article
stringlengths 0
328k
| abstract
stringlengths 261
2.35k
|
|---|---|
formaldehyde is a strong antibacterial and preservative that is utilized for controlling microbial growths in water containing solutions and organic materials .
formaldehyde is a gaseous and colorless molecule at room temperature and it is readily soluble in water .
this compound is a strong antibacterial and very low cost preservative so producers use it in liquid detergents and cosmetic products instead of other preservatives .
the hazard of formaldehyde has been reported which found enough evidence for the mutagenicity and carcinogenicity of this compound [ 1 , 2 ] .
it is an irritating agent to the respiratory zone and eye which can cause allergic contact dermatitis or eczema ( drying and reddening of the skin ) at high concentration .
the formaldehyde and formaldehyde releasing preservative is widely used in surfactants , dishwashing liquids , cosmetic products particularly hair shampoos , and care products such as hair straightening products .
toxicology of formaldehyde has been widely discussed and studies have indicated the highest risk for individuals with a daily contact with this substance [ 4 , 5 ] .
the use of formaldehyde as a preservative is allowed to a maximum concentration of 0.2% in detergent and cosmetic products ( with the exception of nail polish for which a concentration up to 5% is allowed ) . due to allergic potential of formaldehyde , liquid detergents and cosmetic products
contain formaldehyde when there is a minimum content of 0.05% free of this substance [ 6 , 7 ] . because of the above reasons and the influence of formaldehyde in human bodies ,
various methods have been developed for determination of formaldehyde in some detergents and cosmetic products including high performance liquid chromatography ( hplc ) [ 811 ] , headspace solid phase microextraction by gas chromatography ( gc ) , and isotope dilution mass spectrometry [ 12 , 13 ] , fluorimetry , and spectrophotometry [ 15 , 16 ] .
various reagents have been proposed for derivatization of formaldehyde by spectrophotometry [ 1721 ] and also fluorimetry [ 2226 ] . however , spectrophotometric method is not sensitive enough for the analysis of real samples and sometimes subject to numerous interferences which are serious problems .
examined several novel reagents for detection of formaldehyde based on the hantzsch reaction which were benzoylacetone , n - methyl acetoacetamide , n - acetoacetyl - o - toluidine , and acetoacetanilide ( aaa ) used in fluorimetry . in this study ,
the proposed method is based on the hantzsch reaction , which involves the cyclization between 2-methyl acetoacetanilide and formaldehyde in the presence of ammonium acetate .
the derivatization reaction of formaldehyde with 2-methyl acetoacetanilide is shown in scheme s1 ( see supplementary material available online at http://dx.doi.org/10.1155/2016/1720530 ) .
the aim of this study is applying fluorescence spectroscopy to routine determination of formaldehyde in detergents and cosmetic products .
fluorescence spectroscopy as an analytical technique has the advantage of selectivity and sensitivity in comparison with other spectroscopic methods .
although this method may be efficient in some experiments , it is not effective while there are several independent variables and interaction influences affecting the responding factors .
design of experiments ( doe ) is a powerful technique used for discovering a set of variables ( or factors ) which are most important to the process or experiment and then determining what levels of these factors must be kept to optimize the process performance .
optimization strategy sets several experiments that can determine all factors and probable interactions between these independent variables .
when the responses are influenced by several factors , response surface methodology ( rsm ) is a useful tool of modeling with a collection of statistical and mathematical techniques .
the box - behnken design is a second - order design under rsm that requires 3 levels of each factor ; it is reliable , less laborious , efficient , cost - effective , providing sufficient data on the influence variables and decreasing the number of experimental trials and overall experiment error with a minimum number of experiments .
stock solution of 2-methyl acetoacetanilide ( 0.3 m ) was prepared by dissolving 5.73 g of 2-methyl acetoacetanilide ( aldrich pure chemicals , germany ) in 50 ml of ethanol and diluting it to 100 ml with distillation water . an ammonium acetate stock solution was prepared by dissolving 54.00 g of ammonium acetate ( merck pure chemicals , germany ) in the water and diluting it to 100 ml with the purified water .
the ph of ammonium acetate was adjusted as 7.5 by addition of 0.1 m naoh . a 0.10 m standard solution of formaldehyde
was prepared by diluting 0.9 ml of 30.0% formaldehyde solution to 100 ml with distillation water , followed by an accurate concentration determination using the iodometric method before analysis since formaldehyde is volatile .
formaldehyde reacts with potassium iodide solution and iodine is back - titrated with standard solution of sodium thiosulphate in the presence of starch indicator .
the working standard solutions were daily prepared by accurate dilution of the standard stock solution . for interference testing , the following compounds were used : sodium chloride , iron ( iii ) nitrate , nickel , lead and cadmium ( ii ) nitrate , calcium and magnesium ( ii ) chloride , benzaldehyde , propionaldehyde , and acetaldehyde .
a photoluminescence spectrometer ls55 ( perkinelmer , uk ) was employed for spectral measurements . a ph meter model 691 ( metrohm , swiss ) , heater stirrer ( gerhardt , germany ) , and analytical balance model r160p ( sartorius , germany ) were applied .
hnmr spectra were recorded on bruker avance-400 mhz spectrometers in the presence of tetra methyl silane as internal standard .
box - behnken design contains numbers of design points and a repeated center point for calculating of error .
box - behnken design does not contain an embedded factorial design like the central composite design and instead of design points there are the midpoints and it requires 3 levels ( 1 , 0 , and + 1 ) for each factor .
the box - behnken design can be considered a highly fractionalized three - level factorial design where the treatment combinations are the midpoints of edges of factor levels and the center point .
these designs are rotatable ( or nearly rotatable ) and require three levels each under study factors
. box - behnken design can fit full quadratic response surface models that it does not contain an embedded factorial or fractional factorial design and does not contain axial points so all design points are sure to be within safe operating limits . in this design ,
the treatment combinations are at the midpoints of edges of the process space and at the center .
the advantages of the box - behnken design over other response surface designs are as follows : ( a ) it needs fewer experiments than central composite design ( less points ) ; ( b ) in contrast to central composite designs , it has only three levels ; ( c ) it is easier to arrange and interpret than other designs ; ( d ) it avoids combined factor extremes since midpoints of edges of factors are always used . in this work , because of derivatization reaction of formaldehyde depending on five factors in three levels , we employed the response surface method and box - behnken design to optimize the independent factors that are effective on the response . in order to reduce the effects of unexplained variability in the real responses due to irrelevant parameters , the experiments were done in randomized order .
then , a second - order quadratic equation was fitted to the data by multiple regression procedure . the generalized response surface model for a five - factor system is shown by ( 1)yi=0+1x1+2x2+3x3+4x4+5x5+11x12+22x22+33x32+44x42+55x52+12x1x2+13x1x3+14x1x4+15x1x5+23x2x3+24x2x4+25x2x5+34x3x4+35x3x5+45x4x5,where yi is the predicted response , xi values ( i = 1 , 2 , 3 , 4 , and 5 ) are the independent variables , 0 is the intercept ( constant ) , 1 , 2 , 3 , 4 , and 5 are linear coefficients , 11 , 22 , 33 , 44 , and 55 are squared coefficients , 12 , 13 , 14 , 15 , 23 , 24 , 25 , 34 , 35 , and 45 are interactions coefficients . in this work ,
five studied factors consist of reaction time ( x1 ) , % v / v ethanol ( x2 ) , ammonium acetate concentration ( x3 ) , 2-methyl acetoacetanilde concentration ( x4 ) , and temperature ( x5 ) on the analytical signal .
minitab14 as a statistical software package was used for data processing , studying linear terms , squared terms , and interaction between the variables .
a box - behnken design was applied to estimate the correlation of the five independent factors , with three levels for each factor . in this study ,
the name of independent effective factors and their coded levels scheme of box - behnken design are shown in tables 1 and s1 , respectively .
the optimum values were calculated for effective parameters on derivatization reaction for 50 gkg of formaldehyde .
the optimum value of each variable was calculated through codes and their corresponding values to be encoded ( actual ) with minitab14 software ( table 2 ) .
additionally , the optimum response values of each factor can be obtained by the graphical analysis of the surface related to each equation obtained by minitab software ( figures s1 and s2 ) .
the effects of efficient parameters , regression coefficients , and the associated standard errors for derivatization reaction of formaldehyde are shown in table s2 .
the excitation and emission spectra were obtained with 2-methyl acetoacetanilide in the presence and in the absence of formaldehyde .
the maximum wavelengths of excitation and emission were 360 and 460 nm , respectively .
figure 1 shows maximum excitation and emission wavelength for product of formaldehyde derivatization with 2-methyl acetoacetanilide .
the calibration curve for determination of formaldehyde was constructed under the optimum condition summarized in table 2 . for fluorometric measurements ,
emission spectra of 020 10 m of formaldehyde were recorded ( figure 2 ) .
the fluorescence response was linear in the formaldehyde concentration range of 0.3320 10 m ( 160 gkg ) .
the equation of the calibration graph for 0.3320 10 m was expressed as y = 40.12x + 42.12 , where y is the fluorescence intensity and x is the formaldehyde concentration , with a correlation coefficient of 0.997 . as hnmr spectroscopy is a perfect method for characterization of chemicals , this method was used for characterization of the hantzsch product .
all protons of hantzsch product were correctly determined in the hnmr : = 2.4 ppm : 12h ( 4 ch3 ) .
according to the hnmr data ( figure s3 ) , we conclude that the hantzsch product was successfully synthesized and purified . in the hnmr spectra
, the signals of methyl groups joined to the double bond and benzene ring appear as signals at = 2.4 and 2.27 ppm , respectively .
the nh protons related to amino group appears in = 5.16 ppm ( figure s4 ) , while nh signal related to amino groups is shown in 7.86 and 7.87 ppm , respectively .
the signals about = 7.07.5 ppm assigned by proton of ch - ch of aromatic rings in the product spectrum ( figure s5 ) .
the limit of detection is calculated as the concentration corresponding to three times of the baseline noise ( s / n = 3 ) .
the proposed methodology was applied for the analysis of iranian brands of liquid detergents and cosmetic products .
some of these products contained detectable amounts of formaldehyde that were higher than the maximum allowed concentration of 0.2% .
for evaluation of the precision and accuracy of the proposed method , spiking experiments were performed . in table 4
, we spiked 50 mgkg of formaldehyde to surfactant , hair shampoo , body shampoo , and hand cleaner which have no free formaldehyde . after spiking experiments , recovery factors
were then calculated according to the following equation ( the results are shown in table 4):(2)recovery factor=100crecoveredctrue , where crecovered is the measured concentration after adding known concentration of the analyte to the real sample and ctrue is the expected concentration . in table 5 , we spiked 3 , 5 , and 8 gkg of formaldehyde to dishwashing liquid 1 and hair shampoo 1 that contain formaldehyde . after spiking experiments , recovery factor and relative standard errors
the use of formaldehyde as a preservative in liquid detergents such as dishwashing liquids and cosmetic products such as hair and body shampoos and shower gel is allowed to a maximum concentration of 0.2% , that is , 600 mgkg .
considerable decreasing in the content of formaldehyde occurs after a few months in detergents and cosmetic products .
the effect of various spectral interferences possibly present in the real detergent samples was investigated .
detergents and cosmetic products such as hair and body shampoos contain water ( about 70% ) , surfactants as a cleaning and foaming agent ( about 25% ) , and additives ( about 5% ) such as colors , fragrances , and other compounds .
three - dimensional florescence spectrum of a shampoo sample was recorded after derivatization of formaldehyde ( figure s6 ) . to generate three - dimensional fluorescence ,
excitation wavelengths between 200 and 400 nm with 10 nm intervals and emission wavelengths between 250 and 500 nm with 0.5 nm intervals were used .
the tolerable concentrations are defined as the concentration of foreign species causing less than 5% relative error .
the influences of foreign species were examined by adding a certain amount of species in 1.0 10 m hcho solution .
the hantzsch reactions with some diketones analogues reagents are usually slow and therefore detection reactions must be carried out at higher temperature than room temperature .
the effect of reaction temperature on signal intensity in reaction of 2-methyl acetoacetanilide with formaldehyde was examined by varying it from 20 to 60c .
the results obtained are shown in figure s7 that , in the temperature over 30 , the fluorescence intensity is decreased .
the experimental design results show that 27c is the optimum temperature ; thus , above 28c , the intensity gradually decreased with increasing temperature .
however , for convenient operation , 25c ( room temperature ) was selected . in the reaction of formaldehyde with the 2-methyl acetoacetanilide reagents ,
the preliminary examination showed that the fluorescence intensity of product of formaldehyde with 2-methyl acetoacetanilide in acetate buffer was much higher than that in phosphate buffer .
replacement of ammonia by ammonium acetate allowed the efficient synthesis of hantzsch 's compounds under mild conditions .
the effect of ph on the sensitivity was investigated in the range of ph 5.08.0 using ammonium acetate as buffers .
the results obtained are shown in figure s8 , which indicates that , in the ph range over 6.57.5 , the fluorescence intensity is increased , and above ph 7.5 , the fluorescence intensity becomes decreased . from these results ,
the ph of ammonium acetate was adjusted as 7.5 . despite the official regulation , high contents of formaldehyde in detergent and cosmetic products
have been reported in iranian brand of these products but producers have labeled their products formaldehyde free .
our results confirmed that the risk of cosmetic and detergent formulations with formaldehyde above 0.2% is not negligible , as these products may facilitate considerable exposure of formaldehyde for consumers . after spiking experiments ,
comparison of the predicted concentrations and recoveries provided by the proposed method shows a good predictive ability towards the spiked liquid detergents and cosmetic products for determination of formaldehyde with 2-methyl acetoacetanilide by photoluminescence method .
the stability of formaldehyde has been determined in dishwashing liquid 1 and hair shampoo 1 .
the media of cosmetic and detergent products contain water and organic compounds such as surfactants and additive compounds such as colors and fragrances that bacteria could grow easily .
it is evident from table 6 which considerable decreasing occurs in free formaldehyde content after a few months of controlling microbial growths in water containing solutions and organic material .
the effect of various spectral interferences possibly present in the real detergent samples was investigated .
three - dimensional florescence spectrum of a shampoo sample was recorded after derivatization of formaldehyde ( figure s6 ) . in figure s6 , there is no overlap spectrum between compound in shampoo and product of formaldehyde derivatization .
the results are not acceptable if there is spectral overlap between product of formaldehyde derivatization and other compounds in real samples . in order to remove spectral overlap , second - order calibration such as three - way methods
these algorithms can be applied with great success to identify and quantify overlapped fluorophores . due to the unique solution of three - way methods ( e.g. , parallel factor analysis )
nickel , lead , and cadmium did not affect up to 100-fold excess over formaldehyde did not interfere .
iron ( iii ) interfered with determination of formaldehyde at a concentration ratio more than 50 .
these results indicate that the proposed method has good selectivity for determination of formaldehyde ( table 7 ) . in this research ,
a rapid , simple , and selective method was developed for determination of formaldehyde in detergents and cosmetic products . by spiking known concentration of formaldehyde to the real samples ,
the accuracy of the proposed methods was validated and recoveries of the spiked value were calculated .
the proposed method minimizes an additional extraction step and consumption of expensive hazardous and environmentally unfriendly organic solvents and allows saving time compared with liquid and gas chromatography methods .
in addition , the expanses of gc / ms systems are high , operation system is not easy and unavailable in many laboratories , and a separation step was needed to remove the possible matrix effect of detergents and cosmetic products samples .
the reaction of formaldehyde with 2-methyl acetoacetanilide was done in room temperature in comparison with other regents such as acetylacetone or fluoral p that need high temperature and longer reaction time .
the proposed methodology was applied for the analysis of different iranian commercial brands of liquid detergents and cosmetic products .
some brands of these products have measurable amounts of formaldehyde that were higher than the maximum allowed concentration of 0.2% .
the obtained investigation suggests that consumer and user information are required to warn about the highest risks of using detergents and cosmetic products with high formaldehyde content because of allergenic potential and evidence for carcinogenicity of this substance . the results in table 8 show comparison between the proposed method and other methods . | formaldehyde is commonly used in detergents and cosmetic products as antibacterial agent and preservative .
this substance is unfavorable for human health because it is known to be toxic for humans and causes irritation of eyes and skins .
the toxicology studies of this compound indicate risk of detergents and cosmetic formulations with a minimum content of 0.05% free formaldehyde .
therefore , determination of formaldehyde as quality control parameter is very important . in this study ,
a photoluminescence method was achieved by using 2-methyl acetoacetanilide .
also , the box - behnken design was applied for optimization of hantzsch reaction for formaldehyde derivatization .
the investigated factors ( variables ) were temperature , % v / v ethanol , reaction time , ammonium acetate , and 2-methyl acetoacetanilide concentration .
the linear range was obtained from 0.3320 107 m
( 160 gkg1 ) and the limit of detection ( lod ) was 0.12 gkg1 .
the proposed method was applied for the analysis of iranian brands of liquid detergents and cosmetic products .
the formaldehyde content of these products was found to be in the range of 0.033.88%
. some brands of these products had higher concentration than the maximum allowed concentration of 0.2% .
high recoveries ( 96.15%104.82% ) for the spiked dishwashing liquid and hair shampoo indicate the proposed method is proper for the assessment of formaldehyde in detergents and cosmetic products .
the proposed methodology has some advantages compared with the previous methods such as being rapid , without the necessity of applying separation , low cost , and the fact that the derivatization reaction is carried out at room temperature without any heating system . |
pediatric and adolescent urolithiasis has drawn increasing attention of late owing to its increasing morbidity and high recurrence rate .
extracorporeal shock wave lithotripsy ( eswl ) was introduced by chaussy et al . in the 1980s , and the first report of successful eswl in children was published in 1986 .
thereafter , several reports showed the safety as well as the stone - free rates of eswl , which were comparable with those of adults [ 3 - 5 ] . recently , the long - term safety of eswl in children was also proven . in eswl ,
shock waves are generated by a source ( lithotripter ) outside the patient 's body and are then propagated into the body and focused on a renal stone , with the goal of fracturing the stone to allow the passage of the stone fragments via the urinary tract .
this procedure has become more widely available throughout the world and has come to be considered a first - line treatment for the minimally invasive management of pediatric and adolescent urolithiasis .
although eswl is widely accepted throughout the world as a first - line treatment modality , and although various studies have been conducted on it , its role in the management of pediatric and adolescent patients has not been fully established .
furthermore , the endourological procedures available ( e.g. , ureteroscopy , percutaneous nephrolithotomy ) have been used owing to their high single - use probability in pediatric and adolescent urolithiasis .
thus , the efficacy of eswl by age and current condition as a first - line treatment modality for pediatric and adolescent urolithiasis was retrospectively evaluated in this study .
the computerized patient records at the authors ' institute were retrospectively reviewed from march 1991 to july 2007 .
a total of 55 patients who were below 18 years of age and who underwent eswl monotherapy for urolithiasis were included in the study .
there were 36 boys ( 65.5% ) and 19 girls ( 34.5% ) with a mean age of 8.5 years ( range , 0.5 - 18 years ) .
prior to treatment , all patients were routinely evaluated ( i.e. , determining the medical history , physical examination , serum renal function test , serum coagulation test , and urine analysis and culture ) .
the patients with coagulation disorders , sepsis , and nonfunctioning kidneys were excluded from the study . for stone localization and site and size assessment , plain x - ray , intravenous urography , renal ultrasonography , and/or computed tomography scan
the stones were found to be localized in the lower , middle , and upper ureter and in the renal pelvis ( staghorn stone ) and renal calyx .
eswl was performed with a medispec extracorporeal shockwave lithotripter e-3000 ( medispec , yehud , israel ) .
the therapeutic power was started from 15 kv and increased in steps up to 20 kv .
the mean number of shocks was 700 - 1,000 per session , and the pulse frequency was 60 shocks per minute .
general anesthesia was required for all patients aged 7 years or less and for nine patients above 7 years of age ( 29.0% ) .
the other patients did not need anesthesia ; instead , fentanyl 2 - 2.5 g / kg was administered to them for pain control .
the eswl sessions were performed with the patient in the supine position for the renal and upper ureteral stones and with the patient in the prone or supine position for the middle and lower ureteral stones .
the patients were examined 2 weeks after each session via kidney - ureter - bladder and renal ultrasonography to assess stone fragmentation and the presence of renal obstructions .
if additional sessions were needed , one such session was held on a weekly basis .
eswl success was defined as stone - free status or the presence of clinically insignificant residual fragments .
the clinically insignificant residual fragments were asymptomatic , noninfectious , and nonobstructive fragments smaller than 3 mm at 3 months of follow - up .
eswl failure was defined as the continued presence of the rest of the stones and fragmentation after 3 months of follow - up or the nonreduction of the stone size after three sessions of eswl .
of the patients studied , 28 ( 50.9% ) were found to have right - kidney stones , 22 ( 40% ) had left - kidney stones , and 5 ( 9.1% ) had bilateral stones .
there were 30 patients ( 54.5% ) with renal stones ( including two staghorn stones ) and 25 ( 45.5% ) with ureteral stones ( upper , 14 patients ; mid , 2 patients ; lower , 9 patients ) .
the mean size of the stones was 9.48 mm ( range , 4 - 22 mm ) .
the mean number of eswl sessions was 2.02 ( range , 1 - 10 ) . in the patient group aged 7 years or less ,
the mean number of eswl sessions was 1.16 ( range , 1 - 2 ) , and in the patient group older than 7 years , it was 2.97 ( range , 1 - 10 ) .
there was no statistically significant difference between the two groups , however , in urinary tract infection , stone size and location , or congenital renal abnormality .
general anesthesia was required in all the patients aged 7 years or less and in nine patients older than 7 years ( 29.0% ) owing to poor cooperation .
the mean number of eswl sessions of the nine patients older than 7 years who received general anesthesia was 2.2 .
this result also showed a statistically significant difference from the younger patient group ( p=0.042 ) ( table 1 ) .
there was no statistically significant difference between the patient group aged 7 years or less and the patient group aged more than 7 years ( 91.7% vs. 90.3% ) .
complications developed after eswl in three patients ( 5.5% ) , and two patients required intervention owing to steinstrasse . in the patient group older than 7 years , one patient had acute pyelonephritis .
two patients required intervention owing to steinstrasse , one in the younger group and one in the older group ( table 2 ) .
after the initial report that a large series of eswl in children had shown complications , safety and stone - free rates comparable to those in adults were reported in 1986 , and the safety and efficacy of eswl have been shown in children . even though eswl is widely accepted as a first - line treatment modality throughout the world , its role in the management of pediatric and adolescent patients has not been fully established .
the recent refinement of the endoscopic management of urinary stone disease almost enabled it to replace open surgery in children .
both eswl and ureteroscopy had satisfactory curative effects in the treatment of pediatric ureteral stones .
several authors have reported high success rates with ureteroscopy ( 80 - 100% ) [ 13 - 15 ] or percutaneous management of urinary stones ( 79 - 88% ) in children , with minimal morbidity . notwithstanding these reported good surgical outcomes ,
the dilation of the ureteral meatus with ureteroscopy in children may result in vesicoureteral reflux .
in addition to this risk , urethral injury and stricture in males and ureteral damage in both sexes may develop postoperatively .
ureteroscopes less than 6.9 fr in diameter have been used of late for the treatment of ureteral stones in children , without dilation of the ureteral meatus , but the technical requirement for ureteroscopy in children is much higher than in adults .
thus , endourological management is generally reserved as an ancillary procedure for failed eswl owing to its comparable success rate and higher safety profile . in children ,
eswl success was defined in this study as a radiographically stone - free status with no infection at 3 months of follow - up . in this study ,
the overall success rate was 90.9% , and the younger ( 7 years ) and older ( > 7 years ) age groups showed similar results ( 91.7% and 90.3% , respectively ) .
this result is comparable to the success rates reported by other eswl series , with stone - free rates in children in the range of 75% to 98% [ 21 - 23 ] .
the patient was treated with intravenous hydration , antiemetics , analgesics , and antibiotics until pain - free and able to tolerate oral intake .
steinstrasse developed in two patients ( 3.6% ) , one in the younger age group ( 4.2% ) and one in the older age group ( 3.2% ) . in the patient in the younger age group ,
the data obtained in the present study are similar to those obtained in other studies .
the general complaints were pain in the treated side ( 23.6% ) , hematuria ( 36.3% ) , and fever ( 3.6% ) .
all the general complaints were well controlled by oral hydration and nonsteroidal anti- inflammatory drugs , without other complications .
compared adult and pediatric ureters in transporting fragments following eswl and found better stone clearance by pediatric ureters .
this outcome is probably due to the fact that shock waves are transmitted with little loss of energy through the small body volume in contrast with the long course that the wave has to travel in the adult body .
in fact , the pediatric ureter was more elastic and more distensible , which permitted easier passage of stone fragments and prevented ureteral impaction .
all patients in the present study appeared to tolerate the passage of stone fragments quite well .
interestingly , the mean number of eswl sessions for the patient group aged 7 years or less was 1.16 ( range , 1 - 2 ) , whereas that for the patient group aged more than 7 years was 2.97 ( range , 1 - 10 ) .
this result showed that the passing of stone fragments was easier in the younger patients , and that 7 years of age could be the cutoff at which the first - line treatment modality for pediatric and adolescent urolithiasis can be selected ( fig .
1 ) . ever since eswl was adopted for pediatric patients , several concerns have emerged .
one is the concern about the damage to the reproductive organs in a pediatric patient subjected to eswl for ureteral calculi .
this has been disproven by most animal experiments that showed no long - lasting permanent damage on the female reproductive system .
another concern is about renal scarring in children treated with eswl for their renal stones .
this concern was investigated by fayad et al . in a study involving 100 children with renal stones
; the researchers reported that none of the patients in their study exhibited any degree of renal scarring in the dimercaptosuccinic acid scan or any decrease in split kidney function as evidenced by the glomerular filtration rate measurement in ml per minute by using diethylentriamene pertaacetate after shock wave lithotripsy .
there is no agreement on the best anesthetic method to use during eswl in pediatric patients , and numerous anesthetic methods have been used in children undergoing eswl . in the present study ,
all patients less than 7 years of age needed general anesthesia , and nine patients older than 7 years ( 29.0% ) needed general anesthesia owing to poor cooperation .
unfortunately , the present study had some limitations . first was the absence of chemical composition analysis .
depending on the patient 's age , the chemical composition of the stone might be changed , which could affect the stone disintegration ; however , such data were not integrated in this work . carrying out chemical composition analysis will be very helpful for the treatment of pediatric urolithiasis .
second , the mechanical factor was not considered in the present study because the lithotripter was changed once during the study period .
last , the efficacy of eswl was compared with that of endoscopic management indirectly on the basis of data obtained from the literature .
in the patient group aged 7 years or less , the number of eswl sessions and the complication rate were comparable to those of endoscopic management .
thus , eswl is an effective first - line treatment modality for patients aged less than 7 years . | purposeto retrospectively evaluate the efficacy of extracorporeal shock wave lithotripsy ( eswl ) by age and current condition as a first - line treatment for pediatric and adolescent urolithiasis.materials and methodsthe computerized records of 55 children were retrospectively reviewed from march 1991 to july 2007 .
the children were below 18 years of age and had undergone eswl monotherapy for urolithiasis .
there were 36 boys ( 65.5% ) and 19 girls ( 34.5% ) , with a mean age of 8.5 years ( range , 0.5 - 18 years ) .
there were 24 patients aged 7 years or less and 31 patients aged more than 7 years.resultsthe mean size of the stones was 9.48 mm ( range , 4 - 22 mm ) .
the overall success rate of eswl was 90.9% ( 50 children ) .
the mean number of eswl sessions was 2.02 ( range , 1 - 10 ) .
the mean number of eswl sessions for the patient group aged 7 years or less was 1.16 ( range , 1 - 2 ) and that for the patient group aged more than 7 years was 2.97 ( range , 1 - 10 ; p=0.037 ) . there was also a statistically significant difference in the mean number of eswl sessions between the younger and older patients who needed general anesthesia ( 1.16 vs. 2.2 sessions , respectively ; 0.042).conclusionsin the patient group aged 7 years or less , the number of eswl sessions and the complication rate were comparable with those for endoscopic management .
thus , eswl is an effective first - line treatment modality for patients aged less than 7 years . |
hemiplegia associated with stroke , cerebral palsy , or polio commonly leads to movement
disorders1 .
the neurological dysfunctions of
hemiplegic patients are often related to spasticity and/or contracture of ankle
plantarflexors , low muscle activity of dorsiflexors , and loss of selectivity in motor
control2 .
abnormality is due to
interruption of nerve excitability and transmission to muscles through the central nervous
system and causes abnormal gait1 .
therefore , it has been a challenge to provide effective exercises to paralyzed muscles to
improve their functions in walking in clinical rehabilitation practices . in order to find a solution to this problem
, many studies have been performed on gait
analysis and functional electrical stimulation ( fes ) .
chen et al.3 showed that poststroke patients had impaired swing
initiation of the affected limb and exaggerated trunk elevation during the swing phase . in
addition , a shorter duration of single limb support on the affected limb , circumduction gait
pattern , asymmetry in step length , and increased step width were also found in the patients .
bensoussan et al.4 investigated the gait
initiation patterns of hemiplegic patients and found that the healthy limb supported more
body weight than the affected limb and that the affected knee was elevated less than the
healthy limb during the swing phase .
stanic and trnkoczy5 first reported the
results regarding restoration of ankle joint movements of a hemiplegic patient during gait
using fes of antagonistic muscle groups and position feedback .
vodovnic et al.6 demonstrated that patients with wrist
dorsiflexion weakness were able to achieve a full range of motion when treated with
neuromuscular electrical stimulation .
patients with movement disorders receive electrical stimulation induced
by electromyography ( emg ) activities of their proprioceptors , and repeat movement patterns
to help stimulate excitation of the motor cortex , which may cause permanent improvement in
movements and posture .
it has been proven that real - time control plays a key role in the
success of fes .
several previous studies demonstrated that fes significantly increased the
step length of affected limbs7,8,9 , dorsiflexion at
initial contact during walking10 , maximal
knee flexion9 , and emg activities of
muscles related to hemiplegic gait11 .
electrical stimulation devices are commonly used in static and localized applications .
however , static electrical stimulation can not work effectively during dynamic movements .
fes
can only provide stimulations based on feedback from muscle groups that can still generate
contractions .
the fes used in hemiplegia treatments is normally capable of reinforcing or
rebuilding the proprioceptive biofeedback system to enable relevant signals to be relayed
back to the central nervous system and to develop a new proprioception - motion feedback
system .
the multichannel dynamic electrical stimulation system ( m - desa ) developed by our
group can provide assistive strength training to specific muscles involved in certain
movements , and it was developed based on our first - generation single - channel dynamic
electrical stimulation system ( s - desa)12 .
the system has a total of eight channels and is capable of stimulating eight muscles ( or
muscle groups ) simultaneously . during movement ,
electrical stimulations are controlled by a
computer program using inputs from a foot switch and can be generated according to
multi - muscle coordination .
combining voluntary contractions of targeted muscles ( as well as
those muscles that have lost their contractibility due to hemiplegia ) and passive muscle
contractions elicited by electrical stimulation , the system is able to provide efficient
feedback stimulation to the central nervous system so that more muscle fibers are involved
during contractions and more muscle force is generated .
although fes has been widely used in hemiplegia rehabilitation , the stimulation is often
applied to patients statically when they lie on their side or stand with aids .
dynamic modeling and
simulation of human movements can be used to estimate muscle forces and activation sequences
to provide support for efficacy of fes .
few studies have incorporated musculoskeletal
modeling in estimating muscle forces during the gait of hemiplegic patients during or after
fes .
therefore , the purpose of this study was to design and implement a multichannel dynamic
fes system and investigate acute effects of fes of the tibialis anterior and rectus femoris
on ankle and knee sagittal - plane kinematics and related muscle forces of the hemiplegic
gait .
our first hypothesis was that the step length of affected limbs would be greater
during stimulation compared with that prior to fes .
we further hypothesized that the maximum
ankle dorsiflexion and knee flexion angles would be greater during fes compared with that
before fes and that the muscle forces would be greater during stimulation compared with
those before fes .
eight male patients ( age , 40.3 9.2 years ; height , 175 6.6 cm ; and mass , 68.9 7.1 cm )
recruited from a local hospital participated in the study . among the patients , four had
cerebral hemorrhage , three cerebral infarction , and one traumatic brain injury . in order to
be qualified for the study , patients had to show typical hemiplegic gait patterns ,
demonstrate involuntary contraction of the tibialis anterior and quadriceps femoris muscles ,
and be able to walk more than ten meters three times without assistance .
the exclusion
criteria included cardiopulmonary dysfunctions , renal insufficiency , severe cognitive
impairments , speech disorder , inability to give proper informed consent , and neuromuscular
diseases .
all participating patients signed an informed consent form approved by the local
ethics committee .
development of the dynamic muscle electrical stimulation system : the circular hemiplegic
gait is a typical abnormal gait pattern caused by tibialis anterior weakness . we initially
designed the s - desa for the tibialis anterior to target the circular hemiplegic gait , and it
is a wearable mini medical device that includes a control unit ( arm7 cpu ) , stimulation
electrode , stimulation electrode cable , foot switch and trigger .
other features include a
lithium battery , a clip on case , and a weight of 150 g. the device can be clipped on the
belt or strapped to the leg .
its main function is correction of the foot drop gait pattern
by stimulating the tibialis anterior of hemiplegic patients
. the electrical stimulation can
be triggered by either the foot switch or trigger .
the stimulation level increases to its
peak within 0.2 seconds after heel - off and is maintained until heel - strike .
after
heel - strike , the stimulation level decrease to zero when foot is flat in about 0.2 seconds .
the foot switch has a built - in pressure sensor that can be adjustable to detect the
heel - strike and toe - off .
the ascent and descent ramp times for stimulation can also be
adjusted between 0.1 and 10 seconds . in order to stimulate multiple muscles / muscle groups simultaneously during a dynamic
movement ,
the m - desa was developed based on the s - desa to have 8-channel low frequency
current generators .
all current pulse parameters for each channel , including waveform ,
amplitude , frequency , pulse width , start and stop time , and stimulation duration , can be
controlled and adjusted independently by a computer program .
the current pulse stimulation
is triggered by a pressure foot switch according to the status of the gait .
an emergency
shutoff button is used to turn off the current stimulation for all channels when necessary .
the m - desa is based on a single - chip microcomputer ( attiny2313 and max3232e ) .
it receives
stimulation parameters and stimulation temporal sequences from a control computer ( pc ) .
the patients were trained for 4 weeks . during the training period , they were asked to
practice walking and contract the tibia anterior and rectus femoris muscles while the
election stimulation was applied to them .
the motion capture data were collected before and
after the training ( 4 weeks ) using a 6-camera motion analysis system ( 60 hz , motion analysis
corporation , santa rosa , ca , usa ) .
the marker placements and musculoskeletal model the gait analysis data before and after the training were imported into a musculoskeletal
simulation software suite ( lifmod , lifemodeler , inc .
, san clemente , ca , usa ) to establish
musculoskeletal and dynamic models to compute the muscle forces of the rectus femoris and
tibialis anterior13 .
the dependent
variables included muscle forces of the tibialis anterior and rectus femoris , step length ,
and maximum knee and ankle angles before and after training .
the paired sample t - test was
used to detect the differences between before and after training ( ibm spss
statistics , version 19 ) with an alpha level of 0.05 .
before applying stimulation , the step length of the affected limb was 0.1 m less than that
of the healthy limb . a significant increase in the step length of the affected limb
was
found , and the difference between the affected and healthy limbs was no longer significant
after the stimulation was applied ( p<0.05 , table
1table 1.comparisons of selected gait kinematic variables and maximum muscle forces before
and during stimulationvariablesbefore stimulationduring stimulationaffected limbhealthy limbaffected limbhealthy limbstep length ( m)0.443 0.1470.543 0.1540.526
0.0710.585 0.078lateral displacement ( m)0.100 0.032 - 0.063 0.028-max dorsiflexion angle ( )4.95 1.50 - 10.03 2.66-max knee flexion angle ( )24.50 9.90 - 31.42 10.46-max tibia anterior force ( kn)0.49 0.880.53 0.960.62 0.11-max rectus femoris force ( kn)0.53 0.180.95 0.530.81 0.33-mean sd . significantly different from healthy limb before stimulation .
* significantly different from before stimulation in affected limb .
mean sd . significantly different from healthy limb before stimulation .
* significantly different from before stimulation in affected limb .
- : data not
available the lateral displacement of the affected limb decreased ( by 0.036 m ) after stimulation
( p<0.05 , table 1 ) . in addition , the maximum
dorsiflexion angle and maximum knee flexion angle of the affected limb increased , by 5.08
and 6.92 , respectively , after the stimulation ( p<0.05 ) . before fes ,
the maximum muscle forces of the tibia anterior and rectus femoris were
significantly greater in the healthy limb compared with the affected limb ( p<0.05 for all
comparisons , table 1 ) . in the affected limb , the
maximum muscle forces of these muscles increased , by 0.13 and 0.27 kn , respectively , after
stimulation ( p<0.05 ) .
the purpose of this study was to design and implement a multichannel dynamic fes system and
investigate acute effects of fes of the tibialis anterior and rectus femoris on ankle and
knee sagittal - plane kinematics and related muscle forces of the hemiplegic gait .
the first
hypothesis was that the step length of the affected limb would be greater during stimulation
compared with that prior to stimulation .
the results of the study provided support for the
hypothesis , showing a longer step length during stimulation compared with that before
stimulation . before stimulation , the step length of the affected limb was 18% less than that of the
healthy limb , and it was 20% less than that of healthy older adults14 .
when the stimulation was applied , the step length of the
affected limbs increased by19% and was similar to that of the healthy limb .
the differences
in step length between affected and healthy limbs during stimulation was approximate 0.059
m , which was 41% less than that before stimulation .
a previous study showed that healthy subjects had a 25% longer step
length compared with hemiplegic patients15 .
the effects of fes on the step length of affected limbs have been
investigated as well7 , 10 .
kim et al.7
showed that the step length of affected limbs increased by 7% when fes was applied to both
the gluteus medius and tibialis anterior muscles and increased by only 3% when fes was
applied to tibialis anterior alone .
mum et al.8 also showed that stimulating the tibialis anterior and gluteus
medius together was much more effective than stimulating the tibialis anterior alone during
walking .
the hemiplegic gait is characterized by in a semicircular pattern during the swing phase of
the affected limb .
the limb circumduction is reflected in the increased lateral displacement
of the affected limb to maintain foot clearance3 .
a previous study showed that the lateral displacement of the foot
of the affected limb was 0.046 m , which was approximately 3 times that of healthy limbs3 . in the current study ,
the lateral
displacement of the affect limb during stimulation decreased by 37% from the level before
stimulation ( 0.1 m ) .
the second hypothesis of this study was that the maximum dorsiflexion angle and knee
flexion angle would be greater during fes compared with that before stimulation .
the
hypothesis was supported by the results showing a greater peak dorsiflexion angle and knee
flexion angle during stimulation compared with before stimulation . in the current study ,
the
maximum dorsiflexion angle during fes was 10.0 , which was 102% greater than that before fes
of the tibialis anterior .
the maximum knee flexion angle during fes was 31.4 , which was 28%
greater than that before stimulation of the rectus femoris . with simultaneous stimulation of
both the ankle dorsiflexor and hip flexor ,
it
was shown that the maximum dorsiflexion angle at initial contact increased significanly by
13.0 when fes was applied to the peroneal and hamstrings compared with no stimulation10 . when fes was only applied to the
dorsiflexor muscle during the swing phase of gait , the peak maximum dorsiflexion angle
increased by approximately 6.0 , and the peak knee flexion angle barely changed16 .
the maximum knee flexion angle was also
shown to be significantly increased by 18 when fes was applied to the affected dorsiflexors
of patients walking with robot - assisted gait training9 .
our third hypothesis was that the muscle forces would be greater during stimulation
compared with those before stimulation .
this hypothesis was supported by the fact that the
maximum muscle forces of both the tibia anterior and rectus femoris increased significantly
during stimulation compared with those before fes was applied . during stimulation ,
the
maximum muscle forces of the tibialis anterior and rectus femoris of the affected limb were
0.62 and 0.81 kn , which were increased by 26.5% and 50.0% , respectively , after applying
stimulation .
although no studies seem to have examined muscle forces as a results of fes ,
surface emg activities of muscles related to hemiplegic gait before and after fes have been
investigated11 .
sabut et al.11 showed that the maximum root mean square
emg signal of the tibia anterior using a single - channel fes showed an approximately 66%
increase compared with prior to stimulation .
furthermore , dorsiflexors were significantly
stronger at the end of a three - month fes intervention program for hemiplegic patients
compared with before the intervention ( p<0.04)2 .
the study enrolled a small number of patients , so
the results may not be readily applicable to a general hemiplegic population .
in addition ,
the hemiplegic patients demonstrated exaggerated frontal plane movements , such as foot
circumduction which may be related to exaggerated hip movements .
future studies need to
evaluate the effects of fes on frontal plane kinematic and kinetic variables .
this study successfully established a functional electrical stimulation strategy based on
musculoskeletal modeling and 3d hemiplegic gait analysis for each individual . as a result of
fes , muscle forces of the tibialis anterior and rectus femoris increased , and therefore the
dorsiflexion during the stance phase and knee flexion during the swing phase of the gait
cycle were both improved . consequently , the step length was increased to correct foot drop
and alter the circumduction gait pattern .
in addition , the m - desa system developed by our
group is capable of stimulating multiple muscles / muscle groups simultaneously during level
walking . | [ purpose ] the purpose of the study was to design and implement a multichannel dynamic
functional electrical stimulation system and investigate acute effects of functional
electrical stimulation of the tibialis anterior and rectus femoris on ankle and knee
sagittal - plane kinematics and related muscle forces of hemiplegic gait .
[ subjects and
methods ] a multichannel dynamic electrical stimulation system was developed with 8-channel
low frequency current generators .
eight male hemiplegic patients were trained for 4 weeks
with electric stimulation of the tibia anterior and rectus femoris muscles during walking ,
which was coupled with active contraction .
kinematic data were collected , and muscle
forces of the tibialis anterior and rectus femoris of the affected limbs were analyzed
using a musculoskelatal modeling approach before and after training .
a paired sample
t - test was used to detect the differences between before and after training .
[ results ] the
step length of the affected limb significantly increased after the stimulation was
applied .
the maximum dorsiflexion angle and maximum knee flexion angle of the affected
limb were both increased significantly during stimulation .
the maximum muscle forces of
both the tibia anterior and rectus femoris increased significantly during stimulation
compared with before functional electrical stimulation was applied .
[ conclusion ] this
study established a functional electrical stimulation strategy based on hemiplegic gait
analysis and musculoskeletal modeling .
the multichannel functional electrical stimulation
system successfully corrected foot drop and altered circumduction hemiplegic gait
pattern . |
nowadays we talk about metabolic surgery , as obesity surgery goes beyond weight loss and includes improvement of metabolic syndrome , .
restrictive surgeries , such as the adjustable gastric banding ( agb ) and laparoscopic sleeve gastrectomy ( sg ) , are being questioned . beyond roux - en - y gastric bypass ( rygb )
metabolic operations , such as the single - anastomosis - duodeno - ileal bypass with sleeve gastrectomy ( sadi - s ) and the one anastomosis gastric bypass / mini - gastric bypass ( oagb / mgb ) , are gaining additional recognition . in accordance to the high amount of visceral fat and the increased intraabdominal pressure in obese the incidence of hiatal hernia and esophagitis are elevated in obese individuals , .
while weight loss after obesity surgery improves reflux symptoms , it often worsens after sg due to multifactorial nature .
preservation of the pylorus in combination with the antrum leads this operation type creating a high pressure system and the increased intragastric pressure lead to de novo gerd or even worsens existing symptoms . in the long - term outcome 32% of patients
after sg require revisional surgery and different second - step procedures after sg are described to treat weight regain and gerd . in patients with
weight regain biliopancreatic diversion with duodenal switch ( bpd - ds ) and oagb / mgb are more efficient second stage procedures than re - sleeve or rygb , .
cruroplasty , and conversion to rygb or oagb / mgb have been described in gerd after sg .
oagb / mgb as a gastric bypass surgery offers a safe and effective revisional surgery for failed gastric restrictive procedures .
safety and long - term effects of oagb / mgb are proven and oagb / mgb gives the opportunity to convert the high - pressure system into a low - pressure system , improving gerd and additionally including the option on further weight loss , which is not always achieved by rygb , .
sadi - s has been presented as a simple version of a malabsorptive procedure after sg .
it is described as a safe second - step operation that offers a satisfactory weight loss for patients subjected to a previous sg , .
due to preserved pylorus , sadi - s has the disadvantage of the high - pressure system with worsening of gerd . in this clinical case report
we describe the first case in the literature of conversion of sadi - s into oagb / mgb due to prolonged gerd and weight regain .
a 50-year old female patient with a bmi of 45.1 kg / m ( height 1.59 m , weight 113.9 kg ) was transferred to our bariatric center ( academic center of maximal care ) due to protracted reflux and weight regain .
the patient s bariatric history started in 2009 , when she had undergone laparoscopic adjustable gastric banding ( agb ) at an initial weight of 158 kg ( bmi 62.5 kg / m ) .
indication for sg was given and was performed laparoscopically one month after band removal with a weight of 146 kg .
a planned second - step procedure in form of sadi - s ( 250 cm common channel ) with simultaneous cholecystectomy and appendectomy was performed nine months after sg at a weight of 135 kg ( bmi 53.4 kg / m ) .
the patient presented symptoms of important reflux with daily treatment of proton pump inhibitor ( ppi ) 32 months after sadi - s .
upper gastrointestinal endoscopy showed a hiatal hernia with esophagitis grade b according to the los angeles classification .
gerd health related quality of life questionnaire ( gerd - hrql ) was 48 .
after six months the patient was readmitted , due to impaired recurrence of reflux even under high ppi therapy ( omeprazol 40 mg 1 - 0 - 1 ) and an aluminum complex ( sucralfate 1 - 1 - 1 - 1 ) .
upper endoscopy showed a recurrence of a 5 cm large hiatal hernia and esophagitis grade a according to the los angeles classification .
the patient reported a weight regain up to a bmi of 45.1 kg / m ( height 1.59 m , weight 113.9 kg ) .
2 ) and a suspected functional stenosis at the angulus . with the aim of converting the high - pressure system of sg into a low - pressure system of oagb / mgb , indication for revisional surgery was given .
first , important adhesions had to been reduced , than duodenojejunostomy was divided ( fig .
gastric pouch was created as a long tubular pouch against a 42 fr bougie and distal part of the sleeve was resected ( fig .
anastomosis was performed 200 cm after treitz as a gastroenterostomy with a linear stapler ( 45 mm ) and a 24 fr tube for calibration ( fig .
after one hour of adhesiolysis , conversion was performed in less than 60 min .
hiatal hernia repair was not repeated due to important adhesions on the lower esophageal junction and due to the low - pressure system of oagb / mgb .
postoperative course was uneventful and the patient was discharged on the 5th postoperative day without reflux symptoms .
table 1 demonstrates the timetable of the different surgical procedures . in the first follow - up ( fu )
one month after surgery the patient was still under ppi therapy for 6 weeks postoperatively .
in the 6 month fu the patient showed a weight of 102 kg ( bmi 40.3 kg / m , ewl 56.6% ) and with a ppi therapy of 40 mg 1 - 0 - 0 the patient had acceptable sporadic reflux 23 times / week .
in the 12 month fu the patient showed a weight of 91 kg ( bmi 36 kg / m , ewl 67.7% ) and with a ppi therapy of 40 mg 1 - 0 - 0 the patient had reflux only occasionally .
written informed consent was obtained from the patient for publication of this case report and accompanying images .
there are only a few descriptions of sadi - s as a primary- or second - step operation after sg in the literature , , , .
being a malabsorptive operation it has a weight loss about 70% and a high rate of metabolic improvement . due to the malabsorption the described complications and secondary effects , are predominantly diarrhea and hypoalbuminemia .
however surgery is described to be safe and effective , , the side effects of preserving pylorus and creating a high pressure system remain a challenging disadvantage : gerd can worsen or occur de - novo .
due to increasing gerd problems after sg , the same problems are expected after sadi - s or bpd - ds .
further weight loss in rygb is questionable , while mean ewl after sg is reported with 5060% , in the literature and conversion to rygb with an ewl of 66.9% and 65.5% .
oagb / mgb could replace rygb due to additional weight loss but keeping the same effect for gerd while having a low - pressure system . in a study by tolone et al .
manometric features and patterns did not vary significantly after oagb / mgb , whereas intragastric pressures and gastroesophageal pressure gradient statistically diminished . in contrast , sleeve induced a significant elevation in both parameters .
the oagb / mgb is believed to be more malabsorptive than the standard rygb due to its longer biliopancreatic limb , but will not reach the malabsorptive power of a biliopancreatic diversion with its disadvantageous side effects , .
it has reliable weight loss and complications similar to other forms of gastric bypass . due to the low pressure system gastric bypass such as
malabsorption is lesser than in biliopancreatic diversion and the risk of diarrhea and fat malabsorption are low , if the biliopancreatic limb will not extend 150 cm and 1% when biliopancreatic limb is 200 cm .
oagb / mgb can be a valid option in gerd and failed weight loss and should be performed as a rescue operation after failed sadi - s . the systematic identification and intervention of individuals , who maintain or develop eating disorders and other problematic eating - related psychopathology post - operatively , may improve long - term outcomes . changing in eating behavior after agb and rygb
. found in a group of 2022 patients ( 1513 rygb , 509 agb ) a greater weight loss of about 14% compared with participants , who made no positive changes in eating behavior . due to postgastrectomy syndrome , which includes dumping syndrome , diarrhea , nausea , afferent and efferent loop syndrome ,
patients with oagb / mgb are forced to eat small portions to prevent symptoms and change indeed eating behavior .
the resolution of the high - pressure system with gerd indeed changed eating behavior of the patient and further weight loss was achieved .
. nevertheless the combination of sg with retained pylorus and the massive gut bypass by biliopancreatic diversion type operations may lead to gerd , diarrhea and malabsorption syndromes .
the resulting pathologic shift of eating behavior leads to avoid fat in favor of carbohydrates and the intake of large quantity of
finally those changes can include the risk of operation failure , gerd or malabsorptive syndromes .
long - term complications after obesity surgery may arise from restrictive and malabsorptive procedures and bariatric surgeons have to be aware and have to be able to manage them . in this case report
we describe the first conversion of sadi - s to oagb / mgb to improve patients symptoms and quality of life .
oagb / mgb might be a simple method to rescue such failed sadi - s patients in the short term .
bariatric surgeons may face similar scenarios as described in this case report and experiences in re - do and revisional surgery are mandatory for the future .
due to general interest data from revisional surgery should always be collected and should be assessed initially as a series and later as a cohort study .
no ethical approval was necessary as this is a retrospective presentation of a case report .
" written informed consent was obtained from the patient for publication of this case report and accompanying images .
a copy of the written consent is available for review by the editor - in - chief of this journal on request .
performed substantial contributions to conception and design of the article and to acquisition , analysis and interpretation of data .
all authors reviewed the manuscript for important intellectual content and approved the final version for publication .
| highlightsrevisional bariatric surgery will rise in the future.the established single - anastomosis - duodeno - ileal bypass with sleeve gastrectomy ( sadi - s ) as the restrictive part of the procedure .
due to preserved pylorus , sg has the disadvantage of a high - pressure system with de - novo or worsening of existing gastroesophageal reflux disease in the long-term.one anastomosis gastric bypass / mini - gastric bypass ( oagb / mgb ) reduces the high - pressure system of sg in a low - pressure system of oagb / mgb.oagb / mgb might be a simple method to rescue failed sadi - s patients . |
the metallic stent was knitted from a single thread of 0.15 mm nitinol wire filament ( euroflex , germany ) into a tubular configuration and in an interlocking diamond - shaped pattern with 6 bent points on the upper and lower end portions .
all the stents were 10 mm in diameter and 60 mm in length when they were fully expanded .
the dm - eluting stent was made by dipping a metallic stent in a solution of dm and polyurethane ( pu ) .
type 1 and 2 stents were coated with 12% and 20% , respectively , of the dm solution mixed with pu , while the type 3 stent was a bare nitinol stent that was used for the control study . to evaluate the amount of dm that was released from the membrane of the dm / pu mixture that included 12% dm , a stent with a 1 cm membrane was soaked in a tube with 0.1 m neutral phosphate buffer solution , and the bottle
the temperature of the incubator was set to 37 , and the bottle was continuously rotated .
the buffer solution was exchanged every 24 hours , and the amount of dm in the buffer solution was measured by performing high performance liquid chromatography ( rainin instrument co. , wolburn , ma ) at one month .
the wavelength to detect the dm was 254 nm , which was the peak absorption point of dm on the preliminary test .
all the experimental procedures were performed under the national institute of health guidelines for the humane handling of animals and our study was approved by the committee for animal research at our institution .
transjugular intrahepatic portosystemic shunt was performed in 15 domestic pigs that had an initial weight of 15 - 20 kg each .
the authors performed the procedure by using the techniques described in the previous reports ( 7 , 8) .
anesthesia was induced in each swine with an intramuscular injection of ketamine hydrochloride ( yuhan corporation , seoul , korea ) , and the anesthesia was maintained by intravenous injections whenever needed . under fluoroscopic guidance ,
the right internal jugular vein was cannulated while iodinated contrast material was injected through the ear vein , and a 0.035-inch guide wire ( radiofocus , terumo , tokyo , japan ) was then inserted .
the tract was gradually dilated up to 9 fr with a dilator and a 9-f teflon sheath ( transjugular liver access set ; cook , bloomington , in ) was coaxially loaded over the guide - wire and advanced caudally over the guide wire into the inferior vena cava and hepatic vein .
the right hepatic vein was selected for using a 5 fr cobra catheter ( cook ) , and a hepatic venogram and wedge portogram were taken for visualization of the portal vein . for the puncture , a sheathed 16-gauge colapinto needle ( cook )
was placed into the right hepatic vein , and the portal vein was punctured via the intrahepatic route . after the confirmation of the portal vein by the aspiration of venous blood and the injection of contrast media , a guide wire was advanced into the portal vein and the needle was removed . after the advancement of a 5 fr cobra catheter into the portal vein , a direct portogram was taken and the portal pressure was measured ( fig .
1a ) . to induce portal hypertension , a microcatheter ( progreat , terumo , tokyo , japan ) was inserted into the portal vein through a cobra catheter , and an intraportal injection of a mixture of n - butyl-2-cyanoacrylate and lipiodol ( 1:3 ) was done .
when the migration of the mixture from the catheter tip to the peripheral portion of the portal vein was sluggish , injection of the mixture was stopped ; the total amount of the mixture was approximately 1 - 2 ml .
after embolization of the portal vein , the occluded portal perfusion on the follow - up portogram was confirmed , as well as confirming the increased portal pressure ( fig .
the parenchymal tract was dilated with a balloon catheter ( 10 mm in diameter , 4 cm in length ) , and a nitinol stent was placed in the tract .
after two weeks , the animals were sedated with the same method that was used in the tips procedure . to obtain the follow - up shunt venogram , the portal vein was selected by the same method as was used in the tips procedure for the swine with a patent tract ( fig .
meanwhile , in the swine with the completely occluded tips tract , a direct portogram was taken by the following method after performing hepatic venogram .
the skin of abdomen was incised about 10 to 15 cm in length at the midline from the epigastrium . after exposing the small bowel ,
the tributary of the superior mesenteric vein was punctured and the direct portogram was taken each second after the hand injection of 10 ml of contrast media ( fig .
each animal was sacrificed with an intravenous injection of sodium pentobarbital solution ( hanlim pharm .
co. , ltd , seoul , korea ) for the histologic analysis of the tissue around the tips .
the liver , the supra - hepatic and infra - hepatic inferior vena cava and the extrahepatic portal vein were excised en bloc .
the cross sections of the tips tract were obtained , and the specimens were evaluated by staining with hematoxin - eosin and masson - trichrome .
the maximal distance of the pseudointimal hyperplasia from the stent was measured for each animal on the histopathologic examination .
the degree of the maximal pseudointimal hyperplasia was calculated by dividing the stent radius by the thickness of the pseudointimal hyperplasia without inclusion of any thrombus ( fig .
the metallic stent was knitted from a single thread of 0.15 mm nitinol wire filament ( euroflex , germany ) into a tubular configuration and in an interlocking diamond - shaped pattern with 6 bent points on the upper and lower end portions .
all the stents were 10 mm in diameter and 60 mm in length when they were fully expanded .
the dm - eluting stent was made by dipping a metallic stent in a solution of dm and polyurethane ( pu ) .
type 1 and 2 stents were coated with 12% and 20% , respectively , of the dm solution mixed with pu , while the type 3 stent was a bare nitinol stent that was used for the control study .
to evaluate the amount of dm that was released from the membrane of the dm / pu mixture that included 12% dm , a stent with a 1 cm membrane was soaked in a tube with 0.1 m neutral phosphate buffer solution , and the bottle was placed in a shaking incubator .
the temperature of the incubator was set to 37 , and the bottle was continuously rotated .
the buffer solution was exchanged every 24 hours , and the amount of dm in the buffer solution was measured by performing high performance liquid chromatography ( rainin instrument co. , wolburn , ma ) at one month .
the wavelength to detect the dm was 254 nm , which was the peak absorption point of dm on the preliminary test .
all the experimental procedures were performed under the national institute of health guidelines for the humane handling of animals and our study was approved by the committee for animal research at our institution .
transjugular intrahepatic portosystemic shunt was performed in 15 domestic pigs that had an initial weight of 15 - 20 kg each .
the authors performed the procedure by using the techniques described in the previous reports ( 7 , 8) .
anesthesia was induced in each swine with an intramuscular injection of ketamine hydrochloride ( yuhan corporation , seoul , korea ) , and the anesthesia was maintained by intravenous injections whenever needed . under fluoroscopic guidance ,
the right internal jugular vein was cannulated while iodinated contrast material was injected through the ear vein , and a 0.035-inch guide wire ( radiofocus , terumo , tokyo , japan ) was then inserted .
the tract was gradually dilated up to 9 fr with a dilator and a 9-f teflon sheath ( transjugular liver access set ; cook , bloomington , in ) was coaxially loaded over the guide - wire and advanced caudally over the guide wire into the inferior vena cava and hepatic vein .
the right hepatic vein was selected for using a 5 fr cobra catheter ( cook ) , and a hepatic venogram and wedge portogram were taken for visualization of the portal vein . for the puncture , a sheathed 16-gauge colapinto needle ( cook )
was placed into the right hepatic vein , and the portal vein was punctured via the intrahepatic route . after the confirmation of the portal vein by the aspiration of venous blood and the injection of contrast media , a guide wire was advanced into the portal vein and the needle was removed .
after the advancement of a 5 fr cobra catheter into the portal vein , a direct portogram was taken and the portal pressure was measured ( fig .
to induce portal hypertension , a microcatheter ( progreat , terumo , tokyo , japan ) was inserted into the portal vein through a cobra catheter , and an intraportal injection of a mixture of n - butyl-2-cyanoacrylate and lipiodol ( 1:3 ) was done . when the migration of the mixture from the catheter tip to the peripheral portion of the portal vein was sluggish , injection of the mixture was stopped ; the total amount of the mixture was approximately 1 - 2 ml .
after embolization of the portal vein , the occluded portal perfusion on the follow - up portogram was confirmed , as well as confirming the increased portal pressure ( fig .
the parenchymal tract was dilated with a balloon catheter ( 10 mm in diameter , 4 cm in length ) , and a nitinol stent was placed in the tract .
after two weeks , the animals were sedated with the same method that was used in the tips procedure . to obtain the follow - up shunt venogram , the portal vein was selected by the same method as was used in the tips procedure for the swine with a patent tract ( fig .
meanwhile , in the swine with the completely occluded tips tract , a direct portogram was taken by the following method after performing hepatic venogram .
the skin of abdomen was incised about 10 to 15 cm in length at the midline from the epigastrium . after exposing the small bowel ,
the tributary of the superior mesenteric vein was punctured and the direct portogram was taken each second after the hand injection of 10 ml of contrast media ( fig .
each animal was sacrificed with an intravenous injection of sodium pentobarbital solution ( hanlim pharm .
co. , ltd , seoul , korea ) for the histologic analysis of the tissue around the tips .
the liver , the supra - hepatic and infra - hepatic inferior vena cava and the extrahepatic portal vein were excised en bloc .
the cross sections of the tips tract were obtained , and the specimens were evaluated by staining with hematoxin - eosin and masson - trichrome . the maximal distance of the pseudointimal hyperplasia from the stent was measured for each animal on the histopathologic examination .
the degree of the maximal pseudointimal hyperplasia was calculated by dividing the stent radius by the thickness of the pseudointimal hyperplasia without inclusion of any thrombus ( fig .
all the experimental procedures were performed under the national institute of health guidelines for the humane handling of animals and our study was approved by the committee for animal research at our institution .
transjugular intrahepatic portosystemic shunt was performed in 15 domestic pigs that had an initial weight of 15 - 20 kg each .
the authors performed the procedure by using the techniques described in the previous reports ( 7 , 8) .
anesthesia was induced in each swine with an intramuscular injection of ketamine hydrochloride ( yuhan corporation , seoul , korea ) , and the anesthesia was maintained by intravenous injections whenever needed . under fluoroscopic guidance ,
the right internal jugular vein was cannulated while iodinated contrast material was injected through the ear vein , and a 0.035-inch guide wire ( radiofocus , terumo , tokyo , japan ) was then inserted .
the tract was gradually dilated up to 9 fr with a dilator and a 9-f teflon sheath ( transjugular liver access set ; cook , bloomington , in ) was coaxially loaded over the guide - wire and advanced caudally over the guide wire into the inferior vena cava and hepatic vein .
the right hepatic vein was selected for using a 5 fr cobra catheter ( cook ) , and a hepatic venogram and wedge portogram were taken for visualization of the portal vein . for the puncture , a sheathed 16-gauge colapinto needle ( cook )
was placed into the right hepatic vein , and the portal vein was punctured via the intrahepatic route . after the confirmation of the portal vein by the aspiration of venous blood and the injection of contrast media , a guide wire was advanced into the portal vein and the needle was removed .
after the advancement of a 5 fr cobra catheter into the portal vein , a direct portogram was taken and the portal pressure was measured ( fig .
to induce portal hypertension , a microcatheter ( progreat , terumo , tokyo , japan ) was inserted into the portal vein through a cobra catheter , and an intraportal injection of a mixture of n - butyl-2-cyanoacrylate and lipiodol ( 1:3 ) was done . when the migration of the mixture from the catheter tip to the peripheral portion of the portal vein was sluggish , injection of the mixture was stopped ; the total amount of the mixture was approximately 1 - 2 ml .
after embolization of the portal vein , the occluded portal perfusion on the follow - up portogram was confirmed , as well as confirming the increased portal pressure ( fig .
the parenchymal tract was dilated with a balloon catheter ( 10 mm in diameter , 4 cm in length ) , and a nitinol stent was placed in the tract .
after two weeks , the animals were sedated with the same method that was used in the tips procedure . to obtain the follow - up shunt venogram , the portal vein was selected by the same method as was used in the tips procedure for the swine with a patent tract ( fig .
meanwhile , in the swine with the completely occluded tips tract , a direct portogram was taken by the following method after performing hepatic venogram .
the skin of abdomen was incised about 10 to 15 cm in length at the midline from the epigastrium . after exposing the small bowel ,
the tributary of the superior mesenteric vein was punctured and the direct portogram was taken each second after the hand injection of 10 ml of contrast media ( fig .
each animal was sacrificed with an intravenous injection of sodium pentobarbital solution ( hanlim pharm .
co. , ltd , seoul , korea ) for the histologic analysis of the tissue around the tips .
the liver , the supra - hepatic and infra - hepatic inferior vena cava and the extrahepatic portal vein were excised en bloc .
the cross sections of the tips tract were obtained , and the specimens were evaluated by staining with hematoxin - eosin and masson - trichrome .
the maximal distance of the pseudointimal hyperplasia from the stent was measured for each animal on the histopathologic examination .
the degree of the maximal pseudointimal hyperplasia was calculated by dividing the stent radius by the thickness of the pseudointimal hyperplasia without inclusion of any thrombus ( fig .
the mean increased weight of the stent coated with the dm and pu mixture was 22.3 mg and 25.1 mg for the type 1 and 2 stents , respectively .
the mean weight of the dm , as calculated from the concentration of dm in the solution of the dm and pu mixture , was 2.7 mg and 5.0 mg for the type 1 and 2 stents , respectively .
the in - vitro examination using high performance liquid chromatography showed that the amount of dm released for the first from the membrane of the dm / pu mixture was 25% of the loaded dose .
the accumulated amounts of the released dm for the first three days and two weeks were 50% and 70% , respectively .
transjugular intrahepatic portosystemic shunt procedures were technically successful in all the swine ; all the stents were deployed accurately without any complication in all the swine . although the stents partially expanded in the intraparenchymal portion of all swine , an additional balloon dilation was not done because the blood flow to the hepatic vein was improved without disturbance , and the portal pressure was decreased below the initial pressure .
the mean pressure in the portal vein was 23.44 cmh2o and 37.94 cmh2o before and after the injection of n - butyl-2-cyanoacrylate , respectively , and then this immediately dropped back to 19.72 cmh2o following tips . on the follow - up portogram taken two weeks after the stent placement , one case of the 5 swine with the type 1 stent and two cases of the 5 swine with the type 2 stent displayed luminal patency despite of the focal narrowing of the lumen in the intraparenchymal portion ( fig .
the remaining cases using type 1 and 2 stents and all the cases of the 5 swine with the type 3 stent showed completely occluded lumens of their stents ( fig .
the mean of the maximal pseudointimal hyperplasia were 51.2% , 50% and 76% for the type 1 , 2 , and 3 stents .
the microscopic findings showed a relatively thin and uniform pseudointimal hyperplasia within the patent tips tract in the type 1 and 2 stents , and there was complete occlusion of the tips tract by pseuointimal hyperplasia in the type 3 stent ( figs .
the psuedointimal hyperplasia consisted of myofibroblasts and an extracellular matrix that had grown through the stent wires , and inflammatory cells had infiltrated around the stent wires .
the mean increased weight of the stent coated with the dm and pu mixture was 22.3 mg and 25.1 mg for the type 1 and 2 stents , respectively .
the mean weight of the dm , as calculated from the concentration of dm in the solution of the dm and pu mixture , was 2.7 mg and 5.0 mg for the type 1 and 2 stents , respectively .
the in - vitro examination using high performance liquid chromatography showed that the amount of dm released for the first from the membrane of the dm / pu mixture was 25% of the loaded dose .
the accumulated amounts of the released dm for the first three days and two weeks were 50% and 70% , respectively .
transjugular intrahepatic portosystemic shunt procedures were technically successful in all the swine ; all the stents were deployed accurately without any complication in all the swine . although the stents partially expanded in the intraparenchymal portion of all swine , an additional balloon dilation was not done because the blood flow to the hepatic vein was improved without disturbance , and the portal pressure was decreased below the initial pressure .
the mean pressure in the portal vein was 23.44 cmh2o and 37.94 cmh2o before and after the injection of n - butyl-2-cyanoacrylate , respectively , and then this immediately dropped back to 19.72 cmh2o following tips . on the follow - up portogram taken two weeks after the stent placement , one case of the 5 swine with the type 1 stent and two cases of the 5 swine with the type 2 stent displayed luminal patency despite of the focal narrowing of the lumen in the intraparenchymal portion ( fig .
the remaining cases using type 1 and 2 stents and all the cases of the 5 swine with the type 3 stent showed completely occluded lumens of their stents ( fig .
the mean of the maximal pseudointimal hyperplasia were 51.2% , 50% and 76% for the type 1 , 2 , and 3 stents .
the microscopic findings showed a relatively thin and uniform pseudointimal hyperplasia within the patent tips tract in the type 1 and 2 stents , and there was complete occlusion of the tips tract by pseuointimal hyperplasia in the type 3 stent ( figs .
the psuedointimal hyperplasia consisted of myofibroblasts and an extracellular matrix that had grown through the stent wires , and inflammatory cells had infiltrated around the stent wires .
transjugular intrahepatic portosystemic shunt procedures were technically successful in all the swine ; all the stents were deployed accurately without any complication in all the swine . although the stents partially expanded in the intraparenchymal portion of all swine , an additional balloon dilation was not done because the blood flow to the hepatic vein was improved without disturbance , and the portal pressure was decreased below the initial pressure .
the mean pressure in the portal vein was 23.44 cmh2o and 37.94 cmh2o before and after the injection of n - butyl-2-cyanoacrylate , respectively , and then this immediately dropped back to 19.72 cmh2o following tips .
on the follow - up portogram taken two weeks after the stent placement , one case of the 5 swine with the type 1 stent and two cases of the 5 swine with the type 2 stent displayed luminal patency despite of the focal narrowing of the lumen in the intraparenchymal portion ( fig .
the remaining cases using type 1 and 2 stents and all the cases of the 5 swine with the type 3 stent showed completely occluded lumens of their stents ( fig .
on the histopathologic analysis , the mean of the maximal pseudointimal hyperplasia were 51.2% , 50% and 76% for the type 1 , 2 , and 3 stents .
the microscopic findings showed a relatively thin and uniform pseudointimal hyperplasia within the patent tips tract in the type 1 and 2 stents , and there was complete occlusion of the tips tract by pseuointimal hyperplasia in the type 3 stent ( figs .
the psuedointimal hyperplasia consisted of myofibroblasts and an extracellular matrix that had grown through the stent wires , and inflammatory cells had infiltrated around the stent wires .
although tips is an effective method for reducing the portal venous pressure in the patient with variceal bleeding or intractable ascietes due to portal hypertension , a high rate of restenosis and occlusion of the tract are the critical drawbacks of this technique ( 1 - 3 )
. the important mechanisms of restenosis or occlusion of the shunt , as reported in the previous reports , were acute thrombosis , chronic inflammatory reaction , pseudointimal hyperplasia and inhibition of the endothelialization process associated with bile duct injury and bile extravasation within the stented lumen of the hepatic parenchymal tract ( 9 - 12 ) .
the layers of pseudointimal hyperplasia consist of mesenchymal cells and collagen , and this is covered by a layer endothelial cells .
various techniques and prosthesis were developed to reduce the rate of restenosis and to increase primary patency .
some experimental studies that have used stentgrafts covered with polyethylene terephthalate , polytetrafluoroethylene , dacron , silicone or polycarbonate urethane were performed in the tips tract ( 13 - 17 ) .
however , the placement of a stent - graft in the tips tract did not prevent the pseudointimal hyperplasia and it only provided patency equal to that of the bare stent due to the stent 's early occlusion or because of late shunt malfunction in selected cases .
lessie et al . reported on intraluminal irradiation for tips stenosis in a swine model , but the irradiation of the tips did not significantly improve patency or reduce the degree of pseudointimal hyperplasia ( 18 ) .
many investigations have been performed to prevent restenosis after stent implantation in the vessel . to reduce the rate of restenosis that 's due to an inflammatory response to procedural injury and then the intense fibrocellular response , drug - eluting stents with anti - inflammatory and immunosuppressive effects have been developed and clinical applications have been tried in various vessels ; dm is one of the drugs that has been used .
dm is a glucocorticoid with potent anti - inflammatory , anti - fibrotic , anti - thrombotic and anti - proliferative properties , and it interferes with macrophages and reduces the level of growth factors and cytokines . in vessels , the dm acts to prevent both adherence and aggregation of granulocytes to the endothelial cells , and the intimal hyperplasia mediated by the leukocytes is suppressed ( 19 ) .
dm demonstrated the ability to suppress myointimal hyperplasia in an in vitro experiment using a culture of smooth muscle cell ( 20 - 22 ) .
however , previous clinical studies have reported that systemic intravenous , intramuscular or peroral administrations of corticosteroids were not effective treatments for reducing the restenosis after percutaneous transluminal angioplasty ( 23 , 24 ) . as for the results of using dm - eluting stents for placement in vessels ,
some reports have suggested the beneficial effects of dm - eluting stents on the migration and proliferation of the smooth muscle cells of the vessels , and other reports have suggested that dm - eluting stent could not reduce neointimal thickening and thrombotic occlusion within a stent ( 5 , 6 , 25 - 27 ) .
strecker et al have reported that dm - coated stents reduced the neointimal hyperplasia in the femoral arteries of dogs ( 25 ) .
yoon et al . performed the experiment with placement of a dm - coated stent in the canine aorta and inferior vena cava , and they reported that the stent was effective for decreasing the neointimal formation .
yoon and coworkers proved the effectiveness of dm - eluting stent in veins ( 27 ) .
reported their negative results of placing dm - eluting stent in vessels . in those reports ,
the dm - eluting stent was well tolerated within the coronary vessel , but local delivery of dm by the intravascular dm - eluting stent did not decrease the neoinitmal hyperplasia in porcine coronary and carotid arteries ( 5 , 26 ) . in this study , dm was effective to inhibit the pseudointimal hyperplasia in the tips tract .
contrary to histopathologic finding of the control stent , i.e. , complete occlusion of the tips tract by being filled with numerous spindle - shaped myofibroblasts and a collagen matrix , both types of dm - eluting stents having 12% and 20% dm concentrations suppressed the pseuointimal hyperplasia . the findings of a thinner pseudointimal layer than the control stent and the relatively uniform pattern of pseudointimal hyperplasia in dm - eluting stents may be due to the effects of the dm . we suspected that dm - eluting stent in the tips tract had a mechanism similar to that seen for the inhibition of myointimal hyperplasia in the arteries with dm eluting stents ( 10 ) . however , despite the inhibition of the psedointimal hyperplasia by the dm , the occlusion of tips did occur , and the vessel patency was not prolonged in the tips with using the dm - eluting stents .
these results suggested that the anti - proliferative effect of dm , which was eluded from stent alone , was sufficient to reduce pseudointimal hyperplasia in the tips tract , but many other factors might have also promoted the stenosis and occlusion of the tips tract . in this study ,
the formation of thrombus in the tips tract was observed on examination of the gross specimen , and we believed that thrombosis was an important factor for the high rate of tips occlusion in the swine model with using the dm - eluting stent .
the thrombosis we saw in the tips was also suggested to be an important cause of occlusion in the swine model using intraluminal irradiation for tips stenosis because the difference between the patent and occluded tips was the presence and/or absence of thrombus within the lumen ( 18 ) .
although there are some controversies , the transection of major bile ducts that occurs during the formation of the tips tract and the leakage of bile from the injured ducts are both related to the thrombosis observed in the tips tract , and especially for the rapid and early thrombosis ( 10 , 14 , 28 , 29 ) .
the proliferation of the bile duct within the tissue lined stenotic portion of the tips and the incorporation of bile within thrombi are evidence for the relation between bile leakage and thrombosis in the tips tract .
although the relationship between thrombosis and bile leakage was not proven in this experiment , we suggest that the thrombogenic effect was too strong to be suppressed by the anti - thrombotic effect of the dm released from the dm - eluting stents , and the drug effect was insufficient to prevent thrombosis within the tips tract .
any difference of the anti - thrombotic effect between the 12% and 20% dm - eluting stents was not observed because complete occlusions on the follow - up portograms were noted in both types of stents .
however , further studies are needed to investigate whether the combined use of anti - thrombotic agents can reduce thrombosis and solve this problem , and so improve the patency rate for the tips procedure . the concentration of dm in solution
was decided upon based on results of our preliminary study with taking into consideration the physical properties of the stent and the solution .
the highest concentration of dm that was achievable in solution for coating without changing the physical properties of the nitinol stent was 12% , and the radial force of the stent coated by the solution with a higher concentration of dm showed a decrease in strength .
the highest possible concentration for coating the stent was 20% because of the viscosity of the solution .
although yoon et al reported coating the nitinol stents with 25% dm - pu solution , twenty percentage was the highest concentration we could do with our method of coating ( 27 ) . since there was no significant difference in the thickness of pseudointimal hyperplasia and anti - thrombotic effect between the 12% and 20% dm eluting stents , the placement of a 12% dm stent
is recommended rather than placement of a 20% dm stent to inhibit pseudointimal hyperplasia in the tips tract .
when comparing both types of stents , the 20% dm stent will not provide any benefit over the 12% dm stent for the preservation of the physical properties of the nitinol stent since the increased viscosity of the 20% dm solution makes coating the stent extremely difficult .
the reason why the animals were followed - up for only for two weeks after the creation of tips was that in the swine model , all the tips tracts were occluded after two week . although swine models are widely used because tips can be performed with the same techniques and devices used in human and the healing responses after surgery are similar to those of human , the animals rapidly increase in weight and size , and they can be difficult to handle . in another study ,
stenosis and occlusion progressed within 2 - 4 weeks of tips formation in swine ( 14 ) . in this study , all the tips tracts with using the control stent were completely occluded by myofibroblasts , extracellular matrix and inflammatory cells by two weeks following tips ; so , a two week follow - up period might be sufficient . in conclusion , although the patency of the tips tract did not improve because of the partial occlusion by thrombi , the dm - eluting stent showed a tendency to reduce the development of pseudointimal hyperplasia in the tips tract of a swine model with induced portal hypertension . | objectivewe wanted to evaluate the feasibility and efficacy of using a dexamethasone ( dm)-eluting nitinol stent to inhibit the pseudointimal hyperplasia following stent placement in the transjugular intrahepatic portosystemic shunt tract ( tips ) of a swine.materials and methodsfifteen stents were constructed using 0.15 mm - thick nitinol wire ; they were 60 mm in length and 10 mm in diameter .
the metallic stents were then classified into three types ; type 1 and 2 was coated with the mixture of 12% and 20% , respectively , of dm solution and polyurethane ( pu ) , while type 3 was a bare stent that was used for control study . in fifteen swine , each type of stent was implanted in the tips tract of 5 swine , and each animal was sacrificed 2 weeks after tips creation .
the proliferation of the pseudointima was evaluated both on follow - up portogram and pathologic examination.resultsone tips case , using the type 1 stent , and two tips cases , using the type 2 stent , maintained their luminal patency while the others were all occluded .
on the histopathologic analysis , the mean of the maximum pseudointimal hyperplasia was expressed as the percentage of the stent radius that was patent , and these values were 51.2% , 50% and 76% for the type 1 , 2 , and 3 stents , respectively.conclusionthe dm - eluting stent showed a tendency to reduce the development of pseudointimal hyperplasia in the tips tract of a swine model with induced - portal hypertension . |
fe has been characterized by excessive mortality ( > 50% ) and morbidity , regardless of treatment . a combined medical - surgical approach seems to offer an improved outcome .
however , there are no clinical trials to support or refute this opinion , largely because of the rarity of the syndrome advances in medical and surgical therapies , including reconstructive cardiovascular surgery , implantation of intracardiac prosthetic devices , prolonged use of iv catheters , exposure to broad - spectrum antibiotics , and immunosuppression , have been implicated as causes of the increase in the number of cases of fungemia and fe seen .
more than 200 different species of aspergillus are known , but only a few are consistently pathogenic .
a 2 years old girl was diagnosed with pre ball with a total white cell count of 43.000/dl and started treatment on the ukall2003 trial . during intensification block where patients receive vincristine along with anthracyclines
she was admitted with ongoing pyrexia , tachycardia , rigors and a blanching rash on the left thigh .
the full blood count showed a wbc:3.000/dl n:1.800/dl and a high c - reactive protein .
as there was no obvious focus of infection and had a hickman line she was started on broad spectrum antibiotics for presumed line infection according to the regional protocol ( meropenem and vancomycin ) for immunocompromised patients which was switched to second line antibiotics 48 hours later due to persistent pyrexia .
simultaneously blood cultures were positive for aspergillus fumigatus .clinical examination revealed a systolic murmur and bilateral crackles .
the echocardiogram demonstrated a right atrium / superior vena cava echogenic lesion representing a vegetation .
the patient underwent a high resolution chest ct scan which did nt reveal any evidence of fungal infection .
she was commenced on liposomal amphotericin 3 mg / kg along with intravenous voriconazole which was switched to oral voriconazole once adequate levels in the blood were reached .
liposomal amphotericin was discontinued after 2 weeks and she remained on oral voriconazole throughout chemotherapy .
an echocardiogram was repeated after 4 weeks and showed no evidence of vegetations with negative blood cultures .
he was started on intravenous meropenem as guided by the regional protocol for immunocompromised patients and four days later his temperature was settled as well as his symptoms and in the absence of positive blood cultures he was discharged from hospital on oral clarithromycin .
however 5 days later the patient was readmitted with pyrexia , productive cough and the chest x - ray showed right middle lobe consolidation .
two days later he developed a systolic murmur and the antibiotics were changed to benzylpenicillin and gentamycin for presumed endocarditis despite the lack of positive blood cultures .
he had a high resolution ct scan of the chest which showed a cavitation on the right middle lobe representing an aspergilloma .
treatment with intravenous ambisome was initiated along with intravenous voriconazole which was switched to the oral preparation 5 days later .
unfortunately the patient developed profound symptoms of cardiac failure and thus he had an echocardiogram which revealed a right ventricular outflow tract ( rvot ) vegetation of 2.52.0 cm . due to the patient s marked cardiac compromise the rvot vegetation was surgically resected and on the histopathological sections there were numerous pas positive hyphae representing aspergillus .
post operatively he became hypotensive and required inotropic support in the paediatric intensive care unit .
liposomal amphotericin was discontinued after 17 days and he was continued on oral voriconazole for three months .
he had a follow up high resolution ct scan and an echo which confirmed complete resolution of the aspergillomas .
systemic aspergillus endocarditis occurs mainly in severely immunocompromised patients and in most cases in the literature includes a pulmonary focus and the survival was frequently poor .
review of the british literature showed five patients with fungal endocarditis in the setting of bone marrow transplantation and revealed the same difficulties in diagnosis and poor outcome .
amphotericin b , as exemplified in the current literature review , remains the mainstay of medical therapy .
mortality caused by aspergillus endocarditis in recent literature reviews is around 80% , and surgical intervention with valve replacement did not improve mortality rates as compared with rates for patients who received antifungal monotherapy with amphotericin b. in our first case liposomal amphotericin b along with voriconazole resolved the aspergillus endocarditis in a month without the need for surgical intervention whereas on the second case due to the cardiocirculatory compromise , urgent resection of the aspergilloma along with combined antifungal therapy was indicated and despite the need for intensive care treatment the outcome was good . in the literature a patient with prosthetic valve endocarditis due to aspergillus fumigatus was successfully treated with aggressive surgical debridement alone .
the rarity of the syndrome coupled with negative blood culture results in most mold cases and some yeast cases compromises our ability to secure an early diagnosis .
however in our cases aspergillus fumigatus was isolated from the blood cultures in our first case which was found very rarely in the international literature and from the sputum cultures in our second case enabling us to initiate treatment promptly .
furthermore the large vegetations that characterize this illness seem to increase the sensitivity of transthoracic echocardiogram and should prompt a consideration of fungal endocarditis in the setting of blood culture - negative endocarditis in the immunocompromised patient .
the lack of pulmonary involvement in our first case in the presence of generalized infection with aspergillus fumigatus is unique , since most of the cases reported to date included severe pulmonary disease . despite the lack of clinical and pathological signs of a pulmonary port of entry , infection through the respiratory tract
can not be ruled out , since the respiratory tract is considered the usual port of entry for these organisms although the presence of the central line in our first case favours its use as the main site for aspergillus entry and hence it was removed rapidly . in our second case , no venous access device had been in place during the onset of fever , and preceding bacterial sepsis with pneumonia might have caused pulmonary tissue damage , facilitating aspergillus entry along with the use of broad spectrum antibiotics . according to the international literature
the strongest risk factor for disseminated aspergillosis is prolonged granulocytopenia in the context of immunosuppressive chemotherapy . in our patients
aspergillus endocarditis presented in complete remission from leukemia , and the neutrophil count was normal at the onset of infection . in conclusion these two cases of aspergillus
endocarditis showed the diversity of presentation of a critical fungal infection in immunocompromised non neutropenic paediatric patients . the prompt diagnosis and initiation of treatment is crucial for a favourable outcome along with the use of double antifungal treatment with liposomal amphotericin and voriconaz which could be later switched to oral voriconazole with a good tissue penetration . | fungal endocarditis ( fe ) is a rare complication in immunocompromised patients which is difficult to diagnose and has been characterized by excessive mortality ( > 50% ) and morbidity , regardless of treatment .
the lack of clinical trials due to the small number of cases contributes further to a poor outcome . in our two cases of aspergilllus endocarditis
we reviewed the clinical features , echocardiographic findings , microbiologic data , treatment , and outcome of these 2 cases and provide a current characterization of the syndrome . in this paper
we have demonstrated the diversity of presentation of a critical fungal infection in immunocompromised but non neutropenic paediatric patients .
the prompt diagnosis and initiation of treatment is crucial for a favourable outcome along with the use of double antifungal treatment with liposomal amphotericin and voriconazole initially which could be later switched to oral voriconazole with a good tissue penetration .
histological samples as well as radiological evidence and echocardiograms should be reviewed by experienced clinicians in order to aid diagnosis and promptly initiate treatment for these patients in order to achieve a favourable outcome |
a 41-year - old man with a history of incarceration and polysubstance drug abuse presented with 1 day of acute - onset headache , upper back pain , and transient bilateral lower - extremity numbness .
prior to arrival at our institution , the patient was complaining of subjectively decreased sensation involving his bilateral lower extremities . upon admission ,
the patient did have mild nuchal rigidity and patchy decreased sensation to light touch at the t4 level and below but had normal motor strength and no evidence of abnormal upper - motor findings .
the patient admitted to daily smoking of illicit spice but denied use of narcotics or amphetamines . computed tomography ( ct ) of the head revealed extensive posterior fossa sah with a small amount of subdural hemorrhage layering along the falx and tentorium and mild ventriculomegaly ( fig .
1 ) . a ct angiogram of the patient 's head and neck was negative for any vascular abnormality but showed sah throughout the craniocervical region .
magnetic resonance imaging ( mri ) of the cervical , thoracic , and lumbar spine , although significantly limited by motion artifact , demonstrated a curvilinear focus of enhancement ventral to the left thoracic spinal cord at the t23 level ( fig .
2 ) . given the focal spinal clot , cerebral and spinal angiography was performed , but it was negative for any vascular abnormality .
high clinical suspicion for a vascular abnormality , a follow - up cerebral and spinal angiogram was performed on hospital day 6 .
follow - up spinal angiography demonstrated a focal irregularity and enlargement of the t3 radiculomedullary branch , which arose from the left supreme intercostal artery ( fig .
noncontrast computed tomography image at the level of c1 showing extensive subarachnoid hemorrhage surrounding the upper cervical cord ( black arrow ) .
sagittal fat - saturated t1-weighted magnetic resonance image postgadolinium showing a small focus of enhancement ( white arrow ) posterior to the t2t3 disc space on the left , corresponding with the location of the pseudoaneurysm .
digital subtraction angiographic image from a subselective injection of the left supreme intercostal artery shows an irregular , fusiform pseudoaneurysm of the left t3 radicular artery ( white arrow ) .
after a t2 and t3 laminectomy , the dura was opened sharply , revealing a focal subdural clot inferior to the exiting t3 nerve root . the clot was carefully elevated and evacuated , exposing the exiting nerve and associated radiculomedullary artery .
the associated dentate ligaments were divided , and the t3 radiculomedullary artery was followed distally along the lateral extent of the spinal cord , revealing a focally thrombosed pseudoaneurysm .
intraoperative ultrasound with both color and power doppler evaluation did not demonstrate any detectable flow .
the proximal and distal segments were clipped , and the thrombotic arterial dilation was sent for pathological analysis .
pathological evaluation demonstrated a well - organized blood clot with no appreciable vessel intima to allow evaluation for vasculitis .
the dilated vessel wall revealed complete disruption of internal intima with nearly no appreciable vessel wall on the entire length of the dilated arterial segment .
postoperatively , the patient remained neurologically intact without recurrence of his lower - extremity sensory symptoms .
the patient was subsequently readmitted to the cardiology service 14 days later with an episode of coronary vasospasm and mild troponin elevation .
the patient was observed by the cardiology service for 24 hours and discharged without further complication .
although isolated spinal cord aneurysms causing sah have been documented in several case reports,9
10
11
12
13 they are exceedingly rare occurrences .
the most common causes of spinal sah are spinal dural arteriovenous fistulas ( avfs ) , avms , or vascular neoplasms ( e.g. , hemangioblastomas , cavernous malformations).14 despite their increased incidence in spinal sah , spinal avfs and avms typically present with symptoms of venous hypertension and progressive myeloradiculopathy . as an exception , type 2 ( intramedullary )
avms will present with sah in 40 to 50% of cases , sometimes secondary to intranidal aneurysms .
neoplastic vascular lesions more frequently present with symptoms secondary to mass effect.14 in contrast , spinal aneurysms most often present with sah and acute - onset back pain . to our knowledge , we present the first case of spinal aneurysmal sah secondary to methamphetamine abuse .
similar to our patient , none of the patients had any additional intracranial aneurysms , connective tissue disease ( e.g. , ehlers - danlos , fibromuscular dysplasia ) , or history of aortic anomaly that might predispose them to aneurysm formation . also similar to our patient , three of the patients reported in their series had fusiform dilation along the course of the artery and one patient was found to have a thrombosed aneurysm upon surgical exploration .
all four patients were treated with open surgery with good clinical outcomes . in another recent series ,
berlis et al10 described three patients who presented with spinal sah secondary to isolated ruptured spinal aneurysms .
interestingly , in this series , the authors reported spontaneous aneurysm occlusion in all three patients , who all had good neurological recovery .
although exceedingly rare , thoracic radiculomedullary artery pseudoaneurysms have been reported in two previous cases in the literature .
walz et al15 reported a patient with moyamoya disease who presented with acute - onset headache and subsequent quadriplegia .
after a negative cerebral angiogram , the patient underwent spinal angiography , which revealed an enlarged spinal artery arising from the supreme intercostal artery with a 1.1 1.1-cm irregular pseudoaneurysm associated with a cervical subdural hematoma .
the patient was not a surgical candidate , and the aneurysm was managed via endovascular obliteration .
yahiro et al16 reported a patient with a history of autoimmune hepatitis who presented with posterior fossa sah and progressive lower extremity paresis .
spinal angiography revealed a left - sided t5 radiculomedullary artery pseudoaneurysm originating from the fifth intercostal artery .
this increasing experience suggests outcomes are highly dependent on the type and location of the lesion.17
18
19 although there are still limited data on the endovascular treatment of spinal fusiform aneurysms , the long - term occlusion rates of spinal dural avfs may not be as high as those obtained with surgical ligation or excision.20 surgical treatment of vascular malformations , in particular dural avfs , is generally curative with a low morbidity rate.19
21 given the intradural extramedullary appearance , the authors determined that surgical ligation represented a safe and durable treatment option in the present case .
although cocaine and amphetamine abuse are well - known risk factors for intracranial hemorrhage22
23
24
25
26
27
28 and myocardial ischemia,29
30
31
32
33
34 the risks associated with synthetic cannabinoid abuse are largely unknown . the primary psychoactive ingredient in spice is a synthetic cannabinoid , jwh-018 ( 1-pentyl-3-(1-naphthoyl)indole).35 similar to the primary psychoactive ingredient in cannabis , delta-9-tetrahydrocannabinol ( thc ) , synthetic cannabinoids act upon the endogenous cannabinoid receptors.36 until recently , jwh-018 and other similar synthetic cannabinoids ( jwh-081 , jwh-250 , am-2201 , rcs-4 ) were widely available for legal consumption .
a recent move by the u.s . drug enforcement agency and several individual states has made the sale and consumption of these synthetic cannabinoids illegal , thus creating a black market for the sale of spice and various combinations of often - illicit intoxicating substances and known narcotics.37
myocardial ischemia , myocardial infarction , transient ischemic events , and ischemic strokes have all been linked to marijuana use38
39
40
41
42
43
44
45 and are believed to be largely due to the increased heart rate and the labile effect on blood pressure produced directly by thc 's interaction with central and peripheral cannabinoid receptors.46 although little is known about the in vitro effects of synthetic cannabinoids , several recent reports of acute cardiac events following consumption have appeared in the literature.36
47
48 despite these and other reports of complications associated with polysubstance abuse involving cannabis and cocaine , the potential deleterious effects from mixing synthetic cannabinoids with other illicit drugs are yet to be fully realized.38
49
50
51
liu et al52 recently reported a 41-year - old patient who presented with acute - onset back pain and lower - extremity paresis .
the patient tested positive for amphetamines and was found to have both thoracic sah and a focal subdural clot .
the patient was treated with surgical evacuation , and at 6-month follow - up he had made a complete neurological recovery . as described in the review by howington et al,22 patients who present with intracranial sah associated with cocaine use have a statistically higher rate of clinically significant vasospasm and a 3.3-fold increased risk for a poor outcome .
although there are not enough cases in the literature to know whether this holds true for spinal sah associated with stimulant use , our patient had no symptoms of vasospasm during his hospitalization and was neurologically intact upon discharge .
interestingly , this patient was readmitted approximately 1 week later with delayed myocardial ischemia presumably secondary to methamphetamine abuse .
although the association between stimulant use and intracranial aneurysmal sah is well described in the literature , we present the first case of aneurysmal spinal sah associated with methamphetamine and synthetic cannabinoid abuse .
similar to previously reported cases of aneurysmal spinal sah , our patient made a good neurological recovery and demonstrated no evidence of any additional intracranial vascular abnormalities .
in addition , as several authors have observed with their patients , our patient ultimately went on to spontaneous thrombosis of the pseudoaneurysm .
although this diagnosis is exceptionally rare , clinical presentation of sah with associated back pain and lower - extremity symptoms warrants an aggressive imaging workup . even in the setting of negative angiography ,
repeat cerebral and spinal angiograms may be necessary to identify a potentially treatable cause of spinal sah . | background context isolated spinal artery aneurysms not associated with vascular malformations are exceedingly rare .
purpose to present a rare case of subarachnoid hemorrhage after thoracic radiculomedullary artery pseudoaneurysm rupture in a patient who abused synthetic cannabinoids and methamphetamines .
study design case report .
methods a 41-year - old man with a history of polysubstance abuse presented with acute - onset headache , back pain , and transient bilateral lower - extremity numbness . he reported daily use of the synthetic cannabinoid
spice .
he denied use of other illegal drugs , but laboratory testing was positive for methamphetamines .
magnetic resonance imaging showed a focal hematoma at t23 , and spinal angiography was negative for vascular abnormalities ; however , a follow - up angiogram 6 days later revealed interval development of an irregular dilation of the left t3 radiculomedullary artery originating from the left supreme intercostal artery .
results surgical trapping and resection of the lesion yielded a good clinical outcome .
conclusions
although two previous case reports have described patients with thoracic radiculomedullary pseudoaneurysm causing spinal subarachnoid hemorrhage ( sah ) , this is the first reported case associated with synthetic cannabinoids and methamphetamine abuse .
although this diagnosis is exceptionally rare , clinical presentation of sah with associated back pain and lower - extremity symptoms warrants an aggressive imaging workup . even in the setting of negative angiography ,
repeat cerebral and spinal angiograms may be necessary to identify a potentially treatable cause of spinal sah . |
the alternaria sp . isolate
was prepared for scale - up
chemical analysis by culturing it for 4 weeks on a solid - state medium
composed of cheerios breakfast cereal supplemented with a 0.3% sucrose
solution .
the fungal biomass was extracted with etoac , yielding
a crude extract that was subsequently processed over several types
of sorbents ( including silica gel , sephadex lh20 , and c18 ) to provide purified metabolites 117 .
compound 1 was obtained
as a pale yellow , amorphous
powder , and its molecular formula was established as c34h30o14s based on hresims data ( [ m + na ] ion at m / z 717.1253 , calcd
717.1248 ) indicating 20 degrees of unsaturation . the h
and c nmr spectra of 1 provided evidence
for approximately half of the expected proton and carbon resonances ,
which were assigned as belonging to 11 nonprotonated carbons , three
methines , three methyls , and three exchangeable protons .
the initial
analysis of the data set led us to suspect that 1 might
be a dimeric compound .
further examination of the h and c nmr data ( table 1 ) indicated that
the resonances observed for 1 were similar to those for
the known metabolite sulochrin ( 4 ) , which we also purified from the same fungal extract .
the
major differences between 1 and 4 as revealed
by nmr were the loss of signals for a methine unit ( h 6.91 ; c 107.6 ) and the gain of a new nonprotonated
sp carbon resonance ( c 109.1 ) .
the necessity
of including a sulfur atom in 1 as required by the molecular
formula led us to propose that the sulfur served as a thioether bridge
linking the c-2 and c-2 carbons .
thus , the structure of the
new sulochrin dimer was proposed as illustrated ( 1 ) ,
and the metabolite was given the trivial name polluxochrin .
metabolite 1 shares structural similarities to other sulochrin dimers
including , disulochrin , as well as guignasulfide , which is a demethoxy analogue of 1 .
hresims provided a pseudomolecular ion at m / z 685.0981 [ m + na ] ( calcd 685.0986 )
that supported the molecular formula c33h26o13s .
inspection
of the h and c nmr data for 2 revealed that the spectra superficially appeared as the superimposition
of two sets of signals ( table 2 ) with one set
virtually identical to those generated for compound 1 and the other set bearing substantial similarity to methyl-(1,6-dihydroxy-3-methylxanthone)-8-carboxylate
( 5 ) , which was also purified
from the fungal extract .
the additional unit of unsaturation afforded
via the incorporation of 5 in this metabolite readily
accounted for the overall difference of one unsaturation unit between
metabolites 1 and 2 .
the change from a single
c-9 diaryl ketone signal in 1 ( c 197.8 )
( table 1 ) to pyrone ( c 179.2 )
and diaryl ( c 197.7 ) ketone signals in 2 ( table 2 ) further supported the asymmetric
dimeric nature of the new metabolite .
this assertion was subsequently
confirmed by hsqc and hmbc experiments ( figures
s9 and s10 ) , as well as data generated from a single - crystal
x - ray diffraction experiment ( figure 1 ) .
ortep structure generated
from the x - ray diffraction data for a
single crystal of 2 .
compounds 1 and 2 were determined to
be susceptible to transformation under aqueous conditions . upon incubation
for 48 h in various aqueous solvent mixtures , compound 1 was observed by lc - pda - esims to transform into 2 , which
subsequently converted to another compound ( 3 ) ( figure s1 ) .
the transformation process was determined
to be temperature dependent , and even mild heating for brief periods
led to the rapid loss of 1 and generation of 2 and 3 . to obtain
material for structure characterization ,
5.0 mg of 1 in aqueous meoh was held at 40 c for
6 h , generating 3.5 mg of 3 .
the purified product was
examined by hresims , which yielded a pseudomolecular ion at m / z 629.0757 [ m h ] ( calcd 629.0754 ) corresponding to the molecular formula c32h22o12s .
an analysis of the h and c nmr data for the product ( table s1 ) indicated that 3 was structurally similar to compounds 1 and 2 .
immediately apparent was that the c nmr diaryl ketone signal in 1 ( c-9/9 ,
c 197.8 ) had been replaced by a pyrone ketone signal
in 3 ( c-9/9 , c 179.1 ) ( tables 1 and s1 ) .
subsequent
2d nmr experiments ( figures s14 and s15 ) confirmed that these changes resulted in the formation of a new
compound that consisted of a thioether - linked dimer of 5 connected to the sulfur atom through c-2 and c-2. in contrast
to metabolite 1 , compound 3 exhibited two
nearly superimposable sets of nmr signals .
the doubling of the signals
is proposed to result from the hindered rotation of the s
a similar cyclization phenomenon
has been observed for the transformation of metabolite 4 to 5 , but in this case , the reaction rate was much
slower , taking upward of a week to occur .
these results imply that
the sulfur atom might serve to accelerate the intramolecular cyclization
of 1 into 2 and 3 .
the
molecular formula for compound 7 was determined
by hresims to be c13h16o5 .
an analysis
of the 1d and 2d nmr ( in acetone - d6 and
dmso - d6 ) for 7 indicated
that this metabolite had the same planar structure as pyrenochaetic
acid d , but the published account of
this metabolite did not address the compound s absolute configuration .
to address this problem , we prepared crystals of 7 for
x - ray diffraction analysis ( figure 3 ) .
the metabolite s absolute configuration was determined
to be 8s by the hooft method .
this was further supported by comparing the ecd experimental
data for 7 with a computationally derived theoretical
spectrum ( figure 4a , refer to the supporting information for a discussion of how
the theoretical ecd data for 7 were prepared ) .
ortep structure generated from the x - ray diffraction data
for a
single crystal of 7 . calculated and experimental ecd data for compounds 7 ( a ) and 10 ( b ) .
compound 8 was determined by hresims to have
the same
molecular formula as 7 .
analysis of the h
and c nmr data for 8 ( tables 3 and 4 ) revealed that it possessed
the same carbon skeleton as the co - occurring metabolite pyrenochaetic
acid c ( 6 ) .
however , the
carbon and proton signals attributable to an oxidized methylene ( ch2 - 10 , h 3.42 ; c 60.4 ) were
replaced by signals for an aliphatic methyl . taking into account the
hresims data ,
it was proposed that compound 8 contained
a new c-10 hydroxyl group relative to 6 . combining the
proton and carbon chemical shift patterns for 8 with
the h
h cosy correlations among h-8
and h-9 and h-10 , as well as the hmbc correlations between h-8 and
h-9 with c-7 ( figure 2 ) , the position of the
new hydroxyl group was unambiguously assigned .
pyrenochaetic acid f ( 9 ) was
purified as a colorless ,
amorphous solid , and its molecular formula was established to be c15h18o6 based on hresims data ( [ m
h ] ion at m / z 293.1034 , calcd 293.1031 ) .
the compound
exhibited nmr resonances similar to 8 with the addition
of proton and carbon signals corresponding to an acetoxy group ( tables 3 and 4 ) .
the inclusion of
the acetoxy group in the structure was confirmed on the basis of an
hmbc correlation from h-10 ( h 4.03 ) to c-14 ( c 170.8 ) ( figure 2 ) .
pyrenochaetic
acid g ( 10 ) was obtained as a colorless ,
amorphous solid .
an [ m h ] molecular ion
at m / z 251.0932 ( calcd 251.0925 )
in the hresims spectrum was in agreement with the molecular formula
c13h16o5 .
the hmbc correlation data ( h-7 to c-3 , c-4 , c-5 ,
and c-8 , as well as h-9 and h-10 to c-8 ) indicated that the oxidation
pattern of c-7 and c-8 in 7 was reversed in 10 ( i.e. , c-7 bore the hydroxyl group and c-8 was a ketone ) ( tables 3 and 4 , figure 2 ) .
the metabolite s absolute configuration was determined
to be 7r by comparing experimental ecd data with
a theoretical spectrum of the compound ( figure 4b , refer to the supporting information for a discussion of how the theoretical ecd data for 10 were prepared ) .
thus , the structure of the new metabolite was confirmed
as illustrated for 10 and was named pyrenochaetic acid
g. the molecular formula of 11 was determined to
be c13h14o5 based on hresims , which
provided
an [ m h ] ion at m / z 249.0776 ( calcd 249.0768 ) . a comparison of the 1d nmr
data for 11 with 10 ( tables 3 and 4 ) revealed that the carbon and
proton signals attributable to the c-7 methine were missing and had
been replaced by a downfield ketone resonance ( c 196.3 ) .
compound 11 was named pyrenochaetic acid h. dimethylamide
asterrate ( 13 ) possessed the molecular
formula c19h21no7 as determined by
hresims , indicating that the metabolite possessed 10 degrees of unsaturation .
the compound exhibited h and c nmr resonances
( table 5 ) that were similar to the known , co - occurring
metabolite asterric acid ( 12 ) , with the major exceptions being the addition of two new methyl groups
( c-9 : c 34.3 , h 2.91 ;
c-10 : c 37.5 , h 2.85 ) .
considering the chemical shift and hmbc correlation data for 13 ( h 2.91 and 2.85 to c 166.2 ) , the new methyl groups were rationalized to be part of a
tertiary amide that had replaced the carboxylic acid in 12 .
compound 14 was obtained as a pale yellow , amorphous
solid . on the basis of the hresims data ( [ m + h ] ion at m / z 639.1708 , calcd 639.1714 )
analysis of h
nmr , c nmr , and hsqc data ( table 6 ) revealed that this metabolite possessed 17 nonprotonated carbons ,
eight methines , three methylenes , and four methyl groups . further
analysis of the 2d nmr data ( figure 5 ) revealed
that 14 shared the same planar structure as blennolide
g. when the nmr solvent was changed from
dmso - d6 to cdcl3 ( as reported
in the literature ) , compound 14 provided h and c nmr spectra that were identical to blennolide
g ; however , their specific rotation values were in essence the opposite
of one another { 14 : [ ]d 68.8 ( c 0.125 , chcl3 ) ; blennolide
g : [ ]d + 81.1 ( c 0.29 ,
chcl3)}. further analysis of the ecd data for 14 ( figure s80 ) revealed a cotton effect
pattern that was the inverse of that generated for blennolide g. thus ,
metabolite 14 was determined to be the antipode of blennolide
g. selected h
metabolites 15 , 16 , and 17 shared the same molecular formula
( c32h30o14 ) , as well as many other
similarities among their h and c nmr spectral
data ( table 6 ) . in spite of this ,
compound 15 stood out as displaying half of the expected proton and
carbon resonances , which indicated that it was a symmetrical dimer .
hmbc correlation data ( figure 5 ) were essential
for establishing the c-6c-6 linkage and overall planar
structure of 15 .
it was subsequently determined that
metabolite 16 shared the same planar structure as 15 ( figure 5 ) . however , the presence
of two distinct sets of resonances representing the two monomeric
portions of 16 denoted that this metabolite was an asymmetric
diastereomer of 15 .
in contrast to 15 and 16 , hmbc correlations from h-7 to c-8 and h-7 to c-6
( figure 5 ) indicated that metabolite 17 was covalently bonded via a c-8c-6 linkage .
since compounds 1517 were not active
in our panel of assays and were prone to consistent degradation during
both freezer storage and room - temperature handling , our investigation
of their relative configurations was discontinued .
all the purified
compounds were screened for cancer cell cytotoxicity , antibacterial and
antifungal activities , and inhibition
of fungal biofilm formation . only compounds 13 exhibited anti - mrsa activity , with
mic values of 4.1 , 4.9 , and 3.2 m ( 2.9 , 3.2 , and 2.0 g / ml ) ,
respectively , whereas the mic for chloramphenicol was 5 m ( 1.6
g / ml ) .
metabolites 13 also
showed weak mammalian cell cytotoxicity effects against pancreatic
cancer cells ( mia paca-2 ) with ic50 values of 50.8 , 30.3 ,
and 29.3 m , respectively .
optical rotation data
were determined on a rudolph research autopol iii automatic polarimeter .
accurate
mass data were collected on an agilent 6538 hresi qtof ms coupled
to an agilent 1290 hplc .
lc - ms data were obtained on a shimadzu lc - ms
2020 system ( esi quadrupole ) coupled to a photodiode array detector ,
with a phenomenex kinetex column ( 2.6 m c18 column ,
100 , 75 3.0 mm ) .
the hplc system utilized scl-10a vp
pumps and a system controller with luna 5 m c18 columns
( 110 , 250 21.2 mm , 10 ml / min and 110 , 250
10 mm , 4 ml / min ) .
x - ray data were collected using a diffractometer
with a bruker apex ccd area detector and graphite - monochromated mo
k radiation ( = 0.710 73 ) .
the
fungal isolate ( internal strain designation wailua pda-3 ) was obtained
from a soil sample collected in the vicinity of wailua falls , hawaii .
the isolate was identified as similar to alternaria longissima based on its sequence analysis ( 99% sequence homology ) .
km088044 ) was
compared by blast analysis to sequences publicly available through
the ncbi database .
the fungal isolate was cultured under solid - state
conditions on a medium composed of cheerios breakfast cereal supplemented
with a 0.3% sucrose solution with 0.005% chloramphenicol .
the fungus
was grown for 4 weeks at room temperature ( 25 c ) .
the scale - up solid - phase
cultures were pooled and extracted twice overnight with etoac , and
the organic solvent was partitioned against water .
the resultant organic
layers were concentrated under vacuum . the resulting extract ( 71 g )
ch2cl2 ) was subjected to c18 vlc ( h2o meoh ) to give four subfractions .
subfraction 1 ( eluted
with 4:6 h2o meoh ) was further purified by semipreparative
hplc ( mobile phase 1:1 h2o meoh with 0.1% formic
acid in water ) to afford compounds 6 ( 2.0 mg ) , 7 ( 15.0 mg ) , 8 ( 2.5 mg ) , 9 ( 2.8
mg ) , 10 ( 3.0 mg ) , 11 ( 2.3 mg ) , and 12 ( 6.0 mg ) .
subfraction 3 ( eluted with 8:2 h2o meoh )
was applied to a sephadex lh20 column and eluted with 1:1 ch2cl2meoh .
h2o with 0.1%
formic acid in water ) yielded 1 ( 8.0 mg ) , 2 ( 7.5 mg ) , 4 ( 25 mg ) , 5 ( 14 mg ) , 13 ( 6.5 mg ) , 14 ( 4.0 mg ) , 15 ( 5.1
mg ) , 16 ( 4.7 mg ) , and 17 ( 5.0 mg ) .
pale yellow , amorphous
solid ; uv ( meoh ) max ( log ) 210 ( 4.27 ) , 286
( 3.81 ) , 346 ( 3.54 ) nm ; ir ( film ) max 3600 , 2953 ,
1712 , 1641 , 1514 , 1454 , 1344 , 1211 , 1091 , 1022 , 831 cm ; h and c nmr see table 1 ; hresims [ m + na]m / z 717.1253 ( calcd for c34h30o14sna , 717.1248 ) .
pale
yellow , block - like
crystals ; uv ( meoh ) max ( log ) 208 ( 4.37 ) ,
238 ( 4.34 ) , 364 ( 4.05 ) nm ; ir ( film ) max 3600 , 2930 ,
1712 , 1645 , 1585 , 1514 , 1365 , 1209 , 1089 , 1020 , 831 cm ; h and c nmr see table 2 ; hresims [ m + na]m / z 685.0981 ( calcd for c33h26o13sna , 685.0986 ) .
pale
yellow powder ; uv
( meoh ) max ( log ) 210 ( 4.39 ) , 246 ( 4.12 ) ,
298 ( 3.56 ) , 364 ( 3.90 ) nm ; ir ( film ) max 3610 , 2935 ,
1739 , 1699 , 1651 , 1514 , 1365 , 1269 , 1211 , 1008 , 827 cm ; h and c nmr see table
s1 ; hresims [ m h]m / z 629.0757 ( calcd for c32h21o12s , 629.0754 ) .
colorless cubic
crystals ; [ ]d 5.0 ( c 0.18 , etoh ) ; uv ( meoh ) max ( log )
212 ( 4.14 ) , 252 ( 3.68 ) , 302 ( 3.32 ) nm ; cd ( meoh ) max ( ) 254 ( 6.82 ) 317 ( 2.50 ) ; ir ( film ) max 2972 , 1699 , 1541 , 1456 , 1413 , 1315 , 1226 , 1097
, 974 cm ; h and c nmr see tables 3 and 4 ; hresims [ m
h]m / z 251.0931
( calcd for c13h15o5 , 251.0925 ) .
colorless , amorphous
solid ; uv ( meoh ) max ( log ) 212 ( 4.12 ) , 246
( 3.61 ) , 298 ( 3.23 ) nm ; ir ( film ) max 2941 , 1697 ,
1541 , 1456 , 1413 , 1315 , 1234 , 1095 cm ;
h and c nmr see tables 3 and 4 ; hresims [ m h]m / z 251.0931 ( calcd for c13h15o5 , 251.0925 ) .
colorless , amorphous
solid ; uv ( meoh ) max ( log ) 210 ( 4.19 ) , 298
( 3.34 ) nm ; ir ( film ) max 2966 , 1737 , 1687 , 1546 ,
1454 , 1413 , 1238 , 1097 , 1039 cm ; h
and c nmr see tables 3 and 4 ; hresims [ m
colorless ,
amorphous solid ; [ ]d 11.4 ( c 0.18 , meoh ) ; uv ( meoh ) max ( log )
216 ( 4.20 ) , 248 ( 3.79 ) , 296 ( 3.37 ) nm ; cd ( meoh ) max ( ) 244 ( 6.48 ) , 275 ( 1.85 ) ; ir ( film ) max 2965 , 1699 , 1577 , 1456 , 1413 , 1313 , 1226 , 1091 cm ; h and c nmr see tables 3 and 4 ; hresims [ m h]m / z 251.0932 ( calcd
for c13h15o5 , 251.0925 ) .
colorless ,
amorphous solid ; uv ( meoh ) max ( log ) 212
( 4.19 ) , 270 ( 3.88 ) , 326 ( 3.46 ) nm ; ir ( film ) max 2981 , 1685 , 1548 , 1460 , 1311 , 1255 , 1096 cm ; h and c nmr see tables 3 and 4 ; hresims [ m
pale yellow ,
amorphous solid ; uv ( meoh ) max ( log ) 212
( 4.33 ) , 284 ( 3.32 ) , 310 ( 3.34 ) nm ; ir ( film ) max 3439 , 1625 , 1469 , 1357 , 1249 , 1205 , 1149 , 1060 cm ; h and c nmr see table 5 ; hresims [ m + h]m / z 376.1392 ( calcd for c19h22no7 ,
376.1391 ) . pale yellow ,
amorphous solid ; [ ]d 68.8 ( c 0.125 , chcl3 ) ; uv ( meoh ) max ( log ) : 206 ( 4.26 ) , 260 ( 3.97 ) , 340 ( 3.85 ) nm ; cd ( meoh )
max ( ) 211 ( 8.37 ) , 223 ( 14.2 ) , 328
( 3.35 ) ; ir ( film ) max 2967 , 1788 , 1739 ,
1612 , 1435 , 1361 , 1213 , 1047 cm ; h
and c nmr see table 6 ; hresims
[ m + h]m / z 639.1708
( calcd for c32h31o14 , 639.1714 ) .
pale yellow , amorphous
solid ; [ ]d 75.3 ( c 0.473 , chcl3 ) ; uv ( meoh ) max ( log )
208 ( 4.36 ) , 258 ( 4.30 ) , 364 ( 3.84 ) nm ; ir ( film ) max 3439 , 2965 , 1788 , 1645 , 1433 , 1359 , 1273 , 1207 , 1056 cm ; h and c nmr see table 6 ; hresims [ m + na]m / z 661.1530 ( calcd for c32h30o14na , 661.1528 ) .
pale yellow , amorphous
solid ; [ ]d 35.0 ( c 0.035 , chcl3 ) ; uv ( meoh ) max ( log )
206 ( 4.32 ) , 256 ( 4.25 ) , 360 ( 3.79 ) nm ; ir ( film ) max 3458 , 2962 , 1791 , 1647 , 1433 , 1359 , 1286 , 1207 , 1012 cm ; h and c nmr see table 6 ; hresims [ m + na]m / z 661.1531 ( calcd for c32h30o14na , 661.1528 ) .
pale yellow , amorphous
solid ; [ ]d 28.8 ( c 0.125 , chcl3 ) ; uv ( meoh ) max ( log )
210 ( 4.50 ) , 256 ( 4.43 ) , 360 ( 3.93 ) nm ; ir ( film ) max 3441 , 1788 , 1745 , 1647 , 1469 , 1354 , 1280 , 1172 , 1055 cm ; h and c nmr see table 6 ; hresims [ m + na]m / z 661.1527 ( calcd for c32h30o14na , 661.1528 ) .
a yellow plate - shaped
crystal of dimensions 0.46
0.26 0.08 mm of 2 and a colorless prism - shaped
crystal of dimensions 0.44 0.32 0.18 mm of 7 were selected for structural analysis .
intensity data for these
two compounds were collected using a diffractometer with a bruker
apex ccd area detector and graphite - monochromated mo k radiation ( 0.710 73
) .
details of the x - ray crystal structure analysis for 2 and 7 are available in the supporting information .
the x - ray crystallographic data for 2 and 7 have been deposited with the cambridge
crystallographic data center under accession numbers ccdc 993668 and 993669 , respectively .
these data can be accessed free of charge at http://www.ccdc.cam.ac.uk/. conformational analyses were carried out using spartan10 .
geometry , frequency , and ecd calculations were
applied at the dft level with gaussian 09 .
specdis 1.60 was used to average single ecd or uv vis spectra
after boltzmann statistical weighting .
mammalian cell cytotoxicity assays
were performed on pancreatic cancer ( mia paca-2 ) cells by adding 5000
cells per well into 96-well plates .
the cells were allowed to adhere
overnight at 37 c in a humidified incubator ( 5% co2 atmosphere ) .
test compounds were diluted in dmso and added to the
wells so that the final concentration of dmso per well did not exceed
1% by volume .
the plates containing treated and control cells were
incubated for 48 h , and cell viability was determined by mtt assay .
compounds were
tested against methicillin - resistant staphylococcus aureus ( mrsa ) strain atcc 700787 , which also
exhibits reduced susceptibility to vancomycin .
a stock culture was
diluted in brain heart infusion broth and delivered into presterilized
96-well plates .
stocks prepared in dmso were added to each well of
the 96-well plate ( 1% final dmso concentration ) .
optical density measurements
( od600 ) of the cultures were determined on a tecan infinite m200 plate
reader .
the plates were incubated for 17 h in a humidified incubator
at 37 c .
plates were removed and orbitally shaken , and a final
od600 value was recorded .
the final od600 reading was subtracted from
the initial od600 reading to obtain the change in od600 ( antimicrobial
activity was determined based on the change in optical density ) . | polluxochrin ( 1 ) and
dioschrin ( 2 ) , two
new dimers of sulochrin linked by thioether bonds , were purified from
an alternaria sp .
isolate obtained from a hawaiian
soil sample .
the structures of the two metabolites were established
by nmr , mass spectrometry data , and x - ray analysis .
metabolite 1 was determined to be susceptible to intramolecular cyclization
under aqueous conditions , resulting in the generation of 2 as well as another dimeric compound , castochrin ( 3 ) .
an additional nine new metabolites were also obtained , including four
new pyrenochaetic acid derivatives ( 811 ) , one new asterric acid analogue ( 13 ) , and four new
secalonic acid analogues ( 1417 ) .
bioassay analysis of these compounds revealed 13 displayed antimicrobial and weak cytotoxic activities . |
hepatocellular carcinoma ( hcc ) is the fifth and seventh most commonly diagnosed cancer in males and females , respectively , and the third leading cause of cancer mortality worldwide .
the incidence and mortality rates for hcc are similar because most hcc patients are diagnosed at an advanced stage , highlighting the importance of early hcc detection in the application of potentially curable treatment options .
hepatitis b virus ( hbv ) is the major risk factor for hcc and early detection of hcc through surveillance of high - risk populations improves hcc mortality .
therefore , national practice guidelines recommend regular hcc surveillance for high - risk hbv - infected persons . in korea ,
the korean association for the study of the liver and the national cancer center jointly developed guidelines for hcc screening in 2001 recommending that high - risk adults with hbv infection should undergo surveillance for hcc using ultrasonography and alpha - fetoprotein ( afp ) every 6 months . based on this recommendation ,
the korean government introduced nationwide hcc screening as a part of the organized national cancer screening program ( ncsp ) for lower income levels in 2003 .
the ncsp provides a biannual ultrasonography and afp test for males and females 40 years of age that were hepatitis b surface antigen ( hbsag)-positive , had hepatitis c infection , or liver cirrhosis . in the beginning ,
the ncsp supplied medicaid recipients and national health insurance ( nhi ) beneficiaries in the lower 30% income bracket with free hcc screening services . in 2006 , the ncsp provided participants in the lower 50% income bracket with hcc screening services free of charge .
in addition to these national hcc screening programs , ultrasonography and afp testing are performed in outpatient clinics or private health promotion centers across korea .
based on the advantages of early hcc detection , it is crucial to investigate the rate of adherence to hcc screening to understand how hcc surveillance tests are being implemented in high - risk groups in korea .
although a nationwide organized screening program has been provided in korea since 2003 , no study to date has investigated changes in adherence rates to hcc screening in practice .
this study used data from the second and fifth korea national health and nutrition examination surveys ( knhanes ) , which is a nationally representative , cross - sectional survey .
we analyzed screening rates for hcc among the hbv - infected korean population after the introduction of the nationwide hcc screening program and assessed factors related to hcc screening adherence .
this study used the second knhanes ( knhanes ii ) data collected during 2001 and fifth knhanes ( knhanes v ) data collected from 2010 to 2011 . the knhanes is a series of nationally representative , cross - sectional health and nutrition examination surveys conducted by the korean centers for disease control and prevention since 1998 .
it uses a complex , stratified , multistage probability sample representative of the korean population .
the procedures for selecting the sample and conducting the interviews and examinations have been described elsewhere .
consistent with current korea ncsp recommendations , we restricted the analysis to adults 40 years of age at the time of the interview
. there were 14,936 individuals who participated in knhanes ii and 9159 who participated in knhanes v who met the age criteria ; 3763 and 8145 , respectively , of these participants , were tested for hbsag . of these ,
176 and 285 participants in knhanes ii and v , respectively , were infected with hbv . among these populations ,
we excluded participants who reported a personal history of hcc ( n = 4 in knhanes v ) or did not answer questions on compliance to hcc screening tests ( n = 11 and 5 in knhanes ii and v , respectively ) . in the final analysis , we included 165 and 276 participants 40 years of age who were hbsag - positive from knhanes ii and v , respectively [ figure 1 ] .
all participants provided informed consent , and the protocol was approved by the institutional review board of the korea centers for disease control .
hbsag was measured using enzyme - linked immunosorbent assays in knhanes ii ( coda ; bio - rad , hercules , ca , usa ) , and an electrochemiluminescence immunoassay ( modular e-170 ; roche diagnostics , mannheim , germany ) in knhanes v. all other parameters were determined from the self - reported questionnaires .
ii , participants were asked , have you had a screening test for hcc within the last 2 years ? ; possible responses were yes , no , and do not know . in knhanes v ,
participants were asked , when was the last time you had hcc screening test ? ; possible responses were never ,
> 2 years ago , and do not know . to standardize the major outcome variable , participants who had undergone hcc screening test within the previous 2 years were considered to have undergone recent hcc screening .
participants were also asked , have you ever been diagnosed with hbv infection by a doctor or a health professional ? subjects who answered positively to this question were defined as those who were self - aware of hbv infection .
data were also collected on demographic and socioeconomic factors ( e.g. , age , gender , urbanity , marital status , education , household income , health insurance , smoking , and alcohol consumption ) relevant to hcc screening .
two categorical levels for education attainment were used based on the highest level of education achieved by the respondent : high school or higher , and less than high school .
household income was divided into four groups on the basis of monthly income quartile . with regard to health insurance
three categorical groups for alcohol amount were used : light drinking ( < 10 g / d for women , < 20 g / d for men ) , moderate drinking ( 1020 g / d for females , 2040 g / d for males ) , and heavy drinking ( 20 g / d for females , 40 g / d for males ) .
statistical analyses were performed using sas software ( version 9.3 , sas institute , cary , nc , usa ) , which incorporates sample weights and adjust the analyses for the complex sample design of the survey .
the survey sample weights , which were calculated taking into consideration the sampling rate , response rate , and age / gender proportion of the reference population ( 2000 and 2005 national census registry , respectively ) , were used in all analyses to produce estimates representative of the noninstitutionalized civilian korean population considering a complex , stratified , multistage probability sampling design . the prevalence and 95% confidence interval ( ci ) of hbv infection aged 40 years
the hcc screening rate within 2 years and 95% ci for each survey year were calculated using cross - tabulation .
differences in the proportion of participants who had hcc screening in each survey were analyzed using the chi - square test ( proc surveyfreq procedure ) . to identify risk factors for adherence to an hcc screening program ,
the crude and adjusted odds ratios ( ors ) were calculated using logistic regression ( proc surveylogistic procedure ) .
the covariates for the adjusted or calculation were household income , smoking status , awareness of hbv infection , and survey year .
this study used the second knhanes ( knhanes ii ) data collected during 2001 and fifth knhanes ( knhanes v ) data collected from 2010 to 2011 . the knhanes is a series of nationally representative , cross - sectional health and nutrition examination surveys conducted by the korean centers for disease control and prevention since 1998 .
it uses a complex , stratified , multistage probability sample representative of the korean population .
the procedures for selecting the sample and conducting the interviews and examinations have been described elsewhere .
consistent with current korea ncsp recommendations , we restricted the analysis to adults 40 years of age at the time of the interview
. there were 14,936 individuals who participated in knhanes ii and 9159 who participated in knhanes v who met the age criteria ; 3763 and 8145 , respectively , of these participants , were tested for hbsag . of these ,
176 and 285 participants in knhanes ii and v , respectively , were infected with hbv . among these populations ,
we excluded participants who reported a personal history of hcc ( n = 4 in knhanes v ) or did not answer questions on compliance to hcc screening tests ( n = 11 and 5 in knhanes ii and v , respectively ) . in the final analysis , we included 165 and 276 participants 40 years of age who were hbsag - positive from knhanes ii and v , respectively [ figure 1 ] .
all participants provided informed consent , and the protocol was approved by the institutional review board of the korea centers for disease control .
hbsag was measured using enzyme - linked immunosorbent assays in knhanes ii ( coda ; bio - rad , hercules , ca , usa ) , and an electrochemiluminescence immunoassay ( modular e-170 ; roche diagnostics , mannheim , germany ) in knhanes v. all other parameters were determined from the self - reported questionnaires .
ii , participants were asked , have you had a screening test for hcc within the last 2 years ? ; possible responses were yes , no , and do not know . in knhanes
v , participants were asked , when was the last time you had hcc screening test ? ; possible responses were never ,
> 2 years ago , and do not know . to standardize the major outcome variable , participants who had undergone hcc screening test within the previous 2 years were considered to have undergone recent hcc screening .
participants were also asked , have you ever been diagnosed with hbv infection by a doctor or a health professional ?
subjects who answered positively to this question were defined as those who were self - aware of hbv infection .
data were also collected on demographic and socioeconomic factors ( e.g. , age , gender , urbanity , marital status , education , household income , health insurance , smoking , and alcohol consumption ) relevant to hcc screening . two categorical levels for education attainment were used based on the highest level of education achieved by the respondent : high school or higher , and less than high school .
household income was divided into four groups on the basis of monthly income quartile . with regard to health insurance
three categorical groups for alcohol amount were used : light drinking ( < 10 g / d for women , < 20 g / d for men ) , moderate drinking ( 1020 g / d for females , 2040 g / d for males ) , and heavy drinking ( 20 g / d for females , 40 g / d for males ) .
statistical analyses were performed using sas software ( version 9.3 , sas institute , cary , nc , usa ) , which incorporates sample weights and adjust the analyses for the complex sample design of the survey .
the survey sample weights , which were calculated taking into consideration the sampling rate , response rate , and age / gender proportion of the reference population ( 2000 and 2005 national census registry , respectively ) , were used in all analyses to produce estimates representative of the noninstitutionalized civilian korean population considering a complex , stratified , multistage probability sampling design . the prevalence and 95% confidence interval ( ci ) of hbv infection aged 40 years
the hcc screening rate within 2 years and 95% ci for each survey year were calculated using cross - tabulation .
differences in the proportion of participants who had hcc screening in each survey were analyzed using the chi - square test ( proc surveyfreq procedure ) . to identify risk factors for adherence to an hcc screening program , the crude and adjusted odds ratios ( ors ) were calculated using logistic regression ( proc surveylogistic procedure ) .
the covariates for the adjusted or calculation were household income , smoking status , awareness of hbv infection , and survey year .
there were 165 and 276 participants 40 years of age infected with hbv in 2001 and 20102011 , respectively .
the weighted seroprevalence of hbv infection was 4.3% in 2001 , and 3.8% in 20102011 .
the baseline distribution of the study population was broadly similar between survey years , with the exception of educational attainment , household income , smoking status , and alcohol intake .
baseline characteristics of the participants 40 years of age with hepatitis b infection * based on weighted data . based on unweighted data .
p values are derived from rao - scott chi - square test ( proc surveyfreq procedure ) .
the proportion of study participants with hbv infection reporting an hcc screening test within the previous 2 years increased significantly from 17.5% in 2001 to 40.3% in 20102011 ( p < 0.0001 ) .
an increased rate of hcc screening tests from 2001 to 20102011 was also observed in the entire study population .
rate of recent hepatocellular carcinoma screening within 2 years * based on weighted data ; based on unweighted data .
p values are derived from rao - scott chi - square test ( proc surveyfreq procedure ) .
the results of the multivariable logistic regression models for factors associated with the adherence to hcc screening tests are reported in table 3 . following adjustments for household income ,
smoking status , awareness of hbv infection , survey year , and individuals in higher income quartiles were more likely to have undergone recent hcc screening ( third quartile : adjusted or = 3.03 , 95% ci : 1.277.23 ; fourth quartile : adjusted or = 2.49 , 95% ci : 1.085.73 ) .
self - awareness of hbv infection was positively related to recent hcc screening ( adjusted or = 2.74 , 95% ci : 1.405.38 ) .
survey year 20102011 was associated with a significantly higher rate of recent hcc screening ( adjusted or = 3.37 , 95% ci : 1.955.81 ) .
regression models for adherence to hepatocellular carcinoma screening * based on weighted data ; based on unweighted data . crude and
adjusted ors ( 95% cis ) were calculated using logistic regression ( proc surveylogistic procedure ) . or : odds ratio ; ci : confidence interval ; knhanes : korea national health and nutrition examination surveys .
there were 165 and 276 participants 40 years of age infected with hbv in 2001 and 20102011 , respectively .
the weighted seroprevalence of hbv infection was 4.3% in 2001 , and 3.8% in 20102011 .
the baseline distribution of the study population was broadly similar between survey years , with the exception of educational attainment , household income , smoking status , and alcohol intake .
baseline characteristics of the participants 40 years of age with hepatitis b infection * based on weighted data . based on unweighted data .
p values are derived from rao - scott chi - square test ( proc surveyfreq procedure ) .
the proportion of study participants with hbv infection reporting an hcc screening test within the previous 2 years increased significantly from 17.5% in 2001 to 40.3% in 20102011 ( p < 0.0001 ) .
an increased rate of hcc screening tests from 2001 to 20102011 was also observed in the entire study population .
rate of recent hepatocellular carcinoma screening within 2 years * based on weighted data ; based on unweighted data .
p values are derived from rao - scott chi - square test ( proc surveyfreq procedure ) .
the results of the multivariable logistic regression models for factors associated with the adherence to hcc screening tests are reported in table 3 . following adjustments for household income ,
smoking status , awareness of hbv infection , survey year , and individuals in higher income quartiles were more likely to have undergone recent hcc screening ( third quartile : adjusted or = 3.03 , 95% ci : 1.277.23 ; fourth quartile : adjusted or = 2.49 , 95% ci : 1.085.73 ) .
self - awareness of hbv infection was positively related to recent hcc screening ( adjusted or = 2.74 , 95% ci : 1.405.38 ) .
survey year 20102011 was associated with a significantly higher rate of recent hcc screening ( adjusted or = 3.37 , 95% ci : 1.955.81 ) .
regression models for adherence to hepatocellular carcinoma screening * based on weighted data ; based on unweighted data . crude and
adjusted ors ( 95% cis ) were calculated using logistic regression ( proc surveylogistic procedure ) . or : odds ratio ; ci : confidence interval ; knhanes : korea national health and nutrition examination surveys .
given the considerable burden and overall poor prognosis of hcc , early diagnosis through screening enables curative treatments , and , therefore , has the potential to reduce liver - related mortality .
it is important to investigate changes in the use of hcc screening to understand how screening is being conducted in practice following the introduction of a nationwide hcc screening program in korea .
this study revealed a significant increase in recent hcc screening from 2001 to 20102011 . in 2001 , only 17.5% of respondents had undergone hcc screening test ; however , 40.3% of hbv - infected participants had been screened for hcc within the preceding 2 years in 20102011 . this substantial increase in hcc screening
, the korean government has provided individuals at high - risk for developing hcc for free or with a 90% subsidy for hcc screening services .
however , no prominent increase in hcc screening among individuals with low household income was detected .
moreover , the participation rate of hcc screening in the low - income group remained low , even though screening services were offered free of charge by the ncsp .
hcc screening programs are different from those of other solid cancers , such as stomach , breast , cervical , or colorectal cancers , in that they target not a general population but a high - risk population .
therefore , omission from the target population might cause underuse of hcc screening tests among individuals in the low - income group . the target population for hcc screening in korea
first , the ncsp identifies the high - risk population for hcc among the lower 50% of nhi beneficiaries by screening a computerized medical claims database stored in the nhi corporation within the past 2 years .
the ncsp also analyzed serologic tests for hbsag and hcv antibody to identify the high - risk group among medicaid recipients .
therefore , individuals with hbv infection who had never undergone a health check - up might be missing from the target population group .
consequently , the opportunity to make use of free hcc screening services would have been lost in this missing population .
the lower participation rate among the low - income group may also have been due to their unawareness of hbv infection status , and lack of information regarding the nationwide cancer screening program and the benefits of hcc screening .
we also found that moderate - to - high household income , awareness of hbv infection status , and survey year were associated with increased use of recent hcc screening .
the association between household income and hcc screening in this study was similar to a previous report that participants with higher income were more likely to use hcc screening tests .
in general , individuals with higher household income are more likely to undergo screening for colorectal , gastric , breast , and cervical cancer . in addition , self - awareness of hbv infection
several reports have shown that awareness of hbv infection significantly affected participation in hcc screening programs . in this report ,
16.3% of hbv - infected participants aged 40 years were aware of their hbv infection status in 2001 .
however , the rate of infection awareness among hbv carriers 40 years of age was 21% in 20102011 , which was not significantly increased compared to that in 2001 .
these results imply that the identification of hbv - infected individuals among the general population group is important for hcc surveillance among hbv - infected persons .
therefore , to increase the low rate of hcc screening use , a national policy should encourage hbsag screening programs to identify hbv - infected persons , as well as improve patient adherence to hcc screening among hbv - infected individuals .
first , causal associations could not be examined due to the cross - sectional design .
second , this study defined recent hcc screening use as that performed within the previous 2 years to make uniform the measurement in the two survey periods .
the guidelines released jointly by the korean association for the study of the liver and the national cancer center recommended regular screening every 6 months on the basis of tumor doubling time .
therefore , the primary outcome in this study does not represent the recommended hcc screening criteria .
moreover , previous studies reported that the rate of participation in regular hcc screening ( every 6 months ) was lower compared to that of irregular or lifetime hcc screening .
nevertheless , this study that revealed relatively few participants had undergone recent hcc screening within the previous 2 years .
third , we relied on self - reported data to determine whether a subject had actually been screened and when the screening was performed .
therefore , this limitation does not seem to overstate our finding of underuse of hcc screening among the study population .
in korea , opportunistic screening is widely accessible , in addition to nationwide organized screening programs .
finally , other factors influencing hcc screening use , such as a family history of hcc , or replicative state of hbv , or other co - morbidities , were not investigated . despite these limitations , this study had several strengths .
first , it was the first to analyze changes in hcc screening rates following the implementation of organized , nationwide hcc screening programs among hbv - infected groups targeted for screening .
a substantial increase in hcc screening in hbv - infected individuals following implementation of the nationwide screening program provides lessons for government 's hcc screening policy in areas endemic for hbv .
second , we used data representative of the korean population . therefore , we could evaluate the nationwide change in the utilization of hcc screening .
third , we also identified potential factors related to underuse of screening . to improve the efficiency of national hcc screening program and
reduce socioeconomic disparities , identification of proper screening targets for active surveillance is a crucial step in hbv - endemic areas .
we anticipate that our results might bring about improvements in hcc screening of high - risk individuals . in conclusion ,
the rate of adherence to hcc screening within the past 2 years among hbv - infected korean people aged 40 years has more than doubled in 20102011 compared to 2001 . however , the hcc screening rate among the high - risk group remained suboptimal despite the implementation of a nationwide screening program .
household income and awareness of hbv infection were positively associated with hcc screening in this study population at high - risk for hcc .
these results suggest that multiple strategies , including encouragement for hbv - infected persons to attend hcc screening , as well as more efficient identification of hbv - infected subjects unaware of their infection , are urgently needed to maximize the advantages of hcc screening .
this study was supported by a research grant from the korean association for the study of the liver ( the research supporting program of the korean association for the study of the liver ) .
this study was supported by a research grant from the korean association for the study of the liver ( the research supporting program of the korean association for the study of the liver ) .
| background : evaluating a change in the screening rate for hepatocellular carcinoma ( hcc ) is critical for understanding screening implementation , and whether targeted population groups are receiving proper screening .
this study examined recent nationwide changes in hcc screening use among hepatitis b virus ( hbv)-infected populations after the introduction of the korean national cancer screening program and predictors of screening adherence.methods:we analyzed 165 and 276 participants 40 years of age who were hepatitis b surface antigen - positive from 2001 ( 14,936 participants ) to 20102011 ( 9159 participants ) korea national health and nutrition examination surveys , respectively .
demographic data , socioeconomic factors , and hcc screening use were collected by means of self - reported questionnaires.results:the rate of hcc screening within the previous 2 years increased significantly from 17.5% in 2001 to 40.3% in 20102011 ( p < 0.0001 ) .
the rate of hcc screening use increased from 2001 to 20102011 in all study populations .
subjects who had a higher income status and were aware of their infection were more likely to have undergone recent hcc screening.conclusions:this study showed a substantial increase in hcc screening in high - risk hbv - infected subjects from 2001 to 20102011 . however , the hcc screening participation rate remained suboptimal despite the introduction of the nationwide screening program .
efforts should be made to identify high - risk individuals and increase attendance at hcc screening events among high - risk groups . |
the inhalation of silica can induce chronic lung inflammation and fibrosis . upon stimulation by silica
, alveolar macrophages are activated through the nlrp3 inflammasome , leading to some proinflammatory cytokines being modified into their mature forms , such as il-1 and tnf- [ 2 , 3 ] .
then , the activated macrophages can regulate the t - lymphocyte response and promote the secretions of lymphocyte - derived cytokines ( il-4 , il-13 , and ifn- ) by performing their antigen presenting activity in vitro [ 4 , 5 ] .
animal studies have shown that cd4 + t cells are the major t helper ( th ) cells involved in the silica - induced lung inflammatory response .
cd4 + t cells can differentiate into several types , such as th1 , th2 , and regulatory t cells ( treg cells ) , characterized by their typical transcription factors t - bet , gata3 , and foxp3 , respectively .
the th1 immune response is firstly enhanced after silica inhalation in the early inflammation stage .
the secretions and expressions of th1 cytokines , such as il-2 and ifn- , are elevated [ 8 , 9 ] . then , with the development of inflammation and fibrosis , th2 immune response is gradually enhanced to be predominant .
the secretions and expressions of th2 cytokines get increased , such as il-4 and il-13 [ 10 , 11 ] .
this th1/th2 balance is considered to be adjusted by treg cells , which can attenuate the activity of effector t cells ( teff ) by secreting il-10 and tgf- [ 13 , 14 ] .
the recently discovered th17 cells are reported to mediate early lung inflammation in experimental silicosis .
il-6 , together with tgf- , has been identified to induce the differentiation of th17 cells and the expression of ror-t [ 16 , 17 ] .
the proinflammatory cytokine il-1 also plays a critical role in the early stage of th17 cells differentiation . besides
, th17 cells are reported to express a higher level of il-1 type i receptor ( il-1ri ) than other t cell subsets .
so il-1 takes part in the expansion of th17 cells , especially in synergy with il-23 .
meanwhile , il-1 regulates ror-t expression during th17 cells polarization and maintains cytokine productions of effector th17 cells , such as il-17a .
il-17a is the typical proinflammatory cytokine produced by th17 cells and can induce many inflammatory cytokines .
thus , il-17a plays an important role in triggering inflammatory responses [ 22 , 23 ] .
there is a reciprocal developmental pathway for treg cells and th17 cells [ 16 , 24 ] .
the blockage of il-17 causes a rapid increase in the number of treg cells in the inguinal and popliteal lymph nodes of mice .
blocking some key factors in the differentiation of th17 cells can also suppress il-17 function .
il-1ra ( anakinra ) can block the il-1/il-1ri pathway by binding to il-1r competitively , without generating any signal .
therefore , anti - il-17a mab and il-1ra are used to influence il-17a on either the secretion level or the expression level .
the objective of our study was to investigate the role of il-17a in the silica - induced inflammatory response in vitro . in this study , we established a macrophage and lymphocyte coculture system in vitro , and silica was used to induce inflammatory response .
anti - il17a mab and il-1ra were added into the coculture system to influence the level of il-17a .
our study demonstrated that il-17a and th17 cells were involved in silica - induced immune response in vitro .
the reduction of il-17a could modulate the th1/th2 responses by boosting the function of treg cells .
blocking the function of il-1 signal pathway could suppress the level of il-17a , which played the major role in modulating silica - induced th responses in vitro .
healthy female c57bl/6 mice at 68 weeks of age were purchased from the center of experimental animals , china medical university ( shenyang , china ) .
all animals were housed in a specific - pathogen - free environment and maintained on standard mouse chow with free access to food and water .
all animal experiments were approved by the animal care and use committee at the china medical university with a permit number of cmu62043013 , which complies with the national institute of health guide for the care and use of laboratory animals .
after mice were sacrificed , the lungs were removed and washed twice with cold pbs .
bronchoalveolar lavage ( balf ) was conducted several times by cannulating the trachea , injecting , and retrieving 1 ml aliquots of sterile physiological saline to get 6 ml balf in total .
the pellet was washed and resuspended in 1 ml rpmi 1640 ( thermo fisher scientific , waltham , ma , usa ) .
the total cell counts were determined using cell counting chamber according to standard hematologic procedures .
cells were resuspended in rpmi 1640 containing 10% heat - inactivated fetal bovine serum ( fbs biological industries , kibbutz beit - haemek , israel ) and incubated for 2 h in 12-well plate .
after being removed from the sacrificed mice , spleens were ground and disrupted mechanically in 5 ml 1x mouse lymphocyte separation medium ( dkw33-r0100 , ez - septm , dakewe , shenzhen , china ) in 35 mm dishes
. then the total dissociated splenocytes and the separation medium were transferred to 15 ml conical tubes .
after being centrifuged for 30 min at 800 g , the lymphocyte layers were transferred into other 15 ml conical tubes .
the isolated lymphocytes were washed with 10 ml rpmi-1640 and resuspended in prmi-1640 containing 10%fbs .
the total cell counts were determined using cell counting chamber according to standard hematologic procedures .
silica company ( min - u - sil 5 , berkeley springs , wv , usa ) .
. the nature of silica particles has already been tested by many studies [ 30 , 31 ] .
all the macrophages were divided into 4 groups : pbs group , silica group , silica + il-1ra group , and silica + anti - il-17a group .
the macrophages from silica + il-1ra group and silica + anti - il-17a group were rotated with 15 g / ml il-1ra ( biovitrum , stockholm , sweden ) or 20 g / ml anti - il-17a mab ( clone ebiomm17f3 , ebioscience , san diego , ca , usa ) , respectively , for 15 min .
the macrophages from pbs group and silica group were rotated with pbs at equal volume . then 16 l pbs ( the same volume of silica suspension ) was added to pbs group and 40 g / ml silica suspension was added to the other 3 groups each .
the macrophages of 4 groups continued rotating for 45 min , and then the macrophages were placed into 12-well plates .
all the macrophages were incubated for 2 h in 37c with 5% co2 to adhere to the plates .
the lymphocytes were also divided into 4 groups : pbs group , silica group , silica + il-1ra group , and silica + anti - il-17a group .
the lymphocytes from silica + il-1ra group , and silica + anti - il-17a group were treated with 30 g / ml il-1ra or 40 g / ml anti - il-17a mab , respectively , for 30 min .
the supernatant of pretreated macrophages was removed after being cultured for 2 h , and then the pretreated lymphocytes of each group were added to the wells of macrophages with the same group name , respectively .
2 10 macrophages and 1 10 lymphocytes were cocultured for 24 h or 48 h under the following condition : 40 g silica suspension for silica group , 40 g / ml silica suspension + 15 g / ml il-1ra for silica + il-1ra group , and 40 g / ml silica suspension + 20 g / ml anti - il-17a mab for silica + anti - il-17a group .
the liquid sample was collected at two time points and then centrifuged at 800 g for 8 min at 4c .
the cell pellet , which mainly refers to lymphocytes , was used for mrna extraction .
the total mrna of cells was extracted using the trizol reagent ( invitrogen , carlsbad , ca , usa ) according to the manufacturer 's protocol . the mrna concentration and
2 g total mrna was reverse transcribed in a volume of 20 l following the program : 37c for 15 min and 85c for 5 s. 2 l of cdna was used in a 25 l pcr volume .
the difference of the amplification efficiency between the target gene and the housekeeping gene was identified by comparing the slopes of the standard curves .
the pcr reactions were run on abi 7500 ( applied biosystems , carlsbad , california , usa ) using the two following programs : 95c for 30 s , and 40 cycles of 95c for 5 s , and 60c for 34 s , or 95c for 30 s , and 40 cycles of 95c for 5 s , and 62c for 34 s. analysis was performed using the abi 7500 system software ( applied biosystems , carlsbad , ca , usa ) .
the primers and the probes were designed with the primer3 ( http://frodo.wi.mit.edu/primer3/ ) , and the sequences were blasted ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) .
primescript rt - pcr kit ( drr061a , takara , japan ) was used for real - time rt - pcr .
the elisa plate was first coated with 100 l capture antibody in coating buffer per well of elisa kit ( ebioscience , san diego , ca , usa ) and incubated overnight at 4c .
after being washed with 250 l wash buffer , each well was blocked and incubated for 1 h at room temperature ( rt ) . then 100 l supernatant or the different dilutions of standard ( for standard curve )
the well was incubated with 100 l detection antibody for 1 h at rt , followed by incubation with 100 l avidin - hrp for 30 min at rt .
finally 100 l substrate solution was added to each well to incubate for 15 min at rt .
the differences between values were evaluated through a one - way analysis of variance ( anova ) followed by pairwise comparison with the student - newman - keuls test .
p < 0.05 was considered statistically significant , and all values are means sem .
to testify whether il-17a and th17 response play a role in response to silica stimulation in vitro , anti - il-17a mab and il-1ra were added to the coculture system .
the levels of il-17a and ror-t were examined using elisa and real - time pcr .
silica stimulation increased the secretion of il-17a at both time points compared with the pbs group ( figure 1(a ) ) .
the secretion of il-17a was significantly lower in both the silica + anti - il-17a mab group and the silica + il-1ra group compared with the silica group ( figure 1(a ) ) .
besides , the expression of il-17a increased significantly in silica group at 48 h compared with the pbs group ( figure 1(b ) ) .
the il-1ra treatment significantly decreased the expression of il-17a compared with either the pbs group or the silica group ( figure 1(b ) ) .
however , the addition of anti - il-17a mab did not decrease the expression of il-17a compared with the silica group ( figure 1(b ) ) . to further test th17 response
the silica stimulation increased the expression of ror-t significantly at 48 h compared with the pbs group ( figure 1(c ) ) .
the anti - il-17a mab did not influence the expression of ror-t ( figure 1(c ) ) , whereas the expression of ror-t increased significantly after il-1ra treatment compared with the silica group ( figure 1(c ) ) . to study the effect of il-17a and/or th17 cells on th1/th2 response
, we examined the secretions of th1 ( ifn- , il-2 ) and th2 ( il-4 ) cytokines in the supernatant of the cocultured system .
silica stimulation increased the levels of th1 cytokines and its typical transcription factor t - bet ( figure 2 ) .
however , the secretion of ifn- significantly decreased in the silica + anti - il-17a mab group at 48 h compared with the silica group ( figure 2(a ) ) . besides , the secretion of il-2 also decreased in the silica + anti - il-17a mab group at both time points compared with the silica group ( figure 2(b ) ) .
the addition of anti - il-17a mab suppressed the expressions of ifn- and il-2 at 48 h ( figures 2(c ) and 2(d ) ) .
the expression of th1 typical transcription factor t - bet was also examined by real - time - pcr .
anti - il-17a mab restricted the increase of the t - bet expression after silica stimulation ( figure 2(e ) ) .
the il-1ra imitated the effect of anti - il-17a mab by decreasing the secretions and expressions of th1 cytokines and its transcription factor ( figure 2 ) .
we also checked the th2 cytokines and its typical transcription factor gata-3 using the elisa and real - time pcr assays .
the secretion and expression of il-4 increased markedly in the silica + anti - il-17a mab group compared with the silica group at 48 h ( figures 3(a ) and 3(b ) ) .
the expression of gata-3 gained a slight increase in silica + anti - il-17a mab group compared with the silica group at 48 h ( figure 3(c ) ) . the results of th2 related factors in silica + il-1ra group were similar to those in silica+anti - il-17a mab group .
il-1ra not only increased the secretion and expression of il-4 significantly , but also stimulated the increase of gata-3 expression even at both time points compared with silica + anti - il-17a mab group ( figure 3 ) . to investigate the mechanism of how il-17a influenced the th1/th2 immune response
, we checked the treg cells related factors , the transcription factor foxp3 , and negative regulatory cytokines il-10 and tgf-. the secretion and expression of il-10 in silica + anti - il-17a mab group increased significantly at 24 h compared with the silica group ( figures 4(a ) and 4(c ) ) , whereas there was no significant difference in the secretion and expression of tgf- between these two groups ( figures 4(b ) and 4(d ) ) .
in addition , the expression of foxp3 increased significantly in silica + anti - il-17a mab group compared with the silica group at both time points ( figure 4(e ) ) .
the secretion and expression of il-10 in silica + il-1ra group also increased significantly at 48 h compared with the silica group ( figures 4(a ) and 4(c ) ) .
the expression of foxp3 increased significantly in silica + il-1ra group compared with the silica group at 24 h and 48 h ( figure 4(e ) ) .
to further study whether il-17a or th17 cells regulated the th1/th2 response by boosting the treg cells function , we examined some cytokines that were important for th17 cells differentiation and proliferation .
il-6 was considered to promote the nave t cells to differentiate into th17 cells pathways . il-1 and
il-23 further promoted and stabilized the generation of th17 cells [ 20 , 33 ] . according to the elisa and real - time pcr assays , the secretion and the expression of il-6 decreased significantly in silica + il-1ra group compared with the silica group at 48 h ( figure 5(a ) ) , which meant that il-1ra inhibited the expression of il-6 . in contrast , the secretion of il-1 apparently increased after being treated with il-1ra compared with simple silica induction ( figure 5(b ) ) .
similarly , the secretion and expression of il-23 increased significantly in silica + il-1ra group compared with the silica group at 24 h and 48 h ( figures 5(c ) and 5(f ) ) .
there was no significant difference in the expression of il-1 between these two groups ( figure 5(e ) ) .
although il-1ra suppressed the level of il-6 , the level of il-23 got increased after il-1ra treatment .
when silica particles invade our immune system , alveolar macrophages can bind to the silica particles through the marco scavenger receptor as the first line of defense .
first of all , macrophages can recruit many inflammatory cells , such as neutrophils and lymphocytes .
meanwhile , macrophages can also release some proinflammatory cytokines upon silica stimulation , such as il-1 and tnf- [ 2 , 3 ] .
in addition , macrophages also play an important role in antigens presenting , which may induce the activation of nave t cells and different th immune responses .
our previous animal study showed that il-17a might promote the silica - induced early lung inflammation . to further study the role of il-17a during silica - induced inflammatory response in vitro
the aim of this study was to explore the role of il-17a during silica - induced immune response in vitro .
our results showed that silica stimulation increased the level of il-17a and ror-t , which indicated that il-17a and th17 response took part in silica - induced immune response in vitro .
the addition of anti - il-17a mab and il-1ra reduced the level of il-17a significantly .
il-1ra restricted not only the secretion of il-17a , but also the expression of il-17a .
both anti - il-17a mab and il-1ra might suppress the th1 response and enhance the th2 response by boosting the function of treg cells .
but the th17 related factors , such as ror-t and il-23 , were not suppressed by the il-1ra ( figure 6 ) . in this study , in order to discuss the role of il-17a in silica - induced immune response anti - il-17a mab was used to neutralize the il-17a in vitro . after silica stimulation , the expression and secretion of il-17a were enhanced as well as the expression of ror-t , which was consistent with the study in vivo showing that th17 response increased in the silica - induced lung fibrosis .
meanwhile , il-1 , il-6 and il-23 contributed to the enhancement of th17 response after silica stimulation [ 17 , 22 , 35 ] .
besides , the traditional th1 and th2 immune responses enhanced by silica stimulation and treg cells also got promoted .
the increase of th17 related factors indicated that silica could induce th17 response , as well as the th1/th2 response .
it was shown that treg cells and th17 cells shared a reciprocal developmental pathway [ 16 , 24 ] . in this experiment ,
foxp3 was the characterized nuclear transcription factor of treg cells [ 14 , 36 ] .
treg cells played a critical role in maintaining self - tolerance as well as in regulating immune responses , mainly secreting two anti - inflammatory cytokines : il-10 and tgf- ; however , the tgf- was not absolutely required for suppression in vitro [ 7 , 37 ] . besides , there was a key balance between th1 and th2 type responses .
and our previous study showed that treg cells could regulate the balance of th1/th2 immune response through suppressing the th1 response in silica - induced lung fibrosis in vivo . in this experiment ,
il-17a reduction decreased th1 type cytokines ( ifn- , il-2 ) and its transcription factor t - bet , whereas increased the th2 type cytokine ( il-4 ) and its transcription factor gata-3 .
the change of the th1/th2 response model in vitro might also be regulated by treg cells .
il-1ra could negatively regulate function of il-1 by competitively binding to il-1ri without il-1 signal generation .
il-1 signaling played an important role in the secretion of il-17a [ 33 , 38 , 39 ] .
our results showed that the expression and secretion of il-17a decreased significantly after il-1ra treatment .
and il-1ra made an imitated effect by restricting the expression of il-17a and influencing treg cells .
the expression of il-10 and foxp3 got promoted after il-1ra treatment , indicating that the function of treg cells was enhanced . and
the increased treg cells could regulate th immune response by suppressing th1 response and promoting th2 response .
besides , the absence of il-1 signaling could also reduce the secretion of th1 cytokines .
the production of typical th1 cytokine decreased in the supernatants of cultured lymphocytes derived from il-1ri -/- and il-1a / b-/- mice after immunization with mbsa .
the addition of il-1ra in our cocultured system suppressed the secretion and expression of th1 cytokines and its typical transcription factor t - bet .
meanwhile , decreased il-2 , ifn- , and t - bet could improve the th2 differentiation and il-4 production [ 40 , 41 ] , so the th2 cytokines and its typical transcription factor gata-3 were elevated after il-1ra treatment .
therefore , the change of th1/th2 pattern that followed the il-1ra treatment could be attributed to two aspects , the enhanced function of treg cells and/or the absence of il-1 signaling .
although both the anti - il-17a mab and il-1ra influenced the secretion of il-17a in vitro , they made the different impacts on th17 response .
the anti - il-17a mab simply neutralized secreted il-17a , without changing the expression of il-17a , even the th17 differentiation - related factors .
however , the il-1ra treatment not only reduced both the secretion and the expression of il-17a by blocking the function of il-1 , but also affected the th17 differentiation - related factors , such as il-6 , il-23 , and ror-t . on the one hand , the proinflammatory cytokines il-1 or il-6 could trigger il-17a cytokine production in vitro [ 4244 ] .
the silica - induced il-6 expression of pneumocytes was mainly mediated via il-1. and the level of il-6 could reduce effectively after being treated with il-1ra in vitro , which was consistent with our results .
on the other hand , the level of ror-t , the key transcription factor of th17 cells , increased significantly after il-1ra treatment in our coculture system .
the animal study also confirmed that ror-t increased in the silica - induced lung fibrosis in vivo .
the increased ror-t expression could be the result of the increased level of il-23 , which contributed to the expression of ror-t and the th17 cells differentiation [ 35 , 42 , 46 ] .
furthermore , it was reported that there was a balance between th17 and th1 and the decreased th1 response in our cocultured system also may result in the increase of ror-t . consequently , although the il-1ra suppressed the levels of il-17a and il-6 , the expressions of ror-t and il-23 still increased .
this suggested that il-1 signal was important to the th17 cells differentiation and il-17a secretion , but its absence might be compensated by the increased level of il-23 in the expression of ror-t .
our study demonstrated that il-17a and th17 cells were involved in silica - induced immune response in vitro .
il-17a reduction could suppress the th1 response and promote the th2 response by boosting the function of treg cells .
blocking the function of il-1 signal pathway could suppress the level of il-17a , which played a critical role in modulating the silica - induced th responses in vitro . | silica inhalation can induce chronic lung inflammation and fibrosis . upon silica stimulation ,
activated macrophages trigger the t - lymphocyte which can differentiate into many different types of th cells , including the recently discovered th17 cells .
il-17a , the typical th17 cytokine , is reported in some inflammatory diseases . however , the role of il-17a in silica - induced inflammatory response is still not clear .
the regulatory mechanism of silica - induced th17 response also needs to be investigated .
so we established a mice primary cell coculture system ( macrophage and lymphocyte ) to investigate the role of il-17a in silica - induced inflammatory response in vitro , by using anti - il-17a mab and il-1ra .
both anti - il-17a mab and il-1ra decreased the level of il-17a and increased the function of treg cells . the th1 response was suppressed and the th2 response was promoted by the addition of anti - il-17a mab or il-1ra .
il-1ra treatment decreased the level of il-6 , whereas the levels of il-23 and ror-t were increased .
our study demonstrated that il-17a reduction altered the pattern of silica - induced th responses by boosting the function of treg cells in vitro .
blocking the function of il-1 signal pathway could suppress the level of il-17a , which played the major role in modulating silica - induced th responses in vitro . |
the terms physical activity, exercise, physical inactivity, sedentarism, and sedentary behavior have been defined and interpreted differently throughout history .
caspersen et al.1 ) defined physical activity as any bodily movement produced by skeletal muscle that requires energy expenditure , and
exercise involves a planned , structured , and repeated behavior aimed to maintain or improve components of physical fitness .
these definitions remain in popular use.2 ) one method to estimate the intensity of physical activity more accurately is by applying the metabolic equivalent method ( met ) .
thus , physical activity may be classified as of light - intensity ( <3 mets ) , moderate - intensity ( 36 mets ) and vigorous - intensity ( > 6 mets ) physical activity.3 ) currently , a variety of recommendations exists to meet the minimum requirement for physical activity .
most of these recommendations indicate that individuals need to engage in moderate or vigorous intensity physical activity for a certain amount of time per week .
at least 30 minutes of moderate - intensity physical activity , five days per week , or 20 minutes of more intense physical activities , 3 days per week , is recommended , for example.45 ) the world health organization2 ) recommends that adults aged between 18 and 64 years should accumulate at least 150 minutes of moderate - intensity aerobic physical activity throughout the week , or undertake at least 75 minutes of vigorous - intensity aerobic physical activity throughout the week , or perform a combination of both forms of physical activity .
the use of the terms physical inactivity, sedentarism and sedentary behavior has been controversial and some authors have suggested that it is essential to refine their definitions.67 ) one of the first attempts to address the emergence of a health crisis from a physical - inactivity perspective was booth et al.,8 ) who introduced an evolutionary explanation related to thrifty genes for an unhealthy sedentary population .
hamilton et al.9 ) reiterated that sedentary behavior involves all activities with low levels of metabolic energy expenditure .
they highlighted too much sitting as an important sedentary behavior leading to differing health hazards on metabolism , in relation to the lack of exercise.910 ) ten years after booth 's article , a call for scientists to explore the consequences of sedentary behavior , as an independent metabolic risk factor , was still being made.1011 ) an accurate classification of subjects , according to their total daily activities , is essential .
first , they evaluated subject a , who did not meet the recommended levels of physical activity , but was engaged in low - intensity physical activity for 75% of his day , with 25% of his daily activity defined as sedentary behavior ( 1.5 mets ) . secondly , they evaluated subject b , who met the recommended levels of physical activity , but spent 70% of the day in sedentary behaviors .
the authors concluded that subject a had a higher energy expenditure level than subject b ( 26.3 mets and 23.6 mets , respectively ) despite the latter being normally considered as active by most studies.7 ) the development of sedentarism as a research field has been complex , since two working definitions currently exist , namely one definition used by those studying the effects of accumulating sedentary behaviors ( mainly reported within biology and health literature ) ; and another definition used by those who define sedentary behavior as not engaging in minimum levels of physical activity ( mainly reported within sports and exercise literature ) .
aware of inconsistencies in the terminology , the sedentary behavior research network ( sbrn ) proposed , in 2012 , a definition of sedentary behavior as any waking behavior with an energy expenditure of 1.5 mets , while in a sitting or reclining posture . the term
physical inactivity was described as performing insufficient amounts of physical activity , that is , not meeting specified physical activity guidelines.12 ) despite some dissenting views,13 ) an increasing number of researchers agree with the sbrn definition.141516 )
a chronic disease is slow in its progression and long - lasting.17 ) the incidence of chronic disease has increased dramatically in the last century , and are considered to be an underestimated epidemic.81819 ) it is well known that obesity rates have risen dramatically over the last few years . in 2008 , 34.3% of men and women over 20 years of age had a body mass index ( bmi ) of 25 kg / m , globally.20 ) it is estimated that , from 1980 to 2013 , the prevalence of overweight and obese men and women has increased from 28.8% to 36.9% , and from 29.8% to 38% , respectively .
similarly , it was estimated in 1998 that the worldwide prevalence of diabetes in adults had been 4.0% in 1995 , and that this was expected to rise by 5.4% by the year 2025.21 ) finally , in 1999 , 34% of all worldwide deaths in women and 28% in men were related to cardiovascular disease ( cvd).22 ) more recent data shows that one - third of worldwide deaths are due to cvd and this figure is expected to increase.23 )
in 2011 , a study estimated that 1 in 5 people are insufficiently physically active .
the sample recruited almost 300,000 individuals older than 15 years , from 76 different countries.24 ) booth et al.8 ) suggested that the battle against chronic disease is inefficient due to an underestimation of the reality of the problem , and the emphasis is directed toward treatment strategies instead of preventative strategies .
individuals engaging in light , moderate or vigorous physical activity had significantly lower risk for cvd mortality , regardless of their metabolic risk factors.25 ) conversely , physical inactivity resulted in a gain of abdominal and visceral fat.26 ) in addition , physical inactivity has been associated with a higher risk of type 2 diabetes , regardless of age , sex , ethnicity , or bmi.27 ) in fact , the two major risk factors associated with type 2 diabetes are obesity and physical inactivity.5 ) evidence shows that the prevalence of diabetes is higher in obese , overweight and physically inactive individuals , and physical inactivity is independently related to an increased risk of each of these diseases.2829 ) in canada , physical inactivity represents 3.7% of the overall health care costs.30 ) in china , more than 15% of both medical and non - medical costs are attributable to physical inactivity , per year.31 ) the effects of small changes in physical inactivity habits are remarkable . in australia ,
the benefits of reducing physical inactivity by 10% represent a cost saving of 0.19% of total annual health expenditure.32 ) in people aged 70 years , low - intensity physical activity at least once a week is associated with a reduced risk for type 2 diabetes , compared with those physically inactive.33 ) clearly physical inactivity is a determinant for health .
however , recent evidence supports the fact that both physical inactivity and sedentary behavior contribute to the global burden of chronic disease , as discussed below .
for example , warren et al.34 ) found that men who reported being in a car for more than 10 hours per week had an 82% greater risk of cvd mortality compared to men who reported fewer than 4 hours per week .
also , it has been reported that one additional hour of sedentary activity increases the risk of being overweight ( 13% ) and developing high abdominal fat ( 26%).35 ) the effects of different leisure - time sedentary behaviors on obesity have also been studied . in a canadian population study ,
the prevalence of obesity was significantly higher in people who watched television for more than 21 hours per week , and lower in people who watched television for fewer than 5 hours per week ( from 25% to 14% in men and from 24% to 11% in women ) , regardless of leisure - time and physical activity.36 ) an increase of 2 hours per day in watching television was related to a 14% higher risk of developing type 2 diabetes .
moreover , an increment of 2 hours per day in time spent seated at work was associated with a 7% increase in developing diabetes.37 ) recently , the national heart , lung and blood institute , the national institute on aging , and the office of disease prevention of the national institutes of health , assembled a panel of expert scientists to discuss relevant issues in the field of sedentary behavior and to identify research priorities .
discussion meetings were summarized into four areas ; epidemiology , physiology , intervention strategies , and research strategies about sedentary behavior.3839404142 ) this demonstrates a growing institutional scientific recognition of this topic .
there is growing evidence to suggest that there is a potential risk threshold for health , related to the degree of activity or inactivity .
on the one hand , there is an optimal amount of time spent in physical activities to promote favorable health effects , while on the other hand , there is an optimal amount of time spent in sedentary behavior , beyond which developing chronic disease is more likely .
the clear message is that to be physically active is not enough , but one also needs to avoid too much time spent in sedentary behaviors .
a more complete physiological understanding of the implications for health of the physical activity continuum is urgently needed .
it has been proposed that future investigation designs should attempt to include examples of both sedentary conditions and physically inactive conditions , in order to establish a global perspective about the specific contribution of each one to chronic disease.42 ) to achieve this goal , methods should include both subjective and objective measurement tools .
objective measurements , such as accelerometers , provide more accurate information about patterns of physical activity , thereby reducing measurement error .
however , objective measurements can not account for the specific domain of sedentary behavior , such as watching television , playing video games , or being seated at work.39 ) therefore , a global assessment needs to incorporate self - report data from subjects in addition to objective measurements .
future research needs a new approach to focus on the appropriate use of these assessment methods to gain a better understanding of the impact of sedentary behavior and physical inactivity for global population health .
this is necessary because sedentary behavior and physical inactivity represent two different conditions with unique and differing underlying biological mechanisms .
the primary interest of research studies has been centered on the positive health benefits of exercise as a gold standard medicine .
better understanding of the detrimental effects of both physical inactivity and sedentary behaviors can also assist in promoting positive health outcomes . | new research into physical activity suggests that it is no longer sufficient just to meet minimum levels recommended by health guidelines in order to reduce cardiovascular risk .
both physical inactivity and sedentary behavior have their own health hazards and need to be addressed separately , in order to explore their different deleterious mechanisms .
the aim of this review was to define and to characterize both concepts , and their relationship with major non - communicable chronic diseases .
a pubmed database search was undertaken , using the following key words : physical activity , physical inactivity , sedentarism , sedentary behavior , and non - communicable chronic disease .
this literature review provides an updated view on physical inactivity and sedentary behavior , and reevaluates their prevalence and association with major non - communicable chronic disease . |
rhabdoyosarcoma ( rms ) , which is a neoplasm of soft tissue , is seen both in adults and children ; however , its occurrence in infants is very rare .
the most common sites of metastatic involvement are the soft tissues , serosal surfaces , lung , bone marrow , and lymph nodes ; therefore , it can be mistaken for acute leukemia and lymphoma . to the best of our knowledge ,
we present a case of congenital embryonal rhabdomyosarcoma with unusual clinical features of multiple skin nodules and bone marrow metastases .
a 6-month - old female , first child of a family , was presented to our department with irritability and skin lesions which appeared since she was 1-month - old .
her parents noticed these skin lesions as dark - purple swellings in different sizes , first at left extremity and short after throughout her body since she was 1-month - old ( fig .
1 ) . some of these lesions were waxed and waned over time , but did nt have been improved .
lab findings revealed high esr : 88 and ldh : 8932 and low hemoglobin : 7.9 g / dl levels .
vinillylmandelic acid ( vma ) and homovanillic acid ( hva ) tests for neuroblastoma were unremarkable .
ct scanning of brain , thoracic , abdomen and pelvic organs revealed multiple subcutaneous nodules in skull , chest wall , and abdominopelvic skin , some with necrotic centers and the largest measured at 39 * 50 mm .
multiple lymphadenopathies were noted in supraclavicular , both axilla , both iliac chain , inguinal and right paraaortic ( 27 * 15 mm ) . there were nt any significant organic abnormalities ( fig2 ) .
skin biopsy was performed ; histopathologic studies revealed proliferation of small round dispersed cells , composed of primitive mesenchymal cells in various stages of myogenesis with scant to moderate amount of deeply eosinophilic cytoplasm with occasionally cross striations , eccentric , small oval nuclei , and inconspicuous nucleoli ( fig .
4 ) ; while , it was negative for cd1a , lca , cd68 , cd99 , synaptophysin , chromogranin and wt1 .
as the patient developed pancytopenia , she underwent bone marrow aspiration , which showed monotonous infiltration of large tadpole - like cells in bone marrow with abundant bluish cytoplasm ( fig5 ) . on the basis of histopathology , diagnosis of embryonal rhabdomyosarcoma
was made . due to the observation of multiple lesions , the patient underwent chemotherapy with vincristine , actinomycin , cyclophosphamide , and dexamethasone , and remained disease free for 8 months after diagnosis .
rhabdomyosarcoma is a soft tissue tumor which accounts for 48% of all soft tissue tumors in children mostly occurring between the ages of 3 and 12 years , ; however , its occurrence in infancy is extremely rare , , , .
males are affected more often , but there is not gender difference in recent reported neonatal cases , , .
rms is classified into three types of embryonal , alveolar and pleomorphic , as well as several subtypes and possibly minor categories , , , , , , , , .
embryonal type variants and related tumors include botryoid , pleomorphic , clear cell , rhabdoid , spindle cell and sclerosing types , , .
embryonal rhabdomyosarcoma is the most common type in infancy and children among above - mentioned three types , .
this tumor type arises from undifferentiated mesoderm and is common in the head and neck region ( particularly the orbit , nasopharynx , middle ear , and oral cavity ) , retroperitoneum , bile ducts , and urogenital tract , .
clinically , its differential diagnoses are neuroblastoma , lymphoma , leukemia , neurofibroma , hemangioma and fibromatousis , .
the most common sites of metastatic involvement are soft tissues , serosal surfaces , lung , bone marrow , and lymph nodes . in comparison with other soft tissue tumors ,
lymph node metastasis is frequent in rhabdomyosarcoma and is of a great value in tumor staging , .
the prognosis of embryonal rhabdomyosarcoma has markedly improved following multimodality treatment with excision , radiation therapy , and multidrug chemotherapy , , , , .
furthermore , its fast growth in less than one month was noteworthy ; otherwise , the patient seemed to be normal at birth and the symptoms began one month after .
most of the previously reported congenital embryonal rms had male dominancy , but our patient was female , , , .
the radiological examination revealed multiple involvements through the whole body , including subcutaneous lesions and several lymphadenopathies .
although the metastases to bone marrow was established through histologic examination of bone marrow aspiration , it was uncertain whether it has multiple primaries , or from the left extremity and metastasize to other sites .
we examined other markers in this case for ruling out other probable important differential diagnoses .
as synaptophysin , chromogranin , lca(cd45 ) , cd99 , wt1 , cd68 and cd1a were negative , besides immunopositivity for muscle markers , neuroblastoma ( synaptophysin+ , chromogranin+,myogenin- , desmin- ) , large cell lymphoma(cd45 + , b / t cell markers present , desmin- ) , acute lymphoblastic leukemia(lca+ , cd99 + , myogenin- , desmin- ) , wilms tumor(wt1 + , myogenin- , desmin- ) , ewing sarcoma ( cd99 + , myogenin- , desmin- ) and langerhans cell histiocytosis(cd68 + and cd1a + ) were excluded ; , hence , our case did not fit any of these diagnoses , , .
we describe a patient with unusual presentation of multiple rhabdomyosarcoma of a female neonate . it was uncertain whether it has multiple primaries , or from the left extremity and metastasize to other sites .
this rare condition should be considered clinically in the differential diagnosis of neuroblastoma , lymphoma , leukemia , neurofibroma , hemangioma , fibromatousis and mastocytosis .
it is important to keep in mind that rhabdomyosarcoma can be seen as multiple congenital lesions in neonates , therefor necessary diagnostic imunohistochemical staining should be done to the better management of the disease .
this research received no specific grant from any funding agency in the public , commercial , or not - for - profit sectors .
none of the authors have any commercial or financial involvement in connection with this study that represents or appears to represent any conflicts of interest
written informed consent was obtained from the patient s parents for publication of this case report and accompanying images .
a copy of the written consent is available for review by the editor - in - chief of this journal on request . | highlightswe report a neonate patient with congenital rhabdomyosarcoma that had multiple lesions.this rare condition should be considered in the differential diagnosis of neurofibroma and lymphoma in neonates.the rapid diagnosis of congenital rhabdomyosarcoma can prevent disease progression by appropriate chemotherapy regimen.it was very interesting that lesions were multiple and affected different parts of the body.although bone marrow involvement by embryonal rhabdomyosarcoma is very rare , it should be considered even in early manifestation in a neonate . |
coronary artery stents , particularly drug - eluting stents ( des ) , are used in the majority of patients who undergo percutaneous coronary intervention ( pci ) .
stent thrombosis is an uncommon but serious complication of coronary artery stents that almost always presents as death or a large non - fatal myocardial infarction , usually with st elevation .
stent thrombosis can occur acutely ( within 24 hours ) , subacutely ( within 30 days ) , or as late as one year ( late ) or more ( very late ) after stent placement .
we present a case of very late stent thrombosis 59 months after stent placement and review the literature .
a 41-year - old arab male with history of diabetes , hypertension , dyslipidemia , and coronary artery disease presented with exertional angina .
he had undergone multivessel percutaneous coronary intervention ( pci ) in another country in september 2005 for effort angina symptoms .
a 2.75 28 mm sirolimus - eluting stent ( cypher stent ) ( ses ) was deployed in the left anterior descending artery ( lad ) .
three cypher stents ( 3.5 28 mm proximal , 3 33 mm mid and 3 33 mm distal ) were implanted in the right coronary artery ( rca ) .
a cypher stent ( 2.75 33 mm ) was deployed in the posterolateral branch .
a routine ct coronary angiogram performed in june 2009 showed no evidence of restenosis or thrombosis .
he was taking clopidogrel 75 mg / day for a year , stopped and then continued only with aspirin 75 mg / day .
he was on lisinopril , atorvastatin along and oral antidiabetic medication . during the last week of july 2010 ,
his troponin t was negative and a transthoracic echocardiogram was normal . after receiving loading doses of aspirin ( 300 mg ) and clopidogrel ( 600 mg )
, he underwent a coronary angiogram which showed patency of the lad , but rca stents demonstrated multiple thrombi in the mid - to - distal stent segments with thrombolysis in myocardial infarction ( timi ) 2 antegrade flow [ figure 1[. intravenous tirofiban bolus was administered followed by tirofiban and unfractionated heparin infusion for 24 h. he underwent pci the following next day .
multiple balloon inflations were performed within the stent using a 3 15 mm balloon to pulverize the large clots [ figure 2a ] .
this restored the timi 3 antegrade flow with disappearance of thrombus , obviating the need for additional stent placement [ figure 2b ] .
there was no apparent evidence of in - stent restenosis , stent fracture , or late - acquired malapposition , but the distal and proximal rca stents appeared to be mildly underexpanded .
hence these two stents were treated with high - pressure balloon dilatation [ figure 3a and b ] .
coronary angiogram ( a c ) showing multiple in - stent filling defects in mid - to - distal right coronary artery stent segments with a timi 2 flow , in a patient with sirolimus - eluting stent thrombosis coronary angiogram showing balloon angioplasty of the right coronary artery in - stent thrombi ( a ) followed by restoration of a timi 3 grade flow and disappearance of thrombi ( b ) , in a patient with sirolimus - eluting stent thrombosis coronary angiogram showing balloon dilatation of proximal ( a ) and distal ( b ) underexpanded sirolimus - eluting stents in the right coronary artery and the final angiographic result with a timi 3 grade flow and no residual thrombus ( c ) the final angiogram showed excellent results with no residual thrombus and timi-3 flow [ figure 3c ] .
post - procedure , the patient received heparin and tirofiban infusion for 24 h. the patient had an uneventful recovery and was discharged on aspirin ( 300 mg / day ) and clopidogrel ( 75 mg / day ) indefinitely .
platelet functional assays were not available to assess for evidence of aspirin and/or clopidogrel resistance .
stent thrombosis ( st ) is a rare but usually a catastrophic event , frequently associated with large myocardial infarction or death . the rate of early stent thrombosis ( < 30 days ) ( est ) appears to be similar in both des and bare - metal stents ( bms ) , remaining below 1% . in the basket - late ( basel stent kosten effektivitts trial
late thrombotic events ) study , the rates of late stent thrombosis ( > 30 days ) ( lst ) were higher in the des group ( 2.6 vs. 1.3% bms group ) as well as major adverse cardiac events ( 4.9% des group vs. 1.3% bms group ) .
metaanalysis of randomized trials suggest approximately 0.5% increased risk of very late stent thrombosis ( > 12 months ) ( vlst ) with des.[35 ] the exact pathophysiology of vlst is unknown .
the recognized independent predictors for st in the real world include premature antiplatelet discontinuation , acute coronary syndrome , renal failure , diabetes , present malignancy , younger age , low ejection fraction , bifurcation lesions , long stents , undersizing of the coronary stent , timi flow grade <3 , the presence of intermediate coronary artery disease proximal and distal to the culprit lesion , residual dissection , stent underexpansion and in - stent restenosis.[168 ] even though cessation of dual antiplatelet therapy is one of the commonest causes for st , it has been observed that vlst tends to occur despite dual antiplatelet therapy or after long periods of clopidogrel discontinuation ( as in this patient ) and without a clear relationship to the usual technical or lesion risk factors associated with est .
furthermore , events continue to occur at similar rates ( 0.6% per year ) up to 3 years .
dess reduce restenosis by inhibiting neointimal hyperplasia , but at the cost of delaying the healing process far beyond the 3 to 6-month period usually required with bmss .
dess expose the vessel wall to antiproliferative drugs and drug - eluting platforms , with variable effects on endothelial regeneration and function .
endothelial dysfunction and incomplete neointimal coverage of stent strut remain the basic underlying mechanisms responsible for st in des .
it is noted that presence of incomplete late stent apposition along with delayed or absent stent strut endothelialization and persistent chronic inflammation ( late hypersensitivity to des polymer ) are possible mechanisms for vlst . in a recent meta - analysis of late stent malapposition ( procedural or acquired )
using intravascular ultrasound , the risk of malapposition was four times higher and the risk of vlst was six times higher in des compared with bms .
in a recent study from the ses registry , total stent length per lesion per patient had significant impacts on target lesion revascularization rates .
longer total stent length per patient ( > 55 mm ) was associated with increased incidence of stent thrombosis through 3 years . in the case
presented , the total stent length for the patient was 155 mm which could have increased his risk for vlst . in another similar study ,
stent lengths 31.5 mm were associated with significantly higher rates of st ( 4.0 vs. 0.7% ) , death ( 5.2 vs. 3.0% ) , and myocardial infarction ( 2.4 vs. 0.7% ) at 3 years , as compared with stent lengths < 31.5 mm .
in addition , poor biological response to aspirin and/or clopidogrel is also frequent in clinical settings such as diabetes , obesity , and acute coronary syndromes .
the theory of aspirin and clopidogrel resistance is currently accepted , although with limitations due to the different methods used to assess platelet response . in the recently published restart ( registry of stent thrombosis for review and reevaluation ) registry , involving ses - associated st ,
factors associated with lst and vlst were hemodialysis , end - stage renal disease not on hemodialysis , the absence of left circumflex coronary artery target lesion , target lesion of chronic total occlusion , any previously performed pci , and age < 65 years .
in addition , history of heart failure , insulin - dependent diabetes mellitus , and low body mass index were associated with lst when compared with vlst .
overall , clinical presentation of all types of st was st - segment elevation ( 69% ) and non - st - segment elevation ( 23% ) acute coronary syndrome , and cardiac arrest or ventricular fibrillation in 8% of patients . in the desire ( drug - eluting stents in the real world ) late registry with > 4 years follow - up ,
event - free survival and cumulative incidence of definite / probable st were 85% and 1.7% , respectively .
independent predictors of vlst were pci in the setting of acute myocardial infarction , des overlapping , treatment of multivessel disease , presence of moderate - to - severe calcification at the lesion site , and in - stent residual stenosis . in the case
presented , there were no significant clinical risk factors for vlst that are mentioned above , except for age < 65 years .
the lesion risk factors were long length of the stents per patient was well as per lesion with des overlapping and underexpansion .
the other possible risk factor could be stent malapposition that was not apparent visually , but could have been picked up if intravascular ultrasound was available .
even though , he had extensive thrombus , he did not present with myocardial infarction , which is unusual .
in the restart registry , 52% of patients in the lst group and 21% of patients in the vlst group , taking aspirin and thienopyridine developed st . in another study ,
the incidence of st at 30 days was 0.5% , 0.8% at 1 year , and 1.2% at 4 years of des implantation .
discontinuation of clopidogrel therapy was significantly associated with st only in the first 6 months after the procedure .
hence , there is a need for novel stent designs as well as newer therapeutic strategies in preventing late and very late stent thrombosis among patients receiving drug - eluting stents . | very late stent thrombosis occurs more frequently with drug - eluting stents and tends to occur despite dual antiplatelet therapy or after long periods of clopidogrel discontinuation .
stent thrombosis commonly presents with myocardial infarction or death .
we report a 41-year - old arab male with very late stent thrombosis after 59 months of sirolimus - eluting stent implantation and 49 months after clopidogrel discontinuation despite aspirin continuation , presenting with exertional angina .
he underwent successful percutaneous coronary intervention .
this case underlines the need for novel stent designs as well as newer therapeutic strategies in preventing very late stent thrombosis among patients receiving drug - eluting stents . |
it consists of a pair of cylindrically shaped centrioles surrounded by fibrous pericentriolar material . before or during dna replication in s phase , the centrioles split , and each cylinder serves as a template for the assembly of a new
daughter centriole . before mitosis , when cells contain two pairs of centrioles , each pair serves as a nucleation center for microtubules of the spindle apparatus .
defects in centrosome assembly or in centrosome separation can result in defective nucleation of spindle microtubules , and in several cases , in the formation of monopolar spindles and mitotic arrest ( sunkel et al .
several years ago , evidence was published that defective centrosome assembly can prevent cells from entering s phase . in particular , removal of the centrosome by microsurgery or by
laser ablation resulted in a cell cycle arrest , as did inhibition or silencing of several centrosome - associated proteins , such as dynactin , parp-3 , centriolin , or akap450 ( hinchcliffe et al .
, 2001 ; khodjakov and rieder , 2001 ; quintyne and schroer , 2002 ; augustin et al . , 2003 ; gromley et al . , 2003 ; keryer et al
the mechanism leading to this centrosome - dependent cell cycle arrest in g1 phase has been unclear ; it was proposed that a checkpoint control would prevent those cells with imperfect centrosomes from continuing the cell cycle , to prevent the assembly of defective spindles later in mitosis ( murray , 2001 ) . in this study , we followed cell cycle progress after inhibition of centrosome assembly by depleting the pericentriolar proteins pericentriolar material 1 ( pcm-1 ) and pericentrin .
these proteins have been shown to be necessary for the assembly of other centrosomal constituents ( dictenberg et al . , 1998 ; dammermann and merdes , 2002 ; kubo and tsukita , 2003 ) .
we found that depletion of pcm-1 or pericentrin activates the p38-dependent stress pathway and the p53-dependent cell cycle checkpoint .
we have previously shown that depletion of the protein pcm-1 leads to defects in the assembly of the centrosomal components centrin , ninein , and pericentrin , and to an altered organization of the microtubule network in interphase cells ( dammermann and merdes , 2002 ) . to investigate the consequences of pcm-1 depletion on the cell cycle , we performed rna silencing experiments in primary human fibroblasts , mrc-5 .
depleted cells were tested for incorporation of brdu into the nucleus , as an indicator of dna synthesis ( fig .
we determined that in pcm-1depleted cells only 15 4% incorporated brdu , as compared with 35 3% in controls , as expected for a normal cycling population ( fig .
this is consistent with previous reports on microinjection of pcm-1inhibiting antibodies ( balczon et al . , 2002 ) and on centrosome removal by microsurgery or laser ablation , which prevent cells from entering s phase ( hinchcliffe et al .
several years ago , experiments on cells treated with the microtubule drugs colcemid , nocodazole , and taxol indicated that untransformed cells are arrested in g1 phase , when microtubules are depolymerized or when microtubule dynamics are altered ( trielli et al . , 1996 ; di leonardo et al . , 1997
this raises the question of whether dna replication in pcm-1depleted cells is inhibited because of an altered microtubule network , or whether defects at the centrosome itself suffice to induce a cell cycle arrest .
1 a ) , which in contrast to pcm-1 , only slightly reduces microtubule density but seems to have no significant effect on microtubule anchoring at the centrosome ( dammermann and merdes , 2002 ) . consistently ,
( a ) immunofluorescence of mrc-5 fibroblasts treated with control rna or sirna against pcm-1 and pericentrin , respectively .
graphs depict the percentages of cells lacking pcm-1 or pericentrin expression after treatment with control or silencing rnas .
cells were scored as negative if they lacked centrosomal staining of pcm-1 or pericentrin , only displaying diffuse background fluorescence .
( b ) percentages of cells incorporating brdu after treatment with control rna or silencing rna against pcm-1 or pericentrin .
data were obtained from cell cultures that were double labeled for brdu and pcm-1 or pericentrin . among cell cultures treated with silencing rna , only cells that were visibly depleted of pcm-1 or pericentrin were scored .
( a ) immunoblots of mrc-5 cells treated with control rna or sirna against pcm-1 , prb , or both pcm-1 and prb simultaneously .
blots were probed with antibodies against pcm-1 , cyclin a , the licensing factor mcm3 , the dna replication factor pcna , prb , and -tubulin .
( b ) immunoblots of cells treated with control rna or sirnas against pcm-1 , pericentrin , or both simultaneously .
( c ) mrc-5 cells treated with control rna , sirna against pcm-1 , or sirna against pcm-1 and prb simultaneously .
the percentages of cells staining positively for the proliferation marker ki-67 or for incorporated brdu are shown .
( d ) flow - cytometric analysis of mrc-5 cells treated with control rna or sirna against pcm-1 .
( e ) immunoblots of mrc-5 cells treated with control rna or sirna against pcm-1 for 48 or 120 h or with sirna against pericentrin for 72 h. blots were probed with antibodies against p53 , -tubulin , or p21 . because these data indicated that cells failed to undergo s phase
dependent dna replication when missing the full complement of centrosome proteins , we wanted to test in more detail at what stage cells are arrested .
immunoblotting of cell extracts of pcm-1depleted cultures indicated drastic reduction of cyclin a ( fig .
2 a ) , which is normally found expressed in cells during late g1 , s , and g2 phases .
furthermore , we detected that pcm-1depleted cells also showed reduced amounts of the proteins minichromosome maintenance deficient 3 ( mcm3 ) and proliferating cell nuclear antigen ( pcna ) acting in licensing and dna replication ( fig .
2 a ) and reduced percentages of cells expressing the cell proliferation marker ki-67 ( fig .
altogether , these data indicated that depletion of centrosome proteins reduces the number of cells entering s phase .
we verified this hypothesis by comparing profiles of cell cultures analyzed by flow cytometry ( fig . 2 d ) : consistent with our data on brdu incorporation
we then wanted to determine whether s phase entry was blocked because of checkpoint activation in cells depleted of pcm-1 or pericentrin .
we found that the overall levels of the retinoblastoma protein ( prb ) were reduced to 38 17% and that most of the remaining prb , normally hyperphosphorylated during late g1 and s phase , was present in its faster migrating , hypophosphorylated form ( 77 13% in depleted vs. 38 13% in control cells ; fig .
however , was found up - regulated , especially after prolonged depletion of pcm-1 or pericentrin ( fig .
in depleted cells , the cdk2 inhibitor p21 was found equally up - regulated ( fig .
these data suggested that depletion of the two centrosome - associated proteins pcm-1 and pericentrin leads to the activation of the p53-dependent checkpoint . in the next step , we wanted to determine whether cell cycle progress would be affected if the p53-dependent checkpoint control was abrogated
for this purpose , we attempted simultaneous depletion of p53 and pcm-1 by cotransfecting sirna oligomers against both .
3 a shows that p53 levels could not be reduced when pcm-1 was missing . we tried to refine this experiment by sequential depletion of mrc-5 cells , by first depleting > 90% of p53 after 72 h , followed by simultaneous sirna treatment against p53 and pcm-1 .
however , we observed that under these conditions , p53 levels increased back to 4050% in three different experiments ( unpublished data ) .
we concluded that p53 turnover is altered and that the residual p53 protein might be stabilized in the absence of an intact centrosome .
we therefore changed our experimental strategy and compared cell cycle progress after pcm-1 depletion in several cell lines lacking p53 .
we used mouse embryonic fibroblasts from p53 knockout mice ( unpublished data ) as well as the human lung carcinoma cell line h1299 . because of the loss of p53 checkpoint control , both lines displayed a relatively high basic rate of dna synthesis ( fig .
we found that in both p53/ cell lines , pcm-1 depletion did not inhibit cell cycle progress .
, we also tested the effect of pcm-1 depletion in the p53+/+ and p53/ lines of hct116 cells .
brdu incorporation in these was reduced from 42% in controls to 33% in partially depleted p53 + cells , whereas p53 cells showed brdu incorporation in 49% after partial pcm-1 depletion . consistently
, hela cells with functionally suppressed p53 checkpoint control do not arrest in the absence of centrosomes ( la terra et al . ,
in contrast to p53 , the removal of prb did not cause resumption of the cell cycle in pcm-1depleted mrc-5 cells , because the percentages of brdu - incorporating cells and ki-67expressing cells remained low , as did the expression of mcm3 protein ( fig .
on the other hand , the amounts of cyclin a and pcna were restored to nearly control levels .
a possible scenario would be that centrosome defects activate both prb and p53 in parallel , with p53 having feedback effects on prb phosphorylation and prb protein levels but not vice versa .
this would be consistent with our observation that prb levels drop after pcm-1 or pericentrin depletion and that depletion of prb itself does not fully restore s phase activity , which is probably blocked because of checkpoint control mechanisms directly dependent on p53 .
eventually , loss of prb might be compensated by rb - related pocket proteins , such as p107 or p130 .
cell cycle arrest after pcm-1 depletion depends on the checkpoint protein p53 . ( a ) immunoblots of mrc-5 cells treated with control rna or sirnas against pcm-1 , p53 , or both pcm-1 and p53 combined .
( b ) graph depicts brdu incorporation in p53/ h1299 cells treated with control rna or sirna against pcm-1 .
( c ) immunoblots of h1299 and mrc-5 cells treated with control rna or sirna against pcm-1 ( pcm1d ) for 72 h. blots were probed with antibodies against pcm-1 , p53 , pcna , mcm3 , prb , or -tubulin .
finally , we addressed the question of how defects in centrosome assembly could activate the p53-dependent checkpoint .
it has been reported that p38 mapk is involved in the cell 's response to a range of stress factors , such as uv irradiation , osmotic shock , heat shock , starvation , and cytokine treatment ( zarubin and han , 2005 ) .
the response to these stress factors is mediated partly through p53 phosphorylation , which is believed to stabilize p53 and to increase the expression of the cdk inhibitor p21 , thereby blocking the cell cycle ( agarwal et al . , 1998 ) .
to assess the involvement of stress - activated p38 mapk in response to centrosome defects , we have treated pcm - depleted mrc-5 cells with the p38 mapk specific inhibitor sb203580 .
we found that the inhibitor prevented cell cycle arrest , as indicated by resumption of dna synthesis ( fig .
p38 inhibition in pcm-1depleted cells also restored regular levels of cyclin a and hyperphosphorylated prb , as well as expression of ki-67 and mcm3 ( fig .
further , the inhibition of p38 led to decreased levels of p21 but only slightly decreased p53 ( fig .
this could be explained by a stabilization of p53 after centrosome inactivation , as discussed in the previous paragraph , which might occur independently of p38-dependent p53 activation .
alternatively , the centrosome - dependent cell cycle arrest might not simply be a linear consequence of p53 activation via p38 .
for example , p53 might be activated by other kinases in addition to p38 . moreover , although p38 has been shown in multiple experiments to mediate cell cycle arrest by phosphorylating various sites of p53 ( bulavin et al .
, 1999 ; huang et al . , 1999 ) , p38 is also known to phosphorylate and thereby inactivate cdc25a and cyclin d , which in turn arrests the cell cycle ( lavoie et al . , 1996 ; casanovas et al . , 2000
however , p38 mapk activation in the absence of p53 seems to be insufficient for centrosome - dependent cell cycle arrest because pcm-1 depletion in p53/ cells did not stop the cell cycle .
( a ) immunoblots of mrc-5 cells treated with control rna , sirna against pcm-1 , or sirna against pcm-1 together with the p38 inhibitor sb203580 ( pcm-1 + inh ) .
blots were probed with antibodies against prb , cyclin a ( cyc a ) , p53 , the cdk inhibitor p21 , active p38 , or -tubulin .
( b ) graphs depicting mrc-5 cells treated with control rna , sirna against pcm-1 , or sirna against pcm-1 together with the p38 inhibitor sb203580 ( pcm-1 + inh ) .
the staining of brdu incorporation ( after rna treatment for 72 or 96 h ) , ki-67 immunofluorescence ( after rna treatment for 96 h ) , or mcm3 immunofluorescence ( after rna treatment for 72 h ) is shown . in our pcm-1depletion experiments , we observed a significant decrease in the expression of proteins associated with cell proliferation , such as mcm3 , pcna , or ki67 .
however , because about half of the depleted cells were still entering s phase , we wanted to test whether centrosome defects only slowed down cell cycle activity , or whether depleted cells were predisposed to a stable arrest that did not affect all cells simultaneously . immunofluorescence of p53 after pcm-1 depletion revealed that p53 levels varied between individual cells , with some cells showing a very high increase but a small increase or no obvious response in others ( fig . 5 a ) .
we then tested whether the cells ' response to centrosome inhibition induces exit from the cell cycle via senescence .
senescence is marked by the acquisition of a permanent g0 state and an increase of cellular -galactosidase activity ( dimri et al . , 1995 ) .
a cytochemical analysis of pcm-1depleted cultures revealed a 10-fold increase of -galactosidase positive cells ( fig . 5 b ) , compared with a basal level of 3% in controls .
consistently , we previously reported that cultures of u2os cells died after silencing of pcm-1 for long periods ( dammermann and merdes , 2002 ) , although the experimental conditions varied from the protocol used here .
senescence has been characterized as a cellular program activated as a result of physiological stresses preventing further cell proliferation ( ben - porath and weinberg , 2004 ) . instead of a specific centrosome - dependent cell cycle control as proposed by murray ( 2001 ) ,
the idea of the centrosome as a center for stress - related signaling seems plausible , considering its central location in the focus of the microtubule network and its ability to bind various molecules of signaling pathways and of cell cycle regulation .
for example , significant amounts of protein kinase a , polo - like kinase , and protein phosphatases 1 and 2a , as well as cyclin e and p53 , have all been localized to the centrosome ( fry et al . , 2000 ; morris et al . , 2000 ;
is mediated by large coiled - coil proteins such as pericentrin , akap450 , or akap220 ( diviani et al .
, 2000 ; reinton et al . , 2000 ; diviani and scott , 2001 ) . absence or inhibition of anchoring proteins could therefore disrupt cellular signaling pathways and elicit a stress response
. further research will be necessary to investigate the multiple interactions between centrosome proteins , cell signaling , and the complex regulation of the cell cycle .
( a ) fibroblasts treated with control and pcm-1 sirna , stained for pcm-1 ( red ) , dna ( blue ) , and p53 ( green ) .
( b ) -galactosidase assay on control and pcm-1depleted cells 96 h after transfection using 5-bromo-4-chloro-3-indolyl -d - galactopyranoside as a chromogenic substrate .
human fetal lung fibroblasts mrc-5 ( european collection of cell cultures ) and h1299 cells ( a gift from b. vojtesek , masaryk memorial cancer institute , brno , czech republic ) were cultured in dme ( invitrogen ) , supplemented with 10% fetal bovine serum ( perbio science ) , 2 mm l - glutamine , and antibiotics .
hct116 cells ( a gift from b. vogelstein , johns hopkins university , baltimore , md ) were cultured in mccoy 's medium containing the same supplements .
about 3 10 cells from early passages of mrc-5 and 0.5 10 cells of h1299 or hct116 were transfected with 9 or 18 g of sirna oligonucleotides , respectively , in a nucleofector electroporation device , using the appropriate transfection kit ( amaxa ) .
the cells were then plated onto two 10-cm petri dishes to obtain a confluency of 3040% on the next day . routinely , sirna treatment was for a total of 72 h before fixation or preparation of cell extracts , unless indicated otherwise .
p38 mapk inhibition was performed in cells that were transfected with oligos and cultured overnight before the specific inhibitor sb203580 ( calbiochem ) was added at a concentration of 10 m .
inhibitor - treated cells were left in culture for another 48 h and then fixed in methanol or extracted for sds - page .
cells were harvested using trypsin - edta , counted , and washed in ice - cold pbs .
amounts of extract equal to 200,000 cells were loaded and run on 7.5 , 10 , or 12.5% sds - page gels and blotted onto nitrocellulose .
the following antibodies were used for western blot analysis or immunofluorescence : affinity - purified rabbit anti
pcm-1 ( dammermann and merdes , 2002 ) , anti - mcm3 mab clone 3a2 ( mbl international corporation ) , anti - prb mab clone 4h1 ( cell signaling ) , anti - pcna mab clone pc-10 ( sigma - aldrich ) , anti cyclin e mab clone he12 ( zymed laboratories ) , anti cyclin a mab clone cy - a1 ( sigma - aldrich ) , anti p53 mab clone do-1 ( novocastra ) , anti - p21 mab clone sx118 ( bd biosciences ) , rabbit anti - activep38mapk polyclonal antibody ( promega ) , anti-tubulin mab clone dm1a ( sigma - aldrich ) , goat anti
rabbit igg polyclonal antibody hrp ( ge healthcare ) , rat anti - brdu mab ( harlan ) , anti
ki-67 mab clone mm1 ( novocastra ) , rabbit anti - pericentrin polyclonal antibody ( covance ) , donkey anti rabbit or anti mouse igg conjugated with alexa 488 or alexa 594 ( invitrogen ) .
quantification of protein levels was performed by scanning immunoblots and analyzed using the photoshop ( adobe ) histogram tool .
quantification of cells expressing specific proteins was performed by counting sirna - treated cells that were double stained with pcm-1 antibodies to verify depletion .
the following sirna oligomers with dtdt overhangs ( qiagen ) were used : pcm-1.2 , corresponding to human pcm-1 ( ucagcuucgugauucucag ) ; peric , corresponding to human pericentrin ( gcagcugagcugaaggaga ; dammermann and merdes , 2002 ) ; prb ( gcccuuacaaguuuccuag ) ; and p53 ( cuacuuccugaaaacaacg ) .
all cells in a culture dish were harvested by trypsinization , washed in ice - cold pbs , and fixed in 80% ice - cold ethanol in pbs . before staining , the cells were spun down in a cooled centrifuge and resuspended in the cold .
bovine pancreatic rnase ( sigma - aldrich ) was added at a final concentration of 2 g / ml , and cells were incubated at 37c for 30 min , followed by an incubation in 20 g / ml of propidium iodide ( sigma - aldrich ) for 20 min at room temperature .
cells grown on coverslips were fixed in ice - cold methanol and stored at 20c until use .
antibody staining was performed using the reagents listed in the previous paragraphs , according to standard protocols .
the percentage of cells in s phase was assessed by adding 100 m brdu ( sigma - aldrich ) to the cultures 30 min before fixation .
double labeling of brdu and pcm-1 was performed by probing first for pcm-1 , using rabbit anti
pcm-1 and fluorescent anti - rabbit antibody , and coverslips were postfixed in pbs containing 3.7% paraformaldehyde , treated with 2 m hcl for 30 min , and stained with rat anti - brdu and fluorescent secondary anti - rat antibody .
cells were viewed with a fluorescence microscope ( axioskop 2 ; carl zeiss microimaging , inc . )
equipped with a camera ( axiocam ; carl zeiss microimaging , inc . ) and software ( axiovision ; carl zeiss microimaging , inc . ) .
human fetal lung fibroblasts mrc-5 ( european collection of cell cultures ) and h1299 cells ( a gift from b. vojtesek , masaryk memorial cancer institute , brno , czech republic ) were cultured in dme ( invitrogen ) , supplemented with 10% fetal bovine serum ( perbio science ) , 2 mm l - glutamine , and antibiotics .
hct116 cells ( a gift from b. vogelstein , johns hopkins university , baltimore , md ) were cultured in mccoy 's medium containing the same supplements .
about 3 10 cells from early passages of mrc-5 and 0.5 10 cells of h1299 or hct116 were transfected with 9 or 18 g of sirna oligonucleotides , respectively , in a nucleofector electroporation device , using the appropriate transfection kit ( amaxa ) .
the cells were then plated onto two 10-cm petri dishes to obtain a confluency of 3040% on the next day . routinely , sirna treatment was for a total of 72 h before fixation or preparation of cell extracts , unless indicated otherwise .
p38 mapk inhibition was performed in cells that were transfected with oligos and cultured overnight before the specific inhibitor sb203580 ( calbiochem ) was added at a concentration of 10 m .
inhibitor - treated cells were left in culture for another 48 h and then fixed in methanol or extracted for sds - page .
cells were harvested using trypsin - edta , counted , and washed in ice - cold pbs .
amounts of extract equal to 200,000 cells were loaded and run on 7.5 , 10 , or 12.5% sds - page gels and blotted onto nitrocellulose .
the following antibodies were used for western blot analysis or immunofluorescence : affinity - purified rabbit anti
pcm-1 ( dammermann and merdes , 2002 ) , anti - mcm3 mab clone 3a2 ( mbl international corporation ) , anti - prb mab clone 4h1 ( cell signaling ) , anti - pcna mab clone pc-10 ( sigma - aldrich ) , anti cyclin e mab clone he12 ( zymed laboratories ) , anti cyclin a mab clone cy - a1 ( sigma - aldrich ) , anti p53 mab clone do-1 ( novocastra ) , anti - p21 mab clone sx118 ( bd biosciences ) , rabbit anti - activep38mapk polyclonal antibody ( promega ) , anti-tubulin mab clone dm1a ( sigma - aldrich ) , goat anti mouse polyclonal antibody hrp ( promega ) , donkey anti rabbit igg polyclonal antibody hrp ( ge healthcare ) , rat anti - brdu mab ( harlan ) , anti ki-67 mab clone mm1 ( novocastra ) , rabbit anti - pericentrin polyclonal antibody ( covance ) , donkey anti rabbit or anti mouse igg conjugated with alexa 488 or alexa 594 ( invitrogen ) .
quantification of protein levels was performed by scanning immunoblots and analyzed using the photoshop ( adobe ) histogram tool .
quantification of cells expressing specific proteins was performed by counting sirna - treated cells that were double stained with pcm-1 antibodies to verify depletion .
the following sirna oligomers with dtdt overhangs ( qiagen ) were used : pcm-1.2 , corresponding to human pcm-1 ( ucagcuucgugauucucag ) ; peric , corresponding to human pericentrin ( gcagcugagcugaaggaga ; dammermann and merdes , 2002 ) ; prb ( gcccuuacaaguuuccuag ) ; and p53 ( cuacuuccugaaaacaacg ) .
all cells in a culture dish were harvested by trypsinization , washed in ice - cold pbs , and fixed in 80% ice - cold ethanol in pbs . before staining , the cells were spun down in a cooled centrifuge and resuspended in the cold . bovine pancreatic rnase ( sigma - aldrich )
was added at a final concentration of 2 g / ml , and cells were incubated at 37c for 30 min , followed by an incubation in 20 g / ml of propidium iodide ( sigma - aldrich ) for 20 min at room temperature .
cells grown on coverslips were fixed in ice - cold methanol and stored at 20c until use .
antibody staining was performed using the reagents listed in the previous paragraphs , according to standard protocols .
the percentage of cells in s phase was assessed by adding 100 m brdu ( sigma - aldrich ) to the cultures 30 min before fixation .
double labeling of brdu and pcm-1 was performed by probing first for pcm-1 , using rabbit anti
pcm-1 and fluorescent anti - rabbit antibody , and coverslips were postfixed in pbs containing 3.7% paraformaldehyde , treated with 2 m hcl for 30 min , and stained with rat anti - brdu and fluorescent secondary anti - rat antibody .
cells were viewed with a fluorescence microscope ( axioskop 2 ; carl zeiss microimaging , inc . ) equipped with a camera ( axiocam ; carl zeiss microimaging , inc . ) and software ( axiovision ; carl zeiss microimaging , inc . ) . | previous evidence has indicated that an intact centrosome is essential for cell cycle progress and that elimination of the centrosome or depletion of individual centrosome proteins prevents the entry into s phase . to investigate the molecular mechanisms of centrosome - dependent cell cycle progress , we performed rna silencing experiments of two centrosome - associated proteins , pericentriolar material 1 ( pcm-1 ) and pericentrin , in primary human fibroblasts .
we found that cells depleted of pcm-1 or pericentrin show lower levels of markers for s phase and cell proliferation , including cyclin a , ki-67 , proliferating cell nuclear antigen , minichromosome maintenance deficient 3 , and phosphorylated retinoblastoma protein .
also , the percentage of cells undergoing dna replication was reduced by > 50% . at the same time , levels of p53 and p21 increased in these cells , and cells were predisposed to undergo senescence .
conversely , depletion of centrosome proteins in cells lacking p53 did not cause any cell cycle arrest .
inhibition of p38 mitogen - activated protein kinase rescued cell cycle activity after centrosome protein depletion , indicating that p53 is activated by the p38 stress pathway . |
we tested some resin - based composites used in dentistry for their estrogenic activity . a sealant based on bisphenol - a diglycidylether methacrylate ( bis - gma ) increased cell yields , progesterone receptor expression , and ps2 secretion in human estrogen - target , serum - sensitive mcf7 breast cancer cells .
estrogenicity was due to bisphenol - a and bisphenol - a dimethacrylate , monomers found in the base paste of the dental sealant and identified by mass spectrometry .
samples of saliva from 18 subjects treated with 50 mg of a bis - gma - based sealant applied on their molars were collected 1 hr before and after treatment .
bisphenol - a ( range 90 - 931 micrograms ) was identified only in saliva collected during a 1-hr period after treatment .
the use of bis - gma - based resins in dentistry , and particularly the use of sealants in children , appears to contribute to human exposure to xenoestrogens.imagesfigure 1 .
afigure 1 .
bfigure 2.figure 3 .
afigure 3 .
bfigure 4 .
afigure 4 .
bfigure 5 .
afigure 5 .
bfigure 6 .
afigure 6 .
bfigure 7 .
afigure 7 .
bfigure 8.figure 9.figure 10 . |
|
trichoadenoma is a rare benign tumor , with multiple cystic structures closely resembling the infundibular structures of the hair follicle .
it presents as a non - specific nodule over the face or buttocks , however , unusual sites such as the neck , upper arm , thigh shoulder , and shaft of the penis may also be affected .
ours is a case of a 60-year - old female with a trichoadenoma over the left labia majora , which presented as a slow growing nodular plaque .
a 60-year - old married female patient presented to us with asymptomatic gradually increasing skin lesion on vulva since 2 years .
examination revealed a firm , nontender , nodular plaque of 3.5 cm 2.5 cm along with a few shiny papules along the right labia majora [ figure 1a ] .
the left labia majora , labia mijora , clitoris , and perianal areas were not involved .
differential diagnoses considered were fibrosis lymphangioma circumscriptum , giant trichoepithelioma , sarcoidosis , lupus vulgaris , and deep fungal infection .
( c ) post - treatment - 2 months , healing with post - inflammatory hyperpigmentation histopathology from the lesion showed numerous horn cysts present throughout the dermis surrounded by eosinophilic cells [ figure 2a ] .
few of the cyst walls were lined by eosinophilic epidermal cells and contained keratin [ figure 2b ] ; thereby leading to a diagnosis of a less known adnexal tumor trichoadenoma .
( a ) 10 view : showing numerous horn cysts present throughout the dermis . ( b ) 40 view : showing cyst walls lined by eosinophilic epidermal cells , containing keratin
trichoadenoma of nikolowski is a rare , follicular tumor considered as a neoplastic process by some authors and benign malformation by some others .
clinically it presents as a solitary slow growing grayish nodule measuring up to 1.5 cm in diameter , seen over the face ( 57.5% ) and buttocks ( 24.2% ) .
other uncommon sites of involvement are the neck , upper arm , thigh , shoulder and shaft of penis
. it may also present as a chronic discharging nodule or as an ulcerated growth .
rare case reports of trichoadenoma in association with intradermal melanocytic nevus , sebaceous carcinoma , basal cell carcinoma , syringocystadenoma papilliferum have also been recorded .
verrucous variants of trichoadenoma have also been reported . though it is a tumor of adulthood , infants as old as 20 months
numerous horn cysts are present surrounded by eosinophilic cells . in some instances , a single layer of flattened granular cells is interpolated between the horn cysts and surrounding eosinophilic cells .
moreover , the histological similarity of trichoadenoma with trichoepithelioma suggests the development of immature hair structures .
however , because the cyst wall consists of epidermoid cells and keratinization may take place with the formation of keratohyalin , it has been suggested that the tumor differentiates largely toward the infundibular portion of the pilosebaceous unit .
the keratin profile expression of this tumor supports the theory that it differentiates towards the follicular infundibulum and the follicular bulge region .
, we used co2 laser at 9.0 watts with 100 mm hand piece ( 1.0 mm spot size ) in superpulse mode to ablate the growth under local anesthesia [ figure 1b ] .
there has been no recurrence so far and the normal vulvar anatomy has been maintained .
the trichoadenoma is a mystifying follicular tumor . though it is known to occur on the face and buttocks , newer cases with unusual manifestations
are being reported . to the best of our knowledge , a histopathologically proven large trichoadenoma over the vulva has not been reported . | trichoadenoma of nikolowski is a rare , benign , well differentiated , slowly growing tumor of the hair follicle which was first described in 1958 by nikolowski .
it usually occurs as a solitary nodular lesion between 3 and 15 mm in diameter .
it commonly occurs on the face or the buttocks .
herein we report a case of a slowly growing nodular plaque over the vulva of a 60-year - old female , histopathologically proven to be a trichoadenoma .
the lesion was completely removed by ablative carbon dioxide laser ( co2 ) . |
rosacea is a persistent and recurrent inflammatory condition of the middle face as a rule .
classical morphology rosacea frequent subtypes are the erythematotelangiectatic ( et ) rosacea and the papulopustular ( pp ) rosacea , while the other anatomoclinical forms are the granulomatous ( or lupoid ) rosacea , the phymatous rosacea or rhinophyma , and rosacea fulminans or pyoderma faciale . in general , a persistent stasis erythema may precede by years the development and establishment of either an et form or a pp form .
rosacea may appear in any immunocompetent patient and has to be differentiated from demodicosis of either immunocompetent or immunodeficient patients .
semeiology , symptomatology , and pathologic features of rosacea suggest that its pathogenesis is mediated by sensory nerves via antidromically released neuromediators , therefore constituting a model of neurogenic inflammation .
after emotional stimulation or ingestion of alcohol , catecholamine is released from gastric mucosa or adrenal medulla and kallikrein is secreted by salivary glands , increasing bradykinin levels in blood .
substance p ( sp ) is a neuropeptide , secreted by sensory neurons of human epidermis and dermal papillae .
sp biologic functions consist in local axon reflex vasodilatation , acceleration of epidermal and endothelial cell proliferation , mast cell degranulation , antidromic vasodilatation , and liberation of inflammation mediators from macrophages and t lymphocytes .
biopsies on papular lesion and healthy skin of volunteer rosacea patients have shown that , in genetically predisposed persons , sp vasodilatory activity may be involved in the induction and/or maintenance of pp rosacea .
vessel dilatation in rosacea is not due to yielding to damaged connective tissue but to fusion of vessels by a gradual breakdown of adjacent vascular walls .
vascular endothelial growth factor ( vegf ) staining on skin sections has detected no differences between pp rosacea and et rosacea .
laser doppler imager has detected elevated blood flow in affected skin compared with nonaffected skin of the same patient in the pp form but not in the et form of rosacea .
normal skin demodex folliculorum ( a head sebaceous follicle lumen mite ) , usually located at the upper part of the infundibulum of the follicle , has been indirectly involved in rosacea , although a possible causal correlation has not been established up to this day .
the majority of rosacea medications do not affect demodex but do improve rosacea , while treatment with lindane , which is effective on the mite , does not improve the condition .
density of demodex was demonstrated to be significantly higher in the pp form of rosacea , although no correlation was ascertained between demodex intrafollicular inflammation and perifollicular inflammation .
possibly increased blood flow in rosacea skin dilated vessels constitutes an ideal condition for dermis demodex multiplication .
demodex folliculorum antigens reacting with rosacea patients ' sera have been considered to be responsible for stimulating mononuclear cell proliferation .
the number of mast cells ( which promote vasodilatation , angiogenesis , and fibrosis ) was significantly higher in lesional than in nonlesional skin of patients with rosacea .
all things considered , it is evident that neuropeptides such as sp and/or bradykinin may play a decisive role in increasing blood flow and/or vascular density in rosacea .
consequently , it looked reasonable to explore the involvement of single nucleotide polymorphisms ( snps ) within neuromediators and their receptors in rosacea .
tachykinins ( tacs ) are characterized by pharmacological similarity to their endogenous inflammatory mediator , bradykinin , yet tacs are not of similar structure to that of bradykinin .
heparin - initiated bradykinin formation plays an important role in mast cell - mediated diseases , such as rosacea .
tacs are a family of closely related peptides such as sp , neurokinin a , and neurokinin b , which act as neuropeptides in nonneuronal cells and noninnervated tissues . biological actions of tac1 and tac3 are mediated by three types of g protein - coupled receptors ( tacr1 , tacr2 , and tacr3 ) .
tacr3 or nk - r3 or neurokinin b receptor belongs to a family of genes which function as receptors for tacs , characterized by interaction with g proteins , variations in the 5-end of the sequence , and 7-hydrophobic transmembrane regions interactions .
tac1 gene is localized on chromosome 7q21-q22 , tac3 is localized on 12q13-q21 , tacr1 is localized on 2p12 , tacr2 is localized on 10q11-q21 , and tacr3 is localized on 4q25 .
circulating neurokinin b is elevated in women with preeclampsia during the third trimester of pregnancy .
the increased placental expression of tac3 gene belongs to the mechanism responsible for the elevated circulating neurokinin b levels in preeclampsia . in preeclampsia
complicated pregnancies , elevated neurokinin b plasma levels have been associated with elevated nitric oxide metabolite levels possibly in a compensatory mechanism to improve blood flow to the uteroplacental unit . in familial hypogonadotropic hypogonadism ,
mutations of neurokinin b gene and its respective receptor tacr3 suggested an eventual key role for neurokinin b in the central control of reproduction .
neurokinin b ( endogenous ligand of tacr3 ) is involved in pathogenesis of parkinson 's disease by interacting with brain dopaminergic transmission .
kisspeptin / neurokinin b / dynorphin - expressing neurons of hypothalamus , promoting skin vasodilatation , participate in the estrogen modulation of the body temperature and contribute to the induction of ensuing hot flushes in menopausal women ; such flushes are clinically similar to those experienced in rosacea .
the role of mast cells in tachykinin neurogenic skin inflammation induction has been shown and thus their intense presence in pp rosacea [ 21 , 22 ] may be explained .
we chose to study the tacr3 gene polymorphism rs3733631 , because tacr3 endogenous ligand , neurokinin b , by increasing blood flow ( anatomoclinical feature of rosacea ) , is involved in the pathophysiology of ( a ) parkinsonism ( frequently coexists with rosacea ) and ( b ) hot flushes in menopausal women ( clinically similar to rosacea vasomotor crises ) .
possible involvement of the tacr3 gene in rosacea would most probably be associated with either upregulation or downregulation of this gene .
snps such as rs3733631 , localized within the promoter area , upstream from the coding region , make prime candidates to reflect any association between gene and disease .
certain additional tacr3 polymorphisms , such as a29v , g59e , s455 g , a449s , w275x , and rs4580655 , have been associated with idiopathic central pubertal disorders [ 23 , 24 ] , predicting and improving learning and memory in aged organism , alcohol and cocaine dependence , and pediatric slow transit constipation .
one hundred and twenty - eight patients , examined at the outpatient clinic of the university department of dermatology at the university hospital of alexandroupolis , 53 males ( 41.4% ) and 75 females ( 58.6% ) , were included in this study .
patients ' age ranged from 14 to 86 years with a median age of 56.25 16.35 years .
all patients were clinically diagnosed by the same physician and suffered from either the et form ( n = 67 ) or the pp form ( n = 61 ) of central face rosacea .
rosacea patients with accompanying disease were excluded from the study to avoid possible interactions with potentially coexisting genetically determined disorders .
one hundred and twenty - one unrelated subjects , free from rosacea , not suffering from any potentially genetically determined disorder , individually matched to patients by both gender and age , were recruited as controls [ 54 ( 44.6% ) males and 67 ( 55.4% ) females ] . there were no significant differences in gender ( p = 0.608 ) and age ( p = 0.783 ) between patients and controls ( table 1 ) .
we genotyped the tacr3 gene polymorphism rs3733631 c / g by pcr - rflp as follows : primers f : 5-cttgcagcgaatgaatgaaa-3 and r : 5-gggtaatcgagtcacatcagg-3 generated a 216p long amplicon after 40 cycles of pcr at 95 30 , 55 30 , and 72 30. the pcr product was subsequently digested with restriction enzyme haeiii which generates three bands 107 , 86 , and 21 bp for allele g and two bands 128 and 86 bp for allele c. restriction digests were analyzed by electrophoresis in 2.5% agarose gel .
statistical analysis of the data was performed using the statistical package for the social sciences ( spss ) ( inc , chicago , il , usa ) .
the chi - square test was used to assess differences in genotype and allele frequencies between patients suffering from rosacea and matched controls .
it was also used to compare the observed frequency of each genotype with that expected for a population in the hardy - weinberg equilibrium .
multivariate unconditional logistic regression analysis was used to estimate age - adjusted odd rations ( or ) and 95% confidence intervals ( ci ) as the measure of association of the studied polymorphism with the appearance of rosacea .
all tests were two - tailed and statistical significance was considered for values less than 0.05 .
the distribution of genotypes and alleles in patients and healthy controls is shown in table 2 .
c / c , c / g , and g / g genotypes were found in 84.4% , 13.3% , and 2.3% of patients and in 87.6% , 11.6% , and 0.8% of healthy controls , respectively .
the genotype distribution was in hardy - weinberg equilibrium in controls ( = 0.481 , df = 1 , and p = 0.488 ) but not in patients ( = 4.512 , df = 1 , and p = 0.034 ) .
no statistically significant differences were detected in either genotype or allele frequencies between the two groups ( p = 0.433 and p = 0.295 , resp . ) .
however , a trend of higher frequency of g carriers ( g / g or c / g genotype ) and g allele was substantiated within males ( 22.7% versus 13.0% , p = 0.139 for g / g , g / c genotypes , and 14.2% versus 6.5% , p = 0.071 for the g allele ) ( table 2 ) . more specifically , in male patients , an increased ( but not statistically significant ) risk of rosacea incidence was associated with g allele ( or , 2.38 ; 95% ci , 0.936.11 ) .
further stratification for the clinical form of rosacea in each patient suggested a statistically significant predominance of g carriers suffering from pp form of rosacea versus controls ( 70.5% c / c , 26.2% c / g , and 3.3% g / g in patients versus 87.7% c / c , 11.6% c / g , and 0.8% g / g in controls ) as well as a higher frequency of the allele g ( 83.6% c and 16.4% g in patients versus 93.4% c and 6.6% g in controls ) ( tables 3(a ) and 3(b ) ) .
therefore , the frequency of c / g or g / g genotype on one hand is statistically significantly higher in pp rosacea patients ( p = 0.006 ) and g allele is also more frequent in pp patients ( p = 0.004 , table 3(b ) ) .
consequently , a statistically significant increased risk of pp rosacea incidence was associated with g allele ( or , 2.77 ; 95% ci , 1.385.57 ) . in patients with et rosacea ,
the predominance of g allele was not significant ( p = 0.087 ) but the higher frequency of c / g or g / g genotype in patients was closer to being statistically significant ( p = 0.052 ) ( table 3(a ) ) .
regarding the distribution of genotypes in pp rosacea males , the higher frequency of c / g or g / g genotype in patients was statistically significant ( p = 0.021 ) and the frequency of g allele was significantly higher ( p = 0.008 , tables 3(a ) and 3(b ) ) .
genetic polymorphisms have not been previously studied extensively in rosacea . specifically , in one study of bsm1 polymorphism of the vitamin d receptor ( vdr ) , the frequency of allele 1 was increased in patients with rosacea fulminans , but that increase was not statistically significant .
another study showed a statistically significant relationship between both null combination of glutathione - s - transferase m1 ( gctm1 ) and gstt1 genotype polymorphisms and rosacea , in the setting of a comparative genetic study , in a group of rosacea patients and a group of matched healthy controls .
a recently published genome - wide association study reported correlation of rosacea with hla - drb1 , hla - dqb1 , and hla - dqa1 as well as rs763035 , providing evidence regarding contribution of genetic component to pathogenesis of rosacea . in our study
we observed a trend ( p = 0.071 ) within male patients to carry g allele of rs3733631 with higher frequency than controls regardless of the type of rosacea .
there have been no previous studies in the literature reporting association or not of rs3733631 tacr3 gene polymorphism with rosacea ; however , it has been studied in alcohol and cocaine dependence .
the toll - like receptor 2 gene ( tlr2 ) is located at 4q32 , adjacent to tacr3 at 4q25 . in pp rosacea , serine protease kallikrein-5 ( klk5 ) and two abnormal cathelicidin peptides ( ll-37 and fa-29 ) are upregulated in the skin and induce erythema and vascular dilatation when injected in mouse skin .
ll-37 is characterized by lower antimicrobial activity than normal smaller cathelicidin in healthy skin and it promotes angiogenesis and consequently secondary inflammation .
it is possible that the polymorphism at the adjacent tacr3 may be somehow involved in increasing expression of tlr2 in rosacea and therefore in upregulation of klk5 in a calcium - dependent manner ; possibly pp rosacea patients overreact , resulting in the histogenesis of rosacea papules and pustules , even though bacterial diversity and quantities are similar in rosacea lesions and in normal skin .
tlr2 stimulation occurs only as a response to specific triggers , such as emotional stimulation or ingestion of alcohol and kallikrein , secreted by salivary glands , increasing vasodilatory bradykinin blood levels [ 5 , 33 ] .
the vitamin d - dependent amplification mechanism might induce increase of tlr2 susceptibility , as 1,25 ( oh)2 vitamin d gene polymorphism has been correlated with the intensity of inflammation .
this gene participates in the n - terminal caspase recruitment ( nact ) protein domain family , being involved in the response of toll - like receptors transduced inflammatory stimuli .
our study suggested a statistically significant predominance of c / g or g / g genotype ( and g allele ) in patients suffering from pp rosacea versus matched healthy controls .
the number of patients included in our study constitutes a relatively small size sample ; additional studies are needed to confirm our reported results .
pp rosacea is characterized by elevated blood flow and increased sp vasodilatory activity in affected skin .
genotypes carrying g allele may be accompanied by alterations of kisspeptin / neurokinin b / dynorphin ( kndy ) neurons of the hypothalamus and these altered neurons ( via projections to rostral hypothalamic structures such as the medial preoptic area and medial preoptic nucleus which control thermoregulatory effectors ) could maximize the vasodilatation of the skin as well as the inflammation ( induced by vasodilatation ) , resulting in development of pp rosacea [ 6 , 20 , 33 ] .
genotypes carrying g allele may provide a genetic predisposition to pp rosacea and not to the et form .
therefore , pp rosacea may be characterized by a genetic uniqueness , posing the possibility of its nosological distraction from the et form . | background .
rosacea is a chronic skin disease , possibly following the neurogenic skin inflammation model .
neurokinin b , involved in the pathogenesis of parkinson 's disease , frequently coexisting with subsequent onset of rosacea , is an endogenous ligand of the tachykinin receptor 3 ( tacr3 )
. methods .
128 rosacea patients and 121 matched controls were genotyped for rs3733631 by pcr - rflp and analyzed by chi - square test .
results .
we observed statistically significant predominance of the c / g or g / g genotype ( p = 0.006 ) and of the g allele ( p = 0.004 ) in the papulopustular ( pp ) form of rosacea and statistically marginal significance of the c / g or g / g genotype in erythematotelangiectatic ( et ) rosacea ( p = 0.052 ) .
significantly higher frequency of the c / g or g / g genotype and g allele in pp rosacea ( p = 0.021 and p = 0.008 , resp . ) was ascertained within male patients .
conclusion .
tacr3 rs3733631 g allele possibly predisposes the evolution of the initial phase of rosacea to the pp and not the et form in male patients . |
there are various ways of removing unwanted hair from eyebrow region to give a good aesthetic hair line .
of these , threading is the most common and widely acceptable technique because of its convenience , low cost , and negligible complications . before a threading session ,
the skin is prepared by wiping the area with a cotton ball soaked in astringent .
the cotton thread is twisted and rolled along the surface of the skin entwining the hairs in the thread , which are then lifted quickly from the follicle .
unlike tweezing or plucking , eyebrow threading removes one clean line of hair all at once , making it much quicker and easier to shape the brows .
as opposed to waxing , the top layers of skin are not peeled or traumatized in the process .
inexperienced aesthetician / beautician can result in uneven brows , hair breakage , ingrown hairs , or unnecessary pain and other complications .
after a threading session , a soothing lotion / antibiotic cream is applied to the threaded area .
though this technique looks quite benign in nature , it is associated with some dermatological complications , especially near the eyebrows .
many dermatological complications briefly mentioned in various articles include acute erythema during and after the procedure , folliculitis , pseudofolliculitis , bullous impetigo , verruca plana , molluscum contagiosum ( mc ) , hyperpigmentation , and hypopigmentation.[17 ]
we report a series of eight patients between november 2006 and april 2010 who developed molluscum lesions over eyebrows after a session of eyebrows threading from beauty salons .
all patients were young males and females in the age range of 17 to 35 years , with mean age of 23.6 years .
none of the patients had any lesion suggestive of molluscum on any part of body prior to threading .
clinical details of patients presenting with molluscum on eyebrows all patients presented with classical appearance of molluscum lesions as painless , flesh - colored , dome - shaped , pearly white lesions with central umbilication 2 to 4 mm in diameter .
these lesions initially were confined to eyebrows region and later by koebnerization spread to nearby areas .
the classical clinical appearance of the lesions in all the patients was sufficient for diagnosis .
therefore , biopsy was not done to establish the diagnosis in any of the patient .
extraction of molluscum bodies followed by light electric desiccation / chemical cauterization was done in all patients with good cosmetic results .
none of the patient had any lesion suggestive of molluscum on any other part including face prior to threading .
all patients were asked to avoid threading in future but most of them continued because of being more convenient and economical .
in our present day of civilization with globalization and a rapidly growing fashion industry , more and more people of all ages are very particular about their persona .
cinema and television idols cause a mass hysteria , thus causing a great impact on general population to follow their footsteps blindly . in order
to look glamorized , people opt for various beauty regimens without paying attention to their adverse unforeseen consequences .
threading is one such technique which is practiced widely by all adults ( from common layman to film stars ) to give an aesthetic look of eyebrows by removing excess of hair .
it is a centuries - old technique of hair removal practiced widely in india and other countries . due to its easy accessibility ,
being inexpensive , less time consuming , not very painful , it has gained wide popularity .
it is thought to originate from turkey and was traditionally used on the entire face such as the chin , eyebrows , sideburns , and cheeks .
however , it has been an ancient art for many countries such as india . in arabic ,
hair threading is called khite . in egypt , hair threading is called fatla . in the procedure , the beautician removes individual or group of unwanted hair by using
thread which is wound around the fingers like a loop , the thread is looped around hair follicles and pulled out quickly with brisk movements in rapid succession .
though threading is a safe technique , but because it is a traumatic procedure and because of improper hygienic measures , it may cause acute erythema during and after the procedure , folliculitis , pseudofolliculitis , bullous impetigo , verruca plana , mc , hyperpigmentation , and hypopigmentation.[17 ] mc is a viral infection of the skin or occasionally of the mucous membranes caused by a dna poxvirus .
it is transmitted by direct contact , either person to person , or by shared items , such as clothing , towels , etc .
the virus later may be autoinoculated from one primary site to distant site . threading being
a traumatic procedure can disturb epidermal - barriers function , rendering the eyebrow area more susceptible to inoculation and development of warts by seeding the virus .
source of getting infection can be beautician 's hands , cotton puff , powder , cotton thread , towels , clothing 's , scissors , adoption of poor hygienic ways , and lack of awareness . in the present study
, some patients gave history of using same towels and thread on many of customers during threading .
even the beauticians do not understand the importance of sterilizing their instruments prior to using on their customers as well as of use of same cotton thread on many of patients .
use of same towel on many of customers is very common practice in many of haircut and beauty salons .
a beautician should be given a proper awareness regarding maintenance of the local hygienic measures like washing hands prior to any procedure , using disposable gloves , not using the same clothing , cotton , cotton thread , and towels on all customers , and similarly customers should never hesitate to interrupt the beautician if they feel she / he is noncompliant .
moreover , to avoid these hazards completely , customers can carry their own items such as cotton thread , towels , powder , etc .
these simple precautions might change the scenario of threading and will make it free from complications .
appearance of mc after eyebrow threading was first reported by verma sb in a female patient .
the present series of eight patients which also includes three males is the largest case series till date . nowadays , the word beauty is no longer confined to females as males also are not lagging behind in getting themselves pampered .
so , the appearance of mc after eyebrow threading in males in the present case series is reported for the first time .
to conclude , all of the case reports reported so far mentioning the appearance of warts or molluscum are only in females , but in our study , three male patients were also reported to have appearance of molluscum lesions after threading .
current series of case reports warns the young populations and also make the dermatologists aware about the potential hazard of this widely practiced technique . at the same time , people among all sections of society need to be made aware of such incidents since the eye brow threading is a very common procedure not limited to one group , but it is commonly practiced by all , e.g. , males or females , young or old , educated or uneducated , high or low socioeconomic people .
thus , it has become mandatory to raise awareness of complications not only among beauticians , but also in the general population .
there is a growing popularity of threading for shaping of the eyebrows , especially in the young population .
it is very important for the beauticians and the dermatologists to be aware of the potential complications of this seemingly benevolent procedure , as this may lead to significant cosmetic blemish and mental trauma to the patient .
multiple skin - colored and pearly white papular lesions over eyebrow , upper and lower eyelid ( male ) multiple pearly white popular lesions with central umbilication inside eyebrows , on upper eyelid and lid margin ( female ) | eyebrow threading is a practice of shaping the eyebrows .
many dermatological complications have been briefly mentioned in various publications .
there are scant data regarding the appearance of molluscum in the line of eyebrows after a session of threading .
we report a series of eight patients both males ( 3 ) and females ( 5 ) who had lesions of molluscum in the eyebrow region after threading .
the earlier reported cases are only among the females .
the present study is highlighting the appearance of molluscum in the region of eyebrow after a session of threading from beauty salon .
so , to the best of our knowledge , this is the first report of its kind describing same pathology in males .
the rational of reporting this case series is to create awareness among the dermatologists as well as in general population about potential hazards of threading . |
sudden sensorineural hearing loss is defined as a hearing reduction>30 db , over at least three contiguous frequencies and occurring within 72 hr.1 ) the speech discrimination score of a patient suffering from hearing loss may not be considered relative to pure tone audiometry and the hearing test is often only done using pure tone audiometry .
however , the results of a speech discrimination test are as important as those of pure tone audiometry for a patient with retrocochlear hearing loss.2 ) it is difficult to doubt intracerebral hemorrhage or infarction when a patient complains of decreased speech discrimination with no neurologic abnormality . retrocochlear hearing loss is not a common disease and an acute hearing loss is rare .
we report a case of acute bilateral speech discrimination loss as an initial symptom of unilateral thalamic hemorrhage , and the patient recovered .
a 73-year - old woman visited our clinic complaining of acute bilateral hearing loss that occurred 7 hr previously .
a pure tone audiometry test revealed bilateral high frequency loss , and pure tone averages were 25 db in each side .
however , speech discrimination scores were 44% on the right and 56% on the left ( fig .
1 ) . we decided to follow - up audiometry after 1 week of ginexin - f ( ginkgo leaf extract , sk chemical co. , seoul , korea ) and nafril ( nafronyl oxalate , hanall biopharma , seoul , korea ) treatment .
the patient was hospitalized and treated with 20% mannitol injection for managing high blood pressure and was put on absolute bed rest .
the pure tone audiometry scores were the same , and speech discrimination scores were further reduced to 28% on the right and 44% on the left ( fig .
the auditory steady state response threshold was 80 db on the right and 87 db on the left ( fig .
6 ) , and the auditory steady - state response threshold improved about 20% ( fig .
thalamic hemorrhage constitutes 6 - 25% of intracerebral hemorrhages.3 ) fisher described three clinical signs to consider for a thalamic hemorrhage : 1 ) predominance of sensory deficits over motor deficits ; 2 ) oculomotor signs including abnormalities in vertical gaze ; and 3 ) language disturbances due to dominant - hemisphere thalamic hematomas .
consciousness level at the beginning is a predictor of mortality.4 ) our patient was old and had hypertension , but the sudden hearing decrease was the only symptom , as no neurologic abnormality was detected .
, pure tone audiometry from 500 hz to 4 khz was normal but the bilateral speech discrimination scores were very low .
she showed neurologic abnormalities 2 days later and was diagnosed with a left thalamic hemorrhage on an imaging study .
the central auditory pathway consists of the cochlear nucleus , superior olivary complex , inferior colliculus , medial geniculate body , and auditory cortex.5 ) the medial geniculate body ( mgb ) is the main auditory - responsive portion in thalamus , which consists of ventral , dorsal , and medial subdivisions .
the mgv ( the ventral subdivision of the mgb ) is the core subdivision and rapidly transmits sharp tone auditory information to the auditory cortex .
the mgd ( the dorsal division of the mgb ) is a slower , more integrative subdivision and is influenced strongly by non - auditory inputs , such as visual or associating sounds .
the mgm ( the medial division of mgb ) includes diverse regions such as the suprageniculate nucleus , the posterior intralaminal nucleus , and the peripedencular nucleus .
an abnormality in this pathway leads to retrocochlear hearing loss.6 ) the patient 's general condition had improved 3 weeks later , but the follow - up speech test results were worse , and auditory steady state thresholds were high and different from the pure tone audiometry
many studies have reported unilateral hearing loss due to unilateral retrocochlear pathology of varying degrees.7 ) calford8 ) reported that 60% of mgb neurons can be excited by stimuli to either ear , but 20 - 30% can be excited only by contralateral ear stimulation . about 10 - 20%
thus , we speculate that a rapid progressive hemorrhage caused deterioration of the synchronous neural responses and decreased sound location tuning.7 ) her subjective hearing recovered after 5 months with resolution of the brain hematoma .
auditory steady - state response ( assr ) stimulates the auditory brainstem structures at a modulation frequency of 80 hz .
four patients with a vestibular schwannoma with absent or only wave i positive auditory brainstem response responses showed poorer speech discrimination , very small 40 hz assr responses , and a positive n1 m response .
although our assr had a modulation frequency of 80 hz , it did not represent cortical activity but abr or assr can decrease with better pure tone responses in a patient with a retrocochlear lesion .
we supposed it was the influence of dyssynchrony by a neural conduction problem , as progressive hearing loss may be due to the demyelinization of the auditory nerve that recovered.7,9 ) the interesting finding in this case was that after improvement of the thalamic hemorrhage , speech discrimination and the assr average recovered in 5 months .
mri has been recognized as the most exact tool to determine hearing - impaired or retrocochlear hearing loss due to intracerebral diseases .
however , it is not easy to apply mri to a patient with an initial diagnosis of hearing loss without neurological symptoms .
furthermore , it seems easy to overlook the possibility of retrocochlear lesion in the initial diagnosis for a patient with hearing loss .
sudden hearing loss can be diagnosed only by pure tone audiometry ; therefore , a speech discrimination test should not be avoided for patients suffering from hearing loss . in conclusion , a speech discrimination test should always be accompanied by pure tone audiometry when hearing testing is conducted .
this test provides additional information about the hearing state and helps to detect retrocochlear hearing loss .
we report a case of retrocochlear hearing loss due to acute thalamic hemorrhage in a patient who recovered . | a speech discrimination test is a test using a list of 25 phonetically balanced monosyllables .
it is often overlooked but significant enough for pure tone audiometry .
many physicians have performed pure tone audiometry but without a speech discrimination test .
a 73-year - old woman visited our clinic complaining of sudden bilateral hearing loss .
pure tone audiometry showed only bilateral high frequency loss .
however , speech discrimination had decreased markedly .
we decided to follow - up after 1 week of ginexin - f ( ginkgo leaf extract ) and nafril ( nafronyl oxalate ) .
she felt a gait disturbance within 2 days .
magnetic resonance imaging revealed a left thalamic hemorrhage .
after a 1 month hospitalization , the hematoma subsided , and speech discrimination recovered 3 months later .
acute hearing loss due to thalamic hemorrhage that recovered has never been reported .
we report the first case of retrocochlear hearing loss that occurred with a thalamic hemorrhage in a patient who recovered . |
dramatic improvements in socioeconomic conditions and health care resources have led to a substantial increase in life expectancy in industrialized countries , which are nowadays largely composed by elderly people .
this demographical change has also impacted the medical field , and old patients have become common in any setting , including cardiology and oncology .
this is especially the case with breast cancer ( bc ) : according to the latest statistics , around half of bc are diagnosed in women aged 65 years or more .
bc of the elderly most often displays favorable biological characteristics , i.e. , luminal molecular subtype , presence of hormone receptors ( hr ) , low mitotic rate and nuclear grade , absence of p53 mutations , and no overexpression of epidermal growth factor receptor ( egfr ) and human epidermal growth factor receptor-2 ( her-2). however , these features have not historically translated into better outcomes in older vs. younger patients : in fact , mortality is higher in the former than in the latter ones .
various reasons have been proposed to explain this paradox , such as competing risks of death from other diseases or the possibility that tumors exhibiting the same markers , but arising at young vs. old age , behave differently . , it has also been argued that adherence to treatment guidelines is poor and , particularly , that systemic chemotherapy is frequently not delivered in advanced age because of the concern of toxicity .
the fact that elderly subjects have been underrepresented in clinical trials and , thereby , few evidence - based data exist has probably strengthened the tendency to omit chemotherapy in this population .
nevertheless , in the last years there has been a reappraisal of the balance between benefits and side effects of chemotherapy for old patients with bc .
this conclusion has also been reached by a limited number of dedicated trials of chemotherapy in the elderly and is expected to be confirmed by other ongoing clinical studies. hence , it is now recommended not to consider age as an exclusion criterion for cancer treatment as long as survival for a significant period of time is likely and the burden of comorbidity is low . on the other hand , it holds true that toxicity of chemotherapy is enhanced at older ages .
, , as aforementioned , her-2 positivity is relatively uncommon in bc of the elderly . nonetheless , there is already quite a large experience with the use of the her-2 targeting antibody , trastuzumab , in the geriatric population with her-2 expressing tumors .
, at present , trastuzumab may be indicated for old subjects with early stage bc either her-2 positive / hr negative or her-2
the current opinion that adjuvant systemic therapy should be systematically considered for all eligible patients , regardless of age , is likely to foster the prescription of trastuzumab in the elderly in the next future .
cardiotoxicity has been , and will remain , the main safety issue of this treatment .
pubmed and embase were searched for articles written in english and including the following words in the title and/or abstract : trastuzumab , her-2 , erbb-2 , breast cancer , elderly , old .
her-2 ( erbb2 in rodents ) is a membrane tyrosine kinase receptor belonging to the egfr family , which also comprises her-1 ( also known as egfr ) , her-3 , and her-4 ( erbb1 , erbb3 , and erbb4 in rodents ) .
no ligand is known for her-2 . in normal tissues , ligand - stimulated egfr , her-3,and her-4 form homodimers ( a pair of the same receptors , e.g. , egfr / egfr ) or combine with her-2 in heterodimers , and
her-2 is overexpressed and instead capable of undergoing ligand - independent homodimerization and intracellular signal transduction ; moreover , the formation of heterodimers with her-1 and her-3 is facilitated .
this leads to the activation of signaling pathways promoting proliferation and survival of tumor cells ( figure 1 ) . as a consequence ,
, on the other hand , the existence of a subset of bc with high membrane levels of her-2 has allowed the development of her-2 directed therapies .
it is a humanized monoclonal antibody against her-2 that binds to subdomain iv of the extracellular domain of the receptor , halting the growth and causing the death of cancer cells likely through a number of mechanisms , such as induction of antibody - dependent immune cell - mediated cytotoxicity , disruption of ligand - independent her-2/her-3 interaction and downstream signaling , and enhanced activity of cell cycle inhibitor , p27 .
another fda approved anti - her-2 humanized monoclonal antibody is pertuzumab , which also targets the extracellular portion of her-2 , but at a different epitope in subdomain ii . like trastuzumab
, pertuzumab triggers antibody - dependent cellular cytotoxicity ; in addition and differently than trastuzumab it prevents ligand - initiated heterodimerization of her-2 and other her family members , especially her-3 . since trastuzumab and pertuzumab recognize different sites of her-2 and act in a complementary way , their combination results in greater antitumor efficacy .
small - molecule tyrosine kinase inhibitors constitute a second group of anti - her-2 agents .
the prototype , which has already entered clinical practice , is lapatinib , a dual blocker of both constitutive and ligand - induced egfr and her-2 phosphorylation and signaling .
other her tyrosine kinase inhibitors have been evaluated in early - phase clinical studies and are now in phase iii trials .
as soon as trastuzumab was tested in patients , left ventricular ( lv ) dysfunction turned out to be the main side effect of this drug and the leading cause of its discontinuation .
cardiotoxicity secondary to exposure to trastuzumab is dose - independent and , thus , relatively unpredictable , and may culminate in overt congestive heart failure ( chf ) . on the other hand ,
, it has been reported that , after resolution of cardiac complications that have arisen following a first administration of trastuzumab , rechallenge with the drug may be safely attempted while maintaining standard medications for chf .
chemotherapy with anthracyclines , which also have long been known to be cardiotoxic , predisposes to trastuzumab cardiac side effects , whose incidence is highest when anthracyclines and trastuzumab are given at the same time and decreases as the interval between anthracycline and trastuzumab infusion extends .
surprisingly , the addition of pertuzumab to trastuzumab does not seem to raise the risk of lv dysfunction and chf .
, as far as lapatinib is concerned , the data collected so far about its cardiac safety are quite reassuring . in oncology ,
trastuzumab is used to treat breast cancer in which her-2 is overexpressed and spontaneously homodimerizes or forms heterodimers with other her receptors , especially her-3 .
as this ligand - independent activation of her-2 sustains tumor growth and survival , trastuzumab halts the proliferation and causes the death of tumor cells ( left side ) . in the heart ,
her-2 functions as a dimerization partner of her-4 after this latter is recruited by nrg-1 and regulates homeostatic cell responses .
off - target inhibition of cardiac her-2 results in the disruption of part of nrg-1 dependent signaling and , eventually , in alterations of structure and function that may be lethal to cardiomyocytes ( right side ) .
nonetheless , blockade of the action of neuregulin-1 ( nrg-1 ) , the ligand of erbb4/her-4 , within the heart is believed to play a major role .
studies based on animal models and primary cell cultures have revealed that nrg-1-induced erbb4/erbb4 homodimers and erbb4/erbb2 heterodimers mediate protective responses of cardiomyocytes to stress , including the one provoked by anthracyclines .
it is therefore assumed that trastuzumab and other erbb2 antagonists make the myocardium more vulnerable to the damage caused by anthracyclines and , in principle , by other noxious factors as they impede the formation of nrg-1-triggered erbb4/erbb2 heterodimers ( figure 1 ) .
indeed , cardiomyocytes of transgenic mice in which erbb2 expression is deleted specifically in the heart are more susceptible to anthracycline toxicity than wild - type cells , and treatment of rat ventricular myocytes with an antibody against erbb2 significantly worsens myofibrillar disarray due to incubation with anthracycline .
this is likely to happen also in humans , but it still has to be confirmed .
in fact , the few data available about the expression of her-2 in human hearts after anthracycline chemotherapy are discordant .
, interestingly , a downregulation of her-2 has been observed in the cardiac tissue of mice given trastuzumab , but not in cancer cells. some authors have pointed out that there is a discrepancy between the predicted pharmacodynamics of anti - her-2 agents and the reported rates of cardiotoxicity .
trastuzumab should theoretically inhibit only the constitutive activity of tumor her-2 and not affect her-2 in the heart , where her-2 is assumed to function exclusively as a dimerization partner of ligand - occupied her-4 ; clearly , this is not true .
by contrast , off - target effects on the heart are anticipated for lapatinib , as it inhibits both ligand - independent and ligand - dependent signaling of her-2 , but they seem to be actually less frequent than with trastuzumab
. this inconsistency might be due to differences in recruitment criteria between trastuzumab and lapatinib clinical trials , as well as to incomplete blockade of her-2 and/or activation of rescue pathways by lapatinib .
nevertheless , it sheds doubts on the validity of the nrg-1/her-2 paradigm to explain the cardiotoxicity of her-2 antagonists .
trastuzumab cardiotoxicity is commonly viewed as transient , since it has no or only minor histological correlates and most often resolves after treatment withdrawal .
this may happen because trastuzumab causes the death of a substantial proportion of cardiomyocytes , as suggested by the finding that plasma concentrations of troponin i above 0.08 ng / ml after anthracyclines and trastuzumab therapy are associated with an almost three fold higher risk of suffering from a sustained reduction in lv ejection fraction ( ef ) .
alternatively , impairment of cardiac progenitor cells may be the substrate for long - lasting trastuzumab cardiotoxicity . in the last decade ,
, inhibition of proliferation of the endogenous pool of cardiac progenitor cells have been described as pivotal in the pathogenesis of persisting anthracycline - induced cardiomyopathy . , cardiac progenitor cells ensure an intrinsic , although limited capability of the heart to regenerate following injury .
therefore , their depletion may render the myocardium prone to accumulate minor lesions until symptoms appear .
interestingly , trastuzumab has recently been shown to hinder the cardiomyogenic and angiogenic capacities of cardiac explants enriched for progenitor cells .
in the pivotal trial evaluating standard chemotherapy with or without the addition of trastuzumab for metastatic bc , nyha class iii or iv cardiac dysfunction was recorded in 16% of patients receiving anthracycline , cyclophosphamide , and trastuzumab vs. 3% of those treated only with anthracycline and cyclophosphamide , and in 2% of women given paclitaxel and trastuzumab vs. 1% of those assigned to paclitaxel alone .
remarkably , no cardiac safety criteria were applied during enrollment . in subsequent trastuzumab trials ,
the incidence of cardiac side effects was smaller , probably because study design and patient selection were different .
for instance , the national surgical adjuvant breast and bowel project trial ( nsabp ) b-31 , comparing anthracycline and cyclophosphamide followed by paclitaxel with anthracycline and cyclophosphamide followed by trastuzumab and paclitaxel , recruited subjects with node - positive , her-2-positive bc and normal post - chemotherapy lvef on multiple - gated acquisition ( muga ) scan .
source documents were reviewed by a panel of cardiologists for : ( 1 ) nyha iii or iv chf with either a drop in lvef of more than 10% to < 55% or a decrease of > 5% to less than the lower limit of normality ; ( 2 ) possible / probable cardiac death .
the cumulative incidence of cardiac events was 4.1% in the trastuzumab group vs. 0.8% in the control one at three years and 4% vs. 1.3% at 7 years .
, in a joint analysis of the nsabp b-31 trial and of the north central cancer treatment group ( ncctg ) n9831 trial , which also assessed the efficacy and safety of trastuzumab in addition to paclitaxel after anthracycline ( doxorubicin ) and cyclophosphamide , the rates of chf in the trastuzumab or control arms were 3.8% vs. 1.3% and 2.3% vs. 0.9% , respectively . in a meta - analysis of eight major randomized clinical trials of trastuzumab for early and locally advanced bc , in which symptomatic chf incidence ranged from 0.8% to 14.2% in trastuzumab - treated patients vs. 0.2%4.1% in control women , the relative risk of chf associated with use of trastuzumab was 5.11 ( 90% ci:3.008.72 ) .
the relative risk of lvef decline was 1.83 ( 90% ci : 1.362.47 ) , although heterogeneity for this outcome was substantial .
elderly women participated in these trastuzumab clinical trials only to a minor extent . keeping the example of nsabp b-31 ,
in which 32.6% of patients were aged 60 years or more , the cumulative risk of trastuzumab - related cardiotoxicity for those younger or older than 70 years was 1.3% vs. 6.4% after 1 year , 2% vs. 9.8% after 2 years , and 2.2% vs. 9.8% after 3 years , respectively .
in another us registry including cases of trastuzumab - treated her-2 positive metastatic bc , the incidence of grade 3 lv dysfunction was 4.8% , 2.8% , and 1.5% for subjects 75 , 65 - 74 , or < 65 year old , respectively ; and that of chf 3.2% , 1.9% , and 1.5% , respectively . in a multicentric cohort of german women receiving adjuvant trastuzumab the frequency of a drop in lvef or
chf was 3.7% in the subgroup with < 65 years , 3.9% in the one between 65 and 69 years , and 5.7% in the one with 70 years .
table 1 summarizes the results of a series of retrospective analyses carried out to determine the frequency of trastuzumab cardiotoxicity specifically in cohorts of old women with bc .
overall , these investigations have shown that trastuzumab with or without anthracyclines confers a risk of suffering from chf that can be roughly quantified as two times the one faced by trastuzumab non - users. the most robust data come from medicare records , with hazard ratios of hf from 1.95 ( 95% ci : 1.752.17 ) to 2.37 ( 95% ci : 1.763.19 ) . , the limitations of the retrospective approach and the data source used , which do not allow a strict control of confounding factors , must be acknowledged . on the other hand , these community practice - based observational studies take into account a sizable subset of patients who would have not been eligible for clinical trials of trastuzumab , but are actually treated in real - life .
5-year cumulative incidence ; 3-year cumulative incidence . a : anthracycline ; a / tz : anthracycline and trastuzumab ; bc : breast cancer ; chf : chronic heart failure ; cvd : cardiovascular disease ; lvef : left ventricular ejection fraction : na : not assessed ; non - a : non - anthracycline chemotherapy ; ns : not specified ; tz : trastuzumab . in the medicare population ,
the incidence of trastuzumab - related chf in old women increased across age categories i.e .
additional variables associated with trastuzumab cardiotoxicity in elderly subjects are black race , presence of cardiac comorbidities , such as coronary artery disease , and hypertension .
these factors likely operate by independently affecting the heart and making it susceptible to the toxicity of trastuzumab .
recent work , however , has revealed that inappropriate prescription of trastuzumab to frail subjects or without demonstration of her-2 overexpression also enhances the risk of side effects
. a significantly higher rate of cardiac events has been reported in elderly patients who do not complete trastuzumab treatment because of very advanced age and/or too many comorbidities .
based on billing codes in medicare claims between 2000 and 2010 , close to 5% of 65 years old women given trastuzumab did not receive prior her-2 testing ; they had similar survival to those who received chemotherapy and no trastuzumab , but experienced more often chf .
there is general consensus that cardiac function should be monitored during trastuzumab treatment and that a reduction of lvef of at least 10% to < 55% is clinically relevant , even if asymptomatic .
lvef has mainly been evaluated by conventional two - dimensional ( 2d ) transthoracic echocardiography or radionuclide ventriculography ( muga scans ) , which however may miss subtle abnormalities that might allow immediate recognition of trastuzumab cardiotoxicity and institution of a cardioprotective therapy , before cardiac function further declines or symptoms appear .
an elegant work by thavendiranathan and colleagues has shown that the intrinsic variability of 2d ef values over time , secondary to physiological and technical aspects , may be > 0.10 , which ironically corresponds to the > 0.10 cutoff defining asymptomatic cardiotoxicity .
hence , a number of alternative strategies , relying on circulating biomarkers and/or imaging techniques , have been suggested for early and accurate detection of trastuzumab toxicity .
cardiac troponin may be a good marker of trastuzumab cardiac side effects , , although this conclusion has not been reached by all authors . in a multi - center cohort of bc patients undergoing treatment with doxorubicin and trastuzumab
, it has been found that myeloperoxidase also predicts cardiotoxicity of these drugs and that the combination of troponin i and myeloperoxidase may offer additive information . this same study and another one have shown no correlation between levels of high - sensitivity c - reactive protein ( crp ) and lvef decline , in contrast with a third smaller investigation in which , instead , high - sensitivity crp proved to be a valuable marker of trastuzumab - induced cardiotoxicity .
, b - type natriuretic peptide ( bnp ) or n - terminal probnp seem to have no utility either .
, among imaging tools , newer echocardiography methods and cardiac magnetic resonance hold promise for improving the diagnosis of lv remodeling and dysfunction due to trastuzumab .
three - dimensional echocardiography has been suggested to perform better than 2d echocardiography in measuring lvef and volumes and to be more reproducible over time and between different examiners .
, in addition , lv strain and tissue doppler parameters may allow early identification of trastuzumab cardiotoxicity , before lvef changes .
, the same goal may be achieved with cardiac magnetic resonance , which may also reveal a peculiar linear pattern of late gadolinium enhancement in the subepicardial region of the lv lateral wall .
, however , it must be taken into consideration that the studies addressing the role of the latest echocardiography techniques and cardiac magnetic resonance in trastuzumab cardiomyopathy are still few and small - sized ; moreover , the performance and feasibility of these imaging modalities in old and especially very old bc patients have not yet been explored , as well as their cost - effectiveness . in addition , an approach that integrates the use of biomarkers and imaging results to detect chemotherapy cardiotoxicity has been presented , but no data exist as far as trastuzumab is concerned .
unfortunately , even cardiologic consultation and cardiac monitoring of trastuzumab therapy with standard echocardiography or ventriculography are often disregarded in the elderly . among over 2,000 medicare > 65 year old patients , who received adjuvant trastuzumab for stage
i - iii invasive bc between 2005 and 2009 and did not have history of chf , baseline cardiac evaluation was performed in 78.8% and subsequent follow - up only in 42.6% ( 32% of the entire cohort ) .
interestingly , after adjustment for multiple confounders , a positive association was found between being monitored for cardiac safety over time and being diagnosed in more recent years or being referred to a physician of female gender or graduated after 1990 , highlighting that awareness of trastuzumab cardiotoxicity , or anyway attention to it , is not the same in the entire medical community .
besides trastuzumab discontinuation , initiation of beta - blocker and ace inhibitor is recommended if cardiotoxicity develops .
, , even though these drugs may favorably influence the cardiac her system , their use is at present empirical and prompted by the knowledge of their positive effects on cardiac remodeling and on the maladaptive neurohormonal responses occurring in chf of any etiology .
the ongoing multidisciplinary approach to novel therapies in cardiology oncology research trial ( manticore 101breast ) is evaluating the effectiveness of perindopril or bisoprolol in primary prevention of trastuzumab - induced modifications in lv geometry .
since the lv will be evaluated by magnetic resonance imaging , important information about the role of this latter in the cardiologic follow - up after trastuzumab therapy will be also obtained .
in the pivotal trial evaluating standard chemotherapy with or without the addition of trastuzumab for metastatic bc , nyha class iii or iv cardiac dysfunction was recorded in 16% of patients receiving anthracycline , cyclophosphamide , and trastuzumab vs. 3% of those treated only with anthracycline and cyclophosphamide , and in 2% of women given paclitaxel and trastuzumab vs. 1% of those assigned to paclitaxel alone .
remarkably , no cardiac safety criteria were applied during enrollment . in subsequent trastuzumab trials ,
the incidence of cardiac side effects was smaller , probably because study design and patient selection were different .
for instance , the national surgical adjuvant breast and bowel project trial ( nsabp ) b-31 , comparing anthracycline and cyclophosphamide followed by paclitaxel with anthracycline and cyclophosphamide followed by trastuzumab and paclitaxel , recruited subjects with node - positive , her-2-positive bc and normal post - chemotherapy lvef on multiple - gated acquisition ( muga ) scan .
source documents were reviewed by a panel of cardiologists for : ( 1 ) nyha iii or iv chf with either a drop in lvef of more than 10% to < 55% or a decrease of > 5% to less than the lower limit of normality ; ( 2 ) possible / probable cardiac death .
the cumulative incidence of cardiac events was 4.1% in the trastuzumab group vs. 0.8% in the control one at three years and 4% vs. 1.3% at 7 years .
, in a joint analysis of the nsabp b-31 trial and of the north central cancer treatment group ( ncctg ) n9831 trial , which also assessed the efficacy and safety of trastuzumab in addition to paclitaxel after anthracycline ( doxorubicin ) and cyclophosphamide , the rates of chf in the trastuzumab or control arms were 3.8% vs. 1.3% and 2.3% vs. 0.9% , respectively . in a meta - analysis of eight major randomized clinical trials of trastuzumab for early and locally advanced bc , in which symptomatic chf incidence ranged from 0.8% to 14.2% in trastuzumab - treated patients vs. 0.2%4.1% in control women , the relative risk of chf associated with use of trastuzumab was 5.11 ( 90% ci:3.008.72 ) .
the relative risk of lvef decline was 1.83 ( 90% ci : 1.362.47 ) , although heterogeneity for this outcome was substantial .
elderly women participated in these trastuzumab clinical trials only to a minor extent . keeping the example of nsabp b-31 ,
in which 32.6% of patients were aged 60 years or more , the cumulative risk of trastuzumab - related cardiotoxicity for those younger or older than 70 years was 1.3% vs. 6.4% after 1 year , 2% vs. 9.8% after 2 years , and 2.2% vs. 9.8% after 3 years , respectively .
in another us registry including cases of trastuzumab - treated her-2 positive metastatic bc , the incidence of grade 3 lv dysfunction was 4.8% , 2.8% , and 1.5% for subjects 75 , 65 - 74 , or < 65 year old , respectively ; and that of chf 3.2% , 1.9% , and 1.5% , respectively . in a multicentric cohort of german women receiving adjuvant trastuzumab the frequency of a drop in lvef or
chf was 3.7% in the subgroup with < 65 years , 3.9% in the one between 65 and 69 years , and 5.7% in the one with 70 years .
table 1 summarizes the results of a series of retrospective analyses carried out to determine the frequency of trastuzumab cardiotoxicity specifically in cohorts of old women with bc .
overall , these investigations have shown that trastuzumab with or without anthracyclines confers a risk of suffering from chf that can be roughly quantified as two times the one faced by trastuzumab non - users. the most robust data come from medicare records , with hazard ratios of hf from 1.95 ( 95% ci : 1.752.17 ) to 2.37 ( 95% ci : 1.763.19 ) . , the limitations of the retrospective approach and the data source used , which do not allow a strict control of confounding factors , must be acknowledged . on the other hand , these community practice - based observational studies take into account a sizable subset of patients who would have not been eligible for clinical trials of trastuzumab , but are actually treated in real - life .
5-year cumulative incidence ; 3-year cumulative incidence . a : anthracycline ; a / tz : anthracycline and trastuzumab ; bc : breast cancer ; chf : chronic heart failure ; cvd : cardiovascular disease ; lvef : left ventricular ejection fraction : na : not assessed ; non - a : non - anthracycline chemotherapy ; ns : not specified ; tz : trastuzumab .
in the medicare population , the incidence of trastuzumab - related chf in old women increased across age categories i.e .
additional variables associated with trastuzumab cardiotoxicity in elderly subjects are black race , presence of cardiac comorbidities , such as coronary artery disease , and hypertension .
these factors likely operate by independently affecting the heart and making it susceptible to the toxicity of trastuzumab .
recent work , however , has revealed that inappropriate prescription of trastuzumab to frail subjects or without demonstration of her-2 overexpression also enhances the risk of side effects
. a significantly higher rate of cardiac events has been reported in elderly patients who do not complete trastuzumab treatment because of very advanced age and/or too many comorbidities . based on billing codes in medicare claims between 2000 and 2010 , close to 5% of 65 years
old women given trastuzumab did not receive prior her-2 testing ; they had similar survival to those who received chemotherapy and no trastuzumab , but experienced more often chf .
there is general consensus that cardiac function should be monitored during trastuzumab treatment and that a reduction of lvef of at least 10% to < 55% is clinically relevant , even if asymptomatic .
lvef has mainly been evaluated by conventional two - dimensional ( 2d ) transthoracic echocardiography or radionuclide ventriculography ( muga scans ) , which however may miss subtle abnormalities that might allow immediate recognition of trastuzumab cardiotoxicity and institution of a cardioprotective therapy , before cardiac function further declines or symptoms appear .
furthermore , the reliability of lvef measurement by 2d echocardiography has been questioned . an elegant work by thavendiranathan and colleagues has shown that the intrinsic variability of 2d ef values over time , secondary to physiological and technical aspects , may be > 0.10 , which ironically corresponds to the > 0.10 cutoff defining asymptomatic cardiotoxicity .
hence , a number of alternative strategies , relying on circulating biomarkers and/or imaging techniques , have been suggested for early and accurate detection of trastuzumab toxicity .
cardiac troponin may be a good marker of trastuzumab cardiac side effects , , although this conclusion has not been reached by all authors . in a multi - center cohort of bc patients undergoing treatment with doxorubicin and trastuzumab , it has been found that myeloperoxidase also predicts cardiotoxicity of these drugs and that the combination of troponin i and myeloperoxidase may offer additive information . this same study and
another one have shown no correlation between levels of high - sensitivity c - reactive protein ( crp ) and lvef decline , in contrast with a third smaller investigation in which , instead , high - sensitivity crp proved to be a valuable marker of trastuzumab - induced cardiotoxicity .
, b - type natriuretic peptide ( bnp ) or n - terminal probnp seem to have no utility either . , among imaging tools , newer echocardiography methods and cardiac magnetic resonance hold promise for improving the diagnosis of lv remodeling and dysfunction due to trastuzumab .
three - dimensional echocardiography has been suggested to perform better than 2d echocardiography in measuring lvef and volumes and to be more reproducible over time and between different examiners .
, in addition , lv strain and tissue doppler parameters may allow early identification of trastuzumab cardiotoxicity , before lvef changes . , the same goal may be achieved with cardiac magnetic resonance , which may also reveal a peculiar linear pattern of late gadolinium enhancement in the subepicardial region of the lv lateral wall .
, however , it must be taken into consideration that the studies addressing the role of the latest echocardiography techniques and cardiac magnetic resonance in trastuzumab cardiomyopathy are still few and small - sized ; moreover , the performance and feasibility of these imaging modalities in old and especially very old bc patients have not yet been explored , as well as their cost - effectiveness . in addition , an approach that integrates the use of biomarkers and imaging results to detect chemotherapy cardiotoxicity has been presented , but no data exist as far as trastuzumab is concerned .
unfortunately , even cardiologic consultation and cardiac monitoring of trastuzumab therapy with standard echocardiography or ventriculography are often disregarded in the elderly . among over 2,000 medicare > 65 year old patients , who received adjuvant trastuzumab for stage i
- iii invasive bc between 2005 and 2009 and did not have history of chf , baseline cardiac evaluation was performed in 78.8% and subsequent follow - up only in 42.6% ( 32% of the entire cohort ) .
interestingly , after adjustment for multiple confounders , a positive association was found between being monitored for cardiac safety over time and being diagnosed in more recent years or being referred to a physician of female gender or graduated after 1990 , highlighting that awareness of trastuzumab cardiotoxicity , or anyway attention to it , is not the same in the entire medical community .
besides trastuzumab discontinuation , initiation of beta - blocker and ace inhibitor is recommended if cardiotoxicity develops .
, , even though these drugs may favorably influence the cardiac her system , their use is at present empirical and prompted by the knowledge of their positive effects on cardiac remodeling and on the maladaptive neurohormonal responses occurring in chf of any etiology .
the ongoing multidisciplinary approach to novel therapies in cardiology oncology research trial ( manticore 101breast ) is evaluating the effectiveness of perindopril or bisoprolol in primary prevention of trastuzumab - induced modifications in lv geometry . since the lv will be evaluated by magnetic resonance imaging , important information about the role of this latter in the cardiologic follow - up after trastuzumab therapy
trastuzumab therapy carries a significant risk of cardiotoxicity in the elderly like at a younger age , with an incidence of chf in trastuzumab recipients that may be twice as high as it is in women not given trastuzumab .
careful selection of patients is mandatory to avoid unnecessary prescription of trastuzumab and , therefore , unjustified risk of cardiac side effects .
treatment should be offered only to subjects who can be reasonably assumed to be able to complete it , keeping in mind that extremely advanced age and preexisting cardiac disease predispose to trastuzumab cardiotoxicity .
future studies are needed to determine whether selected biomarkers or new imaging techniques may be employed in the geriatric population for timely detection and treatment of trastuzumab cardiac side effects . at the preclinical level , a better understanding of the mechanisms by which trastuzumab specifically affects the old heart | breast cancer ( bc ) is diagnosed in 65 year old women in about half of cases .
experts currently recommend that systemic therapy is offered to elderly patients with bc , if , based on their overall conditions and life expectancy , it can be reasonably anticipated that the benefits will outweigh the risks of treatment .
like for young subjects , the monoclonal antibody against human epidermal growth factor receptor-2 ( her-2 ) , trastuzumab , represents a valid therapeutic option when bc over - expresses this receptor .
unfortunately , administration of trastuzumab is associated with the occurrence of left ventricular dysfunction and chronic heart failure ( chf ) , possibly because of interference with the homeostatic functions of her-2 in the heart .
registry - based , retrospective analyses have reported an incidence of chf around 25% in elderly women receiving trastuzumab compared with 10%15% in those not given any therapy for bc , and the risk of chf has been estimated to be two - fold higher in > 6065 year old trastuzumab users vs. non - users . extremely advanced age and preexisting cardiac disease have been shown to predispose to trastuzumab cardiotoxicity
. therefore , selection of older patients for treatment with trastuzumab should be primarily based on their general status and the presence of comorbidities ; previous chemotherapy , especially with anthracyclines , should be also taken into account .
once therapy has started , efforts should be made to ensure regular cardiac surveillance .
the role of selected biomarkers , such as cardiac troponin , or new imaging techniques ( three - dimension , tissue doppler echocardiography , magnetic resonance imaging ) is promising , but must be further investigated especially in the elderly . moreover , additional studies are needed in order to better understand the mechanisms by which trastuzumab affects the old heart . |
a surgeon needs to improve his laparoscopic skills to overcome the difficulties in laparoscopy , which can be achieved through multiple and repetitive sessions in an alternative training method rather than getting trained in the patients directly .
all must master the difficulties such as loss of depth perception , fulcrum effect of abdominal wall , limited motion freedom , and manipulation of tissues .
this can be made easy by practicing in any of the training materials such as surgical simulators , virtual simulating trainers , and box - trainers .
but the haptic feedback is best learnt in a box - trainer , which is an essential thing for learning the skills .
one of the most difficult tasks in laparoscopic surgery is intracorporeal knot tying and suturing technique .
the fundamental elements of knot tying are its safety , easiness , rapidity of execution and tightness , and maintaining the knot .
it has been an obstacle to all learners as it requires a lot of technical movement in a limited space .
the extracorporeal knot tying is one of the alternate methods to overcome this difficulty . when angle between the working instruments is narrow , the ligation and suturing are very difficult to perform .
most importantly geometric factors of endoscopic reconstruction , such as optimal distances between the working trocars , length of instruments , and angles between the instruments and the object will make lot of difference in suturing .
optimal geometry for intracorporeal suturing can be achieved by creating an isosceles triangle between the instruments with an angle between 25 and 45 and an angle < 55 between the instruments and the horizontal line .
these data should be considered when planning reconstructive laparoscopic procedure . to make secured intracorporeal knot , surgeons knot is the ideal knotting method which consists of 2 1 configuration .
the main aim of intracorporeal knot tying is to control suture tension and to create square knot in secured method . for basic laparoscopic surgery like appendectomy
, a pretied loop can be used . for single instrument knotting dowais tie technique can be used . in a conventional knotting method with two instruments ,
the loop is made with one hand instrument and other hand instrument enters into it to catch the tail end .
an alternative method is by holing the suture half centimeter distal to the needle with one hand instrument and to rotate to make winds [ 7 , 8 ] while the other hand instrument maintains the winds to apply the knot .
there are many studies explaining about the different types of intracorporeal knot and its learning curves .
but there is no information available about the best method of knot tying for teaching the surgical trainees in the box - trainer . in our study
we are aiming to analyse the learning curves in our surgical trainees by using two different intracorporeal knot tying methods .
twenty postgraduate students studying in the department of general surgery at sri ramachandra medical college and research institute were included in this study .
students with prior experience in laparoscopic suturing , suturing in box - trainer , and suturing in simulators were excluded .
participants were divided into two groups : a and b. they were randomized by using the website http://www.randomization.com/. there were ten participants for each group .
group a was asked to follow loop method of knot tying and group b was asked to follow winding method of knot tying .
two needle drivers were used for each participant . a ten - centimeter vicryl suture 2 - 0 ( v62h - ethicon )
material was given to each participant for every set of knots ( 2 1 1 ) .
handling of instrument with manipulation of button and handling of needle driver were allowed five minutes before starting the task .
suturing pad was used to anchor the suture material while applying the knot . prior to start with training , each participant was given explanation about the surgical technique with a video and live demonstration by a single examiner .
proper bite has to be taken in the suture pad at the premarked area . after pulling the needle from the suture pad 2 1 1 configuration knots were made during the training , the time taken for each set of knots
was calculated , and the examiner corrected the participants whenever necessary to make the knot in a standardized manner . after delivering needle from suture pad the right hand needle driver will make two loops ( double forward ) over the left hand needle driver and left hand needle driver will catch the tail of the suture and squaring of knot must be done .
this will be followed with single reverse loop and one forward loop ( figure 1 ) . after delivering the needle ,
the driver will drop the needle and the left needle driver will hold the suture half centimeter distal to the needle . then the left needle driver has to rotate to wind the thread around its axis .
the right needle driver has to then receive the needle once adequate winding was done followed by left needle driver to catch the tail end to make a square knot .
the second throw will be done by reverse wind and last part will be done by forward wind ( figure 2 ) .
participants were allowed to make as many numbers of knots as possible for each session .
each session 's participants were asked for information about frustration level ( ranging from 1 to 5 , 1 being the least and 5 being the maximum ) , difficulty in making knot ( ranging from 1 to 5 , 1 being the least and 5 being the maximum ) , and dexterity ( ranging from 1 to 5 , 1 being the least and 5 being the highest ) .
the collected data was analysed with spss 16.0 version software . to describe the data descriptive statistics , mean and standard deviation were used . to find the significant difference between the bivariate samples in paired groups ( between sessions 1 to 8) wilcoxon signed rank test was used and for independent groups ( loop and wind ) mann - whitney u test was used . for the repeated measures ( from sessions 1 to 8) the friedman test was used . in all the above statistical tools the probability value < 0.05 is considered as significant level .
the comparison of number of knots along the sessions between the loop and winding methods showed that as the sessions were increasing the number of knots tied was increasing in the winding method compared with the loop method which is statistically significant except the first session , p = 0.853 > 0.05 .
the maximum number of knots made along the session in loop technique was seven and it shows a steady increase only from the sixth session , whereas in the winding technique there was a consistent increase in the number of knots from the first session to eighth session and it reached a maximum of fifteen knots at the end of the eighth session itself ( table 1 , figure 3 ) .
the comparison of average time taken along the sessions between the loop and winding method shows that as the sessions were increasing the average time decreases in the winding method compared with the loop method which is statistically significant except the first session , p = 0.436 > 0.05 ( table 2 , figure 4 ) .
the comparison of frustration level along the sessions between the loop and winding method shows that as the sessions were increasing the frustration score is decreasing in the winding method and becomes steadily 1 from sixth session onwards compared with the loop method which is 2 till the end of the eighth session and which is statistically significant except the first three sessions ( table 3 , figure 5 ) .
the comparison of difficulty level along the sessions between the loop and winding method shows that as the sessions were increasing the difficulty score is decreasing in the winding method and becomes steadily 1 from sixth session onwards compared with the loop method which is 2 till the end of the eighth session and which is statistically significant except the first three sessions ( table 4 , figure 6 ) .
the comparison of dexterity along the sessions between the loop and winding method shows that as the sessions were increasing the dexterity score is increasing in the winding method and becomes steadily 5 on seventh session itself compared with the loop method which is 4 till the end of the eighth session and which is statistically significant except the first three sessions ( table 5 , figure 7 ) . in winding method , while comparing the average time for suturing in s8 with other sessions , there is significant improvement in every session ( p value < 0.01 ) .
it means average time taken for knot tying decreases significantly from s1 to s8 ( table 6 ) . in loop method , while doing the same type of comparison , there is significant improvement seen only up to s5 . in s6 and s7 no significant improvement was seen .
it means that there is no significant reduction in average time of knot tying from session 6 to session 8 .
it is well established that minimally invasive surgical skill must be acquired by proper training in box - trainers , rather than directly performing in a clinical setting to ensure patient safety .
but in laparoscopy this may not be applicable since there is a long learning curve .
the haptic feedback in box - trainer will definitely improve the surgeon 's skill . to avoid the injury to the abdominal organs during surgery the moving part of instrument must be in the optic field .
the working port placement must be either side of camera to make adequate triangulation , which will make knot tying easier . in box - trainer
the port placement will be ideal for making triangulation . for suturing and knotting standard technique must be followed . after taking bite from tissue surgeon
must pull the suture to make tail end shorter as 2 cm and he should position it before making knot .
this will make grasping the tail end after making wind or loop easy . to make knot in the tissue there are many knots tying methods available .
for single port users extracorporeal knot tying method may be useful . to make knot tying as strong as open surgery at least two hands instruments ( right and left )
work was a comparative study of suturing practice with haptic feedback and without haptic feedback . in this study result showed haptic feedback may not be warranted in laparoscopic surgical trainers at all stages of training . in our study
haptic feedback of box - trainer definitely improved the suturing skills among our postgraduate students . from session 1 to session 8
this shows the learning curve of both groups going up by our box - training .
, group b ( winding method ) students made significantly higher number of knots and they took less time for each knot than group a ( loop method ) in all sessions except session 1 .
the feedback results of the candidates show no significant difference in view of frustration , difficulty , and dexterity from s1 to s3 . on the other hand from s4 to s8 ,
the difficulty and frustration significantly reduced and dexterity improved in group b ( winding method ) compared with group a ( loop method ) . while comparing each session with last session , in group a ( loop method )
there is statistically significant improvement from s1 to s5 , but from s6 to s8 there is no significant improvement in knot tying .
all the above results show there is significant improvement in the learning curve in every session of training in both groups .
although both knotting methods are standard methods to apply in patients , the winding method of knotting will be simple and easy for the beginners to learn . in winding method of suturing the triangulation of working instrument
is not completely required but in loop method of suturing the triangulation and adequate distance between instruments are required .
it explains that winding method of suturing is more simple and easy to perform , especially for those who have limited experience in intracorporeal suturing and knot tying .
no special instrument is required to perform knot tying with this technique . even in our study frustration level and difficulty level in winding method
are less comparing with loop method and reason could be the same as that mentioned by jagad .
the ergonomics of suturing is very important which will make surgery easier and faster . in winding method of suturing the ergonomic is improved and that is the reason why trainees can make more number of sutures with less difficulty .
explain that an ergonomic chair will improve the suturing in laparoscopic surgery . in our study results
so this method of suturing can improve ergonomics and can make reconstructive laparoscopic surgeries easier .
murphy explained about advance modern surgical techniques of endoscopic knot tying , a new appreciation of knot tying theory , and application of these new techniques in many fields of minimally invasive surgery . in our study two standard methods of suturing techniques were compared which may give useful information to identify the best method of suturing technique in various types of minimally invasive surgeries .
laparoscopic suturing and knotting are difficult skills to develop especially in new learners . even though there are many methods of intracorporeal suturing available , two best methods of suturing techniques
while comparing with loop method of knotting , the winding method of knotting is simpler and easier to perform , especially for the surgeons who have limited experience in intracorporeal suturing and knot tying .
the winding method essay for the learners probably does not require much triangulation while making knot . | objectives . in our study
we are aiming to analyse the learning curves in our surgical trainees by using two standard methods of intracorporeal knot tying . material and method .
two randomized groups of trainees are trained with two different intracorporeal knot tying techniques ( loop and winding ) by single surgeon for eight sessions . in each session participants
were allowed to make as many numbers of knots in thirty minutes .
the duration for each set of knots and the number of knots for each session were calculated . at the end
each session , participants were asked about their frustration level , difficulty in making knot , and dexterity .
results . in winding method the number of knots tied was increasing significantly in each session with less frustration and less difficulty level . discussion .
the suturing and knotting skill improved in every session in both groups .
but group b ( winding method ) trainees made significantly higher number of knots and they took less time for each set of knots than group a ( loop method ) .
although both knotting methods are standard methods , the learning curve is better in loop method . conclusion .
the winding method of knotting is simpler and easier to perform , especially for the surgeons who have limited laparoscopic experience . |
diabetes mellitus is the most common cause of end - stage renal disease , non - traumatic lower - limb amputation and blindness .
furthermore , diabetic retinopathy ( dr ) is the most important cause of visual loss worldwide . the prevalence of dr increases with duration of diabetes .
some other risk factors of dr development include poor glycemic control , type of diabetes , and the presence of associated disorders such as dyslipidemia , hypertension , smoking , pregnancy , and nephropathy .
dr could present as non - proliferative retinopathy , proliferative retinopathy or macular edema , however , the most important cause of visual loss among these patients is macular edema .
retinopathy is essential for the diagnosis of diabetic nephropathy , but it presents in 90% and 60% of type 1 and 2 diabetic patients , respectively . because the rate of progression of retinopathy may be rapid , and treatment can be beneficial for reduction of disease progression , it is important to screen diabetic patients regularly for the development of retinopathy ,
so in type 1 diabetes , after 5 years and in type 2 diabetes , at the time of diagnosis and then annually , retinopathy should be evaluated .
one of the other complications of diabetes is generalized atherosclerosis which can be presented as ischemic heart disease , cerebrovascular accident or peripheral vascular disease .
diabetic atherosclerosis can be detected by measurement of intima - media thickness ( imt ) of common or internal carotid artery ( cimt ) .
the cimt was used to predict of cardiovascular outcomes in diabetic patients . the easy applicability and the noninvasive nature of b - mode ultrasonography
make it suitable for using as a surrogate endpoint for measuring the atherosclerotic burden in people with cardiovascular risk factors .
the mean cimt values by the different incidences were reported as 1.26 0.6 mm ( transversal ) , 1.17 0.54 mm ( longitudinal anterolateral ) , and 1.18 0.58 mm ( longitudinal posterolateral ) .
increases in the thickness of the carotid imt may be associated with an increased risk of myocardial infarction and stroke in old patients without a history of cardiovascular disease .
mean cimt was reported a reliable marker of risk of ischemic stroke in type 2 diabetic patients and could be used as a simple noninvasive screening test for the assessment of atherosclerosis in these patients .
mean cimt may be associated with age , systolic blood pressure ( sbp ) , smoking , the ratio of low - density lipoprotein to high - density lipoprotein cholesterol , mean glycosylated hemoglobin value ( hba1c ) , and urinary albumin excretion rate . in type 2
diabetic patients , significant predictors of imt progression included albuminuria , advanced age , male sex , smoking , and higher sbp .
in diabetic patients without a history of clinical cvd , the presence of advanced stage of dr is associated with subclinical coronary artery disease .
dr was shown as subclinical atherosclerosis marker , so retinopathy may warrant a more careful cardiovascular assessment even in the early stages of diabetes .
intima - media thickness is a sensitive marker of early carotid atherosclerosis , so ultrasound cimt measurement can be used to assess the cardiovascular risk and to determine indications for intensified diabetic treatment ; on the other hand , dr is an early and reliable marker of microvascular disease , and probably diabetic nephropathy , so the aim of our study was evaluation of relationship between retinopathy and cimt as two valuable noninvasive methods for early detection of micro and macrovascular complication of diabetes .
in a cross - sectional study ( 2012 ) , 154 diabetic patients who had a medical history and follow - up in imam ali clinic of shahrekord were enrolled in the study .
they were divided into two equal groups of 77 patients that were case group ( with retinopathy ) and control group ( without retinopathy ) .
diabetes is defined as fasting blood sugar equal or more than 126 mg / dl .
dr is defined as a microvascular complication of diabetes that affect retinal arterioles and it has two forms as nonproliferative and proliferative retinopathy .
exclusion criteria were : age lesser than 40 , presence of cataract in the ophthalmologic exam that prevents retinopathy evaluation , noncooperative patients during the study .
it has been explained to the participants that all information will be confidential and a written consent form were filled in by all patients .
common carotid intima - media thickness ( cimt ) is defined as the largest distance between the luminal intima interface and the medial adventitia interface that is located at 1 cm of the initiation of the common carotid artery that was measured by one sonographist in recombinant position and using doppler sonography devices ( siemens , g50 , germany ) .
demographic criteria such as age , duration of diabetes , body mass index ( bmi ) , sbp and diastolic blood pressure ( dbp ) , and laboratory results including fasting blood sugar ( fbs ) , glycated hemoglobin ( hba1c ) , blood urea nitrogen ( bun ) , and creatinine ( cr ) were checked .
bmi was measured by formula ( body weight [ kg]/length [ m ] ) and laboratory tests were conducted by biotecnica instruments ( bt 3000 ) . collected data were entered to spss ( statistical package for the social sciences , version 19.0 , spss inc , chicago , ill , usa ) and analysis was done by t - test , chi - square test , and pearson correlation .
this study was the result of research project number of 986 , which approved by the research committee of shahrekord university of medical sciences .
mean age of the patients with retinopathy ( group 1 ) was 62.5 9.75 years and in the patients without retinopathy ( group 2 ) was 58 10 years ( p = 0.006 ) .
mean cimt of all patients was 0.84 0.18 and in the female and male patients were 0.82 0.16 mm and 0.88 0.22 mm respectively ( p = 0.03 ) . in all of the patients ,
cimt was associated with age , duration of diabetes ( based on history ) , sbp , serum bun , and cr [ table 1 ] .
the number of male and female in group 1 was 34 ( 44.2% ) and 43 ( 55.8% ) and in group 2 were 21 ( 27.3% ) and 56 ( 72.7% ) , respectively .
cimt of the patients of group 1 was significantly greater than group 2 ( p < 0.001 ) .
mean hba1c in group 1 ad 2 were 7.20 1.21 and7.04 1.33 , respectively ( p = 0.39 ) .
table 2 showed that in patients of group 1 , cimt was correlated only with sbp ( p = 0.01 ) ; however in the patients of group 2 , cimt was correlated with dbp . to remove confounding bias effect ,
comparison of different variables in two groups of the patients association of cimt with different variables in the patients
prevalence of dr in type 2 diabetic patients was reported 34.6% in yau et al .
study with no difference in male and female , whereas zhang et al . showed slightly more common in male patients .
besides , harris et al . found a greater prevalence and severity of dr in non - hispanic and mexican americans with type 2 diabetes .
there are a few studies about correlation of cimt and retinopathy in diabetic patients , for example , miyamoto in evaluation of 102 diabetic patients showed the significant correlation between retinopathy and common carotid artery thickness , also torres et al . in a study on 173 patients with hypertension showed , significant and independent association of carotid intima - media thickness with arteriolar caliber of retina . in our study cimt was associated with age , duration of diabetes , sbp , serum bun , and cr whereas cardoso et al .
found the correlation of cimt with age , male sex , smoking status , and ambulatory blood pressure .
ogawa et al . in a study on 634 type 2 diabetic patients reported the positive correlation of cimt and patients bmi , also he found correlation between maximum bmi and retinopathy , but we did nt find this association in the patients .
the reason of this discrepancy may be due to different number of patients in two studies .
correlation of cimt and htn was reported in some studies , also in our study cimt was correlated with sbp in patients with retinopathy and with dbp in patients without retinopathy , however , alizadeh et al . in a study on
study also cimt had not correlation with control of blood sugar . about association of hba1c and cimt
furthermore similar result was found by choi et al . in the study on 370 type 2 diabetic patients .
small sample size is a limitation in our study , so we suggest more studies to be carried out using larger sample size .
therefore , the relationship between cimt and other complications of diabetes such as microalbuminuria , macroalbuminuria or neuropathy need to be evaluated .
in diabetic patients , cimt is a marker of atherosclerosis and macrovascular damage which has had a correlation with dr ( as a potential reliable marker of microvascular damage ) , so we may use sonographic measurement of cimt as a simple , available , and noninvasive method for screening of macro and microvascular complications among diabetic patients .
all authors have assisted in preparation of the first draft of the manuscript or revising it critically for important intellectual content .
all authors have read and approved the content of the manuscript and confirmed the accuracy or integrity of any part of the work . | background : this study was carried out in order to evaluate the relationship between retinopathy and carotid intima - media thickness ( cimt).materials and methods : in a cross - sectional study , 154 diabetic patients who had a history of diabetic disease were evaluated in two equal groups of 77 patients with and without retinopathy , respectively .
cimt was evaluated in all of the patients.results:mean age of the patients was 59.65 9.37 years .
mean cimt of all patients was 0.84 0.18 .
cimt of patients with retinopathy was significantly greater than patients without retinopathy ( p < 0.001 ) .
cimt also correlated with age , duration of diabetes , systolic blood pressure , blood urea nitrogen , and serum creatinine.conclusion:cimt may be used as a simple , available and noninvasive method for screening of macro and microvascular complication of diabetic patients . |
although vaccination has proved to be an effective strategy , the vaccine antigenic composition frequently does not match the circulating virus strains .
two influenza a subtypes ( a / h1n1 and a / h3n2 ) and two influenza b lineages ( b / victoria and b / yamagata ) have been circulating in the united states and worldwide , whereas commercialized influenza vaccines are trivalent and include the two a subtypes but only one b lineage ( either b / victoria or b / yamagata ) . every year , the world health organization ( who ) issues recommendations on the composition of the next influenza vaccine based on analyses from its network of corresponding centers .
but , past experiences have shown that those recommendations do not always correspond to influenza virus circulation of the following epidemic season.1 the resulting mismatched vaccine has an efficacy lower than expected and fails to prevent a significant proportion of influenza infection.2 new quadrivalent influenza vaccines ( qiv ) that contain both circulating b lineages have been approved for use in the united states since 2012 .
their demonstrated efficacy in children and adults has the potential to overcome the drawbacks of wrongly predicting which b lineage will predominate in a given year.35 quadrivalent influenza vaccines are expected to provide a significant public health and economic benefit , as shown by recent studies.69 however , none of these studies considered the dynamic nature of influenza infection .
in addition , they did not assess the impact of introducing a new vaccine strain on the evolution of the population immunity status and its implications on the long - term dynamics of seasonal influenza epidemics .
another key factor in qiv evaluation , often overlooked , is the potential cross - protection against a mismatched b lineage conferred by the trivalent influenza vaccines ( tiv ) , obviously limiting the added value of qiv over tiv .
the aim of our analysis was to retrospectively assess what would have been the potential benefit of qiv versus tiv in the united states during the period 20002013 , taking into account the transmissible nature of influenza as well as multiyear immunity acquired by infection and interaction between b lineages due to natural or vaccine - induced cross - protection .
due to the comparative nature of our study , we mainly report differences on influenza b cases , but do show estimates and results for influenza a to provide the full perspective and enhance comparisons .
circulation of strains in the united states is reported in the weekly influenza activity reports from the us centers for disease control and prevention ( cdc ) .
we used these data for the study period of interest from 2000 to 2013 ( table1 ) , along with the influenza b lineage contained in the tiv vaccine used for a given year . to obtain weekly time series of influenza incidence by age and for each a subtype ( h1n1 , h3n2 ) and b lineage
, we used the weekly age distribution of visits for influenza - like illness from the cdc s us outpatient influenza - like illness surveillance network ( ilinet ) , applied to the who collaborating laboratories and the cdc s national respiratory and enteric virus surveillance system ( who / nrevss ) data regarding the proportions of influenza - positive tests . in doing so
, we are making the assumptions that most tested patients had influenza - like symptoms .
we then applied the yearly strains distribution published by the cdc to each age group s time series of influenza cases .
influenza strain circulation among cases source : us centers for disease control and prevention , weekly influenza activity .
our analysis uses weekly age - based vaccination coverage from the cdc s behavioral risk factor surveillance system and national immunization survey .
we collected weekly influenza vaccination uptakes over the period 20002013 from cdc and collected separately vaccine efficacy ( ve ) by strain2 and by age ( cdc , unpublished data ) .
we then combined the two datasets , assuming the same relative efficacy by age between different strains ( table2 ) .
cdc , us centers for disease control and prevention ; ve , vaccine efficacy . with exponential decay .
we only consider in our model cross - protection between b lineage , because any potential heterosubtypic immunity between a / h1n1 and a / h3n2 would not impact the comparison between tiv and qiv .
a recent review by diazgranados et al.2 gives a ve point estimate of 71% against a matched strain and 49% against a non - matched b strain . in our model
, we used the same ratio of decreased efficacy ( 49/71 = 70% of ve ) to estimate the mismatched efficacy or cross - protection . to analyze its impact on our results , we varied this estimate from 75% to 0% , with intermediate steps .
our assumption is in line with another study that assumed 66% of the matching ve,8 and conservative compared with another study that does not consider cross - protection at all.6 following results from diazgranados et al.,2 we assumed no loss of efficacy if the mismatch was on the strain but not on the subtype for a and lineage for b. the other main model inputs are given in table2 .
the model is structured in nine age groups : 06 months , 623 months , 24 years , 510 years , 1114 years , 1518 years , 1949 years , 5064 years , and 65 years .
it is composed of two submodels that independently capture influenza a- and influenza b - type epidemics . the model for influenza
a ( figure s1 ) is a variation of a compartmental seir model , where individuals can be either susceptible to infection ( s ) , exposed but not infectious ( e ) , infectious ( i ) , or have acquired an immunity to the disease ( recovered ; r ) . in addition , we have added a vaccination compartment ( v ) to account for individuals effectively protected from infection by vaccination . to account for possible independent infection by influenza a / h1n1 and influenza a / h3n2 , we have split the e , i , and r compartments . as both tiv and qiv systematically contain antigens of the two subtypes , it was not necessary to split the v compartment .
the model for influenza b , shown in figure1 , is built on the same initial principle as the model for influenza a. however , while no interaction is documented between a / h1n1 and a / h3n2 , several studies have shown that both vaccine - induced and naturally acquired protection against a b lineage occur when a person is vaccinated against or infected by the other.2,10 the model accounts for such interactions by considering a second sequence of infection after each primary infection . once individuals have been infected by one lineage , they shift to the r compartment corresponding to their infection .
then , they may be infected by the other lineage , but with a lower probability corresponding to the natural cross - protection they acquired with the primary infection . for vaccine - induced cross - protection ,
the process is similar : individuals protected against one lineage can be infected , with a lower probability , by the other lineage . in both cases , individuals will end up in a compartment where they will be immune to both kinds of infection for the duration of their naturally acquired immunity .
e , exposed but not infectious ; nxp , natural cross - protection ; qiv , quadrivalent influenza vaccine ; r , acquired an immunity to the disease ( recovered ) ; s , susceptible to infection ; v , vaccination compartment ; vxp , vaccine - induced cross - protection .
both submodels are age - structured , with nine age groups ( 06 months , 623 months , 24 years , 510 years , 1114 years , 1518 years , 1949 years , 5064 years , and 65 years ) and use a contact matrix to account for the heterogeneity of contacts between age groups . due to the absence of
published contact data in the united states , mainly available for european countries,11 we used mean daily time of exposure between age groups in the united states compiled by zagheni et al.12 equations of the model are given as supplementary material .
probabilities of influenza infection v and y , respectively for b / victoria and b / yamagata are calibrated simultaneously .
in addition , to replicate yearly variations in influenza peaks and dominance of one lineage over the other , we first calibrate vi and yi for the first year i = 2000 .
we then calibrate vi + 1 and yi + 1 for year i + 1 , taking into account the population immune status acquired the previous years .
each year , the population is vaccinated with a tiv containing the b lineage which was used that year .
we use a 10-year burn - in period ( between 1990 and 2000 ) , with the same epidemic parameters , to let the model reach steady initial values for the first year of calibration ( year 2000 ) .
we end up with a set of ( vi , yi ) , containing one per lineage and per year , each accounting for variations that could not be explained by the evolution of the population immunity ( either vaccine or infection induced ) , but potentially by external factors ( climate , strain pathogenicity , etc . ) .
in contrast to other approaches , mainly in static models , consisting of the computation of an expected probability of infection without vaccination,6 this process directly allows us to account for the impact of vaccination , as the estimates are computed under a given coverage , vaccine composition , and efficacy ; tiv , in this case .
the calibration uses a nelder mead simplex algorithm13 with a least square fitness function .
the model and calibration process are implemented in r14 and take approximately 4 hours to compute on a 26 ghz microprocessing core .
figure2 shows the match obtained , after calibration , between weekly incidence time series computed by the model and weekly incidence observed over the period 20002013 .
our calibration process allowed the model to achieve r of 954% and 930% for b / victoria and b / yamagata , respectively .
ranges of r0 yearly variations , classically computed15 with beta estimated by the model , are given in table2 for b / victoria , b / yamagata , and for a / h1n1 and a / h3n2 ( the absence of epidemic circulation of a particular strain in a given year yields an r0 < 1 , which is not shown in the table ) . comparison of weekly influenza incidence for b / victoria and b / yamagata predicted by the model versus the weekly incidence observed over the period 20002013 .
our analysis is focused on the assessment of the potential incremental differences of using qiv instead of tiv .
consequently , we systematically compare a tiv scenario with a qiv scenario regarding the number of cases due to influenza b strains .
because yearly incidences depend on the incidence of previous years , each yearly impact of a vaccine can not be interpreted independently .
consequently , we could not easily estimate a confidence interval of yearly vaccine impact , and computed instead an impact range defined as the minimum and maximum of the moving average of the vaccine impact with window of 5 years .
cross - protection plays a crucial role in the estimation of the benefits of a multistrain vaccine .
we conservatively used a relatively high estimate of cross - protection as our base case , but chose to vary this estimate in a sensitivity analysis where values go from 0% to 75% of the ve against the matched strain . for each scenario
, the probabilities of infection were recalibrated using the process described earlier , as every change in cross - protection , duration of immunity , and vaccine effectiveness affects the dynamics of the epidemic and hence the potential effects of the vaccine .
we did not define a dedicated sensitivity analysis on vaccine coverage ; however , by design , coverage and efficacy play a similar role at the population level of our model . consequently , the results we show on the sensitivity to efficacy variations can be directly interpreted as results on the sensitivity to coverage variations for a fixed efficacy .
circulation of strains in the united states is reported in the weekly influenza activity reports from the us centers for disease control and prevention ( cdc ) .
we used these data for the study period of interest from 2000 to 2013 ( table1 ) , along with the influenza b lineage contained in the tiv vaccine used for a given year . to obtain weekly time series of influenza incidence by age and for each a subtype ( h1n1 , h3n2 ) and b lineage
, we used the weekly age distribution of visits for influenza - like illness from the cdc s us outpatient influenza - like illness surveillance network ( ilinet ) , applied to the who collaborating laboratories and the cdc s national respiratory and enteric virus surveillance system ( who / nrevss ) data regarding the proportions of influenza - positive tests . in doing so
, we are making the assumptions that most tested patients had influenza - like symptoms .
we then applied the yearly strains distribution published by the cdc to each age group s time series of influenza cases .
influenza strain circulation among cases source : us centers for disease control and prevention , weekly influenza activity .
our analysis uses weekly age - based vaccination coverage from the cdc s behavioral risk factor surveillance system and national immunization survey .
we collected weekly influenza vaccination uptakes over the period 20002013 from cdc and collected separately vaccine efficacy ( ve ) by strain2 and by age ( cdc , unpublished data ) .
we then combined the two datasets , assuming the same relative efficacy by age between different strains ( table2 ) .
cdc , us centers for disease control and prevention ; ve , vaccine efficacy . with exponential decay .
we only consider in our model cross - protection between b lineage , because any potential heterosubtypic immunity between a / h1n1 and a / h3n2 would not impact the comparison between tiv and qiv .
a recent review by diazgranados et al.2 gives a ve point estimate of 71% against a matched strain and 49% against a non - matched b strain . in our model
, we used the same ratio of decreased efficacy ( 49/71 = 70% of ve ) to estimate the mismatched efficacy or cross - protection . to analyze its impact on our results , we varied this estimate from 75% to 0% , with intermediate steps .
our assumption is in line with another study that assumed 66% of the matching ve,8 and conservative compared with another study that does not consider cross - protection at all.6 following results from diazgranados et al.,2 we assumed no loss of efficacy if the mismatch was on the strain but not on the subtype for a and lineage for b. the other main model inputs are given in table2 .
the model is structured in nine age groups : 06 months , 623 months , 24 years , 510 years , 1114 years , 1518 years , 1949 years , 5064 years , and 65 years .
it is composed of two submodels that independently capture influenza a- and influenza b - type epidemics .
the model for influenza a ( figure s1 ) is a variation of a compartmental seir model , where individuals can be either susceptible to infection ( s ) , exposed but not infectious ( e ) , infectious ( i ) , or have acquired an immunity to the disease ( recovered ; r ) . in addition , we have added a vaccination compartment ( v ) to account for individuals effectively protected from infection by vaccination . to account for possible independent infection by influenza a / h1n1 and influenza a / h3n2 , we have split the e , i , and r compartments .
as both tiv and qiv systematically contain antigens of the two subtypes , it was not necessary to split the v compartment .
the model for influenza b , shown in figure1 , is built on the same initial principle as the model for influenza a. however , while no interaction is documented between a / h1n1 and a / h3n2 , several studies have shown that both vaccine - induced and naturally acquired protection against a b lineage occur when a person is vaccinated against or infected by the other.2,10 the model accounts for such interactions by considering a second sequence of infection after each primary infection .
once individuals have been infected by one lineage , they shift to the r compartment corresponding to their infection .
then , they may be infected by the other lineage , but with a lower probability corresponding to the natural cross - protection they acquired with the primary infection . for vaccine - induced cross - protection ,
the process is similar : individuals protected against one lineage can be infected , with a lower probability , by the other lineage . in both cases , individuals will end up in a compartment where they will be immune to both kinds of infection for the duration of their naturally acquired immunity .
e , exposed but not infectious ; nxp , natural cross - protection ; qiv , quadrivalent influenza vaccine ; r , acquired an immunity to the disease ( recovered ) ; s , susceptible to infection ; v , vaccination compartment ; vxp , vaccine - induced cross - protection .
both submodels are age - structured , with nine age groups ( 06 months , 623 months , 24 years , 510 years , 1114 years , 1518 years , 1949 years , 5064 years , and 65 years ) and use a contact matrix to account for the heterogeneity of contacts between age groups . due to the absence of published contact data in the united states , mainly available for european countries,11 we used mean daily time of exposure between age groups in the united states compiled by zagheni et al.12 equations of the model are given as supplementary material .
probabilities of influenza infection v and y , respectively for b / victoria and b / yamagata are calibrated simultaneously .
in addition , to replicate yearly variations in influenza peaks and dominance of one lineage over the other , we first calibrate vi and yi for the first year i = 2000 .
the final state of year i is the initial state of year i + 1 .
we then calibrate vi + 1 and yi + 1 for year i + 1 , taking into account the population immune status acquired the previous years .
each year , the population is vaccinated with a tiv containing the b lineage which was used that year .
we use a 10-year burn - in period ( between 1990 and 2000 ) , with the same epidemic parameters , to let the model reach steady initial values for the first year of calibration ( year 2000 ) .
we end up with a set of ( vi , yi ) , containing one per lineage and per year , each accounting for variations that could not be explained by the evolution of the population immunity ( either vaccine or infection induced ) , but potentially by external factors ( climate , strain pathogenicity , etc . ) .
in contrast to other approaches , mainly in static models , consisting of the computation of an expected probability of infection without vaccination,6 this process directly allows us to account for the impact of vaccination , as the estimates are computed under a given coverage , vaccine composition , and efficacy ; tiv , in this case .
the calibration uses a nelder mead simplex algorithm13 with a least square fitness function . the model and calibration process
are implemented in r14 and take approximately 4 hours to compute on a 26 ghz microprocessing core .
figure2 shows the match obtained , after calibration , between weekly incidence time series computed by the model and weekly incidence observed over the period 20002013 .
our calibration process allowed the model to achieve r of 954% and 930% for b / victoria and b / yamagata , respectively .
ranges of r0 yearly variations , classically computed15 with beta estimated by the model , are given in table2 for b / victoria , b / yamagata , and for a / h1n1 and a / h3n2 ( the absence of epidemic circulation of a particular strain in a given year yields an r0 < 1 , which is not shown in the table ) . comparison of weekly influenza incidence for b / victoria and b / yamagata predicted by the model versus the weekly incidence observed over the period 20002013 .
our analysis is focused on the assessment of the potential incremental differences of using qiv instead of tiv .
consequently , we systematically compare a tiv scenario with a qiv scenario regarding the number of cases due to influenza b strains .
because yearly incidences depend on the incidence of previous years , each yearly impact of a vaccine can not be interpreted independently .
consequently , we could not easily estimate a confidence interval of yearly vaccine impact , and computed instead an impact range defined as the minimum and maximum of the moving average of the vaccine impact with window of 5 years .
cross - protection plays a crucial role in the estimation of the benefits of a multistrain vaccine .
we conservatively used a relatively high estimate of cross - protection as our base case , but chose to vary this estimate in a sensitivity analysis where values go from 0% to 75% of the ve against the matched strain . for each scenario
, the probabilities of infection were recalibrated using the process described earlier , as every change in cross - protection , duration of immunity , and vaccine effectiveness affects the dynamics of the epidemic and hence the potential effects of the vaccine .
we did not define a dedicated sensitivity analysis on vaccine coverage ; however , by design , coverage and efficacy play a similar role at the population level of our model . consequently , the results we show on the sensitivity to efficacy variations can be directly interpreted as results on the sensitivity to coverage variations for a fixed efficacy .
assuming a cross - protection of 70% of the ve of a matching vaccine , the model predicts that qiv would have prevented on average 1580% ( 1037% ; 227% ) ( min max , moving average over 5 years ) extra b lineage cases than tiv over the period 20002013 .
figure3 and table3 illustrate the multiyear incidence evolution of b / victoria and b / yamagata epidemics under tiv and qiv scenarios . the first point to notice
is the relatively large variations in cases prevented by qiv , years with a mismatched tiv vaccine being mainly years with the highest impact of qiv .
it appears that over the period 20002013 , qiv would have prevented a cumulative number of more than 62 million cases .
first , several years show a cocirculation of the two lineages , which allows qiv to be beneficial even during vaccine match years .
second , with a qiv scenario , some years display a slightly higher incidence for one b lineage than a scenario with tiv alone . as shown in table3 , these correspond to years with tiv matching the circulating b lineage ( 20062007 , 20092011 ) , and more importantly , they follow a string of years combining tiv mismatch and medium to high b circulation , leading to large numbers of cases prevented by qiv ( > 16 million in 20042006 and > 27 million in 20072009 ) .
concerning elderly individuals ( age 65 years ) and young seniors ( age 5064 years ) , figure4 shows that they benefit the most from qiv , with 21% and 18% reduction in b cases , respectively . of note , the infant population ( age 06 months ) , not ( yet ) vaccinated , benefits from qiv thanks to indirect protection of the other age groups .
difference in influenza symptomatic cases of a routine vaccination with qiv compared with one tiv over the period 20002013 .
the relative difference with qiv columns give the relative difference between qiv and tiv for cases and susceptible population .
the last columns give the tiv b antigens matching , a match being defined as the vaccine strain represents more than 50% of the circulating b strains , and a qualitative ranking of b virus circulation for the given year ( low < 10% medium < 25% high ) qiv , quadrivalent influenza vaccine ; tiv , trivalent influenza vaccine .
base case comparison between trivalent influenza vaccine ( tiv ) and quadrivalent influenza vaccine ( qiv ) .
cross - protection sensitivity analysis showing reduction in b cases with quadrivalent influenza vaccine ( qiv ) compared with trivalent influenza vaccine ( tiv ) over the period 20002013 .
figure4 also shows that reducing the cross - protection estimate to 50% , 30% , and 0% of the matched ve improves the relative benefit of qiv to 25% , 30% , and 34% fewer b cases in the united states for all age groups . in figure5
, we show the impact of varying ve across all age groups by 20% to + 20% .
in addition , in our model , ve and vaccine coverage play a mutually exchangeable role at the population level , which means that variations invaccination coverage by 20% would display the same results .
lastly , we varied duration of immunity acquired by infection from 6 to 18 years .
results displayed in figure6 show that an increased duration of acquired immunity tends to decrease qiv impact .
however , the relation seems to be asymptotic ; increasing the duration from 12 to 18 years only reduces qiv impact by < 1% ( all age groups ) .
our model is also able to simulate influenza a activity ( figure s1 ) .
although qiv have no additional impact on a compared with tiv , it allows us to put qiv potential benefits in the perspective of a global reduction in influenza cases .
considering all influenza cases ( a and b ) , our analysis predicts a maximum reduction of 11% symptomatic cases on year 20072008 and a total reduction on the entire 20002013 time period of 32% of cases .
figure4 also shows that reducing the cross - protection estimate to 50% , 30% , and 0% of the matched ve improves the relative benefit of qiv to 25% , 30% , and 34% fewer b cases in the united states for all age groups . in figure5
, we show the impact of varying ve across all age groups by 20% to + 20% .
in addition , in our model , ve and vaccine coverage play a mutually exchangeable role at the population level , which means that variations invaccination coverage by 20% would display the same results .
lastly , we varied duration of immunity acquired by infection from 6 to 18 years .
results displayed in figure6 show that an increased duration of acquired immunity tends to decrease qiv impact .
however , the relation seems to be asymptotic ; increasing the duration from 12 to 18 years only reduces qiv impact by < 1% ( all age groups ) .
our model is also able to simulate influenza a activity ( figure s1 ) .
although qiv have no additional impact on a compared with tiv , it allows us to put qiv potential benefits in the perspective of a global reduction in influenza cases . considering all influenza cases ( a and b )
, our analysis predicts a maximum reduction of 11% symptomatic cases on year 20072008 and a total reduction on the entire 20002013 time period of 32% of cases .
the complex dynamic of communicable diseases should not be underestimated when assessing preventive strategies . in the case of influenza
, vaccines have the potential to change the dynamic of seasonal epidemics , mainly by changing the balance between immunity acquired by infection and by vaccination .
our results show that the benefit of qiv varies from 1 year to another .
quadrivalent influenza vaccine reduces the number of yearly cases during our study period ( 20002013 ) by a low of 20 900 in 2000 to a high of 2 543 000 cases in 2007 . for some specific epidemic contexts of tiv matching the circulating b lineage and large qiv - induced reductions in cases preceding years
, the total number of b cases can be larger with qiv than with tiv ( 1400394 800 more cases ) . however , this increase is just a balancing effect due to even larger reductions in the number of cases during previous years .
the reduction in the number of infections results in an increased number of individuals susceptible to new infection the following seasons ( up to 27% , or approximately 4 million ) .
this effect does not outweigh the public health benefit of qiv , as our model predicts an average of 172 cases prevented annually per 100 000 inhabitants in the united states ( or 482 000 fewer cases per year ) .
it also shows that the public health benefit of qiv may have to be evaluated over several years , which may reduce the economic effectiveness of the strategy due to the discounting of future benefits .
in addition , we notice in figures6 , displaying agewise qiv - relative public health benefits , that young seniors and the elderly benefited the most from the switch from tiv to qiv .
indeed , figure5 can be interpreted as a sensitivity analysis on coverage and shows a linear positive correlation between coverage ( or efficacy ) qiv benefits .
hence , a higher coverage should allow qiv to prevent even more influenza cases than would tiv .
our study shares similar objectives and perspectives with the analysis conducted by reed et al.6 in addition to focusing on the us population and sharing most of the data sources , we simulated a hypothetical scenario where qiv would have been used in place of tiv for the past years , and compared the outcomes .
this design allows us to assess under a realistic epidemiologic context the impact of the two vaccines .
however , it limits our ability to describe potential long - term impact of some hypothetical scenarios , like a long duration of naturally acquired immunity ( > 12 years ) , but projecting the use of qiv in the future would have required additional assumptions about vaccine mismatch and b lineage circulations , which may have impaired our results .
however , we also have fundamental differences : we used a dynamic model , we considered cross - protection , differences of ve , coverage , and contacts between age groups , and we took into account the epidemiological link between influenza seasons ( population immunity of year n depends on year n1 ) . hence , our results differ , as we show greater variations of yearly benefits and a greater average number of avoided cases ( over the period 20012009 , reed et al .
show 342 700 avoided cases by qiv , while we predict 661 600 for the same period ) . however , both sets of results are correlated , as lows and highs happen on the same years and remain around the same order of magnitude over the whole time period considered . on the other hand ,
the study by clements et al.,9 also set in the united states , predicts that qiv would only prevent on average 30 000 cases per year .
this result corresponds in our analysis to the 20032004 context of tiv mismatch and low b circulation ( table3 ) .
they use similar estimates of incidence , ve , and cross - protection , but use a static model and only perform a single - year analysis . given the yearly variations that we observe , and the correlations between years , their results may not give a complete and accurate estimate of the likely benefits of qiv over several years and various epidemiological contexts .
although we believe that our analysis is more advanced than previous attempts , we must acknowledge some limits . to keep the model understandable and manageable
one of them concerns individuals recently infected and naturally immune against one strain , who may not be impacted by a vaccination with qiv , or with tiv containing the other strain .
accounting for that situation would have implied tracking too many combinations of remaining duration of immunity , which was not feasible under the current design .
in addition , we considered that the simplification s impact would be in disfavor of vaccination , giving us more conservative results .
for the same reason , an infection by a strain , after vaccination against the other one , leads to immunity against the two strains for the duration of the naturally acquired immunity .
this simplification gives an advantage to tiv , as it can not happen with qiv , leading to more conservative qiv - relative benefits .
finally , as we decided not to take into account the growth of the population due to net immigration , we underestimate the real size of the population
. however , at the central year of our simulation ( 2007 ) , our population is 6% smaller than the census estimate .
as mentioned previously , qiv - relative benefits rise with ve and coverage , meaning that the increased influenza vaccine coverage in recent years , due to pediatric and universal indications , is likely to favor qiv public health impact in the future , but further studies are required to confirm this effect .
in addition , we considered that cross - protection conferred by tiv does not vary with age ; however , no study demonstrates that this assumption is correct .
using a realistic retrospective framework , with real - life vaccine mismatch , our analysis shows that routine vaccination with qiv has the potential to substantially reduce the number of influenza infections .
although our base case scenario uses relatively conservative estimates of tiv - induced cross - protection , it still shows a 1580% reduction in b cases over the period considered . our analysis highlights the necessity of taking cross - protection into account and illustrates the potential public health impact over several years due to the variety of situations that may arise .
subsequent studies will have to assess the economic value of the potential impact of qiv vaccine strategies versus continuation of tiv .
| introductionvaccination is an effective preventive strategy against influenza . however ,
current trivalent influenza vaccines ( tivs ) contain only one of the two influenza b lineages that circulate each year .
vaccine mismatches are frequent because predicting which one will predominate is difficult .
recently licensed quadrivalent influenza vaccines ( qivs ) containing the two b lineages should address this issue .
our study estimates their impact by assessing what would have been the us public health benefit of routinely vaccinating with qiv in 20002013.methodswe developed a dynamic compartmental model that accounts for interactions between influenza b lineages ( natural or vaccine - induced ) and simulates the multiyear influenza dynamics for 20002013 .
age - structured population dynamics , vaccine efficacy ( ve ) per strain , and weekly ramp - up of vaccination coverage are modeled .
sensitivity analyses were performed on ve , duration of immunity , and levels of vaccine - induced cross - protection between b lineages.resultsassuming a cross - protection of 70% of the ve of the matched vaccine , the model predicts 16% more b lineage cases prevented by qiv .
elderly ( 65 years ) and young seniors ( 5064 years ) benefit most from qiv , with 21% and 18% reductions in b lineage cases . reducing cross - protection to 50% , 30% , and 0% of the ve of the matched vaccine improves the relative benefit of qiv to 25% , 30% , and 34% less b lineage cases.conclusionusing a dynamic retrospective framework with real - life vaccine mismatch , our analysis shows that qiv routine vaccination in the united states has the potential to substantially reduce the number of influenza infections , even with relatively high estimates of tiv - induced cross - protection . |
when considering exercise in cancer , several factors have to be taken into consideration , in particular those alterations that could limit the capacity to perform exercise and consequently the resulting beneficial or detrimental effects . actually , many cancer patients suffer from chronic fatigue , either from the disease itself or its treatment , the latter being a confounding factor that limits exercise practice . as a matter of fact
, recent data from our laboratory suggest that exercise may be not advisable when anemia is present .
indeed , as can be seen in table 1 , when tumor - bearing mice suffering from a significant decrease in hematocrit are exercised ( mild endurance training ) , their condition worsens .
it was reported that anemia is a frequent feature of patients with cancer cachexia , contributing to weight loss , reduced exercise capacity , and altered energy homeostasis .
the incidence of anemia varies with tumor type , stage and patient s age : up to one - third of cancer patients are anemic at diagnosis and chemotherapy can even increase this number .
cancer - associated anemia can thus be considered a negative prognostic factor for survival , regardless of tumor type .
the mechanisms by which anemia may contribute to the onset and progression of cachexia still need to be elucidated , however , in the design of a therapeutical approach against cachexia that include exercise training , it is mandatory to correct anemia first , in order to rescue the tolerance to the exercise.table 1body and muscle weight in control ( n = 6 ) , colon26-bearing ( c26 , n = 8) , exercised ( n = 6 , 14 m / min 45 min , 5 days / week on a treadmill ) and c26 exercised ( n = 8)controlsc26exercisec26 exerciseinitial b.w .
( g)+2.88 0.570.82 1.23**+3.02 0.633.34 1.60 * * * * * * * gsn mass ( mg/100 g i.b.w.)572 25471 49**581 26408 54 * * * * * * * hematocrit ( % ) 51 442 7 * 54 244 6 * the hematocrit was measured collecting the blood by means of cardiac puncture from anesthesized mice before sacrifice .
data are expressed as meanstandard deviation*p < 0.05 vs. control ; * * p < 0.01 vs. control ; * * * p < 0.001 vs. control ; * * * * p
< 0.05 vs. c26 body and muscle weight in control ( n = 6 ) , colon26-bearing ( c26 , n = 8) , exercised ( n = 6 , 14 m / min 45 min , 5 days / week on a treadmill ) and c26 exercised ( n = 8) the hematocrit was measured collecting the blood by means of cardiac puncture from anesthesized mice before sacrifice .
data are expressed as meanstandard deviation * p < 0.05 vs. control ; * * p < 0.01 vs. control ; * * * p < 0.001 vs. control ; * * * * p
< 0.05 vs. c26 although relevant , anemia is not the unique factor limiting exercise capacity in cancer , since recent data have reported functional and structural cardiac alterations in tumor - bearing mice .
anemia and cardiac dysfunctions likely act synergistically lowering the threshold of exercise intensity that discriminate between the beneficial adaptations induced by mild exercise and the deleterious effects of strenuous exercise ( fig . 1 ) .
thus , the exercise dose is a crucial point to be carefully evaluated on a single patient basis .
nonetheless , the mode of exercise to be performed in a cancer patient population is very important , although a consensus is still lacking .
considering the maintenance of muscle mass as the primary goal to be achieved in cachexia , resistance rather than endurance exercise appears to be preferred . indeed , while the former exerts an anabolic action , the latter stimulates oxidative metabolic adaptations with little changes in muscle mass .
indeed , resistance exercise in healthy conditions stimulates the akt / mtor signaling pathway , this being reported to be unaffected or even hyperactivated in tumor - bearing animals , suggesting the uselessness of akt stimulation to prevent muscle wasting in cancer cachexia . on the contrary
, mild endurance exercise might counteract the reduction of oxidative capacity found in experimental cachexia .
the stimulation of oxidative metabolism could directly prevent the hyperlipidemia , and consequently ameliorate the insulin resistance .
finally , endurance exercise induces physiological adaptations resulting in the attenuation of the inflammatory response ( fig . 1 ) .
as a result , endurance exercise has been the exercise mode of choice in the majority of atrophy countermeasure studies performed to date .
a recent meta - analysis reported differential effects exerted by exercise , depending on the pathology considered and the type of exercise performed : a global positive effect of exercise was observed when all the pathologies considered were pooled together .
it is interesting to speculate that lower than previously recognized volumes of exercise are quite likely to have a measurable and positive impact in neutralizing muscle loss if practiced diligently and started at early stages of the disease , even in clinical cancer populations .
finally , the relevance of the nutritional state of the patients should be taken into account . in this regard
, the potential benefits of exercise can be completely abrogated if the organism does not have a good nutrient availability that would allow the effective counteraction of the wasting pattern .
thus , the management of cancer cachexia will probably be improved by a multi - functional approach . in this regard
, the effects of specific anabolic / anticatabolic drugs associated with adequate nutritional support could be potentiated by increased muscle use with moderate - to - high endurance.fig .
1diagram depicting the effects of endurance exercise in cancer cachexia diagram depicting the effects of endurance exercise in cancer cachexia | cancer cachexia is a complex syndrome characterized by inflammation , body weight loss , muscle , and adipose tissue wasting that is responsible for the death of a considerable percentage of cancer patients .
in addition , during cachexia muscle strength and endurance are dramatically reduced , limiting the ability to perform daily activities and severely affecting the patient s quality of life .
different studies have emphasized that a single therapy may not be completely successful in the treatment of cachexia . beyond pharmacological strategies ,
exercise training has been suggested as a promising countermeasure to prevent cachexia , in order to restore both strength and endurance , depending on the type of exercise .
unfortunately , a small number of studies , in both clinical and experimental settings , have been performed to date . moreover , when considering exercise in cancer , several factors have to be taken into consideration , in particular those alterations that could limit the capacity to perform exercise and consequently the resulting beneficial or detrimental effects .
this editorial is aimed at stimulating the debate on the suitability of including exercise training in a multi - functional approach against cachexia taking into consideration both limitations and advantages . |
recently , the relation between chronic kidney disease ( ckd ) and neurological disorders , not only cerebrovascular disease such as ischemic brain injury but also cognitive impairment such as alzheimer 's disease , has been highlighted .
cerebral and glomerular small vessel disease might have a common soil of pathogenesis , as these organs are closely connected with each other through anatomic and vasoregulatory similarities . because small vessel disease is a systemic disorder , information about small vessel disease in one organ may provide information on damage in another organ . for the kidney ,
damage markers are albuminuria / proteinuria and a reduction in estimated glomerular filtration rate ( egfr ) , which is also a marker of ckd
. on the other hand , damage markers in the brain could be magnetic resonance imaging- ( mri- ) documented small vessel alterations .
recently , clinical investigations have suggested a relation between these damage markers in the kidney and the brain . here
recently , the relation between ckd and the onset of stroke has been highlighted .
the northern manhattan study ( nomas ) , which followed 3298 stroke - free subjects for vascular outcomes with a mean follow - up time of 6.5 years , showed that ckd , which was estimated using serum creatinine and the cockcroft - gault formula , between 15 and 59 ml / min is a strong risk factor for stroke ( hazard ratio ( hr ) = 2.65 ) . in contrast , bos et al . demonstrated that decreased egfr ( < 60 ml / min/1.73 m ) is a strong risk factor for hemorrhagic but not ischemic stroke ( hr = 4.10 for hemorrhagic stroke versus 0.87 for ischemic stroke ) in the rotterdam study .
the first , decreased gfr indicates small vessel disease not only in the kidney but also in the brain .
small vessel disease seems to be the main pathophysiological mechanism in hemorrhage rather than brain infarction ; therefore , the authors suggested that gfr may be a marker of cerebral small vessel disease , especially hemorrhage .
the second , the authors considered platelet dysfunction to be an inducible factor by ckd .
severe ckd patients show prolonged bleeding time and mucosal oozing , indicating that platelet dysfunction may be involved in the relation between egfr and hemorrhagic stroke . in the relation between microalbuminuria and incident stroke , prospective cohort studies using meta - analysis with 12 prospective cohort studies including 48,596 individuals with more than 1200 stroke events
the presence of microalbuminuria was greatly associated with stroke onset even after adjustment for cardiovascular risk factors ( overall hr 1.92 ) , indicating that albuminuria contribute to be a strong predictor for the incidence of stroke .
recently , asymptomatic cerebral small vessel disease has been investigated as a predictor of the risk of future stroke .
oksala et al . demonstrated that cerebral small vessel disease is closely associated with kidney function in patients with acute stroke .
patients with cerebral small vessel disease and impaired kidney function ( egfr < 60 ml / min/1.73 m ) exhibit poor poststroke survival .
these results indicate that representative cerebral small vessel diseases include white matter lesions ( wmls ) , silent brain infarction ( sbi ) , and microhemorrhages as well as lacunar infarcts and subcortical atrophy .
wmls are detected as hyperintense areas on t2-weighted mri in areas that are bilaterally and symmetrically sited in the hemispheric white matter .
the prevalence of wmls is significantly related to the risk of stroke , cognitive decline , and dementia [ 68 ] .
the nomas demonstrated that white matter hyperintensity volume is associated with moderate - to - severe ckd , which was estimated using serum creatinine and the cockcroft - gault formula , between 15 and 59 ml / min .
wada et al . demonstrated that subjects with lower egfr ( less than 60 ml / min/1.73 m ) tended to have more lacunar infarcts and higher grade of wmls ; moreover , mean grade of wmls and the mean number of lacunar infarcts in subjects with albuminuria were greater than those in subjects without albuminuria .
furthermore , they also reported that urinary albumin level was associated with cerebral small vessel disease , independently of traditional cerebrovascular risk factors , in community - based elderly .
similarly , ikram et al . investigated the relation between kidney function evaluated by egfr and cerebral small vessel disease via mri analysis .
they clearly showed that decreased egfr was related to subclinical markers of cerebral small vessel disease such as deep white matter volume and wnls independent of cardiovascular risk factors such as age , sex , blood pressure , and diabetes .
interestingly , they also demonstrated that persons with lower egfr had a smaller brain volume , indicating that ckd may relate to brain atrophy . on the other hand ,
sbi is defined as a cerebral infarction detected by brain imaging without clinical symptoms .
kobayashi et al . also reported that there is an independent association between sbi and egfr .
the prevalence of sbi and the number of sbis increased markedly as egfr decreased .
the presence of sbi is reported to predict clinical overt stroke [ 14 , 15 ] or cognitive impairment .
therefore , patients with ckd should be assessed for sbi by mri during the follow - up period .
in contrast , uzu et al . followed 608 patients with type 2 diabetes for 7.5 years and very recently reported that sbi may predict the progression of kidney disease in these patients .
the risk of end - stage renal disease ( esrd ) or death was significantly higher in patients with sbi than in those without ( hr 2.44 ) .
the estimated egfr declined more in patients with sbi than in those without ; however , the presence of sbi did not increase the risk of progression of albuminuria .
microhemorrhages are discrete or isolated punctate hypointense lesions smaller than 5 mm on t2 * -weighted mri .
they are considered to be clinically silent but are strongly associated with advanced small vessel or microvascular ischemic disease [ 17 , 18 ] and to be a marker for increased risk of future intracranial hemorrhage [ 19 , 20 ] .
interestingly , cho et al . showed that lower egfr is associated with the presence of cerebral microhemorrhages . moreover ,
proteinuria is also strongly associated with both the frequency and number of cerebral microhemorrhages in patients with recent cerebral ischemia .
hypertensive nephroangiosclerosis was observed in 25% of patients with esrd in the united states . because nephroangiosclerosis is also mostly clinically silent , its prevalence in stroke patients is not well known .
a recent autopsy data bank clearly demonstrated that nephroangiosclerosis is common in patients with fatal stroke .
indeed , nephroangiosclerosis is independently associated with the prevalence or history of hypertension in stroke patients ( 39.8% of patients with stroke versus 9.0% of patients with other neurologic diseases ) .
these results suggest that senile kidney change is also commonly observed in patients with cerebrovascular disease and a true relation between kidney dysfunction and cerebral small vessel disease ; however , the factors connecting kidney dysfunction and cerebrovascular disease remain under discussion .
dementia and cognitive decline impair the quality of life and are associated with a profound disease burden , morbidity , and mortality , not only in patients but also in caregivers .
although an earlier approach to prevent cognitive dysfunction has been expected , there are few markers for evaluating the future risk of cognitive decline in subjects .
recently , impaired kidney function was reported to be associated with dementia and cognitive impairment .
the reasons for geographic and racial differences in stroke ( regards ) study with 23,405 participants showed that reduced kidney function is associated with a higher prevalence of cognitive impairment . in patients with ckd ,
each 10 ml / min/1.73 m decrease in egfr below 60 ml / min/1.73 m was associated with an 11% increased prevalence of cognitive impairment ( hr = 1.11 ) .
yaffe et al . conducted a chronic renal insufficiency cohort cognitive study in 825 adults aged 55 and older with ckd .
participants with advanced ckd ( egfr < 30 ml / min/1.73 m ) were more likely to have clinically significant impairment of global cognition than those with mild - to - moderate ckd ( egfr 4559 ml / min/1.73 m ) ( hr = 2.0 ) .
moreover , buchman et al . reported a prospective , observational cohort study in 886 elderly without dementia .
impaired kidney function ( egfr < 60 ml / min/1.73 m ) at baseline was associated with a more rapidly decline in cognitive , especially in semantic memory , episodic memory , and working memory . in contrast , jassal et al . very recently demonstrated that baseline albuminuria , but not egfr , was associated with reduced cognitive function only in men .
although there is sex difference in the relation between albuminuria and cognitive impairment , kidney function may provide an important window on future cognitive impairment .
recently , changes in the vascular system in the brain have been shown to contribute to the onset and progression of dementia .
the so - called central nervous system ( cns ) neurovascular unit is linked to many common human cns pathological conditions including dementia .
although multiple mechanisms are involved in cognitive impairment and dementia associated with ckd , small vessel disease in the kidney and brain is also considered to have a key role in this connection .
unlike most organs , both the kidney and brain are low resistance end - organs that are exposed to high - volume blood flow throughout the cardiac cycle .
these hemodynamic similarities are observed in the vascular beds in the kidney and the brain ; therefore , small vessel disease in the kidney may let us know of the presence of small vessel disease in the brain .
proposed the very interesting strain vessel hypothesis as a possible mechanism for cerebro - cardio - renal connections .
based on the similarity of the juxtamedullary afferent arterioles in the kidney to the perforating arteries in the brain , they are thought to be evolutionally developed to maintain the perfusion of vital tissues such as nephrons and the brainstem directly from large arteries to deliver blood to the tissue .
these strain vessels are exposed to very high pressure and maintain a high vascular tone . vascular damage induced by high
arterial blood pressure and diabetes mellitus occurs in these similar strain vessels ; therefore , microalbuminuria may be an indicator of vascular damage not only in the kidney but also in the brain .
one of the common molecular components of small - vessel physiology that may also mediate microvascular dysfunction or injury is nitric oxide .
many papers have reported that nitric oxide deficiency could occur in renal disease , and this subject was been well reviewed by baylis .
nitric oxide regulates the microcirculation and the blood brain barrier , both of which are implicated in the development of wmls and other manifestations of small vessel disease in the brain .
moreover , patients with impaired cognitive function show increased levels of endogenous inhibitors of nitric oxide synthesis and decreased nitric oxide metabolites
. therefore , decreased nitric oxide may be one of the key factors in the cerebrorenal connection .
these reports above strongly suggest that a brain and kidney connection exists and that systematic treatment targeting small vessel disease is therapeutically effective on not only the apparent damaged organ but also on the silently damaged organs ( figure 1 ) . according to their unique shared susceptibility to vascular injury from central aortic pressure as a strain vessel , a logical preventive approach to cerebrorenal - related dysfunction
a reduction of the central pulse pressure involves a reduction of the wave reflection by dilation of conduit arteries , since drugs do not directly affect the aorta and large arteries .
therefore , antihypertensive drugs should be selected to reduce the central pulse pressure , such as renin - angiotensin system ( ras ) blockers and calcium - channel antagonists ( ccb ) . for the kidney , there is good evidence from large clinical studies that blockade of ras is highly effective to prevent renal damage compared with other antihypertensive drugs . in the brain ,
recent large clinical trials indicate that ras blockade with angiotensin receptor blockers ( arbs ) is effective to prevent a first or recurrent stroke beyond their blood pressure - lowering effect [ 3537 ] .
moreover , a very recent paper clearly demonstrated that patients treated with arbs have less severe deficit after stroke .
these results suggest that treatment with arbs may be effective not only to reduce blood pressure but also to protect both the kidney and brain via preventing small vessel disease .
however , the blood pressure lowering treatment trialists ' collaboration ( bplttc ) demonstrates that all of the blood pressure - lowering regimens have broadly similar protection against stroke .
moreover , there are not any large clinical studies that demonstrate the effect of arbs on dementia or cognitive impairment .
therefore , there is few evidence of the preventive effect of ras blockade in the brain compared with that in the kidney .
on the other hand , ccbs are proved to have preventive effect on dementia in the systolic hypertension in europe ( syst - eur ) study .
ccb , nitrendipine was found to be effective to reduce the incidence of dementia .
this is the only large clinical study that shows the effect of anti - hypertensive drug on dementia .
although several ccbs are reported to have renoprotective effects , generally ccbs do not have a remarkable effect on ckd prevention compared with ras blockade due to the preferentially dilate afferent arteriole .
therefore , preventive effect of ccbs on cerebrorenal connection is also still under investigation .
furthermore , although hypertension may be involved in each pathological change in brain and kidney , it can be result of high blood pressure in parallel , indicating that direct evidence of common mechanistic factors in hypertension - induced cerebrorenal damage is still under investigation .
ckd markers may be helpful to evaluate the future risk of neuronal disease ( figure 1 ) .
further investigation of the brain - kidney connection may contribute to prevention of impaired quality of life from multiple organ dysfunction due to small vessel disease .
furthermore , protection of the damaged organ will shift to protection of multiple hidden damaged organs , focusing on systemic small vessel disease . | patients with chronic kidney disease ( ckd ) are well known to have a higher prevalence of cardiovascular disease from epidemiological studies .
recently , ckd has also been shown to be related to neurological disorders , not only ischemic brain injury but also cognitive impairment .
this cerebrorenal connection is considered to involve small vessel disease in both the kidney and brain , based on their hemodynamic similarities .
clinical studies suggest that markers for ckd such as estimated glomerular filtration rate ( egfr ) , proteinuria , and albuminuria may be helpful to predict brain small vessel disease , white matter lesions ( wmls ) , silent brain ischemia ( sbi ) , and microhemorrhages .
recently , changes in the vascular system of the brain have been shown to contribute to the onset and progression of cognitive impairment , not only vascular dementia but also alzheimer 's disease .
patients with ckd are also reported to have higher risk of impaired cognitive function in the future compared with non - ckd subjects .
these results indicate that ckd markers may be helpful to predict the future risk of neuronal disease . |
colorectal cancer ( crc ) is one of the most prevalent cancer , along with lung and breast cancers . in 2012 ,
approximately 1.4 million new cases and 700,000 crc - related deaths were estimated worldwide ( 1 ) . over the last decade ,
crc incidence and mortality in the united states have been on a steady decline as a result of advances in its prevention , screening , and treatment .
nevertheless , it is still the second leading cause of cancer deaths ( 2 ) .
moreover , there has been a significant rise in crc incidence in newly developed or economically transitioning countries , such as south america , eastern european countries , and most parts of asia ( 3 ) .
although crc is highly curable at an early stage , approximately 50% of patients with crcs eventually develop metastatic disease ( 4 ) .
five - year survival rate is approximately 10% in patients with a stage iv disease ( 5 ) .
there are many known risk factors for crc including age , sex , smoking , excessive alcohol consumption , high intake of red and processed meat , obesity , diabetes , inflammatory bowel disease , inherited genetic disorder , and family history of crc ( 6789101112 ) . among them ,
ulcerative colitis and crohn 's disease increase the overall risk of colitis - associated cancer ( 14 ) .
approximately 20% of patients with inflammatory bowel disease develop colitis - associated cancer within 30 years of disease onset ( 15 ) . inherited crc , including lynch syndrome and familial adenomatous polyposis , represent less than 5% of crc cases ( 16 ) . in this review ,
we briefly review currently available drugs for the treatment of colorectal cancer and summarize clinical studies that use cell - based cancer immunotherapy as promising therapeutic strategy .
we also suggest the use of cytokine - induced killer ( cik ) cells as an additional therapeutic approach for metastatic colorectal cancer .
most crcs occur without a known genetic risk factor and significant family history . only a small proportion ( 5% ) of inherited crcs , which is also known as familial crc ,
have been thoroughly characterized ( 17 ) , and additional 20~25% are yet to be completely understood ( 17 ) .
crc develops over the course of more than 10 years , and entails multistep genetic events for tumor progression . a multistep genetic model of colorectal carcinogenesis
colorectal cancers occur as a result of oncogenes activation , along with the inactivation of tumor suppressor genes by mutations or loss of heterozygosity ( loh ) ( 18 ) .
mutations in at least four to five genes are required for the formation of a malignant tumor ( 18 ) .
the molecular pathogenesis of colorectal cancer is commonly classified into two main pathways of genomic instability : chromosomal instability ( cin ) and microsatellite instability ( msi ) pathways .
cin leads to an imbalance in chromosome number ( aneuploidy ) such as chromosome gains or losses ( including loh events at specific tumor suppressor gene loci ) , and is observed in 80~85% of sporadic crcs ( 18192021 ) . a mutation coupled with loh of the adenomatous polyposis coli ( apc ) tumor suppressor gene , followed by activating mutations of v - ki - ras2 kirsten rat sarcoma viral oncogene homolog ( kras ) , lead to the initial appearance of adenoma from normal colonic epithelium ( 18 ) .
apc mutations are typically observed in earliest stages of tumors , including in adenomas as small as 0.5 cm ( 22 ) .
this indicates that a functional loss of apc , which is part of the wnt signaling pathway , plays a role in early tumorigenesis .
in contrast , msi , which is observed in 15~20% of sporadic crcs ( 21 ) , is a hypermutable phenotype caused by impaired dna mismatch repair ( mmr ) system to correct errors such as single - base mismatches and insertion - deletion loops that spontaneously occur during dna replication ( 2324 ) .
msi arises from impaired dna mmr genes , such as mutl homolog 1 ( mlh ) 1 , muts homolog ( msh ) 2 , and to a lesser degree msh6 ( 2526 ) .
faulty dna fidelity caused by defects in dna mmr causes frameshift and point mutations , mainly in repetitive sequences ( microsatellites ) ( 26 ) .
lynch syndrome is a well - established hereditary predisposition to colorectal cancer caused by a germline mutation in a dna mmr gene .
however , 12% of msi exhibit sporadic crc with cin ( 27 ) . because pathways are not mutually exclusive , crc can display features of multiple pathways .
i colon cancer , surgery is the definitive treatment without the use of adjuvant chemotherapy .
benefit of adjuvant chemotherapy for patients with a stage ii disease is highly debatable due to minimal gains in overall response .
however , adjuvant chemotherapy is generally acceptable for the use patients with node - positive cancer following surgery ( high - risk stage ii disease ) ( 29 ) .
adjuvant chemotherapy is required for all patients with a stage iii colon cancer after surgical resection , which have a high risk of recurrence of 15~50% ( 30 ) .
conventional chemotherapeutic agents include 5-fluorouracil ( 5-fu ) with leucovorin ( lv ) , capecitabine ( an orally administered prodrug of 5-fu ) , oxaliplatin , and irinotecan .
adjuvant chemotherapy using the 5-fu / lv regimens following surgery provides significant reduction in mortality by 22% and improves event - free survival by 35% ( 31 ) . to improve disease - free survival ( dfs ) and overall survival ( os ) ,
currently , folfox ( 5-fu / lv and oxaliplatin ) or folfiri ( 5-fu / lv and irinotecan ) is widely used for standard first- or second - line treatment in patients with node - positive colon cancer following surgical resection ( 3233 ) .
however , folfox and folfiri demonstrated greater toxicities , including grade 3 or higher acute toxicity , compared to 5-fu / lv alone ( 34 ) . in 2004 , targeted therapeutic agents for metastatic colorectal cancer , such as anti - epidermal growth factor receptor ( egfr ) antibodies ( cetuximab and panitumumab ) , vascular endothelial growth factor ( vegf ) inhibitors ( bevacizumab , ziv - aflibercept , and ramucirumab ) , and a multikinase inhibitor ( regorafenib ) , were approved by the us food and drug administration ( fda ) for combinational use with standard chemotherapy treatment ( 35 ) . currently , there are various regimens of combinational therapies using targeted therapeutic agents and conventional chemotherapy drugs ( 36 ) .
treatment strategy is often dependent on tumor - specific factors , such as kras and/or v - raf murine sarcoma viral oncogene homolog b ( braf ) mutation , and condition of patients and their disease progression following first - line treatment ( 3336 ) .
since ras mutations lead to continuous activation of signaling pathways downstream of egfr , the use of anti - egfr antibodies is effective in patients with wild - type kras exon 2 , but not in patients with kras and/or braf mutations .
thus , approximately 30~40% of crcs are associated with kras gene mutation and do not respond to anti - egfr antibodies ( 37 ) . over the past decade ,
multidisciplinary advances in the treatment of metastatic colorectal cancer with targeted therapy have statistically improved progression - free and overall survivals . despite these advances , only a relatively small effect on survival outcomes was observed , especially in patients with distant metastatic disease .
dendritic cell ( dc ) therapy is one of several strategies in therapeutic cancer vaccines .
sipuleucel - t , a dc - based cancer vaccine , has been approved by the us fda for advanced prostate cancer in 2011 .
the goal of dc vaccination is to elicit anti - tumor response by inducing tumor - specific effector t cells .
dcs are generated ex vivo by culturing hematopoietic progenitor cells or monocytes with a combination of cytokines and then pulsing them with antigens ex vivo ( 38 ) .
there are various type of cancer antigens for dcs loading , including mutated and non - mutated antigens ( 39 ) .
now , we can find 9 clinical trials for the treatment of patients with crc from 2004 to 2015 ( table 1 ) .
antigens that are most commonly used for colorectal cancer include carcinoembryonic antigen ( cea ) peptides ( 4041 ) , melanoma - associated antigen ( mage ) from allogeneic melanoma cell lysates ( 4243 ) , and autologous cell lysates from biopsy material ( 44 ) .
while cea expression in normal colon epithelial cells is relatively low , it is over expressed in most colorectal carcinomas as well as in many cancers ( 45 ) .
therefore , cea has been the major immunological target of dc - based cancer vaccines for colorectal cancer .
clinical trials of cea - pulsed dcs demonstrated its immune - stimulatory capacity and it was well tolerated in patients without any observable toxicities .
however , the overall clinical response was rather unimpressive ( 404146 ) , which may reflect severely impaired immune functions in patients with excessive tumor burdens and tumor immunoediting mechanisms . nevertheless , several clinical studies of mage - pulsed dcs showed 24~40% clinical benefit rate with durable responses and tumor regression ( 4243 ) . moreover , regulatory t cell levels declined upon dc vaccination ( 42 ) .
recently , hunyadi j. and colleagues demonstrated that autologous tumor cell lysates - loaded dcs led to an increase in 6-years survival rate in colorectal cancer patients and more efficient induction of t - lymphocytes proliferation in vitro when compared to cea - pulsed dcs ( 44 ) .
however , because of limited number of patients , additional evaluations in large - scale clinical trials are needed .
although significant advances have been made over the past decade , further studies are required to fully determine the potential antitumor effects of dc vaccination for colorectal cancer .
adoptive cell therapy ( act ) for metastatic melanoma was first described in 1988 ( 47 ) . in act , tumor - infiltrating lymphocytes ( tils ) are collected from solid tumor specimen , and are activated and expanded ex vivo .
subsequently , tils are administered intravenously to the autologous patient . in 2002 , dudley me et al
. demonstrated that host immunodepletion using cyclophosphamide and fludarabine prior to til infusion resulted in dramatic improvement in clinical outcomes for patients with metastatic melanoma ( 48 ) .
although act has been evaluated in various cancers , only a small number of act trials for crc have been performed . in a phase i clinical trial ,
14 patients with colorectal liver metastases received act with tils in combination with high - dose il-2 ( 49 ) .
unfortunately , no significant difference in dfs rates was observed between tils therapy and conventional chemotherapy .
a novel act approach for crc was conducted in two separate studies ; sentinel lymph node ( sln ) t lymphocytes were used in a pilot study ( seven with stage ii - iii and nine with stage iv crc ) ( 50 ) and in a phase i / ii study ( 46 with stage i - iii and nine with stage iv crc ) ( 51 ) , respectively .
all patients with stage iv disease responded to the treatment with the following outcomes : four stable disease , one partial response , and four complete response with no detectable cancer cells remaining .
the overall survival of act - treated patients was also significantly improved to 2.6 years compared to 0.8 years in conventionally - treated control patients .
the latest phase i / ii study also showed favorable clinical outcomes ( 51 ) .
the median overall survival of sln - t lymphocytes - treated and control groups in stage iv patients were 28 and 14 months , respectively .
in the two studies , no significant toxicity was observed following sln - t lymphocytes treatment .
these studies demonstrated that sln - t lymphocyte immunotherapy is indeed feasible and safe for patients with metastatic crc .
however , surgeon 's proficiency may be required for the intraoperative sentinel node detection . in a phase i study of autologous genetically engineered t cells ,
all patients developed severe colitis despite showing a decrease in serum cea levels by cea - specific t cells ( 52 ) .
cytokine - induced killer ( cik ) cells are ex vivo - expanded lymphocytes used for cancer immunotherapy .
cik cells are generated by culturing peripheral blood mononuclear cells ( pbmcs ) with a combination of il-2 and anti - cd3 monoclonal antibodies for 14 days ( 53 ) .
cik cells consist of heterogeneous cell population , mainly cd3cd56 , cd3cd56 , and a minor population of cd3cd56 cells .
importantly , cd3cd56 cells are the distinguishing cell population among the cik cells and have the most potent cytotoxic function ( 53 ) .
cd3cd56 cells originated from cd3cd8cd56 cells but not from cd3cd56 cells during the ex vivo expansion ( 54 ) .
cik cell cytotoxicity is mediated by perforin release and dependent on several activating receptors such as nkg2d , nkp30 , and dnam-1 ( 5556 ) .
cik cells also exhibit non - specific and non - mhc - restricted cytotoxicity ( 56 ) . over the past decade
, cik cell therapy has been evaluated in numerous clinical studies in patients with various types of cancer , such as hepatocellular carcinoma , non - small cell lung cancer , renal cell carcinoma , and gastric cancer ( 57 ) .
cik cell therapy can be used as a postoperative adjuvant treatment as well as a palliative treatment following standard therapies .
cik cell therapy was evaluated in a limited number of clinical studies in patients with colorectal cancer . in a retrospective study , 21 of 96 colorectal cancer patients who underwent surgery as well as adjuvant chemotherapy received one to three cycles of cik cell transfusion for immunotherapy ( 58 ) .
patients in the cik - treated group had significant improvement in their 2-year dfs rates than those in the control group ( 59.6524.80% vs 29.356.39% ) .
other studies used cik in a combination therapy with dcs , specifically tumor lysate - pulsed dcs . in 2014 , two clinical studies of dc vaccine and cik cell combinational therapy for colorectal cancer patients were published .
one study demonstrated that overall survival rates were significantly improved in the dc - cik therapy compared to the control group ( p=0.04 ) ( 59 ) .
moreover , most patients that received dc - cik therapy displayed improvement in quality of life , including physical strength , appetite , sleep , and body weight .
gao , d. and colleagues evaluated the clinical benefits of dc - cik therapy in 54 gastric and colorectal patients following surgery with or without chemo - radiotherapy ( 60 ) .
the study demonstrated that dfs and 5-year survival of colorectal cancer patients were significantly prolonged in dc - cik treatment groups ( dfs rate : 66% and 5-year survival rates : 75% ) when compared to patients in control groups ( dfs rate : 8% and 5-year survival rates : 15% ; p<0.01 ) .
il-12 levels were significantly increased in patients that received the dc - cik treatment . besides fever ,
since they did not compare the efficacy of combination therapy with each alone , we could not clarify whether combination therapy is better than each therapy .
however , when we considered the efficacy of the single therapy of dcs and cik cells described above , we could presume that the combination of cik and dc might exert better antitumor activity than each alone . here
, we provide additional evidence that cik cell therapy can effectively prevent growth of colorectal cancers in a xenograft mouse model .
hypaque density gradient centrifugation , washed three times with pbs , and cultured in the presence of immobilized anti - cd3 antibody ( 5 g / ml ) and recombinant human il-2 ( 700 u / ml ) for five days .
the cell suspension was further incubated in complete medium containing il-2 only ( 170 u / ml ) for nine days .
thereafter , medium containing il-2 was replenished every 2 or 3 days . on day 14
cik cells comprised of 94% cd3 , 3% cd3cd56 , 16% cd3cd56 , 14% cd4 , and 81% cd8 cells ( fig .
1a ) . to examine the cytotoxicity of cik cells , two cell lines , sw620 and k-562 were used .
sw620 cells are metastatic human colon cancer cell lines derived from lymph node ( 61 )
. k-562 cell lines are human leukemic cells commonly used as reference target cells of nk cells due to the very low level of mhc class i antigens on their cell membrane ( 62 ) .
a 4-h cr release assay revealed that cik cells were able to kill 14% , 22% , and 36% of sw620 cells at effector : target ratios of 10:1 , 30:1 , and 100:1 , respectively ( fig .
moreover , cik cells showed strong cytotoxicity against k562 cells , a known nk - sensitive target .
a nude mouse xenograft assay was used to examine the in vivo antitumor activity of cik cells .
sw620 cells ( 610 ) in 300 l of pbs were injected subcutaneously on day 0 , followed by intravenous once - a - week injection of cik cells and adriamycin ( adr ) . on day 25 , mice were sacrificed and the tumor mass and body weight ( to determine toxicity ) were measured . in control mice , sw620 cells grew to a tumor volume of 473190 mm ( n=7 ) ( fig .
cik cells injected at doses of 110 , 310 , and 1010 cells per mouse were able to inhibit tumor growth by 7% , 53% , and 73% , respectively .
cik cells injected at doses of 110 , 310 and 1010 cells per mouse reduced tumor weight by 10% , 54% and 73% , respectively ( fig .
thus , our preclinical efficacy data showed that cik cells were able to kill sw620 cells in vitro and in vivo , suggesting that cik cells might be a good immunotherapy candidate for colorectal cancer .
patients with metastatic colorectal cancer have significant risk of recurrence following surgery and conventional adjuvant therapy . although advances in therapeutic agents for crc have reduced the risk of recurrence and increased overall survival , patients with metastatic disease have a poor prognosis and a particularly low 5-year survival rates of less than 10% .
additionally , current combination therapy is occasionally discontinued due to a grade 3~4 toxicity with negative effects on quality of life ( 63 ) .
overall quality of life should be considered for patients with stage iv disease for palliative therapy .
also , elderly patients with stage iii disease often avoid adjuvant chemotherapy due to anxiety of old age , comorbidities , side effects , and perceived minimal benefit ( 64 ) .
clinical and preclinical studies of crc treatment with dcs , t cells , and cik cells showed promising outcomes , although only limited information have been available till recently . among the immune effector cells , cik cells have certain advantages in a clinical application : they are relatively easy to generate and expanded in large - scale from pbmcs , their non - mhc - restricted cytotoxic activity could eliminate mhc class i - negative tumor cells , and importantly , cik cell therapy causes mild , transient , and easy - to - manage side effects . over the last decades , cik cell therapy has been evaluated in numerous clinical studies in patients with various cancers . in most patients ,
combination therapy using conventional agents and cik cells showed superior clinical outcomes than standard therapy alone .
clinical studies previously reported by others and our preclinical data suggest that immunotherapy of crc with cik cells can be a promising strategy to limit the growth and metastasis of crc . | colorectal cancer is the third leading cancer worldwide .
although incidence and mortality of colorectal cancer are gradually decreasing in the us , patients with metastatic colorectal cancer have poor prognosis with an estimated 5-year survival rate of less than 10% . over the past decade , advances in combination chemotherapy regimens for colorectal cancer have led to significant improvement in progression - free and overall survival .
however , patients with metastatic disease gain little clinical benefit from conventional therapy , which is associated with grade 3~4 toxicity with negative effects on quality of life . in previous clinical studies ,
cell - based immunotherapy using dendritic cell vaccines and sentinel lymph node t cell therapy showed promising therapeutic results for metastatic colorectal cancer . in our preclinical and previous clinical studies ,
cytokine - induced killer ( cik ) cells treatment for colorectal cancer showed favorable responses without toxicities . here , we review current treatment options for colorectal cancer and summarize available clinical studies utilizing cell - based immunotherapy . based on these studies ,
we recommend the use cik cell therapy as a promising therapeutic strategy for patients with metastatic colorectal cancer . |
from early research on pollinator preference patterns , flower color was proposed as an example of honest signals in plant - pollinator interactions . in
many plant species the corolla undergoes a distinct change in color at some point during the life of the flower and in some species the change occurs as the flower opens or at the onset of nectar production .
nectar secretion in streptosolen jamesonii ( solanaceae ) flowers commences around the time the flower opens and continues for about three days .
shuel described a gradual color change from yellow through orange to scarlet as flowers mature , allowing the pollinator to accurately estimate the age and possible nectar content of the flower .
barrows also proposed flower color as an honest signal for nectar rewards as he showed a preference of butterfly pollinators for newly opened , yellow lantana camara ( verbenaceae ) flowers .
yellow flowers contain pollen and nectar , but by the time the flowers turn reddish - orange , they have negligible pollen and no nectar .
a similar coupling of energy reward and flower color , and subsequent pollinator preference was reported for lupinus argenteus ( fabaceae ) .
the flowers are pale blue except for a yellow spot on the banner petal , which turns purple several days after anthesis .
this color change presents an honest signal since it is correlated with significantly greater energy rewards ( pollen ) in yellow spotted flowers compared with purple spotted flowers .
indeed , gori found that bumblebee pollinators visited almost exclusively flowers with a yellow spotted petal .
these findings suggest that the bees learned the association between color and rewards and adjust their foraging behavior in response to the honest information provided by the floral display of l. argenteus . besides flower color
, flower shape has been shown to function as an honest signal as various relationships between morphological floral traits and nectar rewards were described for different plant species . in ipomopsis aggregata ( polemoniaceae ) corolla width is positively correlated with nectar production , and hummingbird flowers with wide corollas are more frequently visited by hummingbird pollinators . in another hummingbird pollinated plant ( silene virginica ;
caryophyllaceae ) , flower size was associated with nectar rewards with larger flowers receiving more visits .
the shape of the corolla can vary greatly even between co - occurring conspecific individuals and in various cases corolla shape was proposed as an honest signal conveying information about profitability .
it was shown that pollinators are able to discriminate between flowers of the different corolla types and prefer the morphs that offer higher energy rewards . despite their general association with nectar rewards ,
the floral traits described above are limited in their accuracy to signal profitability to pollinators ( table 1 ) .
corolla shape is static and changes in floral color happen slowly and do not precisely follow the dynamic pattern of nectar abundance .
barrows , who proposed petal color as an honest signal for profitability in l. camara , demonstrated in the same study the limitation of this signal .
butterfly pollinators were unable to distinguish between yellow rewarding flowers and yellow flowers that were robbed by stingless bees ( 32% in the case of l. camara ) . even though robbed flowers offered no reward , their attractiveness to butterfly pollinators was not reduced .
therefore such floral traits fail to signal transient rewardlessness to pollinators . in spite of such lack of precision and occasional misinformation
, relatively static signals can provide sufficient information for selection to favor a clear behavioral response by pollinators .
as the previous section shows , floral traits that are correlated with energy rewards but change slowly over time are at best honest on average and advertise the potential to encounter floral nectar or pollen rather than conveying more precise information about quantity and quality of the reward . on the other hand , floral traits that are directly linked with nectar rewards
would more reliably indicate floral profitability to pollinators in that they have a higher temporal resolution and allow remote sensing of energy rewards ( table 1 ) .
it is up to debate what information is more valuable to a pollinator : ( 1 ) identifying flowers with a potentially high standing crop of nectar ( mostly achieved through floral traits indirectly linked to rewards ; e.g. , 17 ) or ( 2 ) accurate detection of nectar presence / absence ( mostly achieved through floral traits directly linked to rewards ; e.g. , 23 ) .
i suggest the latter since these floral traits allow pollinators to detect transient rewardlessness in flowers and therefore to avoid visiting empty flowers which would be costly in terms of time and energy .
recent findings from plant species endemic to mauritius describe nectar color as a reliable signal allowing pollinators to assess the presence and size of a reward prior to flower visitation .
the flowers of trochetia boutoniana ( malvaceae ) and t. blackburnia produce red and yellow nectar respectively .
since signal and reward are coupled in colored nectar , hansen et al . hypothesized that color functions as an honest visual signal .
indeed , in a binary choice test phelsuma geckos clearly preferred colored over clear nectar .
further examples of nectar color acting as an honest signal were documented for bird pollinators .
for instance , choice assays and anecdotal observations in the wild led to speculation that pollinating birds learn to associate the distinctive dark - colored nectar of aloe vryheidensis ( xanthorrhoeaceae ) with its presence in newly opened flowers , effectively acting as an honest signal and increasing pollination efficiency .
recently , zhang et al . provided conclusive support for this hypothesis with a himalayan shrub and its bird pollinators .
leucosceptrum canum ( labiatae ) inflorescences are densely packed with small , cream - white flowers that open anthers , dehisce pollen and initiate stigma receptivity 48 h after the corolla opens .
a pigment secreted into the nectar ( 1 ) changes the color from clear white to dark purple and ( 2 ) renders the nectar palatable to bird pollinators .
zhang et al . showed in behavioral experiments that the dark purple nectar of l. canum acts as a foraging signal to the birds .
this is an extraordinary example of simplicity rhyming with efficiency in that one molecule creates an honest foraging signal to increase pollination efficiency through nectar visibility and palatability .
honest signaling using olfaction as a sensory channel was reported for datura wrightii flowers ( solanaceae ) , where transient carbon dioxide ( co2 ) emissions were shown to be associated with nectar production .
suggested that at least some of the co2 released by these flowers derives from the metabolic activity required to produce nectar , because nectar secretion and co2 emission decrease simultaneously .
subsequently it was demonstrated that nave manduca sexta ( sphingidae ) moths prefer surrogate flowers emitting high levels of co2 , a characteristic of newly opened , profitable d. wrightii flowers .
further investigated co2-mediated nectar foraging in m. sexta and showed that floral co2 is also a redundant stimulus with floral odor and affects moth behavior already from a distance
. a closer relationship of volatile organic compunds with nectar can be found when nectar is scented .
raguso outlined the potential of nectar scent as an honest signal , highlighting cases in which the scent of nectar is qualitatively or quantitatively distinct from overall floral scent .
marden provided some evidence that honeybees discriminate between artificial flowers with scented nectar and with water alone .
nectaring duration was significantly increased when particular volatile organic compounds ( e.g. , cis--bergamotene , benzylacetone ) were added to the nectar compared with scentless nectar .
further evidence that pollinators are capable of directly detecting the presence of nectar rewards via volatile organic compounds was found in solitary bees in the genus osmia ( megachilidae ) visiting flowers of penstemon caesius ( scrophulariaceae ) .
bees with uncovered antennae preferred rewarding flowers , whereas bees foraging with silicone - covered antennae and therefore impaired olfactory capabilities visited rewarding and empty flowers equally .
however , the volatile emissions of p. caesius flowers and nectar have not been characterized yet and the identity of the signal used by osmia bees remains therefore speculative .
recently , we provided a proof of principle that humidity gradients produced partly by nectar evaporation could indicate flower profitability to pollinators .
our data remains inconclusive so far concerning whether this floral trait can be characterized as a signal or a cue . according to bradbury and vehrencamp , the two major criteria that have to be fulfilled to characterize a sensory stimuli as a signal are ( 1 ) that the provision of the information is not accidental but only because it benefits the sender and ( 2 ) that the receiver must also benefit by having access to the provided information .
we suggested that humidity gradients are likely to occur in other long - tubed or -throated flowers with an interstitial volume of air within the flower bud and copious nectar production , all characteristics of the hawkmoth pollination syndrome .
hawkmoths can be highly effective pollinators of such flowers as it was found that one visit could be sufficient to achieve complete fertilization of a flower .
the elevated humidity levels we documented for freshly opened flowers with abundant nectar may benefit the plant by attracting pollinators to healthy , non - pollinated flowers . in this case , humidity gradients could ultimately function as a signal , providing benefits to both plant and pollinator .
different aspects of the production and perception of humidity gradients suggest that this floral trait might be more reliable and efficient than the honest signals described above .
this conclusion is based on two main points : ( 1 ) robustness to cheating and ( 2 ) targeting a well - suited sensory system for signal detection . vulnerability to corruption by deceit arises whenever a signal is informative .
there are , however , properties of signal design that can help to maintain honesty . according to zahavi , mechanisms for
the maintenance of honesty can be either that ( 1 ) the signal is costly to produce and therefore the reliability of communication is increased in relation to the investment in the trait and/or ( 2 ) the production of the signal is physically constrained through a material link between the signal and the quality advertised by the signaler . with floral humidity gradients both conditions are fulfilled , suggesting a high robustness to cheating .
it has been appreciated lately that water can be one limiting factor in the development of floral organs , and this is especially true in xeric environments because considerable water can be lost through transpiration .
the transpiration rate of persea americana ( lauraceae ) flowers was shown to be approximately 60% that of leaves ; around 13% of total transpirational water loss from tree canopies could be attributed to floral organs . in the extreme case of the desert succulent agave deserti ( asparagaceae ) , transpirational water loss from the inflorescence and the lateral floral branches exceeded leaf transpiration . concerning the allocation of water to nectar production
, it seems that because of water limitations nectar concentration is generally higher in xeric environments than in temperate environments ( for a review see ref .
nectar production can entail a cost to a plant in terms of growth and/or reproduction and in xeric environments the water component , the substrate for the generation of floral humidity gradients , might be as expensive as the sugar component of the floral nectar .
concerning zahavi 's argument of physical constraint , the production of floral humidity gradients is partly based on the evaporation of nectar a fundamental physical process occurring naturally during anthesis and therefore , mechanistically linked to the nectar reward .
another reason why floral humidity gradients may be an effective indicator of flower profitability , at least for insect pollinator - plant interactions , is related to the sensory channel by which the signal is perceived .
regulations of temperature and water balance are primary components of homeostasis in all organisms , and insects are sensitive to ambient humidity levels they experience at any given time
. changes in humidity levels are detected by hygrosensitive sensilla , which house receptor cells in an antagonistic pair of a dry and a moist cell together with a thermoreceptor .
the general picture of hygrosensitive sensilla follows the concept of protected exposure , being maximally exposed to the environment by their location mostly at the tip of the antennae , but protected from mechanical irritation or damage by their position in a groove .
recent studies documented exceptional sensitivity of insects to changes of ambient humidity levels . since insects possess dry and moist cells , their sensory system conveys qualitative and quantitative information to increasing as well as decreasing humidity levels , in contrast to olfaction for example .
floral humidity gradients are therefore well suited for detection by nectar foraging insect pollinators , since they are perceived by a highly sensitive sensory system , which in a different context is critical for microhabitat selection and survival .
either the flowers cheat , a common strategy in animal - pollinated plants , or flowers were emptied by earlier flower visitors .
nevertheless , under certain circumstances plant - pollinator systems adopt an honest signaling strategy , reflected by the multitude of examples described here .
interestingly , the honest signals described in plant - pollinator systems vary in their degree of reliability and information content .
honest signals that are directly linked to the energy reward seem to be more efficient and reliable to indicate floral profitability to pollinators ( table 1 ) .
further examples of honest signals would shed light on the mechanisms by which plants can couple signal and reward and the circumstances under which they can honestly reveal the presence and value of floral nectar .
post - pollination ethylene signaling in flowers or the unexplained mechanism by which hummingbirds avoid nectar - robbed plants could be promising avenues of future research .
furthermore , plant - pollinator interactions are excellent systems to study honest signaling strategies , since signal modulation is relatively slow and experimental manipulations of the signal is often possible .
therefore , future research on plant - pollinator interactions could help to explain the maintenance of honest signaling between two partners with conflicting interests and contribute to ongoing discussions in the field of signal theory . | floral traits that correlate with nectar availability or are linked functionally to nectar production carry the potential to enable remote assessment of energy rewards by pollinators .
such floral traits can be considered
honest in the sense that they convey information about the quality or profitability of a flower to a pollinator .
recently a new sensory channel used in plant - pollinator interactions was identified .
we demonstrated that evaporation of water from the nectar itself and the petals create local humidity gradients above oenothera cespitosa ( onagraceae ) flowers .
since these humidity gradients are directly linked to nectar volume , they convey reliable information about nectar rewards to hawkmoth pollinators ( sphingidae ) .
several studies document a variety of sensory cues that constitute honest signaling between plants and pollinators , and shed light on the central question of when the two parties should communicate honestly . in the following sections , i will comment on different honest signals mediating plant - pollinator interactions , with a special emphasis on our recent findings about floral humidity gradients . |
the thoracoabdominal zone is defined as the area superiorly delimited by the fourth intercostal space ( anterior ) , sixth intercostal space ( lateral ) , and eighth intercostal space ( posterior ) , and inferiorly delimited by the costal margin.1 this area is similar to that referred to as the intrathoracic abdomen , which is the torso region demarcated by the nipple line , costal margins , and scapulae.2 the abdominal viscera ( i.e. , liver and spleen ) lie below this area , with their precise location varying based on the movement of the diaphragm muscle , which follows the respiratory cycle . hence , a penetrating wound in this area could injure the diaphragm muscle or any thoracic viscera ( i.e. , lung , heart , great vessels , and esophagus ) , in addition to the abdominal organs .
these multiple possibilities make initial diagnostic assessment in such cases challenging.14 the standard initial approach to hemodynamically unstable patients sustaining thoracoabdominal injuries is surgery ( laparotomy or thoracotomy).5 laparotomy is preferred for injuries exhibiting clear signs of peritonitis.4 operative treatment is also used in stable patients for whom the diagnosis of a cardiac , major vascular , or esophageal injury is defined.4,5 this is preceded by a comprehensive diagnostic work - up , which depends on the suspected injury and may involve focused assessment sonography for trauma ( fast ) , computed axial tomography ( ct ) , angiography , and/or endoscopy .
the most challenging diagnostic issue in this situation concerns asymptomatic patients.1,3,6,7 some studies have reported that diaphragmatic injuries can be present in up to 30% of such cases despite the absence of clinical signs . until recently , the sensitivity and negative predictive value of the available diagnostic tests have been considered as very low for the diagnosis of penetrating diaphragmatic wounds.510 these wounds are usually no more than 2 cm long , and there is no visceral herniation to the thoracic cavity.1 therefore , the most sensitive diagnostic methods are videolaparoscopy or videothoracoscopy.1115 these procedures are undertaken under general anesthesia and present real risks for the patient .
however , failure to suture a diaphragmatic tear could ultimately lead to a diaphragmatic hernia .
the mortality associated with complicated diaphragmatic hernias is believed to be considerable in this setting.2,3,16 considering these points , approaches to wounds in the lower chest may vary among surgeons and institutions .
experimental studies have demonstrated that the injured diaphragm can heal and , consequently , development of diaphragmatic hernias is not the rule after penetrating injuries to the diaphragm.17,18 furthermore , no diaphragmatic hernia has been reported after nonoperative treatment of penetrating wounds to the liver , in which diaphragm injuries may be inferred in some cases.19 the accuracy of the new generation of computerized tomography scans has been shown to be considerably high for detection of diaphragmatic wounds , and mortality following deferred treatment of diaphragmatic hernias may be lower than previously estimated.2024 some questions in the management of asymptomatic patients sustaining thoracoabdominal wounds remain unanswered : 1 . should these patients be systematically submitted to operative procedures such as videolaparoscopy or videothoracoscopy in order to diagnose a possible diaphragmatic injury ?
2 . can these patients be initially observed , undergoing operative procedures only if a diaphragmatic hernia develops ?
2 . how high are the morbidity and mortality risks for delayed repair of diaphragmatic hernias ?
the incidence of diaphragmatic injuries depends mainly on the location of the wound and the mechanism of trauma .
hanna et al.25 studied 105 patients with diaphragmatic injuries and found that the external wound was located at the thorax , abdomen , or both in 46% , 19% , and 35% of cases , respectively .
madden et al.2 reported that 19% of the patients who underwent exploratory laparotomies due to penetrating wounds to the lower chest and abdomen sustained diaphragmatic injuries . among asymptomatic patients with thoracoabdominal wounds who routinely undergo videolaparoscopy ,
the incidence of diaphragmatic injuries ranges from 7% to 48%.1 solda et al.1 reported diaphragm injuries in 24.6% of patients with penetrating wounds to the thoracoabdominal area , and several other studies have reported similar incidences of approximately 20%.11,12,26 murray et al.6 observed these lesions in 42% of patients with penetrating wounds to the left thoracoabdominal region .
leppniemi and haapiainen27 reported occult diaphragm injuries in 17% of patients with penetrating trauma to the left thoracoabdominal area . the majority of patients sustaining diaphragmatic lesions have additional associated injuries .
the incidence of isolated diaphragmatic injuries ranges from 2 to 12%.28,29 it is critical to highlight the difference between blunt and penetrating traumas .
victims of blunt diaphragmatic injuries usually have large defects in the muscle , allowing the abdominal viscera to enter the thoracic cavity.30 in these cases , chest x - rays are usually informative . however , the size of the tear in penetrating traumas is smaller , and
real hernias are infrequent.1,3,6 therefore , any exam that bases diagnosis on the presence of herniated viscera into the thorax is not sufficient for penetrating trauma . a normal physical examination is observed in 2045% of patients with diaphragmatic lesions , and radiological findings are minimal in the majority of these cases1 .
murray at al.6 prospectively studied 119 patients with penetrating injuries to the left thoracoabdominal region .
diaphragmatic injuries were identified in 42% of patients ; of these , 31% did not have abdominal tenderness , 40% had normal chest x - rays , and 49% had an associated hemothorax .
radiological investigation is useful for victims of gunshot wounds to the thoracoabdominal area , as the trajectory of the projectile can be determined .
diagnoses , therefore , should not be based solely on the physical examination.1,810 chest x - ray , wound exploration , and pneumoperitoneum have all been tested,1,2,710,16 but none has demonstrated sufficient accuracy and reliable negative predictive value .
moore et al.31 examined the accuracy of diagnostic peritoneal lavages in detecting diaphragmatic lesions . using 1,00010,000 red cells / mm as the laparotomy threshold ,
until recently , imaging technology has not been routinely used to assess patients sustaining penetrating injuries to the abdomen .
older technology using spiral ct scans has not shown optimal results in detecting abdominal injuries.8,32 recently published data suggest improved results with more advanced ct equipment .
stein et al.20 analyzed the role of multidetector - row ct in the diagnosis of penetrating injuries to the diaphragm .
the authors reviewed the admission ct of 803 patients sustaining penetrating torso injury during a four - year period .
diaphragmatic injuries were detected in 67 patients and excluded in 736 . if ct was used to exclude diaphragm injury , the sensitivity ( 94% ) , specificity ( 95.9% ) , and accuracy ( 95.8% ) were consistently high .
we believe that more studies are necessary to confirm the role of multidetector ct scans in the diagnosis of diaphragmatic injuries in penetrating trauma .
diaphragmatic hernias develop over three distinct post - trauma periods . during the acute period directly following trauma ,
the third period is associated with symptoms and , eventually , necrosis of the herniated viscera .
the natural history of diaphragm injuries has not been adequately studied in humans . without treatment , diaphragmatic healing
would be impaired by the pressure gradient between the thorax and abdomen , as well as by respiratory movements.2,17 this would facilitate the development of a diaphragmatic hernia , especially on the left side.4,17 complications are also possible on the right side despite the supposed tamponade protection offered by the liver .
diaphragmatic hernias have been reported on the right side of patients years after thoracic gunshot wounds.33 perlingeiro et al.17 studied the course of diaphragmatic injuries in rats .
animals were observed for six months , and complete diaphragmatic healing was observed in approximately 90% of the animals , while diaphragmatic hernias were present in 10% .
a similar phenomenon was observed by gamblin et al.,18 who studied 48 rats in an experimental model of diaphragmatic injuries produced by a 16-gauge needle puncture or 2.7-mm aortic punch .
only one animal in the aortic punch group , euthanized at 10 months , presented a small hepatic herniation through the diaphragm ( 1/12=8% ) .
the size of the diaphragmatic wound is a very important factor that can not be controlled for in human trauma cases .
however , at least in animals , these data show that the diaphragm can heal without hernia development . but the question remains : should every diaphragmatic wound be sutured ?
several authors have reported nonoperative treatment of penetrating liver injuries.19,34,35 this was accomplished by ct assessment , which revealed the injury through the liver parenchyma .
some of these patients also sustained hemothoraces , and it is possible to infer that they might have had concomitant diaphragmatic injuries19 .
leppniemi and haapiainen27 analyzed 97 patients with stab wounds located between the nipple line , umbilical level , and posterior axillary lines , but without immediate indication for laparotomies .
these patients were randomized into two groups : clinical observation and surgical exploration ( laparotomy or videolaparoscopy ) . in the surgical exploration group ( n=47 ) , four patients ( 9% ) had diaphragmatic injuries .
three of these injuries were isolated , and thus three of 43 patients would have had occult diaphragmatic injuries if surgical exploration had not been performed . in the observation group ( n=50 ) ,
two patients ( 4% ) showed delayed presentation of missed left - side diaphragmatic injuries .
however , we can not definitively state the number of patients with diaphragmatic injuries or the percentage of healing in the group not submitted to operative procedures , as the failure of imaging tests to detect diaphragmatic hernias does not necessarily indicate their absence .
thus , some diaphragmatic tears on the right side could have been treated without operating , at least in this setting .
it is important to stress that there is currently no specific protocol for nonoperative treatment of diaphragmatic injuries .
potential problem associated with leaving a diaphragmatic wound unsutured concern the reported high morbidity and mortality rates of diaphragmatic hernias when treated in the presence of complications such as bowel necrosis .
feliciano et al.16 stated that few topics in trauma surgery have raised more controversy than the delayed diagnosis of a diaphragmatic injury .
madden et al.2 reviewed selected cases of delayed presentation of diaphragmatic injuries due to stab wounds .
the sample included 28 patients , with a mean age of 32 years , and the mortality rate was 36% .
six of the seven patients ( 85% ) shown to have gangrenous viscera died . based on these numbers ,
an invasive diagnostic workup is justified to eliminate even the smallest risk of overlooking a diaphragmatic injury .
the reported mortality rates due to diaphragmatic hernias are not consistent , and may not be as high as some authors estimate .
reber et al.22 reported the treatment of 10 patients with late presentations of traumatic diaphragmatic hernias .
hernias were present on the left side and right side in eight and two patients , respectively .
the time elapsed between trauma and clinical presentation ranged from 20 days to 28 years .
all of these patients underwent laparotomies , and concomitant thoracotomies were necessary in two cases .
only one patient died ( 10% mortality ) , and three ( 30% ) sustained postoperative complications .
bergeron et al.21 evaluated the deferred treatment of traumatic diaphragmatic hernias due to blunt trauma .
their study assessed 160 patients sustaining diaphragmatic injuries who were diagnosed immediately after the trauma .
patients undergoing operations for isolated diaphragmatic injuries did not show higher mortality rates due to delayed repair than those undergoing immediate surgery .
the authors concluded that blunt diaphragmatic rupture in the absence of other surgical injuries is associated with low mortality , and treatment can be deferred if necessary .
these studies do not specifically address the mortality associated with complicated diaphragmatic hernias ( i.e. , gangrenous viscera in the thorax ) .
furthermore , some of these studies assessed victims of blunt trauma for whom the diaphragm defect was expected to be larger and the risk of viscera strangulation was lower.21,22 recently , several studies have reported low mortality in the treatment of complicated diaphragmatic hernias.16,23,24,3638 nevertheless , the rate of complications and mortality in the treatment of complicated diaphragmatic hernias needs to be further addressed .
the ideal treatment should be based on the preoperative diagnosis of the diaphragmatic injury , such that only patients sustaining these injuries undergo operation .
however , current imaging technology limits proper diagnosis . considering the possible complications associated with unsutured diaphragmatic wounds , a protocol for actively searching for diaphragmatic injuries
currently , the most sensitive and specific methods are videolaparoscopy and videothoracoscopy.1,1115 the advantages of videosurgery are evident : the diaphragm can be directly viewed and easily assessed,1,1215 muscular stretching permits better visualization of the defect , and concomitant abdominal lesions may be observed and treated .
moreover , the contents of the thoracic cavity can be aspirated and the diaphragmatic lesion laparoscopically treated.14,15 concerns related to creating a hypertensive pneumothorax with the pneumoperitoneum has not been shown to be a major problem.39 the diaphragmatic lesion can usually be recognized in patients sustaining stab wounds .
the situation is a bit more complicated when gunshot wounds are the cause of trauma , as the trajectory is often unpredictable .
assessment of the splenic flexure of the colon in the left upper quadrant is often difficult .
perforations in the small bowel and colon may be difficult to see , especially when hematomas or free blood are present in the abdominal cavity.1,40 finally , visualization of the posterior portion of the diaphragm with videolaparoscopy may be difficult , particularly in posterolateral wounds .
friese et al.26 prospectively studied 34 hemodynamically stable and asymptomatic patients sustaining penetrating thoracoabdominal wounds .
all patients underwent diagnostic laparoscopy to assess the diaphragm , followed by confirmatory celiotomy or videothoracoscopy .
there were seven true positive , 30 true negative , one false negative , and no false positive tests . the specificity ( 100% ) ,
sensitivity ( 87.5% ) , and negative predictive value ( 96% ) were all high .
the single false negative case was due to a hemoperitoneum associated with a splenic lesion that warranted laparotomy .
a total of 73 patients , 62 of whom were victims of stab wounds , were analyzed .
diaphragmatic injury was diagnosed in 18 patients ( 24% ) , eight ( 44% ) of whom demonstrated isolated diaphragmatic injuries .
of the 510 patients studied , laparotomy was avoided in 277 ( 54% ) and diaphragmatic injuries were laparoscopically treated in 16 cases . only 10 patients presented complications , all of which considered minor .
videothoracoscopy is another available method used to assess asymptomatic patients with thoracoabdominal wounds.14,15 it aids assessment of the posterior portion of the diaphragm .
the pneumoperitoneum is not needed , further thoracic evaluation may be carried out ( i.e. , pericardium window and projectile trajectory ) , and some lesions can be treated ( i.e. , lung suture ) . it is always our policy to perform a videolaparoscopy or laparotomy to evaluate the abdomen in cases of diaphragmatic lesion diagnosed by videothoracoscopy .
videothoracoscopy failed to detect a large right - sided diaphragmatic rupture due to blunt trauma .
this patient underwent videothoracoscopy 30 days after the trauma , with a diagnosis of retained hemothorax .
seven days after the initial operative procedure , the patient underwent thoracotomy and a 15-cm right - sided diaphragmatic rupture was noticed .
each method has an appropriate indication . in asymptomatic patients with penetrating wounds to the thoracoabdominal area
, a videothoracoscopy should be performed in two situations : if placement of a thoracic tube is required ( pneumothorax or hemothorax ) , or cardiac injury is suspected and a pericardial window is to be performed . in all other cases , videolaparoscopy is the best alternative .
this question , related to that of suturing diaphragm wounds , unfortunately remains unanswered . for many years
however , there are risks associated with active searches using videosurgery , and a selective protocol may be warranted .
prospective data detailing the long - term results of pure clinical observations of patients sustaining wounds to the thoracoabdominal zone are not currently available .
leppniemi & haapiainen27 studied 97 patients with stab wounds located between the nipple line , umbilical level , and posterior axillary lines .
forty - seven underwent surgical intervention in order to search for diaphragmatic injuries , which were found in four patients ( 9% ) . in the observation group ( n=50 ) ,
two patients ( 4% ) presented with left diaphragmatic injuries after two and 23 months . considering these numbers
, we may estimate that around 50% of patients with left - side diaphragmatic injuries will develop hernias within the first year after the injury .
it is clear that we lack the evidence to formulate a rule for these cases .
if the surgeon believes that every diaphragmatic injury should be sutured , the price to be paid is a 70% rate of negative videolaparoscopies , in addition to the risks of anesthesia , iatrogenic injuries , and costs . if one chooses not to search for diaphragmatic injuries , the unpleasant diagnosis of a delayed diaphragmatic hernia may occur in some cases .
the risk of developing a hernia seems to be small , but strangulation rates in patients that do develop hernias can be high . an active search with a multidetector ct during follow - up
may be the best course of action for diagnosing diaphragmatic defects before serious complications develop .
demetriades et al.35 described an algorithm for treating hemodynamically stable patients sustaining thoracoabdominal wounds without peritoneal signs . in this protocol
these researchers accepted the risks associated with not suturing right diaphragmatic tears , but active searching for left diaphragmatic lesions was routinely indicated .
we accept that asymptomatic patients sustaining penetrating wounds to the right thoracoabdominal zone may eventually be observed in hospitals where nonoperative treatment protocols are implemented .
however , our current opinion is that even right diaphragmatic lesions should be sutured because complicated right - sided diaphragmatic hernias have been observed in clinical practice.33 therefore , we believe that the majority of asymptomatic patients sustaining penetrating wounds to the thoracoabdominal region should undergo obligatory invasive investigation via videolaparoscopy or videothoracoscopy .
the incidence of diaphragmatic injuries depends mainly on the location of the wound and the mechanism of trauma .
hanna et al.25 studied 105 patients with diaphragmatic injuries and found that the external wound was located at the thorax , abdomen , or both in 46% , 19% , and 35% of cases , respectively .
madden et al.2 reported that 19% of the patients who underwent exploratory laparotomies due to penetrating wounds to the lower chest and abdomen sustained diaphragmatic injuries . among asymptomatic patients with thoracoabdominal wounds who routinely undergo videolaparoscopy ,
the incidence of diaphragmatic injuries ranges from 7% to 48%.1 solda et al.1 reported diaphragm injuries in 24.6% of patients with penetrating wounds to the thoracoabdominal area , and several other studies have reported similar incidences of approximately 20%.11,12,26 murray et al.6 observed these lesions in 42% of patients with penetrating wounds to the left thoracoabdominal region .
leppniemi and haapiainen27 reported occult diaphragm injuries in 17% of patients with penetrating trauma to the left thoracoabdominal area .
victims of blunt diaphragmatic injuries usually have large defects in the muscle , allowing the abdominal viscera to enter the thoracic cavity.30 in these cases , chest x - rays are usually informative . however , the size of the tear in penetrating traumas is smaller , and
real hernias are infrequent.1,3,6 therefore , any exam that bases diagnosis on the presence of herniated viscera into the thorax is not sufficient for penetrating trauma . a normal physical examination is observed in 2045% of patients with diaphragmatic lesions , and radiological findings are minimal in the majority of these cases1 .
murray at al.6 prospectively studied 119 patients with penetrating injuries to the left thoracoabdominal region .
diaphragmatic injuries were identified in 42% of patients ; of these , 31% did not have abdominal tenderness , 40% had normal chest x - rays , and 49% had an associated hemothorax .
radiological investigation is useful for victims of gunshot wounds to the thoracoabdominal area , as the trajectory of the projectile can be determined .
diagnoses , therefore , should not be based solely on the physical examination.1,810 chest x - ray , wound exploration , and pneumoperitoneum have all been tested,1,2,710,16 but none has demonstrated sufficient accuracy and reliable negative predictive value .
using 1,00010,000 red cells / mm as the laparotomy threshold , they reported 90% accuracy ; however , the negative predictive value was 25% .
until recently , imaging technology has not been routinely used to assess patients sustaining penetrating injuries to the abdomen .
older technology using spiral ct scans has not shown optimal results in detecting abdominal injuries.8,32 recently published data suggest improved results with more advanced ct equipment .
stein et al.20 analyzed the role of multidetector - row ct in the diagnosis of penetrating injuries to the diaphragm .
the authors reviewed the admission ct of 803 patients sustaining penetrating torso injury during a four - year period .
diaphragmatic injuries were detected in 67 patients and excluded in 736 . if ct was used to exclude diaphragm injury , the sensitivity ( 94% ) , specificity ( 95.9% ) , and accuracy ( 95.8% ) were consistently high .
we believe that more studies are necessary to confirm the role of multidetector ct scans in the diagnosis of diaphragmatic injuries in penetrating trauma .
diaphragmatic hernias develop over three distinct post - trauma periods . during the acute period directly following trauma ,
the third period is associated with symptoms and , eventually , necrosis of the herniated viscera .
the natural history of diaphragm injuries has not been adequately studied in humans . without treatment , diaphragmatic healing
would be impaired by the pressure gradient between the thorax and abdomen , as well as by respiratory movements.2,17 this would facilitate the development of a diaphragmatic hernia , especially on the left side.4,17 complications are also possible on the right side despite the supposed tamponade
diaphragmatic hernias have been reported on the right side of patients years after thoracic gunshot wounds.33 perlingeiro et al.17 studied the course of diaphragmatic injuries in rats .
animals were observed for six months , and complete diaphragmatic healing was observed in approximately 90% of the animals , while diaphragmatic hernias were present in 10% .
a similar phenomenon was observed by gamblin et al.,18 who studied 48 rats in an experimental model of diaphragmatic injuries produced by a 16-gauge needle puncture or 2.7-mm aortic punch .
only one animal in the aortic punch group , euthanized at 10 months , presented a small hepatic herniation through the diaphragm ( 1/12=8% ) .
the size of the diaphragmatic wound is a very important factor that can not be controlled for in human trauma cases .
however , at least in animals , these data show that the diaphragm can heal without hernia development .
several authors have reported nonoperative treatment of penetrating liver injuries.19,34,35 this was accomplished by ct assessment , which revealed the injury through the liver parenchyma .
some of these patients also sustained hemothoraces , and it is possible to infer that they might have had concomitant diaphragmatic injuries19 .
leppniemi and haapiainen27 analyzed 97 patients with stab wounds located between the nipple line , umbilical level , and posterior axillary lines , but without immediate indication for laparotomies .
these patients were randomized into two groups : clinical observation and surgical exploration ( laparotomy or videolaparoscopy ) . in the surgical exploration group ( n=47 ) , four patients ( 9% ) had diaphragmatic injuries .
three of these injuries were isolated , and thus three of 43 patients would have had occult diaphragmatic injuries if surgical exploration had not been performed . in the observation group ( n=50
) , two patients ( 4% ) showed delayed presentation of missed left - side diaphragmatic injuries .
however , we can not definitively state the number of patients with diaphragmatic injuries or the percentage of healing in the group not submitted to operative procedures , as the failure of imaging tests to detect diaphragmatic hernias does not necessarily indicate their absence .
thus , some diaphragmatic tears on the right side could have been treated without operating , at least in this setting .
it is important to stress that there is currently no specific protocol for nonoperative treatment of diaphragmatic injuries .
potential problem associated with leaving a diaphragmatic wound unsutured concern the reported high morbidity and mortality rates of diaphragmatic hernias when treated in the presence of complications such as bowel necrosis .
feliciano et al.16 stated that few topics in trauma surgery have raised more controversy than the delayed diagnosis of a diaphragmatic injury .
madden et al.2 reviewed selected cases of delayed presentation of diaphragmatic injuries due to stab wounds .
the sample included 28 patients , with a mean age of 32 years , and the mortality rate was 36% .
six of the seven patients ( 85% ) shown to have gangrenous viscera died . based on these numbers ,
an invasive diagnostic workup is justified to eliminate even the smallest risk of overlooking a diaphragmatic injury .
the reported mortality rates due to diaphragmatic hernias are not consistent , and may not be as high as some authors estimate .
reber et al.22 reported the treatment of 10 patients with late presentations of traumatic diaphragmatic hernias .
hernias were present on the left side and right side in eight and two patients , respectively .
the time elapsed between trauma and clinical presentation ranged from 20 days to 28 years .
all of these patients underwent laparotomies , and concomitant thoracotomies were necessary in two cases .
only one patient died ( 10% mortality ) , and three ( 30% ) sustained postoperative complications .
bergeron et al.21 evaluated the deferred treatment of traumatic diaphragmatic hernias due to blunt trauma .
their study assessed 160 patients sustaining diaphragmatic injuries who were diagnosed immediately after the trauma .
patients undergoing operations for isolated diaphragmatic injuries did not show higher mortality rates due to delayed repair than those undergoing immediate surgery .
the authors concluded that blunt diaphragmatic rupture in the absence of other surgical injuries is associated with low mortality , and treatment can be deferred if necessary .
these studies do not specifically address the mortality associated with complicated diaphragmatic hernias ( i.e. , gangrenous viscera in the thorax ) .
furthermore , some of these studies assessed victims of blunt trauma for whom the diaphragm defect was expected to be larger and the risk of viscera strangulation was lower.21,22 recently , several studies have reported low mortality in the treatment of complicated diaphragmatic hernias.16,23,24,3638 nevertheless , the rate of complications and mortality in the treatment of complicated diaphragmatic hernias needs to be further addressed .
the ideal treatment should be based on the preoperative diagnosis of the diaphragmatic injury , such that only patients sustaining these injuries undergo operation .
however , current imaging technology limits proper diagnosis . considering the possible complications associated with unsutured diaphragmatic wounds , a protocol for actively searching for diaphragmatic injuries
currently , the most sensitive and specific methods are videolaparoscopy and videothoracoscopy.1,1115 the advantages of videosurgery are evident : the diaphragm can be directly viewed and easily assessed,1,1215 muscular stretching permits better visualization of the defect , and concomitant abdominal lesions may be observed and treated . moreover , the contents of the thoracic cavity can be aspirated and the diaphragmatic lesion laparoscopically treated.14,15 concerns related to creating a hypertensive pneumothorax with the pneumoperitoneum has not been shown to be a major problem.39 the diaphragmatic lesion can usually be recognized in patients sustaining stab wounds .
the situation is a bit more complicated when gunshot wounds are the cause of trauma , as the trajectory is often unpredictable .
assessment of the splenic flexure of the colon in the left upper quadrant is often difficult .
perforations in the small bowel and colon may be difficult to see , especially when hematomas or free blood are present in the abdominal cavity.1,40 finally , visualization of the posterior portion of the diaphragm with videolaparoscopy may be difficult , particularly in posterolateral wounds .
friese et al.26 prospectively studied 34 hemodynamically stable and asymptomatic patients sustaining penetrating thoracoabdominal wounds .
all patients underwent diagnostic laparoscopy to assess the diaphragm , followed by confirmatory celiotomy or videothoracoscopy .
there were seven true positive , 30 true negative , one false negative , and no false positive tests .
the specificity ( 100% ) , sensitivity ( 87.5% ) , and negative predictive value ( 96% ) were all high .
the single false negative case was due to a hemoperitoneum associated with a splenic lesion that warranted laparotomy .
all patients routinely underwent videolaparoscopy . a total of 73 patients , 62 of whom were victims of stab wounds , were analyzed .
diaphragmatic injury was diagnosed in 18 patients ( 24% ) , eight ( 44% ) of whom demonstrated isolated diaphragmatic injuries .
of the 510 patients studied , laparotomy was avoided in 277 ( 54% ) and diaphragmatic injuries were laparoscopically treated in 16 cases . only 10 patients presented complications , all of which considered minor .
videothoracoscopy is another available method used to assess asymptomatic patients with thoracoabdominal wounds.14,15 it aids assessment of the posterior portion of the diaphragm .
the pneumoperitoneum is not needed , further thoracic evaluation may be carried out ( i.e. , pericardium window and projectile trajectory ) , and some lesions can be treated ( i.e. , lung suture ) . it is always our policy to perform a videolaparoscopy or laparotomy to evaluate the abdomen in cases of diaphragmatic lesion diagnosed by videothoracoscopy .
videothoracoscopy failed to detect a large right - sided diaphragmatic rupture due to blunt trauma .
this patient underwent videothoracoscopy 30 days after the trauma , with a diagnosis of retained hemothorax .
seven days after the initial operative procedure , the patient underwent thoracotomy and a 15-cm right - sided diaphragmatic rupture was noticed .
in asymptomatic patients with penetrating wounds to the thoracoabdominal area , a videothoracoscopy should be performed in two situations : if placement of a thoracic tube is required ( pneumothorax or hemothorax ) , or cardiac injury is suspected and a pericardial window is to be performed . in all other cases , videolaparoscopy is the best alternative .
this question , related to that of suturing diaphragm wounds , unfortunately remains unanswered . for many years
however , there are risks associated with active searches using videosurgery , and a selective protocol may be warranted .
prospective data detailing the long - term results of pure clinical observations of patients sustaining wounds to the thoracoabdominal zone are not currently available .
leppniemi & haapiainen27 studied 97 patients with stab wounds located between the nipple line , umbilical level , and posterior axillary lines .
forty - seven underwent surgical intervention in order to search for diaphragmatic injuries , which were found in four patients ( 9% ) . in the observation group ( n=50 ) ,
two patients ( 4% ) presented with left diaphragmatic injuries after two and 23 months .
considering these numbers , we may estimate that around 50% of patients with left - side diaphragmatic injuries will develop hernias within the first year after the injury .
it is clear that we lack the evidence to formulate a rule for these cases .
if the surgeon believes that every diaphragmatic injury should be sutured , the price to be paid is a 70% rate of negative videolaparoscopies , in addition to the risks of anesthesia , iatrogenic injuries , and costs .
if one chooses not to search for diaphragmatic injuries , the unpleasant diagnosis of a delayed diaphragmatic hernia may occur in some cases .
the risk of developing a hernia seems to be small , but strangulation rates in patients that do develop hernias can be high .
an active search with a multidetector ct during follow - up may be the best course of action for diagnosing diaphragmatic defects before serious complications develop .
demetriades et al.35 described an algorithm for treating hemodynamically stable patients sustaining thoracoabdominal wounds without peritoneal signs . in this protocol
these researchers accepted the risks associated with not suturing right diaphragmatic tears , but active searching for left diaphragmatic lesions was routinely indicated .
we accept that asymptomatic patients sustaining penetrating wounds to the right thoracoabdominal zone may eventually be observed in hospitals where nonoperative treatment protocols are implemented .
however , our current opinion is that even right diaphragmatic lesions should be sutured because complicated right - sided diaphragmatic hernias have been observed in clinical practice.33 therefore , we believe that the majority of asymptomatic patients sustaining penetrating wounds to the thoracoabdominal region should undergo obligatory invasive investigation via videolaparoscopy or videothoracoscopy .
in conclusion , diaphragmatic injuries are difficult to diagnose in asymptomatic patients sustaining wounds to the thoracoabdominal area . with the development of multidetector ct scans ,
although it is possible for diaphragmatic tears to heal without intervention , overlooking lesions remains a major concern .
the reported incidence of diaphragmatic injuries in patients with wounds to the thoracoabdominal area varies widely , from 7% to 48% , depending on the methodology of the study .
it seems that the chance of developing a hernia is small ; however , if a hernia does develop , strangulation of the herniated viscera becomes a serious risk .
more studies assessing the mortality of complicated diaphragmatic hernias are needed , as insufficient data are currently available to definitively state a rule in these cases .
although some surgeons accept the practice of not suturing a right - sided diaphragmatic tear , active searching for a tear on the left side of the diaphragm is warranted .
videolaparoscopy and videothoracoscopy are reliable methods for ruling out these injuries , especially if the wound is located on the left thoracoabdominal area . | the most challenging diagnostic issue in the management of thoracoabdominal wounds concerns the assessment of asymptomatic patients . in almost one - third of such cases ,
diaphragmatic injuries are present even in the absence of any clear clinical signs .
the sensitivity of noninvasive diagnostic tests is very low in this situation , and acceptable methods for diagnosis are limited to videolaparoscopy or videothoracoscopy .
however , these procedures are performed under general anesthesia and present real , and potentially unnecessary , risks for the patient . on the other hand , diaphragmatic hernias , which can result from unsutured diaphragmatic lesions ,
are associated with considerable morbidity and mortality . in this paper ,
the management of asymptomatic patients sustaining wounds to the lower chest is discussed , with a focus on the diagnosis of diaphragmatic injuries and the necessity of suturing them . |
global estimates suggest that one in every three males worldwide is circumcised . according to advocates of the procedure
, circumcision may also provide health benefits to males , the most prominent being the prevention of human immunodeficiency virus infection .
many studies have shown that male circumcision also protects against urinary tract infections in infants and children .
urinary tract infection is a common bacterial infection in childhood and causes significant morbidity . among the significant complications are concomitant bacteremia , acute failure , and progressive renal damage .
many reports have linked the risk of developing urinary tract infection with the circumcision status of the child .
the uncircumcised state is associated with a higher incidence of urinary tract infection , especially in high - risk populations like infants and children with congenital anomalies . however , there is no universal acceptance that circumcision prevents the occurrence of urinary tract infection . in this study
, we evaluated the effect of the preputial type on bacterial colonization and wound healing in boys undergoing routine circumcision in accordance with religious belief .
the study consisted of 78 boys admitted to our clinic for circumcision consecutively between 2009 and 2011 .
the subject relaxed and supine , the prepuce was gently retracted without traumatic force and the degree of preputial retractability was determined .
preputial status was classified into five types on the basis of preputial retractability as follows : type 1 : no retraction of prepuce at all , type 2 : external urethral meatus exposure only , type 3 : glans exposure halfway to the sulcus of the corona , type 4 : glans exposure to above the corona at the site of preputial adhesion , and type 5 : easy exposure of the whole glans .
, preputial cultures were taken after the foreskin was retracted carefully in order to avoid external contamination .
one sterile culture swab was swept circumferentially once around the surface of the glans starting just proximal to the urethral meatus .
control swabs from the same region of the same patients were taken and inoculated after 3 weeks following circumcision .
the circumcision procedure was performed with total removal of the foreskin in all patients . briefly , after full retraction of the preputium and exposure of the whole glans , a circular incision was performed initially at the mucosal surface of the preputium about 5 mm proximal to the glans
. then the preputium was retracted and another circular incision was performed at the level of the coronal sulcus in the outer skin .
the subcutaneous fatty tissue was trimmed and the foreskin marked by the two incisions was removed completely .
preputial cultures were taken with sterile cotton swabs before cleansing with 10% polyvidone - iodine solution .
these were transferred to the laboratory and suspended in 1 ml of 0.9% saline solution in a sterile tube .
the solution was then diluted 100 times by transferring 0.1 ml of the solution to another tube filled with 9.9 ml of 0.9% saline solution .
an amount of 10 l of the final solution was inoculated on to 5% sheep blood agar and eosin - methylene blue agar .
the plates were incubated at 37 for 24 to 48 hours , after which the different bacterial colonies were counted .
cultured bacteria were identified according to colony morphology , gram staining , and biochemical characteristics by use of standard techniques .
clinically significant bacterial colonization was arbitrarily accepted as the presence of the growth of 100,000 colony - forming units per milliliter ( cfu / ml ) before cleansing with 10% polyvidone - iodine solution .
post circumcision cultures were taken from the suture line 3 weeks after the operation . to assess whether preputial type affected wound healing , patient wounds were checked for local swelling , local hyperemia , local temperature increase , and local fluid collection on days 1 and 7 after the operation .
the same evaluation scale was used for local hyperemia , local temperature increase , and local fluid collection to determine possible statistical differences between the types .
data analyses were carried out on a personal computer with the use of spss ver .
the mean age of the children was 46.3 months ( range , 1 to 168 months ) .
classifications by preputial type and the mean age of patients are shown in table 1 .
there was a significant difference among preputial types in terms of mean age ( p<0.005 ) .
a total of 28.2% of the uncircumcised boys had no growth in their preputial culture , 56.4% had pathogenic bacterial colonization , and 15.4% had skin commensals .
the distribution of the ratios of microorganisms according to preputial types is given in table 2 .
of the patients with a pathogenic bacterial colonization in their pre - circumcision antibiogram , three patients of type 1 , two patients of type 2 , one patient of type 3 , one patient of type 4 , and one patient of type 5 had skin flora in their third week control culture antibiograms . patients with a pathogenic bacterial colonization and those with skin commensals were the same individuals .
following circumcision , none of the patients had pathogenic microorganisms in their control culture antibiograms .
when we evaluated the wounds of the patients 1 day after the operation , all had local swelling and hyperemia ; these findings were especially noticeable in type 1 , 2 , and 3 patients .
seven days after the operation , 71.2% of the type 1 patients had swelling and 70.1% had hyperemia , 68.2% of the type 2 patients had swelling and 69.1% had hyperemia , and 45.6% of the type 3 patients had swelling and 35.1% had hyperemia .
seven days after the operation , there was a significant difference in terms of wound healing .
this difference was observed in all types ( p<0.05 ) except type 1 and type 2 ( p>0.05 ) .
patients did not have local fluid collection on either postoperative day 1 or day 7 .
while taking the post - circumcision culture , it was noticed that all patients had complete recovery , and no complications were encountered .
. it may provide health benefits to males , the most prominent being prevention of human immunodeficiency virus infection .
it was recently shown in randomized controlled trials that adult circumcision reduces the risk of acquiring human immunodeficiency virus infection .
many studies have shown that male circumcision also protects against urinary tract infections in infants and children .
urinary tract infections are mostly accepted as arising by the ascending route , and the agents mostly come from the periurethral region .
colonization in the preputial sac may create a reservoir from which the organisms ascend , resulting in bacteriuria and urinary tract infection and inability to retract the preputium .
phimosis promotes this migration by providing an optimum environment for growth of possible uropathogenic bacteria .
many studies designed to evaluate the periurethral flora in uncircumcised boys from birth to 16 years have revealed massive bacterial colonization during early infancy , mainly with escherichia coli .
similarly , wiswell et al . reported that the presence of the foreskin was associated with a higher rate of colonization with gram ( - ) pathogens during the first 6 months of life .
they found that the degree of preputial separation increased with age . before age 6 months , the incidence of types 1 and 2 prepuce was 47.1% and 21.5% respectively .
the relationship between circumcision and urinary tract infection was initially described by ginsberg and mccracken in 1982 .
a meta - analysis of nine of the major studies demonstrated a 12-fold increase in the risk of urinary tract infection in uncircumcised boys , and that between 0.9% and 4.2% of all uncircumcised boys would have symptomatic urinary tract infection in the first year of life . in the study by cascio
a pure growth of uropathogens was isolated in 37% of uncircumcised boys with vesicoureteral reflux who were receiving antibiotic prophylaxis and in 28% of boys who had undergone circumcision . in another study ,
the authors isolated pathogenic bacteria in the periurethral region of 64% of patients before circumcision , and this rate decreased to 10% after circumcision . in our study , there was a 71.8% growth rate in pre - circumcision patients and a 10.25% growth rate in the post - circumcision group ; however , none of these patients had pathogenic microorganism growth .
staphylococcus aureus is known as the most frequently cultured bacteria after circumcision , and circumcision status probably does not affect the colonization of these bacteria , as the results of our study also confirmed .
. showed how the skin flora changed 3 weeks after circumcision from uropathogens to skin commensals .
we found the same result in our study . in some of the pre - circumcision patients who had pathogenic microorganisms in their culture antibiogram , 3 weeks after circumcision , the only organisms cultured from the periurethral region were skin commensals .
analyzed the preputial flora in preschool and primary school boys and found that significant colonization with possible uropathogens still persisted in this age group in 100% of patients with phimosis and 48.1% of cases without phimosis .
. showed no difference in colony counts between boys with phimosis and those without phimosis .
our study revealed a growth of 100% in type 1 , 93.8% in type 2 , 71.4% in type 3 , 44.4% in type 4 , and 53.6% in type 5 .
there was a significant difference between the types in terms of growth ( p<0.001 ) .
the most common microorganisms isolated in children with uncomplicated urinary tract infection are of the enterobacteriaceae family , namely e. coli , klebsiella , and proteus species .
glennon et al . found a 22% rate of proteus mirabilis colonization in uncircumcised boys .
we isolated this bacterium in 6.6% of our cases . in their analysis of periurethral bacterial flora before circumcision , wijesinha et al .
isolated proteus , coliforms , and enterococcus species in 52% of boys ; we documented these bacteria in 52.6% of our cases .
they found e. coli in 3.1% of the cases , klebsiella species in 18.8% , coagulase - negative staphylococcus species in 12.5% and enterococcus species in 43.8% .
the most common microorganism in our study was also enterococcus , in 33% of the cases ; the others were e. coli in 12.8% of cases , proteus species in 6.6% , klebsiella species in 2.6% , and coagulase - negative staphylococcus species in 15.4% .
there is no account of a study on wound healing according to preputial types in the literature . in our study , when we evaluated the wounds on postoperative day 1 , all patients had local swelling and hyperemia , but type 1 , 2 , and 3 patients in particular had more noticeable swelling and hyperemia .
however , 7 days after the operation , 71.2% of type 1 patients had swelling and 70.1% had hyperemia , 68.2% of type 2 patients had swelling and 69.1% had hyperemia , and 45.6% of type 3 patients had swelling and 35.1% had hyperemia .
we believe that late healing in type 1 , 2 , and 3 patients results from preputial adhesiveness and bacterial colonization , and parents should be informed of this .
, as patients get older , bacterial colonization can continue even though the preputial type changes . in circumcision
, the removal of the whole preputium could eliminate the site for bacterial growth and subsequent risk of infection .
preputial type also affects post - circumcision wound healing . especially in countries like ours where circumcision is common and obligatory
, it should be considered that wound healing takes longer in patients with preputium of type 1 , type 2 , and type 3 , and patients should be informed of this . in our opinion , it is due to preputial adhesiveness and bacterial colonization . | purposein this study , we evaluated the effect of preputial type on bacterial colonization and wound healing in boys undergoing circumcision.materials and methodsthis study consisted of 78 boys consecutively admitted to our clinic for circumcision between 2009 and 2011 .
preputial status was classified into five types on the basis of preputial retractability .
one sterile culture swab was swept circumferentially once around the surface of the glans starting just proximal to the urethral meatus .
three weeks following circumcision , control swabs from the same regions of the same patients were taken and inoculated .
thus , the same patients formed the control group .
patients were evaluated on days 1 and 7 after the operation to assess whether the preputial type affected healing.resultsthe mean age of the children was 46.3 months . in our study
, the growth rate was 71.8% in pre - circumcision patients , whereas the rate was 10.25% in the post - circumcision group .
types 1 , 2 , 3 , 4 , and 5 had 100% , 93.8% , 71.4% , 44.4% , and 53.6% colonization , respectively . a significant difference was observed among these types in terms of colonization .
the most common agent was enterococcus species ( 33% ) .
when postoperative patients were evaluated , all had local swelling and hyperemia on postoperative day 1 , whereas there was a significant difference on day 7.conclusionsthere was a significant correlation between preputial type and bacterial colonization , and the preputial type affected post - circumcision wound healing .
practitioners should keep in mind that the healing period will be longer in patients with type 1 , 2 , and 3 preputium . |
the advent of transferrable retinal imaging has enhanced the care of patients with retinopathies by 1 ) improving diagnostic accuracy , assessment , and documentation and 2 ) ushering in telemedicine as a new paradigm of delivering care . with respect to retinopathy of prematurity ( rop ) ,
timely screening and early treatment remain the most crucial factors for prevention of lifelong vision - threatening sequelae .
improvements have been made in image quality and software engineering , and multiple validation studies have demonstrated the efficacy of remote screening .
according to the guidelines published jointly by the american academy of ophthalmology , american academy of pediatrics , and american association for pediatric ophthalmology and strabismus , infants with birth weight < 1,500 g or gestational age 30 weeks , and infants with birth weight 1,5002,000 g or gestational age > 30 weeks with an unstable clinical course should receive dilated ophthalmoscopic examinations for rop screening.1 these exams are most usually performed with binocular indirect ophthalmoscopy ( bio ) at the neonatal intensive care unit ( nicu ) bedside and require the coordination of nicu staff with the screening ophthalmologist .
scleral depression technique is commonly utilized , which can be particularly stressful for premature infants and may cause apnea , bradycardia , and aspiration.2,3 bio and retinal drawings have been used since the 1950s for the screening and documentation of rop .
undoubtedly , the development of an international classification system has allowed standardization of the disease severity , description , and location of retinal abnormalities in rop.4 however , a significant limitation of bedside examination is the subjectivity of the examiner impression of the bio findings especially in a squirming live exam .
sometimes , a poorly dilated eye of a premature infant , corneal clouding , tunica vasculosa lentis , and vitreous haze render the exam even more challenging .
in fact , several studies have shown a wide range of disagreement of rop diagnosis and severity among health care professionals screening for rop.5,6 in the pivotal cryo - rop trial , there was disagreement between two unmasked , certified examiners as to whether threshold disease was present in 12% of eyes.7 furthermore , the documentation of exam findings is solely based on memory using paper charts with handwritten sketches or , more recently , electronic medical records that utilize drawing tools and templates .
the latter makes independent verification of disease status as well as monitoring disease progression particularly challenging .
conversely , there is an increasing discordance between the number of premature infants requiring rop screening and the number of ophthalmologists performing it . in 2006 ,
a survey of 224 pediatric ophthalmologists and retinal specialists by the american academy of ophthalmology revealed that only 54% of retinal specialists and pediatric ophthalmologists were willing to manage rop and 20% of them were considering stopping due to decreasing reimbursement and high medicolegal liability.8
telemedicine refers to the use of telecommunication and information technologies in order to provide clinical health care at a distance.9 with regard to store - and - forward telemedicine , it involves capturing of patient data usually by nonphysician providers for subsequent interpretation by a remote expert .
numerous studies have shown that photographic screening using contact wide - field cameras can detect treatment and/or referral - warranted rop at a rate that is safe and comparable to live screening with bio.1 these results were fairly consistent even among different camera operators , who included trained ophthalmologists,1012 ophthalmic photo graphers,1315 or trained neonatal personnel.14,16,17 most of the studies have compared the gold standard for rop screening , that is , bio bedside exam , against wide - angle contact imaging systems ( eg , retcam ; clarity medical systems , pleasanton , ca , usa ) .
the e - rop study was a multicenter study to test the ability of nonphysicians to recognize referral warranted - rop or alternatively rop at high risk of causing vision loss .
in addition , 43% of severe rop cases were identified by telemedicine before they were detected by an ophthalmologist which was on average 2 weeks earlier.18,19 this is likely due to being able to objectively track the progression of the fundus appearance
15 years of studies validating the accuracy and sensitivity of telemedicine in rop screening , several live telemedicine programs have already demonstrated promising results.20 the stanford university network for diagnosis of retinopathy of prematurity telemedicine program has been screening five nicus in the san francisco bay area since december 2005 .
the recently published 6-year results were highly favorable with respect to diagnostic accuracy of rop.21 remote interpretation of images had a sensitivity of 100% , specificity of 99.8% , positive predictive value of 95.5% , and negative predictive value of 100% for the detection of treatment - warranted rop .
similar results were demo nstrated from telemedicine programs in germany22 and india.23 in the authors group , remote rop screening led to a reduction of live exams by 84% without any infant missing a treatment interval ( figure 1).24 it has been shown that the clinical determination of zone 1 rop disease and the presence of plus disease is imperfect,6,25 which has important implications since the majority of rop treatment decisions are based on the presence of plus or zone 1 disease.26 photographic screening may be particularly helpful in the diagnosis of plus disease and type 1 rop in general as several sophisticated software programs can now objectively quantify the amount of retinal vessel tortuosity2729 or assist in the determination of zone 1 ( figure 2a ) . in a study performed by abbey et al,30 utilizing the rop tool for detecting plus disease ,
it is anticipated that new cameras with better image acquisition will aid in increasing this percentage even further .
a clear advantage of utilizing telemedicine in the screening of rop lies in the fact that it allows improved access to health care by overcoming geographical challenges .
this is especially true given that rop screening is traditionally performed by highly specialized professionals who may not be accessible for rural nicus.31 telemedicine allows immediate communication between local health care providers and expert consultants in a cost - effective manner.32,33 scheduling conflicts are avoided and labor costs are decreased .
telemedicine examinations also require significantly less physician time than standard bio bedside examinations.34 furthermore , the acquisition of fundus photographs aids in the education of parents .
clinical imaging illuminates the disease patterns seen in rop for patients families , an entity otherwise abstract and difficult to comprehend .
clinical improvement would also be easier to document and convey to the patient , families , and other members of the patient care team .
fundus photographs can also serve as educational tools for less experienced rop screeners or those in training .
sick infants are often transferred to tertiary care institutes where expert rop treaters are accessible , but rural hospitals are often caring for less acutely ill infants , and rop screeners in such clinical facilities may not be as familiar with the nuances of advanced rop .
the medicolegal climate surrounding rop has always been complex and a deterrent for the recruitment of more screeners and treaters .
while malpractice claims are , in fact , very rare , each lawsuit can be costly.35 physicians should be aware of risk management strategies , and photodocumentation is one method of demonstrating sound clinical practice and judgment , should legal action occur .
this is particularly an issue in darkly pigmented fundi or infants with small palpebral fissures , which prevent adequate contact of the camera and the corneal surface ( figure 2b ) .
vitreous or corneal haze due to extreme prematurity , vitreous hemorrhage , or motion artifacts are also additional factors that can affect image quality rendering their interpretation challenging .
uninterpretable images range from 8% to 21% in published studies.10,15 in addition , some may argue that the high cost of a wide - field imaging camera is prohibitive for participation in telemedicine programs .
even the smaller , more affordable retinal cameras cost $90,000$140,000 , a cost difficult to absorb for smaller institutions .
it is hoped that the advent of newer , cost - effective imaging technology would allow for more centers to participate in the screening of rop via telemedicine .
of equal importance is medicolegal liability for telemedicine in rop . considering its relatively recent introduction in clinical practice , the legislation concerning telemedicine can be poorly defined and laws governing medical liability may differ from state to state regarding telemedicine .
in summary , telemedicine provides better documentation of disease severity and progression and appears to have several advantages over traditional bedside examination , which has been the gold standard for rop screening .
the future of rop screening is to provide objective data by reducing subjectivity and potentially human error .
the beauty of telemedicine lies in the fact that it provides the platform for reduction of subjectivity in rop by providing objective data overseen by physicians thus providing high quality care . | several studies have validated the role of telemedicine as a new powerful screening and diagnostic tool for retinal disorders , such as diabetic retinopathy and retinopathy of prematurity . with regard to retinopathy of prematurity , bedside examination with
binocular indirect ophthalmoscopy has been the gold standard technique for screening , yet with several limitations .
herein , we review the current evidence that supports the role of telemedicine for the screening of infants with retinopathy of prematurity . |
primary dysmenorrhea ( pd ) , which refers to lower abdominal pain or cramps occurring just before and/or during the menstrual period in the absence of evident pathology , is regarded as one of the most frequent gynecological complaints mainly experienced by adolescents.1 a recent review reported that dysmenorrhea prevalence varied between 45% and 95% among women of reproductive age , and 10% and 25% of the women suffered severe symptoms.2 the cramps are often accompanied by low back pain , nausea , vomiting and diarrhea , resulting in a negative impact on quality of life and even short - term absence from school or work in very severe cases.2 it has been demonstrated that increased secretion of peripheral vasoactive prostanoid was one of the key factors of pathogenesis in pd , which directly gave rise to enhanced frequency of uterine contraction , decreased myometrial blood flow and further uterine hypoxia and dysmenorrhea.2 in recent years , the central disorder has been investigated and abnormal variations in brain structure and function were found in moderate - to - severe pd patients.310 according to the studies , the microstructure of white matter , gray matter ( gm ) volumes and cortical thickness were all altered in pd patients compared with healthy controls ( hcs ) , and the disorders were mainly related to pain transmission and modulation , sensory processing and affect regulation.4,7,10 functional neuroimaging studies reported that hypermetabolism was observed in the orbitofrontal cortex ( ofc ) , medial prefrontal cortex ( mpfc ) and ventral posterior thalamus in pd patients , which suggested that the disinhibition of thalamo - orbitofrontal - prefrontal networks might partly underlie the cramps and hyperalgesia of pd.3,5 the patients also revealed abnormal pain processing when suffering experimental stimuli.5 the resting - state studies found that the functional connectivity of periaqueductal gray ( pag ) and default mode network ( dmn ) was maladaptive / adaptive changed in pd patients.8,9 however , few studies focused on the spontaneous brain activity of the patients . on the basis of our previous studies and other findings , we will define all the aberrant brain areas as regions of interest ( rois ) and then detect the corresponding spontaneous activities in pd patients . regional homogeneity ( reho ) , based on the hypothesis that neighboring voxels within a functional brain region showed a temporal similarity that could be modulated in different states , is proved to be an effective approach to evaluating synchronization of resting - state blood - oxygenation level dependent ( bold ) signals according to kendall s coefficient concordance ( kcc).11,12 reho analysis has been applied to explore the brain functional changes in many neurological and psychiatric disorders , gastrointestinal diseases and chronic pain and gives a better understanding of the corresponding brain mechanisms.1317 here , we employed reho approach to identify regional coherence of spontaneous brain activity in pd patients .
considering the state alterations of gm volumes and the functional connectivity in pd patients,6,8 the spontaneous activity might also be varied with the menstrual cycle .
therefore , we hypothesized that the reho values might dynamically change with the phases of menstrual cycle in women with pd compared with hcs , and the aberrant regions might be included in the regions involved in the descending pain modulation pathways , dmn and sensory regulation .
thirty - four right - handed pd patients ( 21.51.2 years ) and 34 age - matched right - handed hc females ( 22.21.7 years ) were enrolled .
all the subjects were recruited from the college students of chengdu university of traditional chinese medicine ( tcm ) and sichuan university .
the inclusion criteria of pd were primary dysmenorrhea ( diagnosed by the details of menstrual questionnaires and pelvic ultrasound ) ; regular menstrual cycle ( 283 days ) and normal duration of menstruation ( 37 days ) ; moderate or severe abdominal cramp pain ( > 4 points on a visual analog scale in which 0 means no pain and 10 means the worst pain ) ; suffered an attack at least 4 months in the past 6 months ; nulliparous and nonsmoker .
the exclusion criteria for all the subjects were secondary dysmenorrhea induced by endometriosis or pelvic inflammatory disease ( excluded by pelvic ultrasound ) ; recurrent pelvic or lower abdominal pain ; gastrointestinal diseases including recurrent gastritis , gastric or duodenal ulcer ; chronic pain ; pregnant or intending to become pregnant during the course of the trial ; history or evidence of serious diseases , neurological or psychiatric diseases ; receiving nonsteroidal anti - inflammatory drugs ( nsaids ) ( including aspirin ) or analgesics or alcohol within 24 h leading up to magnetic resonance imaging ( mri ) scanning ; receiving oral contraceptives within 6 months prior to the study and any contraindication of mri scanning .
this project was approved by the west china hospital research ethics committee , and written informed consent was obtained from each subject .
one scan was performed on the 1st3rd day of the menstrual cycle ( menstrual phase ) , while the other scan was performed on the 10th12th day of the menstrual cycle ( follicular phase ) .
short - form mcgill pain questionnaire ( sf - mpq ) and cox retrospective symptom scale ( rss)18 were used to evaluate the menstrual pain and associated symptoms experienced by each pd patient retrospectively in the past 3 months .
sf - mpq was also completed only before menstrual phase scan , and the questionnaire was replaced with an oral question by supposing there was no pain before follicular phase scan .
self - rating anxiety scale ( sas ) and self - rating depression scale ( sds ) were applied to assess the subject s anxiety and depression level prior to each scan .
a standard birdcage head coil of a 3 t siemens scanner ( allegra , siemens medical system ) was used to collect imaging data at the huaxi mr research center , west china hospital of sichuan university , chengdu , china .
restraining foam pads were accompanied to minimize head motion and diminish the scanner noise . during the scan , subjects were requested to close the eyes and keep still in the supine position . in follicular phase
, functional images were scanned using a gradient - echo echo planar imaging sequence ( repetition time [ tr ] = 2000 ms ; echo time [ te ] = 30 ms ; flip angle = 90 ; slices = 30 ; field of view [ fov ] = 240 mm 240 mm ; in - plane matrix resolution = 64 64 ; in - plane resolution = 3.75 mm 3.75 mm ) .
after that , high - resolution t1-weighted images were acquired ( tr = 1900 ms ; te = 2.26 ms ; flip angle = 9 ; slices = 176 ; slices thickness = 1 mm , fov = 256 mm 256 mm ; data matrix = 256 256 ; in - plane resolution = 1 mm 1 mm ) . in menstrual phase
preprocessing of the resting - state fmri data was performed using spm8 software package19 and composed of the following steps .
abandoned the first five images of each functional time series for the longitudinal magnetization to reach equilibrium ;
slice - timing adjusted and realigned to the first volume ; motion - corrected by estimating six parameters capturing translation and angular rotation relative to the first volume ( 2 mm or 2 degrees rotation was discarded ) ; normalized to montreal neurologic institute ( mni ) space using the normalization parameters estimated by t1 structural image unified segmentation and re - sampled to 3 mm voxels ; removed estimated motion parameters , linear drift and average bold signals in ventricular and white matter regions through linear regression and reduced the effect of low - frequency drifts and high - frequency noise by temporal band pass filtering ( 0.010.08 hz ) .
individual reho maps were generated by calculating kcc , used to measure the correlation of the time series of a given voxel with the time series of its 26 nearest neighbors , within a prepared mask including the following regions : superior frontal cortex , middle frontal cortex ( mfc ) , medial frontal cortex , inferior frontal cortex ( ifc ) , ofc , precentral , primary somatosensory area ( s1 ) , secondary somatosensory area ( s2 ) , inferior parietal cortex , cuneus , precuneus ( pcu ) , middle temporal cortex ( mtc ) , inferior temporal cortex ( itc ) , insula , anterior and posterior cingulate cortex ( pcc ) , thalamus , basal ganglia , hippocampus and brainstem .
when the center cube was on the edge of the mask , we only calculated reho for a vessel if all the remaining nearest boxes were within the mask . for each participant ,
the kcc map was normalized by dividing kcc in each voxel by the mean kcc of the mask .
at last , smooth was applied with a three - dimensional ( 3d ) gaussian kernel ( full width at half maximum [ fwhm ] = 6 mm ) to reduce noise and residual differences in gyral anatomy .
all of these procedures were performed using dparsf software.20 two independent samples t - test were used to examine the consistency of age , body mass index , the onset of menses , length of menstrual cycle and menstrual phase and the differences of psychological scores ( sf - mpq , rss , sas and sds ) between pd patients and hc by using spss 20.0 .
all p - values were two - sided , and p<0.05 was considered statistically significant . in the group analysis , age
statistical maps were evaluated to determine the differences in reho values with a significance voxel level of p<0.05 ( false discovery rate [ fdr ] corrected ) by using permutation test ( snpm13)21 in the following contrasts : 1 ) group differences between pd and hc in both menstrual phase [ pd(mens ) hc(mens ) ] and follicular phase ( non - menstrual phase ) [ pd(non ) hc(non ) ] were examined separately with two - sample t - test .
2 ) the interaction between phase and group [ pd(mens - non ) hc(mens - non ) ] was examined by repeating ( mens - non ) measures within and independent measures between groups .
correlation analysis was applied using rest software22 to detect the relationship of the reho values in the above significant areas to duration , rss , sas and sds scores of pd patients .
the significance level was set at p<0.05 ( fdr corrected ) . considering that half of the pd patients experienced no pain during the scanning in menstrual phase , here we chose rss as the symptom score instead of sf - mpq .
thirty - four right - handed pd patients ( 21.51.2 years ) and 34 age - matched right - handed hc females ( 22.21.7 years ) were enrolled .
all the subjects were recruited from the college students of chengdu university of traditional chinese medicine ( tcm ) and sichuan university .
the inclusion criteria of pd were primary dysmenorrhea ( diagnosed by the details of menstrual questionnaires and pelvic ultrasound ) ; regular menstrual cycle ( 283 days ) and normal duration of menstruation ( 37 days ) ; moderate or severe abdominal cramp pain ( > 4 points on a visual analog scale in which 0 means no pain and 10 means the worst pain ) ; suffered an attack at least 4 months in the past 6 months ; nulliparous and nonsmoker .
the exclusion criteria for all the subjects were secondary dysmenorrhea induced by endometriosis or pelvic inflammatory disease ( excluded by pelvic ultrasound ) ; recurrent pelvic or lower abdominal pain ; gastrointestinal diseases including recurrent gastritis , gastric or duodenal ulcer ; chronic pain ; pregnant or intending to become pregnant during the course of the trial ; history or evidence of serious diseases , neurological or psychiatric diseases ; receiving nonsteroidal anti - inflammatory drugs ( nsaids ) ( including aspirin ) or analgesics or alcohol within 24 h leading up to magnetic resonance imaging ( mri ) scanning ; receiving oral contraceptives within 6 months prior to the study and any contraindication of mri scanning .
this project was approved by the west china hospital research ethics committee , and written informed consent was obtained from each subject .
one scan was performed on the 1st3rd day of the menstrual cycle ( menstrual phase ) , while the other scan was performed on the 10th12th day of the menstrual cycle ( follicular phase ) .
short - form mcgill pain questionnaire ( sf - mpq ) and cox retrospective symptom scale ( rss)18 were used to evaluate the menstrual pain and associated symptoms experienced by each pd patient retrospectively in the past 3 months .
sf - mpq was also completed only before menstrual phase scan , and the questionnaire was replaced with an oral question by supposing there was no pain before follicular phase scan .
self - rating anxiety scale ( sas ) and self - rating depression scale ( sds ) were applied to assess the subject s anxiety and depression level prior to each scan .
a standard birdcage head coil of a 3 t siemens scanner ( allegra , siemens medical system ) was used to collect imaging data at the huaxi mr research center , west china hospital of sichuan university , chengdu , china . restraining foam pads were accompanied to minimize head motion and diminish the scanner noise . during the scan
, subjects were requested to close the eyes and keep still in the supine position . in follicular phase
, functional images were scanned using a gradient - echo echo planar imaging sequence ( repetition time [ tr ] = 2000 ms ; echo time [ te ] = 30 ms ; flip angle = 90 ; slices = 30 ; field of view [ fov ] = 240 mm 240 mm ; in - plane matrix resolution = 64 64 ; in - plane resolution = 3.75 mm 3.75 mm ) .
after that , high - resolution t1-weighted images were acquired ( tr = 1900 ms ; te = 2.26 ms ; flip angle = 9 ; slices = 176 ; slices thickness = 1 mm , fov = 256 mm 256 mm ; data matrix = 256 256 ; in - plane resolution = 1 mm 1 mm ) . in menstrual phase
preprocessing of the resting - state fmri data was performed using spm8 software package19 and composed of the following steps .
abandoned the first five images of each functional time series for the longitudinal magnetization to reach equilibrium ;
slice - timing adjusted and realigned to the first volume ; motion - corrected by estimating six parameters capturing translation and angular rotation relative to the first volume ( 2 mm or 2 degrees rotation was discarded ) ; normalized to montreal neurologic institute ( mni ) space using the normalization parameters estimated by t1 structural image unified segmentation and re - sampled to 3 mm voxels ; removed estimated motion parameters , linear drift and average bold signals in ventricular and white matter regions through linear regression and reduced the effect of low - frequency drifts and high - frequency noise by temporal band pass filtering ( 0.010.08 hz ) .
individual reho maps were generated by calculating kcc , used to measure the correlation of the time series of a given voxel with the time series of its 26 nearest neighbors , within a prepared mask including the following regions : superior frontal cortex , middle frontal cortex ( mfc ) , medial frontal cortex , inferior frontal cortex ( ifc ) , ofc , precentral , primary somatosensory area ( s1 ) , secondary somatosensory area ( s2 ) , inferior parietal cortex , cuneus , precuneus ( pcu ) , middle temporal cortex ( mtc ) , inferior temporal cortex ( itc ) , insula , anterior and posterior cingulate cortex ( pcc ) , thalamus , basal ganglia , hippocampus and brainstem .
when the center cube was on the edge of the mask , we only calculated reho for a vessel if all the remaining nearest boxes were within the mask . for each participant ,
the kcc map was normalized by dividing kcc in each voxel by the mean kcc of the mask .
at last , smooth was applied with a three - dimensional ( 3d ) gaussian kernel ( full width at half maximum [ fwhm ] = 6 mm ) to reduce noise and residual differences in gyral anatomy .
two independent samples t - test were used to examine the consistency of age , body mass index , the onset of menses , length of menstrual cycle and menstrual phase and the differences of psychological scores ( sf - mpq , rss , sas and sds ) between pd patients and hc by using spss 20.0 .
all p - values were two - sided , and p<0.05 was considered statistically significant . in the group analysis , age was regressed out as covariate .
statistical maps were evaluated to determine the differences in reho values with a significance voxel level of p<0.05 ( false discovery rate [ fdr ] corrected ) by using permutation test ( snpm13)21 in the following contrasts : 1 ) group differences between pd and hc in both menstrual phase [ pd(mens ) hc(mens ) ] and follicular phase ( non - menstrual phase ) [ pd(non ) hc(non ) ] were examined separately with two - sample t - test .
2 ) the interaction between phase and group [ pd(mens - non ) hc(mens - non ) ] was examined by repeating ( mens - non ) measures within and independent measures between groups .
correlation analysis was applied using rest software22 to detect the relationship of the reho values in the above significant areas to duration , rss , sas and sds scores of pd patients .
considering that half of the pd patients experienced no pain during the scanning in menstrual phase , here we chose rss as the symptom score instead of sf - mpq .
thirty - three pd patients and 32 hc volunteers completed all the scans very well .
there was no significant difference between the two groups in age , body mass index , the onset of menses , length of menstrual cycle and menstrual phase .
retrospective sf - mpq , rss scores and sf - mpq scores of patients in menstrual phase were remarkably higher than hc group .
the patients also obtained higher sas and sds scores both in menstrual phase and in non - menstrual phase than hcs ( table 1 ) . in menstrual phase
, the reho values of the pd patients significantly increased in left midbrain and hippocampus , right pcc , mtc and insula and decreased in left dorsolateral prefrontal cortex ( dlpfc ) and right mpfc ( table 2 ; figure 1a ) . among these areas , midbrain and hippocampus survived the phase and group interaction differences ( table 2 ; figure 1c ) .
the other regions did not survive , indicating that these regions in the group differences were not statistically significant across phases . in non - menstrual phase
, enhanced reho values were found in bilateral s1 and pcu , left s2 and mtc .
reduced reho values were observed in left ofc and mpfc ( table 2 ; figure 1b ) .
furthermore , the results of the interaction displayed three more areas that did not exist in either phase , including left pons , itc and right temporal pole ( tp ) ( table 1 ; figure 1c ) .
the correlations between questionnaire scores and the regions that showed significant reho value changes during group comparisons in both phases were analyzed . during menstrual phase ,
rss score was positively correlated with the reho values of midbrain and negatively related to mpfc and pcc .
in addition , there was a negative correlation between the reho value of pcc and sas scores ( figure 2 ) .
no obvious correlation between questionnaire scores and the regions with abnormal reho values was detected in non - menstrual phase .
thirty - three pd patients and 32 hc volunteers completed all the scans very well .
there was no significant difference between the two groups in age , body mass index , the onset of menses , length of menstrual cycle and menstrual phase .
retrospective sf - mpq , rss scores and sf - mpq scores of patients in menstrual phase were remarkably higher than hc group .
the patients also obtained higher sas and sds scores both in menstrual phase and in non - menstrual phase than hcs ( table 1 ) .
in menstrual phase , the reho values of the pd patients significantly increased in left midbrain and hippocampus , right pcc , mtc and insula and decreased in left dorsolateral prefrontal cortex ( dlpfc ) and right mpfc ( table 2 ; figure 1a ) . among these areas , midbrain and hippocampus survived the phase and group interaction differences ( table 2 ; figure 1c ) .
the other regions did not survive , indicating that these regions in the group differences were not statistically significant across phases . in non - menstrual phase , enhanced reho values were found in bilateral s1 and pcu , left s2 and mtc .
reduced reho values were observed in left ofc and mpfc ( table 2 ; figure 1b ) .
furthermore , the results of the interaction displayed three more areas that did not exist in either phase , including left pons , itc and right temporal pole ( tp ) ( table 1 ; figure 1c ) .
the correlations between questionnaire scores and the regions that showed significant reho value changes during group comparisons in both phases were analyzed . during menstrual phase ,
rss score was positively correlated with the reho values of midbrain and negatively related to mpfc and pcc .
in addition , there was a negative correlation between the reho value of pcc and sas scores ( figure 2 ) .
no obvious correlation between questionnaire scores and the regions with abnormal reho values was detected in non - menstrual phase .
in this study , we used reho analytical method to explore the resting - state spontaneous brain activity of pd patients in different phases .
the present results demonstrated that the altered reho value regions were varied with the phases of menstrual cycle in pd patients , which was corresponding with the previous structural and functional neuroimaging findings of pd.6,8 the abnormal reho value regions were mostly involved in the pain modulation network and dmn in menstrual phase and sensorimotor processing and dmn in non - menstrual phase .
furthermore , midbrain , mpfc and pcc were correlated with the clinical symptom scores in pd patients , and pcc also exhibited correlation with anxiety score .
accumulated evidences indicate that dysregulation in descending pain modulation makes a significant contribution to the development of chronic pain.23 in this study , increased reho values were observed in midbrain , which is considered as a key role in the endogenous descending pain inhibitory system.24 both animal and human studies have proved that the pag is rich in opioid receptors and manifests a notable analgesic effect.24,25 various chronic pain such as migraine , chronic low back pain and fibromyalgia presented gm alterations or abnormal functional connectivity in pag , and the dysfunction might be a potential pathogenic mechanism of chronic pain.2629 an acupuncture research further supported this point based on the results that the functional connectivity between pag and rostral acc in migraine patients restoratively increased after treatment and the recovery was significantly associated with clinical symptom improvement.30 previous studies of pd patients have also showed that the regional gm volume in midbrain was increased compared with hcs , and the functional connectivity of pag with dlpfc and dmn appeared maladaptive decreased.4,8 similarly , the correlation of midbrain and rss score in our results inferred that the symptoms of pd patients were closely related to the dysfunction of the midbrain .
the survival of pag during interaction analysis revealed its abnormal spontaneous activity altered with the menstrual phase .
it had been suggested that dlpfc is another important region in descending pain modulation pathway and might act as a pain inhibitor during pain processing.31 insula , which showed disordered functional connectivity to pfc in chronic pain and intrinsic connectivity with pag,32,33 was also involved in the descending pain modulation.34 a heat allodynia study implied that the effect of pain control in dlpfc might derive from suppressing the activity of insula , midbrain and medial thalamic.35 when painful stimulation was controllable , the negative connectivity between dlpfc and insula was increased and that could be the downregulation effect of dlpfc to pain - evoked activation.36 in chronic pain patients , the abnormal gm structure was found in dlpfc and insula,37,38 and the abnormal changes restored in accordance with the reduction of pain and physical disability after treatment.39 the pd studies have been reported that the decreased metabolism was observed in dlpfc and insula3 and the cortical thickness of insula was significantly increased;7 both the regional gm volumes of dlpfc and insula covaried negatively with the menstrual pain experience.4 this study presented the consistent findings that reho values decreased in dlpfc and insula in menstrual phase of pd patients .
therefore , we suggested that the spontaneous activities of pd patients are abnormal in descending pain modulation during menstrual phase .
in this study , a majority of reho values changed regions gathered in dmn , including mpfc , pcc , hippocampus and mtc in menstrual phase and mpfc , pcu and mtc in non - menstrual phase .
dmn is referred to brain activation of subjects when they received no task or pay no attention to the present sensory world by using resting - state functional mri.40 it is considered as one of the most important networks for pain connectome and plays a significant role in the persistence of pain.41 in chronic pain conditions , the functional connectivity within dmn , especially chronic pain hubs pcc / pcu and mpfc to other regions , exhibited abnormal enhancement or diminution.4244 the aberrant functional connectivity between dmn and other regions such as insula and pag also had been reported.42,4447 furthermore , following therapy , the restorative reduction of connectivity between the dmn and insula correlated positively with diminished clinical pain.46 similarly with other chronic pain , a resting - state study of pd patients showed hypoconnectivity between ventromedial pfc and acc and hyperconnectivity between ventromedial pfc and dorsomedial pfc during both menstrual phase and non - menstrual phase.9 our research found that the spontaneous activation of dmn dynamically changed in pd patients across the menstrual cycle comparing with hcs , which was in keeping with the previous findings .
moreover , the results also displayed significant relations between dmn ( mpfc and pcc ) and rss scores in menstrual phase , and then we suggested that dmn might contribute to maintaining the cramps in pd patients during menstrual phase .
ofc was considered as the crucial region in sensory integration , self - control and emotional expression.48,49 patients presented the corresponding behavioral changes such as deficit in recognition of emotional expression following ofc lesions.49 the animal study had been proved that the ofc was selectively connected with other prefrontal ( dlpfc and mpfc ) and sensory cortices including olfactory , gustatory , somatosensory , auditory and visual processing and the amygdala.50 furthermore , ofc was found to participate in pain modulation.5153 the irritable bowel syndrome patients exhibited enhanced cortical thickness in ofc , and the cortical thickening was strongly correlated with greater severity of abdominal pain complaints.51 the ofc of pd patients also manifested increased cortical thickness and hypermetabolism , and the abnormal changes were separately correlations with pd durations and pain ratings.3,7 in agreement with this , we found the decreased reho values of ofc in pd patients in non - menstrual phase compared with hc group .
meanwhile , the reho values of s1 and s2 enhanced in non - menstrual phase .
the aberrant spontaneous activities in ofc , s1 and s2 might implicate in hyperalgesia or allodynia in pd patients even in the absence of pain.54,55 there are some limitations in this study .
it is difficult to collect image on time in pd patients when the cramp occurring , so about half of the patients did not experience noticeable pain during the menstrual phase scanning .
we evaluated only the regional spontaneous activities in this study ; brain networks of pd patients will be explored in the future .
accumulated evidences indicate that dysregulation in descending pain modulation makes a significant contribution to the development of chronic pain.23 in this study , increased reho values were observed in midbrain , which is considered as a key role in the endogenous descending pain inhibitory system.24 both animal and human studies have proved that the pag is rich in opioid receptors and manifests a notable analgesic effect.24,25 various chronic pain such as migraine , chronic low back pain and fibromyalgia presented gm alterations or abnormal functional connectivity in pag , and the dysfunction might be a potential pathogenic mechanism of chronic pain.2629 an acupuncture research further supported this point based on the results that the functional connectivity between pag and rostral acc in migraine patients restoratively increased after treatment and the recovery was significantly associated with clinical symptom improvement.30 previous studies of pd patients have also showed that the regional gm volume in midbrain was increased compared with hcs , and the functional connectivity of pag with dlpfc and dmn appeared maladaptive decreased.4,8 similarly , the correlation of midbrain and rss score in our results inferred that the symptoms of pd patients were closely related to the dysfunction of the midbrain .
the survival of pag during interaction analysis revealed its abnormal spontaneous activity altered with the menstrual phase .
it had been suggested that dlpfc is another important region in descending pain modulation pathway and might act as a pain inhibitor during pain processing.31 insula , which showed disordered functional connectivity to pfc in chronic pain and intrinsic connectivity with pag,32,33 was also involved in the descending pain modulation.34 a heat allodynia study implied that the effect of pain control in dlpfc might derive from suppressing the activity of insula , midbrain and medial thalamic.35 when painful stimulation was controllable , the negative connectivity between dlpfc and insula was increased and that could be the downregulation effect of dlpfc to pain - evoked activation.36 in chronic pain patients , the abnormal gm structure was found in dlpfc and insula,37,38 and the abnormal changes restored in accordance with the reduction of pain and physical disability after treatment.39 the pd studies have been reported that the decreased metabolism was observed in dlpfc and insula3 and the cortical thickness of insula was significantly increased;7 both the regional gm volumes of dlpfc and insula covaried negatively with the menstrual pain experience.4 this study presented the consistent findings that reho values decreased in dlpfc and insula in menstrual phase of pd patients . therefore , we suggested that the spontaneous activities of pd patients are abnormal in descending pain modulation during menstrual phase .
in this study , a majority of reho values changed regions gathered in dmn , including mpfc , pcc , hippocampus and mtc in menstrual phase and mpfc , pcu and mtc in non - menstrual phase .
dmn is referred to brain activation of subjects when they received no task or pay no attention to the present sensory world by using resting - state functional mri.40 it is considered as one of the most important networks for pain connectome and plays a significant role in the persistence of pain.41 in chronic pain conditions , the functional connectivity within dmn , especially chronic pain hubs pcc / pcu and mpfc to other regions , exhibited abnormal enhancement or diminution.4244 the aberrant functional connectivity between dmn and other regions such as insula and pag also had been reported.42,4447 furthermore , following therapy , the restorative reduction of connectivity between the dmn and insula correlated positively with diminished clinical pain.46 similarly with other chronic pain , a resting - state study of pd patients showed hypoconnectivity between ventromedial pfc and acc and hyperconnectivity between ventromedial pfc and dorsomedial pfc during both menstrual phase and non - menstrual phase.9 our research found that the spontaneous activation of dmn dynamically changed in pd patients across the menstrual cycle comparing with hcs , which was in keeping with the previous findings .
moreover , the results also displayed significant relations between dmn ( mpfc and pcc ) and rss scores in menstrual phase , and then we suggested that dmn might contribute to maintaining the cramps in pd patients during menstrual phase .
ofc was considered as the crucial region in sensory integration , self - control and emotional expression.48,49 patients presented the corresponding behavioral changes such as deficit in recognition of emotional expression following ofc lesions.49 the animal study had been proved that the ofc was selectively connected with other prefrontal ( dlpfc and mpfc ) and sensory cortices including olfactory , gustatory , somatosensory , auditory and visual processing and the amygdala.50 furthermore , ofc was found to participate in pain modulation.5153 the irritable bowel syndrome patients exhibited enhanced cortical thickness in ofc , and the cortical thickening was strongly correlated with greater severity of abdominal pain complaints.51 the ofc of pd patients also manifested increased cortical thickness and hypermetabolism , and the abnormal changes were separately correlations with pd durations and pain ratings.3,7 in agreement with this , we found the decreased reho values of ofc in pd patients in non - menstrual phase compared with hc group .
meanwhile , the reho values of s1 and s2 enhanced in non - menstrual phase . the aberrant spontaneous activities in ofc , s1 and s2 might implicate in hyperalgesia or allodynia in pd patients even in the absence of pain.54,55 there are some limitations in this study .
it is difficult to collect image on time in pd patients when the cramp occurring , so about half of the patients did not experience noticeable pain during the menstrual phase scanning .
we evaluated only the regional spontaneous activities in this study ; brain networks of pd patients will be explored in the future .
the imaging data presented here implied that pd is accompanied by dynamic regional spontaneous activity changes during menstrual phase and non - menstrual phase .
the abnormal activated regions were basically involved in descending pain modulation pathways , dmn and sensory processing . among these regions , midbrains , mpfc and pcc were correlated with symptom experience during menstrual phase . in light of the results , we suggest that abnormal activations of descending pain modulation network and dmn may have close correlations with the maintenance of menstrual pain . it remains to be illuminated the causal relationship between these functional changes and the repeated regular cramps . | purposethis study aimed to investigate the regional spontaneous brain activity changes in primary dysmenorrhea ( pd ) patients in different phases of the menstrual cycle by regional homogeneity ( reho ) analysis.patients and methodsthirty - three pd patients and 32 healthy controls ( hcs ) separately received resting - state functional magnetic resonance imaging during menstrual phase and follicular phase ( non - menstrual phase ) .
cox retrospective symptom scale ( rss ) , self - rating anxiety scale ( sas ) and self - rating depression scale ( sds ) were applied to assess related symptoms and emotions.resultsthere was no significant difference between the two groups in demographic data .
the pd patients obtained higher rss score , sas score and sds score than hcs . compared with hcs
, the reho values of the pd patients were increased in left midbrain and hippocampus , right posterior cingulate cortex ( pcc ) , insula and middle temporal cortex ( mtc ) and decreased in left dorsolateral prefrontal cortex and right medial prefrontal cortex ( mpfc ) in menstrual phase . in non
- menstrual phase , enhanced reho values were found in bilateral s1 and precuneus , left s2 and mtc , and reduced reho values were observed in left mpfc and orbital frontal cortex .
rss score positively correlated with reho values of midbrain and negatively correlated with mpfc and pcc.conclusionour results suggested that pd is accompanied by dynamic regional spontaneous activity changes across the menstrual cycle , and the altered regions were involved in descending pain modulation , default mode network and sensory modulation .
these abnormal activations might contribute to maintain the menstrual pain . |
peyronie 's disease ( pd ) can be a debilitating psychosexual condition affecting up to 9% of adult men and is characterized by a constellation of penile symptoms and signs such as penile pain , deformity and plaque , with ensuing erectile dysfunction ( ed ) . while no one truly knows the underlying pathophysiology of pd , it is generally agreed that pd is considered an abnormal wound healing disorder as a consequence of repetitive trauma to the erect penis resulting in fibrous plaque formation within the bi - layer of tunica albuginae in the genetically susceptible individuals .
this fibrotic , inelastic scar gives rise to penile curvature on the contralateral side when the penis is erect . at present ,
pd process can be divided into 2 main phases , acute ( inflammatory ) and chronic ( stable ) stages . in the acute phase of pd
, a patient usually describes a new onset of ( less than 6 months ) penile pain and penile curvature .
if left untreated , pd is a progressive sexual disorder in nearly 50% of men . since the disease process continues to evolve in the early phase , it is likely that the use of noninvasive therapy to halt and/or alter the disease progression may be effective .
low intensity extracorporeal shock wave therapy ( lieswt ) has been used to treat men with pd since the late 1980s .
while the clinical outcomes of lieswt in pd has been mixed , in recent years there has been a renewed interest in the use of lieswt .
we evaluate the efficacy , safety and patient satisfaction rate following lieswt in australian men with pd using a standardised protocol .
following internal departmental ethics approval , patients with pd were prospectively enrolled from june 2013 to march 2014 in this open - label single arm study at the department of urology , princess alexandra hospital , brisbane , australia .
all patients received informed consent based on contemporary literature regarding lieswt and were given the option to undergo surgery .
inclusion criteria included patient age 18 years , failed medical therapy , presence of palpable plaque and/or penile pain , and penile curvature .
exclusion criteria were complex curvature ( more than 1 axis deviation or curvature > 90 degrees ) , hourglass deformity , 2 or more palpable plaques , previous peyronie 's surgery ( including penile prosthesis implant ) and significant ed unresponsive to medical therapy .
penile curvature and plaque hardness , pain ( on a visual analog scale ranging from 0 equals no pain to 10 equals strong pain ) , and international index of erectile function ( iief)-5 score were assessed at initial consultation , 6 weeks and 3 months following completion of lieswt study .
assessment of penile curvature on erection was made based on digital photograph of the erect penis or in - room intracavernosal injection of 10 - 20 mcg of alprostadil to induce maximal penile erection .
measurement of plaque size was performed by clinical palpation to document the length and width of the plaque .
patients were asked to score their overall satisfaction rate on a 5-point scale at the end of the treatment period .
the lieswt was performed without local or systemic analgesia using duolith sd1 ultra ( storz medical ag , tgerwilen , switzerland ) in the outpatient setting .
patients received instruction on the mechanics and procedure on lieswt before informed consent was signed .
each patient stretched his penis fully by holding onto his glans penis with one hand while his other hand held the transducer and placed the probe directly onto the penile plaque .
a clinical nurse will check on each patient at the start of treatment cycle to ensure that the patient adhered to protocol and that the probe was placed correctly over the peyronie 's plaque .
it was explained to the patients that they would hear the generator noise during the course of lieswt and that they will feel some minor discomfort along the penile shaft . since no patient had undergone lieswt before this study ; therefore , no patient was aware of how this treatment felt like . throughout each treatment session , a clinical nurse will periodically review the patient for any adverse event and to ensure correct positioning of probe .
all patients were treated twice weekly for 6 weeks , comprising of 3000 shock waves to the peyronie 's plaque per session with constant energy flow density of 0.25 mj / mm and emission frequency of 3 hz according to the manufacturer 's guidelines .
the shock wave generator implemented in our study has been used in the treatment of tenosynovitis and tendonitis .
cary , nc , usa ) computer software with comparison of pre- and posttreatment parameters at the 6 weeks and 3 months using paired t - test and mcnemar chi - square test with p<0.05 considered statistical significant .
following internal departmental ethics approval , patients with pd were prospectively enrolled from june 2013 to march 2014 in this open - label single arm study at the department of urology , princess alexandra hospital , brisbane , australia .
all patients received informed consent based on contemporary literature regarding lieswt and were given the option to undergo surgery .
inclusion criteria included patient age 18 years , failed medical therapy , presence of palpable plaque and/or penile pain , and penile curvature .
exclusion criteria were complex curvature ( more than 1 axis deviation or curvature > 90 degrees ) , hourglass deformity , 2 or more palpable plaques , previous peyronie 's surgery ( including penile prosthesis implant ) and significant ed unresponsive to medical therapy .
penile curvature and plaque hardness , pain ( on a visual analog scale ranging from 0 equals no pain to 10 equals strong pain ) , and international index of erectile function ( iief)-5 score were assessed at initial consultation , 6 weeks and 3 months following completion of lieswt study .
assessment of penile curvature on erection was made based on digital photograph of the erect penis or in - room intracavernosal injection of 10 - 20 mcg of alprostadil to induce maximal penile erection .
measurement of plaque size was performed by clinical palpation to document the length and width of the plaque .
patients were asked to score their overall satisfaction rate on a 5-point scale at the end of the treatment period .
the lieswt was performed without local or systemic analgesia using duolith sd1 ultra ( storz medical ag , tgerwilen , switzerland ) in the outpatient setting .
patients received instruction on the mechanics and procedure on lieswt before informed consent was signed .
each patient stretched his penis fully by holding onto his glans penis with one hand while his other hand held the transducer and placed the probe directly onto the penile plaque .
a clinical nurse will check on each patient at the start of treatment cycle to ensure that the patient adhered to protocol and that the probe was placed correctly over the peyronie 's plaque .
it was explained to the patients that they would hear the generator noise during the course of lieswt and that they will feel some minor discomfort along the penile shaft . since no patient had undergone lieswt before this study ; therefore , no patient was aware of how this treatment felt like . throughout each treatment session , a clinical nurse will periodically review the patient for any adverse event and to ensure correct positioning of probe .
all patients were treated twice weekly for 6 weeks , comprising of 3000 shock waves to the peyronie 's plaque per session with constant energy flow density of 0.25 mj / mm and emission frequency of 3 hz according to the manufacturer 's guidelines .
the shock wave generator implemented in our study has been used in the treatment of tenosynovitis and tendonitis .
statistical analysis was performed with sas 9.1.3 ( sas institute inc . , cary , nc , usa ) computer software with comparison of pre- and posttreatment parameters at the 6 weeks and 3 months using paired t - test and mcnemar chi - square test with p<0.05 considered statistical significant .
over the 10 months period , a total of 30 patients gave consent and were recruited in the study .
the average age was 55 years ( range , 42 - 68 years ) and 27 patients ( 90% ) reported the presence of penile curvature and/or deformity longer than 6 months ( mean , 12.8 months ; range , 6 - 24 months ) .
the range of penile curvature was 15 to 90 degrees and dorsal ( 12 patients , 40% ) and left ( 10 patients , 33% ) sided curvatures were most common .
penile plaque was palpable in all patients and 24 patients ( 80% ) had palpable plaque size greater than 2 cm2 cm .
twenty of patients ( 66% ) had received and failed medical therapy ( 10 patients received topical vitamin e , 5 patients had oral phentoxifylline , and 5 patients had oral colchicine therapies ) .
ten patients ( 33% ) complained of concurrent mild to moderate ed but were responsive to oral phosphodiesterase ( pde ) 5 inhibitors . at the 6 weeks
posttreatment assessment , there was an improvement in penile curvature ( more than 15 degrees ) observed in 10 patients ( 33% ) with the range of improvement varying between 15 to 60 degrees .
two patients ( 7% ) noticed worsening of penile curvature ( 15 and 20 degrees ) while 10 patients ( 33% ) did not noticed any change in penile curvature ( fig .
1 ) . while the exact measurement of plaque volume was not feasible , no increase in penile plaque size was observed and 18 patients ( 60% ) reported softening of the peyronie 's plaque on physical examination following lieswt with a reduction in palpable penile plaque size by 2 cm observed in 8 patients ( 27% ) .
there was no significant difference found in the stretched penile length pre- and post - eswl despite improvements in penile curvature and reduction in peyronie 's plaque size ( p=0.48 ) .
of the 6 patients who had penile pain , 4 patients ( 67% ) reported resolution of pain during the course of therapy . of the 10 patients who have ed , there was a moderate improvement in iief-5 score ( > 5 points ) reported in 6 patients ( 60% ) and 2 patients were able to resume sexual intercourse without oral pde5 inhibitors .
all patients completed the lieswt course and there was no drop out in this study .
most patients ( 90% ) scored less than 2 out of 10 on the pain visual analog scale and none of the patients reported any persistent pain lasting more than 12 hours .
the majority of patients ( 70% ) were satisfied and rated 4 out of 5 in the overall satisfaction level .
there is a strong positive correlation between changes in penile curvature and patient satisfaction outcome ( p=0.03 ) and more than two - third of patients would recommend lieswt to their friends or family members .
over the 10 months period , a total of 30 patients gave consent and were recruited in the study .
the average age was 55 years ( range , 42 - 68 years ) and 27 patients ( 90% ) reported the presence of penile curvature and/or deformity longer than 6 months ( mean , 12.8 months ; range , 6 - 24 months ) .
the range of penile curvature was 15 to 90 degrees and dorsal ( 12 patients , 40% ) and left ( 10 patients , 33% ) sided curvatures were most common .
penile plaque was palpable in all patients and 24 patients ( 80% ) had palpable plaque size greater than 2 cm2 cm .
twenty of patients ( 66% ) had received and failed medical therapy ( 10 patients received topical vitamin e , 5 patients had oral phentoxifylline , and 5 patients had oral colchicine therapies ) .
ten patients ( 33% ) complained of concurrent mild to moderate ed but were responsive to oral phosphodiesterase ( pde ) 5 inhibitors .
at the 6 weeks posttreatment assessment , there was an improvement in penile curvature ( more than 15 degrees ) observed in 10 patients ( 33% ) with the range of improvement varying between 15 to 60 degrees .
two patients ( 7% ) noticed worsening of penile curvature ( 15 and 20 degrees ) while 10 patients ( 33% ) did not noticed any change in penile curvature ( fig .
1 ) . while the exact measurement of plaque volume was not feasible , no increase in penile plaque size was observed and 18 patients ( 60% ) reported softening of the peyronie 's plaque on physical examination following lieswt with a reduction in palpable penile plaque size by 2 cm observed in 8 patients ( 27% ) .
there was no significant difference found in the stretched penile length pre- and post - eswl despite improvements in penile curvature and reduction in peyronie 's plaque size ( p=0.48 ) .
of the 6 patients who had penile pain , 4 patients ( 67% ) reported resolution of pain during the course of therapy .
of the 10 patients who have ed , there was a moderate improvement in iief-5 score ( > 5 points ) reported in 6 patients ( 60% ) and 2 patients were able to resume sexual intercourse without oral pde5 inhibitors .
all patients completed the lieswt course and there was no drop out in this study .
most patients ( 90% ) scored less than 2 out of 10 on the pain visual analog scale and none of the patients reported any persistent pain lasting more than 12 hours .
the majority of patients ( 70% ) were satisfied and rated 4 out of 5 in the overall satisfaction level .
there is a strong positive correlation between changes in penile curvature and patient satisfaction outcome ( p=0.03 ) and more than two - third of patients would recommend lieswt to their friends or family members .
at the 6 weeks posttreatment assessment , there was an improvement in penile curvature ( more than 15 degrees ) observed in 10 patients ( 33% ) with the range of improvement varying between 15 to 60 degrees .
two patients ( 7% ) noticed worsening of penile curvature ( 15 and 20 degrees ) while 10 patients ( 33% ) did not noticed any change in penile curvature ( fig .
1 ) . while the exact measurement of plaque volume was not feasible , no increase in penile plaque size was observed and 18 patients ( 60% ) reported softening of the peyronie 's plaque on physical examination following lieswt with a reduction in palpable penile plaque size by 2 cm observed in 8 patients ( 27% ) .
there was no significant difference found in the stretched penile length pre- and post - eswl despite improvements in penile curvature and reduction in peyronie 's plaque size ( p=0.48 ) .
of the 6 patients who had penile pain , 4 patients ( 67% ) reported resolution of pain during the course of therapy .
of the 10 patients who have ed , there was a moderate improvement in iief-5 score ( > 5 points ) reported in 6 patients ( 60% ) and 2 patients were able to resume sexual intercourse without oral pde5 inhibitors .
all patients completed the lieswt course and there was no drop out in this study .
most patients ( 90% ) scored less than 2 out of 10 on the pain visual analog scale and none of the patients reported any persistent pain lasting more than 12 hours .
the majority of patients ( 70% ) were satisfied and rated 4 out of 5 in the overall satisfaction level .
there is a strong positive correlation between changes in penile curvature and patient satisfaction outcome ( p=0.03 ) and more than two - third of patients would recommend lieswt to their friends or family members .
published literature reports that the decrease in penile curvature varies between 21% and 74% among men who received lieswt . however
clinical outcomes in recent randomised controlled trials showed an actual change of less than 10 compared to control group .
in addition , hatzichristodoulou et al . reported an increase in penile deviation in 40% of patients following lieswt although only 5 patients ( 10.9% ) showed an increase in plaque size in this group . in our study , the improvement in penile curvature was observed in 33% of men and of these men , two - thirds reported a decrease in penile curvature from 30-60 to < 30. similarly our study showed a reduction in penile plaque by 2 cm in 8 of our patients ( 27% ) at the completion of lieswt , and the change in plaque size appears to correlate with the improvement in penile curvature .
however it should be noted that our measurement of plaque size is two dimensional ( i.e. , not actual plaque volume ) as plaque measurement is often be inaccurate and/or not feasible due to several factors such as operator dependent , configuration of the plaque and the use of appropriate ultrasound software .
furthermore it should be emphasized that our study lacks the control group and therefore we are not able to directly compare the natural progression and/or regression of pd against the success of lieswt .
the improvement in penile curvature observed in our study in contrast to some of the published studies could be attributed to several factors .
firstly , we excluded all patients with complex pd such as the presence of more than 1 axis of penile curvature , curvature greater than 90 , presence of hour - glass deformity , and men with 2 or more palpable peyronie 's plaques .
secondly those men who reported improvement in penile curvature had pd history less than 12 months , indicating likely an active disease process which is more susceptible to mechanical effect . while the exact pathophysiology of pd remains largely unknown , the limited information available to date on the cellular basis of pd points to distinct alterations in wound healing and propagation of fibrotic process as the underlying cause .
therefore it is likely that treatment instituted during the active phase of pd will have the greatest impact and may alter the disease process . in our cohort ,
the 10 patients who reported improvement in penile curvature had mild plaque and duration of pd less than 12 months .
furthermore there was correspondingly softening and reduction in penile plaque size in this successful group of lieswt men .
it may be possible that lieswt has a protective effect on pd progression by stabilizing the penile curvature and plaque progression and actual underlying histological changes within the peyronie 's plaque .
in contrast to published literature supporting the role of lieswt in men with ed , the reported changes in erectile function following lieswt in pd has been mixed .
while iief-5 score is frequently used to evaluate sexual function in men with pd , it has never been specifically validated for use in this disease state .
published meta - analysis in 2004 reported that the improvement in sexual function varies from 12% to 80% .
however more recent studies have found no significant difference between lieswt and control group . in our study , a small minority of patients reported an increase in erectile function and this improvement in iief score was seen in the 6 men who reported mild to moderate ed prior to lieswt .
we postulated that the improvement in the penile curvature with easier sexual penetration , and perhaps underlying neovascularization induced by lieswt might play a role in the greater erectile function . however
any improvement in sexual function should be evaluated using formal penile hemodynamics study over a longer interval period .
prolonged history of pd and presence of plaque calcification , as a marker of chronicity , indicate unlikely history of spontaneous regression .
we acknowledge the various limitations in our study such as the lack of a sham ( control ) arm , objective penile hemodynamic measurements , small number of participants and short term follow - up study .
in addition , detailed documentation of disease including sonographic changes such as tunical thickening , cavernosal calcification and fibrosis undertaken by an independent examiner will minimise certain biases . furthermore
, our treatment protocol is based on manufacturer 's guidelines and is likely derived from previous orthopaedic literature . while published literature has largely failed to demonstrate significant benefit in the use of lieswt to treat penile curvature ( table 3 ) , these outcomes should be interpreted with some caution due to underlying methodological flaws and perhaps inappropriate use of shock wave energy flow density .
interestingly , subgroup analysis of patients in the lieswt group showed an overall better outcome in younger patients with a relatively milder degree of curvature .
comparative studies between lieswt with other treatment modality showed that lieswt is not superior to other options and when used in combination with other therapeutic options such as intralesional injection or tadalafil for men with pd and ed , there were improvement in erectile function score and quality of life score while the plaque size and curvature were unchanged .
we agree that the current literature on the use of lieswt in pd population remains controversial .
it may be possible that newer generation of shock wave lithotripter has an improved technology in disrupting the tunical plaque without inducing further plaque formation or injuring the underlying cavernosal tissue .
while the exact therapeutic mechanism remains unclear , it is postulated that lieswt may play a role in plaque remodelling and improvement in consecutive resorption of calcification , resulting in softer plaque and further correction and/or resolution of the penile curvature .
furthermore lieswt may have a protective effect on disease progression by stabilising penile deviation and pd plaques .
therefore it appears that lieswt should ideally be offered and utilised in younger men during the active phase of pd i.e. , less than 6 months with milder degree of curvature and softer noncalcified plaque , and in the absence of hour glass deformity . in a carefully selected group of men with pd
, our study showed that lieswt appears to reduce penile curvature and plaque size in some men , and overall is safe , tolerable and is associated with high level of patient satisfaction .
many men are keen to pursue minimal invasive therapy such as lieswt to preserve penile length since the current surgical intervention is invariably associated with loss of penile length .
nonetheless there is a need to define which subgroup of pd population is best suited , the lieswt protocols ( modality of shock wave energy , emission frequency , and total energy delivery ) and the role of combination therapy in pd .
other important factors such as the actual physiological changes in the penile tissues and the long - term risk of shock waves have yet to be fully elucidated .
lieswt offers a minimally invasive treatment option for men with pd who have failed conventional medical therapy and are not keen to undergo surgical intervention . in a carefully selected group of men with pd characteristics
, lieswt appears to be safe , has moderate efficacy in improving penile curvature and pain , and is associated with high level of patient satisfaction rate in this short term study . | purposeto evaluate the efficacy , safety and patient satisfaction outcomes following low intensity extracorporeal shock wave therapy ( lieswt ) in men with peyronie 's disease ( pd ) using a standardised protocol.materials and methodsin this open - label single arm prospective study , patients with pd were enrolled following informed consent .
patient demographics , change in penile curvature and plaque hardness , international index of erectile function ( iief)-5 score , and overall satisfaction score ( on a 5-point scale ) were recorded .
treatment template consists of 3000 shock waves to the peyronie 's plaque over 20 minutes , twice weekly for 6 weeks.resultsthe majority of patients have pd history longer than 6 months ( mean , 12.8 months ; range , 6 - 28 months ) .
two thirds of patients have received and failed oral medical therapy .
there were improvements in penile curvature ( more than 15 degrees in 33% of men ) , plaque hardness ( 60% of men ) and penile pain ( 4 out of 6 men ) following lieswt .
there was a moderate improvement in iief-5 score ( > 5 points reported in 20% of men ) .
no complication was reported and the majority of patients were satisfied ( rated 4 out of 5 ; 70% of men ) and would recommend this therapy to others.conclusionsin a carefully selected group of men with pd , lieswt appears to be safe , has moderate efficacy and is associated with high patient satisfaction rate in the short term . |
acute lymphoblastic leukemia ( all ) is an aggressive hematological tumor resulting from the malignant transformation of lymphoid progenitors . despite intensive chemotherapy , 20% of pediatric and over 50% of adult all patients fail to achieve a complete remission or relapse after intensified chemotherapy , making disease relapse and resistance to therapy the most significant challenge in the treatment of this disease1,2 . using whole exome sequencing , here we identify mutations in the cytosolic 5'-nucleotidase ii gene ( nt5c2 ) , which encodes a 5'-nucleotidase enzyme responsible for inactivation of nucleoside analog chemotherapy drugs , in 20/103 ( 19% ) relapse t - alls and in 1/35 ( 3% ) relapse
b - precursor alls analyzed .
nt5c2 mutant proteins show increased nucleotidase activity in vitro and conferred resistance to chemotherapy with 6-mercaptopurine and 6-thioguanine when expressed in all lymphoblasts .
these results support a prominent role for activating mutations in nt5c2 and increased nucleoside analog metabolism in disease progression and chemotherapy resistance in all . |
|
early - onset neonatal sepsis ( eons ) , defined as occurring in the first 3 days of life , continues to be a leading cause of morbidity and mortality in neonates . diagnosis of sepsis is a formidable challenge for neonatal intensive care units ( nicu ) because clinical signs of sepsis are nonspecific , subtle and are observed in other non - infectious conditions .
furthermore , bacterial cultures are time - consuming , frequently false negative , especially in neonates , due to low or intermittent bacteraemia , small blood inoculation volumes or intrapartum antibiotics use .
recently performed meta - analysis of molecular assays used for early detection of bacteraemia in neonates have yielded disappointing results compared with blood cultures .
thus , despite its limitations , blood cultures still remain a gold standard. to assist in the diagnosis of neonates with suspected sepsis , many laboratory tests including whole blood cell count , differential , immature - to - total neutrophils ( i / t ) ratio , along with acute - phase reactants such as c - reactive protein ( crp ) and procalcitonin ( pct ) , are routinely used .
however , so far none of the single laboratory tests can provide reliable and early identification of neonates with sepsis . this lead
the recent interest has focused on chemokines , cytokines and acute phase reactants ( and other substances associated with the inflammatory response ) , whose serum levels may reflect the host s immunological status and response to infection [ 46 ] .
interleukin 17a ( il-17a ) is a cytokine secreted mainly by a recently characterized distinct subset of helper t cells
the th17 cells are considered to be important for immunity to microorganisms that are not eliminated by th1 or th2-cell mediated response .
interleukin 17a mediates pro - inflammatory response by triggering the production of many other cytokines , such as il-1 , il-6 and tumor necrosis factor ( tnf ) and orchestrates the response of both innate and adaptive immune cells .
neutralization of il-17a exerted a protective effect on sepsis mortality , characterized by decreased bacteraemia and a decreased level of inflammatory cytokines .
studies conducted recently in an adult population revealed a significantly higher il-17 production in patients with severe sepsis than in healthy controls [ 10 , 11 ] .
c5a is considered a central mediator in the immunopathogenesis of sepsis , as it modulates other systems , including the coagulation cascade and the release of proinflammatory cytokines .
excessive c5a production , in turn , elicits numerous harmful effects [ 7 , 15 ] . on the other hand
, it has been demonstrated that blockage of c5a greatly improve the survival of rodents during sepsis .
significantly enhanced levels of c5a have been found in septic shock in adult patients compared with healthy individuals , but none of the study has evaluated this anaphylatoxin in the setting of neonatal sepsis , so far .
regulated on activation , normal t cell expressed and secreted ( rantes ) , also known as chemokine ( c - c motif ) ligand 5 ( ccl5 ) , mediates the trafficking and homing of t helper cells , monocytes and eosinophils into inflammatory sites .
an inverse correlation has been reported between the levels of rantes and disease severity , and mortality in patients with sepsis and lower levels of this chemokine were found in non - surviving patients , suggesting its beneficial pro - inflammatory role in host response to infection . a few studies reported rantes levels in infected neonates [ 1922 ] including those with eons [ 20 , 22 ] .
most of them documented lower rantes levels in infected neonates compared to non - infected controls .
the aim of this preliminary study was to investigate serum levels of il-17a , anaphylatoxin c5a and chemokine rantes in neonates with eons and those non - infected , and to evaluate the potential utility of these novel markers for early diagnosis of neonatal sepsis .
a total of 68 neonates were enrolled prospectively in the neonatal intensive care unit ( nicu ) at the nicolaus copernicus hospital in olsztyn and in the tertiary nicu at the medical university of warsaw .
neonates eligible for inclusion in the case group had to have clinical signs of early - onset neonatal sepsis ( eons ) developed within 72 hours of life and/or history of factors associated with increased risk for infection .
clinical signs of sepsis were defined as the presence of three or more of the following clinical manifestations , without any other obvious pathological cause : temperature instability ( core temperature 38.5 or 36c ) ; respiratory symptoms ( apnoea , tachypnoea with respiratory rate > 60 per minute , cyanosis , need for high ventilator settings or oxygen ) ; cardiovascular symptoms including hypotension ( blood pressure < 5 percentile for age ) , tachycardia ( heart rate > 160 per minute ) , bradycardia ( heart rate < 80 per minute ) , or poor perfusion ; neurological symptoms ( hypotonia , hyporeflexia , irritability , lethargy and seizures ) ; gastrointestinal symptoms ( poor feeding , abdominal distension , green or bloody residuals , vomiting ) .
risk factors were : maternal chorioamnionitis , mothers with inadequately treated group b streptococcus ( gbs ) colonisation , mothers non - tested for gbs with premature rupture of membranes ( prom ) for > 18 hours , maternal fever during labour or premature labour .
newborns with the above - mentioned clinical findings and/or risk factors have had sepsis screening laboratory tests , including : acute phase reactant
c - reactive protein ( crp concentrations > 5 mg / l were considered abnormal ) , white blood cell ( wbc ) differential count ( wbc > 35 10/l or < 5 10/l was considered abnormal ) and immature to total neutrophil ratio ( i / t ratio > 0.2 was considered abnormal ) , and platelet counts ( plt < 80 10/l was considered abnormal ) .
wbc , neutrophil and immature wbc counts were measured using an sysmex xt-1800i automated hematology analyzer ( sysmex america , mundelein , usa ) .
the plasma levels of crp were determined using roche cobas integra 800 full - automated analyzer ( roche diagnostics , mannheim , germany ) . at the same time , an additional blood sample was provided for quantitative analysis of il-17a , c5a and rantes .
inclusion criteria for the case group were the presence of clinical signs of sepsis and/or the presence of risk factors plus at least two abnormal laboratory test results .
diagnosis of respiratory distress syndrome , necrotizing enterocolitis , meconium aspiration syndrome , hypoxia , intracranial haemorrhage or congenital heart disease was ruled - out in all neonates included in the study .
the variables of each case recorded included newborn s demographics , prenatal and postnatal history , physical examination findings , vital signs , routine blood test , microbiologic culture results and applied antibiotic therapy .
the criteria for inclusion to the control group were neither evidence of infection in neonate nor perinatal risk factors and a whole blood sample collected within the first 72 hours of life available for assessment of il-17a , c5a and rantes .
data recorded for healthy neonates included : gestational age , gender , delivery mode , birth weight , five - minute apgar score and crp level .
the study was conducted in accordance with the declaration of helsinki and written informed consent was obtained from the parents or legal guardians .
the study protocol was approved by the ethical committee of the children s memorial health institute . for the il-17a , c5a and rantes analysis 1 ml of the venous blood
was collected into test tubes without anticoagulants and allowed to clot for 30 minutes and then centrifuged at 4c for 10 minutes at 1000 g. each neonate s serum sample was separated into 3 aliquots and stored immediately at 20c until analysis .
interleukin 17a , c5a and rantes were measured using commercially available solid - phase sandwich enzyme - linked immunosorbent assay ( elisa ) kits ( human il-17a elisa development hrp kit , mabtech ab , nacka strand , sweden for il-17a ; bd opteia human c5a elisa kit ii , becton , dickinson and company bd biosciences , san jose , ca , usa for c5a ; human rantes elisa construction kit , antigenix america inc . ,
melville , ny , usa for rantes ) . the detection limit was 4 pg / ml , 0.047 ng / ml and 0.016 ng / ml for il-17a , c5a and rantes , respectively .
all clinical specimens were transported frozen on dry ice and tested simultaneously to ensure the uniformity of measurements .
assays for il-17a , c5a and rantes were performed in the department of clinical microbiology and immunology , the children s memorial health institute in warsaw .
categorical variables were expressed as number and percentage . normally distributed continuous variables were summarized as mean standard deviation ( sd ) , whereas other continuous variables were presented as median and 25 to 75 percentiles ( interquartile range , iqr ) .
statistical significances of the differences in serum c5a and rantes levels between different study groups were assessed by the mann - whitney u test . for correlation analysis , spearman
a total of 68 neonates were prospectively enrolled in this preliminary study within the first 72 hours after birth .
eighteen neonates with clinical signs and symptoms of systemic infection formed the eons group , whereas 50 neonates without evidence of infection were classified into the control group . as compared with non - infected neonates , newborns with eons were more likely to have a lower gestational age .
the groups differed also in delivery mode and , as expected , in crp concentration ( table 1 ) .
there was no difference according to birth weight , length or male / female ratio .
demographic and clinical characteristics of septic neonates ( eons group , n = 18 ) and non - infected neonates ( control group , n = 50 ) me median ; irq interquartile range ; eons early - onset neonatal sepsis ; crp c - reactive protein p - values by student t test , mann - whitney u test or fisher s exact test as appropriate ; bold indicated statistical differences .
measured between 23 and 25 hour of life . regarding neonates in the eons group , the diagnosis was based on clinical grounds supported by laboratory tests .
no patients had a positive blood culture . at the time of the sepsis episode 9 neonates presented respiratory distress and 6 of them had a diagnosis of pneumonia .
detailed characteristics of neonates with eons i / t ratio immature to total neutrophil count ; me median ; iqr interquartile range ; gbs group b streptococcus ; prom premature rupture of membranes
. diagnosis of pneumonia in all cases . defined as maternal fever ( > 38oc ) , and at least two of the following criteria : maternal leukocytosis ( wbc > 15 109/l ) , maternal tachycardia ( heart rate > 100 per minute ) , foetal tachycardia ( heart rate > 160 per minute ) , uterine tenderness and/or foul odour of the amniotic fluid . at the time of sepsis investigation serum levels of c5a in the eons group were significantly higher compared to those in the non - infected group ( median 65.35 vs. 50.4 ng / ml , p = 0.034 ; fig .
1a ) , whereas no significant difference in rantes levels between the two groups were found ( median 188.95 vs. 195.2 ng / ml ; p = 0.444 ; fig .
scatter plots representing c5a ( a ) and rantes ( b ) levels in serum of neonates .
the c5a levels measured in septic neonates ( eons ) vs. non - infected neonates ( healthy controls ) showed a significant difference ( p = 0.034 ; by mann - whitney u test ) levels of il-17a were under the detection limit ( < 4 pg / ml ) in both eons and non - infected neonates .
il-17a was excluded from further analysis because of having values below the assay working range , which would not enable an examination as a continuous variable .
a separate analysis was performed to determine whether there was a difference between premature and term neonates as well as among neonates according to delivery mode .
concentrations of c5a and rantes did not differ between premature and term neonates ( median c5a level 46.1 vs. 52.7 ng / ml ; p = 0.397 and median rantes level 254.1 vs. 185.7 ng / ml ; p = 0.367 , for premature and term neonates , respectively ) .
similarly , no significant difference was observed according to delivery mode ( median c5a level 51.4 vs. 56.2 ng / ml ; p = 0.748 and median rantes level 207.6 vs. 171.6 ng / ml ; p = 0.402 , for vaginal and non - vaginal delivery , respectively ) .
correlation analysis revealed a significant positive correlation between serum levels of c5a and crp ( spearman r = 0.33 ; p = 0.010 ) .
the early identification of neonates with eons is critical , because it allows clinicians to implement suitable and more effective medical intervention improving the outcome .
reliable ruling - out of sepsis is also important to avoid exposure to broad - spectrum antibiotics ( which , even if for only a few days , might foster antibiotics resistance patterns ) and the long - term effects of antibiotic overuse in patients .
the lack of a reliable test for early diagnosis of eons forces a search for new biomarkers . in this preliminary study , 3 novel markers such as c5a , il-17a and rantes were measured in neonates with eons and non - infected newborns for their potential use in the diagnosis of early - onset neonatal sepsis . in the current preliminary study , for the first time
significantly higher levels of c5a were found in neonates with eons compared with non - infected cases .
these results are in accordance with the recent study by unnewehr et al . who showed a significant increase of c5a concentrations in adult patients during septic shock .
taken together , these results and data from experimental models linking elevated c5a with immunoparalysis , multi - organ failure , imbalances in the coagulation system and the apoptosis of thymocytes , suggest that c5a increases in early phases of infection and may be an important factor for the inflammatory process in the pathogenesis of sepsis .
regarding il-17a , significantly increased production of this interleukin was observed in two previous studies conducted in adult septic patients [ 10 , 11 ] , while little is known about il-17a levels in neonates , especially those with eons .
contrary to the findings in adults , in the current study il-17a concentrations were under the detected level in both eons and non - infected cases . nevertheless , the results are in accordance with the previous study by papoff et al . comparing il-17 expression in body fluids from 13 sick and 7 healthy neonates admitted to nicu .
undetectable levels of il-17 were found in all plasma samples of infected neonates as well as those with inflammatory non - infectious diseases and controls .
this is in line with a recent study by caron et al . , who examined neonatal production of il-17 in mixed mononuclear cells ( mmcs ) isolated from umbilical cord blood and found severely depressed il-17 production by neonatal mmcs compared to adults .
in addition , reduced intracellular formation of il-17 , and diminished il-17 response to both group b streptococci ( gbs ) and escherichia coli , were observed .
taking into account the fact that in healthy children serum levels of il-17 increase with age , low or undetectable il-17 levels observed in neonates may mirror the immaturity of the neonatal immune system to launch an effective th17 response .
most of the previous studies showed lower rantes concentration in septic neonates compared with healthy subjects [ 1922 ] , though diametrically opposite results have also been reported in the setting of eons . in the current study the median concentration of this chemokine was lower in eons group then in non - infected neonates , but the difference did not reach statistical significance .
this discrepancy in the results between the current and previous studies may be attributed to the relatively small sample size , differences in timing of evaluation ( early vs. late onset - sepsis ) or varied patient population ( including term vs. premature neonates ) .
it must be also underlined , that at the time of sepsis onset , none of the septic neonates enrolled into the current study had significant thrombocytopenia and because platelets are principal reservoir of rantes in peripheral circulation , this may account for the lack of significant difference in chemokine concentration between the groups .
confirmation of this fact are data obtained in the esgni-001 study in which the percentage of positive microbiological blood culture among patients with symptoms of bloodstream infections was 15% in european countries .
due to ethical reasons the marker evaluations were performed in a single serum sample collected within the first 72 hours of life .
serial measurements of the parameters could be more informative , especially when considering their use for the prognosis or treatment monitoring . in conclusion
, the results of our study obtained in this small number of patients are very preliminary nonetheless showed that c5a is a very interesting biomarker .
thus , there is a strong need for further studies evaluating the dynamics of c5a and its sensitivity and specificity in the diagnosis of eons on a large number of neonates .
moreover , it is also necessary to differentiate the usefulness of c5a determination between eons and other pathological conditions , such as necrotizing enterocolitis , meconium aspiration syndrome , hypoxia and respiratory failure of varying etiology .
we conclude that such studies will help to assess whether this anaphylatoxin could be useful laboratory tool for differential diagnosis of infectious vs. non - infectious systemic inflammatory response . | the aim of the present study was to investigate serum levels of novel markers : interleukin 17a ( il-17a ) , anaphylatoxin c5a and chemokine regulated upon activation normal t - cell expressed and secreted ( rantes ) in neonates with clinically suspected early - onset neonatal sepsis ( eons ) , and to compare their values with those of non - infected neonates .
eighteen neonates with clinical signs and symptoms of eons were enrolled in this study .
fifty healthy , non - infected neonates served as the control group . in all neonates
serum levels of il-17a , c5a and rantes were measured by solid - phase sandwich enzyme - linked immunosorbent assay ( elisa ) . at the time of investigation serum levels of anaphylatoxin c5a
were significantly higher in neonates with clinical symptoms of eons than in non - infected neonates ( median 65.35 vs. 50.4 ng / ml , p = 0.034 ) , whereas levels of rantes were similar and levels of il-17a were under detection limit of the method . based on these preliminary results , serum levels of c5a
may be a useful marker of inflammation in early onset neonatal sepsis . because traditional methods of microbiological diagnostics in eons are frequently unsuccessful
, the search for an alternative laboratory biomarkers is of great clinical importance .
thus , there is a strong need for further studies evaluating usefulness of this anaphylatoxin in eons diagnosis on a larger group of patients . |
transverse vaginal septum is a rare anomaly that results from incomplete fusion of urogenital sinus and the vaginal parts of the mullerian duct .
this septum is usually found in the upper and mid - vagina but can be located at any level in the vagina and varies in thickness too .
clinical manifestations depend on whether it is complete or partial septum . in case of complete septum
, it results in hematocolpos and hematometra due to accumulation of menstrual blood resulting in distension of the structures above the septum postpuberty .
these patients present with symptoms of lower abdominal cyclic pain with ultrasonic findings of hematocolpometra .
occasionally , a palpable mass is found in the lower abdomen ( hematometra ) . in case of incomplete septum , patients complain of cryptomenorrhea , dysmenorrhea , and dyspareunia due to limited egress of menstrual blood .
cervical atresia / dysgenesis is still a rare uterovaginal anomaly that can be congenital or acquired leading to fertility problems .
having said about two rare anomalies , here , we present the case of a 16-year - old girl with cyclic abdominal pain who had the rare combination of transverse vaginal septum and cervical dysgenesis with severe anemia and amenorrhea .
resection of the septum with end - to - end anastomosis is the first surgical management of transverse vaginal septum , which might lead to scarring , and development of contractures .
custom - made prosthetic stents can be used to prevent these postsurgical contractures and maintain the patency of the vagina and cervix .
this case report deals with interdisciplinary role of conservative surgical management and custom - made prosthetic appliances in the management of transverse vaginal septum and cervical atresia at an early stage .
a 16-year - old girl reported with cyclical abdomen pain for past 4 months with amenorrhea .
minimal pubic and axillary hair growth ( tanner ii ) with normal breast development was observed .
height and weight were not appropriate for the age , and no tenderness or mass on palpation was observed .
the history of never menstruated was obtained during discussion with the patient 's mother .
ultrasonographic ( usg ) studies showed that the liver , kidneys , spleen , ureters , and urinary bladder were all normal and uterus and ovaries of normal size , with hemoglobin of 7.1 g / dl .
the patient was diagnosed with transverse vaginal septum with probable cervical dysgenesis with the help of usg [ figure 1 ] .
surgery was planned with the vagina being atretic ; dissection was done in the loose areolar space between the bladder and rectum toward the cervix .
then , canalization of the cervix was done through the identified dimple using mosquito artery forceps and with the help of abdominal ultrasound probe as a guide .
a 4 cm long , 2.5 cm diameter hollow prosthetic stent ( acrylic ) was subjected to low - steam sterilization before placing and sutured to the cervical wall to hold the cannula in place .
this hollow stent helped in flushing of the blood during the menstrual period along with maintaining the patency of the cervix .
ultrasonographic showing hematocolpos ethical clearance and patient consent were obtained for publishing this case report in the journal . a 20 ml syringe and suction tip
the syringe was modified according to the specification of 30 mm long and suction tip was cut to 10 mm .
the putty impression material was used to occupy the mold space , to obtain a hollow cylinder configuration .
modeling wax was used for fabrication of the wax pattern over the putty [ figures 3 and 4 ] .
the wax pattern along with the putty mold was flasked and processed with heat cure acrylic resin followed by finishing and polishing [ figure 5 ] . modified 20 ml syringe and suction tip putty mold and wax pattern fabricated flasking followed by dewaxing of the mold processed vaginal stent placed in the cervix
a 20 ml syringe and suction tip were used as the base model [ figure 2 ] .
the syringe was modified according to the specification of 30 mm long and suction tip was cut to 10 mm .
the putty impression material was used to occupy the mold space , to obtain a hollow cylinder configuration .
modeling wax was used for fabrication of the wax pattern over the putty [ figures 3 and 4 ] .
the wax pattern along with the putty mold was flasked and processed with heat cure acrylic resin followed by finishing and polishing [ figure 5 ] . modified 20 ml syringe and suction tip putty mold and wax pattern fabricated flasking followed by dewaxing of the mold processed vaginal stent placed in the cervix
transverse vaginal septum is a rare occurrence . when it coexists with cervical dysgenesis , it is even rarer .
transverse vaginal septum is found between the upper one - third ( mullerian origin ) and lower two - third of the vaginal canal ( urogenital sinus origin ) .
it is categorized as class ii congenital uterovaginal anomaly under the rock and adam 's classification .
patients with transverse vaginal septum experience pain , retrograde menses , difficulty during sexual intercourse and childbearing , and delivery and are exposed to high risk of infection .
after surgical correction of the septum is done , end - to - end anastomosis of the vagina is required . when transverse septum is diagnosed , generally a major portion of the vagina is missing , making it difficult for the anastomosis of the upper and lower segments , postpuberty . to overcome this difficulty ,
z - plasty and simpler flap methods have been advocated . however , neither of the methods were used in this case . a simple excision and dissection through loose tissue
the process of re - anastomosis becomes easy due to distension of the upper vagina with menstrual blood , which acts as tissue distender ; however , in cases where this is not the situation , the use of a vaginal dilator is advised to thin the septum and ease re - anastomosis .
the dimension of the canal was measured and a custom - made hollow prosthesis ( dilator ) was fabricated .
after 2 weeks , the dilator was removed under general anesthesia to make the procedure pain - free and for proper evaluation , and new one was fabricated with which the patient was trained to use until re - anastomoses was achieved to satisfactory level .
the main advantages of this technique are ( a ) the patency of the canal was maintained , ( b ) the hollow in the stent acted as a vessel for collecting the blood and provided a path for its removal , thereby eliminating the risk of canal closure reducing the risk of infection due to pooling of blood .
detailed medical history , clinical examination , and pelvic ultrasound are the ways and means to diagnose the conditions of transverse vaginal septum and cervical dysgenesis / atresia .
diagnosis of cervical obstruction should be made as early as possible so that aggressive surgical procedures such as hysterectomy can be avoided .
this conservative surgical management was made possible with the emerging trends in reproductive technology and laparoscopic techniques and was perhaps going to be the first - line treatment option with the expertise in laparoscopic surgery along with prosthetic management . where no specific funding was sought , department of prosthodontics , sri ramachandra university , porur , chennai-116 , fund was used for fabrication of the prosthesis , and we kindly acknowledge the department for helping us in the case .
where no specific funding was sought , department of prosthodontics , sri ramachandra university , porur , chennai-116 , fund was used for fabrication of the prosthesis , and we kindly acknowledge the department for helping us in the case .
| transverse vaginal septum is a rare anomaly that results from incomplete fusion of urogenital sinus , and the vaginal parts of the mullerian duct .
cervical atresia / dysgenesis is still a rare uterovaginal anomaly that can be congenital or acquired leading to fertility problems .
transverse vaginal septum when it coexists with cervical dysgenesis , it becomes a rare combination where management becomes highly complex .
this case report deals with interdisciplinary role of conservative surgical management and custom made prosthetic appliances in the management of transverse vaginal septum and cervical atresia at an early stage and perhaps this goes to be the first - line treatment option with the expertise in laparoscopic surgery along with prosthetic management . |
fibrous hamartoma of infancy is an infrequent mesenchymal lesion integrated by three tissue elements : immature mesenchyma , fibrous tissue and adipose mature tissue .
fibrous hamartoma of infancy ( fhi ) is an infrequent mesenchymal lesion of a likely myofibroblastic origin with a prototypical histopathologic picture , integrated by three tissue elements - immature mesenchyma , fibrous tissue , and adipose mature tissue - intermingled in varying proportions . until now ,
these changes correspond to altered pigmentation observed grossly , clinical association with hypertrichosis and eccrine gland hyperplasia .
his mother noticed a rapidly enlarging on the child 's upper back on month before admission .
physical examination revealed the presence of 2 4 cm well - circumscribed , firm mass with a hairy and altered pigmentation on the upper back .
the solitary lesion was firm , adherent to underlying tissue and had grown in the last 2 weeks .
grossly it was poorly circumscribed but hairy with firm gray - white tissue fixed to the underlying subcutaneous plane .
histologically , the lesion was centred in the deep dermis although reached the papillary dermis and the cutaneous appendages .
it was composed of three different mesenchymal tissues : well - defined intersecting trabecule of fibrous tissue of varying size and shape , loosely textured areas consisting chiefly of immature small , round or stellate cells in a myxoid matrix , and varying amounts of mature fat .
also the included overlying skin contained foci of eccrine hyperplasia with pronounced duct ectasia , dilated lumens with complex papillary formations and squamous metaplasia .
this abnormal eccrine glands was surrounded mainly by the primitive mesenchymal tissue component of fhi [ figure 1 ] .
also it showed the formation of anomalous hair structures in the overlying epidermis , with microfollicles and abortive hair follicles [ figure 2 ] .
the lesion is composed of three different mesenchymal tissues : well - defined intersecting trabeculae of fibrous tissue , areas of immature cells in a myxoid matrix , and varying amounts of mature fat . also the included overlying skin contained foci of eccrine hyperplasia with pronounced duct ectasia , dilated lumens with complex papillary formations and squamous metaplasia .
this abnormal eccrine glands was surrounded mainly by the primitive mesenchymal tissue ( h and e stain , 400 ) here it is showed the formation of anomalous hair structures in the overlying epidermis , with microfollicles and abortive hair follicles ( h and e stain , 400 )
the fhi is a soft tissue tumour from a monoclonal origin and therefore it likely represents a true neoplasia . in a review of 197 cases on fhi by dickey and sotelo - avila
, 91% arised within the first 12 months of life and 23% of them presented at birth like congenital lesions .
most cases present as solitary masses but multiple separate synchronous lesions have been reported rarely predominant areas include the axilae , shoulders , upper arms and upper trunk , although other sites have been reported .
the complete excision is the treatment of choice , but incomplete excision it has a low recurrence rate between 10 - 15% .
there is no evidence of malignant transformation or spontaneous regression , but long - term follow up indicates a benign biological behavior .
the differential diagnoses to be considered are lipofibromatosis , myofibroma , fibromatosis , infantile fibrosarcoma and so on .
only a few published case of fhi have commented on the changes in the overlying skin .
the most exhaustive report in this topic is a series of 12 patients with fhi settled in the cutaneous changes in this disease . in all the 5 cases that included the overlying skin presented eccrine changes described what hyperplasia , duct dilatation , intraluminal papillary formations , and squamous syringometaplasia .
some authors have postulated a direct relation between the degree of inductive epidermal changes and the distance between the dermal mesenchymal proliferation and the epidermis , whereas other investigators failed to confirm these findings .
although the pathogenesis of the induction changes in the epidermis overlying dermatofibromas and other mesenchymal proliferations are not known , mediators or organizers released from mesenchymall cells of the dermis may be responsible for the epidermal changes , it is interesting to describe our case because , to our knowledge , the altered pigmentation of the overlying skin , with hairs on the surface , and eccrine gland hyperplasia combined with abortive hair follicles has not been reported together in association with the fhi .
following our case , we recommend that all the biopsies must be excisional including overlying skin , thus the epidermal and dermal adnexal changes can be assessed in the microscopic evaluation which could have relevant implications from clinical and embryological point of view . to our knowledge the altered pigmentation of the overlying skin , with hairs on the surface and eccrine gland hyperplasia combined with abortive hair follicles has not been reported together in association with fibrous hamartoma of infancy . | only a few published case of fibrous hamartoma of infancy ( fhi ) have commented on the changes in the overlying skin .
there are descriptions of individual cases with cutaneous hyperpigmentation , hypertrichosis and hyperhidrosis .
it is interesting to describe our case because , to our knowledge , the altered pigmentation of the overlying skin , with hairs on the surface , and eccrine gland hyperplasia combined with abortive hair follicles has not been reported together in association with the fhi .
we recommend that all the biopsies must be excisional including overlying skin , thus the epidermal and dermal adnexal changes can be assessed in the microscopic evaluation which could have relevant implications from clinical and embryological point of view . |
allergic diseases in western countries have steadily increased over the last 20 years , affecting the respiratory system , conjunctiva , and skin.1,2 moreover , an emergent aspect is the association of gastrointestinal involvement with respiratory and/or cutaneous symptoms , arising from allergies and/or intolerance .
gastroenteric expressions of these diseases include acute symptoms ( diarrhea or vomiting ) and chronic symptoms ( bloating , constipation which may alternate with diarrhea ) .
allergy tests , performed with commercial extracts or fresh foods , can be negative or slightly positive in most patients in both situations.3 allergy tests may also be negative in respiratory and cutaneous allergy , and this enables a distinction between , eg , allergic and nonallergic asthma , allergic and nonallergic rhinitis , and allergic and nonallergic dermatitis.4 different explanations for this increase in prevalence have been hypothesized , including genetic predisposition,5,6 environmental factors,7,8 or the hygiene hypothesis,9 but none of these possibilities seems to be completely satisfactory . in this context , since the role of immunoglobulin e ( ige ) antibodies is central to the development of allergies , factors related to the onset of symptoms must also include the possibility of helmintic infections , which induce high ige levels .
the ige increase is proportional to both the severity of infection and invasion of parasites in the tissues , and is the sum of the total ige level plus parasite - specific ige release.10,11 the latter derives from helmintic production of factors that stimulate interleukin-4 production.12 in particular , one study found an increase in circulating ige levels during parasitic infections caused by ascarids,13 while other studies demonstrated a total ige increase in parasitic diseases and their reduction after antiparasitic therapy,14 as well as high ige levels in patients affected by visceral larva migrans with antibodies against toxocara.15 the infestation caused by toxocara canis appears to be very frequent in tropical countries , but also in some areas in europe , especially among children in the first decade of life.16,17 the symptoms caused by toxocara infection in the different target organs in the respiratory , cutaneous , and gastrointestinal systems are often similar to the symptoms of allergic diseases .
the aim of the present study was to evaluate the prevalence of seropositivity to t. canis in a large population of patients referred for symptoms of suspected allergy .
between 2003 and 2008 , we evaluated 9985 new patients presenting with symptoms suggesting an allergic disease .
the clinical symptoms involved seasonal or persistent rhinoconjunctivitis , asthma , urticaria , angioedema , and dermatitis .
all patients underwent clinical examination , careful evaluation of symptoms , and allergy tests , including skin prick tests with inhaled or food allergen extracts and , in patients with dermatitis , patch tests with a standard panel of haptens ( merck , milan , italy ) .
skin prick tests were performed with the panel of allergen extracts from stallergenes , milan , italy .
routine and immunological blood tests and parasitological tests on feces were performed , as well as symptomatic therapy , environmental prophylaxis as preventive treatment , an exclusion diet when food allergy was suspected , and replacement of medication(s ) when a drug allergy was suspected .
a subgroup comprising 753 patients was selected who suffered from chronic recurrent respiratory , eye , skin or gastrointestinal symptoms caused by nonallergic mechanisms , as assessed by results to allergy tests negative or unrelated to clinical history , and these patients underwent further hematochemical and immunological blood tests , ie , enzyme - linked immunosorbent assay ( elisa ) , measured in optical density ( od ) with a range from 0.9 to 1.1 , and western blotting ( wb ) tests for igg antibodies to t. canis , using material from ltbio diagnostics , lyon , france .
these patients mainly suffered from asthma , urticaria , dermatitis , and conjunctivitis ; less frequently they suffered from gastroenteric symptoms , asthenia , headache , dizziness , or drug reactions .
the prevalence of the different clinical presentations was compared using the chi - squared test .
anthelmintic therapy was prescribed for t. canis seropositive patients , using mebendazole ( one 100 mg tablet twice daily for 3 days , 5 ml syrup twice daily in children ) , repeated after 20 days up to three times in an effort to achieve significant symptomatic improvement . in the event of lack of improvement ,
albendazole ( one 400 mg tablet twice daily for 5 days in adults , 5 mg / kg divided in two half doses in children ) was used , and repeated after two months .
these were mainly antihistamines or topical steroids for rhinitis symptoms , inhaled beta - agonists and corticosteroids for asthma symptoms , antihistamines , and topical or systemic corticosteroids for skin symptoms , including urticaria / angioedema , dermatitis and itching , and probiotics ( lactobacillus reuteri ) for intestinal symptoms .
regular control visits were scheduled , the first after 2 months and subsequently every 4 months .
patients who did not come back for the checkup visit were contacted by telephone about their symptoms .
clinical evaluations of symptoms and serological tests with the wb and elisa for antibodies to t. canis were performed in patients who came to the visits .
the study was registered ( eudract number 2010 - 024221 - 20 ) and approved by local authorities .
in the selected group of 753 patients suffering from chronic recurrent symptoms caused by nonallergic mechanisms , 240 ( 31.8% ) tested positive for t. canis by elisa , wb , or both tests ; 64 of them ( 26.7% ) were positive to elisa , 110 ( 45.8% ) to wb , and 66 ( 27.5% ) to both tests .
these patients included 222 adults ( 150 females , 72 males , age range 1872 years ) and 18 children ( seven females , 11 males , age range 217 years ) .
sixty - two of the 753 patients ( 25.8% ) had animals at home ( 28 had a cat , 23 had a dog , and 11 had both animals ) .
fifty - two patients ( 23.3% ) were atopic , with positive results to skin prick testing that were unrelated to clinical symptoms ; in these patients , the mean level of total ige was 280 ku / l . in the 188 nonatopic patients ,
asthma was significantly more frequent compared with the other presentations ( p = 0.029 versus urticaria , p = 0.002 versus dermatitis , p < 0.0001 versus each other presentation ) . among patients with asthma , five had level i , 30 had level ii , 16 had level iii , and eight patients had level iv disease according to the global initiative for asthma ( gina ) classification .
of the 240 t. canis seropositive patients , 162 ( 67.5% ) agreed to undergo anthelmintic therapy , which resulted in considerable improvement in symptoms .
eighty - eight patients did not come for the checkup visit , but they were contacted by phone and confirmed that they did not suffer from symptoms any longer and did not use any more symptomatic drugs . in 14 of the 74 patients who came back to the scheduled control visits , we observed both clinical and serological improvement in wb and elisa tests . in six of these patients , a decrease in the size of bands using wb was found ; in five patients , the size of bands using wb and the od using elisa decreased , and elisa od values decreased from > 1.1 to negative values in the range of 0.91.0 in three patients .
there was a complete remission of symptoms with complete absence of antibodies to t. canis in 26 of the 74 patients .
because we have previously observed cases of t. canis infection that simulated allergic manifestations and were mistakenly considered allergies for a long time,18 we systematically tested allergic patients referred for suspected allergy ( who had negative allergy tests or test results clearly unrelated to history ) for seropositivity to t. canis . of 753 patients with such characteristics , 240 ( 32% ) were positive using in vitro tests ( elisa or wb ) for igg antibodies to t. canis .
the role of t. canis infection in sustaining the symptoms was further demonstrated by the efficacy of anthelmintic treatment , which was evident in more than two thirds of treated patients and was associated with negativization or a decrease in toxocara igg antibodies in 43% of patients who underwent repeat elisa or wb .
human toxocariasis is a zoonosis sustained by parasitic infestation with the nematode t. canis belonging to the order of ascaris , which infects dogs , cats , and many other mammals .
this happens mainly among children when they ingest soil while playing or eating . in human hosts
, the larvae do not develop into adults , but they can migrate to different organs and tissues and survive for long periods of time , varying from a few months to decades , depending on the host immune response.19 the real incidence / prevalence of this infestation in humans has not yet been assessed , because the disease induces nonspecific symptoms
. however , sometimes it mimics a viral infection , and in the mildest cases can be totally asymptomatic .
the first one is called capsulated toxocariasis , which is characterized by very mild symptoms , with no clear clinical manifestations ( for example , nonspecific illness with fever , recurrent hacking cough , insomnia , abdominal pain , headache , and behavioral disorders ) . the second one is called ocular larva migrans , limited to the eye , and may cause a reduction in sight , conjunctival hyperemia , recurrent conjunctivitis , and even granulomas , uveitis , and retinal detachment .
the last one is visceral larva migrans , and its symptoms include fever , asthenia , behavioral depression ( suggesting central nervous system involvement ) , skin afflictions like nodules , chronic hives , recurrent labial and eyelid angioedema and eczematous dermatitis , enteric symptoms such as meteorism and abdominal pain , respiratory symptoms such as dyspnea , persistent cough , recurrent asthmatic and bronchitic manifestations , pleuritis , and bronchopneumonia.17,19 epidemiological studies conducted in europe have shown variable prevalence of seropositivity for t. canis . in spain , 14% of both pediatric and adult patients were found to suffer from eosinophilia , and 6% of these patients showed eye disorders .
20 in sweden , the prevalence of seropositivity was about 7% , indicating a relevant presence of subclinical toxocariasis . in this group ,
eosinophilia was recognized in 32% of the sample , and the most common clinical manifestation was eye problems ( 46% ) while neurological , respiratory and hepatic symptoms were described in 40% of these patients.21 in an italian study that included 2112 healthy adult subjects , the prevalence of t. canis antibody seropositivity was 3.9% .
the percentage increased in the control group of 471 nonhealthy subjects ( 257 affected by epilepsy , 142 by oligophrenia , 76 by strongyloides stercoralis infestation ) , and was 4.35% in epilepsy patients , 9.2% in patients with strongyloidiasis , and 10.6%14.5% in subjects with oligophrenia .
22 thirty - one of 100 toxocara - positive pediatric patients suffered from asthma or bronchitis , while the percentage decreased to only 12% among toxocara - seronegative patients in a study performed in the netherlands.23 toxocara infestation mainly occurs via accidental ingestion of soil , that is why the illness usually affects children , but adults can also be infected . as stated above , the larvae do not develop in the human host but only migrate to different organs and tissues , where they survive for a certain time period depending on the level of the host immune response .
. they may even cause symptoms similar to viral infections or allergy - like symptoms , ie , may present with the clinical expression of allergy .
symptoms can be mild , including fever , recurrent hacking cough , dyspnea , recurrent bronchitis , pleuritis , bronchopneumonia , asthma , skin afflictions like nodules and chronic hives , recurrent labial and eyelid angioedema and eczematous dermatitis , enteric symptoms , or even symptoms limited to the eye causing conjunctiva hyperemia and recurrent conjunctivitis.18,19 most of these symptoms were present in the population we studied , in particular asthma , which was significantly more frequent than any other clinical presentation in patients with positive in vitro tests for toxocara .
this reinforces the suggestion made by cooper that t. canis is an important and neglected environmental risk factor for asthma.24 the role of t. canis infection may be assessed by the detection of specific igg antibodies , it being known that the igg4 subclass is predominantly involved in the response to parasitic infections.25
the findings from this study indicate that t. canis infection , as assessed by seropositivity of igg antibodies by elisa or wb , is not rare in patients presenting with symptoms of apparent allergy but with negative or inconclusive allergy tests .
this suggests that serological tests should be performed to detect toxocara - specific igg antibodies in such patients and to assess the effect of anthelmintic treatment , in an effort to diagnose parasitic infection correctly in patients who are otherwise given a simple ( but incorrect ) diagnosis of nonallergic disease . | backgroundtoxocara canis is an intestinal nematode affecting dogs and cats , which causes human infection when embryonated eggs excreted in dog feces are ingested .
humans are paratenic hosts .
although the larvae do not develop into adult worms in the human body , they may migrate to various tissues and organs where they can survive for several years , giving rise to several clinical symptoms , which can present in allergy - like form.methodsover 5 years , we examined 9985 patients referred for suspected allergies , based on symptoms such as dermatitis , urticaria , rhinitis , asthma , and conjunctivitis ; 753 patients who had allergy tests negative or unrelated to clinical history were tested for seropositivity to t. canis by enzyme - linked immunosorbent assay ( elisa ) or western blotting ( wb).resultsin 240 patients ( 31.8% ) , elisa or wb or both tests were positive for t. canis immunoglobulin g ( igg ) antibodies : in particular , 64 of them ( 26.7% ) were positive to elisa , 110 ( 45.8% ) to wb , and 66 ( 27.5% ) to both tests .
asthma was the most common clinical presentation .
two thirds of patients underwent subsequent anthelmintic therapy and showed a complete remission of symptoms and , in 43% of patients retested by elisa and wb , became negative to toxocara.conclusionthese findings strongly suggest that t. canis plays a significant role in inducing chronic symptoms presenting as suspected allergies . |
schizophrenia is a chronic mental disorder that affects approximately 1% of the world population and is characterized by a relapsing course with significant burden for patients , families , and society.13 although many patients receiving chronic antipsychotic therapy can be considered clinically stable , a subgroup of patients will eventually have poor outcomes , not achieving optimal symptom relief.4 premature discontinuation and poor prescription compliance are well established reasons for suboptimal effectiveness in clinical practice,512 and 40%50% of schizophrenic patients are believed to be only partially compliant.8,12 nonadherence to oral antipsychotic therapy is associated with potential symptom re - emergence and a higher risk of relapse.1318 relapses are responsible for frequent inpatient admissions , and account for 80% of overall schizophrenia treatment costs.19,20 their consequences include social and overall productivity impairment , increased risk of a poor prognosis , and prolonged recovery in subsequent episodes.21,22 in this setting , alongside symptom remission , relapse prevention is a major therapeutic goal for schizophrenic patients .
atypical antipsychotics are currently a critical part of schizophrenia management worldwide , and several studies have demonstrated their efficacy and a better tolerability profile relative to conventional agents , with reduced risk of extrapyramidal side effects.2325 risperidone long - acting injection was the first injectable , long - acting , second - generation agent to become available , providing continuous medication delivery and reducing plasma level fluctuations.26,27 a robust set of evidence has shown that risperidone long - acting injection administered intramuscularly every 2 weeks improves symptom control , prevents relapses , positively impacts patients health - related quality of life , and reduces hospitalizations.13,21,2832 because compliance monitoring is a critical issue for patients with schizophrenia , risperidone long - acting injection can potentially minimize the risk of intermittent or interrupted treatment , by ensuring more stable drug levels through slow and steady release of risperidone over several weeks.13,29,30 individuals with a previous history of nonadherence or partial adherence are a subset of patients of special concern for clinicians regarding future compliance behavior .
the purpose of the present study was to assess the efficacy , safety , and tolerability of switching clinically stable patients with schizophrenia and a history of nonadherence on oral antipsychotic therapy to long - acting risperidone .
this was a 50-week , multicenter , open - label , noncomparative trial of risperidone long - acting injection ( risperdal consta ; janssen pharmaceutical companies , johnson and johnson , sao paolo , brazil ) in stable patients with schizophrenia attending seven brazilian centers who were switched from oral treatment .
a 50-week study duration was chosen to provide information relevant to clinical decision - making in the real - world setting , given that long - term follow - up is essential for schizophrenia patients . as required in multicenter studies , raters from each of the seven sites went through a training process on all clinical assessment scales to be used before initiating the trial .
all raters were required to have prior clinical experience with schizophrenic patients and documented experience administering at least the positive and negative syndrome scale ( panss ) , which was the primary outcome measure in the trial .
the study was approved by the ethics committee at each participating site and written consent was obtained from each patient or their legal representative before enrollment .
patients were recruited for the study if they met the following inclusion criteria : diagnostic and statistical manual of mental disorders fourth edition text revision ( dsm - iv ) criteria for schizophrenia ; age 1850 years ; current treatment with oral antipsychotics ( both first- and second - generation ) ; history of nonadherence to antipsychotic treatment within the previous 12 months ; and panss 90 and a panss 4 for conceptual disorganization , hallucinatory behavior , suspiciousness , and unusual thought content .
nonadherent patients were those fulfilling at least one of the following criteria : hospitalization due to interruption or irregular use of medication within the previous 12 months ; clinical worsening due to irregular use of medication ; patient refusal to take medication , as reported by family members ; difficulty convincing patient to accept medication , as reported by family members ; and at least one treatment interruption with worsening of symptoms .
exclusion criteria included a history of refractoriness to antipsychotic treatment , previous use of clozapine , use of another depot antipsychotic within the previous 12 months , another major axis disorder , and risk of suicide .
women of childbearing age not using an approved method of birth control were also excluded .
patients continued their outgoing antipsychotic for the first 3 weeks to ensure adequate drug coverage , and the previous medication was interrupted thereafter . at the first study visit ,
all eligible patients were prescribed oral risperidone1 mg for 3 days as a sensitivity and tolerability test .
patients received intramuscular injections of risperidone long - acting injection at an initial dose of 25 mg every 2 weeks .
the dose could be increased to up to 50 mg at the investigator s discretion .
biperidene for extrapyramidal symptoms and clonazepam for anxiety and insomnia were allowed as concomitant medications .
the primary efficacy measure was the change from baseline to endpoint for the total score on panss.33 secondary efficacy measures included the change from baseline in panss subscales ( negative symptoms , positive symptoms , general psychopathology ) , clinical global impression ( cgi),34 and personal and social performance scale ( psp).35 the drug attitude inventory ( dai-10 ) was employed to assess patients attitudes towards psychiatric medication.36 psp is a 100-point classification scale that measures personal and social activity in four behavioral domains ( socially useful activities , personal and social relationships , self - care , and disturbing and aggressive behaviors ) .
the final scale score is obtained summing the scores of all four domains , and ranges from 1 to 100 .
dai-10 is a 10-item dichotomous ( true or false ) answer scale that enables classification of patients based upon their attitudes towards medication .
a positive final total score means a positive subjective response ( compliant ) and a negative total score means a negative subjective response ( noncompliant ) .
answers are coded as positive ( + 1 point ) or negative ( 1 point ) , and the final score is the sum of all points
. spontaneously reported adverse events were recorded by the investigator at all visits ( weeks 2 , 4 , 8 , 12 , 16 , 20 , 24 , 38 , and 50 ) , and severity of movement disorders was evaluated using the extrapyramidal symptom rating scale ( esrs).37 electrocardiograms and blood samples for laboratory analysis were obtained at screening , week 24 , and endpoint .
the sample size required to provide the desired 80% power at a two - sided alpha of 0.05 was 60 patients , considering the mean reduction in panss scores reported in two previously published clinical studies of risperdal consta.30,38 all patients who received at least one injection of risperidone long - acting injection and had at least one postbaseline efficacy assessment ( intention - to - treat population ) were included in the efficacy analysis .
the safety population comprised patients who received at least one injection , regardless of efficacy measurement status .
changes in efficacy measures from baseline to endpoint ( week 50 ) were analyzed by the paired t - test and the wilcoxon signed - rank test for normal and asymmetric continuous variables as appropriate .
scores measured over time ( panss , cgi , psp , dai , and esrs ) were compared by repeated - measures analysis of variance using a mixed linear model for time effect ( within - group factors ) .
statistical analyses were carried out using sas ( v 9.1.3 ; sas institute , cary , nc )
patients were recruited for the study if they met the following inclusion criteria : diagnostic and statistical manual of mental disorders fourth edition text revision ( dsm - iv ) criteria for schizophrenia ; age 1850 years ; current treatment with oral antipsychotics ( both first- and second - generation ) ; history of nonadherence to antipsychotic treatment within the previous 12 months ; and panss 90 and a panss 4 for conceptual disorganization , hallucinatory behavior , suspiciousness , and unusual thought content .
nonadherent patients were those fulfilling at least one of the following criteria : hospitalization due to interruption or irregular use of medication within the previous 12 months ; clinical worsening due to irregular use of medication ; patient refusal to take medication , as reported by family members ; difficulty convincing patient to accept medication , as reported by family members ; and at least one treatment interruption with worsening of symptoms .
exclusion criteria included a history of refractoriness to antipsychotic treatment , previous use of clozapine , use of another depot antipsychotic within the previous 12 months , another major axis disorder , and risk of suicide .
women of childbearing age not using an approved method of birth control were also excluded .
patients continued their outgoing antipsychotic for the first 3 weeks to ensure adequate drug coverage , and the previous medication was interrupted thereafter . at the first study visit ,
all eligible patients were prescribed oral risperidone1 mg for 3 days as a sensitivity and tolerability test .
patients received intramuscular injections of risperidone long - acting injection at an initial dose of 25 mg every 2 weeks .
the dose could be increased to up to 50 mg at the investigator s discretion .
biperidene for extrapyramidal symptoms and clonazepam for anxiety and insomnia were allowed as concomitant medications .
the primary efficacy measure was the change from baseline to endpoint for the total score on panss.33 secondary efficacy measures included the change from baseline in panss subscales ( negative symptoms , positive symptoms , general psychopathology ) , clinical global impression ( cgi),34 and personal and social performance scale ( psp).35 the drug attitude inventory ( dai-10 ) was employed to assess patients attitudes towards psychiatric medication.36 psp is a 100-point classification scale that measures personal and social activity in four behavioral domains ( socially useful activities , personal and social relationships , self - care , and disturbing and aggressive behaviors ) .
the final scale score is obtained summing the scores of all four domains , and ranges from 1 to 100 .
dai-10 is a 10-item dichotomous ( true or false ) answer scale that enables classification of patients based upon their attitudes towards medication .
a positive final total score means a positive subjective response ( compliant ) and a negative total score means a negative subjective response ( noncompliant ) .
answers are coded as positive ( + 1 point ) or negative ( 1 point ) , and the final score is the sum of all points . spontaneously reported adverse events were recorded by the investigator at all visits ( weeks 2 , 4 , 8 , 12 , 16 , 20 , 24 , 38 , and 50 ) , and severity of movement disorders was evaluated using the extrapyramidal symptom rating scale ( esrs).37 electrocardiograms and blood samples for laboratory analysis were obtained at screening , week 24 , and endpoint .
the sample size required to provide the desired 80% power at a two - sided alpha of 0.05 was 60 patients , considering the mean reduction in panss scores reported in two previously published clinical studies of risperdal consta.30,38 all patients who received at least one injection of risperidone long - acting injection and had at least one postbaseline efficacy assessment ( intention - to - treat population ) were included in the efficacy analysis .
the safety population comprised patients who received at least one injection , regardless of efficacy measurement status .
changes in efficacy measures from baseline to endpoint ( week 50 ) were analyzed by the paired t - test and the wilcoxon signed - rank test for normal and asymmetric continuous variables as appropriate .
scores measured over time ( panss , cgi , psp , dai , and esrs ) were compared by repeated - measures analysis of variance using a mixed linear model for time effect ( within - group factors ) .
statistical analyses were carried out using sas ( v 9.1.3 ; sas institute , cary , nc )
of the 60 patients who were screened , seven patients could not be enrolled in the study for the following reasons : injectable depot antipsychotic use within the previous 12 months ( n = 1 ) ; a clinically significant abnormality in the screening tests ( n = 2 , one electrocardiographic abnormality and one anemia ) ; self - withdrawal ( n = 2 ) ; and loss to follow - up ( n = 2 , both before receiving the study medication .
fifty - three patients received at least one dose of risperidone long - acting injection ( safety population , n = 53 ) ; of these , two were excluded from the efficacy analysis for not undergoing any postbaseline assessment ( intention - to - treat efficacy population , n = 51 ) .
most dropouts were due to patient s request for withdrawal ( 62.5% ) ; 16.7% were adverse event - related , and none were due to lack of efficacy .
clinical and demographic characteristics of the total sample and the subsample of study completers are summarized in table 1 .
the study group was predominantly male ( 73.6% ) with a mean age of 33.6 years .
the median disease duration was 5.5 years ( mean standard deviation 9.2 9.9 years ) .
most patients were switched from oral risperidone ( 41.5% ) , followed by haloperidol ( 22.6% ) and chlorpromazine ( 11.3% ) .
final doses ( week 48 ) of risperidone long - acting injection were 25 mg in 38.1% , 37.5 mg in 38.1% , and 50 mg in 23.8% of patients . regarding concomitant medication , 15 ( 28.3% ) patients received clonazepam , 10 ( 18.9% ) received biperidene , 17 ( 32.1% ) received risperidone , and 14 ( 26.4% ) received haloperidol .
it was not possible to identify clinically relevant differences between study completers and the initial sample . over a 50-week period ,
there were significant reductions in total panss score and also in the panss positive , negative , and general psychopathology subscales ( table 2 ) .
the mean panss total score was significantly reduced from baseline to endpoint ( 58.8 1.82 vs 49.72 2.32 ; p = 0.0002 ) .
a significant improvement was seen at week 4 , and this effect was maintained throughout the study .
in addition , significant improvements were observed from baseline to endpoint and during the study in all panss subscales .
mean cgi also significantly improved from baseline to endpoint ( mean standard error of the mean = 3.55 0.13 vs 3.19 0.16 ; p = 0.0131 ) .
the factor week of treatment had a statistically significant effect from week 4 ( p < 0.01 ) and these clinical benefits remained stable until the final visit ( table 3 ) . for the psp scale ,
the time factor also had a positive impact on mean performance scores , which improved from 60.0 ( 95% confidence interval [ ci ] : 54.265.7 ) at baseline to 69.1 ( 95% ci : 64.873.4 ) at week 50 ( p = 0.0002 , table 3 ) .
dai-10 scores were measured at four different visits from baseline to endpoint . at all visits ,
significant improvements were observed and the mean ( standard error of the mean ) scores rose from 2.78 0.68 to 5.07 0.77 ( p = 0.0062 ) .
there was a progressive and sustained increase in dai-10 scores , showing positive attitudes towards risperidone long - acting injection throughout the study , as shown in table 3 .
adverse events reported in more than 10% of patients were insomnia ( 22.6% ) , increased prolactin levels ( 17.0% ) , and weight gain ( 13.2% ) .
investigators categorized 22 ( 41.5% ) adverse events as likely or very likely related to the study drug ( table 4 ) .
three serious adverse events were reported by the investigators , ie , psychomotor agitation , worsening of symptoms , and worsening of psychotic symptoms .
there were three ( 5.7% ) early discontinuations due to adverse events ( sexual dysfunction , decreased libido , psychomotor agitation , and worsening of pre - existing symptoms ) .
severity of movement disorders was significantly reduced during treatment with risperidone long - acting injection ( table 5 ) .
significant improvements were noted on the esrs overall scale , subjective evaluation , and extrapyramidal symptoms item from week 4 ( p < 0.0001 ) .
changes in laboratory findings other than serum prolactin were not clinically significant , although high - density lipoprotein and creatinine changes reached statistical significance ( table 6 ) .
the 29 patients for whom weight data at baseline and endpoint were available showed a mean weight gain of 2.8 4.6 kg ( p < 0.001 ) .
the findings of this open - label study demonstrate that risperidone long - acting injection was an effective treatment in a real - world setting for clinically stable brazilian patients with schizophrenia who were switched from other antipsychotic agents due to poor compliance , as assessed by change in scores on panss measures and cgi - s .
patients achieved significant clinical improvements in terms of symptom control when switched directly to risperidone long - acting injection from their current antipsychotic therapy .
most patients maintained the lower doses of risperidone long - acting injection , ie , 25 mg and 37.5 mg , during the trial .
the mean panss total score was significantly reduced from baseline to endpoint , and patients remained stable , not showing any worsening of symptoms .
results from a number of other clinical studies have also reported significant and sustained clinical improvement in patients directly switched to risperidone long - acting injection from their previous antipsychotic agents.29,38,39 in a 12-week , randomized , placebo - controlled trial by kane et al , risperidone long - acting injection was associated with significantly greater improvements in panss and cgi - s scores at endpoint compared with placebo.30 significant improvements in total panss scores ( p < 0.01 ) , positive symptoms ( p < 0.01 ) , and negative symptoms ( p
< 0.001 ) were also observed during an international , open - label , 12-month study conducted by fleischhacker et al in patients with schizophrenia who were switched to risperidone long - acting injection from oral or long - acting conventional or oral atypical antipsychotics.29 risperidone long - acting injection was well - tolerated , with minimal weight change and an overall favorable safety profile .
although of minimum magnitude in clinical terms , the statistically significant change in high - density lipoprotein could potentially raise concern about metabolic side effects .
however , the observed decrease was not accompanied by consistent changes in total cholesterol , low - density lipoprotein , very low - density lipoprotein , triglycerides , and fasting glycemia , reinforcing the absence of clinically sound metabolic effects of risperidone long - acting injection in this sample . the creatinine increase , although statistically significant , was considered clinically irrelevant .
the incidence of adverse events was comparable with those reported in previous studies . according to the report by kane et al ,
risperidone long - acting injection was generally well - tolerated , with an overall incidence of adverse events similar to that with placebo in comparative trials.30 in that study , similar proportions of patients reported adverse events in the active and control group , while serious adverse events were more frequent in the placebo group ( 23.5% ) than in the 25 , 50 , and 75 mg risperidone long - acting injection groups ( 13% , 14% , and 15% , respectively).30 results from other studies have also reported that patients can be safely switched from oral conventional or atypical therapy and conventional long - acting agents to risperidone long - acting injection.38,4042 these findings confirm the effectiveness of switching stable patients with schizophrenia from other antipsychotics to risperidone long - acting injection in a brazilian real - world setting .
following a switch to risperidone long - acting injection , stable patients showed further significant improvements in symptom control over the treatment period , reducing their panss total score and subscales and cgi - s scores .
some of the limitations of the study were its small sample size , a relatively high dropout rate ( 42.5% ) , and the open - label design . in absolute terms , the observed dropout rate was not significantly greater in magnitude than that observed in previous atypical antipsychotic trials ( 33.5% in fixed - dose studies and 45.0% in flexible - dose studies).43 this study enrolled only patients with a previous history of compliance issues , which could also be a factor explaining the higher dropout rates , especially those due to patient request .
another limitation is the lack of inter - rater reliability assessments as part of the trial .
rater training was performed to improve raters clinical skills and to ensure standardized clinical assessments before the study initiation , but statistical evaluation of inter - rater reliability was not conducted .
nevertheless , this study yielded useful knowledge on the effectiveness and safety of risperidone long - acting injection in a brazilian population over a 12-month study period , and observed significant clinical improvements after switching from oral antipsychotics to risperidone long - acting injection .
long - acting injectable risperidone is an effective and safe treatment alternative for patients with schizophrenia and a history of poor adherence to oral treatment .
the study indicates a favorable tolerability profile , a positive effect on personal and social functioning , and adequate patient treatment acceptance .
these findings reinforce long - acting injectable risperidone as a reasonable alternative for long - term care of stable schizophrenia patients in whom compliance issues are anticipated . | background : long - acting injectable antipsychotics may improve medication adherence , thereby improving overall treatment effectiveness .
this study aimed to evaluate the effectiveness , safety , and tolerability of risperidone long - acting injection in schizophrenic patients switched from oral antipsychotic medication.methods:in a 12-month , multicenter , open - label , noncomparative study , symptomatically stable patients on oral antipsychotic medication with poor treatment adherence during the previous 12 months received intramuscular injections of risperidone long - acting injection ( 25 mg starting dose ) every 2 weeks .
the primary endpoint was the change in positive and negative syndrome scale ( panss ) total score.results:of the 60 patients who were screened , 53 received at least one injection ( safety population ) , and 51 provided at least one postbaseline assessment .
mean panss total scores improved significantly throughout the study and at endpoint .
significant improvements were also observed in clinical global impression of severity , personal and social performance , and drug attitude inventory scales .
risperidone long - acting injection was safe and well - tolerated .
severity of movement disorders on the extrapyramidal symptom rating scale was reduced significantly .
the most frequently reported adverse events were insomnia ( 22.6% ) , increased prolactin ( 17.0% ) , and weight gain ( 13.2%).conclusion : risperidone long - acting injection was associated with significant symptomatic improvements in stable patients with schizophrenia following a switch from previous antipsychotic medications . |
previous studies have shown sympathovagal imbalance with sympathetic withdrawal and decreased vagal modulation in hypothyroid patients .
in contrast other studies have shown that thyroid hormone deficiency is associated with increased sympathetic influence on the cardiovascular autonomic system .
kahaly et al , reported a hypofunctional parasympathetic system by analyzing time and frequency domains of heart rate variability ( hrv ) .
a similar response was observed by authors who studied the heart rate response to exercise and recovery .
galetta et al showed an increase in sympathetic tone with a decrease in hrv suggesting a decrease in vagal tone .
this study was therefore undertaken to evaluate autonomic functions in subclinical hypothyroid patients , compare them with hypothyroid patients .
in addition we used standard cardiovascular reflex tests based on change in hr and bp during various maneuvers and scored them in order to ascertain the severity of cardiac autonomic dysfunction and assessed their relationship to the thyroxine and tsh level .
the pilot study was carried out in the departments of physiology , medicine and radiology , maulana azad medical college and lok nayak hospital , new delhi , in the year 2010 - 2011 .
twenty two subclinical hypothyroid female patients , 30 - 50 years and for comparison , 20 age matched female hypothyroid patients were recruited in the medical outpatient department .
the patients were selected on the basis of clinical features suggestive of decreased thyroid function , and laboratory findings of a normal free t3 and t4 levels and tsh more than 5 miu / l , on two occasions six months apart suggesting subclinical hypothyroidism .
patients with diagnosed hypertension , ischemic or valvular cardiac disease , heart failure , previous vascular surgery , pulmonary hypertension , respiratory , hepatic , renal , neurological disease , psychological morbidity , malignancy , history of radiotherapy , taking iodide drugs , lithium carbonate , sulphonyl urea , amiodarone , smokers , postmenopausal and pregnant women were excluded from the study .
the study protocol was approved by the institutional ethical committee and informed consent was taken .
the details of patient 's history and investigations including basal electrocardiography ( ecg ) and colour doppler of thyroid gland , lipid profile and blood sugar estimation were recorded in a proforma .
the battery of tests done were , standing to lying ratio ( sl ratio ) , immediate heart rate response to standing ( 30:15 ratio ) , valsalva ratio , heart rate variations with respiration ( ei ratio ) , hand grip test(hgt ) and cold pressor test(cpt ) .
one or more abnormal test was considered an indication of autonomic dysfunction . in order to make the evaluation more objective ,
five of these tests ( valsalva ratio , 30:15 and ei ratio to evaluate parasympathetic function , hand grip and cold pressor response for sympathetic function ) were scored .
they were scored 0 , for normal , 0.5 if borderline and 1 for abnormal response , as has been standardized in our lab and previously done by other authors .
the sum of the scores were calculated and graded , zero was no damage , more than zero to three was mild damage , more than three to six was moderate damage and more than six indicated severe damage to the ans .
they were further evaluated to see if they had sympathetic , parasympathetic dysfunction or both .
all measurements of heart rate were done using a continuous ecg recording ( lead ii ) and blood pressure ( bp ) was recorded using appropriate zero error mercury sphygmomanometer by auscultatory method .
baseline bp was taken after five minutes rest , as the average of two consistent readings one minute apart .
all patients were asked to come in the immediate post menstrual phase of their cycle for autonomic function testing to alleviate any changes related to the cycle .
patients were instructed to come after a light meal and to refrain from any caffeinated drinks on the day of testing .
all testing of autonomic functions was done in the forenoon , after they were familiarized with the testing procedure .
the outcome of the study was the mean and standard deviation of the record of age , weight , height , computed bmi , biochemical investigations , changes in hr and bp following autonomic function testing and their scoring .
independent sample test like levene 's test for equality of means and t test was done for age , weight , height , bmi , resting heart rate ( rhr ) , resting systolic and diastolic bp(rsbp , rdbp ) , blood sugar and lipid profile and autonomic functions .
mann whitney , wilcoxan test was done and two tailed significance calculated for , ft3 , ft4 , tsh , tpo antibody , and autonomic score .
the battery of tests done were , standing to lying ratio ( sl ratio ) , immediate heart rate response to standing ( 30:15 ratio ) , valsalva ratio , heart rate variations with respiration ( ei ratio ) , hand grip test(hgt ) and cold pressor test(cpt ) .
one or more abnormal test was considered an indication of autonomic dysfunction . in order to make the evaluation more objective , five of these tests
( valsalva ratio , 30:15 and ei ratio to evaluate parasympathetic function , hand grip and cold pressor response for sympathetic function ) were scored .
they were scored 0 , for normal , 0.5 if borderline and 1 for abnormal response , as has been standardized in our lab and previously done by other authors .
the sum of the scores were calculated and graded , zero was no damage , more than zero to three was mild damage , more than three to six was moderate damage and more than six indicated severe damage to the ans .
they were further evaluated to see if they had sympathetic , parasympathetic dysfunction or both .
all measurements of heart rate were done using a continuous ecg recording ( lead ii ) and blood pressure ( bp ) was recorded using appropriate zero error mercury sphygmomanometer by auscultatory method .
baseline bp was taken after five minutes rest , as the average of two consistent readings one minute apart .
all patients were asked to come in the immediate post menstrual phase of their cycle for autonomic function testing to alleviate any changes related to the cycle .
patients were instructed to come after a light meal and to refrain from any caffeinated drinks on the day of testing .
all testing of autonomic functions was done in the forenoon , after they were familiarized with the testing procedure .
the outcome of the study was the mean and standard deviation of the record of age , weight , height , computed bmi , biochemical investigations , changes in hr and bp following autonomic function testing and their scoring .
independent sample test like levene 's test for equality of means and t test was done for age , weight , height , bmi , resting heart rate ( rhr ) , resting systolic and diastolic bp(rsbp , rdbp ) , blood sugar and lipid profile and autonomic functions .
mann whitney , wilcoxan test was done and two tailed significance calculated for , ft3 , ft4 , tsh , tpo antibody , and autonomic score .
the ft3 , ft4 , tsh values were different , with lower thyroxine and higher tsh in hypothyroid patients . both total cholesterol and triglycerides ,
also the tpo values , although higher in hypothyroid patients , were not significantly different between the groups .
demographic and metabolic characteristics of study groups the comparison of rhr , rsbp , rdbp , autonomic function assessment and autonomic function score is shown in table 2 .
however on the basis of individual autonomic function test and scoring analysis it was found that 95.45% ( 21 ) of subclinical hypothyroid patients and 85% ( 17 ) of hypothyroid patients had autonomic dysfunction . in subclinical hypothyroid patients 59% ( 13 ) had sympathetic dysfunction , 13.63% ( 3 ) had parasympathetic function abnormality , while 22.72% ( 5 ) had both .
similarly , 45% ( 9 ) hypothyroid patients had sympathetic dysfunction alone and 40% ( 8) had both abnormalities .
when two test abnormalities was used as a selection criteria , then 50% ( 11 ) subclinical hypothyroid and 75% ( 15 ) hypothyroid patients had autonomic dysfunction . in subclinical hypothyroid patients
was observed in two patients only , one case with sympathetic dysfunction and a case of parasympathetic dysfunction .
autonomic functions in subclinical hypothyroid and hypothyroid patients the correlation analysis showed that in subclinical hypothyroid patients the systolic bp had a significant positive correlation with age ( r = 0.528 , p = 0.012 ) and a negative correlation with ft4 levels ( r = 0.459 , p = 0.032 ) .
in hypothyroid patients the ft3 levels negatively correlated with the resting systolic and diastolic blood pressure ( r = 0.454 , p = 0.042 ; r = 0.581 , p = 0.007 respectively ) .
there was no correlation between tsh levels and autonomic functions and score in both groups .
this study found both subclinical hypothyroid and hypothyroid patients to have autonomic dysfunction with the sympathetic reactivity being affected in most cases .
sahin et al found no difference in the time and frequency domains of hrv compared to controls in those subclinical hypothyroid patients who had tsh levels less than ten but there was a decrease in sympathetic tone if tsh levels were greater than ten .
these patients with high tsh are probably a high risk group likely to proceed to hypothyroidism .
galetta et al had reported an increase in lf / hf frequency in heart rate variability reflecting higher sympathetic activity in subclinical hypothyroid patients .
these findings are in variance to our observations in this study but the authors had also suggested that the lower hf component of the hrv reflected a decrease in vagal tone .
other studies in subclinical hypothyroid patients have also reported a hypofunctional parasympathetic system based on analysis of the heart rate recovery and rr variations in ecg .
inukai et al , referred to a group of patients as masked hypothyroid ( normal t3 , t4 and high tsh ) , and found no change in parasympathetic function .
galetta et al , had found a decrease in sympathovagal balance characterized by decreased cardiovascular sympathetic and vagal modulation in hypothyroid patients .
some authors have even reported that the decrease in parasympathetic activity normalizes following restoration to euthyroid stage .
reviewing many studies heemestra et al , postulated that heterogeneity in the study population , cause and duration of disease may be responsible for the varied response observed in all these cases .
cacciatore et al , found that thyroid deficiency is associated with increased sympathetic influence on the heart but commented that hypothyroid and controls did not differ in the reflex responses as evaluated by traditional autonomic function tests .
however we have used some of the traditional tests and found autonomic dysfunction in both subclinical and hypothyroid patients but no major intergroup differences .
moreover autonomic scoring could be done by these methods . to the best of our current knowledge
this may be the first study to report autonomic dysfunction score in subclinical hypothyroid patients .
as mild autonomic dysfunction was seen in both groups , we can extrapolate our observations to suggest that autonomic abnormalities can begin early , even in the subclinical stage of hypothyroidism and are comparable in severity to that seen in hypothyroid patients .
the mechanisms suggested for autonomic disturbances in thyroid disorders include a high level of plasma adrenaline with a decreased receptor or post receptor sensitization , a decreased chronotropic response to adrenergic stimulation or adrenergic sensitivity , increase in thyrotropin releasing hormone ( trh ) which directly influences the sympathetic outflow , direct effect of thyroid hormone on the heart .
metabolic effects of decreased thyroid hormone , may also lead to increased protein deposition in extracellular space , resulting in water accumulation in myocardial wall , fibrosis in ventricular wall , all leading to increased regional inhomogeneity of ventricular repolarization .
also adverse effects on circulating lipids , vascular smooth muscle cell swelling and impaired endothelial function have been suggested .
autonomic dysfunction has been linked to prehypertension , to family history of hypertension and may lead to development of hypertension .
we did not find any hypertension , in subclinical hypothyroid patients , but systolic bp was higher in older patients and in those with a lower ft4 . in hypothyroid patients both sbp and dbp was higher in patients with lower ft3 levels . in galetta et al 's study , patients had higher systolic bp , and were prehypertensive . in another study
however walsh et al , reported that subclinical hypothyroidism was not associated with hypertension . in conclusion
we report that in this study , both subclinical and hypothyroid patients had autonomic dysfunction but were normotensive .
apparently there was no relationship between the autonomic function score and tsh or tpo levels .
we propose that larger studies investigating autonomic functions and their reversibility with treatment should be undertaken in subclinical hypothyroid patients .
autonomic dysfunction could be a risk factor for cardiovascular morbidity and its correction following therapy , one criterion that favors treatment in these patients . | background : autonomic dysfunction may contribute to cardiovascular morbidity in subclinical hypothyroid patients .
it is controversial whether the abnormality exists in sympathetic or the parasympathetic function .
it is also not known whether the severity of autonomic dysfunction is related to the degree of thyroid deficiency.design of study : prospective case control.materials and methods : autonomic functions based on heart rate ( hr ) and blood pressure ( bp ) responses to various maneuvers were evaluated and scored in twenty two subclinical hypothyroid patients , 30 - 50 years and compared with twenty hypothyroid patients .
biochemical estimation of tsh , ft3 , ft4 , tpo antibody was done.result:sympathetic function abnormalities were seen in 82% subclinical hypothyroid patients and 85%hypothyroid patients when one test was abnormal .
parasympathetic dysfunction was also recorded in eight patients in both groups .
when two abnormal tests were used as the selection criteria sympathetic function abnormality was observed in about 41% subclinical hypothyroid and 65% hypothyroid patients .
there were no intergroup differences in autonomic functions , score and tpo levels .
the tsh levels were not related to type or degree of autonomic dysfunction .
systolic bp in both groups and diastolic bp in hypothyroid patients were higher with lower thyroxine levels but the patients were normotensive.conclusion:autonomic dysfunction of comparable degree was seen in subclinical hypothyroid and hypothyroid patients .
sympathetic function abnormality was more common although decreased parasympathetic function reactivity was also present .
these abnormalities were unrelated to tsh levels . |
various diseases can cause otalgia because the ear has rich sensory innervationthrough many cranial ( v , vii , ix , and x ) and cervical ( 2 and 3 ) nerves .
primary otalgia is ear pain that originates inside the ear , whereas referred otalgia is ear pain that originates from outside the ear .
thus , a detailed patient history and through exam are is required to accurately determine whether otalgia is primary or referred .
the auricle is affected by cranial nerves v , vii , x , c2 , and c3 ; the external auditory meatus by cranial nerves v , vii , and x ; the tympanic membrane by cranial nerves vii , ix , and x ; and the middle ear by cranial nerves v , vii , and ix .
these 4 cranial nerves , as well as cervical nerves 2 and 3 are also distributed in other regions of the body as well as the ears .
we therefore investigated the clinical characteristics of patients with otalgia , including accompanying diseases , the difference between children and adults , and the difference between men and women .
between 2010 and 2013 , 294 patients visited the department of otolaryngology at kyung hee university medical center with complaints of otalgia .
patients were subdivided into those with otogenic or referred otalgia and their clinical characteristics were compared .
in addition , we assessed differences in characteristics of otalgia between adults and children , differences in characteristics of otogenic vs. referred otalgia between adults and children , differences between men and women , and differences according to the side of pain .
there were 52 children , of mean age 5.52.7 years ( range , 1 to 13 years ) and 231 adults , of mean age 49.815.8 years ( range , 20 to 81 years ) .
the patients underwent thorough examinations covered the ear , the teeth , the temporomandibular joint , the nose , the sinuses , and head and neck areas , and when necessary , examinations included direct and indirect laryngoscopy and biopsy .
patients without an ear , nose , and throat disease were referred to other departments for a definitive diagnosis .
groups were compared using the chi - square test , fisher 's exact test , and other statistical analyses , as indicated .
of the 294 patients , 208 ( 70.7% ) were diagnosed with otogenic otalgia and 86 ( 29.3% ) with referred otalgia .
otogenic otalgia tended to be more frequent in males than in females , whereas referred otalgia was more frequent in females ( p<0.05 ) .
ear fullness ( 33% ) and rhinorrhea ( 14.6% ) were the most common symptoms accompanying otogenic and referred otalgia , respectively .
hearing disturbance and otorrhea were significantly more frequent in patients with otogenic otalgia , whereas rhinorrhea , sore throat , and postnasal drip were significantly more frequent in patients with referred otalgia ( p<0.05 each ; table 2 and 3 ) .
there was no different in frequency in unilateral and bilateral otalgia in otogenic and referred otalgia ( table 4 ) .
otogenic otalgia originates from diseases of the external , middle and inner ear , whereas referred otalgia arises from pathologies outside the ear .
the frequency and ratio of these two types of symptoms are dependent on whether patients are seen by otolaryngologists or other physicians . in this study ,
otogenic otalgia was more frequent than referred otalgia , perhaps because these patients were initially examined and treated by otologists .
otogenic otalgia may be due to inflammation , mechanical causes , neoplasm , or eustachian tube dysfunction .
infectious causes include furunculosis , infected sebaceous cysts , cellulitis , otitis externa , necrotizing otitis externa , aom , mastoiditis , petrous apicitis , bullous otitis externa , and bullous myringitis .
neoplastic causes include squamous cell carcinoma and adenocarcinoma ; and eustachian tube dysfunctions include those due to otitis media with effusion and chronic otitis media .
patients with chronic otologic infections , except for chronic myringitis , rarely complain of severe otalgia .
thus , another cause , such as acute infection , is likely if chronic otologic infections are accompanied by otalgia .
for example , 78% of patients with primary otalgia were diagnosed with acute infectious ear disease , similar to previous results
complex sensory innervation of the auricle and external ear originates during the generation of the ear .
otic cysts are located between pairs of branchial arches , with cyst location resulting in the domination of various cranial nerves .
other organs are also under the control of these sensory nerves , resulting in referred otalgia
. referred otalgia may arise from the inability of the brain to distinguish the origin of pain because neurons starting from visceral and somatic sensation territories ascend to the brain via the same pathway .
alternatively , miscommunication may occur at the ventral posterior nucleus between the lateral and medial levels of the thalamus .
finally , referred otalgia may be a high - level phenomenon occurring at the cerebral cortex itself .
for example , the auriculotemporal nerve ( cranial nerve v ) is affected by temporomandibular joint dysfunction , dental diseases , trigeminal neuralgia , and mandibular osteomyelitis / tumor . the posterior auricular nerve ( cranial nerve vii )
jacobson 's nerve ( cranial nerve ix ) is affected by tonsillitis / pharyngitis , sinusitis , pharyngeal tumor , and glossopharyngeal neuroma .
arnold 's nerve ( cranial nerve x ) is affected by laryngopharyngeal reflux , cricopharyngeal spasm , and vagal stimulators .
the greater auricular ( c2 ) and lesser occipital ( c3 ) nerves are affected by cervical spine degenerative disease , cervical root cysts , arnold - chiari type , whiplash , vascular diseases , fibromyalgia , and other psychogenic causes .
therefore , a detailed medical history and a physical examination of all parts of the head and neck are required for patients with otalgia . the presence of lesions in organs other than the ear in patients who complain of otalgia may delay diagnosis and treatment . in this study
, we took detailed medical histories , excluding patients for whom it was impossible to get a medical history or for whom medical records were incomplete .
the only presenting symptom in this patient was otalgia and the physical examination at the first visit included only the ears , nose , and head & neck .
two months later , this patient had progressed to a sore throat along with the symptoms of otitis media .
nasal endoscopy revealed a mass in the nasopharynx , with cancer diagnosed after performing ct and biopsy .
diseases of the ear were the most common causes of otalgia in children , whereas secondary or referred otalgia was more common in adults .
the most common causes of primary and secondary otalgia in children are aom , common colds and other upper respiratory tract infections , otitis externa , foreign bodies , recurrent parotitis , tonsillitis , quinsy , neck abscess , sinusitis / nasal causes , temporomandibular joint dysfunction , dental causes and rare causes . in this study ,
aom was the most frequent cause of otogenic otalgia ( 50% ) , followed by chronic otitis media , otitis externa and ear trauma .
referred otalgia usually arose from a disease such as tonsillitis , pharyngitis or rhinosinusitis , accompanied by systemic symptoms .
children were diagnosed with otogenic otalgia significantly more frequently than adults because the incidence of aom was higher in children than in adults .
referred otalgia was less common in children than in adults , perhaps because otogenic otalgia is more frequent in children than in adults . in this study
otogenic otalgia was more common than referred otalgia in adults ; however referred otalgia was more frequent in adults than in children .
this study found that otogenic otalgia was more frequent in men , whereas referred otalgia was more frequent in women .
males may be more likely than females to pick their ears , thus leading to infectious ear diseases and the more frequent occurrence of otogenic otalgia in males .
the region , duration , and severity of pain , as well as its sudden or gradual onset , are useful in diagnosing otalgia . also , it is essential to confirm the pattern of accompanying symptoms . in this study ,
otologic symptoms , such as ear fullness , hearing disturbance , otorrhea , tinnitus , and dizziness , accompanied otogenic otalgia ; whereas rhinorrhea , nasal obstruction , postnasal drip , sore throat , fever , voice change , and reflux symptoms accompanied referred otalgia .
otalgia , cough , rhinitis , fever , diarrhea or vomiting are symptoms of aom , the most commonly diagnosed cause of primary otalgia .
previous studies found that unilateral otalgia was more common than bilateral otalgia , although the frequencies of right and left sided unilateral otalgia were similar .
we found that 83.7% of patients with otogenic otalgia and 74.4% of those with referred otalgia had unilateral otalgia , but there was no difference between the right and left sides .
otogenic otalgia was more commonly diagnosed than referred otalgia , with the latter usually arising from rhinologic or head and neck diseases .
the proportion of otogenic and referred otalgia differed by age and gender , with otogenic otalgia being more frequent in men and in children and referred otalgia more frequent in women and in adults .
adults who complain of otalgia should be suspected of having referred otalgia and undergo detailed physical examination for other diseases that can cause referred otalgia . | background and objectivesalthough otalgia is usually associated with ear problems , it may also originate outside the ear .
we therefore assessed the clinical characteristics of patients with otalgia.subjects and methodswe analyzed 294 patients who presented with otalgia .
we assessed differences in otalgia between adults and children , differences in otogenic vs. referred otalgia between adults and children , differences between men and women.resultsof the 294 patients , 208 ( 70.7% ) had otogenic otalgia and 86 ( 29.3% ) had referred otalgia . hearing disturbance and otorrhea
were significantly more common in otogenic otalgia , whereas rhinorrhea , sore throat , and postnasal drip were significantly more common in referred otalgia .
children were more likely to have otogenic otalgia than adults .
the proportion of patients with referred otalgia was significantly higher in adults than in children ( p<0.05 ) .
otogenic otalgia was more common in men , whereas referred otalgia was more common in women . among patients with referred otalgia ,
neuralgia was significantly more frequent in women than in men ( p<0.05).conclusionsotogenic otalgia was more frequent in men than in women and in children than in adults , whereas referred otalgia was more frequent in women and adults , indicating that types of otalgia were dependent on age and gender . |
these include very aggressive entities with rapid growth ( tumour volume doubling within weeks ) and spread of metastases within weeks or months such as small cell lung cancer ( sclc ) and some subgroups of non - small cell lung cancer ( nsclc ; fig .
1 ) such as poorly differentiated large cell lung cancer . on the other hand , other tumours take years to double their volume and develop lymphatic or haematogenous metastases , e.g. bronchioloalveolar carcinoma and other types of well - differentiated adenocarcinoma .
nevertheless , lung cancer is the leading cause of death from malignancy worldwide with an estimated 1.3 million deaths per year .
figure 1asymptomatic male smoker with a 12-mm ill - defined nodule posterior to the right upper lobe bronchus in the apical segment of the right lower lobe representing stage ia nsclc .
asymptomatic male smoker with a 12-mm ill - defined nodule posterior to the right upper lobe bronchus in the apical segment of the right lower lobe representing stage ia nsclc . despite extensive research and improvement in surgical , oncologic and radiation therapy during the last decades , its prognosis remains dismal with an overall 5-year survival of < 15% .
this is predominantly due to the fact that , in most patients , the diagnosis is made at advanced stages either with infiltration of adjacent structures or with lymphatic or distant metastases .
however , if the diagnosis is made at an early stage with no metastases , 5-year survival in nsclc may be > 65% and with very small lesions as high as > 80% .
for sclc , the difference in cure rates at early versus advanced tumour stages , unfortunately , is much less pronounced .
therefore , hope for improved cure of lung cancer patients was based on approaches to detect small and usually asymptomatic early stages non - small cell lung cancer using diagnostic tests .
this appears particularly promising as screening would not need to include the entire population but only subsets at an increased risk for lung cancer .
contrary to other malignant tumours such as breast cancer or colorectal cancer in which no individual risk factors can be identified in most patients , lung cancer is almost exclusively limited to individuals with previous exposure to certain carcinogens .
it is estimated that at least 85% of lung cancer patients are active or former smokers . even after smoking cessation , the risk of developing lung cancer decreases slowly .
therefore , currently in the united states , the majority of lung cancer patients are ex - smokers . in non - smoking lung
cancer patients , exposure through passive smoking ( inhalation of smoke from other smokers ) may contribute to the development of the tumour .
a combination of different risk factors may multiply the individual risk of developing lung cancer , e.g. smoking workers exposed to asbestos have a markedly higher risk than smokers with the same exposure to cigarettes alone .
detection of cancer at an asymptomatic stage may not always and automatically translate into a benefit for the patient .
a small asymptomatic lung tumour detected with a diagnostic test may still represent metastatic disease .
up to 20% of stage 1 ( t1 , 2 , n0 , m0 ) nsclc patients after curative resection later develop recurrence mostly at distant sites , which indicates that distant micrometastases were present before surgical removal of the primary tumour . to our current knowledge , this subset of patients does not benefit from early detection and surgery .
in contrast , detection of the lung tumour in an asymptomatic patient with metastatic disease probably does not affect the prognosis but turns a presumably healthy individual into a cancer patient with potential negative effects on that individual s quality of life .
furthermore , if such a patient is followed , the fact that the disease was detected earlier than in an individual with identical disease without screening means that survival from the moment of diagnosis will be longer than without screening , erroneously suggesting that screening has improved the time of survival ( e.g. longer median survival , higher 5-year survival rate ) .
this effect is called lead - time bias with the lead time representing the time between diagnosis through the screening test and the time at which the individual would have presented with symptoms .
similar to individuals with metastatic disease at diagnosis , there is another group of patients in which diagnosis of an asymptomatic tumour may not be beneficial to the patient .
if the diagnostic test detects an early tumour which in the remaining life - time would not have caused symptoms , the person becomes a cancer patient with the adverse effects of diagnostic and therapeutic procedures as well as the diagnosis itself , without any benefit to the person .
this is true of every individual screening programme , as there will always be a proportion of individuals who die with but not from the disease , for example from a traffic accident shortly after the diagnosis is made . as mentioned above
well - differentiated adenocarcinoma and in particular bronchioloalveolar carcinoma may sometimes require several years to double their volume .
if , for example , a tumour is detected at 1 cm diameter and has a volume doubling time of 3 years , it will take 12 years for this tumour to reach a diameter of 2.5 cm and 21 years to grow to a diameter of 5 cm , at which stage it may still not have spread .
if the person dies before this date , the tumour did not have any impact on that individual s health .
every diagnostic screening test performed at regular intervals is more likely to detect this type of slow - growing indolent tumour as an asymptomatic lesion , whereas very aggressive fast growing tumours with early metastases are more likely to present as interval tumours between two screening tests .
this propensity of every screening test to detect an unrealistically high proportion of more benign lesions is called length - time bias .
median survival , 5-year survival , overall survival , cure rate , rate of metastases , etc .
will , therefore , always be favourable in a screening programme , irrespective of the test applied .
one has to consider these effects when interpreting classic outcome surrogate markers in screening programmes .
in general , in a screening programme any test is applied to a large proportion of individuals who do not have the disease to detect a small proportion of patients with the disease . only in this subgroup will there be potential benefit from the test , whereas the side effects such as the consumption of resources , potential further procedures to differentiate between disease and insignificant changes in uncertain findings , radiation exposure , etc .
occurs in all screenees . for this reason the diagnostic performance of a test needs to be much better in a screening setting than when applied to a symptomatic patient .
if the sensitivity ( proportion of true positive ( tp ) diagnoses from all patients with the disease ( tp + false negative ( fn ) ) as well as the specificity ( proportion of true negative ( tn ) diagnoses from all patients without the disease ( tn + false positive ( fp ) ) is 90% respectively in a group of 1000 symptomatic patients with a prevalence of the disease of 50% ( 50% of patients with the symptoms have the disease ) , this will result in the following figures :
1000 individuals with symptoms500 individuals have the disease500 individuals do not have the disease450 individuals with the disease correctly identified50 fn diagnoses50 fp diagnoses 1000 individuals with symptoms 500 individuals have the disease 500 individuals do not have the disease 450 individuals with the disease correctly identified therefore , the positive predictive value ( tp / tp+fp ) is 450/450 + 50=90% , i.e. 90% of patients in whom the diagnosis is suggested by computed tomography ( ct ) do have lung cancer .
if however , the disease is rare in the population in a screening setting ( e.g. disease present in 1 of 100 screened subjects = prevalence of 1% ) , the same diagnostic test will result in these figures :
1000 individuals screened10 individuals have the disease990 individuals do not have the disease9 individuals with the disease correctly identified1 fn diagnosis90 fp diagnoses 1000 individuals screened 10 individuals have the disease 990 individuals do not have the disease 9 individuals with the disease correctly identified in this setting the positive predictive value ( tp / tp+fp ) is 9/9 + 90=9% , i.e. only 9% of patients in whom the diagnosis is suggested by ct do have lung cancer . in other words : 91% of individuals in whom a diagnosis of lung cancer is suggested by ct do not actually have lung cancer .
this means that the test performs quite well in a setting of symptomatic patients in missing the diagnosis in only 10% ( 50/500 ) of affected patients and wrongly suggesting the diagnosis in 10% ( 50/500 ) of cases in which the diagnosis is made . in a screening
setting , the test also misses the cancer in only 10% ( 1/10 ) of patients with the disease , but wrongly suggests the diagnosis in > 90% ( 90/99 ) of positive tests .
this has a significant impact on the cost / benefit ratio of the test , including the concerns of individuals in whom the diagnosis is incorrectly made , the number of unnecessary further tests and maybe invasive procedures .
it is absolutely clear , that the best way to prevent death from lung cancer is for a person to never smoke and if started , to give up smoking immediately .
however , unfortunately , the success rates of all smoking prevention and cessation programs are poor .
if a screening program is to be instituted , effects on smoking habits need to be assessed .
both positive and negative effects may be possible . if the invitation to a screening test could increase awareness of the serious health effects of smoking , potentially supported by demonstrating the extent of smoking - related non - tumorous changes ( e.g. emphysema , atherosclerotic disease ) , the test in combination with a smoking cessation program could prove doubly beneficial . if , however , the screened person ( erroneously ) believes , that there is no need to stop smoking as the test will identify any cancer in time to cure it and there is , therefore , no need to stop smoking
the test could increase the likelihood of dying from lung cancer instead of decreasing it .
chest radiography and sputum cytology were extensively analysed for their potential as screening instruments in smokers in the 1970s .
however , results were disappointing in that more tumours were diagnosed and resected , but mortality from lung cancer did not decrease in the screening groups compared with groups with no screening .
the explanation is probably that both tests are not sensitive enough to detect early cancers . in the 1990s
, ct was shown to be much more sensitive for small pulmonary nodules , which is the most common presentation of nsclc .
unfortunately , standard chest ct is associated with a relatively high level of radiation exposure , which in a screening setting is particularly problematic and important as it affects a large proportion of individuals without lung cancer .
it has , however , been shown that the sensitivity and specificity of ct for small lung cancers did not decrease significantly with major reduction of radiation exposure .
fibre optic bronchoscopy , particularly when using fluorescence or autofluorescence , is able to identify early cancer or even precancerous lesions , however , there are several problems which as yet prevent its widespread use in a population at risk .
it is semi - invasive , is not generally accepted by asymptomatic individuals , is not widely available , and is too expensive and time consuming .
it may , however , be useful to identify and even treat early lesions if the affected individuals are diagnosed with another test ( see below ) .
laboratory tests using modern techniques may allow the diagnosis of lung cancer to be made non - invasively in the future .
different approaches for testing for specific molecular markers in sputum , serum or exhaled air , assessing genetic anomalies in sputum or blood cells and other tests are under investigation . at the time of this writing , | abstractthe poor outcome in symptomatic lung cancer patients and the much better prognosis when lung cancer is diagnosed and treated at early asymptomatic stages call for screening . as
lung cancer predominantly affects smokers and individuals exposed to other carcinogens , screening programs need not include the whole population but only these risk groups .
every screening program will tend to better identify the more indolent tumours that grow slowly enough to be detected by screening before symptoms develop , whereas aggressive fast - growing tumours may present as interval cancers despite screening ( length - time bias ) .
some malignant tumours detected with screening may never cause the person s death due to competing causes for death , particularly in heavy smokers , such as cardiovascular disease or other cancers ( overdiagnosis bias ) . if a cancer is still lethal despite detection through screening , the affected individual may live longer with the diagnosis of cancer but not longer altogether ( lead - time bias ) .
it is likely that this will have a negative effect on that individual s quality of life .
participation in screening programs may have beneficial as well as adverse effects on smoking habits ; in the worst case it may encourage people to continue smoking .
trials assessing chest radiography or sputum microscopy have not demonstrated a reduction in lung cancer mortality through screening , probably because the tests were not sensitive enough .
computed tomography promises better sensitivity .
other modern tests such as fibre optic bronchoscopy , analysis of molecular markers or genetic testing in serum , sputum or exhaled air are not yet ready for clinical practice . |
intrathymic t cell development involves the differentiation and selection of t cells that carry a tcr that is self - mhc restricted but does not bind with high affinity to self - antigen derived peptides presented by self - mhc molecules .
the processes that produce such a selected t cell repertoire are called positive selection and negative selection respectively ( 1 , 2 ) .
negative selection is central to the generation of a self - tolerant t cell repertoire , and recent studies have reiterated the importance of intrathymic negative selection in the prevention of autoimmune disease ( 35 ) .
the phenomenon of negative selection has always presented a paradox to immunologists , as it is mediated by the same tcr / cd3 complex that governs positive selection and cd4/cd8 lineage commitment and later in the life of a t cell mediates activation and clonal expansion .
negative selection is a differentiation stage - specific phenomenon , and depending on the model system , may operate at the immature cd4cd8 double - positive stage of thymocyte differentiation in the thymic cortex and/or at the later cd3cd4cd8or cd3cd4cd8 stage when thymocytes transit through the cortico - medullary junction ( 2 ) .
medullary thymocytes continue to differentiate and eventually reach a stage where they are beyond the window of negative selection and are ready to migrate from the thymus to peripheral lymphoid tissues .
this transition is thought to occur as these cells down - regulate the maturation marker cd24 ( heat stable antigen [ hsa ] ) , a very late event in intrathymic t cell development ( 6 ) .
the clearly distinct outcomes ( deletion versus activation ) after tcr ligation in immature versus mature t cells may reflect a change in the way these cells interpret signals from their tcr , or alternatively , other possibilities are that apoptotic death may result from additional signals received at the immature stage or absence of survival - promoting signals that are received only later in more differentiated cells .
the search for the apoptosis signaling pathway(s ) in thymocyte negative selection has been a long - term quest for t cell immunologists .
mammals have two distinct apoptosis signaling pathways ( 7 ) , one regulated by pro- and antiapoptotic members of the bcl-2 protein family and the other activated by
death receptors members of the tnf - r family with an intracellular death domain , and both have been implicated in thymocyte negative selection .
three intracellular signaling factors have been clearly shown to be critical for negative selection , being nur-77/nurr1/nor1 transcription factor family ( 8 , 9 ) and the pro - apoptotic bcl-2 family members bim ( 4 ) , and bax plus bak ( 10 ) .
many studies have investigated whether death receptors , including : fas , tnf , dr3 , lt , light , and cd30 ( for reviews , see references 1115 ) , play a role in thymocyte negative selection .
evidence has been provided suggesting a role for fas at high but not low intensity tcr / cd3-stimulation .
this is , however , not supported by studies showing that negative selection is intact in transgenic mice lacking fadd or caspase-8 function due to expression of a dominant - interfering mutant of fadd or the viral serpin crma ( 16 , 17 ) .
recently , a critical role for the tnf family member tnf - related apoptosis - inducing ligand ( trail ) was proposed , based upon studies using several in vitro and in vivo models where negative selection was at least partially impaired in trail - deficient mice or in the presence of blocking soluble trail receptor , dr5 ( 18 ) .
this result is also at odds with early results from fadd dominant negative and crma transgenic mice , as fadd and caspase-8 are essential for trail - induced apoptosis . even more puzzling
, it clearly contrasts with a previous study using trail inhibitors that indicated that negative selection of mouse and human thymocytes was trail - independent ( 19 ) .
the reasons for these discrepancies are unclear , although it was suggested that trail might utilize an alternative ( undefined ) apoptosis signaling pathway that does not involve fadd - caspase 8 but may activate bim and bax / bak ( 20 ) .
we sought to investigate this problem using a range of well - established negative selection models , including in vitro tcr / cd3 ligation , in vivo and in vitro deletion of endogenous superantigen reactive t cells , and in vitro stimulation with the superantigen staphylococcal enterotoxin b ( seb ) .
inbred balb / c and c57bl/6 ( b6 ) wt mice were purchased from the walter and eliza hall institute .
the trail gene - targeted mice were originally derived at immunex corporation as described ( 18 , 21 ) and bred at the peter maccallum cancer centre : balb / c trail - deficient mice ( balb / c trail ) were 10 generations backcrossed to balb / c and c57bl/6 trail - deficient ( b6 trail ) mice ( 5 generations backcrossed to c57bl/6 ) . mice were used in all experiments under specific pathogen - free conditions according to animal experimental ethics committee guidelines .
mice were culled and their thymus , spleen , axial , brachial , and inguinal lymph nodes removed for analysis of cellularity and composition . fetal thymic lobes
were isolated from day 15 balb / c wt and balb / c trail embryos and cultured for 12 d in rpmi-1640 ( invitrogen / life technologies ) medium supplemented with 10% fcs ( commonwealth serum laboratories [ csl ] ) , 2 mm glutamax , 100 iu / ml penicillin , 100 g / ml streptomycin , 15 mm hepes buffer ( invitrogen ) , and 1 mm sodium pyruvate ( invitrogen ) with or without 20 g / ml anti - mtrail mab ( n2b2 ; reference 22 ) and 10 g / ml seb ( toxin technology co. ) .
lobes were cultured in groups of 2 per well of a 6-well plate and medium was changed after 6 d. at the end of culture , thymocytes were harvested from lobes , counted and analyzed by flow cytometry . for in vitro analysis ,
thymocyte suspensions were produced from e18 thymic lobes of balb / c and balb / c trail mice .
cells were cultured at a density of 10 cells / ml , in dmem medium supplemented with 10% fcs in wells of a 96-well plate that had been coated overnight with hamster anti
mouse cd3 ( 1452c11 ) , anti - cd28 ( 37.51 ) mab ( both from bd biosciences ) , or pbs .
20 h later , proportions of live and apoptotic cells were identified by staining with propidium iodide ( sigma aldrich ) and annexin v - fitc ( roche ) .
thymocytes , splenocytes , and lymph node cells were stained with surface marker - specific mabs including : anti - cd3-fitc ( 17a2 ) , anti - cd4-percp - cy5.5 ( rm45 ) , anti - cd8-pe ( 536.7 ) , anti - tcrv3-biotin ( kj25 ) , anti - tcrv5.1/5.2-biotin ( mr94 ) , anti - tcrv6-biotin ( rr47 ) , anti - tcrv8.18.2-biotin ( mr52 ) , and anti - tcrv11-biotin ( rr315 ) ( all bd biosciences ) , in the presence of anti - fc receptor block cd16/32 ( clone 2.4g2 ) .
inbred balb / c and c57bl/6 ( b6 ) wt mice were purchased from the walter and eliza hall institute .
the trail gene - targeted mice were originally derived at immunex corporation as described ( 18 , 21 ) and bred at the peter maccallum cancer centre : balb / c trail - deficient mice ( balb / c trail ) were 10 generations backcrossed to balb / c and c57bl/6 trail - deficient ( b6 trail ) mice ( 5 generations backcrossed to c57bl/6 ) . mice were used in all experiments under specific pathogen - free conditions according to animal experimental ethics committee guidelines .
mice were culled and their thymus , spleen , axial , brachial , and inguinal lymph nodes removed for analysis of cellularity and composition .
fetal thymic lobes were isolated from day 15 balb / c wt and balb / c trail embryos and cultured for 12 d in rpmi-1640 ( invitrogen / life technologies ) medium supplemented with 10% fcs ( commonwealth serum laboratories [ csl ] ) , 2 mm glutamax , 100 iu / ml penicillin , 100 g / ml streptomycin , 15 mm hepes buffer ( invitrogen ) , and 1 mm sodium pyruvate ( invitrogen ) with or without 20 g / ml anti - mtrail mab ( n2b2 ; reference 22 ) and 10 g / ml seb ( toxin technology co. ) .
lobes were cultured in groups of 2 per well of a 6-well plate and medium was changed after 6 d. at the end of culture , thymocytes were harvested from lobes , counted and analyzed by flow cytometry .
for in vitro analysis , thymocyte suspensions were produced from e18 thymic lobes of balb / c and balb / c trail mice .
cells were cultured at a density of 10 cells / ml , in dmem medium supplemented with 10% fcs in wells of a 96-well plate that had been coated overnight with hamster anti mouse cd3 ( 1452c11 ) , anti - cd28 ( 37.51 ) mab ( both from bd biosciences ) , or pbs .
20 h later , proportions of live and apoptotic cells were identified by staining with propidium iodide ( sigma aldrich ) and annexin v - fitc ( roche ) .
thymocytes , splenocytes , and lymph node cells were stained with surface marker - specific mabs including : anti - cd3-fitc ( 17a2 ) , anti - cd4-percp - cy5.5 ( rm45 ) , anti - cd8-pe ( 536.7 ) , anti - tcrv3-biotin ( kj25 ) , anti - tcrv5.1/5.2-biotin ( mr94 ) , anti - tcrv6-biotin ( rr47 ) , anti - tcrv8.18.2-biotin ( mr52 ) , and anti - tcrv11-biotin ( rr315 ) ( all bd biosciences ) , in the presence of anti - fc receptor block cd16/32 ( clone 2.4g2 ) .
we first examined anti - cd3 plus anti - cd28 mab - induced apoptosis in vitro .
e18 mice are a rich source of dp immature thymocytes ( 9095% ) , and these importantly lack mature t cells that might upon tcr / cd3 ligation release soluble factors that kill dp thymocytes indirectly .
stimulation with anti - cd3 plus anti - cd28 mabs killed thymocytes from e18 wt balb / c mice in a dose - dependent manner as determined by staining with the vital dye pi and fitc - coupled annexin v ( fig .
1 ) , which detects externalized phosphatidyl - serine , a hallmark of apoptotic cells .
trail - deficient ( trail ) balb / c thymocytes or blocking of trail with a neutralizing antibody in cultures of wt thymocytes afforded no protection at any of the concentrations of anti - cd3/anti - cd28 mabs used ( fig .
the spontaneous death of thymocytes in culture was also equivalent between wt and trail mice .
similar results were obtained in vitro when analyzing dp thymocytes from adult balb / c or c57bl/6 wt and trail mice ( unpublished data ) .
thymocytes from balb / c and balb / c trail e18 mice were cultured in plates coated with anti - cd3 ( 1452c11 ) plus anti - cd28 ( 37.51 ) mabs or pbs . neutralizing anti - trail antibodies
after 20 h , live and apoptotic cells were discriminated by staining with annexin v - fitc plus propidium iodide and flow cytometric analysis .
data represent mean and standard error of the mean for six balb / c mice plus or minus the addition of anti - mtrail mab ) or four balb / c trail mice .
the effect of trail - deficiency was also examined in fetal thymus organ culture ( ftoc ) ( fig .
consistent with previous reports , addition of seb induced complete deletion of cd3 tcr v8 t cells in fetal thymus lobes derived from balb / c wt mice whereas tcrv6 t cells , which do not respond to seb , remained unaffected ( fig .
2 ) . loss of trail or addition of neutralizing anti - trail antibodies had no effect on seb - induced deletion of tcrv8 t cells ( fig .
t cells developing in ftoc were also examined for the deletion of v5 t cells that is caused by the endogenous superantigen mouse mammary tumor virus ( mmtv)9 presented by i - e class ii mhc . also in this depletion process , lack of trail or addition of neutralizing anti - trail antibodies afforded no protection against negative selection ( fig .
thymic lobes from e15 mice were cultured for 12 d in the presence of 10 g / ml seb plus or minus 20 g / ml anti - mtrail mab or an equivalent volume of pbs .
thymocyte suspensions were isolated , counted , and stained with antibodies to cd4 , cd8 , cd3 , and tcr v8 , v6 , or v5 .
( a ) histograms demonstrate expression of tcr v8 , tcr v6 , or tcr v5 on cd3 thymocytes ( cd4 or cd8 ) after incubation with seb or pbs ; and ( b ) total cells per lobe and tcr v8 , v6 , or v5 cells as a percentage of cd3cd4cd8 and cd3cd4 cd8 thymocyte subsets .
mean and standard error of mean were calculated from analysis of six balb / c trail and eight balb / c wt thymic lobes each for both pbs and seb treatment .
intrathymic deletion of developing t cells caused by endogenous superantigens mmtv6 and mmtv9 , was further assessed in adult balb / c mice .
these endogenous superantigens delete tcrv3 and tcrv5 t cells , respectively , in mice that express the class ii mhc antigen ( i - e ) .
we examined the frequencies of tcrv3 and tcrv5 t cells amongst cd4 and cd8 subsets in thymus , spleens and peripheral lymph nodes ( fig .
3 ) in balb / c wt or balb / c trail mice by immunofluorescent staining with tcrv-specific mabs and flow cytometry . similar deletion of t cells with these specificities was observed in balb / c wt and trail mice , compared with c57bl/6 mice ( i - e ) where cells with these specificities were not deleted ( fig .
, we also showed that tcrv6 and tcrv8 t cells are not deleted in either balb / c wt or trail mice .
consistent with an earlier report ( 18 ) , the thymus of adult trail mice ( 2.19 0.14 10 ) was slightly enlarged compared with wt mice ( 1.77 0.04 10 ; p = 0.0127 , mann whitney ) , however there was no significant difference in spleen or lymph node cellularity between the strains ( unpublished data ) .
the basis for this subtle difference is unclear , but does not appear to be due to impaired negative selection . mmtv-6 and mmtv-9 induced deletion of tcr v3 and v5 t cells .
thymocytes , splenocytes , and lymph node cells were isolated from 8-wk - old c57bl/6 ( n = 3 ) , balb / c ( n = 12 ) , and balb / c trail mice ( n = 11 ) .
cell suspensions were stained with antibodies to cd4 , cd8 , cd3 , and tcr v3 , v5 , v6 , or v8 .
( a ) histograms demonstrate expression of tcr v3 , tcr v5 , tcr v6 , or tcr v8 on cd4 cd3 or cd8 cd3 thymocytes .
( b ) tcr v3 , tcr v5 , tcr v6 , or tcr v8 cells as a percentage of cd3cd4cd8 and cd3cd4cd8 subsets of thymocytes , splenocytes , and peripheral lymph node cells .
our data , using four separate models of thymocyte negative selection , has fallen clearly on the side arguing that trail is not required for this process .
it is difficult to explain why our results are so distinct from those recently published ( 18 ) , which use trail mice from the same source and similar models for studying negative selection .
additionally examined thymocyte apoptosis after anti - cd3 treatment in vivo ; however this form of apoptosis is known to be largely tcr - independent , with a major role for tnf and glucocorticoid hormones ( 23 , 24 ) .
nevertheless , we also performed such experiments and trail was not critical for deletion ( unpublished data ) .
careful analysis of at least some of the data in the lamhamedi - cherradi et al .
study reveals some uncertainties in particular , the proportions of tcrv5 and tcrv11 t cells in peripheral lymphoid organs in trail - deficient mice are only slightly ( albeit significantly ) increased .
these t cells are deleted due to the presence of mmtv9 presented by i - e as occurs in balb / c mice . in mmtv9 and i - e negative mice , such as c57bl/6
, the proportion of these cells is at least 10 times that detected in balb / c mice .
the percentage of these cells in trail - deficient balb / c mice is barely above the percentage in control balb / c mice , which indicates that at least for that model , the impact of trail in negative selection is rather subtle at best .
perhaps the best results on mmtv9-mediated deletion would have been obtained from sp thymocytes , rather than dp thymocytes as presented ( 18 ) .
analysis of dp thymocytes is complicated by the fact that most of these cells express only very low levels of cell surface tcr , and only the very latest stages of dp thymocyte development are susceptible to mmtv - mediated negative selection ( 25 , 26 ) .
thus , changes in tcrv representation in this population are far more difficult to detect and less reliable than in sp thymocytes . indeed
, our findings were that in balb / c mice tcrv5 t cells were not dramatically under - represented in the dp thymocyte population , in contrast to their clear deficiency at the sp stage , which is consistent with the earlier study by hugo et al .
furthermore , mmtv9 is able to mediate significant deletion of tcrv5 cells in c57bl/6 mice ( i - a , i - e ) and the proportion and number of these cells is increased in bim - deficient c57bl/6 mice ( 4 ) that are known to have impaired negative selection . by contrast , as no difference in the percentage of tcrv5 cells was reported in c57bl/6 trail - deficient mice ( 18 ) , this again raises some concern over the extent to which trail regulates negative selection
. it will be interesting to further assess intrathymic negative selection in mice lacking the trail death receptor ( dr5 ) or trail and additional tnf family members .
bim mutation leads to impaired negative selection of t cells in mice and spontaneous development of autoimmune glomerulonephritis ( 3 ) .
mutation of autoimmune regulator ( aire ) in mice also leads to a failure to delete organ - specific cells in the thymus and predisposes to a spectrum of organ - specific autoimmune diseases in mice ( 5 , 27 ) and humans ( 28 ) .
we have failed to reveal any signs of spontaneous autoimmunity , even in very old b6 trail mice ( > 550 d ) and balb / c trail ( > 300 d ) mice , compared with similarly aged syngeneic wt mice ( unpublished data ) . similar peripheral lymph node and spleen cellularity and composition , serum ig levels , and pancreas , kidney , and spleen architecture were detected in these aged mice .
while trail - deficient mice may be more susceptible to the induction of autoimmunity in certain experimental models ( 29 , 30 ) , it remains unclear by what mechanism trail suppresses the induction of autoimmunity .
clearly , disease induction in these models is complex and often involves adjuvants that stimulate dendritic cells and innate immune cell networks .
the lack of any signs of autoimmunity in aged trail - deficient mice is further evidence that trail is not critical for maintaining self - tolerance , and is dispensable for intrathymic negative selection . in summary , while trail may be functional on activated mature t cells and nk cells and may be capable of suppressing induction of autoimmune disease , we have shown in four different models that trail is not critical for intrathymic negative selection . using both trail - deficient mice , and a powerful neutralizing anti
mouse trail mab , we failed to detect an essential role for trail in t cell deletion in these systems .
we are unable to easily explain the basis of the discrepancies between our results and those recently published , but in light of our data and other studies supporting our results ( 19 ) , we suggest that the importance of trail in intrathymic negative selection is , at best , unclear and requires further investigation . | the molecular basis of thymocyte negative selection , which plays a critical role in establishing and maintaining immunological tolerance , is not yet resolved . in particular , the importance of the death receptor subgroup of the tumor necrosis factor ( tnf)-family has been the subject of many investigations , with equivocal results .
a recent report suggested that trail was a critical factor in this process , a result that does not fit well with previous studies that excluded a role for the fadd - caspase 8 pathway , which is essential for trail and fas ligand ( fasl ) signaling , in negative selection .
we have investigated intrathymic negative selection of trail - deficient thymocytes , using four well - established models , including antibody - mediated tcr / cd3 ligation in vitro , stimulation with endogenous superantigen in vitro and in vivo , and treatment with exogenous superantigen in vitro .
we were unable to demonstrate a role for trail signaling in any of these models , suggesting that this pathway is not a critical factor for thymocyte negative selection . |
acute pulmonary embolism ( pe ) is a life - threatening cardiovascular pathology with higher mortality and morbidity .
acute pe is the third common cardiovascular cause of mortality following acute myocardial infarction and stroke .
the prognosis and severity of acute pe are related to thrombus burden and the presence of right ventricular ( rv ) dysfunction .
several imaging modalities such as pulmonary computed tomographic angiography ( cta ) , ventilation - perfusion scintigraphy , and transthoracic echocardiography , also laboratory parameters such as d - dimer , cardiac troponin , b - type natriuretic peptide , heart - type fatty acid - binding protein , and ischemia - modified albmin ( i m a ) are helpful in diagnosis and prognosis of acute pe .
i m a is a biomarker , which is formed as a consequence of the modification of albumin by reactive oxygen radicals .
serum i m a levels are found to be increased in acute coronary syndromes , stroke , pe , mesenteric ischemia , and during percutaneous coronary interventions .
previous studies demonstrated that i m a is more sensitive parameter than d - dimer in diagnosis acute pe .
in addition , tredi et al . showed that serum i m a levels are not correlated with pulmonary artery obstruction index ( paoi ) , which is measured with pulmonary cta .
the aim of this study was to evaluate the diagnostic value of i m a and the relationship with rv dysfunction in acute pe .
this is noninterventional and single - center study , which involved 145 patients with acute pe according to the european heart association 2008 acute pe diagnosis and treatment guidelines , who were admitted to necmettin erbakan university , meram school of medicine , department of cardiology , coronary intensive care unit , between february 2010 and march 2012 . in order to confirm the diagnosis pulmonary cta
compliance of the study with the rules of the helsinki declaration was approved by the ethics committee of meram school of medicine .
all patients were informed about the study , and consent was obtained from all patients .
patients with known atrial fibrillation , peripheral arterial disease , acute stroke , acute coronary syndrome , decompensated heart failure , history of percutaneous coronary intervention or bypass surgery within the last 1 month and poor echocardiographic image quality were excluded from the study .
nevertheless , patients with massive pe ( high - risk ) were not included to the study .
all patients were evaluated with a philips envisor c hd ultrasound machine ( royal philips electronics , bothell , wa , usa ) with a 2.5 mhz transducer . the echocardiographic examination was performed at the left decubitus position and at the end of expirium .
rv ejection fraction was measured from the apical four - chamber window by simpson 's method .
estimated systolic pulmonary artery pressure was measured with bernoulli equation using a peak flow which was acquired by placing continuous wave doppler to tricuspid valve regurgitation flow jet .
rv systolic motion ( rv sm ) was measured from the lateral tricuspid annulus via tissue doppler imaging .
patients with rv / left ventricular ( lv ) > 1 were defined as rv dysfunction .
i m a was measured by enzyme - linked immunosorbent assay ( elisa ) method ( human ischemia modified albumin , i m a elisa kit ) .
all specimens were measured using a spectrophotometer at 450 nm ( shimadzu , uv 1601 , japan ) and reported in absorbance units ( absus ) .
all statistical analysis was performed using the spss for windows ( v. 15.0 , spss inc . ,
the kolmogorov smirnov test was used to assess whether the data had a normal distribution ( parametric or nonparametric ) .
for normally distributed variables , a student 's t - test was used to compare groups with independent variables .
a linear spearman test was used to explore the relationship between i m a and both clinical and echocardiographic parameters .
, medcalc software , belgium ) pocket program was used to obtain receiver operating curve and to analyze specificity , sensitivity , negative and positive predictive values of i m a in diagnosis acute pe .
this is noninterventional and single - center study , which involved 145 patients with acute pe according to the european heart association 2008 acute pe diagnosis and treatment guidelines , who were admitted to necmettin erbakan university , meram school of medicine , department of cardiology , coronary intensive care unit , between february 2010 and march 2012 . in order to confirm the diagnosis pulmonary cta
compliance of the study with the rules of the helsinki declaration was approved by the ethics committee of meram school of medicine .
all patients were informed about the study , and consent was obtained from all patients .
patients with known atrial fibrillation , peripheral arterial disease , acute stroke , acute coronary syndrome , decompensated heart failure , history of percutaneous coronary intervention or bypass surgery within the last 1 month and poor echocardiographic image quality were excluded from the study .
nevertheless , patients with massive pe ( high - risk ) were not included to the study .
all patients were evaluated with a philips envisor c hd ultrasound machine ( royal philips electronics , bothell , wa , usa ) with a 2.5 mhz transducer . the echocardiographic examination was performed at the left decubitus position and at the end of expirium .
rv ejection fraction was measured from the apical four - chamber window by simpson 's method .
estimated systolic pulmonary artery pressure was measured with bernoulli equation using a peak flow which was acquired by placing continuous wave doppler to tricuspid valve regurgitation flow jet .
rv systolic motion ( rv sm ) was measured from the lateral tricuspid annulus via tissue doppler imaging .
patients with rv / left ventricular ( lv ) > 1 were defined as rv dysfunction .
i m a was measured by enzyme - linked immunosorbent assay ( elisa ) method ( human ischemia modified albumin , i m a elisa kit ) .
all specimens were measured using a spectrophotometer at 450 nm ( shimadzu , uv 1601 , japan ) and reported in absorbance units ( absus ) .
all statistical analysis was performed using the spss for windows ( v. 15.0 , spss inc . ,
the kolmogorov smirnov test was used to assess whether the data had a normal distribution ( parametric or nonparametric ) .
for normally distributed variables , a student 's t - test was used to compare groups with independent variables . mann
a linear spearman test was used to explore the relationship between i m a and both clinical and echocardiographic parameters .
, medcalc software , belgium ) pocket program was used to obtain receiver operating curve and to analyze specificity , sensitivity , negative and positive predictive values of i m a in diagnosis acute pe .
demographic , clinical , and laboratory characteristics of patients with acute pe and control groups are depicted in table 1 .
there was a significant difference between groups in terms of body mass index , heart rate , systolic blood pressure , and shock index [ table 1 ] .
demographic , clinical and echocardiographic characteristics of the pe group versus control group serum i m a levels were increased in patients with acute pe compared to control group ( 0.41 0.06 vs. 0.34 0.11 p = 0.001 ) [ figure 1 ] . of the laboratory parameters , serum creatinine levels , hemoglobin , and white blood cells
were elevated in patients with acute pe compared to controls [ table 1 ] . from the cardiac biomarkers , troponine levels
were significantly increased in acute pe patients ( 0.28 0.40 ng / ml vs. 0.08 0.10 ng / ml , p= 0.02 ) rv functions were evaluated in both groups .
there were 46 patients with rv dysfunction in acute pe patients ( 46 of 89 , 51.6% ) .
estimated pulmonary systolic blood pressure ( pabs ) was significantly higher in acute pe patients compared to control group ( 44.7 16.6 mmhg vs. 27.1 6.2 mmhg , p = 0.001 ) .
rv sm was significantly lower in acute pe patients ( 12.7 2.3 cm / s vs. 14.9 2.7 cm / s , p = 0.001 ) .
serum ischemia modified albumin levels of patients with acute pulmonary embolism and control group serum i m a levels were similar between patients with and without rv dysfunction ( 0.42 0.12 vs. 0.40 0.11 , p = 0.38 ) [ figure 2 ] .
heart rate and shock index were significantly increased in patients with rv dysfunction ( 106 16 bpm vs. 95 19 bpm , p = 0.01 and 0.94 0.22 vs. 0.65 0.09 , p = 0.01 , respectively ) [ table 2 ] . from the echocardiographic parameters , estimated pabs was significantly elevated in patients with acute pe and rv sm was decreased in patients with acute pe [ table 2 ] .
comparison of serum ischemia modified albumin levels in patients with acute pulmonary embolism with and without right ventricular dysfunction clinical and echocardiographic characteristics of patients with rv dysfunction j1and without rv dysfunction there was significant correlation between serum i m a levels and both shock index and heart rate ( r : 0.36 , p = 0.02 and r : 0.31 , p = 0.001 , respectively ) .
serum i m a levels above 0.4 absu value had sensitivity , specificity , positive predictive value , and negative predictive value of 53.85% , 85.96% , 86% , and 53.8% , respectively ( area under the curve = 0.720 [ 95% ci : 0.6410.791 ] p = 0.001 ) [ figure 3 ] .
receiver operating curve analysis showing specificity and sensitivity of serum ischemia modified albumin levels in the diagnosis of acute pulmonary embolism
in this study , we found that serum i m a levels are increased in patients with acute pe .
i m a levels were significantly correlated with shock index and heart rate . nevertheless , i m a > 0.4 absu had higher positive predictive value in diagnosis acute pe .
acute pe is an important cardiovascular disease with a mortality rate ranging between 7% and 11% ; however in patients with delayed diagnosis the mortality may reach up to 30% . some biomarkers have been reported to be important in diagnosis prognosis of patients with acute pe . from these biomarkers ,
d - dimer , routinely used biomarker in clinical practice , has higher negative predictive value in diagnosis acute pe .
however , d - dimer has lower sensitivity and is affected from the several conditions such as inflammation , malignancy , necrosis , pregnancy , and , etc .
serum i m a levels may be used as a nonspecific biomarker of tissue ischemia .
found that serum i m a levels are elevated in patients with acute pe and have higher positive predictive value compared to d - dimer in diagnosis acute pe .
however , serum i m a levels alone were not sufficient in diagnosis acute pe and additional diagnostic tests are required . nevertheless , in another study performed by tredi et al .
, serum i m a levels were not correlated with paoi and rv / lv ratio measured with pulmonary cta .
previous studies showed that approximately 40% of patients with acute pe have rv dysfunction and presence of rv dysfunction is related with adverse clinical events and in - hospital mortality . in our study ,
we also found that serum i m a levels are not correlated with rv dysfunction .
in addition , i m a > 0.4 absu has higher positive predictive value , and additional tests are also needed . increased levels of serum i m a may be explained with hypoxia and tissue ischemia .
serum i m a levels were correlated with shock index and heart rate , and this correlation may be also explained with tissue ischemia as a cause of hypotension and hypoperfusion .
the main limitation in this study is a lack of power analysis to detect sample size in different groups .
we did not assess the short and long - term prognosis between i m a and acute pe .
the main limitation in this study is a lack of power analysis to detect sample size in different groups .
we did not assess the short and long - term prognosis between i m a and acute pe .
serum i m a levels have higher positive predictive value and may be used as an additional diagnostic tool in patients with acute pe .
however , serum i m a levels were not correlated with rv dysfunction measured with echocardiography that is an important parameter of severity patients with acute pe . | background : acute pulmonary embolism ( pe ) is a life - threatening and a relatively common cardiovascular pathology . although the pathogenesis of pe is well defined , there is no ideal diagnostic biochemical marker .
previous studies showed an increased ischemia modified albumin ( i m a ) levels in acute pe ; however , the relationship between i m a and right ventricular ( rv ) dysfunction has not been examined .
the aim of this study was to evaluate the diagnostic value of i m a and the relationship with rv dysfunction in acute pe.materials and methods : a total of 145 patients ( 70 females ) with suspected acute pe was enrolled to the study .
eighty - nine patients were diagnosed with acute pe via computed tomographic pulmonary angiography .
sixty - five patients with similar demographic and clinical characteristics were assigned to the control group .
all patients were evaluated for rv dysfunction using transthoracic echocardiography.results:serum i m a levels were significantly increased in acute pe compared with control group ( 0.41 0.06 vs. 0.34 0.11 , p = 0.001 ) .
there was no relationship between serum i m a levels and rv dysfunction .
i m a levels were positively correlated with shock index and heart rate .
receiver operating curve analysis demonstrated that serum i m a levels higher than 0.4 put the diagnosis at sensitivity of 53.85% and at specificity of 85.96%.conclusions : although i m a levels are increased in patients with acute pe , it failed to predict rv dysfunction . |
it is a rare intra - abdominal tumor with a strong predilection for the surface of the pelvic viscera .
although considered by many to be benign , this tumor has a high local recurrence rate . when found in the peritoneal cavity ,
it is usually intimately attached to serosal surfaces of the intestine , omentum , spleen , liver or in the retroperitoneal space .
the tumor has a female preponderance , with a female : male ratio of 5:1 .
most patients have a history of a previous abdominopelvic operation , endometriosis or pelvic inflammatory disease . however , there are reports of the disease diagnosed in men and children as well as in rare extra - abdominal locations .
symptoms and signs in symptomatic patients are abdominal or pelvic pain and tenderness or a mass palpated on abdominal or pelvic physical exam .
clinical presentation depends on the size and location of the tumor , and can result , rarely , in dyspareunia , constipation and urinary symptoms .
while some believe this tumor is a neoplastic lesion due to its tendency to recur after surgical resection and the reported low incidence of previous abdominal infection , others believe it is a reactive process . some suggest a hormonal involvement in the tumor pathogenesis .
the use of tamoxifen and long - acting gnrh analogues leads to a reduction in cyst volume and cyst growth . nevertheless , surgical excision with clear margins is the only curative option .
a 19-year - old male presented to the emergency department complaining of right lower quadrant abdominal pain of 2 days duration accompanied by diarrhea .
his father had recently been treated for testicular lymphoma . on physical examination upon admission ,
his temperature was 37c , and an abdominal examination revealed right lower abdominal quadrant tenderness .
complete blood count , urinalysis , liver and kidney function tests were all within normal limits .
1 , right panel ) revealed a multicystic mass of 10 3.4 1.6 cm in the right iliac fossa .
the patient complained of extreme pain upon compression of his abdominal wall with the us probe . due to this finding ,
abdominal ct of the abdomen ( fig . 1 , left panel ) revealed a thin - walled , cystic , multilobulated mass corresponding to the us finding .
a small amount of fluid was noticed in the pelvis and surrounding the cystic mass .
ca 199 as well as cea level were within normal limits . subsequent diagnostic laparoscopy ( fig .
2 ) revealed a grape - shaped pedunculated lesion , containing mucoid material ( fig .
the entire lesion was twisted on a long stalk that originated from the cecal wall .
multiple free intraperitoneal cystic lesions of various size were observed floating in the peritoneal cavity ( fig .
2 , middle and right panels ) . other cystic lesions were noticed on the pelvic wall , peritoneal lining and around the liver ( fig .
2 , right panel ) . the mass and some of the free - floating cysts were carefully harvested and removed for histological evaluation using an endobag .
the patient recovered well from the operation and was readmitted after 6 weeks for additional treatment .
this necessitated right hemicolectomy due to the heavy load of multiple cystic lesions on the ascending colon wall .
radiological tests including ultrasonography , ct and mri may demonstrate the lesions but can not differentiate them from other cystic lesions .
exploratory laparoscopy is the most accurate diagnostic method since it allows local biopsy of the suspected tissue .
pathological differential diagnosis includes a number of benign ( cystic lymphangioma , endometriosis and adenomatoid tumors ) and malignant lesions ( malignant mesothelioma and serous tumors involving the peritoneum ) .
it is agreed that surgery is the only effective treatment , with complete removal of the cystic lesions as the mainstay of treatment and the only chance for avoiding local recurrence .
unfortunately , further follow - up is compounded by the fact that there are no reliable clinical or imaging features , or tumor markers .
the prognosis is excellent . in one of the largest series reported in the literature ,
| a 19-year - old male presented with right lower quadrant pain .
imaging studies revealed a cystic peritoneal mass . at surgery ,
a large peritoneal mass was excised .
the pathology report revealed a benign cystic mesothelioma , and a right hemicolectomy with cytoreductive surgery was completed . |
tobacco is the second major cause of death worldwide , and responsible for about 5 million deaths annually .
this figure is expected to rise to about 8.4 million by the year 2020 , with 70% of those deaths occurring in the developing countries .
it is estimated that more than 150 million men and 44 million women in india use tobacco in various forms .
prevalence of tobacco use varies by area and gender ; ranging from 12.8% in punjab to 69.8% in mizoram in men , and < 1% in punjab to 61% in mizoram in women .
it is the need of the hour to reduce the use of tobacco to decrease the associated morbidity and mortality .
tobacco use is influenced by various factors , such as , individual attitudes , social acceptability , availability , advertising campaigns etc .
tobacco use in india differs from that of the globe , since the dominant form of tobacco used globally is the cigarette ; however , in india only 20% of the tobacco is consumed as cigarettes , 40% is consumed as bidi and the rest in the smokeless forms . as dentists we often come across patients with tobacco habits , and are in a stronger position compared to other medical practitioners to counsel the patients regarding the adverse effects of tobacco . also , it is imperative for a dentist to be equipped with all behavioral facts that can influence the tobacco habits in an individual , and all the epidemiological facts related to the habit .
very few hospital based studies have been conducted to assess the prevalence of the tobacco use and their epidemiological and behavioral patterns among patients with dental needs .
therefore , the present study was conducted to evaluate the prevalence of tobacco use among the patients in a rural set up and to elucidate the associated factors .
the study was conducted at the rural dental college and hospital ( rdch ) , loni from june - december 2010 .
the catchment area of the rdch is the contiguous 200 drought - prone villages of the district .
all the 4426 patients who reported to the deaprtment of oral medicine and radiology were questioned to select the patients who consume tobacco in any form .
the 725 patients who agreed to have the habit of tobacco smoking and/or smokeless , were included in the study after obtaining a written informed consent . trained dental surgeons interviewed the patients through a pre - tested structured questionnaire to collect data on the age , sex , education , socio - economic status , and marital status , form of tobacco , duration and frequency of consumption , reason for initiation , triggers for tobacco use , and any previous attempts to quit the habit .
any respondent using tobacco up to 5 times / day was categorized as a light tobacco user , between 6 to 20 times / day as a moderate tobacco user , and
chi - square test was used to evaluate the presence of a statistically significant difference between the gender and the variable characteristics ( age , educational status , occupational status etc ) under the study .
the data collected was tabulated and analyzed using microsoft excel . chi - square test was used to evaluate the presence of a statistically significant difference between the gender and the variable characteristics ( age , educational status , occupational status etc ) under the study .
of the 4426 patients examined with one or the other dental problems , 725 or 16.4% were found to have tobacco consumption habits . out of the 725 participants of the study population , 661 males ( 91.18% ) outnumbered the 64 females ( 8.82% ) .
majority , that is , 57% of the tobacco users are in the age group of 19 - 38 years . in males ,
the prevalence of tobacco use was the highest in the age group 19 28 years ( 40.09% ) followed by the age group of 29 38 years ( 18.75% ) ; whereas in females , it was highest in the age groups of 29 -38 years ( 29.68% ) and over 59 years ( 29.68% ) , followed by the age group of 39 - 48 years ( 18.75% ) [ table 1 ] .
the age and gender of the people were found to be very strongly associated ( = 12.60 ; p < 0.01 ) as far as the tobacco consumption was concerned .
over 75% males and 98% females either had no income ( housewives / students ) or less than rs .
educational attainment level was higher for males than for females and more than half of the females were illiterate ( 51.56% ) [ table 2 ] .
the difference between the incidence of tobacco users in relation to their educational status and gender was statistically highly significant ( = 73.18 ; p < 0.01 ) distribution of tobacco users by age and sex as seen in the study gender - wise educational status of tobacco users as seen in the study tobacco use was prevalent across all the occupational groups .
however , its distribution reveals that majority of the tobacco consumers were farmers ( 41% ) . in males ,
the prevalence of tobacco use was the highest in farmers ( 42.81% ) ; whereas in females it was highest in housewives ( 67.21% ) [ table 3 ] . the differences of rates of tobacco use with regard to the gender and occupation is statistically highly significant ( = 58.29 ; p < 0.01 ) distribution of tobacco users by occupation and gender as seen in the study use of smokeless tobacco was more prevalent in both the genders . among males ,
the most common smokeless form of tobacco consumption was use of khaini - a mixture of tobacco powder and lime prepared instantaneously by the user ( 38.58% ) followed by gutka ( 26.32% ) in males and mishri-- roasted fine tobacco powder ( 68.75% ) in females . among the smokers ,
maximum patients [ 37.36% males and 29.68% females ] , were using tobacco for 1 - 5 years . over 68% males and 91% females used tobacco 1 - 5 times a day .
nearly 30% males and over 9% females used tobacco for 6 - 20 times a day .
majority of the males ( 65.96% ) and females ( 76.56% ) never attempted to quit the habit . over 72% of the total participants
nearly 14% of the males attributed stress as major cause of initiation ; whereas 34.37% females started the habit for cleaning of teeth
( 53.13% ) turned out to be the most common trigger in females followed by during morning toilet
the study revealed an astonishing fact that 366 patients i.e. , over 50% developed the lesions .
tobacco hyperkeratosis was the most common oral mucosal lesion in both males ( 42.20% ) and females ( 11.07% ) [ table 6 ] .
the association between the presence of oral lesions and the gender proved to be highly statistically significant ( = 37.23 ; p < 0.01 ) .
distribution of tobacco users based on reason for initiation as seen in the study distribution based on triggers for tobacco use ( multiple choices
more than one answer possible ) as seen in the study presence of oral mucosal lesions among tobacco consumers as seen in the study
of the 4426 patients examined with one or the other dental problems , 725 or 16.4% were found to have tobacco consumption habits . out of the 725 participants of the study population , 661 males ( 91.18% ) outnumbered the 64 females ( 8.82% ) .
majority , that is , 57% of the tobacco users are in the age group of 19 - 38 years . in males ,
the prevalence of tobacco use was the highest in the age group 19 28 years ( 40.09% ) followed by the age group of 29 38 years ( 18.75% ) ; whereas in females , it was highest in the age groups of 29 -38 years ( 29.68% ) and over 59 years ( 29.68% ) , followed by the age group of 39 - 48 years ( 18.75% ) [ table 1 ] .
the age and gender of the people were found to be very strongly associated ( = 12.60 ; p < 0.01 ) as far as the tobacco consumption was concerned .
over 75% males and 98% females either had no income ( housewives / students ) or less than rs .
educational attainment level was higher for males than for females and more than half of the females were illiterate ( 51.56% ) [ table 2 ] .
the difference between the incidence of tobacco users in relation to their educational status and gender was statistically highly significant ( = 73.18 ; p < 0.01 ) distribution of tobacco users by age and sex as seen in the study gender - wise educational status of tobacco users as seen in the study tobacco use was prevalent across all the occupational groups .
however , its distribution reveals that majority of the tobacco consumers were farmers ( 41% ) . in males ,
the prevalence of tobacco use was the highest in farmers ( 42.81% ) ; whereas in females it was highest in housewives ( 67.21% ) [ table 3 ]
. the differences of rates of tobacco use with regard to the gender and occupation is statistically highly significant ( = 58.29 ; p < 0.01 ) distribution of tobacco users by occupation and gender as seen in the study
the most common smokeless form of tobacco consumption was use of khaini - a mixture of tobacco powder and lime prepared instantaneously by the user ( 38.58% ) followed by gutka ( 26.32% ) in males and mishri-- roasted fine tobacco powder ( 68.75% ) in females . among the smokers ,
maximum patients [ 37.36% males and 29.68% females ] , were using tobacco for 1 - 5 years . over 68% males and 91% females used tobacco 1 - 5 times a day .
nearly 30% males and over 9% females used tobacco for 6 - 20 times a day . alarmingly , a little over 2% males used tobacco > 20 times a day .
majority of the males ( 65.96% ) and females ( 76.56% ) never attempted to quit the habit . over 72% of the total participants
nearly 14% of the males attributed stress as major cause of initiation ; whereas 34.37% females started the habit for cleaning of teeth
( 53.13% ) turned out to be the most common trigger in females followed by during morning toilet
the study revealed an astonishing fact that 366 patients i.e. , over 50% developed the lesions .
tobacco hyperkeratosis was the most common oral mucosal lesion in both males ( 42.20% ) and females ( 11.07% ) [ table 6 ] .
the association between the presence of oral lesions and the gender proved to be highly statistically significant ( = 37.23 ; p < 0.01 ) .
distribution of tobacco users based on reason for initiation as seen in the study distribution based on triggers for tobacco use ( multiple choices
more than one answer possible ) as seen in the study presence of oral mucosal lesions among tobacco consumers as seen in the study
the researchers are fully aware of the fact that ours being a hospital based study , it can not reflect the true magnitude of the tobacco problem in the community .
the overall prevalence of tobacco use in our study was 16.38% which is lower than that in karnataka ( 29.6% ) , uttar pradesh ( 34.6% ) , and as well as national average of 30.2% . in our study ,
prevalence of tobacco use was 91.7% among men which is higher than reported by sinha et al .
( 52.6% ) , national family health survey ( nfhs)-3 report ( 61.1% ) , and in rural area of up ( 51% ) . in our study ,
prevalence of tobacco use was 8.82% among women which is comparable to rural area of up ( 9.2% ) ; but is lower than overall prevalence in maharashtra ( 15%-20% ) and also reported by gupta et al .
( 17.7% ) . in this study , most of the males and females had very less income ( < 5000 rupees ) which is in contrast with the hospital based study of saraswathi et al . ; but consistent with the study of kinra et al . and the overall national situation , thus supporting the finding that tobacco use is higher among individuals with lower standards of living . in our study , overall education attainment of patients was low which supports the finding that tobacco use is higher among individuals with lower levels of education , as also evidenced by various other studies .
majority of the subjects in this study never thought of quitting the habit since interest in quitting appears to be related to higher levels of education as shown by other studies .
occupation appeared influence men 's tobacco use more than that of women , because a large proportion of the women in this sample were homemakers .
individuals working in the farm were highly associated with the habit ; as they felt that it reduced the tiredness and brought in excitement in the body after heavy labor work . in this study ,
the use of smokeless tobacco ( 65% ) was more common than the smoking form ( 35% ) in males , which is consistent with the finding of sinha et al . , but in contrast to the finding of gupta et al . in our study , all females were using smokeless form of tobacco , mishri ( 68.75% ) in particular , which is consistent with the finding of gupta et al .
indian government has banned smoking in public places ; however , has imposed no ban on smokeless products , which probably could be a reason why smokeless form is more prevalent in this sample studied . in our study , men practiced smoking as well as tobacco chewing , whereas women only chewed or applied tobacco for cleaning of teeth which is consistent with the observation made by gupta et al .
although smoking by women is not well accepted in the indian society , consumption of smokeless tobacco is well accepted , and the use of mishri is a very common practice in maharashtra and goa . the mishri use ( 68.75% ) among women was higher in our study than that reported by pratinidhi et al .
the most commonly used smokeless form of tobacco was khaini ( 38.58% ) which is consistent with the study done by sinha et al .
gutka was the second most commonly used smokeless product and its increasing use may be contributed to the advertising and the marketing strategies of manufacturers .
khaini is less expensive compared to gutka ; hence may be used by more number of people . in our study , among males , cigarette smokers ( 8.17% ) were more than bidi smokers ( 5.75% ) , which is in contrast to the finding of sorensen et al . in this study , among males , light tobacco users ( 68.22% ) were higher in number than moderate tobacco users ( 29.63% ) , which is in contrast to the study of goswami et al .
[ light and moderate tobacco users were equal ] . in our study , females were mainly light tobacco users ( 90.62% ) which is consistent with the study by goswami et al .
( 71.8% ) . since friends and stress were the most common reasons for tobacco use initiation in males ; and , cleaning of teeth the important cause in females , these factors should be kept in mind while designing the interventional strategies .
this study probably for the first time has focused on the triggers for tobacco use .
counseling of patients on how to avoid tobacco in the presence of the triggering factors should be an important aspect of tobacco cessation programs .
the prevalence of oral soft tissue lesions in our study was 8.26% , which is more than reported by saraswathi et al .
( 4.1% ) . in our study , all lesions were more prevalent in men than women , which is consistent with study by saraswathi et al . in our study ,
the most common oral lesion in both the genders was tobacco hyperkeratosis followed by oral submucous fibrosis ( osmf ) which is in contrast with the study by saraswathi et al .
, where , smoker 's melanosis was the most common lesion in both genders , followed by smoker 's palate in males and leukoplakia in females .
tobacco use and its consequences are clearly an impediment to the development of a healthy and prosperous society .
laws enforced by the government alone are not sufficient to curb the menace of tobacco .
since the number of tobacco users visiting the dental hospital is reasonably high , the dental faculty , the dental students along with social scientists , and the public health workers , should plan for regular out - reach activities including health education , de - addiction counseling , early detection etc , to help to curb this issue
. active involvement of the media and influence of religious gurus and the family members in the out - reach activities will certainly help in creating a tobacco free society . | background : world health organization ( who ) predicts that tobacco deaths in india may exceed 1.5 million annually by 2020.objectives:the aim of this study was to estimate the prevalence of tobacco use , its influences , triggers , and associated oral lesions among the patients of rural dental college and hospital of loni , maharashtra.materials and methods : a hospital based cross - sectional study was conducted from june - december 2010 .
all the patients from the outpatient department and with tobacco habits were included in the study .
patients were interviewed through a pre - tested structured questionnaire in relation to their tobacco habits , its influences and triggers .
also clinical examination was carried out to check for any tobacco related oral lesions .
for the data analysis , microsoft excel and chi - square test was used.results:the overall prevalence of tobacco use was 16.38% .
smokeless form of tobacco was more prevalent in both males ( 81.84% ) and females ( 100% ) .
majority of the patients ( males - 68.22% , females- 90.62% ) were light tobacco users .
about 76.09% males and 31.25% females admitted that they developed the habit due to initial influence of friends .
the most common oral mucosal lesion in both the males ( 42.20% ) and females ( 11.07% ) was tobacco hyperkeratosis .
most common trigger for tobacco use was work related
( 69.14% ) in males and after meals ( 53.13% ) in females.conclusion:since the number of tobacco users visiting the dental hospital is reasonably high ; dentists can contribute to restrain the hazard through community educational activities such as de - addiction counseling of tobacco users to quit the habit . |
vitamin d ( vitd ) classically recognized for its role in the musculoskeletal system , has been implicated in myriad of conditions such as diabetes , immune dysfunction , cancers , heart disease , metabolic syndrome , etc .
we studied the role of vitd in acute care setting and its correlation with mortality .
a total of 85 consecutive consenting patients admitted in medical intensive care unit of tertiary care hospital who fulfilled the inclusion criteria were included .
all patients were evaluated clinically , and blood samples were collected for hemogram , biochemical investigations including serum calcium , phosphorus , alkaline phosphatase , magnesium , along with 25(oh ) vitd , 1,25(oh ) vitd and intact parathormone levels . simplified acute physiology score ( saps ii ) was calculated for all patients .
vitd was deficient ( < 30 ng / ml ) in 27 patients ( 32% ) .
the overall mortality was more in vitd deficient group as compared to vitd sufficient group ( 74 vs. 41% ; p < 0.05 ) .
the actual mortality in vitd deficient group was higher than the mortality predicted by saps ii score ( 50 vs. 74% ; p < 0.0507 ) .
vitd deficiency was also associated with more mortality among those requiring ventilator support ( 95% vs. 40% ; p < 0.05 ) as well as with higher blood glucose ( 124.5 29.7 vs. 94.8 19.8 : p < 0.01 ) levels .
vitd deficiency was associated with increased mortality , poor ventilator outcomes , and increased blood glucose in critically ill patients .
vitamin d ( vitd ) is associated with both classical ( actions on the musculoskeletal system ) and non - classical actions ( which are related to the role in the immune system , cell growth and differentiation and regulation of hormone secretion ) .
the role of vitd and impact of vitd deficiency has been widely studied in chronic conditions like cardiovascular disorders , diabetes mellitus , polycystic ovaries , autoimmune disorders , etc .
a limited number of studies have previously dealt with the subject , which had shown increased mortality , increased infections and more likelihood of renal impairment . no study from india until date deals with the topic to the best of our knowledge .
the aim of the current study was to study the impact of vitd deficiency on outcomes in critically ill patients .
the study was conducted at a large tertiary care center hospital run by the municipal corporation in mumbai , india ( latitude 1855n longitude 7254e ) .
after institutional ethics committee approval consecutive consenting patients ( consent of legally accepted representative in case of patients who can not give valid consent ) admitted to the critical care unit of the institute were included in the study excluding those with tuberculosis , chronic kidney disease , chronic liver disease , acute coronary syndromes , known malignancy , known diabetes mellitus , immediate post - operative ( surgery within last 14 days ) , pregnancy ( currently pregnant or pregnancy in last 2 years ) and those on anti - epileptic medications or corticosteroids prior to sample collection . simplified acute physiology score ii ( saps ii ) and
predicted mortality rate ( pmr ) calculated at 24 h of admission to intensive care unit from age , heart rate , systolic blood pressure , temperature , need for mechanical ventilation , arterial oxygen partial pressure ( by arterial blood gas analysis ) , fraction of inspired oxygen , urine output , blood urea nitrogen , white blood cell count , sodium , potassium , bicarbonate , bilirubin , glasgow coma scale and presence of chronic diseases .
samples for analytes mentioned were collected at the time of admission to the critical care unit .
indicated samples were repeated as directed by the intensive care unit team protocol as per case to case basis .
an additional fasting blood glucose sample was collected if the initial sample collection was a non - fasting .
calcium metabolism parameters ( serum calcium , magnesium , phosphorus , albumin , alkaline phosphatase , serum creatinine , 25(oh ) vitd3 [ radioimmunoassay , by biosource [ analytical sensitivity ; as-0.5 ng / ml ] and intact parathyroid hormone [ pth ] ] by immunoradiometric assay by immunotech ; as < 0.2 pg / ml ) were assayed from the blood sample collected within 3 h of admission to intensive care unit .
vitd deficiency was defined as level below 20 ng / ml , insufficiency as level between 20 and 30 ng / ml and sufficiency as level above 30 ng / ml .
statistical analysis was performed by spss version 19 manufactured by ibm , armonk , newyork , us .
mean standard deviation ( standard error of mean or quartiles wherever applicable ) were given as descriptive statistics .
log transformations were applied to highly skewed variables . chi - square test of independence or fisher 's exact test was used to test the distribution of discrete variables .
the mann - whitney rank sum test was used to test the difference among groups in continuous variables at baseline .
a linear regression analysis was done to assess the individual effect of various parameters on mortality .
out of the 85 patients included 64 ( 75% ) were males and 21 ( 25% ) were females .
the mean age was 42.4 16.9 years ( range 19 - 75 years ) .
16 ( 19% ) of cases had some other chronic medical illness apart from acute medical condition ( 12 were known hypertensive , two had chronic obstructive airway disease one had a past history of ischemic heart disease and 1 had cardiomyopathy ) .
mean vitd was 41.5 24 ng / ml ( range 4.8 - 142.1 ng / ml ) .
27 ( 32% ) cases had vitd deficiency / insufficiency , while remaining 58 ( 68% ) were vitd sufficient .
the average saps ii score was 48 ( q1 = 31 ; q3 = 64 ) and pmr was 47 30.61 ( range 4.2 - 98.5 ) . the actual observed mortality was 44/85 ( 52% ) .
there was no difference in age , sex distribution and corrected calcium levels amongst the vitd deficient / insufficient and sufficient groups .
the pth levels were higher and 1.25 vitd levels lower in vitd deficient / insufficient group ; however , the differences did not reach statistical significance . in our study
, we found higher blood glucose levels in vitd deficient / insufficient cases as compared vitd sufficient group ( 124.5 29.7 vs. 94.8 19.8 ; p < 0.01 ) . saps score in vitd deficient / insufficient group was 53 ( q1 = 32 ; q3 = 62 ) , where as in vitd sufficient group it was 46 ( q1 = 30 ; q3 = 66 ) ( p = 0.47 ) . the differences in parameters mentioned among two groups are summarized in table 1 .
the pmr was 50% in vitd deficient / insufficient group whereas it was 44% in vitd sufficient group ( p = 0.43 ) .
the actual mortality was 20/27 ( 74% ) in vitd deficient / insufficient group and 24/58 ( 41% ) in vitd sufficient group .
the difference between predicted and actual mortality neared , but did not reach statistical significance in vitd deficient / insufficient group ( p = 0.0507 ) .
thus , vitd deficiency / insufficiency was associated with higher mortality when compared to vitd sufficient population .
the mortality was more than what was predicted by saps ii score in vitd deficient / insufficient groups .
there was no difference in mortality in vitd deficient ( 9/12 died ; mortality 75% ) and vitd insufficient ( 11/15 died ; mortality 73.4% ) groups ( p = 0.73 ) .
there was no difference in number of patients with vitd deficiency / insufficiency ( 21/27 ) and sufficiency ( 40/54 ) who required ventilator support during the critical care unit stay , but the mortality rate among patients requiring ventilator support was more in vitd deficient / insufficient ( 20/21 died ) group when compared to vitd sufficient ( 16/40 died ) group ( p = 0.0001 ) .
the number of patients requiring ventilator support and mortality rates among them is shown in figure 2 .
comparison of vitamin d deficient / insufficient and vitamin d sufficient groups comparison of predicted and actual mortality ( expressed as percentage ) amongst 25(oh ) vitamin d ( vitd ) deficient / insufficient versus sufficient groups .
there was no difference in predicted mortality by simplified acute physiology score ii score among the 2 groups ( p = 0.43 ) , but the actual mortality was much more than predicted mortality in 25(oh ) vitd deficient / insufficient groups .
pmr = predicted mortality rate outcomes of patients requiring ventilator support amongst vitamin d ( vitd ) deficient / insufficient and vitd sufficient groups ( p = 0.0001 ) logistic regression showed that vitd deficiency / insufficiency was significantly associated with mortality with and odds ratio of 4.125 ( confidence interval = 1.56:11.06 ) .
the result of logistic regression and mortality risk associated is shown in table 2 . logistic regression analysis for mortality risk using possible responsible variables
vitd is classically known for its actions on the musculoskeletal system . however , more and more focus is being shifted on non - classical actions of vitd , which include hormone secretion , cell cycle regulation and immunomodulation .
vitd deficiency has been independently proven to increase the risk of all - cause mortality in the general population .
the study focuses on the role of vitd in acute care setting and tries to understand the impact of vitd deficiency in critically ill patients .
this is the first study in indian subcontinent trying to focus on the role of vitd in acute care setting to the best of our knowledge .
we found the prevalence of vitd deficiency to be 27% which is similar to reports from previous studies ( around 20 - 40% ) , though some authorities have reported higher prevalence .
shivane et al . in their study among healthy volunteers in western india found much higher prevalence of vitd deficiency ( 76% ) .
previous studies have looked at vitd deficiency / insufficiency and mortality in critically ill patients .
paul lee first reported increased mortality among vitd deficient / insufficient groups and stated that vitd deficiency was the second most important association with mortality after saps score .
hospital mortality was higher amongst vitd deficient patients ( p < 0.001 ) , but there was no difference in hospital stay and ventilator days .
the present study also found increased mortality in vitd deficiency / insufficiency , but the ventilator outcomes were extremely poor in vitd deficiency / insufficiency group , though there was no significant difference in ventilator requirement in two groups . respiratory muscle weakness attributable to vitd deficiency may result in poor ventalitory outcomes in vitd deficient group .
previous studies in hospitalized patients have correlated vitd deficiency with renal impairment , more severity of illness , more blood culture positive infections ( odds ratio = 1.64 ) and mortality among critically ill ( odds ratio = 1.69 ) .
vitd has also been attributed in sepsis as it influences local immune responses and systemic inflammatory process as suggested by kempker et al .
vitd deficiency is associated with increases incidence of diabetes , poor glycemic control in diabetics as well as more micro and macrovascular complications of diabetes . in our study , we found higher blood glucose levels in vitd deficient / insufficient cases as compared vitd sufficient group ( 124.5 29.7 vs. 94.8 19.8 ; p < 0.01 ) . to the best of our knowledge ,
no study previously has reported relation of increased blood glucose with vitd deficiency in critical care setting .
vitd is important for secretion of insulin as well as vitd deficiency is associated with insulin resistance , and these could be the possible reasons for high blood glucose in vitd deficient group .
the patients who were known diabetic were excluded from this subset analysis ( n = 4 ; two each in deficient and sufficient groups ) .
vitd deficiency is associated with myopathy that might also be associated with diaphragmatic and respiratory muscle weakness .
the high mortality in vitd deficient / insufficient group who required ventilator support may be due to this and also due to the association of vitd deficiency / insufficiency with a wide range of pulmonary diseases including viral and bacterial respiratory infection , asthma and chronic obstructive pulmonary disease .
critical illness is associated with severe bone resorption as pointed out by nierman et al . whereas van den berghe tried vitd supplementation in critically ill .
this failed to normalize vitd levels in most and no significant decrease was recorded in bone resorption markers .
however the doses used by van den berghe were much less ( 200 - 500 iu / day ) .
critically ill patients usually have multisystem involvement and role of vitd is being implicated in many systems beyond the musculoskeletal .
there is plenty of data about vitd in chronic diseases , but there are very few studies about vitd in acute care setting .
the principle of critical care is to target all reversible factors that may benefit the patient .
there is no denial of the fact that primary medical illness and underlying comorbidities are going to be the most important factors affecting survival and outcome in medical intensive care .
correction of vitd deficiency / insufficiency may at least improve ventilatory outcomes , reduce stress induced hyperglycemia , reduce renal dysfunction and may protect against bone resorption in critically ill patients .
more studies regarding this as well as a therapeutic intervention trials regarding same may further clarify about the role of vitd in critical care setting .
lack of intervention and treatment of vitd deficiency can be one of the major limitation as well as future study direction from the study .
a smaller sample size in the present study is not enough for the drawn conclusion and a larger sample size and involvement of multicentric trials preferably involving wider spectrum of critically ill patients can probably widen our knowledge horizon regarding the crucial role of vitd . | introduction : vitamin d ( vitd ) classically recognized for its role in the musculoskeletal system , has been implicated in myriad of conditions such as diabetes , immune dysfunction , cancers , heart disease , metabolic syndrome , etc .
we studied the role of vitd in acute care setting and its correlation with mortality.materials and methods : a total of 85 consecutive consenting patients admitted in medical intensive care unit of tertiary care hospital who fulfilled the inclusion criteria were included .
all patients were evaluated clinically , and blood samples were collected for hemogram , biochemical investigations including serum calcium , phosphorus , alkaline phosphatase , magnesium , along with 25(oh ) vitd , 1,25(oh ) vitd and intact parathormone levels . simplified acute physiology score ( saps ii ) was calculated for all patients.results:vitd was deficient ( < 30 ng / ml ) in 27 patients ( 32% ) .
the overall mortality was more in vitd deficient group as compared to vitd sufficient group ( 74 vs. 41% ; p < 0.05 ) . the actual mortality in vitd deficient group was higher than the mortality predicted by saps ii score ( 50 vs. 74% ; p < 0.0507 ) .
vitd deficiency was also associated with more mortality among those requiring ventilator support ( 95% vs. 40% ; p < 0.05 ) as well as with higher blood glucose ( 124.5 29.7 vs. 94.8 19.8 : p < 0.01 ) levels.conclusion:vitd deficiency was associated with increased mortality , poor ventilator outcomes , and increased blood glucose in critically ill patients . |
the hospitalization period in acute care hospitals in japan is regulated by several factors including disease severity , general condition of patients , and therapeutic intervention of surgery and/or other intensive cares .
these factors suggest that the hospitalization period is one index for evaluating quality of medical care .
namely , reducing hospitalization days is a reliable index for improving patient prognosis and quality of medical care in japan .
the diagnosis procedure combination ( dpc ) system was introduced in 2003 in japanese medical hospitals authorized to treat patients with health insurance .
the dpc system was practiced in 55% of all general sickbeds in 1,585 hospitals with a total of 492,256 sickbeds .
the main purpose of introducing the dpc system into intensive care hospitals in japan is to maintain a supply of above average medical care .
the dpc system regulates diagnostic and therapeutic approaches in each dpc code for standardization of medical care , and regulates the hospitalization period in each dpc code . in the dpc , hospital days
are set for every identical diagnostic classification ( dpc code ) as follows : period 1 : < 25 percentile of hospital days ; period 2 : < 50 percentile of hospital days ; and period 3 : within mean 2sd .
the aim of the present study was to evaluate causative ( risk ) factors for prolongation of hospitalization days in excess of period 3 according to the dpc system in 20,869 patients in saga university hospital .
the evaluated factors for prolongation of hospitalization period in the present study were hospitalization status with emergency or scheduled admission , selected ward of emergency care unit ( ecu ) , intensive care unit ( icu ) , beds for general patients , and comorbidities regarding diabetes mellitus and infectious diseases .
in the dpc system , hospital days are set for every identical diagnostic classification ( dpc code ) as follows : period 1 : < 25 percentile of hospital days ; period 2 : < 50 percentile of hospital days ; and period 3 : within mean + 2sd . a patient
whose hospitalization period exceeds period 3 is recognized as a significantly prolonged case compared with the national case in each identical diagnostic classification ( dpc code ) . according to the dpc definition , 20,876 patients hospitalized in saga university hospital from april 1 , 2012 , to february 28 , 2015 , were classified into two groups : group i , with hospitalization days within period 3 , and group ii , with hospitalization days exceeding period 3 . in groups
i and ii , the present study evaluated age , gender , hospitalization days , mortality rate during hospitalization , number of days in period 3 in each dpc code , emergency or planned hospitalization , ambulance transportation , use of icu and/or ecu , and underlying diseases ( comorbidities ) before and/or during hospitalization , focusing on diabetes mellitus and infectious diseases . among these factors ,
causative factors for prolongation of hospitalization ( group ii ) were evaluated by multiple logistic regression analysis .
all procedures performed in this study were approved by the ethical committee of saga university hospital ( 2015 - 05 - 05 ) . in the statistical analysis ,
chi square test or mann whitney u test was used for comparison between the two groups , and p<0.05 was used for significant difference .
multiple logistic regression analysis was conducted , with prolonged number of hospital days and onset of infection during hospitalization as objective variables .
table 1 shows the baseline characteristics of the patients hospitalized in saga university hospital in the dpc system .
as indicated in table 2 , the mortality rate during hospitalization was 1.0% , i.e. , 215 of 20,876 patients .
the number of patients transported by ambulance was 2,724 ( 13.1% ) , and the number requiring emergency hospitalization was 3,008 ( 14.4% ) . in total , 2,534 patients ( 12.1% ) had diabetes mellitus , while 765 patients ( 3.7% ) had infectious diseases at admission and 502 patients ( 2.4% ) during hospitalization .
the number of patients categorized into group ii ( hospitalization days beyond period 3 ) was 2,356 of 20,876 ( 11.3% ) .
table 3 shows causative factors for prolongation of hospitalization days beyond period 3 evaluated by univariate analysis . aging but not gender was a risk factor for long hospitalization .
mortality was high in group ii compared with group i ( p = 0.020 ) . setting days of period 3 in each dpc influenced categorization of group ii , indicating that dpc code with short setting dpc days was significantly higher when classified into group ii ( p<0.001 ) .
ambulance transportation and unplanned ( emergency ) hospitalization did not prolong hospitalization days . compared with group i , the patients in group ii were more likely to occupy beds for general patients and icu , but not ecu .
comorbidity of infectious diseases at admission was not a risk factor for prolongation of hospitalization , whereas comorbidities of diabetes mellitus and infectious diseases during hospitalization significantly prolonged hospitalization days ( p<0.001 for each ) .
causative factors for long hospitalization ( group ii ) analyzed by multivariate analysis are indicated in table 4 .
age , short setting period in dpc days , and days spent in icu were risk factors for prolonged hospitalization . regarding comorbidities ,
diabetes mellitus and infection diseases during the hospital stay were risk factors for long hospitalization .
table 5 shows risk factors for contracting infectious diseases during hospitalization evaluated by univariate analysis .
these were aging , long setting days of period 3 in each dpc , high mortality rate , ambulance transportation , unplanned hospitalization , long periods of using beds for general patients , ecu , and icu , and comorbidity of diabetes mellitus and infectious diseases at admission .
as indicated in table 6 , multivariate analysis showed that significant risk factors for suffering from infectious diseases during hospitalization were aging , dpc code with long setting days of period 3 , days in icu , and comorbid diabetes mellitus .
the present study clearly demonstrated that the main causative factors for prolongation of hospitalization in an acute and intensive care hospital in japan were : i ) contracting infectious disease during hospitalization ; ii ) aging ; iii ) comorbid diabetes mellitus ; and iv ) a long stay in icu .
infectious diseases during hospitalization were caused by several factors including nosocomial infection and infection following intensive intervention including surgery .
the results of the present study suggest that infectious disease complications during hospitalization were linked to increased severity of the patient s illness .
this was demonstrated by the higher mortality rate in group ii ( the prolonged hospitalization group ) of 1.49% , which was significantly higher than in group i ( 0.97% ) .
however , the present study did not examine in detail the causes of mortality and/or infectious diseases during hospitalization because of ethical limitations , and these areas warrant further exploration .
aging and diabetes mellitus , which might exacerbate infectious diseases , were also risk factors for prolongation of hospitalization .
regulation and control of infectious diseases during hospitalization has been enforced by the infectious diseases control division in the hospital , and the present study clearly demonstrated the importance of infectious disease control during hospitalization .
in contrast to infectious diseases during hospitalization , infectious diseases at admission were not a risk factor for long hospitalization .
this might be because treating these diseases was the main purpose of hospitalization , and/or that control of these comorbidities was relatively achieved before admission for therapeutic intervention .
this study indicated that diabetes mellitus and aging were risk factors for infection during hospitalization , which suggests that careful medical support is required for these patients during hospitalization .
the results of the present study showed that long duration in icu was equivalent to long hospitalization , indicating that speedy movement from icu to general beds , with appropriate therapeutic intervention , was required for quick discharge , in turn leading to improved prognosis for these patients .
regarding setting days of period 3 in each dpc , this study revealed two results : i ) the setting days of period 3 was shorter in group ii compared with group i , and ii ) setting days of period 3 was longer in the patients with infectious diseases during hospitalization .
the first result suggests that setting days may be re - evaluated in several dpc codes , while the second indicates that setting days of dpc was appropriately long in severe diseases with infection during hospitalization . in conclusion , this relatively large study with 20,876 patients indicated that the most important factor for reducing hospitalization days was to prevent infection during hospitalization especially for aged and/or diabetes mellitus patients .
rapid removal from icu with appropriate therapeutic approaches might be also important for reducing hospitalization days .
principal investigator , data collection , statistical analysis , and manuscript preparation : susumu fujii .
data collection : shinichiro ishikawa , yosuke aoki , keizo anzai , shigeki morita , kazuma fujimoto , and masaaki mawatari .
| this study aimed to evaluate causative factors for prolonged hospitalization based on hospitalization status , type of hospital ward , and comorbidities , specifically diabetes mellitus and infectious diseases , in 20,876 patients hospitalized in saga university hospital from april 1 , 2012 , to february 28 , 2015 .
prolonged hospitalization was defined as hospital days exceeding period 3 in the diagnosis procedure combination system . among all factors , causative ( risk ) factors for prolonged hospitalization
were evaluated by multiple logistic regression analysis .
multivariate analysis indicated causative factors for prolonged hospitalization were aging , comorbid diabetes mellitus , time spent in the intensive care unit , and infectious diseases contracted during hospitalization .
the risk factors for contracting infectious diseases during hospitalization were aging , male sex , comorbid diabetes mellitus , and increased number of days spent in period 3 in the diagnosis procedure combination code .
these data indicated that critical factors for discharge from hospital within an appropriate time frame were prevention of infectious diseases during hospitalization , and a fast and effective therapeutic approach to patients in the intensive care unit . |
research in the field of cardiopulmonary disease in brazil has been very dynamic over recent decades .
the combination of pubmed , scielo , open access and internet searching has led to an increase in the visibility of brazilian scientific journals .
this in turn has produced a significant proportion of original research reports into the brazilian scientific press with this newly acquired international visibility .
this review is intended to highlight some of these studies for the benefit of the readers of clinics .
we have therefore searched through pubmed for significant articles in the field of cardiopulmonary disease published in brazilian journals and included in the journal of citation reports of the institute of scientific information to better expose them to our readers .
an online search was conducted through pubmed for articles published in brazilian journals on cardiopulmonary research that are indexed in the journal of citation reports of the institute for scientific information .
arquivos brasileiros de cardiologia , arquivos brasileiros de endocrinologia e metabologia , brazilian journal of medical and biological reviews ,
revista brasileira de cirurgia cardiovascular , revista da associao mdica brasileira , revista da escola de enfermagem u.s.p . and so paulo medical journal .
this search produced a total of 71 articles , which were divided into four categories : clinical cardiology , cardiac surgery , pneumology and epidemiology .
the importance of exercise for cardiac function was addressed by investigators who reported on the safety of the six - minute walk - test for heart transplantation candidates ( cipriano et al)1 and on left ventricular systolic function ( berisha et al.).2 the circulatory response to a 50-meter walk in acute coronary syndrome was presented by dias et al.3 furtado et al
. reported on blood pressure measurements during aerobic exercise in cardiac rehabilitation,4 whereas oliveira et al .
reported on the effect of the walk test on the length of hospital stay for cardiac surgery patients.5 the relationships between fitness , waist circumference and hypertension in elderly brazilian women were investigated by krause et al.6 pelegrino et al . studied the influence of lean body mass on cardiopulmonary repercussions during the six - minute walk test in patients with chronic obstructive pulmonary disease (
conducted a gender - specific evaluation of coronary disease patients self - esteem and social support.8 barbirato studied the use of resting myocardial scintigraphy during chest pain to exclude the diagnosis of acute myocardial infarction.9 pesaro et al .
investigated the effects of leukocytes and glycemia on the prognosis of patients with acute myocardial infarction.10 finally , santos et al . evaluated
a new risk score for non - st - segment elevation acute coronary syndrome.11 heart failure was discussed in five different papers .
del carlo et al . described the relevance of cardiac troponin t for risk stratification.12 santos analyzed the quality of life in this group of patients.13 savioli et al .
examined the importance of angiotensin - converting enzyme inhibitors and plasma b - type natriuretic peptide levels in elderly patients with heart failure,14 while munhoz correlated microneurography and venous occlusion plethysmography with prognosis.15 margoto et al . examined the clinical and psychosocial features of heart failure patients admitted for clinical decompensation.16 the use of echocardiography as a diagnostic tool
assessed its utility for measuring left ventricular ejection fraction.18 aidar et al . analyzed the effect of sleep apnea on the heart rates of copd patients.19 arteaga analyzed the prognostic value of the collagen volume fraction in hypertrophic cardiomyopathy.20 atik described the clinical progress of patients with small ventricular septal defects.21 costa et al .
showed that body mass index has a good correlation with proatherosclerotic profile in children and adolescents.22 sa et al . described the effects of conventional ventricular stimulation on patients with normal ventricular function.23 barbaro and silva discussed the cardiovascular complications in acquired immunodeficiency syndrome.24 the interaction of diabetes and hypertension was the subject of silva et al
. , who examined the relevance of abdominal fat and insulin resistance to arterial hypertension in non - obese patients,25 of cobas et al . , who described the development of type 1 diabetes into hypertension,26 and of rosa et al . , who analyzed the effects of antihypertensive drugs in obese women.27 this topic was the subject of 16 original publications .
described their experience with heart transplantation in patients with chagas disease.28 rocha and silva et al . analyzed the outcome of surgical mitral valve repair in children with rheumatic fever.29 santana
filho evaluated patients undergoing mitral valve replacement with crossed papillopexy with echocardiography.30 salerno et al . described the results of beating heart mitral valve surgery via the trans - septal approach.31 dalva et al .
described initial results of intermittent annular reduction with alfieri s repair for the treatment of mitral insufficiency in children.32 a midterm follow up of patients undergoing mitral and aortic valve replacement with the st .
jude medical valve was the subject of a study by rodrigues et al.,33 while de bacco et al .
discussed risk factors for hospital mortality in valve replacement with a mechanical prosthesis.34 coronary artery bypass surgery was the topic of four separate studies : atik et al . described indications for and results of the use of the axillary artery for cardiopulmonary bypass.35 brito et al . surveyed risk factors for the development of acute renal failure following cardiopulmonary bypass.36 silva et al . examined late angiographic grafting patency in patients with recurrent symptoms,37 while piegas et al . described the results of myocardial revascularization surgery ( mrs ) in the national health system.38 we also tracked an interesting study by avila et al . on maternal and fetal prognosis as well as outcome of cardiac surgery during pregnancy.39 geovanni
discussed quality of life in heart transplant candidates.41 tirapelli et al . described the occurrence of apoptosis in human saphenous vein grafts in the restoration of blood flow through coronary bypass surgery.42 vieira et al . analyzed the hydrodynamic profiles of different roller pumps models used for cardiopulmonary bypass.43 this field
ferreira et al . analyzed respiratory rehabilitation in copd in the transition from exercise training to real life.44 pelegrino et al . examined the influence of lean body mass on cardiopulmonary repercussions during the six - minute walk test in patients with copd.7 ziegler et al
. looked at predictors of oxygen desaturation during the six - minute walk test in patients with cystic fibrosis.45 oliveira et al . reviewed the relationships between the walk test , pulmonary function tests and length of hospitalization in cardiac surgery patients.5 bertolace et al .
assessed the prevalence of reduced respiratory muscle strength in institutionalized elderly people.47 sleep desaturation and its influence on arterial pressure in copd patients were the subjects of a study by aidar et al.19 malbouisson et al . showed that lung hyperinflation stimulates the release of inflammatory mediators in spontaneously breathing subjects.48 the association between nutritional status measurements and pulmonary function in children and adolescents with cystic fibrosis was analyzed by chavez et al.49 bandeira et al . demonstrated the prevalence of gastroesophageal reflux disease in patients with idiopathic pulmonary fibrosis.50 costa et al .
described the role of inflammatory cells and their mediators in copd pathogenesis.51 perrechi and ribeiro surveyed the effort to integrate tuberculosis treatment between hospitals and public health care clinics in the city of sao paulo , brazil.52 cataneo et al .
described the occurrence of active tuberculosis in surgical patients with negative preoperative sputum smear results.53 parra et al . studied the occurrence of systemic sclerosis ,
idiopathic interstitial pneumonia and histomorphometric differences in lung biopsies.54 the incidence of metabolic syndrome has been examined in multiple brazilian studies.5560 the prevalence of congenital heart disease in patients with down s syndrome was reported.61 two different studies evaluated cardiovascular mortality in different parts of brazil.62 , 63 the profile of newborns who underwent cardiac surgery in a private hospital in the city of sao paulo was described.64 other studies examined diseases of the circulatory system , asthma , tuberculosis , hypertension and smoking in specific geographic settings.6571
the importance of exercise for cardiac function was addressed by investigators who reported on the safety of the six - minute walk - test for heart transplantation candidates ( cipriano et al)1 and on left ventricular systolic function ( berisha et al.).2 the circulatory response to a 50-meter walk in acute coronary syndrome was presented by dias et al.3 furtado et al
. reported on blood pressure measurements during aerobic exercise in cardiac rehabilitation,4 whereas oliveira et al .
reported on the effect of the walk test on the length of hospital stay for cardiac surgery patients.5 the relationships between fitness , waist circumference and hypertension in elderly brazilian women were investigated by krause et al.6 pelegrino et al . studied the influence of lean body mass on cardiopulmonary repercussions during the six - minute walk test in patients with chronic obstructive pulmonary disease (
conducted a gender - specific evaluation of coronary disease patients self - esteem and social support.8 barbirato studied the use of resting myocardial scintigraphy during chest pain to exclude the diagnosis of acute myocardial infarction.9 pesaro et al .
investigated the effects of leukocytes and glycemia on the prognosis of patients with acute myocardial infarction.10 finally , santos et al . evaluated
a new risk score for non - st - segment elevation acute coronary syndrome.11 heart failure was discussed in five different papers .
del carlo et al . described the relevance of cardiac troponin t for risk stratification.12 santos analyzed the quality of life in this group of patients.13 savioli et al .
examined the importance of angiotensin - converting enzyme inhibitors and plasma b - type natriuretic peptide levels in elderly patients with heart failure,14 while munhoz correlated microneurography and venous occlusion plethysmography with prognosis.15 margoto et al . examined the clinical and psychosocial features of heart failure patients admitted for clinical decompensation.16 the use of echocardiography as a diagnostic tool
assessed its utility for measuring left ventricular ejection fraction.18 aidar et al . analyzed the effect of sleep apnea on the heart rates of copd patients.19 arteaga analyzed the prognostic value of the collagen volume fraction in hypertrophic cardiomyopathy.20 atik described the clinical progress of patients with small ventricular septal defects.21 costa et al .
showed that body mass index has a good correlation with proatherosclerotic profile in children and adolescents.22 sa et al . described the effects of conventional ventricular stimulation on patients with normal ventricular function.23 barbaro and silva discussed the cardiovascular complications in acquired immunodeficiency syndrome.24 the interaction of diabetes and hypertension was the subject of silva et al . , who examined the relevance of abdominal fat and insulin resistance to arterial hypertension in non - obese patients,25 of cobas et al . , who described the development of type 1 diabetes into hypertension,26 and of rosa et al .
described their experience with heart transplantation in patients with chagas disease.28 rocha and silva et al . analyzed the outcome of surgical mitral valve repair in children with rheumatic fever.29 santana
filho evaluated patients undergoing mitral valve replacement with crossed papillopexy with echocardiography.30 salerno et al . described the results of beating heart mitral valve surgery via the trans - septal approach.31 dalva et al .
described initial results of intermittent annular reduction with alfieri s repair for the treatment of mitral insufficiency in children.32 a midterm follow up of patients undergoing mitral and aortic valve replacement with the st .
jude medical valve was the subject of a study by rodrigues et al.,33 while de bacco et al . discussed risk factors for hospital mortality in valve replacement with a mechanical prosthesis.34 coronary artery bypass surgery was the topic of four separate studies : atik et al . described indications for and results of the use of the axillary artery for cardiopulmonary bypass.35 brito et al . surveyed risk factors for the development of acute renal failure following cardiopulmonary bypass.36 silva et al .
described the results of myocardial revascularization surgery ( mrs ) in the national health system.38 we also tracked an interesting study by avila et al . on maternal and fetal prognosis as well as outcome of cardiac surgery during pregnancy.39 geovanni analyzed the use of chemoprophylaxis for atrial fibrillation following cardiac surgery.40 helito et al . discussed quality of life in heart transplant candidates.41 tirapelli et al . described the occurrence of apoptosis in human saphenous vein grafts in the restoration of blood flow through coronary bypass surgery.42 vieira et al
ferreira et al . analyzed respiratory rehabilitation in copd in the transition from exercise training to real life.44 pelegrino et al . examined the influence of lean body mass on cardiopulmonary repercussions during the six - minute walk test in patients with copd.7 ziegler et al
. looked at predictors of oxygen desaturation during the six - minute walk test in patients with cystic fibrosis.45 oliveira et al . reviewed the relationships between the walk test , pulmonary function tests and length of hospitalization in cardiac surgery patients.5 bertolace et al . studied the association between obesity and asthma among teenagers.46 simes et al . assessed the prevalence of reduced respiratory muscle strength in institutionalized elderly people.47 sleep desaturation and its influence on arterial pressure in copd patients were the subjects of a study by aidar et al.19 malbouisson et al
. showed that lung hyperinflation stimulates the release of inflammatory mediators in spontaneously breathing subjects.48 the association between nutritional status measurements and pulmonary function in children and adolescents with cystic fibrosis was analyzed by chavez et al.49 bandeira et al . demonstrated the prevalence of gastroesophageal reflux disease in patients with idiopathic pulmonary fibrosis.50 costa et al . described the role of inflammatory cells and their mediators in copd pathogenesis.51 perrechi and ribeiro surveyed the effort to integrate tuberculosis treatment between hospitals and public health care clinics in the city of sao paulo , brazil.52 cataneo et al .
described the occurrence of active tuberculosis in surgical patients with negative preoperative sputum smear results.53 parra et al .
studied the occurrence of systemic sclerosis , idiopathic interstitial pneumonia and histomorphometric differences in lung biopsies.54
the incidence of metabolic syndrome has been examined in multiple brazilian studies.5560 the prevalence of congenital heart disease in patients with down s syndrome was reported.61 two different studies evaluated cardiovascular mortality in different parts of brazil.62 , 63 the profile of newborns who underwent cardiac surgery in a private hospital in the city of sao paulo was described.64 other studies examined diseases of the circulatory system , asthma , tuberculosis , hypertension and smoking in specific geographic settings.6571 | research in the field of cardiopulmonary disease in brazil has been very active in recent decades .
the combination of pubmed , scielo , open access and online searching has provided a significant increase in the visibility of brazilian journals .
this newly acquired international visibility has in turn resulted in the appearance of more original research reports in the brazilian scientific press .
this review is intended to highlight part of this work for the benefit of the readers of clinics . we searched through pubmed for noteworthy articles published in brazilian medical journals included in the journal of citation reports of the institute of scientific information to better expose them to our readership .
the following journals were examined :
arquivos brasileiros de cardiologia ,
arquivos brasileiros de endocrinologia e metabologia , brazilian journal of medical and biological reviews ,
jornal brasileiro de pneumologia ,
jornal de pediatria ,
revista brasileira de cirurgia cardiovascular , revista da associao mdica brasileira , revista da escola de enfermagem u.s.p . and so paulo medical journal .
these journals publish original investigations in the field of cardiopulmonary disease .
the search produced 71 references , which are briefly examined . |
in this tool , the user simply inputs : ( i ) the model equations ; ( ii ) the model parameters ; and ( iii ) the nonmem - like dataset with observations , and matvpc outputs vpcs , qvpcs , or monte carlo simulation plots at will .
the inputted model parameters here include macrokinetic or microkinetic constants , initial conditions of ordinary differential equations ( odes ) and variability terms ; matvpc allows for implementing both interindividual variability and ruv , which can be in the form of proportional , additive , or combined error .
the dataset should be provided in a comma - separated values format including , at a minimum , the following headers in no particular order and in a case - insensitive manner : ( i ) time ; ( ii ) i d ; ( iii ) cmt ; ( iv ) dv ( nonexistent dvs should be represented by a dot ) ; ( v ) evid ; ( vi ) amt ; and ( vii ) rate ( only in the case of intravenous infusion dosing ) .
once the user provides the aforementioned information , they must insert in the command line : ( i ) the name of the dataset ; and ( ii ) the stratification variables , if any , as follows : matvpc ( dataset.csv , { stratification1 , stratification2 } ) .
common stratification variables include but are not limited to arms of a trial ( placebo and active control ) , routes of administration , dose intervals , and , generally , covariates affecting any model parameters.1 at present , matvpc accepts up to two stratification variables , whereas compartment is a default stratification variable and matvpc will always stratify on it .
it should be highlighted that matvpc treats each ode as a compartment , however , it only constructs vpc plots for the compartments with available observations .
once the information ( i ) and ( ii ) is provided , the user is asked ( iii ) to input the name of the model , which can be any alphanumeric value ( e.g. , model1 ) ; and ( iv ) to state whether they want to run simulations and construct vpcs or to simply construct vpcs using previously saved simulation results .
please note that the former option requires the user to simply provide a desired name for the model , unlike the matlab file odes , wherein the user provides the model equations .
option 4 is expected to be useful in cases where simulations of a model have already been carried out and the user wants to simply reconstruct vpcs with modified characteristics , such as different color lines or altered binning edges .
parenthetically , when this option is exploited , the simulation - related parameters should be set to the same values as in the original vpc construction . upon providing all the above , a user - friendly interface commences allowing the user to modify the default values in a series of optional inputs .
this input includes options related to the methods ( e.g. , ode solver to be used or number of datasets to be simulated ) as well as options that determine the graphical settings ( e.g. , color and type of plotting curves ) . table
1 details the accepted optional input along with the default values .
default values and accepted values included in matvpc 's optional input interface ci , confidence intervals ; ode , ordinary differential equation ; qvpc , quantified visual predictive check . for a detailed description of how the bin edges are selected
before the results of the automatic binning are accepted , a visual inspection of the calculated bin edges should be done as , in extreme cases of data point distributions , the code might not generate optimal results . in case
is selected here , a vector with the bin edges should be defined in the following option .
this option allows modification of the number of equally spaced timepoints that are saved during the monte carlo simulations .
this option requests monte carlo simulations can be selected in other options ( see footnotes c and f ) .
the ode solver should be carefully chosen based on the type of the model , in other words , whether the model is stiff or not .
this number represents the percentage of the entire simulation time that is simulated beyond the latest observation point . for instance , in case the user desires to run a monte carlo simulation for an additional time equal to 20% of the entire profile , this number should be set equal to 0.2 ( see monte carlo simulations in model one ) .
this option allows the user to plot simulation results without plotting the observations . in case
the user desires to simply plot monte carlo simulations of the model , no should be selected .
this option should be exploited in case the user wants to avoid negative concentrations and associated plotting issues , for instance , when a logarithmic scale is used . in case
is selected here , the desired replacement value should be defined in the following option .
the color of the curves is defined by writing the name of any of the 139 available color names provided at http://www.w3.org
it is important to stress that , unlike analogous tools that are traditionally used in pharmacometrics , matvpc constitutes an all - in - one package that integrates the following :
it is publicly open ( at https://sourceforge.net/projects/matvpc/ ) ;
constructs vpc plots of complex qsp models ;
offers automatic binning of the observed and simulated data using a rigorous approach9,40 ;
constructs qvpc plots of complex qsp models ;
performs monte carlo simulations of the model and plots the results with any requested summary statistics ;
does not require prior implementation ( e.g. , parameter estimation ) of the model within matlab ;
endows the user with the option to perform post - processing of the vpc , qvpc , or simulation plots .
it is publicly open ( at https://sourceforge.net/projects/matvpc/ ) ;
constructs vpc plots of complex qsp models ;
offers automatic binning of the observed and simulated data using a rigorous approach9,40 ;
constructs qvpc plots of complex qsp models ;
performs monte carlo simulations of the model and plots the results with any requested summary statistics ;
does not require prior implementation ( e.g. , parameter estimation ) of the model within matlab ;
endows the user with the option to perform post - processing of the vpc , qvpc , or simulation plots .
in what follows ,
these models include : ( i ) a linear three compartment pharmacokinetic ( pk ) model with single oral and intravenous ( iv ) bolus dosing ; ( ii ) a nonlinear two compartment pk model with multiple iv infusion dosing41 ; and ( iii ) a highly nonlinear pharmacodynamic ( pd ) model that describes the time - course of body weight.42 to validate the accuracy of the presented vpcs , we directly compare them with vpcs generated either by xpose version 4 ( coupled with psn version 4.2.0 and nonmem version 7.2 ) or by monolix version 4.3.3 .
the first model describes simulated data of a linear three - compartment pk model with linear elimination from the first and third compartment .
the difference between the two studies is nothing but the dosing type ; in study one , the dosing type was iv bolus , whereas in study two , the dosing type was oral .
a single dose was administered at time zero and observations were taken at asymmetric timepoints .
the initial conditions of all compartments were set to zero and the parameters of the model were estimated with nonmem .
the odes of the model are shown in eqs . 1 - 4 :
1
2
3
4 to generate vpc and qvpc plots of model one using matvpc , the user is first required to open the matlab file parameters and provide the model parameters therein .
once the parameters have been provided , the user must open the matlab file odes and type the eqs . 1 - 4 .
a snapshot of the parameters and the odes file upon inserting all the pertinent information of model one is shown in figures
1a , b , respectively . required input in matvpc for model one .
( a ) input in file parameters . in this file , the user inputs the values of the ode parameters , the values of the interindividual variability parameters , the proportional and additive part of the ruv , the initial conditions of the odes and the volume size of each compartment . ( b )
input in file odes . in this file , the user inputs the odes , along with potential algebraic equations , describing the quantitative pharmacology model .
in case of iv infusion dosing , an additional term should be included in the model that accounts for the dosing ( for an example see model two ) . upon completion of the above steps
, the following command must be typed in the command window : matvpc('obs.csv,{'study } ) .
this command requests a vpc that is based on the dataset called obs.csv and is stratified by study .
once the user inserts this command and presses enter , they are asked to provide the name of the model and whether they want to simply create a vpc from previously saved simulation results or to simulate new data and plot the vpcs .
following their response ( y / n ) , matvpc opens a user - friendly interface with optional input that bears default values .
figure
2 shows a snapshot of this interface , which includes the optional input used for constructing vpc and qvpcs for model one . after pressing
ok at the bottom of the interface , matvpc runs all the required simulations , calculates the respective percentiles , constructs the vpc and qvpc plots , and saves them as matlab figures ( .fig ) in a folder that is named after the model name .
unlike comparable software , by saving the plots as matlab figures , matvpc allows for postprocessing of the plots .
more specifically , the user can open the figures ( vpc , qvpc , or monte carlo simulation plots ) that are saved in .
fig format and interactively modify their characteristics , such as : ( i ) the type , color , or size of the curves ; ( ii ) the axes labels and their font size ; ( iii ) the figure title and its font size ; ( iv ) the size , shape , or resolution of the figure ; and ( v ) the axes limits . modifying these characteristics can also be done using the command line , but it is not recommended as it is usually rather laborious .
the user can modify the default values of 40 characteristics of the vpc and qvpc plots ( for a detailed description of these features see table 1 ) .
the vpc and qvpc plots shown in figure 3 were constructed using the input values shown in this figure .
as the sampling times in this case were asymmetric , we exploited the automatic binning option of matvpc to bin the data of model one ( i.e. ,
the vpc and qvpc plots of model one as generated by matvpc are shown in figure
3 .
vpc plots of model one were also constructed with xpose and psn ( running the simulations in nonmem and using the bin edges calculated by matvpc ) and are also provided in figure
3 . for simplicity , we only show the results from compartment two of each study but the agreement between matvpc plots and xpose plots was consistent for all compartments .
( a , d ) vpc plots generated by matvpc showing the results from compartment two and study one ( a ) and two ( d ) .
( b , e ) vpc plots generated by xpose - psn showing the results from compartment two and study one ( b ) and two ( e ) .
red dashed lines correspond to the 5th and 95th percentiles of the observations , whereas red solid lines correspond to the median of the observations .
black dashed lines correspond to the 5th and 95th percentiles of the simulations , whereas black solid lines correspond to the median of the simulations .
blue shaded areas represent the 90% confidence intervals of the simulation 5th and 95th percentiles , whereas pink shaded areas represent the 90% confidence intervals of the simulation median .
( c , f ) qvpc plots of compartment two and study one ( c ) and two ( f ) , as constructed by matvpc . at each timepoint
, the black bar presents the observed data below the model predicted median ( red dots ) , whereas the dark grey bar shows the observed data above the model predicted median .
the total of the black and grey bar combined presents the percentage of available data ( here 100% ) .
( g i ) the 200 monte carlo simulations of model one and study two ( oral dosing ) for compartment one ( g ) , two ( h ) , and three ( i ) .
green dashed lines correspond to the median of the 5th and 95th percentiles of the monte carlo simulations .
red lines correspond to the median of the 50th percentile of the monte carlo simulations .
shaded areas represent the 90% prediction intervals of the monte carlo simulation percentiles . as discussed above ,
one of the key characteristics of matvpc is the option of performing monte carlo simulations of a qsp model , either accounting for or neglecting the residual error .
here , we carried out monte carlo simulations of model one ( only for study two ) without taking into consideration the residual error .
to do so , the ruv terms in the parameters file were set equal to zero ( see supplementary figure s1 ) .
in addition , in the optional input interface , for plot observations was selected no and the simulated time beyond observations was set equal to 0.2 , as we were interested in the dynamics of the model from time zero to 20% additional time beyond the timepoint of the latest observation ( see supplementary figure s2 ) .
the results of the simulations of the three compartments of study two ( oral dosing ) are presented in figure
3 .
the second model was adopted from a previously published study41 and describes simulated pk data of a drug administered via iv infusion . in this case , a total of 100 individuals were simulated with asymmetrically sampled observations .
5 and 6 :
5
6 it is important to note that in case iv infusion dosing is simulated , an additional term should be added in the model to account for iv infusion dosing .
n is equal to the number of model parameters plus one ( please note that all parameters are inserted as
params(i ) ) ; params(n ) should invariably be : ( i ) the last parameter listed in the file
parameters , ; ( ii ) equated to zero ; and ( iii ) added to the equation describing the dynamics of the compartment in which iv dosing is administered . in this example , the term
params(5 ) was added to eq . 5 as the iv infusion is given in compartment one ( see file parameters and odes in figure4 ) .
dy(1 ) to account for iv infusion dosing . similarly to model one , in order to generate the vpc and qvpc plots of model two using matvpc , the user must open the matlab file parameters and insert the model parameters .
once the parameters have been provided , the user must open the matlab file odes and type the odes shown in eqs . 5 and 6 , along with the additional term that accounts for iv infusion dosing .
a snapshot of the completed matlab files parameters and odes file is depicted in figures
4a , b , respectively .
parameters an additional parameter , params(5)=0 , has been listed . as shown in file odes , this parameter has then been incorporated in the first ode of the model ( see last term in first ode ) . upon inserting this information in the two files ,
matvpc then asks the user to provide the model name and to define whether they want to construct vpc plots from scratch or to capitalize on previously generated simulation data . upon completing these steps ,
a snapshot of this interface with the optional input used for model two is shown in supplementary figure s3 .
please note that automatic data binning has been requested through this interface as the sampling timepoints were not consistent and manual binning of data would be challenging . after pressing
ok at the bottom of this interface , matvpc undergoes all the necessary steps and constructs the vpc and qvpc plots of model two .
figures
5a , c illustrate the vpc and qvpc plots , respectively , as constructed by matvpc .
figure
5b shows the vpc of model two as generated with psn and xpose ( with the simulations conducted in nonmem and using bin edges calculated by matvpc ) . for simplicity , only the plots from compartment one are shown .
red dashed lines correspond to the 5th and 95th percentiles of the observations whereas red solid lines correspond to the median of the observations .
black dashed lines correspond to the 5th and 95th percentiles of the simulations , whereas black solid lines correspond to the median of the simulations .
blue shaded areas represent the 90% confidence intervals of the simulation 5th and 95th percentiles , whereas pink shaded areas represent the 90% confidence intervals of the simulation median .
( c ) qvpc plots of compartment one as generated by matvpc . at each timepoint
, the black bar presents the observed data below the model predicted median ( red dots ) , whereas the dark grey bar shows the observed data above the model predicted median .
the total of the black and grey bar combined presents the percentage of available data ( here 100% ) .
purple dashed lines correspond to the median of the 5th and 95th percentiles of the monte carlo simulations .
purple solid lines correspond to the median of the 50th percentile of the monte carlo simulations .
in addition to generating the vpc and qvpc plots of model two , we also carried out 200 monte carlo simulations and the results are presented in figure
5d .
the parameters and odes files , along with the selected options in matvpc interface , that were used to generate the monte carlo simulation plots are shown in supplementary figures s4 and s5 , respectively .
the third case example is a formerly presented highly nonlinear pd model that describes the time - course of body weight.42 the simulated dataset includes observations from a total of 500 subjects that are involved in two different studies , 250 subjects belonging to study one and 250 subjects belonging to study two . the difference between the two studies here is the sampling times .
the pd model is provided in eq . 7 :
7whereby kin is the rate of weight gain , kout is the rate of weight loss , kde and krel are associated with the onset and loss of the lifestyle intervention effect and dstim is the maximum fractional increase in kout caused by the lifestyle intervention .
the parameters and odes files that were utilized in matvpc to construct the vpc and qvpc plots of model three are shown in figures
6a , b , respectively .
as the data originate from two distinct studies , the user would need to stratify on the study number .
to do so , the following should be typed in the command window : matvpc ( ' obs.csv,{'study } ) .
this command requests vpc and qvpc plots of the pd model shown in eq .
once the user defines the name of the model , and whether they want to use previous simulation results , the matvpc interface with the optional input appears . the optional input used in the construction of vpcs for model three
ok in this interface , the vpcs and qvpcs of the model are generated and saved .
the respective vpc plots were also generated with monolix and are provided in figures
7b , e .
it should be underlined that the automatic binning approach implemented in matvpc and monolix is identical.9,40 required input in matvpc for model three .
( b ) input in file odes . for a detailed description about the input see caption in figure 1 .
( a , d ) vpc plots of study one ( a ) and study two ( d ) generated by matvpc .
( b , e ) vpc plots of study one ( b ) and study two ( e ) generated by monolix .
green lines correspond to the 5th , 50th , and 95th percentiles of the observations .
black lines correspond to the 5th , 50th , and 95th percentiles of the simulations .
light blue shaded areas represent the 90% confidence intervals of the simulation 5th and 95th percentiles whereas pink shaded areas represent the 90% confidence intervals of the simulation median .
( c , f ) qvpc plots of study one ( c ) and two ( f ) , as generated by matvpc . at each timepoint
, the black bar presents the observed data below the model predicted median ( red dots ) , whereas the dark grey bar shows the observed data above the model predicted median .
the total of the black and grey bar combined presents the percentage of available data ( here 100% ) .
the first model describes simulated data of a linear three - compartment pk model with linear elimination from the first and third compartment .
the difference between the two studies is nothing but the dosing type ; in study one , the dosing type was iv bolus , whereas in study two , the dosing type was oral .
a single dose was administered at time zero and observations were taken at asymmetric timepoints .
the initial conditions of all compartments were set to zero and the parameters of the model were estimated with nonmem .
the odes of the model are shown in eqs . 1 - 4 :
1
2
3
4 to generate vpc and qvpc plots of model one using matvpc , the user is first required to open the matlab file parameters and provide the model parameters therein .
once the parameters have been provided , the user must open the matlab file odes and type the eqs . 1 - 4 .
a snapshot of the parameters and the odes file upon inserting all the pertinent information of model one is shown in figures
1a , b , respectively . required input in matvpc for model one . ( a ) input in file
in this file , the user inputs the values of the ode parameters , the values of the interindividual variability parameters , the proportional and additive part of the ruv , the initial conditions of the odes and the volume size of each compartment .
( b ) input in file odes . in this file , the user inputs the odes , along with potential algebraic equations , describing the quantitative pharmacology model . in case of iv infusion dosing , an additional term should be included in the model that accounts for the dosing ( for an example see model two ) . upon completion of the above steps , the following command must be typed in the command window : matvpc('obs.csv,{'study } ) .
this command requests a vpc that is based on the dataset called obs.csv and is stratified by study .
once the user inserts this command and presses enter , they are asked to provide the name of the model and whether they want to simply create a vpc from previously saved simulation results or to simulate new data and plot the vpcs .
following their response ( y / n ) , matvpc opens a user - friendly interface with optional input that bears default values .
figure
2 shows a snapshot of this interface , which includes the optional input used for constructing vpc and qvpcs for model one . after pressing
ok at the bottom of the interface , matvpc runs all the required simulations , calculates the respective percentiles , constructs the vpc and qvpc plots , and saves them as matlab figures ( .fig ) in a folder that is named after the model name . unlike comparable software , by saving the plots as matlab figures
more specifically , the user can open the figures ( vpc , qvpc , or monte carlo simulation plots ) that are saved in .
fig format and interactively modify their characteristics , such as : ( i ) the type , color , or size of the curves ; ( ii ) the axes labels and their font size ; ( iii ) the figure title and its font size ; ( iv ) the size , shape , or resolution of the figure ; and ( v ) the axes limits . modifying these characteristics can also be done using the command line , but it is not recommended as it is usually rather laborious . more details about this can be found on matlab 's website ( http://www.mathworks.com/help/symbolic/edit-graphs.html?searchhighlight=edit ) .
, the user can modify the default values of 40 characteristics of the vpc and qvpc plots ( for a detailed description of these features see table 1 ) .
the vpc and qvpc plots shown in figure 3 were constructed using the input values shown in this figure .
as the sampling times in this case were asymmetric , we exploited the automatic binning option of matvpc to bin the data of model one ( i.e. , yes
the vpc and qvpc plots of model one as generated by matvpc are shown in figure
3 .
vpc plots of model one were also constructed with xpose and psn ( running the simulations in nonmem and using the bin edges calculated by matvpc ) and are also provided in figure
3 . for simplicity , we only show the results from compartment two of each study but the agreement between matvpc plots and xpose plots was consistent for all compartments .
( a , d ) vpc plots generated by matvpc showing the results from compartment two and study one ( a ) and two ( d ) .
( b , e ) vpc plots generated by xpose - psn showing the results from compartment two and study one ( b ) and two ( e ) .
red dashed lines correspond to the 5th and 95th percentiles of the observations , whereas red solid lines correspond to the median of the observations .
black dashed lines correspond to the 5th and 95th percentiles of the simulations , whereas black solid lines correspond to the median of the simulations .
blue shaded areas represent the 90% confidence intervals of the simulation 5th and 95th percentiles , whereas pink shaded areas represent the 90% confidence intervals of the simulation median .
( c , f ) qvpc plots of compartment two and study one ( c ) and two ( f ) , as constructed by matvpc . at each timepoint , the black bar presents the observed data below the model predicted median ( red dots ) , whereas the dark grey bar shows the observed data above the model predicted median .
the total of the black and grey bar combined presents the percentage of available data ( here 100% ) .
( g i ) the 200 monte carlo simulations of model one and study two ( oral dosing ) for compartment one ( g ) , two ( h ) , and three ( i ) .
green dashed lines correspond to the median of the 5th and 95th percentiles of the monte carlo simulations .
red lines correspond to the median of the 50th percentile of the monte carlo simulations .
shaded areas represent the 90% prediction intervals of the monte carlo simulation percentiles . as discussed above ,
one of the key characteristics of matvpc is the option of performing monte carlo simulations of a qsp model , either accounting for or neglecting the residual error . here
, we carried out monte carlo simulations of model one ( only for study two ) without taking into consideration the residual error .
to do so , the ruv terms in the parameters file were set equal to zero ( see supplementary figure s1 ) .
in addition , in the optional input interface , for plot observations was selected no and the simulated time beyond observations was set equal to 0.2 , as we were interested in the dynamics of the model from time zero to 20% additional time beyond the timepoint of the latest observation ( see supplementary figure s2 ) .
the results of the simulations of the three compartments of study two ( oral dosing ) are presented in figure
3 .
the second model was adopted from a previously published study41 and describes simulated pk data of a drug administered via iv infusion . in this case , a total of 100 individuals were simulated with asymmetrically sampled observations .
5 and 6 :
5
6 it is important to note that in case iv infusion dosing is simulated , an additional term should be added in the model to account for iv infusion dosing .
n is equal to the number of model parameters plus one ( please note that all parameters are inserted as
params(i ) ) ; params(n ) should invariably be : ( i ) the last parameter listed in the file
parameters , ; ( ii ) equated to zero ; and ( iii ) added to the equation describing the dynamics of the compartment in which iv dosing is administered . in this example , the term
parameters and odes in figure4 ) . required input in matvpc for model two .
dy(1 ) to account for iv infusion dosing . similarly to model one , in order to generate the vpc and qvpc plots of model two using matvpc , the user must open the matlab file parameters and insert the model parameters .
once the parameters have been provided , the user must open the matlab file odes and type the odes shown in eqs .
5 and 6 , along with the additional term that accounts for iv infusion dosing .
parameters and odes file is depicted in figures
4a , b , respectively
parameters an additional parameter , params(5)=0 , has been listed . as shown in file odes , this parameter has then been incorporated in the first ode of the model ( see last term in first ode ) . upon inserting this information in the two files ,
matvpc then asks the user to provide the model name and to define whether they want to construct vpc plots from scratch or to capitalize on previously generated simulation data . upon completing these steps ,
a snapshot of this interface with the optional input used for model two is shown in supplementary figure s3 .
please note that automatic data binning has been requested through this interface as the sampling timepoints were not consistent and manual binning of data would be challenging .
after pressing ok at the bottom of this interface , matvpc undergoes all the necessary steps and constructs the vpc and qvpc plots of model two .
figures
5a , c illustrate the vpc and qvpc plots , respectively , as constructed by matvpc . figure
5b shows the vpc of model two as generated with psn and xpose ( with the simulations conducted in nonmem and using bin edges calculated by matvpc ) . for simplicity , only the plots from compartment one are shown .
red dashed lines correspond to the 5th and 95th percentiles of the observations whereas red solid lines correspond to the median of the observations .
black dashed lines correspond to the 5th and 95th percentiles of the simulations , whereas black solid lines correspond to the median of the simulations .
blue shaded areas represent the 90% confidence intervals of the simulation 5th and 95th percentiles , whereas pink shaded areas represent the 90% confidence intervals of the simulation median .
( c ) qvpc plots of compartment one as generated by matvpc . at each timepoint
, the black bar presents the observed data below the model predicted median ( red dots ) , whereas the dark grey bar shows the observed data above the model predicted median .
the total of the black and grey bar combined presents the percentage of available data ( here 100% ) .
purple dashed lines correspond to the median of the 5th and 95th percentiles of the monte carlo simulations .
purple solid lines correspond to the median of the 50th percentile of the monte carlo simulations .
in addition to generating the vpc and qvpc plots of model two , we also carried out 200 monte carlo simulations and the results are presented in figure
5d .
the parameters and odes files , along with the selected options in matvpc interface , that were used to generate the monte carlo simulation plots are shown in supplementary figures s4 and s5 , respectively .
the third case example is a formerly presented highly nonlinear pd model that describes the time - course of body weight.42 the simulated dataset includes observations from a total of 500 subjects that are involved in two different studies , 250 subjects belonging to study one and 250 subjects belonging to study two . the difference between the two studies here is the sampling times .
the pd model is provided in eq . 7 :
7whereby kin is the rate of weight gain , kout is the rate of weight loss , kde and krel are associated with the onset and loss of the lifestyle intervention effect and dstim is the maximum fractional increase in kout caused by the lifestyle intervention .
the parameters and odes files that were utilized in matvpc to construct the vpc and qvpc plots of model three are shown in figures
6a , b , respectively .
as the data originate from two distinct studies , the user would need to stratify on the study number . to do so
, the following should be typed in the command window : matvpc ( ' obs.csv,{'study } ) .
this command requests vpc and qvpc plots of the pd model shown in eq .
7 , using the dataset called obs.csv while stratifying on the variable study .
once the user defines the name of the model , and whether they want to use previous simulation results , the matvpc interface with the optional input appears . the optional input used in the construction of vpcs for model three
ok in this interface , the vpcs and qvpcs of the model are generated and saved .
the respective vpc plots were also generated with monolix and are provided in figures
7b , e .
it should be underlined that the automatic binning approach implemented in matvpc and monolix is identical.9,40 required input in matvpc for model three .
( b ) input in file odes . for a detailed description about the input see caption in figure 1 .
( a , d ) vpc plots of study one ( a ) and study two ( d ) generated by matvpc .
( b , e ) vpc plots of study one ( b ) and study two ( e ) generated by monolix .
green lines correspond to the 5th , 50th , and 95th percentiles of the observations .
black lines correspond to the 5th , 50th , and 95th percentiles of the simulations .
light blue shaded areas represent the 90% confidence intervals of the simulation 5th and 95th percentiles whereas pink shaded areas represent the 90% confidence intervals of the simulation median .
( c , f ) qvpc plots of study one ( c ) and two ( f ) , as generated by matvpc . at each timepoint
, the black bar presents the observed data below the model predicted median ( red dots ) , whereas the dark grey bar shows the observed data above the model predicted median .
the total of the black and grey bar combined presents the percentage of available data ( here 100% ) .
we have presented a matlab - based tool , dubbed matvpc , that simulates and generates vpc and qvpc plots of qsp models .
the plots generated by matvpc were compared with plots constructed by the gold standard tools in the pharmacometrics community , psn ( with nonmem ) and monolix,43 and the results were interchangeable across all case studies . despite its flexibility , matvpc does have its drawbacks . at present
, matvpc generates qvpc plots using only the available data and does not account for missing data.11 in addition , it can currently run only on a single computer and is not designed for running in parallel processors . however , matvpc will be continuously advanced and its future versions will address these imperfections .
matvpc is publicly available and can be utilized by users with little or no prior matlab experience .
this computational tool can be potentially expanded to perform key analyses in systems pharmacology,44 such as sensitivity analysis45 or model reduction.38,46 collectively , matvpc constitutes a useful addition to the openly available toolboxes exploited by quantitative as well as clinical pharmacologists .
additional supporting information may be found in the online version of this article . supporting information supporting information supporting information supporting information supporting information supporting information supporting information | quantitative systems pharmacology ( qsp ) models are progressively entering the arena of contemporary pharmacology .
the efficient implementation and evaluation of complex qsp models necessitates the development of flexible computational tools that are built into qsp mainstream software . to this end
, we present matvpc , a versatile matlab - based tool that accommodates qsp models of any complexity level .
matvpc executes monte carlo simulations as well as automatic construction of visual predictive checks ( vpcs ) and quantified vpcs ( qvpcs ) . |
leiomyomas are benign painful soft - tissue neoplasms that stem from the erector pili muscle , the muscular layer of blood vessels , and the tunica dartos , labia majora , or nipple .
there are three types : ( a ) piloleiomyoma ( cutaneous leiomyomas , leiomyoma cutis ) ; ( b ) dartoic leiomyoma ; and ( c ) angioleiomyoma .
a 55-year - old male patient presented with a 4 year history of solitary painless swelling over the anterior abdominal wall . to start with the lesion was small in size , which gradually increased to attain the present size of about 5 mm .
cutaneous examination revealed a single firm skin colored nodule over the abdomen just above the umbilical area [ figure 1 ] . on palpation ,
the nodule was non - tender , however , the area adjacent to the lesion was tender .
histopathology of the lesion as well as of a portion of the adjacent normal appearing skin was done , which showed short fascicles and whorls of spindled smooth muscle cells in the dermis which confirmed the diagnosis of cutaneous leiomyoma .
the diagnosis was further confirmed by using masson 's trichome stain ( mts ) which stained the smooth muscles pink [ figure 2 ] .
single skin colored nodule over the anterior abdominal wall dermis depicts a circumscribed spindle cell tumor with cells oriented in short fascicles .
the spindle cells are stained pink and the adjacent collagen blue ( mts ) , original magnification 10
leiomyoma cutis are relatively uncommon benign tumors of smooth muscle derived from the arrector pili muscle
most leiomyomas are sporadic , but it has been suggested that multiple leiomyomas may be inherited as an autosomal dominant trait .
patients with piloleiomyomas often have pain that may be spontaneous or secondary to cold , pressure , or emotion .
some reports suggest that pain could result from local pressure by tumor on cutaneous nerves , whereas others have hypothesized that muscle contraction may be central to induction of pain .
interesting fact in our case was the patient presented with a solitary leiomyoma lesion which was painless .
however , the adjacent normal looking skin was tender . though the leiomyoma lesion may at times be painless , the reason as to why the adjacent area was tender is not understood , probably suggesting the dormant nature of the disease which has not yet become apparent and may progress to develop into a classical leiomyoma lesion later on .
painless leiomyoma tumor with adjacent tender area probably showing the dormant nature of the disease . | herein , we report a case of leiomyoma cutis because of its rarity and unusual presentation . the case presented with a solitary leiomyoma lesion which was painless . however , the adjacent normal appearing area was tender .
a biopsy of the lesion as well as of a portion of the adjacent normal appearing area was taken , which confirmed the diagnosis of cutaneous leiomyoma .
this may suggest the dormant nature of the disease which has not yet become apparent . |
fruit leather , also called a fruit bar or a fruit slab , is a dehydrated fruit - based confectionery dietary product which is often eaten as snack or dessert .
it is chewy and flavorful , naturally low in fat and high in fiber and carbohydrates ; it is also lightweight and easily stored and packed .
consuming fruit leather is an economic and convenient value - added substitute for natural fruits as a source of various nutritional elements .
furthermore , fruit leather has far fewer calories , less than 100 kcals per serving , than many other snacks .
fruit leathers are restructured fruit made from fresh fruit pulp or a mixture of fruit juice concentrates and other ingredients after a complex operation that involves a dehydration step [ 3 , 4 ] .
they contain substantial quantities of dietary fibers , carbohydrates , minerals , vitamins , and antioxidants ( which remain constituents of the finished product ) [ 2 , 5 ] .
most fresh fruits have a short harvest season and are sensitive to deterioration and even when stored under refrigerated conditions ; therefore , making fruit leather from fresh fruits is an effective way to preserve fruits .
fruit leathers are manufactured by dehydrating a fruit puree into a leather - like sheet .
moisture is removed from the wet purees , which are usually laid on a large flat tray until the fruit puree or a prepared boiled fruit juice with additives changes into cohesive
fruit leathers are often considered as a health food and health food marketing images such as pure , sun - dried , or rich in vitamins are used to describe them .
there are large numbers of fruit leather products available on the market , such as mango leather , apricot fruit leather , grape leather , berry leather , kiwifruit leather , and jackfruit leather .
in addition , mixed fruit leathers like guava and papaya fruit leather are also available .
basically , fruit pulps are mixed with appropriate quantities of sugar , pectin , acid , and colour and then dried into sheet - shaped products .
the sugar gave the product a sweeter taste and increased the solids content ; then pectin was used to thicken the pulp , modify the flexible texture , and ensure the retention of the shapes of the dried product .
furthermore , they also prepared mango leather with the addition of potassium metabisulphite to get better sensory qualities and the results were satisfactory for customers / consumers .
they found that so2 reduced the change in color of the papaya leathers during processing and storage .
various additives can be used , such as glucose syrup , sodium metabisulphite , and sorbic acid , depending on the types of fruit leather [ 911 ] .
raisins , sultanas , and dried apricots are examples of the most popular sun - dried fruits .
sun drying permits the final product to have a translucent appearance , a normal color , and a gummy texture . however , there are disadvantages , such as a long drying process - exposure of the products to environmental contamination , dependency on weather conditions , and hand labor requirements .
therefore , alternative drying methods were developed to overcome the problems of hygiene and time , as these methods are rapid , safe , and controllable .
modern dryers , such as tunnel dryers and forced air circulation cabinet dryers , have been used for making fruit leathers with a better color and flavor .
over 85% of industrial dryers are of the convective type with hot air or direct combustion gases used as the drying medium .
the product changes during drying include shrinkage , puffing , and crystallization . sometimes there are also desirable or undesirable chemical or biochemical reactions occurring that will cause changes in color , texture , odor , and other properties in the final product .
conduction , like contact or indirect dryers , convection such as direct dryers , and radiation or volumetrically by placing the wet material in a microwave or radio frequency electromagnetic fields are various methods that are used in making fruit leathers .
the methods chosen are dependent on what kind of fruit and the commercial conditions . in many processes ,
incorrect drying methods result in irreversible damage to the quality of the final product which makes the product nonsaleable [ 3 , 5 ] . with modern dehydrators and well - designed drying methods ,
fruit leathers can be dried at any time of the year to reach the requirements of customers . in the current growing market of fruit leathers ,
packaging materials for fruit leather are required to prolong the shelf - life of the product and , normally , relate to the stability of water activity , microbiological stability , sensory properties , and physicochemical characteristics .
this paper / review will consider various researches on fruit leathers including the methods of preparation , the effect of drying conditions ( e.g. , temperature and velocity ) , and packaging and storage .
the general process of making fruit leather involves the preparation of the fruit puree , with or without addition of other ingredients before mixing and then drying ( figure 1 ) .
these processes may vary depending on the fruit used , the nature of the additional ingredients , and the drying method and technology .
table 1 shows the advantages and disadvantages of the method of preparation of the different fruit leathers .
as the results show , most fruit leathers have few disadvantages which are mostly on the lack of preservatives to protect the color .
apple leather was made using a puree made from golden delicious apples that was poured into 51 76 1.1 cm metal trays to a depth of 0.95 cm and then dried using 107c air blowing across the trays at 4.6 m / s for 3.1 hours or 7.6 m / s for 2.7 hours .
fruits were washed , cut into halves , cored , cut into 14 mm dices , and then steam - blanched for 600 s to avoid enzymatic browning , to soften the tissues , and to allow pectins to be dissolved and distributed before gelation .
seventy - nine g of blanched apple puree was added to 18 g of sucrose and 3 g of an aqueous solution of citric acid ( 0.174% w / w ) per 100 g of formulation before drying to enhance the pectin - sugar - acid gelation . the apple puree mixture was poured into acrylic trays ( 0.18 m long by 0.138 m wide by 0.013 m high ) and then dried in a hot air dryer at 60c from an initial moisture content of 70.6% down to 26.9% w.b . in three hours .
apple leather was also prepared from a base formulation and procedure developed by leiva daz et al . but with added distilled water ( 23.1% w / w ) and potassium metabisulphite ( 0.0057% w / w ) .
the apple puree mixture was dried in a hot air dryer at a temperature of 60c and an air velocity of 2 m / s to a final moisture content of 24.85% w.b .
a metabisulphite concentration of 173.7 mg / kg ( based on the final product composition ) was required to attain 100 mg / kg final product of so2 in the final product .
the formulation was similar to that reported by leiva daz et al . but added with the addition of polydextrose powder ( 9.0% w / w ) and sucralose micronized powder ( 0.02% w / w ) .
another formulation was also prepared but with an additional potassium metabisulphite ( 0.0063% w / w ) .
the apple puree mixtures were placed in 0.20 m square stainless steel trays , with an initial thickness of 6 mm and dehydrated in a tray dryer at 50 , 60 , and 70c with an air velocity of 2 m / s .
samples were dried until reaching a moisture content of about 0.3 kg water / kg dry matter .
apple puree and gelatin were weighed to give final concentrations of 0 , 0.5 , 1.0 , and 1.5% ( w / w ) gelatin .
the required amount of water was added to maintain the total solids content ( 21.5% w / w ) constant in all formulations .
the apple puree mixture was spread as a thin layer on the space of a 2 mm high frame that was placed in an aluminum tray ; the puree was then levelled using a glass rod .
the aluminum tray was previously covered with a silicone sheet to prevent the apple leather from sticking after drying .
drying was carried out in a cabinet dryer using a hot air at a temperature of 60 1c that reduced the moisture content from 3.65 kg water / kg dry solids to a final moisture content of about 0.13 kg water / kg dry solids .
fruit leather made from apple pulp , apple juice concentrate ( ajc ) , blackcurrant concentrate ( bcc ) , and pectin powder was prepared .
different levels of ajc ( 20 , 30 , and 40% ) , bcc ( 3 , 6 , and 9% ) , and pectin powder ( 0 , 2 and 4% ) were used to obtain various fruit leather products to determine the effects of the three factors on various physicochemical and nutritional qualities .
about 315 g of the puree mixture was poured into aluminum pans with a nonstick surface ( 1 cm 20 cm 30 cm ) .
the samples were then dried in a hot air dryer at 70c with an air velocity of 0.20 m / s for 16 hours . the use of 62% apple pulp , 30% ajc , 6% bcc , and 2% pectin powder produced an acceptable fruit leather .
bains et al . processed apple - apricot leather using a fruit puree consisting of 82% apple puree , 16.5% apricot puree ( as flavor component ) , and 1.5% apple juice concentrate .
the fruit puree was poured in galvanized steel trays measuring 12.5 12.5 1.2 cm .
the fruit puree was then placed in a pilot cabinet dryer at 85c , with a flow rate of 4 m / s and relative humidity of 5% for 6.1 hours and this resulted in a good quality product .
a two - stage operation with two hours of initial drying at 102c followed by finish drying at 85c for 3.5 hours also gave a good quality product .
a study was carried out to standardize the technology used for the preparation and storage of a wild apricot fruit bar .
the authors prepared the apricot bar by sorting and washing the fruit and then heating for 5 to 7 minutes in a stainless steel pan with water ( 100 ml / kg of fruit ) , before passing the fruits through a pulper to extract the pulp .
the pulp was boiled over a low flame until its volume reduced to half and then mixed with different quantities of sugar ( 40% , 50% , and 60% ) .
fifty g of sugar was retained for mixing with the pectin to ensure a uniform distribution . weighed quantities of pectin ( 0.20% , 0.30% , and 0.40% )
the treated mixture was then poured into aluminum trays ( smeared with butter ) in layers about 4 - 5 mm thick and the trays were placed in a mechanical dehydrator at 55 2c for about 6 hours .
made a study on the effect of different dryers and drying conditions on the acceptability and physicochemical characteristics of durian leather .
the durian aril was blanched in an enclosed water bath for 5 minutes and then blended with the addition of 10% glucose syrup solid , 5% sucrose , water , 2.67% hydrogenated palm oil , and 0.45% soy - lecithin ; 100 ppm egg yolk was added as a colorant .
the mixture was formed into 1.2 mm thick sheets and dried in a forced - air cabinet dryer at a particular temperature .
also processed durian leather from durian aril by blanching in a water bath at 85100c for 5 minutes and then blended with the same amounts of added ingredients as in che man et al . except that 200 mg / kg sorbic acid was added as a preservative .
all the mixture were formed into 1.2 mm thick sheets and then placed in either oven or cabinet dryers for dehydrating .
it took 12.6 hours to dry at 50c in the oven and 10 hours at 52.5c in the cabinet dryer .
studied the effect of the addition of glucose syrup solid , sucrose , hydrogenated palm oil , and soy - lecithin on the sensory acceptability of durian leather .
was blanched by steaming at 85c in an enclosed water bath for 5 minutes and then blended .
the additive ingredients and formed sheets were the same as in irwandi et al . .
the sheets were dried in a forced - air cabinet dryer at 47c for 8 hours with 1.5 m / s air flow and then rolled into sheets . the most acceptable combination from stage 1
was then chosen and used in stage 2 . in this stage , further hydrogenated palm oil ( 05% ) and soy - lecithin ( 01.5% ) were added during blending and the results showed that soy - lecithin has a significant effect on the aroma , appearance , and overall acceptability and a highly significant effect on taste acceptability ; as hydrogenated palm oil affected the taste and aroma acceptability .
a new process of making guava fruit leather was reported in vijayanand et al . .
the guava leather was prepared by washing ripe guava , then crushing , and extracting them through a pulper to get a puree .
the pectolytic enzyme rohapect d5 l was added to the guava puree at a concentration of 0.5 ml / kg and then the puree was incubated at 40c . after 2 hours
, guava juice was obtained by pressing the puree and this was then mixed with maltodextrin , sucrose , soluble starch , wheat flour , pectin , and an antibrowning agent until it reached total soluble solids of 25brix .
the mixture was then spread on stainless steel trays smeared beforehand with glycerol at the rate of 12 kg / m and was then dried at 50c , 12% rh in a cross - flow hot air dryer with a 2.5 m / s flow rate to a final moisture content of 14 to 15% .
studied the effect of cold temperature storage on the quality attributes of guava fruit leathers .
they made the guava leather by peeling the fresh guava and adding 20% sugar , 0.2% citric , and 0.1% sodium benzoate until the concentration of the pulp was 80% .
the treated pulp was boiled , cooled , and spread on trays that were previously oiled with glycerol .
the pulp was dried at 60c for 8 hours . in a study of the storage stability of guava leather in different packing materials by kumar
, healthy and disease - free guava fruits were picked up for making guava fruit leathers .
the guava fruits were washed , peeled , and pulped by passing the slices of fruit through a superfine pulper cum finisher .
the pulp obtained was heated to 85c to inactivate the enzymes and then cooled to about 45c .
the treated pulp mixture was then poured into stainless steel trays previously smeared with glycerol and dried in cross - flow cabinet dryer at 60c until the moisture level of the pulp reached 1520% .
blended guava - papaya leathers were made by mixing the pulps of guava and papaya in different ratios .
the seeds of papaya were discarded and the fruit pieces were crushed in a mixer to make papaya pulp .
the guava pulp was prepared by passing guava slices through a superfine pulper cum finisher .
the blended papaya and guava fruit pulps were mixed in ratios of 80 : 20 , 60 : 40 , 40 : 60 , and 20 : 80 .
the brix and acidity of all the blends were adjusted to 25brix and 0.5% , respectively .
the pulp mixture obtained was heated to 85c to inactivate the enzymes and cooled to about 45c .
potassium metabisulphite ( 0.2% ) was also added as a preservative before ; the mixture was poured as a 1.00 cm thick layer in stainless steel trays previously smeared with glycerol and dried in a cross - flow cabinet dryer at 60c until the final moisture of the product reached 1520% .
unfertilized floral parts of jackfruit were used to make jackfruit leather by che man and sin .
pieces of the unfertilized floral parts were placed in a jacketed kettle and cooked in boiling water for 60 minutes .
the cooked unfertilized floral parts were then macerated into a puree by using a sharp knife blender and then 15% glucose syrup , 25% sugar , 5% water , 500 g , g sodium metabisulphite , and 200 g / g sorbic acid were added to the puree .
the mixture was placed into a 2 mm thin layer on aluminum foil and dried in a cabinet dryer at 50c with an air velocity of 1.6 m / s for 24 hours .
chowdhury et al . studied the mathematical modelling of thin - layer drying of jackfruit leather .
they prepared the jackfruit leather by extracting the juice from the jackfruit bulb and making it fibre - free by passing through a clean cloth and applying hand pressure .
the jackfruit leather was dried in a thin layer ( 5 mm thickness ) at temperatures ranging from 40 to 70c .
the relative humidity range was 2070% and air velocity ranged from 0.5 to 3.0 m / s .
the effect of solar drying on the quality and acceptability of jackfruit leather made from fresh ripe whole jackfruits was evaluated by okilya et al . .
they pretreated the jackfruit leather by cutting the fruits into half longitudinally , carving out the sticky central cores with a sharp knife , scooping out the bulbs by hand , and cutting out the ends of the bulbs to remove the seeds .
they blended the pulp using a kitchen blender and put the mixture in a pan where it was concentrated for 15 minutes in a water bath at 70c .
the drying time was reduced because the concentration step evaporated off some of the water . under a natural convection condition ,
the treated concentrates were cooled to room temperature and then formed into sheets on fabricated stainless steel metallic trays ( 20 cm 20 cm 3 mm ) lined with waxed paper .
these sheets were dried in a solar dryer ( average temperature of 36.7c for three days ) , convection oven dryer ( 50c for 18 hours ) , and electric cabinet dryer ( 65c for 6 hours with an air velocity of 1.7 m / s per square meter tray area ) to reach moisture contents of about 18.50% , 14.79% , and 18.85% , respectively .
thin layers of pulped kiwifruit flesh under conditions of small biot numbers were dried by chen et al . .
the pulped kiwifruit flesh was dried in an oven dryer at temperatures from 3570c until very close to the equilibrium moisture content .
the drying tray was of 1 mm thick aluminum plate and the shallow dish dimensions were 100 100 7 mm .
the basic ingredients of this fruit leather were pectin powder 150 ( 1.00 , 2.00 , and 3.00 g per 100 g kiwifruit puree ) , sugar ( 6 g ) , salt ( 0.5 g ) , citric acid ( 0.2 g ) , water ( 10.0 g ) , and glucose syrup ( 10.0 , 15.0 , and 20.0 g ) .
fruit puree and glucose syrup were mixed in a blender for 2 minutes before adding the other ingredients .
the ingredients were mixed for additional 2 minutes and immediately spread onto stainless steel drying trays when the blend was consistent .
they prepared the gold kiwifruit leather by evenly spreading the fruit puree ( 400 g ) over stainless steel drying trays .
the stainless steel trays were placed with a polyethylene bag to prevent the fruit leather from sticking to the trays after drying .
they dried the gold kiwifruit leather by using hot air at 70 1c for 12 hours in a batch tray dryer , which had been preheated at least 0.5 hours before drying .
jaturonglumlert and kiatsiriroat prepared longan leather by combining convective and far - infrared drying systems .
they made longan leather by uniformly spreading 100 g longan puree in a tray and placed it in a drying chamber .
the air - velocity at the drying chamber was between 0 and 4.5 m / s and the temperature ranged from 30 to 80c .
a far - infrared ceramic heater with an intensity level control inside the chamber was used in heating the air . the sample for drying
the sample for radiant heating was prepared by inserting a k - type thermocouple into the bottom of the puree layer .
the combined convective and far - infrared drying experiment was conducted at five radiator temperatures ( from 300c to 500c ) with distance between the sample and the infrared heat source of 1030 cm .
the inlet air temperature and velocity were kept at 30c and 0.5 m / s , respectively .
a study on the sorption isotherms of fortified mango bars prepared from the puree of soft ripe mangoes was reported by mir and nath .
they prepared the mango bars by washing and peeling the mangoes , then pulping and heating the pulp at 9193c for 2 minutes .
they added powdered cane sugar , 0.6% citric acid , and 1734 ppm potassium metabisulphite ; the total solids of the mango puree were raised to 30% .
the mango puree was spread uniformly on aluminum trays and dried for 1416 hours in a cross - flow cabinet dryer at 63 2c .
studied the effect of drying and storage time on the physicochemical properties of mango leathers .
they made the mango leather with mango puree passed through a 1 mm sieve and then spread onto petri dishes .
the drying was carried out in an oven at 6080c until the moisture content of the mango leather reached 1518% .
the effect of skim milk powder , soy protein concentrate , and sucrose on the dehydration behavior , texture , color , and acceptability of mango leather was studied by gujral and khanna .
the mango leather was prepared by washing and peeling the mangoes and passing them through a pulper to obtain a mango pulp with 10.6% total solids .
potassium metabisulphite ( 0.2% w / w ) was added to the pulp when it was cooling and then the pulp was sealed in glass jars and stored at 4c .
the mango leather was then dried in aluminum trays measuring 25.5 cm 13 cm and 2 cm deep in a cabinet dryer at about 60c and with an air velocity of 3.5 m / s . soy protein and
they found that this significantly reduced the drying rate of mango leather and lowered the extensibility and energy .
they determined that mango leather containing 4.5% skim milk powder and 4.5% sucrose was the most acceptable to the sensory panelists . in another research , gujral and
brar studied the effect of hydrocolloids on the dehydration kinetics , color , and texture of mango leather .
they made the mango leather by passing the mango pulp through a pulper to obtain total solids of 14.3% .
the treated mango pulp was placed on aluminum trays measuring 25.5 cm 13 cm and 2 cm deep and dried at a temperature of 60 1c and relative humidity of 15% in a cabinet dryer .
the hydrocolloids added were found to decrease the drying rate during the initial 2 hours but had no significant effect later .
also evaluated the effect of incorporating defatted soy flour to process nutritionally enriched mango fruit leather by microwave drying .
sugar ( 50 g ) , corn flour ( 5 g ) , lime juice ( 2 g ) , roasted defatted soy flour with a protein content of 51.8% , and skim milk powder in the ratio of 1 : 1 were added to the mango pulp at concentrations of 10% , 15% , 20% , and 25% .
they heated the treated mixture at each concentration to 80c for 15 minutes and then dried the mixture in a microwave dryer .
drying was conducted at different power levels ( 2 , 4 , 6 , 8 , and 10 , corresponding to 4 , 8 , 12 , 16 , and 20 w / g of sample ) with a power cycle of 30 s on and 30 s off , respectively , until the sample reached a moisture content of 1215% .
the dehydration and storage stability of papaya leather was investigated by chan jr . and cavaletto .
the papaya leather was prepared by steaming whole papaya for 1 minute , slicing , and then separating the flesh , skin , and seeds .
after inactivating the enzymes by heating the puree , the puree was stored frozen at 18c .
sugar ( 10% w / w ) at 4.9 kg / m ( 11 b / ft ) was added in the papaya puree and then the puree was poured evenly onto teflon - coated pans or pans sprayed with a lecithin release agent .
sodium bisulfite was added to give low ( 552 ppm ) and high ( 1105 ppm ) levels of so2 treatment .
the purees were dried in a forced draft oven until they reached about 12 - 13% moisture content or a water activity of 0.500.52 .
also made pawpaw ( papaya ) leather by peeling the fresh fruits and adding 20% sugar , 0.2% citric acid , and 0.1% sodium benzoate to a concentration of 80% pulp .
the pulp was then boiled , cooled , and spread on trays that had been previously oiled with glycerol and then dried at 60c for 8 hours .
huang and hsieh studied the physical properties , sensory attributes , and consumer preference of pear fruit leather .
they prepared pear leather in 18 different formulations homogeneously blending pectin ( 16% , 20% , and 24% w / w ) , water ( 4% , 6% and 8% w / w ) , and corn syrup ( 0% , 8% w / w ) at different levels with pear juice concentrate .
they mixed distilled water ( 23c ) into the preblended mixture of pear concentrate and corn syrup ( both at 5c ) with a presanitized sunbeam mixmaster blender for 1 minute and then added pectin to prevent the formation of lumps .
they blended every second 400 g batch of the final mixture for another 3 minutes and then poured the treated batch into clean plastic flat - bottomed 7 10 mm containers .
the weight in each container was about 35 g so the height of the fruit leather sheet could be about 2.85 mm .
they left the containers on the bench at 23c until the mixture became evenly distributed ( approximately 1 minute ) .
they made the final leathers by placing the containers of the mixture in a convection oven at 70c for 8 hours , with an air velocity in 0.4 m / s .
. reported hot air drying and sun drying for preparation of pestil ( grape leather ) .
the pestil ( grape leather ) was made by washing the grapes to remove dirt , leaves , and foreign materials and then crushing and pressing them manually .
seven grams of natural earth ( 70% caco3 ) was added to the juice per litre to reduce the acidity and clarify the juice .
the mixture was boiled for 35 minutes in order to inactivate the enzymes which cause colour changes .
the juice was then separated from the calcium tartrate precipitate by filtration and centrifugation to obtain the final clarified juice which had a ph of 7.6 and brix of 20. the total juice was divided into two parts .
a 3/4 part of juice was boiled again for 30 minutes with continued stirring to obtain a concentrated juice with 40brix . a wheat starch - juice mixture ( starch dissolved in a 1/4 part of juice )
was added to the boiling juice before boiling for another 4 minutes until it reached a concentration of 4 g/100 g of starch in the total fresh clarified juice .
the cooked grape juice - starch mixture was evenly spread on an 8 cm diameter disk of cloth to be dried under hot air drying conditions or direct sunlight .
the concentrated grape juice mixture samples were dried until there was no weight change . for the sun - dried products ,
the physicochemical characteristics and sensory optimization of pineapple leather was studied by phimpharian et al . .
they researched the effects of glucose syrup ( 2% , 4% , and 6% ) and pectin ( 0.5% , 1.0% , and 1.5% ) concentrations .
they prepared pineapple puree by removing the stalk and rinsing each whole pineapple , then removed the skin , divots , and leafy crown , then rinsed the treated pineapple flesh with tap water , cut them into pieces , and chopped for 30 s into a puree .
the puree was placed into plastic bags and then stored at 18c for up to 2 weeks until used .
they left the pineapple puree in a refrigerator overnight before being used the next day .
pineapple puree was heated at 85 5c while stirring with an automatic pot stirrer at a speed of 57 rpm for 15 minutes and then mixed with pectin , glucose syrup , sugar ( fixed at 15% ) , and maltodextrin ( fixed at 2% ) .
they fed every 500 g portion of pineapple paste through the cylinder ( an inner diameter of 42 mm ) located on the top of the leather forming machine , and pressed the paste into the extruder zone with a pneumatically driven ram at a pressure of two bars , and then extruded them through a die ( 27 mm width 2.2 mm thickness ) at a screw speed of 50 rpm to obtain a flat rectangular paste .
the flat pineapple paste was placed on a conveyor belt lined with a polypropylene plastic sheet , cut , and then dried in a hot air dryer at 60c for 10 hours to form the pineapple leather .
lee and hsieh conducted an experiment with strawberry fruit leather to investigate its thin - layer drying kinetics .
they blended strawberry puree , corn syrup , pectin , and citric acid together in 200 : 40 : 2 : 1 ratios and then spread the mixture into thin layers on an aluminum weighing dish of 70 mm diameter . the thin layers ( 1.8 , 2.7 , and 3.6 mm thicknesses ) were then dried in a convection oven at various temperatures ( 50c , 60c , 70c , and 80c ) .
the drying times for the strawberry leather samples to reach the safe - storage moisture content of 12% ( wb ) varied from 80 to 600 minutes in terms of the different drying temperatures and sample thickness .
they found that the drying rates increased as the sample thickness decreased from 1.8 to 3.6 mm .
jaturonglumlert and kiatsiriroat studied the heat and mass transfer in combined convective and far - infrared drying of longan leather .
infrared heating for food drying has a high efficiency of between 80 and 90% and infrared radiation could be transmitted through water at short wavelength and be absorbed on the surface at long wavelength .
the entering air velocity at the drying chamber varied from 0 to 4.5 m / s .
the temperature of the entering air could be controlled at 3080c by an electrical heater .
there was a far - infrared ceramic heater with an intensity level control inside and its maximum power was 800 w. the target final moisture content of 14% ( d.b . )
was used in order to compare the drying rate curve time for hot air drying alone as well as for the combined convective and far - infrared drying .
the hot air drying was conducted at 70c and 1.0 m / s , and the combined convective and far - infrared drying was at 400c ; the distance between the sample and the infrared heat source was 20 cm .
they concluded that the second method provided a shorter drying time to the target final moisture content due to its higher heat and mass transfer coefficient .
demarchi et al . studied the effect of different temperatures ( 50 , 60 , and 70c ) on the hot - air drying rate and retention of antioxidant capacity ( ac ) in apple leathers with and without potassium metabisulphite .
the drying kinetics of apple leather were accurately predicted by a one - term diffusive analytical solution for plane sheets using internal - external control to predict mass transfer .
the mass transfer biot number was almost unity and the arrhenius dependency of the effective diffusion coefficient with temperature provided an activation energy for drying of 20.6 kj / mol .
retention of ac in the apple leathers was low ( 616% ) and decreased for increasing air temperatures even when the resulting drying times were shorter .
in mathematical terms , this effect is explained by the higher activation energy for ac losses ( above 31 kj / mol ) , compared with that for drying .
thin - layer drying experiments of jackfruit leather were conducted by chowdhury et al . .
the drying air was supplied by a centrifugal fan , through a galvanized iron ( gi ) pipe fitted with an orifice plate to the bottom of a metal tower packed with plastic rings . the heated air passed through the gi pipe to the overflow drying chamber .
they found that an air temperature of 50c was the optimum temperature for drying jackfruit leather and the moisture diffusivity increased from 3.25 10 m / s at 40c to 1.0062 10 m / s at 70c .
hot air drying was used to make pestil ( grape leather ) by maskan et al . .
the sample was dried from one side with hot air flowing parallel to the surface of the sample .
the air velocities were 0.86 0.03 , 1.27 0.04 , and 1.82 0.09 m / s and the sample thicknesses were 0.71 0.035 , 1.53 0.070 , 2.20 0.110 , and 2.86 0.071 mm . in this study ,
the hot air drying temperatures were 55c , 65c , and 75c ( dry bulb ) and 27c , 30c , and 33c ( wet bulb ) temperatures , respectively .
they found that the time required to reduce the moisture content to about 0.12 kg h2o / kg ds ( 11% wet basis ) varied from 40 to 240 minutes , depending on drying temperatures and sample thickness .
they determined that increasing the temperature at a constant sample thickness could reduce the time required to reach the equilibrium moisture content .
the effect of sun drying on color change of pestil was determined by maskan et al . .
the hunter a - value of pestil increased from 3.50 to 3.74 during the first stage of sun drying ( 0 to 325 minutes ) and increased slowly from 3.74 to 3.78 ( 325 to 1830 minutes ) .
however , hunter l- and b - values showed fluctuation during drying without a constant trend .
the order of the reaction for color change based on the a - value during sun drying was a zero order .
studied the effect of different dryers and drying conditions on the acceptability and physicochemical characteristics of durian leather . in the oven drying experiment , they found that the most acceptable taste could be achieved by drying at 52.24c for 11.63 hours , and for the texture it was 52.5c for 9.00 hours .
the best conditions for aroma and appearance were 50.63c for 12.00 hours and 51.7c for 12.58 hours , respectively .
for overall acceptability , the most acceptable combination was 50c for 12.75 hours . in the forced - air cabinet drying experiment , they found that the most acceptable conditions for taste , texture , and aroma were 52.42c for 10.42 hours , 47.50c for 10.00 hours , and 49.71c for 13.50 hours , respectively .
the best conditions for appearance and overall acceptability were 53.81c for 7.71 hours and 52.50c for 10.00 hours , respectively .
they found that drying in a cabinet dryer to reach a certain moisture level took less time than in the oven at the same temperature .
for example , drying at 60c for 7 hours gave a product with 15% moisture from the oven but less than 13% moisture from the cabinet dryer .
the papaya puree was dried in a forced draft oven at an air velocity of 110 fpm to reach about 12 - 13% moisture content or water activity of 0.500.52 .
the average drying times needed for 74c , 84c , and 94c were 4.5 , 3.9 , and 3.1 hours , respectively .
microwave dries a food material faster than a conventional dryer does using short high - frequency energy waves similar to tv , radar , and radio waves .
mango fruit leather was prepared using a 750 w , 2450 mhz microwave by pushpa et al . .
the results showed that the drying time was reduced from 200 seconds to 60 seconds as the microwave power level was increased from 2 to 10 , corresponding to 4 to 20 w / g , respectively .
therefore , mass reduction of the sample was rapid at higher microwave power level and the drying time was very short . they also concluded that decreasing the microwave power level may increase the drying time to unacceptable levels .
part of the incidence solar radiation on the glass cover is transmitted inside the dryer while the remaining is reflected back to the air .
then part of the transmitted radiation is then reflected back from the surface of the fruits while the remaining part is absorbed by the surface of the fruits .
the temperature of the fruit products increases and they start emitting long wavelength radiation as they absorbed the solar radiation .
the long wavelength radiation emitted was not able to escape to the atmosphere because of the presence of the glass cover .
the glass cover reduced the direct convective losses to the ambient air , which further benefitted the rise in temperature of the fruit products and chamber temperature , respectively .
moisture is removed by the air entering the chamber from below and escaping through another opening provided at the top .
sharma et al . investigated three different types of solar dryers based on the principle of natural as well as forced convection drying conditions .
they reported that the cabinet - type solar dryer is very well suited to drying a small quantity of fruits and vegetables on a domestic and household scale .
chowdhury et al . also made jackfruit leather using solar tunnel drying under the same weather conditions as chowdhury et al . in the previous section .
it consisted of a flat plate air - heating collector , a drying unit , a solar module of 40 w capacity , and two 152 mm diameter 12 v dc fans to provide the required airflow over the product .
both of the collector and drying area were covered with a 0.2 mm thick transparent uv stabilised polyethylene sheet .
the input of solar radiation on the collector and on the dryer section comprised the input solar radiation into the solar tunnel dryer .
the ambient air temperature during drying varied from 30c to 36c while the collector outlet temperature varied from 43c to 58c . during the drying period ,
the average temperature in the collector outlet was 54.2c and the average rise in temperature was 19.16c .
jackfruit leather was dried to an 11.88% moisture content ( w.b . ) from an initial moisture content of approximately 76% ( w.b . ) after two days of drying in the solar tunnel dryer .
it has been found that the energy efficiency of the collector varies from 32.34 to 65.30% .
the experimental and neural network prediction for the performance of a solar tunnel dryer for drying jackfruit bulbs and leather was studied by bala et al . .
the structure of the solar tunnel dryer used was similar to the one used in chowdhury et al . .
glass wool was added as an insulation material to reduce heat loss from the dryer .
the cover was fixed like a sloping roof to prevent the entry of water inside the dryer unit when it rained .
the air at the required flow rate was provided by two direct - current fans operated by one photovoltaic module . the solar radiation passed through the transparent cover of the collector and heated the absorber .
the solar tunnel drying required 14 hours to dry jackfruit samples from 78.12 to 5.03% moisture content or 19 hours from 82.44 to 9.77% moisture content .
when short wavelength solar energy falls on the uneven product surface , a part of it was absorbed by the product 's surface while the rest was reflected back .
the absorbed radiation was then converted into thermal energy and increased the temperature of product .
in addition , convective heat losses that occurred were due to the wind blowing moist air over the product surface .
the moisture contents reduced from these evaporative losses and so the fruit products were dried .
the samples were exposed directly to sunlight for 14 hours with an intensity of sunlight at 140 62 j / cm min during the day .
the percent relative humidity of the air was 43.5 11.4 ; the temperature by day was 21.4 9.2 and by night 14.9 5.3c ; the air velocity was 0.53 0.34 by day and 0.32 0.12 m / s by night .
the time used to reach the moisture content of 11% ( wet basis ) was 3 , 5 , 15 , and 25 hours , depending on the thickness of the product .
jackfruit leather was made by chowdhury et al . under natural sun drying conditions .
the jackfruit leather was dried to 13.8% ( w.b . ) under open sun drying for two days .
however , the drying samples received energy only from incident solar radiation and lost a significant amount of energy to the environment .
prepared guava leather to study its storage stability in four packing materials : polypropylene ( pp ) , butter paper ( bp ) , metalized polyester polyethylene ( mpp ) , and aluminum foil ( af ) under ambient and low temperature conditions ( 10 1c ) . during storage ,
the moisture content of the product decreased significantly under ambient conditions while it increased slightly under low temperature conditions .
the products packed in mpp and af showed the minimum loss of moisture . during storage period , it was also found that the acidity of guava leather increased more than under low temperature conditions . a 4050% reduction in vitamin c
the storage of guava leather in different packing materials invariably increased the reducing sugar content during storage under low and ambient temperatures .
it was concluded that the samples stored in mpp retained a higher percentage of nutrients and minimum microbial counts at the end of storage under both conditions .
polypropylene could not be compared with mpp or af wrappers but , after considering economic conditions , it could be used for a shelf - life of one to two months . however , even though af packaging was easy to use , the development of pin holes during handling rendered it unsuitable for packaging the guava leather product .
the quality of apple leathers with and without potassium metabisulphite ( kmbs ) during storage was evaluated by quintero ruiz et al . .
a kmbs - added formulation satisfactorily maintained the quality characteristics of apple leathers without microbial development over a 7-month storage period .
the antioxidant activity ( aa ) , determined over storage and expressed as chlorogenic acid equivalents , decreased by 47% during the 7-month period at 20c in the control formulation , while losses in the kmbs - added formulation were considerably lower , 15.9% of the initial value .
an accelerated storage experiment of the kmbs - added formulation at 30c allowed the estimation of the effect of storage temperature using a q10 coefficient of 2.55 for bi and 16.3 for aa . according to these q10 values , browning would be the storage - limiting parameter at or below 20c .
the thermodynamic properties and sorption equilibrium of a pestil were studied by kaya and kahyaoglu .
they illustrated that water activity was one of the most important quality factors for long - term storage because the changing water activity directly affected all chemical and microbial deterioration reactions .
kaya and maskan determined the water vapor permeability ( wvp ) of pestil ( a fruit leather ) made from boiled grape juice with starch at three different temperatures ( 15 , 25 , and 37c ) and different relative humidity ( rh ) values ( 31 to 76% ) .
after exposure to the high rh environment , the thickness of the film was increased , showing the adsorption of water by the leather itself .
it was found that the water vapor transmission rate ( wvtr ) and wvp of pestil were strongly affected by the changing rh and temperature .
evaluated the effect of cold temperature storage on the quality attributes of pawpaw ( papaya ) and guava leathers .
the calorific content , water activity , ph , and total mould count in pawpaw leather were significantly higher than those in guava leather throughout the duration of storage .
sensory scores in relation to the period of storage showed that guava leather gave better results in overall acceptability at zero , one , and two months of storage at 8 1c .
the guava leather was accepted better based on better sensory qualities in fruitiness , smell , chewiness , toughness , color , and overall acceptability when various cold storage temperatures were considered during storage .
the effects of types of packaging materials on the physicochemical , microbiological , and sensory characteristics of durian fruit leather during storage were studied by irwandi et al . .
the study was carried out over 12 weeks at room temperature using four types of packaging materials : laminated aluminum foil ( laf ) , high - density polyethylene ( hdpe ) , low - density polyethylene ( ldpe ) , and polypropylene ( pp ) film .
they found that laf had the lowest decrease in water activity and changes in moisture content so that it could maintain the desired textural characteristic of fruit leather .
the type of packaging materials and storage time had significant effects on the nonenzymatic browning of durian leather with laf having a lowest decrease in color quality while ldpe showed the highest degree of browning .
both the type of packaging materials and storage time affected the texture significantly by increasing its hardness during storage .
the laminated aluminum foil maintained the desired texture well while samples packed in ldpe had the greatest increase in hardness up to eight weeks .
the packaging materials and storage time both significantly affected microbial growth during storage . laminated aluminum foil seemed to be the best material to inhibit growth of the mesophilic bacteria , moulds , and yeasts .
panelists gave the lowest scores for texture , appearance , aroma , and overall acceptability to the ldpe - packed samples and the highest score to the laf - packed samples .
assessed the storage stability and packaging requirements of a guava fruit bar prepared using a new process that gave better texture and sensory properties .
the bars were packed separately in two materials : pp ( polypropylene ) and bopp ( biaxially oriented polypropylene ) .
the polypropylene had a water vapor transmission rate ( wvtr ) of 6 10
kg / m / d at 90% rh , 38c and an oxygen transmission rate ( otr ) of 35 10 l / m / d atmosphere at 25c .
the biaxially - oriented polypropylene had a water vapor transmission rate of 4 10 kg / m / d at 90% rh , 38c and an otr of 2.5 l / m / d atmosphere at 25c .
guava and mango bars had similar textural characteristics initially that reduced after three months of storage at ambient conditions .
the nonenzymatic browning of both guava and mango bars increased significantly after 60 days of storage .
the overall quality of both the guava and mango bars packed in bopp and pp decreased significantly at the end of 60-day storage because the bars absorbed moisture .
however , the guava and mango bars packed in pearlized bopp or pp were sensorily acceptable with respect to color , flavor , texture , and overall quality for up to 90 days at 27c and 65% rh and for up to 30 days at 38c and 92% rh .
fresh fruits are known to be excellent sources of vitamins , minerals , fibers , carbohydrates , and other bioactive compounds .
a variety of researches have been carried out to study the effects on fruit leathers of different methods of preparation , different drying conditions , and packaging and storage conditions . for the method of preparation ,
most fruit leathers were prepared by sorting , washing , peeling , and seed removing , and then cutting into slices which can be pureed or pulped easily .
purees are heated , boiled , or blanched in a water bath in order to inactivate the enzymes .
additives such as sugar , pectin , acid , glucose syrup , and color are often added before or during blending .
the additives include potassium metabisulphite , sodium bisulfite , sodium metabisulphite , sucrose , soy protein and skim milk powder , corn syrup , and starch .
these ingredients are mixed with the fruit puree to make fruit leathers with a higher quality , longer storage , or better organoleptic quality than the original fruit .
most fruit leathers are dried at 30 to 80c , especially at 50 to 60c for up to 24 hours or until they have reached the final moisture content of 1220% ( w.b . ) .
various drying systems are used in making fruit leather depending on what fruits are being dried and how the products are designed . combined convective and far - infrared drying provided a shorter drying time due to its higher heat and mass transfer coefficients .
hot air drying , including oven drying , forced - air cabinet drying , and thin - layer drying , is widely used and the time taken depended on the drying temperatures and sample thicknesses .
solar cabinet dryers were well suited to drying small quantities of fruits ; solar tunnel drying was a forced convection mixed - mode solar dryer which collected solar radiation from the atmosphere to input solar radiation into solar tunnel dryer .
water activity was one of the most important quality factors for long - term storage .
laminated aluminum foil ( laf ) gave the highest score for overall acceptability from panelists and low - density polyethylene had the lowest score for packaging fruit leathers .
the product packed in metalized polyester polyethylene and aluminum foil showed low losses of moisture .
other packaging materials like high - density polyethylene , polypropylene , butter paper , and biaxially - oriented polypropylene were shown to be acceptable for storage of fruit leathers at low temperatures ( 810c ) for up to two months .
the data from this paper will be useful to many in the food industry and consumers who are health - conscious . | fruit leathers are dehydrated fruit products which are eaten as snacks or desserts .
they are flexible sheets that have a concentrated fruit flavor and nutritional aspects .
most fruit leathers are prepared by mixing fruit puree and other additives like sugar , pectin , acid , glucose syrup , color , and potassium metabisulphite and then dehydrating them under specific conditions .
various drying systems including combined convective and far - infrared drying , hot air drying , microwave drying , solar drying , and sun drying have been used to make fruit leathers .
most fruit leathers are dried at 30 to 80c for up to 24 hours until the target final moisture content ( 1220% ) has been reached .
research about fruit leathers began in the 1970s .
this work has reviewed published papers on fruit leathers in order to summarize useful information about fruit leathers on methods of preparation , effects of drying condition , and effects of packaging and storage , which will be useful to many in the food industry and consumers who are health - conscious . |
lap - protector was developed as a safe and useful device that may help to prevent infections and cancer cell contamination of minilaparotomy wounds .
we applied this device to the gastric anterior wall of the incision in the first step of surgical transgastric cystogastrostomy for a patient with an infected pancreatic pseudocyst . recently
, disposable circular stapler is very popular in digestive organ anastomosis . in 1999 , yunoki et al .
a 69-year - old man presented to our hospital with a 5-day history of high fever , loss of appetite , and hiccups .
laboratory data on arrival were as follows : white blood cell count , 24,800/l ; c - reactive protein , 13.8 mg / dl . computed tomography ( ct ) showed an infected pancreatic pseudocyst which compressed the gastric wall ( fig .
we made a preoperative diagnosis of the recurrence of infected pancreatic pseudocyst ; therefore , emergency operation was performed .
according to the jedlicka 's method , transgastric cystogastrostomy was selected . after performing minilaparotomy with upper median incision ,
a small incision with a length of 3.0 cm was made on the anterior gastric wall . placing the lap - protector over the incision
, the bottom ring is pushed into the lumen of the stomach through the incision .
the top and bottom rings of the lap - protector formed a sandwich around the anterior gastric wall ( fig .
the posterior gastric wall was punctured toward the retrogastric space by a sheath of needle .
a small incision was made on the posterior wall to reach the abscess wall ( fig .
while preventing pollution in the peritoneal cavity , the abscess space was irrigated with saline .
using an auto suture pceea 25 , an anastomosis was approximated between the abscess wall and the posterior gastric wall ( fig .
four days after the operation , upper gastrointestinal examination and ct using a water - soluble contrast agent showed no anastomotic leakage and complete drainage ( fig .
two months after discharge , follow - up evaluation with upper endoscopy and ct revealed no sign of recurrence ( fig .
a variety of treatments in infectious pancreatic pseudocyst have been reported , such as percutaneous drainage , endoscopic cystogastrostomy , and conventional surgical cystogastrostomy .
however , we believe that surgical cystogastrostomy still plays an important role in the management of selected cases of pseudocyst of the pancreas . in this case , we performed cystogastrostomy easily without any contamination using lap - protector and circular stapler . | lap - protector , which is an abdominal wall sealing device , is usually used for wound protection from implantation of malignant cells or pyogenic fluid .
a circular stapler is a common easy - to - use device for anastomosis of the digestive tract .
we report the case of an infected pancreatic pseudocyst which was treated by surgical procedure using these useful devices .
a 69-year - old man was followed up in our hospital after severe acute pancreatitis .
he had undergone drainage surgeries twice for intractable pancreatic abscess followed by severe acute pancreatitis .
he was admitted to our hospital complaining of loss of appetite , hiccups , and high fever .
computed tomography of the abdomen revealed an infected pancreatic pseudocyst which compressed the gastric wall .
internal drainage into the stomach was performed using lap - protector and circular stapler .
the patient recovered uneventfully . recently many endoscopic or laparoscopic procedures in cystogastrostomy
are reported ; however , a conventional open surgical approach is also important
. this easy method may be useful for operative cystogastrostomy . |
they have been traditionally thought to function as the immunocompetent cells of the brain and spinal cord and to be the sensors of injury and infection in the tissue [ 2 , 3 ] .
they derive from primitive c - kit(+ ) erythromyeloid precursors from the yolk sac [ 46 ] , migrate into the brain during the period of early embryonic development prior to the formation of the blood - brain barrier ( bbb ) , and remain there once the bbb is formed .
it is notable that this population is self - sustaining , and peripheral macrophages only contribute to this population in disease states , in which the bbb becomes compromised . within the brain , microglia
have been described to have the ability to detect and mount an inflammatory response to various insults .
sensing neuronal injury has been ascribed primarily to purinergic and chemokine receptors on the surface of microglia , as they monitor the levels of extracellular atp and secreted chemokines , respectively .
their reaction to neuronal injury is accomplished as they undergo a process collectively called activation .
activation consists of several biological events that include migration to the site of injury , local proliferation , a change in morphology and gene expression , antigen presentation , and phagocytosis of dead cells and cell debris [ 10 , 11 ] . during activation ,
some of the changes in gene expression involve the secretion of cytokines and chemokines , which modulate the cns environment and regulate the state of inflammation .
microglia can secrete both proinflammatory mediators , such as tumor - necrosis - factor- ( tnf- ) [ 12 , 13 ] or interleukin- ( il- ) 1 , nitric oxide ( no ) [ 14 , 15 ] , and glutamate , and anti - inflammatory effectors , such as il-4 and il-13 , which can enhance neuronal survival [ 17 , 18 ] . depending on the predominance of factors secreted ,
microglia have classically been characterized , similarly to macrophages , as m1 ( proinflammatory ) or m2 ( anti - inflammatory ) cells .
the m1 and m2 distinctions serve to separate activated microglia into the two broad categories .
it is argued , however , that no specific marker designates a microglial response as definitively m1 or m2 .
moreover , microglia differentially express pro- and anti - inflammatory markers making the m1 and m2 phenotypes the extremes of the categories , respectively , with variable phenotypes seen in between the two . with that in mind , m1 microglia have been associated with neurotoxic and neurodegenerative outcomes , as they are observed in a variety of chronic neurodegenerative diseases , such as alzheimer 's , end - stage amyotrophic lateral sclerosis ( als ) , and multiple sclerosis ( ms ) .
stroke and traumatic brain injury show a characteristic accumulation of m1 microglia as well .
a shift to an m2 phenotype of activated microglia has been correlated with neuroprotection , recovery , and repair in various disease settings [ 2527 ] .
until recently , initial studies to understand neuronal - microglial interactions had described that a variety of neuroactive substances , such as no and tnf- , have potent effects on neuronal function , in particular , synaptic plasticity .
however , the cellular origin of these molecules had not been attributed to microglia but , rather , to astrocytes .
the focus was maintained on the effect that inflammatory processes have on synaptic plasticity . in neuroinflammatory diseases , such as experimental autoimmune encephalomyelitis ( eae ) , a rodent model of ms , alterations in synaptic plasticity
specifically , in the hippocampus of diseased animals , there is greater induction of long - term potentiation ( ltp ) , an electrophysiological measurement that relates to the connectivity and strength of synapses .
this change in ltp was attributed to the secretion of il1 from the accumulated microglial cells .
it is notable , however , that prolonged exposure to inflammatory cytokines can result in priming or sensitization of microglia so they more readily adopt an m2 , rather than m1 , phenotype in response to inflammation .
, chronic inflammation can be induced by lps infusion and has been reported to attenuate ltp in the dentate gyrus ( dg ) of the hippocampus .
found that ltp , dependent on either nmda receptors ( nmdar ) or on voltage - dependent calcium channels , was impaired .
the cytokine , tnf- , increases the surface expression of ampa receptors in neuronal cultures , which is accompanied by the enhancement of synaptic strength . in a model of neuropathic pain in the c fibers of the dorsal horn of the spinal cord ,
inhibition of microglial activation by minocycline resulted in the induction of long - term depression ( ltd ) rather than ltp .
this change in plasticity was found to involve src family kinases and to be mediated partially by tnf- .
some studies have found that microglial activation , when both genetically and pharmacologically induced , results in an increase of ampar / nmdar ratio and an enhanced ratio of ampar- over nmdar - mediated currents .
these studies demonstrated that when microglia were activated under pathological inflammatory conditions , they caused synaptic alterations via secretory mediators .
the precise role of microglia on synaptic activity in the normal brain remained unclear .
imaging studies have shown that microglia extend and retract their processes continuously to survey their local environment in the healthy brain [ 37 , 38 ] .
moreover , interactions between microglia and neuronal synapses in the visual cortex have been directly visualized by electron microscopy ( em ) and by in vivo two - photon microscopy .
the availability of visual stimuli resulted in enhancement of the duration of these contacts and the preservation of the synapse .
these intriguing imaging observations first indicated the possibility that microglia could modulate neuronal functions by direct physical contacts .
on the other hand , wake et al . demonstrated that , under conditions of prolonged ischemia , contact time between microglial processes and synapses increased , associated with a greater chance for elimination of presynaptic boutons .
it is likely that the mechanism of synaptic pruning is modulated by a distinct molecular mechanism in each of these states and not simply by the longevity of contact .
paolicelli et al . explored whether there is a functional role for microglial interactions with synaptic structures during the development of the postnatal brain , using imaging and electrophysiological approaches .
they used a transgenic mouse line expressing gfp in microglia , under the control of the chemokine receptor cx3cr1 promoter .
thus , they were able to label and visualize microglia as well as manipulate them .
the authors found that the number of synaptic elements and dendritic spines expressing the postsynaptic marker psd95 in cx3cr1 mice was about 3-fold higher than that in mice deficient in cx3cr1 ( cx3cr1 ) .
their result provided some insight into potential roles of microglia in synapse maturation , along with the possibility that this may be a direct cx3cr1-mediated event .
these microglial properties , thus , extend beyond immune surveillance and indicate modulatory roles during normal brain development .
provided direct evidence , via confocal microscopy and electron microscopy , that microglia phagocytose synapses in the dorsal lateral geniculate nucleus ( dlgn ) as well .
the authors proposed that the classical complement cascade , which includes members c1q and c3 , was a potential molecular pathway of microglia - synapse interactions in postnatal brain development . according to the experimental data , the synapses that were tagged with c1q and c3 were phagocytosed by microglia that expressed complement receptor cr3 . in mice deficient in the receptor or the ligand , higher numbers of synaptic inputs
moreover , these animals showed deficits in their ability to segregate the territories of each eye .
therefore , the microglia - mediated engulfment was important to drive synaptic stripping during normal development .
together , these observations reveal that complement - mediated phagocytic activity of microglia is crucial in microglia - synapse interactions during normal brain development . to further address whether microglia contribute to synaptic activity in the normal young adult brain , ji et al . used an electrophysiological approach in organotypic hippocampal brain slices and primary neuronal cultures . in this system
, they manipulated the presence of microglia by either depleting them using clodronate , replenishing them in previously depleted cultures , or by using cocultures of neurons and microglia .
the absence of microglia resulted in a robust increase of synaptic frequencies known as spontaneous and miniature excitatory postsynaptic currents ( sepsc and mepsc ) from the ca1 region of the hippocampus .
this increase was subsequently reversed when microglia were replenished in the organotypic slices . in the complementary approach ,
the addition of microglia to neuronal cultures decreased the synaptic activity measured compared to cultures of neurons alone .
the change in synaptic activity coincided with changes in synaptic numbers , which suggested that microglia could participate in the control of synaptic activity by regulating synaptic numbers ( figure 1 ) .
as shown in previous reports , they also observed that the phagocytic activity of microglia drove synapse elimination when microglia were coincubated with neurons .
this could be one mechanism by which synapse numbers are regulated in the normal brain ; however , it is still undefined whether synaptic pruning and phagocytic engulfment by microglia occur via a universal mechanism under normal and pathological conditions .
a proposed mechanism by which microglia could regulate synaptic activity was suggested by the same study .
overall expression of synaptic adhesion molecules , such as protocadherin and syncam1 , which determine synapse remodeling , stability , and synaptic activity , was decreased in neurons incubated with microglia compared to neurons alone ( figure 1 ) .
the decreased levels of the synaptic adhesion molecules were recovered to wild - type levels when neurons were incubated with microglia deficient in the serine protease tissue plasminogen activator ( tpa ) ( figure 2 ) , potentially implicating serine proteolytic functions in the stability of these proteins .
structural changes at the synapse are closely associated with synaptic stability . in particular , numerous synaptic adhesion molecules , such as classic cadherins ( e - cadherin and n - cadherin ) , protocadherins , and ncam , have been studied in modulating structural and functional synaptic plasticity .
hippocampal slices pretreated with antibodies against the extracellular domain of n- and e - cadherins or with antagonistic peptides that inhibit cadherin dimerization exhibit a significantly reduced ltp .
moreover , expression of mutant n - cadherin or short hairpin rna - mediated knockdown of n - cadherin prevents ltp - induced long - term stabilization of synapses .
additionally , yamagata et al . showed that blocking antibodies to protocadherins or ncam in hippocampal slices diminished synaptic transmission and ltp induction .
proteases in a synaptic microenvironment are important in the regulation of dynamic changes in the adhesion molecules associated with synaptic plasticity .
proteases , such as matrix metalloproteinases ( mmps ) and tpa , secreted from neurons , astrocytes , or microglia under basal or pathological conditions of the cns have been associated with the targeted degradation or proteolytic processing of extracellular matrix ( ecm ) and cell adhesion molecules on the cell surface and at the synapse [ 4855 ] . in particular , application of tpa or mmp-9
emerging evidence has shown that application of mmp-9 or tpa decreases the levels of n - cadherin and diminishes synaptic transmission . moreover
it is possible that proteases secreted from microglia could regulate synaptic activity by remodeling the ecm which is known to affect synaptic connectivity .
each of the connected cells provides an array of cx isoforms , which form oligomers containing 6 of these cx proteins .
cx36 and cx43 have been reported to be expressed in microglia [ 60 , 61 ] , where they are thought to be involved in the local release of proinflammatory cytokines ( tnf- and il1 ) and metabolites . during inflammatory events , the expression of cx43
this increase results in the formation of a functional syncytium among microglial cells , confirmed by the diffusion of the fluorescent dye , lucifer yellow .
however , the syncytium neither forms in nonactivated microglia , nor happens if the gap junction formation is inhibited by inhibitors of cx43 , indicating the involvement of cx43 in the process .
cx36 remains active in resting microglia and does not become upregulated during microglial activation . in disease settings
, it has been reported that blocking cx hemichannels resulted in the blockade of the microglial release of glutamate , which led to the subsequent exaggerated activation of neurons ( excitotoxicity ) . in a model of spinal cord
injury ( partial cord transection ) , inhibition of cx resulted in improved functional recovery .
similar to cx proteins , large pore channels are formed in microglia and consist primarily of pannexins and p2x channels .
they are purinergic and activated by extracellular atp . among them , p2x4 is the channel that becomes primarily upregulated in activated microglia . in a recent report , li et al .
state that in the optic tectum of larval zebrafish , neuronal activity drives the activation of pannexin-1 hemichannels .
these can then steer the processes of resting microglia and facilitate their contact with highly active neurons . in turn , when resting microglia are in contact with neurons or neurites , a decrease in both spontaneous and visually evoked neuronal activities is observed , specifically for the neurons contacted .
these results indicate that connexins and large pore channels could constitute one way by which microglia interact directly with neurons , especially during neuronal insult and inflammation , and could directly affect neuronal activity and survival .
they also respond to changes in neurotransmitters by changing morphology and the motility of their processes .
application of the glutamate receptor inhibitors nbqx and gyki , as well as the gabaergic signaling inhibitor bicuculline , has been shown to decrease microglial process motility .
although there is debate on whether microglia express glutamate receptors , the presence of gabaa receptors on the surface of human microglia has been documented . however , there is no concrete evidence that microglia respond in an obvious way to direct application of agonists of glutamate or gaba receptors , that is , in a pure microglial cell culture .
rather , they seem to respond indirectly to such application , on a slice or tissue , suggesting that these agonists potentially have indirect effects on the cells .
these indirect effects have been postulated to be mediated through atp 's effect on purinergic receptors since they are expressed on the surface of the cells .
although the source of the atp release is not entirely determined , the most likely mechanism involves release through neuronal pannexin channels . in models of disease , specifically in the eae model of ms ,
the presence and accumulation of activated microglia have been correlated with decreases in the purkinje cell survival , connectivity in the cerebella of the eae animals , and attenuation of gabaergic transmission .
this has also been observed in the eae striatum and hippocampus , where a decrease in gabaergic interneurons was also noted , accompanied by induction of ltp .
these results suggest that , in this context , microglia may be direct regulators of the numbers of gabaergic neurons and the subsequent attenuation of gabaergic inhibitory transmission .
a new way of communication in the cns has been described involving the release of microvesicles , also referred to as shed vesicles or ectosomes , from the plasma membrane .
these materials were originally thought to be inert but have been recently recognized as critical in mediating cell - to - cell communication .
the vesicles contain lipids , cell surface proteins , and material from the cytoplasm or nucleus of the cell .
the vesicles are recognized by the recipient cell through the presence of phosphatidylserine on their surface and interact with the relevant receptors .
they can also directly fuse with the recipient cell . on the surface of microglia ,
p2x7 receptors , which respond to the release of atp , mediate the shedding of ectosomes .
this process is triggered by the activity of acid sphingomyelinase and involves the activation of the effector protein p38 . although this is not a mechanism exclusive to microglia ( as astrocytes also have been shown to express the p2x7 receptors ) , microglia constitute a significant source of these shed vesicles .
one of the factors thought to contribute to such signaling is annexin a2 , a protein expressed by microglia that affects their activation [ 78 , 79 ] .
annexin a2 has been shown in different systems to affect neuronal ion channels and neuronal functioning [ 80 , 81 ] , either directly or through its interaction with p11 .
in a recent report , it was noted that microvesicles derived from microglia were able to increase the frequency and amplitude of epscs .
this effect required interaction between microglia and neuronal cells and did not involve secretion of cytokines .
it did involve , however , an increase in the metabolism of sphingolipids in neuronal cells .
although in a more chronic exposure to these shed particles the release of cytokines as regulators of neuronal activity can not be excluded , these data provide another possible pathway by which microglia affect neuronal activity .
given the evidence from imaging , cellular , and electrophysiological approaches , the physical proximity between neurons and microglia seems to result in synaptic maturation and synaptic activity ( figure 3 ) .
several different mechanisms , either involving direct contact and interaction between the two cell types , or mediated through chemical ligands and effectors , are described as potential regulators of these microglial functions .
the findings indicate that microglia affect both the maturation of the cns during development and the acute and dynamic regulation of neuronal activity in the mature , healthy , or unhealthy cns and suggest that they are active contributors to a potential quad - partite synapse . | synaptic plasticity is critical for elaboration and adaptation in the developing and developed brain . it is well established that astrocytes play an important role in the maintenance of what has been dubbed the tripartite synapse .
increasing evidence shows that a fourth cell type , microglia , is critical to this maintenance as well .
microglia are the resident macrophages of the central nervous system ( cns ) . because of their well - characterized inflammatory functions
, research has primarily focused on their innate immune properties .
the role of microglia in the maintenance of synapses in development and in homeostasis is not as well defined .
a number of significant findings have shed light on the critical role of microglia at the synapse .
it is becoming increasingly clear that microglia play a seminal role in proper synaptic development and elimination . |
hypertension is one of the most important risk factors for cardiovascular diseases such as left heart failure , myocardial infarction , and renal disease .
accordingly , effective management of hypertension can lead to the prevention of damage to major organs .
it is also an effective means of slowing the progress of diabetes mellitus and diabetic nephropathies .
arb / thiazide combination regimen , an antihypertensive agent with improved hypotensive effects , have been accepted as safe in terms of electrolyte imbalance , thanks to its effects in alleviating hydrochlorothiazide - induced hypokalemia .
we present two cases of patients in whom improvement of hyponatremia was observed after discontinuation of the arb / thiazide combination regimen .
a 73-year - old asian woman presented with progressive general weakness after switching to a different antihypertensive regimen at a local hospital 1 month before .
she had been diagnosed with hypertension 20 years previously and diabetes mellitus 10 years later , for which she was taking oral medications consisting of olmesartan medoxomil 40 mg qd , aspirin 100 mg qd , vildagliptin 50 mg qd and atorvastatin 10 mg qd ; the antihypertensive agent was changed to olmesartan / hydrochlorothiazide 20/12.5 mg qd 1 month before presentation . on arrival , the patient 's vital signs were stable , and physical , neurological and radiological examinations were within normal limits with the exception of a decrease in skin turgor .
initial laboratory results were as follows : wbc 6,160/mm , hb 12.3 g / dl , hct 35.6% , and platelet 302,000/mm ; na 115 mmol / l , k 3.9 mmol / l , cl 83
mmol / l , uric acid 10.0 mg / dl , bun 15 mg / dl , creatinine 0.5 mg / dl , and serum osmolality 247 mosm / kg h2o ; and urine creatinine 65 mg / dl , urine urea nitrogen 620 mg / dl , urine na 74 mmol / l , and urine osmolarity 596 mosm / kg h2o .
the patient 's blood sugar was 118 mg / dl , and the hba1c level was 7.6% . thyroid function test and rapid acth stimulation test results were within normal range .
initial blood tests revealed the presence of hyponatremia with a na level of 115 mmol / l ; blood sugar was 118 mg / dl with serum and urine osmolality at 247 mosm / kg h2o and 596 mosm / kg h2o , respectively , upon which the possibility of hyperglycemia - induced pseudohyponatremia and hyponatremia caused by polydipsia was ruled out .
we initiated treatment for hyponatremia with alteration of the current antihypertensive regimen to olmesartan medoxomil 40 mg qd , in addition to a continuous intravenous infusion of 0.9% nacl . on the following day , the patient 's laboratory test results improved to na 125 mmol / l , serum osmolality 270 mosm / kg h2o , urine osmolality 352 mosm / kg h2o , and urine na 39 mmol / l . on the second day of admission , 0.9% nacl infusion was discontinued as we continued observation of the patient . by simply adjusting the antihypertensive regimen ,
the serum na level improved substantially to 135 mmol / l , while the patient 's blood pressure continued to be under control at 120/80 mmhg .
the patient 's symptoms improved remarkably , and she was discharged . an 86-year - old asian woman presented with general weakness which began on the day of presentation .
she had been suffering from nausea while working in the fields in hot weather for 1 week prior to admission .
the patient had been on losartan potassium / hydrochlorothiazide 50/12.5 mg qd , amlodipine 5 mg qd , and aspirin 100 mg for hypertension which had been diagnosed 4 years before . on arrival ,
the patient 's vital signs were stable , and physical , neurological and radiological examinations were within normal limits .
initial laboratory results were as follows : wbc 8,240/mm , hb 12.4 g / dl , hct 33.5% , and platelet 488,000/mm ; na 102 mmol / l , k 3.5 mmol / l , cl 67 mmol / l , bun 10 mg / dl , creatinine 0.4 mg / dl , and serum osmolality 223 mosm / kg h2o ; and urine creatinine 79 mg / dl , urine urea nitrogen 309 mg / dl , urine na 79 mmol / l , and urine osmolality 398 mosm / kg h2o .
the patient 's blood sugar was 142 mg / dl , and the hba1c level was 5.6% . thyroid function test and rapid acth stimulation test results were within normal range .
initial blood tests revealed the presence of hyponatremia with a na level of 102 mmol / l , and serum osmolality was also low at 223 mosm / kg h2o .
urine osmolality was 398 mosm / kg h2o , upon which primary polydipsia was ruled out ; the patient was hypovolemic , in combination with endocrine test results , implied that the possibility of hypothyroidism , adrenal cortex dysfunction , or siadh was low .
an increased urine na level of 79 mmol / l and normal aldosterone levels , with no history of vomiting , led to the diagnosis of diuretic - induced hyponatremia .
we changed the patient 's antihypertensive medication to a single - drug regimen of amlodipine 5 mg qd .
hyponatremia was corrected with continuous intravenous infusion of 0.9% nacl . on the following day ,
the serum na level improved to 110 mmol / l ; on the second day , it further improved to na 121 mmol / l , at which point 0.9% nacl infusion was discontinued . on the fourth day of admission ,
the serum na level and osmolality were substantially recovered to 130 mmol / l and 271 mosm / kg h2o respectively , with urine osmolality of 207 mosm / kg h2o and urine na of 14 mmol / l .
a 73-year - old asian woman presented with progressive general weakness after switching to a different antihypertensive regimen at a local hospital 1 month before .
she had been diagnosed with hypertension 20 years previously and diabetes mellitus 10 years later , for which she was taking oral medications consisting of olmesartan medoxomil 40 mg qd , aspirin 100 mg qd , vildagliptin 50 mg qd and atorvastatin 10 mg qd ; the antihypertensive agent was changed to olmesartan / hydrochlorothiazide 20/12.5 mg qd 1 month before presentation . on arrival , the patient 's vital signs were stable , and physical , neurological and radiological examinations were within normal limits with the exception of a decrease in skin turgor .
initial laboratory results were as follows : wbc 6,160/mm , hb 12.3 g / dl , hct 35.6% , and platelet 302,000/mm ; na 115 mmol / l , k 3.9 mmol / l , cl 83
mmol / l , uric acid 10.0 mg / dl , bun 15 mg / dl , creatinine 0.5 mg / dl , and serum osmolality 247 mosm / kg h2o ; and urine creatinine 65 mg / dl , urine urea nitrogen 620 mg / dl , urine na 74 mmol / l , and urine osmolarity 596 mosm / kg h2o .
the patient 's blood sugar was 118 mg / dl , and the hba1c level was 7.6% . thyroid function test and rapid acth stimulation test results were within normal range .
initial blood tests revealed the presence of hyponatremia with a na level of 115 mmol / l ; blood sugar was 118 mg / dl with serum and urine osmolality at 247 mosm / kg h2o and 596 mosm / kg h2o , respectively , upon which the possibility of hyperglycemia - induced pseudohyponatremia and hyponatremia caused by polydipsia was ruled out .
we initiated treatment for hyponatremia with alteration of the current antihypertensive regimen to olmesartan medoxomil 40 mg qd , in addition to a continuous intravenous infusion of 0.9% nacl . on the following day , the patient 's laboratory test results improved to na 125 mmol / l , serum osmolality 270 mosm / kg h2o , urine osmolality 352 mosm / kg h2o , and urine na 39 mmol / l . on the second day of admission , 0.9% nacl infusion was discontinued as we continued observation of the patient . by simply adjusting the antihypertensive regimen ,
the serum na level improved substantially to 135 mmol / l , while the patient 's blood pressure continued to be under control at 120/80 mmhg .
an 86-year - old asian woman presented with general weakness which began on the day of presentation .
she had been suffering from nausea while working in the fields in hot weather for 1 week prior to admission .
the patient had been on losartan potassium / hydrochlorothiazide 50/12.5 mg qd , amlodipine 5 mg qd , and aspirin 100 mg for hypertension which had been diagnosed 4 years before . on arrival ,
the patient 's vital signs were stable , and physical , neurological and radiological examinations were within normal limits .
initial laboratory results were as follows : wbc 8,240/mm , hb 12.4 g / dl , hct 33.5% , and platelet 488,000/mm ; na 102 mmol / l , k 3.5 mmol / l , cl 67 mmol / l , bun 10 mg / dl , creatinine 0.4 mg / dl , and serum osmolality 223 mosm / kg h2o ; and urine creatinine 79 mg / dl , urine urea nitrogen 309 mg / dl , urine na 79 mmol / l , and urine osmolality 398 mosm / kg h2o .
the patient 's blood sugar was 142 mg / dl , and the hba1c level was 5.6% . thyroid function test and rapid acth stimulation test results were within normal range .
mmol / l , and serum osmolality was also low at 223 mosm / kg h2o .
urine osmolality was 398 mosm / kg h2o , upon which primary polydipsia was ruled out ; the patient was hypovolemic , in combination with endocrine test results , implied that the possibility of hypothyroidism , adrenal cortex dysfunction , or siadh was low .
an increased urine na level of 79 mmol / l and normal aldosterone levels , with no history of vomiting , led to the diagnosis of diuretic - induced hyponatremia .
we changed the patient 's antihypertensive medication to a single - drug regimen of amlodipine 5 mg qd .
hyponatremia was corrected with continuous intravenous infusion of 0.9% nacl . on the following day ,
the serum na level improved to 110 mmol / l ; on the second day , it further improved to na 121 mmol / l , at which point 0.9% nacl infusion was discontinued . on the fourth day of admission ,
the serum na level and osmolality were substantially recovered to 130 mmol / l and 271 mosm / kg h2o respectively , with urine osmolality of 207 mosm / kg h2o and urine na of 14 mmol / l .
losartan potassium , another arb , is used interchangeably with olmesartan medoxomil as a part of antihypertensive therapy6 ) .
in addition , kjeldsen et al . suggested that hydrochlorothiazide could activate the raas in relation to blood pressure , and thus hydrochlorothiazide in combination with arb is more effective in lowering blood pressure than existing single - drug regimens8 - 10 ) . according to a study by neutel et al .
, dizziness was the single complication with significance that occurred in patients more frequently under olmesartan medoxomil monotherapy than in the control group11 ) .
in addition , norwood et al . reported that adverse events related to treatment with olmesartan medoxomil were nearly equivalent to those of the placebo group , including headache andinfluenza - like symptoms , while dizziness was found in a higher number of cases12 ) . in our cases ,
metabolic disturbances and electrolyte imbalances including hypokalemia and hyponatremia were reported to be possible side effects of hydrochlorothiazide administration13 ) .
initial therapy for elderly patients with hypertension begins with diuretics , which effectively reduces the prevalence and mortality of cardiovascular diseases14 ) .
hyponatremia which was observed in these case reports with initiation of the combination antihypertensive therapy in both patients , seems to have been induced by the use of hydrochlorothiazide .
hyponatremia is an adverse effect of hydrochlorothiazide which is easily overlooked , while greater attention is paid to the prevention of hydrochlorothiazide - induced hypokalemia , as it can lead to sudden cardiac death15,16 ) . hyponatremia is often found in the early stages of diuretic therapy17,18 ) .
reported that hyponatremia was observed as a primary adverse effect in all arb / thiazide combinations19 ) . according to a report by sharabi et al .
, hyponatremia was observed in 45% of patients 6 months after the initiation of diuretic13 ) .
thus , continuous monitoring of blood electrolytes is necessary when administering diuretics as an antihypertensive therapy ; symptoms such as general weakness or nausea could also be a sign of hyponatremia .
furthermore , usage of low - dose diuretics and constant monitoring of blood sodium level is strongly recommended in elderly female patients , as they are more susceptible to hyponatremia13 ) .
additionally , in elderly patient with comorbid condition such as diabetes mellitus , telmisartan / hydrochlorothiazide may cause significant hyperkalemia and hyponatremia20 ) .
the patients in this case report presented with general weakness after administration of an arb / thiazide combination regimen . both were diagnosed with hyponatremia induced by hydrochlorothiazide ; upon alteration of their antihypertensive regimen , blood pressure , blood sodium and osmolality returned to normal levels .
we strongly recommend that antihypertensive therapy involving diuretics should always be accompanied by adequate monitoring for hyponatremia , as well as patient education regarding its symptoms and management . | there are several widely used combinations of angiotensin ii receptor blocker ( arb)/thiazide . the complimentary mechanism of action for such anti - hypertensive therapies is that , while arb inhibits the vasoconstricting and aldosterone - secreting effects of angiotensin ii , hydrochlorothiazide affects the renal tubular mechanisms of electrolyte reabsorption and increases excretion of sodium and chloride in the distal tubule , consequently promoting water excretion . in addition ,
hypokalemia , which may be triggered by a hydrochlorothiazide - induced increase in urinary potassium loss , is resisted by the use of arb .
hence , the arb / thiazide combination is safe in terms of potassium imbalance . for these reasons , fixed - dose arb / thiazide
combination anti - hypertensive drugs have been widely used for the treatment of hypertension .
however , there have not been many studies done regarding cases where patients under such regimens showed severe hyponatremia , even when the amount of thiazide included was low .
here we report two cases in which severe hyponatremia occurred following treatment with the arb / thiazide combinations . upon discontinuation of the regimen , both patients showed recovery from hyponatremia . |
as people are living longer due to advances in health care and lifestyles , spine surgeons will be faced with a greater number of surgical problems in the aged population and with that comes an expected increase in perioperative medical complications .
another substantial challenge is advanced osteoporosis , which is found very predictably in this population . with this poor bone mineralization
comes an array of complications associated with fixation failure . until osteoporosis can be better managed in the perioperative period , surgeons will need to aggressively pursue methods to enhance fixation in the aging spine .
pedicle screw fixation is still the most popular fixation method , but to date this fixation proves to be inadequate in many patients with osteoporosis .
previous studies have shown that not tapping prior to placing a pedicle screw will enhance screw fixation in the osteoporotic spine.1 it has also been shown that cement augmentation of screws in the spine will also enhance fixation.2
3
4
5
6
7
8
9
10
11
12
13 both techniques can be useful in a given situation . however , the effect of tapping versus not tapping when using cement to augment screws has not been evaluated fully .
in addition , surgeons have choices to make regarding the trajectory of the pedicle screws they implant .
although many studies regarded this , very few have addressed implications of changing screw trajectory in the face of osteoporosis .
one study by santoni et al did , however , and espouses a more lateral trajectory in the face of osteoporosis in an attempt to put the screw closer to a cortical buttress.14 to the authors ' knowledge , this has not achieved widespread acceptance for unclear reasons . the purpose of this study is to evaluate the effects of some technical choices a surgeon may make when faced with the need to achieve pedicle screw fixation in the osteoporotic vertebra .
one choice faced is whether to pretap prior to placement of pedicle screws into an osteoporotic spinal segment .
another choice the surgeon faces is the preferred screw trajectory in an osteoporotic spinal segment .
we chose to investigate the mechanical ramifications of a straight - ahead trajectory versus a cephalad - oriented screw trajectory .
synthetic osteoporotic cancellous bone block models were utilized as previously published by choma et al.3 osteoporotic bone was simulated by a 0.09-g / ml density open - cell rigid foam block attached with cement to a short fiber - filled epoxy sheet ( sawbones , pacific research laboratories , vashon , washington , united states ) .
the epoxy sheet mechanically simulated the dense superior end plate of the vertebra , and the whole structure can be seen in fig .
section blocks 30 mm wide 60 mm deep were used for testing .
two groups were tested a nonaugmented ( na ) group and a group augmented with bioactive cement ( bioc ) .
this is a proprietary mixture of calcium sulfate and calcium phosphate provided by wright medical ( arlington , tennessee , united states ) . in each specimen of both groups a centrally located pilot hole , 3.0 mm in diameter by 40 mm deep ,
was drilled into the end of each block using a straight lenke - type probe , and then the blocks were threaded with a 5.5-mm - diameter tap ( stryker xia , kalamazoo , mi , united states ) to a depth of 0 , 20 , 30 , or 40 mm depending upon the configuration .
starter holes and screwdrivers were guided along tracks using custom jigs to ensure proper and repeatable orientation of screw placement .
bioc , if applicable to the group being tested , was then injected ( 1.5 to 2.0 ml ) for samples using a syringe and jamshidi needle ( carefusion , san diego , ca , united states ) before a screw was manually inserted until the base of the head rested against the foam .
the cement augmentation distribution for various tapping depths was characterized visually using backlit photography ( fig .
, we tested four samples per specified tap depth , and in the augmented group , we tested five samples for each tap depth .
more samples were tested in cement group as there was prestudy concern for more variability with the use of cement .
fixed - head pedicle screws were used in both subgroups ( na and bioc ) , which were 6.5 mm in diameter by 40 mm long ( stryker xia ) .
a rod 5.5 mm in diameter by 65 mm long ( stryker xia ) was then inserted into the screw head and secured by tightening the set screw to 12 n / m to complete the test specimen . each augmented sample cured overnight prior to testing , which was well beyond the manufacturer 's recommended minimum time .
synthetic vertebrae with the epoxy end plate .
augmented cases featuring different tap depths .
identical synthetic osteoporotic bone blocks were used to evaluate the effect of varying screw trajectory in the sagittal plane .
two screw trajectories were evaluated in this study : a straight - ahead ( 0 degrees ) screw , parallel to the superior end plate , and a cephalad - oriented screw ( 23 degrees cephalad ) , in which the tip approaches the superior end plate .
we chose 23 degrees based upon screw geometry so that a consistent entry point was maintained between orientation groups and because it allowed the screw tip to contact the end plate .
four groups were evaluated in this portion of the study : an na screw control group ( na-0 ) with the screw placed at 0 degrees relative to the end plate ; an na screw control group ( na-23 ) with the screw placed at 23 degrees relative to the end plate ; a group augmented with calcium phosphate ( cp-0 ) with the screw placed 0 degrees relative to the end plate ; and a group augmented with calcium phosphate ( cp-23 ) with the screw placed 23 degrees relative to the end plate . prior to screw placement , a centrally located pilot hole , 3.0 mm in diameter by 40 mm deep , was drilled into the end of each block using a straight lenke - type probe and then threaded with a 5.5-mm - diameter tap ( stryker xia ) to a depth of 30 mm .
starter holes and screwdrivers were guided along either 0- or 23-degree degree tracks to ensure proper and repeatable orientation of screw placement .
cement , if applicable , was then injected ( 1.5 to 2.0 ml ) for each sample using a syringe and jamshidi needle .
next , a pedicle screw was manually inserted until the base of the head rested against the foam . in the na group
, we tested four samples per specified screw trajectory ( 0 or 23 degrees ) , and in the augmented group , we tested five samples for each screw trajectory .
more samples were tested in cement group as there was prestudy concern for more variability with the use of cement . for both parts of this study , the foam block epoxy sheet assembly , which simulated vertebral bone , was securely mounted between the superior and inferior steel plates of the specimen - loading fixture .
the specimen 's rod was held securely in an angle vise and tilted 45 degrees relative to the test machine 's horizontal table in a sagittal plane orientation .
a 46.6-cm - long pushrod was attached to the universal joint of the test machine 's load cell ram and the axis of the pin in the yoke attaching it to the specimen - loading fixture .
the pushrod was used to transmit a force f along the pushrod 's axis ( vertical initially ) to the test specimen at a point 45 mm anterior of the rod 's z axis and 10 mm below the inferior surface of the superior steel end plate .
this created equal components of pullout force fx and transverse force fz in combination with a flexion bending moment m = fz 0.015
this configuration simulates a combined loading condition in a kyphotic thoracic spine with no external constraints on the relative motion in the sagittal plane between the screw and vertebra .
motion of the pedicle screw relative to the simulated vertebra was measured with a 0.01-mm resolution 3d infrared optical tracking system ( ndi optotrak certus , waterloo , ontario , canada ; fig .
quasi - static loading tests were performed using a servo - hydraulic test machine ( instron 8821s , 100 royall street , canton , massachusetts , united states ) . in quasi - static testing ,
compressive load was applied in displacement control at a rate of 0.40 mm / s until catastrophic failure of the specimen occurred .
failure initiation was defined as the first maximum magnitude of compression force f that resulted in nearly constant or declining load resistance for at least 1 mm of additional ram displacement .
differences in failure initiation force and corresponding screw displacements were statistically compared by using a student t ( two - tailed , unequal variance ) test .
significance was taken as p 0.01 .
instron setup with the optotrak sensors attached .
( reprinted from choma tj , frevert wf , carson wl , waters np , pfeiffer fm .
biomechanical analysis of pedicle screws in osteoporotic bone with bioactive cement augmentation using simulated in vivo multicomponent loading .
spine ( phila pa 1976 ) 2011;36(6):454462 , with permission from lippincott williams & wilkins.3 )
synthetic osteoporotic cancellous bone block models were utilized as previously published by choma et al.3 osteoporotic bone was simulated by a 0.09-g / ml density open - cell rigid foam block attached with cement to a short fiber - filled epoxy sheet ( sawbones , pacific research laboratories , vashon , washington , united states ) .
the epoxy sheet mechanically simulated the dense superior end plate of the vertebra , and the whole structure can be seen in fig .
section blocks 30 mm wide 60 mm deep were used for testing .
two groups were tested a nonaugmented ( na ) group and a group augmented with bioactive cement ( bioc ) .
this is a proprietary mixture of calcium sulfate and calcium phosphate provided by wright medical ( arlington , tennessee , united states ) . in each specimen of both groups a centrally located pilot hole , 3.0 mm in diameter by 40 mm deep ,
was drilled into the end of each block using a straight lenke - type probe , and then the blocks were threaded with a 5.5-mm - diameter tap ( stryker xia , kalamazoo , mi , united states ) to a depth of 0 , 20 , 30 , or 40 mm depending upon the configuration .
starter holes and screwdrivers were guided along tracks using custom jigs to ensure proper and repeatable orientation of screw placement .
bioc , if applicable to the group being tested , was then injected ( 1.5 to 2.0 ml ) for samples using a syringe and jamshidi needle ( carefusion , san diego , ca , united states ) before a screw was manually inserted until the base of the head rested against the foam .
the cement augmentation distribution for various tapping depths was characterized visually using backlit photography ( fig .
, we tested four samples per specified tap depth , and in the augmented group , we tested five samples for each tap depth .
more samples were tested in cement group as there was prestudy concern for more variability with the use of cement .
fixed - head pedicle screws were used in both subgroups ( na and bioc ) , which were 6.5 mm in diameter by 40 mm long ( stryker xia ) .
a rod 5.5 mm in diameter by 65 mm long ( stryker xia ) was then inserted into the screw head and secured by tightening the set screw to 12 n / m to complete the test specimen . each augmented sample cured overnight prior to testing , which was well beyond the manufacturer 's recommended minimum time .
synthetic vertebrae with the epoxy end plate .
augmented cases featuring different tap depths .
identical synthetic osteoporotic bone blocks were used to evaluate the effect of varying screw trajectory in the sagittal plane .
two screw trajectories were evaluated in this study : a straight - ahead ( 0 degrees ) screw , parallel to the superior end plate , and a cephalad - oriented screw ( 23 degrees cephalad ) , in which the tip approaches the superior end plate .
we chose 23 degrees based upon screw geometry so that a consistent entry point was maintained between orientation groups and because it allowed the screw tip to contact the end plate .
four groups were evaluated in this portion of the study : an na screw control group ( na-0 ) with the screw placed at 0 degrees relative to the end plate ; an na screw control group ( na-23 ) with the screw placed at 23 degrees relative to the end plate ; a group augmented with calcium phosphate ( cp-0 ) with the screw placed 0 degrees relative to the end plate ; and a group augmented with calcium phosphate ( cp-23 ) with the screw placed 23 degrees relative to the end plate . prior to screw placement , a centrally located pilot hole , 3.0 mm in diameter by 40 mm deep , was drilled into the end of each block using a straight lenke - type probe and then threaded with a 5.5-mm - diameter tap ( stryker xia ) to a depth of 30 mm .
starter holes and screwdrivers were guided along either 0- or 23-degree degree tracks to ensure proper and repeatable orientation of screw placement .
cement , if applicable , was then injected ( 1.5 to 2.0 ml ) for each sample using a syringe and jamshidi needle .
next , a pedicle screw was manually inserted until the base of the head rested against the foam . in the na group
, we tested four samples per specified screw trajectory ( 0 or 23 degrees ) , and in the augmented group , we tested five samples for each screw trajectory .
more samples were tested in cement group as there was prestudy concern for more variability with the use of cement . for both parts of this study , the foam block epoxy sheet assembly , which simulated vertebral bone , was securely mounted between the superior and inferior steel plates of the specimen - loading fixture .
the specimen 's rod was held securely in an angle vise and tilted 45 degrees relative to the test machine 's horizontal table in a sagittal plane orientation .
a 46.6-cm - long pushrod was attached to the universal joint of the test machine 's load cell ram and the axis of the pin in the yoke attaching it to the specimen - loading fixture .
the pushrod was used to transmit a force f along the pushrod 's axis ( vertical initially ) to the test specimen at a point 45 mm anterior of the rod 's z axis and 10 mm below the inferior surface of the superior steel end plate .
this created equal components of pullout force fx and transverse force fz in combination with a flexion bending moment m = fz 0.015 n / m at the vertebra center .
this configuration simulates a combined loading condition in a kyphotic thoracic spine with no external constraints on the relative motion in the sagittal plane between the screw and vertebra .
motion of the pedicle screw relative to the simulated vertebra was measured with a 0.01-mm resolution 3d infrared optical tracking system ( ndi optotrak certus , waterloo , ontario , canada ; fig .
quasi - static loading tests were performed using a servo - hydraulic test machine ( instron 8821s , 100 royall street , canton , massachusetts , united states ) . in quasi - static testing ,
compressive load was applied in displacement control at a rate of 0.40 mm / s until catastrophic failure of the specimen occurred .
failure initiation was defined as the first maximum magnitude of compression force f that resulted in nearly constant or declining load resistance for at least 1 mm of additional ram displacement .
differences in failure initiation force and corresponding screw displacements were statistically compared by using a student t ( two - tailed , unequal variance ) test .
( reprinted from choma tj , frevert wf , carson wl , waters np , pfeiffer fm .
biomechanical analysis of pedicle screws in osteoporotic bone with bioactive cement augmentation using simulated in vivo multicomponent loading .
spine ( phila pa 1976 ) 2011;36(6):454462 , with permission from lippincott williams & wilkins.3 )
tables 1 and 2 present the force to failure for screws placed into holes tapped to different depths ranging from 0 to 40 mm . in the absence of cement augmentation
each na sample shows a consistent decrease in force to failure as the tap depth increases . in comparing the untapped versus the tapped screw ,
the force to failure decreases 52% if the pilot hole is tapped to 40 mm prior to screw insertion ( 30.93 2.1 n versus 14.87 0.3 n , respectively ) .
this behavior is consistent with previous studies evaluating the effect of tapping prior to screw placement in the lumbar spine.11
12
alternatively , the samples with cement augmentation increased the force to failure as the tap depth increased . the average force to failure increased in each case that the tap depth increased ( tables 1 and 3 ) .
the average force to failure increased 54% when comparing untapped versus pretapping the entire screw length ( 40.35 1.6 n versus 61.95 1.8 n , respectively ) .
a graphical representation of the force to failure for na and augmented screws relative to varied tap depths is shown in fig .
abbreviation : bioc , bioactive cement . in comparing each case of the augmented versus na specimens ,
the p values are all less than 0.01 , taken as a statistically significant difference between the experimental augmented cases and na control cases .
abbreviations : bioc , calcium phosphate and calcium sulfate cement augmentation ; na , nonaugmented .
f
max ( n ) p values in student t test ( two - tailed , unequal variance ) , statistical significance : p < 0.01 .
pedicle screws oriented at 23 degrees relative to the end plate had a significantly higher failure force than their respective counterparts at 0 degrees in both the na and bioc groups ( p < 0.01 ; tables 5 and 6 ) . in the na group , simply changing the trajectory of the screw doubled the average force of failure from 20.95 n to 39.82 n. the cases with the largest change in failure strength were the na screw at 0 degrees versus the calcium phosphate screw at 23 degrees . in this comparison , there was a 3.5-fold increase in the average failure strength from 20.95 n to 73.17 n. again , this comparison 's p value was much less than 0.01 , making it statistically significant . in the bioc group ,
the average force to failure in the bioc group inserted at 0 degrees was 56.82 4.7
n , and the mean force to failure for the screws inserted at 23 degrees was 73.17 2.1
n ( fig . 5 ) . orienting the screw up to the vertebral end plate led to significantly higher force to failure values in both cases , with what appears to be an independent effect by augmenting the screw with cement .
abbreviations : bioc , calcium phosphate and calcium sulfate cement augmentation ; na , nonaugmented . student t test ( two - tailed , unequal variance , statistical significance : p < 0.01 ) .
tables 1 and 2 present the force to failure for screws placed into holes tapped to different depths ranging from 0 to 40 mm . in the absence of cement augmentation
each na sample shows a consistent decrease in force to failure as the tap depth increases . in comparing the untapped versus the tapped screw ,
the force to failure decreases 52% if the pilot hole is tapped to 40 mm prior to screw insertion ( 30.93 2.1 n versus 14.87 0.3 n , respectively ) .
this behavior is consistent with previous studies evaluating the effect of tapping prior to screw placement in the lumbar spine.11
12
alternatively , the samples with cement augmentation increased the force to failure as the tap depth increased . the average force to failure increased in each case that the tap depth increased ( tables 1 and 3 ) .
the average force to failure increased 54% when comparing untapped versus pretapping the entire screw length ( 40.35 1.6 n versus 61.95 1.8 n , respectively ) .
a graphical representation of the force to failure for na and augmented screws relative to varied tap depths is shown in fig .
abbreviation : bioc , bioactive cement . in comparing each case of the augmented versus na specimens ,
the p values are all less than 0.01 , taken as a statistically significant difference between the experimental augmented cases and na control cases .
abbreviations : bioc , calcium phosphate and calcium sulfate cement augmentation ; na , nonaugmented .
f
max ( n ) p values in student t test ( two - tailed , unequal variance ) , statistical significance : p < 0.01 .
pedicle screws oriented at 23 degrees relative to the end plate had a significantly higher failure force than their respective counterparts at 0 degrees in both the na and bioc groups ( p < 0.01 ; tables 5 and 6 ) . in the na group , simply changing the trajectory of the screw doubled the average force of failure from 20.95 n to 39.82 n. the cases with the largest change in failure strength were the na screw at 0 degrees versus the calcium phosphate screw at 23 degrees . in this comparison , there was a 3.5-fold increase in the average failure strength from 20.95 n to 73.17 n. again , this comparison 's p value was much less than 0.01 , making it statistically significant . in the bioc group ,
the average force to failure in the bioc group inserted at 0 degrees was 56.82 4.7 n , and the mean force to failure for the screws inserted at 23 degrees was 73.17 2.1
n ( fig . 5 ) . orienting the screw up to the vertebral end plate led to significantly higher force to failure values in both cases , with what appears to be an independent effect by augmenting the screw with cement
abbreviations : bioc , calcium phosphate and calcium sulfate cement augmentation ; na , nonaugmented .
student t test ( two - tailed , unequal variance , statistical significance : p < 0.01 ) .
pedicle screw fixation in the osteoporotic spine is expected to be a major challenge facing spinal surgeons for the foreseeable future .
fairly clear evidence including the results of this study supports the biomechanical superiority of not tapping prior to placing standard na pedicle screws in an osteoporotic spine . in our study , tapping prior to screw placement led to a 52% decrease in force to failure of the screw fixation .
tapping removes bone that could potentially be compressed by the placement of a screw and therefore not tapping and leaving this bone in place will likely lead to better fixation .
the choice of tapping versus not tapping when placing cement - augmented screws certainly seems less intuitive , which we felt justified further study .
our study used an osteoporotic model with multicomponent loading that was previously established by choma et al.3 the multicomponent loading is thought to more closely approximate how screws might fail in vivo , and therefore this combined pullout , toggle , and translational force was used in our study instead of a one - dimensional screw pullout model . in our study , we evaluated tapping versus not tapping prior to cement augmentation of a screw in a cancellous bone block model . tapping to 40
mm prior to augmentation and screw placement led to a 54% increase in force to failure when compared with a nontapped cement - augmented screw .
the results of our study suggest that tapping prior to placement of cement augmentation substantially improves loads to failure of screw fixation in an osteoporotic model .
it was also clear in our data that tapping longer instead of shorter prior to cement augmentation led to substantially greater stability .
we hypothesize that the tapping creates a larger cavity in which the bioactive cement can more uniformly distribute around the screw and the screw bone interface . tapping longer
limitations exist whenever a synthetic bone model is used and this should be recognized , but this previously established model provides a uniform reproducible simulation of osteoporotic bone.3 synthetic bone blocks helped to minimize the effect of geometric and material property variability associated with cadaveric vertebra .
worst - case scenario of minimal cortical contact of the screw in the pedicle , which is inherent in a cadaveric model due to the pedicle 's oval cross - sectional shape .
there should be some caution translating this research to an in vivo application as tapping prior to placing augmentation and screws may have consequences that have not been well studied .
one potential disadvantage of tapping first , prior to augmentation and screw placement , is that the tap creates a larger hole and could lead to a pedicle breach and therefore a conduit for cement extravasation .
this breach may not have been present if the tract was not tapped prior to cement placement . the obvious advantage to tapping first , beyond the enhanced fixation as suggested in our research ,
the tapping also more closely approximates the diameter of the screw and therefore should better allow the surgeon to palpate a breach or a potentially misdirected screw trajectory .
the other component of this study was the evaluation of screw trajectory and the effect of sagittal screw angulation with or without screw augmentation . in the na screws , changing the angulation from 0 ( straight ahead ) to 23
the hypothesis for such a dramatic difference is that this angulation of screws allows the screw tip to better approximate the simulated superior end plate . in vivo
this cephalad angulation of the screw could better approximate the screw tip to the relatively denser bone found adjacent to the superior end plate .
this might lead to fewer early instrumentation failures in the osteoporotic spine and hopefully translate to improved clinical results . further clinical study is clearly needed .
one certainly needs to be aware of anatomic constraints of placing screws with more cephalad orientation .
violating the end plate or pedicle with this cephalad trajectory could certainly have very undesirable consequences .
the results between the augmented screws with different trajectories also showed a substantial improvement in the group with greater cephalad angulation , but the difference between the two trajectories was less dramatic ( 29% increase in load to failure ) .
cement augmentation alone provides substantial stability , and the marginal increase in stability achieved with a cephalad oriented and augmented screw is likely not worth further investigation given the anatomic constraints and risks of angulating screws cephalad .
unfortunately , the number of patients with osteoporosis and patients with low bone mineral density continues to rise as our population is living longer .
standard pedicle screw fixation in this population is often inadequate and can lead to devastating complications.15
16
17
18 because of this , we need to investigate and exploit every potential advantage for stable fixation in the aging spine .
based on an established osteoporotic bone block model with multicomponent loading , it appears that there is a substantial improvement in stability when tapping and tapping long prior to bioactive cement augmentation of pedicle screws . in our study , pretapping the entire screw length prior to placement of augmented screws led to a 54% increase in load to failure when compared with a nontapped but still augmented screw .
this is a relatively straightforward adjustment in surgical technique when placing augmented screws into the osteoporotic spine and has the potential to further limit early fixation failure .
based on the same osteoporotic model , we conclude that it appears cephalad angulated pedicle screw placement provides substantially greater stability when compared with a standard straight - ahead trajectory with both augmented and na screw constructs .
the screws that are oriented cephalad would more closely approximate the dense bone of the superior end plate and therefore lead to greater fixation . | study design biomechanical study of pedicle screw fixation in osteoporotic bone .
objective to investigate whether it is better to tap or not tap osteoporotic bone prior to placing a cement - augmented pedicle screw .
methods initially , we evaluated load to failure of screws placed in cancellous bone blocks with or without prior tapping as well as after varying the depths of tapping prior to screw insertion .
then we evaluated load to failure of screws placed in bone block models with a straight - ahead screw trajectory as well as with screws having a 23-degree cephalad trajectory ( toward the end plate ) .
these techniques were tested with nonaugmented ( na ) screws as well as with bioactive cement ( bioc ) augmentation prior to screw insertion .
results in the na group , pretapping decreased fixation strength in a dose - dependent fashion . in the bioc group ,
the tapped screws had significantly greater loads to failure ( p < 0.01 ) . comparing only the screw orientation , the screws oriented at 23 degrees cephalad had a significantly higher failure force than their respective counterparts at 0 degrees ( p < 0.01 ) .
conclusions standard pedicle screw fixation is often inadequate in the osteoporotic spine , but this study suggests tapping prior to cement augmentation will substantially improve fixation when compared with not tapping .
angulating screws more cephalad also seems to enhance aging spine fixation . |
there are an estimated 150,000 surgical amputations per year in the us , most of which are secondary in nature , arising from diabetes mellitus , vascular disease , trauma , and cancer.1 residual pain in amputation stumps can extend beyond the normal recovery time , and is seen in 13%71% of cases.2,3 after the nerve injury , spontaneous nerve activity develops at the site of injury and the corresponding dorsal root ganglia .
these changes are followed by sensitization , reduction of the pain threshold , exaggerated response to nociceptive stimuli ( hyperalgesia ) or non - nociceptive ( alodinea ) , and phantom sensations.4 the syndrome of a phantom limb with associated pain is found in 70%85% of amputees , and pain persists in 5%10% of these people.3,5 sensory abnormalities are also described in more than 50% of patients with amputation stumps.6 in a study of 96 upper limb amputees , schley et al7 found that 44.6% of patients suffered from phantom pain , 53.8% had phantom sensations , 61.5% had stump pain , and 78.5% had stump sensation .
the authors reported that stump pain gradually decreased in 19 ( 47.5% ) of 40 amputees in the first year following amputation , but was stable in 12 ( 30% ) patients , and some may present with severe stump pain that is resistant to treatment .
the residual pain may be due to several factors , such as an underlying disease , bone deformities , wound healing , or neuropathic pain.3 many treatments have been reported for pain in a stump following amputation , and these can be divided into three categories : pharmacological , psychological , and physical .
the first includes the use of anti - inflammatory drugs , opioids , anti - depressants , and anti - convulsion drugs , in addition to the use of injections of steroids , analgesic nerve blocks , and painkiller adhesives.7,8 the second is represented mainly by antidepressant therapy , and the third included transcutaneous electrical stimulation of nerves , spinal electrical stimulation , low - intensity laser therapy , rehabilitation exercises and massage , and surgery.911 the use of low - intensity laser therapy ( lilt ) started in europe and russia in the 1960s . lilt also known as photobiology or biostimulation makes use of low levels of radiation , with the use of a single wavelength.12,13 it is suggested that the biological effect of this therapy is secondary to the direct effects of the light radiation , and not the result of thermal processes.14 clinically , there have been many uses of lilt demonstrated , but most require further studies before conclusions can be drawn .
one study indicated that tensor strength of wounds increased considerably after 12 weeks of laser treatment , with this improvement associated with a significant increase in collagen after 2 weeks of treatment.15 the effects of lilt on the peripheral nervous system are also encouraging . when treated with transcutaneous lilt ,
rats with facial nerve injuries caused by crushing had an increased rate of nerve regeneration.16 in a double - blind controlled study , lilt and transcutaneous electrical stimulation were associated with a significant reduction of subjective pain and improved sensory latency in patients with carpal tunnel syndrome.17 patients with maxillofacial pain including trigeminal neuralgia also reported decreased pain in response to laser therapy.18 it is unclear how lilt promotes an analgesic effect . in the case of neuropathic pain , lilt may affect the release of neurotransmitters such as serotonin,19 increase production of mitochondrial atp,20 increase the release of endorphins,21 and have anti - inflammatory effects.22 in controlled laboratory studies it has been shown that lilt may reduce inflammation by lowering the levels of prostaglandin pge2 and inhibiting cyclo - oxygenase -2 ( cox -2 ) in cell cultures.2326
three patients with neuropathic pain in an amputation stump were selected in the pain clinic of our hospital .
all patients experienced significant neuropathic pain in the form of the sensation of shock or needles on the scar of the amputation stump in all cases , this pain was represented by high scores on the visual analog scale ( vas ) of pain , and the pain persisted despite analgesics or functional rehabilitation .
the patients also had functional limitations in the activities they could perform as a result of this pain .
we selected three patients with higher pain intensity ( vas > 8) , pain that did not respond to medical treatment , homogeneity of previous treatment ( the patients were treated with the same medications and rehabilitation ) , and all three patients had undergone their traumatic amputation over 1 year prior to this study .
the first of these was the pain vas , which consists of a horizontal line ten centimeters long with no pain and pain as bad as it could be marked on the left and right ends of the line , respectively .
the patients were required to make a mark on the line indicating how bad the pain was in their amputation stump , and the distance from the left end to the mark on the scale was measured and recorded as the vas score .
the second assessment was the barthel scale , which aims to quantify the patient s ability to carry out daily living activities such as eating or using a toilet , and ranges from the highest dependency ( 0 points ) to the highest independency ( 100 points).27 the third assessment , the lawton scale , quantifies impairment to the carrying out of daily tasks and ranges from the highest dependency ( 8 points ) to the highest independency ( 24 points).28 after assessment , patients received nine sessions ( three treatment sessions per week for three weeks , as reported by lam and cheing)29 of low - intensity laser ( laser diode , = 830 nm , dose ranging from 815 j / cm , p = 70 mw ) on the amputation stump scar .
a continuous wave diode laser was used ( dmc , so paulo , brazil ) . following treatment ,
the patients were re - evaluated using the three scales described above , and patients were monitored for 4 months .
no side effects were observed in response to the lilt . this project was analyzed and approved by the ethics committee of our institution ( research protocol # 01254/09 ) .
the main objective of the study was to assess whether this treatment would result in pain relief in the amputated stump , expressed by a decrease in vas scores . as a secondary objective of the study ,
the effect of lilt on the improvement of independency and functionality of the patient was also assessed ( this would be expressed by an increase in the barthel and lawton scales ) .
all three patients reported subjective pain relief after nine sessions of low - intensity laser .
the patients had allodynia and hyperpathia prior to treatment , and the lilt treatment produced a verified remission in hyperpathia and significant control of allodynia .
the patients post - treatment reporting of pain through the vas also showed a significant reduction in pain in all three cases , as shown in figure 1 , with pain dropping by five to seven points .
measured on the barthel scale , improvements of 45 to 55 points were seen , and in the lawton scale the improvements ranged from eight to ten points ( figure 2 ) .
the application of low - intensity laser treatment contributed to an improvement in our patients reported pain intensity , their ability to carry out daily living activities ( barthel scale ) , and their impairment in the carrying out of daily tasks ( lawton scale ) .
reported pain was reduced by the lilt treatment , with 50%70% less pain after nine sessions .
this improvement should be interpreted with caution since all of the patients studied had high scores of pain intensity on the vas before treatment , and the same outcome should not be expected in patients who begin treatment with lower intensities of pain .
also , the study group is small , and the results should be seen only as a descriptive study of a new tool . although the exact mechanism is unknown , lilt has been beneficial in many studies that have used a range of different pain models .
generally these studies do not show a good evidence level due to a lack of randomization , doubleblind design , or the use of a placebo group.30 a reduction in pain without the use of analgesic drugs can help reduce the excessive use of medication , reducing the potential side effects of high doses . since no side effects were observed in the use of lilt , its use can probably be started at a very early stage and on patients suffering from less pain .
there are no similar studies presented in the current literature , and thus the results of the current study may not be directly compared to other work . in a meta - analysis of
the use of lilt in patients with low back pain by cochrane,31 laser treatment was beneficial in reducing pain unless patients were subjected to physical exercise as an adjunct treatment .
it is known that pain causes loss of function and decreased independence of the individual , often leading to reduced mobility and increased rates of depression .
the present study shows that lilt can result in an improvement in patient independence , with an average gain of 50% in the barthel scale and 37.5% in the lawton scale , and all improved to the point where they gave themselves the highest scores possible for the scales used in the study .
this indicates that lilt can be used in the future to decrease pain in patients following amputations .
this study s sample is small and no control group was used , which prevents any extrapolation of the results .
the reported results should be seen as a stimulus for randomized studies with larger sample sizes to confirm the effectiveness of lilt in the treatment of chronic pain in patients with amputated limbs . | debilitating stump pain following amputation surgery is a major problem when it affects the patient s quality of life , often making the patient totally dependent on others for their day - to - day care .
attempts have been made to treat those patients through pharmacological , psychological , and physical therapies , but in many cases these fail to relieve the pain .
this article focuses on three patients with chronic , intense , and debilitating stump pain who were previously treated with pain medications , but with little success .
these patients underwent nine sessions of low - intensity laser therapy ( lilt ) to the stump this is a new treatment that has been used to treat other pain disorders .
all patients reported a decrease in the intensity of their pain and increased ability to perform daily living activities during a 4-month follow - up . |
beta - galactooligosaccharides ( gos ) are oligosaccharides composed primarily of galactose and often terminate with a glucose residue at the reducing end .
they occur naturally in the milk of many animals including humans , cows , and wallabies .
industrial production of gos can be achieved in several ways , but most commercial products are produced from lactose using -galactosidase under conditions which favour transgalactosylation [ 57 ] .
the structures of gos produced by enzymes of different bacteria have been studied [ 8 , 9 ] as have those from commercial gos production [ 10 , 11 ] . in all cases , the gos
are predominantly composed of a chain of -d - galactose residues terminating at the reducing end with a d - glucose residue .
they are predominantly linear , but a few branched structures have been reported . in some instances ,
studied one commercial gos ( vivinal gos ) and demonstrated the predominance of the ( 1 4)-linked -d - gal residue in the oligosaccharides but other linkages such as ( 1 6)-linked -d - gal and ( 1 3)-linked -d - gal were also observed . on the shorter oligosaccharides ( di- and trisaccharides )
, the reducing end glucose could be linked through position 2 , 3 , 4 , or 6 but as the oligosaccharide chain length increased , linkage through the 4 position predominated .
coulier et al . also reported the presence of 2 nonreducing disaccharides , -d - gal-(11)--d - glc and -d - gal-(11)--d - glc .
hernndez - hernndez et al . studied the glycosidic linkage types present in three commercial gos samples ( vivinal , bimuno , and yum yum ) .
they determined the linkages only via ms fragmentation data ; therefore the anomeric configuration could not be confirmed .
the relative abundances of the different linkage types are difficult to discern from their data due to coelution of different oligosaccharides in their lc system .
nevertheless , all three gos contained ( 1 6)-linked , ( 1 3)-linked , and ( 1
the ( 1 2)-linked -d - gal residue was less common but was present in all three samples .
gos are not hydrolysed in the upper gastrointestinal tract of humans , but they enter the large intestine and can be metabolized by the colonic microflora .
a number of studies have indicated that gos consumption may alter the microflora population by selectively increasing the number of certain types of bacteria , in particular bifidobacteria [ 1319 ] , but this has not been the case in every study . should it be accepted that this modulation of the gut microflora induces a health benefit , these oligosaccharides may be considered as prebiotics . it has also been reported that gos may reduce adhesion of pathogenic bacteria or their toxins to the host receptors , potentially protecting the host against illness via other mechanisms [ 2123 ] .
if it is considered that there is sufficient evidence that gos provide some health benefit , then , in certain markets , they may also be considered as dietary fibres . in 2009 ,
after more than 16 years of discussions , codex settled on a new definition of dietary fibre .
the difference between the two definitions was the chain length of the carbohydrate polymer that could be considered as fibre .
in one , the carbohydrate polymer must consist of 10 or more monomeric units ; in the other , the carbohydrate polymer must consist of three or more monomeric units .
gos ingredients are generally mixtures of oligosaccharides having chain lengths between two and eight monomeric units .
gos therefore can not be considered as fibre in countries using the minimum chain length of 10 monomeric units . on the other hand , in markets that adopted the definition of three monomeric units or more ( such as australia , new zealand , and the european union ) , they may be considered fibres .
however , the gos contain nondigestible disaccharides that , while potentially providing a prebiotic effect or other health benefit [ 12 , 2628 ] , do not fall within the definition of dietary fibre .
it would therefore be necessary to exclude these gos disaccharides when declaring gos as a fibre for product labeling .
the current aoac 2001.02 method for gos analysis is based on the work of de slegte and is the only fully validated official method for determination of gos in food samples .
it uses a hydrolysis to convert the gos to galactose and glucose , and then measurements of the released monosaccharides are used to calculate the gos content .
this method has two limitations : ( 1 ) using this method , it is not possible to distinguish the gos that may fall under the definition of fibre from those that do not and , ( 2 ) in products containing high levels of free galactose or lactose , and containing relatively low concentrations of gos , a small error made on the free galactose or lactose measurement will induce a large error on the gos measurement ( as would be the case in infant formula e.g. ) .
produced some quantitative data to estimate the relative amounts of oligosaccharides of each dp in the gos products they studied .
however quantitation was not the primary aim of their work , hence there was no validation of their methodology and it was not applied to complex food matrices .
albrecht et al . developed a method for gos analysis using capillary electrophoresis with laser - induced fluorescence ( ce - lif ) .
unfortunately , they performed limited validation , and ce - lif is not a common technology in food analysis laboratories . in this paper , we describe a method for gos analysis that overcomes the two limitations of the aoac 2001.02 method and uses more commonly available instrumentation ( hplc ) than ce - lif .
all chemicals were purchased from sigma ( buchs , switzerland ) or merck ( darmstadt , germany ) unless otherwise specified .
all the water used was 18 m deionised water produced by a milli - q system ( millipore , billerica , ma , usa ) .
all of the oligosaccharides were purchased from dextra laboratories ( reading , uk ) with the exception of lactose , maltotriose , and laminaritriose ( sigma ) .
galactooligosaccharide ingredients were obtained from frieslandcampina ( amersfoort , the netherlands ) , yakult pharmaceutical industry ( tokyo , japan ) , kerry group ( tralee , ireland ) , clasado ( sliema , malta ) , ingredion inc .
the gos samples have been coded gos-1a , gos-1b , gos-2 , gos-3a , gos-3b , gos-4 , gos-5 , and gos-6 ( in no specific order ) .
gos-1a and gos-1b are two different formats ( e.g. , powder and syrup ) of product from the same supplier .
the gos contents of gos ingredients were determined using the aoac official method aoac 2001.02 . for determination of gos in infant formula , a sample of the gos ingredient used in production was first analysed by the aoac method .
a solution of the ingredient ( 0.6 g/100 ml ) was profiled by hpaec - pad on an ics 3000 system ( dionex , olten , switzerland ) equipped with a carbopac pa 100 column ( 250 4 mm , dionex ) . an aliquot ( 25 l ) of the solution was injected onto the column and eluted at 1 ml / min with a linear gradient of sodium acetate ( 10100
mmol / l in 30 min ) in sodium hydroxide ( 90 mmol / l ) and marker peaks were selected at around 9 and 13 min .
g / l ) was prepared and an aliquot ( 25 l ) was injected on the same hpaec - pad system using the same method . by comparing the areas of the two marker peaks in the infant formula sample and in the gos ingredient , it was possible to determine the gos content of the infant formula .
samples of gos ingredient ( 250 mg ) were dissolved to 100 ml in water .
samples of infant formula ( 2 g ) were dissolved to 50 ml in water .
a 500 l aliquot of sample solution was taken and 200 l of laminaritriose solution ( 0.3
the mixture was mixed using a vortex mixer , and then a 20 l aliquot was transferred to a 2.0 ml microcentrifuge tube and labelled with 2-aminobenzamide ( 2-ab ) following the protocol of bigge et al . with some modifications previously described by bnet and austin .
briefly , 200 l of 2-ab reagent ( 0.35 mol / l 2-ab and 1.0 mol / l sodium cyanoborohydride in dimethylsulfoxide containing 30% acetic acid ) was added to the aliquot and mixed well .
the solution was heated at 60c for 2 h and then cooled on ice .
1.5 ml of acetonitrile / water ( 75/25 ) was added and the solution was transferred to a vial suitable for the hplc autosampler . if samples contained ( or were suspected to contain ) maltodextrins , then 1.0 ml of ammonium acetate buffer ( 0.1 mol / l ph 5.5 ) was added after the labeling reaction ( but before the addition of acetonitrile / water ) .
an aliquot ( 0.5 ml ) of the solution was transferred to a 2 ml tube and 200 l of amyloglucosidase ( 60 u / ml in 0.1 mol / l ammonium acetate , ph 5.5 ) was added .
samples were then cooled to room temperature and diluted with 0.70 ml of acetonitrile .
labelled oligosaccharides were cleaned and separated using an hplc ( ultimate 3000 rs , dionex , sunnyville , ca , usa , or a prominence , shimadzu , tokyo , japan ) in the configuration described previously on tsk gel amide-80 guard ( 3.2 15 mm , 3 m ) and analytical ( 4.6 150 mm , 3 m ) columns ( tosoh bioscience , stuttgart , germany ) .
detection was performed by a dionex rf-2000 or shimadzu rf-10axl fluorescence detector using
ex = 330 nm and
em = 420 nm .
a 10 l aliquot ( or 20 l aliquot for amyloglucosidase treated samples ) of the labelled os solution was injected onto the guard cartridge under isocratic conditions ( 98% a ) at a flow rate of 1 ml / min for 7.5 min .
the eluent from the guard cartridge was then directed onto a tsk gel amide-80 analytical column ( 4.6 150 mm , 3 m , tosoh bioscience ) held at 23c and the mobile phase composition was ramped to 84% a over 0.5 min .
oligosaccharides were then separated under the following conditions : 84% a from 8 to 16 min , followed by a linear gradient to 61% a at 50 min . at 51 min , the flow rate
was dropped to 0.8 ml / min and the eluent composition was held at 20% a for 3 min to wash the column .
the composition was returned to 90% a over 1 min and then the flow rate was returned to 1.0 ml / min and the column reequilibrated under those conditions for 6 min before returning the system to the load conditions for the next sample . to determine the molecular mass of the os responsible for each chromatographic peak ,
the same procedure as above was followed , but the starting concentrations of the samples were 2 - 3 times greater , and the injection volume was varied between 5 and 100 l to achieve sufficient concentration for ms detection .
the effluent from the analytical column was split approximately 60/40 , and the flow at around 400 l / min was sent to the mass spectrometer , while the remaining flow went to the fluorescence detector using the parameters described above .
the mass spectrometer was an api 4000 q - trap ( ab sciex , foster city , ca , usa ) equipped with a turbo ion spray source controlled by analyst 1.5 ( ab sciex ) .
the hplc was an ultimate 3000 ( dionex ) controlled by analyst 1.5 ( ab sciex ) via dcms link ( dionex ) .
ms source parameters were set as follows : curtain gas ( cur ) : 17.0 , ion source temperature ( tem ) : 400c , nebulizer gas ( gs1 ) : 60.0 , heater gas ( gs2 ) : 20.0 , interface heater ( ihe ) : on , ion spray potential ( is ) : 3800 v , declustering potential ( dp ) : 100 , and entrance potential ( ep ) : 10 .
the experiment was run in multiple ion monitoring ( mim ) mode , using a list of the m / z ratios of the [ m h ] ions covering disaccharides to nonasaccharides . for each mass ,
a dwell time of 50 to 70 ms was set . to determine os concentration , each peak in the fluorescence chromatogram was integrated and the peak area ( relative to the internal standard ) was compared to that of a calibration curve ( produced using different concentrations of maltotriose with laminaritriose as internal standard ) .
these were then converted to mass concentrations by conversion using the molecular weight ( assigned from the ms experiments ) .
the methods were validated by assessing linearity of the calibration curve , the method accuracy , and method precision ( repeatability and intermediate reproducibility ) .
linearity was assessed in the hpaec - pad profiling method by injecting a series of different concentrations of gos ingredient and plotting the area of the two markers against the gos concentration .
linearity was assessed for the hplc - fld method by plotting the ratio ( standard / is ) of the peak areas against the ratio of concentrations ( standard / is ) using different concentrations of maltotriose as the standard and a fixed concentration of laminaritriose ( 300 nmol / ml ) as the internal standard .
repeatability ( r ) and intermediate reproducibility ( ir ) were assessed by analysing samples ( gos or infant formula containing gos ) in duplicate on at least 6 different days .
sd ( r ) and sd ( ir ) were then calculated using the following formulae :
( 1)classicalrobustsd(r)sd(r)=i=1nsdi2n=i=1n(xi1xi2)22nsdrob(r)=1.0484medi=1, ,n{|xi1xi2|}sd(ir)sd(ir)=sd2(b)+12sd2(r)sdrob(ir)=sdrob2(b)+12sdrob2(r ) ,
where
n is the number of ( single or duplicate ) determinations , med { x
i } is the median of the specified set of results { x
i } ,
x
i is the individual result within the set of single determinations with i going from 1 to n ,
x
i1 and x
i2 are the two results within the set of duplicate determination with i going from 1 to n , sdi is the standard deviation within the set of duplicates / replicates with i going from 1 to n , sd ( b ) is the standard deviation between the means of duplicates , and sdrob ( b ) is the robust standard deviation between the means of duplicate .
n is the number of ( single or duplicate ) determinations , med { x
i } is the median of the specified set of results { x
i } ,
x
i is the individual result within the set of single determinations with i going from 1 to n ,
x
i1 and x
i2 are the two results within the set of duplicate determination with i going from 1 to n , sdi is the standard deviation within the set of duplicates / replicates with i going from 1 to n , sd ( b ) is the standard deviation between the means of duplicates , and sdrob ( b ) is the robust standard deviation between the means of duplicate .
recovery was determined for gos samples by comparing the result of the new method against that obtained by the aoac official method . for infant formula samples ,
the recovery was calculated by subtracting the gos content measured in a blank formula from that measured in a spiked formula and dividing the result by the amount of gos spiked into the sample . the result
measurement uncertainty was calculated by combining the results from the recovery experiment with those from the precision experiment as described by barwick and ellison .
all statistical calculations were performed using the in - house statistical package qstat.net using both classical and robust statistics .
using the hplc - fld method , each type of gos gave rise to a distinct gos profile ( figure 1 ) except those from the same supplier which had identical profiles ( data not shown ) .
the data from lc - ms experiments were used to assign the mass ( and hence chain length ) for each peak in the chromatogram .
separation of the major oligosaccharides by chain length was achieved , but , in 3 samples ( gos-6 , gos-5 , and gos-1 ) , coelution of some minor signals was observed ; mostly some hex5 were not completely resolved from some hex4 or hex6 .
the disaccharide area of the chromatograms is always well resolved from the areas containing longer chain gos , thus enabling the separation of gos matching one of the codex fibre definitions from the gos that does not .
standards of each individual gos are not available ; therefore , quantitation can not be performed in the usual way using standards for each individual analyte .
however , since each chain has been labelled with 2-ab and it is the 2-ab which is detected by the fluorimeter , we can exploit this for quantitation .
. already demonstrated that labeling with 2-ab is quantitative for a broad range of different oligosaccharides ; thus , it should be possible to perform molar quantitation based on a calibration curve produced using any suitable 2-ab labelled oligosaccharide .
we selected maltotriose as our calibrant and used laminaritriose as an internal standard ( is ) .
a standard curve was prepared by plotting the relative response of the calibrant to the is against the relative concentration of the calibrant to the is ( figure 2 ) .
the curve was found to be linear in the range from 3 to 750 nmol / ml when using an is concentration of 300 nmol / ml and an injection volume of 10 l .
the curve was then used to calculate the molar content of gos in each area of the chromatogram ; this was then converted to mass concentrations by multiplying by the molar mass of the peaks ( as determined in the lc - ms experiment ) . in the few cases where there were peaks containing oligosaccharides of 2 different masses , the lower mass was assigned to the whole peak .
the results obtained on gos ingredients using the profiling method were compared against those obtained using the aoac method 2001.02 ( table 1 ) . in most cases , the new method produces results within the range 90110% of the current aoac method , but statistical analysis ( t - test ) indicates that , in most cases , the results of the two methods are different ( with the exceptions of gos-2 and gos-6 for which the t - test indicates that the 2 methods give equivalent results ) . however , there are three samples for which the new method gives results outside the 90110% window .
the gos content of the gos-1a and b products seems to be overestimated ( 117120% ) using the new hplc - fld method , and the gos content of the gos-5 product seems to be underestimated ( 84% ) using the hplc - fld method .
since the aoac 2001.02 method is not applicable to infant formula ( lactose levels are too high ) , two approaches were developed for gos analysis in such matrices .
initially , an hpaec - pad profiling method was developed . this method is simple , since it is a case of comparing the peak areas of 2 marker peaks in the gos ingredient profile with the area of the same marker peaks in the formula .
recoveries were assessed using spiked infant formula and were in the region 9499% ( table 2 ) . spiked formulae were also analysed using the hplc - fld method ( table 2 ) ; in this case , recoveries were in the range 92102% .
the precision of the hplc - fld method applied to gos ingredients was determined by analysing each ingredient in duplicate on six different days on the same instrument by the same operator .
the data from these experiments were used to determine the relative standard deviation under repeatability conditions ( rsd ( r ) ) and the relative standard deviation under intermediate reproducibility conditions ( rsd ( ir ) ) ; results are shown in table 3 .
the same data were also used to determine the total dietary fibre ( tdf ) content of the gos ingredients by excluding the gos disaccharides , and the precision of those measurements was also determined ( table 4 ) . for gos analysis , the robust rsd ( r ) is in the range 0.42.0% and the robust rsd(ir ) is in the range 0.73.0% .
for tdf analysis , the robust rsd ( r ) is in the range 0.32.3% and the robust rsd ( ir ) is in the range 1.13.0% .
the precision of the hplc - fld method applied to the analysis of gos containing infant formulae was determined by analysing two commercially available formulae on eight different days in duplicate , on two different instruments using two different columns , and by two different operators ( table 5 ) .
the robust rsd(r ) is in the range 0.40.8% and the robust rsd(ir ) is in the range 1.12.0% .
the hpaec - pad profiling method was performed on one formula on nine different days on a single instrument on the same column by one operator ( table 5 ) .
measurement uncertainty ( mu ) was calculated according to the methods proposed by barwick and ellison combining precision and recovery data ( table 6 ) .
the relative expanded mu for the analysis of gos in infant formula was between 4 and 11% and for gos in gos ingredients was between 4.6 and 20% .
the higher mus were obtained for the products with poorer recoveries ( table 6 ) , that is , gos-1a , gos-1b , and gos-5 .
for the other gos products , the relative expanded mu ranged from 4.6 to 13% .
each of the gos products had a different oligosaccharide profile ; the exceptions are the products from the same supplier but available in different formats ( e.g. , syrup or powder ) , that is , gos-1a and gos 1b and gos-3a and gos-3b .
the different oligosaccharide profiles may ( or may not ) have some impact on the biological effects of the different types of gos , but that remains to be determined . however , there is a significant impact for the tdf content of the different gos .
the disaccharide component of the gos can represent between 15 and 50% of the total gos depending on the product , meaning that the tdf fraction of the gos varies between 50 and 85% .
this is important information and has consequences for the labeling of gos - containing products . using the current aoac 2001.02 method for gos analysis , 100% of the gos would erroneously be considered as dietary fibre .
however , using the hplc - fld method described here , it is possible to differentiate the gos fraction having a dp 3 from the gos disaccharides and thus the contribution of the gos to tdf can be accurately assessed .
in addition , the method enables the quantitation of the different groups of gos according to the degree of polymerization which may be useful for quality control purposes or when trying to understand biological functions . in table 7 , the total gos content has been normalized to 100% in order to compare the relative proportions of the oligosaccharides of different chain length and in addition contains the same data from some previous studies [ 10 , 11 , 30 ] .
there is quite a lot of variation between the gos from different suppliers , although the distributions of chain lengths from the same supplier are comparable .
the application of aoac 2001.02 for the analysis of gos in lactose - containing products is not a problem if the gos content is high and/or if the lactose content is low .
figure 3 shows the estimated error of the gos analysis depending on the concentration of lactose and gos assuming a 5% error in the determination of lactose . the graph demonstrates how rapidly the error in the gos analysis increases
infant formulae have a high lactose content , and their gos contents are typically below 10 g/100 g ; it is clear from figure 3 that such products can not be accurately analysed using the aoac 2001.02 method .
however , it has the disadvantage that the analysing laboratory would need access to both the product for analysis as well as the appropriate gos ingredient to perform the analysis .
furthermore , it requires the lab to perform four chromatographic runs for a single product : ( 1 ) the determination of free galactose and lactose in the ingredient , ( 2 ) the determination of total galactose in the ingredient after hydrolysis , ( 3 ) the profile of the gos ingredient to determine the marker peak intensity versus concentration , and ( 4 ) the profile of the product to find the marker peaks to determine gos concentration in the finished product .
the hplc - fld method has the advantage that only a single run is required and the analysing laboratory does not need access to the gos ingredient .
the disadvantages of the hplc - fld method are that the gos must be derivatised before analysis and if the product contains other reducing oligosaccharides , these may interfere .
fortunately , such oligosaccharides are either nonreducing or they have a fructose at the reducing end .
the conditions used for labelling the oligosaccharides are such that ketoses ( such as fructose ) are not labelled , and thus fructans do not interfere with the analysis .
other oligosaccharides such as maltodextrins can be enzymatically hydrolysed to their monosaccharides to avoid that they interfere .
the performance of the hplc - fld method is quite good for most products ( both formula and gos ingredients ) with a few exceptions .
the major contributor to the measurement uncertainty tends to be the recovery because the recovery is significantly different from 100% .
in fact , it is surprising that the method does not underestimate the gos content in more cases . knowing that the labelling reaction does not work on nonreducing oligosaccharides or on oligosaccharides containing a ketose at the reducing end , underestimation would be expected since detailed gos analyses [ 10 , 11 ] have revealed the presence of both nonreducing gos and gos that terminate in a fructose .
the disaccharide region of the chromatogram around lactose is also quite busy , and , in some cases , there may be gos disaccharides coeluting with the lactose that have not been determined
. apparent overestimation of the gos content , as seems to be the case for gos-1a , gos-1b , gos-3a , and gos-3b , is more difficult to understand .
a possible explanation may be that the reference value ( obtained by aoac 2001.02 ) has actually underestimated the gos content .
the aoac method requires that all gos disaccharides are well resolved from lactose when performing the free sugars part of the analysis .
some products may contain gos disaccharides that coelute with the lactose in the reference method , leading to an overestimation of lactose and consequently an underestimation of gos .
such a situation may not have been encountered during the development of aoac 2001.02 depending on the type of gos product used for the development .
this work was done to address the two major issues with the current aoac 2001.02 method for gos determination , that is , the difficulty in applying it to products containing large amounts of lactose and the incompatibility of the method with the current definition of dietary fibre . the hplc - fld method described here overcomes both of these issues and the expanded measurement uncertainty of the method is below 15% in most cases .
nevertheless , there appear to be a few gos products for which the new method is not optimized . | beta - galactooligosaccharides ( gos ) are oligosaccharides normally produced industrially by transgalactosylation of lactose .
they are also present naturally in the milk of many animals including humans and cows .
gos are thought to be good for health , being potential prebiotic fibres , and are increasingly added to food products . in order to control the gos content of products , the aoac official method 2001.02 was developed .
however , the method has some shortcomings and in particular is unsuited to the analysis of products containing high levels of lactose such as infant formula . to overcome this problem
, we developed a new method for application to infant formula and tested it on various gos ingredients as well as infant formulae . when applied to gos ingredients
the results of the new method compare well with those of the official aoac method , typically giving results in the range 90110% of those of the official method and having an expanded measurement uncertainty of less than 15% . for three products ,
the results were outside this range ( recoveries of 80120% and expended measurement uncertainties up to 20% ) . when applied to the analysis of infant formula ,
recoveries were in the range of 92102% and the expanded measurement uncertainties were between 4.2 and 11% . |
since 1 july 1977 , all incident cases of type 1 diabetes in those aged 014 years are recorded in the swedish childhood diabetes registry ( scdr ) . only those who are insulin treated from diagnosis ( 99% of cases ) are registered .
comparisons with external sources have shown that the level of ascertainment in the scdr is 9699% ( 21,22 ) . the diabetes incidence study in sweden ( diss ) records incident cases of diabetes in the age - group 1534 years since 1 january 1983 .
the completeness of the diss register has varied between 82 and 91% , depending on the source of ascertainment ( 23 ) , with no significant sex difference .
the classification into type 1 , type 2 , and unclassified diabetes is based on the treating doctors ' clinical classification . during 19831991
, the world health organization classification was used , and since 1992 the american diabetes association classification criteria were used . this change in diagnostic criteria
would probably little affect the results , since only clinically overt cases of type 1 diabetes were included . of all patients , < 10% who were classified by clinical criteria as having type 1 diabetes at diagnosis are misclassified when the diagnosis was checked using autoantibodies and c - peptide ( 24 ) .
esrd is defined as need to start active uremia treatment due to renal failure ( glomerular filtration rate < 1015 ml / min ) . the swedish renal registry ( srr )
collects data on all patients with chronic renal failure who start dialysis treatment or receive a kidney transplant .
a validation study showed that > 95% of the patients who started treatment for chronic renal failure had been reported to the srr ( 25 ) .
the srr started in 1991 , and at that time none of the patients in the scdr had diabetes duration longer than 13 years .
when type of diabetes differed between the two diabetes registries and the srr , the classification reported to the srr was used since this was made after a long clinical follow - up .
five patients were classified as having esrd due to type 2 diabetes in the srr and were therefore excluded from the analyses .
patients with esrd due to other diagnoses than diabetes ( n = 11 ) were also excluded .
the present study covers the majority of all cases of esrd due to type 1 diabetes at 13 years duration or longer , during 19912007 , and should hereby represent the swedish type 1 diabetic population at large .
patients with 13 years duration ( i.e. , diabetes onset 1 july 1977 to 31 december 1995 for the scdr and 1 january 1983 to 31 december 1995 for the diss ) would have equal chance of entering the srr , starting in 1991 .
thus , 6,789 patients with onset before age 15 years and 4,892 patients with onset of diabetes between age 15 and 34 years were included .
dates of death were obtained by linking the diabetes registers to the swedish cause of death register .
this study was approved by the regional research ethics committee in ume , according to the swedish law on research ethics and in line with the principles of the helsinki declaration and the european convention on human rights and biomedicine .
the funding bodies had no role in the design and conduct of the study ; in collection , management , analysis , or interpretation of the data ; or in preparation and approval of the manuscript .
the age at onset was divided into three groups , aged 09 , 1019 , and 2034 years ; hence , the 1019 age at onset group includes the pubertal years for the vast majority of the cohort .
incidence rates of esrd were calculated as number of cases divided by number of years at risk in 6-year intervals ( 1318 , 1924 , and 2530 years of diabetes ) .
cox regression analyses were performed to estimate the hazard ratio ( hr ) of developing esrd , to compare the hr by age - at - onset groups and sex , and to adjust for the potential confounding variables age at follow - up and sex . in these analyses , the time at risk was calculated from onset of diabetes until esrd ( i.e. , date of first treatment with renal replacement therapy ) , death , or 31 december 2007 .
kaplan - meier analyses may overestimate the cumulative incidence when the event of death is censored in the same way as when censoring for other reasons .
therefore , we also computed the cumulative incidence when taking into account death as a competing risk event .
this method accounts for death as an event that removes the risk of esrd and hence provides a more accurate estimate of the risk ( 26 ) .
spss 16.0 for windows was used for the kaplan - meier and cox regression analyses , while the r statistical software version 2.5.1 ( the r foundation for statistical computing available at http://www.r-project.org/index.html ) , with the function cuminc from the cmprsk package , was used for calculations with death as a competing risk event .
the age at onset was divided into three groups , aged 09 , 1019 , and 2034 years ; hence , the 1019 age at onset group includes the pubertal years for the vast majority of the cohort .
incidence rates of esrd were calculated as number of cases divided by number of years at risk in 6-year intervals ( 1318 , 1924 , and 2530 years of diabetes ) .
cox regression analyses were performed to estimate the hazard ratio ( hr ) of developing esrd , to compare the hr by age - at - onset groups and sex , and to adjust for the potential confounding variables age at follow - up and sex . in these analyses ,
the time at risk was calculated from onset of diabetes until esrd ( i.e. , date of first treatment with renal replacement therapy ) , death , or 31 december 2007 .
kaplan - meier analyses may overestimate the cumulative incidence when the event of death is censored in the same way as when censoring for other reasons .
therefore , we also computed the cumulative incidence when taking into account death as a competing risk event .
this method accounts for death as an event that removes the risk of esrd and hence provides a more accurate estimate of the risk ( 26 ) .
spss 16.0 for windows was used for the kaplan - meier and cox regression analyses , while the r statistical software version 2.5.1 ( the r foundation for statistical computing available at http://www.r-project.org/index.html ) , with the function cuminc from the cmprsk package , was used for calculations with death as a competing risk event .
the study included patients with at least 13 years duration of type 1 diabetes . in total ,
127 patients had developed esrd due to type 1 diabetes , 79 in the scdr and 48 in the diss ( table 1 ) .
maximum follow - up was 30.0 years for the scdr and 24.9 years for the diss .
the median follow - up time was 21.2 years for patients in the scdr and 18.9 for patients in the diss .
the median time from onset of diabetes to esrd was 21.7 ( range 14.728.2 ) and 18.5 ( 13.724.8 ) , respectively .
the overall incidence rate of esrd during 237,592 person - years of follow - up was 0.53 per 1,000 person - years .
number of patients with and without esrd median ( range ) time from diabetes onset to esrd and number of deaths with and without esrd , by age at diagnosis and sex , in patients with type 1 diabetes with at least 13 years duration .
table 2 shows incidence rates of esrd per 1,000 person - years of diabetes duration , at 1318 , 1924 , and 2530 years after diabetes onset .
was seen between 1318 and 1924 years , while the increase between 1924 and 2530 years was modest , partly due to the fact that the 20- to 34-year - onset group could not contribute as they had a maximum duration of 25 years .
incidence rates per 1,000 person - years at 6-year intervals of diabetes duration ( 1318 , 1924 , and 2530 years after diagnosis ) data are incidence rate ( 95% ci ) .
tables 3 and 4 show the cumulative incidences in the different age - at - onset groups , by sex , with and without accounting for death as competing risk event , respectively .
only 224 of 11,681 patients ( 1.9% ) had died , 33 of them after having developed esrd ( table 1 ) .
the overall mortality in the study was 0.94 deaths per 1,000 person - years of diabetes duration .
there was a 14 times higher risk of death among patients with esrd ( hr 14 [ 95% ci 9.721 ] ) , adjusted for sex and age at follow - up .
male patients had almost twice the risk of death due to any cause , compared with female patients ( 1.9 [ 1.42.6 ] ) , adjusted for esrd and age at follow - up .
cumulative incidences of esrd with death as competing risk , by age at onset and sex , at different diabetes durations data are incidence rate ( 95% ci ) . the cumulative incidence with death as a competing risk takes into account that death is an event competing with the risk to develop esrd .
cumulative incidences of esrd , by age at onset and sex , at different diabetes durations data are incidence rate ( 95% ci ) .
the cumulative incidence is estimated using the kaplan - meier method and given as percent . among patients who developed type 1 diabetes before the age of 20 years
, there was no difference between male and female subjects as can be seen in the cumulative incidence curves ( fig .
male subjects who were aged 2034 years when diagnosed with type 1 diabetes had twice as high risk of esrd as female subjects ( hr 2.3 [ 95% ci 0.995.3 ] ) .
taking death into account as competing risk reduced the male / female risk increase marginally ( 2.2 [ 0.975.2 ] ) .
cumulative incidences of developing esrd in male and female patients with type 1 diabetes onset at 09 , 1019 , and 2034 years . for patients with diabetes onset before 10 or 1019 years of age
, there is no significant difference between male and female subjects ( p = 0.53 and p = 0.50 ) , but with onset at 2034 years of age there is a difference , although borderline significant , between male and female subjects in risk of developing esrd ( p = 0.05 ) .
the cumulative incidences of esrd for male and female subjects in the different age - at - onset groups ( 09 , 1019 , and 2034 years ) are shown in fig .
2 . the lowest risk for esrd was found in male and female subjects with onset of type 1 diabetes before 10 years of age ( fig .
the risk of developing esrd was significantly increased in those developing diabetes at 2034 years of age ( hr 3.0 [ 95% ci 1.55.7 ] ) as well as 1019 years of age ( 2.6 [ 1.54.7 ] ) , compared with the youngest age - at - onset group ( 09 years ) .
cumulative incidences of developing esrd in male and female patients according to age at onset of type 1 diabetes .
when using age at onset 09 years as reference , the risk of esrd is significantly increased with age at onset 1019 years and 2034 years for male subjects . for female subjects , the risk is significantly increased with age at onset 1019 years but not 2034 years . in female subjects
, there was no difference in the risk of developing esrd with diagnosis of type 1 diabetes at age 2034 years compared with diagnosis at younger than 10 years of age , ( hr 1.4 [ 95% ci 0.53.6 ] ) .
the highest risk was observed for the 1019 years age - group ( 2.8 [ 1.45.5 ] ) ( fig .
2 ) . taking death into account as a competing risk did not change the results . using
a grouping of age at onset 09 , 1014 , 1524 , and 2534 years did not change the overall pattern of difference seen by sex .
the study included patients with at least 13 years duration of type 1 diabetes . in total ,
127 patients had developed esrd due to type 1 diabetes , 79 in the scdr and 48 in the diss ( table 1 ) .
maximum follow - up was 30.0 years for the scdr and 24.9 years for the diss .
the median follow - up time was 21.2 years for patients in the scdr and 18.9 for patients in the diss .
the median time from onset of diabetes to esrd was 21.7 ( range 14.728.2 ) and 18.5 ( 13.724.8 ) , respectively .
the overall incidence rate of esrd during 237,592 person - years of follow - up was 0.53 per 1,000 person - years .
number of patients with and without esrd median ( range ) time from diabetes onset to esrd and number of deaths with and without esrd , by age at diagnosis and sex , in patients with type 1 diabetes with at least 13 years duration .
table 2 shows incidence rates of esrd per 1,000 person - years of diabetes duration , at 1318 , 1924 , and 2530 years after diabetes onset .
was seen between 1318 and 1924 years , while the increase between 1924 and 2530 years was modest , partly due to the fact that the 20- to 34-year - onset group could not contribute as they had a maximum duration of 25 years .
incidence rates per 1,000 person - years at 6-year intervals of diabetes duration ( 1318 , 1924 , and 2530 years after diagnosis ) data are incidence rate ( 95% ci ) .
tables 3 and 4 show the cumulative incidences in the different age - at - onset groups , by sex , with and without accounting for death as competing risk event , respectively .
only 224 of 11,681 patients ( 1.9% ) had died , 33 of them after having developed esrd ( table 1 ) .
the overall mortality in the study was 0.94 deaths per 1,000 person - years of diabetes duration .
there was a 14 times higher risk of death among patients with esrd ( hr 14 [ 95% ci 9.721 ] ) , adjusted for sex and age at follow - up .
male patients had almost twice the risk of death due to any cause , compared with female patients ( 1.9 [ 1.42.6 ] ) , adjusted for esrd and age at follow - up .
cumulative incidences of esrd with death as competing risk , by age at onset and sex , at different diabetes durations data are incidence rate ( 95% ci ) . the cumulative incidence with death as a competing risk takes into account that death is an event competing with the risk to develop esrd .
cumulative incidences of esrd , by age at onset and sex , at different diabetes durations data are incidence rate ( 95% ci ) .
the cumulative incidence is estimated using the kaplan - meier method and given as percent . among patients who developed type 1 diabetes before the age of 20 years
, there was no difference between male and female subjects as can be seen in the cumulative incidence curves ( fig .
male subjects who were aged 2034 years when diagnosed with type 1 diabetes had twice as high risk of esrd as female subjects ( hr 2.3 [ 95% ci 0.995.3 ] ) .
taking death into account as competing risk reduced the male / female risk increase marginally ( 2.2 [ 0.975.2 ] ) .
cumulative incidences of developing esrd in male and female patients with type 1 diabetes onset at 09 , 1019 , and 2034 years . for patients with diabetes onset before 10 or 1019 years of age
, there is no significant difference between male and female subjects ( p = 0.53 and p = 0.50 ) , but with onset at 2034 years of age there is a difference , although borderline significant , between male and female subjects in risk of developing esrd ( p = 0.05 ) .
the cumulative incidences of esrd for male and female subjects in the different age - at - onset groups ( 09 , 1019 , and 2034 years ) are shown in fig .
2 . the lowest risk for esrd was found in male and female subjects with onset of type 1 diabetes before 10 years of age ( fig .
the risk of developing esrd was significantly increased in those developing diabetes at 2034 years of age ( hr 3.0 [ 95% ci 1.55.7 ] ) as well as 1019 years of age ( 2.6 [ 1.54.7 ] ) , compared with the youngest age - at - onset group ( 09 years ) .
cumulative incidences of developing esrd in male and female patients according to age at onset of type 1 diabetes .
when using age at onset 09 years as reference , the risk of esrd is significantly increased with age at onset 1019 years and 2034 years for male subjects .
for female subjects , the risk is significantly increased with age at onset 1019 years but not 2034 years . in female subjects
, there was no difference in the risk of developing esrd with diagnosis of type 1 diabetes at age 2034 years compared with diagnosis at younger than 10 years of age , ( hr 1.4 [ 95% ci 0.53.6 ] ) . the highest risk was observed for the 1019 years age - group ( 2.8 [ 1.45.5 ] ) ( fig .
2 ) . taking death into account as a competing risk did not change the results . using a grouping of age at onset 09 , 1014 , 1524 , and 2534 years
in this nationwide population - based study of patients with type 1 diabetes and at least 13 years duration , the cumulative incidence of esrd due to diabetic nephropathy is surprisingly low ( 3.3% at 30 years of duration ) .
the swedish pediatric association working group for diabetes in children in the nationwide diabetes in childhood care program already in 1982 ( updated regularly ) recommended intensive insulin treatment and home blood glucose monitoring . in adults , national guidelines for treatment of diabetes
were issued by the swedish board of health and welfare in 1977 and since then regularly updated .
these guidelines also involve intensive treatment of glucose and blood pressure , including ace inhibition , for type 1 diabetic patients .
these active treatment programs may clearly contribute to the low rate of esrd in sweden , and our findings are in accord with that of a decrease in incidence of albuminuria as reported from a dedicated center in sweden ( 4 ) .
since the study is based on incidence registers , we have no access to individual a1c data , but according to the swedish national diabetes register ( ndr ) since 1996 estimate markers of quality of care , the yearly mean a1c values , have decreased from 8.5% ( diabetes control and complications trial standard ) to 8.1% during the time period 19962005 .
previous studies , from different populations with different years of onset of diabetes , have reported a cumulative incidence of esrd of 713% at 20 years of diabetes duration ( 2729 ) .
the cumulative incidence seen in this study is also lower than reported in a recent finnish nationwide population - based study , in which 2.2% at 20 years of follow - up and 7.8% at 30 years of follow - up were found ( 6 ) .
the finnish study also showed a time - period effect , with a decline in cumulative incidence over time ( 19651999 ) . in our cohort , however , there was no difference in risk of esrd depending on year of diabetes onset , which may be explained by the later starting date of our study ( 1977 ) and more active treatment programs for both metabolic control and signs of incipient nephropathy .
a decline in cumulative incidence of esrd has been indicated by an unchanged reporting rate for type 1 diabetes in both the european dialysis and transplant association registry , including the srr , through the 19902000s , despite an increase in prevalence of type 1 diabetes and longer survival in patients with type 1 diabetes ( 30 ) .
the peak incidence of diabetic nephropathy has been found to occur 1525 years after the onset of type 1 diabetes ( 27,31 ) , and the median duration from onset of diabetic nephropathy to esrd is usually 10 years ( 27 ) .
the development of esrd due to diabetic nephropathy within 15 years of diabetes duration is rare ; in this study , only three patients had developed esrd before this duration .
the relatively constant incidence rates at 1924 and 2530 years of diabetes duration may indicate that the peak incidence of esrd had been reached at 30 years of diabetes duration or that the peak incidence has been delayed beyond 30 years of diabetes duration .
both alternatives suggest a favorable change in the natural history of diabetic nephropathy also in susceptible patients .
these findings of a favorable time trend in diabetes nephropathy is in correspondence with the results of pittsburg epidemiology of diabetes complications study ( 32 ) .
our study confirms previous findings of a reduced risk , or a delay , in development of esrd in patients diagnosed with type 1 diabetes before the age 5 ( n = 2 ) and 10 years ( 6,14,15,33 ) .
a similar age dependency of risk has been found for severe retinopathy and blindness due to diabetes ( 33 ) .
the reasons for this age - at - onset effect could be , for example , genetic , endocrine , or health care related .
it could be argued that children and families who become used to insulin treatment at an early age might adhere better to treatment and diet than those that are diagnosed with diabetes at an older age and especially during puberty .
previous studies ( 17,34 ) have indicated that prepubertal years with diabetes involve a reduced risk or a longer time to development of diabetic nephropathy and retinopathy .
it also has long been speculated that puberty , characterized by rapid growth , hormonal changes ( especially in growth hormone and sex hormones ) , and worsening in glycemic control , may accelerate the processes leading to chronic diabetes complications ( 35,36 ) .
we speculated that if puberty was a strong determinant for development of diabetic nephropathy , then diabetes onset after puberty would give a similar risk as prepubertal onset . in our study , this was found in female subjects only . in male subjects ,
the esrd risk was increased also after puberty compared with onset of diabetes at 09 years of age .
the group with age at onset at 1019 years includes both prepubertal and postpubertal cases , which could dilute the actual effect of puberty ; however , this group includes almost all with diabetes onset during the pubertal years .
male sex has been reported to be a risk factor for development of diabetic nephropathy , even though this relationship is not as strong as in nondiabetic renal diseases ( 12,14 ) . in this study , male subjects had an increased overall cumulative incidence of esrd compared with female subjects but only in patients with age at onset of diabetes at 20 years
. the higher male - to - female ratio of esrd found in our study is further supported by data generated from the ndr ( personal communication ) showing that the mean prevalence of both micro- and macroalbuminuria was higher in men than in women in 2009 ( 15.6 vs. 11.6% and 8.4 vs. 7.2% , respectively ) .
the factors involved in this sex - specific difference could possibly include lifestyle , diet , kidney and glomerular size , differences in glomerular hemodynamics , and direct effects of sex hormones ( 37,38 ) .
when accounting for death as a competing risk event , male subjects still had twice the risk of developing esrd , however not statistically significant , which can be explained by the higher death rates in male subjects .
experimental evidence from animal studies suggests that both estrogens and testosterone play a role in the development of renal disease ( 39 ) ; estrogens slow progression rate ( 40,41 ) , while testosterone exacerbates it , and the absence of testosterone attenuates the development of renal disease ( 42 ) .
the pattern of cumulative incidence by age and sex in the present study indicates that different combinations of factors play a role in postpubertal development of esrd , and further studies are needed to confirm and understand these effects . in conclusion ,
the cumulative incidence of esrd in young patients with type 1 diabetes , with onset after 1977 , is very low in sweden .
prepubertal age at onset of diabetes seems to protect against , or prolong , the time to esrd development , and the same may be true for postpubertal onset in female subjects ( aged 20 years at onset of diabetes ) .
the finding of a sex difference specifically in patients with diabetes onset after 20 years of age is of clear interest and needs further exploration .
| objectivethis study aimed to estimate the current cumulative risk of end - stage renal disease ( esrd ) due to diabetic nephropathy in a large , nationwide , population - based prospective type 1 diabetes cohort and specifically study the effects of sex and age at onset.research design and methodsin sweden , all incident cases of type 1 diabetes aged 014 years and 1534 years are recorded in validated research registers since 1977 and 1983 , respectively .
these registers were linked to the swedish renal registry , which , since 1991 , collects data on patients who receive active uremia treatment .
patients with 13 years duration of type 1 diabetes were included ( n = 11,681).resultsduring a median time of follow - up of 20 years , 127 patients had developed esrd due to diabetic nephropathy .
the cumulative incidence at 30 years of type 1 diabetes duration was low , with a male predominance ( 4.1% [ 95% ci 3.15.3 ] vs. 2.5% [ 1.73.5 ] ) . in both male and female subjects ,
onset of type 1 diabetes before 10 years of age was associated with the lowest risk of developing esrd .
the highest risk of esrd was found in male subjects diagnosed at age 2034 years ( hazard ratio 3.0 [ 95% ci 1.55.7 ] ) . in female subjects with onset at age
2034 years , the risk was similar to patients ' diagnosed before age 10 years.conclusionsthe cumulative incidence of esrd is exceptionally low in young type 1 diabetic patients in sweden .
there is a striking difference in risk for male compared with female patients .
the different patterns of risk by age at onset and sex suggest a role for puberty and sex hormones . |
approximately 24 million people worldwide suffer the effects of some form of dementia , with numbers expected to increase substantially over the next several decades .
neurodegenerative diseases are highly dynamic , multifactorial pathological conditions the causes of which remain poorly understood .
the chronic nature of their development and progression suggests an insidious etiology that may involve multiple synergistic interactions among biochemically unrelated molecular species , and perhaps dysfunctional or overcompensatory metabolic , and immunologic pathways .
numerous studies have contributed to our improved , yet far from complete understanding of the etiological causes of alzheimer 's disease ( ad ) , multiple sclerosis , pick 's disease , creutzfeldt - jakob disease ( cjd ) , and parkinson 's disease ( pd ) .
many of these studies suggest several mechanistic similarities among these clinically disparate diseases , including abnormalities in protein folding and aggregation , elevated release of intracellular reactive oxygen species ( ros ) leading to development of oxidative stress and inflammation , and increased glycation of key cellular proteins . in this paper
we will address key elements of our current level of understanding as they relate to the effects of oxidative stress and inflammation on neuronal degeneration .
we will then focus on the abnormal glycation of proteins and small peptides relevant to specific neurodegenerative diseases and how the formation of aldehydic molecular species , such as the -dicarbonyls methylglyoxal ( mgo ) and glyoxal ( go ) , contribute to the chronic development of this process .
mgo is the most reactive dicarbonyl and in vivo during aerobic glycolysis is formed by the spontaneous decomposition of triose phosphate intermediates , although mgo can also form from the oxidative degradation of pentoses , ascorbate , and lipids .
finally , we will discuss the mechanisms by which certain proteins and peptides prove susceptible to nonenzymatic glycation ( maillard reaction ) through interaction of these dicarbonyls with specific amino acid residues of their primary structure .
this paper is intended to be a succinct overview of current concepts regarding the role of protein glycation in the development of oxidative stress and inflammatory response within the cns . perhaps concurrently
, posttranslational modification of proteins can also occur via oxidative and lipoperoxidative reaction with susceptible amino acids .
these reactions , together with glycoxidation likely contribute by varying degree to neurodegeneration associated with ad and cjd [ 4 , 5 ] .
neurodegenerative disorders of the central nervous system are slowly developing , insidious conditions that contribute to initial neuronal cell degeneration and ultimately cell death .
noteworthy is the occurrence of specific pathological markers that denote the major neurodegenerative diseases , including ad , pd , and cjd . while the cytological location and expression of these posttranslational pathological markers may vary
each of these disorders involves ( 1 ) abnormal protein folding and aggregation and ( 2 ) elevated levels of nonenzymatic protein glycation .
dicarbonyl molecular species ( mgo and go ) are unavoidable byproducts of sugar metabolism and are known contributors to the misfolding , aggregation , and insolubility of susceptible proteins through their ability to adduct and form crosslinks via stable advanced glycation end products ( ages ) [ 6 , 7 ] .
using prp27 - 30 an infective variant of prion protein ( prp ) isolated from infected syrian hamster brain , panza et al .
showed in vitro that age formation by go and mgo is more highly adducted in noninfectious prp than in infectious prp27 - 30 .
interestingly , they found age - modification of prion resulted in reduced fibril formation , an event that may actually contribute to reduced prion infectivity in vivo . in other neurodegenerative diseases , such as ad
the effect of age - related adduct formation may contribute to modification of both intracellular ( lipofuscin , neurofibrillary tangles ; nfts ) and extracellular proteins ( -amyloid ) [ 1012 ] .
in addition to their effects on protein folding and aggregation ages are likely contributors to the generation of ros and nitrogen oxygen species , including the radicals superoxide and peroxynitrite in ad and other neurodegenerative diseases .
superoxide ( o2 ) not only can react with nitric oxide ( no ) to form the reactive nonradical peroxynitrite ( onoo ) , but also in the presence of transition metals ( e.g. , fe ) , and fenton chemistry produces the nonradical hydrogen peroxide ( h2o2 ) that decomposes to the hydroxyl anion ( oh ) and highly reactive hydroxyl radical ( oh ) [ 14 , 15 ] .
a well - established hallmark of alzheimer 's neuropathology is the excessive presence of extracellular senile plaques , comprised predominantly of -amyloid and nft .
previous study has shown that the glycation process results in the extracellular formation of adducts and ages on -amyloid , that mgo is a major glycating agent in this process , and that an accelerated polymerization of the peptide occurs as a result of age crosslinkage .
these findings have led to the proposal that ages may act to promote increased -amyloid and plaque deposition within the ad brain .
ages also adduct to proteins intracellularly , including nft with the level of glycation increasing with age and severity of ad . in a recent review by mnch and colleagues ,
a sequence of events has been outlined detailing the involvement of increased production of mgo through accumulation of triose phosphates .
triosephosphate isomerase ( tpi ) is an enzyme that interconverts dihydroxyacetone phosphate ( dhap ) and d - glyceraldehyde phosphate , thus limiting the metabolic production of mgo under physiological conditions [ 23 , 24 ] .
it is the only glycolytic enzyme that exhibits a functional deficiency correlated with neurodegenerative disease .
the deficiency in tpi function results in the accumulation of dhap that spontaneously degrades to mgo .
dysfunctional tpi in ad appears to result from a -amyloid - dependent nitrosylation of tyrosine in tpi as demonstrated in both ad brain and in mouse brain overexpressing -amyloid and presenilin 1 .
together with increased levels of unchelated transition metals ( copper and iron ) associated with amyloid plaques , glycated proteins become increasingly oxidized , resulting in the elevated presence of cytotoxic proteins [ 2 , 28 ] .
the generation of ros and their cytotoxic effects are common to the pathophysiology of many neurodegenerative disorders .
noteworthy is the mechanism by which these free radicals and free - radical - producing substrates , such as h2o2 , are generated .
evidence for the presence of oxidative stress within the ad brain is substantial [ 2932 ] and is multifactorial , originating from peroxidation of lipids by aldehydes such as hydroxynonenal , protein and dna oxidation by carbonylation , and glycation - related reactions suggesting an imbalance between the abnormal production of free - radical species and the compromised cellular mechanisms responsible for their neutralization .
the question arises however , as to whether the onset of oxidative stress is an early feature of neurodegenerative diseases or an epiphenomenon .
the answer to this question remains equivocal , although there is considerable evidence to support the involvement of ros and oxidative stress in the early development and progression of neurodegeneration . in pd , ros are produced at a higher rate than that observed in age - matched healthy controls .
moreover , appearance of ros occurs in association with the presence of ages in lewy bodies prior to appearance of the parkinson 's phenotype .
the well - characterized nonenzymatic reaction of reducing sugars glucose , fructose and glyceraldehyde with susceptible amino acid residues of proteins can lead to the irreversible formation of the schiff base , and the more stable amadori product .
the reaction may proceed further by condensation , dehydration , and additional rearrangements to form advanced glycation endproducts or ages .
in addition to the potential contribution of -amyloid to protein oxidation and oxidative stress experimental evidence supports the underlying involvement of accelerated age formation as a significant contributor to oxidative stress and neurodegeneration of the alzheimer 's type , not only by the direct production of ros but also through their binding to the multiligand receptor rage , a cell - surface molecule and member of the immunoglobulin superfamily [ 41 , 42 ] . in both in vitro and in vivo studies
ko and colleagues show that ages up - regulated the expression of app , a response that could be prevented by the pretreatment of neuroblastoma cells ( cell line sh - sy5y ) with the ros inhibitor n - acetyl - l - cysteine .
furthermore , the accumulation of -amyloid142 was also increased following the treatment of these cells with age .
the reciprocal interaction between oxidative stress , through protein oxidation and lipid peroxidation , and the activation of proinflammatory pathways as part of the innate immune response within the brain has been extensively studied and shown to be a biologically significant component of neuropathogenesis in ad [ 43 , 44 ] .
this was demonstrated histochemically in ad brain , where activated microglial cells and astrocytes , both resident immune cells of the brain , express proinflammatory cytokines , including interleukin ( il)-1 , il-6 , and tumor necrosis factor- , along with ros .
this expression of proinflammatory cytokines may result from the binding of -amyloid142 fibrils to complement factor c1q and serum amyloid p component , as shown by eikelenboom et al . in cultures of human microglial cells .
the age - rage pathway is a significant contributor to this process in part through the ability of rage to bind with various proinflammatory ligands , including ages and -amyloid and through the generation of ros as second messengers .
this was demonstrated by gasic - milenkovic et al . who showed the inflammatory response from murine microglial cells
neuroinflammation and impairment of neurogenesis in ad may be promoted not only by -amyloid , but also by the intracellular domain of expressed amyloid precursor protein ( aicd ) , as shown by ghosal et al . in transgenic mice coexpressing the 59-residue long aicd fragment and in app - knockout mice .
mgo is the most reactive -dicarbonyl and is increased in normal aging and especially in neurodegenerative disease .
exposure of neuroblastoma cells to mgo for up to 24 hrs induces depolarization of the plasma membrane , release of glutamate , and formation of ros .
experimental evidence also confirms the capability of mgo to impair cellular glucose metabolism and energy depletion , as shown in cultured neuroblastoma cells .
elevated mgo in type 2 diabetes and in at least some neurodegenerative diseases , including ad strongly supports the proposal that dicarbonyl stress , particularly that due to mgo contributes significantly to alterations in protein function in these conditions and to their neuropathology . support for this proposal comes from experiments on cultured rat hippocampal neuronal cells exposed to mgo .
mgo induced oxidative - stress related neuronal cell death and concurrently induced expression of nerve growth factor and release of proinflammatory cytokine il-1. studies also demonstrate the ability of mgo to inhibit protein function .
argpyrimidine , formed by the reaction of mgo with arginine residues , is a specific marker for protein glycation and is present in human renal tissue and lens proteins from diabetic patients , as well as in at least some neurodegenerative conditions [ 5557 ] .
these results lend additional support for a central role of dicarbonyl molecular species in vivo , especially mgo , in the early development and progression of oxidative stress and inflammation in diabetes and neurodegenerative disease .
considerable evidence is presented in the literature supporting the association of the 2 major components of type 2 diabetes mellitus , insulin resistance and hyperglycemia with dementia of the alzheimer 's type [ 58 , 59 ] , although acceptance of this association is not universal .
an often referenced longitudinal study supporting an association is the rotterdam study reported by ott et al . .
study data gathered from 5,000 subjects 55 years of age and older suggested a strong correlation between type 2 diabetes and the subsequent development of ad .
, reporting on a study of human subjects diagnosed with diabetes or presenting with elevated glycemic indices showed that individuals with increased insulin resistance also presented with an ad - like pattern of reduced cerebral glucose metabolic rate in frontal , parietotemporal , and cingulated regions of the brain , suggesting insulin resistance as a predictive marker for ad .
additional support for type 2 diabetes as a risk factor for ad comes from studies by curb et al . and leibson et al . , among others .
in view of recent reports , a causative association between type 2 diabetes , perhaps as a result of hyperinsulinemia and/or hyperglycemia , and cognitive impairment is strong , with an association to ad somewhat less so .
although both diseases exhibit some similarities , such as insulin resistance , dysregulation of iron homeostasis , and increases in metallothionein and heme oxygenase-1 , there is limited evidence that type 1 or type 2 diabetes leads to ad neuropathology .
overall , study findings to date suggest a strong correlation between chronic type 2 diabetes and subsequent development of dementia , however , the effect of diabetes on cerebral function may be related more to an initial predisposition to vascular dementia than to development of classical ad neuropathology [ 67 , 68 ] . in the following section we will discuss the involvement of insulin resistance and hyperglycemia , both hallmarks of type 2 diabetes in the pathophysiology of neurodegeneration , including ad .
although some question remains as to the predisposition of the diabetic brain to develop ad pathology , recent studies suggest a strong correlation between type 2 diabetes , brain atrophy and reduced neuronal integrity . in one clinical study of 89 patients with diabetes , 70 to 82 years of age mri scans and cognitive function testing
was conducted at baseline and again 3 years later . after correcting for age , gender , educational level , hypertension , and treatment with
pravastatin linear regression analysis revealed statistically significant atrophy of the brain in diabetic patients in comparison to matched control subjects without diabetes . a second mri study by de bresser et al . conducted over 4 years on 55 patients with type 2
diabetes showed significant reduction in total brain volume and increased peripheral cerebrospinal fluid volume , leading to the conclusion that type 2 diabetes can lead to slow , chronic cerebral atrophy .
encephalopathy with neuronal degeneration and inflammation has also been demonstrated in the hippocampus of the streptozotocin ( stz ) type 2 diabetic rat model .
the hyperglycemia associated with type 2 diabetes also appears to impair gap junctional communication between astrocytes as shown in ( 1 ) cultured astrocytes harvested from 1-day - old wistar - hanover rats and exposed to high glucose , and ( 2 ) brain slices from 20-to-24-week - old stz rats .
assessment of gap junction channel - mediated dye transfer was used to determine astrocytic gap junctional function .
difficulty in determining the causative relationship between type 2 diabetes and ad is , in part , due to the heterogeneous nature of ad . a definitive diagnosis of ad can only be made postmortem .
moreover , ad is frequently associated with a microvascular component , and as luchsinger and gustafson correctly state , ad may illustrate a neurodegenerative disease with a graded overlapping of vascular and amyloid neuropathologies .
the ad brain exhibits regional glucose hypometabolism as well as abnormalities in insulin signaling , both components of diabetes mellitus [ 76 , 77 ] .
the presence of glucose hypometabolism and development of a hyperglycemic cellular microenvironment precipitated by progressive insulin resistance and altered insulin signaling pathways contribute to neuronal death .
mgo may promote neuronal cell death by contributing directly to insulin resistance via acceleration of age formation , and also by involvement in the combined effects of dicarbonyl reactivity with tau , and hyperphosphorylation of tau and other proteins by protein o - glycosylation via monosaccharide -n - acetylglucosamine attachment to serine / threonine residues via an o - linked glycosidic bond .
present data suggests that glucose hypometabolism and insulin resistance in ad contribute to the development of tau hyperphosphorylation by reduction of this glycosylation process , thus leading to the formation of tangles and eventual neuronal cell death . increased
tau phosphorylation has also been described in a mouse model of type 1 ( stz injected ) and 2 ( db / db ) diabetes mellitus . in this study
, tau phosphorylation was found to increase in the cortex and hippocampus of both mouse models , but the increase was particularly noteworthy in the stz - injected mouse brain .
study results suggested that tau phosphorylation was directly induced by hyperglycemic ( type 2 ) and insulin deficiency ( type 1 ) .
similar results were reported by ke et al . in the pr5 transgenic mouse model of ad with superimposition of type 2 diabetes induced by stz .
immunocytochemical and western blot analyses indicated tau hyperphosphorylation was accelerated in the diabetic transgenic model .
hyperglycemic conditions in type 2 diabetes and perhaps in ad can elevate tissue dicarbonyl levels , primarily mgo and go molecular species , thus contributing to tau crosslinking and oligomer formation . that this can occur
has been shown by kuhla et al . , who demonstrated increased dimer and oligomer formation in wild - type and pseudophosphorylated mutant tau proteins , particularly when exposed to mgo .
production of -dicarbonyl molecular species , most notably go and mgo , occurs slowly under physiological conditions , yet adduction to susceptible lysine , arginine and cysteine residues occurs , with the hydroimidazolones being the most commonly formed adducts , primarily on proteins with long half - lives [ 85 , 86 ] .
compromise of protein function is effected initially by glycation of the lysine side chain and n - terminal amino acid residues , followed by later stage modification involving not only these , but arginine and cysteine residues and stabilization to ages via schiff base and amadori rearrangement [ 87 , 88 ] .
the impact of glycation on protein function depends in part on the turnover rate of the protein , and cellular defense mechanisms , such as activity of the glyoxalase system responsible for the degradation of unadducted dicarbonyl .
because activity of the glyoxalase system declines with progression of type 2 diabetes and ad mgo levels can rise significantly .
glyoxalase activity depends on the availability of reduced glutathione which can be decreased in neurodegenerative disease . both in vitro and in vivo studies
indicate that presence of glycating agents , such as mgo , within the vicinity of arginine , lysine , and cysteine residues of a protein is not necessarily predictive of adduction at these sites .
jia et al . demonstrated in vitro the susceptibility of insulin to glycation by mgo , while glucagon , a protein of similar mass with two arginines and a single lysine , was resistant to modification .
additional support for the selective nonenzymatic glycation of proteins comes from studies of human , mouse , and rat plasma proteins obtained from aged populations .
the tertiary structure of a protein , and therefore accessibility of the glycating agent to susceptible residues , is a primary determinant of whether the glycation process proceeds .
this was shown by gao and wang who correlated selective modification of specific arginine residues within the hemoglobin molecule with solvent accessibility , as determined by the relative surface exposable area calculated for each arginine within the native molecule .
conversely , in an earlier study on glycation of rnase protein watkins et al .
note that the only common characteristic of unreactive lysine residues in the protein were their location on the protein surface , and thus readily solvent accessible .
they point out , however , that this nonreactivity may be due to a calculated 20% reduction in the rate constant for glycation following reaction of highly reactive lysine residues .
a second determinant of site specificity of protein glycation is the pka of the competing residues , with the residue having the lower value more susceptible to initial schiff base formation and subsequent conversion to stable glucosamines via the amadori rearrangement .
however , the initial formation of the schiff base is not necessarily predictive of the amadori rearrangement , as shown by the observation that lys-41 in bovine pancreatic rnase a although less susceptible to schiff base modification than is n - lys-1 , accounts for more than twice the amadori adduct to the rnase . it should be emphasized that failure of the amino acid to initially react with the glycating agent does not preclude eventual modification .
thirdly , reactivity with glucose appears to be enhanced when specific residues , like lysine , are proximal to high - affinity binding sites for phosphate ion or organic phosphate often within basic regions of the molecule , a frequent condition within substrate and effector binding sites of the protein .
proximity of lysine to carboxylic acid containing residues within the primary or tertiary structure has been noted by shapiro et al . .
the preponderance of reported studies support an association between hyperglycemia and insulin resistance / hyperinsulinemia , both components of uncontrolled type 2 diabetes , and similar conditions in ad .
increased glycation of susceptible proteins is also of pathophysiological significance in both diabetes and neurodegenerative diseases . attempting to demonstrate
type 2 diabetes as a risk factor for ad has been inherently difficult for 2 reasons : ( 1 ) the percentage of study subjects maintaining good glycemic control has often not been strictly recorded , thus these individuals may present with few , if any systemic complications such as cardiovascular , renal , or peripheral nerve pathology most often associated with diabetes and ( 2 ) confirmation of ad can not be made until postmortem examination of brain sections . to date , there are no reported study findings relating the level of long - term glycemic control to cognitive function in type 2 diabetes . however , in 2007 , williamson et al
. initiated the action to control cardiovascular risk in diabetes memory in type 2 diabetes study ( accord - mind ) , the first such study to formally assess cognitive outcome following a treatment program designed to compare the effects of standard care versus intensive care guidelines .
this study should contribute importantly to our understanding of how , and whether long - term stability of blood sugar affects cognitive function .
the role of protein and peptide glycation , and that of mgo and other dicarbonyl molecular species , in the development and progression of neurodegenerative diseases remains poorly defined , due largely to a lack of rigorous corroborative studys conducted in vivo .
interpretation of in vitro findings are often tentative , given that tissue localization , concentration , half - life , and reactivity of key reactants , that is , dicarbonyl molecular species , susceptible protein , and host defense systems , such as antioxidants , reduced glutathione , and glyoxylase i and 2 may not be reflective of disease conditions in vivo .
nonetheless , there is considerable evidence supporting the role of protein glycation and associated oxidative stress and inflammation as central to the progression of some neurodegenerative diseases , ad being a prime example .
however , whether these events are early , causative events in the disease remains unclear , although smith et al .
point out that the presence of age epitopes localized to diffuse -amyloid plaques represent an early pathological event in ad .
oxidative stress brought about by glycation of amino acids , and the irreversible formation of ages is likely to be but one of several pathways contributing to protein dysfunction .
recently , elevation of redox - active iron was found in the cerebral cortex and cerebellum in human preclinical ad brains , and brains with mild cognitive impairment ( mci ) , indicating transition - metal - induced free radical generation within these brain regions .
occurrence of increased iron in brain from mci patients is also highly suggestive of an iron - generated free radical - induced primary event within this and perhaps other neurodegenerative diseases that may respond to the use of antioxidant therapies .
elevated levels of transition metals within ad brain may be primary contributors to the augmentation of oxidative stress associated with amino acid - mgo adduct formation .
concurrently , mgo - induced age formation and age - rage binding can regulate expression of proinflammatory cytokines via redox - sensitive pathways that may be central to neuroinflammation in ad .
potential therapies for ad and other neurodegenerative diseases focusing on antioxidants , anti - inflammatory agents , and inhibitors of age - rage pathways are currently intense areas of research . in recent years an increasing number of animal models have been developed that closely approximate conditions reflecting the human disease . increased emphasis on utilization of these in vivo models in long - term studies of dicarbonyl - protein interactions
increased focus on in vivo studies will be required to determine , conclusively , the relative involvement of dicarbonyl - induced glycation , oxidative stress , and inflammatory responses in the etiology of human neurodegenerative disease . | neurodegeneration results from abnormalities in cerebral metabolism and energy balance within neurons , astrocytes , microglia , or microvascular endothelial cells of the blood - brain barrier . in alzheimer 's disease
, -amyloid is considered the primary contributor to neuropathology and neurodegeneration .
it now is believed that certain systemic diseases , such as diabetes mellitus , can contribute to neurodegeneration through the effects of chronic hyperglycemia / insulin resistance resulting in protein glycation , oxidative stress and inflammation within susceptible brain regions . here , we present an overview of research focusing on the role of protein glycation , oxidative stress , and inflammation in the neurodegenerative process .
of special interest in this paper is the effect of methylglyoxal ( mgo ) , a cytotoxic byproduct of glucose metabolism , elevated in neurodegenerative disease , and diabetes mellitus , on cerebral protein function and oxidative stress .
how mgo interacts with amino acid residues within -amyloid , and small peptides within the brain , is also discussed in terms of the affect on protein function . |
fragile x - associated tremor / ataxia syndrome ( fxtas ) is a neurodegenerative disorder caused by a pre - mutation of 55 to 200 cgg repeats in the 5 untranslated region ( utr ) of the fragile x mental retardation 1 ( fmr1 ) gene ( hagerman et al . , 2001 ) .
the carrier prevalence of the cgg pre - mutation is approximately 1 of 200 females and 450 males , but due to incomplete penetrance , it is estimated that 1 in 3,000 men older than 50 years will develop fxtas ( jacquemont et al . , 2004 ,
the clinical features of fxtas include progressive intention tremor and gait ataxia , frequently accompanied by progressive cognitive decline , parkinsonism , peripheral neuropathy , and autonomic dysfunctions ( jacquemont et al . , 2003 ) .
principal neuropathologies of fxtas include mild brain atrophy and white matter lesions with the presence of ubiquitin - positive nuclear neuronal and astrocytic inclusions ( greco et al . , 2006 ) .
in contrast to fragile x syndrome , where expanded full mutation alleles ( > 200 cgg repeats ) result in hypermethylation and silencing of the fmr1 gene , fxtas carriers of pre - mutation expanded alleles ( 55200 cgg repeats ) present increased levels of fmr1 mrna but slightly reduced expression of the protein encoded by fmr1 , fmrp ( tassone et al . , 2000 ,
because fxtas is not observed in fragile x patients with fully silenced fmr1 alleles , a pathogenic mechanism based on expression of mutant fmr1 mrnas containing expanded cgg repeats has been proposed ( hagerman and hagerman , 2004 ) . in support of this hypothesis ,
multiple studies have demonstrated adverse consequences of expressing rna containing expanded cgg repeats in cell , fly , and mouse models ( willemsen et al . , 2003 , jin et al . , 2003 , arocena et al . , 2005 , hashem et al .
, 2009 , entezam et al . , 2007 , hukema et al . , 2014 ,
a first proposed model is that fxtas results from a toxic rna gain - of - function mechanism in which mutant rna containing expanded cgg repeats sequesters specific rna binding proteins , resulting in neuronal cell dysfunctions ( iwahashi et al . , 2006 , sofola et al . , 2007 , jin et al . , 2007 , sellier et al . , 2010 , sellier et al . , 2013 ) .
a second proposed mechanism is that fxtas is caused by repeat - associated non - aug ( ran ) translation of the expanded cgg repeats into polyalanine- and polyglycine - containing proteins named fmrpolya and fmrpolyg ( todd et al . , 2013 ) .
ranum and colleagues originally demonstrated that expanded cag repeats can be translated in all three frames in the absence of any aug initiation codon ( zu et al . ,
subsequently , ran translation was described and proposed as a causative mechanism in various inherited microsatellite neurodegenerative disorders ( reviewed in cleary and ranum , 2014 ) , including fxtas ( todd et al .
however , the mechanism and the pathological consequences of translating expanded cgg repeats are not fully understood . specifically ,
which pathological mechanism ( rna gain - of - function or ran translation ) drives fxtas pathogenesis is a crucial question .
here we find that translation of expanded cgg repeats occurs predominantly in the glycine frame through initiation at a near - cognate acg codon located upstream of the expanded cgg repeats .
importantly , transgenic mice expressing both cgg rna repeats and the polyglycine protein ( fmrpolyg mouse ) , but not mice expressing only the mutant rna containing expanded cgg repeats ( cgg rna mouse ) , exhibit inclusion formation , motor phenotypes , and reduced lifespan .
fmrpolyg interacts with lap2 , a protein essential to anchoring lamin proteins to the inner nuclear membrane , and overexpression of lap2 rescues neuronal cell death induced by expression of fmrpolyg .
overall , these results suggest that translation of expanded cgg repeats into fmrpolyg , which alters nuclear lamina , may contribute to fxtas .
to confirm previous observations of translation of expanded cgg repeats in the absence of an aug start codon ( todd et al .
, 2013 , kearse et al . , 2016 ) , we cloned 100 cgg repeats embedded within the natural human 5 utr of fmr1 , which was fused to the gfp deleted of its atg and in all three possible frames ( figure s1a ) .
these frames were named according to the polypeptide potentially encoded by the expanded cgg repeats namely , glycine , alanine , and arginine .
, 2013 , kearse et al . , 2016 ) and demonstrate that the 5 utr of fmr1 with expanded cgg repeats allows translation of a gfp protein with an 12 kda n - terminal extension corresponding to the expanded cgg repeats translated into the glycine frame ( figure 1a and figure s1b ) .
in contrast , we observed no translation when the fmr1 sequence located upstream of the repeats was deleted ( figure 1a and figure s1b ) .
serial deletions confirmed that a short fmr1 sequence located upstream of the cgg repeats was required for fmrpolyg translation ( figure 1b ) .
treatment with lysostaphin , a polyglycine endopeptidase , confirmed that expanded cgg repeats are translated into a polyglycine - containing protein ( figure s1c ) . to further characterize the initiation site of expanded cgg repeat translation , we immunoprecipitated fmrpolyg and determined its n - terminal sequence by proteomic analysis after trypsin digestion .
lc - ms / ms spectra revealed initiation to an acg near - cognate codon located 32 nucleotides upstream of the cgg expansion ( figure 1c ) . to exclude any bias of digestion , we repeated this experiment with a construct containing a mutation in which a lysine ( sensitive to the lysc enzyme ) is present upstream of the expanded cgg repeats , but the remaining sequence , notably the acg codon , is untouched .
proteomic analysis of fmrpolyg after lysc digestion confirmed that fmrpolyg translation initiates at the acg near - cognate codon ( figure s1d ) . of interest
, proteomic analysis also revealed that the initial amino acid of fmrpolyg is a methionine , suggesting that the acg codon is decoded by an initiator met - trna despite imperfect match ( figures 1c and s1d ) .
this acg near - cognate codon is embedded in a putative kozac consensus sequence that is conserved among multiple species ( figure s1e ) .
translation initiation at the acg near - cognate codon is predicted to result in a small fmrpolyg protein composed of a short , 12-amino - acid n terminus , a central glycine stretch with a length that corresponds to the number of expanded cgg repeats , and a c terminus of 42 amino acids with no predicted structure or homology ( figure 1d ) .
thus , according to the number of cgg repeats , fmrpolyg may range from 7 kda in control individuals with 30 cgg repeats to 15 kda in carriers of pre - mutation with 150 cgg repeats .
upstream orfs ( uorfs ) are short open reading frames that are located in the 5 utr of mrnas upstream of the main orf . due to the 5 to 3 scanning ribosome process , and in absence of ribosome re - initiation , the translation of a uorf generally impairs translation of the downstream main orf . to avoid complete translation inhibition , uorfs
typically start by an aug or a near - cognate codon ( gug , cug , uug , acg , etc . )
embedded in a poor kozac consensus sequence that enables leaky ribosomal scanning and hence translation initiation at the downstream main orf ( reviewed in sonenberg and hinnebusch , 2009 ) . to test the presence of a putative uorf encompassing the cgg repeats in fmr1 , we cloned various lengths of cgg expansion within the human 5 utr of fmr1 fused in the glycine frame with a small flag tag ( eight amino acids , 1 kda ) .
immunoblotting revealed that expression of fmrpolyg - flag is detected only with expanded cgg repeats over 60 to 70 cgg repeats ( figure 2a ) , the threshold over which pre - mutation carriers are at risk of developing fxtas .
fusion of expanded cgg repeats in the glycine frame to the gfp ( 25 kda ) confirmed that translation occurred with expanded cgg repeats of various lengths ( 70 to 100 repeats ) , characteristic of pre - mutation carriers ( figure 2b ) . however , fmrpolyg - gfp was also translated with short stretches of cgg repeats ( 30 ) found in control individuals or even without any cgg repeats ( figure 2b ) .
these results suggest that translation initiation occurs at the acg near - cognate codon independently of the cgg repeats but that expansion over 70 repeats is important for detection of fmrpolyg .
this is characteristic of short upstream orfs that are generally translated into small and most often undetectable peptides but which are detected when fused with large tags , resulting in stable and detectable proteins ( aspden et al . , 2014 ) .
next , we noted that fmrpolyg and fmrp orfs are in different frames , with the last 20 amino acids of fmrpolyg naturally overlapping the fmrp n terminus ( figure 1d ) .
thus , translation of the fmrpolyg uorf may potentially impair ribosomal re - initiation to the downstream fmrp orf . to test that hypothesis , we fused the 5 utr of fmr1 to a flag tag in the glycine frame and also fused the downstream fmrp orf in frame with the gfp ( figure 2c ) .
this construct expresses the flag - tagged fmrpolyg uorf or the downstream gfp - tagged fmrp main orf ( figure 2c ) , suggesting that translation initiation occurs either at the fmrpolyg acg near - cognate codon or at the fmrp atg codon .
deletion of the 5 utr sequence containing the acg near - cognate initiation codon abolished expression of the flag - tagged fmrpolyg uorf but enhanced translation of the downstream gfp - tagged fmrp orf ( figure 2c ) . in contrast , mutation of the acg near - cognate codon into a cognate aug initiation codon predictably enhanced translation of the flag - tagged fmrpolyg uorf , but abolished expression of the downstream , gfp - tagged fmrp orf ( figure 2c ) . to confirm that fmrpolyg is encoded by an orf initiating upstream of the cgg repeats
, we developed an antibody directed against the 12 amino acids located upstream of the glycine repeats ( figure s2a ) .
immunofluorescence revealed the presence of fmrpolyg n terminus in brain sections of fxtas patients , but not in age - matched control individuals ( figure 2d ) .
fmrpolyg n terminus is detected as single nuclear inclusions that co - localize with ubiquitin , which is consistent with the known histopathological features of fxtas ( greco et al .
we confirmed these results by immunoblotting and found that , according to the size of the cgg expansion , fmrpolyg was detected as a 10- to 14-kda protein in the insoluble fraction of brain lysate of fxtas individuals ( figure 2e ) .
the poor quality of the immunoblotting is probably due to the propensity of this glycine - rich protein to aggregate . to ensure that translation successfully passes across the expanded cgg repeats
, we also developed an antibody against the amino acids located downstream of the glycine repeats ( figure s2a ) .
2014 ) , immunofluorescence confirmed presence of fmrpolyg c terminus in brain sections of fxtas patients , but not in age - matched control individuals ( figure s2b ) . finally , translation of expanded cgg repeats into a polyalanine - containing protein was reported previously ( todd et al .
we developed an antibody against the putative c - terminal part of this protein ( figure s2c ) , but observed no or very little fmrpolya in individuals with fxtas ( figure s2d ) .
the presence of both cgg rna aggregates , which can titrate out rna binding proteins , and fmrpolyg positive inclusions in individuals with fxtas raises the question of which pathogenic mechanism is driving neuronal degeneration in this disease . to differentiate between these two hypotheses
the first one contains the full human 5 utr of fmr1 with expanded 99 cgg repeats that express both cgg rna and fmrpolyg protein , while the second mouse model also expresses 99 cgg repeats , but the non - canonical acg initiation codon and surrounding 5 utr sequence are deleted so it only expresses the cgg rna ( figure 3a ) .
both constructs are driven by a chimeric cag promoter inserted within the neutral rosa26 locus and under repression of a loxp - polyadeneylation cassette ( figure 3a ) .
deletion of the loxp cassette using a ubiquitously and embryonically expressed cre recombinase led to high expression of transgene rna throughout the brain , heart , and liver , with lower expression in skeletal muscle , kidneys , and other organs ( figure 3b ) .
importantly , transgene rna expression was similar in bigenic cmv - cre mice with either the full or mutant fmr1 5 utr ( figure 3b ) .
however , we found no or only very rare cgg rna foci in brain sections of full or mutant fmr1 5 utr transgenic mice ( figures s3a and s3b ) . this is consistent with the rare occurrence of cgg rna aggregates in other transgenic mouse models expressing expanded cgg repeats ( sellier et al . , 2010 ) .
concerning the fmrpolyg protein , immunohistochemistry assays demonstrated expression and accumulation of nuclear aggregates of fmrpolyg in brain sections from the full 5 utr fmr1 transgenic mice , but not in the mutant 5 utr mice ( figures 3c and s3c ) .
these results confirm in mouse models that translation of the cgg repeats in the glycine frame requires the presence of an upstream fmr1 sequence . as observed in brain samples of individuals with fxtas , aggregates of fmrpolyg in mice co - localized with ubiquitinated inclusions ( figure 3d ) .
nuclear aggregates of fmrpolyg accumulated over time , with the largest burden of inclusions occurring within the hypothalamus , mirroring transgene rna expression ( figures s3c and s3d ) .
some rare aggregates of fmrpolyg were found in other tissues than brain , which is reminiscent of reported fmrpolyg aggregates in non - cns tissues in fxtas patients ( buijsen et al . , 2014 ) .
in contrast , we did not observe aggregates of fmrpolya in the full or mutant 5 utr mice ( figure s3e ) .
to determine the consequences of fmrpolyg production in mice , we conducted a series of behavioral and locomotor assays on both mouse lines .
mice with the full 5 utr of fmr1 develop obesity at 6 months of age . therefore , behavioral tests were performed at 3 months of age when weight is identical between full and mutant fmr1 5 utr transgenic mice .
importantly , we observed that only mice with both the full 5 utr sequence of fmr1 and expression of the fmrpolyg protein present locomotor deficiency ( movies s1 and s2 ) , with increased falling from rotarod ( figure 3e ) , decreased ability of traction from the hind limbs ( figure 3f ) , decreased grip strength ( figure 3 g ) , and a decreased number of rears in open field observation ( figure 3h ) . at 6 months of age , mice with the full 5 utr of fmr1
lose mobility and develop obesity , while mice with the mutant 5 utr that express only the cgg rna remain normal ( figure 3i ) .
we did not observe massive neuronal cell death , but found some loss of purkinje cells in mice with the full 5 utr of fmr1 compared to mutant 5 utr mice ( figures 3j and s3f ) .
furthermore , iba1 and gfap staining were mildly increased in brain sections of mice with the full 5 utr of fmr1 compared to mutant 5 utr mice , suggesting some increased neuroinflammation in fmrpolyg - expressing animals ( figure s3 g ) . finally ,
expression of fmrpolyg is deleterious , as mice expressing the full 5 utr of fmr1 die at around 10 months , while mutant fmr1 5 utr mice exhibit normal longevity and are indistinguishable from control mice ( figure 3k ) . to assess the tissue origin of these phenotypes , we next analyzed offspring of full 5 utr transgenic mice crossed with nestin - cre mice , which express the cre recombinase in precursors of neurons and glia cells around e10.5 ( figure 4a ) .
quantitative rt - pcr revealed high expression of expanded cgg rna only in mouse brain of the double transgenic nestin - cre / full 5 utr fmr1 mice , confirming the specificity of the nestin promoter ( figure 4b ) .
immunohistochemistry indicated expression and accumulation of nuclear aggregates of fmrpolyg in brain sections of these bigenic mice , but not in control , non - transgenic animals ( figures 4c and s4a ) .
importantly , locomotor testing at 3 months of age revealed increased falling from rotarod compared to control , non - transgenic mice ( figure 4d ) .
histopathological analyzes revealed some purkinje cell loss ( figure 4e ) and evidence of neuroinflammation ( figure 4f ) in 9- to 10-month - old nestin - cre / full 5 utr fmr1 mice compared to control animals .
interestingly , mice expressing fmrpolyg only in the brain developed obesity ( figure 4 g ) and exhibited reduced longevity ( figure 4h ) , similar to the cmv - cre / full 5 utr fmr1 mice .
the obesity developed by these mice may originate from dysfunction of the hypothalamus , as this area is the one expressing the most and the earliest fmrpolyg . in support of that hypothesis
, rt - qpcr indicated that expression of the leptin receptor , which is essential to regulate energy balance by inhibiting hunger , was decreased in the hypothalamic area of these mice ( figure s4b ) .
the absence of rna foci of expanded cgg repeats in full and mutant 5 utr fmr1 mice is puzzling , as fxtas is proposed to result from nuclear accumulation of mutant cgg rna that would sequester various rna binding proteins .
thus , we tested whether transfection of expanded cgg repeats embedded in their natural fmr1 5 utr sequence would form any rna foci in mouse neuronal cell cultures . as positive control , we used a construct expressing expanded cgg repeats without the surrounding fmr1 sequence that was previously shown to form rna foci in transfected cells ( sellier et al .
rna fish assays indicated that expanded cgg repeats embedded in the 5 utr of fmr1 formed rare rna foci compared to the expanded cgg repeats without the surrounding fmr1 sequence ( figure s4d ) .
furthermore , rt - pcr performed on nuclear and cytoplasmic fractions indicated that most of the rnas containing expanded cgg repeats embedded within the 5 utr of fmr1 are exported from the nucleus to the cytoplasm ( figure s4e ) .
in contrast , expanded cgg - repeat rnas without the fmr1 sequence are largely retained within cell nuclei ( figure s4e ) . both constructs present similar plasmid backbones with strong polyadenylation signals ( figure s4c ) .
these results highlight the nuclear retention bias induced by using artificial constructs in which microsatellite repeats are separated from their natural sequence context .
importantly , these data also indicate that cgg expanded repeats embedded in their natural fmr1 sequence are exported into the cytoplasm and thus available for translation into fmrpolyg .
next , we investigated by which mechanisms the fmrpolyg protein may elicit neuronal cell dysfunction .
immunofluorescence assays indicated that fmrpolyg first accumulates in the cytoplasm , where it forms aggregates .
these aggregates then migrate and form an inclusion within the cell nucleus in primary mouse - embryonic neuronal cultures ( figure 5a ) .
similar results were observed in hek293 cells and when a smaller flag epitope tag was used instead of gfp ( figures s5a and s5b ) .
furthermore , immunoblotting indicated that fmrpolyg progressively accumulates in the insoluble fraction of transfected cell lysates , which is consistent with its propensity to form aggregates ( figure s5c ) . to identify the sequence driving fmrpolyg aggregation , we cloned various deletion mutants of fmrpolyg expressing either its n terminus with the glycine repeats or its c terminus in isolation . to obtain comparable expression ,
expression of the full - length fmrpolyg protein in primary cultures of e18 mouse cortical neurons leads to nuclear aggregates associated with cell death ( figure 5b ) .
expression of the polyglycine stretch in isolation , with the c terminus of fmrpolyg deleted , was sufficient to elicit aggregation but was not overtly toxic .
in contrast , expression of gfp fused to the 42 amino acids constituting the c terminus of fmrpolyg caused neuronal cell death without forming nuclear aggregates ( figure 5b ; movies s3 , s4 , s5 , and s6 ) .
similar results were observed in neuro2a cells ( figure s5e ) and when the gfp tag was replaced by the smaller flag tag ( figure s5f ) . to confirm these results in an animal model and test the toxicity of fmrpolyg on a longer time period , we developed drosophila transgenic lines expressing either the full fmrpolyg protein or the polyglycine stretch in isolation under a uas promoter .
first , uas fmrpolyg - gfp and uas polyg cter - gfp flies , both expressed under an atg initiator codon , were crossed with an act5c - gal4 driver line , which leads to ubiquitous expression of the transgene during development . total progeny carrying either the transgenes or a balancer chromosome
importantly , expression of the full fmrpolyg was toxic and reduced progeny eclosion by half , while the eclosion rate was only slightly reduced in flies expressing the polyglycine stretch in isolation ( figure 5c ) .
to exclude any potential bias due to random insertion effects , we generated and analyzed various independent lines expressing either fmrpolyg or its polyglycine stretch .
as control , quantitative rt - pcr showed similar expression of the fmrpolyg or polyglycine transgenes ( figure
importantly , all lines expressing fmrpolyg - gfp showed reduced viability compared to gfp controls .
in contrast , the lines expressing the glycine repeats in isolation consistently exhibited a milder phenotype ( figure s5h ) . as a second measure of fmrpolyg toxicity
, we crossed these same transgenic fly lines to a tubulin - gal4 geneswitch driver , which expression is induced upon addition of mifepristone ( ru-486 ) . as a control ,
adult transgenic flies reared off of ru-486 drug exhibited no differences in viability from control flies , indicating that insertion of the fmrpolyg or polyglycine transgenes had no deleterious effect .
in contrast , transgenic flies fed with ru-486 , activating ubiquitous transgene expression , showed a decrease in viability over time for fmrpolyg expressing flies ( figure 5d ) .
adult drosophila expressing the polyglycine stretch alone also presented a decrease in viability ( figure 5d ) ; however , their survival was significantly prolonged compared to flies expressing the full fmrpolyg sequence .
the difference of toxicity of the polyglycine stretch in isolation between cell culture and drosophila is probably due to the longer time frame and in vivo nature of the drosophila studies .
overall , these results demonstrate that expression of fmrpolyg is pathogenic , with its polyglycine stretch driving aggregation and with both polyglycine and its c terminus contributing to toxicity in vivo .
to identify fmrpolyg binding proteins , we performed a tandem tag purification of ha - flag - tagged fmrpolyg transfected into neuro2a cells followed by nano - lc - ms / ms analysis of associated proteins .
this approach identified various fmrpolyg - associated proteins ( table s1 ) , including lap2 ( figure 6a ) .
lamina - associated polypeptide 2 ( lap ) alpha and beta are two isoforms of the lap2 protein that differ in their c - termini ; these isoforms originate from alternative splicing of the tmpo pre - mrna .
lap2 is diffusely localized in the nucleus , while lap2 carries a transmembrane domain in its c terminus that anchors it to the inner nuclear membrane ( furukawa et al . , 1995 ) .
lap2 interacts with lamin b1 and b2 and helps to organize these proteins near the nuclear inner membrane .
consequently , alteration of lap2 results in disorganization of the nuclear lamina architecture ( dubiska - magiera et al .
co - immunoprecipitation studies confirmed the association of lap2 with ha - flag - tagged fmrpolyg , but not with the polyglycine stretch in isolation ( figure 6b ) .
similar results were observed when a gfp tag was used instead of the double flag - ha tag ( figure 6c ) .
an interaction between lap2 and fmrpolyg raises questions of whether translation of the expanded cgg repeats in fxtas may alter the localization or the function of lap2. expression of fmrpolyg - gfp in primary cultures of cortical neurons from mouse embryo indicated that fmrpolyg recruits endogenous lap2 in nuclear aggregates ( figure 6d ) .
similar results were observed in hek293 cells and when the gfp was replaced by a smaller flag tag ( figure s6a ) .
in contrast , a construct containing only the polyglycine stretch of fmrpolyg did not alter lap2 localization , suggesting that the c - terminal part of fmrpolyg is important for interaction and de - localization of lap2 ( figure 6d ) .
immunohistochemistry assays confirmed that endogenous lap2 localizes in nuclear aggregates in brain sections of the full 5 utr fmr1 transgenic mice , unlike in mutant 5 utr mice ( figure 6e ) .
these aggregates of lap2 co - localized with fmrpolyg inclusions ( figure 6f ) .
we nevertheless observed some lap2 aggregates in cerebellum sections as well as in the hippocampal area of fxtas individuals ( figures 6 g and s6b ) .
furthermore , immunofluorescence assays indicated that lap2 co - localized with fmrpolyg inclusions in individuals with fxtas , but not in age - matched control individuals ( figure 6h ) .
alteration of lap2 results in disorganization of the nuclear lamina ( gant et al .
thus , we next investigated the consequences of fmrpolyg expression on the architecture of the nuclear lamina .
expression of 99 cgg repeats embedded within the 5 utr of fmr1 fused in the glycine frame with either a gfp or a flag tag in hek293 cells resulted in disorganization of the nuclear lamina , as evidenced by alterations of the lamin b1 labeling ( figure s6c ) .
similarly , expression of fmrpolyg - gfp in primary cultures of mouse embryonic cortical neurons altered lamin b1 nuclear organization ( figure s6d ) . furthermore , and as reported previously with lamin a ( iwahashi et al . ,
2006 ) , the localization of lamin b1 was altered in brain sections of fxtas compared to controls ( figure s6e ) .
alterations of the nuclear lamina were observed in autopsied samples that may represent an end stage of the disease . to overcome this potential bias , we developed human induced pluripotent stem ( ips ) cells derived from fibroblasts from two age - matched controls and three different fxtas patients with expansion of 84 , 90 , and 99 cgg repeats .
these ips cells were differentiated into homogeneous populations of telencephalic neurons with no obvious difference of growth or differentiation between fxtas and controls ips cells ( figure s7a ) . as observed previously ( liu et al . , 2012 ) ,
expression of fmr1 mrna was increased 2- to 3-fold in differentiated neurons derived from fxtas ips cells compared to controls ( figure s7b ) .
this is consistent with the increased levels of fmr1 mrna observed in carriers of a cgg pre - mutation ( tassone et al . , 2000 , tassone et al . , 2007 ,
immunofluorescence assays detected accumulation of nuclear aggregates of fmrpolyg in fxtas neurons , but not in control neurons ( figure 7a ) .
fmrpolyg aggregates accumulated over time post - differentiation , with 5% to 10% of neurons exhibiting small fmrpolyg aggregates at 20 days of differentiation , while 20% to 30% of neurons present fmrpolyg nuclear aggregates after 40 days of differentiation ( figure s7c ) .
in contrast , rna foci of expanded cgg repeats were rare or absent in fxtas neurons at 40 days post - differentiation ( figure s7c ) .
importantly , immunofluorescence analysis revealed that endogenous lap2 loses its normal localization and forms nuclear inclusions that co - localize with fmrpolyg in neurons differentiated from fxtas ips cells ( figure 7a ) .
furthermore , aggregation of lap2 and fmrpolyg were associated with disorganization of the nuclear lamina structure , as shown by alteration of the lamin b1 labeling in fxtas neurons ( figure 7b ) .
in contrast , neurons differentiated from ips cells of control individuals exhibited normal lap2 and lamin b1 localization ( figures 7a and 7b ) . finally , lap2 overexpression was sufficient to rescue the cell death induced by transfection of fmrpolyg - gfp in neuronal cells ( figure 7c ) .
consistent with lap2 binding to the c - terminal part of the fmrpolyg protein , expression of lap2 also rescued cell death caused by expression of the fmrpolyg c terminus in isolation ( figure 7c ) . as controls ,
expression of lap2 had no effect on neuronal survival in control gfp - transfected cells or in neurons expressing the polyglycine fragment in isolation .
similar results were observed when the gfp was replaced by a smaller flag tag ( figure s7d ) .
overall , these data suggest a mechanism by which fmrpolyg can elicit toxicity ( figure 8) , and they provide an explanation for previously observed nuclear lamina disorganization in fxtas patients ( arocena et al . , 2005 ,
previous studies have demonstrated that fxtas is caused by expression of mutant rnas containing expanded cgg repeats ( willemsen et al . , 2003 , jin et al . , 2003 ,
entezam et al . , 2007 , hukema et al . , 2014 ,
however , whether expanded cgg repeats are pathogenic through an rna gain - of - function mechanism or through translation into a toxic protein was unclear . using novel mouse models with or without fmrpolyg expression , our study suggests a direct role for fmrpolyg in cgg - repeat - associated toxicity .
this study confirms in a mammalian system previous results obtained in drosophila ( todd et al . , 2013 ) .
moreover , we found that fmrpolyg disrupts nuclear lamina architecture through binding to the nuclear envelope protein lap2. these finding are reminiscent of amyotrophic lateral sclerosis and frontotemporal dementia ( als - ftd ) in which expanded ggggcc repeats in the c9orf72 gene ( renton et al .
, 2011 , dejesus - hernandez et al . , 2011 ) are ran translated into pathogenic di - peptide - containing proteins ( ash et al . , 2013 , mori et al . , 2013 , zu et al . , 2013
, 2015 , zhang et al . , 2016 , freibaum et al . , 2015 ,
in contrast to the ran translation of cag expanded repeats in the polyalanine frame , which was shown to initiate within the expanded repeats ( zu et al . , 2011 ) , our work confirms that expression of fmrpolyg depends largely on initiation at a near - cognate codon located upstream of the cgg repeats ( todd et al . , 2013 ,
moreover , we provide mass spectrometry data indicating that the n - terminal amino acid of fmrpolyg is a methionine in mammalian cells , suggesting a canonical mechanism of initiation with altered start - codon fidelity .
our data also suggest that expanded cgg repeats belong to a potential small orf translated upstream of the main fmrp orf
this is consistent with the difficulties in detecting small proteins below 10 kda , but also with the increased expression of mutant cgg rna in carriers of pre - mutation over 70 cgg repeats ( tassone et al . , 2000 ,
2001 ) and with the proposed increase in ribosomal stalling at a cgg hairpin structure , which would promote translation initiation to near - cognate codons located upstream of the cgg repeats ( todd et al . , 2013 , kearse et al . , 2016 ) .
reduced expression of fmrpolyg below 70 cgg repeats may provide some molecular basis for the threshold of severity and incomplete penetrance observed in fxtas , as most of pre - mutation alleles contain less than 70 cgg repeats ( review in tassone et al .
we also noted that translation of the fmrpolyg uorf reduces the expression of fmrp ; thus , expression of fmrpolyg may contribute to the decrease of fmrp expression observed in fxtas individuals ( tassone et al . , 2000 , tassone et al . , 2007 , kenneson et al . , 2001 ) .
however , other mechanisms may also contribute to the decreased expression of fmrp in fxtas , including the increased ribosome stalling observed with expanded cgg rna hairpin structure ( feng et al .
ribosome profiling and bioinformatics analyses reveal that upstream orfs ( uorfs ) are common in mammalian mrnas and can initiate at non - canonical codons ( calvo et al . , 2009 , ingolia et al . , 2011 , fritsch et al . , 2012 , ji et al . , 2015 ) .
mutations in uorfs are known to cause human disease , mostly by altering the expression of their downstream orfs ( reviewed in barbosa et al . , 2013 ) .
in contrast , we propose here that fxtas is characterized by a mutation extending the length of a uorf and resulting in expression of a toxic , polyglycine - containing protein , fmrpolyg .
this model is reminiscent of expansion of tri - nucleotide repeats in orfs , resulting in expression of pathogenic polyglutamine- or polyalanine - containing proteins ( reviewed in nelson et al . , 2013 ) . of interest ,
a pathogenic mechanism in which expansion of nucleotide repeats into a uorf results in expression of a toxic protein may apply to other diseases .
for example , aggregates of fmrpolyg were observed in ovarian stromal cells of a woman with fragile - x - associated primary ovarian insufficiency ( fxpoi ) , caused , like fxtas , by expanded cgg repeats in the fmr1 gene ( buijsen et al .
similarly , it is striking to note that expanded ggggcc repeats , which are located upstream of the c9orf72 orf and are the main genetic cause of als - ftd , are in frame with an upstream , ctg near - cognate codon in a correct kozac sequence ( gctctgg ) to encode a glycine alanine - polypeptide , which is the most common dipeptide - repeat protein detected in individuals with als - ftd ( mackenzie et al . , 2015 ) .
while hypothetical , extending further the fxtas and fragile x model to c9orf72 might predict that long expansions of ggggcc repeats in tissues prone to somatic expansions would be transcriptionally silent due to epigenetic modification of the promoter , while shorter expansions in tissues prone to repeat contraction would be transcribed and translated .
one of the main conclusions of this work is that mice expressing fmrpolyg develop a locomotor phenotype with reduced longevity , while mice expressing only the expanded cgg repeat rna are indistinguishable from control mice .
these results suggest that accumulation of rna with expanded cgg repeats or ran translation initiating within these repeats is not overly pathogenic in mice , at least in the time frame of our study .
notably , our behavioral and locomotor investigations were limited to the first 3 months of life , because animals expressing fmrpolyg in the brain develop obesity and grow immobile at around 6 months of age .
this is in contrast to an individual with fxtas who do not develop morbid obesity .
furthermore , no fmrpolyg - expressing mice survived past 1 year of age , impairing our ability to observe potential neurodegeneration at later ages .
as transgene expression is driven by an artificial promoter in these mice , it is likely that their premature death is due to a non - physiological level and/or distribution of transgene expression that may be unrelated to what occurs in fxtas .
thus , analysis of potential purkinje cell dropout and ataxia at old age will require specific expression of fmrpolyg in mouse cerebellum .
direct comparison of these novel mice with previous models of fxtas expressing either mrna with 90 cgg repeats and fmrpolyg protein ( willemsen et al .
hukema et al . , 2015 ) or only mrna with 118 cgg repeats ( entezam et al . , 2007 , qin et al . ,
2011 ) is difficult , as these mice either express endogenous levels of fmr1 mrna with knockin of the expanded cgg repeats into the endogenous fmr1 gene ( willemsen et al . , 2003 ,
entezam et al . , 2007 ) or express expanded repeats in more restricted brain regions than the mouse models reported here ( hashem et al . , 2009 , hukema et al . ,
it is noteworthy that knockin mice with expanded cgg repeats , which do not express fmrpolyg due to presence of a stop codon located upstream of the cgg repeats ( entezam et al .
, 2007 , todd et al . , 2013 ) , exhibit some purkinje cell dropout at 2 years of age but exhibit no ataxia or rotarod deficiency and only a mild behavioral phenotype with hyperactivity , reduced anxiety , and some subtle deficits in social interaction ( entezam et al . , 2007 ,
these behavioral alterations are similar to those observed in fmr1 knockout mouse models ; this suggests that they might be caused , in part , by the reduced expression of fmrp observed in this cgg knockin mouse model ( qin et al .
in contrast , the mild purkinje cell dropout observed at 2 years of age in that mouse model ( entezam et al . , 2007 )
could be caused by expression of the mutant rna containing expanded cgg repeats and/or ran translation from these repeats .
we failed to detect rna foci of expanded cgg repeats or nuclear aggregates of fmrpolya in our mouse models or in neurons from human ips cells derived from individuals with fxtas .
however , this could originate from technical issues , notably a lack of sufficient sensitivity of our fish probes of our fmrpolya antibody .
it is also possible that cgg rna foci and fmrpolya appear at a later stage of the disease .
thus , whether accumulation of cgg rna and/or ran translation of cgg repeats into fmrpolya might contribute to pathogenicity in fxtas remains an open question .
finally , we found that toxicity of fmrpolyg is mediated at least in part through sequestration of the lap2 protein into nuclear aggregates , leading to disruption of the nuclear lamina architecture and neuronal cell death .
these data provide a molecular mechanism for the previously reported nuclear lamina disorganization in fxtas ( arocena et al . , 2005 ,
however , the cell toxicity rescue observed upon overexpression of lap2 may also originate from high levels of lap2 blocking the interaction of fmrpolyg with various other proteins .
thus , it is possible that fmrpolyg mediates its toxic effects through more than one mechanism and/or protein partner .
notably , lap2 regulates gene expression through association with various transcription factors as well as with dna and with the dna - binding protein baf1 ( barrier to auto - integration factor 1 ) protein ( shumaker et al . , 2001 ) .
also , proteomic analysis indicates that fmrpolyg pulls down various other proteins , including cytoskeleton , mitochondrial , and proteasome proteins .
some of these proteins are good candidates to contribute to the mitochondrial alterations that have been observed in fxtas ( ross - inta et al .
, 2010 , kaplan et al . , 2012 , hukema et al . , 2014 ) .
similarly , fmrpolyg appears critical for elicitation of ubiquitin proteasome impairment when expressed in cells or drosophila ( oh et al .
further investigations will be needed to test the potential pathological effect of fmrpolyg on mitochondria , protein degradation mechanisms , and cell cytoskeleton in fxtas . in conclusion ,
the fmr1 gene encodes for at least two different proteins , fmrpolyg and fmrp , whose levels are inversely modulated by the size of the cgg repeat expansion and which are involved in two different genetic diseases , fxtas and fragile x syndrome .
all brain samples were obtained from the fxtas brain repository at the uc davis school of medicine with the informed consent of individuals and were approved by the institutional review board of the university of california , davis .
patients have been described previously ( cases lr , 58 - 02-wd and 1007 - 05-hp from greco et al . , 2006 and pretto et al . , 2014 ) .
fibroblasts of three fxtas male individuals with confirmed pre - mutation of 84 , 90 , and 99 cgg repeats were obtained with the informed consent of individuals and approved by the institutional review board of the hospital la piti salptrire .
experiments were performed by c.s . , r.a.m.b . , f.h . , s.n . , | summaryfragile x - associated tremor / ataxia syndrome ( fxtas ) is a neurodegenerative disorder caused by a limited expansion of cgg repeats in the 5 utr of fmr1 .
two mechanisms are proposed to cause fxtas : rna gain - of - function , where cgg rna sequesters specific proteins , and translation of cgg repeats into a polyglycine - containing protein , fmrpolyg .
here we developed transgenic mice expressing cgg repeat rna with or without fmrpolyg .
expression of fmrpolyg is pathogenic , while the sole expression of cgg rna is not .
fmrpolyg interacts with the nuclear lamina protein lap2 and disorganizes the nuclear lamina architecture in neurons differentiated from fxtas ips cells . finally ,
expression of lap2 rescues neuronal death induced by fmrpolyg .
overall , these results suggest that translation of expanded cgg repeats into fmrpolyg alters nuclear lamina architecture and drives pathogenesis in fxtas . |
lower cretaceous pelagic to hemipelagic sediments cover relatively small , restricted areas in the higher dolomites ( southern alps ) . in the southern alps ,
cephalopod - bearing deposits are mainly recorded in two different facies ( lukeneder , 2010 ) , the calcareous limestones of the biancone formation (= maiolica formation in the appenines ; see weissert , 1981 ) and the more marly puez formation ( lukeneder , 2010 ) .
the stratigraphy of the lower cretaceous puez area is based on microfossils , nannofossils and ammonites ( lukeneder and aspmair , 2006 , lukeneder , 2010 ) , but a detailed ammonite biostratigraphy and zonation was still missing because ammonites have not been collected bed - by - bed over the last 150 years .
this paper presents the results of the systematic ammonite sampling at the puez section and concludes with a detailed ammonite zonation of that locality .
the mediterranean character of the ammonite fauna is comparable to numerous lower cretaceous east - central european ( czech republic , france , hungary , slovakia , spain ) , eastern europe ( bulgaria , rumania ) and african ( algeria , morocco ) localities .
the main goal of this paper is to present a valid definition of the lower cretaceous ammonite zonation within the dolomites for the puez formation .
the hauterivian and barremian ammonite faunas from the puez key - section can be correlated with the most recent ammonite standard zonation for the lower cretaceous ( reboulet et al . , 2009 ) .
future work will involve palaeomagnetic , isotope and geochemical analyses along with a precise biostratigraphy based on macro- , micro- and nannofossils .
the outcrop is situated on the puez - odle - gardenaccia plateau in the dolomites ( maps trentino alto adige ; south tyrol ; lukeneder , 2010 ) .
the grey , green to red succession of the puez formation is located on the southern side of the piz de puez .
the studied sites are outcrops on the puez - gardenaccia plateau ( lukeneder , 2010 ) .
they are located within the area of the puez - odle - geisler natural park in the northern part of the dolomites .
the dolomites ( permian cretaceous ) are an internal part of the southern alps ; they are a northern italian chain that emerged during the deformation of the passive continental margin of the adriatic (= apulian plate ) of the south alpine
apennine block ( dercourt et al . , 1993 , fourcade et al .
, 1993 , bossellini , 1998 , cecca , 1998 , stampfli and mosar , 1999 , scotese , 2001 , stampfli et al . , 2002 , bosellini et al . , 2003 )
this block was limited by the penninic ocean (= alpine tethys ) to the north and the vardar ocean to the southeast ( scotese , 2001 , stampfli et al . , 2002 ) .
the puez formation comprises three members from bottom to top : puez limestone , puez redbed and puez marl ( lukeneder , 2010 ) .
the succession shows a transition from limestones and marly limestones into a marl marly limestone alternation in the upper half of the section .
a detailed description of the geology and lithostratigraphy is given in lukeneder ( 2010 ) .
the complex mediterranean palaeogeography , and the presence of microplates in the tethyan oceanic corridor between africa and europe , was discussed in detail in lukeneder , 2010 , lukeneder , 2011 .
the trento plateau extends from the south ( around trento ) up to the puez region and was formerly surrounded by two basins : the lombardian basin to the west and the belluno basin to the east ( lukeneder , 2010 ) . according to recent investigations by muttoni et al .
( 2005 ) , the lombardian basin , and thus the adjacent trento plateau to the east , were located at approximately 20n in valanginian
during the late 19th and early 20th centuries , a rich fauna of cephalopods was collected from lower cretaceous sediments from this area by haug , 1887 , haug , 1889 , hoernes , 1876 , uhlig , 1887 , rodighiero , 1919 and pozzi ( 1993 ) .
additionally , microfacies and ammonites were reported from the alpe puez by cita and pasquar ( 1959 ) and cita ( 1965 ) , leading them to assume a hauterivian
after this period , documented by numerous publications on the ammonite fauna of the puez and adjacent areas by the latter authors , no further investigations were undertaken at the main locality of puez .
this phase of stagnancy in lower cretaceous papers was followed by descriptions of small ammonoid faunas from different localities near the puez area , e.g. , from la stua by baccelle and lucchi - garavello ( 1967 ) and sthr , 1993 , sthr , 1994 .
the latter papers compared the faunas from la stua with the puez ammonite faunas from haug , 1887 , haug , 1889 and uhlig ( 1887 ) .
the most recent contributions on the lower cretaceous of the puez area were published during the last decade and focused on stratigraphy ( lukeneder and aspmair , 2006 ) , palaeoecology ( lukeneder , 2008 ) and lithostratigraphy ( lukeneder , 2010 , lukeneder , 2011 ) .
the ammonites originate from the puez locality ( dolomites ; fig . 1 ) .
bed - by - bed collecting and a systematic - taxonomic study provide the basic data for statistical analysis of the investigated ammonite fauna .
the material was collected over the last 3 years within the fwf project p20018-n10 and is stored in the south tyrol museum of natural sciences and the natural history museum in vienna .
the preservation of the ammonites is fair ( mostly compressed steinkerns without shell ) and represents almost the totality of the macrofauna ( 96% ) .
approximately 1209 ammonites , 6 nautilids , 10 lamellaptychi , 6 belemnites , 150 sea urchins , 40 bivalves , 39 brachiopods , and abundant encrusting species ( bivalves , corals , serpulids ; lukeneder , 2008 ) were examined .
upper barremian genera : phylloceratidae with phylloceras , phyllopachyceras , sowerbyceras ; lytoceratidae with lytoceras , eulytoceras , protetragonites ; desmoceratidae with plesiospitidiscus , barremites , valdedorsella , abrytusites , ?
pseudohaploceras , melchiorites ; silesitidae with silesites ; holcodiscidae with astieridiscus , holcodiscus , maurelidiscus ; pulchelliidae with gerhardtia , heinzia , kotetishvilia , discoidellia ; haploceratidae with neolissoceras ; crioceratidae with crioceratites , pseudothurmannia , paracostidiscus ; emericiceratidae with emericiceras , honnoratia , paraspiticeras ; acrioceratidae with acrioceras , dissimilites ; ancyloceratidae with toxancyloceras , audouliceras ; heteroceratidae with moutoniceras ; leptoceratoididae with karsteniceras , hamulinites , sabaudiella ; ptychoceratidae with ptychoceras ; hamulinidae with hamulina , anahamulina , vasicekina , ptychohamulina , duyeina ; megacrioceratidae with megacrioceras ; macroscaphitidae with macroscaphites , costidiscus . conventions .
, 1996 , klein , 2005 , vermeulen and klein , 2006 and klein et al .
the detailed ammonite systematics and taxonomy were adopted and correlated with papers by numerous authors cited in section 5 below .
the ammonite species and resulting ammonite zones indentified herein for the puez formation allow a correlation of the hauterivian and barremian strata at the puez locality with the recent standard zonation ( reboulet et al . , 2009 ) .
the ammonite zonation established by the cretaceous ammonite working group ( kilian group ) at the international meeting on lower cretaceous ammonite zonation in vienna ( reboulet et al . , 2009 ) is followed .
hoedemaeker and rawson , 2000 , hoedemaeker et al . , 2003 and reboulet et al .
( 2006 ) have been considered for correlation of former and recent literature zonations . if a particular zonal index ammonite is absent the zonal boundary is interpreted by comparison with faunas that characterize the zone elsewhere .
the idea of a pseudothurmannia mortilleti subzone ( middle subzone within the pseudothurmannia ohmi zone ) is accepted .
p. mortilleti was meant to be a senior synonym of pseudothurmannia catulloi ( company et al . , 2003 , company et al . , 2005 , company et al . , 2008 ) .
a scheme is , therefore , followed that includes a p. mortilleti subzone ( fig . 2 , fig . 3 , fig . 5 , fig . 7 ) . the scheme including a p. catulloi subzone as in reboulet et al .
the biostratigraphy is compared to sections in europe ( abridgded list ) from the northern calcareous alps of austria ( immel , 1978 , immel , 1987 , vaek and faupl , 1999 , lukeneder , 2003 , lukeneder , 2004a ) , the gerecse and bakony mountains in hungary ( janssen and fzy , 2005 ; fzy and janssen , 2009 , fzy and janssen , 2006 ) , the balkan mountains of bulgaria ( dimitrova , 1967 , mandov , 1976 ) , the silesian units within the western carpathians and pieniny klippen belt of czech republic and slovakia ( uhlig , 1883 , vaek , 1972 , vaek , 1994 , vaek , 1996 , vaek , 2002 , vaek , 2008 , vaek et al .
, 2004 , vaek and michlik , 1999 ) , the southern alps of northern italy and umbria - marche apennines of central italy ( uhlig , 1883 , uhlig , 1887 , haug , 1887 , haug , 1889 , rodighiero , 1919 , cecca and pallini , 1994 , cecca et al .
, 1994a , cecca et al . , 1994b , cecca et al . , 1995 , cecca et al . , 1996 ,
1996 ) , different districts around the vocontian basin of southeast france ( pictet and loriol , 1858 , lory and sayn , 1895 , busnardo , 1965 , busnardo , 1984 , thomel , 1964 , autran , 1993 , delanoy , 1994 , delanoy , 1997 , vermeulen et al . , 1999 , vermeulen et al . , 2002 , vermeulen , 2002 , vermeulen , 2005a , vermeulen and lazarin , 2007 , bert et al . , 2008 ,
vermeulen , 2008 , vermeulen , 2009a , vermeulen , 2009b ) , the south and east carpathians of romania ( avram , 1990 , avram , 1994 , avram , 2001 , patrulius and avram , 2004 ) , the betic cordillera in southeast spain ( barga et al . , 1982 , aguado et al . , 1992 , aguado et al . , 2001 ,
company et al . , 2008 , hoedemaeker , 1994 ) and the swiss alps and ultrahelvetic units of switzerland ( ooster , 1860 , sarasin and schndelmayer , 1901 , sarasin and schndelmayer , 1902 , busnardo et al . , 2003 ) .
the biostratigraphy is compared with sections in north africa : algeria ( vermeulen and lahondre , 2008 ) and morocco ( company et al . , 2008 ) .
the biotratigraphic zonation at puez ranges from the upper hauterivian balearites balearis zone up to the upper barremian gerhardtia sartousiana zone ( fig . 2 , fig . 3 , fig .
not every standard zone or subzone could be detected at the locality using index ammonite species .
the balearites balearis zone is divided into the balearites balearis , binelliceras binelli , crioceratites krenkeli and spathicrioceras seitzi subzones ( reboulet et al . ,
2009 ) : for correlation , see also company et al . , 2002 , company et al . , 2003 .
the b. balearis zone is the oldest ammonite zone detected at puez , where the succession begins within the b. binelli subzone .
the dominance of the family crioceratidae ( e.g. , crioceratites and pseudothurmannia ) hints at the upper hauterivian .
4h ) and plesiospitidicus strengthens the upper hauerivian age for the lowermost parts of the puez formation at puez ( fig .
the b. binelli subzone is not indicated by the index species but occurs with the family phylloceratidae comprising phylloceras tethys and phyllopachyceras winkleri .
the b. binelli subzone is defined here to be located below the c. krenkeli subzone and characterized by the absence of c. krenkeli .
the c. krenkeli subzone begins with the first appearance of c. krenkeli within bed p1/21 ( fig . 3 ) .
the abundance of the index ammonite c. krenkeli and the co - occurring ammonite assemblage in beds p1/21 up to bed p1/44 hint at the presence of the c. krenkeli subzone .
the c. krenkeli subzone is dominated by the index ammonite c. krenkeli ( fig .
4a c ) and is accompanied by p. radians , anahamulina jourdani ( fig . 4 m ) , p. tethys , phyllopachyceras infundibulum ( fig .
( 2009 ) , b. binelli and c. krenkeli occur only in the uppermost part of the b. balearis zone , which is characterized by the range of the index species . the uppermost subzone within the b. balearis zone , the sp .
seitzi subzone , could not be determined so far based on the zonal index ammonite .
its base is tentatively located at the base of bed p1/44 ( fig . 2 , fig . 3 , fig . 4 ) .
beds within the b. balearis zone display relatively low numbers of species per bed from one to four .
the same numbers are shown in families per bed , with lower numbers in the lower parts increasing to the top of the zone ( fig .
the mean number of families in the b. balearis zone is five , the maximum is eight within the c. krenkeli subzone .
the evaluation of biodiversity calculated from the ratio between number of species vs. number of individuals per species , the shannon index , shows a mean value for the b. balearis zone of 0.84 ( min . 0.5 , max . 1.8 ;
this indicates a low species richness and low evenness in their abundance ( fig .
( 2003 ) reported a more intense ammonite diversification and increased abundance in several ammonite groups for upper hauterivian faunas within the zone from the betic cordillera compared to the subzones below ( e.g. , c. balearis and c. binelli subzones ) .
( 2003 ) broadly correlate with the data presented herein and show that the c. krenkeli zone is characterized by the occurrence of the index ammonites c. krenkeli , crioceratites majoricensis , a. jourdani , n. subgrasianum , p. subdifficilis , a. neumayri , p. guerianianum , d. vermeuleni , l. subfimbriatum , p. tethys , p. winkleri and p. infundibulum .
the same faunal compositions were shown by fzy and janssen , 2009 , fzy and janssen , 2006 within their crioceratites / pseudothurmannia assemblage for the b. balearis zone from the gerecse mountains in hungary .
the b. balearis zone embraces , according to these authors , phylloceras infundibulum (= phyllopachyceras infundibulum ) , phylloceras sp .
, lytoceras sp . , plesiospitidiscus spp . and typically crioceratites sp . accompanied by c. krenkeli .
the same condition can be recognized in the more southwestern bakony mountains of hungary ( fzy and janssen , 2006 ) with p. tethys , p. infundibulum , p. winkleri , l. subfimbriatum , neolissoceras grasianum , abrytusites ssp .
, p. subdifficilis , c. krenkeli , p. radians , silesites ssp . and discoidellia favrei .
this assemblage is equivalent to the fauna corresponding to the interval of the b. balearis zone ( c. krenkeli subzone ) and
data from puez correlate with reported upper hauterivian assemblages from the northern calcareous alps in austria comprising p. subdifficlis , p. cf .
doubleri , l. subfimbriatum , p. tethys and p. infundibulum ( vaek and faupl , 1999 ) .
the same situation was shown from the northern calcareous alps by lukeneder ( 2003 ) , who established a c. krenkeli - abundance zone similar to the c. krenkeli beds of puez comprising also abundant species such as c. krenkeli , p. infundibulum and l. subfimbriatum .
vaek ( 1999 ) reported m. doubleri from beds of the subsaynella sayni or p. ligatus zone from the northern calcareous alps in austria , and therefore appearing earlier than at puez , where it appears in the b. balearis zone .
( 1987 ) designated this new genus megacrioceras ( e.g. , m. doubleri ) for this upper hauterivian form of ptychoceratoidae .
they assumed a range for the taxon in southeast france from the s. sayni zone to the p. angulicostata zone .
( 1994 ) in silesian units of the western carpathians , showing the same dominance in pseudothurmannia .
zones (= euptychoceras borzai and c. binelli zones in vaek et al . , 1994 ) .
autran ( 1993 ) reported faunas from the upper hauterivian of the castellane region ( southeast france ) by referring to ammonite zonations as h6 ( b. balearis zone ; see busnardo , 1984 ) and h7 ( p. ohmi zone ) .
h6 was characterized by the assemblage of p. infundibulum , l. subfimbriatum , acrioceras sp .
paraspiticeras sp . , m. doubleri and p. favrei (= d. favrei ) .
upper hauterivian faunas from the historic veveyse de chtel section ( ultrahelvtique des pralpes externs ) in switzerland were reinvestigated by busnardo et al .
the fauna of the equivalent b. balearis zone comprises p. tethys , p. infundibulum , p. winkleri , l. subfimbriatum , lytoceras sp . and
the upper boundary of the comparable b. balearis zone at puez could not be attributed to a single bed and is tentatively located within bed p1/47 .
avram ( 1994 ) reported two different and specifiable pseudothurmannid assemblages for the south carpathian region around svinia .
the lower one is with pseudothurmannia pseudomalbosi from the b. balearis / p .
ohmi zone boundary , and the upper is characterized by the mixed assemblage of p. angulicostata , p. picteti and p. cf .
catulloi (= junior synonym of p. mortilleti ; see company et al . , 2003 , company et al . , 2008 ) accompanied by the first paraspiticeras specimens , making it comparable to the p. picteti zone at puez ( fig . 3 , fig . 4 ) .
avram ( 1994 ) also noted the presence of the first d. favrei (= avram s psilotissotia favrei ) within the first levels above the pseudothurmannia beds .
d. favrei starts at puez with p. pseudomalbosi within the p. mortilleti zone .
the accompanying lytoceratid and phylloceratid faunas are equivalent in both areas , i.e. , svinia and puez . at the puez section
it is tentatively located at the base of bed p1/47 ( fig . 2 , fig . 3 , fig . 4 ) .
zone reaches up to bed p1/86 ( fig . 2 , fig . 3 ) .
its base is tentatively located at bed p1/47 and its upper boundary is assigned to be at the top of the last bed before the overlying pseudothurmannia mortilleti subzone .
subzone ) is characterized by the presence of pseudothurmannia sp . , karsteniceras sp . and sabaudiella simplex ( fig .
the p. mortilleti subzone starts with the first appearance of p. mortilleti at bed p1/50 ( fig .
this appearance coincides at the puez locality with the last occurrence of c. krenkeli .
p. mortilleti typically co - occurs with p. pseudomalbosi from beds p1/50 up to p1/58 ( fig .
the p. mortilleti subzone from beds p1/50 to p1/65 comprises a characteristic ammonite association of p. mortilleti , p. pseudomalbosi , honnoratia thiollierei ( fig .
4j , k ) , hamulina sp . , anahamulina sp . , hamulinites munieri ( fig . 4p ) p. subdifficilis and plesiospitidiscus sp .
the subzone is also marked by the first occurrence of the family pulchelliidae with d. cf .
p. tethys , p. infundibulum , l. subfimbriatum , lytoceras sp . , and
the p. picteti subzone starts with its index species p. picteti from bed p1/66 and reaches up to the end of the p. picteti subzone , thus to the end of the ps .
the p. picteti subzone is characterized by the association of p. picteti ( fig .
additionally , representatives of the families phylloceratiodae and lytoceratidae occur with p. tethys ( fig .
4y ) , phylloceras sp . , p. infundibulum , l. subfimbriatum , l. anisoptychum ( fig .
haploceratidae show their last members with n. subgrasianum within the p. picteti subzone .
bed p1/86 therefore tentatively marks the upper boundary of the hauterivian . beds within the pseudothurmannia ohmi zone display numbers of species per bed from one to nine .
thirteen families occur within the zone with numbers per bed from zero to ten , with highest values in the p. mortilleti and p. picteti zones ( fig .
the mean number of families in the b. balearis zone is 8.6 , the maximum is twelve within the p. picteti subzone .
this indicates a higher species richness ( e.g. , twice ) than is seen in the b. balearis zone ( fig .
the p. ohmi zone with the p. ohmi , p. catulloi or p. mortilleti and p. picteti subzones are as proposed by company et al .
p. mortilleti was meant to be a senior synonym of p. catulloi ( company et al . , 2003 , company et al . , 2008 ) .
( 2008 ) established a scheme with a p. mortilleti zone , which is followed herein ( fig . 2 , fig . 3 , fig . 5 , fig . 7 ) .
ohmi zone in the gerecse mountains in hungary similar faunas to those of puez , dominated by p. infundibulum , phylloceras sp .
similar to the first appearance of d. favrei at puez within the p. mortilleti subzone , vermeulen ( 2002 ) reported first appearances of d. favrei and psilotissotia sp . at angles ( barremian stratotype ;
alpes de haut - prevence , southeast france ) from the same subzone , and additional occurrences within the p. picteti subzone .
equivalent faunas were reported from upper hauterivian sections of ro argos section in southeast spain by hoedemaeker ( 1994 ) .
he reported assemblages with p. tethys , p. winkleri , l. subfimbriatum , n. subgrasianum , d. favrei , p. mortilleti ,
p. catulloi , p. subdifficilis , c. krenkeli and first appearances of l. densibfimbriatum , p. crebrisulcatus , s. vulpes , paraspiticeras spp . and h. thiollierei ( hoedemaeker s emericiceras thiollierei ) at the top of hoedemaeker s pseudothurmannia catulloi
zone (= top of p. picteti zone in reboulet et al . ,
( 2007 ) , honnoratia honnoratiana and h. thiollierei are the same species ; hence , h. thiollierei is the senior synonym and has priority .
h. thiollierei and paraspiticeras first occur at puez within the p. mortilleti zone .
( 1982 ) from the jan province ( betic cordillera ) , comprising similar components to those of puez with p. mortilleti , a. tabarelli and first appearances of d. favrei (= p. favrei in barga et al . , 1982 ) within their
p. ohmi auct . zone and the p. mortilleti zone of reboulet et al .
zone , which corresponds to the upper part of the b. balearis zone ( i.e. , c. krenkeli subzone ) of reboulet et al .
vaek ( 1994 ) reported d. favrei (= vaek s p. favrei ) from the p. angulicostata zone of the western carpathians ( czech republic and slovakia ) , which is equivalent to the more recently established
d. favrei derives most probably from the p. mortilleti subzone because he gave the exact range of the appearance of his p. mortilleti (= p. catulloi ) .
cecca and pallini ( 1994 ) detected several assemblages from the umbria - marche apennines ( central italy ) with co - occurrences of p. mortilleti catulloi and d. favrei (= cecca and pallini s p. favrei ) .
they assumed the fauna to be uppermost hauterivian ( i.e. , former p. angulicostata auct .
zone , now p. ohmi auct . zone and p. mortilleti subzone ; reboulet et al . , 2009 )
. the subspecies name of p. mortilleti catulloi given by cecca and pallini ( 1994 ) once again shows the confusion within the determination of the members of the pseudothurmannia group , which is also evident for example in hoedemaeker , 1994 , vermeulen et al . , 2002 and company et al .
some species determinations made by cecca and pallini ( 1994 ) seem to be incorrect ( see also vermeulen and klein , 2006 ) because m. moutonianum can not occur with or above silesites seranonis and gerhardtia provincialis (= cecca and pallini s heinzia provincialis ) .
uppermost hauterivian faunas from the maiolica formation of the lessini mountains and central apennines ( northeastern and central italy ) were reported from faraoni et al . , 1995 ,
these faunas were regarded as having been deposited within a guide level , the so - called mediterranean faroni level ( see also galeotti , 1995 , baudin et al . , 1997 ) within the
p. ohmi auct . zone ( i.e. , p. catulloi subzone = p. mortilleti subzone ) .
assemblages include the same members as seen at puez with p. infundibulum , e. anisoptychum , p. catulloi , p. favrei (= d. favrei ) , plesiospitidiscus sp . and e. thiollieri (= h. thiollierei ) .
( 1994 ) , the transitional interval between uppermost hauterivian and lower barremian strata in southeast spain is often missing or condensed , depending on the palaeogeographic position during that time .
condensation in deeper environments and concurrent erosion and manifestation of hiatuses were detected in southeast spain ( company et al . , 1994 ) . as they showed in the sierra del corque ( capres section cp2 ; company et al . , 1994 ) , a total loss of sediments from the upper hauterivian ( b. balearites zone ) up to the holcodiscus caillaudianus zone ( sea - level rise ) occurs .
this fits well with the condensed lower lower barremian succession at puez , which needs more detailed sampling .
the kilian group replaced the h. callaudianus zone by the topmost m. moutonianum zone ( hoedemaeker and rawson , 2000 ) .
( 2003 ) described typical assemblages for the p. mortilleti zone , namely the occurrence of p. mortilleti , p. pseudomalbosi , e. thiollierei (= h. thiollierei ) , acrioceras meriani , anhamulina subcylindrica , p. subdifficilis , a. neumayri , p. guerianianum , first d. favrei , l. densfimbriatum , p. tethys , and p. infundibulum . as they noted , a prominent faunal turnover or renewal takes place within that zone , often referred to as the mediterranean faroni level ( faraoni et al .
, 1995 , faraoni et al . , 1996 , galeotti , 1995 , baudin et al . , 1997 ,
( 2003 ) described typical assemblages for the p. picteti zone , namely the occurrence of p. picteti , e. thiollierei (= h. thiollierei ) , acrioceras ramkrishnai , paraspinoceras morloti , a.subcylindrica , hamulinites munieri , and in the lower parts , the last specimens of p. subdifficilis and a. neumayri , barremites ssp .
, first appearances of silesites sp . , p. guerianianum , d. favrei , l. densifimbriatum , first members of p. obliquestrangulatum , p. tethys , and p. infundibulum . company et al .
( 2005 ) discussed faunal changes linked to the faraoni level of the betic cordillera .
they showed that the ammonite faunal changes ( e.g. , renewal ) from hauterivian to a more barremian face occurs stepwise during the p. ohmi subzone / p .
mortilleti boundary period , and at the base of the p. picteti subzone and within the upper part of the p. picteti subzone , both characterized by diversification and replacement of species .
the first step occurs during a second - order peak transgression , and the second at a sea - level highstand .
extinction event marked by extinctions of several species which appeared during the first two steps ( company et al . , 2005 ) ; this is linked to a major sea - level fall .
( 2005 ) noted the first step as being characterized by the disappearance of n. subgrasianum , p. infundibulum and l. subfimbriatum around the p. ohmi
mortilleti boundary , whereas new forms from pulchelliidae ( d. favrei ) and leptoceratoidinae ( hamulinites ) occur . at puez
the situation is similar because l. subfimbriatum disappears within the p. mortilleti subzone , and p. infundibulum disappears within the p. mortilleti subzone and reappears in the p. picteti subzone .
n. subgrasianum is very rare within the p. mortilleti subzone , whereas hamulinites and d. favrei first appear in this subzone .
the second step is somewhat less spectacular ( company et al . , 2005 ) , marked by species changes within genera and appearances of closely related forms at the base of the p. picteti subzone .
examples include p. mortilleti and p. pseudomalbosi replaced by p. picteti , acrioceras meriani by a. ramkrishnai , and the occurrence of paraspinoceras morloti .
the base of the p. picteti subzone is characterized by the third step , which ranges more or less up to the hauterivian / barremian boundary .
extinctions occur in the betic cordillera , for example , in p. picteti , hamulinites nicklesi , anhamulina fumisugina , p. morloti , and at puez in desmoceratidae , such as a. neumaryi in spain and abrytusites , p. breskovskii and p. subdifficilis .
in contrast , members of holcodiscidae as taveraidiscus in spain and maurelidiscus and astieridiscus both a puez , in addition to silesitidae with silesites occur within that interval .
real barremites dimboviciorensis in spain , and emericiceratidae occur with the last paraspiticeras guerini (= p. guerinianum in company et al . ,
( 2001 ) for the betic cordillera region ; this is closely similar to the most recent one by reboulet et al .
( 2001 ) characterized the b. balearis zone by the presence of anahamulina jourdani and rare first discoidellia .
additionally , numerous specimens of p. subdifficilis , a. neumayri , n. subgrasianum , l. subfimbriatum , p. infundibulum and p. winkleri occur .
zone = p. ohmi zone ; see reboulet et al . , 2009 ) and decided to record a subzonation with a lower p. ohmi , a middle p. mortilleti and an upper p. morloti subzone .
( 2001 ) is characterized by an assemblage with p. ohmi , n. subgrasianum , l. subfimbriatum , l. densifimbriatum and first appearances of silesites and barremites .
additionally , numerous specimens of subzonal index ammonites are p. mortilleti in the middle and p. picteti in the middle (= p. mortilleti subzone ) and subsequently in the upper parts (= p. picteti subzone ; reboulet et al . , 2009 ) of their p. mortilleti zone .
in southeast france the main occurrences of a. tabarelli were reported by thomel et al .
( 1990 ) to be lower barremian , starting from the basal barremian . at puez
( 2010 ) reported simlar faunal components from the upper hauterivian of southeast france with p. picteti and p. pseudomalbosi , plesiospitidiscus sp . and a. neumayri .
( 2003 ) reinvestigated and collected numerous faunas from the uppermost hauterivian from the historic veveyse de chtel section in switzerland .
. , 2003 ) zone comprises p. tethys , p. infundibulum , l. subfimbriatum , lytoceras sp .
, plesiospitidiscus spp . , p. guerinianum , the first abrytusites sp . , hamulina sp . , sabaudiella simplex , p. mortilleti (= parathurmannia mortilleti after busnardo et al .
( 2003 ) ) , as well as the first d. favrei and h. thiollierei (= h. honnoratiana after busnardo et al .
( 2008 ) reported uppermost hauterivian ( p. ohmi zone ) to upper barremian ( g. sartousiana zone ) faunas from the western high atlas .
they noted that most of the logs are not complete and comprise several hiatuses and condensation phases .
they showed that the p. ohmi subzone corresponds to a tst ( transgressive system tract ) and that the p. mortilleti subzone corresponds to the hst ( highstand system tract ) of the sequence ha6 ( the mfs , maximum flooding surface , corresponds to the base of the p. mortilleti subzone = faraoni level ) .
the sequence boundary ha7 is missing in most of the western high atlas localities owing to hiatuses , and followed immediately by the tst and hst of ha7 in the upper t. hugii zone .
the exact sequences at puez from t. hugii to m. moutonianum remain unclear , but seem quite similar . in morocco
the top of t. hugii and base of k. nicklesi were correlated to be the lst of barr1 , but missing .
the tst and hst ( upper part of k. nicklesi zone and lower part of n. pulchella zone ) coincided with a maxium flooding during the barremian .
the k. compressissima zone and the lower middle part of the c. darsi zone (= m. moutonianum zone ) would correspond to the tst and hst of sequence barr2 and the whole of sequence barr3 .
the lst of ba4 corresponds partly to the lower part of the t. vandenheckii zone , and the tst and maximum flooding surface ( mfs ) are represented in the g. sartousiana zone .
the end of barremian sedimentation is marked in the western high atlas by an unsynchronous late early barremian or early late barremian erosive unconformity ( see also hardenbol et al .
, 1998 , adatte et al . , 2005 , arnaud , 2005 ) .
according to data from the western high atlas of morocco ( company et al . , 2008 ) , the p. ohmi zone is characterized by typical faunas with p. ohmi , p. mortilleti , p. pseudomalbosi , p. subdifficilis , a. neumayri and parspiticeras sp . , which broadly correlates with the situation at puez .
by contrast to the situation with p. picteti , the p. picteti subzone and the lowermost part of the t. hugii zone are missing in morocco , marked by a hiatus , and the p. mortilleti subzone is directly overlain by lower barremian sediments .
the hauterivian / barremian boundary could not be determined based on the occurrence of index ammonites , neither could the index ammonite species be detected for the t. hugii auctorum zone or the kotetishvilia nicklesi , nicklesia pulchella and kotetishvilia compressissima zones ( see discussion ) .
the ammonite zonal boundaries are therefore given tentatively ( fig . 2 , fig . 3 , fig . 6 ) .
the base of the lower barremian is fixed at the bottom of bed p1/87 , which corresponds to the base of the t. hugii auct
it shows first appearences of barremites ssp . , melchiorites sp . , silesites sp .
zone , the lowermost zone of the lower barremian , is marked by an increasing number of members of the family desmoceratidae .
holcodiscidae show occurrences of the last astieridiscus sp . , whereas real holcodiscus appears and the first appearance of maurelidiscus cf .
the occurrence of m. kiliani ( within the m. kiliani zone ) was interpreted by vermeulen , 2005a , vermeulen , 2005b , vermeulen , 2009b ) to mark the basal barremian . the m. kiliani zone after vermeulen ( 2003 ;
see vermeulen , 2007b , vermeulen , 2009b ) was considered to be an equivalent of the taveraiduscus hugii zone after hoedemaeker et al .
representatives of the families phylloceratiodae ( p. tethys , p. infundibulum ; fig .
6u ) and lytoceratidae ( l. densifimbriatum ) complete the ammonite assemblage of the t. hugii auct .
eight families occur within the zone with numbers per bed from zero to six , with highest values in lowermost and uppermost parts ( fig .
subzone and an upper psilotissotia colombiana subzone ( reboulet et al . , 2009 ) .
rawson ( 1996 ) defined this zone and the first occurrence of t. hugii as the base of the barremian stage .
p. colombiana was considered as an index species of the zone ( vermeulen , 1996 ) . a detailed discussion on the zone is given by company et al .
. zone in the gerecse mountains of hungary show an occurrence of p. infundibulum , phylloceras winkleri (= phyllopachyceras winkleri ) , phylloceras sp .
, anahumulina sp . , hamulina sp . , and typically the pulchelliids d. favrei , t. hugii and taveraidiscus intermedius ( fzy and janssen , 2009 , fzy and janssen , 2006 ) .
lowermost barremian faunas from the veveyse de chtel section in switzerland ( busnardo et al . , 2003 ) comprise faunal equivalents of the puez t. hugii zone with p. tethys , p. infundibulum , l. subfimbriatum ; in the lowermost beds the last plesiospitidiscus and abrytusites specimens occur . h. thiollierei shows the last occurrence in the lowermost t. hugii beds .
they designated a spitidiscus hugii zone (= t. hugii zone after reboulet et al . , 2009 ) .
the lower t. hugii subzone was characterized by the presence of taveraidiscus ssp . , barremites boutini , lytoceras obliquestrangulatum (= protetragonites obliquetsrangulatum ) , hamulina munieri and the last occurrence of d. favrei .
the upper psilotissotia colombiana subzone is characterized by p. colombiana , holcodiscus , l. anisoptychum and anahamulina paxillosa . according to data from the high atlas of morocco ( company et al . , 2008 )
, two significant hiatuses appear at the hauterivian / barremian boundary and in the lower part of the k. nicklesi zone . both were related to third - order sea - level falls by company et al .
( 2008 ) , who pointed to similarities with the lowermost barremian ( t. hugii zone to k. compressissima zone ) intervals of the puez area . in both areas
the t. hugii zone in the high atlas is marked by the occurrence of emericicceras koechlini , a. tabarelli , d. favrei , barremites dimboviciorensis , l. densifimbriatum , paraspiticeras sp . and hamulinites sp . no index ammonites were found .
( 2008 ) and vermeulen ( 2002 ) , d. favrei extends only up to the lower part of the t. hugii zone in spain , morocco and france . at puez
the k. nicklesi zone extends from the bottom of bed p1/95 up to the top of bed p1/104 .
the overall situation and assemblage composition is a continuation of the underlying t. hugii auct
. zone in that it shows desmoceratidae with numerous specimens of barremites sp . and m. cassidoides .
hamulinidae occur with anahamulina sp . the phylloceratidae are characterized by the first appearance of p. ponticuli and more specimens of p. infundibulum .
beds within the k. nicklesi zone display numbers of species per bed from zero to three .
six families occur within the zone with numbers per bed from zero to five , with highest values in the uppermost parts ( fig .
the shannon index shows a mean value for the k. nicklesi zone of 2.8 ( min .
this indicates a strongly encreased species richness as seen in the k. nicklesi zone but values are shifted because the ammonite occurrence is limited to a single bed ( fig .
the base of the k. nicklesi zone zone is defined by the first occurrence of k. nicklesi ( company et al . , 2008 ) .
this part is mostly devoid of ammonites and therefore not yet defined at the puez locality .
more sampling is needed to confirm or refute any hiatuses . according to data from the western high atlas of morocco ( company et al . , 2008 ) , the k. nicklesi zone is only partly preserved there and encompasses only few beds .
the index ammonite was detected and additional rare specimens of e. koechlini , a. tabarelli , paraspiticeras sp . , hamulinites sp .
, lytoceras sp . and p. ponticuli were detected , accompanied by new forms such as torcapella barremensis , subbpulchellia oehlerti , almohadites camelinus , holcodiscus thomeli and davidiceras cf .
( 2008 ) noted that only the upper part of the k. nicklesi zone is represented in the western high atlas , following a hiatus in the lower part .
species from the moroccan locality include forms that should be found at puez for clarification of zonal boundary .
the n. pulchella zone corresponds to the bottom of bed p1/105 up to the top of bed p1/111 ( fig . 2 , fig . 3 , fig . 6 ) .
the ammonite assemblage is quite similar to that of the underlying k. nicklesi zone .
the family acrioceratidae occurs with the first specimens of dissimilites trinodosus ( fig . 3 , fig .
beds within the n. pulchella zone display numbers of species per bed from one to six .
families occur within the zone with numbers per bed from zero to three , the highest numbers being in the uppermost parts ( fig .
the shannon index shows a mean value for the n. pulchella zone of 1.3 ( min . 0.9 , max . 1.6 ;
this indicates a somewhat lowered species richness as seen in the uppermost barremian t. hugii auct .
the base of the n. pulchella zone is defined by the first occurrence of n. pulchella ( company et al . , 2008 ) . in accordance with hoedemaeker
( 2003 ) the n. pulchella horizon was elevated to the rank of a zone .
the n. pulchellia zone also replaces the upper part of the k. nicklesi zone ( hoedemaeker and rawson , 2000 ) .
comparable to the puez section , the n. pulchella zone described by fzy and janssen , 2009 , fzy and janssen , 2006 from the gerecse mountains are typical , with k. nicklesi ( determined as subpulchellia nicklesi in fzy and janssen , 2009 , fzy and janssen , 2006 ) and n. pulchella . the assemblage is dominated by the first species , but numerous silesites sp . , frequent holcodiscus ssp . and the first ocurrences of the genus barremites were reported .
the correlatable interval largely lacks ammonites and is not , therefore , yet defined at the puez locality .
the last specimens of e. thiollierei occur together with a. subcincta and silesites vulpes in the lower parts of the n. pulchella zone at angles ( southeast france ; vermeulen , 2002 ) .
the n. pulchella zone is dominated in the western high atlas of morocco by the index ammonite n. pulchella accompanied by members such as a. tabarelli , paraspiticeras sp . , hamulinites sp .
, lytoceras sp . and p. ponticuli along with forms such as d. cf .
potieri , the first specimens of m. nodosum and still frequent t. barremensis , which is replaced towards the top by t. suessi ( company et al . ,
the k. compressissima zone extends from the bottom of bed p1/112 up to the top of bed p1/118 .
the ammonite assemblage is quite similar to the underlying n. pulchella zone but more numerous in species and specimens .
, m. cassidoides and mechiorites sp . and the first specimens of valdedorsella cf .
6s ) and are accompanied by the first members of ptychoceratidae with ptychoceras sp . ( fig .
6h ) is the first member of macroscaphitidae to occur in the uppermost part of the zone .
the topmost part of the k. compressissima zone is marked by typical phylloceratidae with p. tethys , phylloceras paquieri and phylloceras sp .
, the first specimens of e. phestum and numerous specimens of protetragonites crebrisulcatum ( fig . 6s ) and protetragonites sp .
beds within the k. compressissima zone display numbers of species per bed from three to seven .
nine families occur within the zone with numbers per bed from zero to eight , the highest values being in the upper half ( fig .
the shannon index shows a mean value for the k. compressissima zone of 1.6 ( min . 0.7 , max . 2.3 ;
the values indicate a lowering of species richness and a low evenness in their abundance compared to those of the n. pulchella zone ( fig .
the k. compressissima and moutoniceras moutonianum zones were established after a proposal by company et al .
( 1995 ) and replaced the top part of the k. nicklesi zone and the holcodiscus caillaudianus zone ( hoedemaeker and rawson , 2000 ) .
( 2009 ) this zone is divided into the holcodiscus fallax , nicklesia didayana , heinzia communis and subtorcapella defayae horizons ( company et al . , 1995 , company et al . , 2008 , vermeulen , 2003 , vermeulen , 2007a , vermeulen , 2007b , vermeulen and klein , 2006 ) .
as noted by fzy and janssen , 2009 , fzy and janssen , 2006 this zone can be easily recognised in the gerecse mountains by the index ammonite k. compressissima ( determined as subpulchellia compressissima by fzy and janssen , 2009 , fzy and janssen , 2006 ) .
numerous holcodiscids occur throughout the zone , including holcodiscus gastaldianus , h. nicklesi , h. cf .
the latter species seems to be restricted to the lower parts and h. caillaudianus to the upper part of the zone ( company et al .
, 1995 , fzy and janssen , 2009 , fzy and janssen , 2006 ) .
( 2009 ) , where an h. fallax horizon is noted in the lowermost part of the k. compressissima zone .
after fzy and janssen , 2009 , fzy and janssen , 2006 , moutoniceras appears within that zone , whereby moutoniceras nodosum is first representative .
similar to the k. compressissima zone from puez , the assemblage from bersek quarry shows additional representatives such as barremites sp . , mechiorites sp . and the first specimens within leptoceratoididae with karsteniceras pumilum ( fig .
delanoy and joly ( 1995 ) and joly ( 2000 ) reported p. ponticuli ( as a typical member of upper barremian ammonite assemblages but rare in lower barremian ) at puez with the first appearance of p. ponticuli in the k. compressissima subzone .
( 1992 ) described barremian faunas from the subbetic domain in the betic cordillera , characterizing the subpulchellia compressissima zone (= k. compressissima ) by the index ammonite k. compressissima , subpulchellia nicklesi (= k. nicklesi of the recent k. nicklesi zone ; reboulet et al . , 2009 ) , n. pulchella ( index for the recent n. pulchella zone ; reboulet et al . ,
2009 ) , subpulchellia brevicostata ( k. brevicostata ) , h. perezianus and h. caillaudianus . at angles ( southeast france ) ,
first k. changarnieri occur in the stratotype in the uppermost k. compressissima zone in the lower s. defayae horizon (= s. defayae subzone after vermeulen , 2002 ) .
macroscaphites , costidiscus and e. phestum seem to originate in the k. compressissima zone at the puez locality .
the k. compressissima zone is characterized in the western high atlas of morocco by a faunal turnover .
this begins in the top of the underlying n. pulchella zone , marked by the new index form k. compressissima and other pulchelliids k. didayana , heinzia communis and , in upper parts , k. changarnieri . at the base of the zone
, holcodiscids show a characteristic diversification ( company et al . , 2006 , 2008 ) with h. fallax , h. perezianus , avramidiscus gastaldianus and , higher in the zone , h. caillaudianus .
ancyloceratoidea are present with m. nodosum , dissimilites dissimilis and members of toxoceras and hamulinites .
the occurrence of the index ammonite m. moutonianum ( bed p1/119 ) with the co - occurring ammonite assemblage hints at the presence of the m. moutonianum zone at the puez section ( fig . 2 , fig . 3 , fig . 6 ) .
the m. moutonianum zone corresponds to the interval from the bottom of bed p1/119 up to the top of bed p1/137 .
the family desmoceratidae is represented by barremites sp . and m. cassidoides . among the silesitidae , real s. vulpes ( fig .
heteroceratidae are present at the base of the zone for the first time with the zonal index ammonite m. moutonianum ( fig .
phylloceratidae are represented by the last individuals of p. tethys , phylloceras sp . ; moreover , p. infundibulum ( fig . 6 t , v ) , phyllopachyceras ladinum and phyllopachyceras sp . also occur .
beds within the m. moutonianum zone display numbers of species per bed from one to seven .
seven families occur within the zone with numbers per bed from zero to five , the highest values being in the lowermost beds ( fig .
the shannon index shows a mean value for the m. moutonianum zone of 0.7 ( min .
values indicate very low species richness and low evenness of abundance compared to other zones ( fig .
the m. moutonianum zone is defined by the first appearance of its index species and the co - occurrence in upper parts of toxancyloceras vandenheckii ( company et al . , 1995 ) .
the former coronites darsi zone sensu vermeulen , 1997 , vermeulen , 1998 ) and the c. darsi zone sensu company et al .
the heinzia sayni zone of vermeulen , 1997 , vermeulen , 1998 is equivalent to the t. vandenheckii zone . according to the data of vermeulen , 2005a ,
vermeulen , 2005b , the first occurrence of m. moutonianum coincides with that of c. darsi ( company et al . , 2008 ) .
( 2009 ) assumed that the m. moutonianum ( sensu company et al . , 1995 ) and c. darsi ( sensu vermeulen , 1997 , vermeulen , 1998 ) zones span the same stratigraphic interval .
the m. moutonianum zone (= coronites darsi zone in company et al . , 2008 )
is subdivided into a c. darsi horizon and a younger h. caicedi horizon ( reboulet et al . , 2009 ) . within the gerecse mountains , fzy and janssen , 2009 , fzy and janssen , 2006 noted the presence of the index species m. moutonianum and the genus heinzia with heinzia sp . and heinzia cf .
these authors reported the index ammonite co - occurring with abundant k. changarnieri and k. sauvageaui (= subpulchellia changarnieri and subpulchellia sauvageaui by fzy and janssen , 2009 , fzy and janssen , 2006 ) .
numerous specimens of the genus heinzia occur , and h. caicedi , when abundant , is typical for that zone .
( 2009 ) encompasses the upper half of the m. moutonianum zone : h. caicedi occurs a few beds lower in the k. compressissima zone at puez .
the family desmoceratidae shows mass occurrences of barremites and melchiorites in single beds ( fzy and janssen , 2009 , fzy and janssen , 2006 ) .
are present together with ptychoceras puzosianum within that zone ( fzy and janssen , 2009 , fzy and janssen , 2006 ) .
ptychocera puzosianum occurs somewhat later during the toxancyloceras vandenheckii zone in the subbetic region ( southeast spain ; company et al . ,
in contrast , it was found only much higher at puez in the g. sartousiana zone .
the acrioceratidae in spain occur once again with dissimilites trinodosum , and hamulinidae occur with several species of anahamulina sp .
avram , 1994 , avram , 2001 defined the ranges of d. dissimilis , d. trinodosum and d. subalternatus within the romanian carpathians .
he assumed that d. dissimilis was present only in the uppermost lower barremian , whereas d. trinodosum and d. subalternatus were characteristic for both the uppermost lower barremian and lowermost upper barremian .
( 2000 ) for a range of d. trinodosum starting in the k. compressissima zone and reaching up to the m. moutonianum zone .
according to vermeulen ( 2007a ) , species of the genus costidiscus appear from the t. vandenheckii zone and derive from ancestors in the base of the m. moutonianum zone (= c. darsi zone of vermeulen , 2007a ) .
as noted above , at puez costidiscus nodosostriatum occurs at the uppermost part of the k. compressissima zone or k. compressissima / m .
vermeulen ( 2007a ) rejected the idea of costidiscus macroscaphites being a sexually dimorphic pair owing to their different stratigraphical range , with costidiscus appearing in the t. vandenheckii zone and macroscaphites in the k. compressissima zone in southern france .
the same situation is shown herein and strengthens vermeulen s assumption , which contrasts with the remarks made by avram , 1984 , delanoy et al . , 1995 , wright et al . , 1996 and delanoy et al .
fzy and janssen , 2009 , fzy and janssen , 2006 reported that both macroscaphites and costidiscus were present in the m. moutonianum zone in the gerecse mountains of hungary .
uhlig ( 1883 ) and vaek and wiedmann ( 1994 ) noted the typical occurrence of karsteniceras pumilium in the lower barremian of the silesian unit ( czech republic ) , which is in accordance to the specimens found at puez .
avram ( 1994 ) reported a faunal condensation in the lowermost barremian of the south carpathian region around svinia .
nevertheless , the overall assemblages are almost identical to the puez faunas in that they comprise , from the beginning , d. favrei , barremites ssp .
the first representatives of macroscaphites and costidiscus occur together with e. phestum in the lowermost upper barremian of the svinia region , i.e. , t. vandenheckii zone .
macroscaphites , costidiscus and e. phestum seem to arise earlier in the k. compressissima zone at the puez locality .
the m. moutonianum zone of the subbetic domain in the betic cordillera was described by aguado et al .
specimens and subpulchellia (= kotetishvilia ) and holcodiscus . in vermeulen s ( 2002 )
report on pulchelliids from the stratotype of angles ( southeast france ) , the coronites darsi zone (= m. moutonianum zone in reboulet et al . , 2009 ) contains k. changarnieri ( throughout ) and k. sauvageaui ( upper part ) .
the base of the upper barremian is , according to vermeulen ( 2002 ) , marked by the h. uhligi zone (= lower part of the t. vandenheckii zone after reboulet et al . , 2009 ) , which is characterized by the co - occurrence of h. uhligi , k. changarnieri , k. sauvageaui , t. vandenheckii and rare specimens of moutoniceras and dissimilites .
the h. uhligi zone after vermeulen ( 2002 ) is followed by vermeulen s h. sayni zone (= upper part of the t. vandenheckii zone after reboulet et al . , 2009 ) , typical in showing h. sayni , dissimilites sp .
binodosus , ancyloceras vandenheckii (= t. vandenheckii ) and s. seranonis . the g. sartousiana zone , and especially the comparable g. sartousiana subzone , is characterized by the index ammonite and the co - occurrence of camereiceras cf .
limentinus , s. seranonis and ezeiceras janus (= janusites janus ) . the coronites darsi zone (= m. moutonianum zone in reboulet et al . ,
2009 ) is marked in the western high atlas of morocco by the rare occurrence of c. darsi and more abundant m. moutonuianum .
additionally , d. dissimilis , barremites vocontius and melchiorites rumanus are frequent and appear with c. darsi , k. changarnieri , t. suessi , holcodiscus diversecostatus , h. perezianus and s. vulpes .
the t. vandenheckii zone extends from the bottom of bed p1/138 up to the top bed p1/193 ( fig . 2 , fig . 3 , fig . 7 ,
the appearance of the index ammonite t. vandenheckii in bed p1/138 marks the lower boundary of the t. vandenheckii zone ( fig . 2 , fig . 3 , fig .
the t. vandenheckii zone is subdivided into the t. vandenheckii subzone and the younger b. barremense subzone .
owing to the absence of the subzonal index ammonites , the t. vandenheckii zone is tentatively subdivided into two equal parts at bed p1/172 , which corresponds with the last occurrence of heinzia cf .
the zone occurs with a typical ammonite fauna comprising members of the family desmoceratidae , with barremites sp . , valdedorsella sp .
occur within the holcodiscidae only in the lower part of the t. vandenheckii zone .
8x ) in the lower part and additional specimens of k. sauvageaui in both parts .
are frequent in the lower part and are accompanied by the zonal index species t. vandenheckii ( fig .
8 m ) and duyeina sp . , whereas the upper part is characterized by the occurrence of the hamulinid member vasicekina cf .
macroscaphitidae occur with only one specimen at the base , along with costidiscus sp . typical members within the phylloceratidae occur throughout the zone and include p. ponticuli , phylloceras sp .
, p. infundibulum , p. eichwaldi , phyllopachyceras sp . and sowerbyceras ernesti .
beds within the t. vandenheckii zone display numbers of species per bed from one to nine .
twelve families occur within the zone with numbers per bed from zero to eight , with highest numbers dispersed throughout the zone ( fig .
if separated into the t vandenheckii subzone and b. barremense subzone the former contains eleven families and the latter seven .
the shannon index shows a mean value for the t. vandenheckii zone of 1.1 ( min .
values indicate slightly higher values of species richness and higher evenness of abundance compared to the m. moutonianum zone ( fig .
the t. vandenheckii zone is marked by the first appearence datum of the index ammonite (= lower / upper barremian boundary ; rawson et al . , 1999 ) and
the co - occurrence g. sartousiana in the upper parts ( company et al . , 2008 ,
( 2009 ) the t. vandenheckii zone is subdivided into the t. vandenheckii subzone and the younger barrancyloceras barremense subzone .
the former h. sayni subzone ( reboulet et al . , 2006 ) was replaced by the lower t. vandenheckii subzone ( reboulet et al . , 2009 ) .
after vermeulen ( 2005b ) , duyeina kleini is characteristic for the g. sartousiana zone and gerhardtia provincialis zone , which were both incorporated into a single g. sartousiana zone with a lower g. sartousiana subzone , a middle g. provincialis subzone and an upper hemihoplites feraudianus subzone . in southern
france the genus duyeina itself appears throughout the upper barremian and has its ancestors in the t. vandenheckii zone ( vermeulen , 2005b ) , which subsequently could be the case with the specimen herein ( i.e. , duyeina cf .
the species k. changarnieri and k. sauvageaui are first present at puez within the t. vandenheckii zone ( lower part = t. vandenheckii subzone ) .
the first specimens of k. sauvageaui in southern france occur in the m. moutonianum zone within the h. caicedi horizon ( vermeulen , 1998 ) , whereas k. changarnieri has its acme in southern france within the k. compressissima zone and disappears in the heinzia sayni zone ( uppermost t. vandehckii zone of reboulet et al . , 2009 ) .
the same range for k. sauvageaui was reported from algeria by vermeulen and lahondre ( 2008 ) . at puez , h. cf .
h. syani occurs in the upper part of the t. vandenheckii zone , which is comparable to the h. sayni zone after vermeulen , 2007a , vermeulen , 2007b .
it disappears in the tethyan region at the base of the b. barremense subzone ( after vermeulen and lazarin , 2007 ) .
vermeulen and lazarin ( 2007 ) subdivided the t. vandenheckii zone into t. vandenheckii , h. sayni and b. barremense subzones .
( 2009 ) into a t. vandenheckii subzone and a younger b. barremense subzone .
the biozone is marked by the strong diversification of the ancyloceratoidae ( toxancyloceras , barrancyloceras ) and acrioceratidae ( dissimilites ) .
( 2008 ) is characterized by the co - occurrence of heinzia syani , kotethisvila sp . , gassendiceras sp . , barrancyloceras sp . and t. vandenheckii . the t. vandenheckii zone after bert et al .
( 2008 ) included the lower holcodiscus uhligi , the middle h. sayni and the upper b. barremense subzones , and several additional biohorizons were introduced .
the lower two subzones are time equivalent to the t. vandeheckii subzone after reboulet et al .
according to fzy and janssen , 2009 , fzy and janssen , 2006 the t. vandenheckii zone is the topmost preserved zone at the bersek quarry , shown by the presence of the index ammonite and h. sayni .
this agrees with the occurrence of h. sayni at puez within the entire t. vandenheckii zone .
the authors reported the t. vandenheckii zone by determining t. vandenheckii , h. sayni and an additional fauna comprising kotetishvilia sp .
( determined as subpulchellia in fzy and janssen , 2009 , fzy and janssen , 2006 ) , holcodiscus ssp . , dissmimites sp .
both the puez area and the gerecse mountains show the occurrence of small leptoceratoididae with karsteniceras and hamulinidae with hamulina sp . , a. cf .
vaek ( 1996 ) also reported t. vandenheckii from the central western carpathians ( butkov , quarry , slovakia ) . from the silesian of the czech republic , vaek , 1999 ,
, 2004 reported a typical upper barremian assemblage including macroscaphites binodosus and m. yvani , and c. nodosostriatus within the t. vandeheckii zone .
sauvageaui , described as deriving from the upper barremian from the silesian unit ( western carpathians ) .
patrulius and avram ( 2004 ) described but did not figure an assemblage comprising k. changarnieri and pulchellia caicedi (= h. caicedi ) as typical for their m. moutonianum zone .
( 1994 ) reported a comparable fauna from the t. vandenheckii zone in the sierra del corque ( capres section cp2 ) from an intermittent zone between the subbetic and prebetic ranges ( southeast spain ) .
the t. vandenheckii assemblage at capres is characterized by the typical co - ocurrence of p. infundibulum , m. cassidoides , barremites spp .
k. sauvageaui and k. cangarnieri ( subpulchellia sauvageaui and s. changarnieri of company et al . , 1994 ) ,
d. trinodosum , and t. vandenheckii (= ancyloceras vandenheckii in company et al . , 1994 ) .
( 1992 ) described barremian faunas from the subbetic domain in the betic cordillera with emericiceras barremense (= b. barremense ) , hemihoplites feraudi and heteroceras astieri zones for the upper barremian .
the upper barremian e. barremense (= b. barremense ) zone was reported with heinzia provincialis ( g. provincialis , index for g. provincialis subzone : reboulet et al . , 2009 )
the h. feraudi zone (= uppermost h. feraudianus subzone of the g. sartousiana zone ; reboulet et al .
( 2009 ) ) was characterized by the presence of macroscaphites yvani and m. ectotuberculatus , costidiscus sp .
, b. strettostoma , s. seranonis , pseudohaploceras and ptychoceras sp . additionally hemihoplites and the last subpulchellia (= kotetishvilia ) occur . the h. astieri zone was reported with a specimen of heteroceras sp .
the t. vandenheckii zone is not well represented in the western high atlas area in morocco ( company et al . , 2008 ) ; it is marked only by the index ammonite and by several members at the base such as h. sayni , the last m. moutonianum , barremites sp . and in the upper parts , new forms such as b. barremense sp . or k. sauvageaui .
the g. sartousiana zone at the puez section extends from the bottom of bed p1/194 up to the end of log p1 with the top of bed p1/204 .
the lower boundary is fixed by the first appearance of the zonal index ammonite g. sartousiana in bed p1/194 ( fig . 2 , fig . 3 , fig .
8 t ) . within the holcodiscidae , one last specimen of holcodiscus sp . was found .
pulchelliidae appear with the typical genus - pairing of the zonal index species g. sartousiana ( fig . 8w , y , z , za ) , gerhardtia sp . and k. sauvageaui ( fig .
macroscaphitidae appear with their most frequent members , namely m. yvani ( fig .
8zf ) , p. eichwaldi , p. ladinum , phyllopachyceras sp . and s. ernesti .
8zd ) , p. crebrisulcatum and protetragonites sp . throughout the g. sartousiana zone .
beds within the g. sartousiana zone display numbers of species per bed from one to fourteen .
ten families occur within the zone with numbers per bed from one to nine , the highest numbers being in the middle part , but high throughout the zone ( fig .
the shannon index shows a mean value for the g. sartousiana zone of 1.6 ( min .
values indicate ( not significant ) slightly higher values of species richness and higher evenness of abundance compared to the t. vandenheckii zone ( fig .
nevertheless , single beds within this zone have yielded abundances of ammonites with over 120 ( bed 197 ) or even more than 200 specimens per bed ( bed 199 ) .
g. sartousiana appears in the g. sartousiana zone and disappears within the g. provincialis subzone in algeria ( vermeulen and lahondre , 2008 ) and southern france ( vermeulen , 2002 ) .
delanoy , 1994 , delanoy , 1997 described typical asemblages from the g. sartousiana zone from the coupe vergons 2 section ( southeast france ) .
the fauna comprises similar assemblages with k. sauvageaui ( delanoy s psilotissotia sauvageaui ) and members of genera such as macroscaphites , costidiscus and s. vulpes , p. ponticuli , p. infundibulum and e. phestum .
delanoy ( 1997 ) described the same assemblage as typical for the g. sartousiana zone in southeast france .
they reported the anomalies in the first occurrence of different sections and therefore had difficulty marking the lower boundary of the g. sartousiana zone .
( 2008 ) were not accepted and transferred to the ammonite zonation scheme for the mediterranean by the kilian group ( reboulet et al . , 2009 ) .
( 2008 ) summarized the strong diversification in hemihoplitidae and the coeval decrease in pulchelliids after the acme of g. sartosuiana .
( 2008 ) included the lower camereiceras limentinus , the middle gerhardtia provincialis and the upper hemihoplites ferraudianus subzones .
equivalents are the g. sartousiana , the g. provincialis and the h. ferraudianus subzones after reboulet et al .
( 2008 ) is characterized by the co - occurrence of g. sartousiana , g. provincialis , c. limentinus , hemihoplites ssp . and
hemiholitidae with the genera hemihoplites , gassendiceras and pseudoshasticrioceras ( see bert and delanoy , 2009 , bert et al . , 2008 ) are still missing at the top of the puez section ( log p1 ) , implying the absence of the time equivalent beds from the middle part of the g. sartousiana zone , i.e. , the g. sartousiana / provincialis boundary upwards .
it is difficult to correlate with species determined by cecca and pallini ( 1994 ; see also vermeulen and klein , 2006 ) because no exact zonation is given and the boundaries are therefore uncertain , nonetheless , faunas seem to appear with same constituents as those of the late barremian time intervals detected at puez .
( 2009 ) divided the g. sartousiana zone into the g. sartousiana subzone , the g. provincialis subzone and the youngest h. feraudianus subzone .
( 2008 ) the former zone of h. feraudianus was lowered to the rank of a subzone and occupies the upper part of the g. sartousiana zone ( reboulet et al . , 2009 ) . concerning the arguments given by reboulet et al .
( 2009 ) , the boundary between the g. sartousiana and imerites giraudi zones is characterized by an important faunal turnover marked by the disappearance of pulchellidae and hemihoplitinae .
based on the ammonite assemblage and further lithological and microfossil analysis , the upper two ammonite subzones , i.e. , the g. provincialis and h. feraudianus subzones , are probably missing and a hiatus occurs at this time at the top of log p1 after bed p1/204 .
the hiatus in the mid g. sartousiana zone is comparable to situations in southeast spain ( company et al . , 1994 ) , where in the capres section the g. sartousiana ( including h. feraudianus subzone ) and imerites giraudi zones are condensed within only 2 m. the condensed lower part was determined by the index species of g. sartousiana ( heinzia sartousiana in company et al . , 1994 ) .
the g. sartousiana zone was reported only from the most distal localities in the western high atlas .
( 2008 ) reported a mixture of lower zone ammonites such as k. brevicostata , janusites cf .
janus and camereiceras sp . with ammonite forms characteristic for the upper part such as g. provincialis ,
( 2006 ) discussed the urgonian platform carbonates in the helvetic alps ( switzerland ) .
they demonstrated that the time of the g. sartousiana zone is coeval with the increasing productivity of the urgonian facies around the western tethyan realm .
( 2008 ) showed that , during the time represented by the b. balearis zone , a change to a more humid climate occurred ; this predates the faraoni event and the demise of the carbonate platform of the helvetic zone , lasting from the late hauterivian spathicrioceras angulicostatus and p. mortilleti zone ( zonation of godet et al . , 2008 ; = p.
2009 ) until the late early barremian c. darsi zone (= m. moutonianum zone in reboulet et al . , 2009 ) . from g. sartousiana zone times , the carbonate production on the platforms increased again , subsequently accompanied by a remarkable sea - level rise ( adatte et al . , 2005 , arnaud , 2005 , godet et al . ,
lithological differences observed around the puez are clearly consequences of an altered palaeo - oceanography and therefore reflect sea - level fluctuations during the early cretaceous , especially within the early late barremian ( i.e. , the g. sartousiana zone ) . a major rise in sea level took place during the time represented by the g. sartousiana zone ( adatte et al . , 2005 , arnaud , 2005 ) of the uppermost puez limestone member ( lower puez formation ; puez /
log 1 ) , containing the melchiorites - level ( beds p1/194 - 204 ) , which is dominated by the genera melchiorites and silesites ( fig . 2 , fig . 5 , fig . 7 ) .
( 2005 ) interpreted barremites , comparable to the morphotype melchiorites , as being epipelagic nekton and silesites was described as nektobenthic .
migrations have always been considered as being controlled by transgressive and regressive cycles in various lower cretaceous ammonite groups ( rawson , 1981 , hoedemaeker , 1990 ) .
this phenomenon was described by bulot ( 1993 ) as opportunity hufs ( horizons of faunal uniformity ) .
opportunity hufs were determined to be locally controlled by changing conditions marked by the change in palaeogeographic distribution or of palaeoecological ranges of different ammonite groups .
the remarkable assemblage change within the melchiorites - level ( g. sartousiana zone ) reflects a complex of changes in eustasy and in primary bioproductivity ( lukeneder , 2003 , lukeneder , 2004b ) .
the macrofauna of the puez formation at the puez section , especially of the puez limestone member , is mainly represented by ammonites . over 1200 ammonite specimens were collected by bed - by - bed sampling .
aptian and albian members such as the puez redbed member and the puez marl member are almost barren in ammonites and other macrofossils .
the ammonite zonation is based on the most recent standard zonation of the international kilian group on lower cretaceous ammonites ( reboulet et al . , 2009 ) .
several zones and even subzones based on the presence of mediterranean index ammonites , such as the c. krenkeli , p. mortilleti , p. picteti , m. moutonianum , t. vandenheckii and g. sartousiana ammonite zones , were detected .
the fossiliferous parts of the log begin with the upper hauterivian b. balearis zone ( b. binelli subzone ) .
the ammonite - rich section ends with a significant hiatus within the lower upper barremian g. sartousiana zone ( g. sartousiana subzone ) .
this hiatus is marked at the top of bed 204 by an omission horizon , and is directly overlain by the aptian puez redbed member .
the situation is comparable to that of other localities located in southeast spain and morrocco .
lower aptian hiatus extends from the middle part of the g. sartousiana zone up to the base of the aptian , reflecting the absence of at least the topmost part of the g. sartousiana subzone ( i.e. , h. feraudianus subzone ) and the entire i. giraudi zone .
the ammonite assemblage clearly indicates a mediterranean character , as reported from numerous comparable lower cretaceous localities in east - central european ( czech republic , france , hungary , slovakia , spain ) , eastern europe ( bulgaria , romania ) and african localities ( algeria , morocco ) .
the fauna is dominated by phylloceratids ( p. infundibulum , p. tethys ) , lytoceratids ( lytoceras , eulytoceras , protetragonites ) , desmoceratids ( barremites , melchiorites , silesites ) and anycloceratids ( anahamulina , crioceratites , dissimilites , karsteniceras , pseudothurmannia , toxancyloceras ) .
ammonite - rich beds were detected within the c. krenkeli zone , the t. vandenheckii zone and the topmost g. sartousiana zone .
abundance peaks occur in bed 66 ( n > 60 ) in the c. krenkeli zone and in the g. sartousiana zone in beds 197 ( n > 120 ) and 199 ( n > 200 ) .
the evaluation of biodiversity calculated by the ratio between number of species vs. number of individuals per species ( shannon index ) shows no clear significance throughout the puez section , although varying from highstand and maximum flooding phases from the upper hauterivian with mean values of 1.6 down to ( in steps ) values of 0.7 in the lower barremian m. moutonianum zone .
ammonite abundances are clearly linked to sea - level changes from late hauterivian to mid late barremian times .
abundance and diversity peaks occur during phases of high sea - level pulses and the corresponding maximum flooding surfaces ( p.
the uppermost hauterivian to lowermost barremian interval has often be reported to be difficult for biostratigraphy because of a potential condensation or a manifestation of a hiatus ( patrulius and avram , 2004 , company et al . , 1994 ) .
the ammonite data are the first step in a detailed biostratigraphic scheme for the puez key - section .
more investigations at the stratotype of the puez formation will be carried out within the dolomite project p20018-n10 ( project of the austrian science fund fwf ) .
additional ammonite collections will be carried out in future to determine the exact position of stage- , zone- , and subzone - boundaries .
analyses will include palaeomagnetic , isotope and geochemical analyses along with a detailed biostratigraphy based on micro- and nannofossils . | a biostratigraphic subdivision , based on ammonites , is proposed for the lower cretaceous pelagic to hemipelagic succession of the puez area ( southern alps , italy ) .
abundant ammonites enable recognition of recently established mediterranean ammonite zones from the upper hauterivian balearites balearis zone ( crioceratites krenkeli subzone ) to the upper barremian gerhardtia sartousiana zone ( gerhardtia sartousiana subzone ) .
ammonites are restricted to the lowermost part of the puez formation , the puez limestone member ( ca . 50 m ; marly limestones ; hauterivian
barremian ) .
numerous ammonite specimens are documented for the first time from the southern alps ( e.g. , dolomites ) .
ammonite abundances are clearly linked to sea - level changes from late hauterivian to mid late barremian times .
abundance and diversity peaks occur during phases of high sea - level pulses and the corresponding maximum flooding surfaces ( p.
mortilleti / p .
picteti and g. sartousiana zones ) .
the ammonite composition of the puez formation sheds light on the early cretaceous palaeobiogeography of the dolomites .
it also highlights the palaeoenvironmental evolution of basins and plateaus and provides insights into the faunal composition and distribution within the investigated interval .
the intermittent palaeogeographic situation of the puez locality during the early cretaceous serves as a key for understanding mediterranean ammonite distribution . |
the goldmann applanation tonometer ( gat ) has long been considered the most accurate and dependable instrument for determining intraocular pressure ( iop).1 noncontact tonometers ( ncts ) became available for clinical use over 30 years ago.2 iop is measured based on the force required to applanate the cornea by a puff of air .
highly trained personnel are not needed to obtain measurements , and ncts require no anesthetic or staining , which reduces the possibility of damaging the corneal surface and cross contamination . in one study ,
noncontact tonometry was found to be comparable to gat in eyes after refractive surgery.3 since their introduction , ncts have undergone technological improvements , simplifying their use and enhancing overall accuracy .
the portable nct , reichert pt100 ( buffalo , ny ) , has been used in community screenings supported by the friends of the congressional glaucoma caucus and the student sight savers program in the united states .
although various studies have demonstrated the accuracy and precision of noncontact or air puff tonometers in measuring iop and their correlation with gat,46 only one recent article has reported comparable performance of pt100 and gat.7 the purpose of this study was to further assess the agreement in iop measurements between gat and nct as measured by the pt100 .
the study population was recruited from comprehensive service of ut department of ophthalmology in memphis , tennessee .
patients signed a written consent to have their iop checked via both the pt100 and gat techniques , and one eye ( right eye ) was arbitrarily chosen for analysis .
patients were recruited from both morning and afternoon clinics and iop measurements were obtained at different time intervals .
a medical student operated the pt100 , while the goldmann tonometers were operated by trained residents and fellows in the clinics .
all iop readings were taken in the sitting position over fifteen minutes in a masked manner .
nct was performed before the gat to avoid the known mild reduction of iop by anterior chamber compression with gat.8 in order to minimize the effect of cardiac pulse on iop when using the pt100 , an average of three readings was recorded , as recommended by the manufacturer.6 any measurement with low confidence interval , as marked with an asterisk , or any out of class reading ( varying by 4 mmhg compared to other measurements ) , marked in brackets , was repeated .
after instillation of topical proparacaine drops , gat was performed according to standard protocol , using a haag streit slit lamp , which was calibrated according to the instructions and schedule provided by the manufacturer . only the first gat measurement on each eye
was used for the gat data since previous literature has reported that serial readings using the gat result in a statistically significant decrease in final iop measurements.8 an unpaired t - test was performed to compare the mean iop measurements obtained with two methods .
statistical analysis was performed using spss ( spss inc , chicago , il ) and primer of biostatistics software .
the study population consisted of 61% men and 39% women ; 56% african - american and 44% caucasian .
the mean sd intraocular pressure measurements were 15.98 5.48 mmhg and 15.65 4.26 mmhg for the pt100 and gat , respectively ( p = 0.64 ) .
the median iop was 15.0 mmhg for the gat and 14.3 for the pt100 measurements .
the range of measurements by gat was from 4 to 29 mmhg and by pt100 was 7 to 33 mmhg .
linear regression analysis of pt100 vs gat measurements revealed a slope of 0.98 with r of 0.58 , indicating comparable performance between the two instruments .
the proportion of eyes with gat measurement of iop 21 mmhg detected by pt100 was 8/8 ( 100% ) and the proportion of eyes with gat measurement of iop < 21mmhg detected by pt100 was 79/90 ( 87% ) .
the frequency of measurements by the two tonometers that were in agreement by 3 mmhg was 92.8% .
the mean difference between the measurements in eyes by the different techniques was 0.3 mmhg , with two sd = 7.1 mmhg .
the difference between measurements appeared to increase with increasing iop , suggesting an increase in variation as the magnitude of the measurements increased .
the role of tonometry in glaucoma screening has been controversial and appears to be of limited diagnostic value as a solitary test.9 nevertheless , it is commonly performed in glaucoma screenings in conjunction with other diagnostic modalities.10,11 screenings may utilize nonmedical and unlicensed personnel .
since nct does not require topical anesthetic or staining drops and the readings are largely operator independent , it allows screenings to be implemented without the direct supervision of medical doctors , allowing screening staff relative autonomy in operation.12 in this study , we found that the portable nct tonometer provided measurements of iop that were comparable to gat in normal patients .
previous comparative studies of iop measurements recorded with nct and gat have shown clinical agreement between the two devices,46 with a tendency towards lower reliability with nct in the higher pressures ranges.6,13 pt100 utilizes the same basic operating principles as the newer generation desktop models , such as the at550 ( depew , ny , usa ) .
at550 measurements have been found equivalent to gat in both normal14 and glaucomatous subjects,15 and comparable iop measurements have been found with portable ncts and previous generations of ncts.7,12 in our study , pt100 and gat demonstrated a close level of agreement when compared within the normal range of iop levels , as shown by the correlation of measurements in linear regression analysis and bland
differences in the performance of gat and nct have been reported with extreme range of iop values.12 in the small subset of eyes , the pt100 identified the majority of eyes with iop 21 mmhg ; however , further evaluation with a large sample size is needed to determine the accuracy of the device with increased iop , especially in screening settings where candidates may present with different levels of iop .
potential limitations of nct include the need for proper fixation , especially with pt100 since it does not have a headrest . although internal indicators within the device direct centration and improved alignment , some degree of practice is required to obtain accurate measurements
. the corneal surface should be regular and smooth for accurate measurements.16 one study has advised about the remote possibility of infection with nct due to micro - aerosol formation.17 another potential drawback is that all tonometers , including both gat and nct , are affected by corneal properties , such as corneal thickness , curvature , rigidity , and hydration.18 a limitation of this study was the relatively small numbers of eyes for analysis of measurement of increased iop , and the possible effects of central corneal thickness ( cct ) on iop measurements .
although this study was not intended to evaluate the influence of cct on iop measurements , ncts have been shown to be affected more by cct than gat.19,20 murase and colleagues have reported that pt100 is more affected by variations in cct than gat.7
the pt100 noncontact tonometer provides an accurate measurement of iop when compared with gat within the normal range of iop .
the pt100 has the advantage of portability , suggesting a possible use by non - medical personnel for nonoffice - based iop measurement . | purpose : noncontact tonometers are useful when regulations preclude use of contact tonometers by medical students and other nonophthalmologists .
our study compared the measurements by the portable , noncontact tonometer ( pt100 ) with goldmann applanation tonometry ( gat).methods : this was a prospective study of 98 eyes from 98 patients .
intraocular pressure ( iop ) was measured by gat and the pt100 ( reichert , buffalo , ny).results : mean iop measurements showed no significant differences in measurements performed by the two tonometers ( p = 0.64 ) .
measurements by the two tonometers were in agreement by 3 mmhg in 92.8% of eyes .
linear regression analysis of pt100 vs gat measurements revealed a slope of 0.98 with r2 = 0.58 .
bland
altman analysis showed a mean difference of measurements by gat and pt100 of 0.3 mmhg with two standard deviation = 7.1 mmhg.conclusion:the portable noncontact pt100 tonometer provides iop measurements comparable to gat within the normal range of iop . |
diabhycar was a 6-year clinical trial conducted in men and women with type 2 diabetes selected on the basis of persistent microalbuminuria ( uae , 20200 mg / l ) or macroalbuminuria ( uae
the trial tested whether a low dose of ramipril , an ace inhibitor able to reduce uae , also would reduce cardiovascular and/or renal events such as myocardial infarction , stroke , acute heart failure , esrd , and cardiovascular death .
for the purpose of the original diabhycar trial , a renal event was defined as the doubling of serum creatinine levels or the requirement of hemodialysis or renal transplantation ( esrd ) during follow - up .
an independent committee reviewed all case records to validate selection criteria , to grade the renal involvement of each patient , and to adjudicate the clinical events during follow - up ( 11 ) .
participants gave written informed consent and study protocols were approved by the ethics committee of angers university hospital .
copeptin concentration was measured in fasting plasma - edta samples , collected at baseline , and kept frozen at 80c .
an automated immunofluorescent sandwich immunoassay was used ( brahms copeptin us kryptor ct - proavp ; thermofisher scientific , hennigsdorf , germany ) ( 13 ) .
estimated glomerular filtration rate ( egfr ) was calculated according to the modification of diet in renal disease formula ( 15 ) .
variation of egfr during the study was computed as the difference between values at the end of follow - up and at baseline divided by the duration of follow - up .
tertiles of plasma copeptin concentration were computed separately for women and men to take into account sex - related differences in copeptin levels .
differences between groups were assessed by pearson test , wilcoxon / kruskal - wallis test , anova , and ancova .
when anova or ancova were significant , comparisons between pairs were made using the tukey - kramer honestly significant difference test .
kaplan - meier curves were used to plot survival ( renal event - free ) rates over time by sex - specific tertiles of plasma copeptin .
cox proportional hazards survival regression analyses were used to examine the effect of explanatory variables on time - related survival ( renal event - free ) rates in prospective analyses .
competing risk regression analysis ( fine and gray model ) was performed to estimate subhazard ratios of risk factors assuming death as a competing risk ( 16 ) .
adjustments for clinical and biological parameters were performed by including these parameters as covariates in the regression models .
interaction between plasma copeptin tertiles and sex or study treatment ( randomization group in the original diabhycar study : ramipril vs. placebo ) on the risk of renal events or in the comparison of egfr decline were assessed by including in the regression model ( cox or ancova ) a crossed compound covariate ( copeptin tertiles / sex or copeptin tertiles / study treatment ) .
c - statistics were used to compare areas of receiver operating characteristic ( roc ) curves .
data were log - transformed for the analyses when the normality of the distribution was rejected by the kolmogorov - smirnov - lilliefors goodness - of - fit test .
statistics were performed with jmp ( sas institute , cary , nc ) and stata ( statacorp , college station , tx ) software .
diabhycar was a 6-year clinical trial conducted in men and women with type 2 diabetes selected on the basis of persistent microalbuminuria ( uae , 20200 mg / l ) or macroalbuminuria ( uae
the trial tested whether a low dose of ramipril , an ace inhibitor able to reduce uae , also would reduce cardiovascular and/or renal events such as myocardial infarction , stroke , acute heart failure , esrd , and cardiovascular death .
for the purpose of the original diabhycar trial , a renal event was defined as the doubling of serum creatinine levels or the requirement of hemodialysis or renal transplantation ( esrd ) during follow - up .
an independent committee reviewed all case records to validate selection criteria , to grade the renal involvement of each patient , and to adjudicate the clinical events during follow - up ( 11 ) .
participants gave written informed consent and study protocols were approved by the ethics committee of angers university hospital .
copeptin concentration was measured in fasting plasma - edta samples , collected at baseline , and kept frozen at 80c .
an automated immunofluorescent sandwich immunoassay was used ( brahms copeptin us kryptor ct - proavp ; thermofisher scientific , hennigsdorf , germany ) ( 13 ) .
estimated glomerular filtration rate ( egfr ) was calculated according to the modification of diet in renal disease formula ( 15 ) .
variation of egfr during the study was computed as the difference between values at the end of follow - up and at baseline divided by the duration of follow - up .
tertiles of plasma copeptin concentration were computed separately for women and men to take into account sex - related differences in copeptin levels .
differences between groups were assessed by pearson test , wilcoxon / kruskal - wallis test , anova , and ancova .
when anova or ancova were significant , comparisons between pairs were made using the tukey - kramer honestly significant difference test .
kaplan - meier curves were used to plot survival ( renal event - free ) rates over time by sex - specific tertiles of plasma copeptin .
cox proportional hazards survival regression analyses were used to examine the effect of explanatory variables on time - related survival ( renal event - free ) rates in prospective analyses .
competing risk regression analysis ( fine and gray model ) was performed to estimate subhazard ratios of risk factors assuming death as a competing risk ( 16 ) .
adjustments for clinical and biological parameters were performed by including these parameters as covariates in the regression models .
interaction between plasma copeptin tertiles and sex or study treatment ( randomization group in the original diabhycar study : ramipril vs. placebo ) on the risk of renal events or in the comparison of egfr decline were assessed by including in the regression model ( cox or ancova ) a crossed compound covariate ( copeptin tertiles / sex or copeptin tertiles / study treatment ) .
c - statistics were used to compare areas of receiver operating characteristic ( roc ) curves .
data were log - transformed for the analyses when the normality of the distribution was rejected by the kolmogorov - smirnov - lilliefors goodness - of - fit test .
statistics were performed with jmp ( sas institute , cary , nc ) and stata ( statacorp , college station , tx ) software .
characteristics of participants at baseline by plasma copeptin tertiles and by sex are shown in table 1 .
for both men and women , subjects in the highest tertile were older , had higher hba1c levels , had lower egfr , and more often had arterial hypertension and proteinuria .
renal events during follow - up comprised 67 cases of doubling of serum creatinine and 19 cases of esrd in 76 subjects ( 2.45% ) .
individuals who presented a renal event , as compared with those who did not , at baseline had a longer duration of diabetes , and higher copeptin , hba1c , and triglyceride levels , and had lower hdl cholesterol levels .
they had lower egfr , higher uae , more often had arterial hypertension and proteinuria , and more often were treated by diuretics .
a history of myocardial infarction was more frequent in individuals who presented a renal event ( supplementary table 1 ) .
clinical characteristics at baseline by tertiles of plasma copeptin and by sex the incidences of renal events during follow - up by sex - specific tertiles of plasma copeptin were 1.06% ( t1 ) , 1.45% ( t2 ) , and 4.84% ( t3 ) for the whole population ( n = 3,101 ) .
they were 2.43% ( t1 ) , 5.11% ( t2 ) , and 11.81% ( t3 ) for the subset of subjects with macroalbuminuria at baseline ( n = 729 ) .
cox proportional hazards survival regression analyses showed a positive association of the highest tertile of plasma copeptin with the incidence of renal events in the whole population , as well as in the subset of subjects with macroalbuminuria at baseline ( fig . 1 and table 2 , model 1 ) .
this association remained significant when adjusted for baseline uae and egfr ( table 2 , model 2 ) .
the highest tertile of plasma copeptin was associated with the incidence of both outcomes comprising the renal events ( doubling of plasma creatinine and esrd ) in subset analyses stratified by outcomes ( supplementary table 2 ) . despite the smaller number of renal events in the subset of subjects with microalbuminuria at baseline ( 25 events in 2,372 subjects ) , the highest tertile of plasma copeptin
plasma copeptin levels were , on average , 15% higher in subjects treated with diuretics as compared with those who were not ( mean sem , 7.55 0.3 vs. 6.58 0.02
however , associations of copeptin tertiles with renal events were similar in subjects treated or not treated by diuretics , and no interaction copeptin / use of diuretics was observed ( data not shown ) .
kaplan - meier survival ( renal event - free ) curves during follow - up by tertiles of plasma copeptin .
renal events were defined as the doubling of the serum creatinine levels or esrd during follow - up .
risk of renal events during the follow - up by tertiles of plasma copeptin at baseline a stepwise multiple regression analysis was performed to evaluate the independence of the association of plasma copeptin levels with renal events from other potentially confounding covariates ( table 3 ) .
the renal event status during follow - up ( yes or no ) was entered in the model as the dependent variable .
sex , age , duration of diabetes , arterial hypertension status ( yes or no ) , use of diuretics ( yes or no ) , hba1c , triglycerides , hdl cholesterol , egfr , uae , and copeptin ( tertiles ) at baseline were entered as independent covariates .
uae and copeptin remained positively associated and hdl cholesterol and egfr were inversely associated with the incidence of renal events .
another potential confounder , smoking behavior , was not associated with plasma copeptin levels and had no impact on the association of copeptin with renal events ( data not shown ) . in an additional analysis , the inclusion in the regression model of blood glucose levels and blood pressure at baseline and changes in blood glucose levels and blood pressure during follow - up had no impact on the results .
we constructed roc curves with uae , plasma copeptin levels , or both as markers of renal events ( data not shown ) .
roc areas were similar for uae and plasma copeptin ( 0.78 vs. 0.73 ; c - statistics p = 0.16 ) adjusted for age , sex , and study treatment .
we observed an added effect for the combined markers ( uae plus copeptin roc area , 0.82 ) as compared with the uae effect ( p = 0.03 ) .
covariates associated with the incidence of renal events in a stepwise regression analysis death occurred in 454 subjects ( 14.65% ) during follow - up , including 19 subjects who had presented a renal event .
the association between tertiles of plasma copeptin and the incidence of renal events evaluated with the cox model might be biased if many patients died of other causes related to or associated with copeptin levels before achieving the renal end point ( 17 ) .
consequently , we performed competing risk regression analyses to estimate subhazard ratios of plasma copeptin tertiles as a risk for renal events assuming death as a competing risk .
subhazard ratios and hazard ratios from the cox model were similar , indicating that death was not a competing risk in the association of plasma copeptin levels with renal events ( table 2 , model 3 ) .
moreover , we observed no independent association of plasma copeptin levels with mortality during follow - up in our cohort ( supplementary table 3 ) .
the yearly variations of egfr during follow - up by tertiles of plasma copeptin were 0.65 0.24 ( t1 ) , 0.77 0.24 ( t2 ) , and 1.91 0.24 ml / min/1.73 m per year ( t3 ) ( mean sem , ancova p = 0.0001 , adjusted for sex , age , and study treatment in the original diabhycar trial ) for the whole population . they were 1.43 0.51 ( t1 ) , 2.29 0.49 ( t2 ) , and 3.52 0.44 ml / min/1.73 m per year ( t3 ) ( p = 0.005 ) for the subset of subjects with macroalbuminuria at baseline ( supplementary fig .
these differences remained significant after additional adjustment for the duration of diabetes , hba1c , triglycerides , hdl cholesterol , uae , arterial hypertension status ( yes or no ) , and use of diuretics ( yes or no ) at baseline ( p = 0.003 for the whole population and p = 0.03 for the subjects with microalbuminuria ) .
in all comparisons , either of the risk of renal events or of the variation of egfr during follow - up , we observed no interaction between copeptin tertiles and sex or between copeptin tertiles and study treatment ( ramipril vs. placebo ) in the original diabhycar study ( data not shown ) .
characteristics of participants at baseline by plasma copeptin tertiles and by sex are shown in table 1 .
for both men and women , subjects in the highest tertile were older , had higher hba1c levels , had lower egfr , and more often had arterial hypertension and proteinuria .
renal events during follow - up comprised 67 cases of doubling of serum creatinine and 19 cases of esrd in 76 subjects ( 2.45% ) .
individuals who presented a renal event , as compared with those who did not , at baseline had a longer duration of diabetes , and higher copeptin , hba1c , and triglyceride levels , and had lower hdl cholesterol levels .
they had lower egfr , higher uae , more often had arterial hypertension and proteinuria , and more often were treated by diuretics .
a history of myocardial infarction was more frequent in individuals who presented a renal event ( supplementary table 1 ) .
the incidences of renal events during follow - up by sex - specific tertiles of plasma copeptin were 1.06% ( t1 ) , 1.45% ( t2 ) , and 4.84% ( t3 ) for the whole population ( n = 3,101 ) .
they were 2.43% ( t1 ) , 5.11% ( t2 ) , and 11.81% ( t3 ) for the subset of subjects with macroalbuminuria at baseline ( n = 729 ) .
cox proportional hazards survival regression analyses showed a positive association of the highest tertile of plasma copeptin with the incidence of renal events in the whole population , as well as in the subset of subjects with macroalbuminuria at baseline ( fig . 1 and table 2 , model 1 ) .
this association remained significant when adjusted for baseline uae and egfr ( table 2 , model 2 ) .
the highest tertile of plasma copeptin was associated with the incidence of both outcomes comprising the renal events ( doubling of plasma creatinine and esrd ) in subset analyses stratified by outcomes ( supplementary table 2 ) . despite the smaller number of renal events in the subset of subjects with microalbuminuria at baseline ( 25 events in 2,372 subjects ) , the highest tertile of plasma copeptin
plasma copeptin levels were , on average , 15% higher in subjects treated with diuretics as compared with those who were not ( mean sem , 7.55 0.3 vs. 6.58 0.02 pmol / l ; p < 0.0001 , adjusted for age and sex )
. however , associations of copeptin tertiles with renal events were similar in subjects treated or not treated by diuretics , and no interaction copeptin / use of diuretics was observed ( data not shown ) .
kaplan - meier survival ( renal event - free ) curves during follow - up by tertiles of plasma copeptin .
renal events were defined as the doubling of the serum creatinine levels or esrd during follow - up . a : subjects with microalbuminuria or macroalbuminuria at baseline ( n = 3,101 ) .
risk of renal events during the follow - up by tertiles of plasma copeptin at baseline a stepwise multiple regression analysis was performed to evaluate the independence of the association of plasma copeptin levels with renal events from other potentially confounding covariates ( table 3 ) . the renal event status during follow - up ( yes or no ) was entered in the model as the dependent variable .
sex , age , duration of diabetes , arterial hypertension status ( yes or no ) , use of diuretics ( yes or no ) , hba1c , triglycerides , hdl cholesterol , egfr , uae , and copeptin ( tertiles ) at baseline were entered as independent covariates .
uae and copeptin remained positively associated and hdl cholesterol and egfr were inversely associated with the incidence of renal events .
another potential confounder , smoking behavior , was not associated with plasma copeptin levels and had no impact on the association of copeptin with renal events ( data not shown ) . in an additional analysis ,
the inclusion in the regression model of blood glucose levels and blood pressure at baseline and changes in blood glucose levels and blood pressure during follow - up had no impact on the results .
we constructed roc curves with uae , plasma copeptin levels , or both as markers of renal events ( data not shown ) .
roc areas were similar for uae and plasma copeptin ( 0.78 vs. 0.73 ; c - statistics p = 0.16 ) adjusted for age , sex , and study treatment .
we observed an added effect for the combined markers ( uae plus copeptin roc area , 0.82 ) as compared with the uae effect ( p = 0.03 ) .
death occurred in 454 subjects ( 14.65% ) during follow - up , including 19 subjects who had presented a renal event .
the association between tertiles of plasma copeptin and the incidence of renal events evaluated with the cox model might be biased if many patients died of other causes related to or associated with copeptin levels before achieving the renal end point ( 17 ) .
consequently , we performed competing risk regression analyses to estimate subhazard ratios of plasma copeptin tertiles as a risk for renal events assuming death as a competing risk .
subhazard ratios and hazard ratios from the cox model were similar , indicating that death was not a competing risk in the association of plasma copeptin levels with renal events ( table 2 , model 3 ) .
moreover , we observed no independent association of plasma copeptin levels with mortality during follow - up in our cohort ( supplementary table 3 ) .
the yearly variations of egfr during follow - up by tertiles of plasma copeptin were 0.65 0.24 ( t1 ) , 0.77 0.24 ( t2 ) , and 1.91 0.24 ml / min/1.73 m per year ( t3 ) ( mean sem , ancova p = 0.0001 , adjusted for sex , age , and study treatment in the original diabhycar trial ) for the whole population . they were 1.43 0.51 ( t1 ) , 2.29 0.49 ( t2 ) , and 3.52 0.44 ml / min/1.73 m per year ( t3 ) ( p = 0.005 ) for the subset of subjects with macroalbuminuria at baseline ( supplementary fig .
these differences remained significant after additional adjustment for the duration of diabetes , hba1c , triglycerides , hdl cholesterol , uae , arterial hypertension status ( yes or no ) , and use of diuretics ( yes or no ) at baseline ( p = 0.003 for the whole population and p = 0.03 for the subjects with microalbuminuria ) . in all comparisons ,
either of the risk of renal events or of the variation of egfr during follow - up , we observed no interaction between copeptin tertiles and sex or between copeptin tertiles and study treatment ( ramipril vs. placebo ) in the original diabhycar study ( data not shown ) .
in this study , we demonstrated that high plasma copeptin concentration was strongly associated with the risk of severe renal outcomes ( doubling of plasma creatinine concentration and/or esrd ) in patients with type 2 diabetes and albuminuria .
this association was independent of relevant covariates such as age , duration of diabetes , blood pressure , and baseline levels of hba1c , uae , and egfr .
plasma copeptin and uae similarly predicted the incidence of renal outcomes , and a 4% added effect was observed for the combined markers . to our knowledge , this is the first clinical study that investigates the association between vasopressin or copeptin concentration and accelerated renal function decline in type 2 diabetic patients during a long - term follow - up .
plasma copeptin has been shown to be positively associated with the prevalence of microalbuminuria in cross - sectional observational and long - term follow - up studies in the general population ( 8,18 ) . in autosomal - dominant polycystic kidney disease
, copeptin is associated with various markers of disease severity including albuminuria and gfr ( 1921 ) . in renal transplant recipients , higher copeptin level at baseline
was associated with a more rapid decline in effective gfr during 3- to 4-year follow - up ( 22 ) .
moreover , studies in australian and canadian community - based cohorts of the general population showed , respectively , an inverse linear relationship between fluid intake and prevalence of chronic kidney disease ( ckd ) ( 23 ) and a faster decline of egfr over time in people with lower 24-h urine volume ( 24 ) . the results of those population studies are in agreement with an adverse effect of vasopressin on kidney function . as in any epidemiological study ,
age and sex have been shown to influence urinary concentrating activity and vasopressin levels ( 25 ) .
we observed a positive association of age with plasma copeptin levels in men and women .
we also found copeptin levels to be higher in men than in women as previously observed ( 8,18,26 ) .
however , we observed no interaction between copeptin levels and sex on the risk of renal events .
moreover , when adjusted for confounding covariates , neither age nor sex was associated with renal events . in a recent study of 1,241 hemodialysis patients with type 2 diabetes in germany , high levels of copeptin were found to be associated with increased risk for all - cause mortality ( 17 ) . in our study ,
death was not a competing risk in the association of copeptin levels with renal events and we observed no association of plasma copeptin levels with mortality .
however , it is noteworthy that all subjects in the german cohort had esrd and were more severely ill than our patients .
it is possible to speculate that the association between copeptin and renal events could be explained , at least in part , by vasopressin - mediated changes in blood pressure .
vasopressin may contribute to hypertension through activation of v1a receptors on the vascular smooth muscle or by v2-receptor
however , the association between copeptin and renal outcomes was independent of blood pressure as previously noted for the association of copeptin and uae ( 8) .
experimental evidence strongly supports a causal role of vasopressin in aggravation of diabetic ckd through v2-receptor activation .
besides well - known antidiuretic effects at the collecting duct level , a v2-receptor agonist was shown to induce glomerular hyperfiltration and to increase uae in normal rats ( 9,28 ) .
moreover vasopressin has been shown to participate in progression to renal failure in rats with five - sixths reduction in renal mass ( 29,30 ) and in rodent models of type 1 diabetes ( 10,31 ) .
acute administration of ddavp has been shown to increase uae in healthy humans but not in patients with diabetes insipidus caused by mutations in the v2-receptor ( 9 ) .
. they may involve changes in the composition of the tubular fluid at the macula densa that influence tubuloglomerular feedback control of gfr , as well as an increase in intraglomerular pressure subsequent to afferent arteriole vasodilatation ( 32 ) .
the latter hemodynamic effect is supposed to be one of the main drivers in the decline of renal function in diabetic ckd since the pioneering works by brenner and colleagues ( 33,34 ) .
however , our study can not preclude or confirm any of these mechanisms because of its observational nature .
first , the design did not allow any conclusion regarding the possible causal relationship between copeptin and disease progression .
second , we have not measured the true gfr , but we used an estimation index based on plasma creatinine levels .
finally , half of the patients of diabhycar received ramipril during the follow - up and this drug may influence blood pressure .
however , we observed no interaction between copeptin and study treatment ( ramipril vs. placebo ) in any of our results , and adjustment for ramipril treatment had no impact on the results .
the strong and independent associations of copeptin with baseline albumin excretion rate and with progression to ckd offer new tools to identify patients with highest risk of progression .
several novel therapeutic strategies have been proposed for slowing the progression of ckd ( 4 ) .
some of them , like double - blockade of the renin - angiotensin system ( va - nephron - d study , nct00555217 ) or antibodies against tumor growth factor-1 ( nct01113801 ) , are still undergoing evaluation but their use will induce a higher risk of side effects , as suggested by the ontarget trial ( 35 ) .
we propose that plasma copeptin can help target patients with the highest risk of ckd progression to optimize the benefit / risk ratio .
water intake may lower vasopressin secretion ; such medicinal use of water has been discussed recently for kidney diseases other than diabetic nephropathy ( 36 ) .
also , vaptans ( vasopressin receptor antagonists ) could selectively target the v2 receptor mediated deleterious effects of vasopressin .
if the increase of water intake or v2 receptor antagonists were shown to be beneficial , then this could open the way to individualized therapy .
these interventions then could be used specifically in subjects with high copeptin levels who , presumably , would benefit the most from the reduction of vasopressin effects .
our study is the first investigation studying the association between endogenous vasopressin and kidney dysfunction in type 2 diabetic patients .
it highlights the role of copeptin as a risk marker for long - term renal outcomes in these patients .
furthermore , it provides a rationale for intervention studies aiming to reduce vasopressin secretion or action .
| objectiveplasma copeptin , a surrogate for vasopressin , was associated with albuminuria in population - based studies .
these associations are consistent with the effect of vasopressin on albuminuria observed in humans and rodents .
the objective of this study was to determine whether plasma copeptin is an independent marker of risk of renal events in people with type 2 diabetes and albuminuria.research design and methodswe studied 3,101 participants of the diabhycar trial ( 6-year follow - up ) with type 2 diabetes and albuminuria .
a renal event was defined as doubling of serum creatinine or development of end - stage renal disease.resultsduring follow - up , 86 renal events occurred in 76 subjects ( 2.45% ) .
incidences by tertiles of baseline plasma copeptin were 1.06% ( t1 ) , 1.45% ( t2 ) , and 4.84% ( t3 ) .
they were 2.43% ( t1 ) , 5.11% ( t2 ) , and 11.81% ( t3 ) for the subset of subjects with macroalbuminuria at baseline ( n = 729 ) .
hazard ratio for plasma copeptin tertiles as a risk for renal events was 4.79 ( 95% ci , 2.489.24 ; p < 0.0001 ; for t3 vs. t1 ) . in a stepwise regression analysis , urinary albumin excretion and plasma copeptin remained positively associated and hdl cholesterol and estimated glomerular filtration rate were inversely associated with the incidence of renal events .
these independent predictors explained 18% of the variance of the outcome .
the yearly variations of estimated glomerular filtration rate by copeptin tertiles were 1.43 0.51 ( t1 ) , 2.29 0.49 ( t2 ) , and 3.52 0.44 ml / min/1.73 m2 per year ( t3 ) ( p = 0.005 ) in subjects with macroalbuminuria.conclusionsplasma copeptin may help to identify subjects with diabetic chronic kidney disease who are at high risk for renal function decline . |
diclofenac is among the most widely used non - steroidal anti - inflammatory agents ( nsaids ) and has been the subject of numerous clinical investigations in the treatment of a wide variety of mild - to - moderate painful conditions , including low back pain .
the action of the combination of diclofenac ( 50 mg ) and vitamins b1 ( thiamine mononitrate , 50 mg ) , b6 ( pyridoxine hydrochloride , 50 mg ) and b12 ( cyanocobalamin , 1 mg ) vs diclofenac ( 50 mg ) monotherapy was evaluated in a previous clinical trial ( dolor study ) among patients presenting with acute lumbago .
primary outcome measures including visual analog pain scale results were reported in the previously published paper entitled diclofenac plus b vitamins versus diclofenac monotherapy in lumbago : the dolor study
. however , in addition to the outcomes reported in the dolor publication , other data that may also be relevant in terms of patient mobility were also recorded during the treatment period .
these measures included the finger - to - floor distance and the schober test , and are the subject of this paper .
in the dolor study , finger - to - floor distance ( ffd ) was recorded after having instructed the patient to plant both feet firmly on the floor and incline frontward with arms extended to the front .
the distance between the patient s middle finger and the floor was measured and recorded in centimeters ( cm ) .
the schober test results were recorded in the following manner : with the patient standing erect , the investigator was asked to place a mark over the spinous process of the 5th lumbar vertebra , and another mark 10 cm above the previous mark , in the midline .
the subject was asked to bend maximally forward and the distance between the two points ( cm ) was recorded .
patients randomized to treatment in the dolor study were divided into two treatment groups : group db ( n = 187 ) received the combination of diclofenac + b vitamins and group d ( n = 185 ) received diclofenac alone .
a total of enrolled subjects were scheduled to participate in study visits occurring at pre - treatment , visit 2 ( following 3 days of treatment ) , visit 3 ( following 5 days of treatment ) , and visit 4 at the end of the 7-day treatment period . at study visits 2 and 3 ,
patients presenting with significant clinical improvement were allowed to prematurely terminate treatment and exit the study .
improvement was defined as visual analog pain scale ( vas ) scores equal to or less than 20 mm on a 100 mm scale , and patient satisfaction with pain reduction .
accordingly , at visit 2 , 87 patients exited the study due to treatment success in the db group and 55 patients exited the study in the d group , leaving 87 patients continuing treatment in group db and 120 patients in group d. at visit 3 , a further 71 patients exited the study in group db and 52 in group d , leaving 16 subjects continuing treatment in group db and 68 subjects in group d. in this analysis , previously tabulated data from the clinical research forms of the dolor study were analyzed using the software graphpad prism 5 for windows , version 5.04 ( graphpad software , san diego ca ) .
statistical significance was defined with a two - tailed p - value of less than 0.05 with a confidence interval of 95% . for continuous variables ,
. additionally , the differences between pre - treatment and visits 2 , 3 , and 4 in the absolute number and percentage of patients with no change , improvement , or worsening of the schober test and the ffd test scores were calculated , and the results were also arranged on contingency tables and analyzed with the chi - squared test . in order to verify the presence of a correlation between decreased pain and improved mobility , we used the spearman non - parametric correlation for total patient population and within treatment groups , correlating vas scores with ffd and schober test scores at each study visit .
throughout the treatment period , there was a statistically significant correlation between the vas scores and the ffd in the total patient population and within treatment groups ( figure 1 ) .
this was not observed for the correlation between the schober s test scores and the vas scores ( table 1 ) .
correlations between vas scores with ffd and schober test scores . at pre - treatment , mean ffd in group db was 19.57 cm ( 6.27 ) , while that in group b was 21.19 cm ( 6.05 ) . following 3 days of treatment , the respective ffd scores were 13.72 cm ( 7.116 ) for group db ( statistically significant change from pre - treatment : p < 0.0001 ) and 16.64 cm ( 7.265 ) for group d ( statistically significant change from pretreatment : p < 0.0001 ) .
mean ffd scores at visit 2 were significantly lower among subjects of group db ( p = 0.0001 ) .
mean ffd scores following 5 days of treatment were : 9.899 cm ( 5.722 ) for group db and 12.86 cm ( 4.992 ) for group d. mean ffd scores at visit 3 were significantly lower in group db ( p = 0.0001 ) . at visit 4 ,
mean ffd in group db was 8.813 cm ( 3.559 ) and 10.49 cm ( 4.755 ) in group d , with no statistically significant between - group difference ( p = 0.1881 ) .
figure 2 summarizes the percentage of subjects presenting improvement , no change , or worsening of ffd at each study visit .
no statistically significant between - group difference was detected at any study visit ( visit 2 : p = 0.351 ; visit 3 : p = 0.465 ; visit 4 : p = 0.965 ) .
percentage of subjects in group db ( db ) and group d ( d ) presenting improvement , no change , or worsening of ffd at each study visit .
pre - treatment schober test scores were 16.01 cm ( 2.587 ) in group db and 16.1 cm ( 2.343 ) in group d. at visit 2 , group db scores increased in a statistically significant ( p < 0.0001 ) manner to 17.23 cm ( 2.431 ) and group d scores increased to 16.8 cm ( 2.26 ) ( p < 0.001 in relation to pre - treatment values ) . while the mean schober test scores in group db were higher than those of group d at visit 2 , this difference did not attain statistical significance ( p = 0.087 ) . at visit 3 ,
mean schober test scores in group db were 17.76 cm ( 2.214 ) , while those in group d were 17.22 cm ( 1.845 ) . while the mean schober test scores in group db were higher than those of group d at visit 3 , this difference did not attain statistical significance ( p = 0.0565 ) . at visit 4 ,
mean schober test scores among subjects of group db were 17.81 cm ( 2.073 ) and 17.56 cm ( 2.589 ) in group d , with no statistically significant between - group difference ( p = 0.7229 ) .
as the second most frequent symptom - related reason for physician visits after the common cold , low back pain represents one of the most common ailments in clinical practice , affecting up to 84% of adults at some point in time
.
low back pain carries a significant economic impact in terms of missed work , work - related disability , and medical expenses
.
it is also important to note that patients with low back pain present both subjective and objective alterations in functional status , interfering with the ability to carry out daily activities and , thus , presenting a significant influence on quality - of - life
,
.
mobility is an important component of quality - of - life in patients with low back pain , and is associated with a profound effect on several aspects of the affected patients life including the ability to carry out essential daily activities
.
mean ffd values did show superiority of the combination treatment over monotherapy after 3 and 5 days of treatment , but no between - group difference at treatment day 7 .
these results are in accordance with the overall findings previously reported in the dolor study of a faster time to treatment effect using combination therapy as compared to monotherapy
.
while the scores of the schober s test were higher among group db subjects at both visits 2 and 3 , the scores did not attain statistical significant superiority over those observed in group d. the results of this post - hoc analysis serve to highlight the correlation between mobility and pain intensity among patients presenting with low back pain .
the results of this post - hoc analysis show that combination therapy with diclofenac plus vitamins b1 , b6 , and b12 had additional positive effects on mobility restoration among the patients of the dolor study and serve to highlight the correlation between mobility and pain intensity among patients presenting with low back pain .
the two fundamental goals of low back pain therapy are to provide improvements in pain and function .
in this sense , the combination of diclofenac with the b vitamins was particularly effective in achieving both of these goals .
no funding was needed since this was a post - hoc analysis of data from a previously performed trial .
the authors report no conflicts of interest . the authors alone are responsible for the content and writing of the paper . | abstract
objective : to assess results of the finger - to - floor distance ( ffd ) and the schober test performed during the dolor study , and to verify correlation between visual analog pain scale scores ( vas ) with these measures .
research design and methods : previously tabulated data from the clinical research forms of the dolor study were analyzed ( statistical significance defined with a two - tailed p value < 0.05 and confidence interval of 95% ) . for continuous variables , the student s t- test or analysis of variance ( anova ) was used , and differences between pre - treatment and visits 2 , 3 , and 4 in the absolute number and percentage of patients with no change , improvement , or worsening of the schober test and the ffd test scores were calculated , and the results were analyzed with the chi - squared test .
spearman non - parametric correlation was used for correlating vas scores with ffd and schober test scores at each study visit .
main outcome measures : ffd , measured in centimeters ; schober test scores .
results : throughout the treatment period , there was a statistically significant correlation between the vas scores and the ffd in the total patient population and within treatment groups .
this was not observed for the correlation between the schober s test scores and the vas scores .
ffd scores within treatment groups improved progressively at each study visit , as did the schober test scores .
conclusions : the results of this post - hoc analysis show that combination therapy with diclofenac plus vitamins b1 , b6 , and b12 had additional positive effects on mobility restoration among the patients of the dolor study and serve to highlight the correlation between mobility and pain intensity among patients presenting with low back pain .
the two fundamental goals of low back pain therapy are to provide improvements in pain and function .
in this sense , the combination of diclofenac with the b vitamins was particularly effective in achieving both of these goals . |
weight - bearing ability has a major influence on the functional behavior of stroke
patients1 .
the degree of weight - bearing
asymmetry while standing still is related to motor function in stroke patients , and the
ability to shift weight in the forward and lateral directions is known to be highly related
to walking ability2 .
reported
that weight - bearing asymmetry while rising from a chair increases the likelihood of falls in
stroke patients3 .
strokes can manifest various clinical signs depending on the level and location of the
cerebrovascular disease .
one of the most common problems is a change in weight - bearing
asymmetry during exercise or in a standing position4 .
the primary goal of functional rehabilitation for a patient with
stroke - induced hemiplegia is to reduce the asymmetry of weight bearing5 .
an ankle - foot orthosis ( afo ) is generally used to improve a hemiplegic patient s weight
transfer and gait .
the afo partially corrects abnormal gait such as foot drop during the
swing phase , anteroposterior instability of the ankle and improper push off during the
stance phase6 .
moreover , it also supports
and protects ankle joints , as well as correcting movements and helping fixation7 .
the afo also increases the body s
weight - bearing on the affected side by improving the control ability of equinus or varus
ankles , and reduces energy consumption while the wearer is walking8 .
eng and chu evaluated weight bearing based on five functional standing tasks : rising from a
chair , quiet standing , lateral weight shift , forward weight shift , and backward weight
shift1 .
the current study examined how
an afo influences the weight bearing of chronic stroke patients during the performance of
these five functional standing tasks .
the subjects were 16 patients who had been diagnosed as having unilateral brain damage
based on ct and mri results .
the study subjects were chosen based on the following criteria : over six months
since stroke onset ; the patient had been prescribed an afo by a rehabilitation medicine
specialist ; the patient had an mmse - k score of 24 or over ; the patient was able to stand up
from a chair independently and had a modified ashworth scale rating of 0 to while 1 using
the afo .
the study excluded patients who were incapable of training , such as high - risk heart
disease patients , patients with internal diseases , and patients with musculoskeletal
disorders ( table 1table 1.general characteristics of subjects ( meansd)subject characteristics ( n=16)gender ( m / f)5/11age ( years)65.19.3affected side ( rt / lt)9/7modified ashworth scaleg0 : 10/g1 : 6time since stroke ( months)9.91.9height ( cm)162.24.6weight ( kg)68.59.2*p<0.05 ) .
this study was approved by daegu fatima hospital institutional review board
and consent was obtained from the subjects after the purpose of the study had been fully
explained to them .
all of the study participants performed the five functional standing tasks suggested by eng
and chu , and their weight bearing was measured on the affected side and on the unaffected
side while they performed each of the 5 tasks1 .
each of the standing tasks was performed five times by each patient
while wearing an afo and five times while not wearing an afo . in this study ,
the results of
the first and last trials were excluded and the mean values of the results of the middle
three trials were calculated .
the five functional standing tasks were : standing on both feet ( task 1 , rising from a
chair ; task 2 , quiet standing ) one foot ( task 3 , lateral weight shift ; task 4 , forward
weight shift , and task 5 , backward weight - shift ) .
the location of the feet and the force
measuring plates are shown in fig .
1.location of the feet and the force measuring plates during the standing tasksa :
rising from a chair ; b : quiet standing ; c , d : weight - shift laterally ; e , g :
weight - shift forward ; f , h : weight - shift backward . each task was performed using the following processes . in task 1 , weight bearing was
measured at the time the buttocks detached from the chair . in task 2 , weight bearing was
measured while the patient maintained a comfortable standing position . in tasks 1 and 2 ,
they were also asked to
load their weight evenly on both feet and to maintain that stance for two seconds . in task
3
, the subjects were asked to stand with their feet shoulder width apart and place maximum
weight on one foot . in task 4 ,
the subjects were asked to put one foot in front of the other
and place maximum weight on the front foot .
they were then asked to place the heel of the
front foot and the toes of the back foot on the same line and to maintain a width of one
foot between the two feet . in task 5 ,
the subjects were asked to put one foot behind the
other and place maximum weight on the back foot .
when performing tasks 3 , 4 , and 5 , they were asked to load their maximum
weight on one foot while keeping the other foot on the ground and were asked to maintain
that position for two seconds .
location of the feet and the force measuring plates during the standing tasksa :
rising from a chair ; b : quiet standing ; c , d : weight - shift laterally ; e , g :
weight - shift forward ; f , h : weight - shift backward the patients performed all the tasks barefoot and the tasks were also performed randomly to
eliminate learning effects .
two force measuring plates ( pdm - multifunction force measuring plate , zebris
medical gmbh , germany , 2004 ) were fixed firmly to the floor to measure the load on both
lower limbs .
one more plate was placed under the chair to detect the point at which the
buttocks detached from the chair .
the force plates measure static pressure and dynamic
pressure using 1,504 pressure sensors , each one covering 1 cm on a 32 47 cm
plate .
the force data was sampled at 600 hz . in this study , the weight - bearing values were measured in newtons and normalized by body
weight to calculate the weight - bearing ratio . in the case of weight - bearing tasks using both
feet
( tasks 1 and 2 ) , the measured value was divided by half the patient s weight the
body - weight ratio . in the case of weight - bearing tasks using one foot
( tasks 3 , 4 , and 5 ) ,
the measured value was divided by the patient s whole weight to calculate the body - weight
ratio .
the mann - whitney test , which is a
non - parametric test , was performed to compare the results of with and without an afo of the
affected and unaffected sides .
patients showed increased weight - bearing ability on the affected side while wearing the afo
in all tasks , and significant differences ( p<0.05 ) were found among tasks 1 , 2 , and 3
( table 2table 2.comparison of the tasks performed with and without an afo in terms of the
affected side ( meansd)taskparetic limbwith non - afo(newtons)paretic limbnormalized(%)paretic limbwith afo(newtons)paretic limbnormalizedwith afo ( % ) differencerising from a chair262.747.978.612.4335.657.3100.816.422*quiet standing265.246.779.914.2308.747.092.18.413*weight - shift laterally465.0105.069.011.4553.783.683.110.814*weight - shift forward399.3207.059.028.0430.5195.764.226.85weight - shift backward423.295.763.212.6456.395.868.413.05p<0.05 ) .
patients showed a small amount of increased weight bearing on the unaffected
side while wearing the afo in all tasks except for task 2 . in task 2 ,
weight bearing
significantly decreased ( table 3table 3.comparison of the tasks performed with and without an afo in terms of the
unaffected side ( meansd)taskparetic limbwith non - afo(newtons)paretic limbnormalized(%)paretic limbwith afo(newtons)paretic limbnormalized withafo ( % ) differencerising from a chair408.576.1121.312.4441.6110.3131.324.210quiet standing406.088.8120.014.2368.770.4109.511.811*weight - shift laterally575.1112.885.28.6576.588.485.97.10weight - shift forward485.1127.972.517.0508.9129.376.317.54weight - shift backward514.5118.175.99.7530.4110.978.38.53p<0.05 ) .
while a healthy person can maintain almost symmetric weight support when standing up or
standing upright9 , this is very difficult
for hemiplegic patients10 .
when a hemiplegic patient performs the task of rising from a chair balanced weight bearing
on both feet decreases the risk of fall3 .
according to the results of this study
, patients wearing an afo on the affected side
increased their weight bearing load from 78.67% to 100.83% while performing the task of
rising from a chair .
reported that wearing an afo improves a hemiplegic
patient s rising from a chair task performance11 , which is in agreement with the results of this study , indicating
that wearing an afo reduces the asymmetry of weight bearing .
eng and chu reported that there is a lower weight - bearing ratio on the affected side
compared to the unaffected side when a hemiplegic patient performs the quiet standing
task1 .
many studies have reported that
an afo increases the weight - bearing ratio on the affected side in the static standing
task4 , 8 ,
12 , 13 .
the results of the present study show that wearing an afo
increased the weight - bearing ratio on the affected side from 79.91% to 92.15% when the
hemiplegic patients performed the quiet standing task , suggesting that an afo improves
static balancing ability .
hemiplegic patients experience motor and sensory disability with abnormal body balance and
asymmetric posture .
in particular , they have difficulties with weight shifting and with the
ability to transfer their weight in various directions12 .
some studies have reported that wearing an afo improves gait speed
and balance14 , 15 .
sackey reported that improved weight - shifting ability correlates
with improvements in gait2 . among
weight - shifting tasks , eng and chu reported that transferring weight in a lateral direction
is the easiest ( due to the passive structure of the hip and knee , as well as the inherent
stiffness of the trunk and si joint ) , while transferring weight in a forward direction is
the most difficult ( as continuous muscle contraction and trunk motion control are required
to maintain the knee joint)1 .
the weight - bearing values were largest in
the order of lateral , backward , and forward directions . after wearing the afo , the patients
weight - bearing ratios increased in all weight - shifting tasks .
thus , it is clear that wearing
an afo allows hemiplegic patients to shift weight more easily in various directions thereby
improv their gait ability .
this study had limitations with regard to the generalization of the results , as the number
of subjects who met the selection criteria was relatively small .
in future studies , it will
be necessary to increase the number of subjects in order to assess the effect of an afo on
weight - bearing ability in acute and subacute stroke patients . | [ purpose ] this study examined how an ankle - foot orthosis ( afo ) influences the
weight - bearing of chronic stroke patients during the performance of five functional
standing tasks .
[ subjects and methods ] sixteen patients with stroke participated in this
experiment .
the subjects performed functional standing tasks with or without the afo and
weight bearing was measured during the tasks .
[ results ] patients showed increased
weight - bearing ability on the affected side during wearing the afo in all tasks , and there
were significant differences among tasks 1 , 2 , and 3 .
patients showed a small amount of
increased weight bearing on the unaffected side while wearing the afo in all tasks except
for task 2 .
[ conclusion ] adl - related functional standing tasks with afo increased the
weight bearing . |
acute appendicitis is a rare complication of colonoscopy that has been reported only 12 times in the english - language literature and is usually associated with obstruction of the appendiceal lumen with fecal matter during colonoscopy .
none of the previous reports have described findings of perforation of the appendix within 24 hours of colonoscopy .
we present the case report of a patient who underwent urgent laparotomy within 16 hours of colonos - copy for findings of free intraabdominal air and peritonitis from acute perforated appendicitis .
laparotomy was necessary to perform appendectomy , exclude a right colonic injury , and control intraabdominal sepsis .
in patients with abdominal pain who have had a recent colonoscopy , a high index of suspicion is necessary for accurate diagnosis of perforated appendicitis .
appendicitis after colonoscopy is a rare condition that has been reported only 12 times previously in the english - language literature .
we searched pubmed for the years 1985 through 2007 , using the search terms acute appendicitis , perforation , and colonoscopy .
the current case presents the unique findings of perforation of the appendix at 2 distinct sites immediately after colonoscopy , suggesting a new mechanism to the development of post - colonoscopy appendicitis .
a 55-year - old otherwise healthy man underwent screening colonoscopy without a biopsy at 8:00 am .
he was observed for 3 hours and discharged home at noon . over the next 2 hours , marked abdominal pain developed acutely , which led him to be brought in by ambulance to the emergency department 4 hours later .
an initial upright abdominal radiograph revealed multiple dilated loops of small bowel measuring up to 3.4 cm in diameter , without intraperitoneal free air .
a computed tomography ( ct ) scan was promptly obtained to investigate other causes of his abdominal pain .
this revealed a thickened appendix measuring 15 mm with an irregular wall ( figure 1 ) and surrounding fluid and fat stranding ( figure 2 ) .
associated free fluid in the pelvis was suggestive of perforated appendicitis . given the presence of acute peritonitis on physical examination , the patient was brought urgently to the operating room with a suspicion of perforated viscus .
computed tomographic scan demonstrating an enlarged appendix measuring 15 mm and mild dilation of the adjacent small bowel .
computed tomographic scan demonstrating adjacent fluid and fat stranding , without evidence of free intraperitoneal air . during the initial attempt at diagnostic laparoscopy ,
the patient had marked right lower - quadrant inflammation that raised the suspicion of right colonic injury .
the patient was found to have 2 perforations of a necrotic appendix ( figure 3 ) and diffuse peritoneal contamination , requiring open appendectomy , irrigation of intraabdominal infection , and drain placement .
photograph taken during the operation revealing 2 perforations of a necrotic appendix , demonstrated with a right - angle clamp .
one at the body of the appendix measured 0.81 cm ; the other near the tip measured 11 cm .
our search of the english - language literature found only 12 reported cases of acute appendicitis after colonoscopy .
each reported acute nonperforated appendicitis , and none described the perforation of the appendix within hours after colonos - copy .
the mechanisms by which colonoscopy might induce acute appendicitis are unknown , but other studies have postulated the following ( 1 ) : pre - existing subclinical disease of the appendix , ( 2 ) barotrauma resulting from overinsufflation , ( 3 ) introduction of a fecalith or impaction of stool into the appendix , leading to obstruction or inflammation , and ( 4 ) direct intubation of the appendiceal lumen or local edema from trauma induced by the endoscope .
our patient had no symptoms of appendicitis before colonoscopy , and no findings during the procedure were suggestive of acute appendicitis .
diffuse peritonitis with pelvic fluid developed rapidly within 16 hours of the procedure ; this time course suggests that the perforation may have been related to excess pressure from the endo - scope at the appendiceal lumen , and possible excess inflation . the fact that there were 2 sites of perforation one at the body of the appendix and one near the tip
possible entry of the colonoscope into the appendiceal lumen appears unlikely given the size of the colonoscope .
it would also be very unlikely for the colonoscope to have perforated the appendix proximally , and then reentered the tip distally .
another explanation is that there was a fistula of the appendix to itself , which was disrupted by insufflation during the colonos - copy .
this barotrauma may have led to immediate perfo - ration of the appendix , in the absence of a fecalith .
appendicitis is a rare but important complication of colonoscopy , and , as this case shows , can occur hours after the procedure .
we therefore think physicians who perform colonoscopies should consider a perforated appendix in the differential diagnosis of postprocedure abdominal pain , in addition to possible occult colonic injury .
a ct scan and physical examination should be used to confirm the diagnosis , and laparotomy may be required if marked intraabdominal inflammation is present . | background : acute appendicitis is a rare complication of colonoscopy that has been reported only 12 times in the english - language literature and is usually associated with obstruction of the appendiceal lumen with fecal matter during colonoscopy .
none of the previous reports have described findings of perforation of the appendix within 24 hours of colonoscopy.methods:we present the case report of a patient who underwent urgent laparotomy within 16 hours of colonos - copy for findings of free intraabdominal air and peritonitis from acute perforated appendicitis.results:laparoscopy confirmed 2 perforations of the appendix and diffuse peritonitis .
laparotomy was necessary to perform appendectomy , exclude a right colonic injury , and control intraabdominal sepsis.conclusion:in patients with abdominal pain who have had a recent colonoscopy , a high index of suspicion is necessary for accurate diagnosis of perforated appendicitis .
perforation can occur hours after colonoscopy even when a biopsy is not performed . |
upper airway diseases compass acute and chronic conditions . in this study , we focus on recurrent upper respiratory tract infections ( rurt ) , allergic rhinitis ( ar ) , nonallergic rhinitis ( nar ) , and acute and chronic rhinosinusitis ( ars / crs ) with and without nasal polyps .
these disorders are extremely common and present in all ages , all ethnic populations , and all countries . apart from their high socioeconomic burden ,
rhinitis is a symptomatic inflammation of the nasal mucosa including nasal symptoms like rhinorrhea , nasal obstruction , nasal itching , and sneezing .
the most common form of noninfectious rhinitis is ar with immunoglobulin e- ( ige- ) mediated immune response after allergen exposure .
nonallergic rhinitis shows periodic or perennial symptoms , which are not ige - dependent such as infectious or vasomotor rhinitis .
infectious rhinitis has either viral , bacterial , or other infectious agents origin and affects millions of people annually .
the european position paper on rhinosinusitis and polyps epos 2012 defines rhinosinusitis as an inflammation of the nose and paranasal sinuses characterised by two or more symptoms , one of which should be either nasal blockage / obstruction / congestion or nasal discharge .
further , either endoscopic or ct proof is obligatory . acute and chronic rhinosinusitis are distinguished in length of illness and grade of decay of symptoms .
it is characterised by a duration of more than 12 weeks without complete resolution of symptoms and affects approximately 515% of the general population [ 79 ] .
state - of - the - art documents aria and epos provide evidence - based treatment guidelines where anti - inflammatory medication represents the first - line treatment . along with steroid / pharmacological treatment ,
epos recommends nasal saline irrigation as additional first - line treatment in acute and chronic rhinosinusitis and after sinonasal surgery .
some reviews also state nasal irrigation as adjunctive treatment for allergic rhinitis , acute upper respiratory tract infections , and rhinitis of pregnancy [ 1113 ] .
data for nasal inhalation is limited ; epos mentions inhalation treatment only in acute rhinosinusitis without evidence .
other guidelines from the german society of otorhinolaryngology have an open suggestion for inhalation in rhinosinusitis for symptomatic relief .
the current treatment regimens for crs and ar are effective in the majority of patients , but there are a number of patients still suffering from symptoms . especially under chronic conditions with long - term drug consumption like glucocorticosteroids ,
it is observed that more and more patients inquire about nonpharmacological therapy approaches in the treatment of rhinosinusitis .
possible approaches besides the proven saline irrigation could be the use of thermal water irrigations and inhalations . concerning medical spending , a study by bhattacharyya points out that the annual costs for medication to treat crs with intranasal steroids , nonsedating antihistamines , and antibiotic therapy were $ 213 , $ 227 , and $ 335 in 2003 .
averaging the annual cost of sinus medications including over - the - counter remedies , nasal steroid sprays , and antibiotics , the calculations of gliklich and metson result in $ 1220 per patient . in the united states the medical spending for ar almost doubled from $ 6.1 billion in 2000 to $ 11.2 billion in 2005 .
nasal saline irrigation in ar patients helps to reduce medicine consumption by an average of 2.99% .
thermal water applications present an inexpensive nonpharmacological adjunction as well and could therefore further reduce the medicine consumption and costs .
balneum : bath ) is the science of natural curative waters , curative gases , and peloides and their use in the treatment of diseases not only as baths , inhalations , or irrigations but also as drinking cures or mud packs .
thermal inhalations and irrigations are century - old practices and already the romans appreciated the health - promoting effects of different thermal sources . according to german regulations , natural curative waters are characterised by a minimum content of 1 g dissolved minerals per liter . the designation thermal water requires a temperature of a minimum of 20c when emerging from the spring . among the many different types of thermal waters
it is said to break disulphide bonds of the mucin and activate breathing and blood circulation and helps to reduce inflammation [ 20 , 22 , 23 ] .
several studies show significant results in thermal water treatment with inhalation or irrigation treatment [ 2529 ] . up to now
no systematic review or meta - analysis on thermal water application in upper airway diseases exists .
a comprehensive search in the databases of medline ( medical literature analysis and retrieval system online ) , central ( cochrane central register of controlled trials ) , embase ( excerpta medica database ) , web of science , and medpilot was conducted . in the systematic search
the terms thermal water , spa therapy , thermal water inhalations , and spa treatment were combined with the terms rhinitis , rhinosinusitis ,
allergic rhinitis , chronic rhinitis , and nasal irrigation with the boolean operator and in all fields .
furthermore , the terms radon spa therapy , balneotherapy , sulphurous water , bromide water , iodic water , salty water , and radon water were linked through and with rhinitis or rhinosinusitis .
no limitation was made in language , publication date , and duration of the study or the demographic data of patients .
the inclusion criteria for this meta - analysis were as follows : clinical studies conducted with thermal water for the upper airway diseases , allergic , chronic , or acute rhinosinusitis , at least three or more points on the modified jadad scale , and the presence of the complete statistical data sets consisting of mean deviation , standard deviation , and sample size ( if appropriate , calculation using standard error or the upper and lower quartile ) at defined follow - up time points .
the following outcome parameters were examined in this study : the mucociliary clearance time ( mct ) , nasal respiratory flow ( flow ) , nasal resistance ( r ) , immunoglobulin values a , e , g , and m , and adverse events ( ae ) .
the search described above initially resulted in 2113 matches . duplicates and studies that were either nonclinical or disease - specific not relevant for this analysis were excluded so that the abstracts of 50 remaining studies were examined .
35 studies were investigated in full - text which led to the exclusion of another seven studies due to divergent treatment modalities [ 22 , 31 , 32 ] , mismatching disease patterns [ 33 , 34 ] , unavailability , or the conduction of the study with animals .
the remaining 28 articles were evaluated by two independent reviewers with the modified jadad scale by oremus et al . .
it amplifies the original 3-item jadad scale consisting of randomization , blinding , and study dropouts by adding inclusion / exclusion criteria , side effects , and statistical methods .
additionally , it features two bonus points for appropriate randomisation method and double - blinding . if this does not apply , these points are deducted .
we set a minimal score of at least three points to establish a qualitative homogeneity essential for our meta - analysis .
thus another 15 studies were excluded [ 3852 ] and 13 studies remained for our analysis .
the different thermal waters used in the studies included were pooled concerning their different substances .
this resulted in two main groups : sulphurous water with nine studies [ 2528 , 5357 ] and radon water with two studies [ 29 , 58 ] .
salt - bromine - iodine water and hypermineral chloride sodium water were used once .
we also pooled a common thermal water group to compare it to isotonic sodium chloride solution ( iscs ) and placebo .
the statistical calculations were performed using the statistic software comprehensive meta - analysis version 2.2.064 ( biostat , inc . ) .
the study values for the identified outcome parameters were sorted according to the time of measurement ( baseline , 12 days , 2 weeks , 30 days , and 90 days ) .
studies with the same parameter and different ( follow - up ) times of measurement , of 12 and 14 days , were combined to one - time measurement ( 2 weeks ) .
all points of measurements of the different studies were summarised and analysed using the random - effect model . the mean and , respectively , the standard error of the mean are depicted in the figures ( figures 25 ) . in the following analysis we assumed a significance if the p value was less than or equal to 5% ( p 0.05 ) .
for clarification , significant improvements / changes are marked with * in tables 47 .
for some identified parameters data were available from one study only and therefore had to be excluded from the meta - analysis but are , for the sake of completeness , included in the figures with an interrupted line .
in total , 13 studies published between 1998 and 2013 have been included in this analysis .
all forms of applications were pooled . the specific form of application and the number of patients is depicted in table 3 .
five studies are randomised , controlled , and double - blind [ 2528 , 54 ] ; other three studies are randomised and controlled [ 56 , 59 , 60 ] ; one study is controlled and double - blind ; one is only double - blind .
the remaining studies are not randomised , blinded , or controlled [ 53 , 57 , 58 ] .
iscs was used for the control groups , drinking water or distilled water for placebo groups .
a total number of 840 patients aged between 2 and 100 years took part in these studies , 510 of them received an application with thermal water , 285 were treated with iscs [ 2528 , 56 , 59 ] , 20 inhaled drinking water , and 25 inhaled distilled water .
mct was examined in seven studies with 422 patients in total ( table 4 ) .
thermal water ( radon , sulphur , and salt - bromine - iodine ) applications showed a significant improvement of mct compared to baseline at both points of measurement ( figure 2 ) .
the measurement for iscs compared to baseline showed no significance after two weeks but after 90 days in the followup .
only one study was conducted with placebo which did not show any significance neither did radon water applications ( p = 0.059 ) .
sulphurous water applications showed significant lower values after two weeks compared to the baseline value ( p < 0.01 ) and are also significant lower after 90 days compared to the baseline values ( p < 0.01 ) . in an internal comparison between the iscs group and the sulphurous water group we had nonsignificant initial situations ( p = 0.211 ) , but after 2 weeks and 90 days the outcome differed significantly ( p < 0.01 ) .
the iscs and the radon group already differed significantly in baseline values ( p < 0.05 ) and had almost parallel curves .
figure 2 illustrates all values calculated in the meta - analysis and noted in table 4 .
nasal resistance was measured in six of the included trials with a total number of 347 patients ( table 5 ) .
thermal water treatment was not significant after two weeks but after 30 and 90 days compared to baseline .
iscs treatment showed significance after two weeks and 30 days compared to baseline , but after 90 days there was no significance .
this graph ( figure 3 , iscs graph ) showed a very erratic curve due to the very heterogeneous study design and the different points of measurement of the three studies included . both the treatment with placebo and the treatment with radon water showed significance after two weeks .
the treatment with sulphurous water showed significance after 30 ( p < 0.01 ) and 90 days ( p < 0.05 ) but not after two weeks ( p = 0.118 ) .
the nasal flow was specified in three of the included trials with 117 patients ( table 6 ) .
figure 4 shows all included studies , using this outcome parameter , the dotted lines for placebo and sulphur indicate single studies . compared to baseline , the combined thermal water group ( p < 0.05 ) , as well as the radon ( p < 0.05 ) and the sulphurous water group ( p < 0.01 ) , showed significant improvement after two weeks , whereas drinking water application ( p = 0.425 ) showed no improvement or significance .
immunoglobulin concentrations in the blood were examined in two of the included trials [ 25 , 26 ] with a total number of 180 patients . both studies compared sulphurous water treatment to iscs treatment .
distribution of the number of patients ( 90 patients per group ) was equal in both studies .
sulphurous water treatment rose significantly ( p < 0.01 ) at both measurement points 12 and 90 days compared to baseline in contrast to iscs treatment which was neither significant after 12 days ( p = 0.442 ) nor after 90 days ( p = 0.567 ) .
no significant differences could be revealed in the analysis of the immunoglobulins a , g , and m , neither beyond the subgroups between iscs and sulphur nor in the individual groups between the baseline and the maximal treatment duration of 90 days .
all adverse events that occurred during the studies in the entire patient population were extracted and illustrated in forest plots . in total , 19 patients out of 840 treated patients suffered from study related adverse events .
all adverse events occurred under the treatment with sulphurous water : 13 patients experienced mild nasal irritation and a sensation of burning after application and five suffered from very limited epistaxis , one from an aggravation of the symptoms , and one from dermatological hypersensitivity .
no adverse events are reported for the treatment with another thermal water , iscs , or placebo . for sulphurous water , 19 adverse events occurred in a total group of 370 patients .
the assumed rate of adverse events ranged from 7.8 to 17.6% ( figure 6 ) .
by pooling all thermal water subgroups we received a total number of 510 treated patients with 19 adverse events .
this led to an adverse event rate of 9.8% with an assumed range from 6.6 to 14.4% ( figure 7 ) .
this review and its appertaining meta - analysis is the first systematic approach to thermal water treatment in upper respiratory tract diseases . for the identified outcome parameters
some significant improvements could be found in the treatment with thermal water irrigation and inhalation . in order to ensure methodological quality of the included trials , two independent reviewers applied the modified jadad scale to every study with a minimal score of 3 .
further this meta - analysis is calculated by the random effects model , which takes possible heterogeneity more into consideration than the fixed effect model .
the confidence intervals are broader and thus capture the true value of the meta - analysis .
where relative overestimation of smaller studies can result in greater inaccuracy , this is a more conservative and cautious estimation .
in addition , we pooled the clinical pictures of allergic , acute , and chronic rhinosinusitis as well as studies with children , adults , and elderly people . in two studies patients with minimally invasive functional endoscopic sinus surgery ( fess ) before treatment
nasal irrigation had a direct physical cleansing effect by flushing out thick mucus , crusts , debris , allergens , and air pollutants . in a review by hermelingmeier
the conclusion drawn is that there is no clear data available naming the most advantageous form of application in nasal saline irrigation .
the present meta - analysis shows a significant advantage of mucociliary clearance changes with thermal water in comparison to isotonic saline solution .
this leads to a more detailed view of the results of thermal water applications found in this meta - analysis .
the mct parameter comprises the best set of data in our meta - analysis with seven included studies and 422 patients .
mucociliary clearance is an important defence mechanism for both upper and lower airways and its impairment [ ] predisposes to chronic infection of the nose , paranasal sinuses and the respiratory tree .
the average mct values range below 15 minutes with a test duration of less than 1 hour . in this meta - analysis a significant improvement of the mucociliary clearance could be determined in thermal water applications .
hereby , the transport time could be reduced from 19.67 minutes initially to 12.98 minutes after two weeks and to 11.34 minutes after 90 days .
especially the application of sulphurous water showed a high significance ( p < 0.001 ) after the two - week treatment period . at the same time the treatment with radon thermal water ( p = 0.059 ) only just lacked a significant improvement ( p = 0.059 ) .
the literature available for these two subgroups was 5 : 2 with only 60 patients in the radon group which might have had an influence on the significance .
in contrast to the thermal water group , the iscs group only showed significance after 90 days of treatment .
in turn the literature available was quite strong with 4 studies and a total of 205 patients .
based on marullo 's study only it was not possible to conduct a meta - analysis and draw a valid conclusion on the use of placebo .
the meta - analysis of the mucociliary clearance time showed a significant benefit especially of the pooled thermal water treatment and sulphurous water over iscs .
the nasal resistance is the resistance offered by the nasal cavity to inspired air and it is measured in pascal ( pa ) .
all studies used for this analysis already resulted in significant changes after two weeks of treatment with radon thermal water .
displayed a high deviation from the baseline of 13.1 pa , which was reduced to 1.28 pa after two weeks and remained rather high after 90 days of treatment with 1.12 pa .
opposed to these findings were those of the two other studies of this pool [ 27 , 28 ] , which began with much lower baseline values of 0.14 and 0.17 pa and had different followups .
therefore these led to an unsteady curve and limited the possibility of a serious interpretation of the healing process .
the treatment with sulphurous water showed good results throughout the whole treatment period of 90 days .
the results were even better after 30 and 90 days than at the beginning , which allows for the assumption that a more permanent improvement is gained here . based on this meta - analysis
the data is quite limited with the results of only one study for placebo and one for sulphurous treatment , so that we can not compare it to the pooled results .
the use of radon thermal water as well as the entire thermal water subgroup showed a significant improvement in the nasal flow after two weeks of treatment . in our meta - analysis of ige , sulphurous water treatment was highly significant after 12 and 90 days .
the present ige results were measured in patients with chronic inflammatory conditions , where eosinophil cells in the mucus are increased .
reduction of eosinophil cells after thermal water treatment was also reported in passali et al . and significantly decreased in staffieri and abramo .
hypereosinophilia is related to high levels of serum concentrations of ige [ 26 , 70 ] .
the ige concentration which decreased significantly after the application with sulphurous water confirmed beneficial effects on chronic inflammatory disorders .
sulphurous water helps to clean the nasal mucosa from irritations and reduces immune responses at a local level [ 25 , 71 ] .
iga , igg , and igm values in the blood did not increase significantly neither with sulphurous water nor with iscs .
unfortunately the literature available on the secretory iga , which is secreted across the mucosa and plays a significant role in specific immune defence by preventing or blocking the adhesion of bacteria and defending the mucous membranes from common infection [ 72 , 73 ] , was not sufficient for a statistical analysis .
adverse events occurred in 19 out of 510 thermal water treatments and mainly consisted of mild nasal irritation , a sensation of local burning after application , and very limited epistaxis .
it should be noted that both the studies by staffieri et al . and ottaviano et al . were conducted in a postoperative setting , which makes the occurrence of such adverse events more likely .
further , the study by de luca et al . was conducted with elderly people between 72 and 100 years .
nasal application of thermal water results in a significant improvement of mct , nasal flow , nasal resistance , and ige concentration . the systematic review and the meta - analysis demonstrate an advantage of thermal water treatment over isotonic saline solution and placebo .
even though this aspect needs to be investigated further with randomised controlled trials in bigger cohorts and longer follow - up periods , it was shown that the application with thermal water can serve as additional nonpharmacological alternative . | background . thermal water inhalations and irrigations
have a long tradition in the treatment of airway diseases .
currently there exists no systematic review or meta - analysis on the effectiveness of thermal water treatment in upper respiratory tract diseases . methods . a systematic search in the databases of medline , embase , central , isi web of science , and medpilot was accomplished .
results .
eight evaluable outcome parameters from 13 prospective clinical studies were identified for 840 patients .
mucociliary clearance time improves significantly ( p < 0.01 ) for the pooled thermal water subgroup and the sulphurous subgroup after 2 weeks ( 6.69/minutes ) and after 90 days ( 8.33/minutes ) , not for isotonic sodium chloride solution ( iscs ) . nasal resistance
improved significantly after 2 weeks ( radon , iscs , and placebo ) , after 30 days ( sulphur and iscs ) , and after 90 days ( sulphur ) .
nasal flow improved significantly with the pooled thermal water , radon alone , and iscs subgroups . for the ige parameter only sulphurous thermal water ( p < 0.01 ) and iscs ( p > 0.01 ) were analyzable .
adverse events of minor character were only reported for sulphurous treatment ( 19/370 ) .
conclusion .
thermal water applications with radon or sulphur can be recommended as additional nonpharmacological treatment in upper airway diseases .
also in comparison to isotonic saline solution it shows significant improvements and should be investigated further . |
non - hodgkin lymphoma ( nhl ) consists of a heterogeneous group of malignancies with varied clinical presentation and biological behaviors .
the estimated number of new cases in 2014 is 70 000 , which represents 4% of all cancers diagnosed and 3% of cancer deaths in the united states .
the histological subtypes of nhl are typically classified as indolent and aggressive histologies . although nhl is predominantly managed with chemotherapy , radiation therapy is used as definitive treatment among patients with early - stage indolent lymphoma and natural killer ( nk ) t - cell lymphoma .
radiation therapy is also used as consolidative treatment in patients with early - stage and bulky aggressive histologies following chemotherapy . despite growing evidence of the benefit of radiation therapy for patients with nhl ,
concerns regarding radiation - associated late toxicities persist and , consequently , radiation therapy is omitted in the management strategy of many patients for whom it may be of benefit . in an effort to reduce radiation - related toxicity ,
these include reducing the dose of radiation in both definitive and consolidative radiotherapy , smaller field sizes and using modern radiotherapy techniques , such as intensity - modulated radiation therapy .
there are several studies examining the dosimetric benefits of proton therapy in patients with hodgkin lymphoma ( hl ) [ 68 ] ; however , there are limited published data reporting outcomes of patients with nhl treated with proton therapy .
the present study evaluated the disease control , toxicities and radiation dose delivered to various organs at risk ( oars ) using proton therapy either definitively or in combination with chemotherapy among a cohort of consecutively treated patients with nhl .
between january 2008 and january 2014 , 11 patients with nhl were treated with definitive ( n = 6 ) or consolidative radiation therapy ( n = 5 ) .
all patients were treated on an institutional review board - approved outcomes tracking protocol with proton therapy . prospectively collected data in the charts
were extracted , including patient and disease characteristics prior to treatment , chemotherapy , proton treatment plan and acute and late side effects and disease control .
this cohort included four patients with indolent orbital lymphoma , three patients with primary mediastinal lymphoma , two patients with plasmablastic lymphoma and two patients with nk t - cell lymphoma .
malt , mucosa - associated lymphoid tissue ; dlbcl , diffuse large b - cell lymphoma ; cvad , cyclophosphamide , vincristine , doxorubicin and dexamethasone ; nk , natural killer ; r - chop , rituximab , cyclophosphamide , doxorubicin ( hydroxydaunomycin ) , vincristine and prednisolone ; c , cycles ; cr , complete response ; r - ice , rituximab , carboplatin and etoposide ; r - eshap , rituximab , etoposide , methylprednisolone , cytarabine and cisplatin ; hyper - cvad , hyperfractionated cyclophosphamide , vincristine , doxorubicin and dexamethasone ; smile , dexamethasone , methotrexate , ifosfamide , l - asparaginase and etoposide ; rbe , relative biological effectiveness ; fx , fractions ; bid , twice daily ; ned , no evidence of disease ; awd , alive with disease .
patients were simulated supine with custom immobilization devices including vaclok bags ( civco medical solutions , orange city , ia ) and aquaplast facemasks ( qfix , avondale , pa ) for those patients with disease involving the head and neck region .
all patients underwent a three - dimensional ( 3d ) computed tomography ( ct ) scan with intravenous contrast .
patients with mediastinal disease or abdominal disease underwent a 4d ct simulation to account for respiratory motion during planning .
scans were transferred to mimvista ( mim software , cleveland , oh ) , and fusions with diagnostic scans were generated .
both the pre- and post - chemotherapy staging scans were fused for patients treated with chemotherapy .
a modified involved - field treatment plan was developed for all patients , similar to the involved - site radiation therapy guidelines . in patients with indolent orbital lymphoma ,
partial orbital radiation was given , where the gross tumor volume ( gtv ) included gross disease seen on ct simulation , the clinical target volume ( ctv ) included the pre - biopsy volume as defined on the pre - biopsy ct or magnetic resonance imaging ( mri ) scan fused to the ct simulation , and the planned target volume ( ptv ) was the ctv with a 5 mm margin to account for set - up uncertainty . in patients with nk t - cell lymphoma ,
the gtv included the sites of involved disease seen on the pretreatment positron emission tomography ( pet)/ct scan fused to the ct simulation , while the ctv included a 5 mm margin within the soft tissue in addition to the entire lymph node station in which enlarged lymph nodes were found .
a ptv margin of 5 mm on the ctv was used . in patients with primary mediastinal b cell lymphoma and lymphoblastic lymphoma ,
the gtv was the residual disease seen at the time of ct simulation , while the ctv included all mediastinal , hilar and cervical lymph node stations that were involved at the time of diagnosis with expansion to account for 4d motion of the mediastinum of up to 5 mm , and the ptv was a 58 mm margin on the ctv .
target and oar volumes were transferred into eclipse ( varian medical systems , salt lake city , ut ) and 3d conformal proton plans were generated .
a smearing factor was included in the proton range compensator design to account for any intrafraction or interfraction motion perpendicular to the beam .
distal and proximal margins were calculated for each proton beam ( ctv depth mm 1.025 + 1.5 mm ) to account for ct - number - to - proton - stopping - power conversion uncertainties ( 2.5% ) . a 1.5 mm water - equivalent margin
was added to the range to account for proton beam reproducibility ( 1 mm ) , water measurement uncertainty during commissioning ( 0.3 mm ) and range compensator fabrication error ( 0.2 mm ) .
field apertures were calculated from the ptv with a block margin to account for the proton beam penumbra at the target depth , and range compensators were calculated using an 810 mm smearing margin .
the minimum target coverage parameter was ptv dose to 95% volume ( d95% ) greater than 95% .
thoracic oar dose constraints were lung volume receiving 20 gy ( v20 ) < 30% , mean lung dose < 14 gy and mean heart dose < 20 gy .
the median follow - up for all patients was 38 months , and seven of the nine living patients have more than 2 years of follow - up .
one patient with nk t - cell lymphoma had progressive disease immediately after completing radiation therapy and died .
another patient with plasmablastic lymphoma was diagnosed with a gastro- esophageal junction tumor outside the radiation field during follow - up and died 6 years following treatment .
the 3-year overall survival rate for the cohort was 91% and the 3-year local control rate was 91% .
table ii summarizes acute and late radiation - associated toxicities for the entire cohort of 11 patients .
four patients were treated with definitive proton therapy for indolent orbital lymphoma in an effort to reduce the dose to the brain .
two of these patients had mucosa - associated lymphoid tissue ( malt ) lymphoma and received 30.6 gy ( relative biological effectiveness , rbe ) in 1.8 gy fractions .
the other two patients had low - grade follicular lymphoma and received 24 gy ( rbe ) in 1.5 gy fractions .
all four patients tolerated proton therapy well , with grade 12 dermatitis ( n = 4 ) , grade 12 headache ( n = 2 ) and/or grade 1 fatigue ( n = 2 ) .
three patients later developed grade 3 cataracts in the treated eye . in these patients ,
the lens had been either entirely in the ptv ( n = 2 ) or partially in the ptv ( n = 1 ) .
one patient developed late grade 1 anhidrosis and another patient developed late grade 1 epiphoria .
three patients were treated with consolidative proton therapy for primary mediastinal b - cell lymphoma to reduce the radiation dose to the heart , lungs , esophagus and breasts .
two of these patients had a complete response to six cycles of r - chop ( rituximab , cyclophosphamide , doxorubicin , vincristine and prednisolone ) chemotherapy and one patient required second - line chemotherapy with continued pet - positive residual disease before high - dose chemotherapy with autologous stem cell transplant .
the dose of proton therapy delivered ranged from 30.6 to 41.4 gy in 1.51.8 gy fractions .
acute toxicities included grade 1 to 2 dermatitis ( n = 3 ) , grade 1 fatigue ( n = 3 ) and other grade 1 gastrointestinal ( n = 2 ) and pulmonary toxicities ( n = 2 ) . at the time of last follow - up there were no grade 2 or greater late toxicities .
this included one located in the head and neck and the other in the stomach and left adrenal gland .
the patient with the head and neck site developed a ge junction cancer out - of - field a few years following treatment and died approximately 6 years following proton therapy .
acute toxicities were grade 1 nausea ( n = 1 ) , grade 1 mucositis ( n = 1 ) and grade 2 dermatitis ( n = 1 ) . there were no grade 2 or greater late toxicities . finally , two patients received definitive proton therapy for treatment of nk t - cell lymphoma of the head and neck region in an effort to reduce the dose to the parotid glands , oral cavity and brain .
one patient had progressive disease and died 5 months later , while the other patient is a 4-year - old boy with involvement extending from the nasopharynx to hypopharynx , who is free of disease at 9 months after completing treatment .
acute toxicities were grade 12 dermatitis ( n = 2 ) , grade 2 mucositis , grade 2 laryngeal edema requiring steroids , grade 3 dysphagia ( n = 1 ) and grade 2 anorexia ( n = 1 ) .
this study is the first to report on a cohort of patients with nhl treated with proton therapy .
proton therapy led to local control rates similar to what is expected with photon radiation , but was delivered with the objective of reducing the long - term side effects of radiation .
several published studies have evaluated the use of proton therapy in hl , but there are few data regarding outcomes of patients treated with proton therapy for nhl .
three studies have evaluated the dosimetric impact of using proton therapy in nhl , including studies from massachusetts general hospital ( mgh ; boston , ma ) , m. d. anderson cancer center ( mdacc ; houston , tx ) and university of florida ( uf ; jacksonville , fl ) and there is a case report from loma linda university medical center ( llumc ; loma linda , ca ) . the study from mgh included four patients with diffuse large b - cell nhl involving the mediastinum treated with proton therapy , and showed reduced cardiac , lung , spinal cord and integral doses with excellent disease control and minimal acute toxicities .
the study from mdacc discussing proton therapy in mediastinal lymphoma included two patients with nhl and showed similar results .
the uf study evaluating the dosimetric benefit of proton therapy compared with 3d conformal radiotherapy in two patients with primary mediastinal b - cell lymphoma demonstrated a clinically meaningful reduction in dose to the heart , lungs and esophagus . finally , a case report from llumc demonstrated that proton therapy can minimize the volume of normal brain tissue receiving low- to moderate - dose radiation in a patient with primary b - cell lymphoma .
these dosimetric studies provide a rationale for the use of proton therapy in the treatment of nhl to potentially reduce the risk of late radiation toxicities .
, who demonstrated a 50% reduction in secondary cancer development among patients treated at mgh with proton therapy compared with matched patients from the surveillance , epidemiology , and end results ( seer ) program registry .
all three patients with primary mediastinal b - cell lymphoma had an excellent response to consolidative proton therapy and no evidence of disease during follow - up .
patients with primary mediastinal b - cell lymphoma generally present at a young age , similar to those with hl involving the mediastinum , and would likely derive the same benefits with proton therapy as patients with hl . in a prospective study , hoppe et al
. demonstrated significant and clinically meaningful dose reduction with proton therapy when compared with 3d and intensity - modulated radiation therapy .
these patients with nhl represent an important cohort who should be considered for consolidative treatment with proton therapy .
furthermore , many of these patients are being treated with dose - dense chemotherapy regimens in an effort to avoid radiation therapy and its associated toxicities .
therefore , in the few patients receiving radiation therapy as part of their treatment , proton therapy should be strongly considered . in patients with orbital lymphoma ,
local disease control outcomes were favorable and consistent with outcomes described in the literature [ 1921 ] . given that the majority of patients with indolent orbital lymphoma achieve long - term survival , it is important to minimize the potential for late treatment - associated toxicities .
the patients in this cohort had similar rates of subacute toxicities ( i.e. cataracts , anhidrosis ) to patients treated with photon therapy .
proton therapy has the advantage of sparing the dose to the pituitary , ipsilateral temporal lobe and ipsilateral hippocampal head , all of which receive low - dose radiation with similarly fractionated conventional photon therapy .
other effective strategies for treating orbital lymphoma have been investigated . in 2011 , lowry et al . published their results of 361 sites of indolent nhl randomized to 4045 gy in 2023 fractions or 24 gy in 12 fractions and 640 sites of aggressive nhl randomized to 4045 gy in 2023 fractions or 30 gy in 15 fractions .
there was no difference in overall response rate , progression - free survival or overall survival between the standard- and low - dose arms in either group .
analyzed a cohort of 20 patients with nhl with ocular adnexal involvement treated with low - dose radiation consisting of two fractions of 2 gy . at a median follow - up of 26 months ,
the treatment was well tolerated , with mild acute side effects in 30% and no late toxicities .
furthermore , patients treated with this low - dose regimen have the option of re - irradiation in the case of local - regional relapse . with conjuctival malt lymphoma ( provided
there is no disease behind the equator of the globe on high - quality orbital mri ) , patients can be treated effectively with an anterior orthovoltage field ( 250300 kv ) .
considering that very low doses for orbital lymphoma are emerging as an effective alternative , the true value of its use in patients with indolent histologies still remains to be seen .
however , more aggressive histologies of the orbit require higher doses , which would benefit from proton therapy . although this study demonstrates that proton therapy can be safely and effectively delivered to patients with nhl involving other anatomical areas , including the abdomen and head and neck region , nhl includes a broad range of anatomic disease locations and histologic subtypes , making it difficult to generalize the benefits of a particular radiation modality among all cases of nhl .
while low - grade indolent lymphoma ( predominantly malt and follicular lymphoma ) and nk t - cell lymphoma can be effectively treated with radiation therapy alone , aggressive histologies ( diffuse large b - cell lymphoma , plasmablastic and burkitt lymphoma ) require individualized chemotherapy regimens in combination with radiation therapy .
current national comprehensive cancer network ( nccn ) guidelines include photons , electrons or protons as appropriate treatment modalities for nhl , depending on clinical judgement .
although ideal , a randomized controlled trial comparing proton and photon therapy based on a primary endpoint of late toxicity is unlikely because of the numerous potential sites of disease , the long time interval between treatment delivery and manifestation of late side effects , and the shrinking role of radiation owing to persistent concerns of radiation - associated toxicities by medical oncologists .
in addition to offering lower radiation doses and involved site radiation therapy , proton therapy may allow more patients to receive the most effective and safe treatment .
the major limitations of the present study are its small sample size and the diversity of primary disease sites and histologies among patients with nhl . despite nccn endorsement for
the use of proton therapy in cases where the dose to the oars can be reduced significantly compared with photon radiation , many patients evaluated at our center for proton therapy for whom the proton plans were superior to the photon plans could not obtain insurance coverage for the treatment of their nhl with protons .
these experiences illustrate the challenges that researchers face when investigating the role of proton therapy for different diseases .
the present study did not examine all possible clinical scenarios in which proton therapy may benefit patients with nhl ; the patients included in this study represent a typical cross - section of disease presentations encountered by radiation oncologists .
more long - term follow - up of all surviving patients included in this study is essential for continued monitoring of disease status and late toxicities .
longer follow - up and additional patients are needed to confirm our findings . given the variable disease locations , histologies and biologic behaviors of nhl , prospective studies evaluating proton therapy in the treatment of this disease will be complex , and likely require pooled data from multiple institutions to demonstrate adequate local control and lower rates of late toxicities .
disclosure forms provided by the authors are available with the full text of this article at www.informahealthcare.com/lal . | proton therapy ( pt ) is a highly conformal type of radiation therapy that can target the tumor while sparing dose to surrounding normal tissues .
this study reviews a single institution 's experience managing patients with non - hodgkin lymphoma ( nhl ) treated with pt .
eleven patients with nhl were treated with pt from january 2008 to january 2014 on an institutional review board - approved outcomes tracking protocol , and included patients with indolent orbital lymphoma ( n = 4 ) , primary mediastinal b - cell lymphoma ( n = 3 ) , plasmablastic lymphoma ( n = 2 ) and natural killer ( nk ) t - cell lymphoma ( n = 2 ) .
the median follow - up was 38 months .
the 2-year rate of local control was 91% , with one patient with nk t - cell lymphoma having recurrence in - field .
toxicities were limited to grade 2 at highest , during follow - up .
pt is a feasible and effective treatment for nhl .
early outcomes are favorable .
longer follow - up and more patients are needed to confirm our findings . |
the synthesis of high - quality
colloidal core shell quantum
dots ( qds ) is usually performed in organic solvents . from these solvents , they can be processed and used in numerous
applications in optoelectronics and photovoltaics . alternatively ,
the qds can be subsequently transferred into aqueous solutions in
order to increase their range of applications , particularly in biological
labeling and environmental sensing .
such a transfer requires either hydrophilic bifunctional ligands
to be exchanged for the native hydrophobic monofunctional coordinating
ligands , usually octadecylamine ( oda ) or the addition
of amphiphilic ligands or diblock copolymers where the hydrophobic
regions intercalate with the native ligands and hydrophilic regions
are exposed to the aqueous environment .
there are
advantages and disadvantages to each approach , but it mainly
comes down to a choice of size vs stability .
the long - chain native
ligands and the amphiphilic nature of ligands used in the intercalation
approach lead to qds with relatively large overall diameters .
the
ligand - exchange approach can , in principle , use extremely small ligands .
however , when using these qds for fluorescence applications , it has
been found that fluorescence quenching depends on both ligand size
and the functional group used , so a balance
is usually found between size , stability , and fluorescence quantum
yield . as a compromise , small polydentate ligands such as dihydrolipoic
acid ( dhla ) have been used to improve colloidal stability over monodentate
ligands , although we have recently found
that the lower density of dhla ligands on the surface compared to
monodentate mpa ligands leads to higher nonspecific adsorption of
target thiol molecules at low concentrations . in any case , the colloidal stability of ligand - exchanged quantum
dots is usually lower than the amphiphilic polymer - coated qds and
depends strongly on the nature of the ligands and the solvent conditions .
this can be a particularly significant problem at low qd concentration
and under reductive or oxidative conditions , as is often the case in biological fluorescence labeling applications . combining the advantages of ligand exchange using compact , water - soluble
ligands with cross - linking
has the potential to allow a better compromise
in which the size increase is modest while the improvement in colloidal
stability should be significant .
only a few examples of cross - linking
compact , ligand - exchanged qds have been reported , and they have used
a chemical cross - linking approach . however , a
major disadvantage with chemical cross - linking is that it is difficult
to inhibit interparticle cross - linking , which means that a purification
step may be required and overall yield will be compromised .
photochemical
cross - linking is an attractive alternative to localize the cross - linking
to within a particle , particularly if the cross - linking group is not
exposed to the solvent environment .
self - assembled monolayers ( sams )
of diacetylene ligands on gold were directly photo - cross - linked using
high - energy ultraviolet light ( uv , 254 nm ) and were shown to result
in surfaces that are extremely robust for use in harsh environments . in this study , we demonstrate that qds themselves can initiate cross - linking
of bifunctional diacetylene ligands using lower energy visible light
to generate radicals ( scheme 1 ) . photoexcited
cdse has been previously used to generate radicals on adsorbed species
for charge separation in photovoltaic applications and in solid - state polymer nanocomposite blends . however , to the best of our knowledge , using a qd - mediated photo - cross - linking
approach in solution to limit interparticle cross - linking while , at
the same time , promoting intraparticle cross - linking to improve the
colloidal stability of those same qds has not yet been demonstrated .
we show that taking advantage of the qd as a visible - light initiator
leads to much better cross - linking of the ligands than direct cross - linking
of the diacetylene groups with uv light , since competing ligand dissociation
reactions induced by uv exposure are avoided .
our approach results
in extensive intraparticle cross - linking but with practically no interparticle
cross - linking , and more importantly , it leads to excellent long - term
colloidal stability of the qds in aqueous environments while maintaining
relatively small hydrodynamic sizes .
the synthesis of the
bifunctional diacetylene ( da ) ligand followed a combination of procedures
described by xu et al . and kim et al .
details of the da ligand synthesis and nmr peak
assignments are provided in the supporting information .
cdse / zns ( core / shell ) quantum dots ( em = 597 nm ) coated with hydrophobic octadecylamine ( oda ) ligands
were purchased from ocean nanotech ( springdale , ar ) as a dried powder
and dissolved in toluene ( emd chemicals inc . , billerica , ma ) .
prior
to the ligand exchange procedure , the as - purchased qds were purified
from excess ligands by precipitating from toluene with acetone ( emd ) ,
centrifuging at 14 100 g ( 14 500 rpm ,
minispin plus , eppendorf ) , and discarding the supernatant .
then , the
precipitated qds were redissolved into chloroform ( drisolv , emd ) ,
mixed with methanol ( emd ) , and centrifuged again and the supernatant
was discarded .
a ligand solution was prepared by adding 10 mg of the
da ligand to 1 ml of chloroform or by adding 2.66 l of mercaptopropanoic
acid ( mpa ) ( alfa aesar , ward hill , ma ) in 1 ml of methanol .
the ph
was adjusted to 11 by adding microliter quantities of a stock solution
of tetramethylammonium hydroxide ( tmaoh ) ( alfa aesar ) in methanol .
the ligand solution was added to the precipitated qds , and stirred
for 24 h at room temperature in the dark .
it has been shown that 254 nm
uv exposure can be used to photopolymerize
diacetylenes .
the fluorescence of the
sample as a function of 254 nm ( short wave ) uv exposure time was monitored
to determine the optimal cross - linking time in terms of the fluorescence
properties .
emission spectra were obtained by exciting at 530 nm in
a 100 l quartz fluorescence cuvette ( starna cells ) . from all
the samples , those exposed for 0 , 20 , 100 , and 210 min
were then analyzed
with an ft - ir spectrometer ( bruker , vertex 70 ) equipped with a dtgs
detector .
a 40 l aliquot of the sample was taken from the stock
solution at the specified time of exposure and placed in the exact
center of a caf2 window which was then left to dry under
a n2 atmosphere so that the ir beam diameter completely
probed the whole sample spot .
to transfer
the water - soluble qd - da and qd - mpa to water , methanol and acetone
were added , respectively , and the mixture was centrifuged to precipitate
the qds from the reaction solution .
having removed the supernatant ,
the qds were redissolved into millipore ( 18.2 mcm ) water .
each solution was transferred to a four - windowed quartz fluorescence
cuvette with a stopper ( starna ) for further analysis .
photographs to show
qd fluorescence and colloidal dispersion in
water were taken with a 10.1 mp camera ( pentax ) whereby a hand - held
uv lamp operating at 366 nm ( long wave ) was shone from beneath the
four - windowed quartz fluorescence cuvettes containing the samples .
single particle burst analysis and fluorescence
lifetimes were acquired on a picoquant microtime 200 fluorescence
microscope as previously described .
a pulsed laser
operating at 485 nm , 15 w , and 5 mhz was used for excitation
and focused though the objective ( planapo 63xw , olympus ) to a diffraction - limited
spot .
the emission was collected by the same objective and passed
through a 100 m pinhole and a 585/55 m filter before being detected
on a single photon counting avalanche diode ( pdm series , microphotonic
devices , bolzano , italy ) , and the data was saved in time - tagged time - resolved
format to enable offline calculation of fluorescence bursts , fluorescence
lifetime , and fluorescence correlation spectroscopy ( fcs ) using the
symphotime software ( version 5.3.2 , picoquant gmbh ) .
the absorption and photoluminescence ( pl )
spectra of the qds before
ligand exchange ( qd - oda ) and after ( qd - mpa , or qd - da ) are shown in
figure 1 .
in addition to the characteristic
qd exciton absorbance peak at 583 nm and the broad absorbance that
increases with increasing energy that is observed in each sample ,
the absorbance of qd - da shows another intense peak between 400 and
430 nm , which is assigned to * transitions in
the diacetylene moiety .
it was found that using the same initial qd
concentration for the ligand exchange resulted in better solubilization
efficiency compared to qd - mpa , as evidenced by the stronger color
of the solutions shown in the inset of figure 1 .
this could be a consequence of the diacetylene ligands favoring
a close - packing arrangement on the qd surface , resulting in a sam - driven
ligand exchange process , whereby hydrophobic interactions between
chains result in a higher ligand density compared to the shorter and
more soluble ( i.e. , labile ) mpa ligands . in both cases , however , the
fluorescence quantum yield decreased by approximately half , which
is common for thiolated ligands on qds even those with a core
the da ligands decreased
the quantum yield a little more than mpa , consistent with a more complete
ligand exchange ( more thiols ) because of sam packing . absorption and photoluminescence
spectra of qds before ( black )
and after ligand exchange with mpa ( blue ) and da ( red ) .
inset : photographs
of qds under room light after ligand exchange using mpa ( left ) and
da ( right ) show relative solubilization efficiency .
we hypothesized that using high - energy uv light
to directly photo - cross - link
diacetylene ligands on qds would not be ideal , since the qd
thiol
coordination bond would be prone to photooxidation but that qds excited with visible light could be used to initiate
photo - cross - linking . to test our hypothesis , we measured the absorption
spectra of qd - da in water as a function of time left exposed to room
light .
one qd - da sample was first exposed to 30 min of uv light , while
the other was not .
this data is presented in parts a and b of figure 2 , respectively . at day 0 ,
the characteristic diacetylene
peak between 400 and 430 nm was stronger for the unexposed qd - da compared
to the uv - exposed qd - da .
this could be a consequence of da ligands
undergoing partial cross - linking and/or uv - induced dissociation ( vide infra ) .
as the qds were left exposed to room light
for up to 2 weeks , significant changes in the absorption spectra were
observed for both samples , although the details are somewhat different .
both samples show the formation of a new peak at 650 nm , which
begins to form within the first day and increases steadily .
this increase
is concomitant with a decrease in the absorbance in the 350450
nm region .
we assign this 650 nm peak to * transition
of the long , conjugated -electron system that results from
extensive cross - linking of the da ligands on the qd induced by visible
light .
a similar peak has also been observed for similar ligands on
gold particles that were irradiated with uv light for 30120
min . in the case of the qds
studied here ,
qd - da that had been exposed to uv light first showed an increase in
the 650 nm peak within 7 days and then saturated , indicating that
cross - linking stopped prematurely . for the qd - da samples
that had
not been exposed to uv light first , the 650 nm peak continued to increase
for the full 14 days and the decrease in the 350450 nm region
was much more pronounced , suggesting that visible - light - induced cross - linking
was slower but more extensive , without the competing process of uv - induced
ligand dissociation that prematurely halts cross - linking . in both
cases , the excitonic qd peak at 583 nm showed a moderate blue - shift :
to 572 nm in the case of uv - exposed qd - da and to 568 nm for the non - uv - exposed
qd - da .
it is interesting to note that , for the uv - exposed samples
on day 0 , the peak at 650 nm was absent , suggesting that the uv exposure
was not able to induce much conjugation even though the 400430
nm peak was attenuated .
this is consistent with our interpretation
of a competition between uv - induced cross - linking and ligand dissociation
which limits the extent of cross - linking that can occur .
such a competition
was probably not observed in the case of gold , since uv light does not excite gold as it does for semiconductor
qds and uv - induced ligand dissociation does not occur for the stable
au s bond .
uv vis absorption spectra of qd - da in water as
a function
of exposure to room light over a 2-week period that ( a ) had been and
( b ) had not been exposed to 30 min of uv light prior to transfer to
water .
further evidence that uv light
leads to only partial cross - linking
of qd - da and competing uv - induced dissociation of the da ligands from
the qd is found using ft - ir spectroscopy .
figure 3 shows the ft - ir transmittance spectra in three regions of
interest as a function of exposure time to uv light . in figure 3a ,
the 31002500 cm region
shows the sp c h stretching peaks and the asymmetric
stretch at 2922 cm is used to normalize the spectra .
the peak
at 3012 cm first increased slightly and then decreased
upon uv exposure .
this peak is usually assigned to alkenyl c h
peaks from c = c bonds .
however , cross - linking of diacetylenes
should not result in such a peak , unless side - reactions occurred that
led to incomplete cross - linking
. this may be possible if there was
no adjacent diacetylene to cross - link to , due to partial ligand removal ,
leaving a reactive c = c radical that may have led to the formation
of a c = c h bond .
figure 3b shows the 21002300 cm region as a function
of exposure time of the qd - da to uv light , where cc bonds
have a weak but isolated absorbance .
in fact , two peaks are observed
in this region , one at 2153 cm and another at
2254 cm ( black arrows ) , which are characteristic
of diacetylenes . after 20 min of uv exposure ,
the 2254 cm peak effectively disappeared , while
the 2153 cm peak diminished only slightly .
as expected from the
cross - linking reaction ( scheme 1 ) , the cc
cc
moieties become ( c = c cc)n , and the change from a double peak to a
single peak within 20 min may reflect this .
however , the fact that
both peaks decreased within 100210 min suggests that neither
type of ligand was present on the particles after extended uv exposure .
figure 3c highlights the 14501700 cm region , which shows peaks related to c = c and
c = o stretching as well as c h bending modes .
the peaks
at 1573 and 1604 cm are assigned as stretches
from the c = o group from deprotonated and protonated carboxylic
acids , respectively , forming a close - packed hydrogen - bonded network
of ligands .
h bending modes , which remained constant within 20 min
of uv exposure and reduced in the 20100 min time window . since
the c
h stretching frequency was normalized , this reduction
may indicate a significant change in the ligand arrangement on this
time scale that partially reduces the oscillator strength of bending
modes , which could be the result of the cross - linking process increasing
the rigidity of the sam .
a small peak at 1652 cm appearing after 20 min of uv exposure ( black arrow ) , which was not
present before cross - linking , may also be indicative of c = c
bonds forming during cross - linking , but due to several overlapping
peaks in this region , it is difficult to make a definitive assignment
at this point .
the ft - ir data can be summarized as follows : changes
in the diacetylene peaks show that the uv light caused these groups
to react within 20 min and that they are completely gone within 100
min .
these changes were also accompanied by small increases in peaks
associated with alkenyl c h and c = c bonds in 20 min
that then decreased within 100 min , suggesting side reactions limited
the extent of cross - linking . in the 020 min time period , the
c = o peaks remained but also started to decrease in the 20100
min period . finally , changes in the c
h bending modes suggest
significant ligand rearrangement on this 20100 min time scale .
taken together , the ft - ir data supports the fact that diacetylenes
can be partially cross - linked on qd - da within 20 min of uv exposure ,
but more complete cross - linking using uv light was inhibited by the
fact that there was a competing process of ligand rearrangement and
dissociation that took over on the 20100 min time scale of
uv exposure .
the photoluminescence intensity as a function of
time exposed to
uv and visible light ( sequentially ) is presented in the supporting information , which shows the effect
of these partial cross - linking and ligand dissociation processes on
the pl properties .
this data provides more evidence that the cross - linking
mechanism can be initiated using both uv and visible light and that
radicals can actually improve the pl of the qds , in agreement with
a recent study , but that continued exposure
to uv light is extremely detrimental to the particles . in a previous
study
, radicals were generated by external
initiators to improve the pl of the qds , but the supplementary pl
data here shows that radicals generated by the photoexcitation of
qds themselves can have a similar effect .
ft - ir transmittance spectra
of qd - da as a function of uv exposure
time showing ( a ) c h stretching , ( b ) cc stretching ,
and ( c ) c = c and c = o stretching , as well as c
the significant advantage
of using visible - light qd - mediated photocatalysis
for cross - linking rather than uv light is highlighted in figure 4 .
photographs of the fluorescence from qd - da with
or without 30 min prior exposure to uv light dispersed in water and
then exposed to room light were taken over several days . as a comparison ,
qds solubilized with one of the
most commonly used , non - cross - linking
thiolated ligands , qd - mpa , is shown .
qd - mpa showed extensive precipitation
from solution even after the first day and the effect was worsened
by prior uv exposure , which would be expected for a uv - induced ligand
dissociation process .
both the qd - da samples showed
significant improvement in colloidal stability over qd - mpa .
however ,
the non - uv - exposed qd - da showed better long - term stability than the
uv - exposed qd - da , highlighted by the fact that the particles remained
suspended in solution for the whole time period .
the uv - exposed qd - da
began to precipitate from solution within 57 days , and by
day 11 was considerably worse than the non - uv - exposed qd - da .
fluorescence
photographs under 366 nm ( long wave ) uv light of qd - mpa
and qd - da samples that either were or were not exposed to 30 min of
254 nm ( short wave ) uv light first to show colloidal stability and
fluorescence intensity as a function of time .
a fluorescence layer
at the bottom of the vial indicated extensive aggregation of the qds .
only the non - uv - exposed qd - da samples show no visible aggregation
over time .
the degree of aggregation or dispersion
in uv - exposed and non - uv - exposed
qd - da was then analyzed using single particle fluorescence spectroscopy
on a picoquant microtime 200 fluorescence confocal microscope , after being left in aqueous solution for 14 days under room light .
samples were stirred and diluted to pm concentrations and analyzed
using burst integrated fluorescence and fluorescence correlation spectroscopy
( fcs ) , the results of which are shown in figure 5 .
example burst integrated fluorescence traces of particles diffusing
through the confocal volume of a fluorescence microscope for ( a ) visible - light - exposed
( black ) and ( b ) uv - light - exposed ( red ) qd - da , obtained after they
have been sitting in water for 14 days and ( c ) fcs autocorrelation
analysis of each qd - da sample to show average diffusion times of particles
through the confocal volume . for the non - uv - exposed qd - da , fitted
curves with ( thick black ) and without ( thin black ) taking blinking
into account are included , with both fits recovering at the same diffusion
times .
blinking is not needed to be taken into account for uv - exposed
qd - da ( red ) due to aggregation .
figure 5a shows an example of a burst
integrated
fluorescence trace from visible - light - exposed qd - da , while figure 5b shows an example from uv - exposed qd - da .
the data
is binned into 1 ms time points , with the intensity of each point
corresponding to the average detector count rate during that 1 ms
time bin .
the peaks in fluorescence intensity arise from fluorescent
particles diffusing through the diffraction - limited focused laser
beam ; a single peak corresponding to a single particle diffusing through
the focus .
the non - uv - exposed samples show much lower intensity bursts ,
with each peak being narrow , compared to the wide , intense peaks from
the uv - exposed samples . these intense ,
wide peaks are due to large ,
highly fluorescent aggregates of qds slowly diffusing through the
laser focus .
the average diffusion time of particles diffusing through
the focus is analyzed by calculating the autocorrelation function
( acf ) from the burst integrated fluorescence traces , which is shown
in figure 5c .
the black curve shows the acf
for the non - uv - exposed qd - da , while the red curve shows uv - exposed
qd - da .
the diffusion coefficients are calculated by fitting these
curves to extract diffusion times through the confocal volume .
the
data were fit to eq 1 , to take blinking into
account as previously described.1where2with w0 and z0 describing the width ( 500 nm )
and height ( 2
m ) of the confocal beam , f describes the fraction
of particles that blinked during the transit time in the beam and a and describe the power - law blinking dynamics ,
as previously described . fits both with and
without taking blinking into account were performed ( i.e. , either
by setting f = 0 or allowing it to be fit ) . for the
non - uv - exposed samples ,
the data are fit better at shorter times by
taking blinking into account , but both recovered the same diffusion
times .
blinking was not a factor for the uv - exposed samples , which
is expected if particles have aggregated .
diffusion times ( d ) through the confocal volume of 3.09 0.11 ms for the
non - uv - exposed qd - da ( i.e. , cross - linked by qd - mediated visible - light
photocatalysis ) and 265 5 ms for the uv - exposed qd - da were
found .
these translate into diffusion constants of 20 1 and
0.236 0.004 m / s , respectively , at the lab
temperature of 20 c . using the stokes
einstein relation
in water at 20 c , these represent hydrodynamic radii of 10 nm
for the qd - mediated visible - light cross - linked qd - da and 900 nm for
the uv - exposed qd - da . on the basis of the sizes of the core
shell
qd and the ligand , 10 nm is a reasonable hydrodynamic radius to be
expected for single particles , while 900 nm highlights the extensive
aggregation of the uv - exposed qd - da .
the lack of aggregation of visible - light
cross - linked qd - da is also evident from the fact that the blinking
parameters are needed to fit the data .
we also measured the fluorescence
lifetime of these samples to determine the extent of fluorescence
quenching caused by the aggregation ( supporting
information ) .
the qd - mediated visible - light photocatalysis
resulted in cross - linked qds that show a fluorescence lifetime in
water of 9.2 ns , while the uv - exposed qds show a shorter fluorescence
lifetime of 6.9 ns .
it is important to reiterate here that no purification
step from potential aggregates was performed before taking either
of these measurements .
the results from this study are schematically
depicted in figure 6 , in which using a qd - mediated
visible - light cross - linking approach for the ligands was able to both
significantly avoid interparticle cross - linking and avoid ligand dissociation
that resulted from uv exposure .
ligand dissociation results in qd
aggregation over time , while extensive cross - linking of ligands is
able to maintain colloidal stability for long periods of time , highlighting
the major outcome from this study .
schematic of the differences observed
using our visible - light qd - mediated
approach to cross - linking compared to using uv light to directly cross - link
the ligands . under the high energy uv light
, ligand dissociation competes
with cross - linking that leads to only partial cross - linking of the
ligands and eventual aggregation of the qds .
we have designed a novel visible - light photo - cross - linking
approach
to qd long - term stabilization in aqueous solution .
this was achieved
by synthesizing a photo - cross - linkable diacetylene ligand and using
the qd to improve the cross - linking of the ligands on the particle
by a visible - light photocatalytic mechanism which , in turn , improved
the colloidal properties of the same qd that helped cross - link the
ligands .
this method combines the advantage of using ligand exchange
to render qds water - soluble with the advantage of controlling cross - linking
so that it remains intraparticle rather than interparticle , thus avoiding
the formation of aggregates and the need for purification .
this new
approach has the potential to lead to smaller particle sizes than
is possible using amphiphilic polymers by further reducing the size
of the bifunctional ligand , although it will be necessary to optimize
the correct balance between chain length and sam packing density to
achieve such a goal .
furthermore , other water - soluble bioreactive
functionalities can be incorporated , since the cross - linking moiety
is completely separated from the bioreactive functional group on the
particle , and does not rely on any other reagents added to the solution
to achieve the cross - linking . | ligand cross - linking is known to
improve the colloidal stability
of nanoparticles , particularly in aqueous solutions .
however , most
cross - linking is performed chemically , in which it is difficult to
limit interparticle cross - linking , unless performed at low concentrations .
photochemical cross - linking is a promising approach but usually requires
ultraviolet ( uv ) light to initiate .
using such high - energy photons
can be harmful to systems in which the ligand nanoparticle
bond is fairly weak , as is the case for the commonly used semiconductor
quantum dots ( qds ) . here
, we introduce a novel approach to cross - link
thiolated ligands on qds by utilizing the photocatalytic activity
of qds upon absorbing visible light .
we show that using visible light
leads to better ligand cross - linking by avoiding the problem of ligand
dissociation that occurs upon uv light exposure .
once cross - linked ,
the ligands significantly enhance the colloidal stability of those
same qds that facilitated cross - linking . |
the assay of bronchoalveolar washings from acutely exposed animals has proven useful as a rapid screen for lung injury from inhaled airborne toxins .
the screen is useful for choosing appropriate compounds and exposure levels for subsequent in - depth studies in which complete histopathologic evaluations will be made .
an inflammatory response can be detected by the appearance of polymorphonuclear leukocytes and an increase in protein content of lung washings .
the release of the cytoplasmic enzyme , lactate dehydrogenase , into the acellular portion of the lavage fluid serves as an indication of cell death or membrane damage .
a large increase in some lysosomal enzymes has been found in the bronchoalveolar lavage fluids from animals chronically exposed to insoluble particles .
angiotensin - converting enzyme has been found to be elevated in bronchoalveolar washings from animals with endothelial cell damage in the pulmonary capillaries .
the correlation of these cellular and biochemical alterations in the bronchoalveolar lavage fluid with morphological indications of damage has served to validate this method of detecting acute lung injury .
further study is needed to validate indicators of developing chronic disease.imagesfigure 1.figure 4 .
c1figure 4 .
c2figure 4 .
c3figure 6.figure 6.figure 6.figure 6 . |
|
wilson disease is a metabolic disorder involving copper metabolism and is associated with abnormal liver functions .
it occurs more frequently in males and usually between the ages of 6 and 20 years .
neuropsychiatric and behavioral disturbances are commonly reported in patients with wilson 's disease with lifetime prevalence estimated to be in the range of 20 - 100% .
the most common psychiatric manifestations in patients with wilson 's disease include sudden and changeable mood swings , anger outbursts , personality changes , depression , anxiety and cognitive impairment . compared to other psychiatric manifestations , psychotic disorders are less commonly reported . in the initial description of 12 cases of the disease , wilson described presence of schizophrenia - like psychosis in two of his cases . however , over the years the accumulating data suggests that prevalence of schizophreniform disorders , catatonia , and hallucinations in patients with wilson 's disease are similar to that seen in the general population . however , the prevalence of psychosis and catatonia is higher in patients with neurological manifestations of wilson 's disease .
most of the literature , describing psychiatric manifestations in patients with wilson 's disease is limited to young adults , with occasional case series / reports describing psychiatric manifestations in children and adolescents . in this report , we present the case of a boy who developed psychotic features , within few days of being diagnosed with wilson 's disease and review the existing literature with respect to psychosis in patients with wilson 's disease .
a 12-year - old boy presented to the hospital with symptoms of abdominal distension associated with dull aching continuous pain for 1 month . about a week following the onset of pain in the abdomen , parents noticed changes in the patient 's behavior .
he developed irritability , delusion of reference , delusion of persecution associated with marked dysfunction in the form of refusal to attend school , secondary to the psychotic symptoms . over the next few days , the psychotic symptoms became more pervasive and systematized ; following which he was found to keep all his belonging under lock and key .
all these symptoms were not associated with any altered sensorium , hallucinations in any modality , thought disorder , depressive cognitions , cognitive disturbances , head injury or substance abuse . there was no family history of any psychiatric illness and developmental milestones were reportedly normal .
he was brought to the hospital primarily for the continuous abdominal pain . during the initial evaluation , his routine investigations in the form of hemogram
, renal function test and liver function test did not reveal any abnormality . however , ultrasound examination of the abdomen revealed parenchymal liver disease with portal hypertension and ascites . in view of the evidence of parenchymal liver disease ,
serum ceruloplasmin was estimated and was found to be low , that is , 8.1 mcg / dl ( normal range 25 - 63 ug / dl ) . serum copper level and total urine copper level were also estimated , reports of which were consistent with a diagnosis of wilson 's disease .
slit lamp examination of the eyes showed the presence of kayser fleischer ring . on the basis of clinical manifestations and laboratory findings , a diagnosis of wilson 's disease was made .
he was started on tab penicillamine 250 mg along with zinc acetate 150 mg / day .
after a week , tab penicillamine was increased to 500 mg / day , with which his psychiatric symptoms worsened .
in addition to the above - mentioned symptoms , the child became very agitated and disinhibited .
the abnormal behavior led to the admission into the hepatology unit of the institute , and psychiatric consultation was sought . on mental status examination ,
the boy was found to be conscious and oriented to time , place and person .
a diagnosis of organic delusional disorder ( f06.2 ) due to wilson 's disease was considered .
as there was some evidence for an increase in psychotic symptoms after increasing the dose of penicillamine , the dose of same was reduced to 250 mg / day . however
, this did not lead to abatement of psychotic symptoms and required use of tab risperidone 1 mg / day , with which , within a week the psychotic symptoms resolved , and he was discharged from the hospital .
wilson 's disease is an autosomal recessive genetic disorder that is caused by the mutation of the atp7b gene .
the hepatic presentation may be in the form of elevated transaminase levels , chronic hepatitis or cirrhosis ; while neurological manifestations may be in the form of tremors , choreiform movements , dysarthria , gait disturbances , etc .
psychiatric manifestations are common with wilson 's disease and occur in 20 - 100% of the cases .
the psychiatric manifestations span a range of diagnostic entities and most commonly include affective and personality changes .
the psychiatric manifestations are common at the initial presentation of the disease but seldom are the main cause for treatment seeking . compared to other psychiatric manifestations ,
the commonly reported psychotic manifestations include that of schizophrenia like psychosis and of delusional disorder . a study from india , which evaluated 350 patients with wilson 's disease , reported psychosis in three cases only , which was of schizophreniform type .
, 1 out of 31 , 8 out of 71 cases , 3 cases of organic delusional disorder out of 45 patients , 2 out of 195 cases and 2 out of 42 cases . however , certain other studies which have reported about the various psychiatric manifestations have not reported a single case of psychosis .
overall the prevalence of psychosis in patients with wilson 's disease varies from 0% to 11.3% . since , the early description of wilson 's disease , few case reports have documented the occurrence of psychosis in patients with wilson 's disease . however , over the last two decades , there is the proliferation of case reports / series describing psychosis in patients with wilson 's disease .
a case report described a patient with wilson 's disease who had psychotic episodes at the age of 18 , 22 and 23 and was diagnosed with paranoid schizophrenia .
however , the diagnosis of wilson 's disease was made after 12 years of the first episode of psychosis .
similarly , a recent case report described a patient who was treated as a case of schizophrenia for 10 years before being diagnosed with wilson 's disease .
one report described 3 cases with psychiatric manifestations that were usually misinterpreted as schizophrenia - like disease and lead to delay in the diagnosis .
diagnosis of wilson 's disease was confirmed on the basis of magnetic resonance imaging findings which showed asymmetric cerebral white matter lesions in the frontal lobe . a case series documenting disturbance of circadian rhythm of temperature , pulse , and blood pressure in wilson 's disease described two cases of schizophrenia like psychosis .
another report described a patient with psychosis who developed movement disorders with the use of haloperidol and was later confirmed to have wilson 's disease .
described a case of delusional disorder presenting with non - persecutory delusional disorder and alcohol abuse in the absence of neurological signs when he discontinued his treatment of wilson 's disease which he was receiving for duration of 3 years .
a case report described the resolution of subchronic hallucinatory psychosis , behavioral symptoms and mood disturbances in a patient with wilson 's disease after liver transplantation . with regards to treatment of psychosis , two case reports described the use of electroconvulsive therapy in a patient with psychosis and wilson 's disease .
another case report described the development of akinetic - rigid syndrome with use of risperidone . whereas two reports described improvement in psychosis with use of penicillamine and reduction in serum copper levels .
what is evident from these case reports / series is that in most cases psychosis is diagnosed prior to diagnosis of wilson 's disease , and the latter is diagnosed later on when the patient developed additional symptoms of wilson 's disease or developed movement related side effects with antipsychotics .
in contrast to many of the previous reports the index case , developed psychosis with onset of abdominal manifestations of wilson 's disease . however , in contrast to some of the previous reports , the index case developed mild worsening of psychosis with increase in the dose of penicillamine
. this could be possibly due to worsening of the primary psychiatric illness or may be due to penicillamine .
however , the symptoms of psychosis reduced to a certain extent with reduction in the dose of penicillamine , and this possibly suggests an association between the two .
but it is also possible that the reduction of psychotic symptoms may be due to the actual effect of penicillamine on serum copper levels .
some of the previous studies support the later hypothesis , which suggest an improvement in psychosis with chelation therapy .
index patient responded to low dose of antipsychotic medication , and this suggests that the use of the chelating agent possibly reduces the need for antipsychotic in patients with wilson 's disease as has been reported in some of the previous reports too .
the case reflects that psychotic symptoms , though rare but may be a presenting feature in patients with wilson 's disease .
as is evident from the literature , wilson 's disease must be considered as a possibility in patients who develop psychosis at a young age and the patients must be adequately investigated for the same , which should include ultrasound abdomen , serum ceruloplasmin levels , serum copper level and total urine copper level .
further , when diagnosed with psychosis associated with wilson 's disease , patients should be treated with low dose antipsychotics with close monitoring for extrapyramidal side effects . | neuropsychiatric manifestations are common in wilson 's disease and mainly include extrapyramidal and cerebellar symptoms .
presentations with psychotic symptoms have been described less frequently . in this report
we present the case of a young boy with wilson 's disease who developed psychotic symptoms .
a 12-year - old boy was diagnosed with wilson 's disease on the basis of the physical examination findings and low ceruloplasmin levels ( 8.1 mg / dl ) .
after 2 weeks of being diagnosed with wilson 's disease , he developed an acute onset illness , characterized by delusion of persecution , fearfulness , hypervigilence and decreased sleep .
these symptoms were not associated with any confusion , clouding of consciousness , hallucinations and affective symptoms .
there was no past or family history of psychosis .
one week after the onset of the symptoms he was prescribed tab penicillamine , initially 250 mg / day , which was increased to 500 mg / day after 3 days . after increase in the dose of penicillamine , his psychiatric symptoms worsened and led to hospitalization .
a diagnosis of organic delusional disorder ( f06.2 ) due to wilson 's disease was considered .
tab risperidone 1 mg / day was started , and the dose of penicillamine was reduced with which symptoms resolved . whenever a young adolescent develops psychosis , especially of delusional type , the possibility of wilson 's disease must be considered . |
brain abscess remains one of the commonly encountered neurologic emergencies in developing countries despite advances in neurosurgical , neuroimaging , and microbiological techniques ; and the availability of new antibiotics .
the successful treatment of brain abscesses requires surgery , appropriate antibiotic therapy , and eradication of the primary source . though high
the common causative organisms of brain abscess are staphylococcus aureus , streptococcus pneumoniae , hemophilus influenzae , escherechia coli , proteus , and pseudomonas species .
we retrospectively reviewed the patients of enterococcal brain abscess treated at our institute in last 5 years .
the clinical profile , microbiological characteristics , treatment , and outcome of these patients were reviewed .
the drained abscess material was processed for gram - staining , ziehl neelsen staining and was cultured aerobically on blood agar , chocolate agar , macconkey agar , lowenstein jensen medium , sabouraud 's dextrose agar and thioglycollate broth with overnight incubation . for the isolation of anaerobic organisms ,
blood agar was inoculated and incubated in anaerobic jar ( hi media gas pak ) where the plates were read after 48 h. the gram - stained smear showed pus cells with gram - positive oval cocci in pairs with typical arrangement suggestive of e. species . following precise aerobic and anaerobic incubations small , translucent ,
the isolates were identified as e. species after subjecting to biochemical studies like catalase test , esculin hydrolysis and ruling out , according to standard identification methods .
antibiotic susceptibility was performed according to clinical and laboratory standards institute guidelines and the different isolates were found to be variably sensitive to common antibiotics .
predisposing factor could be identified in 10 ( 83.33% ) ; eight had chronic suppurative otitis media ( csom ) , and two congenital heart disease ( chd ) .
one lady was 2 months pregnant at the time of diagnosis , she had cardiogenic source . 1 patient had recurrent abscess due to csom , the causative organism of which was bacteroides in first instance and enterococcus in second .
co - infection was found in three ; two were bacteroides , and other one was klebsiella .
predisposing factor could be identified in 10 ( 83.33% ) ; eight had chronic suppurative otitis media ( csom ) , and two congenital heart disease ( chd ) .
one lady was 2 months pregnant at the time of diagnosis , she had cardiogenic source . 1 patient had recurrent abscess due to csom , the causative organism of which was bacteroides in first instance and enterococcus in second .
co - infection was found in three ; two were bacteroides , and other one was klebsiella .
the age , underlying medical and/or surgical condition of the patient , and possible source of infection also determine the causative organisms .
once believed to be harmless , e. species is now considered as causative agent for urinary tract infections , hepatobiliary sepsis , endocarditis , surgical wound infection , bacteraemia , neonatal sepsis , and nosocomial infection with high mortality .
enterococcus faecalis is the most common species associated with clinical infection , while enterococcus faecium poses the higher antibiotic resistance threat .
however enterococci are considered as a rare causative pathogen for central nervous system infection , brain abscess being even rarer .
kurien et al . found enterococcus in only 1 patient among the 153 patients in their series .
we found only 10 cases of enterococcal brain abscess described in literature , and ours is the largest series of its kind .
enterococcal abscesses have been commonly described in supratentorial lobar locations , cerebellum , and cerebellopontine angle .
besides these locations , we had a patient ( case 2 ) with brain abscess in basal ganglia due to chd .
the cause of enterococcal brain abscess was csom in 7 cases , dental procedure in a case of hereditary hemorrhagic telangiectasia in one , and after neurosurgical procedure in one .
chd , which was source in two of our patients , has not been reported as cause of enterococcal abscess earlier .
the species of enterococcus reported were enterococcus avium in 6 cases , e. species in three , and e. faecalis in one .
most of the enterococcal abscesses were treated with aspiration , either stereotactic , or burrhole .
most of our patients underwent craniotomy and excision of brain abscess , as we believe that antibiotic therapy duration can be shortened by totally excising the abscess .
na et al . described 53 patients of enterococcus bacteremia , where vancomycin was the most commonly used antibiotics .
the common antibiotics that have been used to treat enterococcal abscess are ceftriaxone in 5 cases , metronidazole in five , and vancomycin in 3 cases .
other antibiotics that have been used are amikacin , ceftazidime , cefoperazone / sulbactum , moxifloxacin , linezolid , meropenem , and ampicillin . as per our hospital policy
if the organisms are sensitive to these antibiotics , these are continued for variable period based on operating surgeon 's discretion .
there is tendency to shorten the duration of antibiotic therapy if total surgical excision is done .
the common antibiotics used in our patients were ceftriaxone in 7 cases , amikacin in six , metronidazole in five , and vancomycin in 3 cases .
we also have preference of prescribing oral antibiotics , hence we have used ampicillin , ofloxacin , cotrimoxazole , kloxacillin , and chloramphenicol for our patients based on sensitivity report .
the antibiotic therapy duration has been variable in literature , and also in our cases .
our patients received antibiotics for 26 weeks . 1 patient ( case 3 ) , who had recurrence while on first line of antibiotics for 1-month , received other antibiotics for two additional weeks .
the follow - up is not reported well in literature , and the treatment outcome assessment is restricted to condition at discharge .
we had follow - up data of 10 patients , with a duration ranging from 112 months ( median 4 months ) .
enterococcal abscesses have been commonly described in supratentorial lobar locations , cerebellum , and cerebellopontine angle . besides these locations
, we had a patient ( case 2 ) with brain abscess in basal ganglia due to chd .
the cause of enterococcal brain abscess was csom in 7 cases , dental procedure in a case of hereditary hemorrhagic telangiectasia in one , and after neurosurgical procedure in one .
chd , which was source in two of our patients , has not been reported as cause of enterococcal abscess earlier .
the species of enterococcus reported were enterococcus avium in 6 cases , e. species in three , and e. faecalis in one .
most of the enterococcal abscesses were treated with aspiration , either stereotactic , or burrhole .
most of our patients underwent craniotomy and excision of brain abscess , as we believe that antibiotic therapy duration can be shortened by totally excising the abscess .
na et al . described 53 patients of enterococcus bacteremia , where vancomycin was the most commonly used antibiotics .
the common antibiotics that have been used to treat enterococcal abscess are ceftriaxone in 5 cases , metronidazole in five , and vancomycin in 3 cases .
other antibiotics that have been used are amikacin , ceftazidime , cefoperazone / sulbactum , moxifloxacin , linezolid , meropenem , and ampicillin . as per our hospital policy
if the organisms are sensitive to these antibiotics , these are continued for variable period based on operating surgeon 's discretion .
there is tendency to shorten the duration of antibiotic therapy if total surgical excision is done .
the common antibiotics used in our patients were ceftriaxone in 7 cases , amikacin in six , metronidazole in five , and vancomycin in 3 cases .
we also have preference of prescribing oral antibiotics , hence we have used ampicillin , ofloxacin , cotrimoxazole , kloxacillin , and chloramphenicol for our patients based on sensitivity report
. the antibiotic therapy duration has been variable in literature , and also in our cases .
our patients received antibiotics for 26 weeks . 1 patient ( case 3 ) , who had recurrence while on first line of antibiotics for 1-month , received other antibiotics for two additional weeks .
the follow - up is not reported well in literature , and the treatment outcome assessment is restricted to condition at discharge .
we had follow - up data of 10 patients , with a duration ranging from 112 months ( median 4 months ) . only 1 patient had recurrence ( case 3 ) at 1-month of surgery .
. though presence of it does not warrant any extra precaution , the knowledge of its occurrence will help the clinician and the microbiologists to identify and formulate treatment accordingly . | background : neurosurgeons in developing countries come across brain abscess frequently , but enterococcus as a cause of abscess is rare.aims:to describe clinical profile and treatment of a series of patients with enterococcal brain abscess.materials and methods : we retrospectively reviewed microbiological records of patients with brain abscess to identify enterococcus as a causative organism.results:12 patients ( nine males ) were diagnosed to have enterococcal brain abscess .
all were due to e. species.conclusions:the clinical feature and management are not different from other etiological agents .
the prognosis of enterococcal brain abscess is more favourable than bacteremia . |
recent transcriptome studies have revealed that a large number of transcripts in mammals and other organisms do not encode proteins but function as noncoding rnas ( ncrnas ) instead . in vivo experiments
have demonstrated important biological roles of noncoding rnas , including regulation of transcription and translation , rna modification and epigenetic modification of chromatin structure ( 13 ) .
there is immense interest within the biological community to identify and study new noncoding rnas . as millions of transcripts
are generated by large - scale cdna and est sequencing projects every year , there is a need for automatic methods to accurately and quickly distinguish protein - coding rnas from noncoding rnas . since to date
no web server and few standalone tools have been designed for this purpose , researchers sometimes used tools developed for other purposes such as cdna annotation and functionally domain identification ( 412 ) .
however these methods showed varied performance on different datasets ( 12,13 ) . recently a new algorithm and standalone software named conc was published that classifies transcripts as coding or
however , conc is slow for large datasets and does not have a web - server interface , limiting its usefulness .
it works well with high - quality transcripts but may suffer from errors such as frameshifts which are common in ests and even occur occasionally in full - length cdnas ( 11 ) .
new tools are desired that are more accurate , run faster , and have a more user - friendly web - based interface .
to assess a transcript 's coding potential , we extract six features from the transcript 's nucleotide sequence .
a true protein - coding transcript is more likely to have a long and high - quality open reading frame ( orf ) compared with a non - coding transcript .
thus , our first three features assess the extent and quality of the orf in a transcript .
we use the framefinder software ( 14 ) to identify the longest reading frame in the three forward frames . known for its error tolerance ,
framefinder can identify most correct orfs even when the input transcripts contain sequencing errors such as point mutations , indels and truncations ( 14,15 ) .
we extract the log - odds score and the coverage of the predicted orf as the first two features by parsing the framefinder raw output with perl scripts ( available for download from the web site ) .
the log - odds score is an indicator of the quality of a predicted orf and the higher the score , the higher the quality .
a large coverage of the predicted orf is also an indicator of good orf quality ( 14 ) .
we add a third binary feature , the integrity of the predicted orf , that indicates whether an orf begins with a start codon and ends with an in - frame stop codon .
the large and rapidly growing protein sequence databases provide a wealth of information for the identification of protein - coding transcript .
we derive another three features from parsing the output of blastx ( 16 ) search ( using the transcript as query , e - value cutoff 1e-10 ) against uniprot reference clusters ( uniref90 ) which was developed as a nonredundant protein database with a 90% sequence identity threshold ( 17 ) .
first , a true protein - coding transcript is likely to have more hits with known proteins than a non - coding transcript does .
second , for a true protein - coding transcript the hits are also likely to have higher quality ; i.e. the hsps ( high - scoring segment pairs ) overall tend to have lower e - value .
thus we define feature hit score as follows :
where eij is the e - value of the j - th hsp in frame i , si measures the average quality of the hsps in frame i and hit score is the average of si across three frames . the higher the hit score , the better the overall quality of the hits and the more likely the transcript is protein - coding .
thirdly , for a true protein - coding transcript most of the hits are likely to reside within one frame , whereas for a true non - coding transcript , even if it matches certain known protein sequence segments by chance , these chance hits are likely to scatter in any of the three frames .
thus , we define feature frame score to measure the distribution of the hsps among three reading frames :
the higher the frame score , the more concentrated the hits are and the more likely the transcript is protein - coding .
we incorporate these six features into a support vector machine ( svm ) machine learning classifier ( 18 ) .
mapping the input features onto a high - dimensional feature space via a proper kernel function , svm constructs a classification hyper - plane ( maximum margin hyper - plane ) to separate the transformed data ( 18 ) . known for its high accuracy and good performance , svm is a widely used classification tool in bioinformatics analysis such as microarray - based cancer classification ( 19,20 ) , prediction of protein function ( 21,22 ) and prediction of subcellular localization ( 23,24 ) .
we employed the libsvm package ( 25 ) to train a svm model using the standard radial basis function kernel ( rbf kernel ) .
the c and gamma parameters were determined by grid - search in the training dataset .
we trained the svm model using the same training data set as conc used ( 13 ) , containing 5610 protein - coding cdnas and 2670 noncoding rnas .
we evaluated our method , named coding potential calculator ( cpc ) , by 10-fold cross - validation on the training data sets .
for further evaluation we tested cpc on three large datasets including two non - coding rna datasets from the rfam 7.0 database ( 26 ) and rnadb databank ( 27 ) , respectively , and a protein - coding rna dataset from the embl nucleotide databank based on cross - links to the uniprot / swissprot protein knowledgebase ( 17,28 ) .
we recorded the accuracy and computation time of cpc in table 1 , and compared it with conc ( version 1.01 downloaded from the authors website http://cubic.bioc.columbia.edu/~liu/conc/ and installed locally ) .
both cpc and conc were run in a linux box with intel xeon 3.0 g cpu and 4 g ram .
overall , cpc showed better accuracy on all three datasets with an order - of - magnitude faster speed ( table 1 ) . for more stringent evaluations we removed those sequences in the three test datasets that were similar to one or more sequences in the training set ( blastn e - value cutoff 1e-2 ) and tested cpc on the remaining sequences .
we also tested cpc on new entries in the latest uniref90 release ( version 10.1 ) which were not included in the previous release used to train cpc ( version 9.4 ) . in both cases
the accuracy of cpc remained high ( see section more stringent evaluation and table s1 in supplementary data ) .
table 1.evaluation of accuracy and cpu time of cpc and conc on three datasetsdatasetdataset typedataset sizeaccuracytime ( min)cpcconccpcconcrfamnoncoding30 77098.62%97.12%351346 376rnadbnoncoding399691.50%85.44%5987322embl cdscoding121 91499.08%98.70%69 116826 210conc focuses on sequences with at least 80 nucleotides and assumes shorter sequences unlikely to have coding potential .
cpc does not make this assumption and has similar performance on shorter sequences , but to make a direct comparison here we shows results only on sequences with at least 80 nucleotides.because the required cpu time is long , the dataset was split and run on 24 nodes in parallel .
evaluation of accuracy and cpu time of cpc and conc on three datasets conc focuses on sequences with at least 80 nucleotides and assumes shorter sequences unlikely to have coding potential .
cpc does not make this assumption and has similar performance on shorter sequences , but to make a direct comparison here we shows results only on sequences with at least 80 nucleotides . because the required cpu time is long , the dataset was split and run on 24 nodes in parallel .
we then compared cpc with other prediction algorithms following the same evaluation strategy proposed by frith et al .
the results showed that cpc had the highest consistency with expert curation and performed well for the six challenging cases hand - picked by frith et al .
comparison with other protein - prediction algorithms following frith et al. and table s2 in supplementary data ) .
cpc was also able to accurately predict 92% of the 2,849 short peptides with less than 100 amino acids ( see section
the cpc web server accepts a set of nucleotide fasta sequences as input ( allowing symbols
the sequences can be pasted directly into the input box or uploaded from a local sequence file . by default
, the cpc server runs in interactive mode in that results will be shown in the browser once the computation is finished . for a large set of sequences the user can input an email address to run his / her job in
batch mode. the server will send a notice to the user 's mailbox upon completion of the job . a unique
users can use tid to track the job progress and retrieve the results which are saved on the server for 1 week .
the columns show the sequence i d , the coding / noncoding classification , the svm score ( the distance to the svm classification hyper - plane in the features space ) , and a details link ( as described later ) . in general , the farther away the score is from zero , the more reliable the prediction is . as a rule of thumb from our experience ,
weak coding. results in the summary table can be sorted interactively by sequence i d , coding / noncoding classification , and svm score ; they can also be filtered by coding / noncoding classification , and svm score .
( a ) results are summarized in a table view. ( b ) sequence features and additional annotations of an input transcript are shown in an evidence page .
( a ) results are summarized in a table view. ( b ) sequence features and additional annotations of an input transcript are shown in an evidence page .
the current version of cpc can not accurately discriminate transcripts falling entirely within utr regions from true non - coding transcripts , because neither of them produces amino acid sequences . to handle this limitation
, cpc provides the users the option to search database of known utr sequences , utrdb ( 32 ) , using blast ( see section recognizing potential utr regions and figure s1 in supplementary data ) . to
explain why a transcript is classified as coding or noncoding , cpc server provides detailed supporting evidence and other related sequence features of the input transcript in an evidence page ( figure 1b ) .
the evidence page shows the six features of the transcript , color coded for better visualization .
the evidence page also provides options for querying the input transcript against well - annotated database , such as the functional domain database pfam ( 29 ) , smart ( 30 ) and superfamily ( 31 ) , utrdb ( 32 ) and ncrna database rnadb ( 27 ) .
we developed the cpc web server on a java platform using jsp to render the dynamic html pages and apache / tomcat as the j2ee container .
the web site is in compliance with w3c xhtml 1.0 strict specification and works in both the microsoft internet explorer and mozilla firefox browsers .
a standalone version of the software is freely available for download on the web site , distributed under gnu gpl .
with the rapidly increasing amount of data generated by large - scale transcriptome sequencing and intensifying attention on the study of noncoding rnas , methods that can discriminate noncoding rnas from protein - coding ones with high reliability and fast speed are important . integrating multiple sequence features with biological significance , cpc is shown to have good accuracy in both cross - validation and several test datasets .
it also runs an order - of - magnitude faster than the previous state - of - the - art tool , and thus is more suitable for high - throughput analysis .
cpc uses far fewer features than conc does ( 6 versus 180 ) but achieved comparable , even better , performance in the evaluation .
the results demonstrated that the sequence features used by cpc have powerful discriminating power and may reflect the intrinsic properties of coding transcript . using fewer , sequence - based features
also significantly reduced computing cost , thus removing a hurdle for a web server to be developed .
additional information such as potential functional domains and similarity to known utr regions or ncrna is useful to users .
this and other supplementary information is available in the evidence pages of cpc , making the results of cpc more easily interpretable and biology - meaningful .
| recent transcriptome studies have revealed that a large number of transcripts in mammals and other organisms do not encode proteins but function as noncoding rnas ( ncrnas ) instead . as millions of transcripts are generated by large - scale cdna and est sequencing projects every year , there is a need for automatic methods to distinguish protein - coding rnas from noncoding rnas accurately and quickly .
we developed a support vector machine - based classifier , named coding potential calculator ( cpc ) , to assess the protein - coding potential of a transcript based on six biologically meaningful sequence features .
tenfold cross - validation on the training dataset and further testing on several large datasets showed that cpc can discriminate coding from noncoding transcripts with high accuracy .
furthermore , cpc also runs an order - of - magnitude faster than a previous state - of - the - art tool and has higher accuracy .
we developed a user - friendly web - based interface of cpc at http://cpc.cbi.pku.edu.cn .
in addition to predicting the coding potential of the input transcripts , the cpc web server also graphically displays detailed sequence features and additional annotations of the transcript that may facilitate users further investigation . |
, new york , ny , usa ) for most men with erectile dysfunction ( ed ) is 50 mg . for many men ,
50 mg is effective and provides a clinically meaningful benefit.1 consequently , 100 mg may not be offered because the incremental improvement in erectile function is not appreciated .
however , evidence of a dose response between sildenafil 50 mg and 100 mg was seen as early as the initial controlled clinical trials supporting regulatory approval.1 more recently , results of a double - blind , placebo - controlled , flexible - dose study showed that 88% of men who initiated sildenafil at a dose of 50 mg increased their dose to 100 mg to improve efficacy , and 98% of those who increased their dose to 100 mg remained on the higher dose.2 for men who do not initially respond to sildenafil , increasing their dose to 100 mg and reeducating them on proper use may improve treatment response , including erectile function and rate of successful sexual intercourse ( ssi ) , treatment satisfaction , and adherence to treatment.37 the central role of dose optimization in improving treatment response , regardless of reeducation , is suggested by the failure to demonstrate a statistically significant difference in scores on the erectile dysfunction inventory of treatment satisfaction ( edits ) among 1,272 men who were randomized to education to optimize ed treatment outcomes and 1,301 who received only normal clinical care ( edits index = 77.3 versus ( vs ) 76.6 ) ( p = 0.1722 ) , in a prospective study conducted in treatment - nave men prescribed sildenafil by their medical practitioner ; standardized educational materials included a physician tear - off sheet , for use during consultation , and a brochure and video for the patient to take home.8 quality of life is decreased by ed , which is associated with low self - esteem , depression , and anxiety.912 the increased frequency of erections hard enough for intercourse and ssi associated with sildenafil treatment has been correlated with improvement in self - esteem and confidence , as assessed with the self - esteem and relationship ( sear ) questionnaire.13,14 even a shift in erection hardness from
( ehs4 ) was associated with a significant improvement in sear scores.15 furthermore , improvement in the overall sear score was found to be greater in men treated with sildenafil 100 mg compared with those taking sildenafil 50 mg.2 thus , it is reasonable to assume that following a sildenafil dose increase prompted by previous suboptimal dosing , an increase in erection hardness and ssi would be achieved , bringing an improvement in self - esteem , confidence , and continued treatment adherence .
however , to prevent further erosion of self - esteem and confidence , and to minimize patient discouragement and treatment discontinuation , the increase in erection hardness and ability to achieve ssi would ideally occur during the first few attempts following the dose increase .
the objective of this study was to determine the extent of improvement in erection hardness and in the rate of ssi during the final attempt at sexual intercourse when using a dose of 50 mg compared with the results for the subsequent initial attempt at sexual intercourse after a dose increase to 100 mg .
tolerability and safety were not specifically addressed in this analysis because the safety profiles of sildenafil 50 and 100 mg were previously shown to be comparable in a large review of the double - blind , placebo - controlled trials database of sildenafil.16
this analysis uses data from two previously published , randomized , double - blind , placebo - controlled , multicenter , flexible - dose studies of sildenafil for the treatment of men with ed . both studies complied with all appropriate regulations and
the studies were conducted in the us,17 brazil , turkey , and the european union.14 men with ed at screening ( score 25/30 on the erectile function domain of the international index of erectile function ) were randomly assigned to receive a double - blinded , flexible - dose of sildenafil or matching placebo for either 6 weeks , in the larger study ( clinicaltrials.gov identifier nct00159900)14 ( n = 307 ) , or 10 weeks , in the smaller study ( clinicaltrials.gov identifier , nct00147628)17 ( n = 209 ) .
these studies were selected from the overall sildenafil clinical trials database of 74 double - blind , placebo - controlled trials because both administered a flexible - dose regimen of sildenafil and assessed ehs and ssi .
the men were given sildenafil 50 mg or matching placebo at the beginning of the double - blind placebo - controlled phase , to be taken as needed , approximately 1 hour before anticipated sexual intercourse .
after 2 weeks , the dosage could be adjusted based on tolerability and efficacy ; patients who had no tolerability concerns and insufficient efficacy were titrated up to 100 mg .
those who were unable to tolerate 50 mg were titrated down to 25 mg ( larger study ) or had their sildenafil therapy discontinued ( smaller study ) .
the details of the inclusion and exclusion criteria and of the efficacy assessments have been reported previously.14,17 the population included in this post hoc analysis is the subgroup of men whose dose was increased from 50 mg to 100 mg after 2 weeks of treatment .
after each sexual encounter , study participants recorded the following in an event log : study medication use and whether sexual stimulation occurred , an erection was achieved , sexual intercourse was attempted , and whether the intercourse was successful ( did your erection last long enough for you to have successful sexual intercourse ? ) .
this event log also included the validated ehs , which asked the man to rate the hardness of his erection as follows : increase in size but not hard ( ehs1 ) ; hard but not hard enough for penetration ( ehs2 ) ; hard enough for penetration but not completely hard ( ehs3 ) ; and completely hard and fully rigid ( ehs4).18 event log data ( ehs and the outcome [ success or failure ] of sexual intercourse ) for each attempt at sexual intercourse with sexual stimulation and medication use from the patients whose treatment dose was increased from 50 mg to 100 mg were analyzed by study and by treatment group ( sildenafil or placebo ) .
statistical comparisons between the reported results on the last dose before titration and the results reported on the first dose after titration were conducted by using fisher s exact test .
for the subgroups included in the current study , the population from the smaller , 10-week study was older , heavier , had a longer duration of ed , and had more frequent comorbidities than the population from the larger , 6-week study ; in both studies , the distribution of ed severity was similar between the placebo and sildenafil groups , except for slight differences for severe ed and mild ed in the larger study ( table 1 ) .
erection hardness and the rate of ssi were calculated for attempts at sexual intercourse with medication use and sexual stimulation , before and after the dose increase ( table 2 ) . in both studies ,
the sildenafil group had a larger proportion of ehs4 ( completely hard and fully rigid ) erections ( p < 0.001 ) and ssi ( p < 0.005 ) compared with the placebo group , both before and after dose increase . in both studies , the proportion of ehs4 erections increased with the initial 100 mg dose , more so in the sildenafil group than in the placebo group .
the increase in the proportion of ehs4 erections between the final 50 mg dose and the initial 100 mg dose was statistically significant in the larger study ( 8% vs 18% for the placebo group [ p = 0.0466 ] and 34% vs 58% for the sildenafil group
[ p = 0.0003 ] ) and showed clinical significance and borderline statistical significance in the sildenafil group of the smaller study ( 32% vs 49% ) ( p = 0.0578 ) . in both studies ,
the increase in rate of ssi between the final 50 mg dose and the initial 100 mg dose was statistically significant in the placebo group of the smaller study ( 45% vs 63% ) ( p < 0.05 ) and in the sildenafil group of the larger study ( 67% vs 80% ) ( p < 0.05 ) . when assessed at each of the three subsequent intercourse attempts after dose increase , the increase in proportion of ehs4 erections and in the rate of ssi
were sustained in the sildenafil and placebo groups , in both trials , with no more than a three percentage point decrease in proportion of ehs4 erections and a five percentage point decrease in the rate of ssi , in any group at any of the three additional assessments .
this post hoc analysis directly compared erection hardness and the rate of ssi ( with medication use and sexual stimulation ) between the final attempt at sexual intercourse before and the initial attempt after a sildenafil dose increase from 50 mg to 100 mg .
an increase in sildenafil dose from 50 mg to 100 mg was associated with a higher proportion of completely hard and fully rigid erections and a higher rate of ssi during the initial attempt using the higher dose , improvements that were statistically significant in the larger study .
although the proportion of ehs4 erections and the rate of ssi increased in the sildenafil group of both studies , the absence of statistical significance in the sildenafil group of the smaller study may be attributed to a lack of power due to small sample size ( beta error ) .
the results of the current analysis add to previously reported results that suggested a dose - response relationship , between sildenafil 50 mg and 100 mg , in the ability to achieve completely hard and fully rigid erections .
for example , results of a double - blind , placebo - controlled study of fixed - dose sildenafil showed that completely hard erections ( ehs4 ) were achieved by 25% ( 95% ci 19%33% ) of men in the 50 mg group ( n = 94 ) and 35% ( 95% ci 27%43% ) in the 100 mg group ( n = 99).19 in an international survey of more than 3,500 men with ed , the quality of erections and , specifically , the capacity to enable hard erections , was the primary attribute sought in a treatment for ed.14,20 the ehs is psychometrically validated in men with ed,18,21 and ssi is a subjective clinical outcome that has a demonstrable relationship with erection hardness.20 the odds of achieving ssi with an ehs4 were previously shown to be 24 times ( 95% ci , 2029 ) ( p < 0.0001 ) that for ehs3 , with an approximately curvilinear increase in the percentage of ssi with the increase in mean ehs , from almost 60% at ehs3 to 93% at ehs4.20 however , the fact that ssi might be achieved with an erection that is merely hard enough for penetration but not completely hard ( ehs3 ) means that an increase in hardness from ehs3 to ehs4 might not be reflected in a change in ssi status . in the current study , between the final attempt at sexual intercourse before and the initial attempt at sexual intercourse after a sildenafil dose increase from 50 mg to 100 mg , the proportion of ssis increased by 1.2-fold ( from 67% to 80% ) in the patients from the larger study and by 1.1-fold ( from 76% to 87% ) in the patients from the smaller study , despite an increase in the proportion of ehs4 erections by 1.7-fold ( from 34% to 58% ) and 1.5-fold ( from 32% to 49% ) , respectively .
the increase in the proportion of erections hard enough for penetration ( ehs3 or ehs4 ) was only four percentage points in each study ( from 85% to 89% in the patients from the larger study and from 83% to 87% in the patients from the smaller study ) .
regardless , the higher proportion of ssi during the initial attempt using the higher sildenafil dose was statistically significant in the larger study .
this result supports previously published results from controlled clinical trials of fixed - dose sildenafil that showed statistically significant dose - related ( 100 mg vs 50 mg ) improvements in outcomes ( with no dose - related increase in adverse events ) , on questions about the quality of the sexual experience , including the ability to have better sex ( p = 0.0103),19 and on the odds that the patient would be able to have sexual intercourse ( odds ratio , 1.96 ; 95% ci 1.123.41 ) ( p = 0.018 ) , that sexual intercourse would be attempted ( odds ratio 1.29 ; 95% ci 1.021.63 ) ( p = 0.035 ) , that an erection would be maintained long enough to have successful intercourse ( odds ratio 1.29 ; 95% ci 1.001.67 ) ( p = 0.046 ) , and that orgasm would be achieved ( odds ratio 1.30 ; 95% ci 1.031.64 ) ( p = 0.025).22 the ehs has a demonstrable and quantifiable relationship with several health - related quality - of - life patient - reported outcomes.18,21,23 as reviewed by mulhall et al,23 ehs4 erections
correlated positively ( r value > 0.50 ) with several ed - specific and psychometrically validated patient - reported outcomes of satisfaction concepts , including individual sexual satisfaction ( the individual satisfaction domain of the sexual experience questionnaire),24 satisfaction in the context of the couple or relationship ( sear overall relationship satisfaction subscale25 and the sexual experience questionnaire couples satisfaction domain ) , and satisfaction with erection ( quality of erection questionnaire).24,26 also , previously reported results showed that the increased frequency of erections hard enough for intercourse and of ssi associated with sildenafil treatment correlated with improvement in self - esteem and confidence , as assessed with the sear questionnaire,13,14 that a shift in erection hardness from ehs3 to ehs4 was associated with a significant improvement in sear scores,15 and that improvement in the overall sear score was greater in men treated with sildenafil 100 mg compared with sildenafil 50 mg.2 thus , the rapid improvements in erection hardness and ssi with the 100 mg dose of sildenafil in the current analysis suggest that it should increase satisfaction and help prevent further erosion of self - esteem and confidence . in building on previously reported results
, the current analysis shows that the increase in the ability to achieve completely hard and fully rigid erections and to have ssi after sildenafil treatment is related to dose , occurs as rapidly as the initial attempt after increasing to a dose of 100 mg , and is sustained during subsequent attempts .
the results from these analyses are applicable to men with ed who tolerate sildenafil 50 mg
. limitations of this research are that the analyses were post hoc and the sample size was relatively small ; however , the data are informative .
men with ed who received sildenafil 50 mg for 2 weeks and then received a dose increase to sildenafil 100 mg had a higher proportion of completely hard and fully rigid erections and a higher rate of ssi at the initial sexual intercourse attempt with sexual stimulation and using the higher dose than they did with the final sexual intercourse attempt with sexual stimulation and using the lower dose .
these rapid improvements in efficacy with the higher dose ( 100 mg ) of sildenafil suggest that it should help prevent further erosion of self - esteem and confidence and minimize patient discouragement and treatment discontinuation . from a clinical care perspective
, these data support a recommendation that in the absence of contraindications , men failing to achieve completely rigid erections or who have less than satisfactory ssi rates when using sildenafil 50 mg should be prescribed the 100 mg dose .
such men should be informed that they are likely to experience greater efficacy in the initial sexual attempts when using the higher dose of sildenafil . | purposeto determine , in men with erectile dysfunction ( ed ) , the extent of improvement in erection hardness and in the rate of successful sexual intercourse ( ssi ) during the final intercourse attempt using sildenafil 50 mg compared with the subsequent initial attempt after a dose increase to 100 mg.patients and methodsthis post hoc analysis used data from two randomized , double - blind , placebo - controlled studies of flexible - dose sildenafil for the treatment of men with ed , who were given sildenafil 50 mg or matching placebo , to be taken as needed before sexual intercourse .
after 2 weeks , those with no tolerability concerns were titrated up to 100 mg , forming the subgroup of this analysis .
the main outcome measures were event log data , including an erection hardness score ( ehs ) and a question on ssi ( did your erection last long enough for you to have successful sexual intercourse ? ) , for each attempt at sexual intercourse , analyzed by study and treatment group ( sildenafil or placebo ) .
statistical comparisons were conducted by using the fisher s exact test.resultsin both studies , the sildenafil group had a larger proportion of ehs4 ( completely hard and fully rigid ) erections ( p < 0.001 ) and ssi ( p < 0.005 ) compared with the placebo group , both before and after the dose increase . between the final 50 mg sildenafil dose and the initial 100 mg sildenafil dose , the outcomes improved and significantly so in the larger study.conclusionthe improved efficacy with sildenafil 100 mg versus 50 mg , which occurs rapidly , suggests that patients should be encouraged to use 100 mg if they are unable to achieve completely hard and fully rigid erections or ssi with the 50 mg dose . |
pins and wires have long been used in orthopedics for the efficient management of fractures and dislocations .
anecdotal reports of the migration of such devices to sites quite distant to the original point of fixation are well described and are , at times , quite startling in their seriousness .
we report here the migration over a three to five day period of time of one of three shoulder fixation pins through the right chest and right diaphragm to lodge in the right lobe of the liver .
we also present a review of the significant literature and the laparoscopic management of this case .
l.r . is a 78-year - old white female who sought treatment ten days after a fall sustaining an impacted fracture of her right shoulder .
the patient was evaluated in the orthopedics department and three percutaneous fixation ( 9 cm ) pins were placed under fluoroscopic guidance ( figure 1 ) .
the pin ends were secured with standard plastic fixation caps and the wounds were sterilely dressed .
approximately 8 days postoperatively , the patient noted some right sided chest discomfort that she attributed to rib injuries associated with her fall .
she had a routine follow - up visit scheduled with her orthopedist in two days and elected to wait until that time to be evaluated .
she denied shortness of breath or dyspnea on exertion , but did admit to discomfort on deep breathing . on the 10th postoperative day ,
the patient presented for her visit and underwent a routine right shoulder x - ray to evaluate the fracture site ( figure 2 ) .
subsequent x - rays demonstrated migration of one of the fixation pins from the right shoulder through the right chest and diaphragm to lodge in the right lobe of the liver .
the patient was brought to the singer division of the beth israel medical center for evaluation .
her history and physical examination were normal except for slightly diminished breath sounds on the right with poor inspiration secondary to pain .
her vital signs were stable , and the abdominal examination was completely normal . a ct scan with iv contrast was performed .
the results demonstrated a 9.6 cm metallic foreign body representing one of the fixation pins transiting the right chest and entering the right lobe of the liver in a postero - lateral oblique angle .
the tip of the pin appeared confined to the liver at the time of the examination .
the patient was prepped to include both the chest and abdomen , and the operating team was prepared to place a chest tube if needed .
the patient was placed in the reverse trendelenburg position and rotated to the left to achieve maximal exposure of the right infradiaphragmatic space .
the first trocar was placed to the right of the falciform ligament two thirds of the way between the umbilicus and the xiphoid .
the second trocar was placed on the lateral border of the right rectus sheath approximately 3 to 4 fingerbreadths below the costal margin .
care was taken to ensure that the sides of the triangle were 20 to 25 cm from the foreign body ( figure 3 ) and the base of the triangle had approximately 12 to 15 cm of separation between trocar sites .
a 10-mm trocar was used in the nondominant hand position in preparation for the passage of intracorporeal sutures .
the lateral aspect of the liver was examined , and no evidence of retroperitoneal injury was found .
the diaphragm was lifted off of the end of the pin so as not to disturb the pin 's position in the liver .
the pin was extricated from the liver parenchyma taking care not to damage the diaphragm or suprahepatic inferior vena cava .
the area of the diaphragmatic injury was inspected and closed with a single intracorporeal suture of 2-o surgidek ( ussc ; norwalk , ct ) .
inspiratory pressures began to elevate as expected from the transit of abdominal co2 into the chest and a # 20 tube thorocostomy was placed with full expansion of the lung and normalization of inspiratory pressures .
the lateral and inferior aspects of the right lobe of the liver were inspected and adhesions were found , but no evidence existed of retroperitoneal hematoma .
the wound was irrigated , and the port sites were closed under direct vision with a carter - thomassen port closure device and 2-o pds sutures . the skin was closed with subcuticular 3-o catgut sutures and steristrips .
the chest tube did not demonstrate any evidence of air leak and was removed the next day .
the patient was discharged on postoperative day 2 with a normal chest x - ray , stable vital signs , and normal blood work .
the patient was prepped to include both the chest and abdomen , and the operating team was prepared to place a chest tube if needed .
the patient was placed in the reverse trendelenburg position and rotated to the left to achieve maximal exposure of the right infradiaphragmatic space .
the first trocar was placed to the right of the falciform ligament two thirds of the way between the umbilicus and the xiphoid .
the second trocar was placed on the lateral border of the right rectus sheath approximately 3 to 4 fingerbreadths below the costal margin .
care was taken to ensure that the sides of the triangle were 20 to 25 cm from the foreign body ( figure 3 ) and the base of the triangle had approximately 12 to 15 cm of separation between trocar sites .
a 10-mm trocar was used in the nondominant hand position in preparation for the passage of intracorporeal sutures .
the lateral aspect of the liver was examined , and no evidence of retroperitoneal injury was found .
the diaphragm was lifted off of the end of the pin so as not to disturb the pin 's position in the liver .
the pin was extricated from the liver parenchyma taking care not to damage the diaphragm or suprahepatic inferior vena cava .
the area of the diaphragmatic injury was inspected and closed with a single intracorporeal suture of 2-o surgidek ( ussc ; norwalk , ct ) .
inspiratory pressures began to elevate as expected from the transit of abdominal co2 into the chest and a # 20 tube thorocostomy was placed with full expansion of the lung and normalization of inspiratory pressures .
the lateral and inferior aspects of the right lobe of the liver were inspected and adhesions were found , but no evidence existed of retroperitoneal hematoma .
the wound was irrigated , and the port sites were closed under direct vision with a carter - thomassen port closure device and 2-o pds sutures . the skin was closed with subcuticular 3-o catgut sutures and steristrips .
the chest tube did not demonstrate any evidence of air leak and was removed the next day .
the patient was discharged on postoperative day 2 with a normal chest x - ray , stable vital signs , and normal blood work .
metallic fixation pins and wires are used extensively in the management of fractures and dislocations .
the actual incidence of migration of these devices is unknown , although the complication has been well documented and on occasion has been associated with death .
migration is most often to contiguous structures ( chest , lung , heart , trachea , spinal canal , orbit , etc ) , but embolization of foreign bodies through major vascular structures to distant sites has been reported .
lyons and rockwood described 49 cases of migration in 47 patients in which 17 pins migrated directly to major vascular structures ( 4 to the heart , 2 to the subclavian artery , 6 to the ascending aorta , and 5 to the pulmonary artery ) .
eight deaths were attributed to migration , six of which were associated with pericardial tamponade .
all eight deaths were in patients who had fixation of the stern - oclavicular joint , and all died within three months of operation .
six of these patients were known to have had migration of the pins and all died suddenly .
the most common site of origin of migrating pins was the shoulder ( sternoclavicular , 21 ; acromioclavicular , 8 ; fracture of the shaft of clavicle , 7 ; fracture of the medial portion of the clavicle , 3 ; arthrodesis shoulder , 3 ; fracture of the proximal part of the humerus , 3 ; unstable posterior dislocation of the shoulder , 1 ; and excisional arthropasty of the acromioclavicular joint , 1 ) .
an additional unusual case was reported by goodsett et al describing the migration of a kirschner wire from a left wrist fracture site to the right ventricle forty - two months postoperatively .
the pin was noted by the patient under the skin for some time and then disappeared .
only two reports document the passage of a pin from the shoulder , through the thoracic cavity , to the abdomen . as reported by retief et al ,
one of these pins had been placed to stabilize a right acromioclavicular dislocation six weeks previously .
few days after the fall , and the pin was seen protruding from the inferior aspect of the shaft of the clavicle in the direction of the apex of the lung . over the next few days , the pin exhibited aggressive migration to the right upper quadrant .
the pin was ultimately retrieved from the posthepatic retroperitoneal space at laparotomy . in a second case of abdominal migration ,
a pin was used to stabilize a posterior dislocation of the glenohumeral joint . at laparotomy
, the wire was found to be protruding from the costal border of the spleen .
several technical algorithms were used during the course of this procedure that assisted the operating team in the efficient laparoscopic management of this case .
these include the flesh & bone ; steel & plastic approach to room setup , the establishment of optical correctness , the use of the triangle of success
the formulation concepts of proper room setup strategy must be based on a standardized personnel / equipment organizational format .
this serves to decrease room clutter and allows the team to interface with the equipment with greater ease .
first , when applicable , we strive to position all personnel on one side of the table , which is usually the side that is contralateral to the operative site .
flesh & bone ( personnel ) ; steel & plastic ( equipment ) rule ( figures 4a and 4b ) .
( bottom ) ideal operative room set - up for upper abdominal laparoscopic surgical procedures .
optical correctness assures directional stability with respect to the relationship of the actual direction of movement by laparoscopic instruments in the abdomen to the direction of movement of the instruments on the video monitor .
optical correctness is established by having the surgeon , camera , operative site , and video monitor in a linear relationship with each other . to maintain this instrument directional consistency , the surgeon must never operate looking over the shoulder .
the minimally invasive operative approach to this case was enhanced by the use of a structured trocar site selection strategy .
once the pneumoperitoneum is achieved , the triangle of success is established based on visualization of the operative target .
the apex of the triangle is the operative site with the base formed by two trocars .
the distance between the operative site and the two tro - cars should normally be between 20 to 25 cm and is a critical 30 to 40 degrees .
an appropriate instrument entry angle allows efficient intracorporeal wrapping during suturing and prevents either the tangling or falling off , or both tangling and falling off , of the suture from the suturing instrument .
in addition , the distance between the two trocars establishing the base of the triangle of success should be between 12 to 15 cm . this distance dictates the appropriate convergence angle of the instruments over the operative site and prevents the lack of convergence , collisions , and fatigue associated with poor ergonomic positioning produced by a great distance between trocars .
emphasis should be placed on selection of the sizes of trocars and two - handed intracorporeal suturing techniques .
if the operator is right - hand dominant , the needle should be placed into the abdomen with the left hand through the left trocar .
a trocar that is at least 10 mm in diameter must be used to allow successful passage of the sh ( ethicon ; somerville , nj ) or v20 ( ussc ; norwalk , ct ) needle through the trocar .
if the operator is left - hand dominant , the suture is placed into the abdomen using the nondominant or right hand .
therefore , a 10-mm trocar is used for the right - sided port of the triangle .
it differs from other techniques in that the non - dominant hand is extensively used .
preparatory drills are used to improve targeting skills , 2-dimensional depth perception compensation and two - handed choreography .
lastly , a rigidly structured algorithm is used to assist in rapidly establishing intracorporeal suturing capability .
metallic fixation pins and wires are used extensively in the management of fractures and dislocations .
the actual incidence of migration of these devices is unknown , although the complication has been well documented and on occasion has been associated with death .
migration is most often to contiguous structures ( chest , lung , heart , trachea , spinal canal , orbit , etc ) , but embolization of foreign bodies through major vascular structures to distant sites has been reported .
lyons and rockwood described 49 cases of migration in 47 patients in which 17 pins migrated directly to major vascular structures ( 4 to the heart , 2 to the subclavian artery , 6 to the ascending aorta , and 5 to the pulmonary artery ) .
eight deaths were attributed to migration , six of which were associated with pericardial tamponade .
all eight deaths were in patients who had fixation of the stern - oclavicular joint , and all died within three months of operation .
six of these patients were known to have had migration of the pins and all died suddenly .
the most common site of origin of migrating pins was the shoulder ( sternoclavicular , 21 ; acromioclavicular , 8 ; fracture of the shaft of clavicle , 7 ; fracture of the medial portion of the clavicle , 3 ; arthrodesis shoulder , 3 ; fracture of the proximal part of the humerus , 3 ; unstable posterior dislocation of the shoulder , 1 ; and excisional arthropasty of the acromioclavicular joint , 1 ) .
an additional unusual case was reported by goodsett et al describing the migration of a kirschner wire from a left wrist fracture site to the right ventricle forty - two months postoperatively .
the pin was noted by the patient under the skin for some time and then disappeared .
only two reports document the passage of a pin from the shoulder , through the thoracic cavity , to the abdomen . as reported by retief et al ,
one of these pins had been placed to stabilize a right acromioclavicular dislocation six weeks previously .
few days after the fall , and the pin was seen protruding from the inferior aspect of the shaft of the clavicle in the direction of the apex of the lung . over the next few days , the pin exhibited aggressive migration to the right upper quadrant .
the pin was ultimately retrieved from the posthepatic retroperitoneal space at laparotomy . in a second case of abdominal migration ,
a pin was used to stabilize a posterior dislocation of the glenohumeral joint . at laparotomy
, the wire was found to be protruding from the costal border of the spleen .
several technical algorithms were used during the course of this procedure that assisted the operating team in the efficient laparoscopic management of this case .
these include the flesh & bone ; steel & plastic approach to room setup , the establishment of optical correctness , the use of the triangle of success
the formulation concepts of proper room setup strategy must be based on a standardized personnel / equipment organizational format .
this serves to decrease room clutter and allows the team to interface with the equipment with greater ease .
first , when applicable , we strive to position all personnel on one side of the table , which is usually the side that is contralateral to the operative site .
flesh & bone ( personnel ) ; steel & plastic ( equipment ) rule ( figures 4a and 4b ) .
( bottom ) ideal operative room set - up for upper abdominal laparoscopic surgical procedures .
optical correctness assures directional stability with respect to the relationship of the actual direction of movement by laparoscopic instruments in the abdomen to the direction of movement of the instruments on the video monitor .
optical correctness is established by having the surgeon , camera , operative site , and video monitor in a linear relationship with each other . to maintain this instrument directional consistency , the surgeon must never operate looking over the shoulder .
the minimally invasive operative approach to this case was enhanced by the use of a structured trocar site selection strategy .
once the pneumoperitoneum is achieved , the triangle of success is established based on visualization of the operative target .
the apex of the triangle is the operative site with the base formed by two trocars .
the distance between the operative site and the two tro - cars should normally be between 20 to 25 cm and is a critical 30 to 40 degrees .
an appropriate instrument entry angle allows efficient intracorporeal wrapping during suturing and prevents either the tangling or falling off , or both tangling and falling off , of the suture from the suturing instrument .
in addition , the distance between the two trocars establishing the base of the triangle of success should be between 12 to 15 cm .
this distance dictates the appropriate convergence angle of the instruments over the operative site and prevents the lack of convergence , collisions , and fatigue associated with poor ergonomic positioning produced by a great distance between trocars .
emphasis should be placed on selection of the sizes of trocars and two - handed intracorporeal suturing techniques .
if the operator is right - hand dominant , the needle should be placed into the abdomen with the left hand through the left trocar .
a trocar that is at least 10 mm in diameter must be used to allow successful passage of the sh ( ethicon ; somerville , nj ) or v20 ( ussc ; norwalk , ct ) needle through the trocar .
if the operator is left - hand dominant , the suture is placed into the abdomen using the nondominant or right hand .
therefore , a 10-mm trocar is used for the right - sided port of the triangle .
it differs from other techniques in that the non - dominant hand is extensively used .
preparatory drills are used to improve targeting skills , 2-dimensional depth perception compensation and two - handed choreography .
lastly , a rigidly structured algorithm is used to assist in rapidly establishing intracorporeal suturing capability .
migration of orthopedic fixation pins , particularly when used to stabilize the shoulder and especially after fixation of the sternoclavicular joint , is a known and dangerous complication of their use .
patients should be instructed on the importance of notification of their physician with any symptom , such as chest pain or shortness of breath , atypical of their previous course .
close follow - up is essential with periodic radiographs confirming the stability of fixation in all patients , with particular attention to any patient with symptoms potentially related to migration .
if any migration of percutaneous pins is noted , the pin should be removed immediately .
if an intracorporeal pin migrates , it must be urgently removed , regardless of a lack of symptoms .
finally , fixation of the sternoclavicular joint with pins should not be done because of the extraordinarily high risk of migration .
this report presents the successful removal of a shoulder fixation pin from the right lobe of the liver with intracorporeal repair of the diaphragmatic laceration .
in addition , attention to the details of strategic operative planning , ie , rosser 's rules , were needed .
adherence to the principles of room setup , optical correctness , establishment of the triangle of success , appropriate instrument entry and convergence angles , two - handed surgical skills , and competence in intracorporeal suturing techniques were all required for successful completion of the case . | we report the successful removal of a shoulder fixation pin from the right lobe of the liver with intracorporeal repair of a diaphragmatic laceration .
an expeditious workup and urgent operative intervention were required .
we adhered to the principles of room setup , optical correctness , establishment of the triangle of success , appropriate instrument entry and convergence angles , two - handed surgical skills , and competence in intracorporeal suturing techniques that were all required for successful completion of the case.we also present a review of the significant literature . |
the worldwide seaweed industry provides a wide variety of products for direct or indirect human uses that have an estimated total value of us$10 billion per year ( bixler and porse 2011 ; fao 2013 ) .
sea vegetables for human consumption constitute about 83 % of production ( craigie 2011 ) , while the remainder is used as fertilizers and animal feed additives , medical applications ( zimmermann et al .
2005 ; ehrhart et al . 2013 ) , and biotechnological applications ( mchugh 2003 ) .
worldwide , macroalgal production increases 5.7 % every year and more than 18 million tons of macroalgae were produced from global capture and aquaculture in 2011 ( fao 2014 ) . in 2011 , 96 % of the global total production of macroalgae came from aquaculture , with asian countries dominating seaweed culture production ( 99.05 % by quantity and 99.36 % by value , fao 2014 ) .
five genera ( e.g. , saccharina , undaria , porphyra , eucheuma / kappaphycus , and gracilaria ) represented around 98 % of the world s cultivated seaweed production ( suo and wang 1992 ; pereira and yarish 2008 ) .
saccharina japonica was the most cultivated algae in the world until 2010 when the production of eucheuma / kappaphycus reached over 5.5 million tons for a value over us$1.3 billion ( suo and wang 1992 ; mchugh 2003 ; fao 2014 ) .
saccharina and eucheuma / kappaphycus are mostly produced as raw materials for the food and food polymer industries .
aquaculture of seaweed is scarce outside of asia , which triggered a worldwide search for hitherto unexploited natural seaweed resources . in 2011 , 786,466 t of seaweeds was commercially harvested in 28 countries , ranging from cold to tropical coastlines in both hemispheres , with over 55 % of the biomass harvested in latin america and almost 32 % in europe ( fao 2014 ) .
the top producers are chile and norway respectively accounting for 51.3 and 19.2 % of the global catches of natural seaweed ( fao 2014 ) .
the pacific coast of south america is naturally rich in marine resources ( thiel et al .
in latin america , macroalgae are an important group for species richness of all regions , varying from 4.9 to 8.7 % of total marine species biodiversity ( odor et al .
the highest biodiversity of macroalgal species is reported for the brazilian region ( 10.6 species per 100 km of coast ) , followed by the humboldt current system ( 7.3 species per 100 km of coast ) , the tropical west atlantic ( 7.1 species per 100 km of coast ) , and the tropical east pacific ( 6.0 species per 100 km of coast ) , with the lowest diversity attributed to the patagonian shelf ( 4.7 species per 100 km of coast ; miloslavich et al .
the trends reported so far , however , may not truly reflect real patterns , as sampling has not been equal throughout the continent , and taxonomic capacity is very uneven from one country to another , as is the case in the caribbean ( robledo and townsend 2006 ; miloslavich et al .
2010 ) . in this context , there are still some efforts to be made on basic research to describe and evaluate some of the macroalgal resources in the region ( critchley et al .
macroalgae or seaweeds are one of major components of primary biomass production in coastal maritime ecosystems and play an essential ecological role as habitat and substrata for invertebrates , fish , mammals , and birds ( vsquez 1992 ; graham et al .
2007 ) . drastic reduction of any macroalgal community directly influences marine biodiversity , as well as reproduction , recruitment , and growth rates of marine fauna ( vsquez and santelices 1984 ; vsquez 1993 ) .
1984 ) and contribute significantly to the marine carbon cycle ( thiel et al . 2007
it is possible that overexploitation of natural seaweed resources could lead to significant ecological , economic , and social consequences at local , regional , and even global scales ( graham et al .
regard , alvarez and vodden ( 2009 ) examined the relationships between human actors and chondracanthus chamissoi harvesting in the community of pisco in peru . by using local ecological knowledge ( lek ) , these authors found that a disorderly extraction of c. chamissoi generates reductions in the resource that could be exacerbated by climatic change ( el nio and la nia phenomena ) and the rupture of ecological cycles due to pollution of the marine space and decline of marine species .
accurate data about seaweed aquaculture or the exploitation of the natural resource stock are difficult to obtain through the international channels in most of the latin american countries ( except in chile ) .
the necessary information was extracted from database queries at the harvest data from instituto de fomento pesquero ( ifop ) in chile ; secretara de agricultura , ganadera , desarrollo rural , pesca y alimentacin ( sagarpa ) in mexico ; numerous direccin regional de produce ( direpro ) in peru ; and the fao fisheries and aquaculture information and statistics service to discuss the trends for some latin american countries , especially for those harvesting seaweeds .
the potential for seaweed aquaculture , particularly for red seaweeds , has been addressed in hayashi et al .
in latin america , exploitation of seaweed happened or has happened in argentina , brazil , chile , mexico , peru , uruguay , and venezuela ( critchley et al .
the main seaweed exploitation has been reported in argentina , brazil , chile , mexico , and peru . in these countries ,
traditional harvesting and/or aquaculture is presently active or has been attempted and has generated an estimated biomass volume around 554,585 t in 2009 ( equivalent to us$115 million in value ) , with an estimated decline in total volume to 444,686 t in 2011 ( equivalent to us$22 million ; table 1 ) .
the main objective of this study is to present a short overview of the management and regulations in place for the exploitation and harvesting of seaweeds in the five above - mentioned latin american countries .
some of the environmental , social , economic , and political obstacles to sustainable development for seaweed utilization in latin america will be identified through multidisciplinary analyses , combining natural , ecological , and social sciences .
the european environmental agency ( eea ) also stressed the need for an analytical approach for coastal areas and to place this in an ecosystem - based management approach combining integrated spatial planning and management . included in this
is the need for a consolidated knowledge base and widespread information sharing to support informed policy development and management actions ( eea 2013 ) .
examples for long - term management from europe ( norway , portugal ) and north america ( canada ) are then shortly presented , and successful practices in these northern regions are then identified and presented as possible as best practices model for long - term sustainable seaweed exploitation in latin america .
particular emphasis is given to identify the possible actions in particular to overcome social , economic , and political obstacles for using latin american seaweeds as an economic resource for wealth and sustainable livelihoods for coastal communities.table 1harvesting of seaweeds in argentina , brazil , chile , mexico , and peru and commercial aquaculture of seaweeds attempted in only four of these countries .
harvest and aquaculture volumes of seaweed biomass in tons200020012002200320042005200620072008200920102011seaweed harvest
argentina3 brazil chile280,844299,759315,660349,128410,850425,343334,674337,206406,223456,184380,742417,965 mxico33,55546,92730,12428,99627,4185,2775,7515,0934,9005,8146,0095,721 peru1,3235,5176,1767,8647,4185,0003,1189,21312,1073,8743,8365,801seaweed aquaculture
argentina3 brazil320
520
730
730
chile33,47165,53871,64840,07920,27315,49333,58623,66821,68788,19312,17914,469 mxico peru1112
ifop instituto de fomento pesquero ( www.ifop.cl ) , sagarpa secretara de agricultura , ganadera , desarrollo rural , pesca y alimentacin ( http://www.sagarpa.gob.mx ) , direpro direccin regional de produce ( regional direction from production ministry )
harvest data from chile ( ifop ) , mexico ( sagarpa ) , peru ( direpro )
aquaculture data from fao ( 18/12/2013 )
fao estimates harvesting of seaweeds in argentina , brazil , chile , mexico , and peru and commercial aquaculture of seaweeds attempted in only four of these countries .
harvest and aquaculture volumes of seaweed biomass in tons
ifop instituto de fomento pesquero ( www.ifop.cl ) , sagarpa secretara de agricultura , ganadera , desarrollo rural , pesca y alimentacin ( http://www.sagarpa.gob.mx ) , direpro direccin regional de produce ( regional direction from production ministry )
harvest data from chile ( ifop ) , mexico ( sagarpa ) , peru ( direpro )
aquaculture data from fao ( 18/12/2013 )
in latin america , several species of red and brown seaweed are harvested as a raw material for phycocolloid extraction .
chile was one of the first agar producers in the world and supplies 10 % of the global biomass for alginates ( bixler and porse 2011 ; vsquez et al .
coastal communities have harvested primarily gracilaria and lessonia species since the 1980s , while in more recent years , macrocystis species has been cultivated , first to feed abalone and most recently for bioenergy production ( buschmann et al .
in chile , several other benthic fisheries like sea urchins and molluscs depend on existence of seaweed beds .
the exploitation of natural seaweed resources is therefore regulated with aims to protect the target species as well as the associated biodiversity .
several management strategies have been implemented successfully during the last 10 years , considering comanagement between fishermen unions and the state , using strategies with biological and ecological bases like morphological constraints , quotas by fishing areas , biological bans , rotation of harvesting , and also using experimental areas for harvesting and collection ( vsquez 2008 ; vsquez et al .
2013 ) suggested an ecosystem approach and community indicators to manage wild brown seaweed stocks along the country . in argentina ,
different commercial species can be found such as undaria pinnatifida , gracilaria gracilis , gigartina skottsbergii , lessonia vadosa , macrocystis pyrifera , porphyra columbina , ulva lactuca , and codium fragile . in 1958 ,
g. gracilis and g. skottsbergii were already harvested for the agar and carrageenan industries , respectively . since 1980 , l. vadosa and m. pyrifera are exported to the usa and china to supply the alginate industry , and since 1999 , the uses of the argentinian seaweeds have expended to new markets , such as for human consumption , nutraceuticals , and cosmetic including the fucoidan industries .
all seaweed is harvested in patagonia , mostly in the provinces of chubut ( fig .
local farmers directly sell the seaweeds to the processing companies or companies with concessions which directly employ their own workers for harvesting during the year and contracted divers in the summer ( fig
harvest is regulated since 1970 by local government through special licenses for 3 , 10 , or 30 years .
today , there is only one company ( soriano sa ) that has worked steadily through the years producing agar and carrageenan .
the national center of patagonia ( cenpat ) guarantees that the harvesting methods are performed in a sustainable way .
regulations for the management of brown seaweeds and marine concessions are particularly well developed , and the supply in brown seaweed to the alginate industry is well managed and organized ( zaixso et al .
( f ) selection of high - quality algae ( processing of high - quality algae ) .
( i ) quality control on final product ( photos : g soriano ) argentina . harvesting of seaweed in patagonia .
( f ) selection of high - quality algae ( processing of high - quality algae ) .
( i ) quality control on final product ( photos : g soriano ) in mexico , the federal government manages all fisheries
. however , under a law published in 2009 , individual states can also manage sessile marine resources through an agreement to the federation .
presently , mexico s seaweed biomass is sold to the phycocolloid industry , abalone farming , and seaweed extracts for agriculture ( dof 2012 ; zertuche - gonzlez et al .
none of the four commercial seaweed species harvested in mexico ( m. pyrifera , gelidium robustum , chondracanthus canaliculatus , gracilariopsis lemaneiformis ) are endangered , thanks to the application of proper harvesting methods ( hernndez - garibay et al .
the highest reduction of the seaweed resource was observed along the pacific mexican coast during the years when el nio occurred , but even then , the resources recovered successfully ( ladah et al . 1999 ; casas - valdez et al .
, seaweed harvesting may be classified into three broad categories of activity : by hand ( at low tide ) , by diving , and by mechanized methods ( specialized boats ) .
women and other family members are however mostly involved in the manual gathering , while men dominate the diving and mechanical harvesting , due to the hardship of the work . c. canaliculatus has been harvested for carrageenan , by hand , during low tide since 1966 , and it is a sustainable harvest up to today ( fig . 2 a d ) .
the economic outcome from sustainable exploitation of natural resources does not yet necessarily assure a good livelihood to fishermen .
fishermen involved in seaweed harvesting by boat and diving ( such as in the case of g. robustum and m. pyrifera ) get better income than those harvesting by hand in low tide . c. canaliculatus
, for instance , has been harvested for carrageenan , by hand , during low tide since 1966 , and it is a sustainable harvest up to today ( fig . 2 a d ) ; however , harvesting and drying methods are artisanal and seasonal and therefore generate low income .
fishermen that harvest seaweeds from boats and diving gear complement their income by participating in other fisheries such as abalone or sea urchin .
although the seaweed fishery is economically or environmentally sustainable , the livelihood of the fishermen is not always attractive .
it is therefore important to look at the fishery in the larger context , and the cultivation of seaweeds ( as opposed to their harvesting ) may actually offer a better alternative to coastal communities , as it can give them the opportunity to increase production and improve productivity and quality . in this regard , a socio - economic analysis of seaweed farming involving coastal communities was performed in the gulf of mexico coast using assumptions and data from the pilot cultivation of kappaphycus alvarezii carried out in dzilam , yucatan peninsula ( robledo et al .
2013 ) . based on this experience , various social and institutional factors in seaweed farming were discussed , which indicated a good potential for seaweed farming to become an integrated part of the local livelihood strategies for community development ( fig .
one of the major conclusions of this study was that any integration of seaweed growing and industrialization in mexico would require an interest from industry as well as local investors and government authorities in order to ensure successful implementation and development of the activity.fig .
( a d ) harvesting of chondracanthus canaliculatus in san quintin , baja california . c. canaliculatus is harvested by hand in low tide . in the harvest ,
( e g ) kappaphycus alvarezii aquaculture and harvesting in dzilam de bravo , yucatan ( photos : d robledo ) mexico .
( a d ) harvesting of chondracanthus canaliculatus in san quintin , baja california . c. canaliculatus is harvested by hand in low tide . in the harvest ,
( e g ) kappaphycus alvarezii aquaculture and harvesting in dzilam de bravo , yucatan ( photos : d robledo ) peru is just starting to establish regulations for management or exploitation of the seaweed resources including some harvesting restrictions associated with the brown seaweed populations ( vsquez et al .
southern peru has approximately 1,000 km of exploitable coastline , with several major , natural populations of brown seaweed species , such as lessonia nigrescens , lessonia trabeculata , macrocystis integrifolia , and m. pyrifera ( acleto 2006 ) . the peruvian production
drift brown seaweeds were collected along the shoreline and directly sold to one processing company .
mchugh ( 2002 ) reported that l. nigrescens and l. trabeculata were available from natural beds in the south of peru , although the biomass was strongly affected by el nio events ( taylor et al .
2008 ) . in the years when the natural marine resources are not negatively affected by el nio events ,
about 3,000 t of dry l. nigrescens and dry l. trabeculata is exported to asia ( peruvian seaweed exports 2012 , psw sa unpublished report ) .
m. pyrifera is also widely available , and prior to 2001 , it was exported only in small quantities .
in 2012 , 95.5 % of the peruvian seaweed exports was done by the four main peruvian - based companies ( one chilean and three chinese ) .
today , there are four companies purchasing seaweed from the local communities : two peruvian companies , one chilean , and one chinese - owned company .
the occurrence of chinese - owned companies in the peruvian market has triggered an intensive competition for obtaining the seaweed biomass from the local fishers . as captured fisheries ( including seaweed )
likewise , the most commonly harvested fish in peru , anchoveta ( engraulis ringens ) , has had a dynamic history of overharvest and fluctuating production ( diana 2009 ) . as a result
, beach prices of dried seaweeds increased from us$60 to us$400 t between 2006 and 2008 ( table 2 , psw sa unpublished report ) , creating in the short term an uncontrolled intensification of the harvesting and resulting in a depletion of the natural resources that could have long - term consequences for the peruvian fishers and peruvian seaweed industry .
thus , while anchoveta indeed is the fundamental fish species in the peruvian ecosystem , there are other fisheries to be considered for management ( including seaweed ) .
there are trade - offs in managing fisheries , and ideally , such trade - offs should be known when setting fisheries policies ( christensen et al .
this area is well known for experiencing large changes in the abundance and species composition of its main fish resources .
three decades ago , the peruvian fishery also experienced an economic and social crisis due to an absence of adequate management actions in relation to overexploitation of the anchovy resource ( schreiber 2013 ) .
particular favorable environmental conditions , good recruitment coupled with careful management , and a surveillance scheme have apparently contributed to the fast recovery of the anchovy resource at the end of the 1990s , provided by the political regulatory organism for fisheries resource produce ( ministry of production ) with the information given by their scientific and technical entity marine institute of peru ( imarpe).table 2prices in us dollars per ton of dried seaweed paid to the peruvian fishermen excluding the tax ( igv 19 % ; psw sa unpublished data)speciesearly 2007early 2008at present
macrocystis pyrifera
74170400
chondracanthus chamissoi
440840 prices in us dollars per ton of dried seaweed paid to the peruvian fishermen excluding the tax ( igv 19 % ; psw sa unpublished data ) in the case of brazil , historically , the seaweed industry is based on harvesting of seaweed from wild populations , a practice maintained until today .
industries based on kappaphycus farming have also been established in the last 20 years but still need to address the issues relative to the acceptance of this new activity from the authorities ( hayashi et al .
2013 ) . despite the large number of economically commercial species , only few species of gracilaria and hypnea are exploited commercially in brazil ( marinho - soriano et al .
red seaweed exploitation began in the 1960s along the northeast coast and was undertaken without regulations . in 2006 ,
the brazilian institute of environment and renewable natural resources ( ibama ) implemented a regulation on the harvest of natural resources along the coastline .
however , the lack of taxation caused overexploitation of natural beds and most of activities that were then dependent on the harvesting of these species have nowadays stopped ( hayashi et al . 2013 ) .
seaweeds are still a significant source of income and support the livelihoods of many people within coastal communities .
harvest is considered a secondary activity , undertaken without the participation of the family heads , who are generally fishermen ( e marinho - soriano unpublished ) . on the other hand , for many women
, harvesting is considered their main occupation , even if it is performed only part time , during low tide ( fig .
the harvest is done on the shores or by diving from a small boat ( jangadas , fig .
this activity is mostly carried out by women and their children equipped with a net bag ( fig .
, the biomass is brought back to the shore and then sun - dried for 2 to 3 days on land ( fig .
3f ) . finally , the dried seaweed is sold to an intermediate collector and will be used for agar or carrageenan production ( e marinho - soriano unpublished).fig .
harvesting and aquaculture in the community of rio do fogo , rio grande do norte , brazil .
( a b ) women and their children harvesting the natural bed of seaweeds at low tide .
( g ) preparation of the seaweed seedling net by the women of the community .
( h ) culture line of gracilaria birdie ( photos : e marinho - soriano ) brazil .
harvesting and aquaculture in the community of rio do fogo , rio grande do norte , brazil .
( a b ) women and their children harvesting the natural bed of seaweeds at low tide .
( g ) preparation of the seaweed seedling net by the women of the community .
( h ) culture line of gracilaria birdie ( photos : e marinho - soriano ) to improve the situation of poor coastal fishing communities of brazil , in 2001 , the brazilian government started an fao technical cooperation project ( tcp / bra/0065 ) with the objective of assisting the establishment of a sustainable seaweed farming sector that could benefit poor coastal communities in the northeast states ( rio grande do norte , paraiba e cear ) .
the scope of the project was testing farming techniques in pilot communities and verifying the technical and financial feasibility of the packages , promoting the associative work among the producers , monitoring the social impact of the introduction of these new techniques , and facilitating the establishment of an institutional framework for this new production sector ( freddi and aguilar - manjarrez 2003 ) .
moreover , the project showed that community members easily learned techniques for seaweed cultivation , and red seaweed farming ( gracilaria birdiae ) became a significant source of income , particularly for the poorer segments of the coastal fishing population ( fig .
a fivefold increase in the prices of dry seaweed collected from natural beds or from the beaches was experienced by the seaweed - farming industries ( freddi and aguilar - manjarrez 2003 ) .
nowadays , the kilogram of dried gracilaria is sold for us$3.50 ; seaweeds can therefore bring to the coastal communities an additional income as described in the last data published by the brazilian institute of geography and statistics ( ibge 2014 ) . in brazil , the size of the coastal zone and the large ecosystems and diversity produce a false idea of an inexhaustible exploitation potential , causing adoption of development policies that do not take into account the sustainable use of the resources ( mma / revizee 2006 ) . as a result , over 80 % of the resource is currently overexploited ( miloslavich et al .
marine fisheries contribute with 63 % of the national fish production and involve approximately 800,000 professionals creating 3.5 million jobs directly or indirectly on the sector ( aceb 2014 ) . according to the ibge ( 2014 ) ,
approximately one quarter of the brazilian population lives in the coastal area , accounting 50.7 million residents .
the process of urbanization in which population and economic activities are concentrated particularly along the coastline has been one of the main processes responsible for the modification of habitat and communities , as well as increasing pressures on water resources ( marques et al .
only a small portion of the enormous brazilian coastline is under some form of protection or management , and large areas are subject to anthropogenic pressures , encroachments , and overuse ( amaral and jablonski 2005 ) .
while mexico , chile , and argentina have developed coastal management plans and appropriate regulations for harvesting of their natural resources , peru and brazil do not have well - established regulations or sustainable practices in regard to the exploitation of their natural seaweed resources to avoid depletion of their natural beds ( santelices and doty 1989 ; vsquez et al .
due to the significance of the seaweed forest for coastal ecosystems and its place in the maritime food chain , a widespread reduction in south american seaweed resources may have an impact on the overall productivity and stability of the coastal communities , with only moderate capacity to adopt to societal and environmental changes .
in peru , the humboldt current large marine ecosystem ( hclme ) project therefore attempts to develop terms of reference and comprehensive plan of action ( pia ) , for the repopulation of natural seaweed beds along the peruvian coast . in the bay of paracas ecosystem ( ica region , peru ) , through laboratory cultivation , transplanting , and harvesting , the pia enables the recovery of the kelp populations , which were negatively affected by indiscriminate harvesting .
the pia also allows for the sustainability of the economic activity for the community of artisanal fishermen in the area in order to start a sustainable production that includes the transfer of appropriate technologies to them .
the understanding of the synergy between ecology , economy , and sociology involved in the exploitation of selected seaweeds provides a sustainable platform for seaweed exploitation in latin america ( clausen and york 2008 ) .
in europe , the norwegian seaweed industry is producing over 60 % of the biomass and is almost completely reliant on natural beds of ascophyllum nodosum and laminaria hyperborea .
l. hyperborea accounts for about 90 % of the national harvest ( meland and rebours 2012a ) , and the alginate industry is by far the most important sector . the remaining biomass is used directly for food , fodder , cosmetics , and the health sectors .
regulations for harvesting seaweed ( meland and rebours 2012b ) are applied to seabed algae such as l. hyperborea , and private owner rights only regulate the harvest of foreshore algae such as a. nodosum . however
even a strong interest for seaweed aquaculture , particularly as part of integrated multitrophic aquaculture ( leonczek 2013 ) , the development of any new industrial sector in norway follows the principle of precaution and is for now highly restricted and controlled by the existing regulation ( alexander et al . 2014 ) as regulations are under development ( meland and rebours 2012b ) .
portugal seaweed activities are now reduced to the seasonal and low - volume harvest of agarophyte and carrageenophyte species , whereas in the 1980s it was one of the world s largest agar producer ( sousa - pinto and arajo 2006 ) . despite the existence of several economical valuable species ,
regulations only exist for residual ( once important ) activities such as gelidium harvesting and beach cast seaweed activities .
a revision of the existing regulation that allows the exploitation of new species is required not only in order to establish sustainable harvesting activities but also to prevent the uncontrolled harvest of economically important sensitive species ( arajo et al .
on the other hand , the country s recent focus on aquaculture development opens the door for seaweed cultivation in monoculture or integrated multitrophic aquaculture ( imta ) systems ( abreu et al .
commercial exploitation of seaweeds in eastern canada began in the early 1940s with the harvest of the carrageenophyte chondrus crispus . from 1965 to 1980 , canada was the world s main supplier of raw material for the carrageenan industry , with a peak landing over 50,000 wet t in 1974 . by the 1990s , the landings sharply declined to less than 10,000 wet t due to a combination of international competition and biological fluctuations in the abundance of the resource ( chopin and ugarte 2006 ) .
today , a. nodosum is the main economic seaweed resource in canada , with over 40,000 t landed in 2010 ( ugarte and sharp 2011 ) .
this seaweed is being used for among other applications as a biostimulant extract for crops and animal feed supplements , incorporating more than us$40 million to the local economy .
a. nodosum has been managed since 1995 under an ecosystem approach , following strict regulations established in the ocean act ( ugarte and sharp 2001 ) . to solve problems mainly of fluctuating supply and avoid the risks of overexploitation ,
the aquaculture of c. crispus was developed in the 1970s . c. crispus production is the main commercial canadian seaweed aquaculture , with the culture of porphyra species and saccharina latissima as organic extractive components of integrated multitrophic aquaculture system ( levine 2004 ; chopin and ugarte 2006
like other european and american countries , the brazilian and peruvian dependency on traditional coastal fisheries and eventual growth in aquaculture is followed by an urgent need for robust institutions for planning and managing the coastal zone with focus on developing an integrated and sustainable management plan for the seaweed resources ( prates 2007 ; castello 2010 ; johnsen et al .
the steep growth in the use of marine biological resources represents a fundamental change in the way humans derive benefits from the oceans .
marine aquaculture production is growing at 7 % per year and the sector of domestication of marine species is growing at about 3 % per year , while the number of natural marine products of commercial interest is growing at a rate of 4 % per year ( duarte et al .
large - scale integrated conservation and management plans are thus urgently required in order to address the sustainable development of various economic and societal sectors .
in addition to developing and implementing management plans for sustainable use , these countries also face huge tasks connected to mapping , investigating , and monitoring their marine biological diversity .
information and lessons learned may be provided by the scientific communities and management plans in latin american countries such as chile or mexico ( vsquez et al . 2006 ; 2012 ; vila et al . 2013 ; vega et al . 2013 ) and european directives such as those from norway ( meland and rebours 2012a ) or the ecosystem - based management regulated by the ocean act in canada ( ugarte and sharp 2001 ) .
national regulations should be established on best practices for seaweed harvesting , management , and cultivation , and the knowledge should be passed on to the coastal communities , which could then make seaweed a sustainable opportunity for income .
the seaweed aquaculture industry still requires technological and management improvements , institutional changes , and appropriate environmental and social frameworks ( valenti 2008 ; oliveira 2009 ; abreu et al .
as seaweed aquaculture is at its infancy both in europe and america , its development will have to overcome numerous challenges by introducing innovations at different levels , i.e. , technology , biology , and policy .
however , cultivation techniques are standardized and economically sustainable especially in asia ( miura 1980 ) and cultivated macroalgae now supply 96 % of the global demand ( fao 2014 ) .
the aquaculture of macroalgae is also strongly recommended by the eu regulation ( ec no 710/2009 ) for the organic production of animals in aquaculture systems .
the development of regulations for supporting the aquaculture of seaweed is a necessary action in recent years , and these regulations should be guided by best practices .
the combined effect of rapidly increasing domestication and production with increasing demand for seaweed products is likely to promote innovation in seaweed biotechnology , and these efforts must be accompanied by substantial scientific effort ( mazarrasa et al .
in addition , revision of the common agricultural policy ( cap ) intends to include management with high nature value in organic certification .
nordic countries such as denmark , sweden , and norway are also aiming to increase organic products to 15 % of the home market .
several food and food supplement products directly prepared from algae are already certified in europe and in norway as organic food and given opportunities for producers to access to a niche market ( friis pedersen et al .
the seascapes are increasingly managed for multiple functions and services in addition to provision of food , and this requires the integration of ecological and socio - economic research , policy innovation , and public education .
the multiuse dilemma has driven many researchers , experts , and policy makers to try and address issues related to the sustainability of coastal development from disciplinary / sectorial perspectives addressing the interactions and functioning within the wider ecosystem , social , economic , and political contexts ( buchholz et al .
a review by harley et al . ( 2012 ) addressed the significant gaps in understanding , which hamper ability to predict the outcomes of global change in seaweed - dominated systems .
in particular , it addressed the lack of general or even basic understanding of ( a ) the importance of rates , timing , magnitude , and duration of environmental change ; ( b ) nonadditive effects of multiple stressors ; ( c ) population - level implications of variable environmental impacts among life history stages ; ( d ) the scope for population- or species - level adaptation to environmental change ; and ( e ) ecological responses at the level of communities and ecosystems , including tipping points and sudden phase shifts . in this
regard , biological responses ( i.e. , ecophysiological ) to key environmental drivers or combinations of drivers can be incorporated into demographic models to better describe and predict changes in population growth or decline .
the expansion of seaweed cultivation particularly in tropical regions contributes significantly to carbon sequestration since the rapid turnover in seaweed culture , approximately 3 months per crop ( in the tropics ) with yields of over 2,500 wet t ha ( de silva and soto 2009 ; vsquez et al .
nevertheless , some authors have pointed out that a significant proportion ( estimates range up to 60 % ) of the carbon they fix photosynthetically is released into the water , and a proportion of this released dissolved organic carbon ( doc ) is highly labile , entering in the bacterial loop and rapidly remineralizing back to co2 ( hughes et al .
environmental impacts of seaweed farming in the tropics have been reviewed by zemke - white and smith ( 2006 ) .
some authors have also pointed out other environmental impacts of algal farming both positive ( i.e. , increase on fish assemblages ; bergman et al . 2001 ) and/or negative ( i.e. , effect on the meiobenthos ; olafsson et al . 1995 ) .
all of these impacts should be considered when the environmental effects of seaweed aquaculture are taken into account .
the concept of ecosystem - based management approaches based on an integrated approach of entire ecosystem including humans should also be considered to develop the coastal spatial planning and the best practices guidelines for the exploitation of seaweed ( both harvesting and aquaculture ) in order to avoid spatial and temporal mismatches of the governance ( crowder and norse 2008 ) .
the benefits for the well - being of coastal communities as increase of direct permanent employment in previously disadvantaged coastal communities , where unemployment is not only an economic issue but also a socio - political concern , have been exemplified in an imta farm of abalone and seaweed ( nobre et al .
sustainable management of coastal resources creates new economic activities based on the exploitation of a raw material and could participate in the local socio - economic development in coastal areas and communities in latin america .
developing long - term management plans will also produce fundamental long - term results of interest for the international research community .
socio - economic benefits derived from seaweeds have been already exemplified in the philippines where approximately 116,000 families consisting of one million individuals were farming more than 58,000 ha of seaweed , making seaweed farming the largest and most productive form of livelihood among the coastal population . in zanzibar ( tanzania ) , more than 90 % of seaweed farmers are women .
like in latin america , changing the life in the villages by women gaining independent economic power will contribute in reducing childhood malnutrition ( as an indicator that the health of their mothers has improved ) , increasing the numbers of children attending schools regularly , and reversing the trend of rural depopulation by self - employment of the village youths ( msuya 2006 ; msuya et al .
innovation should be promoted when trying to integrate seaweed harvesting or aquaculture as part of the wealth for coastal communities . in this
regard , castellacci ( 2010 ) pointed out that the technology dynamics of a country depend on three main factors : its innovative intensity , its human capital , and its technological infrastructures . nowadays , latin american countries show a much lower innovative strength than norway or canada , where the innovation gap has been quantified with a ratio of 16:1 for patents and 10:1 for scientific articles ( castellacci 2010 ) . in order to get closer and eventually jump to the innovation development stage , developing economies such as in some latin american countries should implement an appropriate combination of policies that takes into account the need to simultaneously develop r & d activities , traditional infrastructures , information and communication technologies , and advanced human skills .
human capital education explains differences in economic performance across countries ; education is therefore a necessity to promote social inclusion and cohesion as well as employment . by focusing on marine resources involving low - cost technology requirements , such as the production of seaweed ,
developing countries are provided an opportunity to access an emerging market , propelled by a diversification of the demand for seaweed products from traditional uses to bioenergy , cosmetics , and biomedicine applications .
the european , canadian , and latin american seaweed industries rely on the harvesting of their natural resources activity limited by the biomass availability and the potential for the harvested species to recover .
different scenarios associated to seaweed resource exploitation can be observed , and several countries are in need of long - term management plans for the sustainable exploitation of their natural seaweed ( hersoug and revold 2012 ) .
as this activity increases , there is also an urgent need to develop and implement ecosystem - based management models and integrated coastal zone planning .
policy makers must develop regulations and directives that enable a sustainable exploitation of the natural resource , not only to preserve marine and coastal ecosystems but also to ensure social stability and economic income of local communities .
both european and latin american countries need to address capacity building and adaptive governance towards seaweed resources .
norway and canada have well - established management regimes for the sustainable exploitation of their seaweed resources based on the development and application of a sound knowledge and cross - sectorial management and spatial plans .
portugal , on the contrary , needs to review the national and regional management plans concerning the exploitation of the seaweed resources . in latin america , it is important to stress that chile has succeeded in establishing a sustainable harvesting in the south of the country .
the further expansion of the seaweed industry in this region thus depends on reliable access to raw material , the development of value - added products , and the transfer of expertise between developed and less developed regions .
an alternative solution to produce seaweed biomass for this growing sector is offered by aquaculture , which will also require guidelines for evolving into a responsible and well - managed farming .
finally , trained human resources are required in order to provide education to coastal communities , based on best practices for harvesting and cultivation , in order to establish profitable businesses which could provide socio - economic development leading to better living conditions to the coastal rural communities .
the current weak participation of developing countries in the seaweed market could then be reversed by strengthening cooperation to transfer technological knowledge and investment to developing nations active in seaweed management and aquaculture , thereby promoting sustainable development based on their own natural resources , as encouraged by the convention on biological diversity ( http://www.cbd.int/doc/legal/cbd-en.pdf ) . in this context , south american , european , and north
american experts should therefore collaborate to develop guidelines to plan an integrated coastal management for latin american seaweed resources .
it is also of great importance for the legitimacy of these guidelines that these originate from transnational and cross - sectorial cooperation , including political , cultural , commercial and industrial actors , ngos , and research communities . as a first action of knowledge transfer , research and technology development ( rtd ) and small and medium enterprises ( sme ) representatives from norway , argentina , brazil , canada , chile , mexico , peru , and portugal have established a common working framework in order to support the development of the latin american seaweed sector .
these industry / academia networks encourage cooperation among the seaweed stakeholders ; across the project areas ; in all aspects related to seaweed production , research , ecosystem services , and management of artisanal and small - scale aquaculture ; and traditional and alternative market and economics . | the european , canadian , and latin american seaweed industries rely on the sustainable harvesting of natural resources .
as several countries wish to increase their activity , the harvest should be managed according to integrated and participatory governance regimes to ensure production within a long - term perspective .
development of regulations and directives enabling the sustainable exploitation of natural resources must therefore be brought to the national and international political agenda in order to ensure environmental , social , and economic values in the coastal areas around the world . in europe
, portugal requires an appraisal of seaweed management plans while norway and canada have developed and implemented coastal management plans including well - established and sustainable exploitation of their natural seaweed resources . whereas , in latin america , different scenarios of seaweed exploitation can be observed
; each country is however in need of long - term and ecosystem - based management plans to ensure that exploitation is sustainable .
these plans are required particularly in peru and brazil , while chile has succeeded in establishing a sustainable seaweed - harvesting plan for most of the economically important seaweeds .
furthermore , in both europe and latin america , seaweed aquaculture is at its infancy and development will have to overcome numerous challenges at different levels ( i.e. , technology , biology , policy ) .
thus , there is a need for regulations and establishment of best practices for seaweed harvesting , management , and cultivation .
trained human resources will also be required to provide information and education to the communities involved , to enable seaweed utilization to become a profitable business and provide better income opportunities to coastal communities . |
dyssynchrony is a frequent feature in severe heart failure ( hf ) patients.13 it is well - established that short- and long - term cardiac resynchronization therapy ( crt ) can improve cardiac function and enhance functional capacity in advanced chronic heart failure.46 the prevalence of responders to crt has been widely varied amongst patients .
presence of left ventricular ( lv ) dyssynchrony indices is the most powerful predictor of favorable response and long - term survival in both ischemic and non - ischemic hf after biventricular pacing1 , 712 and recent studies have deducted that the severity of systolic dyssynchrony is a much better predictor of such a response in comparison to qrs complex duration
. 1 thus , assessment of the severity of systolic dyssynchrony is the key to the appropriate selection of patients .
tissue doppler imaging ( tdi ) has been widely used to assess segments time - to - peak myocardial sustained systolic velocity ( ts ) and investigate parameters of systolic dyssynchrony in patients receiving crt.7 , 8 , 1215 etiology of hf and qrs duration are two parameters which may influence the lv dyssynchrony pattern and subsequently affect the favorable response.12 previous studies investigated lv dyssynchrony indices in hf patients according to qrs duration2 , 3 , 10 , 16 or underlying etiology;2 , 16 however , there are not enough comprehensive studies evaluating various dyssynchrony indices with respect to both of these confounders . the current study aimed to evaluate potential differences in the prevalence of inter and intraventricular dyssynchrony indices in terms of the cause of hf in patients with various qrs durations .
the result would be helpful for the future investigators to have a more accurate prevision on electro conduction differences in hf patients and better control the possible confounders which could influence their studies .
from august 2005 to november 2010 , we retrospectively reviewed the available data on echocardiographic imaging of 230 refractory hf patients ( age = 52.9 16.6 years , 73.5% male ) with refractory hf who were referred to our department for echocardiographic evaluation .
all the patients were still symptomatic ( new york heart association [ nyha ] functional class iii or iv ) despite optimized drug treatment as defined by the current guideline17 and had left ventricular ejection - fraction ( lvef ) of 35% .
patients with previous pacemaker implantation and those with right bundle branch block ( rbbb ) were excluded from the study .
all the patients underwent complete resting conventional echocardiography and tdi for the evaluation of the extent of lv dyssynchrony .
the patients were divided into three categories according to the qrs duration : 57 patients with qrs duration < 120 ms ; 76 with qrs duration 120 150 ms ; and 97 patients with qrs duration 150 ms .
the underlying cause was ischemic cardiomyopathy ( icm ) in 99 patients and dilated cardiomyopathy ( dcm ) in 131 patients .
the etiology was diagnosed as ischemia if the patients had angiographic evidence of significant coronary artery disease ( at least narrowing 70% in one epicardial coronary artery ) with corresponding wall motion abnormality ; otherwise , they were categorized as dcm .
medication included loop diuretics in 44.8% , beta blockers in 85.9% , spirinolacton in 66% , angiotensin - converting enzyme ( ace ) inhibitor or angiotensin receptor blockers in 87.2% , digoxin in 54.6% , and asa in 95% .
the study protocol was approved by the institutional ethics committee review board of the hospital .
standard twelve - lead electrograms were acquired at a paper speed of 25 mm / s and a scale of 10 mm / mv .
the measurements of the qrs duration ( recorded from the surface leads , demonstrating the greatest values ) and the assessment of the qrs axis and morphology were performed by an experienced observer , and complete or incomplete left bundle branch block ( lbbb ) was diagnosed in twelve - lead surface electrocardiography ( ecg ) using the guideline definition.18 complete two - dimensional transthoracic echocardiography , m - mode , pulsed , and continuous - wave doppler with color - flow imaging was performed using a commercially available ultrasonographic system ( vivid 7 , vingmed ge , horten , norway with a 3.5-mhz transducer ) .
all the following parameters were measured in keeping with the guidelines of the american society of echocardiography:19 right and left ventricular dimensions ( vd ) , pulmonary artery pressure ( pap ) , and tricuspid annular plane systolic excursion ( tapes ) . additionally , left ventricular end systolic and diastolic volume and lvef were measured by the multi - plane modality of a four - dimensional probe employing the simpson technique .
according to the currently used grading system , the severity of mitral regurgitation was scored 1 as mild , 2 as moderate , 3 as moderate to severe , and 4 as severe and tricuspid regurgitation was graded 1 as mild , 2 as moderate , and 3 as severe regurgitation.20 interventricular dyssynchrony was assessed by measuring the opening and closing times of the aortic and pulmonic valves using the systolic blood flow by pulsed doppler with the sample volume placed at the level of the aortic and pulmonic annulus .
the aortic pre - ejection time was measured from the beginning of the qrs complex to the beginning of the aortic flow velocity curve recorded by pulsed - wave doppler in the apical view .
similarly , the pulmonary pre - ejection time was measured from the beginning of the qrs complex to the beginning of the pulmonary flow velocity curve recorded in the left parasternal short - access view .
a cut - off value of 40 ms was considered for interventricular dyssynchrony.21 systolic synchronicity was assessed via tdi using the apical views ( four - chamber , two - chamber , and long - axis ) of the lv as previously described22 with adjustments of filter frequency , gain settings , pulse repetition frequency , and color saturation .
at least three consecutive beats were stored , and the images were digitally stored for off - line analysis .
the following twelve segments were interrogated : septal , lateral , anterior , inferior , antroseptal , and posterior at both basal and middle levels .
the timing of the systolic events was evaluated by measuring ts in each lv segment with reference to the onset of the qrs complex .
the following seven indices of systolic dyssynchrony were computed , and the predictive cut - off values for positive response to crt are shown in parentheses in line with the previously reported data :
all segments delay ( ts - all - delay ) : differences between the longest and shortest ts in twelve lv segments ( 105 ms).23basal segments delay ( ts - basal - delay ) : differences between the longest and shortest ts in six lv basal segments ( 78 ms).23all segments standard deviation ( ts - all - sd ) : standard deviation ( sd ) of ts from all twelve lv segments ( 34.4 ms).23basal segments standard deviation ( ts - basal - sd ) : sd of ts from six lv basal segments ( 34.5 ms).23septal to lateral delay ( sep - lat - delay ) : absolute difference in ts between the basal interventricular septum and the lateral wall ( 65 ms).24 , 25anteroseptal - posterior delay ( antsep - pos - delay ) : absolute difference in ts between the basal - posterior and anteroseptal segments ( 65 ms).24anterior - inferior delay ( ant - inf - delay ) : absolute difference in ts between the basal anterior and inferior segments ( 65 ms).24 all segments delay ( ts - all - delay ) : differences between the longest and shortest ts in twelve lv segments ( 105 ms).23 basal segments delay ( ts - basal - delay ) : differences between the longest and shortest ts in six lv basal segments ( 78 ms).23 all segments standard deviation ( ts - all - sd ) : standard deviation ( sd ) of ts from all twelve lv segments ( 34.4 ms).23 basal segments standard deviation ( ts - basal - sd ) : sd of ts from six lv basal segments ( 34.5 ms).23 septal to lateral delay ( sep - lat - delay ) : absolute difference in ts between the basal interventricular septum and the lateral wall ( 65 ms).24 , 25 anteroseptal - posterior delay ( antsep - pos - delay ) : absolute difference in ts between the basal - posterior and anteroseptal segments ( 65 ms).24 anterior - inferior delay ( ant - inf - delay ) : absolute difference in ts between the basal anterior and inferior segments ( 65 ms).24 according to our previous published data , the intraobserver and interobserver variability for tdi measurements for time - to - peak systolic velocity was 13 11% and 18 20% , respectively.22 the results are reported as mean standard deviation ( sd ) for the quantitative variables and are summarized by absolute frequencies and percentages for the categorical variables .
the continuous variables were compared using one - way analysis of variance ( anova ) or kruskal - wallis test when the presumption of normality was not met or in case of unequal variances , while the categorical variables were compared using the chi - square test or fisher exact test when more than 20% of the cells with an expected count of < 5 were observed . between the two subgroups of the icm and dcm patients ,
the continuous variables were compared using the independent two - sample t - test or the nonparametric mann - whitney u test whenever the data did not appear to have normal distributions , and the categorical variables were compared using the chi - square or fisher exact test , as appropriate .
the influence of qrs duration ( classified as < 120 ms , 120150 ms , and 150 ms ) on the conventional echocardiographic measurements and cardiac dyssynchrony indices was appraised by constructing multiple linear regression ( for continuous indices ) , logistic regression ( for binary indices ) , or proportional odds model ( the most commonly used model among the types of cumulative logit models for ordinal responses26 ) for the ordinal indices , including mitral valve regurgitation ( mr ) and tricuspid valve regurgitation ( tr ) grades , while accounting for the confounding effects of age , sex , underlying etiology , and presence or absence of left bundle branch block ( lbbb ) .
additionally , the above multivariable analyses were conducted separately in each subgroup of qrs ( < 120 ms , 120150 ms , and 150 ms ) to assess the possible effect of the underlying etiology on the cardiac dyssynchrony indices , while controlling for age , sex , and qrs duration . for the statistical analysis , the statistical software spss version 13.0 for windows ( spss inc . ,
chicago , il ) and sas version 9.1 for windows ( sas institute inc . , cary , nc , usa ) were used .
all the p values were considered two - tailed , with statistical significance defined by p value 0.05 .
the patients demographic data , clinical characteristics , and conventional echocardiographic measurements are presented in table1 .
there was a significant difference in age between the patient groups according to the qrs duration and also cardiomyopathy etiology .
the subjects with qrs duration 150 ms and those with icm were significantly older then the corresponding groups , and male sex was significantly more frequent amongst the icm rather than the dcm patients . in regard to the cardiac conduction pattern
, the occurrence of lbbb appeared to be significantly raised in the subjects with prolonged qrs duration .
for the standard echocardiographic parameters , no significant difference was found between the patients in terms of the qrs duration or underlying etiology except for tricuspid regurgitation severity , which was greater in the patients with qrs duration < 120 ms than in both groups of patients with qrs duration 120150 and qrs duration 150 ms .
there was no significant difference between the patients groups in terms of medication . according to the substantial differences in the demographic , underlying etiology , and prevalence of lbbb between the groups ,
shows that aortic pre - ejection time associated with both qrs duration and underlying etiology .
the patients with wide qrs duration or dcm revealed a longer aortic pre - ejection time and higher proportion of interventricular dyssynchrony than the corresponding groups . in regard to the pulmonary pre - ejection period , no significant difference was found between the groups according to the qrs duration or underlying etiology .
figure1 shows that , irrespective of the etiology , ts in patients with qrs duration 150 ms was much more delayed in all the twelve lv segments than the corresponding segments in those with qrs duration < 120 ms .
figure 2 indicates that overall the underlying etiology did not influence ts in the individual lv segments in the qrs groups . amongst the intraventricular dyssynchrony indices , dys - ts - all and dys - ts - bas indices were significantly much more frequent in the patients with wide qrs duration than in those with a narrow qrs duration . in regard to the dyssynchrony indices derived from sd of ts ,
neither dys - ts - all - sd nor dys - ts - bas - sd revealed a significant difference between the qrs groups .
with respect to the opposite wall dyssynchrony indices , there was no difference in the frequency of dyssynchrony between the qrs groups or between the patients with icm and dcm in the matched qrs groups .
the present study illustrates that the prevalence of interventricular dyssynchrony was significantly higher in patients with a wide qrs duration ( 120 ms ) than in those with a narrow qrs duration ( < 120 ms ) .
likewise , etiology appeared to influence interventricular dyssynchrony since it was more prevalent in the patients with dcm than in those with icm in each of qrs groups . turning to the tdi measurements , the ts of the individual lv segments were much more prolonged in the patients with qrs 150 ms than the corresponding segments in those with qrs
the dys - ts - all and dys - ts - bas indices were significantly much more frequent in the patients with a wide qrs duration than in those with a narrow qrs duration , and a similar , albeit not significant , trend was found as regards the sd dyssynchrony indices between the qrs groups .
etiology did not appear to affect either ts or the intraventricular dyssynchrony indices . in terms of the opposite wall dyssynchrony indices such as dys - sept - lat , dys - ant - infer , and dys - antrsep - post ,
no significant difference was found with respect to the prevalence of these indices according to the qrs groups or underlying etiology .
. also reported significant age but not gender differences between their patient groups with respect to qrs duration : hf patients with a qrs duration 150 ms were significantly older than were those with a narrow qrs duration < 120 ms.2 , 27 in regard to the underlying etiology in our study , the patients with icm were significantly older than those with dcm , and icm was a much more dominant feature in the males than in the females in all the qrs groups .
these results were not unexpected since male gender and age both are well - recognized risk factors for ischemic heart disease .
van de veire et al . also reported a similar pattern in age difference between icm and dcm patients.28 we found that tr severity was significantly greater in the patients with qrs duration < 120 ms than in those with qrs duration 120150 or 150 ms .
although we neutralized the potential confounding effect of age , sex , etiology , and difference in the frequency of lbbb by including these variables into our multivariate analysis , it seems that other potential confounders such as the presence / absence of pulmonary hypertension or heart rate might have influenced the results .
based on our results , the prevalence of interventricular dyssynchrony increased from 19.3% in the patients with qrs < 120 ms to 64.9% in those with qrs 150 ms duration .
these findings are consistent with previous studies demonstrating a higher prevalence of interventricular dyssynchrony in patients with a wide qrs duration than in those with a narrow qrs duration.2 , 3 , 29 , 30 likewise , the frequency of interventricular dyssynchrony in those with qrs duration 120150 and 150 ms was significantly higher in the dcm than in the icm patients , while a similar trend was also seen in those with qrs duration < 120 ms . by contrast , ghio et al . and
haghjoo et al . did not find any significant relationship between etiology and ivmd.2 , 30 this inconsistency may be due to disregarding the confounding effect of the qrs duration in the comparison of the ivmd between the dcm and icm groups by previous investigators .
nevertheless , in the current study , all the comparisons were conducted regarding the potential confounding effect of the demographic and qrs duration differences between the groups .
furthermore , a larger recruited sample size seems to have slightly raised the power of our study .
regional ts in all the segments were consistently prolonged in the patients with qrs duration 150 ms compared with the corresponding segments in those with qrs duration < 120 ms .
accordingly , ghio et al . reported a similar delay in the comparison of segmental ts between patients with wide and narrow qrs durations.2 in regard to the underlying etiology , there was no significant difference in the segmental ts between the dcm or icm patients in the matched qrs groups except for ts in the inferior region in the patients with qrs 150 ms , which was significantly more delayed than the corresponding region in the icm patients .
contrary to our findings , van de veire reported more prolonged ts in nearly all the lv segments in patients with dcm than in those with icm in the presence of qrs duration 120 ms.28 to explain the difference it is deserving of note that all the ts in the van de veire study were corrected for the heart rate , whereas we did not apply any such correction in the current study . according to the intraventricular dyssynchrony indices , dys - ts - all and dys - ts - basal were more prevalent in the patients with qrs duration 150 ms and 120150 ms than in those with qrs duration < 120 ms .
these data are consistent with those in previous studies indicating a higher frequency of dys - ts - all1 , 30 dys - ts - basal28 indices in patients with a wide qrs than in those with a narrow qrs .
other studies have also reported similar interventricular dyssynchrony prevalence in different qrs groups using various definitions for intraventricular dyssynchrony indices.2 , 3 , 31 neither sd - ts nor the opposite wall dyssynchrony indices revealed similar differences in the comparison of the qrs groups .
in contrast , yu et al . reported significant differences in the frequency of sd - ts dyssynchrony index between patients with wide and narrow qrs.1 van de veire also reported similar results in the echocardiographic evaluation of dcm patients.28 it should be noted that in these studies , dyssynchrony was defined using a cut - off point different from what we applied in our study .
bleeker et al . , in a study of 90 hf patients , reported a greater septum - to - lateral wall delay in patients with a wide qrs duration than in those with a narrow qrs duration ; they , however , did not find any significant regressive relationship between qrs duration and septal - to - lateral delay.27 etiology did not appear to influence any of the intraventricular dyssynchrony indices in the matched qrs duration groups . likewise , previous studies have not indicated any difference in intraventricular dyssynchrony indices between dcm and icm patients.2 , 28 the segmental ts values were not corrected for the heart rate in the current study .
the use of this type of adjustment may lead to more accurate and concise results in future studies .
based on our results , the prevalence of interventricular dyssynchrony increased from 19.3% in the patients with qrs < 120 ms to 64.9% in those with qrs 150 ms duration .
these findings are consistent with previous studies demonstrating a higher prevalence of interventricular dyssynchrony in patients with a wide qrs duration than in those with a narrow qrs duration.2 , 3 , 29 , 30 likewise , the frequency of interventricular dyssynchrony in those with qrs duration 120150 and 150 ms was significantly higher in the dcm than in the icm patients , while a similar trend was also seen in those with qrs duration < 120 ms .
haghjoo et al . did not find any significant relationship between etiology and ivmd.2 , 30 this inconsistency may be due to disregarding the confounding effect of the qrs duration in the comparison of the ivmd between the dcm and icm groups by previous investigators .
nevertheless , in the current study , all the comparisons were conducted regarding the potential confounding effect of the demographic and qrs duration differences between the groups .
furthermore , a larger recruited sample size seems to have slightly raised the power of our study .
regional ts in all the segments were consistently prolonged in the patients with qrs duration 150 ms compared with the corresponding segments in those with qrs duration < 120 ms .
reported a similar delay in the comparison of segmental ts between patients with wide and narrow qrs durations.2 in regard to the underlying etiology , there was no significant difference in the segmental ts between the dcm or icm patients in the matched qrs groups except for ts in the inferior region in the patients with qrs 150 ms , which was significantly more delayed than the corresponding region in the icm patients .
contrary to our findings , van de veire reported more prolonged ts in nearly all the lv segments in patients with dcm than in those with icm in the presence of qrs duration 120 ms.28 to explain the difference it is deserving of note that all the ts in the van de veire study were corrected for the heart rate , whereas we did not apply any such correction in the current study . according to the intraventricular dyssynchrony indices , dys - ts - all and dys - ts - basal were more prevalent in the patients with qrs duration 150
these data are consistent with those in previous studies indicating a higher frequency of dys - ts - all1 , 30 dys - ts - basal28 indices in patients with a wide qrs than in those with a narrow qrs .
other studies have also reported similar interventricular dyssynchrony prevalence in different qrs groups using various definitions for intraventricular dyssynchrony indices.2 , 3 , 31 neither sd - ts nor the opposite wall dyssynchrony indices revealed similar differences in the comparison of the qrs groups .
in contrast , yu et al . reported significant differences in the frequency of sd - ts dyssynchrony index between patients with wide and narrow qrs.1 van de veire also reported similar results in the echocardiographic evaluation of dcm patients.28 it should be noted that in these studies , dyssynchrony was defined using a cut - off point different from what we applied in our study .
bleeker et al . , in a study of 90 hf patients , reported a greater septum - to - lateral wall delay in patients with a wide qrs duration than in those with a narrow qrs duration ; they , however , did not find any significant regressive relationship between qrs duration and septal - to - lateral delay.27 etiology did not appear to influence any of the intraventricular dyssynchrony indices in the matched qrs duration groups .
likewise , previous studies have not indicated any difference in intraventricular dyssynchrony indices between dcm and icm patients.2 , 28 the segmental ts values were not corrected for the heart rate in the current study .
the use of this type of adjustment may lead to more accurate and concise results in future studies .
the prevalence of both interventricular dyssynchrony indices and two of the main intraventricular dyssynchrony indices ( dys - ts - all and dys - ts - basal ) was greater in the patients with a wide qrs duration than in those with a narrow qrs duration .
the underlying etiology may have influenced the frequency of the interventricular but not intraventricular dyssynchrony indices : patients with dcm demonstrated a higher level of interventricular dyssynchrony than did those with icm .
the findings would help future studies investigating the predictive role of dyssynchrony indices on the crt outcome to better adjust the confounders ( such as qrs duration and underlying etiology ) in comparisons between groups . | background : left ventricular ( lv ) dyssynchrony is a prevalent feature in heart failure ( hf ) patients . the current study aimed to evaluate the prevalence of inter and intraventricular dyssynchrony in hf patients with regard to the qrs duration and etiology.methods:the available data on the tissue doppler imaging ( tdi ) of 230 patients with refractory hf were analyzed .
the patients were divided into three groups according to the qrs duration : qrs duration < 120 ms ; 120150 ms ; and 150 ms and the patients were re - categorized into two subgroups depending on the underlying etiology : ischemic cardiomyopathy ( icm ) or dilated cardiomyopathy ( dcm ) .
the time - to - peak myocardial sustained systolic velocity ( ts ) in six basal and six middle segments of the lv was measured manually using the velocity curves from tdi .
lv dyssynchrony was defined as interventricular mechanical delay 40 ms and tissue doppler velocity all segments delay 105 ms ; standard deviation ( sd ) of all segments 34.4 ms ; basal segments delay 78 ms ; sd of basal segments 34.5 ms ; and opposing wall delay 65 ms.results:after adjustment for the possible confounders , interventricular dyssynchrony was more prevalent in the patients with qrs duration 150 ms than in those with qrs duration 120150 ms and < 120 ms .
the patients with dcm also had a higher percentage of interventricular dyssynchrony than those with icm in the wide qrs groups . turning to the intraventricular dyssynchrony indices , the patients with qrs duration 150 ms and 120150 ms revealed a significantly greater delay between ts at the basal and all segments than did those with qrs duration < 120 ms , while etiology did not influence the frequency of these indices in each qrs group.conclusion:the prevalence of both inter and intraventricular dyssynchrony indices was greater in the patients with wide qrs than in those with narrow qrs duration .
the underlying etiology may affect the frequency of interventricular but not intraventricular dyssynchrony indices . |
studies evaluating the relationship between lipid parameters and bone mineral density ( bmd ) in healthy adults and those with metabolic syndrome have revealed inconsistent results .
while most of the studies have been performed in women , there are a few studies in men and adolescents .
since indians have differences in lipid profiles [ higher prevalence of high triglycerides ( tgs ) and low high density lipoprotein cholesterol ] compared with other populations , we assessed the relationship between various lipid parameters with bmd at different sites in previously conducted cross - sectional population in healthy indian volunteers .
this study was carried out as part of voluntary general health check - up of all members of resident welfare associations of four residential colonies , one each from north , south , east , and west delhi .
the study included all participants > 20 years of age ( 2347 participants - male 39.4% ; female 60.6% ) excluding those with infectious , hepatic , renal , neoplastic , gastrointestinal , dermatological and endocrine disorders , steroid intake or alcoholism and drugs affecting lipid parameters like statins , fibrates , diuretics , and beta - blockers .
demographic , anthropometric , and clinical data were ascertained and a detailed physical examination conducted .
body mass index ( bmi ) was calculated by weight in kilogram divided by square of height in meters .
fasting blood samples were drawn for the estimation of serum 25-hydroxy vitamin d [ 25(oh ) d ] , intact parathyroid hormone ( ipth ) , total and ionized calcium , inorganic phosphorus , alkaline phosphatase ( alp ) , total cholesterol ( tc ) , tgs , high - density lipoprotein cholesterol ( hdl - c ) , and low - density lipoprotein cholesterol ( ldl - c ) .
biochemical parameters were carried out using automated analyzer ( hitachi 902 fully automated biochemistry analyzer ; roche , manheim , germany ) and commercial kits ( roche , manheim , germany ) .
measurements of plasma glucose were done by glucose oxidase - peroxidase method by trinder ( clonital , italy ) .
dyslipidemia was defined by tc > 240 mg / dl , serum tg > 150 mg / dl , hdl - c < 40 mg / dl in males , and < 50 mg / dl in females , and ldl - c > 160 mg / dl .
all participants were divided according to age with cut - off of 50 years so that pre- and postmenopausal women can be separated .
total population was divided and grouped for analysis into three groups male ( n = 924 ) , female < 50 years ( premenopausal , n = 788 ) , and females > 50 years ( postmenopausal , n = 635 ) .
interquartile range for tc was 47.75 , 34 , and 51 mg / dl ; for tg was 59 , 26.75 , and 58 mg / dl ; for hdl was 8 , 5 , and 8 mg / dl ; for ldl 32 , 14.75 , and 39 mg / dl for three groups , respectively .
the study was approved by the ethics committee of the institute of nuclear medicine and allied sciences and all participants gave written informed consent .
the normal range for different biochemical parameters are as follows : serum total calcium ( 8.5 - 10.5 mg / dl ) , ionized calcium ( 1.12 - 1.32
mmol / l ) , inorganic phosphorus ( 2.5 - 4.5 mg / dl ) , alp were ( females : < 240
u / l ) , serum tc ( 110 - 230 mg / dl ) , serum tg ( < 150 mg / dl ) , hdl cholesterol ( > 35 mg / dl ) , and ldl ( < 100 mg / dl ) . the serum concentrations of 25(oh ) d ( reference range : 10 - 23 ngl / dl ) and pth ( reference range : 10 - 65 pg / ml ) were measured by ria ( diasorin , stillwater , mn , usa ) and electrochemiluminiscence assay ( roche diagnostics , gmdh - manheim , germany ) , respectively .
bmd at anteroposterior ( ap ) lumbar spine ( l1-l4 ) , femur ( total hip , femoral neck ) , forearm ( 33% radius ) , and total body was measured using the prodigy oracle ( ge lunar corp .
low bmd is defined as z - score < 1.0 in age group < 50 years and t - score < 1.0 in age group > 50 years in both sexes as also defined by another study , while values higher than these were considered as normal bmd .
instrument variation was determined regularly using a phantom supplied by the manufacturer and mean coefficient of variation was < 0.5% . for in vivo measurements ,
statistical analysis was carried out using software spss for windows version 20.0 ( spss , inc . ,
data were presented as mean standard deviation or number ( % ) unless specified .
all parametric data were analysed by independent student 's t - test between age groups .
p - for trends were applied to assess significance of differences in bmd among the four quartiles of lipid parameters .
pearson 's correlation coefficient was calculated to assess the strength of relationship between lipid parameters and bmd at various sites .
multiple regression analysis was done to ascertain association between lipid parameters with bmd at various sites after adjustment with variables like age , bmi , serum ionized calcium , alp,25(oh ) d , and ipth levels .
this study included 2347 participants > 20 years of age ( male 39.4% ; female 60.6% ) .
mean age and bmi were 49.1 18.2 years ( range : 21 - 90 years ) and 25.0 4.7 kg / m ( range : 13.0 - 49.8 ) respectively .
there were 788 ( 55.4% ) premenopausal ( 50 years ) and 635 ( 44.6% ) postmenopausal women ( > 50 years ) .
male were older than females ( 54.0 16.7 vs. 45.9 18.5 years ; p < 0.00001 ) .
basic characteristics of the population bmd at all sites , except radius , decreased significantly from lowest quartile to highest quartile of tc and ldl - c .
bmd at femoral neck showed increasing trend with quartiles of tgs , but the relationship was not significant at lumbar spine and radius [ table 2 ] .
bmd at femoral neck , femur total , and lumbar spine were negatively correlated with tc and ldl - c and positively with tg , which further supported the earlier analysis [ table 3 ] .
there was no obvious trend for bmd at any site with quartiles of hdl - c . in multiple regression analysis , after adjusting for age , bmi , serum ionized calcium , alp,25(oh ) d , and ipthlevels , the relationship between bmd and tc and ldl persisted , while that with tg became insignificant [ table 4 ] .
bone mineral density ( g / cm ) in males with quartiles of lipid parameters correlation of lipid parameters with bone mineral density multiple regression analysis of lipid parameters and bone mineral density ( after adjustment for age , body mass index , ionized calcium , alkaline phosphatase , intact parathyroid hormone and serum 25-hydroxy vitamin d ) bmd at total femurdecreased from lowest quartile to highest quartile of tc and ldl - c .
no significant trends were observed at any other sites with other lipid parameters [ supplementary table 1 ] .
a significant negative correlation was noticed between bmd at femur total and tc and ldl - c .
tg showed a negative correlation with bmd at femur neck ; and hdl - c showed positive correlation and bmd lumbar spine [ table 3 ] . in multiple regression analysis , after adjusting for age , bmi , serum ionized calcium , alp,25(oh ) d , and ipth levels , the above - observed correlation was maintained except for tg , which became nonsignificant [ table 4 ] .
bone mineral density ( g / cm ) in postmenopausal women ( females>50 years ) with quartiles of lipid parameters bmd at femoral neck decreased from second to highest quartiles of ldl - c , but no significant trend was noticed with tc , tg , and hdl - c .
bmd at lumbar spine decreased significantly with quartiles of ldl - c and increased with tg .
hdl - c had no effect on bmd at any site [ supplementary table 2 ] .
however , there was no correlation of any lipid parameters with bmd at any site in premenopausal women [ table 3 ] . in multiple regression analysis , after adjusting for age , bmi , serum ionized calcium , alp,25(oh ) d , and ipthlevels , ldl - c showed significant but weak negative correlation with bmd at femoral neck , total femur , and lumbar spine , but correlation with tg became nonsignificant [ table 4 ] . bone mineral density ( g / cm ) in premenopausal women ( females<50 years ) with quartiles of lipid parameters total population was categorized in to subjects with normal bmd ( 1239 - 52.8% ) and low bmd ( 1108 - 47.2% ) . in subjects with normal bone density , tc and ldl - c were significantly lower compared with subjects with low bone density in both sexes ( men : tc-159 35 vs. 167 35 mg / dl , p = 0.001 ; ldl - c- 99 24 vs. 105 25 mg / dl , p < 0.0001 ; women : tc 153 32 vs. 174 38 mg / dl , p < 0.0001 ; ldl - c : 91 18 vs. 106 25 , p < 0.0001 ) .
there was no significant difference in bmd at any site in any group when study population was categorized according to dyslipidemia ( data not shown ) .
bmd at all sites , except radius , decreased significantly from lowest quartile to highest quartile of tc and ldl - c .
bmd at femoral neck showed increasing trend with quartiles of tgs , but the relationship was not significant at lumbar spine and radius [ table 2 ] .
bmd at femoral neck , femur total , and lumbar spine were negatively correlated with tc and ldl - c and positively with tg , which further supported the earlier analysis [ table 3 ] .
there was no obvious trend for bmd at any site with quartiles of hdl - c . in multiple regression analysis , after adjusting for age , bmi , serum ionized calcium , alp,25(oh ) d , and ipthlevels , the relationship between bmd and tc and ldl persisted , while that with tg became insignificant [ table 4 ] .
bone mineral density ( g / cm ) in males with quartiles of lipid parameters correlation of lipid parameters with bone mineral density multiple regression analysis of lipid parameters and bone mineral density ( after adjustment for age , body mass index , ionized calcium , alkaline phosphatase , intact parathyroid hormone and serum 25-hydroxy vitamin d )
bmd at total femurdecreased from lowest quartile to highest quartile of tc and ldl - c .
no significant trends were observed at any other sites with other lipid parameters [ supplementary table 1 ] .
a significant negative correlation was noticed between bmd at femur total and tc and ldl - c .
tg showed a negative correlation with bmd at femur neck ; and hdl - c showed positive correlation and bmd lumbar spine [ table 3 ] . in multiple regression analysis , after adjusting for age , bmi , serum ionized calcium , alp,25(oh ) d , and ipth levels , the above - observed correlation was maintained except for tg , which became nonsignificant [ table 4 ]
. bone mineral density ( g / cm ) in postmenopausal women ( females>50 years ) with quartiles of lipid parameters
bmd at femoral neck decreased from second to highest quartiles of ldl - c , but no significant trend was noticed with tc , tg , and hdl - c .
bmd at lumbar spine decreased significantly with quartiles of ldl - c and increased with tg .
hdl - c had no effect on bmd at any site [ supplementary table 2 ] .
however , there was no correlation of any lipid parameters with bmd at any site in premenopausal women [ table 3 ] . in multiple regression analysis , after adjusting for age , bmi , serum ionized calcium , alp,25(oh ) d , and ipthlevels , ldl - c showed significant but weak negative correlation with bmd at femoral neck , total femur , and lumbar spine , but correlation with tg became nonsignificant [ table 4 ] .
bone mineral density ( g / cm ) in premenopausal women ( females<50 years ) with quartiles of lipid parameters total population was categorized in to subjects with normal bmd ( 1239 - 52.8% ) and low bmd ( 1108 - 47.2% ) . in subjects with normal bone density , tc and ldl - c were significantly lower compared with subjects with low bone density in both sexes ( men : tc-159 35 vs. 167 35 mg / dl , p = 0.001 ; ldl - c- 99 24 vs. 105 25 mg / dl , p < 0.0001 ; women : tc 153 32 vs. 174 38 mg / dl , p < 0.0001 ; ldl - c : 91 18 vs. 106 25 , p < 0.0001 ) .
there was no significant difference in bmd at any site in any group when study population was categorized according to dyslipidemia ( data not shown ) .
in the present large population - based cross - sectional study , we found that femoral bmd was inversely correlated with total cholesterol and ldl - c in both men and women bmd at lumbar spine was negatively correlated with tc and ldl - c in men , and only with ldl - c in pre - menopausal women .
similar to our results , a korean study also found a weak positive correlation of bmd with lipid profile ( tc and ldl - c ) after adjustment with age , bmi and age at menarche in pre- and postmenopausal women .
in contrast , studies from usa ( national health and nutrition examination survey - nhanes ) and uk ( framingham osteoporosis study - fos ) reported no association of lipid parameters and bmd .
both these studies ( nhanes and fos ) have only evaluated women and have not provided data separately for pre- and postmenopausal women .
further , women with associated comorbidities , including alcohol and drug intake , were not excluded in these studies .
many smaller studies have reported stronger but less significant correlation ; however , larger studies have found weaker but more significant correlation being large sample .
there are very few studies which have evaluated the relationship between lipid parameters and bmd in men , mostly with small sample size .
only two large community - based studies have reported the relationship between lipid parameters and bmd in men , but are not suitable for comparison because in one instance data for men was not separately reported , while in the other , bmd was measured only at the wrist .
the nhanes - iii also reported a similar trend of a negative association between tc and ldl - c with bmd , though it became insignificant after adjusting for multiple variables .
smaller studies among european men reported either absent or positive association of tc and ldl - c with bmd at femur and spine .
it has been proposed that oxidized ldl increase receptor activator of nuclear factor kappa - b ligand expression on osteoblast and increase interaction with osteoclast which affect bone remodeling and may cause decrease in bmd .
further , in animal models , the primary cholesterol metabolite , 27-hydroxycholesterol , interacts with estrogen and liver x - receptors , decreases osteoblast differentiation , and increases osteoclastogenesis , thereby resulting in increased bone resorption and decrease in bmd .
bmd at femoral neck showed positive correlation with tg , which was lost when adjusted for various factors including age and bmi .
a similar positive association of tg with bmd was reported in men and adolescents , which became insignificant when adjusted for body fat or markers of insulin resistance .
however , other small studies have reported both absent and positive correlation of tg with bmd which persisted even after adjustment with body fat .
obesity , weight , and bmi are positively correlated with bmd and tg is also positively correlated with obesity .
hence , it is not surprising to find a positive correlation of tg with bmd , which gets neutralized when adjusted for bmi or fat mass .
hdl - c was not correlated with bmd at any site in the present study , which was also reported previously .
other studies in european men found a negative correlation of hdl - c with bmd at femur and spine , but the relationship was attenuated after adjustment for body fat content in one study .
a similar finding was reported in a large population based study . on the contrary ,
a weak negative association of bmd at radius was observed with tc in one population - based study .
serum tc and ldl - c had weak negative correlation with only total femur bmd .
several studies , including large population - based studies , have also reported a negative association of tc and ldl - c with femur , lumbar spine , and radius .
in contrast , a positive correlation of tc with hip bmd and total body bmd has also been reported , though in one of these studies , samples for lipid profiles were drawn in a nonfasting state .
few studies have also shown no relationship between tc and ldl - c with bmd at any site .
several of these studies are weakened by either small sample size , selection bias , or inclusion of subjects with comorbidities , as well as and consumption of medication known to affect bmd .
bmd at femoral neck was positively related with tg , which became nonsignificant in multivariate regression analysis after adjustment with various factors .
a similar positive association was reported in smaller studies as well large population - based studies .
hdl - c revealed a positive correlation with lumbar spine bmd only in this group , which was maintained in multiple regression analysis .
this relation was further confirmed by observation that hdl - c was higher in women with normal bone density compared with those women with low bone density .
several large population based studies and smaller studies also reported a positive association between hdl - c and lumbar spine bmd .
however , other studies reported either a negative association or no association of hdl - c and bmd .
these differences have been explained by ethnic and racial differences , size of the study population , and inclusion of women on hormone replacement therapy . in the present study , bmd at femoral neck and lumbar spine
decreased significantly with increasing quartiles of ldl - c , and this weak negative correlation was maintained in multiple regression analysis .
large population based studies also found a negative association of tc and ldl - c with lumbar spine bmd and whole body mineral content , but not with femur in premenopausal women .
after adjustment , no significant correlation was found between tg and bmd at any site .
in contrast , a korean population - based study has reported a negative association of tg with bmd at total hip .
hdl - c was not correlated with bmd at any site and a similar observation has been reported among chinese premenopausal women . however , another large population - based study found a positive relation between hdl and bmd at lumbar spine and femur .
another limitation was absence of data on dietary habits , smoking , and physical activity , which can adversely affect both bmd and lipid parameters .
the strength of our study was the large sample sizes from healthy indian population who were free from common morbidities and were not consuming any medication affecting bmd .
there are very few studies which have evaluated the relationship between lipid parameters and bmd in men , mostly with small sample size .
only two large community - based studies have reported the relationship between lipid parameters and bmd in men , but are not suitable for comparison because in one instance data for men was not separately reported , while in the other , bmd was measured only at the wrist .
the nhanes - iii also reported a similar trend of a negative association between tc and ldl - c with bmd , though it became insignificant after adjusting for multiple variables .
smaller studies among european men reported either absent or positive association of tc and ldl - c with bmd at femur and spine .
it has been proposed that oxidized ldl increase receptor activator of nuclear factor kappa - b ligand expression on osteoblast and increase interaction with osteoclast which affect bone remodeling and may cause decrease in bmd .
further , in animal models , the primary cholesterol metabolite , 27-hydroxycholesterol , interacts with estrogen and liver x - receptors , decreases osteoblast differentiation , and increases osteoclastogenesis , thereby resulting in increased bone resorption and decrease in bmd .
bmd at femoral neck showed positive correlation with tg , which was lost when adjusted for various factors including age and bmi .
a similar positive association of tg with bmd was reported in men and adolescents , which became insignificant when adjusted for body fat or markers of insulin resistance .
however , other small studies have reported both absent and positive correlation of tg with bmd which persisted even after adjustment with body fat .
obesity , weight , and bmi are positively correlated with bmd and tg is also positively correlated with obesity .
hence , it is not surprising to find a positive correlation of tg with bmd , which gets neutralized when adjusted for bmi or fat mass .
hdl - c was not correlated with bmd at any site in the present study , which was also reported previously .
other studies in european men found a negative correlation of hdl - c with bmd at femur and spine , but the relationship was attenuated after adjustment for body fat content in one study .
a similar finding was reported in a large population based study . on the contrary ,
a weak negative association of bmd at radius was observed with tc in one population - based study .
serum tc and ldl - c had weak negative correlation with only total femur bmd .
several studies , including large population - based studies , have also reported a negative association of tc and ldl - c with femur , lumbar spine , and radius .
in contrast , a positive correlation of tc with hip bmd and total body bmd has also been reported , though in one of these studies , samples for lipid profiles were drawn in a nonfasting state .
few studies have also shown no relationship between tc and ldl - c with bmd at any site .
several of these studies are weakened by either small sample size , selection bias , or inclusion of subjects with comorbidities , as well as and consumption of medication known to affect bmd .
bmd at femoral neck was positively related with tg , which became nonsignificant in multivariate regression analysis after adjustment with various factors .
a similar positive association was reported in smaller studies as well large population - based studies .
hdl - c revealed a positive correlation with lumbar spine bmd only in this group , which was maintained in multiple regression analysis .
this relation was further confirmed by observation that hdl - c was higher in women with normal bone density compared with those women with low bone density .
several large population based studies and smaller studies also reported a positive association between hdl - c and lumbar spine bmd .
however , other studies reported either a negative association or no association of hdl - c and bmd .
these differences have been explained by ethnic and racial differences , size of the study population , and inclusion of women on hormone replacement therapy .
in the present study , bmd at femoral neck and lumbar spine decreased significantly with increasing quartiles of ldl - c , and this weak negative correlation was maintained in multiple regression analysis .
large population based studies also found a negative association of tc and ldl - c with lumbar spine bmd and whole body mineral content , but not with femur in premenopausal women .
after adjustment , no significant correlation was found between tg and bmd at any site .
in contrast , a korean population - based study has reported a negative association of tg with bmd at total hip . however , this study was retrospective and suffers from selection bias .
hdl - c was not correlated with bmd at any site and a similar observation has been reported among chinese premenopausal women . however , another large population - based study found a positive relation between hdl and bmd at lumbar spine and femur .
another limitation was absence of data on dietary habits , smoking , and physical activity , which can adversely affect both bmd and lipid parameters .
the strength of our study was the large sample sizes from healthy indian population who were free from common morbidities and were not consuming any medication affecting bmd .
while we report a weak correlation between lipid parameters and bmd at various sites in men , pre- and premenopausal women , its clinical significance needs to be elucidated . | introduction : cardiovascular disease and osteoporosis share common risk factors including dyslipidemia .
there are conflicting reports of differential relation of various lipid parameters on bone mineral density ( bmd ) .
hence , we studied the correlation between lipid parameters and bmd in healthy adult.materials and methods : a total of 2347 participants ( male 39.4% ; female 60.6% ) included in this cross - sectional study were divided according to sex and age .
fasting blood samples were drawn for biochemical parameters .
bmd at lumbar spine , femur , and forearm were measured by dual energy x - ray absorptiometry ( dxa).results : in males , bmd at femur and lumbar spine decreased significantly with increasing quartiles of total cholesterol ( tc ) ( p < 0.0001 , and 0.004 ) and low - density lipoprotein cholesterol ( ldl - c ) ( p = 0.001 , and 0.01 ) . in premenopausal women ,
bmd at femoral neck ( p = 0.001 ) and lumbar spine ( p = 0.029 ) showed declining trend with ldl - c ( p = 0.007 ) . in postmenopausal women ,
only bmd at total femur decreased significantly with tc ( p = 0.024 ) and ldl - c ( p = 0.036 ) .
all above findings were confirmed in correlation studies . in multiple regression analysis after adjusting for age , body mass index , ionized calcium , alkaline phosphatase , 25 hydroxy vitamin d , and parathyroid hormone levels correlation of bmd with tc and ldl - c persisted .
tc , ldl - c was higher in subjects with low bone density compared those with normal bone density in both sexes.conclusions:tc and ldl - c had weak but significant negative correlation with bmd at femur and lumbar spine . |
in 2009 , in poland colorectal cancer ( crc ) was the third most commonly observed ( after lung cancer and prostate cancer in men and breast cancer and lung cancer in women ) neoplasm in both genders [ 1 , 2 ] .
approximately , one in three people with colorectal cancer dies as a result of the disease , which is a significant proportion ( 7.1% of men and 7.9% of women ) of all deaths connected with neoplasm .
crc more frequently affects citizens of well - developed countries in comparison to poorly - developed countries .
the higher number of patients with colorectal cancer in well - developed countries is connected with predisposition to carcinogenesis : low physical activity , high calorie and fat diet , obesity and a sedentary lifestyle . in poland , 11 thousand new cases of crc
are noted annually and approximately 8 thousand patients die [ 4 , 5 ] . in western europe , a decrease in mortality rate connected with crc is observed and the percentage of total recoveries is 65% , which is connected with early diagnostics and treatment of crc . in poland ,
the reason for such huge differences is late recognition , frequently in the stage when metastases to the distant organs ( mainly liver ) are noticed [ 8 , 9 ] . despite genetic changes in crc , epigenetic disorders
it has been proved that in some groups of patients carcinogenesis is a result of dna methylation and covalent modification of histones [ 4 , 10 ] .
current oncological diagnostics emphasizes the necessity of early recognition of neoplasms , even in an asymptomatic or pre - cancerous stage
. early recognition of crc is extremely important in patients with acute symptoms and adverse course of the disease ( approx .
155 ) , due to the fact that crc may cause severe intestinal perforation as a result of obstructive ileus .
it is estimated that > 50% of patients will develop colonic polyps ; in 6% of them increased risk of crc is noted . screening examinations , in order to recognize and remove adenomatous polyps , are extremely important in prevention of colorectal cancer .
the simplest method of crc recognition , along with the case history , is per rectum examination . during this examination ,
the accuracy of the examination increases with the experience of the doctor [ 15 , 16 ] .
the most commonly applied and the most efficient method in diagnostics of crc is endoscopy [ 6 , 7 ] .
these examinations allow one to localize the tumor and take part of the large intestine for histological examination .
colonoscopy allows one to obtain an image of the whole intestine with similar sensitivity and specificity [ 15 , 16 ] . in comparison to other screening examinations , colonoscopy has many more advantages : it is performed in less distant time points and increases the acceptance and tolerance of recent sedative techniques . the research which included patients with average risk of crc after colonoscopy showed a 67% decrease in the morbidity rate and a 65% decrease in the mortality rate in comparison to the control group .
endoscopy ( sigmoidoscopy ) may be applied in diagnostics of crc as well as in palliative procedures in patients disqualified from surgical treatment ( according to severity of the tumor or co - morbidities ) .
such procedures include methods enabling clearing of the obstruction connected with cancer . despite many advantages
what is more , colonoscopy brings the risk of perforation or bleeding from the large intestine .
it allows one to obtain a 3d image of the large intestine with simultaneous application of computed tomography .
application of virtual colonoscopy decreases the risk of complications connected with perforation or bleeding from the large intestine [ 15 , 19 ] .
imaging tests are also helpful in diagnostics of crc , including roentgenographic examination of the thorax ( rtg ) , endorectal ultrasonography ( usg ) , abdominal usg , computed tomography ( ct ) and nuclear magnetic resonance ( nmr ) . however , these methods are efficient only in case of severe focal lesions . what is more , positron emission computed tomography ( pet / ct ) is applied in colorectal cancer diagnostics . according to the fact that neoplasm may develop along with changes in metabolism of some chemical compounds , such as carbohydrates , in fluor-18-fluorodeoxyglucose positron emission computed tomography ( 18f - fdg pet / ct ) 18f isotope - labeled deoxyglucose is used with the addition of the most common preparation , f18-fdg . according to researchers , 18f - fdg - pet / ct shows the main prognostic value in response to treatment .
it was proved during fdg pet / ct at staging and after neoadjuvant chemoradiotherapy ( mean 6.7 weeks ) in 69 patients with locally developed rectal cancer that it is possible to stratify patients with rectal cancer before the surgery regardless of the method of image interpretation .
also presented the potential role of 18f - fdg - pet in secondary diagnostics after preoperative chemoradiotherapy in patients with locally developed rectal cancer and indicated that ri ( response index ) seems to be the best index of estimation of response to chemoradiotherapy .
. suggest that fdg - pet / ct along with routine evaluation of patients with colorectal cancer or with different neoplasms with metastases to the liver have a great impact on estimation of the stage of the disease and selection of suitable candidates for solitary liver metastasis resection and outcome . in the diagnosis of colorectal cancer
, 18f - fdg - pet / ct has an established role and an impact on the clinical image of patient . in 18f - fdg - pet /
ct , glucose metabolism does not depend on changes in the size of the tumor and tumor modification before and after the treatment is not connected with its morphological changes .
18f - fdg - pet / ct may be used for monitoring of the response to chemotherapy in patients with advanced colon cancer .
the researchers found that 18f - fdg - pet / ct has higher ct sensitivity in the detection of colorectal cancer metastases to the liver .
an increasing number of reports in the literature is observed proving that fdg pet is a powerful tool for monitoring the response results in gist ( gastrointestinal stromal tumors ) and describing its central role in the evaluation of early response to treatment .
researchers reported a case where 18f - fdg pet / ct showed a very early treatment response in gist , only 10 days after the beginning of the treatment , and was useful for 18 months follow - up .
the examination may be clinically useful in many stages of colorectal cancer development . at the moment , 18f - fdg - pet / ct is used the most frequently to evaluate the response to treatment after radio - chemotherapy in patients with advanced rectal cancer .
the most commonly applied and the most efficient method in diagnostics of crc is endoscopy [ 6 , 7 ] .
these examinations allow one to localize the tumor and take part of the large intestine for histological examination .
colonoscopy allows one to obtain an image of the whole intestine with similar sensitivity and specificity [ 15 , 16 ] . in comparison to other screening examinations
, colonoscopy has many more advantages : it is performed in less distant time points and increases the acceptance and tolerance of recent sedative techniques .
the research which included patients with average risk of crc after colonoscopy showed a 67% decrease in the morbidity rate and a 65% decrease in the mortality rate in comparison to the control group .
endoscopy ( sigmoidoscopy ) may be applied in diagnostics of crc as well as in palliative procedures in patients disqualified from surgical treatment ( according to severity of the tumor or co - morbidities ) .
such procedures include methods enabling clearing of the obstruction connected with cancer . despite many advantages
what is more , colonoscopy brings the risk of perforation or bleeding from the large intestine .
it allows one to obtain a 3d image of the large intestine with simultaneous application of computed tomography .
application of virtual colonoscopy decreases the risk of complications connected with perforation or bleeding from the large intestine [ 15 , 19 ] .
imaging tests are also helpful in diagnostics of crc , including roentgenographic examination of the thorax ( rtg ) , endorectal ultrasonography ( usg ) , abdominal usg , computed tomography ( ct ) and nuclear magnetic resonance ( nmr ) .
however , these methods are efficient only in case of severe focal lesions . what is more , positron emission
computed tomography ( pet / ct ) is applied in colorectal cancer diagnostics . according to the fact that neoplasm may develop along with changes in metabolism of some chemical compounds , such as carbohydrates , in fluor-18-fluorodeoxyglucose positron emission computed tomography ( 18f - fdg pet / ct )
18f isotope - labeled deoxyglucose is used with the addition of the most common preparation , f18-fdg . according to researchers ,
18f - fdg - pet / ct shows the main prognostic value in response to treatment .
it was proved during fdg pet / ct at staging and after neoadjuvant chemoradiotherapy ( mean 6.7 weeks ) in 69 patients with locally developed rectal cancer that it is possible to stratify patients with rectal cancer before the surgery regardless of the method of image interpretation .
also presented the potential role of 18f - fdg - pet in secondary diagnostics after preoperative chemoradiotherapy in patients with locally developed rectal cancer and indicated that ri ( response index ) seems to be the best index of estimation of response to chemoradiotherapy .
. suggest that fdg - pet / ct along with routine evaluation of patients with colorectal cancer or with different neoplasms with metastases to the liver have a great impact on estimation of the stage of the disease and selection of suitable candidates for solitary liver metastasis resection and outcome . in the diagnosis of colorectal cancer
, 18f - fdg - pet / ct has an established role and an impact on the clinical image of patient . in 18f - fdg - pet /
ct , glucose metabolism does not depend on changes in the size of the tumor and tumor modification before and after the treatment is not connected with its morphological changes .
18f - fdg - pet / ct may be used for monitoring of the response to chemotherapy in patients with advanced colon cancer .
the researchers found that 18f - fdg - pet / ct has higher ct sensitivity in the detection of colorectal cancer metastases to the liver .
an increasing number of reports in the literature is observed proving that fdg pet is a powerful tool for monitoring the response results in gist ( gastrointestinal stromal tumors ) and describing its central role in the evaluation of early response to treatment . researchers reported a case where 18f - fdg pet / ct showed a very early treatment response in gist , only 10 days after the beginning of the treatment , and was useful for 18 months follow - up .
the examination may be clinically useful in many stages of colorectal cancer development . at the moment , 18f - fdg - pet / ct is used the most frequently to evaluate the response to treatment after radio - chemotherapy in patients with advanced rectal cancer .
what is more , blood in feces is an unspecific indicator of crc because it may derive not only from cancerous changes but also from polyps > 12 cm . repeating the test increases its sensitivity up to 90% .
the immunohistochemical fecal occult blood test ( fit ) reveals human globin , a protein which builds hemoglobin along with heme and is also applied in crc diagnostics .
methods of molecular diagnostics are also applied including sdna , which reveals changes in dna in colorectal adenocarcinomas .
dna is stable in feces , which allows one to isolate and differentiate it from the dna of bacteria .
it is not commonly available and the expenses are relatively high . disadvantages of molecular diagnostics of crc motivate the search for other biomarkers present in available biological material with lower costs .
tumor markers are substances produced by tumor cells or healthy cells as a response to the tumor .
markers may be applicable in screening tests , differential diagnostics , prognosis and in observation of disease progress .
diagnostics and monitoring of crc use : carcinoembryonic antigen ( cea ) , cancer antigen ( ca ) 19 - 9 , tumor antigen of colorectal cancer ( tumor - associated glycoprotein , tag-72 ) , tissue polypeptide specific antigen ( tps ) and tag-72 ( table 1 ) . increased values of tumor markers evaluate recurrences or metastases , especially to the liver .
unfortunately , tumor markers recently applied in crc diagnostics have insufficient sensitivity and organic specificity .
there is an urgent search for new , more sensitive and specific biomarkers of crc .
non - enzymatic tumor markers of colorectal cancer applied in routine clinical diagnostics comparison of the accuracy of different diagnostic methods
cea is the most frequently examined marker when gastrointestinal tract tumor is suspected .
. an increased level of cea in serum may be connected with carcinogenesis . in 50% of patients
unfortunately , increase of cea concentration rarely occurs in early stages of the disease ; usually it is observed in severe tumors [ 11 , 22 ] . an increased level of cea ( > 5 g / ml ) before the operation may correlate with adverse prognosis . according to locker et al .
, a sustained higher level of cea in patients with metastases but without clinical symptoms allows one to qualify patients for more intense treatment , which in consequence extends the time of survival .
recent research showed that 15% of large intestine tumors do not reveal a higher level of cea or release small amounts of cea . increased concentration of cea in serum
may also occur in inflammatory conditions including hepatitis , inflammatory bowel disease ( ibd ) , pancreatitis or obstructive pulmonary disease .
cea is highly specific in crc but its sensitivity and validity are not sufficient for early cancer recognition [ 25 , 26 ] .
it has to be mentioned that results of cea level estimation in the same portion of serum and in different laboratories may differ significantly .
it is a glycoprotein with high molecular weight which may be released to the blood .
ca 19 - 9 is used in diagnostics of pancreatic , gastric and colorectal cancer . according to the increase of ca 19 - 9 concentration in pancreatitis and liver disorders , the specificity of tests based on this antigen
ca 19 - 9 is applied in diagnostics and monitoring of crc . similarly to cea , it is not specific for a particular histological type of neoplasm and the organ which it derives from .
simultaneous estimation of ca 19 - 9 and cea may increase diagnostic sensitivity in crc recognition .
simultaneous estimation of ca 19 - 9 and cea is applied as a preoperative prognostic factor in evaluation of tumor stage and survival rate .
it is formed in s and g2 phase of the molecular cycle and released to cells after mitosis .
tps is applied in diagnostics and monitoring of chemotherapy in gastrointestinal tract tumors ( mainly pancreatic and colorectal ) and bronchial tumors .
concentration of tps in serum , closely connected with neoplasm cell proliferation , is a function of the cell division rate .
. an increased level of tps in neoplasms indicates hyperplasia of the tumor preceding the growth of its mass .
estimation of tps may be especially applicable in early stages of tumors . increased concentration of tps
michaeli et al . observed an increased level of tps in 75% of patients with histologically confirmed colon and rectal cancer .
the time of survival was significantly shorter in patients with an initially high level of tps .
suggest that tps was more applicable than cea in crc monitoring . during estimation of tps in patients with crc
increased levels of tps may also be observed in autoimmune diseases and inflammatory lesions and the highest values occur in post - alcoholic hepatitis [ 27 , 29 ] .
tag-72 ( tumor - associated glycoprotein ) is a glycoprotein produced by endothelium cells , renal pelvis cells , gastric epithelium and bile ducts
studies have been conducted on application in crc diagnostics of other potential markers : protein mutation p-53 , ras index , thymidine synthesis ( ts ) , dihydropyrimidine dehydrogenase ( dpd ) and thymidine phosphatase ( tp ) .
these tissue markers have been used in prognosis of crc treatment results , but they are useless in screening tests .
it seems that the aforementioned potential markers may be applicable in crc prognosis ; however , there is no reason to apply them in crc diagnostics .
recently , studies have been conducted on application of lysosomal exoglycosidases as crc markers including -mannosidase , -galactosidase and n - acetyl--d - hexosaminidase , its isoenzymes a and b and cathepsin d [ 3032 ] . in the development of crc ,
development of crc and its metastases may be supported by exoglycosidases released by macrophages [ 33 , 34 ] .
[ 30 , 31 , 35 ] noted significant increase of hex , hex a , hex b , gal and fuc activity in serum and urine of patients with crc .
observed that the increase of lysosomal exoglycosidases and cathepsin d activity is connected with increased degradation and restoration of glycoconjugates in colorectal adenocarcinoma .
a correlation has been observed between cathepsin d activity and hex , hex a , fuc and man activity in tumor tissue and urine along with a correlation between cathepsin d and gal in urine .
moreover , gal in crc participates in degradation of glycoconjugate oligosaccharide chains of colonic mucosa .
[ 30 , 31 ] reported a significant increase of gal activity in serum and urine of patients with crc [ 31 , 33 ] .
the advantage of the test is its low cost as well as simplicity and repeatability .
lysosomal exoglycosidase activity also increases in other neoplasms pancreatic , thyroid , renal , ovarian and leukemias [ 3739 ] as well as such diseases as glomerulonephritis , hypertension , sjgren syndrome , idiopathic arthritis and after liver transplantation . in summary
, it may be stated that analysis of single genes and tumor markers in prognostics of the disease is applicable , but frequently connected with insufficient sensitivity and specificity in routine clinical practice .
however , it has to be mentioned that some patients do not want or can not undergo the test due to its local unavailability .
gathering of feces samples for the blood occult test or dna test may be conducted at home without bowel preparation .
patients should understand limitations and requirements of noninvasive tests which are less efficient in prevention of the disease in comparison to invasive tests , should be conducted regularly and if the result is abnormal , invasive test will be necessary .
what is more , for patients who are not able to repeat the test , noninvasive examinations should not be recommended due to their insufficiency .
the best solution seems to be estimation of at least two or three markers at the same time in order to increase their diagnostic applicability .
it has to be mentioned that noninvasive tests should be conducted only during screening examination and therapy monitoring .
screening examination using tumor markers and intervention in early stages of crc may significantly decrease the mortality rate connected with crc .
what is more , blood in feces is an unspecific indicator of crc because it may derive not only from cancerous changes but also from polyps > 12 cm . repeating the test increases its sensitivity up to 90% .
the immunohistochemical fecal occult blood test ( fit ) reveals human globin , a protein which builds hemoglobin along with heme and is also applied in crc diagnostics .
methods of molecular diagnostics are also applied including sdna , which reveals changes in dna in colorectal adenocarcinomas .
dna is stable in feces , which allows one to isolate and differentiate it from the dna of bacteria .
it is not commonly available and the expenses are relatively high . disadvantages of molecular diagnostics of crc motivate the search for other biomarkers present in available biological material with lower costs .
tumor markers are substances produced by tumor cells or healthy cells as a response to the tumor .
markers may be applicable in screening tests , differential diagnostics , prognosis and in observation of disease progress .
diagnostics and monitoring of crc use : carcinoembryonic antigen ( cea ) , cancer antigen ( ca ) 19 - 9 , tumor antigen of colorectal cancer ( tumor - associated glycoprotein , tag-72 ) , tissue polypeptide specific antigen ( tps ) and tag-72 ( table 1 ) . increased values of tumor markers evaluate recurrences or metastases , especially to the liver . unfortunately , tumor markers recently applied in crc diagnostics have insufficient sensitivity and organic specificity .
there is an urgent search for new , more sensitive and specific biomarkers of crc .
non - enzymatic tumor markers of colorectal cancer applied in routine clinical diagnostics comparison of the accuracy of different diagnostic methods
cea is the most frequently examined marker when gastrointestinal tract tumor is suspected . the concentration over 5
. an increased level of cea in serum may be connected with carcinogenesis . in 50% of patients
unfortunately , increase of cea concentration rarely occurs in early stages of the disease ; usually it is observed in severe tumors [ 11 , 22 ]
. an increased level of cea ( > 5 g / ml ) before the operation may correlate with adverse prognosis . according to locker et al .
, a sustained higher level of cea in patients with metastases but without clinical symptoms allows one to qualify patients for more intense treatment , which in consequence extends the time of survival .
recent research showed that 15% of large intestine tumors do not reveal a higher level of cea or release small amounts of cea . increased concentration of cea in serum
may also occur in inflammatory conditions including hepatitis , inflammatory bowel disease ( ibd ) , pancreatitis or obstructive pulmonary disease .
cea is highly specific in crc but its sensitivity and validity are not sufficient for early cancer recognition [ 25 , 26 ] .
it has to be mentioned that results of cea level estimation in the same portion of serum and in different laboratories may differ significantly .
it is a glycoprotein with high molecular weight which may be released to the blood .
ca 19 - 9 is used in diagnostics of pancreatic , gastric and colorectal cancer . according to the increase of ca 19 - 9 concentration in pancreatitis and liver disorders , the specificity of tests based on this antigen is limited .
ca 19 - 9 is applied in diagnostics and monitoring of crc . similarly to cea , it is not specific for a particular histological type of neoplasm and the organ which it derives from .
simultaneous estimation of ca 19 - 9 and cea may increase diagnostic sensitivity in crc recognition .
simultaneous estimation of ca 19 - 9 and cea is applied as a preoperative prognostic factor in evaluation of tumor stage and survival rate .
it is formed in s and g2 phase of the molecular cycle and released to cells after mitosis .
tps is applied in diagnostics and monitoring of chemotherapy in gastrointestinal tract tumors ( mainly pancreatic and colorectal ) and bronchial tumors .
concentration of tps in serum , closely connected with neoplasm cell proliferation , is a function of the cell division rate .
. an increased level of tps in neoplasms indicates hyperplasia of the tumor preceding the growth of its mass .
estimation of tps may be especially applicable in early stages of tumors . increased concentration of tps
michaeli et al . observed an increased level of tps in 75% of patients with histologically confirmed colon and rectal cancer .
the time of survival was significantly shorter in patients with an initially high level of tps .
what is more , michaeli et al . suggest that tps was more applicable than cea in crc monitoring . during estimation of tps in patients with crc
increased levels of tps may also be observed in autoimmune diseases and inflammatory lesions and the highest values occur in post - alcoholic hepatitis [ 27 , 29 ] .
tag-72 ( tumor - associated glycoprotein ) is a glycoprotein produced by endothelium cells , renal pelvis cells , gastric epithelium and bile ducts .
studies have been conducted on application in crc diagnostics of other potential markers : protein mutation p-53 , ras index , thymidine synthesis ( ts ) , dihydropyrimidine dehydrogenase ( dpd ) and thymidine phosphatase ( tp ) .
these tissue markers have been used in prognosis of crc treatment results , but they are useless in screening tests .
it seems that the aforementioned potential markers may be applicable in crc prognosis ; however , there is no reason to apply them in crc diagnostics .
recently , studies have been conducted on application of lysosomal exoglycosidases as crc markers including -mannosidase , -galactosidase and n - acetyl--d - hexosaminidase , its isoenzymes a and b and cathepsin d [ 3032 ] . in the development of crc ,
development of crc and its metastases may be supported by exoglycosidases released by macrophages [ 33 , 34 ] .
[ 30 , 31 , 35 ] noted significant increase of hex , hex a , hex b , gal and fuc activity in serum and urine of patients with crc .
observed that the increase of lysosomal exoglycosidases and cathepsin d activity is connected with increased degradation and restoration of glycoconjugates in colorectal adenocarcinoma .
a correlation has been observed between cathepsin d activity and hex , hex a , fuc and man activity in tumor tissue and urine along with a correlation between cathepsin d and gal in urine .
moreover , gal in crc participates in degradation of glycoconjugate oligosaccharide chains of colonic mucosa .
[ 30 , 31 ] reported a significant increase of gal activity in serum and urine of patients with crc [ 31 , 33 ] .
the advantage of the test is its low cost as well as simplicity and repeatability .
lysosomal exoglycosidase activity also increases in other neoplasms pancreatic , thyroid , renal , ovarian and leukemias [ 3739 ] as well as such diseases as glomerulonephritis , hypertension , sjgren syndrome , idiopathic arthritis and after liver transplantation . in summary
, it may be stated that analysis of single genes and tumor markers in prognostics of the disease is applicable , but frequently connected with insufficient sensitivity and specificity in routine clinical practice .
however , it has to be mentioned that some patients do not want or can not undergo the test due to its local unavailability .
gathering of feces samples for the blood occult test or dna test may be conducted at home without bowel preparation .
patients should understand limitations and requirements of noninvasive tests which are less efficient in prevention of the disease in comparison to invasive tests , should be conducted regularly and if the result is abnormal , invasive test will be necessary .
what is more , for patients who are not able to repeat the test , noninvasive examinations should not be recommended due to their insufficiency .
the best solution seems to be estimation of at least two or three markers at the same time in order to increase their diagnostic applicability .
it has to be mentioned that noninvasive tests should be conducted only during screening examination and therapy monitoring .
screening examination using tumor markers and intervention in early stages of crc may significantly decrease the mortality rate connected with crc
| colorectal cancer ( crc ) is one of the most frequent human malignant neoplasms .
crc has an estimated incidence of more than 1,000,000 new cases annually worldwide .
approximately one out of three people who develop crc dies from the disease .
furthermore , crc often affects inhabitants of industrialized countries in comparison to less developed countries .
several markers of colon cancer , including cea , ca-19 - 9 , tps , tag-72 and lysosomal hydrolases , have been identified and are now being adopted in routine clinical practice . increased values of these markers
are often the first signal of recurrence or metastases , which is useful in prediction and prognosis of clinical outcome of patients with crc .
determination of the activity of lysosomal exoglycosidases in body fluids may bring some hope of improving diagnosis of colorectal cancer .
however , it has to be remembered that currently the most effective diagnostic method of crc is endoscopy . |
the internet is a technology that facilitates accessing various kinds of information resources and information exchange easily via an inexpensive and safe way .
although a standardized definition of internet addiction has not been uniformly agreed upon , some researchers define the internet addiction as having less ability to control enthusiasm for internet activities , losing the importance of the time without being connected to the internet , extreme nervousness and aggressive behaviour when deprived , and progressive deterioration in work , and social and family functionings [ 1 , 2 ] .
researchers point that the internet addiction may be seen at every age in both sexes and begin at earlier ages than other addictions .
prevalence statistics of internet addiction among adolescents vary widely from 2% to 20% across cultures and societies
for this reason , the internet addiction may cause physical and social problems as well as psychological disturbances .
a number of studies have underlined the unfavorable effects of internet addiction on physical and mental well - being and most of the adolescents with internet addiction were also reported to have another psychiatric disorder [ 7 , 8 ] .
mood disorders , substance use disorders , attention - deficit hyperactivity disorder ( adhd ) , disruptive behaviour disorders , anxiety disorders , sleep disorders , eating disorders , and epileptic seizures are some proven internet addiction - related clinical situations .
others have argued that the internet addiction is actually a behaviour pattern which plays role in some of the negative cognitions that compensate for failed areas of life just as seen in depression . in this context
, excessive use of the internet can be seen as a rewarding behavior , and through learning mechanisms , it may be used as an insufficient strategy to cope with some negative feelings .
temperament traits of novelty or sensation seeking are reported to be significantly higher in substance users than in nonusers .
most authors agree that these traits increase the risk of drug addiction in general , presumably because of an increased tendency to experiment with drugs . in studies investigating the temperament features of adolescents with internet addiction , it was revealed that students with internet addiction were easily affected by feeling , emotionally less stable , imaginative , absorbed in thought , self - sufficient , experimenting , and preferred their own decisions .
adolescents with internet addiction were also shown to have higher scores on neuroticism and psychoticism temperament categories than those of the control group . however , to our knowledge , there is not a study in the literature addressing the correlation between affective temperament profiles and the internet addiction .
the first aim of this study was to investigate internet addiction and the relevance to the sociodemographic properties among a sample of turkish adolescent population .
second , it was aimed to compare the affective temperament profiles and emotional and behavioural characteristics of adolescents with or without the internet addiction .
the study population included high school students attending erzurum ataturk high school in turkey in the 2010 - 2011 academic year ( n = 325 ) .
the study sample included 303 students who were present in classes on the day when data were collected , who agreed to participate in the study , and who filled in the questionnaires completely ( response rate = 93.2% ) .
the ethical committee approval was obtained from the institute of health sciences of ataturk university .
the students who were given information about the study and who accepted to participate in the study were included .
also , approval was obtained from the directorate of school education , affiliating with the ministry of education .
four instruments were used to collect data : a sociodemographic characteristics data form , internet addiction scale , the strengths and difficulties questionnaire , and the temperament evaluation of memphis , pisa , paris , and san diego autoquestionnaire .
we developed a 12-item sociodemographic questionnaire with items pertaining to age , sex , grade , average monthly household income , extent and type of internet use ( e.g. , where do you use the internet ? ) , and presence of the computer in the home .
the ias is a self - report instrument consisting of 31 items ( e.g. ,
i have attempted to spend less time on the internet but i have been unable to do so .
) based on the diagnostic and statistical manual of mental disorders , fourth edition , substance dependence criteria , and 2 additional criteria recommended by griffiths .
the ias is a highly reliable and internally consistent measure ( cronbach = .95 ) .
the scale was translated into turkish , and psychometric properties of the turkish version of the scale were evaluated among high school students revealing a highly significant test - retest reliability .
an interitem reliability reduced the initial scale from 31 to 27 items ( with cronbach of .94 ) .
scale items are rated on a 5-point likert scale ( 1 , never ; 2 , rarely ; 3 , sometimes ; 4 , frequently ; 5 , always ) , with higher scores representing greater internet addiction . a cutoff score of 81 ( 3 27 items ) was suggested as indicative of internet addiction .
the sdq was developed to determine adolescents ' areas of strengths and problematic behaviours .
the tool contains 25 questions which asks about behavioural characteristics , some of which are positive , and some of which are negative .
these questions are listed under five subheadings : ( 1 ) conduct problems ; ( 2 ) hyperactivity - inattention ; ( 3 ) emotional symptoms ; ( 4 ) peer problems ; and ( 5 ) prosocial behaviour .
the validity and reliability of the turkish version of sdq was performed by gvenir et al . with an acceptable internal consistency ( cronbach 's alpha = 0.73 ) .
the autoquestionnaire version of the temperament evaluation of memphis , pisa , paris , and san diego ( temps - a ) is a self - report instrument developed by akiskal et al . .
the complete questionnaire measures affective temperamental traits , present in the subject 's whole life , represented in five dimensional scales : depressive , cyclothymic , hyperthymic , irritable , and anxious . in this study ,
the turkish version was used . statistical package for social sciences software ( spss 15 , chicago , il , usa ) was used for the analysis .
pearson 's chi - square test was used to analyze the differences in means and proportions between groups .
spearman 's or pearson 's correlation tests were used to evaluate the association between the ias and the subscales of the sdq and the temps - a . a p value of < 0.05 was considered significant .
a total of 210 boys ( 69.2% ) and 92 girls ( 30.8% ) completed the scale and questionnaires . of the sample , 20 ( 6.6% )
the proportion of boys who were classified as internet addicts was 6.2% . for girls , the corresponding proportion was 7.6% ; the difference was not statistically significant .
having a computer in the home was found to be significantly related with internet addiction .
table 1 lists the baseline subject characteristics by the presence or absence of internet addiction .
the mean ias scores were significantly higher in adolescents who had a computer in home than those who had not ( p < 0.001 ) .
additionally , students who had been using internet for more than two years were found to score higher on the ias than those who had been using internet for two years or less ( p < 0.001 ) .
the ias scores were also significantly higher in adolescents who had been using the internet in home than in those who had been using the internet in other places ( p < 0.001 ) .
the prevalence rate of anxious temperament for internet addicts was 15% , whereas that for nonaddicts , it was 2.8% ( p
temperament subtypes and their distribution in terms of the internet addiction status are shown in table 2 .
the mean ias scores were found to be higher in adolescents with anxious temperament ( 63.9 25.3 ) than those without anxious temperament ( 47.9 18.1 ) ( p < 0.05 ) . presence or absence of other temperament subtypes
was not associated with significantly different scores on the ias . according to pearson 's correlation coefficient
, significant correlations were detected between internet addiction and dysthymic ( r = 0.199 ; p < 0.01 ) , cyclothymic ( r = 0.249 ; p < 0.01 ) , hyperthymic ( r = 0.156 ; p < 0.01 ) , irritable ( r = 0.254 ; p
< 0.01 ) , and anxious ( r = 0.205 ; p < 0.01 ) temperaments .
adolescents with and without internet addiction were also compared according to their temps - a and sdq scores ( table 3 ) .
although no difference was observed in temps - a scores , students with internet addiction scored higher on conduct problems ( p < 0.05 ) and total difficulties ( p < 0.05 ) subscales of sdq than students without internet addiction .
moreover , there was a positive and statistically significant correlation between ias and conduct problems ( r = 0.146 ; p < 0.05 ) , hyperactivity - inattention ( r = 0.133 ; p < 0.05 ) , emotional symptoms ( r = 0.138 ; p < 0.05 ) , and total difficulties ( r = 0.160 ; p < 0.01 ) .
in the present study , the prevalence of internet addiction was found to be 6.6% , which is similar with the rate found in other studies evaluating similarly aged students [ 22 , 23 ] . according to our findings
, the risk of becoming an internet addict increases with the increase in the accesibility of internet .
additionally , internet use with a duration of more than two years was also found to be related to increased internet addiction risk . in our study , presumably because of low participation rates in girls , there was no significant difference between boys and girls according to ias scores .
contrary to our finding , turkey statistical institute has stated that computer and internet use was more prevalent among boys than in girls in 2010 data .
other studies from turkey have also shown that boys were more prone to the effects of harmful internet use [ 17 , 25 ] . in a study which evaluated 535 primary school students using child behavior checklists , adhd scores have been found to be higher in adolescents with internet addiction than in those without .
additionally , yen et al . , evaluating 2793 college students , revealed that there was a relationship between the internet addiction and attention deficit hyperactivity disorder ( adhd ) .
they have also shown that the most prominent relation between the internet addiction was with attention deficit symptom cluster .
similarly , in the present study , internet addiction scores were found to be positively related to attention deficit and hyperactivity scores . according to the rewarding withdrawal syndrome ,
because of the d2 receptor deficiency , children with adhd have marked tendency to predisposition for pathological gambling , substance and alcohol use , and impulsive and compulsive behaviours . the internet addiction , according to the reward deficiency hypothesis , may function as an unnatural reward and may accompany adhd symptoms by this way .
dependent personality traits have been shown to be related with impulsivity , novelty seeking , psychoticism , and social relation problems in several studies [ 29 , 30 ] .
landers and lounsbury evaluated 117 undergraduate students and found that the internet usage was negatively related to three of the big five traits , agreeableness , conscientiousness , and extraversion as well as two narrow traits ; optimism and work drive , and positively related to tough - mindedness . in a study conducted among college students in turkey , psychoticism was shown to be the only personality dimension related to establishing new relationships and having internet only friends .
moreover , extroversion was the only personality dimension that is related to maintaining long - distance relationships and supporting daily face - to - face relationships . in our study , a positive and highly significant correlation was found between the internet addiction scores and depressive , cyclothymic , hyperthymic , irritable , and anxious temperament scores .
furthermore , the frequency of anxious temperament was found to be significantly higher in students with internet addiction than those without .
behavioural addictions demonstrate the core features of physical and psychological addictions such as mental rumination , mood variability , tolerance , withdrawal , interpersonal conflict , and relapse . according to the self - medication hypothesis ,
the patients usually use the substances to change their unwanted temperament status , to reduce their unbearable anxiety , and to cope with cognitive impairments .
this can be seen in the internet addiction , which is also a behavioral addiction .
namely , repeating efforts to get online may be a way of decreasing the severity of withdrawal symptoms such as anxiety .
additionally , the explanation of increased internet addiction frequency in individuals with anxious temperament may be related to self - medication hypothesis .
adolescents who are deprived of emotional and psychological support have been reported to be under increased risk for internet addiction .
morahan - martin and schumacher revealed that 22.7% of the internet users had trouble with peer and family relations and had difficulty in work and school activities because of the internet usage . in our study sample , total strength scores and conduct problems scores of the sdq have been found to be significantly higher in the students with internet addiction .
also , there was a positive correlation between the internet addiction scores and total difficulties , conduct problems , hyperactivity - inattention , and emotional symptoms scores . according to these findings
first , since the sample of this study included students of a high school , the results of the study can not be generalized to the larger population in turkey .
second , the sample size was modest to draw definite conclusions . also , high school education was not mandatory in turkey when this study was conducted .
families in the east and southeast of turkey invest more in the education of their sons than their daughters .
finally , the cross - sectional research design of the present study could not confirm causal relationships of temperament profiles and behavioural problems with internet addiction .
according to the findings of the present study , internet addiction is a relatively common phenomena among the adolescents .
there is a relation between the internet addiction and attention deficit and hyperactivity symptoms and also with anxious temperament .
furthermore , behavioural problems are more frequent in adolescents who have problematic internet use . because of the cross - sectional nature of this study
, it is not possible to define the direction of the causality of the results .
there is a need for further prospective studies evaluating the temperament features of adolescents who are at risk for the internet addiction in larger study populations . | the purpose of this study was to investigate the association of affective temperament profiles and emotional and behavioural characteristics with internet addiction among high school students .
the study sample included 303 high school students . a sociodemographic characteristics data
form , internet addiction scale ( ias ) , the strengths and difficulties questionnaire , and the temperament evaluation of memphis , pisa , paris , and san diego autoquestionnaire were used to collect data . of the sample ,
6.6% were found to be addicted to internet . having a computer in the home ( p < 0.001 ) and using the internet for more than two years ( p <
0.001 ) were found to be related to higher scores on the ias .
the prevalence rate of anxious temperament for internet addicts was more than that for nonaddicts ( p < 0.001 ) .
dysthymic ( r = 0.199 ; p < 0.01 ) , cyclothymic ( r = 0.249 ; p < 0.01 ) , hyperthymic ( r = 0.156 ; p < 0.01 ) , irritable ( r = 0.254 ; p
< 0.01 ) , and anxious ( r = 0.205 ; p < 0.01 ) temperaments ; conduct problems ( r = 0.146 ; p < 0.05 ) , hyperactivity - inattention ( r = 0.133 ; p < 0.05 ) , emotional symptoms ( r = 0.138 ; p < 0.05 ) , and total difficulties ( r = 0.160 ; p < 0.01 ) were found to be correlated with ias scores . according to these findings , there is a relation between the internet addiction and affective temperament profiles , especially with anxious temperament . furthermore , emotional and behavioural problems are more frequent in adolescents who have problematic internet use . |
the lifetime risk of urinary stone disease is estimated to be between 5% and 12% in europe and the united states , afflicting 13% of men and 7% of women . because up to 50% of patients may experience the recurrence of renal stones within 5 years of their first episode
, urolithiasis is a chronic disease with substantial economic consequences and great public health importance .
it is well established that almost 50% of ureteral stones will pass spontaneously over time and that stone size is a critical factor influencing expulsion ( only 20% of stones
alpha-1-adrenergic receptors are present throughout the ureter with a high concentration in the distal third of the ureter .
blockage inhibits basal smooth muscle tone and hyperperistaltic uncoordinated frequency while maintaining tonic propulsive contractions .
ureteral calculi can induce ureteral spasms that interfere with the expulsion of calculi ; thus , reduction of spasm with maintenance of normal peristaltic activity can facilitate expulsion of calculi .
it has been shown that ureteral calculi induce inflammatory changes in the ureteral wall and that submucosal edema around a calculus may worsen ureteral obstruction , thus increasing the risk of impaction and retention .
on the basis of these observations , medical expulsive therapy using -1-adrenergic receptor antagonists or calcium channel blockers and steroids has recently emerged as an efficacious and safe option for the initial management of ureteral stones .
tamsulosin has already been proven to increase the stone expulsion rate and to decrease the time to expulsion .
recently , the newer alpha - blocker naftopidil has been studied in patients with lower urinary tract symptoms due to benign prostatic hyperplasia and has been found to be better than tamsulosin for nocturia owing to its -1d - adrenoceptor blocking action . because the lower ureter and bladder are rich in -1d - adrenoceptors , there is a theoretical advantage in using naftopidil in medical expulsive therapy , because it may reduce the pressure in the intramural part of the ureter , thereby facilitating stone passage .
indeed , naftopidil was shown to increase the spontaneous expulsion rate of distal ureteral stones compared with placebo in a recent study .
therefore , we planned to evaluate the efficacy of naftopidil in comparison with tamsulosin in the management of distal ureteral stones .
the study was conducted in a tertiary care institute in northern india after approval from the institutional ethics committee . between july 2010 and
march 2012 all patients older than 18 years of age with a ureteral stone 5 mm to 10 mm in size located below the common iliac vessels , as assessed by noncontrast computed tomography , were eligible for the study if pain relief was achieved with diclofenac administration within 1 day .
patients who had fever , severe hydronephrosis , acute or chronic renal failure , multiple ureteral stones , a history of open surgery or endoscopic procedures in the urinary tract , diabetes , peptic ulcer , or concomitant treatment with -blockers , calcium antagonists , or nitrates ; those who were pregnant or lactating ; and those desiring immediate stone removal were excluded . after providing written informed consent , the patients were prospectively randomly assigned by use of a computer - generated table into three equal groups of 40 patients each .
the randomization table was stored centrally and the group to which each patient was assigned was conveyed to the author after the patient provided consent to participate in the study .
patients in group a were given tamsulosin 0.4 mg once daily , and those in group b were given naftopidil 75 mg once daily .
in addition , patients in groups a and b received prednisolone 5 mg once daily for a maximum of 1 week . in both groups , alpha - blockers
all patients were evaluated by physical examination ; serum creatinine ; urine culture ; plain x - ray of the kidneys , ureters , and bladder ( kub ) ; ultrasonography ; and noncontrast computed tomography of the kub region .
patients were instructed to filter their urine by using a standard mesh net to detect stone expulsion .
the time to expulsion ; analgesic use ; numbers of hospital visits for pain , follow - up , and endoscopic treatment ; and adverse effects of the drugs were noted .
the maximum time of follow - up was 4 weeks , after which patients underwent semirigid ureterorenoscopy for removal of stones that were not expelled .
secondary endpoints studied were time to stone expulsion , number of painful episodes , analgesic use , and self - reported side effects related to medical therapy .
expulsion of stones was confirmed with plain x - ray , ultrasonography , or noncontrast computed tomography .
normality of the measurable data was tested by use of the kolmogorov - smirnov test .
all three groups were compared for normally distributed data by analysis of variance followed by a post - hoc test ( student - newman - kuels procedure for pairwise comparisons ) .
the skewed data were analyzed for all the three groups by using the kruskal - wallis test , followed by the mann - whitney u test for comparison .
all the classified and categorical data were analyzed for all three groups by using the chi - square test .
because there was multiple testing , using bonferroni correction , the level of significance was taken as p<0.004 .
data were fed into a microsoft excel worksheet and were analyzed by using the spss ver .
the sample size of 40 patients in each group was calculated on the basis of an expected 40% spontaneous expulsion rate and a 75% expulsion rate in the -blocker groups and was enough to achieve a statistical power of 90% at a type i error rate of 5% .
all three groups were comparable with respect to age and sex and the size and side of stones ( table 1 ) .
the stone expulsion rate was 70% , 87.5% , and 32.5% in group a , group b , and group c , respectively .
the expulsion rates in group a ( p=0.002 ) and group b ( p<0.001 ) were significantly higher than in group c. although there was a trend toward a higher expulsion rate in group b than in group a ( p=0.056 ) , it was not statistically significant .
the time to expulsion was significantly higher in group c than in groups a ( p<0.001 ) and b ( p<0.001 ) .
the use of analgesic and the number of episodes of pain was also significantly lower in groups a and b than in group c ( p<0.001 ) .
the average number of hospital visits for pain and follow - up were 3.20.8 ( range , 2 to 5 ) , 3.10.9 ( range , 2 to 5 ) , and 4.00.9 ( range , 2 to 5 ) in groups a , b , and c , respectively .
these were lowest in group b and highest in group c , but the difference was not statistically significant ( table 2 ) .
a , the expulsion rate in the first week was 12.5% and that in the second week was 65% .
b , the cumulative expulsion rate was 15% in the first week , 85% in the second week , and 87.5% in the third week . in group c ,
the expulsion rate was 0% in the first week , 12.5% in the second week , and 32.5% in the third week .
forty - six patients did not expel the stones ( 13 , 5 , and 27 in groups a , b , and c , respectively ) after 4 weeks .
dizziness was reported by one patient in group a. none of the other patients reported any side effects related to the drugs .
among all urinary tract stones , 20% present as ureteral stones , of which 70% are found in the lower third of the ureter .
the factors influencing the spontaneous expulsion of ureteral stones are stone location , size , number , and shape ; spasm in the ureteral smooth muscles ; mucosal edema or inflammation ; and ureteral anatomy .
it has been shown that stones less than 6 mm can be observed for spontaneous expulsion .
it would seem logical that medical therapy should be used to reduce edema , spasm , and relaxation of smooth muscles .
current therapeutic options for distal ureteral stones include surgical intervention , medical expulsive therapy , and conservative wait and watch approaches .
the efficacy of minimally invasive therapies , such as shock wave lithotripsy and ureterorenoscopy , has been proven by several studies . however , although such procedures are effective , they are not free from risk or inconvenience , and there are consequent implications such as lowering the quality of life , high cost , and suspension of regular activities
. a watchful waiting approach can be used in a large number of cases , as demonstrated by several studies that revealed spontaneous passage rates of up to 85% for distal ureteral stones less than 5 mm .
watchful waiting does not always result in stone clearance and may be associated with recurrent renal colic .
thus , to increase the expulsion rate and reduce analgesic consumption , there is a great deal of enthusiasm for adjuvant pharmacological intervention , which can reduce symptoms and facilitate stone expulsion [ 17 - 19 ] .
malin et al . first described the presence of - and -adrenergic receptors throughout the entire length of the human ureter and the physiological response ( increase in tone and frequency of contraction ) of the ureter when exposed to -adrenoceptor agonists .
later it was found that -1d and -1a - adrenoceptors are expressed in significantly larger amounts than the -1b - adrenoceptor in the human ureter .
it was also demonstrated that the distal ureter expresses a greater amount of -1-adrenoceptor mrna than do the proximal and middle ureter .
itoh et al . reported that -1d - adrenoceptor mrna is more highly expressed than -1a - adrenoceptor mrna in each region of the ureter .
according to their results , an -1d - adrenoceptor antagonist can be expected to be more effective for the expulsion of the ureteral stones than an -1a - adrenoceptor antagonist .
alpha-1-receptors have been classified into three subtypes ( -1a , -1b , and -1d ) .
the -1a - receptors predominate in the proximal urethra , prostate , and bladder outflow ; the -1b - receptors are distributed widely in the vascular smooth muscles ; and the -1d - receptors are found predominantly in the intramural ureter and detrusor muscle .
numerous clinical trials have been performed to investigate the efficacy of the -1a - selective -blocker tamsulosin .
most of these studies were randomized and revealed that tamsulosin treatment significantly improves the expulsion rate of medium - sized ( 3 - 10 mm ) distal ureteral stones .
although medical expulsive therapy has become a standard treatment option used by urologists , it is still underused by other physicians in emergency departments .
because -1d - receptors are found prevalently in the distal ureter , these receptors may be a promising target for medical expulsive therapy .
although naftopidil acts on both -1a- and -1d - receptors , it has approximately three - fold stronger affinity for the -1d - receptors than for the -1a .
naftopidil has been used in the treatment of benign hyperplasia of the prostate and has been proved to be more effective and safe than tamsulosin .
it is possible that the effect of -1d - receptor antagonist on the obstructed ureter is to induce an increase in the intraureteral pressure gradient around the stone , as well as decreased peristalsis below the ureter .
we observed a stone expulsion rate of 87.5% with the use of naftopidil . the expulsion rate of naftopidil in previous studies varied from 61% to 90% . the higher dose of naftopidil ( 75 mg / d ) used in our study group as compared to previous studies and the concomitant use of prednisolone could have led to the better expulsion rate in our study than in these previous studies .
it was previously shown that the combination of steroid with tamsulosin leads to a higher stone expulsion rate .
the better stone expulsion rate as compared to tamsulosin may be due to the three times higher affinity of naftopidil for the -1d - adrenoceptor than for the -1a - adrenoceptor , which allows it to cause relaxation of both detrusor and ureteral muscles more effectively . because of the simultaneous detrusor and intramural ureteral relaxation , the compression at the intramural part of the ureter , which is the narrowest part of the ureter that the ureteral calculus has to negotiate , is relieved .
we believe that this peculiar action of naftopidil is a major reason for its higher stone expulsion rate compared with tamsulosin , although the difference was not statistically significant . in our study
, the expulsion rate was 70% in patients who received tamsulosin , which was significantly higher than that of the control group ( 32.5% ) .
tamsulosin has been shown to have a stone expulsion rate varying from 54% to 100% in previous studies .
the time to expulsion in both the tamsulosin and naftopidil groups was similar to that in previous studies . the mean time to expulsion with
this was probably because of the younger study population and the lack of any associated comorbidity .
the use of a near physiological dose of prednisolone and the careful exclusion of patients with contraindications to steroids may explain the lack of significant side effects related to steroid use .
the 5-mg dose of prednisolone is nearly five times lower than the 30-mg deflazacort dose used in previous studies .
analgesic use in the control group was significantly higher than in the tamsulosin and naftopidil groups .
. opined that -blockade may relieve ureteral colic by blocking the c - fibers responsible for mediating pain .
use of -blockers for expulsion of ureteral stones probably decreases the analgesic requirement in two ways : expulsion of stones , leading to longer stone - free periods , and blockade of c - fibers .
it is difficult to assess which of these may be primarily responsible for decreasing the analgesic requirement , because -blockers are known to be associated with both .
medical expulsive therapy using either naftopidil or tamsulosin combined with prednisolone is safe and efficacious compared with watchful waiting for distal ureteral stones .
there was a trend toward a better expulsion rate in the group treated with naftopidil , but this needs to be studied further in adequately powered studies . | purposeto compare the safety and efficacy of naftopidil and tamsulosin with prednisolone as medical expulsive therapy for distal ureteric stones.materials and methodsbetween july 2010 and march 2012 , 120 adult patients presenting with distal ureteric stones of size 5 to 10 mm were randomized equally to tamsulosin ( group a ) , naftopidil ( group b ) or watchful waiting ( group c ) .
tamsulosin or naftopidil was given for a maximum of four weeks .
in addition patients in group a and b were given 5 mg prednisolone once daily ( maximum one week ) .
stone expulsion rate , time to stone expulsion , analgesic use , number of hospital visits for pain , follow - up and endoscopic treatment and adverse effects of drugs were noted .
statistical analyses were done using chi - square test , mann - whitney test and analysis of variance.resultsthere was a statistically higher expulsion rate in groups a ( 70% ) and b ( 87.5% ) as compared to group c ( 32.5% ) ( p<0.001 ) .
the expulsion rates were not statistically different between groups a and b ( p=0.056 ) .
the mean time to expulsion was comparable between groups a and b but longer in group c. analgesic use was significantly lower in groups a and b. average number of hospital visits for pain , follow - up and endoscopic treatment was similar in all groups .
there was no serious adverse event.conclusionsmedical expulsive therapy for the distal ureteric stones using either naftopidil or tamsulosin in combination with prednisolone is safe and efficacious . |
animals : icrp - affected mds evaluated at the veterinary medical center of
the university of tokyo between april 2012 and november 2013 were recruited for the study .
the diagnosis of icrp was determined based on the colonoscopic and histopathological
findings as characterized in a previous study .
as controls ,
these
control mds were confirmed as having no inflammatory , infectious or immune - mediated diseases
with a health examination .
all procedures were conducted according to the animal
experimentation guidelines of the university of tokyo , and informed consent was obtained
from the owners of the mds .
cell preparation and culture : approximately 10 ml of
whole blood in ethylenediaminetetraacetic acid ( edta ) was collected from each dog .
one
milliliter was used for routine blood tests including complete blood count ( cbc ) , and the
remainder was used to obtain peripheral blood - derived monocytes modifying the methods as
described in previous studies [ 4 , 12 ] .
peripheral blood mononuclear cells ( pbmcs ) were
obtained from the edta blood via ficoll - paque plus ( ge healthcare ltd .
louis , mo , u.s.a . ) containing 10% fetal bovine serum ( biowest ,
nuaill , france ) supplemented with penicillin and streptomycin
( sigma aldrich ) .
pbmcs were seeded into 9 wells of a 12-well plate at a concentration of 1
10 cells / well and 9 wells of a 48-well plate at 2.5 10
cells / well and cultured at 37c in 5% co2 overnight . to obtain monocytes , we
washed the cells twice with hank s balanced salt solution ( sigma aldrich ) to remove
non - adherent cells , and the adherent cells were then cultured for an additional 6 days and
used for experiments .
the viability and purity of peripheral blood - derived monocytes were preliminary assessed
using 4 healthy laboratory beagles .
the use of laboratory beagles was approved by the animal
care committee of the university of tokyo ( approval no . p13 - 774 ) .
cell viability was
assessed by trypan blue staining , and 9297% of the cells were regarded as viable ( 100 cells
counted per dog , in duplicate ) .
giemsa
staining ; these cells presented variable cell size,<1.0 of n : c ratios , irregularly
round - shaped nuclei with diffuse chromatins , vacuolated cytoplasms and sometimes
multinucleated .
non - specific esterase staining was performed using a commercially available
kit ( muto pure chemicals , tokyo , japan ) according to the manufacturer s manual ; 9096% of
the cells were positively stained ( 100 cells counted per dog , in duplicate ) .
stimulating cells with pamps : the monocytes were washed twice with culture
medium and cultured in 500 l of culture medium for the 12-well plate and
200 l for the 48-well plate with stimulation by the following pamps :
peptidoglycan - like molecule ( ie - dap ; nod1 ligand , 10
g / ml ) , muramyl dipeptide ( mdp ; nod2 ligand , 10
g / ml ) , synthetic bacterial lipoprotein ( pam3csk4 ;
tlr1/2 ligand , 500 ng / ml ) , peptidoglycan from
escherichia coli k12(pgn - ek ; tlr2 ligand , 20
g / ml ) , synthetic diacylated lipoprotein ( fsl-1 ; tlr2/6
ligand , 50 ng / ml ) , ultrapure lps from e. coli
k12(lps - ek ultrapure ; tlr4 ligand , 10 g / ml ) ,
purified flagellin from salmonella typhimurium(fla - st ultrapure ; tlr5
ligand , 100 ng / ml ) , cpg oligonucleotide ( odn2006 ; tlr9
ligand , 5 m ) ( all from invivogen , san diego , ca , u.s.a . ) and culture
medium only ( negative control ) .
the stimulation lasted 6 hr for monocytes in the 12-well
plate and 24 hr for those in the 48-well plate .
each cell - free supernatant of culture media
was collected and stored at 80c for further analysis .
the cells in the 12-well plate were
washed twice with hank s balanced salt solution and subsequently lysed to extract their
total rna using a commercially available kit ( rnaspin mini rna isolation kit , ge healthcare )
according to the manufacturer s instructions and stored at 80c for further analysis .
quantification of prr and cytokine messenger rna ( mrna ) expression with
quantitative pcr : reverse transcription was performed using a primescript rt
reagent kit ( takara bio inc .
, otsu , japan ) to synthesize complementary dna from total rna
according to the manufacturer s instructions .
subsequently , quantitative real - time pcr was
performed using sybr premix ex taq ii ( takara bio ) and a thermal cycler dice real time
system ( takara bio ) .
the amplification conditions were as follows : 95c for 10 sec , 40
cycles of pcr ( 95c for 15 sec and 60c for 30 sec ) and dissociation ( 95c for 15 sec , 60c
for 30 sec and 95c for 15 sec ) .
nuclease - free water and non - reverse transcription controls
were used as negative controls .
a sample with a known cycle threshold ( ct ) value ( as a
positive control ) was included with all sample runs to control for run - to - run ct variation .
the real - time data were analyzed using thermal cycler dice real time system software version
4.01a ( takara bio ) .
the primers used in our analyses are detailed in table
1table 1.primer sequences of pattern recognition receptors and proinflammatory cytokines
used in the studygeneprimer sequences ( 53)product length ( bp)genbank accession numbernod1forwardgtcactcacatccgcaacac84jf681170reverseccacgatctccgcatcttnod2forwardgcacatcaccttccagtgttt98jf681171reverseggcccatgacaaatgaagatlr1forwardgccatcctaccgtgaacct114nm_001146143.1reversegcactcaaccccagaaactctlr2forwardtcgagaagagccacaaaacc90nm_001005264.2reversecgaaaatgggagaagtccagtlr4forwardgtgcttcatggtttctctggt146nm_001002950.1reverseccagtcttcatcctggcttgtlr5forwardtcgtgttgacagacggttattt143eu551146.1reversetccggttgagggaaaagtctlr6forwardtcaagcatttagacctctcattca109eu551147.1reverseccgtaactttgtagcacttaaaccttlr9forwardactggctgttcctcaagtcc104nm_001002998.1reverseagtcatggaggtggtggatgil-1forwardacccgaactcaccagtgaaatg110nm_001037971reverseggttcaggtcttggcagcagil-6forwardtctgtgcacatgagtaccaagatcc125nm_001003301reversetcctgcgactgcaagatagcctnf-forwardcccaagtgacaagccagtagctc146nm_001003244reverseacaacccatctgacggcactatchmbsforwardtcaccatcggagccatct112xm_546491reversegttcccaccacgctcttctsdhaforwardgccttggatctcttgatgga92xm_535807reversettcttggctcttatgcgatgtbpforwardctatttcttggtgtgcatgagg96xm_849432reversecctcggcattcagtcttttchmbs , hydroxymethylbilane synthase ; il , interleukine ; nod , nucleotide - binding
oligomerization domain ; sdha , succinate dehydrogenase complex subunit a ; tbp , tata box
binding protein ; tlr , toll - like receptor ; tnf , tumor necrosis factor .. the primer sequences were obtained from previous studies [ 24 , 26 , 33 ] .
the most stably expressed reference genes were
preliminarily determined using 50 ng total rna derived from monocytes of 7
icrp - affected mds and 7 control mds via assessment of 10 candidate genes : -2 microglobulin ,
cg14980-pb , glyceraldehyde-3-phosphate dehydrogenase , hydroxymethylbilane synthase ,
hypoxanthine phosphoribosyltransferase 1 , ribosomal protein l13a , ribosomal protein l32 ,
ribosomal protein s18 , succinate dehydrogenase complex subunit a and tata box binding
protein [ 23 , 33 ] .
hydroxymethylbilane synthase , succinate dehydrogenase complex subunit a and
tata box binding protein were selected as the most stable reference genes in the current
study using the genorm , normfinder and bestkeeper programs ( data not shown ) [ 2 , 34 , 45 ] .
hmbs , hydroxymethylbilane synthase ; il , interleukine ; nod , nucleotide - binding
oligomerization domain ; sdha , succinate dehydrogenase complex subunit a ; tbp , tata box
binding protein ; tlr , toll - like receptor ; tnf , tumor necrosis factor .
the amplification efficiency calculated based on standard curves from a 10-fold dilution
series of representative complementary dna samples was > 95% , as required for the ct
method .
the
relative expression of the target gene was calculated as an n - fold difference relative to
the expression of the reference gene by subtracting the reference ct values from the target
( ct ) ct values .
quantification of cytokine production by elisa : the concentrations of
il-1 protein in culture media stimulated with pamps for 24 hr were determined using a
commercially available elisa kit ( canine il-1 vetset elisa development kit ,
kingfisher biotech , st .
statistical analysis : statistical analyses were performed using a
commercially available software package ( jmp pro version 10.0.2 , sas institute , cary , nc ,
u.s.a . ) . the mann - whitney u test was used to compare results between
groups .
animals : twenty - six mds with icrps were included in the current study :
their median age was 125.5 months ( range , 68153 months ) , and the group included 16 males ( 4
intact and 12 neutered ) and 10 females ( 3 intact and 7 spayed ) .
eight of 26 icrp - affected
mds had clinical histories of other inflammatory disease , most predominantly with chronic
gastroenteritis ( table 2table 2.history in 26 dogs with inflammatory colorectal polyps ( icrps)inflammatory diseasecasesnon - inflammatory diseasecaseschronic enteritis5lipomatosis3chronic rhinitis2mammary grand tumor3pancreatitis2corneal dystrophy2anal sacculitis1cryptorchidism2dermatitis1inguinal hernia2otitis externa1alimentary lymphoma1diaphragmatic hernia1intervertebral disk disease1progressive retinal atrophy1prostatic cyst1prostatic hypertrophy1renal lymphoma1sudden acquired retinal degeneration1 ) .
edta blood was collected at initial diagnosis in 17 dogs and at clinical
remission in 9 dogs .
ten of 26 icrp - affected mds had received immunosuppressive therapy
including prednisolone , cyclosporine and/or leflunomide within 3 weeks prior to blood
collection , while 16 icrp - affected mds had not .
in addition , 16 control mds4 males ( 1
intact and 3 neutered ) and 12 females ( 5 intact and 7 spayed)were included , with a median
age of 103 months ( range , 60171 months ) .
thirteen control mds were clinically healthy ,
while 2 had obsolete vertebral fracture resulted from a traffic accident , and 1 had mitral
insufficiency .
the numbers of white blood cells and monocytes in the cbcs were not
significantly different between the groups ( white blood cells : 10,438
4,836/l vs. 10,719 4,595/l ,
p=0.698 ; monocytes : 640 289/l vs. 786
487/l , p=0.521 ; data represent mean sd ) .
quantification of mrna expression levels and protein production of prrs and
pro - inflammatory cytokines in unstimulated canine monocytes : as shown in figs .
1.relative transcription levels of pattern recognition receptor messenger rnas ( mrnas )
in non - stimulated monocytes in miniature dachshunds ( mds ) with inflammatory colorectal
polyps ( icrps ; n=26 ) and control mds ( n=16 ) .
data are expressed relative to the
geometric mean of three reference genes ( hydroxymethylbilane synthase , succinate
dehydrogenase complex subunit a and tata box binding protein ) .
2.relative transcription levels of proinflammatory cytokine mrnas ( a ) and protein
production of il-1 ( b ) in non - stimulated monocytes in mds with icrps ( n=26 ) and
control mds ( n=16 )
. data of mrnas are expressed relative to the geometric mean of
three reference genes .
samples below the limit of detection ( 5.9
pg / ml ) have been assigned a value of zero .
, no significant difference in the mrna expression levels of any of the prrs or
pro - inflammatory cytokines investigated was observed between the groups .
subsequently , we
selected il-1 as an indicator of prr reactivity , since it showed relatively small inter - dog
and inter - group variance ( fig .
the protein secretion of il-1 in the unstimulated monocytes was equivalent between
the groups ( fig .
relative transcription levels of pattern recognition receptor messenger rnas ( mrnas )
in non - stimulated monocytes in miniature dachshunds ( mds ) with inflammatory colorectal
polyps ( icrps ; n=26 ) and control mds ( n=16 ) .
data are expressed relative to the
geometric mean of three reference genes ( hydroxymethylbilane synthase , succinate
dehydrogenase complex subunit a and tata box binding protein ) .
relative transcription levels of proinflammatory cytokine mrnas ( a ) and protein
production of il-1 ( b ) in non - stimulated monocytes in mds with icrps ( n=26 ) and
control mds ( n=16 ) .
data of mrnas are expressed relative to the geometric mean of
three reference genes .
samples below the limit of detection ( 5.9
pg / ml ) have been assigned a value of zero .
responses of canine monocytes to pamps : the il-1 mrna expression level in
monocytes from icrp - affected mds was significantly higher than that from control mds when
stimulated with mdp ( fig . 3fig .
3.relative transcription levels of il-1 mrnas in monocytes stimulated with
pathogen - associated molecular patterns ( pamps ) for 6 hr in icrp - affected ( n=26 ) and
control ( n=16 ) mds .
ie - dap ,
peptidoglycan - like molecule ( nod1 ligand ) ; fla - st , flagellin ( tlr5 ligand ) ; mdp ,
muramyl dipeptide ( nod2 ligand ) ; fsl-1 , synthetic diacylated lipoprotein ( tlr2/6
ligand ) ; lps - ek , lps ( tlr4 ligand ) ; odn2006 , cpg oligonucleotide ( tlr9 ligand ) ;
pam3csk4 , synthetic bacterial lipoprotein ( tlr1/2 ligand ) ; pgn - ek , peptidoglycan ( tlr2
ligand ) . ) .
by contrast , no significant difference in the response of monocytes to stimulation
with ie - dap , pam3csk4 , pgn - ek , fsl-1 , lps - ek , fla - st or odn2006 was observed between the md
groups ( fig .
3 ) . furthermore , il-1 protein
production after stimulation with mdp , pam3csk4 , pgn - ek and fsl-1 in monocytes from
icrp - affected mds was greater than that in monocytes from control mds ( fig .
4.secretion of il-1 protein from monocytes stimulated with pamps for 24 hr in
icrp - affected ( n=26 ) and control ( n=16 ) mds .
samples below the limit of detection ( 5.9
pg / ml ) have been assigned a value of zero .
conversely , no significant difference in monocyte response was observed between the
md groups after stimulation with ie - dap , lps - ek , fla - st or odn2006 ( fig .
relative transcription levels of il-1 mrnas in monocytes stimulated with
pathogen - associated molecular patterns ( pamps ) for 6 hr in icrp - affected ( n=26 ) and
control ( n=16 ) mds .
fla - st , flagellin ( tlr5 ligand ) ; mdp ,
muramyl dipeptide ( nod2 ligand ) ; fsl-1 , synthetic diacylated lipoprotein ( tlr2/6
ligand ) ; lps - ek , lps ( tlr4 ligand ) ; odn2006 , cpg oligonucleotide ( tlr9 ligand ) ;
pam3csk4 , synthetic bacterial lipoprotein ( tlr1/2 ligand ) ; pgn - ek , peptidoglycan ( tlr2
ligand ) .
secretion of il-1 protein from monocytes stimulated with pamps for 24 hr in
icrp - affected ( n=26 ) and control ( n=16 ) mds .
samples below the limit of detection ( 5.9
pg / ml ) have been assigned a value of zero .
in addition , there was no significant difference in all mrna expression and protein
production levels investigated in this study between the icrp - affected mds which had
received immunosuppressive therapy and those had not ( data not shown ) .
furthermore , the
il-1 mrna expression and protein production after stimulation with mdp in icrp - affected mds
without immunosuppression were also significantly greater than those in control mds ( table 3table 3.comparison of il-1 mrna expression and protein production between icrp - affected
miniature dachshunds ( mds ) without immunosuppressive therapy ( n=16 ) and control mds
( n=16)pampsil-1 mrna expressionil-1 protein production
( pg / ml)icrp - affectedcontrolp - value*icrp - affectedcontrolp - value*unstimulated0.03 ( 0.000.57)0.01 ( 0.000.11)0.29124.7 ( 0.055.2)46.9 ( 0.053.6)0.082ie - dap0.10 ( 0.013.84)0.21 ( 0.0035.79)0.2430.0 ( 0.0159.0)16.9 ( 0.043.3)0.230mdp0.59 ( 0.075.35)0.15 ( 0.010.36)0.00263.5 ( 0.0117.8)46.0 ( 0.055.2)0.026fla - st0.04 ( 0.000.54)0.03 ( 0.010.15)0.5470.0 ( 0.038.0)0.0 ( 0.022.4)0.551odn20060.03 ( 0.000.77)0.02 ( 0.000.52)0.1420.0 ( 0.021.3)0.0 ( 0.017.9)0.551pam3csk49.37 ( 0.8244.23)4.47 ( 0.0122.63)0.18776.4 ( 0.0594.7)36.6 ( 0.0258.0)0.304pgn - ek14.32 ( 5.7759.97)12.93 ( 1.82143.07)0.763229.9 ( 0.02223.1)72.4 ( 0.0783.9)0.426fsl-123.37 ( 1.4262.57)11.52 ( 1.8288.99)0.228104.6 ( 0.0839.5)38.3 ( 0.0135.1)0.089lps - ek19.96 ( 1.8637.96)11.07 ( 0.46108.34)0.243124.4 ( 12.01267.9)107.6 ( 0.0294.3)0.522data are represented in median ( range ) . * mann - whitney u - test .
ie - dap , peptidoglycan - like molecule ( nod1 ligand ) ; fla - st , flagellin ( tlr5 ligand ) ;
fsl-1 , synthetic diacylated lipoprotein ( tlr2/6 ligand ) ; lps - ek , lps ( tlr4 ligand ) ;
mdp , muramyl dipeptide ( nod2 ligand ) ; odn2006 , cpg oligonucleotide ( tlr9 ligand ) ;
pamp , pathogen - associated molecular pattern ; pam3csk4 , synthetic bacterial lipoprotein
( tlr1/2 ligand ) ; pgn - ek , peptidoglycan ( tlr2 ligand ) . ) , while no significant difference of il-1 mrna expression or protein
production was observed between them when stimulated with other ligands including pam3csk4 ,
pgn - ek and fsl-1 ( table 3 ) .
moreover , no difference was observed in il-1 mrna expression after stimulation with every
ligand investigated between icrp - affected mds at initial diagnosis and those at clinical
remission , whereas greater il-1 protein productions were observed in icrp - affected mds at
initial diagnosis after stimulation with pam3csk4 , pgn - ek or fsl-1 compared with those at
clinical remission ( table 4table 4.comparison of il-1 mrna expression and protein production between icrp - affected
mds at initial diagnosis ( n=17 ) and those at clinical remission ( n=9)pampsil-1 mrna expressionil-1 protein production
( pg / ml)initial diagnosisclinical remissionp - value*initial diagnosisclinical remissionp - value*unstimulated0.02 ( 0.000.57)0.01 ( 0.000.10)0.50124.3 ( 0.055.2)33.5 ( 0.058.5)0.130ie - dap0.13 ( 0.018.50)0.06 ( 0.031.59)0.34615.3 ( 0.0244.9)0.0 ( 0.074.2)0.228mdp0.33 ( 0.070.54)0.31 ( 0.172.55)0.72666.3 ( 0.0101.2)61.9 ( 0.0117.8)0.935fla - st0.05 ( 0.000.54)0.03 ( 0.010.04)0.0580.0 ( 0.050.2)0.0 ( 0.00.0)0.123odn20060.04 ( 0.000.77)0.01 ( 0.000.05)0.0900.0 ( 0.028.3)0.0 ( 0.045.8)0.764pam3csk410.91 ( 0.8295.79)4.10 ( 1.0137.53)0.16997.8 ( 0.0953.0)21.8 ( 0.0249.4)0.009pgn - ek20.26 ( 4.00328.87)10.93 ( 4.1254.42)0.153413.7 ( 0.02741.1)33.7 ( 0.0597.1)0.007fsl-127.71 ( 1.42146.09)7.51 ( 0.39109.24)0.169164.3 ( 0.0839.5)31.4 ( 0.0479.6)0.049lps - ek21.25 ( 1.17172.59)8.70 ( 2.0747.87)0.435178.4 ( 29.61267.9)98.5 ( 12.0354.9)0.346data are represented in median ( range ) . * mann - whitney u - test . ) .
ie - dap , peptidoglycan - like molecule ( nod1 ligand ) ; fla - st , flagellin ( tlr5 ligand ) ;
fsl-1 , synthetic diacylated lipoprotein ( tlr2/6 ligand ) ; lps - ek , lps ( tlr4 ligand ) ;
mdp , muramyl dipeptide ( nod2 ligand ) ; odn2006 , cpg oligonucleotide ( tlr9 ligand ) ;
pamp , pathogen - associated molecular pattern ; pam3csk4 , synthetic bacterial lipoprotein
( tlr1/2 ligand ) ; pgn - ek , peptidoglycan ( tlr2 ligand ) .
data are represented in median ( range ) . * mann - whitney u - test .
the current study compared the prr responses to specific pamp stimulation in monocytes from
icrp - affected and control mds .
the study aimed to determine candidate prrs responsible for
disease development that might result from genetic predispositions in mds .
we found
hyperreactivity of certain prrs , including nod2 , tlr1/2 , tlr2 and tlr2/6 .
since it has been
reported that the number of macrophage is increased in the polypoid lesion [ 31 , 41 ] , the
hyperreactivity of these prrs in monocytes would be involved in the pathogenesis of icrps in
mds .
mdp , a ligand of nod2 , induced mrna upregulation and il-1 protein production , and the
inductions were greater in icrp - affected mds than in control mds .
nod2 recognizes peptides derived from bacterial
peptidoglycan and induces pro - inflammatory cytokine production through nf-b activation
.
constitutive activation of nf-b and/or
hyperresponsiveness to mdp stimulation , which is due to mutations of the nod2 gene , are considered to associate with blau syndrome ( bs )
in humans ; this is partly consistent with the
findings of the present study .
we did not evaluate nf-b activity in this study ; however ,
baseline il-1 mrna expression and protein production levels were equivalent between the
groups .
bs is characterized as a systemic granulomatous inflammation including uveitis ,
dermatitis and symmetric arthritis .
interestingly , miniature dachshund also commonly
develops a granulomatous disease including sterile panniculitis ; however , no icrp - affected mds included in this study did not have a
history or complication of such disease ( table
2 ) .
moreover , inflammation in bs is thought to be independent of bacterial
participation . by contrast
, nod2 hyperreactivity
seems to play a crucial role in the development of icrp inflammation via response against
fecal antigens , because the large intestine has the highest density of bacteria in the gut
.
therefore , the significance of functional
disorders of nod2 in icrps in mds seems to differ from those of bs in humans .
further
analyses of the genetic background of the nod2 gene in mds with icrps are warranted .
monocytes derived from icrp - affected mds also showed overproduction of il-1 protein in
response to stimulation with pam3csk4 , pgn - ek and fsl-1 , the ligands of tlr1/2 , tlr2 and
tlr2/6 , respectively .
tlr2 recognizes bacterial peptidoglycan and induces pro - inflammatory
and immunomodulatory cytokines via nf-b activation , whereas tlr1 and tlr6 form dimers with
tlr2 and alter tlr2 ligand specificity [ 1 , 28 ] . the activation of nf-b by these tlrs is induced
through a myeloid differentiation factor 88-dependent pathway that is also involved in
tlr4- , tlr5- and tlr9-induced pathways .
therefore , the overproduction of il-1 observed in this study might be the result of
functional disorders of tlrs , especially tlr2 , but not from disorders in lower signaling
pathways .
some polymorphisms of tlr1 , tlr2 and tlr6 in humans have also been associated with
an increased risk of ibd , although their effects
on reactivity have not been well characterized .
therefore , further investigation of the
genetic background of the tlrs contributing to the hyperreactivity and development of icrps
in mds is also needed . despite the increased production of il-1 protein in response to tlr1/2 , tlr2 and tlr2/6
stimulation , the mrna expression level of il-1 in icrp - affected mds and control
first , greater negative feedback on signaling pathway , such as
the nf-b pathways , may be induced by these tlrs , because they usually elicit greater
cellular responses compared with those elicited by nod2 [ 21 , 35 , 46 ] , which is also consistent with the results of the current study ( figs . 3 and
4 ) .
we chose a 6-hr duration of stimulation , because it resulted in the highest
il-1 mrna expression in a preliminary study ( data not shown ) .
however , the 6-hr duration of
stimulation may induce negative feedback and interfere with mrna expression .
sequential
evaluation of mrna expression levels after shorter or longer stimulations may confirm the
existence of the negative feedback interference ; however , we did not extract mrna from the
monocytes stimulated for 24 hr .
furthermore , response against lower - dose stimulation might
also help determine whether the negative feedback interference occurs .
second , an inflammasome disorder may exist ,
because inflammasomes activate the conversion of il-1 from pro - il-1 , which is synthesized
from il-1 mrna . however , we believe this
explanation is unlikely , because protein production with or without the stimulation of other
prrs was not significantly different between the groups . although the hyperreactivity of nod2 , tlr1/2 , tlr2 and tlr2/6 might reasonably lead to the
overproduction of inflammatory cytokines in icrp lesions , several contradictions remain .
the
primary role of nod2 in the gastrointestinal tract appears to be the modulation of tlr
signaling through the induction of interferon regulatory factor 4 and the mediation of
tolerance to bacterial antigens [ 13 , 46 , 47 ] .
a
frameshift mutation of nod2 gene , the most influential mutation for crohn s disease , leads
to the hypo - reactivity to mdp ; the consequent
deficiency of the induction of tlr tolerance is regarded as one of the important etiology of
crohn s disease . in addition
, tlr2 stimulation
leads to the induction of pro - inflammatory and immunomodulatory cytokines [ 5 , 10 ] .
moreover , a
recent study revealed that the responses to prr stimulation differed in duodenal biopsy
specimens and whole blood , which indicates that responses to bacterial stimuli differ by
location . because only monocytes derived from
peripheral blood were used in the present study , we are uncertain whether the observed prr
hyperreactivity can be applied in the same manner to the colorectal mucosa .
however , we
speculate that a genetic disorder affecting the response of monocytes derived from
peripheral blood interferes with the function of macrophages in the colorectal mucosa .
further analyses using colorectal tissue cultures or mucosal macrophages and evaluating both
pro - inflammatory and immunomodulatory responses must be performed .
in addition , interactions
between nod2 and tlrs , particularly as they relate to interferon regulatory factor 4 in both
control and icrp - affected mds , are of interest .
the protein production of il-1 was decreased in both icrp - affected and control mds when
stimulated with fla - st and odn2006 , the ligands of tlr5 and tlr9 , respectively ( see figs . 2 and 4 ) .
these tlrs in the gut have been described that they do not directly induce
pro - inflammatory reactions like tlr2 and tlr4 , but contribute to homeostasis via inducing
the differentiation of anti - inflammatory responses and iga production [ 9 , 43 ] .
house et
al . reported that these pamps hardly induce pro - inflammatory cytokine mrna
expression and protein production in canine pbmc - derived monocytes , which is consistent with the results of il-1 mrna expression in
this study .
the difference in the stimulating duration might explain the reduction of il-1
protein production observed in this study .
house et al . stimulated cells
for 4 hr , while 24 hr - stimulation was performed
in this study ; we selected the duration to obtain detectable amount of il-1 protein in a
preliminary study ( data not shown ) .
the chronic or repetitive stimulation with pamps
including ligands of tlr5 and tlr9 induces a tlr tolerance , which is characterized as the
unresponsiveness of lower signaling pathways and reduced induction of pro - inflammatory
cytokines by further tlr stimulations [ 22 , 40 ] .
the induction of tlr tolerance and little
pro - inflammatory induction might result in the reduction of il-1 protein production .
further analyses whether other pro - inflammatory or anti - inflammatory cytokines show similar
reduction via stimulation of tlr5 or tlr9 and the tlr tolerance induced by them would
confirm these findings .
this study evaluated only pro - inflammatory cytokine as an indicator of prr reactivity .
since it has been reported that the alteration of anti - inflammatory response including il-10
is not consistent with that of pro - inflammatory cytokines in various diseases , such as
canine chronic enteropathy , a possibility that
dysregulation of anti - inflammatory cytokine induction could not be excluded , which can not be
detected in this study design . in addition , tamura et al . reported the
marked up - regulation of il-8 in macrophage at polypoid lesion , which suggests the importance of il-8 overproduction from macrophage
in the pathogenesis of icrps in mds
unfortunately , experiments could not be repeated ,
because of the limited amount of monocytes obtained .
we checked the morphology of adherent cells obtained
from icrp - affected and control mds and regarded them as the monocyte lineage .
however , we
did not perform immunocytochemistry , flow cytometry or other staining on the plate - adherent
cells of icrp - affected and control mds , because of the limited number of cells .
in addition ,
the cell viability was not evaluated in icrp - affected and control mds in this study .
however , the non - adherent cells were removed before and after cell stimulation at each
assay , and thus , we consider that the most of dead cells were not remained in the
experimental system . our study had further limitations .
although the control group was composed of age - matched
mds , their genetic backgrounds were not clarified ; in other words , mds enrolled in the
control group in this study might develop icrps in future .
however , the prevalence of icrps
in mds is approximately 1.1% , according to a previous retrospective study ; therefore , we believe that this limitation does not
affect the results of our study .
another limitation was that inflammatory status and treatment with anti - inflammatory agents
including prednisolone , cyclosporine and/or leflunomide at the time of sampling might affect
the reactivity of monocytes .
although we cultured monocytes for 7 days to reduce their
interference and confirmed that no significant differences in baseline prr and
pro - inflammatory cytokine mrna expression and protein production levels occurred between the
groups , some non - statistically significant differences in unstimulated cells might affected
the results of stimulated monocytes .
thus , we further divided the icrp - affected md group
into two groups by disease status ( whether the dogs were at initial diagnosis or at clinical
remission ) or immunosuppression status ( whether dogs received immunosuppressive therapy or
not )
. consequently , the icrp - affected mds at initial diagnosis showed a greater reactivity
of tlr1/2 , tlr2 or tlr2/6 ( table 4 ) .
furthermore , the reactivity of tlr1/2 , tlr2 or tlr2/6 could not show significant difference
when compared between icrp - affected mds without immunosuppression and control mds ( table 3 ) , although the difference of
immunosuppression status within icrp - affected mds did not result in any significant
difference . therefore , the hyperreactivity of tlr1/2 , tlr2 and tlr2/6 should be interpreted
with caution that the disease or immunosuppression status may interfere with the result ; in
other words , the hyperreactivity of nod2 in icrp - affected mds might be true . confirming this
conclusion requires further investigations of repeatability using pre- and post - treatment
specimens from mds with icrps . in conclusion , we demonstrated that the reactivity of nod2 , tlr1/2 , tlr2 and tlr2/6 in mds
with icrps was greater than that in control mds .
the results indicate that the icrp - affected
dogs have pprs with genetic backgrounds that predispose them to icrp development .
further
investigations of the corresponding genetic backgrounds and the significance of
hyperreactivity on the development of icrps are warranted . | inflammatory colorectal polyps ( icrps ) frequently occur in miniature dachshunds ( mds ) in
japan .
mds with icrps develop multiple polyps with severe neutrophil infiltration that
respond to immunosuppressive therapy .
therefore , icrps are thought to constitute a novel ,
breed - specific form of canine inflammatory bowel disease ( ibd ) .
pattern recognition
receptors ( prrs ) play a key role in the distinction of pathogens from commensal bacteria
and food antigens .
dysfunction resulting from genetic disorders of prrs have been linked
to human and canine ibd .
therefore , we analyzed the reactivity of prrs in mds with icrps .
twenty - six mds with icrps and 16 control mds were recruited .
peripheral blood - derived
monocytes were obtained from each dog and then stimulated with prr ligands for 6 and 24
hr ; subsequently , messenger rna ( mrna ) expression levels and protein secretion of il-1
were quantified using quantitative real - time pcr and elisa , respectively .
the levels of
il-1 mrna and protein secretion after stimulation with a nucleotide - binding
oligomerization domain 2 ( nod2 ) ligand were significantly greater in monocytes from
icrp - affected mds than in those from control mds .
in addition , il-1 protein secretion
induced by toll - like receptor ( tlr ) 1/2 , tlr2 and tlr2/6 stimulation was also
significantly greater in icrp - affected mds .
these results suggest that reactivity against
nod2 , tlr1/2 , tlr2 and tlr2/6 signals is enhanced in icrp - affected mds and may play a role
in the pathogenesis of icrps in mds .
additional studies of the genetic background of these
prrs should be performed . |
subarachnoid hemorrhage ( sah ) is a form of stroke that affects 28,000 individuals in north america each year .
a frequent cause of sah is the rupture of an intracranial aneurysm , leading to extravasation of blood into the subarachnoid space . while aneurysmal sah accounts for only 7% of all cerebrovascular accidents ( cvas ) , those that suffer sah have an average age of 51 years , significantly younger than those with a thromboembolic or hemorrhagic stroke . due to the young age of these patients
, they have great potential to return to their premorbid state and level of productivity , with successful intervention .
however , even with endovascular or surgical repair of the offending aneurysm , those that survive the initial insult can still accumulate additional neurologic defects in the days and weeks post - hemorrhage .
enormous efforts to understand and prevent additional mortality following sah led to the discovery of the phenomenon known as cerebral vasospasm ( cv ) .
cv refers to the constriction of smooth muscle in blood vessels feeding the brain , leading to reductions in blood flow to downstream brain parenchyma .
cv occurs angiographically on days 47 post - sah , with narrowing of the arteries of the circle of willis in 40% to 70% of patients .
clinical manifestations of vasospasm generally follow a characteristic progression , beginning with mental status changes , proceeding to motor and speech impairments , and culminating in permanent neurological damage or death .
vasospasm is hypothesized to underlie the neurologic deficits that occur after sah , given that the deficits seen follow a similar time course as the development of angiographic vasospasm .
however , it is important to note that other mechanisms are likely to contribute to long - term outcome following sah , including cortical spreading depression , generation of microthrombemboli , pathologic vascular changes , and generation of neurotoxic intermediates [ 29 ] .
additionally , vasospasm of vessels supplying noneloquent areas of cortex may not affect clinical manifestations of vasospasm but may affect long - term outcomes .
one promising mechanism to prevent clinical vasospasm involves enhancement of nitric oxide ( no ) signaling in the cerebral vasculature .
no is a gaseous signaling molecule critical for maintaining blood vessel patency and promoting local hemodynamics .
no is synthesized by three different enzymes in the body , and its synthesis is rapidly upregulated following aneurysmal rupture .
additionally , the regulation of no is important for a range of physiological events outside of blood flow regulation
. an improved understanding of no can , therefore , provide insight into additional mechanisms underlying neurologic damage after sah and direct future interventions .
thus , the objective of our review is to ( 1 ) assess the physiological role of no in control of cerebral blood flow , ( 2 ) discuss the evidence supporting no in the pathophysiology of sah , at the level of vasospastic collapse and oxidative damage , and ( 3 ) report the experimental and clinical findings regarding interventions for sah , ranging from enhancement of no signaling directly to indirect stimulation of no synthase .
we hope to assess the strength of evidence and enhance our scientific understanding of the role of no in cv following sah .
as the brain does not have energy storage capacity of its own , it needs to maintain continuous nutrient and oxygen delivery in order to support its metabolic demand .
therefore , when blood flow to the central nervous system is disrupted , as occurs in the acute period following sah and several days later during cv , permanent neurologic damage can ensue .
elaborate mechanisms have evolved to maintain constant blood flow to the cns , mechanisms that are sensitive to changes in mean arterial blood pressure , cerebral perfusion pressure , ph , and pco2 .
emerging evidence suggests that no is one such molecule that has evolved to support cerebral blood flow ( cbf ) during periods of rest and changing metabolic demand , such as alteration in synaptic activity , activation of vasodilator perivascular nerves , and hypercapnia .
the activity of no , and therefore the effects of no on cbf , can be controlled by targeting no signaling cascades and no synthesis .
no signals through activation of soluble guanylyl cuyclase ( sgc ) , a heme - containing enzyme located on the inside surface of the cell membrane .
sgc then acts to stimulate formation of cyclic guanine monophosphate ( cgmp ) from gtp .
cgmp acts as a second messenger , signaling through multiple kinases to regulate the function of numerous signaling cascades and ion channels downstream . as a result of sgc / cgmp signaling ,
no signaling leads to dephosphorylation of myosin light chains and hyperpolarization of smooth muscle cells , causing relaxation of smooth muscle fibers and dilating cerebral arterioles .
no signaling is terminated through the actions of phophodiesterases ( pdes ) , which act to break down cgmp intracellularly .
its synthesis requires one arginine molecule , two oxygen molecules , and 1.5 nadp+ molecules for electron transfer .
the molecule l - citrulline is produced in equimolar amounts with no , a finding critical when considering how to measure no .
all three of the nos isoforms require the cofactors tetrahydrobiopterin , fad , fmn , calmodulin , and heme to function [ 4 , 13 ] .
the heme - containing component of nos is critical for understanding how hemoglobin released by vascular injury can bind to available no , precipitating the development of vasospasm .
furthermore , the tetrahydrobiopterin cofactor plays an important role in nos dysfunction , and subsequent development of harmful reactive oxygen and nitrogen species after sah .
nos is encoded by three isoforms in mammals : endothelial nos ( enos ) , neuronal nos ( nnos ) , and inducible nos ( inos ) .
nnos is located in certain neurons , consistent with a role of no as a retrograde neurotransmitter , and in perivascular nerves , including those that innervate the adventitial layer of arteries .
both enos and nnos produce no in a relatively constitutive fashion , in a manner that fluctuates in response to intracellular calcium levels .
the function of enos and nnos depends on the binding of these proteins to a calcium - sensing protein called calmodulin .
inos is expressed in nearly all cell types , including endothelial cells , vascular smooth muscle cells , macrophages , and others
. the basal expression of inos is very low , but it may be the most critical isoform for no production after sah , as its transcription is stimulated by hypoxia and inflammatory cascades , and it produces roughly 1001000 times the no of its counterparts , in a manner independent of calcium .
both enos and inos phosphorylation are potently stimulated after sah , and nnos levels markedly decrease , perhaps due to degeneration of nnos neurons after sah .
while no is a critical molecule for normal regulation of cerebral blood flow , its overproduction may have significance in pathological states .
no is a free radical signaling species with a very short half life in brain ( between 2 seconds and 2 minutes ) , after which it is rapidly oxidized to its inactive metabolites nitrite and nitrate .
recent evidence indicates that , under certain physiological conditions , nitrite and nitrate can be reduced back into no [ 1720 ] .
the role of no as a free radical is important when considering that , in conditions like sah , the production of no is going to be markedly upregulated .
overproduction of no by inos has been implicated in many pathophysiological processes caused by ischemia and inflammation .
the potential neurotoxic role of no is incompletely understood , but is hypothesized to depend on interactions between no and superoxide anion , resulting in the formation of peroxynitrite .
sah provides many sources of free radicals to potentiate the formation of peroxynitrite , involving the stimulation of enzymes including xanthine oxidase , nadph oxidase , and the arachidonic acid cascade , while inhibiting antioxidant enzymes including superoxide dismutase and glutathione peroxidase .
additionally , animal models demonstrate that sah disrupts the flow of electrons in the mitochondrial electron transport chain after sah , providing a potential source of electrons for superoxide formation [ 2224 ] . in the context of sah ,
a last , but critical , source of free radicals for reactive oxygen / nitrogen species formation is from hemoglobin itself .
indeed , both oxyhemoglobin and methemoglobin are found in much higher amounts in the csf of patients afflicted by sah and have the potential to generate free radical formation , trigger autocatalytic lipid peroxidation cycles , and induce cytotoxic signaling cascades [ 21 , 2628 ] .
these free radical generating mechanisms are important considerations when constructing therapeutic frameworks for treatment of sah , and the role of nos itself in generation of no free radicals will be considered in later sections .
a visual schematic of all signaling pathways involved with no after sah is summarized in figure 1 .
in addition to the mechanisms mentioned above , there are numerous other effects of no that may be critical to neurologic outcome after sah .
evidence from research on cardiovascular disease suggests that no serves to influence platelet aggregation and adhesion , intimal hyperplasia [ 29 , 30 ] , leukocyte adhesion and migration , and smooth muscle proliferation under physiological conditions .
additionally , beyond the role of no in vasospasm itself , no may influence other critical mechanisms that contribute to neurologic outcome after sah , including cortical spreading depression , microthromboemboli formation , and consequences of vascular injury itself .
while these processes warrant further investigation and discussion , this review is focused more specifically on the roles of no in vasodilation and free radical production .
the role of no in vasodilation and free radical production , as it pertains to cv after subarachnoid hemorrhage , will therefore be the focus of subsequent sections .
the half - life of no in the human body , as mentioned previously , is on the order of seconds to minutes . due to the difficulties in measurement of no
directly , measurement of nitrite and nitrate , two stable oxidized metabolites of no , are used instead . in the context of sah , nitrite and nitrate
are most frequently assessed in the csf of patients who have external ventricular drains placed , although studies have been performed involving direct measurement of no in brain through placement of microdialysis catheters .
there are conflicting reports in the literature regarding how nitrite and nitrate levels relate to cv .
however , there is a general consensus regarding the dynamics of no after sah . for the purposes of this review
, we will adopt the framework put forth in a recent review by sehba et al .
[ 32 , 33 ] . due to difficulties in real world assessment of no or its metabolites in the period directly after sah , sehba and authors focused primarily on animal models for the neurochemical changes in the early period after sah ( between 0 and 60 min ) .
according to the generalized consensus in the animal model literature , there is an early decrease in no in the period directly following sah , presumably due to hemoglobin scavenging , consumption by neutrophils , and interaction of no with free radicals .
phase ii , between 1 and 6 hours post - sah , is characterized by a return of no function to baseline , presumably due to induction of enos and inos activity post - sah .
phase iii occurs between 672 hours and is characterized by an increase in nitrite / nitrate compared to control conditions .
this phase iii is based on findings from additional animal models and clinical studies . in terms of clinical studies of patients with sah ,
one finding indeed revealed that , compared to a control population which underwent surgical repair of unruptured aneurysms , patients with ruptured sah had significantly higher levels of nitrite and nitrate in their csf .
another study supported a relationship between nitrite / nitrate and sah , demonstrating that these metabolites correlate with oxygen tension in patients with aneurysmal rupture .
csf relationships between no and vasospasm are less clear than the relationship between sah and no .
suzuki et al . demonstrated decreased levels of nitrite in sah patients who experienced vasospasm compared to those that did not .
similar findings were demonstrated by jung et al . a decade later , replicating not only the decreased nitrite levels in patients with vasospasm but also increased levels of an endogenous nitric oxide inhibitor , adma , in cv patients .
additionally , levels of adma in the csf were not only lower in patients with vasospasm but also correlated with angiographic determination of vasospasm .
however , rejdak et al . demonstrated a contrary finding , showing that patients with very good outcomes had lower levels of nitrite in the csf than those with unfavorable outcomes . supporting rejdak et al .
. additionally suggest that patients with vasospasm after sah in fact have higher levels of nitrite and nitrate than those without .
rejdak et al . suggest that the mechanism underlying this effect is the ability of no overproduction to cause oxidative stress and brain injury .
therefore , no in the csf is not a clear biomarker to assess risk for development of cv .
animal models measuring no directly in brain parenchyma have shown reduced levels of the no metabolites nitrite and nitrate in brain tissue immediately after sah , decreased no availability 2 days post - sah , decreased no release , and decreased staining of nnos in the adventitial layer of animals succumbing to vasospasm .
microdialysis findings in humans are inconsistent in probing a directionality between no metabolite levels and cv after sah . in one microdialysis study ,
sakowitz et al . developed a study design to confirm that nitrate and nitrite levels increased in patients who experienced a ruptured sah compared to patients who did not experience hemorrhage . in their study , however , they found no difference in brain nitrite or nitrate levels between patients who suffered from delayed neurologic deficits and those who did not .
several studies have since been performed involving microdialysis assessments of cv patients , and some findings suggest that increased nitrite / nitrate levels are associated with worse outcomes , while others indicate that there is no difference [ 4044 ] .
the variability in the data is likely to depend on a combination of factors , as most of these studies were relatively low powered , and no is notoriously difficult to measure .
in addition to measurement of no metabolites , investigations regarding the effects of no - associated genes on the sensitivity to vasospasm have recently been initiated . indeed ,
in one study involving an sah cohort , individuals with genetic variation in the promoter region of the enos gene show a dose - dependent increase in risk for vasospasm after sah , with heterozygous individuals for a particular risk alleles having a 3.3-fold increased odds of developing cv and homozygotes a 10.9-fold increased risk .
however , despite initial enthusiasm for this finding , other findings demonstrate contrasting results , with alternative genetic polymorphisms at the same allelic site demonstrating increased risk of vasospasm .
indeed , these initial studies note that the power to detect effects may be lacking , and the patient populations they studied are heterogeneous .
therefore , prospective studies , meta - analyses , and analyses of the functional effect of these genetic polymorphisms are warranted to appropriately measure the true impact of genetic variability on susceptibility to vasospasm . while the relationship between nitrite / nitrate and vasospasm therefore is not entirely clear , the net consensus is that there is at first a reduction in no in the period immediately following sah , followed by a return to baseline at 16 hours , and an increase in no at 672 hours .
progress has been made in terms of establishing a link between no and vasospasm , and future studies should pay attention to measurement of species such as the endogenous nos inhibitor adma , given the potential for such compounds to affect nitrite and nitrate measurements .
additionally , future efforts aimed at quantification of mechanisms like cortical spreading depression , and microthromboemboli formation may help to understand the roles of no signaling in neurologic dysfunction after sah .
one of the biggest prognostic indicators of vasospasm post - sah is the presence of blood in the cisterns .
additionally , it is well known that breakdown products of red blood cells are vasospastic in nature , and that one likely spasmogen is oxyhemoglobin ( oxyhb ) .
these same species are elevated manifold in the csf after sah . intriguingly , in line with the presence of heme in the proteins responsible for no synthesis and signaling ,
hemoglobin is capable of tightly binding no , having 1000x more affinity for no than oxygen .
initial theories regarding the role of no in vasospasm , therefore , suggested that hb in the cisterns acts as a sink for no , depriving it of its ability to control normal vascular tone and thus cause vasoconstriction .
this basic concept is supported by studies of patients with sickle cell disease , which demonstrate that hemoglobin , when it is outside of red blood cells , acts to reduce the bioavailability of no .
indeed , experimental evidence in vivo demonstrates that no is scavenged from canine basilar arteries when hb is applied .
as experimental evidence indicates that no is protective against angiographic vasospasm , and clinical evidence suggests that nitric oxide donors like nitroglycerin improve neurologic outcomes after sah , no remains an attractive pathway for development of future therapies .
apart from the scavenging effect , hb may contribute to vasospasm after - sah through generation of reactive oxygen and nitrogen species [ 4 , 50 ] , stimulation of an nos inhibitor , or the metabolism , and subsequent oxidation of hemoglobin to bilirubin to the boxes complexes , which serve as vasoconstrictive agents .
additionally , a recent body of work suggests that the deoxygenated form of hb ( deoxyhb ) may actually serve to promote no signaling by acting as a nitrite reductase , producing no from nitrite as a precursor .
this potential ability of deoxyhemoglobin to replenish no in this fashion has led to much research into the potential role of nitrite infusions to prevent neurologic damage after sah [ 1720 ] .
additional theories gaining popularity in recent years center around dysfunction in nos itself as the causative event behind cv .
the trigger for this upregulation is hypothesized to be increased shear stress on the endothelium as a result of the aneurysm , coupled with increased release of inflammatory mediators . at the same time , deficient immunoreactivity of nos occurs following sah in perivascular nerves , suggesting loss of nnos after sah .
this loss in nnos is hypothesized to depend on oxidative stress following sah , and subsequent development of box complexes derived from hb . despite the loss of nnos in vasospasm
, it is known that nitrite / nitrate levels increase post - sah , presumably due to increased expression of enos and inos following sah [ 11 , 53 ] . while this upregulation of no production in the acute phase is critical for maintenance of cerebral blood flow in normal conditions , an uncoupling of nos function from no production may occur in pathological conditions , such as during sah .
indeed , the presence of oxidative stress , the depletion of the cofactor tetrahydrobiopterin , and the presence of nos inhibitors like adma [ 14 , 54 ] have all been proposed as mechanisms that disrupt the flow of electrons within the nos complex , leading to production of superoxide anion and peroxynitrite instead of no .
this cascade of events represents targetable mechanisms that may exacerbate post - sah oxidative stress and subsequently lead to vasospasm [ 10 , 11 , 53 ] .
much recent work has focused on whether or not modulation of this nos dysfunction can prevent neurologic injury post - sah .
despite the controversies of no dysfunction in cv and ischemic injury after sah , several reports cite no signaling as a potential therapy in preventing vasospasm .
sodium nitroprusside ( snp ) , a prodrug that is metabolized to no , was the first approach utilized , with early animal studies confirming its vasodilatory effects . however , serious side effects of brain edema , hypotension , and the potential for cyanide toxicity led to discontinuation of this strategy as an intravenous approach .
additional studies involving subarachnoid delivery of snp in small numbers of patients demonstrated some vasodilatory potential , but the side effects of headache , nausea , vertigo , and rebound hypertension remained .
while these studies have small sample sizes , they demonstrate that snp can improve indices of cerebral oxygenation such as brain oxygen tension and ultrasound - measured blood flow [ 5761 ] .
however , while intraventricular delivery of snp improved evidence of vasospasm in some patients , it is not universally effective .
recent animal studies suggest that snp fails to prevent vasospasm , despite biochemical evidence suggesting adequate delivery of the drug . therefore , current recommendations regarding snp in vasospasm suggest that , given the potential consequences and uncertain efficacy , it should be considered for intraventricular administration only in patients that are otherwise medically refractory , mechanically ventilated , and deeply sedated . iv nitroglycerin ( gtn ) is an additional no donor approach , with rodent , canine , and primate studies demonstrating efficacy in preventing angiographic vasospasm [ 6367 ] . the promising aspects of gtn therapy in vasospasm are confirmed in several smaller clinical studies [ 6870 ] .
however , the systemic side effects of this approach , such as systemic hypotension , drug tolerance , and rebound hypertension , prevent both snp and gtn from becoming routine standard of care [ 71 , 72 ] . other studies involving gtn have looked at nonsystemic delivery approaches .
intrathecal approaches have been attempted in rabbit models , involving the implantation of pumps that deliver gtn continuously into the cerebromedullary cisterns , which prevent vasospasm while not affecting arterial blood pressure . however , this approach is not approved for use in humans and warrants further preclinical evaluation before clinical trials .
intra - arterial delivery of gtn has also been described for treatment of vasospasm , though this was in patients who previously underwent superior temporal artery to internal carotid artery bypass graft .
while intra - arterial gtn was effective in two patients who developed vasospasm in this study , it has not yet been determined to prevent vasospasm in the setting of sah . given the systemic side effects of these approaches , new generations of no donors have been developed , such as nonoates , s - nitrosothiols , and sodium nitrite .
nonoates and s - nitrosothiols demonstrate efficacy in animal models but concern about systemic hypotension remain .
intrathecal / intracranial approaches have also demonstrated efficacy in animal models but concerns about potential adverse events preclude the development of human clinical trials [ 52 , 74 ] .
based on recent observations that deoxyhemoglobin acts as a nitrite reductase enzyme , sodium nitrite is a particularly promising donor approach .
recent evidence in primate models suggests that iv sodium nitrite can prevent and reverse vasospasm and increase local csf levels of no .
the safety of sodium nitrite infusions was recently established in a clinical trial , suggesting that it can be infused intravenously at defined concentrations for prolonged intervals without a risk of systemic hypotension , an important finding compared to previous no donors . indeed , this approach has value for the study of ischemic damage in brain , as well as in the management of patients with organ transplants , blood - brain - barrier modulation , and pulmonary hypertension .
in addition to no donors , recent evidence from animal models demonstrated the potential to target cgmp signaling itself for prevention of vasospasm .
intrathecal administration of a cell - membrane permeant form of cgmp prevented hemorrhage - associated hemodynamic changes in one rodent model . additionally , phosphodiesterase-5 inhibitors prevented vasospasm in rodent models [ 76 , 77 ] . however , these approaches have yet to be explored in human studies .
the function of nos is controlled by a combination of mechanisms including its transcription and phosphorylation .
nos activity is stimulated by phosphorylation from protein kinase c , calmodulin kinase ii , akt , ampk , and others in response to upstream signals [ 7880 ] .
given the role of both no and nos dysfunction in vasospasm , nos emerges as an intriguing target to prevent vasospasm .
one such stimulator of nos phosphorylation is the statin class of medications , drugs that target the protein hmg coa - reductase .
multiple animal studies suggest that statins have benefits at preventing vasospasm [ 53 , 81 , 82 ] .
one recent study indicated that statins prevent vasospasm through a mechanism involving recoupling of nos function to no production , and away from peroxynitrite production .
recent reviews on the topic of statins in cv agree that there is promising evidence to support statin therapy for prevention of delayed neurologic damage and improved outcomes ; however , statins may not prevent vasospasm [ 84 , 85 ] .
indeed , despite evidence from pooled randomized controlled trials , which suggest that delayed ischemic neurologic deficits are less in patients treated with statins , meta - analyses taking these rcts into account with case control and observational studies remove this effect .
therefore , statins are not considered standard of care for treatment of cv patients . another interventional strategy to prevent vasospasm after sah involves administration of erythtropoietin ( epo ) .
epo has a number of effects on blood vessels , and recent animal models suggest that adenoviruses expressing epo protect against vasospasm through a mechanism depending on enos phosphorylation and modulation of survival signaling pathways like pi3k / akt [ 87 , 88 ] .
several different clinical trials have tried to translate these findings from animal models into practice .
one such trial did not find an association between epo and outcomes after sah , although the authors of this trial suggest that a limited sample size may have contributed to these results .
an additional trial had promising results including a reduction in the incidence of severe vasospasm , increased cerebral blood flow , and improved outcomes .
this trial additionally found a decreased need for transfusions and an increased reticulocyte count in patients receiving this treatment , consistent with the classic role of epo in hematopoiesis .
the authors performed a follow up study to better understand the beneficial effects of epo in cv , noting that epo had a protective effect in younger patients and those without sepsis .
a recent review suggested that epo does not prevent vasospasm in clinical trials but may reduce the severity of vasospasm and improve outcomes .
epo treatment in sah still requires further investigation . looking forward , recombinant forms of epo that have a diminished erythropoietic effect but preserved neuroprotective effect
many experimental approaches in animal models have aimed to modulate nos in hopes of reducing vasospasm .
both moderate hypothermia and ischemic preconditioning , for example , are two approaches that alter the function of nitric oxide synthetic enzymes and have shown benefit in reducing vasospasm in animal models [ 39 , 93 ] . additionally , the hormone adiponectin , classically associated with fat cells , is also a potentially novel therapy to modulate nos function .
additional approaches to target nos dysfunction itself involve genetic manipulation of nos itself in both sah and cardiovascular disease .
adenoviral mediated transfer of the enos gene has been attempted in preclinical models following injection of the viral inoculum into the csf [ 9597 ] .
these experimental approaches suggest that the viral expression is limited to cerebral arteries and shows vasodilatory effects in sah models [ 9597 ] . additional studies , involving ex vivo preparations of human cerebral blood vessels collected from patients undergoing temporal lobectomy , demonstrate that nos gene transfer can also transform human cerebral blood vessels .
indeed , these ex vivo preparations are also vasodilated by enos transfer , reflecting the effects of enos gene transfer in animal models .
however , while these findings are intriguing applications of gene therapy approaches , an enos gene transfer is difficult to develop a tightly controlled dose response - curve compared to a traditional pharmacological approach .
this is particularly true with the adenoviral vectors used in the studies previously described , which will continue to express nos protein long after the vasospastic phase .
indeed , while these considerations and others prevent clinical trials of nos gene therapy , it is still an approach that has the potential for translation in the future , particularly if nonadenoviral vectors can be constructed that allow for more finely - tuned control of nos gene expression . in conclusion ,
a summary of recent agents aimed at preventing cv using no are seen in table 1 .
two major hypotheses regarding the role of no in sah suggest that either a net defect in no signaling , through the effects of hb as an no scavenger , or nos uncoupling / free radical generation are mechanisms underlying vasospastic consequences .
indeed , the function of adma , which is stimulated by hb production and acts to uncouple nos , provides a potential mechanism to rectify these hypotheses . promising translational data for no supplementation strategies stems from development of mechanisms for no donation and infusions of sodium nitrite . additionally , targeting nos uncoupling and the neurodegenerative effects of reactive oxygen species , through administration of epo , the statins , genetic manipulation of nos , and other strategies , are intriguing and complementary strategies for treatment of sah and other neurologic and vascular diseases .
future studies across clinical and animal models aimed at understanding non - cv mechanisms of neurologic deficits , and better assessment of no itself , are warranted to aid in the understanding and treatment of vasospasm . | in recent decades , a large body of research has focused on the role of nitric oxide ( no ) in the development of cerebral vasospasm ( cv ) following subarachnoid hemorrhage ( sah ) .
literature searches were therefore conducted regarding the role of no in cerebral vasospasm , specifically focusing on no donors , reactive nitrogen species , and peroxynitrite in manifestation of vasospasm . based off the assessment of available evidence ,
two competing theories are reviewed regarding the role of no in vasospasm .
one school of thought describes a deficiency in no due to scavenging by hemoglobin in the cisternal space , leading to an no signaling deficit and vasospastic collapse .
a second hypothesis focuses on the dysfunction of nitric oxide synthase , an enzyme that synthesizes no , and subsequent generation of reactive nitrogen species .
both theories have strong experimental evidence behind them and hold promise for translation into clinical practice .
furthermore , no donors show definitive promise for preventing vasospasm at the angiographic and clinical level .
however , no augmentation may also cause systemic hypotension and worsen vasospasm due to oxidative distress .
recent evidence indicates that targeting nos dysfunction , for example , through erythropoietin or statin administration , also shows promise at preventing vasospasm and neurotoxicity . ultimately , the role of no in neurovascular disease is complex .
neither of these theories is mutually exclusive , and both should be considered for future research directions and treatment strategies . |
civilian noninstitutionalized population conducted by the national center of health statistics , centers for disease control and prevention ( 20 ) . in this study , we included 2,945 non - hispanic white , 1,046 non - hispanic black , and 1,231 hispanic american participants aged 40 years or older who had complete information on the variables of interest in the 20052008 nhanes .
a review board for human subjects approved data collection procedures , and written informed consent was obtained from all study participants .
hba1c measurements were obtained using high - performance liquid chromatography standardized to the diabetes control and complication trial assay ( 20 ) .
demographic information ( including ethnicity , sex , education , and income ) , smoking history , and health history were determined by self - report .
height , weight , blood pressure , and lipids were measured using standard procedures ( 21,22 ) .
a history of diabetes was defined as self - reported diagnosis of diabetes ( not during pregnancy for women ) or current insulin use .
retinal imaging was performed on individuals who were aged 40 years using a canon non - mydriatic retinal camera cr645 nm ; participants with blindness , eye infections , or eye patches were excluded .
briefly , two 45-degree nonmydriatic digital images of the retina were obtained from each eye , and graders at the university of wisconsin ocular epidemiology reading center evaluated the images .
retinopathy level was determined as described by the early treatment diabetic retinopathy study ( edtrs ) and ranged from 1080 ( 23 ) .
we defined any retinopathy as an edtrs level of 14 or higher in the worse eye , thereby classifying individuals as having either no retinopathy or mild nonproliferative retinopathy or worse ( 21,22 ) .
we used logistic regression models to evaluate the independent association between hba1c ( modeled in clinical categories and continuously ) and prevalent retinopathy .
analyses were stratified by diabetes status , and prevalence estimates were age - standardized to the 2010 u.s .
census to obtain estimates of the proportion of individuals with retinopathy by hba1c category and diabetes status .
adjustment variables included age , sex , bmi , hypertension status , history of coronary heart disease , total cholesterol , educational attainment , income level , and smoking status . in analyses modeling hba1c as a categorical variable
, the sample was stratified using clinical categories of hba1c ( in those without diagnosed diabetes : <
5.7% , 5.76.4% , and 6.5% ; in those with diagnosed diabetes : < 7% and 7% ) .
the nondiabetic group with hba1c values in the normal range ( < 5.7% ) served as the reference group .
sensitivity analyses were conducted modeling hba1c using deciles ( tenths ) ( 4,5 ) and using different edtrs cut points to define retinopathy ( 23 ) .
all analyses incorporated the nhanes sample weights and accounted for the complex sample survey design using standard methods ( 20 ) .
civilian noninstitutionalized population conducted by the national center of health statistics , centers for disease control and prevention ( 20 ) . in this study , we included 2,945 non - hispanic white , 1,046 non - hispanic black , and 1,231 hispanic american participants aged 40 years or older who had complete information on the variables of interest in the 20052008 nhanes .
a review board for human subjects approved data collection procedures , and written informed consent was obtained from all study participants .
hba1c measurements were obtained using high - performance liquid chromatography standardized to the diabetes control and complication trial assay ( 20 ) .
demographic information ( including ethnicity , sex , education , and income ) , smoking history , and health history were determined by self - report .
height , weight , blood pressure , and lipids were measured using standard procedures ( 21,22 ) .
a history of diabetes was defined as self - reported diagnosis of diabetes ( not during pregnancy for women ) or current insulin use .
retinal imaging was performed on individuals who were aged 40 years using a canon non - mydriatic retinal camera cr645 nm ; participants with blindness , eye infections , or eye patches were excluded .
briefly , two 45-degree nonmydriatic digital images of the retina were obtained from each eye , and graders at the university of wisconsin ocular epidemiology reading center evaluated the images .
retinopathy level was determined as described by the early treatment diabetic retinopathy study ( edtrs ) and ranged from 1080 ( 23 ) .
we defined any retinopathy as an edtrs level of 14 or higher in the worse eye , thereby classifying individuals as having either no retinopathy or mild nonproliferative retinopathy or worse ( 21,22 ) .
we used logistic regression models to evaluate the independent association between hba1c ( modeled in clinical categories and continuously ) and prevalent retinopathy .
analyses were stratified by diabetes status , and prevalence estimates were age - standardized to the 2010 u.s .
census to obtain estimates of the proportion of individuals with retinopathy by hba1c category and diabetes status .
adjustment variables included age , sex , bmi , hypertension status , history of coronary heart disease , total cholesterol , educational attainment , income level , and smoking status . in analyses modeling hba1c as a categorical variable
, the sample was stratified using clinical categories of hba1c ( in those without diagnosed diabetes : < 5.7% , 5.76.4% , and 6.5% ; in those with diagnosed diabetes : < 7% and 7% ) .
the nondiabetic group with hba1c values in the normal range ( < 5.7% ) served as the reference group .
sensitivity analyses were conducted modeling hba1c using deciles ( tenths ) ( 4,5 ) and using different edtrs cut points to define retinopathy ( 23 ) .
all analyses incorporated the nhanes sample weights and accounted for the complex sample survey design using standard methods ( 20 ) .
overall , the mean age was 57 years , the population was 48% male , and the mean hba1c was 5.7% .
details regarding population characteristics stratified by diabetes status and ethnicity are summarized in table 1 . among nondiabetic adults ,
the mean hba1c was 5.5% in non - hispanic whites , 5.7% in non - hispanic blacks
( p < 0.001 compared with non - hispanic whites ) , and 5.6% in hispanic americans
( p = 0.002 compared with non - hispanic whites ) . among those with diagnosed diabetes ,
mean hba1c was 6.9% in non - hispanic whites , 7.5% in non - hispanic blacks
( p = 0.002 compared with non - hispanic whites ) , and 7.7% in hispanic americans
0.001 compared with non - hispanic whites ) . in the subgroup of individuals with diagnosed diabetes , the mean duration of diabetes was 10 years in non - hispanic whites , 11 years in non - hispanic blacks , and 9 years in hispanics ; there was no significant difference in mean duration of diabetes by ethnicity ( p > 0.05 for each group compared with non - hispanic whites ) .
adults aged 40 years , stratified by diagnosed diabetes status and ethnicity , nhanes 20052008 the prevalence estimates for retinopathy by ethnic group and diabetes status are shown in fig .
( < 5.7% ) who were aged 40 years with no history of diabetes , the prevalence of retinopathy was 6% ( 95% ci , 57 ) in non - hispanic whites , 9% ( 512 ) in non - hispanic blacks , and 8% ( 510 ) in hispanic americans .
the prevalence of retinopathy in persons with undiagnosed diabetes ( hba1c 6.5% ) was 9% ( 117 ) in non - hispanic whites , 19% ( 534 ) in non - hispanic blacks , and 22% ( 1133 ) in hispanic americans . in persons with diagnosed diabetes , the prevalence of retinopathy in those with hba1c
< 7% was 18% ( 95% ci , 1124 ) in non - hispanic whites , 25% ( 95% ci , 1435 ) in non - hispanic blacks , and 16%
( 95% ci , 427 ) in hispanic americans . finally , the prevalence of retinopathy in those with diagnosed diabetes and hba1c 7% was 49% ( 3760 ) in non - hispanic whites , 57% ( 4669 ) in non - hispanic blacks , and 50% ( 4059 ) in hispanic americans .
the proportion of individuals with more severe retinopathy was higher among non - hispanic black and hispanic participants compared with non - hispanic whites ; the proportions of retinopathy severity scores by group are shown in supplementary fig .
age - adjusted prevalence of any retinopathy by ethnic group and hba1c category among u.s .
estimates are weighted proportions se and are age - standardized to the 2010 u.s .
estimate may be unreliable because the se is greater than 30% of the estimate . in crude and adjusted logistic models ( table 2 ) , hba1c categories were strongly associated with prevalent retinopathy .
the magnitude of the association did not differ by ethnic group ( all p for interactions 0.7 ) .
similar results were observed in analyses with hba1c modeled continuously ( per one percentage point ) and stratified by diabetes status ( table 3 and supplementary fig .
2 ) . additional adjustment for diabetes duration or insulin use in the subgroup of participants with diagnosed diabetes did not materially alter our results .
our results were similar in a sensitivity analysis examining the association of hba1c categorized into tenths ( supplementary fig .
our results were also robust to different definitions of retinopathy ( supplementary tables 1 and 2 ) .
finally , results from linear regression models ( log - transforming retinopathy score ) and ordinal logistic regression models predicting retinopathy severity were also similar ( results not shown ) .
unadjusted and adjusted odds ratios for retinopathy by ethnicity , diagnosed diabetes status , and hba1c category among adults aged 40 years , nhanes 20052008 odds ratios per one percentage point hba1c for retinopathy by ethnicity and diabetes status among adults aged 40 years , nhanes 20052008
we found no ethnic differences in the association of hba1c with prevalent retinopathy in this nationally representative sample of u.s .
consistent with previous studies ( 9,2427 ) , the prevalence of retinopathy was substantially higher in non - hispanic blacks and hispanics compared with non - hispanic whites .
this may partially reflect ethnic disparities in the diagnosis of diabetes and management of hyperglycemia among individuals with diabetes .
consistent with previous analyses of nhanes data ( 12,28,29 ) , we observed higher hba1c values in non - hispanic blacks and hispanics compared with non - hispanic whites .
however , we found no evidence that ethnic group modified the relative association of hba1c with prevalent retinopathy .
these findings are consistent with other studies that have demonstrated similar patterns of association between hba1c with microvascular conditions ( 6 ) and long - term vascular outcomes in non - hispanic white and black populations ( 30 ) .
current clinical diagnostic categories for hba1c largely are based on cross - sectional analyses of the association of hba1c with retinopathy ( 1,3,31 ) , where the primary goal was to identify points along the continuum of hba1c where the likelihood of microvascular abnormalities increase ( 4,6,26 ) .
taken together , our results support the current guidelines for the use of hba1c for the diagnosis of diabetes and suggest that current clinical cut points should be interpreted similarly in whites , blacks , and hispanics . these results should help alleviate concerns regarding the use of hba1c for diagnosis and monitoring of diabetes in diverse populations
. important strengths of this study include the rigorous and standardized measurement of hba1c , retinopathy , and covariates in nhanes .
our analyses included large numbers of non - hispanic blacks and hispanic americans using nationally representative data from the u.s .
nonetheless , because retinopathy is relatively uncommon in the general population , our estimates for certain population subgroups ( for example , non - hispanics without diabetes and with hba1c 6.5% and hispanics with diagnosed diabetes and hba1c < 7% ) are imprecise .
furthermore , because of the cross - sectional nature of this study , we are unable to establish the temporality of the observed associations
. the data presented do not support the contention that hba1c is artifactually elevated in non - hispanic black populations , as has been claimed by some experts .
indeed , the higher prevalence of retinopathy in non - hispanic blacks without diagnosed diabetes and across hba1c categories highlights a need for more aggressive screening and prevention efforts to mitigate microvascular complications in this group .
overall , our results support current recommendations for the use of hba1c for diagnosis of diabetes , not only in non - hispanic white populations , but also for non - hispanic black and hispanic individuals .
| objectivecurrent recommendations for the use of hemoglobin a1c ( hba1c ) in diabetes screening and diagnosis aim to identify those at greatest risk for diabetic microvascular complications . however , there is current controversy regarding the clinical implications of ethnic differences in hba1c values .
the objective of this study was to determine whether the association between hba1c and retinopathy differs by ethnic group in a representative sample of u.s .
adults.research design and methodsthe study was a cross - sectional analysis of 2,945 non - hispanic white , 1,046 non - hispanic black , and 1,231 hispanic american participants aged 40 years from the 20052008 national health and nutrition examination survey.resultsamong nondiabetic adults , the mean hba1c was 5.5% in non - hispanic whites , 5.7% in non - hispanic blacks , and 5.6% in hispanic americans . among those with diagnosed diabetes , mean hba1c was 6.9% in non - hispanic whites , 7.5% in non - hispanic blacks , and 7.7% in hispanic americans .
overall , non - hispanic blacks had the highest prevalence of retinopathy . in multivariable logistic models , hba1c clinical categories were strongly associated with prevalent retinopathy . however , the magnitude of the association did not differ by ethnic group ( all p values for interaction 0.7 ) .
similar results were observed with hba1c modeled continuously ( per one percentage point ) and stratified by diabetes status ( all p for interactions > 0.3).conclusionswe observed no ethnic differences in the association of hba1c with retinopathy .
these data do not support ethnic - specific cut points for hba1c for diagnosis or screening of diabetes mellitus . |
stuttering is a developmental speech disorder that occurs in 5% of children with spontaneous remission in approximately 70% of cases .
the treatment of stuttering has been described as a controversial and puzzling issue for speech language pathologists , and recent concerns have been expressed about the absence of strict documentation regarding the efficacy of particular interventions .
it is generally agreed that stuttering is a speech disorder that has an adverse effect on communication .
several data indicate that it may be related to a dysfunction in dopaminergic neurotransmission ; moreover , it can be relieved by dopaminergic receptor blockers , and positron emission tomography ( pet ) studies have shown substantial increase in dopamine uptake activity in cortical and subcortical areas .
positive clinical results with biperiden , clomipramine , haloperidol , cocaine , and fluoxetine have been reported .
the aim of the present study was to compare efficacy of olanzapine with haloperidol to improve stuttering .
the present 12-week , single - blind , randomized clinical trialwas conducted in the isfahan university of medical sciences between october 2009 and october 2010 .
the patients were selected among those who were willing to take part in this research at the neurological disorder , psychiatric disorder , and speech disorder clinics of isfahan university of medical sciences .
the patients included those who were diagnosed as having developmental stuttering and needed to take medications .
the study was approved by the human ethics committee of isfahan university of medical sciences .
all participants and their families received a full explanation of the nature of the study and were required to sign an agreement form . after providing written informed consent , each subject underwent a diagnostic evaluation by aneurologist using the structured clinical interview for dsm - iv .
patients were included in the study if they met the following criteria : agreeing to participate in the study and signing the informed consent form and having the age between 10 and 50 years .
subjects were excluded if they were unable to provide informed consent , had been treated with antipsychotics before , had current substance abuse or significant medical illness ( including cerebral stroke , multiple sclerosis , brain tumors , diabetes mellitus , and hypertension ) , had pregnancy , had a history of intolerance of antipsychotics , were receiving treatment with agents that interfere with olanzapine or haloperidol , and receiving medications that induced stuttering such as risperidone .
the patients profile , including family history , intelligence quality ( iq ) , was recorded by a neurologist .
similarly , patients of haloperidol group were given 2.5 mg / day haloperidol . before the study
, all subjects were examined by a speech therapist and the severity of stuttering was evaluated with van riper 's questionnaire .
the stuttering scores were between 1 and 7 . at the end of the study ,
the speech pathologist who examined the patients was not aware of the kind of drugs the patients received .
speech therapy sessions included a mixed treatment sessions including air flow technique and break valsalva maneuver as well as desensitization from van riper 's protocol .
safety laboratory tests , including complete blood count , creatinine , fasting blood glucose , level of serum prolactin , and liver function tests , based on standard hematological and clinical chemistry values , were performed at baseline and week 12 .
a total of 43 subjects were included in olanzapine group , and 50 were enrolled in haloperidol group .
side effects , such as mild drowsiness , dry mouth , and lethargy , occurred in over 20% of the patients treated with haloperidol , and mild to moderate drowsiness in olanzapine group , but without any missing patients in both groups at the end of the study .
the mean age ( standard deviation [ sd ] ) inolanzapine group was 18.98 ( 9.85 ) and in haloperidol group it was 16.96 ( 6.58 ) ( p > 0.05 ) . there were no significant differences between sexes , family history of stuttering , iq , physical examination , and age of onset in the two groups [ table 1 ] .
mean of stuttering score ( sd ) before treatment was 4.67 ( 0.81 ) and 4.40 ( 1.14 ) in haloperidol and olanzapine groups , respectively ( p > 0.05 ) .
after treatment the mean ( sd ) was 2.87 ( 1.32 ) and 1.56 ( 0.71 ) in haloperidol and olanzapine groups , respectively ( p = 0.000 ) .
the mean difference of stuttering score ( sd ) defined as stuttering score after treatment minus stuttering score before treatment was calculated to be 1.82 ( 1.58 ) and 2.84 ( 0.94 ) , respectively ( p = 0.000 ) .
homogeneous of demographic variables between olanzapine and haloperidol groups in addition , after 12 weeks , no significant change in complete blood count , creatinine , fasting blood glucose , level of serum prolactin , and liver function tests in both groups was detected .
it has been shown through pet that stuttering is associated with hypometabolism of the striatum possibly mediated by a hyperdopaminergic state .
pet studies have also shown that medications act by blocking dopamine and increasing striatal metabolism .
it goes without saying that both haloperidol and olanzapine exert their effects by dopamine blockade ; indeed , the difference in effectiveness might be associated to other neurotransmitters such as serotonin .
antagonism at the serotonin receptor 2a by the atypical antipsychotics such as olanzapine has been explained as the cause of the adverse effects of the drugs on glucose - insulin homeostasis and likewise , such differences may incite some beneficial effects of atypical antipsychotic drugs over typical drugs .
lavid et al . , in 1999 described three cases whose symptoms were successfully controlled with olanzapine .
maguire et al . , in 2004 performed a double - blind placebo - controlled trial to evaluate the effects of olanzapine in controlling the symptoms of stuttering .
that was the first report which systematically applied for assessment of therapeutic effects of olanzapine on stuttering .
but in that study olanzapine was not compared with haloperidol , which is used for the treatment of stuttering routinely .
although olanzapine has shown to reduce the severity of stuttering , it could induce stuttering , especially in patients having pre - existing brain pathology or concomitant use of antidepressants .
thus , following up patients seems to be necessary when they are receiving olanzapine treatment and controlling weight .
in contrast , olanzapine makes patients less sedate than haloperidol , so they feel more comfortable when using olanzapine .
finally , it is recommended to use olanzapine as the first choice to control the stuttering under a careful follow - up .
more studies are warranted with larger case populations in children and adolescents and adults separately . | background : the aim of this study was to compare the effects of olanzapine versus haloperidol to control the signs and symptoms of stuttering.methods:ninety-three patients were recruited in a 12-week single - blind randomized clinical trial , which was held between october 2009 and october 2010 .
forty - three patients received olanzapine ( 5 mg / day ) and 50 patients , haloperidol ( 2.5 mg / day ) . before and after the study , they were evaluated by a speech pathologist by van riper 's questionnaire .
the data were analyzed using the spss version 16 .
t - test was used to compare the data between the two groups.results:mean of stuttering score ( sd ) before treatment was 4.67 ( 0.81 ) and 4.40 ( 1.14 ) in haloperidol and olanzapine groups , respectively ( p > 0.05 ) .
after treatment , the mean ( sd ) score was 2.87 ( 1.32 ) and 1.56 ( 0.71 ) in haloperidol and olanzapine groups , respectively ( p = 0.000).conclusions : it seems that olanzapine does have better impact in controlling stuttering , and it may be recommended to prescribe olanzapine for stutters as the first choice to control the stuttering under a careful follow - up . |
the clinical features of neurological damage produced by acrylamide , lead , organophosphates , hexacarbon solvents , and methylmercury are described , and the differences in effects of these compounds are stressed . the characteristic pattern of electrophysiological changes for each group of substances are described and correlated with pathological findings.imagesfigure 2 . |
|
woolly hair nevus is a rare abnormality of the scalp hair that appears since birth or during first 2 years , characterized by the patch of hair , which is curlier and light colored than the rest of the scalp hair . here ,
we present a case of woolly hair nevus with ipsilateral pigmented demarcation lines and heterochromia iridis .
a 5-year - old girl with a patch of kinky hair in the right parietal region , which had been present since the age of 4 months and different colored eyes since birth referred to our clinic [ figure 1 ] .
the affected hair appeared smaller in diameter and lighter than the normal hair color and no structural hair abnormalities were detected under the light microscope .
she had slightly hyperpigmented linear lesions mostly marked on the anterolateral of the right arm with midline pectoral and abdominal extension [ figure 2 ] .
the right eye was diffusely brown , and the left was green [ figure 3 ] .
the patient was diagnosed with a woolly hair nevus of the right parietal scalp associated pigmented demarcation lines and heterochromia iridis .
. curled woolly hair on the left parietal region pigmentary demarcation lines on the right anterolateral arm extending to the right pectoral and abdominal region heterochromia iridis , right eye has brown eye color and left eye has green
hutchinson et al . classified woolly hair into three categories as hereditary woolly hair , familial woolly hair , and woolly hair nevus .
woolly hair nevus was divided into three groups by post which is ( 1 ) with no associated scalp disorders or hairless skin , ( 2 ) with associated linear verrucous epidermal nevus , ( 3 ) acquired , which has been termed acquired progressive kinking of scalp hair .
pigmentary demarcation lines ( pdl ) are transition lines between the areas of darker and lighter or normal pigmentation with eight different types described ( a h ) .
type a is an anterolateral aspect of upper arm with variable transpectoral extension and the type c is in median or paramedian vertical lines on the chest with midline abdominal extension . in our subject ,
heterochromia iridis is usually a sporadic and benign condition and may be affected by genetic and multiple physiological factors .
melanin is the main chromophore of the human iris and is the most important factor that determines the color of the irides .
heterochromia iridis is related with some dermatologic diseases such as waardenburg syndrome , hypomelanosis of ito , and linear scleroderma .
circumscribed hypopigmentation along with waardenburg syndrome , caf au lait macule , and also hyperpigmented patch without any systemic disease are other mentioned pigmentary anomalies associated with heterochromia iridis .
the association of woolly hair nevus with some other ectodermal defects has been reported before suggesting the term woolly hair nevus syndrome .
whether the coexistence of heterochromia iridis with woolly hair nevus and demarcation lines is just coincidental or a true association remains unclear .
the patients with the woolly hair nevus are suggested to be evaluated for the other systemic or ectodermal defects that may accompany this lesion and long - term follow - up is needed .
the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .
the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . | we report a case of woolly hair nevus with pigmentary demarcation lines and heterochromia iridis .
woolly hair nevus is a rare abnormality of the scalp hair characterized by the patch of hair , which is curlier and light colored than the rest of the scalp hair .
association of woolly hair nevus with some other ectodermal defects effecting skin and eyes has been reported before . here ,
woolly hair nevus associated with demarcation lines and heterochromia iridis , to our knowledge , have not been previously reported . |
brachytherapy as a boost or monotherapy plays an important role in treating breast cancer [ 1 , 2 ] . in the recent years , accelerated partial breast irradiation ( apbi ) with its 4 - 5 day treatment course has been widely used worldwide to treat early stage breast cancer patients .
different techniques are available for apbi with brachytherapy ( bt ) and external beam radiation therapy ( ebrt ) .
brachytherapy techniques include interstitial implants , intracavitary devices with single / multilumen balloons , hybrid applicators , and irradiation with low energy x - ray [ 1 , 2 ] .
external beam radiation therapy can be performed with 3d conformal radiotherapy ( 3d - crt ) , intensity modulated radiation therapy ( imrt ) , volume modulated arc therapy ( vmat ) , proton therapy , and intraoperative electron irradiation . among all apbi techniques ,
currently multicatheter interstitial brachytherapy ( mibt ) has the longest patient follow - up and has a level 1 evidence as a valid treatment alternative to whole breast irradiation after breast conserving surgery .
recommendations for apbi patient selection and treatment workflow were published in europe and in the usa [ 6 , 7 , 8 ] .
recently , the gec - estro ( groupe europen de curiethrapie european society for radiotherapy and oncology ) breast cancer working group has compiled guidelines for target definition and delineation for partial breast irradiation using mibt after breast conserving closed and open cavity surgery [ 9 , 10 ] . in classical breast brachytherapy
, treatment planning was based on two x - ray films . using different reconstruction methods ( e.g. , orthogonal , variable angle , semi - orthogonal ) and a digitizer device ,
catheters were reconstructed in three dimensions ( 3d ) , but the anatomical information about the patients was very limited .
the surgical clips approximately showed the position of the lumpectomy cavity , and the catheter fixation buttons indicated the skin surface in a number of points only . at that time , neither dose coverage nor conformality was possible to be determined , and it was assumed that the catheters are in the right positions .
later , with the introduction of cross - sectional imaging , the real 3d dose planning became available .
the reconstructed catheters geometry and the delineation of target volume and organs at risk on computed tomography ( ct ) slices made possible for conformal irradiation .
but , at the beginnings , the post - implant ct imaging was used only for evaluating dose plans , and just a few quality indices were calculated [ 11 , 12 , 13 , 14 ] .
these studies clearly demonstrated that the conventional fluoroscopy based implantations usually could not result in acceptable dose distributions regarding all dose parameters .
reported significantly increased target coverage and dose homogeneity after implementing their ct - guided implantation technique . in a paper by major et al .
, 91% target coverage and 0.33 for dose non - uniformity ratio was published evaluating 28 ct - based treatment plans .
these values were significantly better than the corresponding data of the radiography - based implantation method .
nowadays , based on the persuading early dosimetric results , ct - based treatment planning has become the gold standard for interstitial bt of breast cancer .
the aim of this article is to review treatment planning issues of multicatheter interstitial brachytherapy and share our experience in forward and inverse planning methods .
since even the most advanced optimization technique can not compensate for a wrong implant geometry , it is of the utmost importance to place the catheters in the right positions . in order to get an acceptable dose distribution ,
the planning target volume ( ptv ) has to be geometrically covered by the catheters . to achieve this , different imaging methods can be used . with ultrasound ( us ) guidance , the deepest needles can be inserted manually if the resection cavity is visible , and then the rest of catheters are placed with a template , which can ensure an even spacing between catheters .
another approach is when the superficial needles are inserted as first under us guidance followed by the deeper needles with template guidance , but the artefacts from the shallow needles may cause visibility problem .
if the needles are manually inserted using us imaging , the ptv contour and all entry and exit points have to be marked on the skin surface in order to plan the needles distribution .
however , the best method is when a 3d imaging with full anatomical information about the resection cavity , ptv , and organs at risk ( oars ) is available before the insertions .
then , the number and positions of the catheters can be determined using a 3d rendered image with a template placed around the breast ( figure 1 ) .
if the intention of the treatment is delivering a boost dose , steel needles can be used with 1 - 3 fractions , but in monotherapy treatments with 7 - 10 fractions , the needles are replaced with plastic catheters for the sake of patient s convenience .
3d rendering of patient anatomy with a template on the right breast in needles - eye - view after pre - implant computed tomography imaging .
the red colored planning target volume is projected into the template with the holes and the light blue dots show the planned positions of the catheters however , any imaging technique is used before the implantation , after the insertions of the catheters , a new ct imaging is needed for planning purpose .
generally , the patient is positioned on the ct table in the same way as for ebrt making sure the same anatomical conditions at boost treatment as for external irradiation .
generally , 3 mm slice thickness is acceptable for accurate catheter reconstruction and target delineation .
organs at risk and resection cavity must be outlined , and the ptv should be created according to the available guidelines . using special markers in the catheters with good visibility but without artefact is a great help during catheter reconstruction ( figure 2 ) .
nevertheless , without markers , the catheters can be also visualized merely by the inside air ( figure 2 ) , and with proper windowing , the reconstruction can be properly performed . in this case
, it is important to see and identify the fixation button at the distal end of each catheter , since the first possible dwell position has to be related to it .
the catheter reconstruction can be performed in axial , sagittal , coronal planes , or even in oblique planes , which have been created parallel with or orthogonal to the catheters ( extra coordinate system ecs ) .
catheters should be numbered or uniquely labelled , so that each individual catheter can be identified .
the active source positions inside the ptv can be defined manually or automatically with or without margin inside or outside the target surface , if needed . in classical bt planning using the paris dosimetry system ( pds ) , the basal dose points in the central plane play an important role .
the central plane can be easily created using the ecs in the ct - based planning .
the midpoints between catheters ( basal dose points ) can be placed manually by visual inspection , or automatically by a software if the catheters geometry is regular .
after normalizing the dose distribution ( 100% ) to the mean central dose ( mcd in paris system ) , which is the mean dose in basal dose points , the isodose level for prescription can be selected using a special multiplication factor between 0.1 and 10 . for example , using the factor of 0.85 , the dose will be prescribed to the 85% isodose level corresponding to the pds . to calculate the treatment time ,
theoretically , the pds provides homogeneous dose distribution , but the target coverage and conformality may not be sufficient enough . to increase the coverage lower than 85% , isodose level can be selected for dose prescription , but the worsening homogeneity must be taken into consideration . in the contrary , if increasing the isodose level for prescription , the dose distributions will be more homogeneous , and the target coverage decreases simultaneously . another way to manage the target volume coverage and homogeneity of dose distribution is applying several dwell time optimization methods . a transversal and sagittal computed tomography slice with implanted catheters . in most of the catheters , special markers are inserted ( shown with white lines / dots ) , but some of them do not have any markers and only the inside air makes them visible ( shown with black lines / dots ) various dose optimizations are available in bt using a stepping source ( table 1 ) .
the classical paris dosimetry system can be imitated by using uniform dwell times in all dwell positions , which means no optimization is applied . in that case
, the dose distribution is always homogeneous , but the conformality will not be optimal .
the target volume can be covered by the prescription isodose surface adequately , but relatively large volume of normal tissue will be unnecessarily irradiated by the prescription dose ( pd ) .
this is the consequence of the extending active lengths in the catheters out of the target volume , which is required in the pds .
however , the concepts of its implant geometry and dose prescription are still employed even if the dwell times are calculated with a forward optimization method . in most optimization methods
, the 3d target volume is not used directly during optimization ; only in plan evaluation , the dvh parameters are related to the ptv .
optimization methods in high - dose - rate brachytherapy stepping source dosimetry system inverse planning simulated annealing hybrid inverse planning optimization changing the individual dwell times or weight factors manually in a spreadsheet is not an effective method to shape the dose distribution .
it is rather time consuming and recommended only for small local adjustments . after geometrical optimization
another advantage is that there is no need to define dose points for optimization because the source dwell positions themselves will serve as reference dose points .
the dwell time at any dwell position will be inversely proportional to the dose delivered by the other dwell positions .
the consequence is the increased dwell times at the ends of the catheters , and in dwell positions in deviating catheters .
if the catheters geometrically cover the target volume properly , the reference isodose surface will always include the ptv .
since the dose distribution is related only to the catheters , if there is a geometric miss , a significant underdosed region may develop in the ptv . by selecting a lower isodose level for dose prescription
, the target coverage can be slightly improved , but the dose to normal tissues may increase . at polynomial optimization , an objective function
is minimized , which describes the difference between the calculated and required dose values in specified dose points .
these points can be placed at a distance outwards of or in mid - positions between the catheters ( distance or volume dose points ) .
using distance dose points , it is assumed that they are placed on the surface of the target volume . with volume dose points
, we can optimize the doses in central points between the catheters in the whole volume and not only in the central plane .
this method is called stepping source dosimetry system ( ssds ) and is the extension of the pds . regarding dosimetry , due to the stepping source
, the dose can be prescribed for a proper isodose level similarly to the go .
when the ptv is defined three - dimensionally , we can place dose points on its surface and can optimize and prescribe the dose ( 100% ) on them ( conformal dosimetry system ) . with this method , even if the target volume is irregular , very conformal dose distribution can be obtained if the catheters are evenly distributed inside the volume .
since the dose homogeneity is not taken into account during optimization , the dose homogeneity will be unacceptable , since large high dose volumes develop inside the ptv .
the graphical optimization ( gro ) is an attractive way to change the shape of an isodose curve locally or globally . on the screen with the cursor
, we can select an isodose line , and with the drag and drop method , the isodose line can be shifted into the desired position .
if the local adjustment option is selected , only the nearby dose distribution will be changed , while with the global option , the dose distribution will change isotropically in 3d .
the coverage and conformality can be easily improved with gro , but it must not be forgotten that at the same time , the homogeneity will deteriorate . in many cases , the go followed by gro results in acceptable dose distribution , since the go can provide the homogeneity , and with the gro , the coverage can be further increased .
the key point in inverse optimization is that all dosimetric requirements ( dose coverage , dose homogeneity , and organs at risk protection ) are simultaneously and automatically taken into account in the planning process . in the first step ,
the clinical objectives are translated into minimum or maximum dose limits and importance factors , and then , the source dwell times are calculated with minimizing objective functions , describing the differences between the calculated and required doses .
the prerequisites for inverse optimization are as follows : reconstructed catheters geometry , delineated ptv and oars , defined active source dwell positions , dose objectives for ptv , oar - s and normal tissue .
the two most common inverse algorithms are the hipo ( hybrid inverse planning optimization ) and ipsa ( inverse planning simulated annealing ) [ 22 , 23 , 24 ] . the former uses deterministic , while the latter works with stochastic method .
hipo is implemented in the oncentra brachy version 4.3 planning system ( nucletron , an elekta company , elekta ab , stockholm , sweden ) , where the target coverage and dose homogeneity are controlled by minimum and maximum dose values in the ptv , respectively . in a clinical case ,
the minimum value in the ptv is 100% corresponding to the pd , while the maximum value is selected 150% of the pd . during optimization ,
furthermore , with a weight factor , the importance of the given requirement can be taken into account .
regarding protection of normal tissue and oars , maximum doses can be specified for them , which are also taken into consideration during optimization .
the min value and max value refer to relative doses , while the min weight and max weight mean relative importance factors in classical bt , the plan evaluation was limited , having dose values in reference points and looking at the 2d dose distributions related to catheters / applicators
. the use of these evaluation methods is still recommended , but additional tools are now available to assess the quality of the implant
. visual inspection of dose distribution on ct slices including sagittal and coronal reconstructions is still mandatory , however , the large number of ct slices and outlined organs make the evaluation quite subjective . for an objective assessment ,
implant related parameters can always be calculated , even if the target volume is not defined .
they characterize the size of the irradiated volume and homogeneity of the dose distribution . in optimal implant ,
the dnr is minimal and the dhi is maximal , since they are complementary indices , namely dhi = 1 dnr . when 3d ptv is defined , additional parameters can be calculated .
additionally , the dhi can be determined for the target , when volumes in the ptv only are taken into account . in the relative homogeneity index ( hi ) ,
volume receiving a dose between 100% and 150% of the pd is related to the volume of the ptv .
although only small differences occur between the various dhis , its exact definition always must be given when used for reporting dose homogeneity and for intercomparisons of different plans .
the overdose volume index ( oi ) characterizes the dose homogeneity with volume irradiated by 2 x pd , related to volume of ptv . in an ideal implant
the coverage index ( ci ) is the fraction of the ptv receiving at least the pd .
the conformal index ( coin ) considers the coverage of the ptv by the pd ( ptvpd / vptv ) , and also the unwanted irradiation of normal tissues outside the ptv ( ptvpd / vpd ) .
ptvpd is the volume inside the ptv irradiated by the pd , and the vpd is the volume receiving at least the pd .
the definition of coin can be extended to critical structures also , but this formalism is rarely used in breast bt , since the oars nearly always receive less dose than the pd .
the dose distribution is most conformal when the coin is maximal and is as close to 1 as possible .
the external volume index ( ei ) is also related to conformality ; it is the ratio of the normal tissue volume outside the ptv receiving at least the pd , to the volume of the ptv .
dose that irradiates certain part of the ptv is also used , e.g. d10 means the relative dose that irradiates 10% of the ptv .
the most common dose - volume parameters used in interstitial brachytherapy pd prescribed dose , ptvpd volume in ptv received at least the pd depending on the type of the oar , the mean dose , volume irradiated by a given relative ( v5 ) , absolute dose ( v5gy ) , or dose irradiating a small volume ( eg . d0.1 cm , d2 cm ) are generally reported . in several studies ,
however , recently in ct - based planning , volumetric doses are already recommended to be used , e.g. d0.01 cm or d0.1 cm .
the rationale behind is that the point dose is clinically meaningless , and the dose to a volume may be better correlated with the side effects . in the bt community , no general agreement exists regarding the acceptable criteria for a good breast implant . in the gec - estro randomized study ,
the coverage index ( ci ) had to be larger than 0.9 , i.e. at least 90% of the ptv had to receive the pd .
there was a requirement for dose uniformity , namely the dnr < 0.35 . in the study ,
only skin was regarded as oar , and the maximum surface dose had to be less than 70% of the pd . for reporting purpose , several additional parameters had to be recorded , but fulfilment of condition was not set up for them . in the nsabp
b-39/rtog 0413 protocol for multi - catheter breast bt , the dhi for implant should be 0.75 , which corresponds to dnr 0.25 .
the volume of tissue receiving 150% and 200% of the pd should be less than or equal to 70 cm and 20 cm , respectively .
regarding target coverage , the dose 90% of the pd must cover 90% of the ptv .
for uninvolved normal breast , the limitation is that < 60% of the whole breast volume should receive 50% of the pd , and the skin surface dose should not exceed the pd . the dose to other organs including the heart , lung , and ribs is generally minimal , so no thresholds are used , however , recording few parameters for reporting is recommended . in a paper by darby et al .
, it was found that the risk of major cardiac events increased linearly by 7.4% per gray of mean heart dose , therefore , to characterize the dose to heart reporting the mean dose is recommended . in multicatheter breast bt ,
chest wall pain or rib fracture are rare events , but the doses should be kept as low as possible .
initially , ct imaging was used only for evaluation purpose after standard fluoroscopy - guided implantation [ 12 , 13 , 14 , 15 , 29 ] , but afterwards , the implantations themselves were performed using 3d ct information [ 15 , 16 , 30 , 31 , 32 , 33 ] . these and other studies confirmed that with introduction of image - guided implantation techniques , the treatment plans improved considerably compared to the traditional fluoroscopy - guided implantation and planning [ 11 , 34 ] .
reported that the percentage of patients satisfying with their dosimetric goals of target coverage and dose homogeneity increased from 42 to 93% , when ct - guided technique was used instead of fluoroscopic guided free - handed catheter insertion technique . in their study , not only the coverage but also the dhi was better with the ct planning .
compared two different pre - planning methods ( 2d vs. 3d ) . in the first group of patients ,
the catheter positions were planned with x - ray fluoroscopy imaging ( 2d ) , while in the second group , the treatments were pre - planned with cone beam ct imaging ( 3d ) . for dvh - based plan evaluations ,
the target coverage ( v100 ) was significantly higher for 3d pre - planning ( 91.7% vs. 86.1% ) , and the dose distributions were more homogeneous ( dhi : 0.60 vs. 0.53 ) . the transition from classical x - ray film based planning to 3d planning was carried out step - by - step in many institutions , and the 3d dosimetry induced lots of challenges for radiation oncologists and medical physicists .
furthermore , a learning curve can be observed during this process as it was well demonstrated by cholewka et al . and reported by wiercinska et al . .
the quality of dose distributions in interstitial bt can be improved with the use of different dose optimization methods and image based 3d information for planning the geometry of the catheter positions [ 12 , 13 , 14 , 37 ] . geometrically optimized implants are much more conformal than the non - optimized ones ( pds ) with much less dose to normal tissues . with conformal dose planning ,
the target volume coverage can be significantly increased compared to the traditional dosimetry systems , but the dose homogeneity worsens [ 13 , 14 , 16 , 18 ] .
geometrical optimization followed by graphical optimization can provide acceptable dose plans in most of the clinical cases [ 18 , 32 ] . in classical breast bt ,
the dosimetry was relied on reference dose points , which were related to the catheters geometry .
the dose points were placed either in the center points between catheters or at specified distances from the catheters in outer directions . in the former case ,
the prescription isodose was generally selected as 85% of the mean central dose like in the pds , while with the latter technique , the dose was normalized to the mean dose in the dose points . in both cases , the target volume could only be approximated roughly . from this
follows that the plan evaluation confined to the evaluation on dose uniformity in the implant volume and dose values in points .
anatomy - based inverse optimization algorithms are already available in brachytherapy systems for clinical use [ 22 , 23 , 24 , 38 ] . during the optimization process , the source dwell times for active source dwell positions are calculated with the aim of fulfilling thresholds for dose - volume parameters .
then , an objective or cost function measuring how well the limits are fulfilled is minimized . since the calculation is very time - consuming , in order to get the results in a reliable time , a powerful computer is needed for the clinical use .
the requirements for target coverage , dose homogeneity , and sparing of oars are conflicting and to find the proper parameters and weight factors is a challenge for the physicist .
this is demonstrated in figure 4 , where dose homogeneity characterized by the dnr and target coverage denoted by v100 are shown in the function of weight factor of maximum dose value ( max weight ) .
the calculations were performed in the oncentra brachy version 4.3 planning system , and the oars were not taken into account .
we note , that the weight factor for maximum dose ( max weight and max value in figure 3 ) controls the homogeneity , and the weight factor for minimum dose ( min weight and min value in figure 3 ) influences coverage .
figure 4a shows that by increasing the weight factor for maximum dose , the dnr is becoming less meaning better homogeneity .
however , at the same time , the v100 is also decreasing and the target coverage is worsening . to select the proper weight factor , it requires clinical judgement , balancing between dose homogeneity and target coverage .
a weight factor in the range between 20 - 40 seems to be an appropriate choice with low dnr and concurrently high v100 . from the figure 4 ,
the role of minimum dose factor ( min weight ) can be observed . by using a higher minimum dose factor ,
the coverage is better ( red line in figure 4b ) , but simultaneously , the dose will be less homogeneous ( red line in figure 4a ) . at first sight
, the inverse planning seems to be an easy task , but it requires some experience to find those input parameters , which will result in clinically acceptable dose distribution . in figure 5a , qualitative comparison between dose distributions of forward and inverse planning is presented in a ct slice . regarding target coverage , the difference is negligible , but the high dose volume surrounded by the 150% is less with the hipo ( figure 5b ) resulting in better dose homogeneity .
table 3 shows a quantitative comparison between dosimetric parameters calculated for fifteen treatment plans made with geometrical optimization , followed by graphical optimization ( geom+graph ) and hipo . at the same target coverage ( 91% ) , the hipo plans were superior over the forward plans regarding all other parameters .
the better conformality ( coin : 0.77 vs. 0.71 ) resulted in 29% less high dose volume ( v100 ) in the ipsilateral non - target breast .
the dose homogeneity improved ( dnr : 0.35 vs. 0.37 ) , and dose to oars was less by percentage values in the range of 1 - 15% . based on our initial experience and quantitative data presented here , we can claim that hipo is an optimization tool that can produce clinically sound treatment plans at a significantly reduced overall planning and optimization time .
dosimetrical comparison of treatment plans made by forward planning using geometrical optimization followed by graphical optimization ( geom+graph ) and inverse optimization ( hipo ) .
the percentage difference is related to geom+graph plans dependence of dose homogeneity ( a ) and target coverage ( b ) on the weight factor for maximum dose ( max weight ) in the planning target volume ( ptv ) .
min weight is a weight factor , which controls the target coverage through minimum dose at the periphery of the ptv representative relative dose distributions on an axial computed tomography ( ct ) slice in treatment plan made with a ) forward planning ( geom+graph ) , and with b ) inverse planning ( hipo ) .
more homogeneous dose distribution can be observed in the hipo plan nowadays , quantitative dose - volume histogram based evaluation of treatment plans is proposed .
however , there is no consensus on which parameters should be reported . for the ptv
, the minimum requirement is to report the ci or v100 , dhi or dnr , and the coin . in our department in line with the gec - estro study , we intend to have at least 90% ptv coverage by the prescribed dose ( v100 ) , while in the nsabp b-39/rtog 0413 protocol , the 90% of the prescribed dose should cover at least 90% of the ptv . with the latter constraint ,
conformality is rarely investigated in breast bt , and there is no consensus on what degree of conformality is acceptable or desirable .
. obtained a conformality number of 0.48 at a typical breast implant with geometrical optimization .
kolotas et al . reported coin value of 0.76 for 42 breast implants , while baltas et al .
aimed to achieve a coin value above 0.64 by using their ct - based planning system . in a study by major et al
, the mean coin was 0.68 ( range , 0.510.82 ) calculated for 49 patients .
similar coins were reported by cholewka et al . and gurran et al . with the values of 0.69 ( range , 0.37 - 0.84 ) and 0.67 ( range , 0.59 - 0.87 ) ,
respectively . reporting the dose to oars is particularly not uniform at all . from this
follows that the dose - volume limits can be very different for the various parameters . moreover , no common guidelines are available on how to define the skin dose or the skin as an organ .
berger et al . investigated dvh parameters for skin dose , and they recommended a more sophisticated way to report organ dose than using point doses only .
similarly , lasota et al . used different skin models to estimate the dose to skin , and they concluded that large differences exist between models using various skin contouring protocols .
recommend using d0.2 cm for a 2-mm thick skin layer as a surrogate for dose to skin area of 1 cm . in a paper of lettmaier et al .
, dose to 1 cm and 0.1 cm of skin volume with 5 mm thickness were reported .
gifford et al . has found that large differences in skin volume definition leads to confusion and can result in significant dose differences , making the dosimetric comparisons and correlations with toxicities difficult or impossible .
traditionally , the dose to skin was characterized with the maximum surface dose , which is a point dose . in a recent paper by major et al .
, doses to the most exposed small volumes in oars are reported . to make the intercomparisons between point doses and volumetric doses , a correlation analysis should be made .
figure 6 presents the correlation between the dose to small volumes and maximum point dose for skin and ribs calculated for thirty - four breast implant patients .
the skin was outlined as a 5-mm shell inside the body , and the maximum skin dose was calculated on the outer surface , while the maximum dose in ribs was calculated inside the organ . regarding the skin ,
the d0.01 cm is not a good substitute for dmax ( r = 0.8513 ) , because the dmax is always on the outer surface of the skin volume , while the high dose volumes ( e.g. 0.01 cm ) develop in the inner part of the skin closer to the source dwell positions and the corresponding doses can be different .
for the ribs , an excellent correlation ( r = 0.9977 ) can be observed between d0.01 cm and dmax , since these two values are nearly always identical .
the dmax is always inside the most exposed volume of 0.01 cm . for larger volumes ( 0.1 cm , 1 cm )
correlation between the dose to the most exposed small volumes and maximum point dose for the a ) skin , and b ) ribs
similarly to ebrt , inverse planning is expected to be used in bt in daily clinical practice very soon , especially in multicatheter breast implants .
however , the protocols with the dose - volume constraints used during the optimization still should be defined . for a plan evaluation ,
the use of volumetric dose parameters is already recommended , and will be obligatory in the future in order to find a correlation between dosimetry and clinical outcome .
however , a consensus is needed on which parameters should be reported , and which can have real clinical significance . | in the last decades , treatment planning for multicatheter interstitial breast brachytherapy has evolved considerably from fluoroscopy - based 2d to anatomy - based 3d planning . to plan the right positions of the catheters , ultrasound or computed tomography ( ct ) imaging
can be used , but the treatment plan is always based on postimplant ct images . with ct imaging , the 3d target volume can be defined more precisely and delineation of the organs at risk volumes is also possible .
consequently , parameters calculated from dose - volume histogram can be used for quantitative plan evaluation .
the catheter reconstruction is also easier and faster on ct images compared to x - ray films . in high dose rate brachytherapy ,
using a stepping source , a number of forward dose optimization methods ( manual , geometrical , on dose points , graphical ) are available to shape the dose distribution to the target volume , and these influence dose homogeneities to different extent .
currently , inverse optimization algorithms offer new possibilities to improve dose distributions further considering the requirements for dose coverage , dose homogeneity , and dose to organs at risk simultaneously and automatically . in this article , the evolvement of treatment planning for interstitial breast implants is reviewed , different forward optimization methods are discussed , and dose - volume parameters used for quantitative plan evaluation are described .
finally , some questions of the inverse optimization method are investigated and initial experiences of the authors are presented . |
the occurrence of hyperglycemia in non - diabetics in development of acute coronary ischemia ( aci ) indicates latent disorder of glucose metabolism or newly discovered diabetes mellitus ( dm ) as a result of stress , which leads to increased secretion of stress hormones ( cortisol , catecholamines , glucagon , growth hormone and mediators of inflammation interleukin and tumor necrosis factor tnf- ) , which weakens the effect of insulin in cells .
acute coronary syndrome refers to a group of clinical syndromes caused by a sudden circulatory disorder in coronary arteries , resulting in the corresponding portion of myocardial ischemia .
it covers range from unstable angina and myocardial infarction ( mi ) without q wave in the electrocardiogram ( nstemi ) myocardial infarction with q wave in the electrocardiogram ( stemi ) ( 1 ) .
transiently elevated levels of plasma glucose or stress hyperglycemia in patients with acute mi are very frequent .
the most commonly is detected by routine determination of plasma glucose when starting clinical treatment of patients , so the value of glycemia on admission is most often used as an indicator of the presence or absence , or level of stress hyperglycemia ( 2 , 3 , 4 ) .
a blood glucose level on admission is an independent factor ( independent on existence of dm ) that has predictive value as far as the hospital mortality , but the long - term impact on mortality has not been proven ( 3 , 5 , 6 ) .
to determine the incidence of hypoglycemia in non - diabetics immediately after the occurrence of acute coronary ischemia and assess its risk factors .
the study included 80 patients , treated in intensive coronary care unit of clinical hospital mostar , in the period from january 1 , 2013 to december 31 , 2013 .
the participants were at age from 27 to 80 years , non - diabetics of both sexes , who developed aci .
we analyzed : demographic characteristics : age , sex , bmi ; diagnosis ( myocardial infarction , angina pectoris ) ; clinical parameters : systolic and diastolic blood pressure ; selected hematological - biochemical parameters : glucose , lipids , hba1c , erythrocyte sedimentation rate
se , blood count , c - reactive protein ; risk factors : diabetes , hypertension and current smoking .
the subjects were at mean age of 62.813.8 years with the youngest aged 27 and the oldest 80 years .
the percentage of patients with angina pectoris in relation to the percentage of patients with mi was significantly different p<0.0005 . in the study dominated respondents with the i m ( table1 ) .
all respondents before aci had normal glycemia . during the first measurement , immediately after hospital admission ,
50% of respondents had increased blood glucose value and after the second measurement 62% of them . during the third measurement in 56% data was missing discharged ( figure 1 ) .
hypertension as a risk factor had 54% and 56% are smokers ( figure 2 ) .
the incidence of stress diabetes after aci does not depend on the diagnosis of hypertension , =0.050 ; p=0.823 . of 43 patients without hypertension
after aci , 51% had elevated blood glucose levels , and 59% reference value blood glucose .
of the 37 patients with hypertension after aci , 49% had elevated values of blood glucose , while 51% had the values in normal range .
the differences of bmi mean values ( median ) between examined respondents with or without stress dm are not statistically significant , p=0.402
. subjects with dm had a bmi=25.25 ( 23.8 to 27 ) kg / m and respondents without dm bmi=25.25 ( from 23.78 to 27.8 ) kg / m .
the differences of mean values ( median ) in systolic and diastolic blood pressure between the examined patients with or without stress dm were not statistically significant ( systolic / dm , p=0.522 ; diastolic / dm , p=0.899 ) .
independent t - test showed that there was no statistically significant difference in the average values of hdl and ldl in patients with stress diabetes than in patients without stress diabetes after aci p>0.05 .
also , differences in the mean value ( median ) of cholesterol ( p=0.776 ) , triglycerides ( p=0.658 ) and crp ( p=0.124 ) between the examined persons with / without stress diabetes were not statistically significant .
subjects with elevated blood sugar had an average hba1c=5.8 ( 5.37 to 6.1% ) , and those without high blood sugar had an average hba1c = 5.2 ( 5.0 to 5.9% ) .
binary logistic regression examined the influence of age , sex and bmi at the occurrence of
backward wald showed that age and gender have a statistically significant effect of which has a greater impact -wald age=9.0 , p = 0.003 by half wald = 5.25 , p = 0.22 .
stress diabetes for 78% and 95% confidence interval = 94% -20% ( table 2 ) .
impact of dependent variables ( age , sex , bmi ) on outcome ( stress diabetes yes / no ) after aci binary logistic regression examined the impact of se , er , hemoglobin , hematocrit , mcv , tr , le , cholesterol , triglycerides , hdl , ldl and hba1c at the occurrence of
stress diabetes yes / no after acute coronary artery disease . in eight step method
medical history and clinical status are important prognostic indicators in patients with stable angina pectoris or other verified coronary disease .
diabetes , hypertension , cigarette smoking and high cholesterol ( untreated or unregulated despite treatment ) are considered predictors of poor outcome .
a large number of authors believe that stress hyperglycemia is an independent predictive factor for such complications after acute coronary artery disease in diabetics and non - diabetics ( 7 , 8) . in our study ,
the incidence of stress diabetes after aci is not dependent on sex ( 2=1.147 , p=0.284 ) .
both variables have a statistically significant impact on the development of the disease with higher influence of age . for each year of age odds ratio that the respondent develop stress diabetes increases by 7% .
results are compared with other studies , since the older age is more prone to developing complications examined in our study , due to weaker immunity in the elderly , but also because of comorbidity that burdens them ( 10 , 11 ) .
jimenez et al . examined the risk factors in the development of de novo dm after cardiac transplantation .
age , obesity , ischemic mi , hypertension and kidney failure are marked as the main factors in the development of diabetes .
unlike them , moro et al . as a dominant risk factor cited hypertension and old age
, while there was no statistically significant difference in relation to bmi , dyslipidemia , smoking and acute kidney disease .
also show that there were no statistically significant differences in risk factors such as age , sex , smoking , cholesterol , triglycerides and creatinine in three categories of patients ( newly developed hyperglycemia , earlier diabetics and those with normoglycemia ) .
so , followed are different risk factors depending on which aspect of acute coronary events are analyzed ( 11 , 12 , 13 ) . a study we present
was designed differently in relation to risk factors for other studies because there was no control group to test the statistically significant difference .
all subjects had a value before aci of blood glucose in reference values80 ( 100% ) , hypertension had 54% and the smoking as a risk factor 56% .
systolic blood pressure and frequency were significantly increased in the group of newly established diabetics in a study presented marfella and colleagues .
our results are not in this sense , considering that there was no statistical significance in the values of blood pressure in the study population ( 13 ) . in the post - hospital period patients who have had proper glycemia after discharge should be followed once a year , while those with elevated glycemia more often .
also , a number of studies suggesting that persistent hyperglycemia during hospital follow - up or non - diabetic patients represent a predictor of poor prognosis after acute coronary artery disease ( 14 , 15 , 16 , 17 , 18 ) .
evaluated the effect of changes in glucose levels after admission of the patient with respect to mortality and found that elevated glucose during the first 24 hours of hospitalization was associated with higher mortality rate after 30 and 180 days and lower blood glucose value is reflected as a predictor of a good prognosis .
this correlation is present in non - diabetics but not in diabetics ( 13 , 19 ) .
measuring blood glucose , both during admission and hospital monitoring should be part of the regular program of evaluation of patients with aci .
the incidence of hyperglycemia ranges from 3 to 71% according to different threshold that is set for the diagnosis of acute coronary patients .
fox and colleagues emphasized that the need for monitoring the effectiveness of therapies or the discovery of new diabetes after disease ( stress diabetes ) ( 14 ) . | introduction : the occurrence of hyperglycemia in non - diabetics during development of acute coronary ischemia ( aci ) indicates latent glucose metabolism disorder , or is a case of newly discovered diabetes mellitus ( dm ) as a result of stress . acute coronary syndrome refers to a group of clinical syndromes caused by a sudden circulatory disorder in coronary arteries , resulting in the corresponding myocardial ischemia .
it covers range from unstable angina and myocardial infarction ( mi ) without q wave in the electrocardiogram finding ( nstemi ) up to myocardial infarction with q wave in the electrocardiogram finding ( stemi).goal : to determine the incidence of hyperglycemia in non - diabetics immediately after the occurrence of acute coronary ischemia and assess its risk factors.results:the sample included 80 respondents .
men dominated with a total prevalence of 77.5% .
the respondent was at mean age of 62.813.8 years . during the first measurement , immediately after hospital admission ,
50% of respondents had increased blood glucose value and during the second measurement 62% .
hypertension as a risk factor has 54% and 56% smoking .
the incidence of stress diabetes after aci does not depend on the diagnosis of hypertension , 2=0.050 ; p=0.823 .
the differences of mean values ( median ) bmi between examined persons with / without stress dm are not statistically significant p=0.402 .
independent t - test showed that there was no statistically significant difference in the average values of hdl and ldl in patients with stress diabetes than in patients without diabetes stress after aci p>0.05 .
for each year of age odds ratio for stress diabetes
increases by 7% and 95% ci is 2% -12%.conclusion : the incidence of stress diabetes aci is not dependent on the working diagnosis ( mi or angina pectoris ) . as risk factors we set hypertension and current smoking .
there were no statistically significant associations between active smoking and hypertension as a risk factor in relation to occurrence of stress diabetes . |
the hypnotic drug zolpidem , acts at the 1-subunit of gamma aminobutyric acid ( gaba)-benzodiazepine receptor complex .
however , its use in and by psychiatric patients has led to abuse , dependence , and complications like delirium.[13 ] we report here a case of zolpidem withdrawal delirium in a patient with alcohol dependence syndrome unusual in its presentation in that the delirium was not a part of zolpidem intoxication or dependence syndrome and occurred at only slightly higher than recommended dose .
he had a history of alcohol dependence for 12 years and dysthymia for 7 years . off and on , he was on escitalopram 10 - 20 mg for past one year . at admission ( day 1 ) , all his physical parameters were within normal limits except for bilateral fine tremors of hands ( post - detoxification diagnosed by neurologist as essential tremors ) and a mild hepatomegaly ( with fatty change on ultrasound ) .
alcohol detoxification was done using lorazepam 8 mg / day , tapered off between days 4 and 22 .
escitalopram ( 20 mg / day ) was continued and for tremors long - acting propranolol ( 40 mg / day ) was added on day 1 , increased to 80 mg on day 24 , and 120 mg on day 29 . for persisting sleep initiation disturbance , he was prescribed zolpidem ( 10 mg ) on day 13 , increased to 15 mg and 20 mg on days 17 and 18 , respectively .
persistence of sleep problems led to addition of mirtazapine 7.5 mg at bed time from day 21 . his sleep normalized , and on day 24 , prescription instructions were revised to initiate taper - off of zolpidem from 20 mg / day at the rate of 5 mg every fourth day . on day 36 , about 20 hours after the last dose of zolpidem
, he was observed to be pacing in the ward and misrecognizing the treating staff .
blood pressure varied from 130/90 to 160/110 mmhg , and pulse from 84 to 100 beats per minute .
arterial blood gas analysis , ecg , full blood count , blood sugar , serum electrolytes , liver function test , blood urea , serum creatinine , and urine analysis were within normal limits . over next 24 hours ,
a review of medication over past 72 hours revealed an inconsistency between the prescription order and the actual administration of zolpidem . on day 24 , zolpidem prescription was written in two brand names and either one was to be administered depending on availability .
the nurse , however , administered both the brands concurrently resulting in doses of 25 mg and 20 mg instead of 10 mg and 5 mg on days 28 to 32 , respectively . on day 35 , when zolpidem was to be omitted ( from 5 mg / day ) , the nurse realized her mistake and reduced the
additional zolpidem from 15 mg to 7.5 mg , making the actual dose reduction from 20 mg to 7.5 mg [ figure 1 ] . after this discovery ,
lorazepam 1 mg twice daily ( b.i.d . ) was initiated . over next two days ,
one , the possibility as an adverse drug reaction of escitalopram , propranolol , zolpidem , and mirtazapine is unlikely as the patient was on these medications for 2 - 4 weeks without any abrupt dose change except for zolpidem .
two , pharmacodynamic interaction between escitalopram and mirtazapine causing delirium is easily ruled out as there were no concurrent symptoms suggestive of serotonin syndrome .
three , zolpidem is highly plasma - protein bound ( 92.5% ) and other such drugs ( propranolol 90% ; mirtazapine
four , medications ( escitalopram and mirtazapine ) that are substrates for or inhibitors of zolpidem - metabolizing hepatic cytochrome p450 3a4 isozyme may raise plasma zolpidem levels .
both these possibilities are unlikely as the delirium occurred during weaning - off and not with peak dose of zolpidem . due to wrong prescription implementation ,
the index case was maintained on zolpidem at a higher ( 15 - 25 mg / day ) than usually recommended dose ( 5 - 10 mg / day ; range=5 - 20 mg ) for 18 days . within 24 hours of dose reduction ( 20 mg /
day to 7.5 mg / day ) , the patient became delirious [ figure 1 ] .
his symptom profile resembled dsm - iv - tr criteria for sedative - hypnotic withdrawal .
the withdrawal symptoms of zolpidem reported in less than 1% of the subjects appear within 48 hours of discontinuation .
zolpidem withdrawal is hypothesized to be due to long - term supratherapeutic doses saturating the lower - affinity 2 , 3 and 5 subunits on gabaa receptors along with 1 subunits .
the index case was on slightly higher than recommended dosages ( 15 - 25 mg vs 5 - 10 mg daily ) for 18 days , and had shown no evidence of developing dependence on zolpidem .
long - term alcohol use had possibly caused structural or receptor level neuronal changes rendering the index case susceptible to even smaller alterations in zolpidem dose and resulting in delirium .
these changes may further interact with other novel properties of zolpidem such as electrochemistry and electrostatics . while most cases of delirium reported in literature were either during withdrawal from very high - doses ( up to 180 mg / day ) zolpidem dependence , or were single dose ( 5 - 200 mg ) intoxication,[138 ] the index case differed in that it developed delirium on abrupt dose reduction from 20 mg to 7.5 mg .
also , the index case had none of the predisposing factors such as acute hospitalization , older age , female gender , and hepatorenal dysfunction , that could lead to higher than optimal drug plasma levels even at recommended dose - range ; thus , increasing the risk of an adverse event . instead
, the temporal relation between symptom onset after abrupt dose reduction , failure of the trial of low dose haloperidol , and an almost dramatic response to lorazepam strongly implicate zolpidem as the cause of delirium .
this case highlights the risk of prescription of zolpidem in dual diagnosis patients on multiple medications .
it re - emphasizes the merits of strict adherence to recommended doses and to the time - tested practice of gradual taper - off .
lastly , it reinforces the sanctity of medical charting and prescription writing so as to minimize the prescription errors . | the z - category hypnotics are promoted for their relative safety . however
, this view is challenged by the emerging clinical evidence in the form of zolpidem related intoxication delirium and seizures , and dependence and complicated withdrawal .
we report the case of a zolpidem - naive alcohol - dependent inpatient that , while undergoing alcohol de - addiction , was prescribed zolpidem for insomnia and developed delirium during taper - off .
he was successfully detoxified for alcohol , treated for delirium and put on disulfiram prophylaxis .
the case highlights the need for being cautious while using zolpidem for insomnia in alcohol dependent subjects . |
to date no treatment can completely reverse the clinical outcomes associated with spinal cord injury ( sci ) .
tissue injury following sci occurs in two phases : the first involves the primary mechanical injury itself , whereas the second is progressive , mediated over the course of days to weeks after sci by a variety of cytotoxic factors present within the injury environment . host cellular efforts to restrict progressive tissue injury , including glial reactivity , extracellular matrix deposition , and scar formation around the lesion site , subsequently give rise to a nonpermissive environment for axon regeneration and the endogenous recovery of function .
this extrinsic antagonism of neurorepair is compounded by a reduction in the intrinsic growth capacity of adult central neurons .
finding novel therapeutics that combat secondary injury , overcome the growth - inhibiting environment of the lesion site , and/or enhance the intrinsic capacity of neurons to regenerate is imperative for restoring function after sci .
strategies combining cellular with pharmacological , molecular , or biomaterial approaches have shown the most promise in overcoming these obstacles to attain meaningful anatomical and functional repair .
one encouraging adjunctive strategy for both surmounting the growth - inhibitory environment of the lesion and stimulating intrinsic regeneration has been the elevation of cyclic adenosine monophosphate ( cyclic amp ) , a second messenger molecule . sustained elevation of cyclic amp
has been shown to facilitate the extension of neurites across inhibitory substrates such as myelin and myelin - associated glycoprotein , to promote neuroprotection by elevating antiapoptotic proteins , and to suppress immune cell activation and ensuing inflammation .
the primary target of the cyclic amp pathway is the dna - bound , constitutive transcription factor creb , which upon phosphorylation by the cyclic amp - activated protein kinase a ( pka ) initiates the expression of numerous genes , including those that encode certain neuropeptides , neurotrophins , and arginase 1 ( a crucial enzyme in the synthesis of polyamines ; figure 1 ) .
downstream products of arginase 1 , including the polyamine putrescine , have been shown to mediate several of cyclic amp 's effects on neurite outgrowth .
supplementing glial - derived neurotrophic factor gene delivery with the substrate of arginase 1 , l - arginine , demonstrated significant reductions in contusion size in traumatic brain injury models , although without improvement in cognitive function .
in paradigms of sci , augmenting peripheral nerve grafts with acidic fibroblast growth factor supplementation increased arginase 1 expression and polyamine synthesis and was associated with favorable m2 macrophage responses and axonal regeneration [ 8 , 9 ] . additionally , human mesenchymal stromal cell implants that overexpressed a key enzyme in the synthesis of polyamines , arginine decarboxylase , resulted in improved locomotor recovery and reduced scar formation following sci . based upon our previous studies demonstrating the ability of cyclic amp elevation to improve the effectiveness of sc implants after sci and the growing evidence that polyamine synthesis may mediate several of cyclic amp 's downstream effects on axon regeneration [ 3 , 4 , 6 ]
, we investigated whether the supplementation of sc implants with putrescine , given either within 30 minutes or following a 1-week delay after contusive sci , could improve sc implant - host integration , axon growth support , and locomotor recovery in an experimental contusive sci paradigm .
scs were obtained from the sciatic nerves of adult female fischer rats ( harlan co. , indianapolis , in ) as previously described [ 11 , 12 ] .
scs were grown to confluence and thrice passaged onto new dishes . following previous methods , sc purity for implantation
adult female fischer rats ( harlan co. , n = 34 ; 180200 g ) were housed according to the guidelines recommended by the nih and the guide for the care and use of animals . all animal procedures were approved by the institutional animal care and use committee of the university of miami .
prior to surgery , rats were anesthetized ( 70 mg / kg ketamine , 5 mg / kg xylazine ) by intraperitoneal injection .
the mascis weight drop device was used to induce a moderate thoracic ( t9 ) contusion injury .
a laminectomy was performed at the t8 thoracic vertebra prior to injury in order to expose the dorsal surface of the underlying spinal cord ( t9 ) without perturbing the dura mater .
the exposed spinal cord was then subjected to a moderate injury by dropping a 10 g rod from a height of 12.5 mm .
those which had height or velocity errors exceeding 6% or a compression distance that was not within a range of 1.251.75 mm were immediately excluded [ 3 , 15 ] . according to these injury parameter criteria no animals required exclusion from the study . following injury
, the muscles were sutured in layers and the skin was closed with metal wound clips .
animals were allowed to recover in warmed cages with easy access to food and water .
gentamicin ( 5 mg / kg ; abbott laboratories , north chicago , il ) was intramuscularly administered immediately after the surgery and repeated daily for 7 days .
mg / kg ; reckitt benckiser , richmond , va ) was delivered subcutaneously following surgery and then daily for 2 days , accompanied by postoperative treatment as described previously . prior to sci induction , animals were randomly assigned into one of the following three treatment groups : ( i ) sc implant with 0.9% physiological saline ( vehicle ) control ( n = 11 ) , ( ii ) sc implant with acute putrescine ( administered within 30 minutes of injury , n = 14 ) , and ( iii ) sc implant with delayed putrescine ( administered 1 week after injury at time of implantation , n = 9 ) .
putrescine ( 100 mm ) was delivered at a rate of 0.5 l / hr using two sequentially implanted subcutaneous alzet minipumps ( model 2001 ; durect corp . , cupertino , ca ) for a 2-week administration period ; emptied pumps were replaced after 1 week .
, scs were trypsinized , harvested , counted , resuspended in dmem / f12 media as aliquots and placed on ice prior to surgery .
one week after injury the rats were anesthetized with 2% halothane and the injured spinal cord was reexposed .
, all animals received 2 10 scs in 6 l of dmem - f12 media into the epicenter of the contused area , injected at the midline to a depth of 1 mm .
injections were performed at a rate of 2 l / min using a 10 l siliconized hamilton syringe with a pulled , beveled glass pipette tip ( 120 m diameter ) , which was held in a micromanipulator with an attached microinjector ( world precision instruments , sarasota , fl ) .
the injection pipette was held in place for an additional 3 min postinjection to minimize leakage upon withdrawal .
one animal was excluded from the study due to a malfunction of the microinjector during cell transplantation . following the injection , the muscle layers and the skin
rats were euthanized at 10 weeks after injury ( 9 weeks after implantation ; 100 mg / kg ketamine , 10 mg / kg xylazine ) and transcardially perfused with 4% paraformaldehyde ( pfa , 0.1 m , ph 7.4 ) .
the tissue was then dissected and sectioned with a freezing microtome for immunohistochemical analysis according to previous procedures .
spinal cords ( 2 cm ) encompassing the injury epicenter were sectioned sagittally at 40 m into five series free - floating .
as previously described , every fifth sagittal section was immunochemically stained for subsequent fluorescent microscopic analysis using a double labeling procedure involving monoclonal and polyclonal antibodies .
these antibodies were raised against the low - affinity neurotrophin receptor ( p75 ; 1 : 5,000 ; abcam , cambridge , ma ) , serotonin ( 5ht ; 1 : 5,000 ; immunostar , hudson , wi ) , or calcitonin gene related peptide ( cgrp ; 1 : 1,000 ; peninsula laboratories , san carlos , ca ) for identifying the implanted scs or delineating the growth of specific descending or ascending axonal populations , respectively , within the p75 sc implants .
sections were then washed and incubated with corresponding fluorescent secondary antibodies ( alexa 488- or alexa 594-conjugated goat anti - rabbit or anti - mouse antibodies , 1 : 200 ; molecular probes , eugene , or ) .
sections were mounted onto snowcoat x - tra slides ( surgipath , richmond , il ) and cover - slipped with vectashield mounting medium ( vector laboratories , burlingame , ca ) containing the nuclear dye hoechst for storage at 4c . in one series of sections , the average area of p75-positive cellular immunoreactivity was quantified across three sections containing the center of the sc implant .
expression of p75 permits delineation of the implant and identification of the implant - host cord interface . for this analysis
, stained sections were visualized and quantitatively assessed using an unbiased method employing computer - assisted fluorescence microscopy and neurolucida software ( version 4.5 ; microbrightfield bioscience , williston , vt ) .
the p75 area for each of the three sections that comprised the center of the sc implant was traced under a 20x objective , quantified using neurolucida , and then the sc implant area calculated for each animal as the average p75 area across the three sections .
quantification of 5-hydroxytryptophan ( 5ht ) labeled axon growth along the rostral - caudal axis of the spinal cord at distances of 1000 , 500 , 100 , and 0 m rostral to the center of the implant ( as identified using p75 immunoreactivity ) was performed on the second series of sections using 63x objective under oil immersion .
calcitonin gene related peptide ( cgrp ) labeled axons were quantified similarly , but at 1000 , 500 , 100 , and 0 m caudal to the center of the implant .
the average number of fibers per section was obtained by counting those immunostained axons that crossed imaginary lines perpendicular to the rostral - caudal axis at the 1000 , 500 , 100 , and 0 m intervals from the center of the implant .
the total number of axons counted for a given animal was summated across the sections analyzed ( ~1012 sections per animal ) and then divided by the number of sections to determine the number of fibers per section ( f / s ) at each distance . the open field bbb locomotor test developed by basso et al
in addition , a subscore analysis of the bbb that allows for evaluation of hind limb positioning and placement as well as balance and tail use on a 013 point scale was also used as described previously by our group .
lastly , deficits in descending motor control were examined by counting footfall errors on an irregularly spaced horizontal grid walk at the end of the study , prior to animal perfusion .
a one - way anova and subsequent bonferroni post hoc test were used to compare counts of immunostained axons among groups . for analysis of weekly functional recovery patterns following implantation ( bbb and bbb subscore ) ,
a mixed factorial ( repeated measures ) anova followed by the tukey - kramer posttest was employed .
differences were acknowledged to be statistically significant at p < 0.05 , < 0.01 , and < 0.001 , compared to the sc only control or the other temporal treatment group , as indicated . all errors are given as standard errors of the mean .
statistical comparison of sc implant size among control and treatment cohorts showed a significant effect of treatment ( f2,31 = 5.784 , p < 0.05 ) . compared to the implant size in the sc only group ( 1.23 0.07 mm ) , those animals receiving putrescine administration beginning at the time of implantation exhibited 1.8-fold increase in implant area ( 2.24 0.34 mm ; t33 = 3.391 , p < 0.01 ; figures 3(a ) , 3(c ) , and 3(d ) ) as identified using p75 immunochemistry ( a marker highly expressed on scs ) .
in contrast , putrescine administration beginning at the time of injury was without effect ( 1.56 0.19 mm , p < 0.05 ) .
serotonergic axons descending from the reticular formation and raphe nuclei of the brainstem were identified penetrating the sc implant using immunostaining for 5ht ( figures 4(a)4(c ) ; white arrows ) . for all animal groups
there were few serotonergic axons that were able to penetrate beyond the center of the sc implant and no treatment effect was observed at this location ( f2,31 = 1.414 , p > 0.05 ; figure 3(c ) ) .
however , statistical comparison of 5ht axon numbers within the rostral part of the sc implant showed a significant treatment effect ( f2,31 = 4.104 , p < 0.05 at 1000 m , f2,31 = 6.200 , p < 0.01 at 500 m , and f2,31 = 41.15 , p < 0.001 at 100 m from the center of the implant ) .
acute putrescine supplementation significantly increased the number of serotonergic fibers within the proximal sc implant compared to the vehicle control : an average of 20 1.2 5ht fibers per section ( f / s ) at 500 m ( t33 = 4.829 , p < 0.01 ) and 9 0.6 f / s at 100 m ( t33 = 12.82 , p <
0.001 ) was quantified rostral to the center of the sc implant , while in vehicle controls 13 1.8 5ht f / s and 2 0.4 f / s , respectively , were observed at these distances ( figures 4(a)-4(b ) ) .
in addition , many more 5ht axons were observed crossing the host - sc implant interface in acute putrescine treated animals ( figures 4(a)-4(b ) ; white arrows ) .
delayed putrescine supplementation produced a significant increase in 5ht axon numbers only at 100 m rostral to the center of the sc implant ( 5.6 0.8 f / s , t33 = 6.011 , p < 0.001 ) .
small diameter sensory axons originating from dorsal root ganglia that were immunoreactive for cgrp were quantified within the sc implant ( figures 5(a)5(c ) ; white arrows ) .
statistical comparison of cgrp axon numbers among groups showed a significant treatment effect at both 100 m caudal to ( f2,31 = 35.17 , p < 0.001 ) and within the center of the sc implant ( f2,31 = 16.16 , p < 0.001 ) . at 100 m caudal to the center of the sc implant , acute and delayed putrescine supplementation resulted in 2.3-fold ( 19 1.0 f / s , t33 = 11.86 , p < 0.001 ) and 1.7-fold ( 14 0.8 f / s , t33 = 5.941 , p < 0.001 ) increases in cgrp axon numbers , respectively , compared to the vehicle control ( 8.3 0.77 f / s ) .
in addition , acute putrescine administration ( 11 1.2 f / s ) significantly increased cgrp axon ingrowth within the center of the sc implant compared to the vehicle control ( 2.8 0.4 f / s , t33 = 9.491 , p < 0.001 , a 3.9-fold increase ) .
acute putrescine was also significantly more effective in promoting cgrp axon growth than delayed delivery at both 100 m caudal to ( 14 0.8 f / s , t33 = 4.935 , p < 0.01 , a 1.4-fold increase ) and within the center of the sc implant ( 5.3 0.7 f / s , t33 = 6.257 , p < 0.001 , a 2.1-fold increase ) .
locomotor performance and functional recovery following sci , sc implantation , and putrescine treatment were assessed using the bbb score , bbb subscore , and the irregularly spaced grid walk test .
statistical comparison of bbb scores among groups showed a significant treatment effect both at endpoint ( f2,31 = 4.303 , p < 0.05 ) and at various time points after implantation ( f2,31 = 8.520 , p < 0.01 at week 3 ; f2,31 = 4.771 , p < 0.05 at week 5 ; figure 6(a ) ) . compared to the sc implant , vehicle controls ( 11.3 0.3 , 10 weeks after sci )
, open field locomotor performance was significantly greater at endpoint in both the acute ( 12.1 0.1 , t33 = 4.079 , p < 0.05 ) and delayed ( 11.9 0.3 , t33 = 3.929 , p < 0.05 ) putrescine with sc implant treatment groups . statistical comparison of bbb subscores among groups showed a significant effect of treatment at all weeks after implantation ( f2,31 = 4.320 , p < 0.05 , 10 weeks after sci ; figure 6(b ) ) .
compared to sc implant , vehicle controls ( 3.0 0.3 , 10 weeks post - sci ) , hind paw placement and tail positioning were significantly superior in both acute ( 6.6 1.1 , t33 = 3.631 , p < 0.05 ) and delayed ( 7.0 1.4 , t33 = 3.574 , p < 0.05 ) putrescine with sc implant treatment groups .
statistical comparison of the number of footfall errors on the grid walk among groups showed a significant effect of treatment ( f2,31 = 16.76 , p < 0.001 ; figure 6(c ) ) .
acute putrescine administration with sc implantation resulted in significantly better hind paw placement performance as evidenced by a lower number of footfalls on the grid walk ( 5.9 0.2 footfalls ) compared to both delayed administration ( 7.3 0.2 footfalls , t33 = 3.832 , p < 0.01 ) and the sc implant , vehicle controls ( 7.8 0.4 footfalls , t33 = 5.538 , p < 0.001 ) .
bridging the hostile environment of the injured spinal cord with implanted scs has been shown to be an effective foundation approach for a number of combinatorial repair strategies in a diverse array of experimental sci models [ 3 , 4 , 19 ] .
in addition to ensheathing and myelinating axons , scs provide growth - promoting neurotrophins , which may limit tissue loss and encourage axons to overcome the growth - inhibitory injury milieu .
importantly , scs can be safely harvested from a patient 's own peripheral nerve and autologously implanted back into his spinal cord , a major advantage to their use in the clinical setting . however
, sc implants by themselves can not entice significant numbers of axons to exit the injury site , are unable to support robust growth of most supraspinal axon populations except under specific conditions , and provide only modest improvements in functional outcome [ 13 , 15 , 21 ] . in order to mediate significant anatomical repair and/or functional improvements
, sc implants must be augmented with various pharmacological , molecular , or biomaterial approaches that overcome intrinsic or extrinsic inhibitors of axon growth , such as neurotrophin supplementation , chondroitinase abc , polysialic acid , matrix suspension , or cyclic amp elevation [ 4 , 19 , 22 ] . in the current study
we have demonstrated that the administration of the initial polyamine , putrescine , when combined with sc implants , significantly improved the size of the implant ~2-fold and thus potentially the number of surviving , implanted scs .
in addition , acute putrescine administration enhanced the sprouting and/or sparing of both descending serotonergic and ascending peptidergic axons within the implant / lesion site by up to 400% . delaying
the administration of putrescine mirrored the effects of the acute model , but generally with a reduced effectiveness .
the improvements in implant size and axon growth support following putrescine administration were accompanied by enhanced functional recovery , including significant gains in open field locomotor ability and hind paw placement compared to animals receiving sc implants alone .
we have previously shown the therapeutic potential of combining sc implantation with cyclic amp elevation .
elevated levels of cyclic amp are critical in facilitating the growth of axons over inhibitory substrates , such as myelin in vitro , and across the growth - retarding milieu of the injured spinal cord .
the upregulation of arginase 1 , a downstream effector of cyclic amp that synthesizes the precursor for polyamines , has similarly been shown to enhance axonal regeneration , whereas blocking ornithine decarboxylase , the rate limiting enzyme which decarboxylates the product of arginase 1 into putrescine , attenuates the ability of dibutyryl cyclic amp and brain - derived neurotrophic factor to overcome growth antagonism by myelin - associated inhibitors [ 610 ] . the polyamine putrescine can further be converted into the polyamines spermidine and spermine ; however the reverse reactions release toxic aldehyde byproducts , making putrescine the polyamine of choice for experimental or clinical application of polyamines [ 23 , 24 ] .
in addition to its axon growth - promoting abilities , putrescine has also been shown to act as a neuroprotectant , preventing neuronal cell death following ischemia or trauma , likely through its antioxidant and free radical scavenging actions [ 25 , 26 ] .
in addition , polyamines are thought to be incorporated into the elf5a factor , which has been reported to mediate the neurotrophic and neuroprotective effects of nerve growth factor . taken together ,
these studies evidence the therapeutic benefit of using polyamines to enhance the functionality of cellular implants after sci . in the current study
, sc implants were visualized immunohistochemically using an antibody against p75 , the low - affinity nerve growth factor receptor highly expressed in scs both in culture and following spinal cord implantation .
we show that delayed , but not acute , supplementation of sc implants with putrescine resulted in an 80% increase in the size of the implant . from the overlap in administration time between the acute and delayed paradigms and the absence of an effect with acute putrescine , it is unlikely that the observed enhancement in implant size is due to a direct stimulation of sc survival or proliferation by putrescine but instead requires the presence of additional host - supplied factors . as both endogenous sc in - migration and axonal ingrowth occur with a 13-week delay after sci , the later delivery of putrescine may enhance endogenous sc in - migration and/or work in concert with signals from in - growing axons to stimulate proliferation of implanted scs [ 3 , 28 ] . following traumatic sci ,
endogenous scs have been shown to dedifferentiate in the spinal nerve roots , migrate into the injury site , proliferate , and significantly upregulate p75 expression [ 28 , 29 ] . migration and proliferation of endogenous scs occur between 1 and 3 weeks following injury , which temporally corresponds with our delayed putrescine supplementation paradigm . in addition ,
axon presence is one of the strongest signals for inducing sc mitogenesis and proliferation , and there may be insufficient growth of axons within the implant / lesion site during the first week after sci to stimulate sc proliferation acutely .
therefore , implanted sc proliferation and an ensuing increase in implant size may be best benefited by the combination of putrescine and axonal growth signals during the delayed administration period . whether an increased area of p75 immunoreactivity denotes an enhanced proliferation of implanted scs or an enhanced proliferation and/or migration of endogenous scs into the lesion is difficult to determine unequivocally without cell tracking methods . however , depletion of polyamines in a variety of cell types has been shown to impair cell migration by reorganizing the f - actin of lamellipodia , impeding microtubule reformation , and preventing the accumulation of -actin and -tubulin mrna [ 3032 ] .
on the other hand , scs are largely mitotically quiescent under normal physiological conditions , proliferating only during development , wallerian degeneration , or a demyelinating condition or insult .
the enhanced proliferative capacity of scs during wallerian degeneration has been closely associated with an elevation of ornithine decarboxylase activity , suggesting that putrescine supplementation may promote the proliferation of either endogenous or exogenous scs within the lesion [ 33 , 34 ] .
amplified activity of ornithine decarboxylase and polyamines and the elf5a translation factor derived from polyamines have all been shown to upregulate proliferation of a number of cell types [ 35 , 36 ] .
further investigations are needed to ascertain the exact mechanism by which p75 and sc implant size are enhanced following sci , implantation , and delayed supplementation of putrescine .
in addition to mediating cell migration and proliferation , putrescine and other downstream polyamines have also been shown to promote cell survival .
deficiencies in putrescine levels cause swelling of the endoplasmic reticulum and golgi bodies , as well as the disappearance of stress fibers , all of which are hallmarks associated with necrosis .
intracellular polyamines can alter ion transport , either blocking k channels to prevent neuron excitotoxicity or promoting ca influxes [ 38 , 39 ] .
polyamine - induced ion influxes have been shown to be required to induce the release of 5ht synaptosomes , which may help restore serotonergic axon functionality after sci .
sc implants , when used in combinatory approaches , were previously shown to improve the regeneration of serotonergic fibers following sci .
here we observed that supplementing sc implants with putrescine significantly increased the number of serotonergic fibers proximal to the center of the implant / lesion , an effect strengthened by administering the putrescine acutely .
serotonergic axon projections within the spinal cord are believed to be important for the recovery of locomotion following injury .
while it is difficult to determine whether the increase in the numbers of serotonergic fibers is due to the regeneration of axotomized axons , collateral sprouting from existing serotonergic fibers , or sparing of axons , an enhanced presence of serotonergic axons following putrescine administration may provide important stimulatory effects for improved locomotor functioning .
future use of a complete spinal cord transection paradigm with sc grafting would provide a means for identifying whether such 5ht axon growth is due to regeneration , sprouting , or sparing and , when combined with neuroanatomical tracing , whether the serotonergic axons are from supraspinal or intraspinal neurons .
the growth of primary sensory afferents , immunoreactive for cgrp , which have terminations in the superficial lamina of the spinal cord and are associated with transmission of pain , also benefitted from the delivery of putrescine , with enhanced axon numbers within the center of the sc implant .
cgrp - positive neurons have also been implicated in the modulation of fine motor control and the control of posture and thus their growth could be indicative of changes in locomotor function .
primary dorsal horn afferent fibers are known to sprout into more medial lamina of the spinal cord following sci , again making it challenging to ascertain whether the increasing number of cgrp - positive fibers was due to regenerating sensory afferents or collateral sprouts . like 5ht axon growth ,
acute administration of putrescine following sci and sc implantation generated the greatest amount of cgrp fiber growth , almost four times as many fibers compared to scs alone and more than twice as many fibers as delayed supplementation .
these cgrp axons may have arisen from drgns present at the level of the lesion or from drgns located more distally .
further investigation is needed to explore the mechanisms by which putrescine encourages primary sensory afferents to surmount the inhibitory environment of the host cord - implant interface and penetrate deeply into the sc implants as well as the use of tracing techniques to identify the level(s ) from which responding drgns are located .
putrescine supplementation of sc implants also resulted in significant functional improvement , as measured in the open field with the bbb score and on the grid walk test .
irrespective of the timing of putrescine delivery , enhanced locomotor ability , as measured by using the bbb score and subscore , was obtained with treatment compared to sc implanted , vehicle controls .
overall , both acute and delayed putrescine administration generated similar improvements in hind limb performance and tail posturing , including a one - point higher bbb score and five - point higher bbb subscore .
only the acute delivery of putrescine , however , reduced footfall errors on the horizontal grid walk test , by 25% compared to the vehicle control .
the effectiveness of acute putrescine only on this outcome measure would indicate that tissue preservation would be a likely mechanistic explanation for this effect .
the observed functional improvements following supplementation of sc implants with putrescine are in addition to those that are known to be provided when sc implants alone are used after sci [ 4 , 13 ] .
the most pronounced behavioral improvement was displayed by the bbb subscore , in which a persistent improvement in outcome was observed starting at 1 week after implantation .
this highly acute benefit may imply that these effects acted through putrescine - mediated neuro- or axopreservation .
the later improvements in bbb score and the continuous improvement in subscore may in turn be due to the reparative actions instigated by the initial delivery of putrescine .
in conclusion , we supply evidence that modulating polyamines in conjunction with cell implantation is an effective approach for enhancing the functionality of the implant as well as locomotor recovery after sci .
future research should seek to gain a greater understanding of the mechanisms underlying putrescine 's effects on sc function , migration , and survival , as well as its ability to promote axon sparing , growth , and/or sprouting . | schwann cell ( sc ) transplantation exhibits significant potential for spinal cord injury ( sci ) repair and its use as a therapeutic modality has now progressed to clinical trials for subacute and chronic human sci . although sc implants provide a receptive environment for axonal regrowth and support functional recovery in a number of experimental sci models , axonal regeneration is largely limited to local systems and the behavioral improvements are modest without additional combinatory approaches . in the current study we investigated whether the concurrent delivery of the polyamine putrescine , started either 30 min or 1 week after sci , could enhance the efficacy of scs when implanted subacutely ( 1 week after injury ) into the contused rat spinal cord .
polyamines are ubiquitous organic cations that play an important role in the regulation of the cell cycle , cell division , cytoskeletal organization , and cell differentiation .
we show that the combination of putrescine with scs provides a significant increase in implant size , an enhancement in axonal ( sensory and serotonergic ) sparing and/or growth , and improved open field locomotion after sci , as compared to sc implantation alone .
these findings demonstrate that polyamine supplementation can augment the effectiveness of scs when used as a therapeutic approach for subacute sci repair . |
menarche is a vital maturational event of puberty in female adolescents . unlike other pubertal changes that are gradual and continuous ,
it is highly correlated with other pubertal characteristics and is , therefore , preferred as a benchmark for sexual maturation .
the timing of menarche is an important determinant of population size , reproductive performance , and other chronic outcomes , such as cancers of the reproductive organs ( 1 ) .
early onset of menarche has been associated with premature marriage and first childbirth , especially in developing countries , and is a risk factor for breast - cancer , ovarian cancer , and other diseases ( 1,2 ) . during the past century , there has been a secular ( time - related ) trend towards an earlier onset of menarche in most developed countries , with a decline of 23 months per decade in europe and the united states ( 3 ) .
general improvements in nutrition and health have been suggested to explain the downward trend ( 3,4 )
. the earlier onset of menarche has also been observed in some developing countries , such as bangladesh .
the most recent study of unmarried female adolescents conducted in 1996 in a rural area of bangladesh reported an average age at menarche of 13.0 years ( 4 ) , which was substantially lower than the previous estimate of 15.8 years in 1976 ( 5 ) .
the relatively high age at menarche in 1976 was linked to severe malnutrition caused by inflation , famine , and flooding following bangladesh 's war for independence in 1971 ( 5 ) .
the association between the nutritional status and the onset of menarche has been well - documented ( 46 ) . in general , adolescents who are taller and heavier with a greater body - fat mass tend to reach menarche at younger ages ( 46 ) .
female adolescents in bangladesh , particularly those in rural areas , are largely affected by undernutrition , with 48% and 59% being stunted ( height - for - age <3 percentile ) and thin ( body mass index [ bmi]-for - age < 5 percentile ) respectively , applying the national center for health statistics reference ( 7 ) .
considering the high prevalence of undernutrition and a lack of significant improvement in nutritional status during recent years ( 7 ) , it is not clear whether the age at menarche has continued to decrease in rural bangladesh . a marked seasonal pattern of menarche has previously been reported such that the monthly occurrence of menarche is not uniformly distributed throughout the year but peaks show up in summer and winter ( 8,9 ) .
seasonal factors , such as length of daylight , ambient temperatures , and the psychological effects of reduced stress and increased relaxation during school vacation , are some suggested explanations for this seasonal variation ( 811 ) .
the present analysis was conducted to determine the age at menarche using self - reported date of onset in a group of female adolescents aged 1219 years in a rural area of bangladesh and to examine its association with marital and nutritional status and season .
we believe that the study of onset of menarche is important not only from an anthropological point of view but also because the mean menarcheal age has been accepted as a particularly sensitive indicator of the biosocial status of the population ( 12 ) .
the mean age at menarche in rural bangladesh was last estimated more than a decade ago , and a number of biological , social and ecological factors have likely changed since then .
we believe that it is opportune to re - assess the onset of menarche and its association with various factors , particularly marital status , considering the numerous negative consequences of marriage and pregnancy in adolescence , which may be triggered by early onset of menarche .
data were collected as part of a cohort study of the consequences of pregnancy and lactation on growth of adolescents in gaibandha district in rural northwest bangladesh ( 13 ) .
this study was conducted in a smaller area ( 96 communities with 200 households in four unions of gaibandha district ) , which was part of the study area where a randomized community trial for assessing the impact of vitamin a and -carotene supplementation on maternal and infant survival called the jivita project was being conducted by our group .
this rural and densely - populated ( 1,000 per sq km ) region is characterized by average to below - average socioeconomic status indicators , rates of health service - use , child health , and nutritional status compared to national statistics . at the outset , all the households in this area were visited by 96 local female workers from january to march 2005 to identify and list all married and unmarried adolescents aged less than 20 years .
all enumerated adolescents were interviewed in the home to elicit dates of their birth , months and years of menarche , marital status , and pregnancy history using recall and to measure mid - upper arm circumference ( muac ) .
home records of date of birth , when available , were requested and , in their absence , parental input was obtained to confirm the self - reported year and month of birth .
various probes , such as age at school enrollment , differences in age between siblings , year of marriage , and tools , such as a local events calendar , were used for determining the year and month of birth .
adolescents who were post - menarcheal at the time of enumeration were asked to recall the year and month of menarche .
reference to age of school enrollment and the number of years spent in each class was used as recall probes as the majority of adolescents in the study area had received some schooling due to the government support for female education ( 14 ) .
for example , the adolescents were asked in which grade they had started menstruating , along with the highest grade completed and its corresponding calendar year . also , the number of years for which a particular grade was repeated was recorded .
family events , seasons , school examinations , and a local events calendar were used for probing the month of menarche .
in addition , the mother or other female relatives living in the household were asked to help with the recall of the age at menarche . the year and month of marriage
muac was assessed as a measure of nutritional status to the nearest millimetre following standard procedures ( 15 ) .
of the 5,582 female adolescents enumerated , 100 ( 1.8% ) refused to participate in the study , and 1,365 ( 24.4% ) were excluded either due to not meeting the age criteria of 1219 years or for not being able to provide years of their birth .
further , 29 ( 0.5% ) adolescents who were unable to report months of their menarche and 165 ( 3.0% ) who had previously been pregnant were excluded because the adolescent cohort study enrolled only never - pregnant adolescents ( 13 ) .
the resulting sample included in the analysis comprised 3,923 ( 70.3% ) married nulliparous and unmarried female adolescents aged 1219 years .
of the 3,923 female adolescents , 483 ( 12.3% ) were unable to report months of their birth .
thus , the mean age at menarche was assessed by assigning a random month of birth to this group using microsoft excel 2000 ( microsoft corp , redmond , wa , usa ) .
as some households had more than one female adolescent aged 1219 years and age at menarche of those living in the same households could be correlated , we estimated the mean age at menarche adjusting for the clustering of girls of the same households .
the differences in age at menarche , age , and muac between married and unmarried adolescents and that in muac and age between pre- and post - menarcheal adolescents were examined using a t - test .
a multiple linear regression analysis was conducted with age at menarche as the dependent variable and marital status , age , and muac as the independent variables . to examine the seasonality of menarche , frequencies of onset by calendar month and season were computed .
seasons were defined as follows : winter = novemberfebruary ; summer = marchjune ; and monsoon = julyoctober .
the uniformity of monthly and seasonal distribution of menarche was examined using a test ( 8,9 ) , accounting for the different number of days in each month .
the observed frequencies of menarche for each month and season were compared against the expected uniform distribution [ 31/3653,452 ( total number of adolescents ) , 28/3653,452 , etc . ] .
all analyses were performed using the stata software ( version 8.0 ) ( stata corp , college station , texas , usa ) .
the bangladesh medical research council and the institutional review board at the bloomberg school of public health , johns hopkins university , baltimore , md , usa , approved the study .
of the 3,923 female adolescents , 483 ( 12.3% ) were unable to report months of their birth .
thus , the mean age at menarche was assessed by assigning a random month of birth to this group using microsoft excel 2000 ( microsoft corp , redmond , wa , usa ) .
as some households had more than one female adolescent aged 1219 years and age at menarche of those living in the same households could be correlated , we estimated the mean age at menarche adjusting for the clustering of girls of the same households .
the differences in age at menarche , age , and muac between married and unmarried adolescents and that in muac and age between pre- and post - menarcheal adolescents were examined using a t - test .
a multiple linear regression analysis was conducted with age at menarche as the dependent variable and marital status , age , and muac as the independent variables . to examine the seasonality of menarche , frequencies of onset by calendar month and season were computed .
seasons were defined as follows : winter = novemberfebruary ; summer = marchjune ; and monsoon = julyoctober .
the uniformity of monthly and seasonal distribution of menarche was examined using a test ( 8,9 ) , accounting for the different number of days in each month .
the observed frequencies of menarche for each month and season were compared against the expected uniform distribution [ 31/3653,452 ( total number of adolescents ) , 28/3653,452 , etc . ] .
all analyses were performed using the stata software ( version 8.0 ) ( stata corp , college station , texas , usa ) .
the bangladesh medical research council and the institutional review board at the bloomberg school of public health , johns hopkins university , baltimore , md , usa , approved the study .
the mean ( sd ) age and muac of the adolescents included in the analysis ( n=3,923 ) were 15.1 ( 1.8 ) years and 22.4 ( 2.3 ) cm respectively .
only 13% of the adolescents were married at the time of interview , although most ( 88% ) were already menstruating . of those who had already attained menarche , the mean age of onset of menarche was 12.8 ( 1.4 ) years
. a higher proportion of married vs unmarried female adolescents was post - menarcheal ( 99% vs 86% , p<0.01 ) , and married adolescents had an earlier onset of menarche than unmarried girls ( 12.61.3 years vs 12.91.4 years , p<0.01 ) , a difference that remained significant after adjusting for age and muac ( =-0.44 , p<0.01 ) ( table ) .
the mean muac was significantly higher among post- vs pre - menarcheal adolescents ( 22.82.0 vs 19.51.9 cm , p<0.01 ) , and there was a negative linear association between age at menarche and muac , after adjusting for age and marital status ( =-0.11 , p<0.001 ) ( table ) . factors associated with mean age at menarche among adolescents in rural bangladesh r=0.20 , f=250.31 , p=<0.01 ; muac = mid - upper arm circumference the monthly occurrence of menarche was not uniformly distributed throughout the year ( = 885.97 , df=11 , p<0.001 ) but had peaks in december and january and troughs in august and september ( fig . ) .
more than half of the female adolescents reached menarche during the winter months whereas less than 20% had an onset in monsoon ( = 634.97 , df=2 , p<0.001 ) .
frequency distribution of calendar month of onset of menarche among adolescent girls , aged 1219 years , in rural bangladesh ; expected frequencies for each month calculated as 31/3653,452 ( total number of adolescents , 28/3653,452 , 30/3653,452 , etc . )
the estimated mean age at menarche of 12.8 years reported from this study indicated a slightly earlier onset of menarche of the female adolescents in a rural area of bangladesh by 2 months compared to the mean of 13.0 ( 0.9 ) years that had been estimated in narayanganj district of bangladesh in 1996 ( 4 ) .
while not directly tested , this apparent small difference in age at menarche compared to that found in a survey in 1996 may be attributable to differences in the timing of studies , location of study areas , and sample characteristics .
while the present study included both married and unmarried female adolescents aged 1219 years , the previous study included only unmarried ones aged 1017 years ( 4 ) .
on the other hand , one can conjecture that the mean age at menarche in rural bangladesh has lowered slightly over the past decade and that the downward trend in age of onset of menarche observed elsewhere ( 3 ) may also be occurring in rural bangladesh , albeit at a slower pace . in europe , a trend towards an earlier onset of menarche by 23 months per decade has been reported , with the smallest magnitude of decline of 1.1 months per decade observed in france ( 3 ) .
analysis of the national health and nutrition examination survey ( nhanes ) in the usa indicated declines in age at menarche for all race / ethnic groups , with non - hispanic white females having a decline in the mean age at menarche from 13.3 years in the pre-1920 birth - cohort to 12.5 years in the 19801984 birth - cohort ( 16 ) . while the declining trend in age at menarche has been attributed to improvements in health and nutrition in developed countries , a large proportion of female adolescents in rural bangladesh is still affected by undernutrition as reflected by the high prevalence of stunting and thinness ( 7 ) .
if real , factors associated with a potential declining trend in age at menarche in rural bangladesh remain to be elucidated .
the accuracy of recall of the date depends on factors , such as interval of recall ( 17 ) . in the present study ,
the mean interval of recall was 2.5 years , and 63% of the adolescents had reached menarche within three years of the time of interview .
previous studies that used a similar recall procedure reported a correlation coefficient of 0.83 and 0.67 between the actual and the recalled age at menarche when the mean interval of recall compared to occurrence of menarche was 4.8 years and 33 years respectively ( 18,19 ) .
therefore , the recall errors are expected to be low in this study due to the relatively short interval of recall .
the married adolescents reached menarche at an earlier age than the unmarried adolescents . in developing countries , such as bangladesh and pakistan , age at menarche
is suggested to be positively associated with age at marriage and first childbirth ( 20 ) .
a similar association has been found in some developed countries where the intervals between menarche and first marriage are much larger ( 20,21 ) .
although the mechanisms of this positive association are poorly understood , in developing countries , menarche has been suggested to serve as a marker of maturity and readiness for marriage , signalling the parents to place their daughters in the marriage market ( 2,20 ) .
the mean age at marriage in the jivita study area is 16.5 years despite the legal age of marriage being 18 years in bangladesh , and the first pregnancy ( conception ) occurs within an average of 13 months from marriage ( 13 ) .
the inverse association between age at menarche and muac shown in this study corresponds with the previous findings that adolescents who are taller and heavier with a greater body - fat mass tend to attain menarche at younger ages ( 4,5 ) .
the nutritional status of the adolescents was assessed by muac in this study whereas most previous studies measured weight , height , bmi , or skinfold thickness . in general , muac is a good indicator of nutritional status , serving as a proxy for wasting malnutrition and weight , particularly in adult women ( 22 ) . in a study of rural senegalese female adolescents , the mean muac
was shown to be higher among post- vs pre - menarcheal girls ( 23 ) , coinciding with the present finding .
the winter peak of menarche found in our study corresponds with the previous findings from rural bangladesh that about half of adolescents attained menarche in winter whereas less than 20% had an onset in may through august ( 5 ) .
a factor that most likely explains the winter peaking of menarche in rural bangladesh is the increased food consumption during the harvest season .
food availability and consumption generally increases during the winter harvest season in bangladesh , thereby improving nutritional status , a factor known to be associated with onset of menarche ( 5 ) . in a study by tetens et al . elsewhere in rural bangladesh ,
the mean energy intake increased from 6.5 mj per person per day in the lean season to 8.3 mj per person per day in the harvest season in female adolescents ( 24 ) . in the jivita study ,
the proportion of women consuming more than one egg per week increased from 37% in the lean season to 56% in the harvest season . likewise ,
73% of the women consumed dark green - leafy vegetables at least once a week in the harvest season compared to 60% in the lean season ( data not shown ) .
another potential explanation may be the psychological effects of reduced stress due to school vacation . during school season , adolescents have homework and regular examinations , including mid - term and final , which could contribute to the increased level of stress . in addition , the support for female education by the government of bangladesh , particularly for secondary school , is merit - based ; so , to receive continuous financial support from the government , the student needs to perform well in school .
thus , a relaxing and less - stressful atmosphere during school vacation has been postulated to trigger the onset of menarche by influencing the hypothalamus ( 810 ) .
the winter school vacation which follows the final examination in december may explain the high frequencies of menarche in winter , especially in december .
however , we are limited in supporting this hypothesis because , to our knowledge , there is no evidence showing that female adolescents in bangladesh have reduced stress during school holidays , and we lack data to estimate the proportion of adolescents enrolled in school at the time of onset of menarche
. the winter peak of onset of menarche in the present study is consistent with a previous finding in 1977 and may be related to increased intake of foods during the winter harvest season .
, the date of menarche was self - reported , and the associated recall bias can not be ruled out despite the relatively short interval of recall . although efforts were made to help elicit the date of birth of all the enumerated female adolescents , approximately 12% were unable to report the months of their birth .
assigning a random month of birth when only year was available ; as done in our study , may have limitations due to the seasonality of birth reported in bangladesh and other countries ( 25,26 ) . in this study
, muac was measured after the onset of menarche . using the post - menarcheal muac measurement as a proxy for nutritional status before the onset of menarche is not ideal .
in addition , the study sample comprised female adolescents , aged 1219 years , living in a defined study area .
thus , our findings may not be generalizable to or comparable with other randomly - sampled populations of adolescents in bangladesh . in conclusion ,
the mean age at menarche of the adolescents in this rural area of bangladesh was slightly lower than the previous estimate of 13.0 years in 1996 ( 4 ) .
although the small difference in age at menarche could be an artifact of different study sites and sample characteristics , it may also reflect the downward trend of onset of menarche taking place in rural bangladesh , as observed elsewhere .
these findings need confirmation in random samples of married and unmarried adolescents in rural bangladesh , assessing age at menarche using pros - pective and probit analysis methods ( 27,28 ) .
the negative association between the nutritional status and the onset of menarche in the present study was consistent with the previous findings that adolescents who are better - nourished tend to attain menarche at younger ages .
it is likely that , in a rural setting in bangladesh , in addition to the strong cultural and social norms favouring early marriage , an early onset of menarche may also trigger premature marriage and first childbirth .
this is associated with numerous adverse birth outcomes , such as premature birth , low birthweight , and neonatal and maternal mortality .
meanwhile , it is accepted that maintaining optimal nutritional status during adolescence is important for future reproductive outcomes in adulthood .
thus , while continuing efforts should be made to improve the nutritional status of female adolescents , educational activities , advocacy , and strong policies need to be in place at the same time to help delay marriage and first childbirth among female adolescents in the deve - loping world .
the jivita project was conducted under a global research activity cooperative agreement between the johns hopkins university and the office of health and nutrition , us agency for international development , washington , dc ( ghs - a-00 - 03 - 00019 - 00 ) , and the bill & melinda gates foundation , seattle , washington , dc ( global control of micronutrient deficiency , grant no .
. additional direct or in - kind support for this trial was provided by sight and life , basel , switzerland , the sight and life research institute , baltimore , md , nutrilite health institute ( nutrilite division , access business group , buena park , ca , usa ) , the canadian international development agency , and the national integrated population and health programme of the ministry of health and family welfare , government of bangladesh .
barkat ullah , hasmot ali , shafiul alam , shahab uddin , and sayeda khatun sharifa , and the jivita field management team .
additional appreciation goes to the field staff of the jivita project for their excellent work and dedication during data collection .
the authors acknowledge keith west , principal investigator of the jivita trial , for his insightful comments and guidance throughout the study and rolf klemm for his helpful comments and support .
special thanks are due to allan massie , maithilee mitra , ahasanul haque , and lee wu for computer programming and data - management support ; jonathan sugimoto and salahuddin ahmed for gis support ; and andre hackman for technical assistance . | menarche is an important milestone in the development of female adolescents .
the study assessed the age at menarche using recall , its seasonality , and association with marital and nutritional status ( using midupper arm circumference [ muac ] ) among 3,923 female adolescents aged 1219 years in a rural area of bangladesh . at the time of assessment ,
most ( 88% ) adolescents had attained menarche at the mean ( standard deviation [ sd ] ) age of 12.8 ( 1.4 ) years .
age of onset of menarche among married adolescents ( 13% ) occurred earlier than in those who were unmarried ( 12.61.3 years vs 12.91.4 years , p<0.01 ) .
age at menarche was negatively associated with muac after adjusting for age and marital status ( =0.10 , p<0.01 ) .
more than 50% of the adolescents had an onset of menarche during winter ( 2=634.97 ; p<0.001 ) , with peaks in december and january . in this rural population , the current age at menarche
was found to be slightly lower than the previous estimates of 13.0 years in bangladesh .
an early onset of menarche was associated with season and better nutritional status of the female adolescents and may be associated with early marriage . |
there is a long history of challenge with both defining and measuring ecological diversity ( for example , ricotta , 2005 ) .
an inherent challenge is that there is no universally accepted , absolute value of diversity for a given community .
contrast this to other quantitative measurements considered to have absolutes that are comparable across different methods or scales of measuring .
for example , whether temperature is measured in kelvin , celsius or fahrenheit , there is a belief that there is one true ' equivalent value upon which all scales will agree .
there is not a belief that an absolute diversity value can be determined and compared across methods : each method is a slightly different reduction of multivariate information about a community . if determining an absolute value of diversity were achievable ( and it likely is not ) , it would unite the field of community ecology by ending the debate about the merits of different diversity measurements , and instead redirecting focus toward underlying mechanisms . thus , diversity ' can refer to be any number of metrics considering any one or number of aspects of a community . because no absolute value of diversity exists , each method has its own biases and advantages , as discussed previously ( for example , hill et al . , 2003 ) .
a lack of specificity about which method is used can lead , at best , to confusion , or at worst , oversimplification or misinterpretation of community outcomes .
thus , the precise method(s ) for calculating diversity should be carefully considered , and justified either ecologically or biologically according to the scientific question , and then interpreted considering the chosen diversity metric 's strengths and limitations .
for example , if there is a working hypothesis of differences in phylogenetic breadth between communities in a control and treatment , a diversity metric that incorporates information about the relatedness of taxa may be selected .
diversity metrics are , by design , flexible , and thus can be calculated from any type of community data set . because it is difficult to observe individual microbial cells and distinguish among microbial taxa , microbial ecologists use many inexact methods for observing communities , including cell morphology or probe binding with microscope counts , fingerprinting , colony phenotypes , and sequencing .
thus , owing to methodological differences , diversity often is not comparable directly across studies even if the same metric is calculated .
this results in vagueness and does not promote a deeper understanding of microbial community ecology .
it also means that diversity can not be important ' in itself because much context is needed for interpretation .
for a high - throughput sequencing data set , diversity is straightforward to determine , perhaps in part , because popular sequence analysis pipelines automatically output these calculations .
the ease of diversity calculation may tempt us to indiscriminately report them or to assume that they are informative for our study .
however , for sequencing methods , there are a range of analysis choices regarding the operational taxonomic unit definition ( eren et al . , 2013 ; preheim et al . , 2013 ;
the taxonomic unit is whatever is appropriate to the scientific question ( or , as it often happens , default in the sequence analysis pipeline ) , as chosen by the researcher .
this is an important consideration because operational taxonomic unit definitions will impact our perspective of diversity , and some operational taxonomic unit - defining methods consistently over or underinflate the number of taxa observed ( for example , edgar , 2013 ) , which directly impacts diversity calculations .
diversity metrics may be inflated by the dna of inactive or dormant organisms ( jones and lennon , 2010 ) .
dna extraction protocols can bias against lyses of certain groups , skewing their representation in the community ( for example , gram - positive bacteria ) .
co - extraction of relic or taphonomic dna can overestimate standing diversity ( carini et al .
, 2016 ) . there is also primer bias in amplicon sequencing , which can underestimate diversity by omitting or underrepresenting certain microbial lineages ( klindworth et al . , 2013 ) .
for some marker genes , like the 16s ribosomal rna gene , bacterial and archaeal taxa may have very different copy numbers ( stoddard et al . , 2015 ) , which complicates our perception of their relative contributions to the community .
for taxon - rich microbial communities , like soils , and especially for highly uneven , rich communities that are dominated by a few very abundant taxa ( adams et al . , 2013 ) , undersampling of the community is an additional consideration ( for example , gihring et al . , 2012 ) . increasing the amount of sequences generated for undersampled communities resulted in continued increase in diversity estimates , with particular sensitivity in the performance of nonparametric estimators that extrapolate absolute community diversity based on the number of singletons and doubletons ( gihring et al . , 2012 ) .
however , owing to our inexact methods for observing communities , microbial diversity calculations in particular have so many biases that they may be considered as rough approximations .
efforts should be made to standardize biases across samples prior to making diversity comparisons , and , even then , to interpret results with care .
if higher diversity were universally better for communities , why devote resources to understanding ecological mechanisms ?
if it were true that higher diversity is always an improvement , we could manage microbial communities by simply making them more diverse .
there are countless examples of ecosystems in which higher diversity is not more meritorious . as a simple example , a rainforest harbors more plant species per hectare than a temperate forest , but it is not interpreted that the temperate forest is a less important or less - thriving ecosystem .
these two ecosystems are different , and for many abiotic or biotic reasons that could be uncovered and investigated further .
similarly , vaginal microbial communities exhibit a range of diversities across healthy women , including some communities that are dominated by lactobacilli and others ( reported as 20%30% of asymptomatic individuals ) that have less lactobacilli but more diverse membership ( ma et al . , 2012 ) . as another example
, high - fat and low - fat diets had comparable levels of shannon diversity , chao diversity and richness ( though , different taxonomic compositions ) in humanized mouse models ( turnbaugh et al . , 2009 ) .
these studies and others demonstrate that lower diversity is not necessarily indicative of a worse community or ecosystem , and lower diversity does not necessarily imply less stable or less healthy ' communities .
there is a recent example in which we do overwhelm microbial communities with more and different diversity in an effort to manage them : fecal transplants after an opportunistic infection by clostridium difficile ( kassam et al . ,
not all fecal transplants are successful , despite the apparent deluge of additional diversity to the community .
it would be a misinterpretation to suggest that the diversity in itself is the answer to the frequent success of fecal transplants in mitigating c. difficile infection .
notably , microbial ecologists have borrowed value - laden terms from traditional ecology to describe diversity , which may be one historical reason for the persistence of assumptions that higher diversity is better . for example
, ecologists use richness to refer to the number of species , and depauperate to describe communities with low diversity .
this terminology was used in the literature as early as the 1920 's ( for example , wheeler , 1926 ) , but seems to have become more prominent by the 1940 's ( for example , hubbs and lagler , 1949 ) .
thus , microbial ecologists perhaps have intuited value from legacy jargon without reconsideration of its merit .
except in the context of informing study design and approach ( for example , how many sequences are needed for exhaustive coverage of a community ? ) , there is little ecological value in reporting that a community has 10 000 taxa or 10 .
the insight emerges when comparing that community with another situation or community of interest , and then asking what is the difference observed and why .
this could be in the context of an experimental design between control and treatment conditions , over a natural or controlled environmental gradient , over time , in response to a disturbance or stressor , or over geographic space .
comparative microbial diversity , especially when multilayered community and functional measurements are applied , has provided key insights into underlying processes .
for example , two sets of replicated methanogenic bioreactors responded differently to a pulse glucose shock : one set was stable , whereas the other decreased in performance ( fernandez et al .
it was discovered that the sets harbored very different microbial compositions , measured using several complementary methods , including cell morphology , fingerprinting and ribosomal rna probes , which allowed the researchers to delve more precisely into the comparative mechanisms of functional stability . in particular , the bioreactors with less diverse membership had an ability to perform parallel substrate processing during the glucose shock to maintain performance .
one important conclusion from this study was that communities with higher diversity were not necessarily more functionally stable in the face of disturbance . because of all of the nuances in calculating diversity , comparing diversity within a single study or across a series of related studies ( often by the same researcher ) provides situation - specific insights and modest advances . for understanding larger scale patterns in diversity over space or time , or across many ecosystems
, researchers often have to spend much time curating disparate data sets for meta - analysis , and redefining taxonomic units across studies to be maximally comparable . even then , owing to methodological differences , each data set sometimes must remain as a distinct unit and quantitative cross - study comparisons are limited . though quantifying large - scale patterns in microbial ecology is challenging ,
one of the scientific reasons for doing so is to test ecological theories established in traditional ecology for microbial communities .
calculating diversity for microbial communities and analyzing their overarching patterns using methods directly comparable to studies in traditional ecology pushes forward our pursuit of a unified ecological theory .
for example , studies have considered latitudinal gradients of diversity ( for example , chu et al . , 2010 ) , and species - area and species - time relationships ( for example , bell et al . , 2005 ; shade et al . , 2013 ) .
in some cases , microbial diversity exhibits similar large - scale patterns to communities of larger organisms ( macroorganisms ' , for example , locey and lennon , 2016 ) , and in some cases , they are distinct ( for example , fierer et al . , 2011 ) .
understanding these points of distinction for microbial diversity will allow us to delve deeper into the ecological mechanisms driving their patterns , and better place them in the context of a grander view of biology .
to provide specific example of how comparisons of large - scale patterns in diversity can uncover common underlying ecology , a recent meta - analysis used species richness , observed community size , and maximum community size of both macrobial and microbial communities to discover a universal scaling law relationship between the size of the community and its evenness ( inclusive of dominance and rarity ) , where larger communities exhibit lower evenness and a larger rare biosphere ' ( locey and lennon , 2016 ) .
for example , can any insight be gleaned to consider that an acid mine drainage community is much less diverse than a soil ( or , to be a bit facetious , that a mammal gut has different diversity than the surface of a kitchen counter ) ? in these examples , there are very distinct ecosystems with fundamentally different drivers and constraints .
we do not need to calculate diversity in each to be led to hypotheses as to why they are different .
an exception to this is in questions concerning source tracking of specific community members ( for example , knights et al . , 2011 ) , where disparate but connected ecosystems or regional metacommunities may be implicated in seeding each other 's diversity .
there are many ecological mechanisms that underpin patterns in community diversity , and they are inherently difficult to unravel .
for instance , abiotic drivers and constraints , like environmental filters and carrying capacity of an ecosystem , limit the type and number of organisms capable of exploiting the habitat .
abiotic disturbances may disrupt resource availability and make new niche space available , driving replacement or proportional changes in communities .
disturbances sometimes impact specific members rather than the whole community , driving selection , or release from competition or predation .
biotic interactions are also important drivers of diversity , and the nature and strength of interactions like antagonism and synergism can result in complex and nonintuitive multimember interactions ( for example , tilman , 1994 ) . thus , our ultimate understanding of diversity requires more than measurements of diversity ; we also need contextual data and sufficient numbers of community observations for thoughtful comparisons that test specific hypotheses about how diversity may , or may not , change across sample categories or gradients .
suppose a hypothetical study used marker gene sequencing to uncover evidence that a certain pathogen is more successful in invading a host - associated microbial community that has relatively lower diversity as compared with a higher - diversity community .
the researchers may then report that high diversity prevents pathogen invasion , and then attribute this to an underlying higher functional diversity in that community .
the question to consider is : what about the ecology of the more diverse community that is inhibitory toward the pathogen , and what about the less diverse community that is permissive ?
perhaps , it is that there is a direct competitor of the pathogen in the more diverse community . or
, perhaps there is a mutualist of the pathogen in the low - diversity community that promotes its growth . perhaps , the higher - diversity community has lower ph , and the pathogen is sensitive to this specific abiotic driver . perhaps , it is because a subset of community members has stimulated the host immune response in the higher - diversity community . perhaps , it is because the higher - diversity community is at carrying capacity , and there are no available niches for the invading pathogen . perhaps , the pathogen acquired a beneficial gene , via horizontal gene transfer , from a member of the lower - diversity community that improved its success .
( also , without directly measuring function or functional potential , it is a conceptual leap to move from the observation of high compositional diversity to the assumption of high functional diversity . )
understanding how these mechanisms collectively contribute to community outcomes is of great importance for the goals of predicting , conserving and managing microbial communities , and reporting diversity without underlying hypotheses , contextual data for interpretation or useful comparisons does not advance our understanding toward these goals .
furthermore , common assumptions that higher diversity is better ' oversimplifies complex mechanisms and can sidetrack progress .
there is a lot of work to be carried out , and measuring diversity is the first step in a rich line of scientific inquiry .
measurement of diversity should serve as a starting point for further inquiry of ecological mechanisms rather than an answer ' to community outcomes . | local diversity ( within - sample or alpha diversity ) is often implicated as a cause of success or failure of a microbial community .
however , the relationships between diversity and emergent properties of a community , such as its stability , productivity or invasibility , are much more nuanced .
i argue that diversity without context provides limited insights into the mechanisms underpinning community patterns .
i provide examples from traditional and microbial ecology to discuss common complications and assumptions about within - sample diversity that may prevent us from digging deeper into the more specific mechanisms underpinning community outcomes .
i suggest that measurement of diversity should serve as a starting point for further inquiry of ecological mechanisms rather than an ' answer ' to community outcomes . |
in 2004 , the world health organization ( who ) and the united nations children 's fund ( unicef ) recommended , in a joint statement , the use of zinc supplementation for the treatment of acute diarrhea in developing countries .
this recommendation was based on strong biological and epidemiological evidence which suggested that zinc supplementation can significantly reduce the overall duration of diarrhea and is also likely to reduce stool volume and frequency .
however , there exists significant heterogeneity in the effects of zinc on diarrhea - related outcomes observed across published randomized controlled trials [ 35 ] .
there is some evidence to suggest that the beneficial effect of zinc may not be equivalent against the common causative organisms .
had first demonstrated that the extent to which mucosal permeability is affected in different diarrheas depends on the causative organisms in general , diarrheas caused by invasive organisms show higher permeability .
second and consistent with this observation , canani et al . observed that zinc - induced promotion of ion absorption across the gut is evident in response to the ion secretion caused by vibrio cholerae toxin but not the escherichia coli heat - stable enterotoxin .
third , surjawidjaja et al . showed that although zinc sulphate can inhibit the growth of enteropathogens in vitro , the lethal dose required to kill 50% of the organisms ( ld50 ) widely varies across the species of the causative organisms .
consequently it is possible that the overall beneficial effect of zinc supplementation observed in a trial may depend on the spectrum of the causative organisms within that study .
the influence of zinc supplementation on diarrhea could thus be dependent on the organisms present in the gut . using microbiological and clinical data from a three - arm randomized controlled trial of zinc supplementation
, we therefore determined whether differential organisms can partially contribute to the effect of zinc .
due to limited resources , we were unable to conduct serotyping for pathogenic organisms causing diarrhea . in this report ,
therefore , we demonstrate the modulation of effect of zinc supplementation by bacterial isolates in the stool and rotavirus infection .
this dataset comes from a double - blind , randomized , placebo - controlled clinical trial in children aged 659 months attending the indira gandhi government medical college and hospital , in nagpur , india with > 3 unformed stools in the prior 24 hours ; duration of diarrhea < 72 hours ; and ability to accept oral fluids or feeds .
details about the study subjects , the trial design , and its rationale are provided elsewhere .
briefly , all children aged 6 months to 59 months attending study center with more than three unformed stools in the prior 24 hours with a total duration of diarrhea at recruitment of up to 72 hours and who were able to accept oral fluids were recruited in the study .
the exclusion criteria were chronic or severe complicating illness , known positive hiv status , kwashiorkor , residing outside a radius of 30 km around the hospital , participating in another study , or already enrolled in this study .
the trial is registered with the international standard randomized controlled trial register with the unique identifier isrctn85071383 .
the ethics committee of indira gandhi government medical college , nagpur , and the human research ethics committee of the university of newcastle , new south wales , australia ( hrec approval no : h-500 - 0203 ) approved the study protocol and the treatment effects monitoring committee monitored the trial for safety .
each recruited child was sequentially assigned to one of the following three treatment arms using a randomization protocol fixed a priori : placebo ( pl , n = 271 ) arm , zinc ( zn , n = 264 ) only arm , and zinc and copper ( zn + cu , n = 273 ) arm .
participants in the zn arm received the therapeutic dose 2 mg / kg / day of zinc while participants in the zn + cu arm received the same dose of zinc as well as 0.2 mg / kg / day of copper .
microbiological investigations were conducted with a sterile container having a plastic spoon attached to the inside of the screw cap for stool collection .
the fecal sample first underwent a naked eye examination for consistency , presence of mucous and blood . in the laboratory , the sample underwent gross and microscopic examination of wet and iodine preparations .
kenyon 's method of acid fast staining for parasitic cyst was also done . for bacterial isolation sample
was inoculated on sheep blood agar , macconkey bile salt agar , selenite f broth , skirrow 's campylobacter medium , alkaline peptone water , and thiosulphate citrate bile salts agar .
enzyme - linked immunosorbent assay ( elisa ; premier rotaclone , meridian bioscience , inc , cincinnati , oh ) was used for rotavirus antigen detection . in this study we examined whether zinc supplementation either alone or in combination with copper
was associated with improvement in two diarrhea - related outcomes the likelihood of continued diarrhea beyond 3 days since initiation of therapy , and the volume of stool collected during hospital stay .
this latter outcome was divided into two categories based on the median stool volume in the study subjects .
this study was conducted as a set of prespecified subgroup analyses that specifically aimed to tease out possible heterogeneity of zinc supplementation effects across the spectrum of the organisms isolated from stools .
we followed the existing guidelines for reporting subgroups analyses from randomized controlled trials [ 11 , 12 ] . recognizing that the interpretations and recommendations based on subgroups analyses heavily depend on a critical and careful statistical analysis , we conducted our analyses in two steps . in the first step
, we attempted to establish that our analyses will have sufficient statistical power while addressing the issues of multiple comparisons and of treatment ( zinc ) modifier ( isolated organisms ) interactions . for this
( a ) the first is the method of multifactor dimensionality reduction ( mdr ) to examine the likely interactions among isolated organisms and zinc supplementation for the two diarrhea related organisms .
mdr is a nonparametric , exploratory approach that identifies and characterizes the potential interactions in a large number of discrete predictors with a binary outcome and is commonly used to identify gene - gene interactions .
( b ) we next looked for significant bivariate interaction of each major isolated organism with zinc supplementation for both the outcomes .
for this , we used the interaction contrast statistic ( ) described by gnen .
we tested the statistical significance of this interaction using the breslow - day test for heterogeneity and also determined the statistical power of our study to make inferences about these interactions . to estimate the power we made use of the statistic .
this was estimated using the arcsine transformation as 2sin ( p)where p is proportion of subjects developing the outcome of interest for a given combination of the therapy received and the isolated organism .
the statistic has a standard normal distribution with variance 1/n , where n is the number of observations .
( c ) we next conducted stepwise multiple logistic regression analysis for each outcome where the primary objective was to arrive at a reduced list of significant interactions based on the organisms identified in step ( b ) .
for stepwise regression we used the backward elimination strategy with a conventional probability retention criterion of 0.2 . in the full model , we considered the main effects and all interactions ( bivariate as well as higher - order ) among the therapy and diarrheal isolates .
, we counted the total number of comparisons and reported the likelihood of false positive identification of significant interactions . in the second step of the analysis
, we aimed to test the robustness of our findings in the light of possible correlations with other predictors of zinc effectiveness . in this step , we used multivariate unconditional logistic regression modeling .
in these multivariate models we adjusted for the following covariates : age , gender , presence of stunting ( weight - for - age z - score < 2 ) , presence of wasting ( length - for - age z - score < 2 ) , wealth index score , hand washing score , baseline plasma zinc level , baseline plasma copper level , and baseline hemoglobin level .
all other analyses were conducted using stata 10.2 ( stata corp , college station , tx ) software package .
of the total 808 study subjects , microbiological data was available for 801 ( 99.1% ) children .
from these 801 children a total of 913 organisms were isolated548 ( 68.4% ) children had a single organism isolated , 195 ( 24.3% ) children had mixed isolates with at least 2 organisms , while no organisms could be isolated in 58 ( 7.3% ) children . in the order of commonness
the following organisms were isolated in the study subjects : e. coli 451 ( 56.3% ) , klebsiella spp 276 ( 34.5% ) , rotavirus 169 ( 21.1% ) , parasitic ova and cysts in stool 121 ( 15.1% ) , shigella spp 8 ( 1% ) , salmonella spp 5 ( 0.6% ) , and campylobacter jejuni 2 ( 0.2% ) .
interestingly , of the 169 children with rotavirus infection , e. coli - rotavirus combination was observed in 100 . at baseline ,
children with weight for age < 2 z - score were 19% , 57.5% , and 32.7% in those with rotavirus infection , e.coli and klebsiella isolates in the stool samples . correspondingly the proportions with serum zinc < 60 g / dl were 25.2% , 56.4% , and 35% , respectively .
adherence to supplementations was similar in the three groups at 92.2% , 90.4% , and 88% , respectively .
three hundred and six ( 38.2% ) children had diarrhea that extended beyond 72 hours after initiation of therapy .
the median stool volume for all the study subjects was 685 ml . based on this cut - off
we dichotomized the study children in to those who had low stool volume ( < 685 ml ) and those who had high stool volume ( 685 ml ) .
we first conducted mdr analyses to identify and characterize potential interactions among zinc supplementation and four major isolates : e. coli , klebsiella , rotavirus , and parasites .
our results indicated ( figure 1 ) that for the outcome of diarrhea > 3 days e. coli was not found to be contributory to any interaction while klebsiella was noncontributory to the outcome of high stool volume .
presence of rotavirus was associated with a higher proportion of children with diarrhea > 3 days especially when they received zinc supplementation as indicated by taller red bars in cells 4 , 8 , and 12 in figure 1 . on the other hand ,
when klebsiella but not rotavirus was isolated from the stools , zinc supplementation appeared to be associated with a reduced likelihood of diarrhea > 3 days ( compare the red and blue bars in cells 6 , 13 , and 14 of figure 1 ) .
although mdr included parasites as another potential source of interactions for the outcome of diarrhea > 3 days , its role did not appear to be definitive . using this set interactions identified by mdr ,
its odds ratio for accurate prediction of the outcome was 2.34 ( 95% ci 1.733.17 , p = 2.6 10 ) with an overall accuracy of 63.1% . for the outcome of high stool volume ,
mdr analysis again identified presence of rotavirus as a potential deterrent to the beneficial effect of zinc ( magenta bars in cells 4 , 8 , 12 , and 16 in figure 1 ) . in general , presence of e. coli in the stool
was associated with an increased risk of high stool volume ( magenta bars in cells 7 , 8 , and 1316 in figure 1 ) . again
the role of parasites , although identified by mdr as a possible dimension , was equivocal . for this outcome ,
the or for correct prediction based on mdr results was 2.33 ( 95% 1.733.14 , p = 1.7 10 ) with an overall accuracy of 59.4% .
we next examined the bivariate interactions between each of the major isolates and zinc supplementation for both the outcomes ( figure 2 ) . for diarrhea > 3 days , the interaction constant was positive for e. coli and rotavirus , significantly negative for klebsiella , and uninformative for parasites .
this indicated that zinc supplementation may provide detrimental results in the presence of e. coli and rotavirus but may be associated with a shorter period of diarrhea in the case of klebsiella isolates .
the breslow - day test also identified e. coli , rotavirus , and klebsiella to be interacting significantly with zinc supplementation for this outcome .
as shown in figure 2 ( grey bars ) our study had moderate to sufficient power to detect significant interactions .
although similar directionality for interactions was also observed for the outcome of high stool volume , statistical significance as well as sufficient power was only achieved for the e. coli isolates .
since parasites did not demonstrate any significant interaction with zinc supplementation and had negligible statistical power for either of the outcomes , we omitted this source of interaction from all further analyses .
we studied four main effects ( zinc , e. coli , klebsiella , and , rotavirus ) , six bivariate interactions ( listed as covariates 5 through 10 in figure 3 ) , and four three - way interactions ( covariates 11 through 14 in figure 3 ) . to control for multiple comparisons in this step of the analysis we employed the method of stepwise logistic regression with a conventional retention criterion of 0.2 . in the final models
, we observed that for the outcome of diarrhea > 3 days zinc supplementation provided two statistically significant and directionally opposite interactions : with rotavirus and ( or > 1 ) and with klebsiella ( or < 1 ) .
in contrast , for the outcome of high stool volume there were two synergistic and significant interactions of zinc supplementation : with e. coli and with rotavirus ( both or > 1 ) .
thus , there were four significant interaction terms that involved zinc supplementation in our stepwise multivariate regression procedure .
as shown in figure 3 , there were a total of 10 interaction terms in the full model for each outcome , and thus , a total of 20 interactions were considered in the analysis . at a type i error rate of 0.05 , this would mean that one of the significant interactions detected in our study is likely to be a false positive .
we next set out to investigate whether the significant interactions observed held the significance in the face of several other potential contributors to the two outcomes .
consistent with our previous observations , we found that zinc supplementation either alone or in combination with copper supplementation did not influence either of the study outcomes after adjusting for baseline covariates ( rows titled overall in tables 1 and 2 ) .
for the outcome of continued diarrhea > 3 days , we observed that zinc supplementation had a strikingly protective effect when klebsiella was isolated , no effect when single e. coli or intestinal parasites were isolated , but a high risk of the outcome when rotavirus was isolated and an even higher likelihood ( 3.39 times ) of prolonged diarrhea when e. coli were isolated along with rotavirus .
moreover , the protective effect in the context of klebsiella isolates was nullified when rotavirus isolates were simultaneously found .
notably , we observed the protective effects of zinc supplementation when klebsiella was isolated and the detrimental effects of zinc supplementation in e. coli - rotavirus infections were boosted by the addition of copper .
we found similar results when we used other cut - points for dichotomizing the diarrheal duration like 5 days and 7 days ( data not shown ) .
thus , the influence of zinc supplementation on the proportion of subjects with prolonged diarrhea was substantially modulated by the micro - organisms isolated . for the outcome of high stool volume we observed similar effects ; however , in most instances the observations did not reach statistical significance ( table 2 ) .
there are four - key findings of this study . first , the beneficial effect of zinc supplementation in acute diarrhea was not equal against all organisms isolated from stools . of special concern , however , was our observation that zinc may actually increase the risk of prolonged diarrhea in the presence of e. coli - rotavirus ( prevalence of 12% in this study ) .
prescreening for rotavirus reactivity may enhance the utility of zinc supplementation by restricting it to subjects not reactive to rotavirus .
it is interesting to note that two studies in young infants in four countries ( bangladesh , ethiopia , india , and pakistan ) showed no effect of zinc supplementation on duration of acute diarrhea .
rotavirus is known to be the commonest causative organism in breast fed young infants , and although the authors acknowledge that it could be the reason for failure of zinc effect , it was not assessed in any of these studies [ 16 , 17 ] .
the only other randomized controlled trial that has conducted a subgroup analysis based on the presence or absence of rotavirus in diarrhea concurs with our finding that the beneficial effect of zinc could not be observed in rotavirus - infected children .
diarrhea in rotavirus infection may be caused by several mechanisms , namely , enterocyte destruction , villus ischaemia , activation of enteric nervous system by release of vasoactive agents , and intestinal secretion by intracellular and extracellular action of nonstructural protein ( nsp4 ) which stimulates ca dependant cell permeability .
our results also gain operational importance since in many situations it may not be feasible to conduct microbiological studies in deciding the value of zinc supplementation in children with acute diarrhea .
second , in children from whom the commonest organism ( e. coli ) in the present study was isolated , zinc supplementation showed no significant association with the length of diarrhea or stool volume .
this is despite the fact that this group had the highest proportion of wasted children , had serum zinc < 60 g / dl , and most could thus be expected to benefit from zinc supplementation . including this study , two other trials [ 20 , 21]both from india had found that e. coli was the commonest stool isolate in children with diarrhea .
one of these studies found no significant impact of zinc supplementation on diarrheal duration while the other study found a significant benefit but had used a high dose ( 40 mg / kg / d ) of elemental zinc .
this finding is interesting in the light of the observation that a higher concentration of zinc sulphate is needed in vitro to inhibit the enteropathogenic strains of e. coli .
together these observations suggest that the possibility of higher dose zinc supplementation should be considered when e. coli is the probable cause of diarrhea .
our findings along with those of surjawidjaja et al . , dutta et al . , and sachdev et al .
also raise an interesting possibility that an optimum dose of zinc may be beneficial against most of the causative organisms and that a possible future direction to take would be to design studies focused on the dose - response to zinc supplementation .
it should be remembered however that in vitro , ex vivo , or in vivo benefit of zinc supplementation in rotavirus diarrheas is currently unstudied and unknown .
third , although mechanistically unclear , our results suggest that klebsiella - associated diarrheas may be more responsive to zinc supplementation .
klebsiella enterotoxins cause reduced na absorption and net cl secretion in rabbit ileum by increasing cgmp .
although the addition of zinc does not affect cgmp - mediated ion secretion , zinc may still have a protective effect that is associated with its action on basal ion transport .
it is well recognized that the enteroaggregative patterns exhibited by klebsiella spp and their heat - stable enterotoxins are structurally and functionally distinct from those of e. coli and chiefly induce diarrhea by chloride ion depletion [ 22 , 23 ] . since it has been shown that zinc can specifically inhibit the luminal secretion of the chloride ion [ 7 , 24 ] , it is likely that the klebsiella - induced diarrhea is amenable to zinc supplementation .
considering the similarity in the mechanism of diarrhea causation it is conceivable that zinc supplementation may also be very useful in cholera a premise that is strongly supported by in vitro and epidemiological observations [ 7 , 25 ] .
finally , our results shown in table 2 indicated that the significant interactions observed for the outcome of high stool volume may likely have been false and could have originated from the complex correlation structure among the covariates that better predicted the outcome .
this reiterates the general view that zinc supplementation has a more significant effect on the diarrheal duration rather than on the volume of stool .
we believe that the limitations of this study must be recognized before a generalization of the results can be undertaken .
first , we did not have the resources to serotype the organisms isolated in the stools .
consequently , it can not be presumed that the isolated organisms would necessarily indicate a causal association with the diarrhea episode .
nevertheless we could demonstrate a differential response in rotavirus infection and in the presence of different bacterial organisms in the gut regardless of the fact that some may not have been pathogenic .
second , this study only had statistical power in excess of 60% which can be considered as sufficient but not very high .
thus , replication and substantiation of our findings in larger and more statistically powerful studies is needed .
this study suggests that more research is needed to understand the effect of zinc supplementation on acute diarrhea due to different causative pathogens .
therefore we suggest that zinc efficacy trials should now include a more complete assessment of the causative organisms at baseline .
fourth , microbiological prescreening prior to zinc supplementation in resource - limited countries is unlikely to be feasible .
there is now a growing recognition that the beneficial effects of zinc supplementation may not be universal [ 9 , 26 ] .
although we did not have data on further typing of the isolates in this study , our findings suggest that the universal strategy of zinc supplementation regardless of the organism isolated in the stool may be an oversimplification .
if our results are indeed pointing towards a true differential benefit of zinc supplementation by the causative organisms , then more care will be required in recommending an optimum dose of zinc that is most beneficial as it will depend on the differential ld50 values and the relative prevalence of the microbes included in the causative spectrum of acute diarrhea . | zinc supplementation is recommended in all acute diarrheas in children from developing countries . we aimed to assess whether zinc supplementation would be equally effective against all the common organisms associated with acute diarrheas .
we used data on 801 children with acute diarrhea recruited in a randomized , double blind controlled trial ( isrctn85071383 ) of zinc and copper supplementation . using prespecified subgroup analyses , multidimensionality reduction analyses , tests of heterogeneity , and stepwise logistic regression for tests of interactions
, we found that the influence of zinc on the risk of diarrhea for more than 3 days depended on the isolated organism beneficial in klebsiella , neutral in esherichia coli and parasitic infections , and detrimental in rotavirus coinfections .
although we found similar results for the outcome of high stool volume , the results did not reach statistical significance .
our findings suggest that the current strategy of zinc supplementation in all cases of acute diarrheas in children may need appropriate fine tuning to optimize the therapeutic benefit based on the causative organism , but further studies need to confirm and extend our findings . |
intestinal intussuception in an adult is a rare entity that differs in etiology from its pediatric counterpart owing to underlying pathologic lead points in adults , mostly neoplasms .
the main clinical presentation in chronic intussuception in adults remains dull abdominal pain , and acute intussuception is uncommon . computed tomography ( ct ) remains the diagnostic modality of choice and surgical resection is the optimal treatment .
we report a case of chronic intussuception in a young adult presenting with severe anemia and chronic abdominal pain in right hypochondrium and lumbar region .
pre operative diagnosis of chronic ileocolocolic intussuception was made on the basis of ultrasound , barium and ct scan findings .
histopathological examination of resected specimen revealed presence of tuberculosis in the mass along with mesenteric lymph nodes involvement .
postoperative recovery was uneventful and he was put on antitubercular drugs . in follow - up
chronic ileocolocolic intussuception due to tuberculosis should be considered as a possible cause of intestinal obstruction in young patients presenting with vague abdominal pain and severe anemia even in the absence of any specific medical history .
adult intussuception is rare and accounts for 1 in 100 of all cases operated for intestinal obstruction and one case of adult intussusception in comparison to every 20 patients in pediatric age group .
90% cases in children are idiopathic whereas adults have a demonstrable cause in 70%-90% of cases .
the presentation of pediatric intussuception often is acute with sudden onset of intermittent colicky pain , vomiting , and blood stained cherry , mucoid stools , with a palpable abdominal mass . whereas adults may present with acute , subacute , or chronic non - specific symptoms .
surgical management is the rule and resection without reduction is the preferred modality in colonic intussuceptions .
gastrointestinal ( git ) tumors mostly benign are the etiological lead points but tuberculosis of intestine and mesenteric lymph nodes , a very rare cause of intussuception as in our case incites us to report this case .
25 years male presented to the hospital with chief complaints of pain in the right hypochondrium for 8 - 9 months without history of vomiting and constipation .
he was non - diabetic , non - smoker without any history of tuberculosis . on examination
, there was severe anemia and vague abdominal mass in right hypochondrium extending to the right lumbar region with increased bowel sounds .
abdominal ultrasound ( usg ) revealed thickened matted bowel loops forming phlegm on in right lumbar region suggestive of inflammatory etiology .
ct abdomen and barium meal follow through ( bmft ) revealed empty right iliac fossa and pulled up caecum with ascending colon with gross thickening of their walls leading to a large lump in right lumbar area .
a few loops of small gut and fat containing mesentery were also seen with this lump . on the basis of clinical examination and diagnostic armentarian preoperatively diagnosis of chronic ileocolocolic intussuception with severe inflammatory changes
this was confirmed on exploration and right hemicolectomy with end - to - end anastomosis was done ( figs . 2 , 3 ) .
ct scan showing empty right iliac fossa with gross thickening of wall of caecum and ascending colon forming a lump in right lumbar area .
intraoperative picture showing part of ileum entering inside caecum and ascending colon forming an ileocolocolic mass after mobilisation of right sided colon .
histopathological examination of the resected specimen showed presence of granulomas consisting of caseation necrosis , langerhans 's giant cells , epitheloid cells and lymphocytes and with these characteristics , a diagnosis of tuberculosis was made to be the cause of this intussuception .
the patient was put on antitubercular drugs and in the follow up , patient is asymptomatic .
intussusception is a common cause of intestinal obstruction in pediatric surgical practice , where it is the predominant cause of intestinal obstruction in children aged 3 months to 6 years .
they develop iliocolic intussusception , probably from hyperplasia of peyer 's patches secondary to a viral infection . in contrast
intussusception in adults accounts for 0.1% of all adult hospital admissions and 5%-16% of all intussusceptions in contrast to intussusception in childhood , which is idiopathic in 90% of cases , adult intussusception have a demonstrable cause in 90% of the cases .
the incidence of adult intussusception is equivocal in both genders in contrast to pediatric age group where males have predilection to females , ratio being 3 : 1 . in majority of cases ,
the cause of intussuception in the small intestine consist of benign lesions , such as benign neoplasms , inflammatory lesions , meckel 's diverticuli , appendix , adhesions etc .
malignant lesions ( either primary or metastatic ) account for up to 30% of cases of intussusception in the small intestine . on the other hand ,
intussusception occurring in the large bowel should be considered as having malignant etiology as it represents up to 66% of the cases .
however , tuberculosis of intestine as a causative factor hardly finds a mention in the world literature which was the lead point in our case .
however , abdominal pain and mass remains the striking feature in 90% and 24 - 42% respectively as reported in different series .
chronic refractory anemia is not a common manifestation of intussuception in adults but was predominant to the extent requiring multiple blood transfusions in our patient . although investigations were done preoperatively to find the cause of anemia but it could not be detected .
however after the surgical treatment patient had an excellent improvement in anemia during the follow up period of three months .
the preoperative diagnosis of chronic intussuception is infrequent , however , with the advent of usg and ct diagnostic ability has improved tremendously[710 ] .
colonic intussusception should be resected en bloc , without any attempt of reduction due to its chronicity and high likelihood of malignancy ( 58% ) one stage procedure of right hemicolectomy and end - to - end anastomosis without attempt of reduction was done in this patient as well .
intussusception due to tuberculosis though extremely rare should be kept on back of mind as a possible cause . surgical resection without attempt of reduction remains the rule of thumb while dealing with chronic intussuception of colonic origin . | context : intestinal intussuception in an adult is a rare entity that differs in etiology from its pediatric counterpart owing to underlying pathologic lead points in adults , mostly neoplasms .
the main clinical presentation in chronic intussuception in adults remains dull abdominal pain , and acute intussuception is uncommon .
computed tomography ( ct ) remains the diagnostic modality of choice and surgical resection is the optimal treatment.case report : we report a case of chronic intussuception in a young adult presenting with severe anemia and chronic abdominal pain in right hypochondrium and lumbar region .
pre operative diagnosis of chronic ileocolocolic intussuception was made on the basis of ultrasound , barium and ct scan findings .
exploratory laparotomy was done and right hemicolectomy with end to end anastomosis was performed .
histopathological examination of resected specimen revealed presence of tuberculosis in the mass along with mesenteric lymph nodes involvement .
postoperative recovery was uneventful and he was put on antitubercular drugs . in follow - up
the patient is asymptomatic.conclusion:chronic ileocolocolic intussuception due to tuberculosis should be considered as a possible cause of intestinal obstruction in young patients presenting with vague abdominal pain and severe anemia even in the absence of any specific medical history . |
the sample consisted of inuit preschool children recruited in the late summer and early fall of 2007 ( august november ) and 2008 ( august september ) in 16 of the 25 communities of nunavut , representing all 3 regions of the territory ( kivalliq , baffin , and kitikmeot ) .
communities were selected based upon logistical and cost consideration and upon achieving representation of latitude , region , and community size .
inclusion criteria for participation consisted of self - identified inuk by parents or a caregiver and 35 years of age .
children were recruited from both the community health centre lists of age - appropriate children and from randomly selected households with 35 year - olds that had participated in the international polar year inuit adult health survey .
a randomized list of children was created from the health centre list using a random number table and parents / caregivers were contacted in the order that they appeared on the list .
of the 537 successfully contacted households , 75 refused upon initial contact and 74 cancelled or failed to attend the study appointment ; thus , the overall participation rate was 72.3% and 388 children were recruited .
the study was approved by the mcgill faculty of medicine institutional review board and by the nunavut research institute . a parent or primary caregiver provided signed informed consent .
a person was considered a child s primary caregiver if he / she was the person primarily responsible for the child at the time of the study . consent forms and an information dvd were available in english and inuit languages .
the research team consisted of bilingual interviewers who conducted face - to - face interviews .
information about household composition , living conditions , diet , supplement use , and health status were collected through interviews with the child s caregiver .
caregivers were asked an open ending question on average , about how many hours per day , does your child play outside ? a qualitative food frequency questionnaire ( ffq ) ( without assessment of portion sizes ) was completed by the child s caregiver .
the ffq reflected the previous month and contained 30 commonly consumed tf items , some of which are considered good sources of vitamin d , ( whitefish , arctic char , seal meat , seal liver , caribou , caribou liver , polar bear meat and walrus meat ) .
it also contained the following mf sources of vitamin d : milk , margarine , and eggs .
furthermore , 24-hour dietary recalls ( 24-h recalls ) were conducted with the caregiver using a multiple pass technique .
portion sizes were estimated using a 3-dimensional food model kit ( sant quebec ) to better standardize 24-h recalls .
twenty percent of the caregivers were asked to return for a repeat 24-h recall , which was conducted on a non - consecutive day to allow assessment of nutrient adequacy .
interviewers recorded if there were times when the caregiver did not know what the child ate .
this approach has been shown to be an accurate method of assessing intake in this age group ( 18 ) .
vitamin d and calcium intakes were adjusted for the second 24-h recall and an estimation of the adjusted intake for sequence and day of week was calculated using the iowa state software for intake distribution estimate ( iowa state university , 1996 ) .
the adjusted data were only used to compare intakes against the dris . since data collection for this study
was performed before the release of the 2011 guidelines of the institute of medicine , accordingly , vitamin d and calcium intake of participants were compared to the both the adequate intake ( ai ) ( 19 ) and the estimated average requirement ( ear ) ( 20 ) .
vitamin and/or mineral supplement use and frequency were recorded , however , due to low prevalence of supplement intake , vitamin d or calcium intake reflected only dietary intake .
venous blood ( 3 ml ) was collected into heparin coated vacutainers followed by centrifugation and storage of plasma at 20c and was then transported on ice packs in coolers to mcgill university and stored at 80c until analysis . height was measured to the nearest 0.1 cm using a portable stadiometer ( road rod214 portable stadiometer , seca ) and weight was measured to the nearest 0.1 kg using an electronic scale .
bmi - for - age z - score ( baz ) , height - for - age z - score ( haz ) and weight - for - age z - score ( waz ) were calculated and interpreted using the world health organization ( who ) child growth charts for children ( 21 ) .
the non - dominant calcaneus was measured using ultrasound sahara sonometer ( hologic , bedford , ma , usa ) .
measurement of the os calcis consisted of bua ( expressed in decibels per megahertz , db/mhz ) and sos ( expressed in meters per second , m / s ) .
the quantitative ultrasound device measures bua and sos and the results are combined to estimate bmd .
ultrasound bone densitometry was shown to be sensitive enough to detect physiological bone development in childhood ( 22 ) and compromised bone health in diseased children ( 16 ) . at the start of each clinical day ,
briefly , the machine was checked using a control bone also known as a phantom .
these assessments were recorded in a quality control log and tracked to ensure the machine was working consistently .
plasma alkaline phosphatase ( alp ) and total calcium were measured by beckman coulter dc 800 ( beckman coulter inc . ,
the laboratory participated in external validation and received a proficiency certificate for 20092010 from digitalpt .
high sensitivity c - reactive protein ( crp ) was measured in the serum using enzyme linked immunosorbance assay .
plasma 25(oh)d and parathyroid hormone ( pth ) concentrations were measured using liaison total 25(oh)d and n - tact pth assays ( diasorin inc . ,
stillwater , mn , usa ) at mcgill university . the inter - assay and the intra - assay coefficient of variation ( cv ) were 4.5 and 11.1% for the low 25(oh)d control ( 38.2 nmol / l ) and 6.2 and 5.3% for the high 25(oh)d control ( 127.2 nmol / l ) ; the accuracy using the mid - range of the manufacturer s specifications was 95% . for the pth low control ,
the inter - assay cv% was 19.1 ( 5.2 pmol / l ) and 8.7 for the high pth control ( 52.1 pmol / l ) .
the laboratory ( hw ) that measured 25(oh)d participated in the vitamin d external quality assessment scheme program and obtained a certificate of proficiency for 20092010 , which reflects that 80% of the reported results fell within 30% of the all - laboratory trimmed mean . questionnaires and clinical information were entered into a microsoft access database and 24-h dietary recall data were entered using candat ( godin london ) .
for outliers , all dietary variables exceeding mean+3 standard deviations ( sd ) were substituted with mean+3 sd . for all other variables ,
all variables were tested for normality prior to statistical analysis using shapiro wilk test .
since variables were skewed , spearman correlations were used to identify correlations between bua or sos and different continuous characteristics .
anova , followed by bonferroni post - hoc tests whenever appropriate , were used to determine whether dietary , anthropometric , biochemical and lifestyle factors were different by bua or sos quartiles when variables were continuous and chi - square was used when variables were categorical . prior to anova , all skewed variables were log transformed or square rooted .
sos and bua measurements were available for 285 children and full multivariable analysis was possible for 211 children , because data on food intake , accurate anthropometry measures , the number of hours spent outside or 25(oh)d concentration were missing .
smirnov test along with visual examination of residual - normal quantile plot , and heteroskedasticity was evaluated using the breusch
variance inflation factors were examined post - regression to ensure the absence of multicollinearity . for all tests ,
values in the text are percent ( 95% ci ) , meanssd , or medians with interquartile ranges ( iqr ) .
the sample consisted of inuit preschool children recruited in the late summer and early fall of 2007 ( august november ) and 2008 ( august september ) in 16 of the 25 communities of nunavut , representing all 3 regions of the territory ( kivalliq , baffin , and kitikmeot ) .
communities were selected based upon logistical and cost consideration and upon achieving representation of latitude , region , and community size .
inclusion criteria for participation consisted of self - identified inuk by parents or a caregiver and 35 years of age .
children were recruited from both the community health centre lists of age - appropriate children and from randomly selected households with 35 year - olds that had participated in the international polar year inuit adult health survey .
a randomized list of children was created from the health centre list using a random number table and parents / caregivers were contacted in the order that they appeared on the list .
of the 537 successfully contacted households , 75 refused upon initial contact and 74 cancelled or failed to attend the study appointment ; thus , the overall participation rate was 72.3% and 388 children were recruited .
the study was approved by the mcgill faculty of medicine institutional review board and by the nunavut research institute . a parent or primary caregiver provided signed informed consent .
a person was considered a child s primary caregiver if he / she was the person primarily responsible for the child at the time of the study .
the research team consisted of bilingual interviewers who conducted face - to - face interviews .
information about household composition , living conditions , diet , supplement use , and health status were collected through interviews with the child s caregiver .
caregivers were asked an open ending question on average , about how many hours per day , does your child play outside ? a qualitative food frequency questionnaire ( ffq ) ( without assessment of portion sizes ) was completed by the child s caregiver .
the ffq reflected the previous month and contained 30 commonly consumed tf items , some of which are considered good sources of vitamin d , ( whitefish , arctic char , seal meat , seal liver , caribou , caribou liver , polar bear meat and walrus meat ) . it also contained the following mf sources of vitamin d : milk , margarine , and eggs .
furthermore , 24-hour dietary recalls ( 24-h recalls ) were conducted with the caregiver using a multiple pass technique .
portion sizes were estimated using a 3-dimensional food model kit ( sant quebec ) to better standardize 24-h recalls .
twenty percent of the caregivers were asked to return for a repeat 24-h recall , which was conducted on a non - consecutive day to allow assessment of nutrient adequacy .
interviewers recorded if there were times when the caregiver did not know what the child ate .
this approach has been shown to be an accurate method of assessing intake in this age group ( 18 ) .
vitamin d and calcium intakes were adjusted for the second 24-h recall and an estimation of the adjusted intake for sequence and day of week was calculated using the iowa state software for intake distribution estimate ( iowa state university , 1996 ) .
the adjusted data were only used to compare intakes against the dris . since data collection for this study
was performed before the release of the 2011 guidelines of the institute of medicine , accordingly , vitamin d and calcium intake of participants were compared to the both the adequate intake ( ai ) ( 19 ) and the estimated average requirement ( ear ) ( 20 ) .
vitamin and/or mineral supplement use and frequency were recorded , however , due to low prevalence of supplement intake , vitamin d or calcium intake reflected only dietary intake .
venous blood ( 3 ml ) was collected into heparin coated vacutainers followed by centrifugation and storage of plasma at 20c and was then transported on ice packs in coolers to mcgill university and stored at 80c until analysis .
height was measured to the nearest 0.1 cm using a portable stadiometer ( road rod214 portable stadiometer , seca ) and weight was measured to the nearest 0.1 kg using an electronic scale .
bmi - for - age z - score ( baz ) , height - for - age z - score ( haz ) and weight - for - age z - score ( waz ) were calculated and interpreted using the world health organization ( who ) child growth charts for children ( 21 ) .
the non - dominant calcaneus was measured using ultrasound sahara sonometer ( hologic , bedford , ma , usa ) .
measurement of the os calcis consisted of bua ( expressed in decibels per megahertz , db/mhz ) and sos ( expressed in meters per second , m / s ) . the quantitative ultrasound device measures bua and sos and the results are combined to estimate bmd .
ultrasound bone densitometry was shown to be sensitive enough to detect physiological bone development in childhood ( 22 ) and compromised bone health in diseased children ( 16 ) . at the start of each clinical day ,
briefly , the machine was checked using a control bone also known as a phantom .
these assessments were recorded in a quality control log and tracked to ensure the machine was working consistently .
plasma alkaline phosphatase ( alp ) and total calcium were measured by beckman coulter dc 800 ( beckman coulter inc . ,
the laboratory participated in external validation and received a proficiency certificate for 20092010 from digitalpt .
high sensitivity c - reactive protein ( crp ) was measured in the serum using enzyme linked immunosorbance assay .
plasma 25(oh)d and parathyroid hormone ( pth ) concentrations were measured using liaison total 25(oh)d and n - tact pth assays ( diasorin inc . ,
stillwater , mn , usa ) at mcgill university . the inter - assay and the intra - assay coefficient of variation ( cv ) were 4.5 and 11.1% for the low 25(oh)d control ( 38.2 nmol / l ) and 6.2 and 5.3% for the high 25(oh)d control ( 127.2 nmol / l ) ; the accuracy using the mid - range of the manufacturer s specifications was 95% .
for the pth low control , the inter - assay cv% was 19.1 ( 5.2 pmol / l ) and 8.7 for the high pth control ( 52.1 pmol / l ) .
the laboratory ( hw ) that measured 25(oh)d participated in the vitamin d external quality assessment scheme program and obtained a certificate of proficiency for 20092010 , which reflects that 80% of the reported results fell within 30% of the all - laboratory trimmed mean .
questionnaires and clinical information were entered into a microsoft access database and 24-h dietary recall data were entered using candat ( godin london ) . for outliers ,
all dietary variables exceeding mean+3 standard deviations ( sd ) were substituted with mean+3 sd . for all other variables ,
all variables were tested for normality prior to statistical analysis using shapiro wilk test .
since variables were skewed , spearman correlations were used to identify correlations between bua or sos and different continuous characteristics .
anova , followed by bonferroni post - hoc tests whenever appropriate , were used to determine whether dietary , anthropometric , biochemical and lifestyle factors were different by bua or sos quartiles when variables were continuous and chi - square was used when variables were categorical .
sos and bua measurements were available for 285 children and full multivariable analysis was possible for 211 children , because data on food intake , accurate anthropometry measures , the number of hours spent outside or 25(oh)d concentration were missing .
smirnov test along with visual examination of residual - normal quantile plot , and heteroskedasticity was evaluated using the breusch
variance inflation factors were examined post - regression to ensure the absence of multicollinearity . for all tests ,
values in the text are percent ( 95% ci ) , meanssd , or medians with interquartile ranges ( iqr ) .
although 388 children participated in the health survey , not all children had bmd measures .
children with available sos and bua measures ( n=285 ) were similar to those with unavailable values ( n=103 ) for age , gender , bmi percentile , number of hours spent outside , amount of tf consumed the previous day , milk intake , calcium intake , vitamin d intake , carbohydrates intake , protein intake , fat intake , pufa intake , monounsaturated fatty acids ( mufa ) intake , saturated fatty acids ( sfa ) intake , plus concentrations of crp , alp , total calcium , pth , and 25(oh)d .
thus , results are presented for only the 285 children with available bmd measures ( table i ) . selected characteristics of inuit preschool children :
nunavut inuit child health survey , 20072008a
values are percent , meansd , or median [ iqr ] . according to world health organization ( 23 ) .
crp values 8 ng / ml indicating active infection ( 40 ) were excluded ( n=8 ) .
the average latitude of communities participating in the study was 65.2 [ 95% ci : 64.865.6n ] .
median plasma total calcium , alp , crp , and pth concentrations of inuit preschoolers fell in the normal range .
however , median 25(oh)d concentration was below 50 nmol / l ( table i ) with 57.5% [ 95% ci : 50.964.1% ] of the children below this cut off and 82.2% were below 75 nmol / l . of inuit preschoolers , 60.9% met the ear of 800 mg / d for calcium while 10.5% met the ear of 10 g / d for vitamin d. since correlation coefficients were similar between boys and girls , all participants were analyzed together .
anthropometric variables , including waz , haz and baz correlated significantly ( p<0.01 ) with sos ( r=0.21 , 0.19 and 0.19 , respectively ) .
anthropometric variables , including waz , haz and baz correlated significantly ( p<0.01 ) with bua ( r=0.39 , 0.28 and 0.32 , respectively ) . none of the dietary variables , including energy ( kcal / d ) , carbohydrates ( g / d ) , fat ( g / d ) , sfa ( g / d ) , mufa ( g / d ) , pufa ( g / d ) , vitamin d ( g / d ) and calcium ( mg / d ) correlated significantly with either bua or sos , except protein ( g / d ) .
none of the food groups , including milk intake ( ml / d ) , dairy products including milk ( servings / d ) , fruits and vegetables ( servings / d ) , tf ( g / d ) , frequency of fish consumption ( times / month ) and frequency of marine mammals consumption ( times / month ) correlated significantly with bua or sos .
none of the biochemical variables , including 25(oh)d ( nmol / l ) , pth ( pmol / l ) , calcium ( mmol / l ) or crp ( mg / l ) , correlated with sos and bua , except alp ( u / l ) .
alp correlated positively with sos ( r=0.17 , p=0.02 ) . from the lifestyle variables ,
latitude inversely correlated with sos ( r=0.11 , p=0.04 ) while it did not correlate with bua and the number of hours spent outside ( h / d ) did not correlate with either variables .
children in the sos and bua quartiles were not different by age ( years ) , sex ( m / f ) , presence of an active hunter in the household ( yes / no ) , carbohydrates intake , milk intake , fruits and vegetables intake , tf intake , fish and marine mammals , plasma crp , calcium , pth and latitude .
however , children in the highest quartile of sos or bua had higher bmi and baz compared to those in quartiles 1 ( tables ii and iii ) . also , children in sos quartile 4 had higher alp compared to those in quartile 3 , while results were not different by bua quartiles .
comparison of selected characteristics by broadband ultrasound attenuation of inuit preschool children : nunavut inuit child health survey , 20072008 data were log - transformed or square rooted before statistical analysis .
values are median [ iqr ] and geometric meanssd . for a variable , means for variables with superscripts without a common letter differ , p0.05 .
comparison of selected characteristics by speed of sound quartiles of inuit preschool children : nunavut inuit child health survey , 20072008 .
values are median [ iqr ] and geometric meanssd . for a variable , means for variables with superscripts without a common letter differ , p0.05 .
data derived from 24-h recall . using multivariate linear regression , higher bmi and mufa intake plus older age were the only positive predictors of bua in inuit preschool children ( table iv ) , while age , sex , number of hours spent outside , vitamin d status ( 0<75 and
175 nmol / l ) , energy , saturated fat , vitamin d , protein and calcium intake did not contribute to the model .
on the other hand , only higher bmi was a significant predictor of sos in inuit preschoolers ( r=0.19 , p<0.01 ) ( table v ) .
predictors of broadband ultrasound attenuation of inuit preschool children : nunavut inuit child health survey , 20072008a , b
multivariate linear regression . the number of hours spent outside , vitamin d status , sex , energy , protein ,
predictors of speed of sound of inuit preschool children : nunavut inuit child health survey , 20072008a , b
multivariate linear regression .
the number of hours spent outside , vitamin d status , latitude , sex , age , energy , protein , vitamin d and calcium intake did not contribute to the model .
this is the first study to report upon parameters of bone health in inuit children .
children in the highest sos and bua quartile had higher adiposity , as measured using bmi than those in quartile 1 .
the strongest predictors of bua were higher bmi , older age and higher mufa while only higher bmi was a predictor of sos .
previous studies suggest aboriginal children as a group are at a higher risk for low bone mass compared to other canadian infants as a function of low vitamin d status ( 23 ) .
it appears from this sample that median vitamin d concentration of inuit preschoolers was below the 50 nmol / l cut - off recommended by the institute of medicine ( 20 ) .
in contrast to the suggested hypothesis , vitamin d intake and plasma 25(oh)d concentration , regardless of the definition of optimal concentration ( 50 or 75 nmol / l ) in the regression model , were not associated with sos and bua in our cross - sectional analysis .
very few children ( 18% ) had 25(oh)d values in the range suggested to enhance bone health ( 75
( 25 ) and zochling et al . ( 18 ) did not find an association between vitamin d status and qus parameters among large samples of institutionalized elderly .
on the other hand , using dual - energy x - ray absorptiometry , among a younger sample of 1215 year - old adolescents recruited throughout the year , in the united kingdom , vitamin d status ( 74.1
nmol / l ) was not associated with heel bmd . however , within the same study , only girls with high vitamin d status ( 74.1
it has been suggested that the effect of vitamin d on the skeleton may be site - specific ( 27 ) . using multivariable linear regression ,
the effect of age on bua was in agreement with results derived from quantitative ultrasound ( 28,29 ) .
further , bmi was a significant predictor of sos and bua in the multivariable linear regression model , as hypothesized .
similarly , anthropometry including weight and bmi were positively associated with bua ( 29,30 ) and sos ( 28,31 ) in children and adults , but not once obesity is reached .
an increasing number of studies suggests that a bmi>30 kg / m might interfere with bone health ( 32 ) . in the current study , at this age and in absence of obesity , the lifestyle variables support accommodation of bone to the larger weight bearing load .
similar results were reported by others among school - aged children using quantitative ultrasound ( 29,33 ) .
however , zhu et al . ( 28 ) found gender differences , measured by bua , between the ages of 12 to 13 years old .
similarly , mufa intake was positively associated with bone health , particularly bmd measured by single photon absorptiometry , in both men and women in an epidemiological study in greece ( 34 ) .
it is important to point out the main source of mufa , in the greek diet , is olive oil , which also contains pufa .
likewise , the inuit diet is known to be high in mufa and pufa , particularly derived from marine mammals and their oils ( 35 ) which are also rich sources of vitamin d ( 36 ) . in the present study , mufa , sfa and pufa contributed to 11.1 , 10.0 and 4.6% , respectively , of total energy intake which is close to the intake of 18 year - old canadian children in the canadian community health survey , cycle 2.2 which reported an intake of mufa , sfa and pufa of 11 , 12 and 4% of energy intake ( 37 ) .
children in the 4th quartile of bua or sos tended to have higher intakes of pufa and mufa than children in the first quartile , but these trends did not reach statistical significance .
it is likely that we did not observe any difference in pufa intake , since we did not differentiate between omega 3 and omega 6 and the ratio of omega 6 : omega 3 due to the lack of the data in tf in the canadian nutrient file .
evidence suggests that bmd is positively correlated with omega 3 intake and is negatively associated with omega 6 : omega 3 ratio in both men and women ( 38 ) .
further , children in the higher 2 bua or sos quartiles did not have higher milk intake , dairy intake , tf intake , and monthly consumption of fish and marine mammals .
all of these dietary variables were consumed scarcely , for instance mean daily milk intake of inuit preschoolers was below 1 serving ( data derived from the 24 h recall ) and almost one - third of children did not consume fish and marine mammals in the previous month ( data derived from the ffq ) .
strong evidence suggests that calcium intake and absorption from childhood through early adulthood , is a crucial determinant of bone health throughout life ( 39 ) , however , in the current study , this association was not detected , in contrast to the hypothesis .
this observation is similar to another study among a large sample ( n=1,016 ) of children ( 613 years old ) in taiwan ( 29 ) .
it has been suggested that cross - sectional studies are less sensitive in finding the influence of calcium intake on bone health , in comparison to prospective studies involving calcium interventions ( 40 ) .
recently , we published nutrient intakes of inuit preschoolers using all available 24-h recall data ( n=374 ) ( 12 ) .
mean intake of most nutrients , including protein , vitamin d and calcium was above the recommendations set by the institute of medicine ( 19 ) . only 8.8 and 24.0% met the recommended daily servings of fruits and vegetables and dairy products , respectively , of canada s food guide for first nations , inuit and mtis .
the strength of this study is that , to our knowledge , it is the first to assess bone parameters in inuit children , in combination with vitamin d intake , age , gender , latitude , bmi and other known predictors of bone health .
however , the study findings can not be generalizable beyond inuit preschoolers and because the study was cross - sectional in nature , causality can not be inferred .
further , for pth measurements , intact pth assays were used , instead of bioactive 184 pth assays , that might have cross - reacted with carboxyl - terminal pth fragments and lead to an overestimation of biologically active pth ( 41 ) .
physical activity was not assessed among inuit preschoolers , and the literature has shown positive association between physical activity and bone health ( 39 ) , future studies should take this factor into consideration .
measuring physical activity through a pedometer or accelerometer would be an accurate measure ; however compliance issues are problematic among preschoolers . even though , peripheral quantitative ultrasound is the most suitable method to assess bmd in large populations in the field for its several advantages , being easy , portable , safe , cost - effective , rapid , and radiation - free , this technique is limited by the difficulty to compare its results with those of the dual - energy x - ray absorptiometry ( 16 ) . in summary
, these data suggest that factors in support of bone health in young inuit children are higher mufa intake , older age and bmi .
since the dietary data was mainly derived from the 24 h recall data , further investigation assessing usual intakes of tf and nutrients affecting bone health using multiple 24 h recalls and ffq along with serial assessment of vitamin d status of inuit children across different seasons is required to confirm this observation .
further , future studies should assess physical activity , including weight bearing activities , and body composition , particularly body fat , as important predictors of bone health .
the author s responsibilities were as follows : ge and hw designed research ; jh , ge and hw conducted research ; ge and hw provided essential materials and reagents ; jh analyzed data ; jh wrote the manuscript and ge and hw critically reviewed the manuscript ; jh had primary responsibility for final content .
this study was supported by the canadian federal program for international polar year , canadian institutes for health research , arcticnet , government of nunavut , indian and northern affairs canada , and health canada . | objectivesinvestigate the effects of selected factors associated with quantitative ultrasound parameters among inuit preschoolers living in arctic communities ( 56 3272 40n).materials and methodschildren were selected randomly in summer and early fall ( n=296 ) .
dietary intake was assessed through the administration of a 24-h dietary recall ( 24-h recall ) and a food frequency questionnaire ( ffq ) .
anthropometry was measured using standardized procedures .
plasma 25-hydroxy vitamin d ( 25(oh)d ) and parathyroid hormone ( pth ) were measured using a chemiluminescent assay ( liaison , diasorin ) .
quantitative ultrasound parameters were measured using sahara sonometer , ( hologic inc.).resultschildren divided by speed of sound ( sos ) and broadband ultrasound attenuation ( bua ) quartiles were not different for age ( years ) , sex ( m / f ) , calcium ( mg / d ) and vitamin d intake ( g / d ) and plasma 25(oh)d concentration ( nmol / l ) .
however , children in the highest bua and sos quartile had higher body mass index ( bmi ) compared to those in quartile 1 . using multivariate linear regression , higher bmi ,
older age and monounsaturated fatty acids ( mufa ) intake were predictors of bua while only bmi was a predictor of sos.conclusionsfurther investigation assessing intakes of traditional foods ( tf ) and nutrients affecting bone parameters along with assessment of vitamin d status of inuit children across seasons is required . |
m. tuberculosis is spread through the inhalation of aerosolized droplet nuclei emanating from infected individuals .
it has been shown that proper treatment constitutes a key factor in the control of the disease .
however , with the advent of aids , it has re - emerged in developed countries as well , .
the causes of this increased incidence of tb in developing countries include ineffective control programs , the presence of human immunodeficiency virus ( hiv ) , low socioeconomic status ( poverty and civil unrest ) , rapidly increasing populations , and drug resistance .
similarly , in developed countries , immigration from high - prevalence tb areas , hiv , social deprivation and drug resistance contribute to the increasing incidence of the disease .
studies have shown that international travel , migration and movement of populations can facilitate the spread of tb .
saudi arabia has a unique population dynamic , as annually , more than two million pilgrims visit the country for the hajj pilgrimage , and , in addition , more than six million expatriates living in saudi arabia come from endemic areas .
this study was undertaken to identify the proportion of tb cases due to the non - saudi population and to estimate the impact of poorly screened expatriates working here on the tuberculsosis burden in saudi arabia .
this cross sectional study was carried out in the chest disease hospital , taif , a tertiary care referral hospital in western region of saudi arabia .
cases were defined as patients with pulmonary tb ( sputum positive ) and extra - pulmonary tb , the diagnosis of which was based on standard clinical , radiological and histological criteria .
group a consisted of taif residents , and group b was made up of patients referred from other cities in the country .
all confirmed cases of tb admitted to the hospital from june 2009 to may 2010 were enrolled .
inclusion criteria were diagnosed cases of tb , aged between 14 and 65 , and the study included patients with new onset and/or re - activation of previously diagnosed tb .
similarly , the pattern of their tb , individual diagnostic procedures and treatment plans , as well as any eventual complications were also recorded .
the study was carried out with the approval of the hospital ethical committee , and was conducted in full compliance with the guidelines laid down in 1964 and later amendments in the ethical principles for medical research involving human subjects statement of the world medical assembly declaration of helsinki .
the data was entered on microsoft excel and statistical analysis was carried out using spss version 13 .
descriptive statistics were used to describe the basic features of the data in this study .
univariate analysis was done to evaluate the patterns of distribution , the main tendencies and the dispersion of the disease .
the data was entered on microsoft excel and statistical analysis was carried out using spss version 13 .
descriptive statistics were used to describe the basic features of the data in this study .
univariate analysis was done to evaluate the patterns of distribution , the main tendencies and the dispersion of the disease .
4 patients for potential inclusion were excluded ( 2 had carcinoma lung , 1 had hepatic encephalopathy and 1 had lymphoma ) , and finally data on 686 patients with confirmed tb was analyzed .
group a ( n=110 ) comprised patients from taif and group b ( n=576 ) consisted of patients coming from other cities . as shown in table 1 ( tab .
1 ) in both groups , most of the patients were aged 20 to 29 . among the 110 patients in group
similarly , among the 576 patients in group b , 403 ( 69.97% ) were males and 173 ( 30.03% ) were females .
diverse ethnic groups were represented in both group a and group b. 80 patients in group a were saudi nationals , as were 290 in group b ( table 2 ( tab .
2 ) ) . the total number of saudi patients in both groups was 370 ( 54% ) .
110 patients came from taif , 233 from makah , 275 from jeddah and 30 from qunfuda ( figure 1 ( fig .
a , 70 ( 63.64% ) patients had pulmonary tb while 40 ( 36.36% ) had extra - pulmonary tb . in group
b , 457 ( 79.34% ) patients were diagnosed with pulmonary tb and 119 ( 20.66% ) patients were suffering from extra - pulmonary tb . thus pulmonary tb was found to be more prevalent in group b , while the same was true of extra - pulmonary tb in group a. in group a , 19 ( 17.27% ) patients had a history of contact with tb individuals , while 91 ( 82.73% ) had no previous history of contact . on the other hand , in group b , out of 576 patients , 128 were found to have a history of tb patient contact ( table 3 ( tab .
overall , of the 686 patients in our study , 599 ( 87.32% ) were newly diagnosed and 87 ( 12.68% ) were re - treated cases of tb .
ten patients suffered from hypertension ( htn ) , 18 patients had diabetes mellitus ( dm ) and htn , and 15 had dm , htn and ischemic heart disease ( ihd ) .
18 patients had various other ailments such as bronchial asthma , benign prostatic hypertrophy , chronic renal failure , chronic obstructive pulmonary disease , poliomyelitis , bronchiectasis , hypothyroidism , hepatitis b and c , cerebrovascular accidents , epilepsy , schizophrenia and peptic ulcer disease ( table 4 ( tab .
x - ray chest studies showed bilateral radiological characteristics of tb in 22 patients , whereas 65 had unilateral findings in which the upper lobe of lung ( either right or left ) was predominantly involved .
all patients had been treated with the standard treatment of four drugs ( isonicotinylhydrazine ( inh ) , rifampicin , ethambutol , pyrazinamide ) for an initial 2 months , and , in cases of pulmonary tb , followed by a combination of inh and rifampicin for another 4 months .
patients were admitted as in - patients until their sputum was negative , and were then followed up in their local centers later . in group
a all 110 patients could be contacted on phone and followed up while in group b only 119 out of 576 patients could be followed up .
hence , of a total of 686 patients , only 229 could be followed up .
, either the patients had provided wrong phone numbers , or else their telephone services had expired .
another common reason was that some of these patients could have been illegal immigrants who feared questioning , and we could not follow them . in group a , 3 patients had died ( mortality rate 2.7% ) and in group b , 11 patients had died ( mortality rate 9.24% ) .
thus an overall mortality of 6.1% was to be observed in this study ( table 5 ( tab .
all patients had been treated with the standard treatment of four drugs ( isonicotinylhydrazine ( inh ) , rifampicin , ethambutol , pyrazinamide ) for an initial 2 months , and , in cases of pulmonary tb , followed by a combination of inh and rifampicin for another 4 months .
patients were admitted as in - patients until their sputum was negative , and were then followed up in their local centers later . in group
a all 110 patients could be contacted on phone and followed up while in group b only 119 out of 576 patients could be followed up .
hence , of a total of 686 patients , only 229 could be followed up .
in some cases , either the patients had provided wrong phone numbers , or else their telephone services had expired .
another common reason was that some of these patients could have been illegal immigrants who feared questioning , and we could not follow them . in group a ,
3 patients had died ( mortality rate 2.7% ) and in group b , 11 patients had died ( mortality rate 9.24% ) .
thus an overall mortality of 6.1% was to be observed in this study ( table 5 ( tab .
its incidence has increased , due to the interesting and unique population dynamics of this country . of 6 million expatriate workers living in saudi arabia ,
the majority come from areas where tb is endemic , a factor which could be affecting the increased prevalence of tb in saudi arabia . in our study
these cities are close to the hajj regions , where more than 2 million pilgrims from all over the world come annually to perform hajj .
previous studies have shown that tb infection in jeddah ( the main sea and airport for pilgrims arriving into mecca ) can reach up to 64 cases per 100,000 , compared with 32 per 100,000 in central regions like riyadh .
qureshi et al . observed that cough was the most common complaint , affecting more than 50% of pilgrims , and also that the commonest cause of pneumonia among hospitalized pilgrims visiting saudi arabia during the hajj was tb . in our study of 686 patients , 316 ( 46.1% ) were non - saudi , working in this country , as shown in table 2 ( tab .
these immigrant nationalities have a high incidence of tb . of saudi cities , qunfuda city had the highest number of tb cases , probably because of poor socioeconomic living standards and may be the high numbers of illegal expatriates working there .
this leads to the suspicion that workers coming to saudi arabia are not properly evaluated in their home countries before leaving to take up employment in saudi arabia .
it raises many questions about the fitness certificates issued by the various health institutions of these parent countries prior to their nationals leaving them to seek employment in saudi arabia .
the authors concluded in their study that the large number of falsified health certificates issued by their home countries to non - national drivers working in saudi arabia added to the transmission of tb .
having said this , it is pertinent to mention that the ministry of health in saudi arabia urgently needs to take up the matter with various countries so that employees and pilgrims are properly evaluated in their countries of origin prior to their visit to saudi arabia .
conducted a prospective study among singaporean hajj pilgrims by applying quantiferon tests both before and 3 months after their hajj .
the authors of this study were of the opinion that pilgrims may be at a higher risk of acquiring tb during hajj .
consequently , all countries need to co - operate to ensure proper screening of pilgrims for the hajj and the umrah in order to avoid the pooling of tb and its subsequent transmission . the saudi arabian ministry of health has previously recommended the use of face masks during pilgrimage in order to prevent the spread of airborne diseases during pilgrimages but unfortunately compliance remains poor .
the question of which methods to use for the identification of latent tb ( ltbi ) is open .
the tuberculin skin test ( tst ) has high sensitivity , but low specificity , especially in bacillus calmette - gurin ( bcg)-vaccinated individuals , because of cross - reactivity to non - tubercular mycobacterias ( ntm ) or due to a booster - effect caused by repetitive testing .
blood based interferon - gamma release assays ( igra ) offer better specificity ( 98100% ) and at least as good sensitivity ( 7097% ) as the tst , since they are unaffected by previous bcg vaccination and most ntm , , , .
concerning the cost factors , whether routine igra would be better for screening instead mass usage of tst prior to hajj and umrah needs to be studied .
our study has shown an increased incidence of tb among young adult males ( in both group a and group b ) , and these results concur with the conclusions of other researchers as well , .
we observed pulmonary tb more frequently than extra - pulmonary tb with predominant unilateral and apical lobe lung involvement .
because of its high potential for transmission to others , the discovery of cases of pulmonary tb raises the alarm among health planners , and emphasizes the need for hyper - conservative approach to prevent its spread .
control measures such as health education , actively searching for and identifying cases , and prompt and well - supervised medical treatment are all needed to curb the ongoing transmission of tb .
it has been recommended that more studies using molecular techniques are carried out in order to establish the real incidence of cross infection in saudi arabia .
in addition , molecular techniques are to be instituted in all reference laboratories to help the detection of ongoing active transmission and the molecular epidemiology of this infection . pilgrims and many illegal expatriate workers in saudi arabia who develop tb do not report to the hospitals fearing questioning etc .
as has been described in this study of 686 patients , we could follow only 286 patients , as illegal residents commonly escape follow - up after 2 to 3 weeks of treatment . unfortunately
, often these individuals take refuge on large farms or within the households of local nationals . in so doing ,
they ultimately contribute towards the transmission of tb and the development of drug resistant strains of the disease .
the limitations of our study are that , due to the factors described above , owing to the difficulty we experienced in following up some of the patients in the study , we could neither predict resistant cases of tb , nor could we identify the predictors of mortality .
possibly a proper way of reception , documentation , admissions and reassurance regarding the confidentiality of our follow - up of the patients could rectify such limitations in future . in conclusion , our study brings to the fore the urgent need for improved tb surveillance of non - saudi workers and pilgrims , in their home countries .
the conclusions drawn from this study highlight the need for concerted and effective action by those international health services connected with pilgrimage and migrant labour as well as by the ministry of health saudi arabia so that burden of tb is effectively controlled .
| background : international travel , migration and human population movements facilitate the spread of tuberculosis ( tb).objective : to study the impact of poorly screened expatriates working in saudi arabia on the local incidence of tbs.patients and methods : this cross sectional study was carried out in the chest disease hospital , taif .
all confirmed cases of tb from june 2009 to may 2010 admitted to the hospital were enrolled .
inclusion criteria were diagnosed cases of tb ( pulmonary & extra - pulmonary ) in patients between the ages of 14 to 65 years .
patients with hiv and coexistent malignancies were excluded .
the age , gender and ethnic group of each patient was recorded , and patients were divided into two groups .
of the two groups , group a consisted of taif residents and group b of patients referred from other cities in the country.results : of the 686 cases studied , 370 ( 54% ) were saudi nationals ( group a = 80 & group b = 290 ) and 316 ( 46% ) cases were from other countries .
males outnumbered females and most of the patients were aged 20 to 29 years .
the number of cases from the areas close to the pilgrimage sites , i.e. makah ( 233 ) and jeddah ( 275 ) , outnumbered those in taif ( 110).conclusions : our study identifies an increased prevalence of tb cases in areas close to the pilgrimage ( group b ) .
the higher proportion of non - saudi tb patients in group b is most likely explained by the higher number of poorly screened illegal expatriates in the region . |
between 1999 and 2005 , 27 m. tuberculosis strains were isolated for sequencing from unique patients in madurai and 196 strains from 169 unique patients in tiruvallur .
the sample set included data from 154 males and 42 females with median age 39 14.5 years .
for each strain , resistance to isoniazid , ethambutol , rifampicin , and streptomycin was determined .
in order to examine genetic features of m. tuberculosis strains from southern india , we generated high - quality whole genome sequences for 223 isolates ( table 1 ; supplementary table 1 ) . within our data set , phenotypic drug resistance , including mdr - tb , was not significantly associated with relapse , gender , smoking or drinking ( fisher exact test , p > .05 ) , even after correcting for over - representation from related same - patient isolates ( see methods ) .
hiv status was only known for strains from madurai , all of which were hiv positive , and only 5 of which were drug resistant ( table s1 ) .
we did not detect a significant association between strains from hiv - positive hosts and mdr or drug resistance though sample size was small .
summary of strain information for the set of 201 strains , after removing highly similar strains found within the same patient a ) distribution of strains with resistant and susceptible phenotypes for each of the four drugs tested .
for streptomycin , an additional 11 strains did not have dst information for this drug
198 of the 201 strains
, we constructed a phylogenetic tree and used digital spoligotyping ( see methods ) to determine lineages and spoligotypes ( supplementary figures 12 ) .
lineage 1 strains dominated among newly sequenced isolates ( table 1 ) , representing 141 ( 70% ) of strains after correcting for over - representation from related same - patient isolates .
the relative abundances of lineages 1 and 3 were in agreement with earlier epidemiological observations [ 2 , 3 ] . to place our strains within a global context
, we constructed a phylogeny combining genomic data from newly sequenced strains with a previously published set of sequences from 243 globally diverse m. tuberculosis isolates ( figure 1 ) .
although lineage 1 and 3 isolates from the published comas study were phylogenetically intermingled with newly sequenced strains , the average distance between a new strain and its closest relative from the comas set was 313 single - nucleotide polymorphisms ( snps ) ( range : 71833 ) , representing an average divergence of > 500 years ( range : 1182276 years ) ( see detailed methods ) .
in contrast , we observed deeply branching clusters composed solely of indian strains , with many strains having few or no snp differences ( average 147 snps , range 0810 snps , and representing an average divergence time of 245 years with times ranging from 0 to 2,700 years ) .
based on the number of unique snps , the new genomic data from lineage 1 and 3 isolates roughly doubled the known genetic diversity within these lineages ( supplementary table 2 ) .
phylogeny of all 223 newly sequenced strains , together with 243 previously published strains from comas et al .
branches are colored according to lineage , and outer ticks are colored according to dataset of origin and geographic location . for each strain
, we performed variant detection relative to the m. tuberculosis h37rv reference genome ( see detailed methods ) and identified a total of 67722 variable snp loci that were used to construct this phylogeny . .
in addition to revealing close relationships among isolates from this study , the phylogeny indicated that recent transmission of strains was occurring among patients from the same and not different regions . to examine this more systematically , we clustered all strains from this study into clonal groups having 10 snp differences ( see methods ) , a threshold previously used to define recent transmission [ 17 , 28 ] .
six of the 22 clonal groups ( d28 , d15 , d30 , d1 , d8 , and m4 ) contained strains from more than 1 patient ( figure 2 ; table 2 ) , and none contained strains from both madurai and tiruvallur .
instead , strains from each of these clones were from patients reporting to the same treatment center , indicating recent transmission was highly localized . in all but 1 case ,
patients having the same clone were infected with a susceptible strain . in the exceptional clone , m4 ( figure 2 )
, we observed that an isoniazid monoresistant strain from patient 54 belonged to the same clone as three isoniazid and rifampicin - resistant strains isolated from patient 97 more than 8 months later , indicating that a strain from this clonal group likely acquired rifampicin resistance during this time period ; however , resistance could have occurred earlier in either patient or in an unsampled individual .
indicates drug susceptibility for isoniazid ( inh ) , ethambutol ( emb ) , rifampicin ( rif ) and streptomycin ( str )
genotypic resistance is determined based on the cohen et al
. set clonal groups overlaid onto a phylogeny of all 223 newly sequenced strains from southern india .
the central rings of dots indicate susceptibility phenotypes for isoniazid ( 11 ) , rifampicin ( 11 ) , ethambutol ( 11 ) , and streptomycin ( 11 ) ( from inside to outside , marked as ires ) . a gray missing
, the next ring is a numeric patient identifier , followed by clonal group i d ( in red ) and treatment center .
treatment centers p01-p14 are in tiruvallur , whereas all madurai strains are from the gov . rajaji hospital .
clonal groups d16 and d24 contained a strain that lacked patient information and were excluded from further analysis .
our strain collection was enriched for drug resistant isolates , as compared to the overall incidence of drug - resistant m. tuberculosis in india ( see methods ) .
isoniazid resistant strains were most common ( 36 strains ; table 1a ) , consistent with previous observations from other global regions [ 29 , 30 ] . using a parsimony - based analysis ( see methods ) , we determined that resistance to isoniazid arose 33 independent times across the phylogeny . for 4 isoniazid / rifampicin pairs of resistance arisals across the nodes of our phylogeny , we had sufficiently dense sampling to determine relative ordering .
although there were only a small number of resistance pairs for which we could determine the order , the observation that isoniazid arose first in all 4 cases is in agreement with results from previously published genomic studies from south africa and south america .
recent sequencing studies suggest that known mutations can account for the majority of phenotypic resistance [ 1619 ] but have been far from exhaustive in representing global m. tuberculosis diversity . to assess how well - known mutations explain drug resistance in india
, we calculated how well 2 previously published mutation lists explained phenotypic resistance in these isolates .
these lists included ( 11 ) 1325 mutations explaining resistance to 15 drugs ( coll set ) and ( ii ) a curated list of polymorphisms explaining resistance to eight drugs ( cohen set ; table 3 ) .
the sensitivity to predict isoniazid resistance among strains from southern india was 73% for the coll set and 74% for the cohen set .
overall , these sensitivities were significantly lower than those reported from an analysis of isolates from the united kingdom , sierra leone , and south africa ( > 85% ) but were similar to an earlier study from southern india in which isoniazid resistant strains had a lower frequency of known katg mutations .
the sensitivities for detecting rifampicin , streptomycin , and ethambutol resistance ( 73% , 2760% , and 5080% , respectively ) were also lower than those reported for other geographic regions by walker et al .
( 92% , 82% , and 82% , respectively ) and desjardins et al .
( > 90% ) , indicating that novel mechanisms may drive some drug resistance in india .
though novel rpob and gidb mutations previously identified in indian strains were not included in either list , neither mutation was present within this set of strains [ 20 , 21 ] .
notably , 27% of rifampicin resistant strains lacked mutations in the resistance - determining region of rpob , the basis for a widely used mdr - tb diagnostic [ 34 , 35 ] .
we confirmed that our results extended to other published mutation lists and that overall sensitivity was only marginally improved by including any mutation that would impact the resulting protein in genes associated with resistance ( see supplementary note and supplementary figure 3 ) .
sensitivity and specificity for predicting phenotypic resistance using the coll et al . and cohen et al .
lists of mutations
ambiguous single - nucleotide polymorphism calls , with reads supporting a drug sensitive and a drug resistant genotype .
the large number of false positives for streptomycin using the coll dataset is due to the presence of the embb e378a mutation , which other publications suggest does not cause ethambutol resistance .
this mutation has been previously reported as a phylogenetic marker of lineage 1 of the ancestral mtbc , and this mutation is indeed present in most lineage 1 strains in this collection .
analysis performed for 201 strains , after removing highly similar strains found within the same patient . to further examine cases of unexplained resistance
, we first searched for potential novel mutations within genes previously implicated in resistance but not found in our mutation lists .
of the 9 strains with unexplained isoniazid resistance ( table 4 ; supplementary figure 4 ) , one encoded the katg n138s mutation , previously implicated in resistance but not present on either list .
three strains contained mutations in 1 or more well - recognized resistance - determining targets , katg ( a290p or l427p ) , fade24 ( r454s ) or fabd ( a159 t ) , that had not previously been implicated in resistance but that were specific to resistant strains in this study ( table 4 ; supplementary figure 4 ) .
the remaining 4 strains lacked mutations in genes previously associated with isoniazid resistance ( table 4 ; supplementary figure 4 ) . for streptomycin , we identified mutations in gidb and rrs ( gidb r137w and rrs 877 ) that may explain resistance for 2 of these strains .
however , for all remaining isolates with unexplained resistance ( 4 rifampicin- , 2 ethambutol- , and 2 streptomycin - resistant isolates ) , we could identify no additional candidate resistance - conferring mutations .
overview of phenotypic drug resistance not explained by either the mutations in the coll et al . or cohen et al .
lists , or by mixed infections .
putative novel mutation is defined by a non - synonymous mutation in a gene previously associated with drug resistance that was confined to phenotypically resistant isolates .
unexplained is defined when no new mutations were identified within genes previously associated with drug resistance . published mutation is defined by mutations not present in either the coll et al . or cohen et al .
mutation sets , but were previously associated with drug resistance .
multiple entries in the strain identifier column correspond to same - patient strains with high identity
previously published mutations , which were not included in either the coll et al . or cohen et al .
recent studies suggest that tuberculosis patients can be infected with more than 1 m. tuberculosis strain , including strains with differing resistance profiles [ 3740 ] .
we searched for evidence of mixed infections by , first , comparing repeat isolates from single patients and , second , examining variant data to identify evidence for conflicting base calls at sites implicated in resistance .
sixteen patients were sampled multiple times : 8 patients were sampled at different time points , and 14 were sampled multiple times on the same day .
consistent with rates from other studies [ 41 , 42 ] , none of the isolates collected from same - day , same - patient samplings belonged to different clonal groups ( supplementary table 3 ) , differing by only 06 snps , and indicating that same - day , within - patient m. tuberculosis sequence variation is low . with one exception ,
for longitudinally sampled patients , the first and last isolate(11 ) differed by only 28 snps , also supporting limited diversity .
the exception ( patient 38 ) was represented by 2 isolates differing by 301 snps , collected 6 months apart . given slow mutation rates [ 17 , 27 ] and lack of recombination [ 43 , 44 ] in m. tuberculosis , these 2 isolates were either transmitted to this patient at the initial point of infection or were acquired at different times . though we observed very consistent genotypes within the same patient , 3 longitudinally sampled patients exhibited changes in drug resistance phenotypes over the study ( supplementary table 3 ) . however , we observed no accompanying genotypic change that could explain this change , even when we expanded our analysis to include any changes in known resistance targets . because m. tuberculosis cells are known to bundle , making it difficult to isolate single genotypes in culture
, we hypothesized that unexplained changes in phenotype may be due to mixed communities of genotypically distinct strains that we could detect through sequencing .
however , we could find no evidence for ambiguity in any gene previously associated with drug resistance among these isolates .
using the same strategy , we systematically examined all strains for examples of mixed infections that could help explain cases of unexplained resistance ( table 4 ) .
fifteen strains had ambiguous variant calls within genes known to be involved in resistance ( supplementary table 4 ) , including 7 strains with ambiguous calls at sites found within the coll and cohen sets ( table 3 ; supplementary table 4 ) . in these cases , we observed additional ambiguous positions at > 10 positions with similar allele ratios at other non resistance - associated sites , indicating mixed infections with nonclonal strains .
ambiguous at 2 known resistance sites found in the coll and cohen sets , as well as at 3 other sites within genes known to be involved in resistance .
at each site , the major allele was observed 5258% of the time ( supplementary table 4 ) .
although we detected strains having ambiguity at sites within drug resistance genes not present within the cohen and coll sets , none of these ambiguities could explain additional resistance for isolates in table 4 . despite this , the fact that at least 7% of our strains had ambiguity within drug resistance genes , and that ambiguous sites were not taken into account when we calculated sensitivity and specificity of known mutations to explain resistance , underscores mixed infections as a confounder of genotype - based predictions of phenotypes .
using whole genome data , we constructed a phylogenetic tree and used digital spoligotyping ( see methods ) to determine lineages and spoligotypes ( supplementary figures 12 ) .
lineage 1 strains dominated among newly sequenced isolates ( table 1 ) , representing 141 ( 70% ) of strains after correcting for over - representation from related same - patient isolates .
the relative abundances of lineages 1 and 3 were in agreement with earlier epidemiological observations [ 2 , 3 ] . to place our strains within a global context
, we constructed a phylogeny combining genomic data from newly sequenced strains with a previously published set of sequences from 243 globally diverse m. tuberculosis isolates ( figure 1 ) .
although lineage 1 and 3 isolates from the published comas study were phylogenetically intermingled with newly sequenced strains , the average distance between a new strain and its closest relative from the comas set was 313 single - nucleotide polymorphisms ( snps ) ( range : 71833 ) , representing an average divergence of > 500 years ( range : 1182276 years ) ( see detailed methods ) .
in contrast , we observed deeply branching clusters composed solely of indian strains , with many strains having few or no snp differences ( average 147 snps , range 0810 snps , and representing an average divergence time of 245 years with times ranging from 0 to 2,700 years ) .
based on the number of unique snps , the new genomic data from lineage 1 and 3 isolates roughly doubled the known genetic diversity within these lineages ( supplementary table 2 ) .
phylogeny of all 223 newly sequenced strains , together with 243 previously published strains from comas et al .
branches are colored according to lineage , and outer ticks are colored according to dataset of origin and geographic location . for each strain
, we performed variant detection relative to the m. tuberculosis h37rv reference genome ( see detailed methods ) and identified a total of 67722 variable snp loci that were used to construct this phylogeny . .
in addition to revealing close relationships among isolates from this study , the phylogeny indicated that recent transmission of strains was occurring among patients from the same and not different regions . to examine this more systematically , we clustered all strains from this study into clonal groups having 10 snp differences ( see methods ) , a threshold previously used to define recent transmission [ 17 , 28 ] .
six of the 22 clonal groups ( d28 , d15 , d30 , d1 , d8 , and m4 ) contained strains from more than 1 patient ( figure 2 ; table 2 ) , and none contained strains from both madurai and tiruvallur . instead
, strains from each of these clones were from patients reporting to the same treatment center , indicating recent transmission was highly localized . in all but 1 case ,
patients having the same clone were infected with a susceptible strain . in the exceptional clone , m4 ( figure 2 )
, we observed that an isoniazid monoresistant strain from patient 54 belonged to the same clone as three isoniazid and rifampicin - resistant strains isolated from patient 97 more than 8 months later , indicating that a strain from this clonal group likely acquired rifampicin resistance during this time period ; however , resistance could have occurred earlier in either patient or in an unsampled individual .
indicates drug susceptibility for isoniazid ( inh ) , ethambutol ( emb ) , rifampicin ( rif ) and streptomycin ( str )
genotypic resistance is determined based on the cohen et al
. set clonal groups overlaid onto a phylogeny of all 223 newly sequenced strains from southern india .
the central rings of dots indicate susceptibility phenotypes for isoniazid ( 11 ) , rifampicin ( 11 ) , ethambutol ( 11 ) , and streptomycin ( 11 ) ( from inside to outside , marked as ires ) . a gray missing
, the next ring is a numeric patient identifier , followed by clonal group i d ( in red ) and treatment center .
treatment centers p01-p14 are in tiruvallur , whereas all madurai strains are from the gov . rajaji hospital .
clonal groups d16 and d24 contained a strain that lacked patient information and were excluded from further analysis .
our strain collection was enriched for drug resistant isolates , as compared to the overall incidence of drug - resistant m. tuberculosis in india ( see methods ) .
isoniazid resistant strains were most common ( 36 strains ; table 1a ) , consistent with previous observations from other global regions [ 29 , 30 ] . using a parsimony - based analysis ( see methods ) , we determined that resistance to isoniazid arose 33 independent times across the phylogeny . for 4 isoniazid / rifampicin pairs of resistance arisals across the nodes of our phylogeny , we had sufficiently dense sampling to determine relative ordering . in all 4 cases , isoniazid arose first .
although there were only a small number of resistance pairs for which we could determine the order , the observation that isoniazid arose first in all 4 cases is in agreement with results from previously published genomic studies from south africa and south america .
recent sequencing studies suggest that known mutations can account for the majority of phenotypic resistance [ 1619 ] but have been far from exhaustive in representing global m. tuberculosis diversity . to assess how well - known mutations explain drug resistance in india
, we calculated how well 2 previously published mutation lists explained phenotypic resistance in these isolates .
these lists included ( 11 ) 1325 mutations explaining resistance to 15 drugs ( coll set ) and ( ii ) a curated list of polymorphisms explaining resistance to eight drugs ( cohen set ; table 3 ) .
the sensitivity to predict isoniazid resistance among strains from southern india was 73% for the coll set and 74% for the cohen set .
overall , these sensitivities were significantly lower than those reported from an analysis of isolates from the united kingdom , sierra leone , and south africa ( > 85% ) but were similar to an earlier study from southern india in which isoniazid resistant strains had a lower frequency of known katg mutations .
the sensitivities for detecting rifampicin , streptomycin , and ethambutol resistance ( 73% , 2760% , and 5080% , respectively ) were also lower than those reported for other geographic regions by walker et al .
( 92% , 82% , and 82% , respectively ) and desjardins et al .
( > 90% ) , indicating that novel mechanisms may drive some drug resistance in india .
though novel rpob and gidb mutations previously identified in indian strains were not included in either list , neither mutation was present within this set of strains [ 20 , 21 ] .
notably , 27% of rifampicin resistant strains lacked mutations in the resistance - determining region of rpob , the basis for a widely used mdr - tb diagnostic [ 34 , 35 ] .
we confirmed that our results extended to other published mutation lists and that overall sensitivity was only marginally improved by including any mutation that would impact the resulting protein in genes associated with resistance ( see supplementary note and supplementary figure 3 ) .
sensitivity and specificity for predicting phenotypic resistance using the coll et al . and cohen et al .
lists of mutations
ambiguous single - nucleotide polymorphism calls , with reads supporting a drug sensitive and a drug resistant genotype .
the large number of false positives for streptomycin using the coll dataset is due to the presence of the embb e378a mutation , which other publications suggest does not cause ethambutol resistance .
this mutation has been previously reported as a phylogenetic marker of lineage 1 of the ancestral mtbc , and this mutation is indeed present in most lineage 1 strains in this collection .
analysis performed for 201 strains , after removing highly similar strains found within the same patient . to further examine cases of unexplained resistance , we first searched for potential novel mutations within genes previously implicated in resistance but not found in our mutation lists . of the 9 strains with unexplained isoniazid resistance ( table 4 ; supplementary figure 4 ) ,
one encoded the katg n138s mutation , previously implicated in resistance but not present on either list .
three strains contained mutations in 1 or more well - recognized resistance - determining targets , katg ( a290p or l427p ) , fade24 ( r454s ) or fabd ( a159 t ) , that had not previously been implicated in resistance but that were specific to resistant strains in this study ( table 4 ; supplementary figure 4 ) .
the remaining 4 strains lacked mutations in genes previously associated with isoniazid resistance ( table 4 ; supplementary figure 4 ) . for streptomycin , we identified mutations in gidb and rrs ( gidb r137w and rrs 877 ) that may explain resistance for 2 of these strains .
however , for all remaining isolates with unexplained resistance ( 4 rifampicin- , 2 ethambutol- , and 2 streptomycin - resistant isolates ) , we could identify no additional candidate resistance - conferring mutations .
overview of phenotypic drug resistance not explained by either the mutations in the coll et al . or cohen et al .
is defined by a non - synonymous mutation in a gene previously associated with drug resistance that was confined to phenotypically resistant isolates .
unexplained is defined when no new mutations were identified within genes previously associated with drug resistance . published mutation is defined by mutations not present in either the coll et al . or cohen et al .
multiple entries in the strain identifier column correspond to same - patient strains with high identity
previously published mutations , which were not included in either the coll et al . or
recent studies suggest that tuberculosis patients can be infected with more than 1 m. tuberculosis strain , including strains with differing resistance profiles [ 3740 ] .
we searched for evidence of mixed infections by , first , comparing repeat isolates from single patients and , second , examining variant data to identify evidence for conflicting base calls at sites implicated in resistance .
sixteen patients were sampled multiple times : 8 patients were sampled at different time points , and 14 were sampled multiple times on the same day .
consistent with rates from other studies [ 41 , 42 ] , none of the isolates collected from same - day , same - patient samplings belonged to different clonal groups ( supplementary table 3 ) , differing by only 06 snps , and indicating that same - day , within - patient m. tuberculosis sequence variation is low . with one exception ,
for longitudinally sampled patients , the first and last isolate(11 ) differed by only 28 snps , also supporting limited diversity .
the exception ( patient 38 ) was represented by 2 isolates differing by 301 snps , collected 6 months apart . given slow mutation rates [ 17 , 27 ] and lack of recombination [ 43 , 44 ] in m. tuberculosis , these 2 isolates were either transmitted to this patient at the initial point of infection or were acquired at different times . though we observed very consistent genotypes within the same patient , 3 longitudinally sampled patients exhibited changes in drug resistance phenotypes over the study ( supplementary table 3 ) .
however , we observed no accompanying genotypic change that could explain this change , even when we expanded our analysis to include any changes in known resistance targets . because m. tuberculosis cells are known to bundle , making it difficult to isolate single genotypes in culture
, we hypothesized that unexplained changes in phenotype may be due to mixed communities of genotypically distinct strains that we could detect through sequencing .
however , we could find no evidence for ambiguity in any gene previously associated with drug resistance among these isolates .
using the same strategy , we systematically examined all strains for examples of mixed infections that could help explain cases of unexplained resistance ( table 4 ) .
fifteen strains had ambiguous variant calls within genes known to be involved in resistance ( supplementary table 4 ) , including 7 strains with ambiguous calls at sites found within the coll and cohen sets ( table 3 ; supplementary table 4 ) . in these cases , we observed additional ambiguous positions at > 10 positions with similar allele ratios at other non resistance - associated sites , indicating mixed infections with nonclonal strains .
ambiguous at 2 known resistance sites found in the coll and cohen sets , as well as at 3 other sites within genes known to be involved in resistance . at each site ,
although we detected strains having ambiguity at sites within drug resistance genes not present within the cohen and coll sets , none of these ambiguities could explain additional resistance for isolates in table 4 . despite this , the fact that at least 7% of our strains had ambiguity within drug resistance genes , and that ambiguous sites were not taken into account when we calculated sensitivity and specificity of known mutations to explain resistance , underscores mixed infections as a confounder of genotype - based predictions of phenotypes .
our study , focused on m. tuberculosis from southern india , expands the catalog of genetic diversity for the m. tuberculosis complex , particularly contributing to our understanding of lineage 1 and 3 strains that predominate in india , a region for which whole genome sequencing - based analyses of m. tuberculosis have been limited [ 46 , 47 ] .
in addition , our study provides insights into m. tuberculosis transmission patterns in southern india , how these strains evolve drug resistance and provides a community resource for exploration of global m. tuberculosis diversity , including the unique characteristics of lineages 1 and 3 .
we observed highly localized cases of patient - to - patient transmission of strains ( 10 snp differences ) within individual treatment centers .
consistent with previous studies in india , this could indicate a need for focus on prevention of nosocomial transmission .
however , we lacked sufficient metadata to determine whether transmission occurred within a hospital or community setting .
though our strains were enriched for resistant isolates ( 56 ) compared to the overall incidence in india , including 21 mdr - tb , we were only able to disambiguate the relative ordering of acquisition of resistance for a small number of pairs .
though further studies will be needed to confirm our results , they were consistent with previous work showing that isoniazid resistance arises first and serves as a precursor for mdr - tb in other world regions [ 27 , 31 ] .
a substantial fraction of phenotypic drug resistance in our sample could be explained by known mechanisms , consistent with studies in other lineages [ 1619 ] .
however , we observed that lists of known mutations performed less well in predicting phenotypic drug resistance for indian strains than for other regions [ 17 , 33 ] . that we could not explain the cause of resistance for a quarter ( 14 of 56 ) of strains
may not be surprising given that current catalogs of drug resistance mutations rely predominantly upon data from other lineages . though enriched for drug resistance , our data set contained only a small number of resistant isolates particularly for ethambutol , rifampicin , and streptomycin which may impact the reliability of our sensitivity and specificity calculations for larger collections and also makes identifying novel mechanisms outside of known targets difficult .
katg a290p , katg l427p , fade24 r454s , and fabd a159t that should be experimentally prioritized for assessing their role in resistance .
these add to the list of mutations previously identified as special to indian strains [ 20 , 21 ] .
we did not find previously identified special resistance mutations among isolates from this collection , which could be explained by the fact that our study was small relative to the total number of resistant cases in india , and that it was also geographically constrained .
second , careful examination of ambiguous base calls revealed that some patients harbored mixed infections of sensitive and resistant genotypes , impacting 7% of the strains we examined .
however , even after accounting for the possibility of mixed infections at additional positions within genes involved in drug resistance , there were still 14 strains with unexplained resistance .
of the patients harboring these strains , 4 defaulted on treatment , which could have contributed to the development of resistance , and four were classified as treatment failure .
further studies are needed to examine whether these discrepancies are due to novel resistance mechanisms , the existence of mixed communities undetectable with our approach , phenotyping error , or alternative intrinsic mechanisms of resistance , such as the permeability of the cell wall and efflux pumps , which can vary between strains due to factors such as variable expression of genes .
ultimately , the identification of putative novel resistance conferring mutations , paired with the higher rate of unexplained resistance , highlights the challenges for diagnosing drug resistance in india .
our findings raise the possibility that molecular diagnostics for tuberculosis drug resistance may need to be tailored for india .
for instance , genexpert mtb / rif , the front - line diagnostic used worldwide , relies on rifampicin resistance mutations to detect drug resistance , whereas in our study , we observed cases of rifampicin resistance of unknown cause . in addition , other commercially available diagnostics , such as hain mtbdrplus ( http://www.hain-lifescience.de/en/products/microbiology/mycobacteria/tuberculosis/genotype-mtbdrplus.html ) , and hain mtbdrsl ( http://www.hain-lifescience.de/en/products/microbiology/mycobacteria/tuberculosis/genotype-mtbdrsl.html ) would also not have detected resistance for strains in table 4 .
larger whole - genome sequencing studies of strains from india are needed to establish patterns of lineage 1 and 3 specific mutations and to determine the utility of developing novel diagnostics specific for strains circulating in india .
consisting of data provided by the authors to benefit the reader , the posted materials are not copyedited and are the sole responsibility of the authors , so questions or comments should be addressed to the corresponding author .
| key pointsby sequencing 223 m. tuberculosis strains from southern india , we expanded the studied genetic diversity of lineages 1 and 3 .
we observed local transmission of strains ; unexplained resistance ; potential novel resistance mutations ; and that isoniazid resistance was gained first . |
the dutch healthcare inspectorate is in search for a better insight into how to measure the quality of integrated care .
the central purpose of this study was to identify indicators that provide insight into the performance of the chain as a whole , by means of a clinical logic model .
the extent to which such requirements are met constitutes an indicator of the quality of care delivered . in order to be able to identify suitable indicators ,
chain care is charted in the form of a schematic model , a so - called clinical logic.
a clinical logic captures the elements of the disease process and the care chain to which it gives rise .
the components of the model and the factors that determine the quality of care are described in an analytical manner , based on scientific evidence .
measures are selected that capture the following questions : what are the key elements of care at each step in the process? , how does the patient flow through the care system? , where are the major decision points in treatment related to the goal?
clinical logics were applied on three patient groups : dementia , heart failure and depression . on the basis of the clinical logic for heart failure patients 15 indicators
clinical logics have proven to be a sound method to chart chain / integrated care , but it is mainly focused on the process of care . | introductionthe dutch healthcare inspectorate is in search for a better insight into how to measure the quality of integrated care .
the central purpose of this study was to identify indicators that provide insight into the performance of the chain as a whole , by means of a clinical logic model.theory and methodschain care makes high demands on communication and transfer of information between caregivers .
the extent to which such requirements are met constitutes an indicator of the quality of care delivered . in order to be able to identify suitable indicators ,
chain care is charted in the form of a schematic model , a so - called
clinical logic.a clinical logic captures the elements of the disease process and the care chain to which it gives rise .
the components of the model and the factors that determine the quality of care are described in an analytical manner , based on scientific evidence .
measures are selected that capture the following questions : what are the key elements of care at each step in the process? , how does the patient flow through the care system? , where are the major decision points in treatment related to the goal?results and conclusionsclinical logics were applied on three patient groups : dementia , heart failure and depression . on the basis of the clinical logic for heart failure patients 15 indicators
were proposed , for dementia 9 indicators and for depression 12 indicators.clinical logics have proven to be a sound method to chart chain / integrated care , but it is mainly focused on the process of care .
it is more concrete than the chronic care model .
next , the identified indicators will be tested into practice . |
in the present era , orthodontics treatment spectrum has widened and is not limited to children and adolescents any more .
the past two decades have seen a sudden surge in increasing number of adults seeking orthodontic interventions to enhance their esthetics . in this appearance related society that we live in , young adults are becoming increasingly self - conscious about their smile .
this trend toward a heightened awareness of esthetics has challenged the field of orthodontics to look into this aspect in a more organized and systematic manner . in order to achieve this ,
facial and dental appearance is broadly categorized into three parts ; macro - esthetics , the examination of facial proportions in all three planes of space , mini - esthetics , the dentition in relation to the face , micro - esthetics , the teeth in relation to each other .
this includes assessment of tooth proportions in height and width , gingival shape and contour , connectors and embrasures , black triangles , and tooth shade . in an ideal situation
the apparent width of the lateral incisor is 62% of the width of the central incisor and the apparent width of the canine is 62% of the width of the lateral incisor .
, 1.0:0.62:0.38:0.24.1 frequently , the lateral incisors are disproportionately smaller than the central incisors . in such situations
the golden proportion is an excellent guideline to determine what the post - treatment size of the lateral incisor should be .
gingival height , shape , and contour are an integral part of micro - esthetics and plays an important role in determining the post - treatment outcome .
gingival recession is usually defined as a displacement of the gingival margin apically to the cementoenamel junction2 and is a mark of unesthetic smile .
the prevalence of gingival recession is sex and population dependent and increases with age.3,4 the mandibular central incisors were the teeth with the highest prevalence of gingival recession.3,5 usually , the lateral incisors maintain a more lingual position to the central incisors during eruption .
a more pronounced labial position of the central incisors might result in a thin labial bone plate and apical migration of the marginal gingiva .
the developmental position of the teeth also seems to be important as a predisposing factor to local gingival recession.57 successful treatment outcome is an interdigitation of harmonious tooth proportion and ideal gingival morphology .
multidisciplinary dental treatment is the new approach in the practice of dentistry as people now understand the requirements of a healthy and beautiful smile .
more and more doctors are now doing specialty practice so as to deliver higher standards of quality dental care .
different specialists are now working as a cohesive unit under the same roof in order to deliver cost effective treatment plans so that they can pursue the objective of excellence in dentistry .
this increases the horizons of treatment approach and is less stressful for the patients as well .
the treatment approach is changed from paternalism to autonomy so as to meet the expectations of the patient .
a team of dental specialists can have a deeper insight into detailed diagnosis and resolve cumbersome dental issues effectively and fruitfully .
the present case report synchronizes interrelationship between various branches of dentistry and orthodontics to enhance esthetic outcomes .
a 22-year - old girl came for orthodontic treatment with the chief complaint of crooked teeth and unesthetic smile .
the patient had a straight profile with normal nose , competent lips , average mentolabial sulcus , and an average chin ( figure 1 ) .
intra - oral examination ( figure 2a d ) revealed class i molar and canine relation on right and left side .
the maxillary arch was broad with crowding in the anterior segment , retroclined incisors and peg shaped upper right lateral incisor . in the mandibular arch crowding was seen in the anterior segment with retroclined incisors and lingually placed lower right lateral incisor with a relatively thin cortical bone over lower right central incisor as observed clinically on inspection and palpation .
the occlusal features showed an overjet of 1 mm , overbite of 5.5 mm , and the lower midline was shifted to patient s right by 2 mm .
cephalometric analysis showed class i skeletal base , an average growth pattern , and a good soft tissue drape ( table 1 ) .
model analysis revealed contracted upper and lower arches with space requirement of 3 mm in maxillary arch and 5.5 mm in mandibular arch .
other relevant radiographic findings included mesioangular lower right third molar and erupting upper and lower left third molars .
periodontal surgery for lower right central incisor if required . to establish long - term stability of results .
since the patient had good soft tissue drape , the treatment plan followed was non - extraction therapy .
it was decided to gain space by proclination of the upper and lower incisors and by expanding the arches in order to achieve ideal axial inclination .
appliance used was pre - adjusted edgewise with slot size 0.0220.028 , roth prescription ( mini - roth series ao , american orthodontics , sheboygan , wi , usa ) . anchorage was reinforced by banding of upper and lower second molars .
ideal smile and esthetic needs of the patient were to be accomplished using composite buildup of upper right peg lateral .
minor adjunctive surgery planned consisted of full thickness periodontal graft for lower right central incisor which had thin cortical plate .
proposed retention strategy was upper and lower bonded retainers and hawley s wraparound for the upper arch .
active treatment time was 21 months . initially upper bands and brackets were placed , 0.016 heat activated nickel - titanium ( hant ) (
after 2 months of leveling and aligning , upper wire was changed to 0.018 ss and then to 0.0190.025 hant .
lower bands and brackets were placed after 3 months and 0.016 hant wire was engaged .
once alignment was accomplished , wire was changed to 0.018 ss arch wire with active molar stops for expansion and proclination . after expansion , consolidation of spaces in lower arch
subsequently space was created for alignment of lingually placed lower right lateral incisor . a jockey arch wire
final alignment of lower right lateral incisor was achieved by engaging lower 0.016 hant wire with individual ligation .
after alignment of lower incisors 0.0190.025 hant wire was engaged which was moved on to lower 0.0190.025 ss with reverse curve .
torque expression was performed with upper and lower 0.0210.025 ss wires which were kept for a span of 4 months .
buildup of upper right peg lateral incisor was done and subsequently upper bonded retainers were fixed ( figure 3a and b ) .
patient was called for lower arch vestibuloplasty done under local anesthesia in order to reduce the strain on the attached gingiva ( figure 4 ) .
after 1 month of periodontal surgery healing full thickness graft for lower right central incisor was done under local anesthesia ( figure 5a and b ) .
the entire upper and lower arch brackets were debonded and wraparound hawley s retainers were given .
postoperative recommendations in the form of oral hygiene regime and follow - up every 4 months ( quarterly ) for scaling were given to the patient in order to prevent failure of graft which was placed .
the patient has been under regular follow - up for the last 18 months and there has been no sign of attachment loss .
ideal smile esthetics was achieved by buildup of upper right lateral incisor and periodontal surgery of lower right central incisor . crowding and deep bite were corrected and an ideal overjet and overbite were accomplished .
post - treatment opg revealed adequate root parallelism ( figure 8) and lateral cephalogram showed adequate torque expression ( table 2 ) .
the occurrence of gingival recession has long been a subject of controversy . according to some studies proclination of the lower incisors during orthodontic treatment
has been considered to be detrimental to periodontal health.810 in a recent review article , it was concluded that more proclined teeth had a higher occurrence or severity of gingival recession compared with less proclined or untreated teeth .
however , the differences were small and the clinical consequences questionable.11 in contrast to this notion there are other studies which show that the risk of getting more severe gingival recession is increased in cases with retroclined mandibular incisors and a mesial basal relationship of the jaws .
various long - term studies indicate that in the presence of gingival recession , retroclination of the mandibular incisors in cases of mesial basal relation ( angle class iii ) seems to increase the risk of a more severe gingival recession . keeping the gingiva in the mandibular frontal area as healthy as possible during orthodontic treatment appears to be the determinant in the development of gingival recession.12 inflammation seems to be a contributory factor for this condition .
a careful examination of the buccal gingival and overlying alveolar bone in the lower incisors , before deciding how much the teeth need to be moved , seems important . in the present case
report the alveolar bone covering the lower right central incisor was thin both on inspection and palpation .
hence the option of full thickness graft was kept open from the initial phase of diagnosis and treatment planning . in the present case
report the patient showed gingival recession with lower right central incisor at the end of orthodontic treatment which was corrected by periodontal surgery full thickness graft .
initially vestibuloplasty was done in order to increase the depth of lower arch vestibule and to reduce gingival strain on lower right central incisor .
gingival recessions are frequently associated with shallow vestibule or coronal frenum insertion especially in lower anterior region .
poor mucogingival conditions may influence the passive surgical shift of the coronally advanced flap toward the cementoenamel junction and further decrease the vestibular depth .
free gingival graft is the treatment of choice in cases demonstrating lack of keratinized tissue adjacent to the recession defect as it is effective in extending the fornix and in increasing both width and thickness of the keratinized tissue.13,14 however , it does not achieve predictable results in terms of complete root coverage with consequent impaired recovery from root sensitivity.14 in addition , it is associated with poor esthetic appearance due to the unsatisfactory chromatic and texture tissue integration and the apical misalignment of the alveolar mucosa.15 hence full thickness graft was chosen as it is devoid of above disadvantages . of the various adverse outcomes that may be encountered following periodontal surgery , the risk of infection stands at the forefront of concern to the surgeon , since infection can lead to poor healing outcomes .
there are studies which confirm previous research demonstrating a low rate of postoperative infection following periodontal surgical procedures .
although the total postoperative complications were minimal in our case , literature reveals osseous surgery to be three times more likely than pure mucogingival surgery to cause complications of bleeding , infection , swelling or adverse tissue changes .
antibiotics are commonly used when performing certain regenerative and implant surgical procedures , studies suggest that there may be no benefit in using antibiotics for the sole purpose of preventing post - surgical infections . further large - scale , controlled clinical studies are warranted to determine the role of perioperative antibiotics in the prevention of periodontal post - surgical infections.16 studies suggest that the incidence and severity of complications following periodontal surgeries are minimal.17 tooth proportion is one of the most important elements of anterior dental esthetics .
this ratio is an ideal treatment guide and can be mathematically defined as 1.0:0.62:0.38:0.24.1 when the rules of golden proportion are followed , the results obtained are naturally attractive and pleasing to the eye .
it is imperative to restore the size of malformed lateral incisor after completion of orthodontic treatment for good overall treatment results which are harmonious , symmetrical , and proportionate .
peg shaped lateral incisors occur in approximately 2%5% of the general population , and women show a slightly higher frequency than men .
usually they are found equally on the right and left , uni- or bilaterally , however some studies have shown their bilateral occurrence slightly higher than the unilateral occurrence . when peg shaped laterals erupt in the mouth , esthetically it can be a disappointment to the patient that their teeth are not perfect or too small in comparison to the rest of the anterior teeth .
treatment could be the combination of orthodontic treatment first to align the teeth in the arch , direct composite bonding onto peg laterals , indirect composite placement , bonded crowns , porcelain bonded to metal crowns , crown lengthening surgery to get better gingival heights then direct bonding , extractions , and implant placement .
benefits of direct composite bonding include :
preserved sound tooth structure;18can be placed directly onto the tooth surface;can place as a type of direct composite veneer;it is a conservative restoration;can easily change the emergence profile and angle;can alter the shape and length of the tooth;can close diastema;can be used as an interim restoration in an adolescent and added to as the gingival heights matures;can be repaired easily;can be polished and repolished to a high shine;long - lasting treatment option .
disadvantages of direct composite bonding include : can chip and break;possible discoloration of older composite used;can develop marginal leakage;19can stain easily in those patients who smoke and have poor oral hygiene;can have a deleterious effect on gingival health in patients with poor oral hygiene.20 preserved sound tooth structure;18 can be placed directly onto the tooth surface ; can place as a type of direct composite veneer ; it is a conservative restoration ; can easily change the emergence profile and angle ; can alter the shape and length of the tooth ; can be used as an interim restoration in an adolescent and added to as the gingival heights matures ; can be repaired easily ; can be polished and repolished to a high shine ; long - lasting treatment option .
disadvantages of direct composite bonding include : possible discoloration of older composite used ; can develop marginal leakage;19 can stain easily in those patients who smoke and have poor oral hygiene ; can have a deleterious effect on gingival health in patients with poor oral hygiene.20 in the current case report lower arch was expanded to attain ideal inter canine width , overjet , and overbite .
non - extraction therapy was followed ; full complement of dentition was maintained in order to bestow a fuller esthetic smile .
differential treatment option of lower right central incisor was discussed and rejected because of its evident disadvantage .
treatment with mandibular incisor extraction is not a popular technique in orthodontics because of its apparent shortcomings characterized by increase in overbite , overlap , unsatisfactory posterior occlusion , recurrence of mandibular crowding , and loss of esthetics of the inter dental papilla .
the present case report demonstrates the interrelationship between various specialties of dentistry to achieve harmonious results in the form of ideal symmetry , proportion , and esthetics .
synchronizing various specialties with orthodontics in an organized and systematic manner is required to diagnose and resolve esthetic problems predictably .
our ultimate goal as orthodontist is to achieve pleasing composition in the smile by creating an arrangement of various esthetic elements .
this case report suggests that the incidence and severity of complications following periodontal surgeries are minimal .
the patient was happy with the overall treatment results and was satisfied with the pleasant and esthetic smile achieved at the end of the treatment .
this article reviews the various principles which are important when creating an esthetic smile with satisfactory functional and static occlusion . | backgroundin contemporary dental care , an increasing number of adult patients are now seeking orthodontic treatment with the primary motive of improvement in appearance and achievement of esthetic smile .
proper recognition of the dental and facial defects at the outset of treatment is the most important key to esthetic success and is essential in satisfying the patient s needs . by following the rules of golden proportion smiles
can be made attractive , harmonious , symmetrical , and proportionate.methodologyconsisted of 22-year - old girl who came for treatment of crowding in maxillary and mandibular arches , abnormal overjet and overbite and had unesthetic peg lateral.resultsnon-extraction therapy was carried out since the patient had good soft tissue drape , alignment was achieved by expanding the arches and moving teeth in ideal axial inclination .
esthetic smile was attained using composite buildup of upper right peg lateral and minor adjunctive surgery ( full thickness periodontal graft ) on lower right central incisor.conclusionthe present case report orchestrates interrelationship between various branches of dentistry and orthodontics .
it exhibits how multidisciplinary approach can be used to achieve ideal dental esthetics in a 22-year - old girl who was successfully treated for peg shaped lateral incisor , gingival recession , and unesthetic smile . |