . three eyes were excluded as a result of insufficient follow - up , with all 3 anatomically attached after one procedure at last follow - up visit . the mean age was 60.1 11.3 years ( range , 35 - 93 years ) . the mean follow - up was 13.7 9.2 months and a median of 12 months ( range , 3 - 34 months ) . there were 56% male ( 51 males ) and 44% female ( 40 females ) patients . out of 91 , 65% ( 59 eyes ) were phakic , 35% ( 32 eyes ) were pseudophakic , and 7% ( 6 eyes ) had undergone prior laser in situ keratomileusis surgery . the mean extent of the rrd was 7.3 clock hours ( range , 1.5 - 12 clock hours ) . the mean number of retinal breaks was 2.2 ( range , 1 - 9 breaks ) . among the 91 eyes , 16% ( 15 eyes ) had vitreous hemorrhage ; 62% ( 56 eyes ) had breaks located superiorly ( from 10 - 2 oclock ) ; 20% ( 18 eyes ) had breaks located nasally or temporally ( between 2 - 4 oclock or 8 - 10 oclock ) ; 18% ( 17 eyes ) had breaks located inferiorly ( from 4 - 8 oclock ) ; 36% ( 33 eyes ) had macula - on rrds with the average time from loss of vision to presentation was 9 days ( range , 1 - 60 days ) ; and 64% ( 58 eyes ) had macula - off rrds with the average duration of macula - off status ( from loss of va based on patient history until time of presentation ) was 13 days ( range , 1 - 150 days ) [ table 2 ] . this was defined as anatomically flat retina ( no subretinal fluid after a minimum of 3 months of follow up ) without the need for additional procedures ( laser , cryotherapy , or additional surgery ) . the single surgical re - attachment rate in phakic eyes was 93% ( 55/59 ) and in pseudophakic eyes was 97% ( 31/32 ) ( p = 0.442 ) . the single surgical re - attachment rate was 100% ( 56/56 ) for eyes with superior breaks , 89% ( 16/18 ) for eyes with nasal or temporal breaks , and 82% ( 14/17 ) for eyes with inferior breaks . the location of the break did not have any significant impact on the successful re - attachment of the retina ( p = 0.629 ) . the single surgical re - attachment rate was 94% ( 31/33 ) for macula - on rrds and 93% ( 55/59 ) for macula - off rrds ( p = 0.621 ) [ table 3 ] . percentage of anatomic success with a single procedure the mean pre - operative va was 20/300 ( range , 20/20-hand movements , hm ) while the mean final bcva was 20/40 ( range , 20/20 - 5/200 ) . the mean pre - operative va in macula - on rrds was 20/50 ( range , 20/20-hm ; vision was hm in those eyes with vitreous hemorrhage but were still macula - on rrds ) while the mean final bcva was 20/30 ( range , 20/20 - 5/200 ) . the mean pre - operative va in macula - off rrds was 5/200 ( range , 20/70-hm ) while the mean final bcva was 20/40 ( range , 20/20-hm ) . of the 91 eyes , 82% ( 75/91 ) achieved mean final bcva 20/60 and 75% ( 68/91 ) achieved mean final bcva 20/40 . in the macula - on rrd eyes , 97% ( 32/33 ) and 91% ( 30/33 ) achieved mean final bcva 20/60 and 20/40 , respectively . in the macula - off rrd eyes , 74% ( 43/59 ) and 66% ( 38/59 ) achieved mean final bcva 20/60 and 20/40 , respectively . in this study , 5.5% ( 5/91 ) of the eyes required additional retinal re - attachment surgery . two eyes developed pvr grade c or higher and 3 eyes developed new rrds secondary to new retinal breaks ( posterior to laser ) . all eyes were anatomically flat after second retinal reattachment surgery at last follow - up visit . the average number of surgical procedures to reattach the rrd in our study was 1.05 . of the 91 eyes , 3.2% ( 3 eyes ) eyes had subsequent ppv for other retinal pathology . two eyes had ppv for epiretinal membrane ( erm ) ( each 4 months after initial ppv for rrd ) , and 1 eye had ppv for macular hole ( mh ) 16 months after initial ppv for rrd . all 59 phakic eyes had progression of cataract during follow up ; 66% ( 39/59 ) had uncomplicated cataract extraction as of last follow - up visit . the importance of vitreous base shaving for the repair of pseudophakic rrds and rrds with pvr has been documented previously . the development of new technologies allows the surgeon to gain excellent access to the vitreous base . chandelier lighting provides superior illumination of the peripheral retina , alleviating the need for endoilluminator . the chandelier light allows direct visualization of the vitreous base while the vitreous farther away can be identified with retroillumination . the chandelier permits the surgeon to use his other hand for controlled scleral depression , making him independent from support staff ( in both phakic and pseudophakic eyes ) . to avoid touching the lens in phakic eyes , we did not perform vitrectomy anterior to the ora serrata . a temporary reduction of intraocular pressure also helped anterior scleral indentation by reducing counter pressure . in these cases , a high cut rate and low suction with gentle movement of scleral depressor prevented softening of the eye . meticulous shaving of the peripheral vitreous may reduce the risk for the formation of new retinal breaks post - operatively , since it has been thought that post - operative breaks are caused by vitreous base traction . peripheral vitreous shaving theoretically reduces the vitreous scaffold needed for anterior pvr formation as described by cowley et al . when they demonstrated the use of ppv for rrd was the single strongest predictor of pvr . veckeneer and wong demonstrated the benefit of vitreous base shaving using transscleral , diaphonoscopic illumination in eyes with rrds . their modified light source ( lightindentor ) allowed transscleral illumination of the vitreous base , allowing for controlled vitreous base removal . martinez - castillo et al . also found that meticulous peripheral vitreous dissection ( n = 61 ) leads to high re - attachment rate in phakic , pseudophakic , and aphakic rrds with unseen breaks ( 98% ) . in the current study , 2 eyes developed pvr leading to re - detachment and 3 eyes developed new breaks leading to re - detachment . peripheral vitreous shaving may play a role in increasing the single surgical success rate for ppv for rrd . another step in reducing the rate of post - operative complications ( new retinal breaks and recurrent rrds ) is the placement of 360 degree peripheral retinopexy which effectively produces a second ora serrata . a curved , lighted endolaser probe allows treatment near the ora serrata in both phakic and pseudophakic patients . the 360 degree laser has been shown to be successful in a variety of conditions , including ppv , for retained lens fragments and after removal of silicone oil . koh et al . showed that intraoperative 360 degree retinopexy was associated with a three - fold reduction in the incidence of rrd after ppv . and mittra suggested that the development of pvr and erm is a disadvantage of ppv for rrd . of the 91 patients , 3.2% ( 3/91 ) of the patients in study underwent a second ppv for repair of either erm ( n = 2 ) or mh ( n = 1 ) . reported that 12.8% of eyes ( n = 141 ) undergoing ppv ( all patients underwent standard three - port ppv , posterior vitreous detachment with laser or cryotherapy for retinopexy , internal drainage of subretinal fluid , air fluid exchange , and placement of an intraocular gas tamponade ) for rrd develop post - operative erm , and 4.2% underwent second ppv with membrane peeling for erm . the rate of erm formation requiring ppv and membrane peeling in our study ( 3.2% ) was similar to katira et al . yoon and marmor reported that it takes 24 hours to 3 days to achieve chorioretinal adhesion following laser photocoagulation . during this time , the subretinal fluid can re - detach the retina . to avoid retinal re - detachment by formation of new inferior breaks , all patients in this study received 14% c3f8 gas and positioned face down for one week post - operatively . this theoretically would tamponade the inferior retina during while chorioretinal adhesions are forming from the endolaser treatment . the use of c3f8 , however , is associated with increased risk of cataract progression , angle closure glaucoma , transient increased intraocular pressure , and fibrinous pupillary membranes . thirty - nine of the 59 eyes ( 66% ) , who were phakic at initial visit , had uncomplicated cataract extraction by the last follow up visit . this is comparable to previous reports where 5358% of phakic patients undergoing ppv for rrd had cataract surgery at their last follow up . the major drawbacks for utilizing c3f8 gas were progression of cataract and delay of air travel . in this study , surgeon - assisted vitreous shaving , 360 endolaser , and c3f8 gas yielded an overall 95% ( 86/91 ) single surgical success rate . in literature , ppv for primary rrd has a single surgical re - attachment rate of 70 - 98% . the single surgical re - attachment rate in our study was 97% ( 31/32 ) of pseudophakic eyes , 93% ( 55/59 ) of phakic eyes , 82% ( 14/17 ) of eyes with inferior breaks , 89% ( 16/18 ) of eyes with nasal or temporal breaks , 100% ( 56/56 ) of eyes with superior breaks , 93% ( 55/59 ) of macula - off rrds , and 94% ( 31/33 ) of macula - on rrds . although we did not find a statistically significant difference between the superior , nasal / temporal , or inferior rrds ( p = 0.629 ) , the study 's small sample size of rrds with inferior breaks ( n = 17 ) does not give the study enough power to fully understand the difference in outcome . ppv alone for rrds in phakic eyes has been shown to have a single surgical re - attachment rate of 63.8% to 92% . miki et al . showed a 92% success rate ( n = 87 ) for phakic superior rrds with flap tears . our results for rrds in phakic eyes ( 93% ) were higher than these numbers . the anatomical success of ppv for phakic rrds in our study may be explained by the extensive peripheral vitreous shaving , 360 degree retinopexy , and use of c3f8 to help reduce the risk of post - operative breaks and recurrent rrd ( with or without pvr ) . visual rehabilitation following rrd , particularly with macula - off rrds , can be limited . the difficulty in visual recovery depends on outer retinal changes in the detached retina . in this study , the mean pre - operative va in macula - off eyes was 5/200 ( range , 20/70-hm ) while the mean final bcva in macula - off eyes was 20/40 ( range , 20/20-hm ) . ross and kozy reported 59% of macula - off rrds regain 20/50 or better va while speicher et al . found the mean final bcva in macula - off eyes to be 20/73 . in this study , 66% of the macula - off eyes achieved mean final bcva of better than 20/40 ( mean final bcva 20/40 ) . our results are consistent with previous findings that although eyes with macula - off rrds have poorer visual outcome than eyes with macula - on rrds , the majority ( 66% ) achieve visual rehabilitation to 20/40 or better . the primary limitations of this technique are cataract progression and delay in air travel . in conclusion , ppv with surgeon assisted scleral depression , 360 degree peripheral endolaser , and c3f8 gas leads to successful anatomic outcome and functional improvement in phakic , pseudophakic , inferior , superior , macula - on , and macula - off primary rrds , as highlighted by chong and fuller . overall , 82% of eyes achieved mean final bcva 20/60 , and 75% achieved mean final bcva 20/40 .

purpose : to review the characteristics and outcomes of patients who underwent pars plana vitrectomy ( ppv ) with scleral depressed vitreous shaving , 360 degree peripheral endolaser , and 14% c3f8 gas for rhegmatogenous retinal detachment ( rrd).materials and methods : a retrospective review of a consecutive series of patients who underwent primary repair of rrd by ppv with scleral depressed vitreous shaving , 360 degree peripheral endolaser , and 14% perfluoropropane ( c3f8 ) was conducted . patients with less than 3 months follow - up , previous retinal surgery , and higher than grade b proliferative vitreoretinopathy were excluded.results:ninety-one eyes were included in the study . the mean age was 60.1 years . the mean follow - up was 13.7 months . the macula was detached in 63% ( 58/91 ) of the eyes . the reattachment rate after one surgical procedure was 95% ( 86/91 ) while overall reattachment rate was 100% . there was no statistically significant difference between reattachment rates of superior , nasal / temporal , or inferior rrds . the mean final best corrected visual acuity ( bcva ) was 20/40 . of all the patients , 66% of patients with macula - off rrds had a final bcva of 20/40 or better.conclusions:ppv with scleral depressed vitreous shaving , 360 degree peripheral endolaser , and 14% c3f8 leads to successful anatomical reattachment with visual improvement in patients with primary rrd .

despite the rapidity with which genomic science has enabled the identification of genes essential to bacterial homeostasis , the translation of these targets into pharmacological agents has proven to be much more difficult than anticipated . post - translational modification ( ptm ) pathways represent a unique subset of these targets since such events are scarce in prokaryotes relative to their frequency of occurrence in eukaryotes . in metabolism , bacterial ptms involve the attachment of prostheses that impart a chemical functionality distinct from that of the 20 proteogenic amino acids . thus , effector enzyme function is wholly dependent upon the installation of these groups . one such ptm is performed by 4-phosphopantetheinyl transferase ( pptase ) enzymes ( figure 1a ) , which install 4-phosphopantetheinyl ( 4-pp ) arms to carrier protein domains of synthase enzymes ( figure 1b ) . this functionality serves to store and channel reactive intermediates that would otherwise be lost to the cellular milieu by diffusion . ( a ) bacteria utilize synthase enzymatic pathways to assemble small carboxylic and amino acid monomers into complex polymeric molecules , including membrane components , virulence factors , and medicinally important compounds . a key feature of these synthases is the presence of a post - translational appendage to which the nascent polymer is tethered during extension and elaboration ; the attachment of this appendage is catalyzed by pptase enzymes . ( b ) pptase enzymes utilize coa as a 4-phosphopantetheinyl group donor and install the functionality to conserved serine residues within apo - cp domains of synthase enzymes , generating biochemically active holo - cp - containing synthases and the nucleotide pap as products . pptase = phosphopantetheinyl transferase , cp = carrier protein , and pap = 3-phosphoadenosine 5-monophosphate . pathways activated by pptases include microbial fatty acid synthase ( fas ) , a multidomain enzyme complex that has received considerable attention for both its orthogonal structural characteristics relative to the mammalian fas system and its novelty as a drug target . reduction in fas anabolic capacity is anticipated to exert pleotropic effects on cell viability by inhibiting the production of the primary membrane component palmitate and halting the assembly of virulence - determining components of the gram - negative , gram - positive , and mycobacterial cell walls ( lipid a , lipoteichoic acid , and mycolic acids , respectively ) . furthermore , fas as a drug target has been validated in vivo with chemical probes that act upon -ketoacyl - acp synthase . additionally , bacterial secondary metabolism contains polyketide and nonribosomal synthases which require 4-pp groups from pptases to produce metabolites needed for bacteria to thrive in environmental and infection settings . representative compounds from these pathways include siderophores that are secreted to scavenge iron and the phenolic glycolipids of mycobacterium spp . in many cases , the capacity to manufacture these compounds has been linked to virulence , and disruption of synthase genes precludes the establishment of infection . these avirulent phenotypes have been recapitulated in vitro with chemical probes that target synthase enzymes . since pptase enzymes represent the gatekeeper of these pathways , their inhibition stands to attenuate bacterial cell viability through direct inactivation of fas . at the same time , the concomitant disruption of secondary metabolism offers a path to mitigate numerous aspects of pathogenicity . these hypotheses have been confirmed at the genetic level , where disruption of pptase genes has been observed as either lethal or severely compromising to the fitness of both escherichia coli(14)and mycobacterium tuberculosis . thus , pptase represents an important enzyme in bacterial metabolism and is well - deserving of further study . it is noteworthy that , in most cases , bacterial genomes contain two structurally distinct pptase enzymes , the acps- and sfp - pptases . enzymes of the former class are typically responsible for activating fas , while enzymes of the latter type modify secondary metabolism synthases . given these associations and the above - mentioned therapeutic potential of targeting pptases , there have been several reports by academic and industrial researchers describing the development of small - molecule acps - pptase inhibitors , yet no reports of agents targeting sfp - pptase ( see figure 2 ) . chu and co - workers isolated sch-538415 ( figure 2 ) , a symmetrical and highly planar compound , from an unidentified bacterial extract and reported it to have moderate inhibitory activity toward acps . prior to the initiation of our current program , we had found that analogues of anthranilic acid - based leads originating from a wyeth research program targeting acps - pptase ( e.g. , ucsd-18ae , figure 2 ) possessed no activity toward sfp - pptase and had overall weak activity . an additional publication from wyeth research came out shortly thereafter detailing further medicinal chemistry efforts leading to wyeth-16 ( figure 2 ) , which was optimized for potency toward acps - pptase ( ic50 = 1.4 m ) but had limited antimicrobial activity . on the basis of the limited antibacterial activity observed for these acps - pptase - specific compounds , we have put forth a hypothesis that the presence of an sfp - pptase in the bacterial genome provides an inborn mechanism of resistance . therefore , it is our presumption that a viable antibacterial agent must simultaneously target both classes of pptase enzymes to effectively halt bacterial proliferation . previously reported inhibitors of sfp- and acps - pptase . toward this end , we developed a strategy to search for small - molecule inhibitors of sfp - pptase . these efforts identified sch-202676 as the first compound reported to have activity against sfp - pptase ( figure 2 ) . however , compounds belonging to this class are known covalent modifiers and possess promiscuous activity ( 20% hit rate in pubchem assays ) , which ultimately limits their utility as probe compounds . therefore , we conducted a high - throughput screen ( hts ) in search of additional small - molecule inhibitors of sfp - pptase . herein we describe the discovery and sar investigation of the 2-pyridinyl - n-(4-aryl)piperazine-1-carbothioamides as best in class small - molecule inhibitors of sfp - pptase . this work led to the development of ml267 ( 55 ) , a new chemical probe and potent inhibitor of this bacterial enzyme . we demonstrate that 55 possesses the required selectivity , mechanism of action , physicochemical properties , and cellular activities to interrogate the role of pptases in bacterial metabolism , and we utilize this compound to test hypotheses about the importance of pptase to the function of whole bacterial cells . as shown in scheme 1 , compound 1 was readily synthesized by 1,1-thiocarbonyldiimidazole - assisted coupling of commercially available 4-methylpyridin-2-amine and 1-(3-(trifluoromethyl)phenyl)piperazine at 40 c . the same procedure was utilized to generate a small library of compounds ( table 1 ) around the 4-methylpyridine region using differentially substituted pyridylamines , 3-toluidine , and other heterocycles ( in table 1 , analogues 111 and 1921 ) . reagents and conditions : ( a ) 1,1-thiocarbonyldiimidazole ( tcdi ) , ch2cl2 , 40 c , 1 h. ic50 values represent the half - maximal ( 50% ) inhibitory concentration as determined in the hts assay , and the experiment was performed in triplicate . the term inactive refers to compounds with ic50 114 m . through bioisosteric replacement of the thiourea , analogues 1217 were synthesized utilizing known protocols reported for similar compounds in the literature as shown in scheme 2 ( see the supporting information for details ) . phenoxycarbonyl chloride - assisted coupling of 1-(3-(trifluoromethyl)phenyl)piperazine with 4-picolin-2-amine afforded the urea analogue 12 . analogue 13 was prepared by stirring the analogue 1 with ammonium hydroxide and sodium periodate at 80 c in a dmf compounds 14 and 15 , which represent the bioisosteric replacement of the thiourea functionality , were prepared by refluxing 1-(3-(trifluoromethyl)phenyl)piperazine and 4-picolin-2-amine with diphenyl n - cyanocarbonimidate ( for 14 ) or 2-[bis(methylthio)methylene]malononitrile ( for 15 ) in acetonitrile . the thiadiazole derivative 16 was prepared utilizing xanthphos - catalyzed amination of the 2-bromo-5-(4-(3-(trifluoromethyl)phenyl)piperazin-1-yl)-1,3,4-thiadiazole in the presence of pd2(dba)3 and cesium carbonate . the kindler reaction of 2-acetyl-4-picoline and 2-formyl-4-picoline with 1-(3-(trifluoromethyl)phenyl)piperazine under microwave ( mw ) conditions furnished analogues 17 and 18 , respectively . reagents and conditions : ( a ) phococl , dipea , dmap , 0 c to rt , 3 h ; ( b ) nh4oh , naio4 , dmf h2o , 80 c , 1 h ; ( c ) acetonitrile , reflux , 16 h ; ( d ) acetonitrile , 70 c , 24 h ; ( e ) xantphos , pd2(dba)3t - buona , toluene , 110 c , 3 h ; ( f ) s , dmf , mw , 130 c , 0.5 h. to explore the sar around the 3-trifluorophenyl region as shown in table 2 , a robust synthetic method was required to generate a library of arylpiperazine precursors , since many of the targeted compounds were not commercially available . given the large number of available boronic acids , we found the chan - lam reaction to be an ideal method to generate several mono- and disubstituted arylpiperazine precursors for preparation of analogues 27 , 28 , 36 , and 40 . however , the use of a large excess of copper or a constant supply of oxygen gas is necessary to regenerate the copper(ii ) catalyst , making this method less compatible with parallel library synthesis . to overcome this drawback , we used a modified version of the chan - lam reaction reported by quach et al . which requires only 10 mol % copper(ii ) acetate but still uses an oxygen atmosphere . to facilitate analogue synthesis , we further modified this method by carrying out this reaction in a sealable microwave vial . in this case , all the reactants were mixed together , the vessel was charged with oxygen gas , and then the vessel contents were stirred at 45 c for 1224 h as shown in scheme 3a . several mono- and disubstituted arylpiperazines were prepared using this method followed by boc deprotection with trifluoroacetic acid in dichloromethane . ic50 values represent the half - maximal ( 50% ) inhibitory concentration as determined in the hts assay , and the experiment was performed in triplicate . reagents and conditions : ( a ) cu(oac)2 ( 10 mol % ) , 4 molecular sieves , o2 , ch2cl2 , 45 c , 1224 h ; ( b ) tfa / ch2cl2 , rt , 1 h ; ( c ) binap ( 10 mol % ) , pd(oac)2 ( 5 mol % ) , cs2co3 ( 1.5 equiv ) , toluene , 110 c , 1224 h ; ( d ) johnphos ( 10 mol % ) , pd2(dba)3 ( 5 mol % ) , t - buona ( 1.5 equiv ) , toluene , 110 c , 28 h ; ( e ) binol ( 20 mol % ) , cubr ( 20 mol % ) , k3po4 ( 2 equiv ) , dmf , rt , 1224 h ; ( f ) 1,1-thiocarbonyldiimidazole ( tcdi ) , ch2cl2 , 40 c ; ( g ) dmf , 90 c , 1 h. despite these encouraging results , this method was insufficient for use with several di- and trisubstituted aryl and heterocyclic boronic acids . amination of the requisite aryl or heteroaryl bromides was achieved using binap or johnphos ligands in combination with pd(oac)2 or pd2(dba)3 with sodium tert - butoxide or cesium carbonate in toluene . the arylation of boc - piperazine with aryl iodides was accomplished using a binol / cubr catalytic system in the presence of potassium phosphate in dmf at room temperature ( scheme 3b ) . subsequent boc deprotection with trifluoroacetic acid ( tfa ) in dichloromethane gave the desired free piperazinamines ( see the supporting information for details ) . as shown in scheme 3c , the commercially available arylpiperazines and compounds obtained from the above methods were treated with various 4,6-substituted pyridin-2-amines in the presence of 1,1-thiocarbonyldiimidazole to furnish analogues 2256 ( table 2 ) . to explore the sar of the piperazine core itself , analogues 5967 were synthesized using 1,1-thiocarbonyldiimidazole - assisted thiourea synthesis ( table 3 ) . the acyclic analogues 57 and 58 were prepared by condensation of the 4-picoline-2-isothiocyanate with corresponding acyclic amines as shown in scheme 3d . ic50 values represent the half - maximal ( 50% ) inhibitory concentration as determined in the hts assay , and the experiment was performed in triplicate . specifically , the synthesis of analogues 5963 , 65 , and 67 was accomplished by arylation of the requisite boc - protected amine cores with 3-trifluorophenyl iodide utilizing the 2-isobutyrylcyclohexanone / cui system ( scheme 4 ) , followed by 1,1-thiocarbonyldiimidazole - assisted coupling with 4-methylpyridin-2-amine . analogues 64 and 66 were synthesized utilizing the general procedure outlined in scheme 3 using commercially available precursors 6-(trifluoromethyl)-1,2,3,4-tetrahydroisoquinoline and 4-(3-(trifluoromethyl)phenyl)piperidine , respectively . reagents and conditions : ( a ) 2-isobutyrylcyclohexanone , cs2co3 , cui , dmf , 70 c , 210 h ; ( b ) tfa , dcm , rt , 1 h ; ( c ) 1,1-thiocarbonyldiimidazole ( tcdi ) , ch2cl2 , 40 c . we profiled the molecular libraries small molecule repository ( at the time totaling 311 260 compounds ) for pptase inhibitors with a previously described activity assay for sfp - pptase . the highly miniaturized format enabled the experiment to be conducted at eight concentrations ranging from 3.6 nm to 114 m following the quantitative hts methodology . data generated by this experiment are deposited in the public database pubchem under assay identifier number ( aid ) 1490 . data analysis and chemoinformatic filtering identified 388 structurally diverse compounds that were selected for follow - up in a battery of assays . this characterization began with retest of freshly prepared serial dilutions of hit compounds in the sfp - pptase screening assay ( aid 2701 ) and included further activity profiling with acps - pptase ( aid 602360 ) . in addition , this set of compounds was evaluated with sfp - pptase in a gel - based phosphopantetheinylation assay to confirm biochemical inhibition with an orthogonal detection format ( aid 2707 ) . finally , since prior work has established the essential nature of pptases to bacterial viability , we profiled these compounds for antibacterial activity with bacillus subtilis hm489 , whose viability depends solely on sfp ( aid 602366 ) . the sum of these experiments identified 1 ( figure s1a , supporting information ) as a confirmed screening hit with inhibitory activity against both acps- and sfp - pptases ( figure s1b ) and modest antibacterial activity against b. subtilis . we subsequently confirmed the identity and integrity of the chemical matter by resynthesis and reaffirmed the above findings for the resynthesized sample . to further characterize the biochemical activity of 1 , we first addressed the use of fluorescent substrates in our primary and confirmatory assays . as recently highlighted , the potential exists that the observed inhibition could be a result of compound , we developed and implemented a label - free biochemical assay that assessed pptase activity on the basis of differences in the electrophoretic mobility of the apo and holo states of the carrier protein under native page conditions . these experiments revealed that 1 elicited inhibition through a mechanism independent of the fluorescent label , with a dose - dependent inhibition being observed in the presence of the natural coa and acyl carrier protein ( acp ) substrates ( figure s1e , f , supporting information ) . to better understand the mechanism through which 1 inhibits the target , we evaluated the effects that a varying substrate concentration had on potency . in these experiments , which utilized an hplc assay and operated under an initial - rates regimen , 1 exhibited a near constant ic50 of 300 nm when coa or apo - acp acceptor substrates were increased to concentrations 50- and 100-fold above their km values , respectively ( figure s1c , d , supporting information ) . this trend is consistent with a noncompetitive mechanism of inhibition and indicates that the compound binds to the free enzyme , enzyme substrate complex , or ternary complex with similar affinities at a location other than the active site : a form of allosteric modulation . finally , we probed the reversibility of inhibition with a rescue - by - dilution experiment that assessed the recovery of enzymatic activity after a large ( 100-fold ) dilution from conditions producing 90% inhibition of enzymatic activity . these experiments included control compounds pap and sch-202676 , the latter of which was discovered during assay optimization as an active compound from lopac . inhibition by the former proved to be reversible , as anticipated by the fact that it is one of the reaction products ( figure s2a , supporting information ) , while the latter was found be an irreversible inhibitor , a result that is consistent with other reports of the compound s reactivity ( figure s2b ) . parallel evaluation of our primary hit 1 ( figure s1 g , supporting information ) in the same manner revealed completely reversible inhibition of sfp , with enzymatic activity restored upon dilution of the enzyme1 solution in a compound - free buffer ( orange data symbols , figure s1 g ) , relative to a buffer containing a constant concentration of the compound ( green data symbols , figure s1 g ) . after confirming the activity of 1 , we planned systematic structural modifications to the various regions of the molecule in an effort to establish tractable sar . our first area of exploration was the western 2-aminopyridine moiety as shown in table 1 . removal of the 4-me group ( 2 ) resulted in only a slight drop in potency , whereas addition of electron - withdrawing groups such as 4-cf3 ( 4 ) and 4-c(o)ome ( 7 ) resulted in a significant loss of activity . moreover , removal of the pyridine nitrogen ( 5 ) or changing the position of the pyridine ( 6 ) also led to inactive compounds . thus , it appears that the pyridine nitrogen needs to be adjacent to the thiourea motif to maintain sfp - pptase inhibitory activity . conversely , modification with electron - donating groups , such as addition of an extra methyl group adjacent to the nitrogen ( 3 ) , 4-ome ( 8) , and other heterocycles ( 10 and 11 ) , led to compounds with activity comparable to that of 1 . with initial sar explorations of the western region of the molecule complete , we then focused our attention on the thiourea moiety . as shown in table 1 , replacement of the thiourea was not well tolerated with the urea ( 12 ) , guanidine ( 13 ) , and thiadiazole ( 16 ) all being inactive . attempts to replace the thiourea structural motif with bioisosteres such as cyanoguanidine ( 14 ) or a 1,1-dicyanoketene group ( 15 ) also led to complete loss of activity . methylation of the nitrogen ( 19 ) or changing the nitrogen from being a part of a ring to being exocyclic ( 20 ) resulted in loss of potency . interestingly , replacement of the 2-amino group with a methylene spacer ( 17 ) retained some activity toward sfp - pptase albeit much reduced , with an ic50 value of 5.8 m . as such , these data suggested that the thiourea moiety was clearly the most optimal group for the desired activity . however , the thiourea functionality is often considered an undesirable structural feature , primarily due to its potential in forming toxic metabolites via oxidation to the s - oxide or sulfinic acid ( typically p450 or fmo - catalyzed ) , followed by gsh - trapping . these covalent gsh adducts could ultimately lead to oxidative - stress - induced cell death . therefore , upon completion of the sar efforts , we planned to investigate the propensity of this undesired reaction to occur with our lead compound(s ) ( vide infra ) . given that the 4,6-dimethyl substitution in 3 displayed potency comparable to that of the 4-methylpyridine moiety of 1 , we decided to further investigate both pyridine derivatives when exploring the sar of the eastern phenyl region . in these efforts , a large number of analogues were synthesized , and representative compounds are shown in table 2 . overall , substitution of the pendant phenyl group was very well tolerated , with most of the analogues 2244 having comparable activity . the general trend suggested that electron - withdrawing groups are preferred , with most of these analogues exhibiting submicromolar potency . the analogues which showed the most potent activity included 29 ( r = 3,5-cf3 ) , 40 ( r = 3-cf3 - 4-cl ) , 41 ( r = 2-cf3 - 4-cl ) , and 43 ( r = 3,4,5-cl ) . in contrast , compounds in which electron - donating substituents were incorporated ( e.g. , 24 ( r = 3-nme2 ) and 34 ( r = 3,5-ome ) ) had weaker potency with ic50 values of 5.8 and 2.0 m , respectively . these data suggest that this region of the molecule may provide a handle for modulating the adme properties ( e.g. , solubility ) in future sar efforts given the general tolerance for structural modifications . with analogues 4556 ( table 2 ) , we aimed to investigate more significant structural changes to this region , including removal of the aryl group ( 45 ) or replacing it with smaller groups such as a methyl group ( 46 ) , and both changes significantly diminished the potency ( ic50 = 14.5 and 6.5 m respectively ) . addition of a methylene spacer between the aryl group and piperazine ( 48 ) was not well tolerated ( ic50 = 11.5 m ) . however , incorporation of a sulfonamide moiety ( 49 ) resulted in potency comparable to that of 1 . replacement of the aryl group with a thiadiazole ( 50 ) resulted in a 2-fold drop in potency . in an effort to improve the overall solubility of the molecule gratifyingly , this change was tolerated and led to the discovery of analogue 55 , which was ultimately determined to be our probe molecule ( ml267 ) after all compound attributes such as potency , in vitro adme properties , and antibacterial activity were taken into consideration ( vide infra ) . notably , compound 55 possesses a 4-ome group in contrast to the 4,6-dimethyl derivative , which led to a 23-fold improvement in potency ( ic50 = 0.81 m ( 54 ) vs ic50 = 0.29 m ( 55 ) ) but also contributed to improvement in other attributes mentioned above . we had synthesized and tested a small set of analogues containing the 4-methoxypyridine combined with the best arylpiperazines in the right - hand side of the molecule . these analogues showed similar or less potency compared to compound 55 and exhibited a consistent sar trend ( data not shown ) . our final area of sar exploration was modification of the piperazine linker , as shown in table 3 . a literature search uncovered troviridine [ 1-(5-bromopyridin-2-yl)-3-(2-(pyridin-2-yl)ethyl)thiourea ] ( also known as ly300045-hcl ) , a thiourea - containing small molecule that was originally developed by eli lilly as a non - nucleoside reverse transcriptase inhibitor but later was found to have antimicrobial properties . similar to our lead scaffold , troviridine contains a 2-aminopyridine attached to the thiourea moiety ; however , instead of a piperazine , it contains an acyclic linker . therefore , we replaced the piperazine core with two acyclic linkers ( 57 and 58 ) ; however , these compounds lost all activity . despite this , we were encouraged that a compound with a structure comparable to that of our lead had advanced into human trials . moreover , the inactivity of troviridine - like analogues 57 and 58 assured us that our compound has a divergent mechanisms of action , particularly in reference to the antimicrobial activity . additional sar explorations of the piperazine motif included varying the ring size to smaller , larger , and fused ring systems . the smaller rings showed similar activity ( 60 ) , whereas larger rings ( 67 ) or the substituted piperazine ( 62 ) had reduced potency . the fused pyrrolidine motif ( 65 ) had comparable potency ( ic50 = 0.73 m ) , but the solubility was markedly reduced . interestingly , when the nitrogen linked to thiourea is exocyclic ( e.g. , 59 ) , all activity is lost , whereas the piperazine nitrogen attached to an aryl ring is not essential ( e.g. , 66 , ic50 = 0.81 m ) . initial sar explorations around compound 1 led to a thorough understanding of the structural features that are required for activity . thus , we then sought to more thoroughly characterize the best sfp - pptase inhibitors for their activity against acps - pptase and antibacterial activity . additionally , we profiled this panel for activity with the human pptase , an important antitarget , and cytotoxicity with human hepg2 cells ( table 4 ) . as mentioned above , our primary target of interest was sfp - pptase , yet activity against acps - pptase is desirable for maximal antimicrobial activity . as shown in table 4 , most compounds display activity toward acps - pptase , but the ic50 values were generally 510-fold less potent . to assess acute cytotoxicity , we chose to profile the top compounds using hepg2 ( hepatocellular carcinoma ) cells since hepatotoxicity has been reported for some thiourea - containing compounds , and this profiling not only reveals potential toxicity of the parent compound , but also its metabolites . while this method is certainly not to be considered a thorough investigation of toxicity , it provided us a means to quickly profile numerous compounds . notably , despite the generally favorable activity of the original compound 1 , it demonstrated moderate toxicity toward this cell line , whereas most other compounds were inactive . finally , as part of our initial biological activity profile , we sought to further characterize the compounds for antibacterial activity using the b. subtilis hm489 strain . this strain contains sfp as the only locus encoding a functional pptase gene product , making the allele essential to viability of this organism . these experiments revealed that we had modest inhibitors of bacterial growth that generally tracked with sar in the biochemical assay . this important finding is exemplified by urea derivative 12 , which was inactive against sfp / acps - pptase and lacked activity in the antibacterial assays ( table 4 ) . while the antibacterial activity of these compounds was modest in these high - throughput assays , in subsequent antibacterial studies using more traditional methods of minimum inhibitory concentration ( mic ) determination , we found the compounds to be generally more potent ( vide infra ) . after careful analysis of the data in table 4 , and profiling of select compounds for their in vitro adme properties , 55 emerged as the compound with the best balance of properties . in these profiling studies , 55 demonstrated dual activity toward the bacterial sfp- and acps - pptase targets ( figure s4 , supporting information ) , presenting ic50 values of 290 nm and 8.1 m , respectively . furthermore , we profiled top compounds for activity with the human pptase , an important antitarget . while we observed inhibition of this enzyme with pap and sch202676 , 55 exhibited no inhibition at concentrations up to 125 m ( figure s4b , lower panel ) . comparison of these data to the inhibition observed in the same biochemical assay for sfp - pptase ( figure s4b , upper panel ) indicated the selectivity index , the ratio of inhibition observed for the bacterial target relative to the human enzyme , to be greater than 500-fold . sfp - pptase and acps - pptase ic50 values were determined using the hts assay . compound toxicity toward hepg2 cells was assessed by measuring the cellular atp content using a luciferase - coupled atp quantitation assay ( celltiter - glo , promega corp . , antibacterial activity against b. subtilis ( hm489 ) was accessed by measuring the cellular atp content using a luciferase - coupled atp quantitation assay ( bac - titer glo , promega corp . ) . to evaluate the antibacterial spectrum of activity possessed by 55 , we assembled a panel of microorganisms which included b. subtilis strains hm489 , 168 , and okb105 , which possess all possible pptase genotype combinations sfp / acps , sfp / acps , and sfp / acps , respectively , in a strain 168 isogenic background , as well as e. coli k12 and the laboratory strain bw25113 . with respect to human pathogens , the panel contained pseudomonas aeruginosa atcc9028 , a gram - negative organism of clinical importance , as well as three strains of methicillin - sensitive and community - acquired methicillin - resistant staphylococcus aureus ( atcc6538 , usa300 , and usa500 ) . finally , the panel also contained fluconazole - sensitive and -resistant strains of candida albicans as archetypical fungal pathogens ( atcc90028 and atcc96901 , respectively ) . compound 55 displayed a spectrum of activity that targets gram - positive organisms , where , in addition to inhibiting the growth of b. subtilis at a concentration of 1.7 g / ml , it also thwarted the growth of both methicillin - sensitive and -resistant strains of s. aureus in a similar concentration range [ figure 3 , where the growth indicator resazurin ( purple ) is reduced to resorufin ( pink ) by metabolically active microorganisms]. no growth inhibition was observed for the gram - negative organisms e. coli and p. aeruginosa , a result that was investigated further ( vide infra ) , or for fungal organisms . the finding of null activity with eukaryotic microbes was not discouraging , as total coverage of the panel would have been taken as nonspecific inhibition of growth and could be considered suspicious for an antibacterial candidate . broth dilution experiments were performed to assess the microbicidal activity of 55 with different organisms . in these experiments , growth is detected with the indicator resazurin , a purple dye which is reduced to the pink compound resorufin by metabolically active organisms . the antibacterial activity of 55 was restricted to gram - positive organisms , represented here by strains of b. subtilis and s. aureus , with no growth inhibition observed for gram - negative bacteria or fungi . we followed up on this finding with a study of bacterial cell membrane integrity , as gram - positive whole - cell experiments can be convoluted by nonspecific damage to the lipid bilayer . we employed the differential nucleic acid staining of b. subtilis 168 bacterial cells by syto9 and propidium iodide in the baclight live / dead microscopy assay , which utilizes green and red staining to differentiate healthy and compromised cells , respectively . chloramphenicol ( cam ) and cetyltrimethylammonium bromide ( ctab ) , two compounds that possess minimum inhibitory concentration ( mic ) values similar to that of 55 ( 2 g / ml ) , were included as controls to serve as known specific and nonspecific agents , respectively . testing of these agents indicated a rapid compromise of bacterial cell integrity for ctab after 15 min of incubation , where similar testing of chloramphenicol and 55 revealed continued cellular viability over the short incubation period at concentrations that exceeded mic by 10-fold ( figure 4a ) . therefore , we concluded that compound 55 does not elicit antibacterial activity through the nonspecific disruption of the gram - positive membrane and likely acts on an intracellular target . compound 55 does not disturb bacterial membranes and is expelled by efflux pumps in gram - negative bacteria . ( a ) microscopy experiments using the exclusion of propidium iodide ( pi ) were conducted to evaluate the effects of 55 on the integrity of the membrane in b. subtilis . in these , syto9 stains dna of all bacteria green , while pi can only penetrate compromised bacterial cells . cam , ctab , and 55 were evaluated at 1 , 4 , and 10 their mic values , and the number of observed cells was counted . chloramphenicol ( cam ) , a non - membrane - active antibiotic , and cetyltrimethylammonium bromide ( ctab ) , a known membrane - disrupting agent , were included as controls for the experiment . ( b ) disruption of tolc , the primary efflux pump of e. coli , induced a 55-sensitive phenotype in broth dilution experiments , where concentrations as low as 12 m inhibited bacterial growth ( red - outlined well ) . ( c ) building upon the results of ( b ) , checkerboard synergy experiments were conducted with the acrab - tolc inhibitor phenylarginine--napthamide ( pan ) and demonstrate an effective chemical knockout strategy to induce a 55-sensitive phenotype in wild - type e. coli . wells containing no metabolically active bacteria are observed as purple in this experiment , and wells corresponding to the lowest concentration of pan capable of synergizing with 55 to halt bacterial proliferation at each concentration of 55 are outlined in red . with this information , we further characterized the antibacterial activity of 55 to discern whether the compound merely halted proliferation of bacteria or possessed bactericidal activity . the results of these experiments , summarized in table s1 ( supporting information ) , demonstrated that the minimum bactericidal concentration ( mbc ) of 55 fell within a range of 14 the mic in s. aureus and b. subtilis . the generally accepted criteria of defining antibacterial activity as cidal is a ratio of mbc to mic less than or equal to 4 . by this definition , the limited spectrum of activity possessed by 55 was surprising , since our biochemical testing indicated that the compound was active with acps in the direct enzymatic assay . this led us to hypothesize that the gram - negative outer membrane was the source of this complication , as it presents a formidable barrier possessing both low penetrability and an active efflux mechanism . acrb gene products constitutes the primary efflux pump and source of resistance through this mechanism . thus , we tested e. coli bw25113 and jw0451 , the wild - type strain and an efflux - defective mutant that contains a lesion in the acrb locus , respectively , for susceptibility to 55 . tolc system would manifest as an observed hypersusceptibility of the acrb strain , while insensitivity would indicate cellular penetration or another mechanism as the source of resistance . for these experiments , we observed a clear differential susceptibility between the two strains ( figure 4b ) , where disruption of the acrb locus rendered the organism susceptible to 55 at concentrations as low as 12.5 g / ml . these findings indicated that efflux is the primary mechanism of resistance in this organism and that 55 is capable of penetrating the gram - negative bacterial cell . to further validate the above findings using a chemical genetic model , we tested 55 for synergistic activity with the broad - spectrum efflux pump inhibitor phenylarginine--naphthamide ( pan ) . in these experiments , neither compound alone was found to possess antibacterial activity against the wild - type strain bw25113 at the top concentrations tested , but offered pronounced growth inhibition in combination ( figure 4c ) . the fractional inhibition concentration index , a ratio of the potency of the combined test articles relative to that of the singular components , was estimated to be less than 0.25 , a finding strongly indicative of synergism , although we were not able to precisely determine this parameter since neither compound elicited growth inhibition at the top concentrations tested . to further understand the on - target engagement of pptase enzymes within the bacterial cell , we exploited the association of sfp - pptase with secondary metabolism in b. subtilis . the lipopeptide surfactin 68 is produced by a nonribosomal peptide synthetase pathway , diagrammed in figure 5a . this canonical megasynthase complex contains 24 functional domains , 7 of which are 4-pp - accepting carrier protein domains . a singly missed 4-pp transfer event will disrupt processivity in the megasynthase and render the complex incapable of producing the metabolite . as such , this system represents a strategy to study target engagement by 55 in the bacterial cell through monitoring of the fermentative yield of 68 . toward this end , we conducted time course experiments for cultures of b. subtilis in the presence of increasing concentrations of 55 , where we periodically measured both bacterial growth and surfactin titer over 28 h ( figure 5b , c ) . given the potent antibacterial activity of 55 against this organism , delicate selection of test conditions was required to supply high enough concentrations of compound to elicit a response but also provide for normal bacterial growth . in these experiments , cultures treated with 55 at concentrations of 0.53 or 1.1 g / ml resulted in 33% and 41% reductions in surfactin titer relative to a vehicle control after 28 h of culture , respectively ( figure 5b ) . these reductions in titer were accompanied by modest extensions in the culture lag phase , although continued culture revealed that 55 had a null effect on both the doubling time in the log phase and final cellular densities ( figure 5c ) . this dose - dependent attenuation of surfactin titer in cultures which accumulated similar quantities of biomass is consistent with engagement of sfp - pptase by 55 inside living bacteria . ( a ) surfactin 68 is produced by a nonribosomal peptide synthetase pathway in b. subtilis that contains 24 distinct functional domains , represented as cubes . seven of these are cp domains that require post - translational activation by sfp - pptase , and the monitoring of the fermentative yield provides a means to assess the blockade of pptase - dependent processes in the bacterial cell . ( b ) culture time course experiments demonstrate that sublethal concentrations of 55 attenuate surfactin production by b. subtilis okb105 . ( c ) culture density data are plotted for the culture time course experiment in ( b ) and demonstrate a modest effect of 55 on the growth of the cultures , indicating that the compound did not impede their ability to reach a terminal density . while our preliminary studies involved some characterization of the in vitro adme properties , after selection of 55 as a lead compound , a more detailed analysis was obtained . as shown in table 5 , 55 has a modest solubility in pbs buffer ( ph 7.4 ) of 20 m , which is approximately 60 times higher than the recorded ic50 value ( 290 nm ) . moreover , 55 displayed stability to mouse and rat liver microsomes with t1/2 values of 49.5 and > 30 min , respectively . the compound was completely stable ( measured for 1 h ) in the absence of the nadph cofactor , suggesting a cyp - mediated oxidation event . passive permeability was assessed using the pampa assay , and very favorable permeability was observed ( 1122 10 cm / s ) . next , we wanted to examine whether the probe compound inhibits specific cytochrome p450 enzymes 2d6 and 3a4 as these two isoforms account for the metabolism of approximately 80% of drugs . to assess the potential for cyp inhibition and drug drug interactions ( ddis ) , we looked at the effect of coincubation of our compound(s ) at 3 m with known cyp substrates ( 2d6 with dextromethorphan and 3a4 with 6-hydroxytestosterone ) . we found that 55 exhibits modest cyp inhibition of 25% and 20% for 2d6 and 3a4 , respectively . to further elucidate the potential for cyp liabilities , follow - up ic50 values and testing of a more expansive representation of cyp isoforms will be required . however , we also investigated cyp inhibition for other analogues , and inhibition was inconsistent across the series , so we are confident that these liabilities could be addressed through targeted structural modifications . given the potential instability of the thiourea moiety in aqueous and biological media , we were encouraged that 55 showed no signs of degradation in aqueous media at a wide ph range ( 29 ) , buffers ( pbs and hepes ) ( figure s7 , supporting information ) , and mouse plasma ( table 5 ) . in addition , the thiourea functionality is a known structural alert that can cause toxicity due to formation of reactive metabolites under physiological conditions ( vide supra ) . however , our probe compound 55 and analogue 41 are not susceptible to bioactivation and did not show any gsh adducts in follow - up studies ( table s3 , supporting information ) . aqueous solubility ( pbs buffer ) , mouse liver microsome ( mlm ) stability , cyp2d6/3a4 inhibition , and plasma stability were determined at pharmaron inc . dextromethorphan and 6-hydroxytestosterone were the substrates used for the cyp2d6 and cyp3a4 inhibition studies , respectively . having demonstrated a favorable in vitro adme profile of 55 , we next sought to investigate the in vivo pk profile in support of testing this compound in proof of concept ( poc ) antibacterial animal models ( vide infra ) . as shown in table 6 , 55 was administered to cd1 mice via both iv and ip routes at 3 and 30 mg / kg doses , respectively , using a solution formation consisting of 5/10/85 ( w / w / w ) dmso , solutol , and water . compound 55 exhibits favorable systemic exposure levels ( aucinf = 68860 hng / ml ) that are 4050-fold higher than the mic values against s. aureus strains at 30 mg / kg dosing . moreover , the compound has a reasonable t1/2 ( 2.0 h ) , and low clearance ( 7.2 ml / min / kg ) results in an exposure ( total drug concentration , not free drug concentration ) that exceeds the in vitro antibacterial mic value for over 8 h. the compound also efficiently crosses the bbb and thus could be potentially used for bacterial infections which reside in the brain . furthermore , dosing of 55 at these concentrations did not result in any adverse clinical observations over the 24 h period , which seems to indicate that no acute toxicity is to be expected at the doses used for in vivo poc studies . data were collected in triplicate at eight time points over a 24 h period . 55 was formulated as a solution ( 5% dmso and 10% solutol in h2o ) . for iv , mrt = mean residence time ( the time for elimination of 63.2% of the iv dose ) . as discussed above , 55 exhibits antibacterial activity against mrsa and has a desirable adme / pk profile , and thus , it was poised to be tested in vivo . for these studies , we profiled a panel of clinical isolates to assess the susceptibility of various genotypes ( table s2 , supporting information ) , and this revealed similar potencies ( within 3-fold ) for all strains tested . with this information , we pursued an in vivo poc study that utilized the mrsa - usa500 strain ( bk2395 ) since our compound had demonstrated favorable in vitro activity against it and it has demonstrated suitable virulence in mouse models of sepsis . unfortunately , in this experiment , 55 did not increase survival compared to the vehicle control , while vancomycin treatment completely protected animals from morbidity ( figure s6 , supporting information ) . these findings led us to investigate the source of discrepancy between our in vitro and in vivo results . to rule out the rapid development of resistance in vivo , bacteria were harvested from the kidneys of mice treated with the vehicle or 55 . for each crude we then determined mic values for these strains in parallel along with the parental mrsa - usa500 strain and observed identical susceptibility of all strains to 55 . these results indicated that neither passage of the organism in mice nor challenge with 55 in vivo led to reduced susceptibility to the compound . realizing that the antibacterial activity of compounds can be attenuated in the presence of whole blood and/or serum , we repeated the mic determinations of 55 in the presence of calf serum ( 20% , v / v ) in cation - adjusted mueller hinton ii broth and observed a significant shift in potency ( > 57 m vs 3.4 m ) . these data , along with subsequent analysis via equilibrium dialysis , revealed that 55 displays a high degree ( 98.6% ) of plasma protein binding ( ppb ) , and thus , the lack of activity is likely a consequence of the lipophilic nature of this compound . while disappointing , other groups have shown the ability to successfully modulate the lipophilicity of the lead compound through the strategic placement of polar moieties to improve the antibacterial activity in vivo . in fact , a group of researchers at pfizer recently reported improved in vivo efficacy of their lead antibacterial candidate by lowering ppb via lowering clogp . as described above , the eastern region of the molecule is highly tolerant to structural modifications ( table 2 ) , which could be exploited to modulate the clogp and thus hopefully improve activity in vivo . in addition , we plan on conducting more extensive pk studies to look at tissue distribution and free drug concentration , which may guide not only a future medicinal chemistry effort , but also aid the design of our in vivo proof of concept models . over the course of this work , a heated debate has emerged as to the suitability of the fas as a drug target . it appears that , in some gram - positive pathogens , fas is dispensable when bacteria are propagated in the presence of serum , which is a nutrient source rich in fatty acids . further study has found that the results may not be accurately predictive for even closely related bacteria , and further investigation of this phenomenon is warranted to tease apart the details with finer resolution . nonetheless , this discrepancy provides another mechanism through which bacterial tolerance to 55 may be occurring in vivo , and such a mechanism may confound the advancement of in vitro pptase - targeting inhibitors through in vivo poc studies of staphylococcal septicemia . however , this does not speak to the role that pptase plays in the production of virulence factors and elaborate cell wall components , especially in the case of mycobacterium spp . , where recent findings have confirmed the essential nature of both acps- and sfp - pptases . these organisms depend on the concerted effort of fas and pks systems for the assembly of mycolic acids , and these pptase dependencies have been substantiated in rodent models of infection . thus , pptase inhibitors remain a target worthy of pursuit and may find a more immediate applicability as tools to pharmacologically probe the role of pptases in mycobacterial pathogenesis . pptase enzymes catalyze an essential ptm that activates the assembly of fatty acid , polyketide , and nonribosomal peptides . metabolites from all three of these classes are necessary for bacterial cell viability and virulence . as a result , inhibition of these pathways has received attention as an attractive approach to the development of new antimicrobial compounds . rather than targeting the machinery involved in the production of a single metabolite , we have chosen to investigate the inhibition of this ptm as it represents a unifying feature between these pathways . pptase inhibitors may leverage this overlap to downregulate the production of key cellular components and virulence - determining factors . the critical role of this ptm in bacterial metabolism has been studied by others , but to date these efforts have not produced compounds with appreciable antibacterial activity . this limited success can likely be attributed to the inability of these programs to consider the presence of an sfp - pptase in addition to their primary target , acps - pptase . this secondary enzyme is capable of compensating for loss of the acps locus and thus provides a direct mechanism through which bacterial organisms may develop resistance through simple transcriptional / translational upregulation . to address this issue , we have pursued the development of a chemical probe with dual pptase inhibitory activity . here we have detailed the development and characterization of 55 , a novel small molecule that possesses these characteristics . we have demonstrated the qualities of this chemical probe and evaluated it according to the benchmarks suggested by the community . the features of 55 can be summarized according to the five principles of a quality chemical probe as follows : ( i ) we have performed detailed molecular profiling with relevant molecular targets , with observed potencies of 290 nm and 8.1 m against the primary development target sfp - pptase and bacterial orthologue acps , respectively , which is contrasted by null activity with the human enzyme . in the context of an antibacterial discovery campaign , where the end goal is the inhibition of bacterial growth in man , this indicates a selectivity index of > 500-fold with respect to the human orthologue . ( ii ) with respect to the mechanism of action , we demonstrate that the chemotype inhibits sfp - pptase independent of a fluorescent label through an allosteric mechanism that is noncompetitive with substrates and is rapidly reversible . ( iii ) regarding the identity of the active species , synthetic / medicinal chemistry efforts verified the structure , purity , stability , and chemical tractability of the chemotype . in addition , a structurally similar but inactive control was identified which was devoid of acps / sfp - pptase inhibitory activity as well as antibacterial activity . ( iv ) to demonstrate the utility of 55 as a probe , we confirmed the ability of a dual - specific pptase inhibitor to thwart the growth of bacteria in the absence of a rapid cytotoxic response . additionally , 55 demonstrated activity against clinically relevant microorganisms , where it stifled the growth of methicillin - resistant s. aureus . expanding on these findings , we also identified the primary mechanism of resistance in e. coli to be efflux by the acrab tolc system and demonstrated a chemical genetic approach to mitigate this issue and extend the spectrum of antibacterial activity to include gram - negative organisms . we recognize that optimizing a chemotype to circumvent efflux is a formidable task and is exacerbated in clinically relevant gram - negative pathogens where efflux pathways are more complex than in the model organism e. coli . beyond these assessments of antimicrobial activity , the ability of 55 to attenuate the production of surfactin , a metabolite dependent on the biochemical functionality of sfp - pptase ( figure 5b ) , strongly indicates that 55 is acting on - target inside the bacterial cell . ( v ) finally , in conjunction with the spirit and principles of the scientific community and the probe characteristic of availability , we will provide samples of 55 freely upon request . all air- or moisture - sensitive reactions were performed under positive pressure of nitrogen with oven - dried glassware . anhydrous solvents such as dichloromethane , n , n - dimethylformamide ( dmf ) , acetonitrile , methanol , and triethylamine were purchased from sigma - aldrich . the column used was a phenomenex luna c18 ( 5 m , 30 75 mm ) at a flow rate of 45 ml / min . the mobile phase consisted of acetonitrile and water ( each containing 0.1% trifluoroacetic acid ) . analytical analysis was performed on an agilent lc / ms system ( agilent technologies , santa clara , ca ) . method 1 : a 7 min gradient of 4100% acetonitrile ( containing 0.025% trifluoroacetic acid ) in water ( containing 0.05% trifluoroacetic acid ) was used with an 8 min run time at a flow rate of 1 ml / min . a phenomenex luna c18 column ( 3 m , 3 75 mm ) method 2 : a 3 min gradient of 4100% acetonitrile ( containing 0.025% trifluoroacetic acid ) in water ( containing 0.05% trifluoroacetic acid ) was used with a 4.5 min run time at a flow rate of 1 ml / min . a phenomenex gemini phenyl column ( 3 m , 3 100 mm ) purity determination was performed using an agilent diode array detector for both method 1 and method 2 . mass determination was performed using an agilent 6130 mass spectrometer with electrospray ionization in the positive mode . chemical shifts are reported in parts per million with undeuterated solvent ( dmso - d6 at 2.49 ppm ) as the internal standard for dmso - d6 solutions . all of the analogues tested in the biological assays have purity greater than 95% on the basis of both analytical methods . high - resolution mass spectrometry was recorded on an agilent 6210 time - of - flight lc / ms system . confirmation of the molecular formula was accomplished using electrospray ionization in the positive mode with the agilent masshunter software ( version b.02 ) . a mixture of substituted pyridin-2-amine ( 1 equiv ) and 1,1-thiocarbonyldiimidazole ( tcdi ) ( 1.05 equiv ) in dichloromethane ( 2 ml / mmol ) was stirred for 15 min at room temperature . to the clear yellow solution was added arylpiperazine ( 1.1 equiv ) , and the reaction mixture was stirred at 40 c for 1 h. the solvent was evaporated , and the crude product was taken up in 2 ml of dmso and purified via reversed - phase chromatography to give the products as tfa salts ( the details and characterization for all the compounds is depicted in the supporting information ) . this compound was prepared following the above general procedure starting from commerically available 4-methylpyridin-2-amine and 1-(3-(trifluoromethyl)phenyl)piperazine : lc / ms retention time t1 ( method 1 , 7 min ) = 4.91 min and t2 ( method 2 , 3 min ) = 3.13 min ; h nmr ( 400 mhz , dmso - d6 ) 10.09 ( s , 1h ) , 8.22 ( d , j = 5.4 hz , 1h ) , 7.537.42 ( m , 2h ) , 7.337.18 ( m , 2h ) , 7.167.07 ( m , 1h ) , 7.03 ( d , j = 5.4 hz , 1h ) , 4.08 ( t , j = 5.2 hz , 4h ) , 3.40 ( dd , j = 6.5 , 3.9 hz , 4h ) , 2.36 ( s , 3h ) ; c nmr ( 101 mhz , dmso - d6 ) 181.16 , 158.49 , 153.14 , 150.95 , 130.53 , 130.49 , 130.22 , 126.22 , 120.70 , 119.17 , 118.96 , 115.15 , 111.29 , 111.25 , 48.49 , 47.41 , 21.38 ; hrms ( esi ) m / z ( m + h ) calcd for c18h20f3n4s 381.1355 , found 381.1341 . this compound was prepared following the above general procedure starting from commerically available 4-methylpyridin-2-amine and 1-(2-(trifluoromethyl)phenyl)piperazine : lc / ms retention time t1 ( method 1 , 7 min ) = 4.993 min and t2 ( method 2 , 3 min ) = 3.215 min ; h nmr ( 400 mhz , dmso - d6 ) 8.18 ( d , j = 5.3 hz , 1h ) , 7.767.57 ( m , 3h ) , 7.467.34 ( m , 2h ) , 6.96 ( d , j = 5.1 hz , 1h ) , 4.093.95 ( m , 4h ) , 2.93 ( m , 4h ) , 2.32 ( s , 3h ) ; hrms ( esi ) m / z ( m + h ) calcd for c18h20f3n4s 381.1355 , found 381.1361 . this compound was prepared following the above general procedure starting from intermediate 1-(4-chloro-2-(trifluoromethyl)phenyl)piperazine ( see the supporting information for the synthesis ) and commerically available 2,4-dimethylpyridin-2-amine : lc / ms retention time t1 ( method 1 , 7 min ) = 5.384 min and t2 ( method 2 , 3 min ) = 3.247 min ; h nmr ( 400 mhz , dmso - d6 ) 7.75 ( dd , j = 7.1 , 2.5 hz , 2h ) , 7.687.59 ( m , 1h ) , 7.23 ( s , 1h ) , 6.85 ( s , 1h ) , 4.01 ( d , j = 5.6 hz , 4h ) , 2.93 ( q , j = 4.6 , 3.7 hz , 4h ) , 2.40 ( s , 3h ) , 2.29 ( s , 3h ) ; hrms ( esi ) m / z ( m + h ) calcd for c19h21clf3n4s 429.1122 , found 429.1133 . this compound was prepared following the above general procedure starting from commerically available precursors 2,4-dimethylpyridin-2-amine and 1-(5-(trifluoromethyl)pyridin-2-yl)piperazine : lc / ms retention time t1 ( method 1 , 7 min ) = 4.615 min and t2 ( method 2 , 3 min ) = 3.114 min ; h nmr ( 400 mhz , dmso - d6 ) 8.45 ( d , j = 2.5 hz , 1h ) , 7.85 ( dd , j = 9.2 , 2.6 hz , 1h ) , 7.29 ( s , 1h ) , 6.96 ( d , j = 9.5 hz , 2h ) , 4.103.99 ( m , 4h ) , 3.79 ( dd , j = 6.5 , 4.0 hz , 4h ) , 2.44 ( s , 3h ) , 2.33 ( s , 3h ) ; hrms ( esi ) m / z ( m + h ) calcd for c18h21f3n5s 396.1464 , found 396.1469 . this compound was prepared following the above general procedure starting from commerically available precursors 2,4-dimethylpyridin-2-amine and 1-(3-chloro-5-(trifluoromethyl)pyridin-2-yl)piperazine : lc / ms retention time t1 ( method 1 , 7 min ) = 5.113 min and t2 ( method 2 , 3 min ) = 3.287 min ; h nmr ( 400 mhz , dmso - d6 ) 8.58 ( d , j = 2.1 hz , 1h ) , 8.23 ( d , j = 2.1 hz , 1h ) , 7.25 ( s , 1h ) , 6.93 ( s , 1h ) , 4.06 ( dd , j = 6.5 , 3.6 hz , 4h ) , 3.61 ( dd , j = 6.6 , 3.7 hz , 4h ) , 2.43 ( s , 3h ) , 2.31 ( s , 3h ) ; hrms ( esi ) m / z ( m + h ) calcd for c18h20clf3n5s 430.1075 , found 430.1089 . this compound was prepared following the above general procedure starting from commerically available precursors 4-methoxypyridin-2-amine and 1-(3-chloro-5-(trifluoromethyl)pyridin-2-yl)piperazine : lc / ms retention time t1 ( method 1 , 7 min ) = 4.88 min and t2 ( method 2 , 3 min ) = 3.04 min ; h nmr ( 400 mhz , dmso - d6 ) 8.56 8.61 ( m , 1h ) , 8.168.26 ( m , 2h ) , 7.15 ( s , 1h ) , 6.83 ( s , 1h ) , 4.054.13 ( m , 4h ) , 3.88 ( s , 3h ) , 3.583.67 ( m , 4 h ) ; c nmr ( 101 mhz , dmso - d6 ) 180.45 , 168.50 , 159.01 , 153.62 , 143.08 , 136.44 , 136.41 , 124.78 , 122.09 , 119.61 , 118.77 , 118.44 , 107.22 , 102.47 , 102.37 , 56.43 , 56.29 , 48.06 , 47.56 ; hrms ( esi ) m / z ( m + h ) calcd for c17h18clf3n5os 432.0867 , found 432.0856 . a mixture of 4-methylpyridin-2-amine ( 0.1 g , 0.925 mmol , 1 equiv ) and tcdi ( 0.165 g , 0.925 mmol , 1.0 equiv ) in dichloromethane ( 3 ml ) was stirred for 15 min at room temperature . to the clear yellow solution was added commercially available n-(3-(trifluoromethyl)phenyl)piperidin-4-amine ( 0.226 g , 0.925 mmol , 1 equiv ) , and the resulting solution was stirred at 40 c for 1 h. the solvent was evaporated , and the crude product was taken up in 2 ml of dmso and purified via reversed - phase chromatography to give the product as a tfa salt : lc / ms retention time t1 ( method 1 , 7 min ) = 4.954 min and t2 ( method 2 , 3 min ) = 3.025 min ; h nmr ( 400 mhz , dmso - d6 ) 8.21 ( d , j = 5.4 hz , 1h ) , 7.39 ( d , j = 1.6 hz , 1h ) , 7.317.22 ( m , 1h ) , 7.057.00 ( m , 1h ) , 6.916.85 ( m , 2h ) , 6.836.77 ( m , 1h ) , 5.50 ( br s , 1h ) , 4.54 ( d , j = 13.2 hz , 2h ) , 3.68 ( tt , j = 9.4 , 3.9 hz , 1h ) , 3.43 ( ddd , j = 13.7 , 11.1 , 2.8 hz , 2h ) , 2.35 ( s , 3h ) , 2.071.89 ( m , 2h ) , 1.43 ( dtd , j = 13.6 , 10.2 , 3.8 hz , 2h ) ; hrms ( esi ) m / z ( m + h ) calcd for c19h22f3n4s 395.1512 , found 395.1510 . to a mixture of 4-methylpyridin-2-amine ( 0.5 g , 4.62 mmol , 1 equiv ) , ( i - pr)2net ( 0.970 ml , 5.55 mmol , 1.2 equiv ) , and dmap ( 0.113 g , 0.925 mmol , 0.2 equiv ) in dichloromethane ( 25 ml ) was added phenyl carbonochloridate ( 0.664 ml , 5.09 mmol , 1.1 equiv ) at 0 c , and the reaction was allowed to stir at room temperature for 1 h. to the resulting clear solution was added 1-(3-(trifluoromethyl)phenyl)piperazine ( 1.13 ml , 6.01 mmol , 1.3 equiv ) , and the reaction mixture was stirred for an additional 2 h at room temperature . volatiles were removed by forced air , and the residue was dissolved in dmf and purified via reversed - phase chromatography to give 12 as a tfa salt : lc / ms retention time t1 ( method 1 , 7 min ) = 4.43 min and t2 ( method 2 , 3 min ) = 3.095 min ; h nmr ( 400 mhz , dmso - d6 ) 10.21 ( s , 1h ) , 8.17 ( d , j = 5.9 hz , 1h ) , 7.547.39 ( m , 2h ) , 7.297.18 ( m , 2h ) , 7.177.05 ( m , 2h ) , 3.713.63 ( m , 4h ) , 3.313.29 ( m , 4h ) , 2.40 ( s , 3h ) ; c nmr ( 101 mhz , dmso - d6 ) 158.27 , 153.81 , 150.90 , 150.53 , 140.63 , 130.07 , 130.04 , 129.76 , 119.59 , 119.03 , 115.02 , 114.70 , 111.33 , 111.29 , 47.41 , 43.50 , 21.45 ; hrms ( esi ) m / z ( m + h ) calcd for c18h20f3n4o 365.1584 , found 365.1590 . the assay was performed in 50 mm hepesna ( ph 7.6 ) , 10 mm mgcl2 , 0.01% nonidet p-40 , and 0.01% bsa . a 3 l volume of each reagent , consisting of buffer ( in columns 3 and 4 as a negative control ) and sfp- or acps - pptase ( in columns 1 , 2 , and 548 , final concentration of 15 or 100 nm , respectively ) were dispensed into a 1536-well greiner black solid - bottom plate . compounds ( 23 nl ) were transferred via a kalypsys pintool equipped with a 1536-pin array . the plate was incubated for 15 min at room temperature , followed by the addition of 1 l of substrate ( final concentrations for rhodamine coa and bhq-2-ybbr were 5 and 12.5 m , respectively ) to start the reaction . the plate was then centrifuged at 1000 rpm for 15 s , and the fluorescence intensity was recorded on a viewlux high - throughput charge - coupled device ( ccd ) imager ( perkin - elmer ) using standard bodipy optics ( 525 nm excitation and 598 nm emission ) . the plate was then incubated for 30 or 60 min ( sfp or acps , respectively ) , and a second read on the viewlux was performed . the fluorescence intensity difference over the 30 or 60 min period ( sfp or acps , respectively ) was used to calculate the respective reaction rate for each well . all screening operations were performed on a fully integrated robotic system ( kalypsys inc . , san diego , ca ) as described elsewhere . plates containing dmso only ( instead of compound solutions ) were included approximately every 50 plates throughout the screen to monitor any systematic trend in the assay signal associated with reagent dispenser variation or a decrease in enzyme specific activity . a dmso solution of confirmed hits ( 0.5 l ) was added to a 1.33 enzyme solution ( 15 l , containing 26.6 nm sfp , 66 mm hepesna , 13.3 mm mgcl2 , 0.0133% np-40 , and 0.133% bsa , ph 7.6 ) . after a 10 min incubation , the enzymatic reaction was initiated by the addition of a 4 substrate solution ( 4 l , containing 50 m rhodamine coa and 50 m apo - actinorhodin acp ) . the reactions were terminated after a 30 min incubation at room temperature by the addition of a 2 quench solution ( 20 l , containing 4 m urea , 25 mm edta , and 0.004% phenol red , ph 8.0 ) . samples were separated under native conditions on a 20% polyacrylamide gel using standard laemmli conditions . following the run , the gels were imaged with a chemi - doc plus imager ( bio - rad , hercules , ca ) , and the band intensity was quantified using the imagej software package . pixel density values were normalized to control wells and fit with the four - parameter hill equation using in - house tools . methods for mic determination were made in accordance with standards put forth by the national clinical laboratory standards institute detailed in documents m07-a8 and m27-a2 for bacterial and fungal species , respectively . innoculum was prepared from overnight liquid cultures of bacteria or by suspending 2 day old colonies in rpmi 1640 medium . test articles dissolved in dmso ( 1 l ) were added to sterile medium [ 50 l , cation - adjusted mueller hinton ii broth for bacteria ( bd bbl , franklin lakes , nj ) or rmpi 1640 for fungi ( invitrogen corp . , carlsbad , ca ) ] followed by innoculum prepared in the same medium ( 50 l , containing 1 10 cfu ) and incubated at 3037 c for 1620 h ( 48 h for fungi ) . the plates were visually inspected for microbial growth , and the first well containing no visible microbial growth was scored as the mic . coli k12 , p. aeruginosa atcc 9028 , s. aureus atcc 6538 ( methicillin - sensitive ) , s. aureus atcc baa-1717 ( community - acquired methicillin - resistant strain usa300-hou - mr ) , c. albicans atcc 90028 ( fluconazole - sensitive ) , and c. albicans atcc 96901 ( fluconazole - resistant ) . for the acquisition of images for figures 3d and 4c , resazurin was employed as an indicator to assist in visualization in a method similar to that of sarker et al . a 10 l volume of sterile aqueous resazurin solution ( 0.7% w / v ) was added to the wells of test plates resulting from the protocol above . after further incubation 4 h at 37 c ,

4-phosphopantetheinyl transferases ( pptases ) catalyze a post - translational modification essential to bacterial cell viability and virulence . we present the discovery and medicinal chemistry optimization of 2-pyridinyl - n-(4-aryl)piperazine-1-carbothioamides , which exhibit submicromolar inhibition of bacterial sfp - pptase with no activity toward the human orthologue . moreover , compounds within this class possess antibacterial activity in the absence of a rapid cytotoxic response in human cells . an advanced analogue of this series , ml267 ( 55 ) , was found to attenuate production of an sfp - pptase - dependent metabolite when applied to bacillus subtilis at sublethal doses . additional testing revealed antibacterial activity against methicillin - resistant staphylococcus aureus , and chemical genetic studies implicated efflux as a mechanism for resistance in escherichia coli . additionally , we highlight the in vitro absorption , distribution , metabolism , and excretion and in vivo pharmacokinetic profiles of compound 55 to further demonstrate the potential utility of this small - molecule inhibitor .

cachexia is a wasting condition , directly associated with 2240% of all cancer deaths.1 , 2 it has been defined as a multifactor syndrome , characterized by ongoing loss of skeletal muscle mass ( with or without loss of fat mass ) that can not be fully reversed by conventional nutritional support and leads to progressive functional impairment.3 , 4 although muscle wasting has been the main focus of cachexiarelated research,5 , 6 studies show that fat loss occurs more rapidly and more precociously than the reduction of lean mass in cancer cachexia ( cc)7 , 8 , 9 and may extend up to 80% within a very short interval , especially in the immediate period preceding death . still , more recently , we have shown that the adipose tissue ( at ) of cachectic cancer patients , in particular the subcutaneous at ( scat ) depot , is a possible relevant systemic source of inflammatory molecules during the development of the disease.10 several factors have been demonstrated to contribute to cachexiarelated loss of at , such as ( i ) increased lipid mobilization due to enhanced adipocyte triglyceride lipolysis,8 , 11 ( ii ) reduced lipogenesis and fatty acid esterification due to decrease of both fatty acid synthase and lipoprotein lipase activity12 and ( iii ) impairment of fat cell turnover ( preadipocyte / mature adipocyte ) , resulting in a disruption in the organization and development of at.13 in addition to that , several morphological and molecular changes in at depots of rats during the progression course of cc have been described.9 , 14 , 15 , 16 most of the alterations , nevertheless , are perceived before any detectable morphological disruption , notably the downregulation of genes related with adipogenesis , metabolism and mature adipocyte function . furthermore , at inflammation is a wellcharacterized aspect of the syndrome.9 , 17 , 18 such condition seems to be most apparent at the final stages of cachexia ( cachexia to refractory cachexia ) . at has been described as a heterogeneous tissue that possesses marked anatomicallyrelated depot specialization in regard to many parameters , including cellularity , form of growth and expansion , metabolism , production of and response to cytokines , hormones , density and distribution of innervation , as well as to fatty acid composition ( reviewed by pond19 ) . several chronic diseases , such as obesity,20 metabolic syndrome and lipodystrophy,21 induce at remodelling , involving two major processes : adipose cell morphometric changes ( hypertrophy or atrophy ) and immune cells accumulation . inflammation , endoplasmatic reticulum stress and hypoxia are also part of the general biologic alterations subsidizing the attraction and retention of inflammatory cells in at.22 at extracellular matrix ( ecm ) remodelling has been found to play an essential role in adipogenesis22 and tissue structure establishment.23 in obesity , these alterations were demonstrated to be crucial to accommodate cellular alterations.24 in db / db obese mice , epididymal at morphological changes occur concomitantly to upregulation of various types of collagens , such as i , iv and vi.25 the former is related with increased adipocyte size.26 this feature is generally followed by persistent inflammatory stimulus in at that may underline excessive synthesis of ecm components . consequently , subsequent interstitial deposition of fibrotic material ( fibrosis ) and enhanced expression of ecm proteins seem to be a result of a pervasive tissue response to unresolved chronic inflammation.20 divoux et al.20 have reported increases in ecm components secretion induced by products synthesized by macrophages infiltrated in the at ( atms ) , suggesting a possible interaction between inflammatory cells and at remodelling . in the same study , other inflammatory cells , including tlymphocytes and mast cells , were shown to participate in one such process . however , despite at remodelling being well described in obesity , few studies have addressed this topic in cc . thus , to obtain broader insight into at remodelling in the setting of cc , we have analysed the scat depot of cancer patients . the choice of scat , rather than visceral at , relies on the fact that we have previously shown10 that this pad responds more precociously to the presence of the tumour in the organism , acting as a source of inflammatory markers . firstly , we evaluated fibrosis in a qualitative and quantitative manner and in particular , collagen density in scat of weightstable and cachectic cancer patients . secondly , we characterized the inflammatory cells surrounding fibrotic depots . finally , we determined scat inflammatory gene expression in cancer patients . the analysis shows discrete early morphological modifications in scat , followed by increased inflammatory cell infiltration and fibrosis , which are more evident in the cachectic cancer patients . patients were recruited between november 2008 and july 2010 at university hospital of the university of so paulo ( n = 26 ) . the inclusion criteria were as follows : 1 , not having received prior anticancer treatment and 2 , willingness to participate . the exclusion criteria were as follows : chemotherapy at the time of the study ; continuous antiinflammatory therapy ; and kidney or liver failure , acquired immunodeficiency syndrome , inflammatory bowel disease or chronic inflammatory processes not related with cachexia , such as autoimmune disorders . patients with body mass index ( bmi ) greater than 29.9 were also excluded from the study . the study was approved by the ethics committee from the institute of biomedical sciences and by the human ethics committee of the university of so paulo hospital ( cepicb / usp 1117/13 , cephu / usp 752/07 and 1117/13 , caae 0031.0.198.01907 ) . the investigation was explained in detail to each patient , and written informed consent was obtained . the subjects were subdivided into cc ( cc , n = 12 ) and weightstable cancer ( wsc , n = 7 ) and weightstable control ( noncancer ) ( control , n = 7 ) . patients were considered cachectic based on criteria from the international consensus.2 cachexia is recognized in patients with weight loss > 5% in the past 6 months or any degree of weight loss > 2% in the last 6 months + bmi < 20 kg / m . the stable weight groups were considered as those with no important weight change during the previous year and bmi < 25 kg / m . in the cancer groups ( cc and wsc ) , the tumour primary location was colon ( n = 8) , stomach ( n = 5 ) , pancreas ( n = 2 ) and other ( n = 4 ) . the control group included patients undergoing surgery for incisional hernia ( n = 5 ) and chronic cholecystitis ( n = 2 ) . the study was designed as intention to compare ; therefore , all subjects were kept in the analyses despite a few missing values of the measurements . characteristics of study groups bmi , body mass index ; cc , cancer cachexia ; crp , creactive protein ; hg , haemoglobin ; il , interleukin ; ldl , lowdensity lipoprotein levels ; n , number of patients ; p , plasma ; s , serum ; tag , triglyceride serum levels ; wsc , weightstable cancer . values are mean standard deviation . statistical analysis , p vs. control subjects . height and weight were determined , and approximately 10 ml of blood was collected after overnight fast , within the venous access procedure for anaesthesia during the surgery , allowing the measurement of plasma creactive protein , serum urea , creatinine and haemoglobin . tumour staging was determined postoperatively , according to the guidelines of the union for international cancer control tnm.27 approximately 1 g of subcutaneous white at ( by approximate anatomical site ) was collected in within a 5 min interval , similarly to that described by agustsson et al.11 a portion of at biopsy was immediately transferred into liquid nitrogen and kept at 80 c before rna analysis . the other part was fixed overnight at 4 c in 4% paraformaldehyde and processed for standard paraffin embedding.10 this procedure presents a minimal degree of risk and does not interfere with the standard surgery procedure . the sequential 5 m sections obtained were first stained with haematoxylin and eosin and then , with picro sirius red . the sections were analysed with a leica microscope ( dm 750 ) , equipped with filters to provide circularly polarized light . for the analysis of morphometric aspects , the area , average diameter , perimeter and shape were measured by imagen proplus 6.0 ( 100 adipocytes per stained section ) . picro sirius red staining sections allowed collagen fibres detection with different colours.28 type i collagen fibres appear orange to red , whereas the thinner type iii collagen fibres are stained with a yellow to green hue . tissue images were obtained with a 40 objective lens , recorded on a digital camera ( dfc 295 , leica ) , displayed on a highresolution monitor ( lg , flatron , e1941 ) and analysed with sigmascan pro image analysis ( chicago , il , usa ) . for the different morphological analysis , immunohistochemistry of at was carried out with sections fixed in buffered formalin and embedded in paraffin . after quenching of endogenous peroxidase activity with 0.3% h2o2 in methanol and blocking of free proteinbinding sites with 5% normal goat serum , sections were immunostained for immune cells : macrophages with cd68 antimouse kp1 monoclonal antibody ( dako , denmark ref m 0814 ) , neutrophils with cd15 ( dako , denmark ref ir062 ) and histochemical reactions were performed employing vecta stain abc kit ( vector laboratories ) and sigma fast 3,3diaminobenzidine as substrate ( sigma , st . total rna of the samples was isolated with tripure isolation reagent ( roche ) , following the recommendations of manufacturer,29 and total rna concentration , quantified by spectrophotometry ( nanodrop nd1000 ) . complementary dna synthesis was carried out employing 13 l assay mix containing 3 g total rna , 10u rnase inhibitor , 2 l random primers , 2 l dntp ( 10 nmol ) , 2 l dithiothreitol , 10u moloney murine leukemia virus ( mmlv ) reverse transcriptase and 4 l of 10 reaction buffer ( 100 mm trishcl , 500 mm kcl ; 150 nm mgcl2 in nuclear free water ) ( invitrogen ) . gene expression of cd68 ( nm_001040059.1 , forward 5'act gaa ccc caa caa aac ca3 ' , reverse 5'ttg tac tcc acc gcc atg ta ) and mcp1 ( ccl2 ) ( nm_002982.3 , forward 5 ' ccc cag tca cct gct gtt at 3 ' and reverse 5'tgg aat cct gaa ccc act tc 3 ' ) . five microlitres of cdna ( 25 ng ) were mixed with 2x sybr green pcr master mix ( applied biosystems ) and primers ( invitrogen ) . quantitative realtime pcr was performed with an abi 7300 realtime systems ( applied biosystems ) . a ct value was obtained by subtracting 18 s values from those of the gene of interest . the average ct value of the control group was then subtracted from the sample to derive a ct value . the expression of each gene was evaluated by 2 the statistical analysis was performed with the commercially available statistical package from sigmastat ( version 3.1 , sigma stat , systat , point richmond , ca ) . data are expressed as mean standard error and analysed by oneway analysis of variance . when a significant fvalue was found by oneway analysis of variance , a bonferroni 's post hoc test was performed to demonstrate all pairwise multiple comparisons between the means . all calculated pvalues were two sided , and a p < 0.05 was considered significant . patients were recruited between november 2008 and july 2010 at university hospital of the university of so paulo ( n = 26 ) . the inclusion criteria were as follows : 1 , not having received prior anticancer treatment and 2 , willingness to participate . the exclusion criteria were as follows : chemotherapy at the time of the study ; continuous antiinflammatory therapy ; and kidney or liver failure , acquired immunodeficiency syndrome , inflammatory bowel disease or chronic inflammatory processes not related with cachexia , such as autoimmune disorders . patients with body mass index ( bmi ) greater than 29.9 were also excluded from the study . the study was approved by the ethics committee from the institute of biomedical sciences and by the human ethics committee of the university of so paulo hospital ( cepicb / usp 1117/13 , cephu / usp 752/07 and 1117/13 , caae 0031.0.198.01907 ) . the investigation was explained in detail to each patient , and written informed consent was obtained . the subjects were subdivided into cc ( cc , n = 12 ) and weightstable cancer ( wsc , n = 7 ) and weightstable control ( noncancer ) ( control , n = 7 ) . patients were considered cachectic based on criteria from the international consensus.2 cachexia is recognized in patients with weight loss > 5% in the past 6 months or any degree of weight loss > 2% in the last 6 months + bmi < 20 kg / m . the stable weight groups were considered as those with no important weight change during the previous year and bmi < 25 kg / m . in the cancer groups ( cc and wsc ) , the tumour primary location was colon ( n = 8) , stomach ( n = 5 ) , pancreas ( n = 2 ) and other ( n = 4 ) . the control group included patients undergoing surgery for incisional hernia ( n = 5 ) and chronic cholecystitis ( n = 2 ) . the study was designed as intention to compare ; therefore , all subjects were kept in the analyses despite a few missing values of the measurements . characteristics of study groups bmi , body mass index ; cc , cancer cachexia ; crp , creactive protein ; hg , haemoglobin ; il , interleukin ; ldl , lowdensity lipoprotein levels ; n , number of patients ; p , plasma ; s , serum ; tag , triglyceride serum levels ; wsc , weightstable cancer . values are mean standard deviation . statistical analysis , p vs. control subjects . height and weight were determined , and approximately 10 ml of blood was collected after overnight fast , within the venous access procedure for anaesthesia during the surgery , allowing the measurement of plasma creactive protein , serum urea , creatinine and haemoglobin . tumour staging was determined postoperatively , according to the guidelines of the union for international cancer control tnm.27 approximately 1 g of subcutaneous white at ( by approximate anatomical site ) was collected in within a 5 min interval , similarly to that described by agustsson et al.11 a portion of at biopsy was immediately transferred into liquid nitrogen and kept at 80 c before rna analysis . the other part was fixed overnight at 4 c in 4% paraformaldehyde and processed for standard paraffin embedding.10 this procedure presents a minimal degree of risk and does not interfere with the standard surgery procedure . the sequential 5 m sections obtained were first stained with haematoxylin and eosin and then , with picro sirius red . the sections were analysed with a leica microscope ( dm 750 ) , equipped with filters to provide circularly polarized light . for the analysis of morphometric aspects , the area , average diameter , perimeter and shape picro sirius red staining sections allowed collagen fibres detection with different colours.28 type i collagen fibres appear orange to red , whereas the thinner type iii collagen fibres are stained with a yellow to green hue . tissue images were obtained with a 40 objective lens , recorded on a digital camera ( dfc 295 , leica ) , displayed on a highresolution monitor ( lg , flatron , e1941 ) and analysed with sigmascan pro image analysis ( chicago , il , usa ) . for the different morphological analysis , different histological slices ( non serial sections ) from the same group were employed . immunohistochemistry of at was carried out with sections fixed in buffered formalin and embedded in paraffin . after quenching of endogenous peroxidase activity with 0.3% h2o2 in methanol and blocking of free proteinbinding sites with 5% normal goat serum , sections were immunostained for immune cells : macrophages with cd68 antimouse kp1 monoclonal antibody ( dako , denmark ref m 0814 ) , neutrophils with cd15 ( dako , denmark ref ir062 ) and histochemical reactions were performed employing vecta stain abc kit ( vector laboratories ) and sigma fast 3,3diaminobenzidine as substrate ( sigma , st . total rna of the samples was isolated with tripure isolation reagent ( roche ) , following the recommendations of manufacturer,29 and total rna concentration , quantified by spectrophotometry ( nanodrop nd1000 ) . complementary dna synthesis was carried out employing 13 l assay mix containing 3 g total rna , 10u rnase inhibitor , 2 l random primers , 2 l dntp ( 10 nmol ) , 2 l dithiothreitol , 10u moloney murine leukemia virus ( mmlv ) reverse transcriptase and 4 l of 10 reaction buffer ( 100 mm trishcl , 500 mm kcl ; 150 nm mgcl2 in nuclear free water ) ( invitrogen ) . gene expression of cd68 ( nm_001040059.1 , forward 5'act gaa ccc caa caa aac ca3 ' , reverse 5'ttg tac tcc acc gcc atg ta ) and mcp1 ( ccl2 ) ( nm_002982.3 , forward 5 ' ccc cag tca cct gct gtt at 3 ' and reverse 5'tgg aat cct gaa ccc act tc 3 ' ) . five microlitres of cdna ( 25 ng ) were mixed with 2x sybr green pcr master mix ( applied biosystems ) and primers ( invitrogen ) . quantitative realtime pcr was performed with an abi 7300 realtime systems ( applied biosystems ) . a ct value was obtained by subtracting 18 s values from those of the gene of interest . the average ct value of the control group was then subtracted from the sample to derive a ct value . the statistical analysis was performed with the commercially available statistical package from sigmastat ( version 3.1 , sigma stat , systat , point richmond , ca ) . data are expressed as mean standard error and analysed by oneway analysis of variance . when a significant fvalue was found by oneway analysis of variance , a bonferroni 's post hoc test was performed to demonstrate all pairwise multiple comparisons between the means . all calculated pvalues were two sided , and a p < 0.05 was considered significant . the body mass 612 months before inclusion in the study , as reported by patients , showed difference among the groups . cc mass was significantly lower , as compared with wsc and control , considering weight loss , both as absolute values ( 13.6 kg , p < 0.01 , compared with control ) as relative values ( 19.9% , p < 0.01 , compared with control ) . plasma lipid profile was affected by cc , with decreased level of triglyceride serum levels ( 31.8% , p < 0.01 ) , total cholesterol ( 15.6% , p < 0.01 ) and lowdensity lipoprotein levels ( 14.3% , p < 0.01 ) when compared with the control patients . there was no difference with respect to other biochemical parameters ( i.e. plasma creatinine and urea and serum haemoglobin values ) . cc patients showed values ranging from 8.9% to 30.8% of body weight loss during the previous 6 months and creactive protein higher than 5 g / ml , as well as increased levels of interleukin ( il)6 ( 12.6fold and 9.4fold , respectively , p < 0.001 ) compared with control , indicating that the studied cachectic patients demonstrated weight loss and increased plasma inflammatory markers . wsc patients showed values ranging from 3.2% to 5.4% of body weight loss during the previous 6 months and creactive protein values ranging from 1.2 to 10.7 5 g / ml . cancer cachexia patients showed body weight loss and bmi reduction , suggesting the possibility that modification of at cell morphology may be a response to cc . in order to address this question , we determined cell perimeter and the crosssectional area in samples of the subcutaneous depot ( figure 1 ) . light microscopy examination indicates that morphometric alteration of scat is only evident in the cc group ( figure 1a c ) . in scat from cc , adipocyte size , determined as sectional area ( figure 1d ) , and cell perimeter ( figure 1e ) showed a decrease of 32.9% ( p < 0.05 ) and 18.5% ( p < 0.05 ) , respectively , compared with the control samples . haematoxylin and eosin stained sections of subcutaneous tissue from ( a ) weightstable subjects and control , ( b ) weightstable cancer ( wsc ) patients and ( c ) cancer cachexia ( cc ) patients . morphometric analysis of sectional area ( d ) and ( e ) perimeter of adipocytes from different experimental groups . photomicrographs ( a c ) illustrate the most representative images considering data related to morphological analysis ( d , e ) . * p < 0.05 vs. control subjects . when examined under polarized light microscopy , the same samples from cc patients demonstrated that types i ( red label ) and iii ( green label ) collagen fibres were present around the adipocytes , in organized bundles of various thicknesses ( figure 2a f ) . as compared with control patients , cc samples showed an increase of 1.7fold ( p < 0.01 ) of total type i collagen , no changes in type iii collagen ( p = 0.10 ) and an increase in collagen i iii ratio ( p = 0.0159 ) ( figure 2g h ) . type i collagen fibres are orange to red , whereas the thinner type iii collagen fibres appear yellow to green from ( a , b ) weightstable subjects and control , ( c , d ) weightstable cancer ( wsc ) patients and ( e , f ) cancer cachexia ( cc ) patients . total collagen quantification in cachexia and control patients of ( g ) type i collagen and ( h ) types i iii ratio . values are mean sem . * p < 0.05 vs. control subjects . taking into account the scope of data regarding at remodelling induced by cachexia , notably the modification in total collagen density ( fibrosis ) , we also examined the presence of inflammation and infiltrated cells in scat from the patients . immunostaining for macrophages ( cd68 ) , tlymphocytes ( cd3 ) and neutrophils ( cd15 ) and analysis of gene expression of mcp1 and cd68 were carried out ( figures 3 , 4 , 5 ) . identification of different immune cell types present in subcutaneous adipose tissue obtained from cancer cachexia patients . serial sections of weightstable subjects and control , weightstable cancer ( wsc ) patients and cancer cachexia ( cc ) patients were stained with markers of macrophages ( cd68 ) , tlymphocytes ( cd3 ) and for neutrophils ( cd15 ) . immunohistochemistry for immune cells from weightstable subjects and control , weightstable cancer ( wsc ) patients and cancer cachexia ( cc ) patients . subcutaneous adipose tissue ( scat ) macrophages localize to crownlike structures ( cls ) around individual adipocytes , which increase in frequency with cancer cachexia . light microscopy of scat of cc patients showing cd68 immunoreactive macrophages ( brown colour ) aggregated to numerous ( c , cc patients ) cls among unilocular adipocytes . cd3 immunoreactive tlymphocyte shows positive cells in fibrotic areas , stained with dab ( brown colour ) ( arrow ) . bar ( m ) : 50 m for a and b ; 25 m for c and d. expression levels of genes involved in the inflammation of subcutaneous adipose tissue depots in subjects from different experimental groups . realtime pcr analysis of rna isolated from weightstable subjects and control , weightstable cancer ( wsc ) patients and cancer cachexia ( cc ) patients . mrna levels of target genes were normalized to 18 s. values are mean sem for five to nine samples per group . * although the presence of cd15 neutrophils was minimal in cc , we observed an abundant number of macrophages stained with cd68 surface markers in the groups ( cc and wsc ) ( figure 3 ) . additionally , in tissue sections stained for cd68 positive cells , we found higher intensity that was more pronounced in the surrounding of adipocytes [ crownlike structures ( cls ) ] in cc ( figure 4a , c ) . however , crown aggregates were not extensive , and there was no signal of syncytial giant cells . less frequently , sections for cd3 positive cells showed irregular distribution more often observed in the scat fibrotic areas from cc ( figure 4b , d ) . cd68 mrna expression increased in scat obtained from cc patients ( 109fold , p = 0.029 , respectively ) , when compared with the control group ( control vs. cc ) . in scat of wsc , an increase of 48fold in mcp1 mrna levels was detected , when compared with the control group ( p = 0.010 ) ( figure 5 ) . the body mass 612 months before inclusion in the study , as reported by patients , showed difference among the groups . cc mass was significantly lower , as compared with wsc and control , considering weight loss , both as absolute values ( 13.6 kg , p < 0.01 , compared with control ) as relative values ( 19.9% , p < 0.01 , compared with control ) . plasma lipid profile was affected by cc , with decreased level of triglyceride serum levels ( 31.8% , p < 0.01 ) , total cholesterol ( 15.6% , p < 0.01 ) and lowdensity lipoprotein levels ( 14.3% , p < 0.01 ) when compared with the control patients . there was no difference with respect to other biochemical parameters ( i.e. plasma creatinine and urea and serum haemoglobin values ) . cc patients showed values ranging from 8.9% to 30.8% of body weight loss during the previous 6 months and creactive protein higher than 5 g / ml , as well as increased levels of interleukin ( il)6 ( 12.6fold and 9.4fold , respectively , p < 0.001 ) compared with control , indicating that the studied cachectic patients demonstrated weight loss and increased plasma inflammatory markers . wsc patients showed values ranging from 3.2% to 5.4% of body weight loss during the previous 6 months and creactive protein values ranging from 1.2 to 10.7 5 g / ml . cancer cachexia patients showed body weight loss and bmi reduction , suggesting the possibility that modification of at cell morphology may be a response to cc . in order to address this question , we determined cell perimeter and the crosssectional area in samples of the subcutaneous depot ( figure 1 ) . light microscopy examination indicates that morphometric alteration of scat is only evident in the cc group ( figure 1a c ) . in scat from cc , adipocyte size , determined as sectional area ( figure 1d ) , and cell perimeter ( figure 1e ) showed a decrease of 32.9% ( p < 0.05 ) and 18.5% ( p < 0.05 ) , respectively , compared with the control samples . haematoxylin and eosin stained sections of subcutaneous tissue from ( a ) weightstable subjects and control , ( b ) weightstable cancer ( wsc ) patients and ( c ) cancer cachexia ( cc ) patients . morphometric analysis of sectional area ( d ) and ( e ) perimeter of adipocytes from different experimental groups . photomicrographs ( a c ) illustrate the most representative images considering data related to morphological analysis ( d , e ) . when examined under polarized light microscopy , the same samples from cc patients demonstrated that types i ( red label ) and iii ( green label ) collagen fibres were present around the adipocytes , in organized bundles of various thicknesses ( figure 2a f ) . as compared with control patients , cc samples showed an increase of 1.7fold ( p < 0.01 ) of total type i collagen , no changes in type iii collagen ( p = 0.10 ) and an increase in collagen i iii ratio ( p = 0.0159 ) ( figure 2g h ) . type i collagen fibres are orange to red , whereas the thinner type iii collagen fibres appear yellow to green from ( a , b ) weightstable subjects and control , ( c , d ) weightstable cancer ( wsc ) patients and ( e , f ) cancer cachexia ( cc ) patients . total collagen quantification in cachexia and control patients of ( g ) type i collagen and ( h ) types i iii ratio . taking into account the scope of data regarding at remodelling induced by cachexia , notably the modification in total collagen density ( fibrosis ) , we also examined the presence of inflammation and infiltrated cells in scat from the patients . immunostaining for macrophages ( cd68 ) , tlymphocytes ( cd3 ) and neutrophils ( cd15 ) and analysis of gene expression of mcp1 and cd68 were carried out ( figures 3 , 4 , 5 ) . identification of different immune cell types present in subcutaneous adipose tissue obtained from cancer cachexia patients . serial sections of weightstable subjects and control , weightstable cancer ( wsc ) patients and cancer cachexia ( cc ) patients were stained with markers of macrophages ( cd68 ) , tlymphocytes ( cd3 ) and for neutrophils ( cd15 ) . immunohistochemistry for immune cells from weightstable subjects and control , weightstable cancer ( wsc ) patients and cancer cachexia ( cc ) patients . subcutaneous adipose tissue ( scat ) macrophages localize to crownlike structures ( cls ) around individual adipocytes , which increase in frequency with cancer cachexia . light microscopy of scat of cc patients showing cd68 immunoreactive macrophages ( brown colour ) aggregated to numerous ( c , cc patients ) cls among unilocular adipocytes . cd3 immunoreactive tlymphocyte shows positive cells in fibrotic areas , stained with dab ( brown colour ) ( arrow ) . bar ( m ) : 50 m for a and b ; 25 m for c and d. expression levels of genes involved in the inflammation of subcutaneous adipose tissue depots in subjects from different experimental groups . realtime pcr analysis of rna isolated from weightstable subjects and control , weightstable cancer ( wsc ) patients and cancer cachexia ( cc ) patients . mrna levels of target genes were normalized to 18 s. values are mean sem for five to nine samples per group . although the presence of cd15 neutrophils was minimal in cc , we observed an abundant number of macrophages stained with cd68 surface markers in the groups ( cc and wsc ) ( figure 3 ) . additionally , in tissue sections stained for cd68 positive cells , we found higher intensity that was more pronounced in the surrounding of adipocytes [ crownlike structures ( cls ) ] in cc ( figure 4a , c ) . however , crown aggregates were not extensive , and there was no signal of syncytial giant cells . less frequently , sections for cd3 positive cells showed irregular distribution more often observed in the scat fibrotic areas from cc ( figure 4b , d ) . cd68 mrna expression increased in scat obtained from cc patients ( 109fold , p = 0.029 , respectively ) , when compared with the control group ( control vs. cc ) . in scat of wsc , an increase of 48fold in mcp1 mrna levels was detected , when compared with the control group ( p = 0.010 ) ( figure 5 ) . the present study documents , for the first time , increased number of atms in scat obtained from gastrointestinal cachectic cancer patients . one such change was accompanied by ecm remodelling and associated with adipocyte size reduction and at atrophy . fibrosis was detected , as well as the presence of distinct patterns of fibrous material surrounding adipocytes , while collagen fibre organization was altered in scat samples obtained from cancer patients . in this aspect , markedly increased total collagen amounts were found in the cachectic patients while being already mildly increased in the cancer ( weight stable ) patients . interestingly , such structural modification of scat was accompanied by increased inflammatory cells subset presence , which was more conspicuous in the cachectic patients . cd68labelled atms localized to crowns surrounding adipocytes and expressed higher mrna levels of scavenger receptor ( cd68 ) , as well as chemokine attractant for macrophages ( mcp1 ) . additionally , cd3 ly was more abundant in the fibrotic areas in scat samples from cachectic patients , in a different fashion compared with infiltrated atms . the hallmark of cc is body weight loss.30 , 31 loss of muscle and at mass , anorexia , anaemia and alterations in metabolism are also evident during the development of the disease . in particular , at catabolism followed by tissue mass depletion ( atrophy ) and metabolic dysregulation are consistent and prominent findings in cc patients.1 , 9 , 10 , 31 , 32 in this aspect , the present study shows adipocyte size reduction in scat of cachectic cancer patients . at atrophy induced by cachexia has been consistently demonstrated in both patients7 , 33 and animal models.9 , 34 in cc , longitudinal investigation has suggested that fat loss is not only due to loss of adipocyte volume ( lipolysis)29 , 34 , 35 but also may be attributed to a decrease in lipid accretion in these cells,36 both resulting in a smaller cell.37 recently , a welldesigned investigation8 showed consistent evidence that lipases in at breakdown stored fat , contributing to cancerassociated cachexia . however , despite several studies having consistently shown at atrophy as a result of cachexia , the associated mechanisms are still not fully elucidated . another aspect addressed was ecm fibrosis , in order to assess whether there was at remodelling in this scenario . simultaneously , an increase in both types i and iii collagen content was observed in these patients , whereas in wsc , only a discrete change detected in type i collagen was found . a recent microarray data analysis from scat of cachectic patients demonstrated a possible connection between regulation of energy turnover , cytoskeleton and ecm , with loss of at.38 in an animal model of cachexia , at fibrosis was demonstrated by ultrastructural analysis showing severe delipidation and alterations in cell membrane conformation , irregular cytoplasmic projections and increased electrondense mitochondria . an enhanced level of collagenfibril staining was also evident in the tumourbearing group.39 in fact , the ecm is one of the most important regulators of cellular and tissue function in the body.40 disruption in ecm leads to marked metabolic dysregulation and failure to expand at in both obese patients and experimental obesity ( high fat diet and ob / ob knockout).41 in the same way , at reduction as induced by a body weight reduction programme was shown to result from modified ecm gene expression profile.42 in obese patients , body fat loss as a consequence of gastric bypass was associated with increased fibrosis in fat depots after a 3 month to 1 year postsurgery period.43 however , even considering the important role of ecm to at homeostasis , there is limited information regarding quantitative emc analysis in cachectic cancer patients . the few studies that have addressed this question propose that at solely adjusts its extracellular environment to adapt to the shrinking volume of the fat cells.11 , 38 contrary to this view , we show a robust increase in total collagen content and additionally , that , even before any morphofunctional disruption in at occurs , as reported for wsc patients , at is already affected by the syndrome . indeed , it seems that the process of at remodelling induced by cachexia is triggered before any of the clinical signs of the disease . as described above , several researchers have shown that at ecm remodelling is a crucial event to accommodate obesityinduced cellular alterations . one such process has also been described to be the end point of a persisting inflammatory stimulus ( unresolved chronic inflammation ) in at , which may be responsible for the excessive synthesis of ecm components and subsequent interstitial deposition of fibrotic material.44 , 45 there are , however , no studies , to our knowledge , that describe the nature of the inflammatory infiltrate in the at of cachectic patients . one previous study by our group demonstrated that at , in particular , scat , contributes in a significant manner to systemic inflammation , as a potent source of inflammatory factors.10 we presently show an accentuated modification in gene expression , as well as in plasma concentration of adipokines and proinflammatory molecules in cachectic gastrointestinal cancer patients , in relation to their noncachectic counterparts . furthermore , in the present study , we provide new information in regard to the inflammatory cells found in the at of cc patients . tissue sections stained for cd68 atms positive cells show a higher intensity for the macrophage marker , especially in the surrounding surface of adipocytes ( cls ) in cc . however , crown aggregates were not as cell dense as those normally described in obesity , and there was no signal of occasional coalescence to form syncytial giant cells . in a different way , we previously hypothesized that infiltrating atms may play an important role(s ) in cachexiaassociated at remodelling , based on our observation that atms in cachectic rats and humans are placed surrounding or in close proximity to the adipocytes.46 in addition , we demonstrated that atms aggregates display a cls pattern . this may be a consequence of an increased lipid scavenging function of atms , induced by cc . in obesity , a positive relationship between infiltrating atms and at remodelling has been demonstrated.41 , 47 , 48 , 49 in particular , cls are described at sites of adipocyte death . such structures are related with envelopes and ingest the moribund adipocyte and its potentially cytotoxic remnant lipid droplet.47 consequently , cls become lipidladen foam cells47 frequently observed in at in obesity . in an animal model of cachexia , we have shown46 that foamcell resembling macrophages are present in the at . during cc , increased lipolysis has been consistently demonstrated in both patients7 , 11 and animal models9 , 32 and that might be an important source of lipids to atms . in tumourbearing animals , lipid profile was modulated by the cachectic state in an anatomical regionrelated pattern . visceral at composition is changed and presents increased storage of monounsaturated fatty acids ( 16:1 ) , as well as decreased percentage of stearic acid , a saturated fatty acid.50 in the same animal model , abundant lipid inclusions were found in infiltrated atms in the mesenteric depots obtained from cachectic rats . those cells also exhibited increased tumour necrosis factor secretion when stimulated with lipopolysaccharide.45 however , this aspect was not assessed in the present study . infiltrating inflammatory cells secrete proinflammatory mediators that are enhanced in the scat of cc patients.10 upregulation of il6 has been a consistent finding in several studies , notably in cachectic patients , independent of the aetiology of the syndrome.51 we previously demonstrated that plasma il6 is markedly increased during cachexia , a result that may represent an interesting tool for diagnostic purposes . although our previous study reported increased inflammatory cytokine profile gene expression in scat samples from cc patients , we herein show that cd68 gene expression was also increased in scat from these patients , corroborating the observation that cd68 atms positive cells were more abundant in the same situation . interestingly , mcp1 gene expression was solely augmented in wsc samples , with no changes in cc patients . atms infiltrate to at as circulating monocytes in response to at secretion of mcp1 , which recruits monocytes expressing the cc chemokine receptor type 2 . this is one of the initial steps to trigger inflammatory response and consequently increase ms subset in at . in cc , high mcp1 levels found in wsc might be suggestive of a precachexia stage , once increased gene expression of cd68 , il6 and il10 was already demonstrated in such cc patients11 . however , the relationship between mcp1associated atms augment and the initial signals of cachexia , as well as the importance of this process for the development and progression of cachexia complications , remains unclear . the brazilian patients enrolled may not be representative of a typical cancer patient population from europe or north america and some differences concerning total fat mass of patient in the cancer groups , and overweight and obesity prevalence should be considered . cachectic groups showed values ranging from 9% to 31% of body weight loss in the previous 6 months and creactive protein ranging from 4.9 to 77 g / ml , indicating that we studied patients staging between cachexia and refractory cachexia . regarding the wsc patients , some of them could be perhaps considered precachectic , once they showed values ranging from 3.2% to 5.4% of body weight loss in the previous 6 months and creactive protein values ranging from 1.2 to 10.7 5g / ml . however , there was no difference when compared with controls , and we have not attempted to adopt this staging system to classify cc , due to the relatively small sample . the current study was addressed to assess the effect of cachexia and tumour per se but was not empowered to detect differences between different tumour types . however , the study was powered to detect the observed differences in fibrosis and inflammation in scat . we report consistent modification consisting of fibrosis and inflammatory cell presence in scat induced by cachexia in gastrointestinal cancer patients . the latter was characterized by the presence of cls composed of cd68 positive atms surrounding adipocytes , and increased cd3 ly , more evident in the fibrotic areas . in addition , some of these changes were already present in the cancer group , suggesting that at disruption may occur at a precocious stage of cachexia , even before the detection of precachexia clinical features . in this particular , increased mcp1 and cd68 gene expression in scat of cancer patients may indicate an important role of these inflammatory mediators as early biomarkers of cancer .

abstractbackground and aimscachexia is a syndrome characterized by marked involuntary loss of body weight . recently , adipose tissue ( at ) wasting has been shown to occur before the appearance of other classical cachexia markers . we investigated the composition and rearrangement of the extracellular matrix , adipocyte morphology and inflammation in the subcutaneous at ( scat ) pad of gastrointestinal cancer patients.methodssurgical biopsies for scat were obtained from gastrointestinal cancer patients , who were signed up into the following groups : cancer cachexia ( cc , n = 11 ) , weightstable cancer ( wsc , n = 9 ) and weightstable control ( noncancer ) ( control , n = 7 ) . the stable weight groups were considered as those with no important weight change during the last year and body mass index < 25 kg / m2 . subcutaneous at fibrosis was quantified and characterized by quantitative pcr , histological analysis and immunohistochemistry.resultsthe degree of fibrosis and the distribution and collagen types ( i and iii ) were different in wsc and cc patients . cc patients showed more pronounced fibrosis in comparison with wsc . infiltrating macrophages surrounding adipocytes and cd3 ly were found in the fibrotic areas of scat . subcutaneous at fibrotic areas demonstrated increased monocyte chemotactic protein 1 ( mcp1 ) and cluster of differentiation ( cd)68 gene expression in cancer patients.conclusionsour data indicate architectural modification consisting of fibrosis and inflammatory cell infiltration in scat as induced by cachexia in gastrointestinal cancer patients . the latter was characterized by the presence of macrophages and lymphocytes , more evident in the fibrotic areas . in addition , increased mcp1 and cd68 gene expression in scat from cancer patients may indicate an important role of these markers in the early phases of cancer .