Datasets:

LeaBresson

/

pubmed-summarization-sample2

like 0

provincial reconstruction teams ( prts ) are small , civilian - military units that assist provincial and local governments to govern more effectively and deliver essential services . the purpose of prts in afghanistan is to extend the authority of the central government into the provinces . prts concentrate in three areas : governance , reconstruction , and security . to improve governance , prts work with appointed provincial governors , police chiefs , and elected provincial councils to increase capacity and improve the provision of services . in reconstruction the mission of a role ii military hospital is to provide a rapidly deployable initial surgical service to stabilize non - transportable patients from the area of operations . the capabilities of the medical detachment and surgical squads are to provide life- and limb - saving surgery in the combat zone with subsequent hospitalization up to 48 hours with pre- and postoperative care of patients . moreover , it provides care and treatment of acute illness , injury , or wounds in patients who are able to return to duty as soon as possible , and gives emphasis on prevention . the intent of this study was to analyze the database of a role ii hospital of prt kunduz in north afghanistan in order to describe the acute and elective cases , which were managed , and find the distribution of wounds and the mechanisms of injuries during the current conflicts . in particular , it focused in the 3-month co - operation between two surgical teams ( one from germany and one from greece ) under very difficult and unique war challenges . from july 21 , 2009 through october 20 , 2009 , 1,106 patients were admitted to the role ii hospital of prt kunduz . there were 1,041 male ( 94.1% ) and 65 female ( 5.9% ) patients with an age range of 1 to 70 years ( median age : 32.4 years ) . the medical records were reviewed for demographic information regarding patients status , sex , and age . variables including type of diseases , mechanism and location of injuries , physical findings , laboratory findings , glasgow coma scale ( gcs ) score , and radiologic imaging ( x - rays and ultrasound ) at the time of initial patient presentation were recorded . operative or non - operative management , type of surgical procedures performed , blood supply , and outcome ( uneventful recovery , postoperative complications , mortality and cause of the death ) were also collected . patients were divided into three groups ; isaf ( international security assistance force which includes united states and other nato coalition forces ) , ngos ( including members of non- government organizations ) , and local nationals ( lns ) , which included personnel of the afghan national army and national police as well as afghan civilians . furthermore , the patients were divided in three groups according to the types of diseases they were managed for . the data included 792 isaf patients , 18 ngos patients , and 296 local patients . the majority of them ( 71.6% ) were isaf personnel followed by local patients ( 26.8% ) . they were 2 males and 2 females aged 11 , 3 , 6 , and 1-year - old , respectively , and they were operated for non - combat burn injuries ( gasoline and hot water ) . one male and 1 female among the isaf patients were operated for burn wounds ( 20% and 15% of total body surface , respectively ) . they were admitted to intensive care unit ( icu ) postoperatively and transferred to military hospitals in germany within a maximum time of 24 hours . furthermore , 2 isaf patients with the diagnosis of h1n1 positive and 1 patient with severe upper gastrointestinal bleeding were transferred to germany . patients demographics during our time study period , 33.4% of the patients had a diagnosis of disease with internal medicine interest , while 37.5% of the patients had general surgery interest diseases . table 2 shows the distribution of diseases ( acute and chronic ) according to the field of interest . distribution of diseases according to the field of interest of the 1,106 patients treated , 51 ( 4.6% ) patients underwent a surgical operation . of these 51 patients , 35 ( 68.6% ) were operated immediately while 16 ( 31.4% ) were operated as elective cases . a total number of 55 surgical procedures were performed ; it was observed due to the fact that in 3 patients four second looks were performed within the maximum time of 48 hours after the initial operation . forty ( 78.4% ) of the patients were locals and 11 ( 21.6% ) were isaf personnel . in 22 ( 43.1% ) of the patients , orthopedic procedures were performed while in the rest 29 ( 56.9% ) patients the operation were of the general surgery interest . table 3 summarizes the patients needed emergency or elective surgical procedure , while table 4 summarizes the total number of emergency and elective surgical procedures by specialization and nationality . emergency and elective surgical procedures by specialization , nationality , and sex emergency and elective surgical procedures by specialization and nationality ten of the operated patients and 1 patient with severe upper gastrointestinal bleeding were transferred to role iii military hospital in afghanistan or military hospitals in germany for further treatment within 24 hours . only one isaf personnel patient with severe gunshot head injury was dead during admission . during the hospitalization time a few differences between isaf and lns members were noticed . more than 75% of the local patients had temperature higher than 37c , without any clinical or laboratory findings of infection . the fact that the lns patients required significantly less doses of analgesia ( opioids , non steroids anti - inflammatory drugs , and local anaesthetics ) than the isaf ones has also to be reported as well as the fact that in many cases of operated lns patients the analgetic doses , which were used were more than 50% less in comparison with the isaf soldiers . furthermore , despite the fact that all the lns patients were being covered by triple scheme of anti - nausea and anti - vomiting drugs during the operation , all of them had significant postoperative nausea and vomiting . unfortunately , we can not provide any scientific explanation for these people definitions . continued analysis and further investigation of these patients including their habits and characteristics the united states ( u.s . ) established the first prts in afghanistan in 2002 . and 12 other nato and coalition partners ; another dozen countries contribute personnel , financial , and material support . there is no overarching concept of operations or organizational structure for prts in afghanistan . in north and west , prts are operated by european countries and engage in peacekeeping . in south and east , u.s . , british , canadian and dutch prts provide the civilian side of counterinsurgency ( coin ) operations.2 prts depend on a vast array of civilian and military funding programs and sources . the german prt in kunduz has over 1,300 personnel and a large economic assistance unit located separately from a military force that operates under caveats that severely circumscribe its operations . the role ii military hospital in prt kunduz in north afghanistan provides increased medical and surgical treatment capability focusing in emergency cases and dental care including limited preventive dentistry . moreover , it supplies treatment of chronic and elective cases , mental health services , occupational and preventive medicine . it is supported by x - ray , ultrasound , laboratory facilities , 2-bed icu , technicians , and blood supplies , which usually consist of up to 50 units of packed red blood cells ( prbcs ) . it also has the capability of administering initial resuscitation and stabilization of casualties in the field of action using ground ambulances , wheeled , track vehicles , and helicopters . it finally provides ward services for up to 15 patients under normal conditions expanding to 25 patients in cases of mass casualties within a few hours . the two surgical teams ( german and greek ) performed triage , initial resuscitation , stabilization , and preparation of sick , wounded , or injured patients for evacuation . they also provided consultation , medical , and surgical service for lns , ngos , and isaf patients with chronic , elective diseases . both the teams were consisted of two general surgeons , one orthopedic surgeon , one resident in orthopedic , two anesthesiologists , and one resident in anesthesiology . however , in cases of mass casualties a total number of three operating room tables could be used . the mentioned 3-month co - operation between the two surgical teams took place in a german military hospital . obviously , this fact was established the hierarchy of the teams ; there was a german head anesthesiologist , a german chief surgeon , and a german head nurse . each surgical team was on call every second day . if there were patients who were needed a simple surgical management , the on call team was responsible for them . however , in cases of mass casualties or in cases of severe injured patients both the surgical teams were working together for managing all these wounded patients . german and greek personnel in the same specialty sometimes were working together in the operating room , while sometimes they were working separately . all the members of both the surgical teams were speaking the english language in a high level and all medical care was carried out in english as well . in the 3-month period of the deployment of the combined surgical team , 21 patients were operated because of gunshot injuries , 3 patients due to improvised explosive devices ( ieds ) , one patient due to knife injuries , while 4 patients were operated for no combat burn wounds . thirteen of the 29 mentioned patients with gunshot or ieds injuries of the extremities had sustained a fracture . gunshot injuries were the main mechanism of injury for lns personnel , whereas isaf personnel were usually presented with burns after ieds and rocket attacks . there was also one lns patient with knife injuries of the abdomen and the left leg . one of the gunshot wounds was in the head and neck region , one in the chest wall region , one in the testis , while the majority of the injuries which required emergency surgical treatment were gunshot injuries of the extremities ( 5 in the upper limb , 7 in the lower limb , 1 in both upper and lower limbs ) . only 2 isaf soldiers were treated surgically for gunshot wounds of the extremities ( both of them had gunshot injuries in the upper limbs ) and one for gunshot injury of the right testis . many authors have recently reported the high percentage of the extremity injuries during the operations iraqi and enduring freedom . gunshot wounds of the extremities in war action are distinctive of their devastating injury pattern . it is self - evident that all these injuries were thought of as potentially contaminated . soft tissue compromise may be extensive . in our study , 3 patients with severe soft tissue injuries were re - operated for a 2nd and 3rd look debridement within 48 hours . vacuum assistant fascia closure ( vac ) technique was used in 3 another patients for the treatment of extended soft tissue injuries with residual cavities . in 2 patients there were multiple entry and exit points . one patient with a tibia fracture presented with an irreparable rapture of the popliteal artery 7 hours after the injury ; this fact made an above the knee amputation inevitable . the second patient with a distal femoral fracture was presented with an ischemic distal leg but normal circulation was reestablished after fracture reduction and stabilization with external fixation . the third patient had multifocal lesions of the radial artery ( 4 partial lesions ) in its course through the forearm . finally , 1 patient with a forearm soft tissue injury required fasciotomy of the forearm due to impeding compartment syndrome . in this study , 6 patients with burn wounds were treated ; 4 lns children and 2 isaf personnel . all the children had noncombat burn wounds due to gasoline or hot water while the isaf personnel burn wounds were because of ieds . the anatomic distribution of burns seen in this study is typical of both military and civilian burn data . it is necessary to be noticed that burns to these areas are highly morbid and have significant cosmetic and functional consequences . the vast majority of the internal medicine cases were treated conservatively in the role ii hospital . another 3 lns patients with huge thyroid gland and hyperthyroidism received the appropriate medication and were planned to be operated some weeks or months later after normalization of the thyroid hormones . finally , 1 isaf patient was admitted with severe upper gastrointestinal bleeding because of esophageal varicose due to portal vein hypertension . he was unstable and received 5 prbcs and 4 units of fresh frozen plasma after his intubation . he was admitted to icu and was transferred to military hospital in germany within 24 hours . a total number of 11 patients transferred to a role iii military hospital in afghanistan or to military hospitals in germany for further treatment . there were registered nurses , critical care nurses , emergency department and surgical nurses , as well as licensed practical nurses . they were trained personnel in the resuscitative , surgical , and perioperative management of patients . they were required to administer drugs and blood products , manage ventilated patients , assist in surgical procedures , and occasionally to place body tubes . it is important to be underlined the ideal co - operation between the greek and the german surgical team in this 3-month period . it is noteworthy that while the members of the german surgical team had repeated experience of similar missions , it was only the first mission of this kind for their greek colleagues . despite their disproportionate experience , the two medical teams had an unimpeded collaboration , which could be attributed to the fact that both teams had almost the same patient management plans , the same wound management protocols , very similar guidelines for antibiotic administration and the same pain relief plan . principally , because of the nature of this study ( heterogeneous group of patients including acutely injured and chronically diseased ) , we are unable to generate conclusions based on the available data . another limitation here is that we had no opportunity for a complete follow - up , especially from the majority of the lns patients . after their discharge from the hospital , many of them were transferred to regional afghan hospitals for further treatment and their follow - up was carried out by local doctors or physicians . it is self evident that final results and late complications are not enrolled in this study . a number of factors contributed greatly to the integration of german and greek surgical teams during the time period of their co - operation . daily teaching sessions ( by both german and greek colleagues ) , concentrating on trauma management along standard advanced trauma life support ( atls ) and battlefield advanced trauma life support ( batls ) protocols and these had been attended by doctors , nurses , and medics from both units . these sessions demonstrated that there were no fundamental differences in practice between the two surgical teams.the two surgical teams had set up and exercised some combined incident scenarios of mass casualties.some of the greek nurses had previously worked with german doctors and nurses at the isaf field hospital in kabul.the greek anesthesiologist and the greek surgeon had previously worked at combined german - greek training courses in germany . daily teaching sessions ( by both german and greek colleagues ) , concentrating on trauma management along standard advanced trauma life support ( atls ) and battlefield advanced trauma life support ( batls ) protocols and these had been attended by doctors , nurses , and medics from both units . these sessions demonstrated that there were no fundamental differences in practice between the two surgical teams . the two surgical teams had set up and exercised some combined incident scenarios of mass casualties . some of the greek nurses had previously worked with german doctors and nurses at the isaf field hospital in kabul . the greek anesthesiologist and the greek surgeon had previously worked at combined german - greek training courses in germany . the prime purpose of this study was to focus on the unique features not only of the war trauma but also of elective and chronic cases and their management regarding the restraints imposed by the personnel and equipment of a role ii hospital in the field of action . these information and thoughtful review of these data in addition with the collection of combat casualty data , at a similar level , should be the beginning of optimal medical planning , training , and research as well as should allow more analysis and should provide means for improving patient care in the combat environment of afghanistan . in our point of view , all medical personnel and especially military surgeons should be properly trained , agile , skilful , and prepared for special aspects like polytrauma , mass casualty situations with triage , special field medicine requirements , and field hemostatic techniques . these special military medical skills must be specifically promoted and formed during the training of military medical personnel who is active in surgical fields abroad and especially under these difficult circumstances as our experience mentioned in german military hospital in kunduz . furthermore , trauma training centers with carefully designed and planned combined multination programs in areas such as neurosurgery , pediatric , urology , gynecology and obstetrics , hygiene and atomic , biological and chemical protection . emphasis should be placed on practical lessons with purpose to provide training in the specific surgical procedures appropriate to the life - threatening soft tissue trauma cases to be expected during this kind of operations . sufficient attention should also be paid to collaboration with adjacent disciplines , emergency treatment , anesthesia , and intensive care . all types of physicians and a good level of specialist experience and teamwork skills are essential elements within a medical organization . in addition , because of the high turnover of the deployed nurses and physicians working in this challenging environment , there is a need to develop standardized treatment guidelines . the co - operation between medical teams from different countries , when appropriately trained , staffed , and equipped , can be highly effective in order to manage not only mass war casualties but also elective cases of military personnel and civilians . thorough evaluation of the results of such collaborations as well as common training or continuous education based on similar protocols of patient management will ensure even better outcomes .

background and aim : there are a lot of unique challenges for the military medical personnel assigned to afghanistan . we evaluate the results of the co - operation between a german and a greek surgical team during a 3-month period in a role ii hospital.materials and methods : patients who were admitted to the role ii german hospital of kunduz were evaluated . we reviewed the type of diseases , mechanism and location of injuries , management , types of surgical procedures , blood supply , and outcome.results:the data included 792 isaf patients , 18 ngos patients , and 296 local patients . out of them , 71.6% of the patients were isaf personnel ; 51 patients underwent a surgical operation ; 35 of them were operated in an emergency base . fifty - five surgical procedures were performed . in 22 ( 43.1% ) of these patients , orthopedic procedures were performed , while in the rest 29 ( 56.9% ) patients the operations were of general surgery interest . gunshot injuries were the main mechanism of injury for locals , whereas isaf personnel were usually presented with injuries after ieds and rocket attacks . a total number of 11 patients were transferred to role iii military hospitals for further treatment within 24 hours.conclusions:the co - operation between surgical teams from different countries , when appropriately trained , staffed , and equipped , can be highly effective in a combat environment .

china 's extraordinary economic growth , industrialization , and urbanization , coupled with inadequate investment in basic water supply and treatment infrastructure , have resulted in widespread water pollution . in china today approximately 700 million people -- over half the population -- consume drinking water contaminated with levels of animal and human excreta that exceed maximum permissible levels by as much as 86% in rural areas and 28% in urban areas . by the year 2000 , the volume of wastewater produced could double from 1990 levels to almost 78 billion tons . these are alarming trends with potentially serious consequences for human health . this paper reviews and analyzes recent chinese reports on public health and water resources to shed light on what recent trends imply for china 's environmental risk transition . this paper has two major conclusions . first , the critical deficits in basic water supply and sewage treatment infrastructure have increased the risk of exposure to infectious and parasitic disease and to a growing volume of industrial chemicals , heavy metals , and algal toxins . second , the lack of coordination between environmental and public health objectives , a complex and fragmented system to manage water resources , and the general treatment of water as a common property resource mean that the water quality and quantity problems observed as well as the health threats identified are likely to become more acute.imagesfigure 1figure 2figure 3figure 4

there are many variables of success in an in - vitro fertilization / embryo transfer ( ivf / et ) cycle , few are beyond our control but are thought to be directly related to the implantation and successful outcome . the implantation potential of good quality embryos remains low during ivf / et treatment , despite advances in ovarian stimulation regimens , the method of assisted fertilization and improved culture conditions . different strategies have been developed to evaluate endometrial receptivity , such as the histologic dating of an endometrial biopsy , endometrial cytokines in uterine flushing , the genomic study of a timed endometrial biopsy or more commonly a non - invasive ultrasound examination of the endometrium . ultrasound examination of the endometrium is a commonly used non - invasive method to assess endometrial receptivity during ivf treatment . a good blood supply towards the endometrium is usually considered to be an essential requirement for implantation and therefore assessment of endometrial blood flow in ivf treatment has attracted a lot of attention in recent years . doppler study of uterine arteries does not reflect the actual blood flow to the endometrium . endometrial and sub - endometrial blood flows can be more objectively and reliably measured with three - dimensional power doppler ultrasound . however , conflicting results are reported with regard to their role in the prediction of pregnancy in ivf treatment . the aim of our study was to evaluate the role of endometrialthickness , pattern and sub - endometrial blood flows measured by 2d power dopplerultrasound on the day of hcg to predict pregnancy during ivf treatment . ultrasound parameters including endometrial thickness , endometrial pattern , endometrial volume , doppler study of uterine arteries and endometrial blood flow have been used to assess endometrial receptivity during ivf treatment . assessment of endometrial blood flow adds a physiological dimension to the anatomical ultrasound parameters and has drawn a lot of attention in recent years . this prospective clinical study was undertaken at the ivf unit of department of obstetrics and gynecology and was approved by the institute 's ethics committee . one hundred and one subjects were recruited in the study of age group ( 2042 years ) undergoing ivf - et / icsi for primary or secondary infertility for various etiologies like tubal , male , endometriosis , pcos , unexplained factors . the patients were stimulated using standard long protocol using gnrh analog for pituitary suppression followed by stimulation using recombinant fsh and hmg . the blood flows was recorded on the day of hcg administration in the endometrial and sub - endometrial zones using siemens usg machine . the same dose of hcg , 10,000 iu intramuscularly was administered when there were at least three leading follicles of size 1718 mm , and 36 h later the ovum pickup was performed under intravenous sedation . after a true longitudinal view of the uterus had been obtained , the endometrial thickness was measured as the maximum thickness between the highly reflective interfaces of the endometrial the surrounding low - amplitude echo layer was excluded , because it represents the inner layers of the myometrium . endometrial morphology was classified as types a ( hyperechoic ) , b ( isoechoic ) and c ( triple - line ) endometrium , respectively . a triple - line pattern was described as hypo - echogenic endometrium surrounded by a hyper - echogenic zone [ figure 1 ] . the zones of vascular penetration into the sub - endometrial and endometrial regions have been defined as : zone i i.e. the sub - endometrial zone , zone ii is the outer hyperechogenic zone and zone iii is the inner hypoechogenic zone [ figure 2 ] . after completion of the b - mode examination a 6-mhz pulsed doppler system was used for blood - flow analysis . the blood - flow velocity waveforms from the sub - endometrial vessels were obtained by placing the doppler gate over the color area and activating the pulsed doppler function . a recording was considered satisfactory when at least five consecutive waveforms were obtained , each demonstrating the maximum doppler shift . the resistance index ( ri = peak systolic velocities - peak diastolic velocities / peak systolic velocities ) and s / d ratio was calculated on three consecutive uniform waveforms . all examinations were performed by one investigator with siemens acuson antares ( siemens medical solution , usa , inc ) . the reproducibility of doppler measurements was tested in 10 patients , in whom ri was measured by the same operator three times at 10 mins intervals and analyzed by analysis of variance . patients had two or three embryos replaced into theuterine cavity 48 h after the retrieval . triple layer endometrium doppler blood flow till zone 3 luteal phase support was given by 100 mg intramuscular progesterone daily . a urine pregnancy testwas done 16 days after embryo transfer and if positive , ultrasound examination was performed three weeks after embryo transfer to confirm intrauterine pregnancy and to determine the numberof gestational sacs present . only clinical pregnancies definedby the presence of one or more gestational sacs or the histologicalconfirmation of gestational product in miscarriages was considered.ongoing pregnancies were those pregnancies beyond 1012weeks of gestation , and patients were then referredfor antenatal care . the primary outcome measure in this study was pregnancy and secondary outcomes were endometrial thickness and blood flow . multiple logistic regressionanalysis and the receiver operator characteristic ( roc ) curveanalysis were applied to determine the best predictive variables [ figure 3 ] . statistical analysis has been performedusing the statistical program for social sciences ( spss inc.,version 12.0 , chicago , usa ) . the primary outcome measure in this study was pregnancy and secondary outcomes were endometrial thickness and blood flow . multiple logistic regressionanalysis and the receiver operator characteristic ( roc ) curveanalysis were applied to determine the best predictive variables [ figure 3 ] . statistical analysis has been performedusing the statistical program for social sciences ( spss inc.,version 12.0 , chicago , usa ) . total number of patients recruited was 101 , their mean age was 35 years , mean duration of infertility was 8 years [ table 1 ] . seventy five ( 74.25% ) patients had primary infertility and 26 ( 25.74% ) had secondary infertility . the endometrial blood flow was in zone i in 18 patients , 28 patients had blood flow in zone ii and 54 had in zone iii . overall twenty seven ( 26.73% ) patients conceived and in these women the endometrial thickness was between 6 and 12 mm [ table 2 ] . only one achieved pregnancy with an endometrial thickness of less than 6 mm and one when the thickness was between 12 and 14 mm . fourteen ( 51.8% ) patients who became pregnant had blood flow in zone iii [ table 3 ] . we found three patients with calcifications in the uterus and two with fluid in the endometrial cavity on the day of hcg . endometrial receptivity is crucial to implantation of an embryo . it is agreed that both endometrial thickness and endometrial pattern are useful as prognostic parameters for successful pregnancy in in - vitro fertilization / intracytoplasmic sperm injection and embryo transfer ( ivf / icsi - et ) . no consensus has been reached with regard to the minimum endometrial thickness required for successful pregnancy . pregnancies did not occur when the endometrial thickness was less than 7 mm ; however , other studies found that a minimum endometrial thickness of 6 mm is acceptable for implantation.[58 ] interestingly , sundstrm reported a successful pregnancy with an endometrial thickness as little as 4 mm . in our study , the thinnest endometrial lining for successful ongoing pregnancy was 5.8 mm and maximum number of conceptions occurred when the thickness was 810 mm . with increasing endometrial thickness ( > 14 mm ) , a high miscarriage rate was reported by weissman , which was not observed in the present study . in our study , the overall clinical pregnancy rate was 26.73% . we observed a higher pregnancy rate when the blood flow to the endometrium was in zone iii ( 51.8% ) compared to zone i ( 14.8% ) . consistent with several previous studies , we found that endometrial echo patterns have no prognostic value for pregnancy.[1113 ] in a prospective study , wang et al , studied the endometrial thickness , echo pattern and blood flow on transvaginal sonography in 182 women , eight hours prior to hcg injection . they observed a higher clinical pregnancy rate and implantation rate in women with detectable blood flow . ng et al , observed a lower vascularity in the endometrial and sub - endometrial region by a 3d power doppler in patients who had low - volume endometrium as compared to those with thin endometrium . several studies have suggested that a premature secretory endometrial pattern is introduced by the advanced progesterone rise , and this premature conversion has an adverse effect on pregnancy rates . the reason that no - triple - line endometrial pattern was observed prior to ovulation is not known and can not be explained by higher progesterone levels . the three patients with calcifications [ figure 4 ] in the uterus and two with fluid in the endometrial cavity [ figure 5 ] on the day of hcg did not conceive . calcification in the uterus fluid in the endometrial cavity the coexistence of a thinner endometrium in association with no - triple - line pattern reflects a diminished endometrial responsiveness to ovarian hormones and poor receptivity of the endometrium , leading to a low clinical pregnancy rate and poor clinical outcome . one limitation of our study is that the number of subjects in the study population was too small to make a definitive statement . in conclusion , when a thinner endometrium ( 7 mm ) and no - triple - line endometrial pattern coexist in an ivf / icsi candidate , cryopreservation should be recommended . however , further study is needed to make a definitive conclusion . with a thin endometrium and a good texture ( triple - line ) , other prognostic factors , such as embryo quality , the endometrial vascularity has a useful predictive value on the implantation rate in ivf cycles irrespective of the morphological appearance of the endometrium .

aims and objectives : to evaluate the role of endometrial thickness , pattern and sub - endometrial blood flows measured by 2d power doppler ultrasound to predict pregnancy during in - vitro fertilization ( ivf ) treatment.study design : prospective , non - randomized clinical study.materials and methods : this was a prospective observational study . a total of 101 infertile women were recruited from our ivf - et program from january to december , 2009 . women with tubal factor , male factor and unexplained infertility were included in the study.results:the mean age was 35 years and mean duration of infertility was 8 years . seventy five ( 74.25% ) patients had primary infertility and 26 ( 25.74% ) had secondary infertility . the mean endometrial thickness was 8.1 mm and endometrial blood flow was in zone i in 18 patients , 28 patients had blood flow in zone ii and 54 had in zone iii . overall , 27 ( 26.73% ) patients conceived and in these women the endometrial thickness was between 6 and 12 mm.conclusions:with a thin endometrium ( 7 mm ) and no - triple - line endometrial pattern coexisting in an in - vitro fertilization / intracytoplasmic sperm injection ( ivf / icsi ) candidate , cryopreservation should be recommended . with a thin endometrium and a good texture ( triple - line ) , other prognostic factors , such as embryo quality , should be taken into account . the endometrial vascularity has a useful predictive value on the implantation rate in ivf cycles irrespective of the morphological appearance of the endometrium . however , further study is needed to make a definitive conclusion .

in spite of numerous prophylactic measures infections after primary total hip arthroplasty ( tha ) still occur in 0.5 - 1.4 % of the cases 4 . generally , joint infections are categorised in early ( within 6 weeks after surgery ) and late infections ( > 6 weeks ) 15 . efforts for infection management in early cases with prosthesis preservation include debridement , necrosectomy , pulsatile lavage , insertion of antibiotic - loaded device ( pmma - beads , collagen sponges ) or flush - suction drain 15 . should these methods be unsuccessful , a one - stage procedure is usually carried out 1 , 15 . hereby , the infected prosthesis is removed , debridement and jet lavage of the infected area are performed and a new endoprosthesis is reimplanted at the same time . in most of these cases the infection management consists of systemic antibiosis and antibiotic - loaded bone cement for fixation of the prosthesis . the patient is not endangered by the risks of additional surgeries , and the success rates are reportedly between 80 - 85 % 15 . however , in case of a surgical revision with prosthesis retention , one of the major problems might be wound healing complications with a persistent draining sinus despite revision . in multiple surgical fields the vacuum - assisted closure ( v.a.c . ) has been established as an efficient treatment option even for deep wound infections . the most important advantages of this system are an increased localised blood flow , the reduction of tissue bacterial counts , elimination of interstitial edema and the safe fluid flow in a closed system 2 . furthermore , the structure of the sponges and the altered pressure environment in the wound stimulate the proliferation of granulation tissue 2 . however , although the v.a.c .- therapy corresponds with the concept of infection treatment with implant / prosthesis preservation , it is not often used in orthopaedic surgery . in this study , we report our experience on the management of bacterial infections and/or draining sinus of the hip joint by means of the v.a.c . - therapy . between 2000 and 2007 , 66 patients with early infections after various hip joint surgeries ( fig . an infection eradication could be achieved after a single revision , consisting of hematoma removal , pulsatile lavage and insertion of gentamicin - loaded collagen sponges . the remaining 28 patients ( 11 male/ 17 female ; mean age 71 y. [ 43 - 84 ] ) have been treated by means of v.a.c .- therapy ( table 1 ) . in all cases , at least one surgical revision [ 1 - 7 ] has been performed for infection treatment prior to v.a.c . all data about the patients , primary surgical procedures , revisions and follow- up are shown in table 1 . our operative concept always began by injecting methylene blue into the fistula in order to define the areas of necessary debridement and lavage ( fig . the surgical approach was chosen according to the surgeon 's preferences or along the pre - existing surgical approach . all tissue layers were anatomically prepared until reaching the wound / resection cavity or the prosthesis . meticulous debridement of all necrotic and infected tissues and jet lavage with 10 l ringer solution pl 2511 ( fresenius - kabi , bad - homburg , germany ) were performed . 1 - 3 polyvinylalcohol ( pv ) sponges have been placed either around the prosthesis stem or into the resection cavity ( fig . we chose the pv sponges instead of the polyurethane ones because they cause less pain and can be left in situ for a longer time period . the wounds have been closed in layers under meticulous reconstruction and accurate adaptation of the tissue layers ( fig . postoperatively , a continuous subatmospheric pressure of 200 mm hg has been initially attached to the wound via v.a.c . ats ( kci , medizinprodukte gmbh , walluf , germany ) . after infection eradication ( defined by the clinical course , laboratory parameters and inspection of the drained fluid by the v.a.c . - system ) the v.a.c . after pulsatile lavage , 1 - 2 gentamicin - loaded collagen sponges were inserted into the wound . one redon drain was placed around the prosthesis or into the wound cavity and another was placed subfascial . postoperatively , all patients have been treated with systemic antibiosis according to antibiogram for the first 2 weeks followed by an oral antibiosis for another 2 weeks . in cases without germinal proof , 48 - 72 h after surgery an alteration from haemorrhagic to serous fluid could be observed in the v.a.c . afterwards , the continuous pressure was decreased to 150 mm hg and remained at this level until sponge removal . after a mean period of 9 [ 3 - 16 ] days the inflammation parameters ( c - reactive protein ( crp ) , erythrocyte sedimentation rate ( esr ) , leucocytes blood count ) were retrogressive , and the wound secretion was obviously reduced so that we were able to plan the surgical removal of the sponges . at this point , we accurately debrided the skin parts of the tubes exit holes . in cases with a macroscopically not clean operative situs , the sponges were only exchanged and tissue samples as well as parts of the removed v.a.c sponges were sent for further microbiological examination . no complications were observed during the sponges ' removal , independent on the implantation period . at sponges removal , tissues samples sent for microbiological examination were negative in 26/28 cases . at a mean follow - up of 36 [ 12 - 87 ] 2 , it was necessary to remove the sponges after 8 days due to a postoperative haemorrhagia and consecutive coagulation complications caused by liver cirrhosis and consecutive thrombocytopenia . however , there was no negative influence on the remaining therapy progress with regard to the infection sanitation . in cases 10 and 16 , the infection persisted so that the endoprosthesis had to be removed and a gentamicin - vancomycin - impregnated pmma spacer ( 1 g gentamicin/ 4 g vancomycin/ 80 g pmma ) was implanted , respectively . a prosthesis reimplantation was performed in both cases . at a further follow - up of 30 and 32 months , infections after total hip replacement are based on the bacterial colonisation on the surface area of an endoprosthesis involving the local tissue and causing an immune reaction 15 . the most common problem hereby is the draining sinus , prolongating and preventing wound healing . the pathophysiological mechanisms are the emergence of interstitial edema , disturbed microcirculation and bacterial contamination , usually leading to prosthesis explantation 15 . morykwas et al . have demonstrated that the application of the v.a.c . - system increased the granulation tissue formation and the local blood flow , and enhanced the bacterial clearance function 13 . since interstitial edema is eliminated without any impact on systemic haemodynamics , the surrounding tissue is decompressed and local microcirculation is re - established . the increase of the oxygen gradient facilitates the transportation of toxins and inhibitors inducing thereby the wound healing 16 . as a result of the increased angiogenesis , last but not least , the transport of cellular and humoral components of the immune system to the infected area is facilitated , which leads to a significant reduction of the bacterial count . could show that exposed implants can be preserved by v.a.c .- application and an overgrowth of granulation tissue can be observed 5 . despite its advantages as granulation tissue formation , safe wound fluid flow and bacteria count reduction , the v.a.c .- system is not often used in the treatment of prosthesis - related infections . reported an infection eradication in 9 out of 10 patients having early infections after total hip or excision arthroplasty by means of the conventional v.a.c .- . showed good results in 3 cases by using the v.a.c .- instill system in the treatment of early infections after total hip replacement ( follow - up not reported ) 7 . lehner and bernd made similar observations with the v.a.c .- instill system in 2 cases at a follow - up of 8 and 22 weeks , respectively 10 . an infection persistence or reinfection was seen in 8 cases ( 47 % ; follow - up not reported ) , however , the authors defined early infections as those within the first postoperative year and not within the first six postoperative weeks . to our knowledge , our patient collective is the largest one having been treated by means of the v.a.c .- therapy at the site of an early hip joint infection . we believe that the careful patients ' selection as well as the modified technique is responsible for the good outcome . in the usual v.a.c . - technique , the sponges are fixed on wound areas by a sterile self adhesive foil . in contrast to that , we insert the sponges either periprosthetically or into the resection cavity . hereby , intact soft - tissues are an indispensable premise for emergence and retention of the vacuum . the tubes supporting the subatmospheric pressure applied are transcutaneously led out . then the wound is closed . in order to achieve a bacterial count reduction , the following requirements have to be met : meticulous debridement of the tissue 16 - 17 , mechanical cleaning and lavage of the exposed prosthesis parts . moreover , we advance the view that an adequate wound closure can only be performed after an exact anatomical preparation and mobilisation of the tissue layers . this anatomical preparation and the resulted reconstruction of the soft - tissue layers may allow an enhanced biomechanical function for the postoperative clinical outcome . hereby , the tissue blood flow is optimised , thus contributing to infection sanitation 11 . further advantages of our procedure are the less extensive bandage changing , with a positive influence on the patients convenience 16 and the possibility of costs minimization 8 , 14 . the disadvantage of lacking inspections of the sponges can be compensated by daily controlling of the canister fluid and monitoring of the inflammation parameters . our clinical outcome with a success rate in 26 out of 28 cases after a mean follow - up of 3 years indicates that the v.a.c .- therapy can be a valuable contribution to the treatment of early hip joint infections . application should be strictly made . if a vacuum can not be developed due to skin and tissue lesions or necroses , then the v.a.c .- therapy should not be used for infection management of the underlying implant . moreover , the virulence of the causative pathogens , the severity of infection and the host response to antimicrobial treatment are parameters to bear in mind when v.a.c .- therapy is elected for infection management . multimicrobial infections , including bacteria and fungi 9 , seem to overstrain the clearance function of the v.a.c .- therapy , thus being probably the reason for the system failure in the infection treatment in case 10 . one limitation of our study is that we can not define the ideal frequency for sponge exchange since there exists no consensus regarding the use of the v.a.c . - system would have the same outcome as the polyvinylalcohol sponges did in the present study . equally to that , our results account only for an initial pressure of -200 mm hg with a reduction after 2 - 3 days to -150 mm hg . however , patients ' collectives suffering from joint infections are frequently so inhomogenous that a randomization is difficult , and therefore , the orthopaedic surgeon should treat each case individually . in conclusion , we recommend that the v.a.c .- therapy can be used in cases with prolonged draining sinus or early infections after total hip and excision arthroplasty . intact soft - tissues are an indispensable premise for development and retention of the vacuum . the patients ' comfort can be enhanced and the frequency of the bandages exchange reduced . hereby , the creation of a therapy concept is essential with respect to the treatment strategies of septic surgery and the causes of the infection .

the aim of the present study was to evaluate the efficacy of the vacuum - assisted closure ( v.a.c . ) system in the treatment of early hip joint infections . 28 patients ( 11 m / 17 f ; mean age 71 y. [ 43 - 84 ] ) with early hip joint infections have been treated by means of the v.a.c .- therapy . at least one surgical revision [ 1 - 7 ] has been unsuccessfully performed for infection treatment prior to v.a.c . - application . pathogen organisms could have been isolated in 22/28 wounds . during revision , cup inlay and prosthesis head have been exchanged and 1 - 3 polyvinylalcohol sponges inserted into the wound cavity/ periprosthetically at an initial continuous pressure of 200 mm hg . postoperatively , a systemic antibiosis was given according to antibiogram . 48 - 72 h after surgery an alteration from haemorrhagic to serous fluid was observed in the v.a.c .- canister . afterwards , the pressure was decreased to 150 mm hg and remained at this level till sponge removal . after a mean period of 9 [ 3 - 16 ] days the inflammation parameters have been retrogressive and the sponges were removed . an infection eradication could be achieved in 26/28 cases . in the two remaining cases the infected prosthesis had to be explanted and a gentamicin - vancomycin - loaded spacer has been implanted , respectively . at a total mean follow - up of 36 [ 12 - 87 ] months no reinfection or infection persistence was observed . the v.a.c .- system can be a valuable contribution in the treatment of early joint infections when properly used . indications should be early infections with well - maintained soft - tissues for retention of the negative atmospheric pressure .

progressive prostate cancer that has been treated with androgen - deprivation therapy using an antiandrogen , such as bicalutamide , occasionally causes antiandrogen withdrawal syndrome ( aws ) , which results in a response involving a significant decline in prostate - specific antigen ( psa ) levels . aws is generally defined as subjective and/or objective improvement following discontinuation of an antiandrogen in patients with elevated psa levels who are treated with combined androgen blockade ( cab ) using steroidal or non - steroidal antiandrogens ( 1 ) . the duration of aws varies considerably ( 1 ) and only a limited number of cases exhibiting a complete response , in terms of psa level decline , have been reported . we herein report the case of a patient with metastatic prostate cancer who received cab , with the longest duration of a complete response reported to date . a 72-year - old man visited the cancer institute hospital ( tokyo , japan ) on june 9 , 2004 , complaining of right hip joint pain . laboratory examination revealed a psa level of 588.8 ng / ml and an elevated alkaline phosphatase level 539 tomography ( ct ) and bone scintigraphy scans revealed metastases to the right pelvis and right femoral head ( extent of disease i ) . cab consisting of a luteinizing hormone - releasing hormone analog and bicalutamide 80 mg / day was immediately administered . the serum psa level promptly decreased to 0.16 ng / m in 3 months and had reached a nadir of 0.02 ng / m by may 26 , 2005 . external beam radiation therapy ( 70 gy ) to the prostate was then performed for local cancer control . the psa level had decreased to 0.00 ng / ml by january 31 , 2006 . the psa level gradually increased to 0.34 ng / m by march 3 , 2009 ; however , no new lesions of distant metastasis were detected by ct or bone scintigraphy . the psa level again decreased to 0.00 ng / ml by august 18 , 2009 . to date , this undetectable psa level has been maintained , and no recurrence has been detected by bone scintigraphy or ct for the past 6 years since the introduction of aws . written informed consent was obtained from the patient regarding the publication of the details of this case . kelly and sher first reported aws with the non - steroidal antiandrogen flutamide ( 2 ) ; they reported a decrease of 50% in the psa level following discontinuation of flutamide in 10 of their 35 patients ( 29% ) ( 3 ) . the association between antiandrogen withdrawal and a change in psa level is a general phenomenon observed for all antiandrogens . the response rate previously reported by suzuki et al was 15.5% for bicalutamide and 12.8% for flutamide , with no significant difference between the two antiandrogens ( 5 ) and a reported mean response duration of 5.83.8 months . noguchi et al reported the case of a patient who exhibited a complete psa decline for > 2 years after the discontinuation of a steroidal antiandrogen ( 6 ) . compared to these previously reported studies , the response duration of the present case is the longest reported to date . the duration of antiandrogen use prior to withdrawal was identified as an aws predictor by sator et al ( 7 ) , who reported that only the duration of prior antiandrogen exposure was a significant predictor of psa response after withdrawal . additionally , a higher frequency of aws was observed in the group of patients who received antiandrogen for a longer duration ( > 32 months prior to withdrawal ) . in the present case , consistent with sator 's report , the patient received bicalutamide for ~48 months prior to withdrawal . mutation of androgen receptors ( ars ) is the most supported hypothesis ( 8) . in this hypothesis , bicalutamide acts as an agonist for mutant ars . in the present case , a luteinizing hormone - releasing agonist was used for > 4 years , and external beam radiation ( 70 gy/35 fx ) was performed prior to the discontinuation of bicalutamide . it is suggested that , during this period , androgen - dependent and hormone - sensitive tumor cells were eliminated , whereas a moderate number of ar - mutated cells survived . takeshita et al reported a case in which aws and radiotherapy of the prostate contributed to the disappearance of metastatic lymph nodes and a decline in psa level to below the detection limit for a long period ( 9 ) . culp et al recently reported that local therapy for the prostate may confer a survival advantage to selected patients with metastatic disease ( 10 ) . therefore , in the present case , aws combined with local treatment to the prostate ( radiation therapy ) may achieve good cancer control . small et al reported that there was no significant difference between the median survival times of aws responders and non - responders ( 11 ) . however , despite advanced disease , the patient in the present case has survived for > 10 years since the diagnosis . it is thus considered that aws has contributed to the prolongation of the patient 's life expectancy and has improved his quality of life . in conclusion , although the long response duration seen in the present case is rare , the aws phenomenon should be considered , even in patients with advanced disease .

antiandrogen withdrawal syndrome ( aws ) is a well - established phenomenon in prostate cancer treated with combined androgen blockade ( cab ) . aws is generally defined as subjective and/or objective improvement following discontinuation of an antiandrogen . however , the duration of the aws response is usually limited . in addition , a complete response is quite rare . we herein present the case of a patient who achieved complete response from aws , with the duration of this response lasting for > 6 years . a 72-year - old man with metastatic prostate cancer received cab with a luteinizing hormone - releasing hormone analog and bicalutamide . in addition , for local cancer control , external beam radiation therapy ( 70 gy ) to the prostate was performed . subsequently , the serum prostate - specific antigen ( psa ) level reached a nadir ( undetectable level ) . four years later , the patient 's serum psa level started to rise , and bicalutamide was discontinued to confirm aws at a serum psa level of 0.34 ng / ml . the psa level immediately decreased again to an undetectable level ( 0.00 ng / ml ) , where it has been remained for 6 years . bone scintigraphy and computed tomography scans have shown no evidence of bone or other metastases since the introduction of aws . to the best of our knowledge , there have been no reports of such a long duration of complete response from aws . therefore , this phenomenon should always be considered , even in patients with advanced disease .

cystic fibrosis ( cf , omim 219700 ) is a lifeshortening autosomal recessive disease that affects one in 3900 individuals in the united states ( us ) . the highest incidence of cf worldwide has been observed in european whites and ashkenazi jews , at one in 2500 and one in 2270 , respectively 1 , 2 , 3 . a wide ethnic variation of cftr mutations has been reported , indicating the need for diverse and ethnicspecific mutations to be included in diagnostic and carrier screening conducted in the diverse us population 1 , 4 . many of the mutations identified by temporal temperature gradient electrophoresis ( ttge ) and/or dna sequencing in the us hispanic population are not detected in the standard acmg / acogrecommended 23mutation screening panel , despite several of these having a relative frequency over 1% 1 . here , we report a case of a 10yearold hispanic boy diagnosed with cystic fibrosis by positive sweat chloride test , who was found to have two rare cftr gene mutations , c.233dupt and 7t/12tg . this is the first homozygous case of c.233dupt and only the second case described in the literature with this mutation , with only six in the clinical and functional translation of cftr ( cftr2 ) database to date 5 . we describe the aggressive progression of his disease , indicative of the phenotypic severity of this particular mutation . we reinforce the recommendation for a wide mutation screening panel for patients with cf in this ethnic population , due to the potential benefits of early recognition and treatment . a tenyearold hispanic boy with history of cystic fibrosis ( cf ) diagnosed at 2 months of age presented to the pulmonology clinic with worsening pulmonary function and recurrent pulmonary infections . the patient 's birth history was unremarkable ; he was born at term , with no history of consanguinity . the patient 's family history is significant only for the paternal side having diabetes mellitus , but no known family history of cf . the patient 's newborn screen was positive for elevated irt , but a subsequent 97cftr mutation panel was negative . at 2 months of age , a history of failure to thrive , sweat chloride concentration of 94 mmol / l , repeat level 84 mmol / l , and fecal elastase levels ( < 100 ) , led to his diagnosis of cystic fibrosis with pancreatic insufficiency . the patient was reported to have sporadic followup with the pulmonologist in his birth state . full cftr gene sequencing ( john hopkins mutation analysis program [ map ] ) identified a novel mutation , c.233dupt on exon 3 of the cftr gene ( fig . 1 ) and a 7t/12tg polymorphism several years later , with no other mutations identified . after his diagnosis , his mother tested negative for 23 mutations , and younger sister 's sweat test and 40mutation analysis were negative , suggesting that the most common mutations were unlikely to be present in their family . genomic sequencing identifying the c.233dupt frameshift mutation in exon 3 of the cftr gene in our patient . his longterm therapy at this early stage included a bronchodilator , dornase alfa daily , airway clearance with chest percussion therapy , vitamins , and pancreatic enzyme replacement . at 6 months of age , he was admitted for his first cf exacerbation , at which time his sputum culture was positive for pseudomonas , treated with chronic tobramycin inhalation . by 2 years of age , he had multiple cf exacerbations and had received several weeks of iv and inhaled antibiotics . chest xrays beginning at 3 months of age , followed by ct scan , showed significant bronchiectasis , and consolidation of the right middle lobe and inferior segment of the lower lobe . bronchoscopy and bronchoalveolar lavage ( bal ) were unable to resolve the significant mucous plugging . the patient underwent thoracoscopic right middle lobe and right lower lobectomies . at the age of four , he demonstrated persistent right upper lobe atelectasis versus infiltrate , with flexible and rigid bronchoscopy revealing purulent fluid in the right bronchi that grew staphylococcus aureus . the right upper lobe infiltrate persisted , however , and a ventilation perfusion ( vq ) scan measured only 3% pulmonary perfusion to the right upper lobe , leading to a right completion pneumonectomy . after the pneumonectomy , the patient continued to have recurrent cf exacerbations with respiratory infections despite being fully immunized . immune workup was unremarkable , with normal immunoglobulin levels and expected streptococcus pneumoniae igg antibody levels . his sputum and respiratory cultures have been positive for strenotrophomonas maltophila , methicillinresistant staphylococcus aureus ( mrsa ) , and pseudomonas aeruginosa . in the past 3 years , he has been admitted to the hospital four times per year and required iv antibiotics for onemonth duration on multiple occasions . flexible bronchoscopy showed obstruction of the stump by thick material , and bal and brush biopsy were positive for candida parapsilosis that responded well to caspofungin . his last chest ct showed hyperinflated left lung with moderately severe changes of cystic fibrosis , bronchiectasis , bronchial wall thickening , mucus plugging , atelectasis , scarring in the lingula , and stable changes of prior right pneumonectomy ( fig . his best forced vital capacity ( fvc ) was 0.97 l , best forced expiratory volume in the first second ( fev1 ) was 0.61 l , with fev1s ranging from 20% to 40% of predicted value . his o2 saturation on room air was 94% , with venous o2 saturation 70% , and venous partial pressure o2 40 mmhg , total co2 33 mmhg at last examination . the patient currently takes levalbuterol tartrate and dornase alfa and uses a saline nebulizer , positive pressure device to help mucociliary clearance , and highfrequency chest wall oscillation ( vest ) treatments . chest ct with contrast after right pneumonectomy shows a hyperinflated left lung with stable moderatetosevere bronchiectasis . a marked rightward mediastinal and cardiac shift is seen with elevation of the right hemidiaphragm . additionally are treeinbud densities consistent with peripheral airway occlusion , patchy areas of air trapping within the inferior lingula , and chronic subsegmental collapse and fibrosis with marked focal cystic bronchiectasis . a gastrostomy tube was placed when the patient was 7 years old to meet his caloric goals with complete liquid tube feeding formula . he was also found to have cfrelated diabetes mellitus that is managed with insulin , vitamin d deficiency , and cfrelated liver disease , for which he receives ursodiol . other laboratories showed normal hemoglobin , platelets and electrolytes , elevated bun of 40 but normal creatinine 0.3 mg / dl . dualenergy xray absorptiometry ( dexa ) scan showed bone density consistent with chronological age and total body less head zscore of 1.9 . on his most recent examination , he coughed occasionally and had few crackles on the left and hollow tubular breath sounds on the right chest , 2 + clubbing , notable chest wall deformity with scoliosis , 2 + tonsils , and cobblestoning of the posterior pharynx . his frequent exacerbations , moderately severe lung disease on imaging studies and consistently poor postpneumonectomy pulmonary function tests , have led his clinical care team and family to begin discussing the possibility of lung transplant . more extensive genomic sequencing of the patient 's mother and father suggests this patient is homozygous for the c.233dupt mutation as both parents are carriers of this rare mutation on exon 3 of the cftr gene . in addition , his mother also carries a 5t/12tg polymorphism that was not passed on to the patient ( fig . sequencing results showed the c.233dupt mutation on exon 3 of the cftr gene on exon 3 in the patient 's mother and father . the patient 's mother was found to be heterozygous for both the c.233dupt mutation , 5t/12tg and 7t/12tg polymorphism . the patient 's father was found to be heterozygous for the c.233dupt mutation with 7t/7 t . cystic fibrosis is caused by mutations in the cystic fibrosis transmembrane conductance regulator ( cftr ) gene on chromosome 7q31 . this encodes a transmembrane chloride ion channel protein that requires adenosine triphosphate ( atp ) binding and hydrolysis to function . deficiency or dysfunction of this protein has systemic downstream effects on exocrine glands that lead to elevated sweat chloride levels , thick mucus in the lungs , and in 85% of patients , severely impaired gastrointestinal absorption due to exocrine pancreatic insufficiency 6 , 7 . typically , other complications including cfrelated diabetes and cf liver disease are seen in the second decade of life . median predicted survival age has consistently increased since 1986 to 39.3 years in 2014 8 . although mutations in the deltaf508 cftr gene allele are the most common and account for nearly twothirds of cftr mutations , the cystic fibrosis mutation database and cftr2 database currently list over 2000 cftr mutations seen in individuals with cf , with ongoing work to identify the diseasecausing mutations 2 , 5 , 9 , 10 . to the best of our knowledge to date , this is the first case describing a cystic fibrosis patient homozygous for c.233dupt , with only six cases of the c.233dupt ( p.phe77 fs ) cftr mutation reported in the cftr2 database 10 . the mutation identified in our patient , 365_366inst ( c.233dupt , p.phe77 fs , p.trp79leufsx32 ) , is a rare frameshift mutation and truncation on exon 3 that causes no cftr protein to be produced . the complete loss of this protein rather than merely a partial dysfunction as seen with many other mutations may help predict the mechanism of increased disease severity . phenotypic penetrance appears to be dependent on homozygosity of the c.233dupt mutation , as both parents are heterozygous and asymptomatic , yet this patient has severe disease . alper et al . described the only other case of this mutation reported in the literature in a 10yearold hispanic female who was diagnosed with cf at 10 months of age after presenting with recurrent respiratory tract infections and failure to thrive , and a sweat chloride concentration of 84 mmol / l 5 . she was found to have a compound heterozygous mutation identified as c.233dupt ( p.phe77 fs , 360_365inst ) with 1756g > t ( p.gly542ter ) by temporal temperature gradient gel electrophoresis ( ttge ) scanning of all cftr gene coding exons . she had no family history of cf and , by 10 years old , had developed moderate obstructive lung disease and clubbing 5 . both our patient and the patient in the alper case are hispanic without a family history of cf . although definitive conclusions can not be drawn from two cases alone due to low power , these cases suggest that this rare mutation has a higher incidence in the hispanic population and is associated with higher clinical severity . the 7t/12tg variant that our patient demonstrates may also influence the expression of his disease . common variants of the polythymidine ( poly t ) tract in intron 8 of the cftr gene include 5 t , 7 t ( most common polymorphic variant ) , and 9 t . based on their size , they have been associated with cftrrelated disorders including cystic fibrosis and congenital absence of the vas deferens . the tg tract adjacent to the poly t tract typically includes 11 , 12 , or 13 tg repeats , where longer tg repeats ( 12 or 13 , as in our patient ) tend to correlate with an abnormal phenotype . in combination , a shorter poly t tract ( 5 t ) and longer tg tract lead to the most decreased efficiency of intron 8 splicing , which may contribute the wide range of clinical presentations 11 , 12 . the severity and unrelenting nature of this patient 's disease is suggested by his history of lobectomies and eventually a total pneumonectomy due to persistent atelectasis and mucous plugging , despite more conservative management . in addition , our patient has earlyonset cfrelated diabetes and cf liver disease . in retrospect , it is difficult to judge whether the decision to perform the initial lobectomies at 2 years of age was too aggressive . additionally , psychosocial and financial circumstances , including language barrier ( parents spoke limited english ) and poor adherence , may have contributed to his severe progressive disease 13 . a wide range in cftr allele mutation frequency has been observed in different ethnic groups , as well as regional heterogeneity worldwide 5 , 14 . ttge was found to increase the detection rate of cf mutations in hispanic patients from 58.0% to 97.5% after common mutation analysis 5 . previous studies have reviewed the distribution of cftr mutation in the us hispanic and african american population and noted an increased frequency of mutations that are not detected by the standard 87mutation panel as well as many with variable expression 1 , 4 , 15 . in fact , the 23mutation panel ( american college of medical genetics and genomics ) that is used for diagnosis and newborn screening in the general population detects fewer than half of the molecular mutations of patients with cf who are neither caucasian nor native american 15 . thus , prior studies have recommended a diverse mutation screen analysis including ethnicspecific mutations testing when screening for mutations in the diverse us population , with additional benefits to testing deletion / duplication rearrangements in hispanics 1 , 4 , 15 , 16 . the current case supports this recommendation , as our patient initially tested negative for 97 different mutations before fullgene sequencing detected his rare mutation . early detection and treatment of cf has shown to significantly improve outcomes in children , with treatment initiation before 2 months of age associated with improvement in respiratory and digestive outcomes before 6 years of age . in fact , treatment initiation advanced by 413 months appeared to affect outcomes throughout childhood 17 . advances in treatment options have also allowed for significantly improved disease control and increased life expectancy over time . cystic fibrosis is a lifeshortening autosomal recessive disease caused by mutations in the cftr gene , in which over 2000 mutations have been identified . this points to the need for a broad range of cftr mutation analyses or even full genotyping for patient populations who do not have their mutations identified with the standard mutation panels . this case also suggests a severe disease course associated with this particular mutation , for which early detection and treatment has the potential to improve outcomes . written informed consent was obtained from the guardian for publication of this case report and any accompanying laboratory values and images . a copy of the written consent is available for review by the editor of this journal on request . ks : gathered data and drafted the initial manuscript ; mmgb : supervised , assisted in data collection , critically reviewed and revised the manuscript . all authors approved the final manuscript as submitted and agree to be accountable for all aspect of the work .

key clinical messagecystic fibrosis is a lifeshortening multisystem genetic disease . while readily tested , few tests analyze rare gene mutations prevalent among ethnic minorities . this case of a hispanic child with a rare cfcausing c.233dupt mutation and severe disease emphasizes the need for broad cftr mutation analyses and genotyping particularly in minority populations .

proteases constitute the most important group of industrial enzymes used in the world today , accounting for approximately 50% of the total industrial enzyme market . they have diverse applications in a wide variety of industries such as detergent , food , pharmaceutical , leather , peptide synthesis , and for the recovery of silver from used x - ray films [ 2 , 3 ] . fish viscera , one of the most important by - products of fishing industry , is known to be a rich source of digestive enzymes , especially proteases that have high activity over a wide range of ph and temperature conditions [ 46 ] and exhibit high catalytic activity at relatively low concentration . these characteristics of fish proteases have made them suitable for some interesting new applications in food - processing operations . in addition , fish enzymes could be utilized to produce bioactive peptides from fish proteins [ 8 , 9 ] . considering the specific characteristics of these enzymes , fish processing by - products are currently used for enzyme extraction . the most important digestive proteolytic enzymes from fish and aquatic invertebrates viscera are the aspartic protease pepsin secreted from gastric mucosa , and the serine proteases , trypsin , and chymotrypsin secreted from the pancreas , pyloric caeca , and intestine . acidic proteases from fish stomachs display high activity between ph 2.0 and 4.0 , while alkaline digestive proteases , such as trypsin , are most active between ph 8.0 and 10.0 . digestive enzymes of several species of fish have been isolated from the internal organs including gastric , intestinal , and hepatopancreas [ 5 , 9 , 1113 ] . chitin , a homopolymer of n - acetyl - d - glucosamine residues linked by -1,4 bonds , is the most abundant renewable natural resource after cellulose . chitin and its derivatives are biomolecules of a great potential , possessing versatile biological activities , demonstrating excellent biocompatibility and complete biodegradability . therefore , they have found extensive applications in pharmacy , medicine , agriculture , food and textile industries , cosmetics , and wastewater treatment [ 1517 ] . the main sources of raw material for the production of chitin are cuticles of various crustaceans , principally crabs and shrimps . chitin in biomass is closely associated with proteins , inorganic compounds ( such as calcium carbonate ) , lipids , and pigments . they all have to be quantitatively removed to achieve the high purity of chitins necessary for biological applications . conventionally , to extract chitin from crustacean shells , chemicals processing for demineralization and deproteinization have been applied . raw materials were first treated with dilute hydrochloric acid at room temperature to remove metal salts , particularly calcium carbonate , and then with strong bases to remove proteins . however , the use of these chemicals may cause a partial deacetylation of the chitin and hydrolysis of the polymer , resulting in final inconsistent physiological properties . an alternative approach to these harsh chemical treatments is the use of proteolytic microorganisms [ 2023 ] or proteolytic enzymes . bustos and healy demonstrated that chitin obtained by the deproteinization of shrimp shell waste with various proteolytic microorganism had higher molecular weights compared to chemically prepared shellfish chitin . in the present paper , we describe the extraction and characterization of alkaline proteases from z. ophiocephalus , r. clavata , and s. scrofa which are suitable in the chitin production process . casein sodium salt from bovine milk , trichloroacetic acid ( tca ) , ethylene diamine tetraacetic acid ( edta ) , and bovine serum albumin were purchased from sigma company co. ( st louis , mo , usa ) . hydrochloric acid and tris(hydroxymethyl)aminomethane were procured from panreac quimica sa ( barcelone , spain ) . sodium dodecyl sulphate ( sds ) , acrylamide , ammonium persulphate , n , n , n , n - tetramethyl ethylenediamine ( temed ) , and coomassie brilliant blue r-250 were from bio - rad laboratories ( mexico city , mexico ) . goby ( z. ophiocephalus ) , thornback ray ( r. clavata ) , and scorpionfish ( s. scrofa ) were purchased from the fish market of sfax city , tunisia . the samples were packed in polyethylene bags , placed in ice with a sample / ice ratio of approximately 1 : 3 ( w / w ) and transported to the research laboratory within 30 minutes . after the fish were washed with water , their viscera were separated , rinsed with cold distilled water , and then stored in sealed plastic bags at 20c until they were used for enzyme extraction . viscera ( 20 g ) were separated and rinsed with distilled water , and then homogenized for 5 minutes with 20 ml of extraction buffer ( 10 mm tris - hcl , ph 8.0 ) with the use of tissue homogenizer . the resulting preparations were centrifuged at 8500 g for 30 minutes at 4c . the pellets were discarded and the supernatants were collected and then frozen at 20c and used as crude protease extracts . sodium dodecyl sulphate - polyacrylamide gel electrophoresis ( sds - page ) was carried out as described by laemmli , using 5% ( w / v ) stacking and 15% ( w / v ) separating gels . samples were prepared by mixing the crude enzyme extracts at 1 : 5 ( v / v ) ratio with distilled water containing 10 mm tris - hcl ph 8.0 , 2.5% sds , 10% glycerol , 5% -mercaptoethanol , and 0.002% bromophenol blue . after electrophoresis , the gel was stained with 0.25% coomassie brilliant blue r-250 in 45% ethanol-10% acetic acid and destained with 5% ethanol-7.5% acetic acid . protease activity staining was performed on sds - page according to the method of garcia - carreno et al . with a slight modification . after electrophoresis , the gel was submerged in buffer a ( 100 mm of tris - hcl buffer ( ph 9.0 ) ) containing 2.5% triton x-100 , with shaking for 1 hour to remove sds and allow enzyme renaturation . triton x-100 was removed by washing the gel three times with buffer a. the gel was then immersed in 100 ml of 1% ( w / v ) casein in buffer a for 5 minutes at 4c , then further incubated for 10 minutes at 50c to allow for the digestion of the protein substrate ( casein ) by the active enzymes . finally , the gel was stained with 0.25% coomassie brilliant blue r-250 in 45% ethanol-10% acetic acid and destained with 5% ethanol-7.5% acetic acid . the development of clear bands on the blue background of the gel indicated the presence of protease activity . protease activity in the crude alkaline enzyme extracts was measured by the method described by kembhavi et al . using casein as a substrate . a 0.5-ml aliquot of the crude enzyme extract , suitably diluted , was mixed with 0.5 ml of 100 mm tris - hcl ( ph 8.0 ) containing 1% ( w / v ) casein , and incubated for 15 minutes at 50c . the reaction was stopped by the addition of 0.5 ml of tca 20% ( w / v ) . the mixture was allowed to stand at room temperature for 15 minutes and then centrifuged at 10.000 g for 15 minutes to remove the precipitate . one unit of protease activity was defined as the amount of enzyme required to liberate 1 g of tyrosine per minute under the experimental conditions used . the optimum ph of the crude protease extracts was studied over a ph range of 5.013.0 , using casein as a substrate at 50c . for the measurement of ph stability , the crude enzyme extracts were incubated for 1 hour at 4c in different buffers and then the residual proteolytic activities were determined under standard assay conditions . the following buffer systems were used : 100 mm sodium acetate buffer for ph 5.0 - 6.0 , tris - hcl buffer for ph 7.0 - 8.0 , glycine - naoh buffer for ph 9.011.0 , na2hpo4-naoh buffer for ph 12.0 , and kcl buffer for ph 13.0 . to investigate the effect of temperature , the activity was tested using casein as a substrate at the temperature range from 30 to 80c in 100 mm tris - hcl buffer , ph 8.0 for z. ophiocephalus and r. clavata proteases , and ph 10.0 for s. scrofa crude alkaline proteases . thermal stability was - examined by incubating crude enzyme extracts for 60-minutes at different temperatures from 30 to 70c . aliquots were withdrawn at desired time intervals to test the remaining activity at standard conditions . the influence of various metals ions , at a concentration of 5 mm , on enzyme activity was investigated by adding the monovalent ( na or k ) or divalent ( mg , hg , ca , zn , cu , co , ba , or mn ) metal ions to the reaction mixture . the activity of the crude enzyme extracts without any metallic ion was considered as 100% . the effect of nacl concentrations on the activity of the alkaline crude protease extracts was studied , using casein as a substrate , by increasing nacl concentrations in the reaction mixture . the effects of some surfactants ( triton x-100 , tween 80 , and sds ) and oxidizing agents ( sodium perborate ) on alkaline crude proteases stability were studied by preincubating enzymes for 1 hour at 30c . briefly , shrimp waste , collected from the marine food processing industry , was washed thoroughly with tap water and then cooked 20 minutes at 90c . the solid material obtained was dried , minced to obtain a fine powder , and then stored in glass bottles at room temperature . the chemical composition ( proteins , chitin , lipids , and ash ) was determined . the moisture and ash content were determined according to the aoac standard methods 930.15 and 942.05 , respectively , . shrimp shell wastes ( 15 g ) were mixed with 100 mm tris - hcl buffer ph 8.0 at a ratio of 1 : 3 ( w / v ) , minced and then cooked for 20 minutes at 90c to inactivate endogenous enzymes . the ph of the mixture was adjusted to 8.0 , and then the shrimp waste proteins were digested with proteolytic enzymes at 45c using en enzyme / substrate ratio of 10/1 ( unit of enzyme / mg of protein ) . after 3-hour incubation at 45c , the reaction was stopped by heating the solution at 90c during 20 minutes to inactivate enzymes . the shrimp waste protein hydrolysates were then centrifuged at 5000 g for 20 minutes to separate insoluble and soluble fractions . the solid phase was washed , pressed manually through four layers of gauze , and then dried for 1 hour at 60c . the press cake was packed in a plastic bag and stored at 20c until further processing . deproteinization percentage ( % dp ) was calculated by the following equation as described by rao et al . : ( 1)%dp=[(poo)(prr)]100poo , where po and pr are protein concentrations ( % ) before and after hydrolysis ; while o and r represent the mass ( grams ) of original sample and hydrolyzed residue in dry weight basis , respectively . all experiments were carried out in triplicate , and average values with standard deviation errors are reported . mean separation and significance were analyzed using the spss software package ( spss , chicago , ill ) . in order to estimate the number of proteases in the alkaline crude enzyme extracts , samples were separated by sds - page , and then proteolytic activities were revealed by casein zymography activity staining . casein zymography is a very sensitive and rapid assay method that detects nanogram of proteins , in contrast with sds - page which detects micrograms . as can be observed in figure 1 , all crude enzyme extracts showed several clear bands of protease activity with different molecular weights , indicating the presence of several different proteases . it seems that goby crude enzyme extract contained more proteolytic enzymes than the other ones as illustrated in figure 1 by the presence of at least five clear bands of proteolytic activity . when comparing the different profiles , it can be observed the presence of at least one protease common with all crude proteases . the activity of proteolytic enzymes was determined at different ph values from 5.0 to 13.0 . the ph activity profiles of the crude alkaline proteases are shown in figure 2(a ) . the relative activities at ph 7.0 and 10.0 were 55.6% and 81.3% , respectively , of that at ph 9.0 . however , protease activity decreased significantly above ph 10.0 . at ph 11.0 , the activity was approximately 5-fold lower than that at ph 9.0 . the relative activity at ph 9.0 was about 94% . however , an appreciable decrease in activity was observed above ph 9.0 . with s. scrofa crude enzyme extract , the enzyme preparation was highly active between ph 8.0 and 11.0 , with an optimum at ph 10.0 . the relative activities at ph 9.0 , 11.0 , and 12.0 were about 94% , 69% , and 39% , respectively , of that at ph 10.0 . the optimum ph for s. scrofa proteases was similar to those reported by esposito et al . for proteases extracted from the viscera of colossoma macropomum and el hadj - ali et al . for proteases extracted from striped seabream ( lithognathus mormyrus ) . the ph stability profiles of the three crude alkaline proteases are reported in figure 2(b ) . interestingly , the three crude enzyme extracts are highly stable over a wide broad ph range , maintaining about 100% of their original activity between ph 5.0 and 10.0 after 1 hour of incubation at 4c . our results showed that goby proteases present a high ph stability compared to the others crude enzyme extracts . the enzyme preparation from scorpionfish , which is highly active in the alkaline ph range , was also stable over a wide ph range . these results suggest that the viscera of scorpionfish would be a potential source of alkaline proteases for certain industrial applications that require high alkaline conditions , such as detergents . in fact , one of the most important parameters for selection proteases for detergents is the optimum ph . since the ph of laundry detergents is commonly alkaline ( in the range of 9.012.0 ) , protease and other enzymes currently used in detergent formulations should be alkaline in nature with a high optimum ph . optima temperatures for activity of crude alkaline proteases were determined in order to assess their suitability for biotechnological applications . the relative activities at various temperatures using casein as a substrate are reported in figure 3 . the optimum temperature for s. scrofa proteases was 55c , however , alkaline proteases from goby and thornback ray displayed maximum activity at 50c . the relative activities of goby proteases at 40 and 60c were 54% and 70% , respectively . however , an appreciable decrease in enzyme activity was observed above 65c , due to thermal denaturation . thornback ray proteases were more active at 60c than the other crude proteases , retaining 90% of their activity after 1-hour incubation . however , the relative activities of z. ophiocephalus and r. clavata crude proteases were 70% and 45% , respectively . thermal stability of crude alkaline proteases is depicted in figure 4 . enzyme preparations from goby and scorpionfish are highly active at temperatures below 40c , while that of thornback ray were stable at 30c . goby crude enzyme remains fully active even after 60 minutes of incubation at 40c , indicating that this crude enzyme might be used under mild heating conditions . the enzyme preparations from z. ophiocephalus and s. scrofa retained about 24% and 45% of their initial activity after 60 minutes of incubation at 50c , respectively . however , the proteolytic enzymes from r. clavata were completely inactivated in the same conditions . the effects of various metal ions , at a concentration of 5 mm , on the activity of the crude alkaline proteases were studied at optimum conditions for each crude enzyme by the addition of the respective cations to the reaction mixture ( table 1 ) . the addition of cacl2 and mgso4 increased the activity of crude protease extracts of goby and scorpionfish . ca increased the activity of crude proteases from goby and scorpionfish to 110% and 129% , respectively . these results indicated that ca was very effective in improving the activity of the crude proteases . the enhancement of protease activity in the presence of calcium may be explained by the strength of interactions inside protein molecules and the better stabilization of enzymes against thermal stabilization . the ions ba affect partially the protease activity with a relative activity between 87% and 96% . however , fe and hg affect greatly the activity of all crude enzymes . the presence of 5 mm nacl and kcl did not affect protease activity . in addition to activity and stability at high ph range and various temperatures , enzymes incorporated into detergent formulations must be compatible and stable with all commonly used detergent components such as surfactants , perfumes , oxidizing agents , and other additives which might be present in the formulation . furthermore , detergent enzymes should be stable during storage and active during washing in the detergent solution for a long period of time . the suitability of crude alkaline proteases as detergent additive was investigated by testing their stability in the presence of some surfactants and oxidizing agents . as shown in table 2 , crude protease extracts were highly stable in the presence of non - ionic surfactants such as tween 20 , tween 80 , and triton x-100 . for example , the activities of scorptionfish after incubation for 1 hour at 40c were 107% , 109% , and 107% in the presence of 5% triton x-100 , tween 20 , and tween 80 , respectively . however , the strong anionic surfactant ( sds ) at 1% caused 100% inhibition proteolytic activity of r. clavata proteases . in addition , we investigated the effects of oxidizing agents on the crude protease extract . thornback ray and goby proteases were little influenced by oxidizing agents , retaining about 70% and 66% of their initial activity after incubation for 1 hour at 30c in the presence of 1% ( w / v ) sodium perborate , respectively . interestingly , the crude enzyme of scorpionfish remains fully active after 1 hour incubation at 40c . the stability of scorpionfish enzyme extract against sodium perborate was higher than a21 protease from bacillus mojavensis which retained 35% of its initial activity in the presence of 1% oxidizing agent after incubation for 1 hour at 30c . the high stability of scorpionfish enzyme extract in the presence of oxidizing agents is a very important characteristic for its eventual use in detergent formulations . important commercial detergent proteases like subtilisin carlsberg , subtilisin bpn , alcalase , esparase , and savirase are stable in the presence of various detergent components . however , most of them are unstable in the presence of oxidant agents , such as hydrogen peroxide . the effect of nacl concentration on the activity of crude alkaline proteases is shown in figure 5 . the relative activities of goby , scorpionfish , and thornback ray at 10% nacl were approximately 53% , 37% , and 14% , respectively . the results showed that goby proteases exhibited a high activity in the presence of nacl compared to the other crude enzymes . the decrease in activity might be due to denaturation of enzymes caused by the salting out chitin , a polysaccharide found in abundance in the shell of crustaceans , is closely associated with proteins . chemical treatment requires the use of hcl and naoh , which can cause deacetylation and depolymerization of chitin . few studies on the use of proteolytic enzymes for the deproteinization of shrimp wastes have been reported . to the best of our knowledge , there are no available reports on the enzymatic deproteinization of shrimp wastes by fish proteases . many factors , such as the specificity of the enzyme used for the proteolysis , e / s ratio and the conditions used during hydrolysis ( initial temperature value and hydrolysis time ) have been reported to influence the enzymatic deproteinization process . in the present study , alkaline proteases from z. ophiocephalus , r. clavata , and s. scrofa were applied for the deproteinization of shrimp waste to produce chitin and protein hydrolysates using an e / s ratio of 10 u / mg . as depicted in figure 6 , all fish extracts were efficient in shrimp waste deproteinization , and s. scrofa crude extract was the most efficient with a deproteinization percentage of 80% . the deproteinization activity of crude proteases used in this study was similar to many bacterial proteases reported in many previous studies [ 20 , 25 ] . in the present study , alkaline proteases were extracted from the viscera of z. ophiocephalus , r. clavata and s. scrofa and characterized , and their efficiencies in deproteinization of shrimp waste to produce chitin were investigated . crude alkaline proteases from z. ophiocephalus , r. clavata , and s. scrofa showed optimum activity at ph 8.0 - 9.0 , 50c ; ph 8.0 , 55c , and ph 10.0 , 55c , respectively . the alkaline crude proteases were found to be effective in the deproteinization of shrimp waste powder . the protein removals with a ratio e / s of 10 were more than 76% . considering their promising properties , crude protease extracts used in this study may find potential applications in the deproteinization of shrimp waste to produce chitin and chitosan . further research is needed to purify alkaline proteases , and to determine their properties as a possible biotechnological tool in the fish processing and food industries .

the aim of this work was to study some biochemical characteristics of crude alkaline protease extracts from the viscera of goby ( zosterisessor ophiocephalus ) , thornback ray ( raja clavata ) , and scorpionfish ( scorpaena scrofa ) , and to investigate their applications in the deproteinization of shrimp wastes . at least four caseinolytic proteases bands were observed in zymogram of each enzyme preparation . the optimum ph for enzymatic extracts activities of z. ophiocephalus , r. clavata , and s. scrofa were 8.0 - 9.0 , 8.0 , and 10.0 , respectively . interestingly , all the enzyme preparations were highly stable over a wide range of ph from 6.0 to 11.0 . the optimum temperatures for enzyme activity were 50c for z. ophiocephalus and r. clavata and 55c for s. scrofa crude alkaline proteases . proteolytic enzymes showed high stability towards non - ionic surfactants ( 5% tween 20 , tween 80 , and triton x-100 ) . in addition , crude proteases of s. scrofa , r. clavata , and z. ophiocephalus were found to be highly stable towards oxidizing agents , retaining 100% , 70% , and 66% , respectively , of their initial activity after incubation for 1 h in the presence of 1% sodium perborate . they were , however , highly affected by the anionic surfactant sds . the crude alkaline proteases were tested for the deproteinization of shrimp waste in the preparation of chitin . all proteases were found to be effective in the deproteinization of shrimp waste . the protein removals after 3 h of hydrolysis at 45c with an enzyme / substrate ratio ( e / s ) of 10 were about 76% , 76% , and 80% , for z. ophiocephalus , r. clavata , and s. scrofa crude proteases , respectively . these results suggest that enzymatic deproteinization of shrimp wastes by fish endogenous alkaline proteases could be applicable to the chitin production process .

heart rate recovery ( hrr ) is the rate at which heart rate declines from the end of exercise to a predetermined time point during recovery , typically one minute after exercise [ 1 , 2 ] . after submaximal exercise , the withdrawal from sympathetic activity typically takes place 30 seconds into recovery [ 2 , 4 ] . in contrast , increased sympathetic activity following peak intensity exercise may continue for approximately one to three minutes , delaying hrr [ 2 , 5 , 6 ] . a slower hrr has been related with lower cardiovascular fitness , thereby indicating an increased risk of cardiovascular disease . therefore , hrr has been suggested as a noninvasive method for cardiovascular risk assessment in both children and adults [ 3 , 8 ] . body fat is positively associated with risk for cardiovascular disease in children and adults . as hrr is an indirect measure of cardiovascular disease risk , studies in adults have shown that indices of obesity are strong predictors of hrr following exercise [ 3 , 11 ] . dimkpa and oji showed that in healthy adults , obesity surrogates negatively correlated with hrr following submaximal intensity exercise . similarly , singh and colleagues demonstrated that overweight youth experienced a slower one - minute postexercise hrr than healthy weight youth after a maximal protocol followed by one - minute cool - down period . moreover , dangardt and colleagues suggested that children with obesity displayed a significantly lower vagal activity at rest compared to overweight and lean controls . though these studies related body fat and hrr , no research has investigated hrr from aerobic exercise in children with excessive adiposity ( i.e. , those classified as obese , not overweight ) compared to lean controls . in addition , measuring hrr in children predisposed to excessive adiposity ( e.g. , individuals with prader - willi syndrome ) can also reveal particular mechanisms that affect postexercise hrr response . prader - willi syndrome ( pws ) is the best characterized genetic cause of childhood obesity . pws is characterized by hypotonia , hyperphagia , abnormally high adiposity , hypogonadism , and lack of normal growth hormone production . past work investigating autonomic nervous system ( ans ) function in youth with pws presents equivocal results [ 1518 ] ; therefore , those with pws are a particularly unique comparison group to nonsyndromal children as hrr may be related to congenital adiposity and/or syndrome - related ans dysfunction . stinted hrr immediately following peak exercise reveals deficits in parasympathetic reactivation [ 2 , 5 , 6 ] , while stinted hrr from submaximal exercise reveals deficiencies in either parasympathetic reactivation or sympathetic withdrawal [ 2 , 4 ] . thus , studying hrr response from peak and submaximal exercise provides information about different ans regulatory mechanisms . this study investigated whether adiposity and pws influenced postexercise hrr from two different exercise intensities . sixteen ( 7 m and 9 f ) children of normal weight ( nw = body fat percentage 85th percentile for age and sex ; bmi z - score : 0.1 0.6 ; age : 9.4 1.1 y ) , 18 ( 12 m and 6 f ) children with obesity ( ob = body fat percentage > 95th percentile for age and sex ; bmi z - score : 2.0 0.5 ; age : 9.3 1.1 y ) , and 11 ( 8 m and 3 f ) youth diagnosed with pws ( bmi z - score : 1.7 0.7 ; age : 11.4 2.5 y ) participated in this study . this study was approved by the institutional review boards from california state university , fullerton , children 's hospital of orange county , and the united states army medical research and materiel command . written informed assent and consent were obtained from all participants and parents prior to participation . children with diabetes mellitus type 2 , confirmed pregnancy , or those unable to participate in moderate to vigorous physical activity were excluded from participation . , all participants were measured for anthropometrics , body composition , resting heart rate ( hr ) , and blood pressure ( bp ) ; subjects then completed a graded exercise test . during visit two participants were instructed not to engage in physical activity ( i.e. , sports games , bike rides , physical education , etc . ) for a minimum of 24 hours before exercise testing . in addition , participants were provided with a standardized breakfast that contained no caffeine to consume two hours prior to visit arrival . this study was part of a larger research effort devoted to examining the physiological and hormonal responses to exercise in youth with pws . parents of participants completed a medical history questionnaire regarding their child 's health and participation in moderate to vigorous physical activity . pws youth underwent a full health screening by a physician to determine contraindications for exercise testing and participation in the study , as well as tanner stage determined by breast , genital , and pubic hair development . participants removed shoes before all measurements . body mass was measured using a digital scale ( es200l , ohaus , pinewood , nj ) while participants wore a t - shirt and shorts . height was measured after participants inhaled using a wall - mounted stadiometer ( seca , on , canada ) . waist circumference was measured following nhanes guidelines at the top of the participant 's iliac crest at the end of exhalation . total body fat percentage was determined using a whole body dual energy x - ray absorptiometry ( dxa ) scan ( ge healthcare , ge lunar corp . , female participants who had their first menses were required to complete a pregnancy test prior to completing the dxa scan . resting hr , measured via telemetry ( polar usa , lake success , ny ) , and resting bp , measured via aneroid sphygmomanometer ( diagnostix 752 , american diagnostic corporation , hauppage , ny ) , were recorded following five minutes of seated rest . participants completed the mcmaster protocol , a cycling protocol tailored to height and sex , on a cycle ergometer ( corival pediatric , lode b.v . the test consisted of two - minute stages at incremental workloads until the participant reached volitional exhaustion , failed to sustain the desired workload , requested to stop , stood up on the bike pedals , or experienced fatigue - related symptoms . relative peak power output was computed by dividing the test termination load by the participant 's lean body mass obtained from the dxa scan . hrr was determined by computing a hrr value ( hrrv ) calculated as the difference between test termination hr and hr recorded after one minute after exercise . one - minute postexercise hrr is the most commonly used methodology to assess recovery heart rate in children [ 13 , 6 , 8 ] . participants completed a discontinuous submaximal test consisting of ten two - minute cycling intervals each separated by one minute of rest . the resistance setting was based on the hr obtained during the mcmaster protocol and chosen to elicit a hr 160 bpm throughout . this intensity was chosen based on a previous study that used a discontinuous protocol in youth of normal weight and obesity to assess counterregulatory hormonal responses to acute exercise . bp and hr were measured and recorded using the same procedures as visit one . one - way analysis of variance ( anova ) tests were initially conducted to determine group differences for participant characteristics and all exercise responses . anovas were then conducted to determine group differences for hrrv for each exercise intensity . in case of significant group differences , no sex differences were found between and within groups for hrr ; therefore , all children were analyzed together . as expected , ob and pws displayed a significantly greater total body mass , waist circumference , trunk body fat percentage , and total body fat percentage compared to nw . in contrast , nw had significantly greater lean mass percentage than their counterparts ; there was no difference in lean mass percentage between ob and pws ( table 1 ) . all groups had a similar absolute peak workload , peak sbp , and peak dbp , while youth with pws exhibited a lower relative peak power output ( expressed per kg of lean body mass ) and peak hr than nw or ob ( see table 2 ) , who had similar relative peak workloads and hr . absolute submaximal workload was also similar amongst groups ; however , pws had a lower relative power output than nw only during submaximal exercise ( see table 3)ob children were not significantly different from either pws or nw . when expressed as a percentage of peak relative workload , all groups worked at a similar aerobic effort during submaximal exercise ( table 3 ) . all groups had significantly different mean submaximal exercise hr responses , with nw having the highest and pws having the lowest ( see table 3 ) . when expressed as a percentage of peak hr , the hr response during submaximal exercise was significantly lower in ob compared to nw ; pws was similar to both groups ( table 3 ) . ob also had a significantly higher sbp in response to submaximal exercise compared to nw , and pws had a similar response to both groups . for submaximal intensity exercise , youth with pws had a significantly lower hrrv compared to both nw and ob , who had similar hrrv ( figure 1 ) . the results of this study showed that the decline in heart rate following exercise was not dependent on excessive adiposity . the only difference observed was in youth with pws who displayed a significantly slower hrr following submaximal intensity exercise compared to other children . two possible mechanisms explain the lower hrr following submaximal exercise in pws : cardiovascular fitness and/or autonomic abnormality . children of normal weight and those with obesity but without pws had similar recovery responses following both peak and submaximal aerobic exercises . therefore , the results of this study contradicted the results of an earlier study by showing that increased adiposity did not affect postexercise hrr in children with nonsyndromic obesity . however , there was a key methodological difference between the previous study and the present study . the present study measured passive ( i.e. , no cool down , seated ) hrr immediately following test termination . by doing so , postexercise hrr was not affected by continued , voluntary sympathetic activation ( which occurs during active cool down ) and better isolated true recovery rate . another factor that could have influenced the hrr results of this study is cardiovascular fitness . higher levels of cardiovascular fitness have been positively associated with a faster hrr following exercise [ 2731 ] . adults with high levels of physical activity have shown to either sustain or improve hrr over 20 years compared to adults with low levels of physical activity . in addition , hrr improved after exercise training and a hypocaloric diet in obese children . the fact that cardiovascular fitness is related to hrr may partially explain the results of this study . both participants with obesity and those of normal weight were similarly fit ( i.e. , peak wkg lbm , peak hr , and peak estimated vo2peak ( 13.9 1.0 versus 13.6 1.2 mlkg lbmmin ) ) . in contrast , those with pws were significantly less fit compared to children without pws ( i.e. , lower peak hr , lower wkg lbmand lower estimated vo2peak ( 12.4 1.3 mlkg lbmmin ) ) . previous work showed poor cardiovascular fitness and low physical activity level in pws [ 32 , 33 ] . poor cardiovascular fitness in pws might be best explained by physiological characteristics inherent to the syndrome including hypotonia , reduced knee flexor and extensor muscle strength , and/or muscle fiber size deficiency and atrophy . therefore , the lower hrr after submaximal exercise in those with pws compared to the other children possibly indicates that the low cardiovascular fitness in those with pws was related to the slow hrr [ 28 , 31 , 36 ] . in addition , it is possible that hrr in pws may have also been influenced by altered ans function . a review by haqq et al . suggests that in obesity there is an increased sympathetic activity as well as reduced parasympathetic activity . this mechanism is not so clear in pws , although it appears that pws presents similarities with an autonomic disorder called familial dysautonomia where more sympathetic neurons are affected than parasympathetic neurons . richer and colleagues investigated a small cohort of children with pws and controls to determine possible differences in ans function . postganglionic sympathetic function was evaluated through quantitative sudomotor axon reflex testing ( sweat volume ) , cardiovagal testing ( hr response to deep breathing ) , and pupillary response ( hr and bp responses and hr variability spectral analysis to head - up tilt ) . children with pws exhibited a trend towards lower total sweat volume , a smaller hr increase with head tilt - up , and lower low frequency power hr variability at rest and with head - up tilt compared to the controls indicating possible impaired sympathetic function . the results of the present study showed a lower peak hr in pws perhaps related to lower muscular work capacity or sympathetic stimulation . however , the lower hrr following submaximal exercise in those with pws compared to nonsyndromal children may indicate a delayed sympathetic withdrawal and impaired function as suggested by richer and colleagues . in terms of peak exercise responses , it is possible that the chosen protocol limited the capacity to fully assess ans function , and therefore no differences among groups were obtained . past studies suggested that after peak intensity exercise hrr is delayed due to sympathetic activity lasting one to three minutes into the recovery period . the present study measured hrr only during the first minute after exercise , and this is a limitation of the study design and results [ 2 , 5 ] . in addition , the participants with pws were significantly older than nonsyndromal obese controls , which might explain the deterioration in ans function . seven youth with pws presented tanner stages i iii , while two youth presented stage iv and one stage v. in comparison , all nonsyndromal children presented tanner stages i through iii based on their self - report . follow - up analyses were done to determine differences among groups in hrr including only participants with tanner stages i through iii . youth with pws ( n = 7 ) still presented a significantly slower hrr following submaximal intensity exercise compared to nw ( n = 16 ) . however , ob ( n = 17 ) responded similarly to both groups following submaximal exercise . similar to the previous analyses , no group differences were observed following maximal intensity exercise . it is possible that those youth with pws in later stages of puberty experienced more ans deterioration , exacerbating the hrr differences with the nonsyndromal obese controls . regardless , youth with pws still showed a delayed recovery from submaximal intensity exercise compared with normal weight controls , indicating possible ans dysfunction . it is necessary for future studies to account for pubertal status as a screening criterion to better assess whether the differences in hrr are related to ans function . lastly , recording blood pressure at the end of the recovery period is another measurement that could have helped assess the ans function in response to exercise . overall , the results of this study suggest that ans dysfunction in youth with pws could influence hrr following submaximal intensity exercise . having participants with pws complete these protocols presented barriers . most of these limitations were related to the physiological ( lower than normal muscle force capacity , lack of stamina , and lower than normal motor proficiency ) , psychological ( mild to severe mental retardation and mental rigidity ) , and behavioral ( attention deficit , temper tantrums , and inability to accept change ) characteristics of pws [ 13 , 14 , 32 , 33 , 39 ] . even with these difficulties , it was verified that the submaximal effort was similar between those with and without pws by calculating the percentage of relative power output and heart rate compared to peak effort . the present study lacked comparison groups with low and high cardiovascular fitnesses , a comparison that would have isolated the effect of cardiovascular fitness on hrr . however , a study with such research design may not be feasible given that inherently pws presents poor cardiovascular fitness . as demonstrated by the similar recovery rate in children of normal weight and those with obesity , adiposity did not influence hrr following peak or submaximal exercise . youth with pws showed a low cardiovascular recovery capacity , suggesting that poor cardiovascular fitness and/or an altered ans function may impact hrr .

heart rate recovery ( hrr ) is an indicator of all - cause mortality in children and adults . we aimed to determine the effect of adiposity and prader - willi syndrome ( pws ) , a congenital form of obesity , on hrr . sixteen children of normal weight ( nw = body fat % 85th percentile , 9.4 1.1 y ) , 18 children with obesity ( ob = body fat % > 95th percentile , 9.3 1.1 y ) , and 11 pws youth ( regardless of body fat % ; 11.4 2.5 y ) completed peak and submaximal bike tests on separate visits . hrr was recorded one minute following peak and submaximal exercises . all groups displayed similar hrr from peak exercise , while nw ( 54 16 beats ) and ob ( 50 12 beats ) exhibited a significantly faster hrr from submaximal exercise than pws ( 37 14 beats ) . these data suggest that excess adiposity does not influence hrr in children , but other factors such as low cardiovascular fitness and/or autonomic dysfunction might be more influential .

the millennium cohort is the largest prospective study using primary data collection ever undertaken by the department of defense ( dod ) . the study began in 2001 with the objective to collect and evaluate data on health , behavioral risk factors , and occupational characteristics related to military service that may be associated with adverse health outcomes ( 14 ) . this report includes participants from the first enrollment cycle that spanned 20012003 and comprised 77,047 participants ( 36% of those able to be contacted ) . approximately 71% of those participants enrolled at baseline responded to follow - up surveys conducted in 2004 and 2007 . the surveys were administered via paper and the internet and included questions on self - reported provider - diagnosed medical conditions , mental health symptoms , physical and functional status , alcohol and tobacco use , occupational status , military exposures , sleep patterns , and demographic information . this study was approved by the naval health research center institutional review board , and informed consent was obtained from all study participants . this research has been conducted in compliance with all applicable federal regulations governing the protection of human subjects in research ( protocol nhrc.2000.0007 ) . of the 77,047 participants enrolled at baseline , follow - up surveys were completed by 55,021 participants at year 3 and 54,790 at year 6 . since incident diabetes was the outcome of interest , eligible participants included those who were followed until either the outcome was reported to have occurred at year 3 or 6 , or until their last completed follow - up if the outcome was not reported . exclusions included participants reporting provider - diagnosed diabetes at baseline , missing outcome or exposure data , or if dod outpatient or inpatient medical encounter data contained codes for type 1 diabetes ( n = 72 ) ( icd-9 codes 250.x1 and 250.x3 ) . the primary data sources were the self - administered millennium cohort surveys and dod electronic personnel files , managed by the defense manpower data center ( dmdc , seaside , ca ) . for these analyses , electronic records from dmdc provided information on age , sex , race / ethnicity , education , pay grade , service branch , service component , military occupation , dates of separation , and deployment dates . dmdc information was supplemented with self - reported data to reduce missing values when necessary . three sleep variables were included in the analyses : 1 ) trouble sleeping , 2 ) sleep duration , and 3 ) sleep apnea . trouble sleeping was assessed using the sleep items on the prime - md patient health questionnaire ( phq ) and the ptsd checklist civilian version ( pcl - c ) ( 1720 ) . the phq asks , over the last 4 weeks , how often have you experienced trouble falling asleep or staying asleep ? the pcl - c asks , in the past month , have you had trouble falling asleep or staying asleep ? participants with trouble sleeping were defined as those who responded moderately or above on the pcl - c sleep item or several days or longer on the phq sleep item . sleep duration was reported as whole number of hours slept in an average 24-h period over the past month . participants with sleep apnea were identified by self - report as being told by a doctor or other health professional they had sleep apnea . ptsd was assessed using the pcl - c ( 17 ) , a 17-item self - report screening tool for ptsd symptoms during the past 30 days on a 5-point likert scale , ranging from 1 ( not at all ) to 5 ( extremely ) . a positive screen for ptsd at baseline was defined as a report of a moderate or higher level of at least one intrusion symptom , three avoidance symptoms , and two hyperarousal symptoms ( criteria established by dsm - iv ) ( 21 ) . major depressive disorder was assessed using nine items from the phq ( sensitivity = 0.93 ; specificity = 0.89 ) corresponding to the depression diagnosis based on the dsm - iv ( 19 ) . a positive screen for depression at baseline was defined as 1 ) endorsement of depressed mood or anhedonia and 2 ) response of more than half the days or nearly every day to at least five items . other anxiety ( 6 items ) and panic ( 15 items ) symptoms problem drinking was defined using items from the phq on risky behaviors related to alcohol use , such as driving under the influence more than one time over the past year , where endorsement of at least one item indicated problem drinking . binge drinking was defined as consuming five or more drinks ( men ) or four or more drinks ( women ) in 1 day during the past year . smokers were identified as those ever smoking 100 cigarettes in their lifetime , with those persisting in this habit defined as current smokers and those having quit as past smokers . in longitudinal models , service branch , service component , pay grade , military occupation , birth year , race / ethnicity , and education were assessed at baseline . smoking status , alcohol use , bmi , combat deployment , ptsd , depression , anxiety , panic , and all sleep variables were assessed at all available time points . the outcome of interest was incident diagnosed diabetes self - reported on a follow - up survey among people without diabetes at the baseline assessment . at baseline , participants reported if they had ever been told by a doctor or health professional that they had diabetes or at follow - up assessments , participants responded to the same question in regard to the previous 3 years . univariate analyses assessed associations of incident diabetes with sleep , military , demographic , behavioral , and mental health characteristics while accounting for multiple periods of observation per subject . since repeated measurements were available with up to two follow - up assessments per person , generalized estimating equations ( gees ) were used to account for these multiple assessments while adjusting for fixed and time - varying covariates , to estimate adjusted odds of reporting incident diabetes ( 22 ) . incident diabetes was determined at each follow - up assessment , and all covariates were evaluated using data from the previous assessment ( 22 ) . in all multivariable models , adjustments were performed for known type 2 diabetes risk factors captured in the study : age , sex , education , bmi , and race / ethnicity . the final adjusted models were built using a stepwise backward reduction algorithm that retained all significant variables ( p < 0.10 ) ( table 1 ) while always keeping age , sex , race / ethnicity , education , and bmi in the model . additionally , mental health variables were added to the final models to determine if this altered the relationship between sleep and diabetes . first - order interaction terms between retained sleep variables and age , sex , and bmi were tested to determine whether the exposure - outcome associations varied by these characteristics . possible presence of multicollinearity in multivariable models was considered if the variance inflation factor exceeded 4 . best - fitting gee models were judged using the quasilikelihood information criterion , the measure developed for gee models analogous to the akaike information criterion . statistical analyses were performed using sas statistical software , version 9.3 ( sas institute , inc . , baseline demographic , military , and behavioral characteristics of millennium cohort participants by development of diabetes at follow - up of the 77,047 participants enrolled at baseline , follow - up surveys were completed by 55,021 participants at year 3 and 54,790 at year 6 . since incident diabetes was the outcome of interest , eligible participants included those who were followed until either the outcome was reported to have occurred at year 3 or 6 , or until their last completed follow - up if the outcome was not reported . exclusions included participants reporting provider - diagnosed diabetes at baseline , missing outcome or exposure data , or if dod outpatient or inpatient medical encounter data contained codes for type 1 diabetes ( n = 72 ) ( icd-9 codes 250.x1 and 250.x3 ) . the primary data sources were the self - administered millennium cohort surveys and dod electronic personnel files , managed by the defense manpower data center ( dmdc , seaside , ca ) . for these analyses , electronic records from dmdc provided information on age , sex , race / ethnicity , education , pay grade , service branch , service component , military occupation , dates of separation , and deployment dates . dmdc information was supplemented with self - reported data to reduce missing values when necessary . three sleep variables were included in the analyses : 1 ) trouble sleeping , 2 ) sleep duration , and 3 ) sleep apnea . trouble sleeping was assessed using the sleep items on the prime - md patient health questionnaire ( phq ) and the ptsd checklist civilian version ( pcl - c ) ( 1720 ) . the phq asks , over the last 4 weeks , how often have you experienced trouble falling asleep or staying asleep ? the pcl - c asks , in the past month , have you had trouble falling asleep or staying asleep ? participants with trouble sleeping were defined as those who responded moderately or above on the pcl - c sleep item or several days or longer on the phq sleep item . sleep duration was reported as whole number of hours slept in an average 24-h period over the past month . participants with sleep apnea were identified by self - report as being told by a doctor or other health professional they had sleep apnea . ptsd was assessed using the pcl - c ( 17 ) , a 17-item self - report screening tool for ptsd symptoms during the past 30 days on a 5-point likert scale , ranging from 1 ( not at all ) to 5 ( extremely ) . a positive screen for ptsd at baseline was defined as a report of a moderate or higher level of at least one intrusion symptom , three avoidance symptoms , and two hyperarousal symptoms ( criteria established by dsm - iv ) ( 21 ) . major depressive disorder was assessed using nine items from the phq ( sensitivity = 0.93 ; specificity = 0.89 ) corresponding to the depression diagnosis based on the dsm - iv ( 19 ) . a positive screen for depression at baseline was defined as 1 ) endorsement of depressed mood or anhedonia and 2 ) response of more than half the days or nearly every day to at least five items . other anxiety ( 6 items ) and panic ( 15 items ) symptoms problem drinking was defined using items from the phq on risky behaviors related to alcohol use , such as driving under the influence more than one time over the past year , where endorsement of at least one item indicated problem drinking . binge drinking was defined as consuming five or more drinks ( men ) or four or more drinks ( women ) in 1 day during the past year . smokers were identified as those ever smoking 100 cigarettes in their lifetime , with those persisting in this habit defined as current smokers and those having quit as past smokers . in longitudinal models , service branch , service component , pay grade , military occupation , birth year , race / ethnicity , and education were assessed at baseline . smoking status , alcohol use , bmi , combat deployment , ptsd , depression , anxiety , panic , and all sleep variables were assessed at all available time points . the outcome of interest was incident diagnosed diabetes self - reported on a follow - up survey among people without diabetes at the baseline assessment . at baseline , participants reported if they had ever been told by a doctor or health professional that they had diabetes or at follow - up assessments , participants responded to the same question in regard to the previous 3 years . univariate analyses assessed associations of incident diabetes with sleep , military , demographic , behavioral , and mental health characteristics while accounting for multiple periods of observation per subject . since repeated measurements were available with up to two follow - up assessments per person , generalized estimating equations ( gees ) were used to account for these multiple assessments while adjusting for fixed and time - varying covariates , to estimate adjusted odds of reporting incident diabetes ( 22 ) . incident diabetes was determined at each follow - up assessment , and all covariates were evaluated using data from the previous assessment ( 22 ) . in all multivariable models , adjustments were performed for known type 2 diabetes risk factors captured in the study : age , sex , education , bmi , and race / ethnicity . the final adjusted models were built using a stepwise backward reduction algorithm that retained all significant variables ( p < 0.10 ) ( table 1 ) while always keeping age , sex , race / ethnicity , education , and bmi in the model . additionally , mental health variables were added to the final models to determine if this altered the relationship between sleep and diabetes . first - order interaction terms between retained sleep variables and age , sex , and bmi were tested to determine whether the exposure - outcome associations varied by these characteristics . possible presence of multicollinearity in multivariable models was considered if the variance inflation factor exceeded 4 . best - fitting gee models were judged using the quasilikelihood information criterion , the measure developed for gee models analogous to the akaike information criterion . statistical analyses were performed using sas statistical software , version 9.3 ( sas institute , inc . , baseline demographic , military , and behavioral characteristics of millennium cohort participants by development of diabetes at follow - up a total of 47,093 participants were included in this analysis and followed for up to 6 years . incident diabetes was assessed at each 3-year period separately , with 13,621 participants followed for one 3-year period , and 33,472 participants followed for two 3-year periods . a total of 383 cases occurred during years 03 and 488 cases occurred during years 36 of follow - up . the 488 cases that did not occur until years 36 are also present in the first column of table 1 as not having diabetes from year 03 . at baseline , participants overall were on average young ( 34.9 years of age , sd 9.0 years ) , slightly overweight ( bmi 26.0 kg / m , sd 3.3 ) , 25.6% female , and more likely than not to be white , non - hispanic race , less than college educated , army service branch , and on active duty ( table 1 ) . overall , 871 participants newly self - reported diabetes , for a cumulative annual incidence of 3.6/1,000 person - years . participants who newly self - reported diabetes during follow - up were significantly more likely at baseline to have reported trouble sleeping , sleep duration 5 h , and sleep apnea ( table 1 ) . sleep duration > 8 h was reported by similar proportions of participants with and without newly self - reported diabetes . participants with new - onset diabetes were on average older , had a higher bmi , and were more likely of nonwhite race . characteristics associated with new - onset diabetes included no deployment , having separated from the military since baseline , army or navy / coast guard service branch , reserves / national guard service component , enlisted pay grade , and administration / supply occupation . binge or problem drinking was less likely to have been reported in people reporting new - onset diabetes , and current and former smoking frequency was similar in groups with and without new - onset diabetes . all mental health symptoms occurred significantly more frequently among those who newly reported diabetes during follow - up . factors associated with a higher odds of incident diabetes in models adjusted for sex and known type 2 diabetes risk factors ( age , bmi , education , and race / ethnicity ) included trouble sleeping , sleep duration 5 h compared with 7 h , and sleep apnea ( table 2 ) . several military service characteristics remained significantly related to the outcome , including no deployment , enlisted pay grade , administration / supply occupation , and having separated from the military since baseline ( table 2 ) . binge or problem drinking remained significantly associated , and current smoking emerged as a risk factor for new - onset diabetes after adjustment . screening positive for depression , panic , other anxiety disorder , and ptsd were all significantly associated with higher odds of new - onset diabetes in these adjusted models ( table 2 ) . relative odds of incident self - reported diabetes by each baseline characteristic of interest in the multivariable model ( table 3 ) , sleep characteristics remained significantly and independently associated with higher diabetes odds . the sleep variables that entered the final model included reported trouble sleeping and sleep apnea , which were associated with significant increases in the odds of diabetes of 1.21 to 1.78 , respectively . these associations were not only independent of each other but also the other covariates adjusted for in the model ( table 3 ) . military service characteristics significantly associated with diabetes odds included deployment without combat experience , administration or supply occupations , pay grade , and having separated from the military since baseline . a positive screen for ptsd was significantly associated with higher diabetes odds , independent of sleep characteristics and other covariates in the model , and panic disorder was of borderline significance . tests for interactions between the sleep variables included in the models in table 3 and age , sex , and bmi were all nonsignificant ( p > 0.10 ) . no variable had a variance inflation factor > 4 , indicating that collinearity was unlikely . the model in table 3 was rerun with sleep duration substituted for trouble sleeping but with the other included covariates unchanged . the quasilikelihood information criterion for the model containing trouble sleeping was slightly lower ( 8,640.9 ) than when sleep duration was included in the model ( 8,646.3 ) . the sleep duration variable was insignificant overall in this model ( p = 0.1585 ) , although two sleep categories were significantly related to diabetes odds ( < 5-h odds ratio [ or ] 1.52 [ 95% ci 1.092.14 ] ; 5-h or 1.28 [ 1.011.62 ] ) . several additional modifications of the multivariable model shown in table 3 were conducted . in the first modification , symptoms of depression and anxiety disorder were included in the model to assess whether adjustment for these additional factors altered the association between sleep and diabetes odds . in the second modification , all subjects reporting sleep apnea were removed from the model shown in table 3 . in each of these modifications , the statistical significance of the associations between the sleep variables and diabetes odds remained unchanged , and the associations were of similar magnitude to those seen in table 3 ( data not shown ) . longitudinal multivariable regression model of sleep characteristics and mental health symptoms as risk factors for incident self - reported diabetes in the millennium cohort our study findings confirm that sleep characteristics are associated with subsequent new - onset self - reported diabetes . these associations persisted after adjustment for multiple mental health conditions known to affect sleep duration and quality , including ptsd and depression ( 1113 ) . therefore , it is unlikely that sleep simply serves as a surrogate marker for associated mental health conditions previously shown to predict higher diabetes risk ( 9,10 ) . additionally , participants reporting provider - diagnosed sleep apnea were at higher risk of developing self - reported diabetes during follow - up . although sleep apnea is associated with higher bmi and both altered sleep quality and quantity , adjustment for these variables did not alter the significance of the higher diabetes risk associated with this condition ( 23 ) . overall , these results suggest that the associations between type 2 diabetes risk and mental health conditions and sleep characteristics , if causal , may involve different pathways . whereas trouble sleeping and shorter sleep duration were associated with higher risk of diabetes in a model adjusted for known diabetes risk factors , longer sleep duration was not , in contrast to findings that others have reported ( 4 ) . the reason for this discrepancy is unclear , but it may be due to the relatively younger age of our cohort compared with investigations reporting higher diabetes risk with longer sleep duration ( 24,25 ) . the independent role of mental health conditions associated with poor quality and quantity of sleep in predicting risk of diabetes has only been addressed in a limited manner in previous research . the nurses health study investigators examined sleep as a predictor of incident diabetes in this cohort from 19861996 and adjusted for an assessment of depression based on the short form 36 health survey that was obtained in 1992 , approximately midway through the follow - up period ( 24 ) . thus , it is unclear whether depression preceded or followed diabetes onset during the first 6 years of follow - up . an analysis using the national health and nutrition examination survey i epidemiologic follow - up study adjusted for depression while examining the association between sleep and diabetes incidence , although no association was seen between depression and diabetes incidence in this cohort ( 25 ) . lastly , a prospective study of swedish men assessed the presence of depression with a simple yes / no question , do you feel depressed ? and did not provide information on the accuracy of this question in capturing this condition ( 26 ) . to our knowledge , our study is the first to consider mental health conditions other than depression as potential confounding factors and to measure their occurrence prior to the onset of diabetes . previous prospective research on sleep characteristics and type 2 diabetes risk has not considered whether sleep duration or quality is related to this outcome independent from sleep apnea , a known cause of sleep disturbance . in our fully adjusted analysis , both sleep apnea and trouble sleeping had independent associations with diabetes risk , suggesting that the associations between sleep characteristics and diabetes risk do not merely serve as markers for the presence of sleep - disordered breathing . in addition to the known higher risk of obesity associated with sleep apnea , other factors associated with sleep - disordered breathing may be involved in higher diabetes risk and include abnormal sympathetic activity and release of proinflammatory mediators such as tumor necrosis factor- and interleukin-6 ( 27 ) . in support of the latter , we observed an independent association between sleep apnea and diabetes risk after adjustment for bmi . this suggests that manifestations of sleep apnea other than the impact of greater general adiposity may be associated with diabetes risk , although it is possible that incomplete adjustment due to residual confounding occurred due to the inaccuracy of bmi in characterizing body composition . the association between trouble sleeping or shorter sleep duration and diabetes risk independent of associated weight gain and sleep apnea is not well understood , but it may be related to both changes in insulin sensitivity , secretion , and glucose effectiveness . one investigation reported significant or borderline - significant reductions in insulin sensitivity , insulin secretion , glucose effectiveness , and the disposition index immediately after a 5-day period of sleep deprivation ( 4 h of sleep per night ) among 11 healthy lean males in a controlled setting ( 28 ) . all these changes have been associated with higher risk of the development of type 2 diabetes ( 29 ) . several characteristics of military service were significantly associated with lower diabetes risk in multivariable models , including deployment , officer pay grade , and remaining in military service . for most comparisons , military deployment with or without combat exposure was related to a lower risk for diabetes , possibly reflecting selection of people medically fit for deployment who are at lower risk for diabetes . the mental health conditions independently associated with diabetes risk included those characterized by excessive stress , including ptsd and panic disorder . a review of the literature on stress and diabetes risk concluded that both general emotional and job stress were repeatedly associated with a higher risk of developing diabetes in adults ( 30 ) . overactivation of the hypothalamic - pituitary axis and abnormal stimulation of the sympathetic nervous system are thought to accompany excessive levels of stress , with accumulation of visceral fat and promotion of an inflammatory state with greater insulin resistance ( 31 ) . a previous analysis of the members of this cohort recruited in 2001 and followed for 3 years similarly demonstrated a higher diabetes risk associated with ptsd symptoms . first , type 2 diabetes was determined using self - reported data , and it was not confirmed by medical record review . however , because self - reported diabetes compared with physician diagnosis or medical record data have been shown to have a high sensitivity ( 7099% ; median 81% ) and specificity ( 9299% ) , there is less likelihood for misclassification ( 32 ) . also , it is possible that individuals self - reporting type 1 diabetes were included in this analysis . however , individuals with a type 1 diabetes diagnosis in their dod medical records were excluded , although this elimination process would miss those participants no longer receiving care from military treatment facilities after discharge or as reservists . in addition , positive screens for mental disorders were determined from self - report . also , we were unable to adjust for diet or family history , which are known risk factors for diabetes . we expect these findings to generalize to younger populations who are sufficiently healthy to enter into the u.s . armed forces , but it is unclear whether the results would apply to dissimilar populations . self - report of clinician - diagnosed sleep apnea was obtained , and the sensitivity and specificity of this report compared with the medical record are not known . medical encounter data were not used to confirm diagnoses of diabetes or sleep apnea in this cohort due to the potential for some of its members , particularly those in the reserves or national guard , to have received care in non - dod facilities . inaccurate classification of sleep apnea and other covariates potentially may have limited our ability to adjust for confounding . finally , self - reported sleep data were assessed during the prior 4 weeks , and sleep duration was rounded to the nearest whole hour , potentially biasing the estimate of actual sleep time ( 3335 ) . this is the first study , to our knowledge , to examine baseline sleep characteristics in relation to incident diabetes while adjusting for several mental health conditions known to impair sleep and be associated with type 2 diabetes . furthermore , this research was conducted in a large population - based study of active duty and reserve / national guard u.s . military personnel from all service branches . additional strengths include the large sample size and up to 6-year duration of follow - up . moreover , no association was found between reporting type 2 diabetes at baseline and nonresponse to the first follow - up questionnaire among the first panel of enrollees , suggesting that the development of diabetes was unlikely to have influenced the probability of responding to the follow - up survey ( 36 ) . finally , previous evaluations of possible biases suggest the cohort is reasonably representative of military personnel in terms of baseline demographic and mental health characteristics , that participants report health and exposure data reliably , and that enrollment in the study is not influenced by health status ( 14,3740 ) . we conclude that trouble sleeping and sleep apnea predict higher diabetes risk , independent of multiple diabetes risk factors and several mental health conditions . of note , self - reported sleep apnea was also associated with a significantly higher risk for diabetes even after adjustment for other sleep characteristics , bmi , and mental health conditions . substitution of sleep duration for trouble sleeping in multivariable modeling yielded nearly identical results , with significantly higher risk seen with < 6 h of sleep . confirmation of these findings through further analyses may advance our understanding of diabetes pathophysiology and create new opportunities for prevention .

objectiveresearch has suggested that a higher risk of type 2 diabetes associated with sleep characteristics exists . however , studies have not thoroughly assessed the potential confounding effects of mental health conditions associated with alterations in sleep.research design and methodswe prospectively assessed the association between sleep characteristics and self - reported incident diabetes among millennium cohort study participants prospectively followed over a 6-year time period . surveys are administered approximately every 3 years and collect self - reported data on demographics , height , weight , lifestyle , features of military service , sleep , clinician - diagnosed diabetes , and mental health conditions assessed by the prime - md patient health questionnaire and the ptsd checklist civilian version . statistical methods for longitudinal data were used for data analysis.resultswe studied 47,093 participants ( mean 34.9 years of age ; mean bmi 26.0 kg / m2 ; 25.6% female ) . during 6 years of follow - up , 871 incident diabetes cases occurred ( annual incidence 3.6/1,000 person - years ) . in univariate analyses , incident diabetes was significantly more likely among participants with self - reported trouble sleeping , sleep duration < 6 h , and sleep apnea . participants reporting incident diabetes were also significantly older , of nonwhite race , of higher bmi , less likely to have been deployed , and more likely to have reported baseline symptoms of panic , anxiety , posttraumatic stress disorder , and depression . after adjusting for covariates , trouble sleeping ( odds ratio 1.21 [ 95% ci 1.031.42 ] ) and sleep apnea ( 1.78 [ 1.392.28 ] ) were significantly and independently related to incident diabetes.conclusionstrouble sleeping and sleep apnea predict diabetes risk independent of mental health conditions and other diabetes risk factors .

multiple sclerosis ( ms ) is a chronic , inflammatory , demyelinating disease of the central nervous system characterized by the formation of focal demyelinated regions ( plaques or , magnetic resonance imaging ( mri ) has been routinely used to help with the diagnosis of ms , as well as to monitor disease evolution and treatment efficacy . however , the mechanisms underlying the clinical progression of ms and the relationship of mri findings to pathology ( demyelination , axonal loss and neuronal degeneration ) remain poorly understood . meanwhile , numerous studies have attempted to more specifically assess the demyelination process occurring in ms by measuring indirectly the local myelin content using various mr techniques , such as diffusion tensor imaging , magnetization transfer ( mt ) imaging , and separation of t2 relaxation components ( laule et al . , 2007 ) . the separation of t2 relaxation components has been used to measure the amount of water trapped between the myelin layers , which is generally considered to reflect brain myelin content . this is based on the fact that the diffusion - restricting properties of myelin lead to distinct t2 values for water between the myelin layers ( or myelin water ) , intra - axonal water , and interstitial water ( or extracellular water ) , with the myelin water pool having the shortest t2 ( lancaster et al . , 2003 ; laule et al . , 2004 ; andrews et al . , 2005 these studies have tried to assess the relative concentration of myelin water using mathematical analyses of the t2 relaxation decay curves acquired with a multi - spin - echo ( mse ) technique . strong correlation between the short t2 signal fraction and the anatomical distribution of myelin was found in postmortem ms brain samples ( moore et al . , 2000 ; laule et al . , 2006 ; laule et al . , 2008 ) , supporting the notion that this fraction reflects myelin water . absence of myelin water signal was also found in chronic demyelinated ms lesions ( moore et al . , 2000 ) . the post mortem findings were further supported by in vivo studies that also reported decreased amount of myelin water in ms lesions ( mackay et al . , 1994 ; vavasour et al . , 1998 ; laule et al . , 2004 ) . more recently , multi - gradient - echo ( mgre ) techniques have been proposed as another way to obtain cellular compartment - specific information ( du et al . , 2007 ; hwang et al . , 2010 ; van gelderen et al . similar to the t2-based method , the premise is that the myelin - associated water has a distinctly decreased t2 * and that the exchange between the free and myelin water pools is slow enough to observe non - mono - exponential t2 * decay as a function of echo time ( te ) for myelin - containing tissue ( van gelderen et al . , 2012 ) . therefore , information about myelin water can also be gained from multi - component fitting of the t2 * relaxation decay curve . moreover , compared to mse - based acquisition measurements , it has been reported that mgre - based acquisition for mapping t2 * provides higher contrast - to - noise ratio in structural mri and bold fmri ( duyn et al . , 2007 ) and lower radiofrequency power deposition at high magnetic field strengths . another advantage of the three - component t2 * model is that it provides frequency information , which improves the discrimination between myelin , axonal , and interstitial water due to their different frequency shifts ( van gelderen et al . , 2012 ; sati et al . , 2013 . therefore , in addition to demyelination , this model might provide new insights into axonal injury and degenerative processes . the fitting of a three - component model to t2 * decay curves acquired at 7 t was recently evaluated in healthy human brains ( sati et al . , 2013 ) , but the feasibility of this technique in ms patients , and what it uncovers about lesion biology , remains to be demonstrated . for this purpose , mgre data were acquired in cohort of ms patients at 7 t to investigate whether the fitting of a three - component model to the t2 * decay curve can be used for characterizing demyelination in patient brains . twenty - five relapsing remitting ms ( rrms ) patients ( 6 men , 19 women ; age range , 3063 years ; mean 41 years ; standard deviation 8.4 ) were recruited from august 2013 to may 2014 under an internal review board approved human protocol . experienced ms clinicians determined disability according to the expanded disability status scale ( edss ) and obtained clinical data . median edss score was 1.5 ( range = 16.5 ) and mean disease duration was 8.5 years ( range = 0.321.6 years ) . all mri examinations were performed on a 7 t human mri scanner ( siemens , erlangen , germany ) equipped with a 32-channel receive coil . the mgre data for mapping the t2 * decay curves were acquired with an in - house developed pulse - sequence ( van gelderen et al . , 2012 ) . thirty - eight echoes ( positive read gradient only ) were acquired with an echo spacing of 1.6 ms . repetition time ( tr ) was 1 s and flip angle ( fa ) was 70. fifteen slices with 1.5 mm slice thickness and 25% gap between slices were measured per scan , with an in - plane resolution of 1.5 1.5 mm and a fov of 240 180 mm ( the acquisition matrix size is 160 120 ) . the slices were parallel to the plane of the anterior and posterior commissure line and captured a section of the corpus callosum . whole brain 3d t1-weighted magnetization - prepared rapid gradient echo ( t1-mprage ) was acquired before ( pre - gad t1 ) and after ( post - gad t1 ) contrast injection ( 0.1 mmol / kg gadobutrol ; bayer healthcare , leverkusen , germany ) . all mgre data analyses were performed in interactive data language ( idl , exelis visual information solutions , boulder , co , usa ) . the complex images were combined from individual receiver channels using unaccelerated ( rate-1 ) sense reconstruction ( pruessmann et al . , 1999 ) , then co - registered based on the fourth echo of the first repetition , since increased image contrast at this te is expected to increase registration performance . the phase corrections before fitting consisted of two steps , one was a function of echo time , the other a spatial correction . step one : in every voxel the average offset frequency was subtracted based on a linear fit ( over te ) to the phase of the echoes , accounting for possible 2 wrapping jumps . step two : for each echo time , a spatial linear phase was subtracted , that is for every image the global phase and the in - plane ( spatial ) gradients were taken out . the complex images were normalized to the smoothed magnitude image at first echo ( te = 2.3 ms ) . smoothing was accomplished by gaussian filtering over 30 voxels within a brain mask , excluding the skull and extracerebral cerebrospinal fluid , to preserve the contrast between lesions and their surrounding tissue . normalization to a smoothed image was performed to remove both scan - to - scan variability and residual receive coil sensitivity effects , while preserving increased signal intensity in lesions due to their higher water content . using normalized t2 * -weighted mgre magnitude images ( 20th echo , te = 33.6 ms ) , regions of interest ( rois ) were drawn manually in the splenium of the corpus callosum ( scc ) ( fig . 1b ) , excluding visible lesions , to check the reproducibility of the fitting of the three - component model to the t2 * decay curve . furthermore , rois were chosen in all lesions visible on these t2 * -weighted mgre magnitude images ( 20th echo , te = 33.6 ms ) ( fig . lesions were identified by hyperintensity on these same normalized t2 * -weighted mgre magnitude images ( 20th echo , te = 33.6 ms ) , because myelin decreases t2 * and thus myelin loss leads to brighter intensity on the t2 * -weighted image . 2b , blue ) were chosen in normal appearing white matter ( nawm ) with a size and shape similar to the lesions . any visible veins , which were low image intensity on t2 * -weighted mgre , were excluded from all the rois . similarly to our previous study ( sati et al . , 2013 ) , the roi - averaged complex signal s was calculated and fitted with a three - component model using the following equation.s=(a1e(1/t2,1*+i2f1)t+a2e(1/t2,2*+i2f2)t+a3e(1/t2,3*)t)ei(2fgt+ ) . here , an is the amplitude , t2,n * is the relaxation time , and fn is the frequency shift of component n , which is defined relative to global / interstitial water frequency fg . components 1 , 2 and 3 were assigned to myelin , axonal and interstitial water respectively ( van gelderen et al . , 2012 ; based on our preliminary data , the starting values for the fitting were defined as a1 = 0.16 , a2 = 0.43 , a3 = 0.41 ; t2,1*=6.3ms , t2,2*=41.7ms , t2,3*=26.3ms ; f1 = 21 hz , f2 = 6 hz , fg = 0 hz , and = 0 hz . for the analyses of lesions , the t2,1 * and f1 were fixed at values from contralateral nawm as the myelin water signal in lesions proved to be too small to determine these independently . a range of values was tested , which did not change the results significantly ( supplementary table ) . statistical analysis was carried out using a two - tailed student 's t - test to investigate differences between enhancing lesions and nawm , non - enhancing lesions and nawm , and enhancing versus non - enhancing lesions for the three - component fitting results . twelve enhancing lesions were detected in 7 patients , these appeared on both post - gad t1-mprage and magnitude images . voxel - level image average snr was approximately 200:1 in the first echo in the rois examined . the average size of lesions was 77.6 mm ( range 10.1253.1 mm ) ( table 1 ) . in total , 25 rois in scc and or , as well as 73 lesions and their corresponding contralateral nawm rois , were analyzed using the fitting of a three - component model to the t2 * decay curve . as seen in fig . 4 and table 1 , the model described the mgre data . goodness of fit was assessed using the 1-r values , where r is the coefficient of determination ( colin cameron and windmeijer , 1997 ) and indicates how well the data fit the decay curve . all 1-r values were lower than 0.001 , which means that over 99.99% of the variance was explained using this model . the residues were further evaluated by comparing temporal standard deviation to the thermal noise level in the roi - averaged signal . note that this noise level varies notably from one roi to the next , since it depends on the number of voxels averaged and thus on roi size . results from the fitting of this three - component model for the different rois ( scc , or , lesion and contralateral nawm ) are shown in table 2 . the average amplitude of myelin water ( a1 ) was 0.12 in scc and 0.10 in both or and nawm , but only approximately 0.03 in lesions . as expected , the t2 * of myelin water was the shortest , whereas the axonal water had the longest t2*. myelin water showed the largest frequency shift ( 25.8 hz in scc ) , whereas that of axonal water was small and negative ( 6.3 hz in scc ) . the frequency shift of myelin water was smaller in nawm than in scc and or , presumably due to orientation effects . in both enhancing and non - enhancing lesions , the amplitude of myelin water ( a1 ) was found to be significantly decreased ( a1 ~ 0.07 , p < 0.001 ) compared to contralateral nawm . since one would expect reductions in a1 to be accompanied by increases in t2 * and thus signal intensity ( s ) at longer echo times in the mgre images , this relationship was investigated by generating a scatter plot ( fig . 5 ) in which the fitted myelin water amplitude ( a1 ) was plotted as a function of the signal intensity ( s ) in the normalized 20th echo ( 33.6 ms te ) mgre magnitude image ( ste = 33.6 ) . indeed , a significant correlation ( r = 0.61 , p < 0.001 ) and a negative slope ( 0.21 ) between the two parameters are seen , which appears dominated by the differences between lesions and nawm . the axonal water amplitude ( a2 ) was found to be increased in both enhancing lesions ( a2 = 0.04 , p < 0.05 ) and non - enhancing lesions ( a2 = 0.04 , p < 0.001 ) in comparison to nawm . in the comparison of interstitial water amplitude ( a3 ) between lesions and nawm , the interstitial water amplitude ( a3 ) in enhancing lesions increased 0.06 ( p < 0.05 ) and in non - enhancing lesions only 0.03 ( p < 0.001 ) . the t2 * values of axonal and interstitial water both showed a significant increase in lesions compared with nawm ( t2,2*~27ms , p < 0.001 ; t2,3*~12ms , p < 0.05 ) . the f values were lower by ~2.3 hz ( p < 0.001 ) for axonal water in both enhancing and non - enhancing lesions when compared to nawm . no significant difference between enhancing and non - enhancing lesions was found for any of the parameters studied , including the amplitudes of myelin , axonal , and interstitial water ( a1 , a2 , and a3 ) , the t2 * values of interstitial and axonal water , or f of axonal water . in this exploratory study , we investigated the effects of demyelination on t2 * relaxation in a clinical ms cohort at 7 t. our 3-compartment model of white matter allowed reproducible fitting of the t2 * decay curves , demonstrating the feasibility to detect and potentially discriminate demyelination in ms . the results obtained here for rois in scc are consistent with our previous study in healthy volunteers ( sati et al . , 2013 ) , which confirm that t2 * decay curves can be adequately described by a three - component model with distinct relaxation rates and frequency shifts for each component . our average value for the amplitude of myelin water ( a1 ) in scc was around 0.12 , which is also consistent with previous studies using both t2-based ( whittall et al . , 1998 ; laule et al . , 2004 ) and t2 * -based methods ( du et al . , 2007 in addition , our average value for the myelin water amplitude measured in nawm rois ( around 0.10 ) is also similar to a previous report in healthy volunteers ( hwang et al . , 2010 ) . our values for the multiple frequencies in scc are also consistent with our previous results ( sati et al . , 2013 ) and with similar results from another group ( wharton and bowtell , 2013 ) . as expected , the mean frequency shift is largest for the myelin water compartment ( table 2 ) due to the perpendicular orientation of the scc fibers relative the static b0 magnetic field . note that this myelin frequency shift is strongly dependent on the fiber orientation ( lee et al . , 2010 ; sati et al . , 2013 ; duyn , 2014 ) . therefore , the nawm rois used here , which in general contain a wider mix of fiber orientations , were expected to display a lower mean value and larger variation for the myelin water frequency shift when compared to the more directionally aligned fibers in scc and or ( table 2 ) . as nawm in ms patients may harbor undetected pathology , the lower frequency shift of myelin water compared to healthy brain might be related to reductions in myelin as well . in both types of lesion rois ( enhancing and non - enhancing ) , our finding of a significant decrease in the amplitude of myelin water suggests ongoing demyelination in these lesions . note that because the myelin water signal in the lesions was very small , the parameters t2,1 * and f1 were fixed to the reference values obtained from fitting of the contralateral nawm rois . no significant change for fitting results while using different fixed values ( supplementary table ) , which supports that taking the fixed parameters is not a major issue and not a cause for the small numbers of myelin water fraction . interestingly , the standard deviation ( sd ) of myelin water amplitude was found to be around 0.02 , which is quite large compared to the average myelin water amplitude in lesions but similar to the sd of the fitted myelin water amplitude in scc and nawm . this suggests that our estimate of the myelin water amplitudes is reasonable and probably could imply different degrees of demyelination in lesions , while the precision of these amplitude estimates is limited by sensitivity . at the same time , our estimate of the myelin water fraction in lesions is lower than found previously using a t2-based method ( laule et al . , 2004 ) . this discrepancy could result from various factors , including methodological differences : for example , a loss of anisotropic susceptibility in the lesion could reduce the distinction between the water pools . a positive correlation between total water amplitude and ste = 33.6 was found when combining data from both lesions and nawm , which indicates that lesions have higher proton density and/or increased t2 * due to more water than nawm . however , this correlation was not apparent within the lesion group . it is possible that , in some of the lesions of the current patient cohort , the effects of myelin loss on ste = 33.6 are overwhelmed by the presence of csf - like interstitial fluid with very long t2 * as is sometimes seen in chronic lesions . our finding of a significant increase in the amplitude of both interstitial and axonal water compartments of the lesions is interpreted as water moving from between myelin layers to the extracellular and/or axonal compartments during the demyelination process . myelin loss may cause relatively large changes in t2 * because of the diamagnetic properties of myelin ( stanisz et al . , 1999 ) , and because myelin compartmentalizes water and thereby reduces diffusion - mediated averaging of the associated magnetic field inhomogeneities . the separation of interstitial and axonal water in lesions is expected to be affected by the significantly reduced myelin content , which can lead to a reduced frequency offset between axonal and interstitial water that was expected ( table 2 ) . however , the similar sd of the fitted amplitudes of interstitial and axonal water in lesions when compared to scc suggests that these components were separated fairly well within lesions . increased t2 * was demonstrated to correspond to severe loss of myelin in comparisons of mri with histology in ms lesions ( yao et al . in our study , the t2 * of interstitial and axonal water showed a significant increase in lesions compared to nawm ( around 27 and 12 ms respectively ) , which suggested myelin loss . moreover , in ms lesions , f values were found to be smaller for axonal water relative to nawm , consistent with myelin loss ( yablonskiy et al . , we did not find any significant difference between enhancing and non - enhancing lesions for any of the compartmental amplitudes , for t2 * of interstitial and axonal water , or for f of axonal water . if we assume that enhancement reflects an inflammatory process that accompanies ongoing demyelination , and thus that non - enhancing lesions may be more stable and/or partially remyelinated , one would expect this to be reflected in the t2 * decay characteristics . however , the increased sds of the component parameters in both enhancing and non - enhancing lesions compared to contralateral nawm , suggest that the absence of significant correlation may be due to a large variation in demyelination within each lesion type , combined with the small number of enhancing lesions included in the analysis . the fitting of a three - component model to the t2 * decay curves , as was done here , has several limitations . first , aside from myelin , iron and protein content can also affect t2 * decay ( duyn et al . , 2007 ) , which was not accounted for . second , the range of tes in the current study ( 2.3 ms 62.7 ms ) might be suboptimal for fitting long - t2 components present in some lesion types . third , using results from nawm as reference values to fix the t2,1 * and f1 of the contralateral lesion may not be accurate , considering that nawm can have abnormal myelin water amplitude as well ( laule et al . , 2004 ; this could in principle be mediated by using values from age- and sex - matched healthy volunteers , although accurate delineation of corresponding rois would be difficult . finally , in absence of histopathological evidence , the precise relationship between the amplitude of the short t2 * component and brain myelin content remains unclear . in summary , fitting of a three - component model to the t2 * decay curves at high magnetic field allows characterization of myelin water and detection of demyelination in ms . it also provides frequency information of axonal water , which may help to further characterize tissue damage in this disease . the experimental findings reported here are consistent with expectations based on prior radiological and pathological work and further strengthen the cases that analysis of t2 * decay curves promises to have important consequences for understanding myelin pathology in ms and other neurological disorders . the following is the supplementary data related to this article.supplementary tableroi - based fitting of a three - component model to the t2 * decay curve for enhancing and non - enhancing lesions with different fixed myelin water t2 * ( t2,1 * ) and frequency shift ( f1 ) values . within a reasonable range , changing the fixed parameters only affects the myelin water amplitude . an is the amplitude , t2,n * the relaxation time ( ms ) , and fn the frequency shift ( hz ) of component n. mean values ( standard deviation ) over n rois are shown . * p < 0.05 , significant difference between the fitting result showed in the table and result of the same lesion that was listed in table 2 . roi - based fitting of a three - component model to the t2 * decay curve for enhancing and non - enhancing lesions with different fixed myelin water t2 * ( t2,1 * ) and frequency shift ( f1 ) values . within a reasonable range , an is the amplitude , t2,n * the relaxation time ( ms ) , and fn the frequency shift ( hz ) of component n. mean values ( standard deviation ) over n rois are shown . * p < 0.05 , significant difference between the fitting result showed in the table and result of the same lesion that was listed in table 2 .

multiple sclerosis ( ms ) is a relatively common cause of inflammatory demyelinating lesions of the central nervous system . in an attempt to detect and characterize ongoing demyelination in ms patient brains , we used a novel magnetic resonance imaging ( mri ) technique , involving the fitting of a three - component model to the t2 * relaxation behavior at high - field ( 7 t ) . this model allowed estimation of the amount of myelin water ( and thus indirectly myelin content ) , axonal water , and interstitial water . in this study , 25 relapsing remitting ms patients underwent a 7 t mri from which 12 gadolinium - enhancing lesions , 61 non - enhancing lesions , and their corresponding contralateral normal appearing white matter ( nawm ) regions were analyzed . in both enhancing and non - enhancing lesions , the amplitude of myelin water was significantly decreased , and interstitial and axonal water were increased relative to the contralateral nawm . longer relaxation time t2 * of interstitial and axonal water , and lower frequency shift of axonal water , were also observed in both enhancing and non - enhancing lesions when compared to the contralateral nawm . no significant difference was found between enhancing lesions and non - enhancing lesions . these findings suggest that the fitting of a three - component model to the t2 * decay curve in ms lesions may help to quantify myelin loss .

significant progress in using of atomic force microscope ( afm ) as a tool for investigations of eukaryotic and prokaryotic cells has been reached during past decade [ 1 , 2 ] . in contrast to traditional methods of visualization scanning electron and optical microscopy atomic force microscopy offers important benefits : high spatial resolution , real quantitative data acquisition in three dimensions , relatively simple and nondestructive sample preparation procedure , and flexibility in ambient operating conditions ( i.e. , without the need for a vacuum or gold sputtering ) . besides topographic imaging , afm makes it possible to probe local surface forces and mechanical properties of biomaterials . in particular , mechanical properties of mammalian and bacterial cells have been measured . though the method of atomic force microscopy is relatively new , it could become widespread in microbiological studies that use bacteria as sensors , changing their morphological characteristics at various exposures . thus , afm has been used to study temperature - dependent morphological alterations of prokaryotic cells and effects of antibiotics on e. coli and s. aureus . it is important to take into consideration that different environmental conditions that often remain unregistered could distort afm results at investigation of physical and morphological properties of bacterial cells . for example , the humidity of the environment where afm specimens are left to dry is often ignored [ 8 , 9 ] , though distinct differences in morphology of bacterial cells growing at different relative humidity were observed by de goffau et al . . therefore , the development and standardization of afm methods for preparation and imaging of bacterial cells in different environmental conditions are of great importance for microbiology . the standardization of the methods will allow to compare results , obtained by different authors , and is an essential condition for carrying out multicentre studies . the aim of this study was to evaluate the effect of a relative humidity on results of afm investigation of morphological characteristics and mechanical properties of bacillus cereus and escherichia coli bacteria . gram - negative e. coli k12 and gram - positive b. cereus ip5832 strains were used as model organisms to investigate the effects of the relative humidity on the morphology of the cells . bacteria were grown in 2.5 ml nutrient bouillon ( grm - bouillon contains pancreatic digest of fish flour and sodium chloride , ph 7.0 ) at 37c for 24 hours to produce a bacterial concentration of 10 viable cells ml . bacterial concentrations were determined by measuring a540 of the culture in a spectrophotometer ( sf-46 , lomo , russia ) . samples of each strain were collected , centrifuged ( 3000 rpm , 1700 g , 7 min ) and twice washed with distilled water . the drop of the cell suspension was deposited then on pieces of freshly cleaved mica ( 5 5 mm ) which were placed for 24 hours in different exsiccators to dry . to maintain required ambient humidity , saturated aqueous salt solution percentage of relative humidity ( rh ) above saturated solutions of used salts at 25c according to greenspan was 65% ( nano2 ) , 75% ( nacl ) , 84% ( kcl ) , and 93% ( kno3 ) . bacteria were imaged in contact mode , using smm-2000 afm ( jsk kpd , russia ) . images were obtained using v - shaped silicon nitride cantilevers msct - aunm from veeco instruments inc . with a spring constant of 0.01 n / m . root - mean - square roughness ( the standard deviation of the z values ) for the height images was determined by drawing section plot of the cell surface and was calculated using smm-2000 software . the reliability of the difference was estimated according to nonparametric wilcoxon 's signed - rank test . after the determination of the bacteria surface topography , force curves were obtained at various locations in each cell . force - indentation curves were derived from the measured force versus displacement relationship using the mica surface to calibrate the deflection of the cantilever . to obtain young 's modulus of the cell we used the hertz model . equation ( 1 ) shows the relationship between the load force ( f ) and the sample indentation ( ) : ( 1)f=43e123/2r , where e is young 's modulus , r is the probe - sphere radius , and is the poisson ratio . the sample indentation is calculated by subtracting the piezo displacement from the cantilever deflection . typical afm images of b. cereus and e. coli on mica surface are shown in figure 1 . for each type of cells , the following morphological parameters were measured : length , width , and height . relying on this data , perimeter section , area section , and volume of the cells were calculated . the observed changes of morphological parameters should also affect morphological properties of a surface . to reveal such changes , the surface roughness analysis and determination of bacterial cell elasticity root - mean - square roughness ( rq ) distribution of studied structures is shown in figure 2 . there is a gradual increase of cell wall roughness taking place at rh reduction both for b. cereus and for e. coli . the shift of rh from 93% to 65% leads to the change of roughness of b. cereus surface insignificantly ( figure 2(a ) ) . at 93% the mean value of roughness insignificant changes of roughness occur at decreasing of humidity down to 65% : the rq values in this case are within 1.61.9 nm range . the roughness distribution curves during the dehumidification are shifting in direction of greater roughness values that describe the reaction of gram - positive bacteria at rh reduction in general . in comparison with b. cereus , cell surface of gram - negative e. coli is more rough ( figure 2(b ) ) . the transition from 93% to 65% rh is accompanied by more evident changes in cell surface , as compared to b. cereus . reduction in rh leads to increasing of the cells roughness ( rq = 3.4 nm ) . the symmetry of the cells distribution is characterized by the shift and tilt in the direction of greater roughness values . roughness distribution curves illustrated in figure 2(b ) show that the dehydration of e. coli bacteria , as in the case of b. cereus , is a gradual process . quite contrary behavior of stiffness change is demonstrated by e. coli cells the fall of humidity on 10% causes the increase of young 's modulus from 3.4 to 5 mpa . as can be seen in diagram , further stiffness , we have determined that the gradual dehumidification of the gram - positive b. cereus cells environment does not lead to significant changes of morphological parameters , but induces increase of surface roughness and cell wall stiffness . all studied characteristics remain stable in wide range of rh , partly changing at reaching 65% rh . fixed changes included decreasing of width parameter and increasing of cell wall stiffness as a result of dehumidification . the roughness of bacteria during the humidity reduction undergoes reliable changes only at 65% and amounted to 1.9 nm , whereas at 93% it was 1.6 nm . in comparison with gram - negative e. coli , cell wall of b. cereus quantitative changes are expressed in growth of young 's modulus from 7.9 mpa to 9.4 mpa . more significant changes occur with gram - negative e. coli during dehumidification ; however , behavior of the changes is different . e. coli bacteria are more sensitive to humidity difference : reliable changes of the roughness are already detected at reduction of rh from 93% ( rq = 1.7 nm ) to 84% ( rq = 2.6 nm ) . the further humidity fall is accompanied by growth of a roughness up to 3.4 nm at 65% . at a humidity transition from 93% to 84% , the loss of mechanical properties of e. coli cellular wall occurs ; it is expressed by shifting of young 's modulus values from 3.4 mpa to 5 mpa . we suppose that the described differences in surface and elastic properties are in distinction of cell wall structure of gram - negative and gram - positive bacteria . gram - positive bacteria possess a thick cell wall containing many layers of peptidoglycan and teichoic acids and are therefore initially more rigid . such structure allows to retain water inside the cell at rh values over 65% and demonstrates high tolerance of bacteria to drying . from our point of view , this resistance to drying reflects features of cell wall molecular organization of b. cereus and other gram - positive microorganisms that have three - dimensional bag - shaped peptidoglycan sacculus . such organization of a cell wall provides possibility of microorganisms ' existence in natural habitats where differences of relative humidity can be essential . contrary to them gram - negative cells have a relatively thin cell wall and reveal lesser resistance to rh change ; therefore , at 84% e. coli cells already lose their mechanical strength and significantly increase the roughness of the surface . this process can be explained by rearranging of liposaccharides and other membrane components that have to occupy smaller area of cell surface at dehumidification . our results explain processes occurring with bacteria at native environment and may be useful for standardization of conditions at morphometry of the biological objects . therefore , during specimen preparation and scanning , it is recommended to sustain ambient humidity for e. coli and other gram - negative bacteria on the level of 93% . for b. cereus and other gram - positive bacteria the effect of a relative humidity on morphological and elastic properties of bacillus cereus and escherichia coli cells is evaluated using atomic force microscopy . it is determined that such morphological characteristics as length , width , height , and cell volume are relatively stable at drying . on the other hand , roughness of a bacterial surface and especially stiffness of the cell it is shown a dependence of registered changes on cell wall structure of model bacteria . gram - positive b. cereus cells change morphological and mechanical properties only at 65% rh , whereas gram - negative e. coli are more sensitive , significantly increasing their parameters at rh 84% rh . these findings can explain some ecology features of the bacteria , defining requirements to rh standardization at study of different groups of microorganisms .

the effect of a relative humidity ( rh ) in a range of 9365% on morphological and elastic properties of bacillus cereus and escherichia coli cells was evaluated using atomic force microscopy . it is shown that gradual dehumidification of bacteria environment has no significant effect on cell dimensional features and considerably decreases them only at 65% rh . the increasing of the bacteria cell wall roughness and elasticity occurs at the same time . observed changes indicate that morphological properties of b. cereus are rather stable in wide range of relative humidity , whereas e. coli are more sensitive to drying , significantly increasing roughness and stiffness parameters at rh 84% rh . it is discussed the dependence of the response features on differences in cell wall structure of gram - positive and gram - negative bacterial cells .

this stems from the groundbreaking discovery that rna is not solely a carrier of genetic information , but a key player in a wide range of essential processes within the cell , such as protein synthesis and transport , rna processing and splicing , gene silencing , and chromosome replication ( 13 ) . rna is also involved in many pathological processes , like cancerous tumors and retroviral infections as aids . much like proteins , understanding the functions of these active rna molecules requires methods for analyzing their tertiary structures . however , in contrast to the wide range of 3d structure - based approaches available for proteins ( 4 ) , a similar field for rna is only now emerging . many methods for structure analysis of rna have been developed to work at the secondary structure level , that is the level of base pairing ( 5 ) . in the absence of rna tertiary structures , such methods provide an excellent starting point for exploring rna structures . however , their inherent limitation is that they are incapable of predicting and annotating tertiary interactions . these interactions are formed between secondary structure elements and are crucial for establishing the global fold of an rna ( 6,7 ) . fortunately , in the past few years both the number and size of solved rna tertiary structures has dramatically increased . a variety of methods are available for analyzing and classifying nucleotide conformations and spatial base interactions ( 813 ) . several other methods have been suggested for measuring the similarity between larger rna structures , but require the structures to be with the same number of nucleotides and with a predefined correspondence between them ( 1416 ) . fewer methods are available for locating small predefined motifs in larger structures ( 15,17 ) . these methods are useful for finding new examples of known motifs , but are incapable of discovering novel ones . to date , the problem of identifying a priori unknown common substructures is only partially addressed by a few methods for recognizing recurring 3d contiguous fragments ( 18,19 ) . herein , we present a web server built around the arts method [ ( 20 ) ] for aligning 3d nucleic acid structures . compared with the current very few comparison tools available for tackling this task , arts is suitable for identifying a priori unknown common substructures that may not necessarily be contiguous . the common substructures can be either large global folds containing hundreds and even thousands of nucleotides or small local spatial motifs with at least two successive base pairs . arts is also highly efficient requiring typically a few seconds for comparing a pair of average - size rna structures with hundreds of nucleotides . the tool has been used to conduct an all - against - all comparison of all the rna 3d structures currently available in the protein data bank ( pdb ) ( 21 ) . the input is a pair of nucleic acid structures represented by the 3d coordinates of their atoms . the phosphate atoms are singled out as critical points and each structure is represented as a set of points in 3d space , where each point is the position of a phosphate atom . using this representation the problem is a version of the largest common point set ( lcp ) problem in computational geometry . namely , the task is to find a rigid transformation ( rotation and translation ) that superimposes the largest number of phosphate atoms of one structure onto the phosphate atoms of the other one within a predefined bottleneck matching distance ( 22 ) error . although this problem has been studied extensively , the current known exact and approximate algorithms for solving it are impractical , since they require o(n ) and o(n ) time , respectively , where n is the number of phosphate atoms ( 22,23 ) . arts [ ( 20 ) ] is thus a heuristic method . by exploiting the base pairing and stacking properties of nucleic acids , it is capable of providing biologically relevant solutions in practical running times , even for large compact structures with thousands of nucleotides like the ribosome . the goal is to maximize both the number of superimposed phosphate atoms and the number of superimposed base pairs . the rationale is that more than half of the nucleotides in an average non - coding rna are involved in base pairing and the stems that they form are evolutionarily more conserved than loops ( 7 ) . it is thus unlikely that an alignment with a large number of superimposed base pairs will be biologically meaningless , as might happen when solving the pure geometric lcp problem . in the first stage , all the possible local alignments of two successive base pairs between the structures are constructed . then , a greedy approach is used to extend the local alignments so that a maximal number of phosphate atoms and base pairs will be superimposed . finally , the global alignments are scored , clustered and ranked , and the highest scoring ones are reported . we estimate the significance of the obtained alignments by computing the p - value of their score with respect to a random dataset of pairwise alignments . in the current version of the application contains 245 000 alignments that have been randomly chosen from an all - against - all comparison of all the rna structures in the pdb . the p - value of an alignment between a pair of rna structures with n and m nucleotides is computed with respect to all alignments in for which the number of nucleotides in the smallest structure is 20% min(n , m ) . the resulting p - value of the alignment represents the probability that a pairwise alignment for which the size of the smallest structure is similar would receive a higher or equal score by chance . the arts web server as well as an accompanied software package are freely available at . it requires the user to enter an email address and a pair of nucleic acid structures in pdb format ( 21 ) . the structures can be either uploaded to the server or retrieved from the pdb . in the second case the user has to enter a four - character pdb code , optionally followed by a colon and a list of chain ids , for instance 1u6b , 1u6b : b and 1u6b : bc. in both cases , the structures must contain all atoms and not only the ones on the backbone . the reason is that otherwise hydrogen bonds can not be computed and these are necessary for finding base pairs . ( a ) the entrance page of the web server . the user is required to enter an email address and a pair of nucleic acid structures in pdb format ( 21 ) . the structures can be either uploaded to the server or retrieved from the pdb . in the second case the user has to enter a four - character pdb code , optionally followed by a colon and a list of chain ids . ( b ) a web page with a summary of the 10 top - ranking alignments obtained for 1u6b : b and 1y0q pdb codes . ( c ) the page obtained after clicking on the bp core size field of the top - ranking alignment in the summary page presented in ( b ) . ( d ) the superimposition of the input structures displayed by pymol ( 26 ) after clicking on the pdb alignment field of the top - ranking alignment in the summary page presented in ( b ) . the backbone of the two structures , pdb:1u6bb and pdb:1y0q , is depicted in red and blue , respectively . the matched base pairs are in green and the matched unpaired nucleotides are in yellow . a typical run of arts for comparing a pair of average - size nucleic acid structures with hundreds of nucleotides takes a few seconds . after the run completes , a web page with a summary of the obtained alignments in addition , an email with a link to this web page is sent to the user . figure 1b displays a summary page obtained for two self - splicing group i introns , the azoarcus pre - trna intron with both exons [ pdb1u6b : b ( 24 ) ] and the twort ribozyme intron [ pdb1y0q ( 25 ) ] . the upper table shows the name of the compared structures and the number of nucleotides and base pairs in each structure . the bottom table shows the 10 top - ranking alignments sorted in descending order by their score . besides the score , the following data are presented for each alignment : ( i ) the number of matched base pairs ( bp core size ) ; ( ii ) the total number of matched nucleotides including unpaired ones ( core size ) ; ( iii ) the root mean square deviation ( rmsd ) between the phosphate atoms of the matched nucleotides in the core ; ( iv ) the p - value ; and ( v ) a pdb file with the aligned structures . clicking on the bp core size field of one of the alignments displays a new page with a table of the matched base pairs . figure 1c shows the page obtained after clicking on the bp core size field of the top - ranking alignment in the summary page presented in figure 1b . each line corresponds to a match between 2 base - pairs , and each entry provides the chain identifier , base type and residue number of the 2 nucleotides in the corresponding base pair . clicking on the core size field of one of the alignments in the summary page ( figure 1b ) displays a similar page with a table of all matched nucleotides ( paired and unpaired ) . a pdb file with the input structures superimposed one onto another will be downloaded or presented by a viewer ( if configured ) when clicking on the pdb alignment field of one of the alignments in the summary page . figure 1d shows the superimposition of the input structures displayed by the pymol viewer [ ( 26 ) ] after clicking on the pdb alignment field of the top - ranking alignment in the summary page presented in figure 1b . are pymol [ ( 26 ) ] and rasmol ( 27 ) scripts for displaying the alignments and selecting the matched base pairs ( bpcore ) and all matched nucleotides including unpaired ones ( core ) . it requires the user to enter an email address and a pair of nucleic acid structures in pdb format ( 21 ) . the structures can be either uploaded to the server or retrieved from the pdb . in the second case the user has to enter a four - character pdb code , optionally followed by a colon and a list of chain ids , for instance 1u6b , 1u6b : b and 1u6b : bc. in both cases , the structures must contain all atoms and not only the ones on the backbone . the reason is that otherwise hydrogen bonds can not be computed and these are necessary for finding base pairs . ( a ) the entrance page of the web server . the user is required to enter an email address and a pair of nucleic acid structures in pdb format ( 21 ) . the structures can be either uploaded to the server or retrieved from the pdb . in the second case the user has to enter a four - character pdb code , optionally followed by a colon and a list of chain ids . ( b ) a web page with a summary of the 10 top - ranking alignments obtained for 1u6b : b and 1y0q pdb codes . ( c ) the page obtained after clicking on the bp core size field of the top - ranking alignment in the summary page presented in ( b ) . ( d ) the superimposition of the input structures displayed by pymol ( 26 ) after clicking on the pdb alignment field of the top - ranking alignment in the summary page presented in ( b ) . the backbone of the two structures , pdb:1u6bb and pdb:1y0q , is depicted in red and blue , respectively . the matched base pairs are in green and the matched unpaired nucleotides are in yellow . a typical run of arts for comparing a pair of average - size nucleic acid structures with hundreds of nucleotides takes a few seconds . after the run completes in addition , an email with a link to this web page is sent to the user . figure 1b displays a summary page obtained for two self - splicing group i introns , the azoarcus pre - trna intron with both exons [ pdb1u6b : b ( 24 ) ] and the twort ribozyme intron [ pdb1y0q ( 25 ) ] . the upper table shows the name of the compared structures and the number of nucleotides and base pairs in each structure . the bottom table shows the 10 top - ranking alignments sorted in descending order by their score . besides the score , the following data are presented for each alignment : ( i ) the number of matched base pairs ( bp core size ) ; ( ii ) the total number of matched nucleotides including unpaired ones ( core size ) ; ( iii ) the root mean square deviation ( rmsd ) between the phosphate atoms of the matched nucleotides in the core ; ( iv ) the p - value ; and ( v ) a pdb file with the aligned structures . clicking on the bp core size field of one of the alignments displays a new page with a table of the matched base pairs . figure 1c shows the page obtained after clicking on the bp core size field of the top - ranking alignment in the summary page presented in figure 1b . each line corresponds to a match between 2 base - pairs , and each entry provides the chain identifier , base type and residue number of the 2 nucleotides in the corresponding base pair . clicking on the core size field of one of the alignments in the summary page ( figure 1b ) displays a similar page with a table of all matched nucleotides ( paired and unpaired ) . a pdb file with the input structures superimposed one onto another will be downloaded or presented by a viewer ( if configured ) when clicking on the pdb alignment field of one of the alignments in the summary page . figure 1d shows the superimposition of the input structures displayed by the pymol viewer [ ( 26 ) ] after clicking on the pdb alignment field of the top - ranking alignment in the summary page presented in figure 1b . are pymol [ ( 26 ) ] and rasmol ( 27 ) scripts for displaying the alignments and selecting the matched base pairs ( bpcore ) and all matched nucleotides including unpaired ones ( core ) . we have presented a freely available web server accompanied by a software package for 3d structural alignment of nucleic acids . the web server receives as input a pair of tertiary structures of nucleic acids in pdb format , and searches for a priori unknown common substructures that are not necessarily contiguous . the output consists of the top - ranking superpositions between the two input structures in pdb format and corresponding lists of matched nucleotides in the common substructures . to the best of our knowledge , this is the first web server that performs rna structural comparisons that are truly 3d and irrespective of the order of the nucleotides on the chain . the only requirement is that there are at least two consecutive base pairs in the match . the algorithm behind the web server is highly efficient , where a typical comparison of two nucleic acids takes a few seconds on a standard pc . an all - against - all comparison of all the rna structures currently available in the pdb has been carried out and the results can be accessed via the web server . in future work we intend to allow online searches of uploaded structures against the entire pdb .

rna molecules with common structural features may share similar functional properties . structural comparison of rnas and detection of common substructures is , thus , a highly important task . nevertheless , the current available tools in the rna community provide only a partial solution , since they either work at the 2d level or are suitable for detecting predefined or local contiguous tertiary motifs only . here , we describe a web server built around arts , a method for aligning tertiary structures of nucleic acids ( both rna and dna ) . arts receives a pair of 3d nucleic acid structures and searches for a priori unknown common substructures . the search is truly 3d and irrespective of the order of the nucleotides on the chain . the identified common substructures can be large global folds with hundreds and even thousands of nucleotides as well as small local motifs with at least two successive base pairs . the method is highly efficient and has been used to conduct an all - against - all comparison of all the rna structures in the protein data bank . the web server together with a software package for download are freely accessible at .

hypertension is a major risk factor for cardiovascular accidents and may also accelerate the onset and progression of ischemia stroke and cerebral hemorrhage . hypertension is associated with low - grade inflammation , which may be associated with hypertension - mediated damage to target organs . inflammation in brain parenchyma can occur as a local process that can be triggered and sustained by activated glial cells , which is thought to contribute to the pathogenesis of several diseases . the innate immune response , predominantly represented by toll - like receptors ( tlrs ) , has been shown to contribute to the development of this condition . tlrs are first - line molecules for initiating the innate immune responses , and thus its signaling is involved in the activation of microglia by pathogens and damaged host cells . activated microglia subsequently secret proinflammatory cytokines and express costimulatory molecules needed for protective immune responses to pathogens and efficient clearance of damaged tissues . tlr4 is an important contributor to microglial activation and known to initiate an inflammatory cascade in response to various brain injuries . tlr4-mediated signaling activates the nuclear factor kappa b ( nf-b ) signaling pathway , which plays a critical role in immune and inflammatory responses , cell death , and survival [ 5 , 9 ] . therefore , enhanced expression of brain tlr4/nf-b may play an important role in cerebral pathology induced by hypertension . 5,6,4-trihydroxyflavone-7-o - glucoronide ( scutellarin ) is a flavone and the major active component of erigeron breviscapus ( vant . ) hand - mazz , a herbal medicine in use in the orient for the treatment of cerebrovascular diseases [ 1113 ] . in recent years , many studies in different animals and cells models have provided evidence for the protective effects of scutellarin because of its antioxidant [ 12 , 14 , 15 ] , antiapoptotic [ 14 , 1618 ] , anti - inflammatory [ 19 , 20 ] , and calcium channel antagonist properties . therefore , the aim of the present study was to investigate whether scutellarin treatment reduced the expression of brain tlr4/nf-b , the inflammatory status , and blood pressure in renovascular hypertensive rats . all experimental procedures were approved by the institutional animal ethical committee of sun yat - sen university and were conducted according to the guide for the care and use of laboratory animal of the national institute of health ( publication no . a total of 24 male sprague - dawley rats ( 6080 g ) were purchased from the center for experimental animals of sun yat - sen university . rats were randomly assigned into four groups ( six rats per group ) : ( 1 ) sham - operated group ( normotensive controls ) , ( 2 ) hypertension with normal saline ( ns ) treatment , ( 3 ) hypertension with low - dose ( 5 mg / kg per day ) scutellarin , and ( 4 ) hypertension with high - dose ( 20 mg / kg per day ) scutellarin . scutellarin scutellarin ( yunnan biovalley pharmaceutical company ltd , yunnan , china ) was dissolved in sterile ns , and different doses of scutellarin were administered by gavage lasting for 2 weeks . hypertension was induced using a 2-kidney , 2-clip method ( 2k2c ) , as described by zeng et al . . briefly , under anesthesia with 10% chloral hydrate ( 3 ml / kg body weight , intraperitoneally [ i.p . ] ) , a median longitudinal incision on the abdominal skin was performed , and then the roots of both right and left renal arteries were constricted by placing ring - shaped silver clips with an inner diameter of 0.30 mm to induce hypertension . approximately 8 weeks later , those rats with systolic blood pressure higher than 140 mmhg and without stroke symptoms were selected for the experiment . different doses of scutellarin were administered by gavage daily for 2 weeks . in the ns group , renal arteries in sham - operated rats also underwent surgery but without placement of clips . systolic blood pressure ( sbp ) was measured by an indirect tail - cuff sphygmomanometer ( mrb - iiia , shanghai institute of hypertension , shanghai , china ) in conscious rats heated ( heat lamp at 37c , for 5 min ) before and after renal artery constriction ( at weekly intervals ) for 10 weeks . the preparation of tissue samples was performed as described previously [ 24 , 25 ] . briefly , after 2 weeks of scutellarin treatment , rats were sacrificed under deep anesthesia with 10% chloral hydrate ( 5 ml / kg body weight , i.p . ) and then transcardially perfused with 0.9% sodium chloride ( at 4c ) . the brains were removed , and the left frontal cerebral cortex and striatum were rapidly dissected and used for western immunoblotting analysis . for immunofluorescence labeling , the right frontal brain was sliced into horizontal sections ( 10 m thick ) using the cm1900 cryostat ( leica , heidelberg , germany ) , and these section , were then fixed with 4% paraformaldehyde ( in 0.01 m phosphate - buffered saline ( pbs ) , ph 7.4 ) . triton x-100 in 0.01 m pbs ( 10 min ) , blocked with 10% normal goat serum ( kpl , ca , usa ) ( 1 h at room temperature rt ) , and then incubated ( overnight at 4c ) with the primary antibodies ( in primary antibody diluents ( dako , denmark ) ) : rabbit anti - tlr4 ( 1 : 100 ) ( santa cruz biotechnology , santa cruz , ca , usa ) , mouse anti - neuronal nuclei ( neun ) ( 1 : 400 ) ( chemicon , usa ) , mouse anti - rat glial fibrillary acid protein ( gfap ) ( 1 : 800 ) ( cell signaling technology , beverly , ma , usa ) , or mouse anticluster of differentiation 11b ( cd11b or ox-42 ) ( 1 : 300 ) ( millipore , usa ) . ( h + l ) , f(ab)2 fragment ( 1 : 1000 ) , alexa fluor 555 conjugated goat anti - mouse igg ( h + l ) , f(ab)2 fragment ( 1 : 1000 ) ( both from cell signaling technology ) , or fluorescein isothiocyanate - goat anti - mouse igg antibodies ( 1 : 200 ) ( zymed , usa ) in 0.01 m pbs ( 1 h at rt ) . sections counterstained for nuclei were exposed to 4,6-diamidino-2-phenylindole dihydrochloride ( 1 : 1000 ) ( roche , mannheim , germany ) and then mounted in prolong gold antifade reagent ( p36930 , invitrogen , usa ) prior to imaging . negative control sections were incubated with pbs only , and showed no positive staining ( data not shown ) . briefly , the left frontal cerebral cortex and striatum were homogenized in lysis buffer ( ph 7.6 ) with 0.01 g / ml phenylmethanesulfonyl fluoride centrifuged ( 16,400 rpm for 30 min ) , and then protein concentrations were determined using a bicinchoninic acid ( bca ) protein assay kit ( pierce , usa ) according to the manufacturer 's instructions . soluble protein ( 50 g ) was separated by 420% gradient sds / page ( sodium dodecyl sulfate polyacrylamide gel electrophoresis ) ( bio - rad ) and then transferred onto polyvinylidene fluoride membranes ( millipore , usa ) . membranes were blocked with 5% skim milk in tris - buffered saline containing 0.1% tween-20 and then incubated with the primary antibodies : rabbit anti - tlr4 ( 1 : 1000 ) , rat anti - interleukin 1 beta ( il-1 ) ( 1 : 1000 ) , rabbit anti - myeloid cell leukemia-1 ( mcl1 ) ( 1 : 1000 ) ( all from abcam , usa ) , mouse anti - nf-b p65 ( 1 : 1000 ) ( cell signaling technology , usa ) , goat anti - tumor necrosis factor alpha ( tnf- ) ( 1 : 5000 ) ( novus biologicals , usa ) , rabbit anti - il-18 ( 1 : 300 ) , rabbit anti - bax ( 1 : 300 ) , or mouse anti - caspase-3 p17 ( 1 : 300 ) ( all from santa cruz biotechnology , usa ) . membranes were exposed to the secondary antibodies diluted in blocking buffer for 1 h at room temperature : horseradish peroxidase ( hrp)-conjugated goat anti - mouse ( 1 : 6000 ) ( earthox , usa ) , hrp - conjugated goat anti - rabbit ( 1 : 3000 ) ( cell signaling technology ) , or hrp - conjugated rabbit anti - goat igg antibodies ( 1 : 3000 ) ( invitrogen , usa ) . mouse monoclonal anti--actin ( 1 : 3000 ) ( proteintech group inc . , immunoreactive bands were detected using chemiluminescent hrp substrate ( millipore , usa ) and visualized on kodak x - omat films . the optical densities were normalized to those of -actin and calculated as target protein expression/-actin expression ratios ( using image j 1.42q ) . all histological images were analyzed with image - pro plus image analysis software ( media cybernetics , silver spring , md , usa ) by one blinded assessor . the number of positively stained cells was counted using image - pro plus image analysis software in nine comparable , nonoverlapping fields ( 425 m 320 m ; 3 fields per section 3 sections per rat ) and was presented as the average cell number per field on each section [ 27 , 28 ] . all data are expressed as the mean standard deviation and were analyzed by one - way analysis of variance ( anvoa ) followed by the least significant difference ( lsd ) post hoc test . statistical analysis was performed with statistical product and service solutions ( spss ) 13.0 ( spss inc . , sbp was only slightly increased in hypertension - induced rats but increased progressively to 174.7 13.9 , 180.9 6.2 , 178.8 6.7 , and 126.4 9.8 mmhg in ns , low - dose , high - dose , and sham - operated groups , respectively ( figure 1 ) . sbp in the ns , low - dose , and high - dose groups was significantly higher compared with the sham - operated group ( p < 0.001 ) . there were no incidences of stroke or death in the four groups ( table 1 ) . no significant difference in sbp was found before treatment in ns , low - dose and high - dose groups . compared with the ns group ( 196.5 9.8 mmhg ) , scutellarin treatment significantly reduced sbp in a dose - dependent manner ( p < 0.001 ) . in the low - dose group , sbp was decreased by approximately 11.5 6.5 mmhg , from 180.9 6.2 mmhg to 169.1 7.1 mmhg . in the high - dose group , sbp was reduced by approximately 17.2 7.4 mmhg , from 178.8 6.7 mmhg to 161.2 9.9 mmhg . furthermore , sbp was significantly different between the low - dose and high - doses group ( p < 0.001 ) and was significantly higher compared with the sham - operated group ( 137.2 8.3 mmhg ) ( p < 0.001 ) . chronic hypertension induced microglia / macrophage activation ( figure 2 ) . compared with the sham group , the number of cells positively stained with ox-42 was significantly increased in the ns group ( 178.7 18.5/mm versus 86.2 16.8/mm ) ( p < 0.001 ) . in contrast , the number of cells positively stained with ox-42 was significantly decreased with low - dose and high - dose scutellarin , 143.1 21.9/mm and 117.4 17.8/mm , respectively ( p furthermore , counts in the high - dose group were significantly lower compared with the low group ( p < 0.001 ) . tlr4 immunoreactivity was sparse in the cerebral cortex and striatum in sham - operated rats ( figure 3(a ) ; sham ) . in contrast , chronic hypertension induced higher tlr4 expression in these regions ( figure 3(a ) ; hypertension ) . tlr4 was further investigated for its cellular distribution using markers for neurons ( neun ) , astrocytes ( gfap ) and microglia ( ox-42 ) . the majority of tlr4 ( red ) was colabeled with ox-42-positive cells ( green ) ( figure 3(b ) ; ( a ) ) . in contrast , few tlr4-positive cells were co - labeled with gfap - positive ( green ) ( figure 3(b ) ; ( b ) ) or neun - positive ( green ) ( figure 3(b ) ; ( c ) ) cells . western immunoblot analysis showed that compared with the sham - operated group , levels of tlr4 protein were significantly increased ( approximately 6-fold ) in the ns group ( figure 3(c ) ) ( p < 0.001 ) . however , treatment with scutellarin significantly decreased this level in a dose - dependent manner , approximately 39.9% and 72.1% in the low - dose and high - dose groups , respectively ( figure 3(c ) ) ( p < 0.001 ) . tlr4 mediates the activation of transcription factors , such as nf-b , which subsequently induces the production of inflammatory cytokines . in the present study , western immunoblot analysis showed that compared with the sham group , protein levels of nf-b p65 , tnf- , il-1 , and il-18 in ns rats were significantly increased by approximately 7- , 6.5- , 3.7- , and 4-fold , respectively ( figures 4(a)4(d ) ) ( p < 0.001 ) . these proteins were significantly reduced by scutellarin , with the high - dose group inducing a markedly higher attenuation compared with the low - dose group ( figures 4(a)4(d ) ) ( p < 0.001 ) . levels of nf-b p65 , tnf- , il-1 , and il-18 were reduced to 51.1% , 61.2% , 82.9% , and 83.3% , respectively , in the low - dose group , in contrast to 31.4% , 41.9% , 57.8% , and 53.4% , respectively , in the high - dose group . therefore , these results suggest that scutellarin reduced hypertension - mediated induction of the inflammatory response . to investigate the potential effect of scutellarin on neuronal cell survival , we evaluated the expression of the apoptosis - related proteins , mcl1 , bax , and cleavedcaspase-3 p17 in brains of hypertensive and sham - operated rats . western immunoblot analysis indicated that compared with the sham group , levels of mcl1 , bax , and cleavedcaspase-3 p17 were significantly increased in hypertensive rats ( figures 5(a)5(c ) ) ( p < 0.001 ) . compared with sham rats , mcl1 , bax , and cleavedcaspase-3 p17 were significantly ( p < 0.001 ) elevated in the ns group by approximately 2- , 3.8- , and 8.9-fold , respectively . compared with the ns group , treatment with scutellarin significantly upregulated the level of mcl1 , particularly with the high - dose group ( approximately 2.1-fold compared with the ns group ) ( figure 5(a ) ) ( p < 0.001 ) . however , scutellarin significantly downregulated the levels of bax and cleavedcaspase-3 p17 protein in a dose - dependent manner , to 71.4% and 73.9% ( for bax and cleavedcaspase-3 p17 , resp . ) for the low - dose group and 56.3% and 27.1% ( for bax and cleavedcaspase-3 p17 , resp . ) for the high - dose group ( figures 5(a ) and 5(c ) ) ( p < 0.001 ) . in the present study , we demonstrate that scutellarin is protective against chronic hypertension - induced activation of brain tlr4 and subsequent nf-b - mediated inflammatory responses . we show that scutellarin possesses anti - inflammatory and antiapoptotic properties and lowers blood pressure , thus suggesting its use as a potential therapeutic agent in hypertension - associated diseases . in the central nervous system , tlr4 has been reported to be expressed in both microglia and astrocytes , as well as in neurons . in this study , chronic hypertension augmented the expression of tlr4 predominantly in microglia / macrophage cells , indicating its involvement in chronic hypertension - induced inflammation . however , the expression of tlr4 in astrocytes and neurons also suggested their potential involvement , and thus further studies could explore this possible relationship . innate and adaptive immunities have been shown to contribute to hypertension - associated end - organ damage , although the mechanism by which this occurs remains unclear . previous studies suggest that enhanced expression of tlr4 may be linked with the development and maintenance of hypertension and low - grade inflammation and augmented vascular contractility in hypertensive rats [ 8 , 29 ] . chronic hypertension causes cardiac hypertrophy , characterized by low - grade inflammation and accompanied by increased expression and activity of tlr4 , and elevated gene expression of tnf- and il-6 in cardiac tissue . treatment with anti - tlr4 was shown to decrease mean arterial pressure , tlr4 protein in mesenteric resistance arteries , and serum levels of il-6 in spontaneously hypertensive rats . furthermore , tlr4 signaling is also involved in brain damage and in neuroinflammatory processes associated with ischemic stroke and neurodegenerative diseases , such as alzheimer 's disease [ 10 , 3032 ] . neutralizing tlr4 at the time of intracerebral hemorrhage and ischemic stroke provides neuroprotection . this effect may result from tlr4-mediated activation of nf-b signaling pathways linked to the transcription of many proinflammatory genes encoding for cytokines , chemokines , proteins of the complement system , and cell adhesion molecules . findings from our study of chronically hypertensive rats revealed that in addition to reducing blood pressure , scutellarin prevented inflammatory mediated neuronal damage by suppressing microglial activation and the concomitant rise in expression of nf-b , tnf- , il-1 , and il-18 . the underlying mechanism involves , at least in part , inhibition of tlr4/nf-b - dependent signaling pathway . interestingly , although treatment with scutellarin decreased sbp , the antihypertensive effect was moderate and without a dose - response relationship , suggesting that the low dose of scutellarin may have already reached the maximum antihypertensive effect . thus , the antihypertensive action may play a minor role in the protective activity of scutellarin against hypertension - induced brain inflammation . therefore , these results suggest that tlr4 is a promising target for the prevention and treatment of hypertension - associated diseases . studies in rat primary microglia and bv2 mouse microglia cell lines have shown that scutellarin inhibits lps - induced nuclear translocation and dna binding activity of nf-b , accompanied by reduced production of proinflammatory mediators , such as tnf- and il-1 . furthermore , recent reports have demonstrated the protective effects of scutellarin in the brain and heart of ischemic rats [ 16 , 33 ] . in line with these results , the present study found that scutellarin decreased hypertension - mediated neuronal apoptosis , possibly resulting from reduced tlr4- and nf-b - mediated production of the proinflammatory cytokines . scutellarin is a small molecule , and its neuroprotective effects have been well documented in different brain disease models [ 13 , 33 ] . the present study further demonstrated its anti - inflammatory and antiapoptotic action in the hypertensive brain . however , the precise molecular mechanism by which scutellarin protects against hypertension - induced brain damage still remains elusive . further study on the protective molecular mechanisms , pharmacokinetics and brain penetration of scutellarin will help explain its limited effects on blood pressure and provide relevant evidence for future clinical applications . in summary , chronic hypertension significantly enhanced the expression of tlr4 , nf-b , and the production of the proinflammatory cytokines , tnf- , il-1 , and il-18 in brains of hypertensive rats .

hypertension is associated with low - grade inflammation , and toll - like receptor 4 ( tlr4 ) has been shown to be linked to the development and maintenance of hypertension . this study aimed to investigate the effects of scutellarin ( administered by oral gavage daily for 2 weeks ) on brain tlr4/nuclear factor kappa b-(nf-b- ) mediated inflammation and blood pressure in renovascular hypertensive ( using the 2-kidney , 2-clip method ) rats . immunofluorescence and western immunoblot analyses revealed that hypertension contributed to the activation of tlr4 and nf-b , accompanied by significantly enhanced expression of proinflammatory mediators , such as tumor necrosis factor- ( tnf- ) , interleukin-1 ( il-1 ) , and interleukin-18 ( il-18 ) . furthermore , expression of the antiapoptotic protein , myeloid cell leukemia-1 ( mcl1 ) , was decreased , and the pro - apoptotic proteins , bax and cleavedcaspase-3 p17 were increased in combined cerebral cortical / striatal soluble lysates . scutellarin significantly lowered blood pressure and attenuated the number of activated microglia and macrophages in brains of hypertensive rats . furthermore , scutellarin significantly reduced the expression of tlr4 , nf-b p65 , tnf- , il-1 , il-18 , bax and cleaved - caspase-3 p17 , and increased the expression of mcl1 . overall , these results revealed that scutellarin exhibits anti - inflammatory and anti - apoptotic properties and decreases blood pressure in hypertensive rats . therefore , scutellarin may be a potential therapeutic agent in hypertension - associated diseases .

retrobulbar injection has been the most commonly employed technique of ocular anesthesia for many decades . as the technique is quick and efficient and requires lesser volume of anesthetic agent than other techniques , it is very popular in most developing countries like india , where cataract surgeries are being done in large numbers . nevertheless , the technique is not free from complications . retrobulbar hemorrhage , globe perforation , and central retinal artery occlusion ( crao ) are some of its vision - threatening complications ; inadvertent injection of the drug into the optic nerve can rarely result in central nervous system complications that can be life threatening . our first patient was a 65-year - old female who experienced poor vision os on the 1 postoperative day of an uneventful manual small incision cataract surgery performed under retrobulbar anesthesia at our institute . she was a known diabetic and hypertensive patient but had no history of cardiac illness . fundus revealed marked retinal whitening in the macular region with cherry red spot suggestive of crao [ figure 1a ] . spectral domain optical coherence tomography ( sd oct ) was performed to confirm the diagnosis [ figure 1c ] . she was treated with ocular massage and anterior chamber paracentesis along with iop - reducing agents . fundus fluorescein angiography ( ffa ) was done on the next day to assess the retinal perfusion [ figure 1b ] . her best - corrected visual acuity was counting fingers ( cfs ) at 5 m at 1-month follow - up visit . ( a ) fundus picture showing retinal whitening in the posterior pole with cherry red spot suggestive of central retinal artery occlusion , ( b ) fundus fluorescein angiography taken on the next day showing normal arm retinal time with delayed arterio - venous time suggestive of reperfusion , ( c ) optical coherence tomography shows hyperreflective inner retinal layers with thickening and an intact outer retina suggestive of central retinal artery occlusion . inner retinal layers are edematous and fused due to an acute ischemic event our second patient was a 46-year - old female who was referred to our institute with complaints of vision worsening following os cataract surgery . retrospectively , we found that she had undergone uneventful cataract surgery under retrobulbar anesthesia , a month ago . fundus revealed pale disc , sclerosed arteries , and veins with superficial hemorrhages , suggestive of a long - standing combined occlusion of central retinal artery and vein [ figure 2a ] . sd oct showed thinning and atrophy of inner retinal layers , suggestive of a long - standing arterial occlusion [ figure 2c ] . laboratory workup and cardiac assessment of both patients were found to be within normal limits . ( a ) fundus image ( montage ) shows pale disc , sclerosed vessels , and intraretinal hemorrhages in all quadrants suggestive of combined occlusion , ( b ) fundus fluorescein angiography shows occluded artery ( arrow head ) and occluded vein ( arrow ) , ( c ) optical coherence tomography shows thin and atrophic retinal layers suggestive of a long - standing vascular occlusion the risk of combined occlusion of the central retinal artery and vein is more in individuals with cardiovascular disease or hypercoagulable state . vascular occlusion secondary to retrobulbar injection is rare and has not been reported commonly in literature . retrobulbar injection has been widely practiced as a technique of ocular anesthesia for many decades . the technique requires blind insertion of a thin , long needle into the retrobulbar space which contains neural and vascular structures in close association . the anesthetic agent ( 3 ml of 2% lignocaine with adrenaline 1:200,000 dilution ) is typically given using a 26-gauge , 35 mm retrobulbar needle piercing the lower lid at the junction of medial two - third and lateral one - third of the inferior orbital margin . the location of the artery on the inferior surface of the dural sheath before piercing into the substance of optic nerve places the vessel in a vulnerable situation for direct trauma . the risk of arterial injury can be minimized using a 35 mm retrobulbar needle rather than a conventional 38 mm needle and also by rotating the globe downward and outward so as to keep the optic nerve away from the tip of the needle . the piston is withdrawn slightly before injection to assess the position of the needle tip . table 1 summarizes the risk factors , proposed mechanism , and final visual outcome of similar cases that were reported in literature . klein et al . reported direct trauma to the artery as the mechanism for crao . sullivan et al . reported optic nerve sheath hematoma as the mechanism for combined occlusion . morgan et al . proposed trauma to the artery and embolization as mechanisms for crao and injection into the optic nerve sheath as the mechanism for combined occlusion . reported significant retrobulbar hemorrhage associated with marked rise of orbital or iop as the mechanism for crao . direct trauma to the vessel could have been the most likely mechanism in our first case and optic nerve dural sheath hematoma compressing both artery and the vein as the probable mechanism in our second case . we also report the role of sd oct in confirming the diagnosis and also to prognosticate the disease condition . we conclude that retrobulbar injections can rarely be associated with dreadful vision - threatening complications such as crao and combined vascular occlusion . this can be avoided by having a sound knowledge on the anatomy of retrobulbar structures and by knowing the nuances of retrobulbar injection .

retrobulbar injection has been widely practiced as a technique of ocular anesthesia for many decades . nevertheless , the technique is not free from complications . vascular occlusion secondary to retrobulbar injection is rare but can be vision threatening . we report a case series of two such patients who presented with poor vision following retrobulbar injection . fundus showed pale retina with cherry red spot suggestive of central retinal artery occlusion in case 1 and pale disc with sclerosed vessels and multiple superficial hemorrhages suggestive of a combined occlusion of retinal artery and vein in case 2 . optical coherence tomography ( oct ) showed thickened inner retinal layers with intact outer retinal layers in case 1 and thinning in case 2 . we conclude that retrobulbar injections can rarely be associated with dreadful vision - threatening complications like in our patients . we also report the role of oct in assessing the prognosis following vascular occlusion .

postural alignment worsens gradually over the course of aging.1 this poor postural alignment , which manifests as spinal kyphosis , can result in irreversible degeneration of the intervertebral disks and ligaments . it also often causes postural instability and leads to vertebral bone fracture and increased risk of falling.2,3 due to these problems , various interventions are used for elderly persons who have spinal deformity to improve postural alignment . battaglia et al4 reported that exercise improved spinal flexibility , and imagama et al5 reported the improvement of lumbar lordosis angle , sagittal balance , and back muscle strength in elderly patients through a training program that included muscle strength and spinal range of motion exercises . spinal orthoses provide a way to directly modify the posture of elderly persons with spinal misalignment . piffer et al6 reported that use of a newly designed spinal orthosis , the spinomed ( medi gmbh & co. kg , bayreuth , germany ) , for 6 months improved muscle strength , body balance , kyphosis angle , and vital capacity in elderly patients with osteoporosis . ishida et al7 reported that a rucksack - type orthosis instantly modified spine alignment and decreased erector spinae ( es ) activity in elderly patients with kyphosis . as mentioned earlier , previous studies have reported that exercise and orthotic therapy are effective in treating the elderly with spinal misalignment . it is , however , also important to offer preventive intervention for the healthy elderly . costantino et al8 reported that chronic low - back pain ( lbp ) in elderly people without specific spinal deformity could be effectively treated using a back school program , including exercise therapy for rehabilitation . however , to our knowledge , no previous studies have reported the effectiveness of a spinal orthosis or lumbosacral orthosis ( lso ) in healthy elderly people without specific spinal deformity . a review of data from the cochrane database also found no evidence for the efficacy of lumbar support for decreasing low - back load.9 in addition , rostami et al10 reported that use of an lso for 4 weeks resulted in decreased trunk core muscle volume , and therefore , the drawback of long - term corset use may exceed the benefits . in a previous study , to provide a preventive method against abnormal posture and lbp in elderly persons , we designed a trunk orthosis to address these issues by training good postural alignment while decreasing low - back load via resistive force provided by joints with springs ( figure 1).11 this orthosis with joints providing resistive force ( hereafter , the orf ) produces a resistive moment that rotates the trunk backward and the pelvis forward ( figure 2 ) . resistive moment applied to the trunk can not only rotate it backward to shift the center of gravity of the head , arms , and trunk to the l4/l5 joint but also directly decrease low - back extension moment because the resistive moment work is in the same direction as that produced by es activity . in addition , reaction moment can promote forward rotation of the pelvis , and this effect can also facilitate extension of the thorax . the orf may therefore improve alignment and decrease es activity in elderly people . indeed , our recent studies reported that the orf improved trunk alignment and gait performance of hemiparetic patients11 and elderly persons during level walking.12 however , we did not examine the effect of the orf on es activity and spinal alignment during static standing . in light of the finding of no decrease in low - back muscle activity using lsos,9 this study aimed to examine , through biomechanical analysis , the effects of the orf on healthy elderly people during static standing and to compare the effects with those of an lso and no orthosis . we hypothesized that wearing the orf would effectively decrease es activity and modify trunk alignment in healthy elderly people during static standing . we enrolled 15 healthy community - dwelling elderly men ( mean age , 67.76.1 years ; mean height , 162.45.7 cm ; mean weight , 62.37.8 kg ) from a group of 31 candidates . we excluded those with neurological disease , pain , history of orthopedic surgery , history of orthopedic treatment within the past 5 years , and history of lbp within the past 1 year . in the first phase of recruitment , we identified only two female subjects willing to participate in our study ; however , due to a history of orthopedic treatment within the past 5 years , they were excluded . therefore , we decided not to include any female subjects to mitigate the potential effects of sex and orthopedic disease . all participants provided written informed consent , and the study was approved by the ethics committees of the participating institutions , international university of health and welfare . the features of the orf ( figures 1 and 2 ) were described in our previous report.11 briefly , the orf weighs 0.99 kg and has a 40 range of motion . stainless steel joints are connected to the upper support , with a nylon pad , and also to the pelvic support . these joints employ extension springs to produce tension , which is translated by a link mechanism into a resistive moment on the chest and a reaction moment on the posterior pelvis . the upper support initially inclines backward to exert resistive force on the chest and is then released via a mechanism that pulls tension levers downward . the orf is currently an investigational product that is not fda - approved or approved by the corresponding national agency for the indication described herein . participants freely stood for 10 seconds under three conditions in the laboratory setting : with no orthosis , with the orf , and with an lso ( damen corset , pacific supply , osaka , japan ; figure 3 ) . as the damen corset is frequently prescribed for patients with lbp , it was selected for use in this study . our previous study reported carry - over effects of the orf on body alignment of hemiparetic patients after removal while level walking.11 we therefore decided to measure two trials without intervention ( no orthosis ) first , after which subjects completed the two orthosis trials in random order . participants were given 5 minutes to become accustomed to wearing the orthoses , and there was a minimum rest interval of 5 minutes between conditions . resistive force exerted on the chest was measured in real time with a strain gauge ( compression load cell lcn - a , kyowa , tokyo , japan ) . n during static standing , and pressure between the corset and abdomen was set to 10 mmhg in all measurement conditions.13 to obtain maximal voluntary contraction ( mvc ) values for normalization of individual muscle activities , participants performed maximal isometric contractions against gravity , while the experimenter ( a licensed therapist ) applied maximum resistance.14 after practicing stable isometric contraction efforts , single maximal contractions of each muscle were recorded according to daniels and worthingham s muscle testing . subjects performed contractions against gravity , with maximum resistance applied by the examiner in the supine position to obtain mvc of the left internal abdominal oblique ( io ) muscle ( lifting head and shoulders from the table with right elbow toward left knee against imposed resistance to the right shoulder region ) , in the prone position to obtain mvc of the bilateral es ( back extension with hands resting on head against imposed resistance to the scapular region ) , and in the side - lying position with test leg elevated to obtain mvc of the right gm muscle ( abduction with limb slightly extended beyond the midline and the pelvis rotated slightly forward while imposing resistance to the lateral surface of the knee ) . static standing was recorded with a three - dimensional ( 3d ) motion capture system ( vicon 612 , vicon , oxford , uk ) that employed two force plates ( amti , watertown , ma , usa ) , 12 infrared cameras ( sampling rate , 120 hz ) , and 13 infrared - reflective markers ( diameter , 14 mm ) attached to the c7 spinous process , t12 spinous process , l5 spinous process , manubrium sterni , second sacral vertebra and bilateral acromion process , bilateral anterior and posterior superior iliac spine , and bilateral iliac crest ( figure 4 ) . all markers were captured in a reference static standing position , and then , the bilateral anterior superior iliac spine and iliac crest markers were removed before initiating measurements because they interfered with wearing of the orthoses . the positions of these removed markers were then interpolated using the reference static trial . to measure low - back muscle activity during static standing , electromyograms employing active electrodes to decrease noise ( biometrics , newport , uk ) were obtained for bilateral es ( 2 cm to the side between l4 and l5 vertebrae),15 left io ( 2 cm below the anterior superior iliac spine [ asis ] aligned approximately 6 from the line between bilateral asis),16 and right gm ( 2.5 cm below the line between the iliac crest and greater trochanter)17 ( figure 3 ) . the target muscle to confirm the effect of the io is classified as a core abdominal muscle , and rostami et al10 reported that io volume decreased after long - term use of a corset . also , hip abduction moment increased when elderly subjects wore the orf while level walking in our previous study.12 thus , unilateral io and gm activities were included as supplementary measures in this study . electromyography ( emg ) signals were measured at 1,080 hz because the acquisition frequency should be a whole - number multiple of the sampling frequency of the vicon system ( vicon ) ( 120 hz ) . all signals , including marker displacements and analog emg signals , were acquired by the vicon datastation ( vicon ) and then synchronized by correcting for the difference in sampling frequency ( 120 vs 1,080 hz ) using vicon workstation software ( vicon ) . band pass filter ( 20420 hz ) was used during acquisition to decrease noise,18 and the data were then imported into visual 3d analytical software ( c - motion , inc . , root mean squares ( rms ) for a 50 ms window were calculated , and integral values for these muscles ( iemg ) were calculated . consequently , equation 1 is given as follows : iemg=0t[emgrms](t)dt(1)where emgrms denotes emg after conducting rms for a 50 ms window and t denotes 10 seconds , indicating the end time of static standing . the physical coordinates and ground reaction force data were low - pass filtered with a second - order recursive butterworth filter ( cutoff frequencies 6 and 18 hz , respectively ) according to winter s technique.19 also , the link segment model consisted of a trunk segment and a pelvis segment , and markers on each segment were used to calculate 3d trunk and pelvic angles using coordinate systems and the eulerian method . center of pressure ( cop ) displacements are commonly used to evaluate balance performance in the elderly,20 and cop path length was validated as a performance outcome measure in a large group study.21 we therefore calculated cop path length to evaluate balance in the elderly subjects . the cop of the force vector of bilateral feet and cop total trajectory length were calculated for 10 seconds of standing . average kinetic , kinematic , and emg values , as well as iemg were acquired for 10 seconds of static standing . mean average values of 3d trunk and pelvic angles , average emg , and iemg were calculated from two trials , per condition for analysis . variables were compared by repeated measures analysis of variance ( rt - anova ) followed by multiple pair - wise comparisons to bonferroni correction . we enrolled 15 healthy community - dwelling elderly men ( mean age , 67.76.1 years ; mean height , 162.45.7 cm ; mean weight , 62.37.8 kg ) from a group of 31 candidates . we excluded those with neurological disease , pain , history of orthopedic surgery , history of orthopedic treatment within the past 5 years , and history of lbp within the past 1 year . in the first phase of recruitment , we identified only two female subjects willing to participate in our study ; however , due to a history of orthopedic treatment within the past 5 years , they were excluded . therefore , we decided not to include any female subjects to mitigate the potential effects of sex and orthopedic disease . all participants provided written informed consent , and the study was approved by the ethics committees of the participating institutions , international university of health and welfare . the features of the orf ( figures 1 and 2 ) were described in our previous report.11 briefly , the orf weighs 0.99 kg and has a 40 range of motion . stainless steel joints are connected to the upper support , with a nylon pad , and also to the pelvic support . these joints employ extension springs to produce tension , which is translated by a link mechanism into a resistive moment on the chest and a reaction moment on the posterior pelvis . the upper support initially inclines backward to exert resistive force on the chest and is then released via a mechanism that pulls tension levers downward . the orf is currently an investigational product that is not fda - approved or approved by the corresponding national agency for the indication described herein . participants freely stood for 10 seconds under three conditions in the laboratory setting : with no orthosis , with the orf , and with an lso ( damen corset , pacific supply , osaka , japan ; figure 3 ) . as the damen corset is frequently prescribed for patients with lbp , it was selected for use in this study . our previous study reported carry - over effects of the orf on body alignment of hemiparetic patients after removal while level walking.11 we therefore decided to measure two trials without intervention ( no orthosis ) first , after which subjects completed the two orthosis trials in random order . participants were given 5 minutes to become accustomed to wearing the orthoses , and there was a minimum rest interval of 5 minutes between conditions . resistive force exerted on the chest was measured in real time with a strain gauge ( compression load cell lcn - a , kyowa , tokyo , japan ) . force was set to 2025 n during static standing , and pressure between the corset and abdomen was set to 10 mmhg in all measurement conditions.13 to obtain maximal voluntary contraction ( mvc ) values for normalization of individual muscle activities , participants performed maximal isometric contractions against gravity , while the experimenter ( a licensed therapist ) applied maximum resistance.14 after practicing stable isometric contraction efforts , single maximal contractions of each muscle were recorded according to daniels and worthingham s muscle testing . subjects performed contractions against gravity , with maximum resistance applied by the examiner in the supine position to obtain mvc of the left internal abdominal oblique ( io ) muscle ( lifting head and shoulders from the table with right elbow toward left knee against imposed resistance to the right shoulder region ) , in the prone position to obtain mvc of the bilateral es ( back extension with hands resting on head against imposed resistance to the scapular region ) , and in the side - lying position with test leg elevated to obtain mvc of the right gm muscle ( abduction with limb slightly extended beyond the midline and the pelvis rotated slightly forward while imposing resistance to the lateral surface of the knee ) . static standing was recorded with a three - dimensional ( 3d ) motion capture system ( vicon 612 , vicon , oxford , uk ) that employed two force plates ( amti , watertown , ma , usa ) , 12 infrared cameras ( sampling rate , 120 hz ) , and 13 infrared - reflective markers ( diameter , 14 mm ) attached to the c7 spinous process , t12 spinous process , l5 spinous process , manubrium sterni , second sacral vertebra and bilateral acromion process , bilateral anterior and posterior superior iliac spine , and bilateral iliac crest ( figure 4 ) . all markers were captured in a reference static standing position , and then , the bilateral anterior superior iliac spine and iliac crest markers were removed before initiating measurements because they interfered with wearing of the orthoses . the positions of these removed markers were then interpolated using the reference static trial . to measure low - back muscle activity during static standing , electromyograms employing active electrodes to decrease noise ( biometrics , newport , uk ) were obtained for bilateral es ( 2 cm to the side between l4 and l5 vertebrae),15 left io ( 2 cm below the anterior superior iliac spine [ asis ] aligned approximately 6 from the line between bilateral asis),16 and right gm ( 2.5 cm below the line between the iliac crest and greater trochanter)17 ( figure 3 ) . the target muscle to confirm the effect of the io is classified as a core abdominal muscle , and rostami et al10 reported that io volume decreased after long - term use of a corset . also , hip abduction moment increased when elderly subjects wore the orf while level walking in our previous study.12 thus , unilateral io and gm activities were included as supplementary measures in this study . electromyography ( emg ) signals were measured at 1,080 hz because the acquisition frequency should be a whole - number multiple of the sampling frequency of the vicon system ( vicon ) ( 120 hz ) . all signals , including marker displacements and analog emg signals , were acquired by the vicon datastation ( vicon ) and then synchronized by correcting for the difference in sampling frequency ( 120 vs 1,080 hz ) using vicon workstation software ( vicon ) . band pass filter ( 20420 hz ) was used during acquisition to decrease noise,18 and the data were then imported into visual 3d analytical software ( c - motion , inc . , root mean squares ( rms ) for a 50 ms window were calculated , and integral values for these muscles ( iemg ) were calculated . consequently , equation 1 is given as follows : iemg=0t[emgrms](t)dt(1)where emgrms denotes emg after conducting rms for a 50 ms window and t denotes 10 seconds , indicating the end time of static standing . the physical coordinates and ground reaction force data were low - pass filtered with a second - order recursive butterworth filter ( cutoff frequencies 6 and 18 hz , respectively ) according to winter s technique.19 also , the link segment model consisted of a trunk segment and a pelvis segment , and markers on each segment were used to calculate 3d trunk and pelvic angles using coordinate systems and the eulerian method . center of pressure ( cop ) displacements are commonly used to evaluate balance performance in the elderly,20 and cop path length was validated as a performance outcome measure in a large group study.21 we therefore calculated cop path length to evaluate balance in the elderly subjects . the cop of the force vector of bilateral feet and cop total trajectory length were calculated for 10 seconds of standing . average kinetic , kinematic , and emg values , as well as iemg were acquired for 10 seconds of static standing . mean average values of 3d trunk and pelvic angles , average emg , and iemg were calculated from two trials , per condition for analysis . variables were compared by repeated measures analysis of variance ( rt - anova ) followed by multiple pair - wise comparisons to bonferroni correction . average pelvis forward tilt angle , thorax extension angle , and thorax angle on the pelvis coordinate system are shown in table 1 for the three static standing conditions : no orthosis , orf , and lso . one - way rt - anova revealed a significant main effect of condition for all three angles . pelvis forward tilt angle tended to increase while wearing the orf and decrease while wearing the lso , but these results were not significant compared to those without an orthosis . thorax extension angle and thorax angle on the pelvis coordinate system were significantly increased while wearing the orf compared to the other two conditions . one - way rt - anova indicated significant main effect of condition on integral and average muscular activities of the bilateral es and left io , but not on the gm . integral and average muscular activities of the bilateral es were significantly smaller while wearing the orf compared to no orthosis . for the left es , integral and average muscular activities the same trend was seen for the right es , but it was not significant . integral and average muscular activities of the left io were significantly dimished while wearing the lso compared to no orthosis , but there was no significant difference between orf and no orthosis conditions . incidence of lbp increases with age.22 age - related spinal deformity as well as es hyperactivity are among the major causes of lbp.18 we previously developed the orf to modify trunk and pelvis alignment and decrease es activity . we examined the effects of this orthosis on healthy elderly participants and found that the orf could effectively modify trunk alignment while decreasing es activity compared to an lso or no orthosis . coskun benlidayi and basaran23 reported that lumbar lordosis is significantly smaller in elderly than in young subjects . wearing of the orf in this study significantly extended the upper trunk and tended to tilt the pelvis forward , which would contribute to increasing lumbar lordosis . lee et al13 reported the effectiveness of a lumbar belt and pelvic belt to modify pelvic and spinal alignment on posture in healthy young participants . additionally , piffer et al6 reported that use of the newly designed spinomed ( medi gmbh & co. kg ) orthosis for 6 months improved kyphosis in elderly patients with osteoporosis . however , the present study appears to be the first to report on an orthosis that can modify alignment in healthy elderly participants without spinal deformity or chronic lbp . based on the findings of this study , the orf shows promise for the modification of spinal alignment in elderly people without any specific deformity or syndromes related to lbp . previous studies reported that interventions teaching awareness of posture , such as lessons on the alexander technique , could be beneficial in treating lbp , as well as cost - effective.24,25 back school programs that include exercise therapy could also be effective in elderly people with chronic lbp with no specific spinal deformities.8 therefore , the orf s ability to modify trunk alignment in elderly people might be useful to increase awareness of proper posture and help prevent misalignment and spinal deformity . the most significant effect of wearing the orf in this study was to decrease es activity . a systematic review reported that wearing an lso alone could not decrease low - back load.9 however , cholewicki et al18 reported that wearing an lso could decrease es activity during a postural control task such as sitting on an unstable seat . in this study , es activity decreased slightly by 1%2% mvc while wearing the orf . despite this small decrease , a modeling study showed that adding a 32 kg mass to the trunk required an increase in trunk muscle cocontraction of approximately 1%2% mvc above the level normally necessary to maintain a stable upright position of the spine around the neutral posture.26 furthermore , previous studies have reported that maintaining muscular contraction above 5% mvc may cause back - muscle fatigue and pain.27 in the present study , average right es activity was below 5% mvc while wearing the orf , but was higher for the other two conditions . in addition , average left es activity decreased within the 6% mvc range while wearing the orf , but was approximately 8% for the other two conditions . these results indicate that the orf was effective in decreasing the activity of low - back muscles , which was not observed while wearing the lso . in a postural control task , trunk muscle activity does not usually exceed 3% mvc in young participants.27 however , muscular activity of elderly people during mvc is lower , and therefore greater relative effort would be needed to maintain an upright standing position . rostami et al10 reported that wearing an lso led to decreased muscle volume in the abdominal side muscles , including the io . wearing the orf in the present study did not significantly decrease io activity , whereas wearing the lso significantly decreased it , compared to no orthosis . these results support those of rostami et al10 and suggest that resistive force might not decrease low - back muscle activity without a decrease in side abdominal muscle volume . no significant changes in cop trajectory were observed while wearing either orthosis in this study . cholewicki et al18 reported that cop displacement during an unstable sitting task did not significantly differ from the control condition ( no orthosis ) while wearing an lso . furthermore , chen et al28 reported that their insole served to improve the stability index , as calculated using cop displacement in elderly participants . cop is mainly controlled by the ankle plantar flexors , and therefore intervention using foot - based orthotic devices may be more useful than trunk - based devices . wearing the orf during static standing served to decrease es activity and modify trunk alignment , which may be effective for the prevention and treatment of lbp and spinal deformity in elderly people . first , we did not confirm the effects of long - term orf use , as wearing the orf or lso for lengthy periods might adversely affect muscle control . second , participants were healthy elderly men only and this was a within - subject trial . healthy elderly women and participants with lbp or low - back disorders should be included in future studies , including randomized controlled trials . third , we confirmed reduction of es activity , but it might not be the exact cause . resistive moment generated by the orf joints may have decreased extension moment exerted by the es muscles , or greater thorax extension angle could have decreased es activity by reducing the lever arm from the l4/l5 joint to gravitational force on the center of gravity of the upper trunk . moreover , es is a surface muscle . in a future study , we must confirm these changes in spinal loading using a more detailed biomechanical model including the deep back muscles , such as bilateral multifidus muscle . this study revealed that the orf significantly improved trunk alignment and decreased es activity in healthy elderly participants . these findings suggest that the orf may help prevent lbp and spinal deformity in elderly people . further studies are needed to examine the use of the orf in patients with lbp and spine deformity .

purposepostural alignment of elderly people becomes poor due to aging , possibly leading to low - back pain and spinal deformity . although there are several interventions for treating these conditions , no previous study has reported the effectiveness of a spinal orthosis or lumbosacral orthosis ( lso ) in healthy elderly people without specific spinal deformity . we therefore developed a trunk orthosis to decrease low - back muscle activity while training good postural alignment through resistive force provided by joints with springs ( here , called the orf , which stands for orthosis with joints providing resistive force ) as a preventive method against abnormal posture and low - back pain in healthy elderly persons.patients and methodsfifteen community - dwelling elderly men participated in this study . participants stood freely for 10 seconds in a laboratory setting under three conditions : without an orthosis , with the orf , and with an lso . the damen corset lso was selected as it is frequently prescribed for patients with low - back pain . postural alignment during static standing was recorded using a three - dimensional motion capture system employing infrared cameras . two force plates were used to record center of pressure . electromyograms were obtained for bilateral erector spinae ( es ) , left internal abdominal oblique , and right gluteus medius muscles.resultspelvis forward tilt angle tended to increase while wearing the orf and decrease while wearing the lso , but these results were not significant compared to no orthosis . thorax extension angle and thorax angle on pelvis coordinate system significantly increased while wearing the orf compared to the other two conditions . es activity significantly decreased while wearing the orf compared to the other two conditions . internal oblique activity was significantly smaller while wearing the lso than with no orthosis . center of pressure did not significantly differ among the conditions.conclusionthe orf significantly improved trunk alignment and decreased es activity in healthy elderly subjects during static standing .

ion channels gated by cyclic nucleotides are widely distributed throughout eukaryotes ( kaupp and seifert , 2002 ; robinson and siegelbaum , 2003 ) . as the molecular hardware linking changes of intracellular cyclic nucleotide levels occurring in sensory transduction to cellular electrical responses , these proteins are especially important in the coherent functioning of electrically excitable tissues . they have been most widely studied in sensory neurons , where they carry out essential tasks in the detection of photons or odorants , in cardiac myocytes , where they underlie pacemaking activity , and in cerebellar neurons , where they contribute to fine tuning in motor - coordination circuits . all such channels belong to the s4 superfamily ( yellen , 2002 ; yu and catterall , 2003 ) , which also includes voltage - dependent ca , na , and k channels ; these proteins are tetramers of identical or similar subunits , or of honorary subunits inhabiting the same polypeptide in tandem , with each subunit having six transmembrane sequences and a pore - forming sequence positioned between the fifth and sixth of these . the cyclic nucleotide - modulated channels additionally carry a cyclic nucleotide - binding domain ( cnbd ) in the cytoplasmic cooh - terminal region . these channels fall operationally into two broad subclasses , denoted cng ( cyclic nucleotide gated ) and hcn ( hyperpolarization and cyclic nucleotide activated ) . channels of the first class depend absolutely on cyclic nucleotides for opening , gate in a voltage - independent manner , and permit conduction only by monovalent cations , with little ionic selectivity among the group ia cations . in contrast , hcn channels are merely modulated by cyclic nucleotides in their primary mode of voltage - dependent gating , and , while also conductive to monovalent cations , favor k over na by a factor of approximately four . at the molecular level , both cng and hcn channels show the arginine - decorated fourth transmembrane sequence characteristic of the s4 family , and both carry similar cnbd sequences . in keeping with their k selectivity , pore - forming selectivity sequence unique and common to k channels ( heginbotham et al . , 1992 ) , while cng channels lack this sequence . the recent high - resolution structures of several k channels ( doyle et al . , 1998 ; jiang et al . , 2002 , 2003 ) provide an outline of molecular architecture in this protein family but leave many questions specific to the cyclic nucleotide - binding subfamily unaddressed . are these , like k channels , built as fourfold symmetric structures , as in the structure of an isolated cnbd of an hcn channel ( zagotta et al . , 2003 ) , or as dimers - of - dimers , as suggested by functional experiments on cng and hcn channels ( liu et al . , 1998 ; ulens and siegelbaum , 2003 ) ? what accounts for the hyperpolarization - dependent opening of hcn channels , a voltage dependence with polarity opposite to that of conventional kv - type k channels ( mannikko et al . , 2002 the 80-residue sequence connecting the cnbd to the sixth transmembrane helix , mediate between cyclic nucleotide binding and channel opening ( gordon and zagotta , 1995 ) ? so much less k selective than other k channels , which typically show 1001,000-fold selectivity for k over na ? the only productive avenue toward high - resolution ion channel structure is currently provided by bacterial homologues , which in some cases allow overexpression in escherichia coli of properly assembled proteins amenable to purification and crystallization . for this reason , we searched prokaryotic databases for s4-type ion channels containing cyclic nucleotide - binding domains . we now describe the overexpression , purification , and functional reconstitution of an s4-superfamily homologue from mesorhizobium loti , with a k selectivity sequence and a cnbd . the channel 's chromatographic behavior in detergent micelles and its ionic flux properties in liposomes respond to micromolar levels of cyclic nucleotides , and its selectivity for k is higher than that of either cng or hcn subtypes . a putative bacterial channel protein homologous to eukaryotic cyclic nucleotide - gated channels was identified by a homology search of the tigr bacterial database . the coding sequence was pcr cloned from m. loti genomic dna and inserted into an e. coli expression vector ( pask - iba2 ; sigma - genosys ) with a cooh - terminal hexahistidine tag . e. coli jm83 were transformed with this construct , and after plating on lb - amp , cells were harvested and grown in terrific broth . expression of protein was induced for 90 min with 0.2 mg / l anhydrotetracycline at a cell density ( a550 ) of 1.0 . cells were pelleted , resuspended in 100 mm kcl , 50 mm tris - hcl , ph 7.5 ( 50 ml for 13 liter culture ) , and lysed by sonication on ice in the presence of protease inhibitors ( complete edta - free , roche , and pmsf 0.17 mg / ml ) . membrane protein was extracted 2 h by adding 50 mm n - decylmaltoside ( dm ; anatrace ) , and the extract , clarified by centrifugation , was applied to a ni affinity column ( qiagen ) . after washing off nonspecifically bound proteins with running buffer ( 100 mm kcl , 20 mm tris - hcl , 5 mm dm , ph 7.6 ) supplemented with 40 mm imidazole , the protein was eluted by raising imidazole to 400 mm , concentrated to 815 mg / ml in amicon ultracentrifugal concentrators , and chromatographed on a superdex 200 size exclusion column ( amersham biosciences ) in running buffer . when needed , cyclic adenosine monophosphate or cyclic guanosine monophosphate ( camp , cgmp , fluka ) , 50200 m unless otherwise specified , was added to the bacterial suspension before sonication and maintained during all purification and reconstitution steps . in experiments in which cyclic nucleotide concentration was varied , protein was always prepared in high cyclic nucleotide , and the desired final concentration was introduced in the reconstitution step . eluted protein was analyzed by sds - page gel electrophoresis and the proteins visualized by coomassie staining . the purified protein was immediately reconstituted into liposomes at a concentration of 0.150 g protein / mg lipid in 20 mg / ml e. coli polar lipids ( avanti polar lipids , inc . ) in the presence or absence of camp or cgmp . detergent was removed either by overnight dialysis against 1,000 volumes of 400 mm kcl , 10 mm hepes , 5 mm n - methyl glucamine ( nmg ) , ph 7.6 , or by chromatography on sephadex g-50 fine , equilibrated in this same solution . the rb flux assay has been described in detail ( heginbotham et al . , 1998 ) . in brief , liposomes were thawed , sonicated , and passed over g-50 spin - columns ( 100 l liposome , 1.5 ml column ) equilibrated in uptake buffer ( 400 mm sorbitol , 50 m kcl , 10 mm hepes , 5 mm nmg , and the desired concentration of camp or cgmp ) to establish a k gradient across the liposome membrane . uptake of rb was initiated by mixing the liposomes with two to six volumes of uptake buffer containing trace amounts of rb ( 0.1 ci / ml ) , as depicted in the inset of fig . , extraliposomal rb was removed by passing a 100 l aliquot over a 1.5-ml cation - exchange dowex column ( 50wx4 - 100 ; sigma - aldrich ) converted to the nmg form , and radioactivity was measured in a liquid scintillation counter . valinomycin ( 1 g / ml ) was added at the end of each experiment to assay maximum rb uptake into all liposomes present . to follow proton uptake into electrically polarized liposomes , protein - free or reconstituted vesicles were thawed and supplemented with 50 mm kpi , ph 7.3 , and were then sonicated 510 s to trap the buffer in the internal space . for each assay , 100 l of vesicles was applied to a 1.5-ml spin column equilibrated with proton uptake solution ( 350 mm nacl , 10 mm kcl , 2 mm kpi , ph 7.3 ) to exchange the external solution and establish a k gradient . the liposomes ( 100 l ) were immediately diluted into a stirred vial containing 1.9 ml of proton uptake solution , in which a ph electrode was positioned . the ph of the solution was recorded on chart paper on a high - sensitivity scale ( 0.06 ph units full scale ) . fccp and valinomycin were used to permeabilize the liposomes to h and k , respectively . a putative bacterial channel protein homologous to eukaryotic cyclic nucleotide - gated channels was identified by a homology search of the tigr bacterial database . the coding sequence was pcr cloned from m. loti genomic dna and inserted into an e. coli expression vector ( pask - iba2 ; sigma - genosys ) with a cooh - terminal hexahistidine tag . e. coli jm83 were transformed with this construct , and after plating on lb - amp , cells were harvested and grown in terrific broth . expression of protein was induced for 90 min with 0.2 mg / l anhydrotetracycline at a cell density ( a550 ) of 1.0 . cells were pelleted , resuspended in 100 mm kcl , 50 mm tris - hcl , ph 7.5 ( 50 ml for 13 liter culture ) , and lysed by sonication on ice in the presence of protease inhibitors ( complete edta - free , roche , and pmsf 0.17 mg / ml ) . membrane protein was extracted 2 h by adding 50 mm n - decylmaltoside ( dm ; anatrace ) , and the extract , clarified by centrifugation , was applied to a ni affinity column ( qiagen ) . after washing off nonspecifically bound proteins with running buffer ( 100 mm kcl , 20 mm tris - hcl , 5 mm dm , ph 7.6 ) supplemented with 40 mm imidazole , the protein was eluted by raising imidazole to 400 mm , concentrated to 815 mg / ml in amicon ultracentrifugal concentrators , and chromatographed on a superdex 200 size exclusion column ( amersham biosciences ) in running buffer . when needed , cyclic adenosine monophosphate or cyclic guanosine monophosphate ( camp , cgmp , fluka ) , 50200 m unless otherwise specified , was added to the bacterial suspension before sonication and maintained during all purification and reconstitution steps . in experiments in which cyclic nucleotide concentration was varied , protein was always prepared in high cyclic nucleotide , and the desired final concentration was introduced in the reconstitution step . eluted protein was analyzed by sds - page gel electrophoresis and the proteins visualized by coomassie staining . the purified protein was immediately reconstituted into liposomes at a concentration of 0.150 g protein / mg lipid in 20 mg / ml e. coli polar lipids ( avanti polar lipids , inc . ) in the presence or absence of camp or cgmp . detergent was removed either by overnight dialysis against 1,000 volumes of 400 mm kcl , 10 mm hepes , 5 mm n - methyl glucamine ( nmg ) , ph 7.6 , or by chromatography on sephadex g-50 fine , equilibrated in this same solution . the rb flux assay has been described in detail ( heginbotham et al . , 1998 ) . in brief , liposomes were thawed , sonicated , and passed over g-50 spin - columns ( 100 l liposome , 1.5 ml column ) equilibrated in uptake buffer ( 400 mm sorbitol , 50 m kcl , 10 mm hepes , 5 mm nmg , and the desired concentration of camp or cgmp ) to establish a k gradient across the liposome membrane . uptake of rb was initiated by mixing the liposomes with two to six volumes of uptake buffer containing trace amounts of rb ( 0.1 ci / ml ) , as depicted in the inset of fig . , extraliposomal rb was removed by passing a 100 l aliquot over a 1.5-ml cation - exchange dowex column ( 50wx4 - 100 ; sigma - aldrich ) converted to the nmg form , and radioactivity was measured in a liquid scintillation counter . valinomycin ( 1 g / ml ) was added at the end of each experiment to assay maximum rb uptake into all liposomes present . to follow proton uptake into electrically polarized liposomes , protein - free or reconstituted vesicles were thawed and supplemented with 50 mm kpi , ph 7.3 , and were then sonicated 510 s to trap the buffer in the internal space . for each assay , 100 l of vesicles was applied to a 1.5-ml spin column equilibrated with proton uptake solution ( 350 mm nacl , 10 mm kcl , 2 mm kpi , ph 7.3 ) to exchange the external solution and establish a k gradient . the liposomes ( 100 l ) were immediately diluted into a stirred vial containing 1.9 ml of proton uptake solution , in which a ph electrode was positioned . the ph of the solution was recorded on chart paper on a high - sensitivity scale ( 0.06 ph units full scale ) . fccp and valinomycin were used to permeabilize the liposomes to h and k , respectively . in a blast search for s4-type channels containing cnbds , we noticed , among four other hits , a putative k channel homologue in the plant symbiont m. loti , an organism commonly used for genetic studies of rhizobial symbiosis and nitrogen fixation . np104392 ) encodes a 355-residue polypeptide of 38 kd with six putative transmembrane sequences ( s1s6 ) , where s4 bears three basic residues ( two arginines , one lysine ) , a k selectivity sequence ( ttgygd ) between s5 and s6 , and a cooh - terminal cnbd ( fig . the pore sequence for this protein , which we call mlok1 , is homologous to the corresponding region of other k channels such as kcsa ( 60% identity ) and shaker ( 50% ) , and its cnbd displays convincing similarity ( 30% ) to those of eukaryotic cng and hcn subtypes . unlike its eukaryotic counterparts , mlok1 does not contain the four - helix c - linker domain , which connects the end of s6 to the cnbd and is thought to transmit the cyclic nucleotide binding signal to the channel 's gate ( gordon and zagotta , 1995 ; ; johnson and zagotta , 2001 ; wang et al . , 2001 ) . in mlok1 , mlok1 in the s4 ion channel superfamily . predicted transmembrane segments shown as cylinders , cnbd in yellow , pore region in cyan . the completely conserved arg is shown in green and the adjacent conserved hydroxy amino acid in red . asterisk marks the position of acidic residues in cng channels ( varnum et al . , 1995 ) channel abbreviations , with ncbi accession nos . , are as follows : hcn1 , mouse hcn ( o88704 ) , hcn2 , human hcn ( q9ul51 ) , cnga1 , bovine cng ( q00194 ) , cnga2 , bovine cng ( q03041 ) , spih , sea urchin hcn ( np999729 ) . the channel protein , engineered with a cooh - terminal his6 tag and placed behind a tetracycline promoter , is efficiently expressed in e. coli ( fig . 2 ) , with an induction - dependent band of 35 kd visible on sds - page even in the whole - cell lysate . after extraction of the cells in detergent , high purity is achieved in a single pass over a ni - chelate column with a yield of 3 mg / l culture . the chromatographic behavior of the affinity - purified protein on gel filtration is cyclic nucleotide dependent ( fig . much of the protein elutes as an aggregate in the void volume , with some tetrameric material ( 150 kd ) following , along with several other peaks . however , with 50 m camp present , most of the material runs as a single tetrameric peak , as though the protein population is monodisperse under this condition . although gel filtration chromatography does not rigorously determine particle size , we are reasonably confident of our measurement here , since the column was calibrated with six membrane proteins of known size , run under identical detergent conditions . we note that these experiments were performed on two separate preparations processed in parallel in which the protein was extracted , purified , and chromatographed in the presence or absence of camp . this result implies that occupancy of the cnbd by ligand promotes native folding and perhaps stabilizes the channel during the purification procedure ; we have found ( unpublished data ) that the tetrameric peak purified without camp and maintained in its absence remains tetrameric for at least 7 d at 4c . protein samples were run on a 10% polyacrylamide sds gel stained with coomassie blue as follows : lane 1 , protein ladder with molecular weights indicated ; lanes 2 and 3 , pre- and post - induction whole e. coli lysates ; lane 4 , clarified membrane extract of induced cells ; lane 5 , ni column flow - through of membrane extract ; lane 6 , nonspecifically bound protein wash of ni column ; lane 7 , ni column eluted mlok1 ( 7 g ) ; lane 8 , gel filtration column - purified mlok1 ( 7 g ) . preparations of ni column purified ( solid curve ) or gel filtration purified ( dashed curve in b ) mlok1 were applied to a superdex gel filtration column monitored at 280 nm in the absence ( a ) or presence ( b ) of 50 m camp . dashed lines mark the tetrameric mlok1 peak and arrows indicate the void volume and molecular weights of two calibrated membrane proteins run under identical conditions : mthk k channel tetramer ( 250 kd ) and clc - ecl cl transporter dimer ( 92 kd ) . according to a calibration using five membrane proteins of known sizes run under identical conditions , the elution volume of mlok1 corresponds to 150 kd . scale bar for absorbance at 280 nm represents 20 mau for a and 100 mau for b. does mlok1 function as a cyclic nucleotide - gated ion channel ? we reconstituted the protein into liposomes and examined its ability to catalyze transmembrane movement of rb , a convenient radioactive k analogue . influx was followed under conditions wherein liposomes loaded with high kcl are suspended in low kcl solution containing radioactive tracer , a circumstance that leads to concentrative accumulation of radioactivity . under these conditions , significant tracer uptake can occur only in liposomes that are permeable to k but not to cl ( heginbotham et al . , 1998 ) . 4 a illustrates a typical influx time course , in which rb becomes trapped within the liposomes with approximately exponential time dependence characterized by a half - time of 30 min . however , even on the long , 2-h time scale of this experiment , the influx does not reach completion , and so the equilibrium level of trapped rb remains uncertain . we measure the maximum capacity of rb uptake by adding valinomycin , an ionophore which instantly permeabilizes all liposomes to k and rb . thus , in this experiment , mlok1 catalyzes rb uptake into 35% of the liposome space in 2 h , but because of the slowness of the time course , we can not claim that this represents the fraction of liposomes carrying functional mlok1 ; it does place a lower limit on this fraction , however . henceforth we normalize influx time courses to the maximum uptake measured by valinomycin to compare results obtained from different reconstitution conditions , as in fig . 4 b. here , the effect of camp on influx is shown . over the 1-h time course reconstitution of mlok1 increases the initial rate of uptake , and a maximal concentration of camp ( 200 m ) approximately doubles this . these results show that mlok1-mediated ion transport is not absolutely dependent on camp , but that the ligand enhances the protein 's intrinsic activity . ( a ) representative time course of accumulation of rb into liposomes reconstituted with mlok1 ( 10 g / mg lipid , 200 m camp ) . each point represents radioactivity of a single 100-l sample removed from the reaction mix at the time point indicated . after the 2-h sample was collected , valinomycin was added ( arrow ) and a sample was taken 2 min later . ( b ) valinomycin - normalized rb uptake in liposomes reconstituted with mlok1 ( 10 g / mg lipid ) in the presence of camp ( 200 m , black circles ) or in its absence ( gray circles ) . inset , cartoon of rb uptake assay , with liposomes loaded with high k ( 400 mm ) immersed in low k solution ( 50 m ) containing tracer rb ; this leads to a high negative intraliposomal potential , which the rb tracer follows ( heginbotham et al . the rate of rb uptake increases with the density of channels in the reconstituted membranes ( fig . ( < 2 g protein / mg lipid ) , uptake increases linearly , as liposomes in excess are titrated with channel protein . eventually , uptake levels off at high protein density > 5 g / mg ( fig . , this effect can not be quantified , as has been done by poisson statistics in other liposome systems ( goldberg and miller , 1991 ; heginbotham et al . , 1998 ; maduke et al . , 1999 ) , since the final steady level of rb uptake can not be accurately determined here ; nonetheless , the value of the half - saturation density ( 1 g / mg ) indicates that a large fraction of the protein is functionally active , since it is at this density that the number of liposomes is roughly equal to the number of protein molecules present in the reconstitution mix ( heginbotham et al . , 1998 ) . ( a ) valinomycin - normalized rb uptake time course for 0 ( white ) , 0.1 ( light gray ) , 1 ( dark gray ) , and 5 ( black ) g mlok1/mg lipid in the presence of 50 m camp . each time point represents rb accumulation after 45 min in liposomes containing mlok1 at the indicated concentrations and in the presence of 50 m camp . the appearance of a k selectivity sequence ( ttgygd ) between s5 and s6 suggests strongly that mlok1 should show a familiar k selectivity profile , permitting permeation by k and rb and effectively barring na and li . to test this expectation , we adapted the concentrative uptake assay to assess ion selectivity , comparing rb uptake into liposomes loaded with different test cations in the presence of camp ( fig . uptake is similar in k and rb , while neither na nor li supports significant uptake . these experiments do not allow precise estimates of ionic permeability ratios , but it is clear that rb influx rate is close to the k rate , and na and li permeate , if at all , at much lower rates . each bar represents rb uptake into liposomes reconstituted with 5 g protein / mg lipid measured after 45 min of uptake and normalized to the total amount of radioactivity in the sample . reconstituted liposomes were formed in the presence of the 400 mm of the cl salts of the indicated cations , along with of 50 m camp . cyclic nucleotides bias the open closed equilibrium of eukaryotic cng and hcn channels toward open conformations . this behavior is mirrored in mlok1 , although the maximum stimulatory effect of camp is only twofold ( fig . 4 ) . to examine the ligand dependence of this effect , we reconstituted the channel into liposomes and used the uptake assay to determine dose response curves for camp and cgmp . rb flux time courses in the presence of varying cyclic nucleotide concentrations are shown in fig . 7 ( a and b ) . both camp and cgmp stimulate the uptake , and both give similar approximately twofold maximal stimulation . response curves were derived from these time courses by normalizing the uptake values measured at 15 or 45 min to the corresponding isochronal uptake at maximal ligand concentration . these follow a simple langmuir - type concentration dependence ( hill coefficient of unity ) , with camp being 10-fold more effective than cgmp ( k1/2 = 60 and 600 nm , respectively ) . flux time courses into liposomes reconstituted with 5 g mlok1/mg lipid in the presence of camp ( a ) and cgmp ( b ) , at 0 ( white ) , 0.1 ( light gray ) , 1 ( dark gray ) , and 10 ( black ) m concentration . uptake values at 15 min ( squares ) and 45 min ( circles ) are normalized to both maximum ( saturating concentration of cnmp ) and minimum ( no cnmp ) values . smooth curves are drawn according to single - site binding functions , with k1/2 = 60 nm for camp ( black ) and 600 nm for cgmp ( gray ) . the uptake experiments above demonstrate that mlok1 mediates membrane transport for rb and k but do not distinguish between electrically conductive ion movement , as would be expected for a channel homologue , and an electroneutral mechanism . the preferred way of demonstrating a conductive mechanism is to reconstitute the protein into planar lipid bilayers and record electrical currents ; however , we have been so far unable to do this the method employs proton uptake to report on the electrical potential set up across the liposome membrane by a k gradient . 8 a ; liposomes loaded with high k are suspended in low k solution , and the ph of the suspension is recorded . a k - selective conductance present in the membrane produces a negative - inside electrical potential that attracts protons into the intraliposomal space . the proton - impermeable liposome membrane does not allow protons to follow this potential , but treatment with a proton ionophore removes this kinetic constraint and allows protons to enter , as may be observed by a ph increase in the external solution . addition of the weak - acid uncoupler fccp , which permeabilizes the membranes specifically to protons , has no effect on the ph of the suspension by itself . addition of the k - specific ionophore valinomycin polarizes the membrane and produces an immediate rise in ph , as protons are taken up against a ph gradient but down their electrical gradient . when this experiment is repeated on liposomes reconstituted with mlok1 , however , fccp causes prompt h influx without addition of valinomycin ( fig . thus , mlok1 substitutes functionally for valinomycin in setting up a negative internal membrane potential , and is therefore conductive , not electroneutral . the experiment further shows that mlok1 is selective for k over both na and h. subsequent addition of valinomycin causes only a small additional ph increase , as though < 25% of the liposomes in the population are free of functional mlok1 protein . these ph responses are completely abolished in the absence of a k gradient ( unpublished data ) . liposomes are loaded with high k and suspended in low k , with a k - specific conductance present in the membrane . under these conditions , if a proton ionophore is present to circumvent the impermeability of the lipid bilayer , protons will be drawn into the liposomes to follow the electrical potential set up by the k gradient . vesicles ( 20 mg / ml ) loaded with high k ( 450 mm ) were diluted 20-fold into lightly buffered low k ( 10 mm ) medium , and ph was recorded . at asterisk , fccp ( 0.050.5 g / ml ) , and at arrow , valinomycin ( 0.5 g / ml ) were added . horizontal scale bar , 30 s ; vertical scale bar , 13 nmol h , 0.003 ph units . all structures of ion channels determined so far have been prokaryotic in origin , mainly because of the empirical and tragic fact that overexpression of eukaryotic integral membrane proteins in e. coli has been so reliably unsuccessful . for this reason , if we wish to know what a eukaryotic channel protein looks like , we are currently forced into the unsatisfactory but practical necessity of seeking bacterial or archeal homologues of the channel of interest . in such a search we found five putative s4-type ion channels of the cyclic nucleotide - binding subclass . in striking contrast to the abundance of other channel families among bacterial genomes , such as kv and kir k channels and clc cl channels , these cnbd - containing homologues are rare , so far found only in five bacterial genomes , three of which are rhizobial symbionts . in no case is the biological function of any of these prokaryotic channels known . we chose to focus on mlok1 , which expresses well in e. coli and may be readily purified in quantity . to maintain the protein in a homogenous tetrameric state , it is necessary to keep cyclic nucleotide present throughout all steps of the purification procedure . the purified protein reconstituted into liposomes catalyzes rb uptake in a cyclic nucleotide - stimulated fashion . these two phenomena , along with the low concentration range in which the ligands act , imply that the cooh - terminal cnbd is properly folded and functionally competent . furthermore , the tetrameric nature and k - like ionic selectivity of conductive fluxes are as expected for a k channel . for these reasons , we consider that the purified mlok1 protein , in fulfilling the expectations of its sequence , is correctly folded and functional . to which subtype of cyclic nucleotide binding channel does mlok1 belong : cng or hcn ? it is certainly not of the cng subtype , since it is k selective and shows a k signature sequence . we are tempted to assign it to the hcn subfamily , on the basis of this k selectivity , as well as the substantial basal activity in the absence of cyclic nucleotides . but in fact we can not definitively assert that the channel is of hcn subtype . since we have not been able to record electrical currents from mlok1 , we can not gauge its voltage dependence , a fundamental defining characteristic of hcn channels . moreover , the high selectivity of mlok1-mediated flux for k over na would not be expected for a conventional hcn channel , as these are only weakly selective for k. we are therefore unwilling to assign this channel firmly to either of the categories defined in eukaryotic channels . both camp and cgmp bind to this channel , as indicated by chromatographic behavior and ion fluxes . in the flux assay , camp shows 10-fold higher potency than cgmp , with the two ligands giving similar maximal effects . several ligand - selectivity determinants have been identified in cnbds from eukaryotic channels , from both electrophysiological analysis of cng channels ( altenhofen et al . , 1991 ; varnum et al . , 1995 ) and direct structure determination of an isolated cnbd from an hcn channel ( zagotta et al . , 2003 ) . all eukaryotic cnbds , regardless of ligand preference , have a conserved arginine residue that coordinates the cyclic nucleotide phosphate ( zagotta et al . , 2003 ) , a threonine is always found adjacent to this arginine in eukaryotic channels that bind both camp and cgmp ; in the structure of hcn2 cnbd , the hydroxyl group of this threonine hydrogen bonds to the n2 atom of the guanine ring , while camp - specific channel isoforms , such as the sea urchin hcn channel ( gauss et al . , 1998 ) , lack this hydroxyl group . in mlok1 , this position uses a serine ( s308 ) , the hydroxyl of which may play an equivalent h - bonding role , permitting cgmp to bind . finally , cng channels that are highly selective for cgmp have an acidic residue closer to the cooh terminus ( fig . 1 , asterisk ) , and neutralizing this residue removes the ligand selectivity ( varnum et al . , 1995 ) ; mlok1 has an alanine residue here , in harmony with responsiveness to both camp and cgmp . on several grounds , therefore , the ligand dependence of mlok1 is consistent with expectations based on molecular determinants in its cnbd . one feature of mlok1 , however , is unexpected from precedent : the absence of a c - linker sequence , a motif found in all eukaryotic cng and hcn channels . the c - linker domain has been proposed to transmit the ligand - binding signal to the channel 's gate in s6 . this proposal arose from mutagenesis studies in cng and hcn channels ( gordon and zagotta , 1995 ; zong et al . , 1998 ; paoletti et al . , 1999 ; johnson and zagotta , 2001 ; wang et al . , 2001 ) and was strengthened by high - resolution structures of an isolated cnbd from an hcn isoform ( zagotta et al . , 2003 ) , where most of the intersubunit contacts in the tetramer are formed by the c - linker , which is composed of four -helices . this structure suggested that cyclic nucleotide binding drives a rearrangement of the c - linker domains , which opens the channel 's ion permeation pathway . our results refute this proposal , at least as a necessary , general mechanism of channel modulation by cyclic nucleotides , and they suggest that a minimal linking sequence is able to substitute for this function in the prokaryotic homologue . finally , we should ask whether the results here prove that mlok1 is a k channel . in fact to be sure , the gross functional characteristics of the reconstituted protein are consistent with a channel mechanism : electrically conductive transport with k - like ionic selectivity . but without a direct measurement of unitary transport rate , it is impossible to rigorously distinguish channel from transporter mechanisms , and the liposome system on which we rely does not permit an estimate of this . we note that mlok1-mediated rb uptake is 10100-fold slower than the rate expected for an always - open channel with a typical unitary conductance in the range 10100 ps , or than that observed under similar conditions for kcsa ( heginbotham et al . , 1998 ) . this low uptake rate might reflect a small unitary conductance or a low open probability , even when maximally activated by cyclic nucleotide , or a combination of both . in the absence of direct single - channel recording , this point must remain unresolved , but it is worth noting that eukaryotic hcn channels have extremely low single - channel currents ( difrancesco and mangoni , 1994 ) . in light of its tetrameric architecture , k - selective cyclic nucleotide - modulated ion fluxes , and unambiguous membership in the s4 superfamily of ion channels ,

a search of prokaryotic genomes uncovered a gene from mesorhizobium loti homologous to eukaryotic k+ channels of the s4 superfamily that also carry a cyclic nucleotide binding domain at the cooh terminus . the gene was cloned from genomic dna , and the protein , denoted mlok1 , was overexpressed in escherichia coli and purified . gel filtration analysis revealed a heterogeneous distribution of protein sizes which , upon inclusion of cyclic nucleotide , coalesces into a homogeneous population , eluting at the size expected for a homotetramer . as followed by a radioactive 86rb+ flux assay , the putative channel protein catalyzes ionic flux with a selectivity expected for a k+ channel . ion transport is stimulated by camp and cgmp at submicromolar concentrations . since this bacterial homologue does not have the c - linker sequence found in all eukaryotic s4-type cyclic nucleotide - modulated ion channels , these results show that this four - helix structure is not a general requirement for transducing the cyclic nucleotide - binding signal to channel opening .

ovarian cancer is the most lethal gynecologic malignancy at present . despite the recent new diagnostic possibilities and medical advances , the 5-year survival rate of patients with advanced ovarian cancer is only 2535% . prognosis is usually very poor due to the late diagnosis , more than 70% of patients diagnosed with this cancer have reached late - stage ( stage iii - iv ) when cancer has already spread beyond the ovaries . one reason for this high mortality rate is the lack of an effective early detection method for ovarian cancer . indeed , the 5-year survival rate at early - stage ( stage i - ii ) can reach 90% . therefore , there is immediate need of reliable diagnostic biomarkers and novel therapeutic tools that can realize the early diagnosis of ovarian cancer . among this , the recently discovered micrornas ( mirnas ) have been learned a lot . a total of 2578 human mirnas have been found until now ( sanger mirbase database , version 20.0 ) . moreover , studies have found that mirnas play a key role in various biological processes of ovarian cancer , such as development , proliferation , differentiation , apoptosis , and metastasis . these phenomena appear in early - stage , suggesting mirna can be used as a new biomarker for early diagnosis of ovarian cancer . this review summarizes the current clinical diagnosis method and diagnostic biomarkers of ovarian cancer , and the early detection methods of ovarian cancer mirnas are explored . conventional diagnostic methods for ovarian cancer include the history of disease , physical examination , symptom index diagnosis and imaging diagnosis , etc . history of disease and physical examination can only understand the general condition of patients while symptom index diagnosis is an only preliminary clinical evaluation . imaging diagnostic methods mainly include ultrasonic , computed tomography ( ct ) scan , magnetic resonance imaging ( mri ) , and positron emission tomography - ct ( pet - ct ) , etc . ultrasound diagnosis is widely used due to the low price and low radiation hazard , which is an important diagnostic method for ovarian cancer , but it has limited specificity and sensitivity . therefore , ultrasound diagnosis should not be used alone as the screening method for ovarian cancer but should be combined with other test results to analyze comprehensively and diagnose early - stage ovarian cancer . it provides better soft tissue contrast in the pelvic examination , and the sensitivity is obviously improved than ct ( mri for 90% , ct for 66% ) . however , mri is expensive , which is not suitable for ovarian cancer screening in the general population . based on the tracking of radioactive tracer , pet - ct can provide information of cell anabolic metabolism rate , identify target cells in a specific organization and reflect the metabolic changes of tumor cells . therefore , compared with ct or mri , pet - ct has higher sensitivity in the diagnosis of ovarian cancer recurrence . however , its diagnostic accuracy is not ideal for early - stage , small , and low - grade malignant tumors . but due to the various defects of the image device , it is usually to combine several kinds of technologies for diagnosis . moreover because of the low sensitivity and specificity , the methods are often used in the diagnosis of high - risk groups , rather than early detection . therefore , it is urgently needed to develop new methods for early diagnosis of ovarian cancer . in addition to the formation of ovarian cancer and the limitations of conventional diagnostic methods , the selection of biomarkers is also a big influencing factor on the difficulty of early diagnosis of ovarian cancer . occurrence and development of tumor can be understood through the existence and changes of biomarkers , thus assisting diagnosis , classification and prognosis judgment on tumor and guidance on tumor treatment . the ideal biomarker needs good specificity , high sensitivity and should be closely related to tumor progression . ovarian cancer - related biomarkers at present are mainly carbohydrate antigen , lysophosphatide acid , human epididymis protein 4 , nectin-4 and tyrosine kinase receptor , etc . until now , diagnostic index that is used in clinical for diagnosis , recurrence and prognosis of patients with ovarian cancer is still ca-125 only . the preoperative diagnostic sensitivity for patients with ovarian cancer of stage i and ii is lower than 60% , so it can not realize the early detection on small and curable cancer . ca-125 is increased to different degrees in lung cancer , liver cancer , pancreatic cancer , cervical cancer , colorectal cancer , and other malignant tumors , so there are some false positives . for these reasons , european group on tumor marker and national academy of clinical biochemistry do not claim to use ca-125 as biomarkers in early diagnosis of ovarian cancer . therefore , a lot of researchers are devoted to seeking a new diagnostic biomarker with strong specificity . mirna was discovered by victor ambros et al . in 1993 in their study on lin-14 gene regulating development of nematodes . mature mirna is a kind of endogenous , noncoding , single - stranded small rna , which is composed of about 2022 nucleotides . in this review mirna is involved in many physiological processes and is expressed abnormally in a variety of pathological conditions . these abnormal expressions of mirna are closely related to the occurrence and development , and diagnosis and prognosis of the human disease , and form the specific characteristics of diseases spectrum . compared to protein markers , mirna changes before the protein and along with the progress of tumor . in addition , mirna is small and can effectively avoid degradation in an endogenous and exogenous fluid , so mirna is more stable than dna and messenger rna ( mrna ) . , primary microrna transcribed by genome is processed in the nuclei by drosha enzyme to become precursor microrna of stem - loop structure ( 70100 nucleotides ) . then precursor microrna is transferred from nuclei to cytoplasm via rangtp / exprotin-5 transport mechanism ( rangtp concentration is higher in nuclei , and exprotin-5 can promote precursor microrna to release from drosha complex and bring it to the outside by combining with it ; while rangtp is lower in cytoplasm and precursor microrna is released by exprotin-5 ) . at last , precursor microrna is digested by another double - stranded rna - specific ribonuclease ( dicer ) to finally obtain the mature microrna consisting of 2022 nucleotides . micrornas combined with rna - induced silencing complex and bind to 3-untranslated region of target messenger rna . these mature micrornas may set up complete or incomplete base pairing with messenger rna to degrade target messenger rna or lead to inhibitions on translation and further regulate the gene expressions after gene transcription . a lot of studies over the comparison between normal ovary tissue and ovarian cancer tissues in mirna expression showed that there were significant changes of mirna in ovarian cancer tissue . iorio et al . compared 29 tissue mirnas between epithelial ovarian cancer patients and healthy controls . the results showed that only 4 mirnas ( mir-141 , mir-200a , mir-200b , and mir-200c ) were up - regulated , and 25 mirnas were down - regulated , where mir-125b-1 , mir-140 , mir-145 , and mir-199a had the highest multiples of down - regulation . they suggested that the aberrant expression of mirnas could exert on the pathogenesis and the development of different histotypes of ovarian carcinoma . further study found that stage i epithelial ovarian cancer histotypes have their own characteristic mirna expression and specific regulatory circuits . the result showed that mir-30a-5p and mir-30a-3p were increased in clear cell histotype , indicated that mir-30a-5p and mir-30a-3p could be a stage - independent clear cell marker ; whereas mir-192 and mir-194 were significantly highly expressed in mucinous histotype , suggested that mir-192 and mir-194 were key markers of mucinous subtypes . recently , multiple studies prove that mirna expression signature can be identified as potential prognostic indicators , which are summarized in table 1 . potential prognostic mirnas for ovarian cancer sac : serous adenocarcinoma ; eac : endometrioid adenocarcinoma ; mirnas : micrornas ; ppc : primary peritoneal carcinomas . tissue mirna can not be used for early detection because tissue samples at or post diagnosis are required . studies have shown that serum / plasma mirna has obvious advantages as a tumor marker : first , mirna is involved in all stages of tumor including occurrence , development , and metastasis , with good specificity ; next , serum / plasma mirna , both stable and insensitive to ribonuclease , temperature , and ph , can be preserved for a long time while can be frozen and unfrozen repeatedly ; finally , it is simple to detect serum / plasma mirna , with low cost . these features make the serum / plasma mirna become a promising potential noninvasive diagnostic marker . resnick et al . detected serum mirna of 28 patients with serous ovarian cancer and 15 normal controls . the result showed that serum mir-92 , mir-93 , mir-21 , mir-29b , and mir-126 in patients with ovarian cancer were significantly highly expressed , and mir-99b , mir-127 , and mir-155 were lower expressed . it is worth mentioning that in these patients , mir-92 , mir-93 , and mir-21 have appeared before the increase of ca-125 , suggesting these three kinds of mirna can be used as the early diagnosis marker for serous ovarian cancer . husler et al . using a mirna microarray to analyze the whole blood - derived mirna expression in 24 cases of serous ovarian cancer patients and 15 cases of healthy controls ( hcs ) . the authors reported that mir-30c-1 - 3p was highly expressed and mir-181a-3p , mir-342 - 3p , and mir-450 - 5p were lowly expressed in serous ovarian cancer patients . in addition , these mirnas had good specificity ( 88.1% ) and sensitivity ( 86.7% ) when compared with control group . four mirnas ( mir-132 , mir-26a , let-7b , mir-145 , and mir-143 ) were significantly under - expressed in the serum of serous ovarian cancer patients compared to controls . the results suggested that these mirnas could be used as novel biomarkers of serous ovarian cancer . found that plasma mir-205 was up - regulated and plasma let-7f was down - regulated in ovarian cancer cases than in controls , and combined these mirnas could be useful biomarkers for ovarian cancer detection , especially in patients with stage i disease ( specificity was 77.8% and sensitivity was 90.0% ) , they also found that let-7f may be predictive of ovarian cancer prognosis . showed that serum mir-221 may have a role as a noninvasive diagnostic marker in epithelial ovarian cancer . furthermore , the over - expression of mir-221 was an independent unfavorable prognostic factor in epithelial ovarian cancer . reported that the expression of mir-200a , mir-200b , and mir-200c were significantly up - regulated in the serum of epithelial ovarian cancer patients compared with normal controls . interestingly , the results also showed that mir-200a over - expression was found be associated with tumor , histology , and stage ; mir-200c over - expression was found be associated with lymph node metastasis . they suggested that serum mir-200a , mir-200b , and mir-200c were recognized as reliable markers to predict the prognosis and survival in epithelial ovarian cancer patients . liang et al . showed that serum mir-145 could discriminate patients with ovarian cancer from hcs , suggested that it could potentially serve as an outstanding biomarker for ovarian cancer . reported that serum mir-200c and mir-141 were significantly increased in ovarian cancer patients compared with controls . in particular , the group with high mir-200c level achieved significantly a higher 2-year survival rate , while low mir-141 group showed a significantly higher survival rate . the results showed that mir-200c and mir-141 might be predictive biomarkers for ovarian cancer prognosis . all these studies prove the thought that the detection of ovarian cancer - associated mirnas from the peripheral blood can be an important method for early diagnosis of this disease . potential diagnostic mirnas for ovarian cancer sac : serous adenocarcinoma ; cac : clear cell adenocarcinoma ; eac : endometrioid adenocarcinoma ; mac : mucinous adenocarcinoma ; hc : healthy control ; mirnas : micrornas . mirna plays a biological role via combining with 3-untranslated region ( 3utr ) of target mrna , and then triggering either mrna degradation or translational repression . therefore , it can function as master coordinators , efficiently regulating and coordinating multiple cellular pathways and processes . increasing evidence has led to the view that the expression of mirnas is remarkably deregulated in ovarian cancer , suggesting that mirnas may play important roles in multiple biological processes such as angiogenesis , adhesion , migration , cell proliferation , etc . , and intervention on mirna expression of known target genes and potential target genes can be novel treatment strategies for ovarian cancer therapy , as summarized in table 3 . potential therapeutic mirnas for ovarian cancer eoc : epithelial ovarian carcinomas ; sac : serous adenocarcinoma ; cac : clear cell adenocarcinoma ; mirnas : micrornas . how to realize the early diagnosis of ovarian cancer and excellent detection method are the important factors to improve the detection sensitivity and specificity . the sequence of mature mirna is generally very short , and there is interference of cross - hybridization of sequences between homologous mirnas , so the new challenge is put forward in detection sensitivity and specificity , etc . common mirna detection methods mainly include northern blotting , microarray , and reverse transcription - polymerase chain reaction ( rt - pcr ) . northern blotting can identify the expression of the corresponding gene by detecting the expression of rna , and it can realize a semi - quantitative analysis of mirna by combing with rna marker . applied northern blotting to explore the construction of eukaryotic expression vector mir-101 and its expression in human placental villi carcinoma , and the results showed mir-101 can significantly inhibit translation of endogenous ezh2 , thus regulating tumor occurrence and infiltration . northern blotting does not need to preamplify mirna samples , but its sensitive is low , and the requirement of the sample is large . the microarray is a main technology realizing an analysis of mirna expression spectrum and high - throughput detection of a variety of mirnas at the same time . it can obtain expression spectrum of different mirna specimens through detection on the intensity of hybridization signals , thus comparing the expression differences in mirna specimens . used microarray to analyze the mechanisms of let-7e , mir-30c , mir-125b , mir-130a and mir-335 in drug - resistant cells a2780tax , a2780tc1 , a2780tc3 ( paclitaxel ) , and a2780cis ( resistance to cisplatin ) , and found that down - regulation of mirna can activate chemotherapy - resistance gene m - csf . this result showed that resistance to drug of ovarian cancer was associated with the mirna expression spectrum . through microarray has the advantage of high flux , it is susceptible to the interference of cross hybridization of homologous mirna sequences , and the equipment are expensive . rt - pcr can observe the real - time signal changes during the experiment by fluorescence signal changes . used sybr green i for fluorescence quantitative detection and found that low expression of mir-21 can obviously increase apoptosis of papillary ovarian cells ovcar3 in vitro and reduce proliferation , invasion and migration ability of ovcar3 cells . used sybr green rox for fluorescence quantitative detection and found low expressions of mir-15 and mir-16 in ovarian cancer . moreover , it results in the growth of tumor cells by combining with 3utr in brni-1 gene , suggesting tumor suppressor role of mir-15 and mir-16 . the advantage of sybr green is easy to use . it does not need to design complex fluorescent , so it simplifies the detection methods and reduces the cost cittelly et al . confirmed ovarian cancer patients with low expression of targets ( tubb3 ) of antimicrotubular drugs had obviously longer survival period than patients with high expression of tubb3 by taqman probe , suggesting mir-200c can increase the sensitivity of ovarian cancer tissues to chemotherapy drug taxol via target regulation on tubb3 . the emergence of taqman probe solves the non - specificity of fluorescent . at the reaction end , but its price is high , and it is only suitable for a specific target and inconvenience to popularize and application . in addition , fluorescence group and quenching group on both sides of taqman probe are close to each other , so incomplete quenching results in high background . since mature mirna molecules only have 22 bases and the sequence is short , amplification reaction can not be directly implemented by pcr . ( a ) northern blotting method ; ( b ) microarray method ; ( c ) two reverse transcription - polymerase chain reaction methods : ( 1 ) the sybr green reverse transcription - polymerase chain reaction method ; ( 2 ) the taqman probe reverse transcription - polymerase chain reaction method . with the development of nano science and technology , researchers have developed more and more new methods used in detection on sensitivity and specificity of mirnas . these methods can be divided into two categories , one detection method is based on the sample amplification reaction ; another detection method is based on the probe hybridization ( sample without amplification ) . sample amplification detection methods mainly include rolling circle amplification ( rca ) , hybridization chain reaction ( hcr ) and ligase chain reaction ( lcr ) , etc . rca is an isothermal amplification technique copying circular template based on displacement activity of dna polymerase chain . moreover , the amplified product further induced branch rolling amplification as a primer , thus realizing detection on sensitivity and specificity of mirna . they used a probe that was fixed in hydrogel particles to capture mirna and can quantitatively detect a variety of mirnas . it can distinguish the mismatching of a base and the linear range crosses 6 magnitudes ( 300 am-40 pm ) . hcr triggers long chain of nucleic acids with a gap by trigger chain , and achieve amplification detection on the target by competitive hybridization between nucleic acids . yang et al . established a new method to detect mirna based on the differences between grapheme oxide and single and double chains in acting forces and amplification of hcr signals . the new probe and hcr amplification method can largely increase the sensitivity of detection on mirna . and lcr uses dna ligase to build covalent phosphate bond , which connects double - stranded dna specifically . after heating denaturation , annealing , and connection , cycles is repeated for many times , thus target dna is amplified to a large amount . established a new method detecting mirna that was of high sensitivity by connecting lcr and fluorescence resonance energy transfer of cationic conjugated polymer assisted by lambda exonuclease . the new method can achieve high sensitivity detection on target mirna ( 0.1 fm ) . probe hybridization is a direct detection method , we do not need to be preamplified rna samples . these methods mainly include nano - gold labeling technique and direct quantitative analysis of multiple mirnas ( dqammir ) . the basic principle of nano - gold labeling technique is based on the molecular hybridization technology . alkyl thiol modified oligonucleotides can be combined with nano - gold covalent , and then the probe may be formed with the target mirna sequence hybridization . degliangeli et al . designed a probe based on the dna - gold nanoparticle , which is immobilized on pegylated gold nanoparticles ( aunps ) . the dna aunp probes can achieve high sensitivity detection on mir-203 , and the detection limit can reach 0.2 fm . this new method can significantly advance the use of mirnas as biomarkers in the clinical praxis . dqammir is the new method to measure accurately amounts of multiple mirnas in biological samples . mirnas and excessive dna probe hybridization , and separation by capillary electrophoresis . due to different mirnas corresponding modified amino acid dna probe length is different , so the migration velocity also different . using this method can simultaneously detect more than 10 kinds of mirnas . with the rapid development of the mirnas detection technology , this is widely used in many aspects of cancer early detection . however , it is worth pointing out that pubmed search with mirnas and cancer lists around 16,717 publications , whereas search with the term mirnas and ovarian cancer lists around 616 publications ovarian cancer has characteristics of high malignant degree , poor prognosis , and high mortality rate . in clinical , image detection since mirna is closely related to the occurrence and development of ovarian cancer , its expression is stable , and can be used as a marker for early diagnosis of ovarian cancer . emerging evidence strongly supports the mirnas have the potential to be useful diagnostic and prognostic biomarkers . thus , in the near future , mirna therapy could be a powerful tool for ovarian cancer prevention and treatment . it is worth noting that with the in - depth research of mirnas , it is found the expression of mirna is different in serum and plasma , and in patients body fluid including ascites , pleural effusion , urine and saliva , etc . it can be imagined that this simple , convenient and less painful test method has profound significance for diagnosis , treatment , and prognosis for patients with ovarian cancer . on the other hand , as mirna plays more and more important role in early diagnosis of ovarian cancer . although mirna detection technologies are quickly developed , these new mirna detections have not yet been used widely in early diagnosis of ovarian cancer . therefore , by combining the new analysis technology and new nano materials , point - of - care tests for mirna with high throughput , high sensitivity , and strong specificity are developed to achieve the application of diagnostic kits in the screening of early ovarian cancer . this work was supported by a grant from shanghai health system important disease joint research project ( no . this work was supported by a grant from shanghai health system important disease joint research project ( no .

objective : this review aimed to update the progress of microrna ( mirna ) in early detection of ovarian cancer . we discussed the current clinical diagnosis methods and biomarkers of ovarian cancer , especially the methods of mirna in early detection of ovarian cancer.data sources : we collected all relevant studies about mirna and ovarian cancer in pubmed and cnki from 1995 to 2015.study selection : we included all relevant studies concerning mirna in early detection of ovarian cancer , and excluded the duplicated articles.results:mirnas play a key role in various biological processes of ovarian cancer , such as development , proliferation , differentiation , apoptosis and metastasis , and these phenomena appear in the early - stage . therefore , mirna can be used as a new biomarker for early diagnosis of ovarian cancer , intervention on mirna expression of known target genes , and potential target genes can achieve the effect of early prevention . with the development of nanoscience and technology , analysis methods of mirna are also quickly developed , which may provide better characterization of early detection of ovarian cancer.conclusions:in the near future , mirna therapy could be a powerful tool for ovarian cancer prevention and treatment , and combining with the new analysis technology and new nanomaterials , point - of - care tests for mirna with high throughput , high sensitivity , and strong specificity are developed to achieve the application of diagnostic kits in screening of early ovarian cancer .

paragonimiasis is a parasitic disease caused by ingesting crustaceans , such as crabs or crayfish , that are infested with the metacercariae of paragonimus ( 1 ) . korea was once endemic for the disease because korean people traditionally ate soybean - sauced freshwater crabs , of which paragonimus infestation rates were high ( 3 ) . the 1950 's and 1960 's , cerebral paragonimiasis was quite prevalent in korea , and treatment of the disease was one of the chief duties of korean neurosurgeons ( 4 ) . since the 1970 's , economic development and improvement of public hygiene have decreased the prevalence of the parasitic disease in korea . cerebral paragonimiasis has been an unfamiliar disease to the general public and to medical community for a long time . however , sporadic cases of paragonimiasis are occasionally observed in korea because of the spread of infested , intermediate hosts into domestic streams and because of the increasing importation of infested crabs from endemic countries ( 5 ) . here , we report the case study of a young patient with cerebral paragonimiasis who presented with intracerebral hemorrhage , an atypical manifestation of the disease . both the rarity of the disease in current domestic medical milieu and the atypical presentation pattern made the diagnosis a challenging task . this case warns clinicians that cerebral paragonimiasis is not an outdated disease and that this forgotten parasitic disease could return because of environmental and social changes in korea . on june 2011 , a 10-yr - old , previously healthy girl visited the emergency room ( er ) because of sudden - onset dysarthria , right facial palsy and clumsiness of the right hand . the motor power of her right hand and arm was classified as grade v , but fine movements of her right hand and fingers were impaired . 1b ) showed acute intracerebral hemorrhage in the left frontal convexity surrounded by edema involving the precentral motor cortex . cerebral angiography was performed , but it did not reveal any vascular abnormalities . an occult vascular malformation or a small arteriovenous malformation ( avm ) compressed by the hematoma were still suspected . in her initial complete blood count ( cbc ) test , white blood cell count was within the normal range ( 8.91 10/l ) but eosinophils comprised 20.0% of total white blood cells ( wbc ) . however , the cbc result was then overlooked . a follow - up appointment with careful clinical and imaging procedures one month after the discharge , no significant changes were detected by the follow - up mri . surgical exploration of the lesion site was planned , but the parents of the patient refused to consent to the operation . two months after the initial onset of symptoms , the patient visited the er again because she developed a partial motor seizure involving right facial twitching and tonic movement of her right hand . she did not take antiepileptic drugs for several days . on a follow - up mri , the size of pre - existing hematoma and the surrounding edema increased ( fig . 2a ) . a bubble - like lesion with rim - enhancement appeared at the posterior aspect of the hematoma ( fig . considering the patient 's clinical course and the progression of the brain lesion , it was strongly suspected the cause of the lesion was due to bleeding from an intra - axial tumor , presumptively of a high grade . however , no hypermetabolism suggestive of malignancy was detected by f - fluorodeoxyglucose positron emission tomography ( fdg - pet ) ( fig . the cyst was located in the middle frontal gyrus just anterior to the precentral gyrus ( fig . the cyst had a tough wall and contained a partially - liquefied hematoma . in the posterior and medial side of the cyst , a reddish friable mass with a clear margin the frozen biopsy of the mass revealed a considerable amount of plasma cells without tumor cells . there were ovoid , asymmetric eggs having thick shells with chronic granulomatous inflammation and heavy eosinophilic infiltration ( fig . upon asking the patient about any prior intake of raw crabs , the patient reported having ingested soybean - sauced freshwater crabs in a restaurant located in bundang - gu , seongnam , korea twice several months ago . further evaluations such as chest ct scans and serum enzyme - linked immunosorbent assay ( elisa ) were performed after pathological diagnosis of paragonimasis to reinforce the diagnosis . the patient had no pulmonary symptoms , but chest ct scans revealed multiple cavitary lesions with irregular walls at the apex of the right upper lobe of the lung ( fig . serum antibody levels corresponding to multiple parasites were measured using an enzyme - linked immunosorbent assay ( elisa ) . the elisa activity for paragonimiasis was 0.359 , higher than the reference limit ( 0.280 ) . in addition , reviewing the cbc test at the first admission , we noticed the abnormally high proportion of eosinophils in peripheral blood . a dosage of 75 mg / kg of praziquantel was administered to the patient for 2 days . the patient was followed - up for 9 months from the operation and did not presented with neurological deficits or seizure attacks . was recommended to her parents and her mother showed a positive elisa result . a cbc test of the mother revealed peripheral eosinophilia ( 7.9% of the total wbc count ) and chest ct scans of the mother also showed multiple cavitary lesions in the left upper lobe ( fig . immediate antihelminthic treatment was recommended , but the mother refused treatment and was lost to follow - up . six months later , the mother visited emergency room for fever , cough , and sputum . on chest x - ray , hydropneumothorax in the left side she received a chest tube insertion procedure and took praziquantel for 4 days . because of recurrent pneumothorax during hospitalization , she received a lobectomy of the involved lung . in the 1950 's and 1960 's , parasite infestation was one of the major public health problems of korea . pulmonary paragonimiasis was rampant because the juice of crushed crayfish was used as a medication for measles ( 5 ) . therefore , cerebral paragonimiasis was the most common " brain tumor " occurring in korean people during the 1950 's and 1960 's ( 3 ) . surgical resection was the only treatment for cerebral paragonimiasis until bithionol was introduced as a chemotherapeutic agent for paragonimiasis in 1962 . in fact , the first hemispherectomy in korean neurosurgery was performed in 1958 on a 21-yr - old male patient with excessive cerebral paragonimiasis ( 4 , 7 ) . since the 1970 's , the prevalence of paragonimiasis has decreased markedly because of nationwide stool exams , mass chemotherapy treatment with bithionol or praziquantel and public education in personal prophylaxis . the incidence of larvae in the intermediate host has also diminished because of the broad spray of pesticides and because the construction of dams has changed the river ecosystem ( 8) . a field study published in 2009 reported that no metacercaria of paragonimus westermani was found in 363 freshwater crabs examined from 6 different localities in the country ( 5 ) . the result in this study implies that the transmission of paragonimus by freshwater crabs is presently very rare in korea . several papers reporting on cerebral paragonimiasis were published in the fields of neurosurgery and neuroradiology in the 1980 's and 1990 's . only a few neurosurgical cases have been reported after 2000 in korea ( 9 - 11 ) . therefore , cerebral paragonimiasis is an unfamiliar disease to the contemporary neurosurgeons and neuroradiologists in korean . the rarity of this disease in contemporary neurosurgical practices and atypical presentation with intracranial hemorrhage made the diagnosis delayed . there may have been many clues for the diagnosis of paragonimiasis , if appropriately asked or sought before the operation : an intake history of raw freshwater crabs , typical symptomatology of partial seizures , peripheral eosinophilia , positive elisa results , and suspicious brain and chest imaging findings . nonetheless , because of the long obsoleteness of this disease entity in the neurosurgical field in korea , the practicing neurosurgeons and neuroradiologists were short of clinical suspicion for the disease . although negative angiography and fdg - pet findings evoked some skepticism about the diagnoses of avm or a high - grade brain tumor , cerebral paragonimiasis was still out of the way in the preoperative diagnosis . on pathological examinations , we found only eggs of paragonimus westermani but no body of worms . therefore , it was possible that the worms were lost by the suction and only inflammatory tissues and some eggs were left for histological examinations . food - borne parasite infestation warrants screening examination for other family members . in this case , the mother of the patient showed evidence of pulmonary paragonimiasis : positive elisa test , peripheral eosinophia , and cavitary lesions on chest imagings . the clinical course of the mother was complicated as she refused antihelminthic treatment in asymptomatic period and later developed serious hydropneumothorax that required surgical resection of the involved lung lobe . wild freshwater crabs are produced more than before because of improved conservation of the river ecosystems of korea ( 5 ) . also some wildlife reservoirs are keeping this worm in the nature . in addition , cultured freshwater crabs from china where paragonimiasis is still endemic are distributed in markets ( 12 ) . the restaurants serving soybean - sauced freshwater crabs are gaining popularity recently ( 13 ) . it is concerned that environmental alterations and life - style changes can induce resurgence of this formerly prevalent infectious disease .

paragonimiasis is caused by ingesting crustaceans , which are the intermediate hosts of paragonimus . the involvement of the brain was a common presentation in korea decades ago , but it becomes much less frequent in domestic medical practices . we observed a rare case of cerebral paragonimiasis manifesting with intracerebral hemorrhage . a 10-yr - old girl presented with sudden - onset dysarthria , right facial palsy and clumsiness of the right hand . brain imaging showed acute intracerebral hemorrhage in the left frontal area . an occult vascular malformation or small arteriovenous malformation compressed by the hematoma was initially suspected . the lesion progressed for over 2 months until a delayed surgery was undertaken . pathologic examination was consistent with cerebral paragonimiasis . after chemotherapy with praziquantel , the patient was monitored without neurological deficits or seizure attacks for 6 months . this case alerts practicing clinicians to the domestic transmission of a forgotten parasitic disease due to environmental changes .

it 's known that 230,000 cases of prostate cancers are reported annually in america , with 27,000 of them are leading to death . in 1960 , brachytherapy is one of the common radiotherapy modalities applied for treatment of cancer . in this method , one of the aims of radiotherapy is to irradiate the tumor with a lethal dose , while minimizing the radiation dose received by the surrounding normal tissues . one option for treatment of prostate cancer is the use of low energy brachytherapy sources such as i and pd . recently , cs radionuclide has been introduced as a brachytherapy source [ 5 , 6 ] . having a uniform dose distribution inside the tumor to minimize the quantity of hot / cold spots is an advantage in prostate brachytherapy using interstitial implants . the doses to other healthy tissues outside the tumor should be decreased to the minimum amounts . the dose to the sensitive organs should not exceed their tolerance levels . in various studies , i , pd , yb , and ir brachytherapy sources were evaluated in prostate brachytherapy [ 2 , 4 , 8 , 9 ] . it should be noted that in addition to i and pd brachytherapy sources , there are also high - dose - rate ( hdr ) radionuclides ( ir ) that are routinely used in prostate brachytherapy . i and cs have the same energy spectrum , and their average energies are 28.37 and 30.45 kev , respectively . this results to lower dose to the organs at risk such as rectum and urethra , on the other hand , increases the risk of underdosage in the prostate . in contrary , i and cs have extension of dose distributions to larger distances , and this results to deliver more dose to the organs at risk for a given prostate dose . however , with these sources , there is a lower probability of cold spots in the prostate . generally , studies have reported that i , pd , and cs radionuclides are used , in addition to prostate , for treatment of tumors in lung , brain , breast , and eye [ 3 , 4 , 5 , 6 , 7 ] . in order to simplify and speed up the calculations , dose distributions can be calculated more accurately by monte carlo codes such as mcnp , egs4 , and geant4 . zhang et al . simulated a prostate model as a sphere with radius of 1.5 cm , while forty eight i sources were defined within the prostate . then isodose curves were obtained for prescribed doses of 108 , 144 , 145 , and 160 gy on the target volume . their results demonstrated that the variseed treatment planning system ( varian medical systems , inc . , palo alto , ca , usa ) has 29% and 136% larger dose coverage than the monte carlo simulation with 150% and 200% isodose lines , respectively . this was due to the simplification of the seed characteristics using a point source approximation and neglecting inter - seed attenuation in this treatment planning system . 64 of american association of physicists in medicine ( aapm ) suggests that technical innovations , image - based planning , computerized dosimetry analysis , and improved quality assurance have important roles in modern prostate brachytherapy . this task group has been also committed to summarize the knowledge in various aspects in prostate brachytherapy including treatment planning , dose specification , and reporting . it recommends practical guidelines for the clinical medical physicist community and identifies issues for future investigation in this field . the details on physical aspects and the related issues in prostate brachytherapy can be found in this report . heintz et al . evaluated physical and dosimetric characteristics for various i sources in prostate brachytherapy . their assessment was performed on the differences in designs , construction , and dosimetric characteristics of each source and the results were compared with those of an amersham 6711 source model ( amersham , little chalfont , uk ) . this led to present a simple equation that can be used clinically to convert the standard strength of 6711 source to an equivalent strength of a new brachytherapy source . in a study by meigooni et al . , the effect of the dosimetric differences of i and pd sources were evaluated within the scope of their clinical applications . the quantitative and qualitative evaluations were performed via comparisons of dose distributions and dose volume histograms in prostate implants with various designs of the i and pd sources . the comparisons were with identical implant scheme including the same number of seeds for each source . the results were compared with the amersham 6711 i and the theragenics 200 pd seeds ( theragenics corporation , buford , georgia , usa ) . there was no significant difference between the dose distributions of the new designs of i and pd sources in a typical prostate implant compared to the i and pd reference sources . however , this plan needs to be evaluated for any new design of brachytherapy source . while various studies have been performed on dose distribution evaluation in prostate brachytherapy , to the best of our knowledge , there are not any study on dosimetric assessment and comparison of i , pd , and cs sources with the same geometries in interstitial prostate brachytherapy . the aim of the current study is to compare dose distributions of i , pd , and cs sources in interstitial prostate brachytherapy . additionally , the use of cs radionuclide as a hypothetical source in interstitial prostate brachytherapy is evaluated . in this study , a mills biopharmaceuticals prostaseed i source ( model 125sl ) ( oklahoma city , usa ) has been simulated . the validation of this source simulation was performed in a previous study on this source model . in the present study , all the simulations were performed using a monte carlo n - particle transport code ( mcnpx , version 2.6.0 ) . mcnpx code was developed by los alamos laboratory , and is used worldwide for transport of various types of particles in nuclear physics and medical physics applications . the prostaseed i source ( core oncology , santa barbara , us ) is composed of five silver spheres , on which radioactive i radionuclide was coated superficially . these spheres are placed in a titanium capsule having side walls with thickness of about 0.05 mm . the external length of the capsule is 4.5 mm and its external diameter is 0.8 mm . the titanium capsule has thickness of 0.3 mm on both end welds of the source . the geometry of the source model , including dimensions as well as the compositions of materials is shown in figure 1 , [ 2 , 15 ] . the hypothetical pd and cs sources were simulated and used for prostate brachytherapy simulations in this study with geometries based on the commercially available prostaseed i source ( model 125sl ) . however , in the hypothetical pd and cs sources , the active cores were replaced by pure pd and cs radionuclides , respectively . the photon spectra used in the simulations of these sources are based on previous studies on the sources : rivard et al . for i , rivard for pd , and rivard for cs , which are presented in table 1 . using these spectra the photon yields for the i , pd , and cs are : 1.4757 , 0.7714 , and 0.8138 photons / dis , respectively . probable electron emissions ( auger , conversion , etc . ) by these radionuclides were not considered , since they are absorbed in the source 's capsule due to their low energy and have not considerable effect on the dose in the phantom . a schematic figure of the iai i brachytherapy source indicating dimensions and materials photon energy spectrum for i , pd , and cs brachytherapy sources with the same procedure as the study by ghorbani et al . , monte carlo simulations of the prostate tumor and brachytherapy source implants were performed . the prostate was considered as a sphere with radius of 1.5 cm and forty - eight sources were distributed within the prostate . a schematic geometry indicating the distribution of the sources , prostate and the surrounding phantom is illustrated in figure 2 . the prostate was composed of four - element soft tissue , which was presented by international commission on radiation units and measurement ( icru ) report no . , soft tissue has four elements with weight fractions as follows : 76.2% oxygen , 11.1% carbon , 10.1% hydrogen , and 2.6% nitrogen . the normal tissue was defined as the surrounding medium ( phantom ) and was composed of four - component soft tissue in the form of a sphere with radius of 25.0 cm . a sphere composed of air with radius of 150.0 cm around the soft tissue phantom the forty - eight sources were distributed in the volume of the tumor in such an arrangement that included eight arrays of sources , each array included six sources . the sources arrays were placed symmetrically on a circle with 1.2 cm radius in the prostate ( figure 2 ) . it should be noted that by alignment of six sources having distances between each other , especially on the peripheral regions , some of them are located outside the prostate . this arrangement is optimum to have a suitable dose distribution in the prostate and it is routine in clinical practice of prostate brachytherapy . the arrangement of the sources and tumor was similar to those used in the previous studies on prostate brachytherapy [ 2 , 11 ] . the distributions of the i brachytherapy sources and hypothetical pd and cs sources were similar to each other . a ) transverse cross section , b ) longitudinal cross section type 1 mesh tally ( using pedep option ) was used to score the photon doses in this step . the use of this tally type and this option in mcnp equals to application of f6 tally , which scores kerma . kerma can be used as an approximation for absorbed dose calculation in the positions where there is electronic equilibrium . it can be mentioned that electronic equilibrium exist at distances , which are not in the close vicinity of the source . this mesh included 2 mm 2 mm 2 mm voxels , in which the value of tally was scored . energy cut off for photon and electron was 10 kev in the monte carlo input programs . except for the energy cut - off , no other variance reduction technique was used in the above mentioned simulations . in the monte carlo programs , a photon source was defined , while both photons and electrons were transported and the photon tally was scored for the purpose of calculation of photon dose . this leads to transport of various photon interactions and scoring primary and secondary particles including photons and electrons . a number of 2.0 10 , 2.0 10 , and 2.0 10 photons were run in each input file for the i , pd and cs , respectively . the type a statistical uncertainties of all monte carlo calculations were less than ( or equal to in one case ) 2.30% in these programs . absolute and relative doses were calculated for this configuration in various points inside and outside the tumor on the central transverse ( y ) and longitudinal ( z ) axes . the transverse and longitudinal data were extracted from the 2d dose distribution matrix obtained from the above described mesh tally . in relative dose calculations , dose values were normalized on dose on the surface of prostate ( at 1.5 distance ) on the transverse axis . dose profiles were obtained on y and z axes for the sources in terms of cgy/(h.u ) . isodose curves of 10% , 30% , 50% , 100% , and 150% were plotted while the prescribed dose was at the point located at distance of 1.5 cm from the center of the tumor on the y - axis ( on the surface of the prostate ) . the dose at this point was considered as the reference dose and the relative doses were calculated as the ratio of dose relative to the dose at this point . it is obvious that the doses at this point were different for the i , pd , and cs sources , and for each source the dose at this point with the same source was considered as the reference . therefore , the contour of 100% covered the surface of the prostate . finally , the transverse and longitudinal dose profiles , isodose curves for the sources were compared . advantages and disadvantages of the sources were discussed from dose distribution aspects for use in interstitial prostate brachytherapy as well . figure 3 ( part a and b ) illustrate dose profiles ( cgy/(h.u ) ) determined by the cumulative dose distribution from the multi - seed implant simulations for the i , pd , and cs sources in the transverse and longitudinal axes , respectively . dose profiles ( cgy/(h.u ) ) for the i , pd , and cs sources in prostate brachytherapy . ( a ) transverse axis , ( b ) longitudinal axis isodose curves including 10 - 150% contours are plotted in figure 4 . the contours are located inside and outside the prostate tumor , and are plotted for the i , pd , and cs sources . in this figure , the dotted and dashed lines are related to pd , and cs sources , respectively . doses were normalized to the dose on the tumor surface . in order to have better comparisons , each part in this figure illustrates the dose distribution for two sources . from the top to the bottom , the curves are related to the i and pd sources ( part a ) , i and cs sources ( part b ) , and pd and cs sources ( part c ) , respectively . eight circular contours around the sources are isodose contours of 150% . in these simulations , the prostate was defined as a sphere with radius of 1.5 cm and forty - eight sources of each type were distributed in the prostate volume separately . isodose curves including 10% , 30% , 50% , 100% , and 150% contours inside and outside the prostate tumor , for ( a ) i and pd sources , ( b ) i and cs sources , ( c ) pd and cs sources . solid contours represent those of i source , dotted lines represent pd source isodose , and dashed lines represent cs source isodose figure 5 presents percentage differences between the relative dose values for the i , pd , and cs source implants . in this figure , from the top to the bottom , percentages differences are related to the i and pd sources ( part a ) , i and cs sources ( part b ) , and pd and cs sources ( part c ) , respectively . absolute dose differences ( % ) between the three sources.(a ) between the i and pd sources , ( b ) between the i and cs sources , ( c ) between the pd and cs sources . in this study , a prostaseed i source and two hypothetical pd and cs brachytherapy sources were simulated with the same geometry of the prostaseed i source . then comparison of y and z axes dose profiles and dose distributions for the sources inside and outside the tumor was performed in interstitial prostate brachytherapy . for the purpose of comparison of various radionuclides in prostate brachytherapy , not only dosimetric and treatment planning aspects but also zhang et al . in a systematic review , compared the effectiveness and adverse effects in 1406 patients with prostate cancer treated with i and pd brachytherapy sources . their results have shown that after one or six months following the treatment , there were differences between the adverse effects in the patients treated with i or pd sources . however , it was not found significant difference in adverse effects between the i and pd groups , following 12 months after source implantation . finally , it was reported that the effects of brachytherapy with i and pd sources for low risk prostate radiotherapy are similar . determined normal tissue complication probability for urethra in three prostates patients implanted with i , pd , cs , pd - i , or pd - cs seeds . the large uncertainties in the fitting parameters in the modeling of the urethral normal tissue complication probability , resulted in large uncertainty on this probability value . therefore , it was announced that application of a model for normal tissue complication probability in permanent brachytherapy is possible , but it is necessary to minimize the uncertainties in the parameters in this model . as it can be seen in figure 3 ( dose profiles in terms of cgy/(h.u ) in the transverse and longitudinal axes ) , the results show that the dose distribution in terms of cgy/(h.u ) are quite different with the i , pd , and cs sources . since the same geometries were defined with these sources , this effect is due to the differences in photon energy spectra , and photon yields ( number of photons per disintegration ) of these sources . these differences are incorporated in calculation of air kerma strength ( in terms of u ) and therefore have their effect on dose distribution in terms of cgy/(h.u ) . since tg-43 proposed air kerma strength for characterization of the source strength instead of activity , presentation of dose rate in terms of cgy/(h.u ) are of relevance in dose calculation and optimization in treatment planning in prostate brachytherapy . therefore , based on interpretation of the results in cgy/(h.u ) as the reference results ( based on the recommendations of tg-43 ) , cs , i , and then pd has higher dose rates per u inside and outside the tumor , respectively . this will be accounted as an advantage of cs over the others , however , the higher dose outside the tumor with this source is a disadvantage . in other words , from clinical and radiobiological point of view , a higher dose by cs source will reduce the likelihood of cold spots inside the prostate . on the other hand , this is with the cost of higher dose to organs at risk ( rectum and urethra ) for a given prostate dose . a higher dose to organs at risk will increase the risk of rectal and urethral complications with this source . considering figure 4 ( part a ) , generally speaking , there is no significant difference in hot / cold spots for various sources . when one considers figure 4 , with an accurate assessment of 10% isodose lines , it can be evident that i source presents a more suitable dose relative to cs this is due to the fact that 10% isodose line for i is more internal than that for cs . this manner for i is advantageous than cs in terms of reduction of dose to the around oar . as can be seen in figure 4 ( part b ) , using pd source , dose decreases outside the tumor faster than i source . these isodose lines are more internal for pd than the i ones , which indicates less dose delivery to outside the tumor . this is mentioned in some extent as an advantage of i source . regarding little difference between the 100% isodose lines for these two sources , it can be claimed that using pd is more beneficial than i. as it can be seen in figure 4 ( part c ) explicitly , 10% , 30% , and 50% isodose lines of pd are more internal relative to cs cold spots . additionally , considering 100% isodose lines for these two sources , it can be concluded that the 100% isodose line for cs is more internal . as it is demonstrated in figure 5 , with increase in the distance from the source , the percentages differences between the two - source cases become larger . for distances greater than about 2 cm with i - pd and there is also an increasing trend of dose differences for pd - cs source comparisons with increase in distance from the center of prostate in other words , absolute dose is smaller at larger distances , and when the dose differences are divided to a smaller dose value at larger distances , the relative dose increases . as another effect , as it can be seen from figure 5 , the percentage relative dose differences for i - pd and i - cs are smaller than the pd - cs sources . this can be related to the differences in photon energy spectra , photon yields , and in - phantom photon attenuations for these three sources . since in the current study cs radionuclide in the studied form was proposed as a hypothetical source in brachytherapy , based on assessment of its isodose curves and longitudinal and transverse dose profiles relative to i and pd brachytherapy sources , it can be concluded that cold spots for the hypothetical cs source are more external than the other two sources , which may be disadvantageous for cs . this is due to the organs at risk around the tumor receives higher dose relative to the other two sources . comparing hot spots for hypothetical cs source with pd and i brachytherapy sources , there is no significant difference . therefore , it can be claimed that cs have no significant difference with the other two sources in terms of distribution of hot spots . actually , 100% isodose lines for hypothetical cs source are more internal than the pd and i brachytherapy sources . this effect indicates that cs delivers higher dose to the tumor relative to the other two sources , which can be reported as an advantage of using the cs source in brachytherapy . another consideration for these sources is that they are used as permanent implants in prostate brachytherapy . in this modality , the prescription dose is the criteria and is calculated as the total dose during the presence of the implants inside the tumor . in this case , the total dose is calculated as 1.44 half - life initial dose rate ( cgy / h.u ) . in this study , the initial dose rates for these sources were obtained from the monte carlo simulations . therefore , while having the number of seeds ( 48 seeds ) , air kerma strength for each source , half - life of each radionuclide , and the initial dose rates , it is possible to calculate the total dose . in the above sections only initial dose rates were as the criteria for comparison of the sources . as examples , initial dose rate per air kerma strength on prostate in the transverse axis for the cs , i , and pd sources are 0.54 cgy/(h.u ) , 0.43 cgy/(h.u ) , and 0.32 cgy/(h.u ) , respectively . the corresponding values for these sources on the longitudinal axis are 0.32 cgy/(h.u ) , 0.25 cgy/(h.u ) , and 0.15 cgy/(h.u ) , respectively . it is obvious that with the same number of seeds and initial air kerma strengths , the half - life will have effect on the total dose . the half - lives of the i , pd , and cs sources are 59.40 days , 16.991 days , and 9.7 days , respectively . with these half - lives , while having the same number of seeds and initial air kerma strengths , i will have a higher total dose due to its longer half - life . in the above discussions , the initial dose rates were the criteria , however , based on the total dose the i source has advantage over the others for example it was considered the prostate shape as a symmetric sphere but we know that it is not the true shape in reality . it is suggested that the evaluation of this study with more real treatment plans in terms of the asymmetric prostate shape and presence of urethra in this organ asymmetrically . in routine brachytherapy practice , a comparison of dose volume histograms by these sources in prostate brachytherapy can be a subject of further research in this field . it is obvious that since all of these sources are not available clinically with the same treatment planning system , this subject can be performed via monte carlo simulation of these sources . this is beneficial to have comparison between these sources with the same conditions and the dose differences are related to the radiation characteristics of these sources . on the other hand , a comparison of these sources with their own commercially available geometries can be a subject of further research in this field . in the current study a number of simplifications were used in definition of the geometry of phantom and sources . additionally , in order to have a precise comparison between various radionuclides , the geometries of pd and cs sources were considered the same as the prostaseed i source . in other words , the comparison of these sources could be completed doing the measurements with real sources in an anthropomorphic phantom , and with this work there may be very interesting parameters for decision about the correct source for application in brachytherapy treatment . implication of these issues on the study design and subsequent source comparisons can diminish the accuracy of the results , and these effects can be subjects for future researches . considering the transverse and longitudinal dose profiles and isodose contours for the i , pd , and cs source in interstitial prostate brachytherapy indicates that with the same geometries , these sources have different dose distributions . therefore , based on the results in cgy/(h.u ) as the reference ( in accordance with tg-43 recommendation ) , a comparison of dose distributions of these three sources indicates that , with the same time duration and air kerma strength , it is possible to deliver a higher dose to the prostate volume with the cs source . however , relative dose rate inside the tumor is higher and outside the tumor is lower for the pd source . pd has more rapid dose falloff outside the tumor , which can be beneficial for the normal tissues outside the tumor . additionally , the results show the dose distribution in terms of cgy/(h.u ) are quite different and this should be considered in clinical applications of prostate brachytherapy . while having the same number of seeds and initial air kerma strengths , i will have a higher total dose due to its longer half - life . therefore , based on the total dose , the i source has advantage over the others .

purposelow energy sources are routinely used in prostate brachytherapy . 125i is one of the most commonly used sources . low energy 131cs source was introduced recently as a brachytherapy source . the aim of this study is to compare dose distributions of 125i , 103pd , and 131cs sources in interstitial brachytherapy of prostate.material and methodsprostaseed 125i brachytherapy source was simulated using mcnpx monte carlo code . additionally , two hypothetical sources of 103pd and 131cs were simulated with the same geometry as the prostaseed 125i source , while having their specific emitted gamma spectra . these brachytherapy sources were simulated with distribution of forty - eight seeds in a phantom including prostate . the prostate was considered as a sphere with radius of 1.5 cm . absolute and relative dose rates were obtained in various distances from the source along the transverse and longitudinal axes inside and outside the tumor . furthermore , isodose curves were plotted around the sources.resultsanalyzing the initial dose profiles for various sources indicated that with the same time duration and air kerma strength , 131cs delivers higher dose to tumor . however , relative dose rate inside the tumor is higher and outside the tumor is lower for the 103pd source.conclusionsthe higher initial absolute dose in cgy/(h.u ) of 131cs brachytherapy source is an advantage of this source over the others . the higher relative dose inside the tumor and lower relative dose outside the tumor for the 103pd source are advantages of this later brachytherapy source . based on the total dose the 125i source has advantage over the others due to its longer half - life .

from september 2008 to september 2011 , we collected blood samples from 136 kiso horses , which represent 91% of all the horses registered with the kiso horse conservation association . the horses were bred in the mountainous region of central japan : mainly in nagano , gifu and aichi prefectures . within the surveyed horses , 17 were males , 102 were females , and 17 were geldings . after the sample was transferred to an edta blood collection tube , it was promptly taken to the laboratory , and the dna was extracted using the wizard dna extraction kit ( promega kk , tokyo , japan ) . the 411-bp reference sequence of the mtdna d - loop region between positions 15,437 and 15,847 from each horse was sequenced using the following primers ; forward : 5 ctagctccaccatcaacacc-3 , reverse : 5-atggccctgaagaaagaacc-3. using the geneamp kit ( applied biosystems , lifetechnologies co. , carlsbad , ca , u.s.a . ) , a total of 15 l of the reagent containing 20 ng of a dna template , 15 pmol primer set , 2.5 mm mgcl2 , 0.33 mm dntps , 1.5 l of 10 buffer and 1.5 u amplitaq gold was subjected to initial denaturation for 10 min at 95c , followed by 30 cycles of pcr ( 30 sec at 94c , 1 min at 60c and 30 sec at 72c ) and final extension for 10 min at 72c . the pcr products were incubated with exonuclease i and shrimp alkaline phosphatase and used as template dna . then , direct sequencing was performed using the big dye terminator v3.1 cycle sequencing kit ( applied biosystems ) . the sequence products were analyzed using an automatic dna sequencer ( abi prism3130xl , applied biosystems ) , and the resulting sequences were processed using sequencing analysis software ( applied biosystems ) . the accuracy of sequencing was determined using sequencing scanner v1.0 ( applied biosystems ) . variation of each haplotype was confirmed using multiple alignments by clustal x . to estimate the demographic history of the kiso horse , we used the basic local alignment search tool ( blast ) of national center for biotechnology information ( ncbi ) and searched for homology between the obtained sequences and known sequences . using arlequin , we also performed mismatch analysis to estimate the mutation processes . we then used molecular evolutionary genetics analysis ( mega ) software to build a phylogenetic tree , which shows the relationship of the mtdna haplotypes for 24 horse breeds around the world [ 7 , 14 , 16 , 20 , 23 , 32 ] , including przewalskii ( table 1table 1.the accession numbers of the haplotypes in 24 horse breeds analyzed for phylogenetic relationship with the haplotypes in the kiso horsepopulationno . of haplotypesaccession numberabbreviationgeographical regionakhal - teke8dq327950 , dq327953 , dq327956 - 60 , dq327962at1 - 8west asiaarabian15af064628 - 9 , ef437553 - 62 , ef437564 - 6are1 - 15west asiabelgian3af064630 - 2bel1 - 3europebreton2ab329597 , ab329617brt1 - 2europecheju7af014405 - 8 , af014410 - 12cj1 - 7east asiahokkaido3ab329589 , ab329596 , ab329620hkd1 - 3japanhucul12jf951834 - 7 , jf951840 - 7hcl1 - 12europeicelandic14hq153701 , hq153711 - 2 , hq153715 , hq153719 , hq153722 - 6 , hq153728 , hq153753 - 4 , hq153757icl1 - 14europeirish draught30dq327892 , dq327898 - 900 , dq327902 , dq327904 - 6 , dq327909 - 10 , dq327912 , dq327915 - 6 , dq327918 - 21 , dq327923 , dq327925 - 28 , dq327933 - 36 , dq327938 , dq327944 - 5 , dq327948id1 - 30europekiso*3ab329600 , ab329626 - 7ks1 - 3japanmisaki1ab329624mskjapanmongolian19af014413 - 5 , af056071 , dq327986 - 7 , dq327989 - 92 , ab329587 , ab329592 , ab329604 , ab329606 , ab329618 , ab329622 - 3 , ab329625 , ab329628mng1 - 19east asianoma2ab329591 , ab329609nm1 - 2japanorlov trotter9dq328002 - 5 , dq328007 , dq328012 - 3 , dq328015 , dq328018ot1 - 9north asiapercheron2ab329603 , ab329619pcr1 - 2europepottoka10ay519958 - 67pot1 - 10europeprzewalskii2ap012267 , ap012269prw1 - 2taishu2ab329588 , ab329614 , af169009 - 10ts1 - 4japanthoroughbred18ab329590 , ab329593 - 5 , ab329599 , ab329601 - 2 , ab329605 , ab329607 - 8 , ab329610 - 3 , ab329615 , ab329621 , d14991 , d23665trb1 - 18europetibetan3ef597512 - 4tb1 - 3east asiatokara1ab329598tkrjapanvyatka10dq328020 - 4 , dq328026 , dq328028 , dq328034 - 5 , dq328037vyt1 - 10north asiayakutian13dq328038 - 40 , dq328042 - 5 , dq328050 , dq328052 - 4 , dq328056 - 7yk1 - 13north asiayunnan1af014416yneast asia * from kakoi , h. et al . ) . the statistical reliability of each node within this phylogenetic tree was confirmed by 1,000 random bootstrap replicates . * from kakoi , h. et al . to assess the diversity of current maternal lineage in the kiso horse , we classified the resulting sequences and calculated the haplotype diversity ( h ) and nucleotide diversity ( ) using arlequin . the relationship among haplotypes was visualized by a median - joining network using network 4.6.0.0 ( http://www.fluxus-engineering.com . suffolk , u.k . ) . to predict future change of the diversity of maternal lineage in kiso horse according to the results of analysis of the d - loop region ( 411 bp of 136 kiso horses ) , we confirmed that the kiso horse has 7 haplotypes ( k1k7 ) , namely haplotypes k1 , k2 , k3 , k4 , k5 , k6 and k7 . forty horses ( 29.4% ) had k1 , 33 horses ( 24.3% ) had k2 , 28 horses ( 20.6% ) had k3 , 19 horses ( 14.0% ) had k4 , 9 horses ( 6.6% ) had k5 , 6 horses ( 4.4% ) had k6 , and 1 horse ( 0.7% ) had k7 . when we compared these results with the reference standard x79547 , there were 25 polymorphic sites in the corresponding genomic region of the kiso horse ( table 2 table 2.the mitochondrial dna d - loop region of haplotypes k1-k7 in the kiso horse compared with the reference sequence x79547 ) . these 25 mutations were all point mutations between identical types of bases showing significant deviation that occurs between transversion and transition in the course of evolution of mtdna in mammals , and the analyzed region was a / t rich ( a : 30.3% , t : 27.7% , c : 28.5% and g : 13.5% ) ; this finding correlates with the findings of previous report on equine species . according to the blast results , the 6 haplotypes , k1 , k2 , k4 , k5 , k6 and k7 , correlated with ab329626 ( kiso horse - derived h46 ) , ab329627 ( kiso horse - derived h47 ) , ab329588 ( taishu horse - derived h2 ) , ab329600 ( kiso horse - derived h14 ) , ab329589 ( hokkaido horse - derived h3 ) and ab329604 ( mongolian native horse - derived h18 ) , respectively . there were no sequences , however , that matched k3 , suggesting that k3 is a new sequence in terms of evolution . in the mismatch analysis , sequence differences ranged from 1 to 14 bp , showing a bimodal distribution with a major peak at 0 mutational differences and a secondary one at 12 mutational differences ( fig . the number of pairs with nucleotide site differences is labeled on the top of each bar . the number of pairs with nucleotide site differences is labeled on the top of each bar . the h in the kiso horse was 0.79 0.01 ( mean sd ) , while was 0.017 0.009 . the number of nucleotide mutations among the haplotypes ranged from 1 ( between k1 and k2 and between k4 and k6 ) to 14 ( between k3 and k5 ) , and the distance between bases ranged from 0.002 to 0.036 . according to the median - joining network , which visualizes this information , k1 and k2 as well as k4 and k6 form a group ( each pair ) ; this result shows that the mtdna d - loop haplotypes of the kiso horse were divided into 4 clusters ( fig . the relationship between the kiso horse haplotypes and the haplotypes of horse breeds worldwide was elucidated in the neighbor - joining tree ( fig . 3fig . 3.neighbor-joining phylogenetic relationships between 7 haplotypes of the kiso horse and the haplotypes of other 24 breeds . the branched numbers represent bootstrap probability ( 1,000 replicates ) , and the letters a the 7 haplotypes of the kiso horse k1 , k2 , k3 , k4 , k5 , k6 and k7 were distributed in clusters f , f , c , e , b , e and c , respectively . neighbor - joining phylogenetic relationships between 7 haplotypes of the kiso horse and the haplotypes of other 24 breeds . the branched numbers represent bootstrap probability ( 1,000 replicates ) , and the letters a with regard to the regional distribution of each haplotype , the distribution of the haplotype was different in each prefecture . in nagano prefecture , main breeding region of kiso horse , there were k1 ( 28 horses ) , k3 ( 24 horses ) , k2 ( 15 horses ) , k4 ( 7 horses ) , k5 ( 4 horses ) , k6 ( 3 horses ) and k7 ( 1 horse ) in decreasing order . then , the distribution in gifu prefecture in decreasing order was k2 ( 11 horses ) , k4 ( 7 horses ) , k1 ( 5 horses ) , k6 ( 3 horses ) , k3 ( 2 horses ) and k5 ( 1 horse ) . the distribution in aichi prefecture in decreasing order was k1 ( 6 horses ) , k5 ( 3 horses ) and k4 ( 2 horses ) ( fig . the figures within the graph represent the number of horses for each haplotype . ) . in this study , we attempted to elucidate the genetic characteristics of the kiso horse by looking at the genetic diversity of the maternal lineage . our research provided compelling suggestions about the demographic history , the current maternal lineage diversity and prediction about its future changes . this is because approximately 6,000 years ago , many horses that inhabited eurasia were caught and domesticated , and the descendants of those horses rapidly spread throughout the world . the fact that k1k7 are categorized into various clusters shows that the kiso horse also has various ancestors . in addition , although k3 and k5 are haplotypes confirmed only in the kiso horse , we were able to confirm that haplotype k1 is present in arabian horse ; haplotype k2 is present in the mongolian native horse ; k4 is present in the taishu horse ( japanese native ) , misaki horse ( japanese native ) and mongolian native horse ; k6 is present in the hokkaido horse ( japanese native ) ; and k7 is present in the asian and european breeds of horses . furthermore , mismatch analysis showed bimodal distribution , which suggests reconvergence of the populations . these results may support the information on the demographic history of the kiso horse obtained from various studies of proteins and nuclear dna and from archeological researches , that is , a ) horses with various roots entered the japanese archipelago from areas , such as the mongolian grasslands , and then stayed in kiso , and these horses became the ancestors of the kiso horse , and b ) in the various eras , mares were brought in kiso area from other regions of japan , and the kiso horse breed was improved in accordance with the region and/or the era [ 12 , 21 , 22 , 29 ] . second , we would like to discuss the current diversity of the maternal lineage in the kiso horse . the kiso horse has 7 haplotypes that were divided into 4 clusters . in this study , because we were able to collect samples from 91% of the entire population of this breed , we were able to identify more haplotypes including a new one than those identified in previous report . unfortunately , the 28-year - old mare with the k7 haplotype died immediately after the survey ; therefore , haplotype k7 has disappeared from the kiso horse population . however , the number of haplotypes in the remaining kiso horses is smaller than those in the lusitano ( 27 haplotypes ) , lipizzan ( 37 haplotypes ) and arabian horses ( 27 haplotypes ) , but greater than those in the iberian , south american and north american horses ( 26 haplotypes ; mean 3.8 ) . furthermore , if we keep in mind the sorraia horse , which is also endangered with a similar size of the population as the kiso horse has only 2 haplotypes , the number of haplotypes in the kiso horse is by no means small . in addition , h in the kiso horse is 0.79 0.01 , which is slightly lower than that in the thoroughbred and breton horses ( 0.89 and 0.88 , respectively ) . also , in the kiso horse is 0.017 0.009 , which is similar to that in the mongolian native ( 0.021 ) , thoroughbred and breton ( 0.020 ) and percheron ( 0.014 ) horses . given that ranges from 0.000 to 0.104 in different breeds , with a mean of 0.0104 [ 14 , 18 , 19 ] , in the kiso horse is considered an average level . these data show that although the kiso horse has only a small population , the genetic diversity of the maternal lineage is comparatively preserved . third , we would like to predict future changes of the maternal lineage in the kiso horse . interestingly , although we did not find regional differences in microsatellite dna distribution in the previous study , the mtdna d - loop region haplotype exhibited different distribution in each prefecture . the kiso horse , which experienced a bottleneck in 1970s , was almost exclusively bred within nagano prefecture until the 1980s , and later , kiso horse enthusiasts in various regions began breeding this horse until the present day . therefore , it is thought that there was a founder for the maternal lineage in each region , and colonies were formed in each region mainly with that founder . in addition to this regional isolation and artificial factors [ 15 , 34 ] , there has been a decline in the number of private owners , because of aging , together with the increasing number of zoological parks and equestrian clubs keeping the kiso horses in herds of several animals . this trend , bringing a biased - breeding for a specific use of the horse and/or the preference of a limited number of breeders keeping horses in herds , is suggested to accelerate the deviation of haplotypes of each region and the decline in the diversity of the maternal lineage . in this study , we attempted to understand the kiso horse population on the basis of the diversity of the maternal lineage . the results clearly show that the genetic diversity of the maternal lineage in the kiso horse has been maintained reasonably well . nevertheless , the population is still small , and thus , the kiso horse may be in the extinction vortex : when the population becomes small , and that such decline could accelerate loss of their genetic diversity , while inbreeding will progress further . moreover , various genes of the kiso horse have been fixed because of the past population bottleneck , and those genes are considered to include the genes that bring about inbreeding depression . furthermore , as suggested in this study , it is possible that diversity of maternal lineage of kiso horse which was preserved by traditional manner of breeding will be decreasing . consequently , to preserve the kiso horse for our next generation , the following key vital measures should be taken , that is , i ) clarify the genetic characteristics of the kiso horse from various perspectives , ii ) use reproductive technologies to preserve sperm and zygotes , iii ) search for new ways to utilize the horses , thereby inspiring demand to breed the kiso horse and iv ) take action aimed at gathering national support for conserving our unique genetic resource and living cultural asset of the region .

abstractto determine genetic characteristics of the maternal lineage of the kiso horse based on polymorphisms of the mitochondrial dna d - loop region , we collected blood samples from 136 kiso horses , 91% of the entire population , and sequenced 411 bp from 15,437 to 15,847 in the region . first of all , we estimated the demographic history ; by searching homology between the obtained and known sequences using basic local alignment search tool , by mismatch analysis to evaluate the mutation processes using arlequin , and by building a phylogenetic tree showing the relationship of the mtdna haplotypes for 24 horse breeds around the world using molecular evolutionary genetics analysis softwear . the results suggested that various horses that came to japan stayed at kiso region and became ancestors of kiso horse and also genetically supported the theory that the kiso horse was historically improved by other japanese native horse breeds . next , we analyzed the diversity of current maternal lineage by classifying the resulting sequences , and by calculating the haplotype diversity and nucleotide diversity using arlequin . then , we visualized the relationship among haplotypes by a median - joining network using network 4.6.0.0 . the results suggested the diversity of maternal lineage in the kiso horse was reasonably maintained . lastly , we predicted future change of the diversity of maternal lineage in kiso horse by assessing the regional distribution of the acquired haplotypes . the distribution suggested that diversity of maternal lineage would possibly be reducing .

bladder cancer is the second most common malignancy of all genitourinary tumors in the united states and korea . recurrence of bladder cancer is common , and is reported to occur in 50%-70% of cases , and approximately 10%-15% of patients will experience disease progression . detection of bladder cancer when it is still at an early stage is important for effective treatment , and currently the standard approach in detection of bladder cancer is urethrocystoscopy and urine cytology . urine cytology has a reasonable sensitivity for detection of high - grade bladder cancer ; however , it is restricted in its capacity for detection of low - grade urothelial carcinoma , with sensitivity and specificity of 8.5% and 50% , respectively . unfortunately , biomarkers for bladder cancer that can provide reliable information about diagnosis , progression , and surveillance have not been clearly established . development of a bladder tumor biomarker with high sensitivity and specificity would be a useful adjunct tool for detection or follow - up of cases of bladder cancer . a bladder cancer usually originates from cells lining the bladder transitional cells , which could be exposed to several cytokines during chronic inflammation and dna damage . the urinary bladder is a sac which acts as a reservoir containing metabolites , waste products , and several releasing proteins from the cells . interestingly , it was reported that redox regulating and dna repair protein such as apurinic / apyrimidinic endonuclease 1/redox factor-1 ( ape1/ref-1 ) was increased with occurrence of cancer . ape1/ref-1 is a multifunctional protein involved in both base excision dna repair and transcriptional regulation . there is growing evidence linking heterogeneous ape1/ref-1 expression to a wide range of pathological conditions , including metabolic and differentiation disorders such as cancers . ape1/ref-1 is mainly localized in the nucleus , but cytoplasmic and mixed nuclear / cytoplasmic localization of ape1/ref-1 has been reported in several tumor types . active secretion of ape1/ref-1 into the circulation also occurs in response to lipopolysaccharides or intracellular acetylation , so that it could act as a serologic biomarker . ape1/ref-1 secretion from cells is also supported by the presence of auto - antibody against ape1/ref-1 in blood of lung cancer patients . because tumor biomarkers may originate from tumors or adjacent tissue in response to tumor growth therefore , the aim of the current study was to determine whether serum ape1/ref-1 levels are elevated in bladder cancer patients . the study groups were classified as either non - cancer controls ( n=55 ) , consisting of individuals with no evidence of malignancy , or patients with operable bladder cancer ( n=51 ) . all samples were obtained from the archives of the department of urology , chungnam national university from 2010 - 2011 . this study was approved by the chungnam national university hospital institutional review board , and all participants signed informed consent forms . in the control group , we included patients with benign prostate hyperplasia ( n=22 ) , a urinary tract stone ( n=18 ) , trauma ( n=11 ) , and urethral stricture ( n=4 ) . we excluded patients with chronic or recurrent urinary tract infections , unevaluated gross hematuria , and malignancy . in the bladder cancer group , postoperative histological confirmation of urothelial cell carcinoma , including grade and stage , was recorded . thirty - eight patients underwent transurethral resection of bladder cancer and 13 patients underwent radical or partial cystectomy . blood ( 8 - 10 ml ) was drawn from an antecubital vein in patients with bladder cancer or healthy control subjects using a 22-g needle and placed in a vacuum tube . serum was separated by centrifugation at 3,000 rpm for 10 minutes at room temperature , and then re - centrifuged at 5,000 rpm for 5 minutes to obtain cell - free serum , which was stored in liquid nitrogen until use . the clinical and pathological characteristics of the bladder cancer subjects , which were divided according to nonmuscle invasive bladder cancer ( nmibc ) and muscle invasive bladder cancer ( mibc ) , are shown in table 1 . clinical staging of bladder cancer was performed using cystoscopy , computed tomography , bone scanning , and simple chest radiography . all tumor tissues were analyzed by a single genitourinary pathologist according to a standardized protocol . pathological staging was recorded in accordance with the 2003 tnm classification and the tumors were assigned a grade according to the world health organization classification . tumors were thus classified as ta ( noninvasive papillary carcinoma ) , t1 ( invasive up to the subepithelial connective tissue ) , t2 ( invading the muscle ) , t3 ( invading the perivesical fat ) , and t4 ( invading an adjacent organ ) . tumors were also graded based on the likelihood of recurrence and progression into grade i ( tumors may recur but have only a low risk of progression ) , grade ii ( tumors are more likely to recur and progress compared with grade i ) , and grade iii ( tumors are very likely to recur and progress ) . bladder cancer patients were followed - up , and cystoscopy and urine cytology were performed every 3 months for the first year , every 6 months for the second year , and annually thereafter . recurrence was defined as transitional cell carcinomas with lower or equivalent pathologic stage after treatment . for mibc patients who had undergone partial cystectomy or radiation treatment , reappearance of bladder cancer including ta and carcinoma in situ 96-microwell plates ( nunc , penfield , ny ) were precoated overnight with 100 l of a 1:1,000 dilution of a rabbit anti - ape1/ref-1 antibody ( abcam , cambridge , uk ) in coating buffer ( 0.5 m carbonate buffer , ph 9.6 ) in each well . after blocking with blocking buffer ( 5% bovine serum albumin in phosphate buffered saline [ pbs ] containing 0.05% tween 20 [ pbs - t ] ) at room temperature for 60 minutes , 100 l of sample was added to the wells and the plates were incubated at 4c for 90 minutes , and then washed five times with pbs - t . this was followed by addition of 100 l of a 1:1,000 dilution of mouse anti - ape1/ref-1 antibody ( abcam ) , and further incubation at room temperature for 2 hours . the plate was then washed seven times with pbs - t , and 100 l of horseradish peroxidase conjugated secondary antibody ( 1:5,000 ) was added , followed by incubation at room temperature for 30 minutes . after further washing , 100 l of freshly prepared tetramethyl benzidine substrate was added to the wells . the color development reaction was stopped by addition of 100 l of 2.5 m h2so4 , and the absorbance was measured at 450 nm using an automatic microtiter plate reader ( sunrise xfluor 4 , tecan systems inc . , san jose , ca ) . each sample was assayed in duplicate , and mean values were determined . to establish a standard curve , purified recombinant human ape1/ref-1 ( 1 mg / ml ) was serially diluted ( 5-fold ) and used in a concentration series from 0.16 - 20 ng/100 l . human full length ape1/ref-1 dna was inserted into the pet28b expression vector ( novagen , gibbstown , nj ) , containing a 6-histidine tag for easy purification . pet28b - ape1/ref-1 plasmids were then transformed into the bl21(de3 ) strain of escherichia coli . following induction with isopropyl -d-1-thiogalactopyranoside ( iptg ) , the cells were sonicated in lysis buffer ( 100 mm nacl , 20 mm hepes ) , and the recombinant protein was purified on a nickel - nitrilotriacetic acid agarose column ( qiagen , valencia , ca ) . after washing , the isolated ape1/ref-1 protein was eluted with 250 mm imidazole buffer followed by desalting on a pd-10 column ( amersham pharmacia biotech , liverpool , uk ) in pbs , and frozen in 10% glycerol at 80c . imunohistochemical staining of ape1/ref-1 was determined in paraffin - embedded sections of bladder tissues , which were stored in the tissue bank of chungnam national hospital . tissue specimens were cut into 4-m sections from randomly selected tumor and non - tumor blocks . distant , apparently normal tissue samples from the same patient were used as the non - tumor blocks . a monoclonal antibody against human ape1/ref-1 was used at a 1:600 dilution ( novus biological , littleton , co ) . the sections were lightly counterstained with hematoxylin and mounted using immu - mount ( thermo shandon , midland , canada ) . negative control slides were incubated with the mouse igg1 negative control reagent provided with the kit for evaluation of nonspecific staining . tumor tissues from bladder cancer patients were obtained from the tissue bank of chungnam national hospital . distant , apparently normal tissue samples from the same patient were used as the non - tumor tissues . tissues were suspended in pbs containing protease and phosphatase inhibitors , cut into small pieces , and homogenized using a polytron . the homogenates were centrifuged at 14,000 rpm for 40 minutes and the resultant supernatant fractions were used for immunoblotting . the proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane . after blocking with 5% skimmed milk powder , the blots were incubated with anti ape1/ref-1 antibody ( 1:1,000 , abcam ) . each membrane was stripped and re - probed with an anti glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) antibody to ensure equivalent protein loading . changes in protein levels were quantified by densitometric scanning of the immunoreactive band and normalized against gapdh loading control . a statistical evaluation was performed using a one - way analysis of variance and post - hoc analysis . differences were considered statistically significant if the null hypothesis could be rejected with > 95% confidence interval ( p < 0.05 ) . nonparametric receiver operating characteristic ( roc ) curves were generated by plotting the sensitivity value against the false - positive rate ( 1specificity).we assessed the potential predictive value of ape1/ref-1 for bladder cancer as well specific cancer stages and grades , and recurrence , by calculating the area under the curve ( auc ) . we estimated the sensitivity and specificity of ape1/ref-1 at the optimal cutoff value ( youden index ) to maximize the sum of sensitivity and specificity . the study groups were classified as either non - cancer controls ( n=55 ) , consisting of individuals with no evidence of malignancy , or patients with operable bladder cancer ( n=51 ) . all samples were obtained from the archives of the department of urology , chungnam national university from 2010 - 2011 . this study was approved by the chungnam national university hospital institutional review board , and all participants signed informed consent forms . in the control group , we included patients with benign prostate hyperplasia ( n=22 ) , a urinary tract stone ( n=18 ) , trauma ( n=11 ) , and urethral stricture ( n=4 ) . we excluded patients with chronic or recurrent urinary tract infections , unevaluated gross hematuria , and malignancy . in the bladder cancer group , postoperative histological confirmation of urothelial cell carcinoma , including grade and stage , was recorded . thirty - eight patients underwent transurethral resection of bladder cancer and 13 patients underwent radical or partial cystectomy . blood ( 8 - 10 ml ) was drawn from an antecubital vein in patients with bladder cancer or healthy control subjects using a 22-g needle and placed in a vacuum tube . serum was separated by centrifugation at 3,000 rpm for 10 minutes at room temperature , and then re - centrifuged at 5,000 rpm for 5 minutes to obtain cell - free serum , which was stored in liquid nitrogen until use . the clinical and pathological characteristics of the bladder cancer subjects , which were divided according to nonmuscle invasive bladder cancer ( nmibc ) and muscle invasive bladder cancer ( mibc ) , are shown in table 1 . clinical staging of bladder cancer was performed using cystoscopy , computed tomography , bone scanning , and simple chest radiography . all tumor tissues were analyzed by a single genitourinary pathologist according to a standardized protocol . pathological staging was recorded in accordance with the 2003 tnm classification and the tumors were assigned a grade according to the world health organization classification . tumors were thus classified as ta ( noninvasive papillary carcinoma ) , t1 ( invasive up to the subepithelial connective tissue ) , t2 ( invading the muscle ) , t3 ( invading the perivesical fat ) , and t4 ( invading an adjacent organ ) . tumors were also graded based on the likelihood of recurrence and progression into grade i ( tumors may recur but have only a low risk of progression ) , grade ii ( tumors are more likely to recur and progress compared with grade i ) , and grade iii ( tumors are very likely to recur and progress ) . bladder cancer patients were followed - up , and cystoscopy and urine cytology were performed every 3 months for the first year , every 6 months for the second year , and annually thereafter . recurrence was defined as transitional cell carcinomas with lower or equivalent pathologic stage after treatment . for mibc patients who had undergone partial cystectomy or radiation treatment , reappearance of bladder cancer including ta and carcinoma in situ a sandwich enzyme - linked immunosorbent assay ( elisa ) was used to quantify serum ape1/ref-1 levels . briefly , 96-microwell plates ( nunc , penfield , ny ) were precoated overnight with 100 l of a 1:1,000 dilution of a rabbit anti - ape1/ref-1 antibody ( abcam , cambridge , uk ) in coating buffer ( 0.5 m carbonate buffer , ph 9.6 ) in each well . after blocking with blocking buffer ( 5% bovine serum albumin in phosphate buffered saline [ pbs ] containing 0.05% tween 20 [ pbs - t ] ) at room temperature for 60 minutes , 100 l of sample was added to the wells and the plates were incubated at 4c for 90 minutes , and then washed five times with pbs - t . this was followed by addition of 100 l of a 1:1,000 dilution of mouse anti - ape1/ref-1 antibody ( abcam ) , and further incubation at room temperature for 2 hours . the plate was then washed seven times with pbs - t , and 100 l of horseradish peroxidase conjugated secondary antibody ( 1:5,000 ) was added , followed by incubation at room temperature for 30 minutes . after further washing , 100 l of freshly prepared tetramethyl benzidine substrate was added to the wells . the color development reaction was stopped by addition of 100 l of 2.5 m h2so4 , and the absorbance was measured at 450 nm using an automatic microtiter plate reader ( sunrise xfluor 4 , tecan systems inc . , san jose , ca ) . each sample was assayed in duplicate , and mean values were determined . to establish a standard curve , purified recombinant human ape1/ref-1 ( 1 mg / ml ) was serially diluted ( 5-fold ) and used in a concentration series from 0.16 - 20 ng/100 l . human full length ape1/ref-1 dna was inserted into the pet28b expression vector ( novagen , gibbstown , nj ) , containing a 6-histidine tag for easy purification . pet28b - ape1/ref-1 plasmids were then transformed into the bl21(de3 ) strain of escherichia coli . following induction with isopropyl -d-1-thiogalactopyranoside ( iptg ) , the cells were sonicated in lysis buffer ( 100 mm nacl , 20 mm hepes ) , and the recombinant protein was purified on a nickel - nitrilotriacetic acid agarose column ( qiagen , valencia , ca ) . after washing , the isolated ape1/ref-1 protein was eluted with 250 mm imidazole buffer followed by desalting on a pd-10 column ( amersham pharmacia biotech , liverpool , uk ) in pbs , and frozen in 10% glycerol at 80c . imunohistochemical staining of ape1/ref-1 was determined in paraffin - embedded sections of bladder tissues , which were stored in the tissue bank of chungnam national hospital . tissue specimens were cut into 4-m sections from randomly selected tumor and non - tumor blocks . distant , apparently normal tissue samples from the same patient were used as the non - tumor blocks . a monoclonal antibody against human ape1/ref-1 was used at a 1:600 dilution ( novus biological , littleton , co ) . staining the sections were lightly counterstained with hematoxylin and mounted using immu - mount ( thermo shandon , midland , canada ) . negative control slides were incubated with the mouse igg1 negative control reagent provided with the kit for evaluation of nonspecific staining . tumor tissues from bladder cancer patients were obtained from the tissue bank of chungnam national hospital . distant , apparently normal tissue samples from the same patient were used as the non - tumor tissues . tissues were suspended in pbs containing protease and phosphatase inhibitors , cut into small pieces , and homogenized using a polytron . the homogenates were centrifuged at 14,000 rpm for 40 minutes and the resultant supernatant fractions were used for immunoblotting . the proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane . after blocking with 5% skimmed milk powder , the blots were incubated with anti ape1/ref-1 antibody ( 1:1,000 , abcam ) . each membrane was stripped and re - probed with an anti glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) antibody to ensure equivalent protein loading . changes in protein levels were quantified by densitometric scanning of the immunoreactive band and normalized against gapdh loading control . a statistical evaluation was performed using a one - way analysis of variance and post - hoc analysis . differences were considered statistically significant if the null hypothesis could be rejected with > 95% confidence interval ( p < 0.05 ) . nonparametric receiver operating characteristic ( roc ) curves were generated by plotting the sensitivity value against the false - positive rate ( 1specificity).we assessed the potential predictive value of ape1/ref-1 for bladder cancer as well specific cancer stages and grades , and recurrence , by calculating the area under the curve ( auc ) . we estimated the sensitivity and specificity of ape1/ref-1 at the optimal cutoff value ( youden index ) to maximize the sum of sensitivity and specificity . serum levels of ape1/ref-1 in bladder cancer patients were significantly elevated compared to those of the control group ( 3.5480.333 ng/100 l [ n=51 ] for bladder cancer vs. 1.5470.319 ng/100 l [ n=55 ] for the control group ) ( fig . the us national cancer institute recommends use of roc curve for evaluation of the performance of potential cancer detection markers . serum samples from 55 non - cancer controls and 51 patients with bladder cancer were used for the roc curve analysis to determine the sensitivity and specificity of ape1/ref-1 in detection of bladder cancer . the roc curve for all tumors resulted in an auc of 0.824 ( 95% confidence interval , 0.74 to 0.90 ) ( fig . the range of sensitivity and specificity at these different values was 0.51 - 0.95 and 0.51 - 0.86 , respectively ( table 2 ) . the sensitivity and specificity of ape1/ref-1 were estimated at the optimal cutoff value in order to maximize the sum of sensitivity and specificity . on this basis , the optimal combination of sensitivity and specificity were determined to be 0.93 and 0.59 , using a cut - off value of 2.83 ng/100 l ( table 2 ) . the grade of bladder cancer provides important prognostic information and can help guide treatment , and is based on the degree of cellular abnormality . we found that serum ape1/ref-1 levels were associated with the grade of bladder cancer ( fig . 2a ) . in particular , the mean values of serum ape1/ref-1 levels of patients with grade ii and iii bladder cancer ( 2.7190.465 ng/100 l for grade ii , n=12 ; 4.8910.389 ng/100 l for grade iii , n=23 ) were significantly greater than those of the control group ( 1.5470.319 ng/100 l , n=55 ) . the roc - auc for grade i , grade ii , and grade iii cancers were 0.70 , 0.71 , and 0.96 , respectively ( fig . 2b ) , suggesting that serum ape1/ref-1 may serve as a predictor of tumor grade . in addition to grade , bladder cancer is also staged by depth of invasion into the bladder wall . thus , we attempted to determine whether serum ape1/ref-1 is also associated with the tumor stage ( fig . 2c ) . serum ape1/ref-1 levels were significantly elevated among patients with ta ( 2.4500.365 ng/100 l ) , t1 ( 3.2510.305 ng/100 l ) , and t2-t3 ( 5.7110.437 ng/100 l ) bladder tumors compared to the control groups . the roc auc for ta , t1 , and t2-t4 were 0.67 , 0.87 , and 0.99 , respectively ( fig . 2d ) . serum ape1/ref-1 levels in mibc ( 5.7110.437 ng/100 l ) were significantly elevated , compared with nmibc ( 2.8010.249 ng/100 l ) ( fig . the roc - auc for nmibc and mibc were 0.76 and 0.99 , respectively ( fig . next , we attempted to determine whether serum ape1/ref-1 levels were also elevated in bladder cancer recurrence . among the 51 patients with bladder cancer , 20 patients ( 39% ) had recurrent bladder cancer the mean serum ape1/ref-1 level titer in these patients was ( 4.4800.430 ng/100 l ) , significantly greater than in patients with non - recurrent tumors ( 2.9400.324 ng/100 l ) ( fig . the auc for non - recurrent tumors was 0.75 , and the auc for recurrent tumors was 0.93 ( fig . 2 g ) , suggesting a high predictive value of serum ape1/ref-1 for recurrent bladder tumors . serum ape1/ref-1 levels in patients with multifocal tumors did not differ significantly from those who had single tumors ( data not shown ) . to determine whether ape1/ref-1 protein was differentially expressed in bladder cancer , immunoblotting for ape1/ref-1 was performed in non - tumor tissues and tumor tissues of bladder cancer ( fig . differences in protein level were quantified by densitometric scanning of the immunoreactive bands and normalized against the gapdh loading control . this revealed that ape1/ref-1 protein was expressed at a far higher level in tumor tissue ( t ) compared to non - tumor tissue as normal ( n ) ( fig . ape1/ref-1 protein expression in tumor and non - tumor tissues of bladder cancer was visualized using immunohistochemistry ( fig . 3b ) . ape1/ref-1 in non - tumor tissues and tumor tissues were mainly localized in the nucleus . in addition , mononuclear cells including monocytes and lymphocytes were infiltrated close to tumor regions . serum levels of ape1/ref-1 in bladder cancer patients were significantly elevated compared to those of the control group ( 3.5480.333 ng/100 l [ n=51 ] for bladder cancer vs. 1.5470.319 ng/100 l [ n=55 ] for the control group ) ( fig . the us national cancer institute recommends use of roc curve for evaluation of the performance of potential cancer detection markers . serum samples from 55 non - cancer controls and 51 patients with bladder cancer were used for the roc curve analysis to determine the sensitivity and specificity of ape1/ref-1 in detection of bladder cancer . the roc curve for all tumors resulted in an auc of 0.824 ( 95% confidence interval , 0.74 to 0.90 ) ( fig . the range of sensitivity and specificity at these different values was 0.51 - 0.95 and 0.51 - 0.86 , respectively ( table 2 ) . the sensitivity and specificity of ape1/ref-1 were estimated at the optimal cutoff value in order to maximize the sum of sensitivity and specificity . on this basis , the optimal combination of sensitivity and specificity were determined to be 0.93 and 0.59 , using a cut - off value of 2.83 ng/100 l ( table 2 ) . the grade of bladder cancer provides important prognostic information and can help guide treatment , and is based on the degree of cellular abnormality . we found that serum ape1/ref-1 levels were associated with the grade of bladder cancer ( fig . 2a ) . in particular , the mean values of serum ape1/ref-1 levels of patients with grade ii and iii bladder cancer ( 2.7190.465 ng/100 l for grade ii , n=12 ; 4.8910.389 ng/100 l for grade iii , n=23 ) were significantly greater than those of the control group ( 1.5470.319 ng/100 l , n=55 ) . the roc - auc for grade i , grade ii , and grade iii cancers were 0.70 , 0.71 , and 0.96 , respectively ( fig . 2b ) , suggesting that serum ape1/ref-1 may serve as a predictor of tumor grade . in addition to grade , bladder cancer thus , we attempted to determine whether serum ape1/ref-1 is also associated with the tumor stage ( fig . 2c ) . serum ape1/ref-1 levels were significantly elevated among patients with ta ( 2.4500.365 ng/100 l ) , t1 ( 3.2510.305 ng/100 l ) , and t2-t3 ( 5.7110.437 ng/100 l ) bladder tumors compared to the control groups . the roc auc for ta , t1 , and t2-t4 were 0.67 , 0.87 , and 0.99 , respectively ( fig . 2d ) . serum ape1/ref-1 levels in mibc ( 5.7110.437 ng/100 l ) were significantly elevated , compared with nmibc ( 2.8010.249 ng/100 l ) ( fig . the roc - auc for nmibc and mibc were 0.76 and 0.99 , respectively ( fig . next , we attempted to determine whether serum ape1/ref-1 levels were also elevated in bladder cancer recurrence . among the 51 patients with bladder cancer , 20 patients ( 39% ) had recurrent bladder cancer the mean serum ape1/ref-1 level titer in these patients was ( 4.4800.430 ng/100 l ) , significantly greater than in patients with non - recurrent tumors ( 2.9400.324 ng/100 l ) ( fig . the auc for non - recurrent tumors was 0.75 , and the auc for recurrent tumors was 0.93 ( fig . 2 g ) , suggesting a high predictive value of serum ape1/ref-1 for recurrent bladder tumors . serum ape1/ref-1 levels in patients with multifocal tumors did not differ significantly from those who had single tumors ( data not shown ) . to determine whether ape1/ref-1 protein was differentially expressed in bladder cancer , immunoblotting for ape1/ref-1 was performed in non - tumor tissues and tumor tissues of bladder cancer ( fig . differences in protein level were quantified by densitometric scanning of the immunoreactive bands and normalized against the gapdh loading control . this revealed that ape1/ref-1 protein was expressed at a far higher level in tumor tissue ( t ) compared to non - tumor tissue as normal ( n ) ( fig . ape1/ref-1 protein expression in tumor and non - tumor tissues of bladder cancer was visualized using immunohistochemistry ( fig . 3b ) . ape1/ref-1 in non - tumor tissues and tumor tissues were mainly localized in the nucleus . in addition , mononuclear cells including monocytes and lymphocytes were infiltrated close to tumor regions . in this report , we describe a new potential diagnostic marker for bladder cancer . in clinical practice , the differential diagnosis of bladder cancer grade using non - invasive techniques is difficult . our study demonstrates for the first time that ape1/ref-1 protein is detectable in the serum of patients with bladder cancer , and is associated with tumor stage , grade , and recurrence . the underlying mechanism for serum ape1/ref-1 existence was completely uncovered . in the current study , our data showed increased expression of ape1/ref-1 in tumor tissues and mononuclear cell infiltration close to tumor tissues . ape1/ref-1 can be secreted from tumor cells itself and its secretion can also be evoked by cellular signaling between tumor and inflammatory cells . a previous study showed that intense inflammation occurs in patients with invasive bladder carcinoma , and it is likely that metalloproteinase-9 is derived from inflammatory cells infiltrating tumors . in addition , nitric oxide ( no ) is elevated in the urine of patients with bladder cancer . no influences the subcellular localization of ape1/ref-1 by nitrosation , and may similarly lead to extracellular translocation of ape1/ref-1 . in previous reports we showed that ape1/ref-1 was secreted into the circulation in response to lipopolysaccharide , which can induce no and tumor necrosis factor production . thus , the release of ape1/ref-1 by tumor cells into the circulation might be a result of tumor - mediated inflammation . for measurement of secretory ape1/ref-1 into blood , we developed a new elisa assay and obtained roc curve by applying to human serum samples . the roc curve is used to evaluate the usefulness of a biomarker for classifying disease status . we used roc curve based on the youden index , the sum of sensitivity and specificity minus one , for setting an optimal cut - point for use in diagnostic testing . a cut - off ape1/ref-1 value of 2.83 ng/100 l resulted in a sensitivity of 93% and a specificity of 59% . in the current study , we showed that increased serum ape1/ref-1 levels are associated with bladder cancer severity , suggesting that it could act as a potential serologic biomarker for bladder cancer . in studies of nuclear maxtrix protein 22 ( nmp-22 ) as a urinary marker of bladder cancer , the results vary widely depending on the reporting group : values of 47%-100% for sensitivity and 58%-91% for specificity with this test have been previously reported . in a recent prospective test for nmp-22 test they concluded that nmp-22 assessment alone can not be recommended for bladder cancer screening in a high - risk group nor as a reliable alternative to cystoscopy during follow - up . urine cytology is a more widely accepted noninvasive tumor - specific marker for bladder cancer . however , despite being highly specific for carcinoma in situ and high - grade urothelial carcinoma , it has a relatively low sensitivity for low grade carcinoma . the majority of bladder cancers were diagnosed low grade and stage tumors , the relative value of cytology is limited . collectively , we have demonstrated that ape1/ref-1 protein is detectable in the serum of patients with bladder cancer , and its level is associated with tumor stage and recurrence . our findings provide a good foundation for development of a new serological biomarker for bladder cancer .

purposeapurinic / apyrimidinic endonuclease 1/redox factor-1 ( ape1/ref-1 ) is a multifunctional protein that shows elevated expression in a number of cancers . we attempted to determine whether serum ape1/ref-1 is elevated in patients with bladder cancer.materials and methodsserum ape1/ref-1 levels were determined using enzyme - linked immunosorbent assay in serum from patients with bladder cancer who had not received chemotherapy or radiotherapy ( n=51 ) and non - tumor controls ( n=55 ) . the area under the receiver operating characteristic area under the curve was applied to determine the correlation between clinical factors and the serum levels of ape1/ref-1.resultsserum levels of ape1/ref-1 in bladder cancer patients were significantly elevated compared to those of the control group ( 3.5480.333 ng/100 l [ n=51 ] for bladder cancer vs. 1.5470.319 ng/100 l [ n=55 ] for the control group ) , with a sensitivity and specificity of 93% and 59% , respectively . serum ape1/ref-1 levels are associated with tumor stage , grade , muscle invasion , and recurrence.conclusionserum ape1/ref-1 might be useful as a potential serologic biomarker for bladder cancer .

the sleeve gastrectomy ( sg ) is the first part of the duodenal switch operation and leaves a lesser curvature tube after excising the fundus and greater curvature portion of the stomach . this surgery has become more and more popular as the first stage in the treatment of obesity [ 1 , 2 ] . minimally invasive surgery is being incorporated into general surgical practice . during the last decade , the advent of the da vinci surgical system ( intuitive surgical , sunnyvale , ca , usa ) has enabled many complex procedures to be performed with minimally invasive techniques in bariatric surgery . roux en y gastric bypass remains one of the most challenging procedures performed by bariatric and general surgeons . sleeve gastrectomies are a less technically demanding procedure , and for this reason , we used them to gain dissection and suturing experience using the da vinci system . this initial experience was used to determine the learning curve in performing the robot - assisted sleeve gastrectomy . between february 2010 and april 2011 , a trained surgeon in advanced laparoscopic surgery ( rv and jmf ) performed 32 consecutive robotic sleeve gastrectomies ( rsgs ) for the treatment of morbid obesity . patients were included according to the waiting list inclusion and all meet the criteria for sleeve gastrectomy . the surgical team consisted of two attending physicians who shared the console and the scrubbed table activities . r. vilallonga trained in a pig model performing 10 nephrectomies prior to beginning the rsg . the two surgeons worked consistently within the same roles ; r. vilallonga was in the console and j. m. fort at the patient 's side in all cases . a 12 mm port was inserted 120 mm inferior and slightly left to the sternum for camera access . for the latter port , we used an extra large 150 mm long trocar ( xcel trocar , ethicon - endosurgery , cincinnati , oh , usa ) . the right 12 mm working port was positioned 6 cm from the midline trocar . the left 12 mm working port was located 6 cm to the left of the midline trocar . an 11 mm trocar was placed laterally to the left hypochondrium ( to allow the table assistant to assist and also to place the left arm of the robot during surgery ) and an 8 mm da vinci trocar was placed under the right hip as laterally as possible ( anterior axillary line ) to allow liver retraction . the 8 mm da vinci trocars were inserted through standard , disposable 12 mm trocars . this double - cannulation technique was used because standard 12 mm trocars are required during the insertion of the staples . all trocars were inserted under direct visualization with the da vinci system camera ( figure 1 ) . at this stage of the procedure , we began recording the docking time ( dt ) . the robotic camera was locked last but was used to insert all robotic cannulas and instruments . the robotic cart was positioned over the patient 's head ( which was covered with head protection designed for this purpose ) . once the general setup was ready , the procedure began with the console surgeon using a grasper in the left hand and a modified harmonic scalpel in the right hand . the third da vinci arm used another forceps in order to retract the liver from the 8 mm trocar placed in the right - hand side of the patient . the greater curvature of the stomach was sectioned at the lowest point in order to reach the lesser epiploic sac . this stage of the procedure is completely robotic and the first assistant does not usually participate . the division of the gastrocolic and gastrosplenic ligament continued exactly as in a standard lsg . the robot ensures precision in the upper part of the stomach , in which you need to avoid any injury to the spleen and properly visualize the vessels . dissection continued up to 5 cm from the pylorus following dissection of the upper part of the stomach . at this stage of the procedure , the anesthesiologist did not encounter any difficulty placing the bougie with the robotic bedside cart . a stapler ( echelon 60 endopath stapler , endoscopic linear cutter straight , ethicon - endosurgery , cincinnati , oh , usa ) , loaded with a green cartridge , was used to divide the stomach from the lowest tip of the greater gastric curvature , 5 cm proximally to the pylorus , towards the lateral edge of the bougie . the right arm was again docked and the left robotic arm was switched to the left lateral 11 mm trocar . this manoeuvre allowed the decannulation of the right arm from the 12 mm trocar without moving the robot and can be performed within a few seconds . the table surgeon inserted a stapler loaded with blue cartridges in order to divide the sleeve up to the end of the upper part . the stomach was then removed from the cavity through the 12 mm trocar . a robotic continuous polypropylene suture ( 3/0 ) ( prolene , ethicon - endosurgery ) the anaesthesiologist filled the sleeve with diluted methylene blue in order to detect any leakage from the staple line . all patients underwent a mandatory upper gastrointestinal tract series with contrast material on the third postoperative day . all patients received nutritional advice and were instructed to follow a liquid and semiliquid diet for 2 weeks . all patients are followed up every 3 months in the outpatient clinic until the end of the second postoperative year and then are seen annually . variables examined included overall operative time , docking time , length of hospital stay , and complications . the patient number at which a < 5% change occurred within a variable gave the minimum number of cases needed to reach the learning curve for that variable . in order to examine the learning curve associated with selected continuous endpoints as the number of operative cases increased robot - assisted sleeve gastrectomy was performed in 32 patients , of whom 12 were males and 20 females . their mean age was 44 years , and the mean bmi was 48.3 kg / m . 8 patients had diabetes , 13 had hypertension , 9 patients had dyslipidemia , and 16 were using a continuous positive airway pressure ( cpap ) device at home at the time of operation . there were no differences between the two cohorts in terms of bmi ( table 1 ) . all patients were included consecutively according to the waiting list order and the eligibility for sleeve gastrectomy . from the first 12 cases that configured cohort 1 , the set - up time gradually decreased to 34.9 minutes as the nurses became more experienced . two laparoscopic and robotic operating tables were always prepared and preparation of the robot was included in this set - up time . the overall operating time ( ot ) decreased from 89.8 minutes in cohort 1 to 70.1 minutes in cohort 2 ; there was less than 5% change in ot after case 19 up to case 32 ( figure 2 ) . this decrease in ot was attributed to better understanding of the technique and the development of a coordinated procedure . however , time from incision to docking decreased from 9.5 minutes in cohort 1 to 7.6 minutes in cohort 2 . the time taken to dock the robotic system also decreased from 9.1 minutes in cohort 1 to 6.6 minutes in cohort 2 . the plateau on the curve for time from incision to docking , docking , and total operative time occurred at the 19th22nd patient with < 5% change from this point ( figure 3 ) . the followup was uneventful for all patients in terms of nausea , vomiting , or stenosis , with a mean followup of 10 months . sleeve gastrectomy is a purely restrictive operation that reduces the size of the gastric reservoir to 60100 ml , permitting the intake of only small amounts of food and imparting a feeling of satiety earlier during a meal . it has been performed laparoscopically with good results . in 2000 , the food and drug administration ( fda ) approved the da vinci surgical system ( intuitive surgical inc , sunnyvale , ca , usa ) for use in general laparoscopic surgery , and since then many surgeons have used this system in order to improve their surgical outcomes . it has also been used in bariatric surgery to complete demanding surgeries such as gbp , which requires high levels of expertise even in trained surgeons [ 6 , 7 ] . our data support the conclusion that both setup and docking of the robot can be achieved within an acceptable time after the learning curve . however this can only be determined by comparing subsequent cases with the first cases performed by each surgeon . unfortunately , the relevant data were not available . set - up time and docking time were recently evaluated for different robotic surgeries , and it was shown that they could be initially time consuming but that they are easy to learn and have steep learning curves . the same was found in our initial experience working with the same scrub - nurse team and the same surgical team members . also , we have not been able to compare the learning curve of rsg procedure to rgbp because only 7 cases have been performed . laparoscopic sleeve gastrectomy can be safely and efficiently performed in a newly established bariatric centre following a mentorship procedure . it is known that sleeve gastrectomy is a less technically demanding procedure compared to gastric bypass . however , when implementing new technologies such as robotic assisted surgery , it can be a more amenable procedure than gastric bypass . in addition , the learning curve has been reported to be shorter for surgeons who initiated their experience at an institution with an established laparoscopic bariatric programme [ 10 , 11 ] . we included more patients in order to determine the number of cases needed to produce a plateau in these variables . some previous articles have suggested that it took 30 robotic cases to perform the procedure in less time than it took for her median laparoscopic times . buchs in his article learning curve for robot - assisted roux - en - y gastric bypass assessed the learning curve using a cumulative sum method . he found the learning curve consisted of two distinct phases : phase 1 ( the initial 14 cases ; mean ot , 288.9 min ) and phase 2 ( the subsequent cases ; mean ot , 223.6 min ) , which represented the mastery phase , with a decrease in ot ( p = 0.0001 ) . however there could be a phase three , a phase four , or even beyond as in our case series . his mean operative time of 223.6 min for phase 2 ( his defined mastery phase ) , which is considerably longer than typical operative times for robotic gastric bypass , makes it very likely that there are more stabilization points in operative time . for this reason , we have to comment that we could have a sample size too small to capture this stabilization phenomenon . however , times and result in terms of complications , outcomes , and results are satisfactory . for this reason , we focused specifically on the set - up and docking times of the da vinci surgical system in order to perform surgery efficiently . according to our data , trained nurses can achieve robotic setup efficiently , and docking can be conducted time effectively by the console surgeon and the first assistant . as shown previously , a trained nurse can complete robotic draping within 35 minutes while the patient is in preparation for anesthesia . the learning curve for docking some authors have observed an increase in operating time when using the robotic system , but we believe that a learning curve is required in order to decrease time loss and potential risks [ 1517 ] . to our knowledge the only previous report of robotic sleeve gastrectomy mentioned the advantages of using this procedure instead of a robotic gastric bypass ( rgbp ) as the first step to introducing robotic surgery to a bariatric unit . they suggested , and we agree , that it is always wiser to start with a less demanding procedure in order to avoid errors in the initial phases of the overall robotic learning curve . in this paper , no data were reported concerning the learning curve before attempting to undergo a rygbp . in our experience , and according to our protocol , we perform sleeve gastrectomy in superobese patients ( bmi > 50 ) and we consider it more suitable for initial robotic training . using robotic assisted techniques , even in part , could be considered in rygbp during a learning curve instead of reinforced staple line rsg . however , we suggest that rsg be completed before rygbp is introduced to routine clinical practice within a bariatric unit . our early experience in rsg suggests that robotic surgery is safe , feasible , and could be an effective alternative to the conventional laparoscopic approach in bariatric surgery . robotic surgery gives all the benefits of the laparoscopic approach , with added benefits in certain challenging surgical cases . however , we believe that bariatric surgeons should be trained in rsg before rygbp . completion of a learning curve is mandatory even in experienced laparoscopic surgeons before undergoing technically demanding robotic procedures such as the rygbp . despite the lack of tactile feedback , the long set - up time , long learning curve , and continued high costs , robotic systems can be used in particularly challenging surgeries . according to our criteria and our results , the learning curve for a console surgeon for sleeve gastrectomy once this point has been reached and the operator is confident in suturing and docking with the robot , more challenging techniques can be considered . in our experience , sleeve gastrectomy can be achieved safely and could be considered as a preliminary step prior to attempting more complex bariatric procedures through a robotic assisted approach . however

objective . robot - assisted sleeve gastrectomy has the potential to treat patients with obesity and its comorbidities . to evaluate the learning curve for this procedure before undergoing roux en - y gastric bypass is the objective of this paper . materials and methods . robot - assisted sleeve gastrectomy was attempted in 32 consecutive patients . a survey was performed in order to identify performance variables during completion of the learning curve . total operative time ( ot ) , docking time ( dt ) , complications , and length of hospital stay were compared among patients divided into two cohorts according to the surgical experience . scattergrams and continuous curves were plotted to develop a robotic sleeve gastrectomy learning curve . results . overall ot time decreased from 89.8 minutes in cohort 1 to 70.1 minutes in cohort 2 , with less than 5% change in ot after case 19 . time from incision to docking decreased from 9.5 minutes in cohort 1 to 7.6 minutes in cohort 2 . the time required to dock the robotic system also decreased . the complication rate was the same in the two cohorts . conclusion . our survey indicates that technique and outcomes for robot - assisted sleeve gastrectomy gradually improve with experience . we found that the learning curve for performing a sleeve gastrectomy using the da vinci system is completed after about 20 cases .

gastrointestinal stromal tumors ( gists ) represent the largest group of subepithelial tumors ( set ) of the stomach , duodenum and small intestine but occur only very seldom in the esophagus and large intestine . in contrast to leiomyomas , lipomas and most other sets , they may have a malignant behavior . therefore , after detection of a subepithelial lesion in the upper gastrointestinal ( gi ) tract , correct characterization is crucial to start an assessment whether surgery would be an appropriate approach to the patient . in contrast - enhanced computed tomography ( cect ) , gist has necrotic or unenhancing areas in about 50% , if larger than 50 mm . necrotic areas is a sign with a high positive predictive value for the diagnosis of gist , but the negative predictive value is low . in short , exclusion of gist is frequently not possible . endoscopic ultrasound ( eus ) has become the method of choice for the characterization of upper gi tract disease , especially in subepithelial lesions as an adjunct to endoscopy . however , endosonographic discrimination of gists from benign subepithelial gi tumors , in particular leiomyoma , may be difficult and is based on minor differences of shape , echogenicity and homogeneity . in particular , necrotic areas can not be displayed properly with conventional eus . thus , contrast - enhanced ultrasound ( ceus ) is used to display microperfusion on the capillary level with a high specificity for the contrast signal due to software reasons and the strict intravascular behavior of the contrast agent . recently , real - time contrast - enhanced eus ( ce - eus ) with low mechanical index imaging based on contrast - specific harmonic imaging modes has become available . based on previous experience in other tumors , we postulated that ce - eus and eus elastography might be helpful for discrimination of hypoechoic subepithelial gi tumors , in particular for discrimination of gist and leiomyoma . all consecutive patients from four tertiary referral centers with sets of the upper and middle gi tract submitted for us and eus evaluation were analyzed and their data prospectively evaluated . all patients gave informed consent , and institutional board approval had been received for the study . all patients with sets of the upper gi tract were evaluated using eus . in patients with sets not within the reach of upper gi eus , in particular sets of the small intestine , transabdominal us was performed . eus was performed using hitachi preirus and hitachi ascendus with pentax eg utk 3870 or pentax eg urk 3670 scanners . the size , shape , layer of origin and vascularization with conventional color or power doppler ultrasound were analyzed . ce - eus was performed after injection of 4.8 ml of sonovue ( bracco , italy ) . using real - time imaging , the enhancement pattern was analyzed with special focus on the enhancement pattern and possible foci without contrast uptake . real - time elastography has been also performed , using a region of interest that included at least 50% of the tumor , as well as surrounding structures . percutaneous us was performed using toshiba aplio , ge logiq e9 , or hitachi ascendus . the final diagnosis was established by eus - guided tissue acquisition , bite - on - bite forceps biopsy , or surgical resection with pathological examination and immunohistochemistry . forty - two out of 62 ( 68% ) patients had sets of the stomach , 17/62 ( 27% ) of the small intestine , 2/62 ( 3% ) of the esophagus , and 1/62 ( 2% ) extraintestinal . fifty out of 62 patients ( 81% ) underwent surgery , in 11/62 ( 18% ) cytology was obtained by eus - guided biopsy and in 1/62 ( 2% ) histology was obtained by endoscopic forceps biopsy . histology revealed leiomyoma in 5/62 ( 8% ) and gist in 57/62 patients ( 92% ) . all patients but 1 ( 61/62 , 98% ) had gists with blue pattern in elastography , 13 of them ( 13/61 , 21% ) had heterogeneous patterns , and 48/61 ( 79% ) had homogenous patterns . all patients except 1 ( 56/57 , 98% ) had a hyperenhancing gist in ce - eus . , hyperenhancement had a sensitivity , specificity , positive predictive value , negative predictive value and accuracy of 98% , 100% , 100% , 93% and 98% . typical enhancement pattern of leiomyoma ; leiomyomas show frequently very low contrast uptake fifty out of 57 patients with gist ( 88% ) showed avascular areas in the center of the lesions which we interpreted as necrosis [ figures 24 ] . there was a trend toward smaller size for gist without avascular areas ( 65.8 43 [ 16200 ] vs. 39.6 26.9 [ 2290 ] , p = 0.062 ) . in the current group , lesions with avascular areas developed no metastasis and were never classified as high risk . gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing hypervascularization and displaying avascular areas gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing less pronounced hypervascularization and displaying small avascular areas gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing pronounced hypervascularization and displaying a tiny avascular area in the center characteristics of patients and lesions two out of five leiomyoma ( 40% ) were found in the esophagus , and no gist was found in the esophagus . thirty - nine out of 57 ( 68% ) patients had gist lesions in the stomach , 17/57 ( 30% ) had gist of the small intestine , and 1/57 ( 2% ) patients had extraintestinal gists . gist size was 62.6 42.1 [ 16200 ] mm . there were 26/57 ( 46% ) patients with high - risk gists , 17/57 ( 30% ) with intermediate - risk gist , 14/57 ( 25% ) patients with low - risk gists , and 0/62 ( 0% ) with very low - risk gists . seven out of 26 ( 27% ) patients with high - risk gist had simultaneous liver metastases . the majority of patients with liver metastases ( 9/62 , 15% ) had high - risk gist ( 7/9 , 78% ) , but 2/9 ( 22% ) patients with liver metastases had intermediate histology [ table 1 ] . there was a trend toward smaller size in leiomyoma compared with gist , but it did not reach statistical significance ( p = 0.066 ) [ table 1 ] . all lesions were hypoechoic compared to submucosal layer and isoechoic compared to the muscularis propria layer . in 49/57 ( 86% ) of all lesions , the layer of origin could be identified as proper muscular layer . the remaining 8/57 ( 14% ) lesions were located extraintestinally ( 1/8 , 13% ) or in the small intestine ( 5/8 , 50% ) , where layer association was difficult due to the low thickness of the bowel wall . two out of eight lesions ( 38% ) were located in the stomach , and the reasons for failing layer association could not be identified . all patients but 1 ( 61/62 , 98% ) had gists with blue pattern in elastography , 13 of them ( 13/61 , 21% ) had heterogeneous patterns , and 48/61 ( 79% ) had homogenous patterns . all patients except 1 ( 56/57 , 98% ) had a hyperenhancing gist in ce - eus . all leiomyomas showed hypoenhancement [ figure 1 ] . in our cohort , hyperenhancement had a sensitivity , specificity , positive predictive value , negative predictive value and accuracy of 98% , 100% , 100% , 93% and 98% . typical enhancement pattern of leiomyoma ; leiomyomas show frequently very low contrast uptake fifty out of 57 patients with gist ( 88% ) showed avascular areas in the center of the lesions which we interpreted as necrosis [ figures 24 ] . there was a trend toward smaller size for gist without avascular areas ( 65.8 43 [ 16200 ] vs. 39.6 26.9 [ 2290 ] , p = 0.062 ) . in the current group , lesions with avascular areas developed no metastasis and were never classified as high risk . gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing hypervascularization and displaying avascular areas gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing less pronounced hypervascularization and displaying small avascular areas gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing pronounced hypervascularization and displaying a tiny avascular area in the center characteristics of patients and lesions two out of five leiomyoma ( 40% ) were found in the esophagus , and no gist was found in the esophagus . thirty - nine out of 57 ( 68% ) patients had gist lesions in the stomach , 17/57 ( 30% ) had gist of the small intestine , and 1/57 ( 2% ) patients had extraintestinal gists . gist size was 62.6 42.1 [ 16200 ] mm . there were 26/57 ( 46% ) patients with high - risk gists , 17/57 ( 30% ) with intermediate - risk gist , 14/57 ( 25% ) patients with low - risk gists , and 0/62 ( 0% ) with very low - risk gists . seven out of 26 ( 27% ) patients with high - risk gist had simultaneous liver metastases . the majority of patients with liver metastases ( 9/62 , 15% ) had high - risk gist ( 7/9 , 78% ) , but 2/9 ( 22% ) patients with liver metastases had intermediate histology [ table 1 ] . there was a trend toward smaller size in leiomyoma compared with gist , but it did not reach statistical significance ( p = 0.066 ) [ table 1 ] . all lesions were hypoechoic compared to submucosal layer and isoechoic compared to the muscularis propria layer . in 49/57 ( 86% ) of all lesions , the layer of origin could be identified as proper muscular layer . the remaining 8/57 ( 14% ) lesions were located extraintestinally ( 1/8 , 13% ) or in the small intestine ( 5/8 , 50% ) , where layer association was difficult due to the low thickness of the bowel wall . two out of eight lesions ( 38% ) were located in the stomach , and the reasons for failing layer association could not be identified . all patients but 1 ( 61/62 , 98% ) had gists with blue pattern in elastography , 13 of them ( 13/61 , 21% ) had heterogeneous patterns , and 48/61 ( 79% ) had homogenous patterns . all patients except 1 ( 56/57 , 98% ) had a hyperenhancing gist in ce - eus . all leiomyomas showed hypoenhancement [ figure 1 ] . in our cohort , hyperenhancement had a sensitivity , specificity , positive predictive value , negative predictive value and accuracy of 98% , 100% , 100% , 93% and 98% . typical enhancement pattern of leiomyoma ; leiomyomas show frequently very low contrast uptake fifty out of 57 patients with gist ( 88% ) showed avascular areas in the center of the lesions which we interpreted as necrosis [ figures 24 ] . there was a trend toward smaller size for gist without avascular areas ( 65.8 43 [ 16200 ] vs. 39.6 26.9 [ 2290 ] , p = 0.062 ) . in the current group , lesions with avascular areas developed no metastasis and were never classified as high risk . gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing hypervascularization and displaying avascular areas gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing less pronounced hypervascularization and displaying small avascular areas gastrointestinal stromal tumors in contrast - enhanced endoscopic ultrasound showing pronounced hypervascularization and displaying a tiny avascular area in the center characteristics of patients and lesions two out of five leiomyoma ( 40% ) were found in the esophagus , and no gist was found in the esophagus . thirty - nine out of 57 ( 68% ) patients had gist lesions in the stomach , 17/57 ( 30% ) had gist of the small intestine , and 1/57 ( 2% ) patients had extraintestinal gists . gist size was 62.6 42.1 [ 16200 ] mm . there were 26/57 ( 46% ) patients with high - risk gists , 17/57 ( 30% ) with intermediate - risk gist , 14/57 ( 25% ) patients with low - risk gists , and 0/62 ( 0% ) with very low - risk gists . seven out of 26 ( 27% ) patients with high - risk gist had simultaneous liver metastases . the majority of patients with liver metastases ( 9/62 , 15% ) had high - risk gist ( 7/9 , 78% ) , but 2/9 ( 22% ) patients with liver metastases had intermediate histology [ table 1 ] . there was a trend toward smaller size in leiomyoma compared with gist , but it did not reach statistical significance ( p = 0.066 ) [ table 1 ] . all lesions were hypoechoic compared to submucosal layer and isoechoic compared to the muscularis propria layer . in 49/57 ( 86% ) of all lesions , the layer of origin could be identified as proper muscular layer . the remaining 8/57 ( 14% ) lesions were located extraintestinally ( 1/8 , 13% ) or in the small intestine ( 5/8 , 50% ) , where layer association was difficult due to the low thickness of the bowel wall . two out of eight lesions ( 38% ) were located in the stomach , and the reasons for failing layer association could not be identified . our findings show that contrast - enhanced low mechanical index eus displays avascular areas and hyperenhancement in a high percentage of gists . a small control group consisting of gi leiomyoma constantly displayed hypoenhancement , thus suggesting ce - eus to be an appropriate method to distinguish both entities . another finding was the hard character ( low strain ) of gist in real - time eus - elastography . therefore , in contradiction to recently published data , eus elastography might not be helpful for differential diagnosis of gist from gi leiomyoma . the most common locations of gist are stomach ( 60% ) , small bowel ( 30% ) and duodenum ( 5% ) . the relative risk of malignant behavior of a gist primarily depends on the number of mitoses per 50 high - power fields , on its size , on certain types of mutation , and on the location within the gi tract . nevertheless , gist tumors have an indeterminate malignant potential and current diagnosis can not rely on imaging alone . current gist guidelines recommend surgical resection when lesions are larger than 20 or 30 mm . resection can be problematic when patient 's situation or tumor localization makes wedge resection or similar techniques problematic . however , smaller tumors ( < 2030 mm ) can be safely considered for endoscopic resection , with or without laparoscopic control . consequently , nccn guidelines recommend follow - up only in tumors < 20 mm without high - risk eus features while the rest should be resected . the most common imaging method is computed tomography ( ct ) . ulceration , heterogeneous enhancement , lack of annular growth and lymphadenopathy , and demonstration of a supplying artery as well as draining veins are predictive for gists . in sets , eus is the most accurate method to predict the layer of origin and to evaluate structural features . a definite diagnosis was possible only in 34%88% of cases using eus - guided tissue acquisition . since a few years , ceus is now available for eus techniques . preliminary data suggested that ce - eus can discriminate gist ( hypervascular in all cases ) from benign lesions . eus is further recommended in most of the guidelines for upper gi tract tumors . for gastric stromal tumors , eus has a high accuracy ( 99% ) for localization , characterization of the lesion as gi mesenchymal tumors ( 83% ) and for differentiating benign from malignant tumors ( 80% ) . one study assessing the vascularity of gist using ce - eus showed that all 16 high - risk tumors had irregular vessels , whereas only 5 of 13 low - risk gists showed this feature . all tumors with homogeneous enhancement were low - risk gist or benign spindle cell neoplasias ( leiomyoma , schwannoma ) . seven high - risk gists displayed avascular areas on ce - eus , whereas none of the low - risk tumors were found to have this feature . interestingly , in one study , the sensitivity of ce - eus for detecting intratumoral vessels ( 100% ) was significantly higher than that for contrast - enhanced multidetector ct ( 31% ) and for power doppler - eus ( 63% ) . one study assessing the vascularity of gist using ce - eus showed that all 16 high - risk tumors had irregular vessels , whereas only 5 of 13 low - risk gists showed this feature . all tumors with homogeneous enhancement were low - risk gist or benign spindle cell neoplasias ( leiomyoma , schwannoma ) . seven high - risk gists displayed avascular areas on ce - eus , whereas none of the low - risk tumors were found to have this feature . interestingly , in one study , the sensitivity of ce - eus for detecting intratumoral vessels ( 100% ) was significantly higher than that for contrast - enhanced multidetector ct ( 31% ) and for power doppler - eus ( 63% ) . one study assessing the vascularity of gist using ce - eus showed that all 16 high - risk tumors had irregular vessels , whereas only 5 of 13 low - risk gists showed this feature . all tumors with homogeneous enhancement were low - risk gist or benign spindle cell neoplasias ( leiomyoma , schwannoma ) . seven high - risk gists displayed avascular areas on ce - eus , whereas none of the low - risk tumors were found to have this feature . interestingly , in one study , the sensitivity of ce - eus for detecting intratumoral vessels ( 100% ) was significantly higher than that for contrast - enhanced multidetector ct ( 31% ) and for power doppler - eus ( 63% ) . our data confirm preliminary evidence that ce - eus is an accurate technique for discrimination of gist and benign gi mesenchymal tumors , in particular gi leiomyoma . hypervascularity and the presence of avascular areas are highly predictive criteria of gist as compared to gi leiomyoma and may be used in addition to b - mode features in the differential diagnosis of gi set . due to the fact that both types of gi mesenchymal tumors are relatively hard lesions , eus elastography is not useful for differentiation of gist and gi leiomyoma . however , we did not use quantification techniques in eus elastography ( strain ratio or histogram analysis ) , which might have the potential to better discriminate between various degrees of stiffness of gi set . further limitations of our study were its retrospective design and the small control group including only five gi leiomyomas .

background and objectives : gastrointestinal stromal tumors ( gists ) represent the largest group of subepithelial tumors ( set ) of the upper gastrointestinal ( gi ) tract . they may show malignant behavior , in contrast to other set . endoscopic ultrasound ( eus ) is frequently used to characterize set . with the introduction of contrast - enhanced ultrasound ( ceus ) into eus ( ce - eus ) , distinct enhancement patterns can be detected . in the presented study , the characteristic features of ce - eus in gist are analyzed and compared with those of other set.materials and methods : consecutive patients from four centers with set of the upper and middle gi tract were included and received endoscopic or transcutaneous ceus . the results were compared with eus - guided tissue acquisition , forceps biopsy , or surgical resection.results:forty-two out of 62 ( 68% ) patients had set of the stomach , 17/62 ( 27% ) of the small intestine , 2/62 ( 3% ) of the esophagus , and 1/62 ( 2% ) extraintestinal . eighty - one percent underwent surgery . leiomyoma was found in 5/62 ( 8% ) and gist in 57/62 patients ( 92% ) . thirty - nine out of 57 ( 68% ) patients had gist lesions in the stomach , 17/57 ( 30% ) had gist of the small intestine , and 1/57 ( 2% ) patients had extraintestinal gists . gist size was 62.6 42.1 ( 16200 ) mm . hyperenhancement had a sensitivity , specificity , positive predictive value , negative predictive value , and accuracy of 98% , 100% , 100% , 93% , and 98% for the diagnosis of gist . fifty out of 57 patients with gist ( 88% ) showed avascular areas in the center of the lesions.conclusion:ce-eus and ceus show hyperenhancement and avascular areas in a high percentage of gist but not in leiomyoma . thus , gist and leiomyoma can be discriminated accurately .

the debate on the importance of randomized controlled trials ( rcts ) versus observational studies has been ongoing for several decades . however , in the debate of superiority of observational versus rcts or vice versa , a key message is lost . the issue that needs to be emphasized is that while rcts provide the most unbiased answers in scenarios where it is logistically and ethically feasible to conduct rcts as opposed to observational studies . nevertheless , it is not always the case to conduct all study designs for all clinical questions due to various ethical and logical reasons . that is , study design is not a choice but a function of matching the research question to the study design that will provide the most unbiased answers . the basic concept that underpins every clinical research project is the requirement of a clearly defined research question domain . broadly , the clinical research question domain relates either to prognosis , diagnostic accuracy , treatment , or adverse events . research on the type of questions shows that a majority relates to diagnosis and treatment . while rcts provide the most unbiased answers on questions related to efficacy of compared treatments , other designs are better suited to answer questions related to prognosis or diagnostic accuracy of tests . in addition , rarely an answer to a clinical question is obtained from one study and accordingly results from systematic reviews and meta - analysis of several studies are considered more reliable than results from single studies . evidence - based medicine classifies different types of studies on the basis of research design as the criterion for hierarchical rankings . rcts or systematic reviews and meta - analysis of rcts are at the top of the pyramid , while anecdotal evidence is at the bottom [ figure 1 ] . however , the evidence pyramid does not provide the disclaimer that all study designs are not possible to conduct to answer all research questions . the aim of this paper is to illustrate the importance of matching the study design to the research question domain while using clinical scenarios as an example . while there are several other question domains that also concern the practice of medicine , we are focusing only on study designs concerning the issue of prognosis and diagnostic accuracy in this paper . overall , the study design tree can be divided into two broad categories of descriptive and analytical studies . while descriptive studies provide us with the information on the occurrence of certain outcomes over time , analytical studies quantify the association between a predictor and an outcome variable . case reports , case series , and cross - sectional surveys are the most commonly used descriptive study designs and are helpful in generating a hypothesis . a case report or a case study is the most basic descriptive study design and focuses on an individual with an unusual disease . a sequence of case reports is called case- series which is when more than one case is reported in a certain time frame and studied in detail . descriptive cross - sectional ( survey based ) are conducted to estimate the frequency and distribution of a disease . in these surveys , information is collected on several individuals at one point in time about their health status , behavior , or other risk factors . basic research designs analytical studies are divided into two main categories of observational and experimental designs , as shown in figure 2 . the key difference between observational and experimental study designs relates to the assignment of exposure . in experimental studies , researchers make a decision on the assignment of exposure or intervention , while in observational studies exposure is not assigned by the researcher . based on the study design , rcts can be classified into cross - over , parallel , and factorial designs . randomization is the only known mechanism to create balanced groups in all aspects except the exposure or intervention for known and unknown prognostic factors . however , rcts like any other designs are prone to biases if not implemented appropriately . we are intentionally not providing details on conduct of rcts as the focus of this paper is on observational study designs related to question domains of prognosis and diagnostic accuracy . in observational studies , as the name suggests , a specific population is observed versus assigned and the information is collected on outcomes according to exposure . that is , unlike experimental study designs , the investigator does not control the assignment of exposure and is only involved passively in collecting data on exposure followed by outcomes assessments . the three types of observational study designs are cohort , cross - sectional , and case - control . while cohort and cross - sectional studies are prospective in nature , case - control studies are retrospective . that is , in the case of cohort and cross - sectional studies , exposure precedes the outcome , whereas in case - control studies , outcomes precede the exposure . a classic prospective cohort study design examines the association between health exposure and resultant outcomes . for example , a cohort study is helpful in estimating the incidence and etiologies of diseases as well as questions on prognosis . study subjects are grouped according to exposure status and followed over time to determine the incidence of outcome . the incidence of the disease in the exposed group is compared with the incidence of disease in the unexposed group . properly designed and conducted cohort studies offer several advantages . a key advantage is showing an appropriate temporal sequence between exposure and outcome . since exposure precedes outcome , it is easier to attribute the outcome to the exposure and is therefore best suited to assess an association between exposure and outcome . furthermore , cohort studies allow for the direct calculation of incidence rates in the exposed and unexposed groups summarized as risk ratios or relative risk . cohort studies are essentially key to address research questions associated with rare diseases due to the fact that exposure is determined first . it can be determined a priori if there is an adequate number of exposed and unexposed subjects [ figure 3 ] . some of the disadvantages of cohort studies include requirements of large sample size and longer time duration for follow - up . a cohort study is not feasible in cases of chronic diseases where the latency period is prolonged as well as in cases of rare diseases where the incidence is low . it is also important to note that due to the long time needed to follow - up , reassessment of exposure status is required . this has the potential to change during the course of follow - up leading to association with significant costs and logistical issues . due to the long course of follow - up , loss to follow - up is also a major challenge and a potential source of bias . prospective cohort study design analytical cross - sectional studies are useful to determine prevalence , which is important for clinical practice . prevalence provides information on the likelihood of a diagnosis and the predictive value of a diagnostic test . while differentiating cohort and cross - sectional studies , we can use the analogy of a picture versus a video . cohort studies are similar to a video which allows viewing the whole scenario over a period of time and permit multiple measurements unlike cross - sectional studies which are like a snapshot and permit measurement only at one time . that is , cross - sectional study design involves observation of a subset of a population for studying exposure and outcome variables at one point in time without any follow - up . cross - sectional study design is useful to assess the diagnostic accuracy of compared tests [ figure 4 ] . for example , the same study subject is given two diagnostic tests and associated observations with each test in terms of true positive , true negative versus false positive , or false negative are determined . in cohort or case control studies , there are two groups with different observations whereas in a cross - sectional study design , there are two observations from the same group . the most important advantage of cross - sectional studies is that they require no follow - up and therefore are relatively cheap to conduct requiring fewer resources . however , cross - sectional studies are not adequate in differentiating between cause and effect or the sequence of events . cross - sectional study design in contrast to cohort and cross - sectional studies , case control studies are retrospective . a case control study design provides an estimate on the strength of association between each predictor variable and the presence or absence of a disease . retrospectively , subjects with certain outcome or disease are selected and then matched with the normal controls . information is obtained from these subjects to estimate the prevalence of exposure to risk factors [ figure 5 ] . odds ratio is an appropriate measure to estimate the association between an exposure and an outcome . the major strength of a case control study is that it can provide rapid and useful information on a smaller sample size . there can be a problem of recall and selection bias in this type of design as an investigator relies on past information to determine the exposure status . for rare diseases or the diseases that have a long latency period between an exposure and outcome , case control studies are often the only feasible choice . case control study design we will now discuss here two clinical scenarios to illustrate the importance of matching the study design with the research question . overall , the study design tree can be divided into two broad categories of descriptive and analytical studies . while descriptive studies provide us with the information on the occurrence of certain outcomes over time , analytical studies quantify the association between a predictor and an outcome variable . case reports , case series , and cross - sectional surveys are the most commonly used descriptive study designs and are helpful in generating a hypothesis . a case report or a case study is the most basic descriptive study design and focuses on an individual with an unusual disease . a sequence of case reports is called case- series which is when more than one case is reported in a certain time frame and studied in detail . descriptive cross - sectional ( survey based ) are conducted to estimate the frequency and distribution of a disease . in these surveys , information is collected on several individuals at one point in time about their health status , behavior , or other risk factors . basic research designs analytical studies are divided into two main categories of observational and experimental designs , as shown in figure 2 . the key difference between observational and experimental study designs relates to the assignment of exposure . in experimental studies , researchers make a decision on the assignment of exposure or intervention , while in observational studies exposure is not assigned by the researcher . based on the study design , rcts can be classified into cross - over , parallel , and factorial designs . randomization is the only known mechanism to create balanced groups in all aspects except the exposure or intervention for known and unknown prognostic factors . however , rcts like any other designs are prone to biases if not implemented appropriately . we are intentionally not providing details on conduct of rcts as the focus of this paper is on observational study designs related to question domains of prognosis and diagnostic accuracy . in observational studies , as the name suggests , a specific population is observed versus assigned and the information is collected on outcomes according to exposure . that is , unlike experimental study designs , the investigator does not control the assignment of exposure and is only involved passively in collecting data on exposure followed by outcomes assessments . the three types of observational study designs are cohort , cross - sectional , and case - control . while cohort and cross - sectional studies are prospective in nature , case - control studies are retrospective that is , in the case of cohort and cross - sectional studies , exposure precedes the outcome , whereas in case - control studies , outcomes precede the exposure . a classic prospective cohort study design examines the association between health exposure and resultant outcomes . for example , a cohort study is helpful in estimating the incidence and etiologies of diseases as well as questions on prognosis . study subjects are grouped according to exposure status and followed over time to determine the incidence of outcome . the incidence of the disease in the exposed group is compared with the incidence of disease in the unexposed group . properly designed and conducted cohort studies offer several advantages . a key advantage is showing an appropriate temporal sequence between exposure and outcome . since exposure precedes outcome , it is easier to attribute the outcome to the exposure and is therefore best suited to assess an association between exposure and outcome . furthermore , cohort studies allow for the direct calculation of incidence rates in the exposed and unexposed groups summarized as risk ratios or relative risk . cohort studies are essentially key to address research questions associated with rare diseases due to the fact that exposure is determined first . it can be determined a priori if there is an adequate number of exposed and unexposed subjects [ figure 3 ] . some of the disadvantages of cohort studies include requirements of large sample size and longer time duration for follow - up . a cohort study is not feasible in cases of chronic diseases where the latency period is prolonged as well as in cases of rare diseases where the incidence is low . it is also important to note that due to the long time needed to follow - up , reassessment of exposure status is required . this has the potential to change during the course of follow - up leading to association with significant costs and logistical issues . due to the long course of follow - up , loss to follow - up is also a major challenge and a potential source of bias . prospective cohort study design analytical cross - sectional studies are useful to determine prevalence , which is important for clinical practice . prevalence provides information on the likelihood of a diagnosis and the predictive value of a diagnostic test . while differentiating cohort and cross - sectional studies , we can use the analogy of a picture versus a video . cohort studies are similar to a video which allows viewing the whole scenario over a period of time and permit multiple measurements unlike cross - sectional studies which are like a snapshot and permit measurement only at one time . that is , cross - sectional study design involves observation of a subset of a population for studying exposure and outcome variables at one point in time without any follow - up . cross - sectional study design is useful to assess the diagnostic accuracy of compared tests [ figure 4 ] . for example , the same study subject is given two diagnostic tests and associated observations with each test in terms of true positive , true negative versus false positive , or false negative are determined . in cohort or case control studies , there are two groups with different observations whereas in a cross - sectional study design , there are two observations from the same group . the most important advantage of cross - sectional studies is that they require no follow - up and therefore are relatively cheap to conduct requiring fewer resources . however , cross - sectional studies are not adequate in differentiating between cause and effect or the sequence of events . cross - sectional study design in contrast to cohort and cross - sectional studies , case control studies are retrospective . a case control study design provides an estimate on the strength of association between each predictor variable and the presence or absence of a disease . retrospectively , subjects with certain outcome or disease are selected and then matched with the normal controls . information is obtained from these subjects to estimate the prevalence of exposure to risk factors [ figure 5 ] . odds ratio is an appropriate measure to estimate the association between an exposure and an outcome . the major strength of a case control study is that it can provide rapid and useful information on a smaller sample size . there can be a problem of recall and selection bias in this type of design as an investigator relies on past information to determine the exposure status . for rare diseases or the diseases that have a long latency period between an exposure and outcome , case control studies are often the only feasible choice . case control study design we will now discuss here two clinical scenarios to illustrate the importance of matching the study design with the research question . a 30-year - old woman presents with progressive weakness of both legs for last 10 days . she has difficulty in walking , climbing stairs , and standing up from a sitting position . she has developed decreased sensation up to the level of umbilicus and urgency of micturition . all muscles of both lower limbs have decreased tone and power ( grades 3 to 4/5 ) with flexors weaker than extensors and absence of involuntary movements . there is a graded ( distal more than proximal ) sensory loss involving all modalities of sensation with a sensory level of d10 . all deep tendon reflexes are elicitable and plantars are extensor . subsequent mri of the brain reveals seven white matter t2 hyperintensities of variable size and location . a diagnosis is made of demyelinating disease of the central nervous system and intravenous methylprednisolone is prescribed . the patient is informed that her symptoms and test results will be monitored over time . she would like to know what her chances are of developing multiple sclerosis ( ms ) in the next few years . as evident from the clinical scenario , the primary question or concern of the patient pertains to the domain of prognosis . that is , among patients ( problem ) with the described symptoms ( intervention / exposure ) and those who do not have these symptoms ( control / no exposure ) , the question pertains to the incidence of ms ( outcome ) over time . it is obvious that in this case , an rct would be impossible to conduct . since the presence of symptoms can not be manipulated by an investigator , an experimental design can be ruled out . in this case , investigators can not randomize patients according to certain symptoms which brings observational study designs into consideration . another possible observational design is the cross - sectional study , which examines both exposure and outcome at the same time in the same group of people . this is clearly not a relevant study design for this scenario since the aim is to measure the incidence of the outcome between two groups over time . the next possibility is a case - control design . in the case - control study design , participants could be separated into those with ms and those without and then go retrospectively to assess the differences in terms of presence or absence of risk factors between the two groups . while this study design is feasible , there are two limitations first , because the primary interest is associated with several risk factors ( i.e. , composite outcome ) , this study could be subject to recall bias . second , incidence can not be calculated in a case - control study as patients can not be followed retrospectively . this leaves the cohort study as the best study design to answer the clinical research question on prognosis . in this scenario , subjects would be separated into those that have the described symptoms and those that do not . they would then be followed over time and the incidence of ms in the exposed group would be compared to the incidence of ms in the unexposed group . from this data , the relative risk would be calculated . a 30-year - old woman presents with progressive weakness of both legs for last 10 days . she has difficulty in walking , climbing stairs , and standing up from a sitting position . she has developed decreased sensation up to the level of umbilicus and urgency of micturition . all muscles of both lower limbs have decreased tone and power ( grades 3 to 4/5 ) with flexors weaker than extensors and absence of involuntary movements . there is a graded ( distal more than proximal ) sensory loss involving all modalities of sensation with a sensory level of d10 . all deep tendon reflexes are elicitable and plantars are extensor . subsequent mri of the brain reveals seven white matter t2 hyperintensities of variable size and location . a diagnosis is made of demyelinating disease of the central nervous system and intravenous methylprednisolone is prescribed . the patient is informed that her symptoms and test results will be monitored over time . she would like to know what her chances are of developing multiple sclerosis ( ms ) in the next few years . as evident from the clinical scenario , the primary question or concern of the patient pertains to the domain of prognosis . that is , among patients ( problem ) with the described symptoms ( intervention / exposure ) and those who do not have these symptoms ( control / no exposure ) , the question pertains to the incidence of ms ( outcome ) over time . it is obvious that in this case , an rct would be impossible to conduct . since the presence of symptoms can not be manipulated by an investigator , an experimental design can be ruled out . in this case , investigators can not randomize patients according to certain symptoms which brings observational study designs into consideration . another possible observational design is the cross - sectional study , which examines both exposure and outcome at the same time in the same group of people . this is clearly not a relevant study design for this scenario since the aim is to measure the incidence of the outcome between two groups over time . the next possibility is a case - control design . in the case - control study design , participants could be separated into those with ms and those without and then go retrospectively to assess the differences in terms of presence or absence of risk factors between the two groups . while this study design is feasible , there are two limitations first , because the primary interest is associated with several risk factors ( i.e. , composite outcome ) , this study could be subject to recall bias . second , incidence can not be calculated in a case - control study as patients can not be followed retrospectively . this leaves the cohort study as the best study design to answer the clinical research question on prognosis . in this scenario , subjects would be separated into those that have the described symptoms and those that do not . they would then be followed over time and the incidence of ms in the exposed group would be compared to the incidence of ms in the unexposed group . from this data , the relative risk would be calculated . she had her first child when she was 35 years old and had an amniocentesis at 18 weeks to test for down syndrome . she is currently 8 weeks pregnant and would like to know as soon as possible of any abnormalities . an ultrasound can be done in the first trimester for diagnosing down syndrome , but it is unknown if the results are as reliable as the conventional test of amniocentesis . the question can be formulated as follows : among pregnant women over the age of 35 ( patient / problem ) , what is the accuracy of ultrasound ( intervention / experimental test ) compared to amniocentesis ( control / conventional test ) in detecting down syndrome in fetus ( outcome ) ? again , the rct can be eliminated because , in order to determine diagnostic accuracy in an unbiased manner , both tests need to be administered to the same subset of the population . in the case - control study , subjects with the outcome of interest are selected and then matched with healthy controls . since we do not know whether or not the outcome of down syndrome is present , a case - control study can not be used . the cohort study group 's subjects are selected based on exposure status followed over time and the incidence of the outcome is calculated . in this clinical scenario , no exposure is described and we are not interested in calculating the incidence of down syndrome . accordingly , the characteristics of the cross - sectional study make it the best choice to answer this clinical research question . a cross - sectional study would allow two observations from the same group to be determined . in this case , a sample of pregnant women over the age of 35 would be given both an ultrasound and amniocentesis . the results of the tests would be recorded and the number of true positives and negatives versus the false positives and negatives would be calculated along with positive and negative predictive values . she had her first child when she was 35 years old and had an amniocentesis at 18 weeks to test for down syndrome . she is currently 8 weeks pregnant and would like to know as soon as possible of any abnormalities . an ultrasound can be done in the first trimester for diagnosing down syndrome , but it is unknown if the results are as reliable as the conventional test of amniocentesis . the question can be formulated as follows : among pregnant women over the age of 35 ( patient / problem ) , what is the accuracy of ultrasound ( intervention / experimental test ) compared to amniocentesis ( control / conventional test ) in detecting down syndrome in fetus ( outcome ) ? again , the rct can be eliminated because , in order to determine diagnostic accuracy in an unbiased manner , both tests need to be administered to the same subset of the population . in the case - control study , subjects with the outcome of interest are selected and then matched with healthy controls . since we do not know whether or not the outcome of down syndrome is present , a case - control study can not be used . the cohort study group 's subjects are selected based on exposure status followed over time and the incidence of the outcome is calculated . in this clinical scenario , no exposure is described and we are not interested in calculating the incidence of down syndrome . accordingly , the characteristics of the cross - sectional study make it the best choice to answer this clinical research question . a cross - sectional study would allow two observations from the same group to be determined . in this case , a sample of pregnant women over the age of 35 would be given both an ultrasound and amniocentesis . the results of the tests would be recorded and the number of true positives and negatives versus the false positives and negatives would be calculated along with positive and negative predictive values . in this paper , we primarily focus on the observational study designs of cohort , case - control , and cross - sectional studies . through the overview of study designs and demonstration of case scenarios , it is clear that the choice of study design is a function of the clinical research question . while rcts provide most unbiased answers to questions related to efficacy of competing interventions , they are not suited to answer questions related to prognosis or diagnostic accuracy issues . therefore , investigators are encouraged to match the clinical research question to an appropriate study design according to the question domains . a thorough understanding of the research question is necessary in order to select the best study design .

the importance of randomized controlled trials ( rcts ) versus observational studies has been debated for several years . however , the question is not whether rcts are better than observational study designs . rcts certainly provide the most unbiased answers in scenarios where it is logistically and ethically feasible to conduct both rcts and observational studies . that is , study design is not a choice but a function of matching the research question to provide the most unbiased answers . the basic concept that underpins every clinical research project is the requirement of a clearly defined research question domain . broadly , the clinical research question domain relates to prognosis , diagnostic accuracy , treatment or adverse events . while rcts provide the most unbiased answers on questions related to the efficacy of treatments , other designs are better suited to answer questions related to prognosis or diagnostic accuracy of tests . in this paper , we illustrate the significance of matching study design to the research question domain while using clinical scenarios as an example . although there are several other question domains that also concern the practice of medicine , we are only focusing on study designs concerning the issue of prognosis and diagnostic accuracy in this paper .

there is persuasive evidence that obesity increases , whilst regular physical activity reduces the risk of cardiovascular disease . however , contradictory findings from previous studies has led to debate about the relative importance of weight and physical activity with respect to risk of future adverse health outcomes [ 35 ] . two studies have shown that the risk of all - cause mortality among overweight but fit men was similar to or less than the risk among healthy weight unfit men , leading to the hypothesis that cardiovascular fitness may offset the health risks of being overweight . in contrast , physical activity , rather than cardiovascular fitness , has not been found to negate the excess mortality or cardiovascular risk resulting from being overweight or obese [ 812 ] . in keeping with this , there is evidence that physical activity also does not completely counteract the risk of diabetes among overweight or obese individuals . however , little is known about the effect of physical activity on the association between weight and hypertension . to our knowledge , only one previous prospective population - based study has addressed this issue . in it , hu et al . found that among women , physical activity attenuated the increased risk of hypertension associated with higher weight , but there was little difference in risk between overweight physically active women and normal weight physically inactive women . however , bmi and physical activity were measured at one time point only , and the authors did not distinguish between overweight and obese participants . as both physical activity and bmi are likely to change over time , and the effects of physical activity may be different for overweight and obese women , we aimed to investigate relationships between both physical activity and bmi and risk of hypertension and the extent , if any , to which physical activity moderates the effect of bmi on risk of incident hypertension among mid - aged participants in the australian longitudinal study on women 's health . we included participants from the australian longitudinal study on women 's health ( alswh ) , a national population - based study of women born in 192126 , 194651 , and 197378 . women were randomly selected from the medicare database , which covers all citizens and permanent residents of australia , including refugees and immigrants . women born in 194651 , and thus aged 4550 at baseline , were first surveyed , using self - completed questionnaires , in 1996 ( survey 1 , s1 ) and again in 1998 ( survey 2 , s2 ) , 2001 ( survey 3 , s3 ) , 2004 ( survey 4 , s4 ) , 2007 ( survey 5 , s5 ) , and 2010 ( survey 6 , s6 ) . we included women from the 194651 cohort who reported no history of hypertension at baseline and were not underweight at baseline or at followup . we included those who responded to at least two sequential surveys and who had complete data on all exposures and hypertension at the appropriate time points . at each survey , bmi was computed as self - reported weight ( kg)/height ( m ) and categorized as healthy weight ( 18.524.9 kg / m ) , overweight ( 2529.9 kg / m ) , or obese ( 30 kg / m ) . at s1 , the weekly frequency of exercise ( never = 0 ; once a week = 1 ; 2 or 3 times per week = 2.5 ; 46 times per week = 5 ; every day = 7 ; and more than once a day = 10 ) was multiplied by the intensity of activity ( vigorous = 5 ( e.g. , aerobics , jogging ) and less vigorous = 3 ( e.g. , walking and swimming ) ) . the resulting physical activity scores ranged from 0 to 50 and were categorized as none ( < 5 ) , low ( 5 to < 15 ) , moderate ( 15 to < 25 ) , or high ( 25 ) . at s2 to s6 , physical activity was assessed using modified ( self - report ) version of the active australia questionnaire . the women were asked to report frequency and total duration of walking , moderate , and vigorous intensity leisure time physical activity during the last week . a physical activity score in metabolic equivalent ( met ) minutes per week was derived using the following formula : metmin / week = ( walking minutes 3.5 mets ) + ( moderate minutes 4.0 mets ) + ( vigorous minutes 7.5 mets ) . physical activity was categorized as sedentary ( 039 metabolic equivalent ( met ) min / wk ) , low ( 40599 met min / wk ) , moderate ( 6001199 met min / wk ) , and high ( 1200 met min / wk ) , based on international guidelines . we created a composite variable of bmi and physical activity , thereby creating 12 categories of each possible bmi / physical activity combination at each survey . smoking at each survey was categorised as never , ex - smoker , or current smoker . alcohol intake was categorized as non / rarely drinker ( less than once per month ) ; low risk ( up to 14 drinks per week ) ; or risky drinkers ( 15 or more drinks per week ) . education , ascertained at s1 , was categorised as no formal qualifications ; school certificate ; trade / apprenticeship ; or higher education . at s1 women were asked if they had ever been diagnosed with or treated for diabetes mellitus , heart disease , stroke , or hypertension . at subsequent surveys they were asked if they had been diagnosed with these conditions in the three - year period since the previous survey . women were classified as having diabetes if they reported having been diagnosed with or treated for diabetes by a doctor . a history of cardiovascular disease was defined as present if women reported having been diagnosed with or treated for heart disease or stroke by a doctor . new cases of hypertension were identified through self - report at s2 to s6 . to account for multiple observations for each participant , we used generalised estimating equation regression models for binary outcome data ( using an unstructured correlation structure and a logit link function ) . we calculated odds ratios ( ors ) with 95% confidence intervals ( cis ) for the association between each of bmi and physical activity ( included as time - varying covariates ) and incident hypertension . women who reported hypertension at any survey did not contribute to the analyses of time periods thereafter . we calculated crude ors before adjusting for age and education at baseline and history of cardiovascular disease , diabetes , smoking , and alcohol , as time - varying covariates . once women reported cardiovascular disease or diabetes , they were considered to have that condition at subsequent surveys . we examined the joint association between bmi and physical activity by comparing the odds of hypertension in each combined bmi / physical activity category with the odds in the reference category of healthy weight and high physical activity . we also performed a sensitivity analysis , where we repeated the primary analysis but excluded the women with a history of diabetes or cvd at baseline . this paper was prepared in accordance with the strengthening the reporting of observational studies in epidemiology ( strobe ) statement . of 13,715 women recruited at baseline , 3001 had a previous history of hypertension and 375 were underweight at one or more time points . of the remaining women , 72 did not respond to the question on hypertension at baseline and 1050 did not have complete data on all exposures and the outcome for at least two consecutive surveys . therefore , data from 9217 ( 89% ) women were included in the analyses ( figure 1 ) . in general , women who were excluded due to nonreturn of surveys or incomplete data were less healthy and had a lower education level than those who were included in the analyses ( table 1 ) . there was no difference between included and excluded women in terms of bmi at baseline , but a greater proportion of excluded women were sedentary . at baseline , the mean age of included women was 47.6 ( 1.5 ) years and 5097 ( 56.5% ) were of healthy weight . almost a fifth of all women were highly physically active , a quarter were moderately active , a third reported low physical activity , and a quarter were classified as participating in no physical activity . as shown in table 2 , we compared baseline characteristics of women in the three weight categories at baseline . during followup , 2260 incident hypertension cases were identified , giving a hypertension prevalence of 24.5% in 2010 . the odds of developing hypertension were almost double ( adjusted or 1.92 , 95% ci 1.72 , 2.15 ) in overweight women and more than three times higher ( adjusted or 3.52 , 95% ci 3.12 , 3.97 ) in obese women than in healthy weight women ( p for trend < 0.001 ; table 3 ) . the effect of physical activity on hypertension risk was less marked , but still evident . compared with high active women , odds of hypertension were not significantly higher in those who reported moderate activity , but 26% higher in those who reported low physical activity ( adjusted or 1.26 , 95% ci 1.11 , 1.43 ) and 28% higher in those who reported no physical activity ( adjusted or 1.28 , 95% ci 1.11 , 1.47 , p for trend < 0.001 ; table 3 ) . a formal test for interaction between bmi and physical activity revealed a significant interaction ( p value < 0.0001 ) . the odds of hypertension were 37% higher in healthy weight inactive women than in healthy weight high active women ( adjusted or 1.37 , 95% ci 1.05 , 1.78 ; table 4 ) . compared with healthy weight women , overweight and obese women also had increased odds of hypertension , irrespective of activity level ( table 4 ; figure 2 ) . however , physical activity reduced the effect of bmi on hypertension , and this was more apparent for obese than for overweight women . the odds of hypertension were 3.4 times higher in obese high active women ( adjusted or 3.43 , 95% ci 2.68 , 4.39 ) and 4.9 times higher in obese inactive women ( adjusted or 4.91 , 95% ci 3.92 , 6.13 ) than in healthy weight high active women ( table 4 ) . physical activity therefore reduced but did not remove the effect of obesity on hypertension risk ( figure 2 ) . we found similar results in a sensitivity analysis where we excluded women with a history of diabetes or cvd at baseline ( data not shown ) . in this population of mid - aged women , both high bmi and low physical activity were individually associated with an increased risk of hypertension , but the effects were more marked for bmi than for physical activity . when the joint associations of bmi and physical activity with hypertension were studied , we found that being active attenuated but did not eliminate the excess risk of hypertension associated with being overweight or obese . odds of hypertension were almost twice as high in women who were obese but physically active as in healthy weight inactive women . our results are consistent with previous findings on the joint association of obesity and physical activity with diabetes , cardiovascular morbidity , and mortality [ 812 ] . all these studies found that bmi and physical activity independently predicted incidence of diabetes and chd , but that physical activity did not completely counteract the risk among overweight or obese individuals . similarly , one study found that multiple low - risk lifestyle factors were significantly associated with lower risk of hypertension among normal weight and overweight women , but not among obese women . until now , only one prospective study had examined the joint associations of bmi and physical activity with incidence of hypertension . similar to our findings , this study showed that physical activity attenuated the increased risk of hypertension associated with weight . however , this study showed little difference in risk between overweight active women and normal weight inactive women . in contrast , we found that the risk of hypertension was higher in obese active women than in healthy weight inactive women . our findings therefore suggest that even high levels of physical activity can not completely negate the increased risk of hypertension associated with overweight and obesity . differences in findings may be explained in part by the diversity of hypertension , physical activity , and bmi measures . we used a self - reported measure of hypertension , whereas the previous study defined hypertension on the basis of national data for hypertension treatment . furthermore , physical activity in the previous study included occupational , commuting , and leisure time physical activity , whereas our measure did not include occupational activity . however , unlike our study , the previous study collected data on exposures at baseline only and any changes in exposure during followup were therefore not accounted for . this is important because bmi typically increases with age , especially during mid - age . this is important because the risk of hypertension was much higher and the effects of activity more marked in the obese women in our study . it has been suggested that moderate to high levels of cardiovascular fitness , in contrast to physical activity , completely eliminate the increased mortality or cardiovascular risk associated with obesity [ 6 , 7 ] . in the present study however , a recent study of the association between hypertension and cardiorespiratory fitness found that the adverse contribution of baseline bmi to the risk of hypertension was substantially attenuated , but not eliminated , after controlling for cardiorespiratory fitness . however , this study was small and the findings need to be replicated in larger prospective studies . however , self - reported height and weight have been shown to be valid for calculating bmi in this cohort . the physical activity questionnaire in this study has also been found to have measurement properties which compare favourably with those of other commonly used physical activity measures . moreover , studies that compared self - reported hypertension against medical records , indicated good validity of self - reported hypertension [ 24 , 25 ] . a validation study found that 86% of self - reported hypertension cases were verified by medical records . in addition , the prevalence of self - reported hypertension is also in line with the worldwide hypertension prevalence in women . it is also likely that any misclassification will have occurred at random , which may have attenuated the observed findings toward the null , leading to an underestimate of effect estimates . concordance between self - report of cardiovascular disease with health records has been found to be substantial . some misclassification may have occurred , but again this is more likely to have occurred at random . second , although we adjusted for a range of major lifestyle , biological and psychosocial risk factors for hypertension , residual confounding due to unmeasured factors , such as diet ( including salt intake ) and presence of prehypertension , can not be excluded . third , our study population included mid - aged women and thus we can not necessarily extrapolate our results to women outside this age group or to men . further study is therefore warranted in more diverse populations . finally , we assessed adiposity through bmi measurement . although bmi is correlated with percentage body fat , other clinical measures of adiposity , such as waist circumference or waist hip ratio , may be a better predictor of hypertension and should be examined in future studies . to our knowledge , this study is one of the first to examine the combined effects of bmi and physical activity on incidence of hypertension . our study population was large and community - based which allows us to extrapolate our findings to other middle - aged women . a further strength is the long duration of followup and subsequent large number of accrued hypertension cases , leading to sufficient power for assessing the joint effects of physical activity and bmi . the longitudinal approach of the alswh , with repeated measures of exposures and confounders , enabled us to model bmi and physical activity more accurately over time and to take into account changes in exposure variables during followup . furthermore , the large study sample allowed us to differentiate between obese and overweight women . both elevated bmi and reduced physical activity appear to play an important role in the development of hypertension . the lowest odds of hypertension were in healthy women who reported moderate or high levels of physical activity , thus reinforcing the importance of maintaining a healthy weight and being physically active to reduce the risk of hypertension in mid - aged women , who often find weight reduction difficult . risk of hypertension associated with overweight and obesity was however reduced considerably by increased physical activity levels . further large prospective studies in both men and women , with more objective measures of bmi , physical activity , and hypertension , along with measurement of cardiorespiratory fitness , are needed to confirm our findings .

introduction . there is debate as to whether physical activity counteracts the adverse effect of weight on health outcomes . we investigated how physical activity modifies the effect of body mass index ( bmi ) on hypertension risk . methods . bmi , physical activity , and hypertension were measured at baseline and at three - year interval for 14 years ( from 1996 to 2010 ) , in 10,339 participants in the australian longitudinal study on women 's health . generalised estimating equation models for binary repeated measures were performed to determine the individual and joint effects of bmi and physical activity on incident hypertension . results . at baseline ( mean age 47.6 1.5 sd ) , 57% were healthy weight , 28% overweight , and 14% obese . increasing bmi and decreasing physical activity were associated with increased risk of hypertension . physical activity attenuated the positive association between weight and risk of hypertension , especially for obese women . compared to healthy weight high active women , risk of hypertension in obese high active women was 3.4 times greater ( or 3.43 , 95% ci 2.68 , 4.39 ) and in obese inactive women 4.9 times greater ( or 4.91 , 95% ci 3.92 , 6.13 ) . conclusions . both physical activity and maintenance of a healthy body weight are associated with lower risk of hypertension . physical activity reduced but did not remove the effect of obesity on hypertension risk .

ocular discomfort often manifests when viewing certain image types , such as repetitive striped patterns . the intensity of these effects will vary according to individual susceptibility and the precise nature of the pattern , most notably , its spatial frequency and contrast level . an adverse response when viewing stimuli of this type , i.e. , striped patterns , has been termed patterned glare and latterly pattern glare . for susceptible individuals , this can result in visual stress , giving rise to symptoms of eyestrain , headaches and glare , along with illusions of colors , shapes , and motion . the symptoms that arise from pattern glare susceptibility , resulting in visual stress , are often referred to by their historically derived terms , meares irlen syndrome and scotopic sensitivity syndrome and more recently referred to by the acronym misvis , which denotes the title meares irlen syndrome / visual stress . the characteristics of the visual stimulus , which cause ( or at least contribute in generating visual stress ) is sensory in origin and therefore distinguishable from factors of motor origin , such as oculomotor balance , binocular vergence , and accommodation . the visual perceptual distortions that are generated by susceptibility to pattern glare is maximal when the spatial frequency of the stimulus is around three cycles per degree , with a pattern of even width and spacing , high contrast and viewed binocularly [ 1 , 2 ] . many of the attributes necessary to generate pattern glare in the susceptible individual are present within standard text documents formed by the individual rows of words separated by the successive spacing between rows [ 3 , 9 , 10 ] . the spatial frequency of this alternating high contrast pattern , formed by text , has been shown to fall within the range known to generate pattern glare symptoms . this is coupled with striped patterns formed by letter strokes in individual words , as well as the vertical strokes of letters that also have a spatial frequency falling within a range sufficient to generate pattern glare symptoms in susceptible individuals . although the origins of pattern glare and visual stress are equivocal , it is thought that these effects arise due to cortical hyper - excitability [ 2 , 7 , 1214 ] . pattern glare has been shown to be associated with a range of neurological conditions including photosensitive epilepsy , migraine [ 13 , 16 , 17 ] , dyslexia [ 1821 ] , autism , multiple sclerosis , as well as misvis [ 24 , 25 ] . hitherto , there is little evidence detailing the existence of pattern glare in other neurological conditions , such as stroke . some evidence has emerged from symptom - based investigation , where patients with traumatic brain injuries , including stroke , have demonstrated visual perceptual symptoms , which include light - sensitivity , strain , fatigue and reading difficulties which were subsequently reduced with the intervention of optimally selected tinted spectacle lenses . other reports have recognized a susceptibility to photophobia following traumatic brain injury and these individuals have shown improvements in reading ability with the use of photochromic filters . further evidence recognizes that many brain injury patients , including those with stroke , have difficulty with reading , such as skipping lines of text , and difficulty moving to the next row of print , albeit with the suggestion that these problems arise from motor rather than sensory origin . it has been shown that even following minor head injuries , particularly those involving concussion , subjects demonstrate a lowered tolerance to brightness and sound ; this is supported by earlier evidence of photophobia and sound sensitivity in patients with closed head injury . measures of critical flicker frequency have also been found to be elevated in those with mild traumatic brain injury , with accompanying symptoms of light and motion sensitivity . it has been proposed that neurological disinhibition , as a result of the brain injury , may cause the subjective hypersensitivity to light and motion in these individuals ; this theory supports earlier work , which demonstrated hyperexcitability in the visual cortex , in patients with homonymous hemianopia , following stroke . stroke is the second leading cause of mortality , accounting for 9% of all deaths around the world , and is major cause of disability . the average age - adjusted stroke mortality for developed countries is around 50100 per 100,000 people . with the burden of an ageing population considering the paucity of literature to date , it would seem logical to determine if there is an association between pattern glare and stroke . consequently , the purpose of this study is to measure pattern glare susceptibility in stroke subjects as determined by the pattern glare test . twenty stroke participants were recruited along with an equivalent number of age and gender - matched control subjects . suitable candidates for this project were recruited by displaying notices at the research venue ( the optometric practice of the investigator ) requesting volunteers . all candidates had been discharged from the care of the hospital department involved in the treatment of their stroke . the stroke participants consisted of 11 females and nine males with an age range of 3885 years ( mean 66.4 sd 13.43 years ) . the control participants had an age range of 3684 years ( mean 57.9 , sd 13.91 years ) consisting of 11 females and nine males . these groups were calculated as being age - matched ( unpaired t test : t = 1.813 , df = 38 , p = 0.078 ) . the time since the stroke ( or most recent stroke ) had a range of 0.8312 years ( mean 4.66 , sd 3.31 years ) . prior to commencing the research , ethical approval was obtained from aston university s audiology / optometry research ethics committee with the study designed to follow the tenets of the declaration of helsinki . each subject was given detailed information regarding the nature of the study , both verbally and in written form ; this allowed informed consent to take place prior to their participation . the participants were required to complete a short questionnaire to ensure that they met the inclusion criteria . this was also necessary to pre - determine if any of the subjects had conditions that could potentially predispose them to pattern glare , e.g. , migraine . crucially , they were asked to confirm if they had suffered from any epileptic seizures , as this was the principal exclusion criterion for the study . subjects were also asked to confirm if they were dyslexic , autistic , or suffered from multiple sclerosis , or migraine . all subjects demonstrated that they were able to read n8 sized print at 40 cm with their habitual spectacle correction , prior to undertaking the pattern glare test . from the initial questionnaires , two migraine sufferers were identified within the stroke participants and three migraine sufferers within the control subjects . none of the subjects in either group reported a diagnosis of dyslexia , autism , multiple sclerosis or epilepsy . one stroke participant ( subject 2 ) , had reported using a colored overlay and latterly , precision tinted lenses , on a regular basis , since having her stroke a few years prior , although these were not used whilst undertaking the pattern glare test . the pattern glare test is designed to induce visual perceptual distortions in susceptible subjects and is now considered to be an established , efficient way to identify individuals with visual stress . it is a simple test , consisting of three high - contrast gratings , each subtending 13.63 at the eye when viewed at 40 cm . each pattern has a duty cycle of 50% with their grating orientation set horizontally to mimic text . the first pattern has a low spatial frequency ( low - sf ) of 0.3 cycles per degree ( cpd ) , designed to trigger relatively few distortions and unlikely to have an association with headaches and eyestrain ; this first pattern , therefore , serves as a useful control for suggestive individuals . the second pattern is designed to elicit maximum distortions , with a mid - spatial frequency ( mid - sf ) of 2.3 cpd and those who respond adversely to this pattern are likely to experience symptoms of visual stress in their everyday environment . the third high - contrast grating serves as another control with a higher spatial frequency ( high - sf ) of 9.4 cpd and it would be expected that this would generate fewer symptoms than the second pattern . the patterns are viewed in succession and the numbers of symptoms generated are summed to give a pattern glare score for each of the gratings . pattern glare would be suggested if the patient responds with a high score on the mid - sf grating and/or a score with the mid - sf pattern , which is greater that the score with the high - sf grating , the so - called mid - high difference variable . this relative , rather than absolute , mid - high difference measure allows for normalization of the subject by accounting for suggestive individuals . normative values for the pattern glare test have been established , taking into account that only a high test score should be regarded as clinically significant . the normal range for the mid - sf pattern has been shown as a pattern glare score of < 4 , and an upper limit of the normal range for the mid - high difference variable as being 1 . in other words , those with a pattern glare test score of > 3 on the mid - sf grating , or a score of > 1 on the mid - high difference variable demonstrate an abnormal degree of pattern glare . the literature also shows that individuals with relatively low visual discomfort are more likely to report distortions with the high - sf than the mid - sf grating ; this is attributable to a greater influence of optical factors when viewing this finer grating rather than symptoms of neurological origin . it has been shown that pattern glare scores are similar in males and females . when considering age , younger participants were found to report more distortions on the mid - sf and the high - sf gratings than older subjects . overall , with advancing age , there was found to be a greater decrease with the high - sf grating than the mid - sf grating which in turn , results in a small overall increase in the mid - high difference variable , although this was not found to be of statistical significance . migraine sufferers were found to score similarly to a control population when viewing each grating in turn , however they were found to score significantly higher when considering the mid - high difference variable . all subjects were asked to perform the pattern glare test in line with the developer s instructions . the subjects were asked to view pattern 1 at 40 cm ( low - sf ) , concentrating on the central square in the pattern for 5 s. they were then asked to report if any of the following effects were noticed : ( 1 ) colors , ( 2 ) bending of lines , ( 3 ) blurring of lines , ( 4 ) shimmering or flickering , ( 5 ) fading , ( 6 ) shadowy shapes ( 7 ) any other effects ( to be specified ) . the subjects were also asked to specify if any of these effects were more noticeable mainly on the left side , right side or both sides of the pattern . the process was then repeated for pattern 2 ( mid - sf ) and finally for pattern 3 ( high - sf ) . the numbers of symptoms reported were then added to give an individual pattern glare score for each of the three patterns . the scores for the high - sf grating were subtracted from the mid - sf grating to determine the mid - high difference variable . all data were analyzed using the commercially available software ( pasw , v. 18 , ibm , new york , usa ) . . a significance level of = 0.05 was used throughout the analysis . all data were analyzed using the commercially available software ( pasw , v. 18 , ibm , new york , usa ) . . a significance level of = 0.05 was used throughout the analysis . a summary of the data from the questionnaire and pattern glare test for the stroke and control participants can be seen in tables 1 and 2 , respectively.table 1data from questionnaire and results from pattern glare test for stroke subjectsstroke subjectagegenderdetailpgs mid - sfpgs mid - high differencepgs high - sf183female550238femaleprecision tint624364female532472male110571male532652male541777female321865male220962male3211069female0001156femalemigraine2201249female3301376female1101443male4221581female1101680female5411774female3211872malemigraine2201959male0002085male220table 2data from questionnaire and results from pattern glare test for control subjectscontrol subjectagegenderdetailpgs mid - sfpgs mid - high differencepgs high - sf145femalemigraine110238male202363male011468female000570female022655female112784female202836femalemigraine110938male2111062femalemigraine1101155male0111260male3121350male3251468female1121583male1101661male1101760male4131854female4041940female4222078female202 data from questionnaire and results from pattern glare test for stroke subjects data from questionnaire and results from pattern glare test for control subjects data for the mid - sf pattern were found to be normally distributed for the stroke participants ( p = 0.579 ) and also for the control subjects ( p = 0.219 ) . for the relative score of the mid - high cpd difference , the data were also normally distributed for the stroke subjects ( p = 0.174 ) as well as the control participants ( p = 0.202 ) . data for the stroke participants responses to the high - sf pattern were not found to exhibit a normal distribution ( p = 0.045 ) . however , for the control subjects these data were normally distributed ( p = 0.271 ) . statistical analysis of the pattern glare scores ( see table 3 ; fig . 1 ) showed significantly higher values for the stroke participants versus control subjects when viewing the mid - sf pattern ( unpaired t test : t = 2.457 , df = 38 , p = 0.019 ) ; this was also the case when comparing the relative score of the mid - high difference ( unpaired t test : t = 5.421 , df = 38 , p < 0.0001 ) . when subjects were asked to view the high - sf spatial frequency grating , however , the control subjects yielded a higher pattern glare score than the stroke subjects ( mann whitney u test : p = 0.040).table 3results from the pattern glare test detailing mean pattern glare scores for stroke and control participantsscore ( mean sd)score ( mean sd)mid - sf2.9 1.831.65 1.35mid - high difference2.15 1.270.10 1.12high - sf0.75 1.071.55 1.39stroke ( n = 20)control ( n = 20)fig . 1mean pattern glare scores , from the pattern glare test , for stroke and control participants . statistically significant elevation of pattern glare scores were found for the stroke subjects when considering the mid - sf grating , and most notably , the mid - high difference variable results from the pattern glare test detailing mean pattern glare scores for stroke and control participants mean pattern glare scores , from the pattern glare test , for stroke and control participants . statistically significant elevation of pattern glare scores were found for the stroke subjects when considering the mid - sf grating , and most notably , the mid - high difference variable one of the stroke participants ( subject 2 ) had reported during the initial questionnaire that she had previously used spectral filters and continued to use precision tinted lenses on an on - going basis . although these were not worn whilst undertaking the pattern glare test , the prolonged use of filters may have potentially altered performance on a test designed to induce visual stress . it is of interest to highlight , however , that this subject did score highly when viewing the mid - sf pattern ( pattern glare score = 6 ) , and moderately so on the relative score of the mid - high difference ( pattern glare score = 2 ) . notwithstanding this , the data were considered again , with this subject omitted from all subsequent analyses . with the removal of this subject , the mean age of the stroke group ( mean 67.89 , sd 11.97 years ) was higher than the control participants ( mean 58.40 , sd 14.46 years ; unpaired t test : t = 2.227 , df = 37 , p = 0.032 ) . this new data set were found to follow a normal distribution for scores on the mid - sf grating ( p = 0.656 ) as well as for the relative score mid - high difference ( p = 0.256 ) but not when considering data for the high - sf grating ( p = 0.017 ) . 2 ) , were comparable with earlier measures , demonstrating that the stroke participants score more highly on the mid - sf grating ( unpaired t test : t = 2.197 , df = 37 , p = 0.034 ) , and the mid - high difference variable ( unpaired t test : t = 5.301 , df = 37 , p = 0.000 ) , whereas they score lower on the high - sf grating than control subjects ( mann whitney u test : p = 0.016).table 4results from the pattern glare test detailing mean pattern glare scores for stroke and control participants , with the exclusion of subject 2 from the stroke groupspatial frequencyscore ( mean sd)score ( mean sd)mid - sf2.74 1.731.65 1.35mid - high difference2.16 1.300.10 1.12high - sf0.58 0.771.55 1.39stroke ( n = 19)control ( n = 20)fig . 2mean pattern glare scores , from the pattern glare test , for stroke and control participants , with the exclusion of stroke subject 2 results from the pattern glare test detailing mean pattern glare scores for stroke and control participants , with the exclusion of subject 2 from the stroke group mean pattern glare scores , from the pattern glare test , for stroke and control participants , with the exclusion of stroke subject 2 the data were also considered for the effect of gender in the stroke group . the males ( mean 64.56 , sd 12.40 years ) in the stroke group were slightly younger than the females ( mean 70.90 , sd 11.34 years ) , ( unpaired t test : t = 1.165 , df = 17 , p = 0.260 ) . the data were found to follow a normal distribution for the males when viewing the mid - sf pattern ( p = 0.842 ) , and for the mid - high difference variable ( p = 0.491 ) , as well as for the high - sf grating ( p = 0.265 ) . the data were also found to be normally distributed for the females on the mid - sf grating ( p = 0.874 ) , the mid - high difference variable ( p = 0.904 ) , and the high - sf pattern ( p = 0.149 ) . the results ( see table 5 ; fig . 3 ) , revealed a marginally higher pattern glare score for the females compared to the males when viewing the mid - sf grating ( unpaired t test : t = 0.163 , df = 17 , p = 0.872 ) . the females also demonstrated a higher mid - high difference variable score than the males , ( unpaired t test : t = 0.491 , df = 17 , p = 0.630 ) . conversely , the males recorded a higher score when viewing the high - sf pattern ( unpaired t test : t = 0.462 , df = 17 , p = 0.650).table 5results from the pattern glare test detailing mean pattern glare scores for gender comparison within the stroke groupspatial frequencyscore ( mean sd)score ( mean sd)mid - sf2.66 1.732.80 1.81mid - high difference2.00 1.112.30 1.49high - sf0.66 0.870.50 0.71male ( n = 9)female ( n = 10)fig . 3mean pattern glare scores from the pattern glare test for male and female stroke participants . results showed no statistically significant difference between the gender types for any of the measures results from the pattern glare test detailing mean pattern glare scores for gender comparison within the stroke group mean pattern glare scores from the pattern glare test for male and female stroke participants . results showed no statistically significant difference between the gender types for any of the measures as pattern glare has a known association with migraine , the data were examined with the respective migraine sufferers in each group removed from the analysis . these groups were found to be age - matched for the stroke group ( mean 68.35 , sd 12.29 years ) and the control group ( mean 60.29 , sd 14.18 years ; unpaired t test : t = 1.770 , df = 32 , p = 0.086 ) . the data for the stroke group with the migraine sufferers removed , were found to be normally distributed for the mid - sf pattern ( p = 0.644 ) , the mid - high difference variable ( p = 0.518 ) and the high - sf grating ( p = 0.056 ) ; this was also the case for the control group for the mid - sf pattern ( p = 0.687 ) , the mid - high difference variable ( p = 0.671 ) , and the high - sf grating ( p = 0.165 ) . the results for this modified data set ( see table 6 ; fig . 4 ) , showed that the stroke subjects exhibited higher pattern glare scores than the control subjects when viewing the mid - sf grating ( unpaired t test : t = 1.888 , df = 32 , p = 0.068 ) , as well as for the relative score of the mid - high difference variable ( unpaired t test : t = 5.141 , df = 32 , p = 0.0000 ) . consistent with earlier measures , the stroke subjects scored much lower on the pattern glare test , when viewing the high - sf pattern , compared to the control group ( unpaired t test : t = 3.133 , df = 32 , p = 0.004).table 6results from the pattern glare test detailing mean pattern glare scores for stroke and control participants , with the exclusion of migraine subjectsspatial frequencyscore ( mean sd)score ( mean sd)mid - sf2.82 1.811.76 1.44mid - high difference2.18 1.380.06 1.14high - sf0.65 0.791.82 1.33stroke ( n = 17)control ( n = 17)fig . 4mean pattern glare scores from the pattern glare test for stroke and control participants , with the exclusion of migraine subjects . statistically significant elevation of pattern glare scores were found for the stroke subjects , when considering the mid - high difference variable results from the pattern glare test detailing mean pattern glare scores for stroke and control participants , with the exclusion of migraine subjects mean pattern glare scores from the pattern glare test for stroke and control participants , with the exclusion of migraine subjects . statistically significant elevation of pattern glare scores were found for the stroke subjects , when considering the mid - high difference variable the present study has demonstrated that stroke subjects respond with significantly higher pattern glare scores than a control population when undertaking the pattern glare test ; this elevation in scores being most notable for the mid - high difference variable , a relative score that allows for normalization of the subject by taking into account suggestibility . abnormal pattern glare is considered to be present when a subject delivers a pattern glare score of > 3 on the mid - sf grating , or a score of > 1 on the mid - high difference variable . in fact , 75% of the stroke participants recorded an abnormal degree of pattern glare when considering the mid - high difference measure , compared to just 5% within the control population . for the stroke participants , the mean score approached the cut - off for abnormality of > 3 when viewing the mid - sf grating , but did not exceed it . it was , however , significantly higher than the scores of a control group , at a level of statistical significance . further suggestion of elevated pattern glare in the stroke group was shown by a decreased measure on the high - sf grating for stroke subjects versus control subjects . the high - sf measure , which was found to be of statistical significance , is usually higher in subjects with a low degree of visual discomfort . these three principal measures were still found to persist even when subjects with potential correlates of pattern glare , namely migraine , were removed from the analyses . it should be noted that the control group were some 10 years younger than the stroke subjects . established normative values have shown that with advancing age , there is a greater decrease with the high - sf grating than the mid - sf grating which , in turn , results in a small overall increase in the mid - high difference variable , although not at levels of statistical significance . despite a paucity of literature , there is evidence of sensitivity to patterns following traumatic brain injury , including stroke , as determined by analyzing self - test responses to a questionnaire designed to recognize sensitivity to glare , light , contrast , bright colors , and patterns . it has also been shown , however , that this indirect method of determining the existence of pattern related visual stress is not as useful as a direct presentation of a patterned stimulus to the individual concerned . whilst an indirect method of analyzing pattern glare symptoms serves as a useful indicator , it does not appear to isolate those individuals who are more likely to have their symptoms alleviated by an intervention such as a spectral filter . since pattern glare results from cortical hyperexcitability [ 7 , 11 ] , it is perhaps unsurprising that stroke sufferers can be shown to demonstrate abnormal levels of pattern glare ; this is in line with evidence of cortical hyperexcitability following stroke . lesion - induced cortical hyperexcitability has also been demonstrated following short transient ischemic attacks , suggesting that symptoms of pattern glare could potentially exist in those experiencing milder episodes of so - called mini - stroke in the absence of more obvious functional impairment , and represents an opportunity for further work in this area . it would be valuable for future studies to consider the association of pattern glare , with co - existing visual deficits , such as visual field defects and binocular vision anomalies , in stroke individuals . the present study was limited by a modest sample size , and further work with a larger subject group should be considered , to examine pattern glare trends in a broader stroke population . furthermore , it should be recognized that some of the sample were recruited from an optometric practice , and given that these subjects may have a higher predisposition to visual symptoms associated with their stroke , this could overestimate the levels of visual stress in stroke patients . an opportunity for further work would be to consider the effect of time interval , and number of stroke events , on the outcome measures . in the present study , the majority of the subjects had suffered a stroke several years prior to the data collection . in conclusion , it appears that pattern glare is associated with stroke , indicated by an abnormal pattern glare score on the pattern glare test , most notably when considering the mid - high difference variable . this remains the case when those with other co - morbidities of pattern glare , such as migraine , or previously identified visual stress , are removed from the data set . further work is required to investigate other measures of visual perceptual deficits within a stroke group , along with the management of these symptoms with spectral filters .

the aim of this work was to measure susceptibility to pattern glare within a stroke group , employing a direct method of assessment . twenty stroke subjects , aged 3885 years , were recruited , along with an age - matched control group ( n = 20 ) . assessment of pattern glare susceptibility was undertaken using the pattern glare test . an abnormal degree of pattern glare is present when individuals score > 1 on the mid - high spatial frequency difference variable , a relative score that allows for normalization of the subject , or > 3 when viewing the mid spatial frequency grating . stroke subjects demonstrate elevated levels of pattern glare compared to normative data values and a control population , as determined using the pattern glare test . this was most notable when considering the output measure for the mid - high difference variable . the mean score for the mid - high difference variable was 2.15 sd 1.27 for the stroke subjects versus 0.10 sd 1.12 for the control subjects . when considering the mid - high difference variable , 75% of the stroke group recorded an abnormal level of pattern glare compared to 5% in the control group . this study demonstrates an association between stroke subjects and elevated levels of pattern glare . cortical hyperexcitability has been shown to present following stroke , and this has been proposed as a plausible explanation for the perceptual distortions experienced by individuals susceptible to pattern glare . further work to assess the benefits of spectral filters in reducing perceptual distortions in stroke patients is currently underway .

the unique physical properties attributed to nanoscale materials have led to a rise of nanomaterials research in recent years . for example , nanopatterned magnetic structures have been studied for applications as varied as high - density data storage to biomedical sensing . additionally , plasmonic nanomaterials have received much attention due to their unique optical and electronic properties as well as their potential implementation in a variety of applications including ultrasensitive biosensors , enhanced surface - sensitive spectroscopy , and optical metamaterials . optical metamaterials , defined as periodic structures whose features are smaller than the wavelength of light , can be used to create a variety of unique optical effects : negative refractive index materials , cloaking devices , and perfect lenses . the fabrication of nanoring arrays has been of particular interest in nanomaterials research . magnetic nanorings have been proposed as an ideal candidate for use in random access memory devices due to their well - defined magnetic remnant states , which would be suitable for data storage of multiple bits for each ring . also , the strong plasmonic resonance arising from gold nanorings has been used for detecting polymer film growth and for dna biosensing . in addition to nanorings , an optical metamaterial that has been the focus of much interest is arrays of split ring resonators , which have been exploited to create materials with negative permeability and negative refractive index in the near - infrared ( nir ) , infrared ( ir ) , and microwave spectral regions . plasmonic split nanoring arrays exhibit a strongly polarization - dependent absorption spectrum and can be employed for nanophotonic biosensors and plasmonic nir dichroic polarizing filters . in addition , electromagnetic hot spots in the closely related nanocrescent structures have been used in localized surface plasmon resonance based sensing and surface - enhanced spectroscopies ( e.g. , raman and infrared absorption ) . composite plasmonic and magnetic nanocrescents have been employed as surface - enhanced raman scattering substrates that are capable of being controlled by external magnetic fields . this recent growth in nanotechnology has necessitated the development of facile , inexpensive , and high - throughput processes for the fabrication of nanoscale periodic arrays that are made of a large number of materials . while electron beam lithography ( ebl ) can be used to generate such nanostructures on the scale of tens to hundreds of microns , the time and cost required to fabricate arrays over larger areas using ebl is prohibitive . alternatively , patterned nanostructures have been fabricated using such methods as nanochannel glass replica membranes , colloidal lithography , and evaporative self - assembly . we have recently described a novel method for the fabrication of plasmonic nanoring arrays over large areas ( cm ) that combines colloidal lithography with lithographically patterned nanoscale electrodeposition ( lpne ) . in this paper , we expand the use of this nanofabrication method to make large - scale arrays of nanorings and split nanorings from a wide range of materials , including magnetic materials ( nickel and cobalt ) , semiconductors ( cadmium selenide ) , and insulating polymers ( polydopamine ) . additionally , we present bimetallic ( nickel / gold ) and split gold nanoring arrays as examples of extending our fabrication strategy to create more complex nanostructured surfaces . the large area fabrication method described here provides a high degree of control over nanoscale features such as spacing , radii , thickness , and ( in the case of split nanorings ) the ring opening size . carboxylate - coated polystyrene bead solutions ( 2.6% w / v , 1 m diameter ) were purchased from polysciences ( warrington , pa ) . shipley s1808 photoresist , thinner p , and mf-319 developer were purchased from microchem ( newton , ma ) . clean earth chemicals 24k gold plating solution ( grobet usa , carlstadt , nj ) was used as received . fisher premium glass microscope slides ( 1 mm thick ) were used as substrates . magnetite nanoparticles of 20 nm ( 20 mg / ml in citrate buffer ) were purchased from nanocomposix ( san diego , ca ) and diluted 1000-fold in water prior to use . a densely packed monolayer of polystyrene beads was formed by spin coating polystyrene beads ( concentrated to 5.2% in 3:1 methanol : water ) on hydrophilic oxygen plasma cleaned microscope glass slides cut to 2.5 cm 2.5 cm pieces . upon drying , the beads were etched in oxygen plasma ( 200 mtorr , 50 w , 400 vdc , south bay technologies , san clemente , ca ) for 5 min . a 70 nm layer of ag ( over a 1 nm cr adhesion layer ) was vapor deposited on top of the etched beads by thermal evaporation . to remove the beads , the samples were sonicated sequentially in toluene and acentone . shipley s1808 photoresist ( diluted 1:1 with thinner p ) was spin coated on the nanohole arrays ( 80 s , 2500 rpm ) and baked for 20 min at 90 c . the photoresist was backside exposed through the nanohole array with 20 mw / cm . for split nanoring arrays , the angle of exposure was controlled by mounting the samples onto triangular blocks cut to achieve the desired angles . a potentiostat ( pgstat12 , metrohm , riverview , fl ) was used for electrodeposition . ni , co , cdse , and au were deposited by potentiostatic electrodeposition using the following plating conditions : ni , 0.85 v for 9 min using a ni plating solution ( 5 mm nicl2 , 5 mm boric acid , 0.1 m kcl ) ; co , 1.2 v for 2.5 min using a co plating solution ( 0.14 m coso4 and 0.65 m boric acid ) ; cdse , 0.64 v for 7 min using a cdse plating solution ( 0.30 m cdso4 , 0.70 mm seo2 , and 0.25 m h2so4 ) ; au , 0.85 v for 10 min using a commercial gold plating solution . polydopamine was deposited by cyclic voltammetry ( 20 scans at a rate of 20 mv / s ; vertex potentials of 0.6 and 0.66 v ) in a dopamine solution ( 5 mm dopamine in phosphate buffer ( ph 6.5 ) ) . all potentials were measured versus a ag / agcl reference electrode ; a pt foil was used as the counter - electrode . the ag sacrificial electrode was removed with a 5% nh4oh and 1% h2o2 etching solution . sem : the samples were imaged on a fei magellan scanning electron microscope . xrd : grazing incidence x - ray diffraction measurements were performed on a rigaku smartlab x - ray diffractometer . ft - nir absorption spectra : a mattson rs-1 ftir with a halogen source , caf2 beamsplitter , and insb detector was used to capture nir spectra from 2000 to 10000 cm . the beam was focused to 3 mm in diameter to interrogate different areas of the sample . our method to fabricate magnetic , semiconducting , bimetallic , and insulating nanoring arrays and plasmonic split nanoring arrays ( illustrated in figure 1 ) is an extension of our previous methodology for lithographically patterned electrodeposition of plasmonic nanoring arrays . first , carboxylate - functionalized polystyrene beads dispersed in a mixture of ethanol and water are spin - cast onto an oxygen plasma treated glass substrate to form a tightly packed monolayer . the beads are then etched to the desired size in oxygen plasma ( figure 1a ) . a sacrificial metal film ( 70 nm silver ) is then formed by evaporation deposition over the etched beads , which are subsequently dissolved in toluene , yielding a nanohole array ( figure 1b ) . positive photoresist is then spin coated over the nanohole array ( figure 1c ) . for closed nanoring fabrication , exposure of the photoresist at normal incidence ( figure 1d ) results in complete opening of the nanoholes . in contrast , for split nanoring arrays , exposure at an angle from the surface normal ( figure 1h ) leaves part of the photoresist unexposed ; thus , the holes do not completely open upon photoresist development ( figure 1i ) . during the electrodeposition step ( figure 1f and 1j ) , with the nanohole array acting as the working electrode , the desired material can only be deposited on the exposed metal . this process results in fully closed nanoring arrays when = 0 ( figure 1 g ) or split nanorings when exposed at an angle ( figure 1k ) after removal of photoresist and sacrificial metal material . nanoring and split nanoring array fabrication scheme : ( a ) polystyrene beads self - assembled in a monolayer are etched to size in an oxygen plasma ; ( b ) nanohole mask is formed by vapor depositing silver over the etched beads and removing the beads ; ( c ) positive photoresist is spin coated onto the nanohole mask . for nanorings : ( d ) photoresist is backside exposed at normal incidence through the nanoholes ; ( e ) holes are formed in the photoresist upon development ; ( f ) nanorings are electrodeposited onto the exposed silver ; and ( g ) photoresist and silver are removed to reveal nanorings . for split nanorings : ( h ) exposure at an angle leaves part of the nanohole covered by photoresist after ( i ) development ; ( j ) split nanoring is electrodeposited through the holes formed in the photoresist to the exposed silver ; and ( k ) split nanorings arrays are completed upon photoresist and silver removal . this fabrication method combination offers complete control over all size parameters of the array . as discussed previously , the periodicity of individual split nanorings is determined by the initial size of the polystyrene beads ; the outer diameter is controlled by the time exposed to oxygen plasma ; and the nanoring thickness and inner diameter are controlled by amount of charge passed during the electrodeposition process . finally , the nanoring opening size is determined by the exposure angle ( = 0 for closed rings ) . the described method produces square centimeter scale arrays of nanoscale structures while avoiding relatively expensive and time - consuming sequential fabrication processes such as ebl . in addition to size and dimensional control , we are able to form nanoring arrays from a broad range of materials available for electrodeposition . using our combined colloidal lithography and nanoscale electrodeposition process , we have fabricated nanoring arrays of nickel , a well - known ferromagnetic material . a top - down scanning electron microscope ( sem ) image of a ni nanoring array formed from 1 m diameter polystyrene beads is shown in figure 2a . in addition to simply nickel nanorings , we have formed composite magnetic and plasmonic nanorings by sequential electrodeposition of nickel and gold ( step g in figure 1 ) . by this process , the resulting bimetallic nanorings have a core of nickel and a shell of gold ; the shell does not completely envelope the nickel because the outer part of the nickel rings is not available for gold electrodeposition . shell structure by etching away exposed nickel in nitric acid ; when compared to the bimetallic structure before etching ( figure 2c ) , a distinct gold lip over where the nickel had been is visible ( figure 2d ) . fourier transform near - infrared ( ft - nir ) absorbance spectra of nickel and nickel / gold nanoring arrays are depicted in figure 2b . the nickel spectrum shows a resonance at 5000 cm and a weaker higher - order resonance at 9000 cm . as expected , the addition of a gold shell greatly enhances the resonant response of the nanoring arrays . interestingly , we see a strong and distinct double resonance for our bimetallic nanorings , which likely corresponds to two resonances from nickel and gold . ( b ) ft - nir absorbance spectra of nickel ( red ) and core shell nickel / gold ( blue ) nanoring arrays . ( c , d ) cross - sectional views of nickel / gold rings before ( c ) and after ( d ) etching of nickel in nitric acid . in addition to nickel , we have also fabricated magnetic nanostructures with cobalt . the cobalt deposition was performed by potentiostatic electrodeposition in an electrolyte containing cobalt sulfate and boric acid . while a top - down view ( figure 3a ) of the cobalt structures makes the array appear as tightly packed rings , a tilted view ( figure 3b ) on the sem reveals mushroom - like structures . these nanomushrooms are a result of electrodeposition out of the photoresist hole to the top of the photoresist layer . we tested the ferromagnetism of the nanomushrooms by immersing the array into a solution of 20 nm magnetite nanoparticles . after thorough rinsing in water and ethanol , followed by drying under a nitrogen stream , the studding of the nanomushrooms by the nanoparticles was confirmed by sem ( figure 3c ) . the physical anisotropy present in these nanomushrooms is difficult to replicate using traditional nanofabrication strategies and opens the door to facile production of similar structures made with magnetic or nonmagnetic materials . ( a , b ) top - down ( a ) and tilted ( b ) sem images of cobalt nanomushrooms . scale bars : 1 m . along with metallic nanoring arrays , we are also able to fabricate nanorings of semiconducting and insulating materials . as an example of nanoring arrays of a semiconductor material , we electrodeposited cadmium selenide by potentiostatic deposition ( sem image shown in figure 4a ) and confirmed the structure by xrd analysis ( figure 4b ) . our fabrication method could provide a facile and high - throughput route for production of quantum rings . additionally , nanoring arrays of insulating materials have been fabricated using this process . we have recently reported the electrodeposition of polydopamine ( pda ) thin films for patterning dna microarray . this deposition was performed by repeated cyclic voltammetry ( cv ) scans at a carefully controlled ph . our nanoring fabrication strategy allows us to scale down pda electrodeposition to the nanoscale . while we expect the thickness of these pda rings to be around 3 nm , we can see in the inset that the thickness appears to be much greater , which we attribute to the collapsing of the pda structure upon removal of the sacrificial electrode . as expected , the cathodic and anodic currents in the cyclic voltammograms decrease with repeated cycle numbers as the surface becomes more coated with pda and thus electrically passivated . as we have shown previously with macroscale films , these nanoscale pda ring arrays will allow the development of nanoscale biosensing platforms . ( a ) sem images of pda nanorings at low and high ( inset ) magnifications . ( b ) cyclic voltammograms of cycles 1 , 3 , and 10 during the growth of pda nanorings . in addition to forming nanorings of a multitude of materials , our fabrication strategy allows us to also produce split nanorings and control the ring opening size . gold split nanoring arrays were characterized by a combination of sem and polarized fourier transform near - infrared ( ft - nir ) spectroscopy . as shown in the sem image in figure 6a , this angled photoexposure process creates an array where the openings are all on the same position on the nanorings . the size of the nanoring opening can be tuned by varying the exposure angle ( ) of the photoresist , as seen in the sem images in figures 6b6d . for a given exposure dosage , a smaller results in smaller ring openings . as seen in the sem images , the ring opening can be controlled to be 50% , 20% , or 10% of the ring circumference by exposing at a of 45 , 40 , and 35 , respectively . the size of the ring openings decreases with the angle of the backside uv exposure , : ( a ) and ( b ) = 45 , ( c ) = 40 , and ( d ) = 35. the nir absorption spectra of these gold split nanoring arrays were characterized as a function of optical polarization with respect to the ring gap orientation . transmission spectra were taken with light at normal incidence to the array surface . in this configuration , the split ring arrays exhibit strong infrared resonances that are dependent on the polarization of the incident light . as seen in figure 7 , two distinct resonances are apparent in the near- to mid - infrared region as the polarization of the light is varied from = 0 ( perpendicular to the ring opening ; red trace ) , = 30 ( orange trace ) , = 60 ( green trace ) , to = 90 ( blue trace ) . two bands are observed in the optical spectrum : one at 7400 cm that dominates when = 0 and the other at 3800 cm that dominates when = 90. polarization dependence of near - infrared absorbance for a split ring array . polarization of the incident light was rotated in 30 increments on the same spot of the same sample starting perpendicular to the ring openings ( red , = 0 ) and continuing until parallel to the ring openings ( blue , = 90 ) . these two nir bands are plasmonic resonances of split nanoring arrays that have been observed previously . the openings in the nanorings break the symmetry of the ring geometry and drastically change the surface charge distributions ( and thus the optical responses ) for different polarization states . the lower - frequency resonance in figure 7 ( at 3800 cm ) that dominates when light is polarized across the ring opening ( = 90 ) is commonly referred to as the lc resonance , in which the gap in the split ring acts as a capacitor . following this analogy , decreased capacitance from larger gaps results in higher - frequency resonances . the higher - frequency resonance in figure 7 ( at 7400 cm ) , which is strongest when light is polarized perpendicular to the ring opening ( = 0 ) , corresponds to a plasmon mode that redshifts in response to smaller ring openings . as expected , the lc resonance becomes dampened as the polarization is rotated and less of the electric field is directed across the ring opening ; this resonance disappears completely after 90 rotation . effect of back exposure angle , ( i.e. , ring opening size ; same samples as depicted in figure 6 ) , on near - infrared absorbance for ( a ) polarization perpendicular to the opening and ( b ) polarization across the ring opening . the dotted line indicates the position of the polarization - independent plasmonic resonance for an array of fully closed rings . the position of the two resonances could be controlled by varying the size of the rings and the amount of nanoring opening . figure 8 depicts the responses to light polarization along ( 8a , = 0 ) and across ( 8b , = 90 ) the ring openings for the three samples imaged in figure 6 formed with back exposure angle = 45 ( blue trace ) , = 40 ( green trace ) , and = 35 ( red trace ) . as noted above , all conditions other than were the same ( i.e. , the only difference between the three samples was the size of the ring openings ) . as the nanoring openings increase with increased exposure angle , both the higher- and lower - frequency resonances ( corresponding to the resonances for the two polarizations ) appear at higher wavenumbers . the blueshift of the higher - frequency resonance with increasing ring opening in figure 8a can be attributed to the decrease in the sides of the rings as the opening gets larger . the lc resonance ( figure 8b ) also blueshifts with larger ring openings , as expected . for our split nanorings , the position of this lc resonance could be tuned to a range greater than 2000 cm by simply changing the size of the ring opening . for comparison , the peak resonance position of fully closed nanorings ( fabricated under the same conditions with normal incidence exposure of the photoresist ) is indicated by the dotted lines in figure 8 . predictably , the resonance position for fully closed rings does not change with polarization . in summary , we have expanded the application of our method for fabricating densely packed and well - ordered nanoring arrays over large areas with a combination of colloidal lithography and lpne to a variety of electrodeposited materials : magnetic ( ni and co ) , semiconductor ( cdse ) , and insulator ( pda ) . additionally , we have shown that this nanofabrication process can be modified to create unique asymmetric nanomushrooms , bimetallic core the plasmonic split gold nanoring arrays display polarization - dependent absorbances over a broad frequency range ( 8000 cm ) . by having complete control of the spacing , diameter , ring width , and gap size of these split ring resonators , we can tune the optical properties throughout the near - infrared and create dichroic materials in the spectral range from 1 to 5 m . in addition to their potential use as metamaterials , plasmonic split nanoring arrays can also be used as improved refractive index based biosensor surfaces for detecting nucleic acids and proteins . in the future , split magnetic nanorings can also be created with this fabrication method ; split magnetic nanorings have been used to stabilize and alter the magnetic flux closure states of magnetic nanorings with potential applications in high - density magnetic memory storage .

large area arrays of magnetic , semiconducting , and insulating nanorings were created by coupling colloidal lithography with nanoscale electrodeposition . this versatile nanoscale fabrication process allows for the independent tuning of the spacing , diameter , and width of the nanorings with typical values of 1.0 m , 750 nm , and 100 nm , respectively , and was used to form nanorings from a host of materials : ni , co , bimetallic ni / au , cdse , and polydopamine . these nanoring arrays have potential applications in memory storage , optical materials , and biosensing . a modified version of this nanoscale electrodeposition process was also used to create arrays of split gold nanorings . the size of the split nanoring opening was controlled by the angle of photoresist exposure during the fabrication process and could be varied from 50% down to 10% of the ring circumference . the large area ( cm2 scale ) gold split nanoring array surfaces exhibited strong polarization - dependent plasmonic absorption bands for wavelengths from 1 to 5 m . plasmonic nanoscale split ring arrays are potentially useful as tunable dichroic materials throughout the infrared and near - infrared spectral regions .

mother s early age at menarche has been associated with taller offspring height and greater body mass index ( bmi ) at age 9 years , suggesting that mother s age at menarche may be an intergenerational marker of growth . we examined the association between mother s age at menarche and childhood size at birth , and at the ages 1 , 3 , 4 , 7 , and 8 years in the collaborative perinatal project ( cpp ) . child size was examined in mixed models , adjusted for center , child sex , race , socioeconomic index , child s exact age at measurement ( in months ) , mother 's age at recruitment and , depending on which measure was the outcome in the specific model , mother 's height , pre - pregnancy weight , or bmi . compared with children whose mother had menarche at age 15 or later , children whose mothers had age at menarche before age 12 were taller from age 1 and had higher bmi at ages 7 and 8 ( 0.17 and 0.19 z , respecively ) . mother s age at menarche is a modest predictor of their children s growth trajectory . the collaborative perinatal project was a prospective pregnancy cohort of 58,760 pregnancies in 48,197 women who gave birth between 1959 and 1966 . academic medical centers during pregnancy ( baltimore , boston , buffalo , memphis , minneapolis , new orleans , new york columbia , new york metropolitan , philadelphia , portland , providence , and richmond ) and were followed through delivery , while their children were followed up to 7 years of age in all centers , and up to 8 years of age in approximately half the centers12 . length / height was measured to the nearest 0.5 cm , in a supine position through 20 months age , and standing thereafter . we included the first singleton live birth contributed by each woman during the study enrollment period ( not necessarily her first child ) with non - missing data on baby s sex , birth weight , and mother s age at menarche ( n=43,037 ) . we excluded women with race other than black or white ( n=3,553 ) , infants with major malformations ( n=3,266 ) , and those with unlikely birth weight ( n=35 ) . among the remaining 36,183 , 4,531 children had no further weight measurements ( beyond birth ) , thus leaving 31,652 eligible children . finally , we excluded 3 records with mother s age at menarche recorded as having been less than 7 years , and 175 mothers whose age at menarche was within 2 years of age at recruitment . we excluded these mothers because we wanted to be sure that menstruation had been fully established by the time of conception . as we only had age in completed years for age at recruitment , a 2 year difference was chosen to guarantee this . the final sample included 31,474 children with valid birth weight and at least one later weight measurement , with 128,636 measurements in total . some analyses , however , include fewer individuals due to missing length / height in children or missing weight or height in mothers , as mother s anthropometry was included as a covariate in the models . sample size varied also by age of the children , depending on how many were measured at each point in time . we examined the association between mother s age at menarche and child length / height , weight , and body mass index ( bmi ) at birth and ages 1 , 3 , 4 , 7 , and 8 years ( 2 months ) using linear mixed models . due to the relatively small number of measurement times and the nonlinear nature of child growth , we modeled age as a step function with different intercepts and different menarche slopes for each age at measurement . we also included a continuous covariate accounting for the month of measurement in each year ( children could , however , be only 2 months younger or older than the nominal age , otherwise the observation was excluded ) . we considered the data both in their original scale and as z - scores calculated from the whole cpp cohort . as the z - score was sex- and age - specific , it is not influenced by age,14 which allowed us to easily compare the relative effects at different ages . here , we present the results based on the z - score . in our primary models , we categorized mother s age at menarche as 11 , 12 , 13 , 14 , and 15 years or older . the categorical treatment provided us with a non - parametric assessment of the age at menarche - child size relations , which is consistent with the approach of ong and colleagues1 . however , to determine if there was a significant linear relation between age at menarche and child size at different ages , we also treated age at menarche as continuous , with values , in completed years , in the range 1115 , with < 11 coded as 11 , and > 15 coded as 15 . regardless of how we treated age at menarche , we always allowed the effect to change with child s age in order to test for a menarche - by - year interaction . for each measurement , our primary model ( ignoring covariates ) was as follows : yit=0t+1t(q1i)+2t(q2i)+3t(q3i)+4t(q4i)+5t(ageitt)+it , where yit is the measurement ( height , weight , or bmi ) for child i at year t , qki is an indicator variable that equals 1 if the age at menarche of the child s mother was in the k category ( k = 1 , 2 , 3 , 4 with menarche at 15 + serving as the reference category ) ; ageit is the age of the child at time of measurement in year t , 0 t , 1 t , 2 t , 3 t , 4 t , and 5 t are the year - specific intercept and slopes , and it is the residual error . an unstructured covariance matrix was used to model the variances and correlations between the errors from the same child at different years . we used the kenward - roger method15 to calculate the degrees of freedom for tests of menarche effects and menarche - by - year interactions , assuming an unstructured covariance matrix for measurements obtained from the same child at different years . we first tested whether there were significant interactions between mother s age at menarche and children s sex and race on their body size . we used age at menarche as a continuous variable to have a more sensitive test . when using the z - score , there was no interaction with a p<0.10 , and we thus present the results for blacks and whites and boys and girls together ( stratified results are shown in the online appendix ) . when using the measurements in the original scale , for weight there was a significant interaction between mother s age at menarche and race ( we present these results in the online appendix ) . estimates were adjusted for center , race ( black or white ) , child sex , socioeconomic index ( 3 levels , plus a separate category for the 3% with missing values ) , child s exact age at measurement ( in months ) , mother 's age at recruitment and , depending on which measure was the outcome in the specific model , mother 's height , pre - pregnancy weight , or bmi . we adjusted for mother s anthropometry to evaluate whether an effect of age at menarche was present beyond that due to correlation with the size of the mother . in a further analysis , however , we also ran models not adjusted for mother s anthropometry , using the total available sample ( i.e. , including the women with missing height and weight ) . we did not treat mother s smoking as a confounder , because smoking is likely to have started after menarche . however , because a previous analysis showed that mother s smoking during pregnancy was associated with higher bmi in their children16 , we checked whether including smoking in the models had an impact on our estimates . as expected , women with age at menarche 11 were , on average , shorter and more frequently overweight than women with menarche at later ages ( table 1 ) . table 2 shows mean length / height , weight , and bmi of the children at different ages , according to mother s age at menarche . especially at ages 7 and 8 , children whose mother s age at menarche was 11 years were slightly taller and had a higher bmi compared with children whose mother s age at menarche was later , particularly 15 or older . although the association between age at menarche and offspring anthropometry was statistically significant at several ages in the adjusted models , the largest and most consistent association was seen when the children were aged 7 and 8 ( appendix table 1 , contrasts ) . figure 1 shows the difference in length / height , weight , and bmi ( expressed as z scores ) at the various ages as a function of mother s age at menarche ( children whose mother had menarche at 15 years constitute the reference category ) . there was a small difference in birth length with mother s age , and the trend became stronger with age , with children born to mothers with age at menarche before 12 years being taller than children whose mothers had menarche at an older age , particularly 15 + . babies born to mothers with early age at menarche tended to be slightly lighter at birth , but the pattern reversed at 1 year and thereafter resembled the trend seen with height . the results for bmi were similar to those for weight , although a clear trend of increasing bmi among children born to women with early menarche is not seen until age 4 . for reference , at age 7 , a difference of 0.2 z corresponded to about 1 cm ( < 1% of the mean height ) , 0.8 kg ( 3% of the mean weight ) , and 0.4 kg / m ( approximately 2.5% of the mean bmi ) , respectively . ( appendix figures 1 and 2 show the results for the analogous models , stratified by sex and race , for height and bmi ) . table 3 shows the linear coefficients from the mixed models when age at menarche is treated continuously ( as described above ) . although the effect of each increment in mother s age at menarche on offspring size is small , all estimates ( except that for bmi at age 3 ) were significant ( p<.05 ) . we saw similar results in the models where mother s anthropometry was not included as a covariate . however , the association of age at menarche with child s height was slightly attenuated by omitting mother s height in the model , while the association with child s bmi was strengthened when mother s bmi was omitted . the results were virtually identical when we further adjusted for mother s smoking ( never , former , current , and missing ) , and also when we reintroduced the 175 women excluded because their age at menarche was within two years of their age at enrolment ( not shown ) . the results were also very similar when we used the measurements in the original scale instead of the z - score ( not shown ) . however , the relation between mother s age at menarche and child weight in the original scale showed statistical evidence of varying according to race ( p=0.052 ) . we thus report the results for weight stratified by race ( appendix figure 4 ) . in this large cohort of us children born from 1959 to 1966 , we saw that children whose mothers had menarche at 11 years or younger appeared to have a faster growth trajectory than children born to mothers with later age at menarche . we saw similar results in blacks and whites , and in boys and girls , and we present the combined results . the estimated effects were small in absolute terms , but consistent in showing that children of women with early age at menarche were , on average , taller and had a higher bmi at ages 7 and 8 than women with later age at menarche . our estimates were adjusted , among other factors , for mother s anthropometry ( mother s height when child s length / height was the outcome , etc ) , because we wanted to assess whether there was an association beyond that due to the mother s own size . when we omitted mother s anthropometry in the analysis , the results were attenuated for height and strengthened for weight and bmi . as mothers with early age at menarche were themselves heavier , we included their bmi in the model to see whether any effect remained following adjustment . the fact that inclusion of height in the models strengthened the association , rather than attenuate it , is due to the fact that mothers with earlier age at menarche were shorter than mothers with late age at menarche , while their children were taller in the age range of this study . the larger size of children born to mothers with early menarche was more apparent at ages 4 and , especially , 7 and 8 than in earlier childhood but such a pattern was detectable in infancy for length / height and weight . children of mothers with menarche at 11 years , although taller at age 8 , are likely to end up being shorter adults , since their vertical growth stops earlier1 . girls with a high bmi for their age have a tendency to experience menarche earlier17 and to have higher bmi as adults18 . in a study based on 597 mother - daughter pairs from the cpp with complete menstrual history available , keim et al reported that a maternal bmi of 25 or higher predicted earlier age at menarche in their daughters , a finding symmetrical to ours19 . terry et al20 reported that , among 262 women who had been born to mothers enrolled in the cpp , higher percentile change in weight between 4 months and 1 year of age was associated with earlier age at menarche , after adjustment for mother s age at menarche . garn and colleagues have speculated that the same factors cause both fatness and early maturation18 and these factors may in part be genetic7 . early age at mother s menarche predicted larger size in both boys and girls , suggesting that it may be one of many markers related to programming of overall growth , rather than being specific to female development . our results indicate that , when accounting for the mother s own height , children born to mothers who had early menarche tend to be slightly taller from infancy and , by age 7 , these children are taller and have higher weight and bmi than children born to mothers with later age at menarche . although trends were , for the most part , linear , the largest difference was mostly between children born to women with menarche at age 11 or earlier and those born to women with age at menarche of 15 or older . it has been suggested that rapid growth in infancy may have a programming effect on later body composition21 . while this may be true , the finding of a relation between mother s age at menarche and more rapid growth suggests that a tendency to faster growth is , at least in part , inherited . rapid early postnatal growth , childhood adiposity , and earlier age at puberty may all have shared genetic determinants2,22 , and heritability of age at menarche has been estimated to be between 0.5 and 0.7810 . it is , however , also possible that mothers age at menarche is associated with non - genetic characteristics , such as nutritional status or physical activity , that also influence their children s growth . mothers with younger age at menarche were generally younger , tended to be of higher social class , and were more likely to be smokers ( appendix table 2 ) . we adjusted for age and socioeconomic index in our analyses , but we can not rule out that other correlates of age at menarche , such as diet , could have produced our findings . adair23 reports that girls who were relatively long and thin at birth tended to have earlier menarche . an earlier age at first conception24 and higher social class 23 had been previously reported among women with early menarche . along similar lines , our results suggest that women with early menarche give birth to slightly longer and thinner babies . the cohort was large , and children were measured at various ages by trained personnel , although not all ages were equally well represented . furthermore , we were able to adjust for several covariates , and we had a large number of blacks . the fact that maternal age at menarche and pre - pregnancy anthropometry were self - reported constitutes a limitation of this study , as well as the absence of any information about the father s height or age at puberty ( although indicators of puberty in males are difficult to recollect ) . however , we saw the expected relation between mother s age at menarche and her height and bmi . we used bmi as an outcome for infants , which may not be the best measure to assess adiposity at such an early age . most of the influence of mother s age at menarche was , however , observed at ages 7 and 8 . missingness of the child s measurements at some ages was weakly associated with body size ( based on the non - missing measurements ) . however , the estimates from the mixed model are unbiased as long as missingness is not related to the unobserved measurements . if the children s body size determined , in some instances , their willingness to take part in later measurements , and if these children were more likely to have mothers who themselves had a higher bmi , we may have underestimated the relation between mother s age at menarche and children size . our findings , based on data collected 30 years before those in the alspac cohort , corroborate those reported by ong et al 1 , and indicate that mothers age at menarche is a modest predictor of their children s size at age 7 and 8 .

objectivean individual s growth trajectory is , at least in part , inherited . mother s early age at menarche has been associated with taller offspring height and greater body mass index ( bmi ) at age 9 years , suggesting that mother s age at menarche may be an intergenerational marker of growth . we examined the association between mother s age at menarche and childhood size at birth , and at the ages 1 , 3 , 4 , 7 , and 8 years in the collaborative perinatal project ( cpp).subjectswe examined 128,636 measurements from 31,474 black and white children . we transformed the original measurements into z - scores . child size was examined in mixed models , adjusted for center , child sex , race , socioeconomic index , child s exact age at measurement ( in months ) , mother 's age at recruitment and , depending on which measure was the outcome in the specific model , mother 's height , pre - pregnancy weight , or bmi.resultscompared with children whose mother had menarche at age 15 or later , children whose mothers had age at menarche before age 12 were taller from age 1 and had higher bmi at ages 7 and 8 ( 0.17 and 0.19 z , respecively).conclusionsmother s age at menarche is a modest predictor of their children s growth trajectory . the mechanism is likely to be heritable , although other explanations are possible .

in many instances , hemodynamic optimization requires the use of fluids . however , the response to fluids may be quite variable and can not be adequately predicted from the measurements of intravascular pressures ( central venous pressure or pulmonary artery pressure ) or volumes . dynamic indices reflecting respiratory - induced variations in stroke volume have been developed , but these can not be used in patients with cardiac arrhythmias or in patients with spontaneous respiratory movements or ventilated with a low tidal volume . recently , the so - called passive leg raising ( plr ) test has been proposed . this test is based on the principle that plr induces an abrupt increase in preload due to autotransfusion of blood contained in capacitance veins of the legs . this abrupt increase in preload leads to an increase in cardiac output in preload - dependent patients but not in other patients . however , the test requires the determination of cardiac output with a fast - response device , because the hemodynamic changes may be transient . in a previous issue of critical care , lafanechre and colleagues used esophageal doppler to monitor cardiac output and reported that a plr - induced increase in cardiac output higher than 8% can predict fluid responsiveness in critically ill patients . the predictive value of the plr test was similar to that of respiratory - induced variations in pulse pressure . although this study basically confirms the results of monnet and colleagues , it brings some new pieces of information to the field , but also raises important questions . indeed , the 22 patients investigated by lafanechre and colleagues were all in acute circulatory failure and treated with high doses of epinephrine or norepinephrine . however , the use of vasopressor agents may be of paramount importance in determining the response to dynamic tests . in an experimental study , nouira and colleagues reported that norepinephrine decreased respiratory - induced variations in pulse pressure in dogs subjected to severe hemorrhage . in their study , lafanechre and colleagues observed that variations in pulse pressure predicted fluid responsiveness in these patients treated with vasopressor agents , and the cutoff level was similar to that found in other series . under physiologic conditions , the blood volume contained in capacitance veins in the legs and recruited during plr is estimated to be close to 300 ml . although norepinephrine and epinephrine may decrease the amount of recruited blood , because vasopressor agents also induce venous vasoconstriction , the impact of these agents on plr was negligible in this study because plr predicted fluid responsiveness in patients treated with high doses of vasopressor agents . in addition , the changes in cardiac output induced by plr were correlated with changes in cardiac output obtained after the administration of 500 ml of saline , with a slope of the regression line close to 1 . these results suggest that dynamic tests are useful in patients treated with high doses of vasoactive agents . however , the exact cutoff value for changes in cardiac output measured with esophageal doppler that should be used to separate responders from non - responders remains to be determined . indeed , the characterization of responders and non - responders is a key issue . a 15% increase in cardiac output with thermodilution , this error is considered to be close to 7% ( it depends on the number of boluses averaged ; this value is accepted for three boluses , it may be lower when at least five boluses are averaged ) , hence a 15% ( 7% + 7% , rounded to 15% ) difference between two measurements is required to ensure that the difference is real and can not be ascribed to random errors in measurements . with esophageal doppler determination of cardiac output , this value may differ . the intraobserver variability needs to be defined , because without this information it is difficult to distinguish responders from non - responders . in their study , lafanechre and colleagues arbitrarily used a 15% cutoff . because the respiratory variation in pulse pressure separating responders and non - responders was similar to values reported in the literature , it is likely that this 15% cutoff value was adequate . however , it is quite evident that the cutoff for plr - induced changes in cardiac output can not be lower than 15% , because this represents the cumulative errors in measurements . accordingly , the 8% cutoff value for plr - induced changes in cardiac output proposed by lafanechre and colleagues is probably too small . with esophageal doppler , cutoff values for fluid responsiveness prediction ranging between 10% and 18% have been reported for plr - induced changes in cardiac output plr and for respiratory variations in aortic blood flow . further studies should be performed to define the exact cutoff value that should be used ; these studies should include an evaluation of the magnitude of random errors in cardiac output measurements with esophageal doppler . this study confirms that plr and respiratory - induced variations in pulse pressure can be useful to predict fluid responsiveness in patients treated with high doses of vasoactive agents . however , further studies should be performed to determine more precisely the cutoff value for plr - induced changes in cardiac output that should be used to discriminate between responders and non - responders with esophageal doppler .

predicting fluid responsiveness has become a topic of major interest . measurements of intravascular pressures and volumes often fail to predict the response to fluids , even though very low values are usually associated with a positive response to fluids . dynamic indices reflecting respiratory - induced variations in stroke volume have been developed ; however , these can not be used in patients with arrhythmia or with spontaneous respiratory movements . the passive leg raising ( plr ) test has been suggested to predict fluid responsiveness . plr induces an abrupt increase in preload due to autotransfusion of blood contained in capacitance veins of the legs , which leads to an increase in cardiac output in preload - dependent patients . this commentary discusses some of the technical issues related to this test .

it occurs among 0.622% of symptomatic patients being treated with cyclosporine ( csa)-based immunosuppression [ 2531 ] and 49% of asymptomatic cases detected by ultrasonography during a 2- to 11-year follow - up . mtor - i / psi are associated with an increased incidence of mild or moderate lymphocele . in clinical studies , the rates of lymphocele in renal transplant patients receiving a 6-month treatment with evl 1.53.0 mg / day , or srl 2.05.0 mg / day were 6.415.2 and 1213% , respectively . post - marketing experience with srl factors predisposing to lymphocele formation include drainage from open lymphatics divided during surgery to dissect the host iliac vessels [ 29 , 35 ] , injured lymph channels in the donor kidney hilum vessels [ 31 , 36 ] , acute allograft rejection episode [ 26 , 37 , 38 ] , acute tubular necrosis , transplant kidney biopsy , retransplantation and adult polycystic kidney disease as the original renal disease . clinical experience shows that mild lymphocele can resolve itself , while moderate lymphocele usually responds to povidine - iodine . although some patients who receive mtor-1/psi may develop early massive lymphocele that requires surgery , mtor-1/psi dose reduction or complete withdrawal is not necessary . topical , oral and parenteral are well recognized to create eyelid swelling through generalized fluid retention , ae , urticaria or topical blepharoconjunctivitis . mtor-1/psi - related eyelid oedema in kidney transplant recipients was described in a few case reports of srl- [ 18 , 23 ] and evl - based treatments . development of eyelid oedema was gradual , occurring over 15 months after starting mtor - i / psi . the oedema may be mild and easily managed with low - dose furosemide and reduction of srl dose was not warranted . in some patients , discontinuation of mtor - i / psi was followed by delayed resolution of the swelling , with full recovery taking as long as months . . the most important mechanisms behind the symptom include venous and lymphatic pathology , volume overload , increased capillary permeability and lowered oncotic pressure . therefore , the most frequent diseases associated with leg swelling are deep vein thrombosis and chronic venous insufficiency , primary or secondary lymphoedema , cardiac failure , hypoproteinaemia , idiopathic cyclic oedema and drug - induced oedema . lymphoedema may be primary ( congenital lymphatic abnormality ) or secondary , frequently related to cancer treatment . other causes of secondary lymphoedema include obstruction by tumour , infection ( filariasis ) , recurrent cellulitis and connective tissue disease . a less - common form of oedema is lymphoedema , which causes an abnormality in the lymphatic system . the most common cause is interruption of the axillary lymphatic system by surgery and/or radiation therapy in women with breast cancer . unilateral or bilateral peripheral oedema / lymphoedema is common following the initiation of mtor - i / psi use [ 24 , 43 ] and frequently sufficiently severe enough to require medication discontinuation . however , it may be less frequent with evl with a retrospective series reporting 4- to 5-fold less oedema when compared with matched srl - treated patients ( 14 versus 64% ) , respectively . it has been mentioned that a preponderance in any specific gender is unlikely and it develops 7 months to 2 years after the start of srl ( mean srl levels ranging from 10 to 20 ng / ml ) or a few days to 36 months after the start of evl ( mean evl levels ranging from 3 to 26 ng / ml ) in an arm- or leg - localized lymphoedema form of varying severity ( table 2 ) . usually , peripheral oedema / lymphoedema was controlled with low doses of furosemide accompanied by reduction of the immunosuppressant . mtor - i / psi - related lymphoedema is not dependent on its cumulative dosage and exposure duration . moreover , the occurrence of limb lymphoedema in renal transplant recipients under srl treatment , especially if on the same side as the haemodialysis access , should alert the transplant physician to the need for rapid srl reduction or withdrawal , before complete obstruction occurs , further complicating an already disabling condition . close monitoring of this side effect is warranted . recognizing this association may prevent many unnecessary , costly and invasive investigations . the pathophysiology seems to be due to altered lymphatic drainage [ 18 , 19 ] . the lymphatic vasculature transports extravasated tissue fluid , macromolecules and cells back into the blood circulation . one pathway of regulation of cell growth and proliferation is mediated by the regulatory associated protein of mtor ( raptor)g protein -subunit - like protein ( gl)and mtor complex , which is a target of rapamycin . important downstream effectors of the mtor system are the translation regulators p70s6 kinase and eukaryotic initiation factor 4e - binding protein . the mtor pathway is regulated by the pi3k / akt kinase system , which is upregulated in tumours . activation of pi3k / akt causes activation of mtor and promotes cell growth and proliferation . lymphatic endothelium expresses vegf receptor-3 ( vegfr-3 ) , which is activated after binding to vegf - c , and vegf - d plays an important role in lymphangiogenesis . the gene that encodes vegfr-3 ( flt4 ) is defective in most families with congenital hereditary lymphoedema and impaired lymphangiogenesis and lymphoedema is observed in soluble vegfr-3 ( vegf - c / vegfd signaling inhibitor ) expressing transgenic mice . demonstrate that rapamycin interferes with the intracellular vegf - c - activated pathway of lymphatic endothelial cells . in rapamycin - treated animals , the anti lymphangiogenic effect during tissue regeneration occurs with prolonged lymphoedema , emphasizing the clinical relevance of this effect of the mtor inhibition in solid organ transplant recipients . an increased incidence of pleural and pericardial effusions has been described in mtor - i / psi - treated renal and cardiac transplant patients . the frequency of pericardial effusions following cardiac transplant is 3-fold greater in srl - treated patients often requiring interventions such as drainage with or without srl dose reductions [ 4951 ] . the prevalence of effusions , pleural and pericardial , is similar between mycophenolate mofetil-(mmf ) and evl - treated patients , suggesting that this side effect may be psi specific with greater frequency seen in srl- versus evl - treated patients . cases of pericardial tamponade have been described following the initiation of srl both in de novo cardiac and late conversion heart transplant patients as well as non - cardiac transplants patients [ 50 , 51 ] . ae is a self - limiting swelling that occurs in the deeper cutaneous and mucous membrane layers . most cases of ae result from a reaction to food or drugs , but some episodes have no identifiable trigger . drug - induced ae is well documented in patients taking angiotensin - converting enzyme inhibitors ( acei ) , angiotensin ii receptor antagonists ( aiira ) , fibrinolytic agents , oestrogens and nonsteroidal anti - inflammatory drugs . in addition , the frequency of acei - induced ae is high in transplant recipients , estimated at 15 versus 0.10.5% in the general population [ 53 , 54 ] . reported a 24- and 5-fold higher incidence of ae in cardiac and renal transplant recipients , respectively , who were maintained on cyclosporin a , azathioprine and prednisone when compared with the general population . several reports focused on the putative role of mtor - i / psi ( srl and evl ) in the pathogenesis of ae in organ transplant recipients [ 17 , 22 , 5558 ] . in previous reports , the associated risk factors were acei therapy or african - american patients taking metoprolol [ 55 , 57 ] , which are known to be associated with a higher frequency of ae [ 6062 ] . fuchs et al . reported that 6 out of their 114 patients ( 5.3% ) experienced for the first time in their lives the occurrence of lingual ae after switching them over to evl . the time period from starting mtor - i / psi to the occurrence of ae ranged from 1 to 41 days . in all six patients , the ae was associated with petechial bleeding and with lingual bullae on the lateral part of the tongue and required hospitalization . at the time when the ae occurred , the following concomitant medications were used : acetyl - salicylic acid ( ass ) , ace inhibitors or angiotensin-1-receptor inhibitors . because the symptoms ceased after discontinuation of ass in five out of the six patients , it may well be that ass has triggered the occurrence of evl - associated side effects . however , the time course after initiation of the immunosuppressive drug , the recurrence in one patient , and the favourable outcome after stopping the drug provide an argument for the pathogenic link between evl and tongue ae . lingual oedema seems to occur predominantly within the first weeks after initiation of mtor - i / psi therapy . drug trough level at presentation is variable within or below the target level or in the toxic range . a history of food and/or drug allergies and a lack of c1-esterase inhibitor could be excluded in all patients . in all cases , the condition responded promptly to parenteral steroids , h1 and h2 blockers and discontinuation of srl . in the majority of patients , the ae seems to disappear without further recurrence after adequate therapy of the symptoms . the responsibility of mtor - i / psi in the pathogenesis of ae is suggested either as the sole aetiological factor or more probably as a cofactor [ 17 , 22 , 56 , 57 ] several hypotheses can be advanced to explain the potential triggering role of mtor - i / psi : cytochrome p450 3a4 metabolism pathway interaction [ 6365 ] , experimental interaction between mtor - i / psi and the bradykinin pathway and autoimmune diseases induced by mtor - i / psi introduction . the absence of urticaria with ae suggests that mtor - i / psi - associated aes are not ige mediated [ 17 , 22 , 56 , 57 ] . in conclusion , mtor - i / psi may facilitate the occurrence of oedema . it is important to be aware of this phenomenon to avoid burdensome and cost - intense investigations for patients showing this symptom during treatment with mtor - i / psi .

mammalian target of rapamycin inhibitor ( mtor - i)/proliferation signal inhibitors ( psi ) including sirolimus and everolimus represent a new class of drugs increasingly used in solid - organ transplantation as alternatives to calcineurin inhibitors for patients with renal dysfunction , transplant coronary arterial vasculopathy or malignancy . the most frequently occurring mtor - i / psi - related adverse events are similar to those associated with other immunosuppressive therapies , but some side effects are more characteristic of proliferation signal inhibitors ( e.g. lymphocele , arthralgia , oedema and hyperlipidaemia ) . the present paper review incidence , clinical presentation and mechanism of oedema within the clinical experience of mtor - i / psi in solid organ transplantation .

ms commonly appears in young adults and requires lifelong management , with significant potential for disability among people of working age . indeed , the world health organisation and multiple sclerosis international federation have estimated that about 60% of patients with ms will no longer have full ambulatory function twenty years following diagnosis of the disease . a group of european experts in ms care recently used a structured process of information sharing and consensus building to define a new vision for optimal ms care in the 21st century . as therapeutic practices and cultural influences vary between regions , it is important that such initiatives be conducted in other parts of the world where ms has a major impact on public health . accordingly , a group of physicians involved in the care of ms patients from ten middle eastern countries recently considered the current and future management of ms within this region . the expert group are all coauthors of this paper and drawn from a panel of experts convened for this purpose ( on the basis academic and research history in the field of ms and representation of countries across the middle east and north africa ) at a closed meeting ; additionally , ke acted as chair and pr ( who led the european expert group ) acted as moderator . firstly , a list of perceived needs in ms care in the middle east was generated by participants , in terms of how care for ms might develop in the future , what barriers might prevent the achievement of optimum standards of care , and what factors might drive the change required . following discussion , this initial list was condensed into a series of principles , which were displayed in view of the group . these items were narrowed down using a voting system in which each participant had five votes which could be allocated in any combination among the principles identified above ( e.g. , each participant could distribute the votes singly among five different items or , alternatively , up to all five votes could be given to a single item that the individual expert considered to be of major importance ) . voting was open and the six principles with the highest total of votes were selected . participants discussed these further and generated a consensus statement encapsulating their vision for future ms care in the region . limited epidemiological data are available from the middle eastern countries regarding the prevalence , incidence or natural history ( including prognosis and economic impact ) of ms , or with regard to the increasing expanding cost of managing the condition . based on the kurtzke classification , the middle east is located in a low - risk zone for ms ; however , recent studies suggest a moderate - to - high prevalence in areas within the region ( 3155 ms per 100,000 individuals ) , with an increase in incidence and prevalence in recent years , especially among women [ 1 , 38 ] . thus , the countries of the middle east bear a considerable burden of ms . the left - hand column of table 1 shows the twelve core principles identified by experts as important factors underpinning their vision of 21st century care for ms in the middle east . these encompassed improved communication and contact with diverse stakeholders in care delivery , including patients , healthcare practitioners , and regulators and recognised the importance of personalised care and empowerment of patients . factors related to treatments for ms were included , with regard to improved therapeutic profiles of interventions , the choice of interventions , the timing of delivery of treatments , and cost . the importance of furthering the research agenda in ms was also recognised , with regard to the need for and design of new clinical studies . the six core principles arising from the consensus process are shown in the right - hand column of table 1 . it should be noted that questions and discussions during this process led to some merging or modification of original principles that expressed similar or overlapping aspirations for ms care ; in all cases , this was achieved by consensus . accordingly , items were merged relating to communication between stakeholders and patients , to regulatory matters and reimbursement , and to the properties of therapy options . some other items were made more specific ; namely , the experts emphasised the multidisciplinary nature of ms centres of excellence and the importance of timely diagnosis of ms in addition to prompt therapeutic intervention where required . the six core principles were distilled by consensus into the following vision statement : optimization of patient - centred multidisciplinary strategies to improve the quality of life of people with ms . there is no doubt that early diagnosis of ms or its pathological predecessor , cis , facilitates timely intervention with disease - modifying therapy which , in turn provides better long - term patient outcomes [ 9 , 10 ] . there is a need to improve the disease recognition and the process and the time of referral for ms patients from primary health care system to specialty care . moreover , starting therapy earlier is more cost effective than delaying therapy for ms . training of primary care physicians to recognise the symptoms of ms or cis and to refer appropriately to a specialist will be required alongside universal access to disease - modifying therapy . improving access to care was a priority in the 2003 guideline for the management of ms from the uk national institute for health and clinical excellence ( nice ) , but even in this developed nation , this goal was described as aspirational . ms is a complex and multifactorial disease with a major impact on patients , caregivers , and families . the nice guideline for the management of ms defines the minimum membership of a specialist neurological team as comprising doctors , nurses , physiotherapists , occupational therapists , speech / language therapists , clinical psychologists , and social workers . additionally , the team may contain expertise in ( or have ready access to expertise in ) dietetics , liaison psychiatry ( to manage comorbid psychiatric conditions ) , urology ( to manage issues related to bladder dysfunction and sexual health ) , pain management , and ophthalmology . moreover , effective teamwork is essential to manage the patients ' overall condition effectively . the presence of a core team of relevant healthcare professionals within a multidisciplinary clinic will be essential to deliver the multifaceted care necessary to maintain physical functioning and quality of life of the patient with ms . publications of detailed audits of the delivery of care in middle eastern countries are lacking , in common with other areas of ms care in the regions , as described elsewhere in this paper . the experience of the authors indicated that local healthcare systems are often fragmented and highly variable in regard to resources , quality and accessibility . in general , good care is available with all available approved medication available for prescription ; however , the concept of multidisciplinary team - based care is not well established , except in few centres in the region . constructive engagement with patients is necessary to support adherence to treatment , which is an important issue in ms and is likely to limit the effectiveness of disease - modifying therapies . physicians may underestimate the extent of poor adherence to disease - modifying therapies by patients with ms , who frequently take breaks from treatment , and physicians also have limited understanding of the reasons for this behaviour . an earlier expert group of physicians from the middle east identified education of patients , appropriate management of comorbid conditions that inhibit compliance ( such as depression ) , and the active involvement of specialist nurses and lay support groups as key activities in maintaining optimal adherence to therapy . a recent survey found that emotional support was an important unmet need of patients with ms in usa , which provides an example of an important facet of support that can be delivered by stakeholders other than the physician in the healthcare team . patients and caregivers have an urgent need for information when diagnosed with ms , and they look to both physicians and nonclinical stakeholders to provide it . the emotional needs of support group personnel also need to be managed , to preserve the quality and availability of support . improving the self - efficacy of patients with ms has been shown to impact favourably on general aspects of self - care , such as diet . in these ways , positive and constructive engagement between patients and a network of other key stakeholders can improve treatment outcomes in ms . the middle east is a region of developing nations , with considerable disparities of income within them . thus , the cost of treatments for ms particularly newer , branded treatments is likely to represent a barrier to care for many patients in the region , as elsewhere , with limited reimbursement for disease - modifying therapies . moreover , a study in uk showed that higher levels of disability in ms were associated with greater service use and lower quality of life . provision of adequate reimbursement for treatments for ms will be important to ensure that patients are not faced with insurmountable barriers to adequate care . regulators and governments will play a key role in determining access to care in ms . table 2 provides an overview of the position with regard to reimbursement in two countries from the region , as an example of variations in access to medicines for ms in the region . treatments for ms are effective in middle eastern populations , both in reducing relapse rates patients with clinically established ms [ 2226 ] and in delaying the conversion to ms in patients with a clinically isolated syndrome ( cis ) [ 27 , 28 ] . nevertheless , a number of important research questions remain . for example , the aetiology of ms and the reasons for its increasing prevalence remain incompletely understood and further knowledge will drive the development of new treatments . quantitative data on barriers to healthcare for ms in middle eastern countries are lacking , but cost / reimbursement , education , and geography are likely to be important : appropriate studies need to be conducted to quantify the importance of barriers to early diagnosis and intervention in the region . a key current aim of treatment in ms is to reduce the rate of progression of disability , and there is considerably more to be achieved in preserving long - term mobility outcomes in this population . in addition , studies to measure and enhance the quality of life of the patient with ms are needed . the clinical characteristics of ms appear to be changing with time , with patients tending to present with milder disease in recent years , which complicates comparisons of efficacy and tolerability of treatments evaluated at different time points . while the evidence base for interferon in ms is extensive , the place of newer disease - modifying agents in ms care is less certain , particularly when patients have progressed on previous treatment ( see the section on new therapies , below ) . in addition , suggestions that interferon 1b may have increased longevity in patients with ms need to be evaluated rigorously . recent research suggests that treatment can be tailored individually , based on characteristics of ms in a given patient , and more research is needed here . only more randomised , head - to - head trials can fill the gaps in our knowledge regarding the therapeutic profiles of available interventions and of new interventions yet to be introduced . while a comprehensive review of unmet needs is beyond the scope of this paper , the examples described above provide some areas where new research could impact markedly on the future care of ms . inevitably , research funds will be limited for ms as a relatively uncommon disease . projected research funding for the usa in 2013 estimates that 121 million will be allocated to ms in that country , with funding for cancer research 45-fold higher , funding for research onto infectious diseases 32-fold higher and funding for heart disease research 10-fold higher , to provide just a few examples . nevertheless , an increased commitment to research , including in middle eastern populations is essential to address important research questions . disease - modifying therapies reduce the rate of relapse of ms by about 30% per year , and also reduce the rate of development of sustained disability [ 3335 ] . also , some studies suggest that currently available disease - modifying therapies may delay secondary progression to progressive ms in patients with relapsing - remitting ms . however , the goal of relapse - free lives for patients with the disorder remains elusive . interferons are generally well tolerated ( the main symptoms are injection - site reactions and influenza - like symptoms ) , although the need for injection is likely to hinder compliance for some patients , and orally administered agents are becoming available [ 9 , 37 , 38 ] . about half of patients in usa who discontinued disease - modifying therapies did so because of side effects , with about one fifth discontinuing through perceived lack of efficacy . there remains room for improvement in therapies for ms , and achieving evidence - based improvements in this area will be linked closely to maintaining a commitment to research , as described above . the outcome of the consensus process described above reflects the views of physicians caring for patients with ms in middle eastern countries . this represents both a strength and a limitation of the process , in that the principles identified reflect the day - to - day experience of these physicians , but necessarily reflect only the views of those physicians present . also the voting system was open ; this encouraged further discussion which in turn strengthened the consensus achieved . the panel were expert physicians in ms care and an important limitation was a lack of perspective from different members of the multidisciplinary healthcare team . the purpose of our paper is to identify initial priorities relevant to the management of ms and the views of all key stakeholders in the delivery of care will be crucial for implementing strategies to make the care of ms in the middle east for the 21st century . we have identified core principles and we believe that they will underpin the optimisation of care for ms in the 21st century . these encompass commitment to research , improved interactions between patients , different healthcare professionals and regulators , and improved processes for delivery of more effective and better tolerated interventions .

the prevalence of multiple sclerosis ( ms ) is now considered to be medium - to - high in the middle east and is rising , particularly among women . while the characteristics of the disease and the response of patients to disease - modifying therapies are generally comparable between the middle east and other areas , significant barriers to achieving optimal care for ms exist in these developing nations . a group of physicians involved in the management of ms in ten middle eastern countries met to consider the future of ms care in the region , using a structured process to reach a consensus . six key priorities were identified : early diagnosis and management of ms , the provision of multidisciplinary ms centres , patient engagement and better communication with stakeholders , regulatory body education and reimbursement , a commitment to research , and more therapy options with better benefit - to - risk ratios . the experts distilled these priorities into a single vision statement : optimization of patient - centred multidisciplinary strategies to improve the quality of life of people with ms . these core principles will contribute to the development of a broader consensus on the future of care for ms in the middle east .

secondary infertility is a situation in which parents fail to have more children after one year of trying . more specifically , secondary infertility is the inability of the mother to become pregnant once again , or to carry a pregnancy to term , following the birth of one or more biological children ; provided that the birth of previous children did not involve any assisted reproductive technologies or fertility medications . about one third of secondary infertility cases are related to male factors ; another third are related to the female , whereas the remaining are concerned with problems in both the man and the woman , or remain unexplained . while it is primary infertility that attracts media attention , secondary infertility is just as common . according to statistics collected by the center for disease control ( cdc ) , 11% of couples in usa , who already have a child , this represents approximately 4 million families , or about half of all infertility cases . in some communities , as couples experiencing secondary infertility already have a child ; their struggle is often downplayed or even ignored by friends , family , couples experiencing primary infertility , and even doctors . in contrast , in other communities where polygamy is common , it is not unusual for a fifty or sixty year old man who fathers children , to marry a young lady who in turn wishes to conceive . spermatogenesis is a sophisticated , long and very orderly process of cellular division and differentiation that is under the regulation of endocrine signals ( gnrh , lh , inhibin and fsh ) , paracrine signals derived from the interrelation of the different types of cells in the tubules and interstitium , as well as autocrine signals of self communication within the cell . in the testicular tubules , testosterone reaches concentrations 100 times higher than circulating testosterone . the effect of aging on the male reproductive system relies largely on the individual 's characteristics , including acute and chronic diseases , urogenital traumas , as well as lifestyle and environmental factors . age related changes in the reproductive system include all aspects of reproductive function , from deregulation of the hypothalamic pituitary gonadal axis and of local auto / paracrine interactions , to effects on testicular stem cells , flaws in testicular architecture and spermatogenesis , and finally low testosterone secretion and poorly functioning sperms . several theories place mitochondria at the top of cellular events related to aging ; especially concerning the accumulation of oxidative damage to cells and tissues ; a process in which these organelles play a notable role . however , oxidative stress is not the only process involved in mitochondrial evidently , all these issues are likely interdependent . a review of the literature revealed that no age difference was taken into account while managing secondarily infertile men , as most researchers and authors believe that the causes of primary and secondary male infertility are similar . for that reason , the same approach and investigations should be applied to either case . other researchers found that until the age of 40 , the man 's age did not seem to have a significant effect . after 40 , the quality of the semen diminished , possibly to an extent that leads to in vetro fertilization ( ivf ) treatment failure . besides producing low quality semen , age also affects the genetic quality of male sperm . in a study conducted at the lawrence livermore national laboratory ( llnl ) and the university of california at berkeley , researchers discovered that genetic defects in the sperm increase with age in men , possibly leading to decreased fertility , increased chance of miscarriage and increased risk of some birth defects . this article discusses additional approaches to senior fathers complaining of infertility in terms of history taking , blood tests and medical consultations to the relevant specialties . for young men , before the age of andropause and senile prostate enlargement ( spe ) , the causes of secondary male infertility are due to low or absent sperm count , problems with sperm morphology and motility . conventionally , the patient is examined for the presence of varicocele , questioned for relevant past surgeries , systemic illnesses , psychological disturbances and bad habits such as smoking and alcohol abuse . when older patients are concerned , all the aforementioned causes are looked at carefully ; in addition , more investigations are made related to the health problems of aging men , including androgen deficiency of the aging male ( adam ) syndrome , irritable male syndrome , spe and spe medications ( table 1 ) . as age passes , the negative impacts of an unhealthy lifestyle , bad habits and chronic illnesses accumulate . causes of secondary male infertility std sexual transmitted disease spe senile prostatic enlargement prostate problems can affect pregnancy in a number of ways . an enlarged prostate may compromise normal ejaculation ; this could be very disappointing for couples wishing to start a family later in life , especially when the husband 's advanced age is concerned . the possibility of a woman 's egg being fertilized is within a time frame of 12 to 24 hours . if the aged husband was unable to cope with the frequency of intercourse required to target a viable ovum on time or had trouble with ejaculation , the woman 's chance of pregnancy would be lost . a prostate removed due to cancer or spe , could also be a cause of infertility ; as the semen flows backward causing retrograde ejaculation . tamsulosin , an alpha adrenergic antagonist , has been reported to cause decreased sexual drive and abnormal ejaculation in the form of ejaculation failure , ejaculation disorder , retrograde ejaculation and decrease in ejaculation volume in 818% and impotence in 2.9% of the cases . finasteride , a type ii , 5alpha reductase inhibitor is reported to cause abnormal sexual function ( 2.5% ) , erectile dysfunction ( 1.3% ) , ejaculation disorder ( 1.2% ) , and sperm dna damage . testosterone levels in men older than 40 years can de crease at a rate of 12% per annum . reports show that more than 50% of 80year old men have testosterone levels consistent with hypogonadism . loh is a clinical and biochemical syndrome associated with advancing age and characterized by a cluster of symptoms related to senility and androgen hormone deficiency that includes diminished libido , depressed mood and cognition , reduced sense of vitality and well being , increased fatigue , and infertility . andropause symptoms and erectile dysfunction are common among infertile men , affecting approximately 38% of this population . in loh patients , moreover , there is an improvement in cavernous vasodilation and response to sildenafil in arteriogenic erectile dysfunction cases ; the veno occlusive function is also improved . ims , sometimes called the old man syndrome is defined as a state of anxiety , anger , low level of tolerance , short temper , irritability , lack of libido , and infertility . these symptoms take place in elderly men as a result of aging related biochemical changes , hormonal fluctuation , and stress . ims symptoms are believed to be due to decreasing testosterone levels in old male mammals ( figure 1 ) . approximately , 1520% of the healthy fertile male population is estimated to have varicoceles ; however , 30% of infertile men may have them . the mechanism by which a varicocele impairs sperm structure , function , and production is not known , but researchers believe it interferes with testicular thermoregulation . varicocele has been reported to have a higher incidence in secondary infertility in males than in primary infertility . data published by in 1993 by gorelick et al . , suggested that varicocele causes a progressive decline in fertility , whereas that prior fertility in a man with varicocele does not predict resistance to varicocele induced impairment of spermatogenesis . this supports the clinical observation of dealing with more varicocele cases in secondarily infertile men than primary infertility cases . over 124 million individuals worldwide suffer from diabetes mellitus ( dm ) . in communities where diabetes is common , men , the prevalence of sexual dysfunction in diabetic men approaches 50% , presenting as testicular dysfunction , impotence , poor semen quality in the form of decreased sperm motility and concentration , abnormal morphology and increased seminal plasma abnormalities leading to reduced fertility potential . erectile dysfunction and retrograde ejaculation in diabetic men are primarily due to vasculogenic impotence and autonomic neuropathy of the bladder neck respectively . growing evidence indicates that oxidative stress is increased in diabetes due to the overproduction of reactive oxygen species ( ros ) , and the decreased efficiency of antioxidant defenses , a process that starts very early and worsens over the course of the disease . diabetes related oxidative stress may be the trigger for many alterations of sexual function , which can also include decreased testicular mitochondrial function with subsequent infertility . aging is likely to induce oxidative stress , and an increase in oxidative damage to the cells nucleic acids . moreover , impairment of normal spermatogenesis and sperm function are the most common causes of male factor infertility . elevated levels of reactive oxygen species are seen in up to 3080% of infertile men . the role of free radicals in damaging sperm dna has been studied extensively in the process of human reproduction . the excessive level of free radicals can cause detrimental effects on sperm function , and subsequent fertilization and offspring health . oxidative stress develops when there is an imbalance between the generation of free radicals and the scavenging capacity of anti oxidants in the reproductive tract . furthermore , it has been shown to affect both standard semen parameters and fertilizing capacity in a wide spectrum of subfertility conditions ranging from infertility and repeated miscarriages to birth defects and infant deaths . based on the overwhelming evidence surrounding the noxious effects of free oxygen radicals on sperm function and integrity , antioxidant and anti aging formulas have become prescribed to infertile old men ; however , the exact mechanism of the action of dietary antioxidants and their optimal dietary supplementation have not been established . a review of the literature revealed that no age difference was taken into account while managing secondarily infertile men , as most researchers and authors believe that the causes of primary and secondary male infertility are similar . for that reason , the same approach and investigations should be applied to either case . other researchers found that until the age of 40 , the man 's age did not seem to have a significant effect . after 40 , the quality of the semen diminished , possibly to an extent that leads to in vetro fertilization ( ivf ) treatment failure . besides producing low quality semen , age also affects the genetic quality of male sperm . in a study conducted at the lawrence livermore national laboratory ( llnl ) and the university of california at berkeley , researchers discovered that genetic defects in the sperm increase with age in men , possibly leading to decreased fertility , increased chance of miscarriage and increased risk of some birth defects . this article discusses additional approaches to senior fathers complaining of infertility in terms of history taking , blood tests and medical consultations to the relevant specialties . for young men , before the age of andropause and senile prostate enlargement ( spe ) , the causes of secondary male infertility are due to low or absent sperm count , problems with sperm morphology and motility . conventionally , the patient is examined for the presence of varicocele , questioned for relevant past surgeries , systemic illnesses , psychological disturbances and bad habits such as smoking and alcohol abuse . when older patients are concerned , all the aforementioned causes are looked at carefully ; in addition , more investigations are made related to the health problems of aging men , including androgen deficiency of the aging male ( adam ) syndrome , irritable male syndrome , spe and spe medications ( table 1 ) . as age passes , the negative impacts of an unhealthy lifestyle , bad habits and chronic illnesses accumulate . prostate problems can affect pregnancy in a number of ways . an enlarged prostate may compromise normal ejaculation ; this could be very disappointing for couples wishing to start a family later in life , especially when the husband 's advanced age is concerned . the possibility of a woman 's egg being fertilized is within a time frame of 12 to 24 hours . if the aged husband was unable to cope with the frequency of intercourse required to target a viable ovum on time or had trouble with ejaculation , the woman 's chance of pregnancy would be lost . a prostate removed due to cancer or spe , could also be a cause of infertility ; as the semen flows backward causing retrograde ejaculation . tamsulosin , an alpha adrenergic antagonist , has been reported to cause decreased sexual drive and abnormal ejaculation in the form of ejaculation failure , ejaculation disorder , retrograde ejaculation and decrease in ejaculation volume in 818% and impotence in 2.9% of the cases . finasteride , a type ii , 5alpha reductase inhibitor is reported to cause abnormal sexual function ( 2.5% ) , erectile dysfunction ( 1.3% ) , ejaculation disorder ( 1.2% ) , and sperm dna damage . testosterone levels in men older than 40 years can de crease at a rate of 12% per annum . reports show that more than 50% of 80year old men have testosterone levels consistent with hypogonadism . loh is a clinical and biochemical syndrome associated with advancing age and characterized by a cluster of symptoms related to senility and androgen hormone deficiency that includes diminished libido , depressed mood and cognition , reduced sense of vitality and well being , increased fatigue , and infertility . andropause symptoms and erectile dysfunction are common among infertile men , affecting approximately 38% of this population . in loh patients , symptoms are reversed by androgen supplements . moreover , there is an improvement in cavernous vasodilation and response to sildenafil in arteriogenic erectile dysfunction cases ; the veno occlusive function is also improved . ims , sometimes called the old man syndrome is defined as a state of anxiety , anger , low level of tolerance , short temper , irritability , lack of libido , and infertility . these symptoms take place in elderly men as a result of aging related biochemical changes , hormonal fluctuation , and stress . ims symptoms are believed to be due to decreasing testosterone levels in old male mammals ( figure 1 ) . approximately , 1520% of the healthy fertile male population is estimated to have varicoceles ; however , 30% of infertile men may have them . the mechanism by which a varicocele impairs sperm structure , function , and production is not known , but researchers believe it interferes with testicular thermoregulation . varicocele has been reported to have a higher incidence in secondary infertility in males than in primary infertility . data published by in 1993 by gorelick et al . , suggested that varicocele causes a progressive decline in fertility , whereas that prior fertility in a man with varicocele does not predict resistance to varicocele induced impairment of spermatogenesis . this supports the clinical observation of dealing with more varicocele cases in secondarily infertile men than primary infertility cases . over 124 million individuals worldwide suffer from diabetes mellitus ( dm ) . in communities where diabetes is common , men , the prevalence of sexual dysfunction in diabetic men approaches 50% , presenting as testicular dysfunction , impotence , poor semen quality in the form of decreased sperm motility and concentration , abnormal morphology and increased seminal plasma abnormalities leading to reduced fertility potential . erectile dysfunction and retrograde ejaculation in diabetic men are primarily due to vasculogenic impotence and autonomic neuropathy of the bladder neck respectively . growing evidence indicates that oxidative stress is increased in diabetes due to the overproduction of reactive oxygen species ( ros ) , and the decreased efficiency of antioxidant defenses , a process that starts very early and worsens over the course of the disease . diabetes related oxidative stress may be the trigger for many alterations of sexual function , which can also include decreased testicular mitochondrial function with subsequent infertility . aging is likely to induce oxidative stress , and an increase in oxidative damage to the cells nucleic acids . moreover , impairment of normal spermatogenesis and sperm function are the most common causes of male factor infertility . elevated levels of reactive oxygen species are seen in up to 3080% of infertile men . the role of free radicals in damaging sperm dna has been studied extensively in the process of human reproduction . the excessive level of free radicals can cause detrimental effects on sperm function , and subsequent fertilization and offspring health . oxidative stress develops when there is an imbalance between the generation of free radicals and the scavenging capacity of anti oxidants in the reproductive tract . furthermore , it has been shown to affect both standard semen parameters and fertilizing capacity in a wide spectrum of subfertility conditions ranging from infertility and repeated miscarriages to birth defects and infant deaths . based on the overwhelming evidence surrounding the noxious effects of free oxygen radicals on sperm function and integrity , antioxidant and anti aging formulas have become prescribed to infertile old men ; however , the exact mechanism of the action of dietary antioxidants and their optimal dietary supplementation have not been established . old men presenting with secondary infertility should be approached comprehensively , as more clinical conditions that impair fertility might emerge with aging . the biology of senescence itself has a negative effect on fertility probabilities . moreover , as the impact of existing chronic illnesses , such as diabetes mellitus and senile prostatic enlargement , on body health becomes more severe with time , potential fertility is diminished further . still , there remain unclear causes related to the aging of male physiology that affect sperm parameters and sexual function , leading to an increase in time to pregnancy and decreased fertility rates . the prescription of antioxidant and anti aging supplements to infertile aged men is beneficial . we believe that secondary infertility in aged men is a developing subject that still has many gaps requiring large scale studies .

introductionold men preparing themselves for marriage late in their lives might face infertility . infertility in this group of men should be considered from a wider perspective , as they face any age related health troubles that include , but are not limited to , androgen deficiency and psychological disorders that impede early conception . this review aims to shed light on the proper approach to this minority of secondarily infertile men.material and methodsa comprehensive electronic english literature search was conducted , using various medical websites and books , for the factors that cause infertility in senior fathers . the physiology of geriatric males , together with their common comorbidities , were discussed.resultsold men presenting with secondary infertility should be approached differently . aging , itself , has a significant impact on male sexual function , sperm parameters , and fertility ; all of which contribute to poor fecundability , decreased fertilizing capacity , increased time to pregnancy , increased rate of dna damage , high abortion rates and increased prevalence of fetal developmental failures . the complexity and the unknowns of the aging male physiology , together with the interaction of obstinate diseases the patient might have , make the issue very difficult to tackle.conclusionsmanagement should include the conventional way of treating young sufferers and further target the underlying causes , if known , along with the provision of geriatric , psychologic , and andrologic support .

a 10-year - old , 5.1 kg ( 11.2 lb ) , male castrated cat was presented with signs of lethargy and decreased appetite at home after being previously healthy . serum biochemical analysis identified normokalemia ( 5.1 mmol / l ; reference interval [ ri ] 3.45.6 mmol / l ) and severe hyponatremia ( 123 mmol / l ; ri 145158 mmol / l ) , with an na / k ratio of 24 ( ri 3241 ) . baseline serum cortisol was low to normal , but serum aldosterone was markedly decreased with a pre - adrenocorticotropic hormone stimulation concentration of 13 pmol / l ( ri 194388 pmol / l ) and post - adrenocorticotropic hormone stimulation concentration of 21 pmol / l ( ri fine - needle aspiration was strongly suggestive of lymphoma of the adrenal glands , and pcr for antigen receptor rearrangement was positive for b - cell clonal expansion ; based on these findings , a diagnosis of primary adrenal b - cell lymphoma was made . stable disease was achieved for a short period of time following vincristine , cyclophosphamide , prednisolone and fludrocortisone therapy , followed by progressive adrenal enlargement and electrolyte derangements that responded to neither doxorubicin nor adjustments in fludrocortisone dosage . ultrasonographic metastasis was not identified at any time , and other organ derangements were not noted on hematologic or biochemical analyses . this is the first report of primary adrenal lymphoma in a cat , with presenting signs compatible with hypoaldosteronism . lymphoma should be a differential for cats presenting with adrenal enlargement or clinical signs and biochemical changes consistent with hypoaldosteronism or hypoadrenocorticism . a 10-year - old , 5.1 kg ( 11.2 lb ) , male castrated domestic shorthair cat was examined for a 1 day history of lethargy and hiding in unusual places . the cat had eaten during the day but at a slower pace than normal and had not displayed any vomiting , diarrhea , coughing or sneezing . before this incident the cat did not have any known medical issues , was housed indoors and had an up - to - date vaccine status . a snap felv / fiv elisa assay ( idexx ) was negative 2 years prior to presentation . on physical examination the cat was alert , appeared euhydrated and had a body condition score of 7/9 . results of hematologic testing were all within normal limits ( see table s1 in the supplementary material ) . serum biochemical analysis revealed hypochloremia ( 97 mmol / l ; reference interval [ ri ] 104128 mmol / l ) , mild hypermagnesemia ( 1.3 mmol / l ; ri 0.751.25 mmol / l ) , normal potassium ( 5.1 mmol / l ; ri 3.45.6 mmol / l ) and severe hyponatremia ( 123 mmol / l ; ri 145158 mmol / l ) with an na / k ratio of 24 ( ri 3241 ) ( see table s2 in the supplementary material ) . urine specific gravity was 1.028 ( ri 1.0151.060 ) ; no other abnormalities were noted on urinalysis . a baseline serum cortisol concentration was low to normal at 57.4 nmol / l ( ri three - view thoracic radiographs identified a small caudal vena cava and otherwise normal cardiovascular structures . abdominal ultrasound ( ge logiq 9 ultrasound machine ) performed by a board - certified radiologist identified a markedly enlarged ( 2 cm 1.6 cm 1.7 cm ) , heterogeneous and hypoechoic left adrenal gland and an enlarged ( 2.2 cm 0.8 cm 0.8 cm ) hypoechoic right adrenal gland ( figure 1 ) . the remainder of the abdomen was normal , with no lymphadenopathy or other changes noted . ultrasonographic images of the ( a ) left and ( b ) right adrenal glands at presentation . note the heterogeneous and hypoechoic appearance ; the right adrenal gland retains a recognizable adrenal shape the cat initially received a 30 ml / kg intravenous ( iv ) bolus of saline ( 0.9% nacl ) and was then administered saline at 125 ml / kg / day . the cat ate overnight and its blood pressure improved to 130 mmhg . on day 2 the cat s electrolyte derangements had improved ( sodium 141 mmol / l , potassium 4.3 mmol / l ) but were still present ( see table s3 in the supplementary material ) . serology for toxoplasma gondii antibodies were submitted and empiric treatment with clindamycin ( 12 mg / kg iv q12h ) was instituted . an adrenocorticotropic hormone ( acth ) stimulation test , using previously described protocols , was performed with a 5 g / kg dose of cosyntropin ( amphastar pharmaceuticals ) to measure pre- and post - acth serum aldosterone concentration . cortisol concentrations were also intended to be measured ; unfortunately , owing to laboratory miscommunications , these were not performed . on day 3 the cat continued to eat well ; sodium had increased but was still below the ri at 144 mmol / l and potassium had increased further to 4.4 mmol / l . its blood ph had also decreased , to 7.289 ( previously 7.337 ; ri 7.2507.400 ) . the results of the aldosterone testing revealed a pre - acth aldosterone concentration of 13 pmol / l ( ri 194388 pmol / l ) and a post - acth concentration of 21 pmol / l ( ri fludrocortisone acetate ( 0.01 mg / kg po q24h ) was added to the cat s treatments . on day 4 , t gondii titers were negative at < 1:64 for both igg and igm , and clindamycin and iv fluid therapy were discontinued . ultrasound revealed a static right adrenal gland but enlargement of the left adrenal gland ( increased to 2.3 cm 1.6 cm 1.8 cm ) . ultrasound - guided fine - needle aspiration of the left adrenal gland was performed , and a cytologic diagnosis of lymphoma was made by a board - certified clinical pathologist . pcr for antigen receptor rearrangement ( parr ) was positive for b - cell clonal expansion . cytology of the liver and spleen did not show evidence of metastasis to those organs . the cat was discharged to the owner on fludrocortisone pending consultation with the oncology service . seven days after initial presentation the cat was presented to the oncology service for assessment of bilateral lymphoma of the adrenal glands . prednisolone ( chop ) uw - madison protocol was selected , and the cat received 0.7 mg / m vincristine iv and was discharged with prednisolone ( 2.0 mg / kg po q24h ) , maropitant ( 1.6 mg / kg po q24h as needed for nausea ) , mirtazapine ( 0.76 mg / kg po q72h as needed for inappetence ) and continued fludrocortisone . the cat s owner reported that the cat initially did well at home , but 7 days after receiving vincristine it became inappetant and lethargic . the cat presented the next day , where its body weight was 4.70 kg and a complete blood count revealed a normal white blood cell count . the cat received 32 ml / kg lactated ringer s solution subcutaneously and prednisolone was continued at the current dose ( 2.1 mg / kg po q24h ) . it was re - evaluated on day 20 since initial presentation where its body weight had increased to 4.75 kg and its owner reported improved appetite and energy levels . electrolytes were revealed to be once again deranged , with a sodium of 133 mmol / l and a potassium of 4.9 mmol / l , so its fludrocortisone was increased to 0.01 mg / kg ( po q12h ) . prednisolone was tapered to 1.6 mg / kg ( po q24h ) . on day 27 the cat was stable and doing well , with a leukocyte count of 8.43 10/l ( ri 3.517.0 10/l ) and a neutrophil count of 7.31 10/l ( ri 2.58.5 10/l ) ( table s1 in the supplementary material ) . it received a decreased dose of 0.6 mg / m of vincristine given its inappetence after the initial dose , and prednisolone was tapered to 1.1 mg / kg ( po q24h ) , but on day 31 the cat was presented to the emergency service for lethargy and anorexia . the cat s weight had decreased to 4.4 kg and it was mildly febrile at 39.4c ( 102.9f ) . biochemical analysis revealed a mild hyponatremia at 142 mmol / l and normokalemia at 4.3 mmol / l ( table s3 in the supplementary material ) . complete blood count revealed a non - regenerative anemia at 0.25 l / l with 17,000/l reticulocytes ( ri 045,000/l ) , along with a severe leukopenia at 0.6 10/l , including a lymphopenia at 0.348 10/l ( ri 1.28.0 10/l ) and severe neutropenia at 0.06 10/l . bone marrow suppression secondary to chemotherapy was suspected , an iv catheter was placed using aseptic technique and the cat was hospitalized on 0.9% nacl iv at 75 ml / kg / day , enrofloxacin ( 5.1 mg / kg iv q24h ) , ampicillin ( 22.7 mg / kg iv q8h ) and maropitant ( 1.0 mg / kg sc q24h ) . the cat was discharged 48 h later on amoxicillin - clavulanic acid ( 14.2 mg / kg po q12h ) , prednisolone ( 1.1 mg / kg po q24h ) and fludrocortisone , which was increased to 0.02 mg / kg in the morning and 0.01 mg / kg in the evening . the cat was presented on day 35 for re - evaluation ; it was doing well at home but its body weight had decreased to 4.3 kg . recheck abdominal ultrasound revealed a stable left adrenal gland ( 2.3 cm 1.8 cm 1.8 cm ) and a more enlarged right adrenal gland ( 2.1 cm 2.0 cm 1.9 cm ) . doxorubicin ( 1.0 mg / kg iv ) was administered with plans to transition to a single - agent protocol because of the lack of response to vincristine and cyclophosphamide , and evidence of progressive disease based on declining body weight and enlarging adrenal glands . by day 48 the cat weighed 4.0 kg , but its owner reported it was much improved at home with a good appetite and energy level . mmol / l ) and high normal potassium level ( 4.5 mmol / l ) . the cat received a second dose of doxorubicin and prednisolone was continued at 1.2 mg / kg ( po q24h ) . on day 54 the cat was presented for abdominal ultrasound ; its body weight had decreased further to 3.8 kg and its appetite had become moderately decreased . abdominal ultrasound revealed progressive enlargement of both the left ( 2.4 cm 2.6 cm 2.9 cm ) and right ( 2.8 cm 2.6 cm 2.8 cm ) adrenal glands , with the surrounding tissue noted to be mildly hyperechoic ( figure 2 ) . the cat received 400 iu / kg asparaginase subcutaneously and was hospitalized for iv fluid therapy . the following day its electrolyte abnormalities had worsened , with a hyponatremia of 132 mmol / l and a hyperkalemia of 5.9 owing to lack of response to therapy and evidence of progressive disease the owners elected humane euthanasia ; necropsy was declined . ultrasonographic images of the ( a ) left and ( b ) right adrenal glands on day 54 . to our knowledge , this is the first description of a primary adrenal lymphoma ( pal ) in a cat . this is a rare but well - described syndrome in humans , but has not been reported in cats . few studies have identified hypoadrenocorticism of various causes in cats , none of which identified lymphoma as an underlying cause , apart from a single case report of two cats with lymphoma metastasizing to the adrenal glands . a retrospective study of 33 cats with adrenal masses identified 17 carcinomas , 13 adenomas and three pheochromocytomas but no cases of lymphoma . the single reported case study of two cats with hypoadrenocorticism as a manifestation of adrenal lymphoma identified multiple sites of metastasis , with evidence such as abdominal effusion or a mass effect present . a retrospective evaluation of metastatic tumors to the adrenal glands in domestic animals identified bilateral masses in 50% of cats , and lymphoma was identified as one of the metastasizing tumors . the infiltration was severe and obliterating in 60% , regardless of underlying histopathology , which was suspected in the cat of the current report given that adrenal function must be compromised by at least 90% in order to detect clinical changes . in this cat , in contrast , thoracic radiographs and abdominal imaging revealed no abnormalities throughout the progression of the disease , with only the adrenal glands themselves increasing in size . normal adrenal glands in cats measure from 0.451.37 cm in length , whereas this cat s adrenal glands ultimately reached 2.9 cm in length . in one human study 71.4% of cases of pal presented with hypocortisolism , whereas this cat s baseline cortisol concentrations were low to normal at the time of presentation . in the previous report , one cat had a low cortisol concentration and one cat had a low to normal cortisol concentration . this is consistent with peterson s findings that not all cats with hypoadrenocorticism had cortisol concentrations below the ri , but all were at least low to normal . aldosterone concentrations were not measured in either case of metastatic lymphoma , but that report did identify hyperkalemia in both cats . previous reports of hypoadrenocorticism in cats have not thoroughly examined aldosterone concentrations in response to acth stimulation , although all 10 cats in the 1989 study did have abnormal serum sodium : potassium ratios , consistent with hypoaldosteronism . at least one case report has identified both low cortisol and aldosterone concentrations both pre- and post - acth administration . studies have also confirmed that cats with normal adrenal function will show large increases in serum aldosterone concentrations after administration of both 125 g / cat and 5 g / kg , indicating that a low serum aldosterone concentration post - acth stimulation is a reliable indicator of mineralocorticoid insufficiency . a study has evaluated the effects of lymphoma on adrenal testing in dogs ; none of these dogs had acth stimulation results consistent with hypoadrenocorticism , suggesting that lymphoma is not an expected cause of low cortisol or aldosterone concentrations after acth stimulation . repeat cortisol concentration was not measured after the initial acth stimulation in this cat because of concurrent prednisolone administration as a part of the chop protocol , so whether it was initially hypocortisolemic or this eventually developed , hypocortisolemia can not be determined . however , given the low - to - normal basal cortisol , hypotension and lack of stress leukogram or hyperglycemia upon initial presentation , along with the apparent response to corticosteroid supplementation , it is likely that hypocortisolemia was also present . initial improvements in the cat s demeanor and appetite can likely be attributed to the exogenous corticosteroid administration ( in the form of both fludrocortisone and prednisolone ) , as well as vincristine . this would also be consistent with pal in humans , where hypoadrenocorticism is more common than hypoaldosteronism alone . ideally histopathologic evaluation of the adrenal gland would also have been performed post mortem to evaluate changes in the zona glomerulosa , as well as the zona fasciculata . post - mortem examination would also have allowed for confirmation of pal although lymphadenopathy or changes in other organs were not identified based on serial ultrasonography or biochemistry , the possibility of a separate primary tumor can not be completely ruled out in this case . however , at no time were changes such as a mass effect or abdominal effusion noted , which were present in the two cats in which lymphoma metastasized to the adrenal glands . this is also the first known report of the use of chemotherapy for treatment of pal in a cat the two cats in the previous study of lymphoma and hypoadrenocorticism were euthanized without undergoing any chemotherapy other than corticosteroids administered prior to diagnosis . after vincristine and cyclophosphamide , stable disease was evident based on static ultrasound findings , and progressive disease was identified after two doses of doxorubicin ; although the cat improved clinically at home after each dose it subsequently declined within 13 weeks each time . this is consistent with human studies , where the success rate is poor for those with tumor - induced adrenocortical insufficiency . in one study , all four patients with non - hodgkin s lymphoma with signs of hypoadrenocorticism died of lymphoma within 6 months of the initiation of chemotherapy . even in more recent studies where > 50% of patients were alive after 1 year , the long - term prognosis remains poor . in the human literature , < 200 cases of pal have been reported , accounting for < 1% of non - hodgkin lymphomas , and 10% of cases of bilateral adrenal masses . the two most common subtypes are diffuse large b cell ( 78% ) and peripheral t cell ( 7% ) , and up to half of reported patients presented with signs of adrenal insufficiency . parr of adrenal gland aspirates in this cat similarly identified b - cell clonal expansion . in humans the disease tends to be highly symptomatic and aggressive , and appears to have a predilection for elderly males , although younger people and females have also been affected . the prognosis is poor compared with that of nodal diffuse large b - cell lymphoma , and adrenalectomy does not appear to confer a survival benefit in humans . more recently the addition of rituximab , a chimeric monoclonal antibody against the protein cd20 , which is primarily found on the surface of immune system b cells , to the traditional chop protocol ( r - chop ) has been utilized in human patients with pal leading to improved survival rates . one study reports that a single patient receiving r - chop achieved complete remission after three cycles of chemotherapy , remaining tumor - free 3 years after chemotherapy . a larger study of 31 patients identified a complete remission rate of 54.8% and an overall response rate of 87.0% with r - chop , with a 2 year overall survival of 68.3% , an improvement over chop alone in pal patients . the tumor in this case was found to be b cell in origin , although immunocytochemistry was not performed so the value of specific anti - cd20 monoclonal antibodies can not be determined . the use of these therapies is just beginning to be investigated in dogs , and , at the time of writing , has not been investigated in cats but may offer improved survival in these species as well given the apparent similarities to the form of the disease seen in humans . this case report describes a cat that presented for investigation of mild signs of lethargy and hyporexia , with laboratory testing consistent with hypoaldosteronism and adrenal insufficiency . a diagnosis of primary adrenal b - cell lymphoma was made using fine - needle aspiration and parr , but the cat responded poorly to treatment for both lymphoma and hypoadrenocorticism . pal has not previously been reported in cats , and should be a differential in cases of hypoaldosteronism , hypoadrenocorticism or adrenal masses .

case summarya 10-year - old , 5.1 kg ( 11.2 lb ) , male castrated cat was presented with signs of lethargy and decreased appetite at home after being previously healthy . serum biochemical analysis identified normokalemia ( 5.1 mmol / l ; reference interval [ ri ] 3.45.6 mmol / l ) and severe hyponatremia ( 123 mmol / l ; ri 145158 mmol / l ) , with an na / k ratio of 24 ( ri 3241 ) . baseline serum cortisol was low to normal , but serum aldosterone was markedly decreased with a pre - adrenocorticotropic hormone stimulation concentration of 13 pmol / l ( ri 194388 pmol / l ) and post - adrenocorticotropic hormone stimulation concentration of 21 pmol / l ( ri 277721 pmol / l ) . hematologic and biochemical analyses were otherwise unremarkable . abdominal ultrasound revealed bilaterally enlarged adrenal glands with no other abnormalities noted ; thoracic radiographs also did not identify any signs of metastasis . fine - needle aspiration was strongly suggestive of lymphoma of the adrenal glands , and pcr for antigen receptor rearrangement was positive for b - cell clonal expansion ; based on these findings , a diagnosis of primary adrenal b - cell lymphoma was made . stable disease was achieved for a short period of time following vincristine , cyclophosphamide , prednisolone and fludrocortisone therapy , followed by progressive adrenal enlargement and electrolyte derangements that responded to neither doxorubicin nor adjustments in fludrocortisone dosage . ultrasonographic metastasis was not identified at any time , and other organ derangements were not noted on hematologic or biochemical analyses . the cat was euthanized 55 days after initial presentation.relevance and novel informationthis is the first report of primary adrenal lymphoma in a cat , with presenting signs compatible with hypoaldosteronism . lymphoma should be a differential for cats presenting with adrenal enlargement or clinical signs and biochemical changes consistent with hypoaldosteronism or hypoadrenocorticism .

were isolated from the peripheral blood by density gradient centrifugation ( ficoll - hypaque , ge , piscataway , nj ) . monocytic cd14 cells were isolated from pbmcs using anti - cd14 magnetic microbeads and the automacs pro separator ( miltenyi biotec , auburn , ca ) , per manufacturer 's instructions . purity of isolated cell populations was > 90% , as evaluated by flow cytometry . melanoma cell line [ a375 ] ( atcc crl-1619 ) was purchased from atcc ( manassas , va ) and maintained in dmem containing 10% ( v / v ) fbs . we do not culture this cell line for longer than 68 weeks and all cell - stocks came from thawed vials that were frozen at passage two after receiving from atcc . a375 cell line was authenticated by atcc cell bank using the short tandem repeat ( str ) profiling . we established an in vitro model of melanoma cell - line - induced mdscs that faithfully recapitulates patient - derived cd14 hladr monocytic mdsc phenotype and function , . cd14 cells ( 1 10 cells / well ) , isolated from pbmcs obtained from healthy donors , were co - cultured with a375 tumor cells ( 5 10 cells / well ) in complete imdm ( supplemented with 10% human ab serum [ sigma - aldrich , st . louis , mo ] , l - glutamine [ 2 mm ] , and penicillin / streptomycin ) per well in a 6-well plate ( bd falcon ) . tumor / monocyte co - cultures were treated twice with the small molecule inhibitor of mif , 4-ipp ( 100 m on day 0 and 50 m on day 2 ) , or 0.1% dmso ( vehicle control ) . a375 co - cultured monocytes ( both vehicle - treated and 4-ipp - treated ) and control monocytes cultured without tumor cells ( cultured monocytes ) were gently harvested after 6468 h of culture and cd11b cells ( a375-mdscs ) were purified with anti - cd11b microbeads and automacs separator ( miltenyi biotec ) ( fig . we refer to the cd11b cells isolated from the a375 monocyte co - cultures as a375-mdscs although we are cognizant of the fact that these cells represent a heterogenous population of cells . the percentage of cd14 cd11b cd33 hladr cells are substantially increased in a375-monocyte co - cultures in comparison to that of monocytes cultured in the absence of melanoma cells an expression signature that closely corresponds to monocytic mdscs isolated from late stage melanoma patients , , . furthermore , in contrast to tumor cell - free cultured monocytes , a375-mdscs exhibit potent suppressive activity against autologous t cell proliferation and ifn- production , . gene expression profiles of vehicle - treated a375-mdscs or 4-ipp - treated a375-mdscs ( a375-mdsc + 4-ipp ) were compared to that obtained using monocytes cultured without tumor cells ( fig . 1 ) . total rna from cultured monocytes , vehicle - treated , and 4-ipp - treated a375-mdscs ( n = 3 ) were isolated post-68 h in vitro culture and analyzed over a microarray . for rna extraction , cells were lysed in buffer rlt ( qiagen , valencia , ca ) , homogenized , and purified using rneasy mini kit ( qiagen ) following manufacturer 's instructions . integrity of rna was checked using a bioanalyzer 2100 ( agilent technologies , santa clara , ca ) . biotinylated crna was prepared from 100 ng of total rna according to the standard protocol for affymetrix 3 ivt express plus reagent kit . following fragmentation , crna was hybridized for 16 h at 45 c to affymetrix primeview human arrays according to the genechip 3 array hybridization user manual from affymetrix . the arrays were processed following the manufacturer recommended wash and stain protocol on an affymetrix fs-450 fluidics station and scanned on an affymetrix genechip scanner . the resulting .cel files were imported into partek genomics suite 6.6 and transcripts were normalized and summarized using rma as normalization and background correction method . step - up false discovery rate was chosen as multiple test correction for the resulting p - values . the microarray datasets discussed in current study have been deposited in ncbi 's gene expression omnibus ( geo ; www.ncbi.nlm.nih.gov/geo ) and are accessible through geo series accession number gse73333 . were isolated from the peripheral blood by density gradient centrifugation ( ficoll - hypaque , ge , piscataway , nj ) . monocytic cd14 cells were isolated from pbmcs using anti - cd14 magnetic microbeads and the automacs pro separator ( miltenyi biotec , auburn , ca ) , per manufacturer 's instructions . purity of isolated cell populations was > 90% , as evaluated by flow cytometry . melanoma cell line [ a375 ] ( atcc crl-1619 ) was purchased from atcc ( manassas , va ) and maintained in dmem containing 10% ( v / v ) fbs . we do not culture this cell line for longer than 68 weeks and all cell - stocks came from thawed vials that were frozen at passage two after receiving from atcc . a375 cell line was authenticated by atcc cell bank using the short tandem repeat ( str ) profiling . we established an in vitro model of melanoma cell - line - induced mdscs that faithfully recapitulates patient - derived cd14 hladr monocytic mdsc phenotype and function , . cd14 cells ( 1 10 cells / well ) , isolated from pbmcs obtained from healthy donors , were co - cultured with a375 tumor cells ( 5 10 cells / well ) in complete imdm ( supplemented with 10% human ab serum [ sigma - aldrich , st . louis , mo ] , l - glutamine [ 2 mm ] , and penicillin / streptomycin ) per well in a 6-well plate ( bd falcon ) . tumor / monocyte co - cultures were treated twice with the small molecule inhibitor of mif , 4-ipp ( 100 m on day 0 and 50 m on day 2 ) , or 0.1% dmso ( vehicle control ) . a375 co - cultured monocytes ( both vehicle - treated and 4-ipp - treated ) and control monocytes cultured without tumor cells ( cultured monocytes ) were gently harvested after 6468 h of culture and cd11b cells ( a375-mdscs ) were purified with anti - cd11b microbeads and automacs separator ( miltenyi biotec ) ( fig . 1 ) . purity of isolated cell populations was > 90% as evaluated by flow cytometry . we refer to the cd11b cells isolated from the a375 monocyte co - cultures as a375-mdscs although we are cognizant of the fact that these cells represent a heterogenous population of cells . the percentage of cd14 cd11b cd33 hladr cells are substantially increased in a375-monocyte co - cultures in comparison to that of monocytes cultured in the absence of melanoma cells an expression signature that closely corresponds to monocytic mdscs isolated from late stage melanoma patients , , . furthermore , in contrast to tumor cell - free cultured monocytes , a375-mdscs exhibit potent suppressive activity against autologous t cell proliferation and ifn- production , . gene expression profiles of vehicle - treated a375-mdscs or 4-ipp - treated a375-mdscs ( a375-mdsc + 4-ipp ) were compared to that obtained using monocytes cultured without tumor cells ( fig . 1 ) . total rna from cultured monocytes , vehicle - treated , and 4-ipp - treated a375-mdscs ( n = 3 ) were isolated post-68 h in vitro culture and analyzed over a microarray . for rna extraction , cells were lysed in buffer rlt ( qiagen , valencia , ca ) , homogenized , and purified using rneasy mini kit ( qiagen ) following manufacturer 's instructions . integrity of rna was checked using a bioanalyzer 2100 ( agilent technologies , santa clara , ca ) . biotinylated crna was prepared from 100 ng of total rna according to the standard protocol for affymetrix 3 ivt express plus reagent kit . following fragmentation , crna was hybridized for 16 h at 45 c to affymetrix primeview human arrays according to the genechip 3 array hybridization user manual from affymetrix . the arrays were processed following the manufacturer recommended wash and stain protocol on an affymetrix fs-450 fluidics station and scanned on an affymetrix genechip scanner . the resulting .cel files were imported into partek genomics suite 6.6 and transcripts were normalized and summarized using rma as normalization and background correction method . step - up false discovery rate was chosen as multiple test correction for the resulting p - values . the microarray datasets discussed in current study have been deposited in ncbi 's gene expression omnibus ( geo ; www.ncbi.nlm.nih.gov/geo ) and are accessible through geo series accession number gse73333 . a microarray analysis of normal monocytes , vehicle - treated - a375-mdscs , and 4-ipp - treated a375-mdscs was performed to identify downstream mif effectors that could be responsible for mif - dependent phenotypic and functional contributions to human mdscs . melanoma cell line - induced mdsc transcriptome reveals a unique gene expression profile that is largely reversed to normal monocyte levels by mif inhibition . inflammatory cytokines , chemokines / chemokine receptors , matrix metalloproteases , angiogenic growth factors , and arachidonic acid / prostaglandin - generating enzymes are all differentially expressed in a375-mdscs and restored to part of this work was performed with assistance of the genomics facility ( university of louisville ) , which is supported by nih p20gm103436 ( ky idea networks of biomedical research excellence ) , nih p30gm106396 ( j. g. brown cancer center , university of louisville , phase iii cobre ) , and the james graham brown foundation , and user fees .

myeloid - derived suppressor cells ( mdscs ) are potently immunosuppressive innate immune cells that accumulate in advanced cancer patients and actively inhibit anti - tumor t lymphocyte responses [ 1 ] . increased numbers of circulating mdscs directly correlate with melanoma patient morbidity and reduced anti - tumor immune responses [ 2 ] , [ 3 ] . previous studies have revealed that monocyte - derived macrophage migration inhibitory factor ( mif ) is necessary for the immune suppressive function of mdscs in mouse models of melanoma [ 4 ] , [ 5 ] . to investigate whether mif participates in human melanoma - induced mdsc differentiation and/or suppressive function , we have established an in vitro mdsc induction model using primary , normal human monocytes co - cultured with human melanoma cell lines in the presence or absence of the mif antagonist4-ipp [ 4 ] , [ 6 ] , [ 7 ] , [ 8 ] , [ 9 ] . to identify potential mechanistic effectors , we have performed transcriptome analyses on cultured monocytes and on melanoma - induced mdscs obtained from either untreated or 4-ipp - treated a375:monocyte co - cultures . here , we present a detailed protocol , which can facilitate easy reproduction of the microarray results ( ncbi geo accession number gse73333 ) published by yaddanapudi et al . ( 2015 ) in cancer immunology research [ 10 ] .

um has a high mortality rate due to a high incidence of metastasis that usually occurs in the liver [ 13 ] . metastasis is a multistep process , which includes migration , adhesion , and invasion of cancer cells into the blood or lymphatic vessels that lead to the metastasis . matrix metalloproteinases ( mmps ) are a group of proteolytic enzymes that play an important role in the degradation of extracellular matrix ( ecm ) . mmp family members collectively can degrade all structural components of the ecm and lead to tumor cell migration , invasion , metastasis , and angiogenesis . the expression and activity of mmps are increased in many types of human cancer , and this correlates with advanced tumor stage , increased invasion and metastasis , and shortened survival [ 4 , 5 ] . mmp-2 is a member of the mmp family and can degrade matrix collagen and basement membrane . high levels of mmp-2 are associated with an increased of invasion and metastasis in several types of cancer [ 410 ] . zeaxanthin , a natural bioactive , which belongs to the xanthophyll subclass of the carotenoid family , has been found to have specific cytotoxic effects on several types of cancer cells [ 1118 ] . our previous study revealed that zeaxanthin reduced the cell viability of um cells whereas it did not affect the cell viability of normal ocular cells . zeaxanthin induced apoptosis in human cultured um cells through the activation of mitochondrial pathway . however , to the best of our knowledge , the effects of zeaxanthin on the cell migration and invasion of um cells have not been reported . the purpose of the present study was to investigate the effects of nonlethal doses of zeaxanthin on the cell migration , invasion , and the secretion of mmp-2 by cultured human um cells and its relevant signal pathways . c918 is an immortal um cell line isolated from um patients with metastasis by the university of iowa . cells were cultured with dulbecco 's modified eagle 's medium ( dmem ) supplements with 10% fetal bovine serum . briefly , um cells ( 5 10/well ) were seeded into 96-well plates and treated with zeaxanthin ( 0 , 1 , 3 , 10 , and 30 m ) for 24 h. zeaxanthin was obtained from dr . dennis l. gierhart ( chesterfield , mo , usa ) and was prepared as a stock solution at 60 mm by dissolving into dmso ( sigma , st . louis , mo , usa ) . after washing with medium , mtt ( 50 l of 1 mg / ml in dmem ) was used for the quantification of living cells . mitochondrial dehydrogenases in living cells metabolize mtt to a purple formazan dye , which is measured photometrically at 540 nm by a microplate reader ( multiskan ex , thermo , ventana , finland ) . cell viability is proportional to the reading of absorbance and was expressed as the percentage of the reading from the control ( cells cultured without zeaxanthin ) . the cell monolayer was scratched with a 200 l micropipette tip to create a wound . the cultures were washed twice in pbs to remove float cells and debris and replaced with fresh culture medium . cultures were photographed at various time periods by using an olympus ix70 inverted phase - contrast microscope ( olympus inc . cells migrating from the leading edge were counted in 4 random fields and expressed as mean sd . the leading edge at different time periods was adjusted based on the width of unclosed wound of the control ( cells not cultured with zeaxanthin ) . migration assays for um cells were performed by using a 48-well boyden chamber and a cellulose nitrate membrane with 8 m pore size ( both from neuro probe , inc . , gaithersburg , md ) . the lower chamber was filled with dmem with 10% serum . um cells ( 2 10 cells / well ) in serum - free dmem solution with or without zeaxanthin ( 10 m ) were seeded into the upper chamber . after 8 h of incubation , cells on the upper surface of the membrane that had not migrated were gently scraped away with a cotton swab . the migrating cells on the lower side of the membrane were fixed with methanol and stained with hematoxylin . ten fields were randomly selected and cells that had migrated to the lower surface of the membrane were counted under a light microscope at 200 . corning matrigel invasion chamber ( 8 m pore size , coated with matrigel ; discovery labware inc . , bedford , dmem with 10% serum was added into the lower chamber ; 5 10 um cells in serum - free dmem with or without zeaxanthin ( 10 m ) were added to the upper chamber and cultured . after 16 h of incubation , cells in the upper surface of the filter membrane that had not migrated were gently scraped away with a cotton swab . the invading cells on the lower surface of the filter membrane were fixed , stained , and counted as described above . the cultured medium was withdrawn and replaced with serum - free medium after washing the cells . cells were cultured with or without zeaxanthin at various levels . after being cultured for 24 h , conditioned medium was collected and centrifuged at 500 g for 10 min , and the supernatants were collected and stored in vials at 70c until analysis . the protein amount of mmp-2 in the conditioned media was determined using the human mmp-2 quantitation elisa kit ( r&d systems , minneapolis , mn , usa ) according to the manufacturer 's instructions . optical density was read by using a microplate reader at 450 nm and corrected with 540 nm . the amount of mmp-2 ( pg / ml ) was calculated from a standard curve and expressed as percentages of the negative controls ( cells cultured without zeaxanthin ) . the sensitivity of the mmp-2 kit was 0.082 ng / ml . um cells were plated into 6-well plates at a density of 1 10 cells per well . after 24 h of incubation , the medium was replaced and cells were cultured with or without zeaxanthin ( 10 m ) for 30 min . cells were scraped from the well and the nuclear fraction was extracted by using nuclear extraction kit ( biosource , camarillo , ca , usa ) . cells were treated with hypotonic cell lysis buffer , incubated for 10 min at ice , treated with detergent solution , vortexed , and centrifuged ( 800 g , 6 min at 4c ) . the pellet ( nuclear fraction ) was collected , washed with nuclear wash buffer , and centrifuged ( 800 g , 6 min at 4c ) . the pellet ( nuclear fraction ) was collected , treated with complete extraction buffer , vortexed , incubated at ice , and centrifuged ( 14,000 g , 30 min at 4c ) . the amount of nuclear factor - kappa b ( nf-b ) in the nuclear extracts was measured by using nf-b elisa kits ( invitrogen , carlsbad , ca , usa ) according to the manufacturer 's instructions . the levels of nf-b were calculated using a standard curve and expressed as percentages of the negative controls ( cells cultured without zeaxanthin ) . the sensitivity of this kit was < 50 pg / ml . all tests were performed in triplicate . data in each group were calculated and expressed as mean and standard deviation ( mean sd ) . statistical significances of difference of means throughout this study were calculated by student 's t - test in comparing data between two groups and anova one - way test in comparing data from more than two groups . chicago , il , usa ) was used for the analysis of the data . a difference at p in mtt assay , zeaxanthin at the final levels of 1.0 and 3.0 m did not influence the cell viability of cultured human um cells ( p > 0.05 , compared with cells not treated with zeaxanthin ) ( figure 1 ) . cell viability in um cells cultured with zeaxanthin at 10 m was slightly lower than that of the controls and the difference was statistically nonsignificant ( p > 0.05 ) , whereas cell viability was significantly lowered in 30 m zeaxanthin treated cells ( p < 0.05 ) . dye exclusion staining showed that the number of nonvial cells was significantly increased in cells treated with 30 m zeaxanthin , but not in 110 m treated cells ( data not shown ) . therefore , level ranges 110 m of zeaxanthin were chosen as nonlethal dosages for subsequent experiments . um cell cultures were scratched and cultured with 0 , 1 , 3 , and 10 m zeaxanthin . photos taken at 0 , 4 , and 8 h after scratch ( figure 2 ) show that the migration of um cells was dose - dependently inhibited by zeaxanthin . after incubation for 4 h , cells migrating from the leading edge at cultures treated with zeaxanthin at 0 , 1 , 3 , and 10 m were 152.5 10.2 , 142.0 7.5 , 124.0 9.3 , and 82.0 6.6 ( mean sd ) , respectively , and expressed as the percentages of the controls ( without zeaxanthin ) at 1.00 0.07 , 0.93 0.05 , 0.81 0.06 , and 0.54 0.05 ( mean sd ) , respectively ( figure 2(b ) ) . migrating cells in cells cultured with 1 m zeaxanthin were not significantly different from those in the controls ( cells cultured without zeaxanthin ) ( p > 0.05 ) . migrating cells at 3 and 10 m zeaxanthin groups were significantly less than those in the controls and cultured with 1 m zeaxanthin ( p < 0.05 ) . migrating cells at 10 m zeaxanthin group were significantly less than those cultured with 3 m zeaxanthin ( p < 0.05 ) . after incubation for 8 h , cells migrating from the leading edge at cultures treated with zeaxanthin at 0 , 1 , 3 , and 10 m zeaxanthin were 196.8 12.8 , 178.5 13.2 , 134.5 8.8 , and 70.3 6.8 , respectively , and expressed as the percentage of the controls at 1.00 0.07 , 0.91 0.07 , 0.68 0.04 , and 0.36 0.03 , respectively ( figure 2(c ) ) . migrating cells in cells cultured with 1 m zeaxanthin were not significantly different from those in the controls ( p > 0.05 ) . migrating cells at 3 and 10 m zeaxanthin groups were significantly less than those in the controls and with 1 m zeaxanthin ( p < 0.05 ) . migrating cells at 10 m zeaxanthin group were significantly less than those cultured with 3 m zeaxanthin ( p < 0.05 ) ( figure 2 ) . cells were treated with and without zeaxanthin ( 10 m ) and cultured for 8 h. the results are shown in figures 3(a ) , 3(b ) , and 3(c ) . numbers of migrating cells in cultures with and without zeaxanthin were 67.2 6.16 and 107.3 9.75 cells , respectively . zeaxanthin significantly decreased the transmembrane migration of um cells as compared with cells not treated with zeaxanthin ( p < 0.05 ) . the effects of zeaxanthin on cell invasion of um cells were studied by matrigel invasion chamber . cells were treated with and without zeaxanthin ( 10 m ) and cultured for 16 h. the results are shown in figures 4(a ) , 4(b ) , and 4(c ) . numbers of invaded cells in cultures with and without zeaxanthin were 135.8 12.2 and 231.9 20.4 cells , respectively . zeaxanthin significantly decreased the invasion of um cells as compared with cells not treated with zeaxanthin ( p < 0.05 ) . one - way anova analysis of the results on the mmp-2 assay revealed that zeaxanthin had a dose - dependent inhibitory effect on the secretion of mmp-2 protein by um cells ( p < 0.05 ) ( figure 5 ) . secretion of mmp-2 by um cells treated with zeaxanthin at 3.0 and 10.0 m was significantly less than that from the negative control ( cells not treated with zeaxanthin , p < 0.05 ) . zeaxanthin ( 10.0 m ) treatment decreased nf-b levels in nuclear extracts of the um cells . the levels of nf-b in nuclear extracts in cells cultured with zeaxanthin were only 42% of the control values ( cells not treated with zeaxanthin ) . the difference of nf-b levels between cells treated with and without zeaxanthin was statistically significant ( p < 0.05 ) . in the present study , the nonlethal dosages of zeaxanthin significantly inhibited the cell migration of cultured human um cells as demonstrated by the wound healing assay and the boyden migration assay . matrigel is the extracellular matrix secreted by the engelbrecht - holm - swarm mouse sarcoma cell line . it contains laminin , collagen iv , nidogen / entactin , and proteoglycans and resembles the basement membrane . cell invasion is usually tested by the use of matrigel invasion chamber . in the present study , zeaxanthin significantly inhibited the invasion of um cells through the matrigel - coated membrane from the upper surface of the membrane to the lower side . mmps are a group of zinc - dependent proteinase capable of digesting virtually any component of the ecm to enhance the migration , invasion , and metastasis of cancer cells . the mmps could be divided into collagenases , gelatinases , stromelysins , and matrilysins on the basis of their specificity for ecm components or be grouped according to their structure . mmp-2 ( also called 72-kda type iv collagenase , or gelatinase a ) belongs to gelatinases ( based on the substrate ) or gelatin binding mmp group ( based on the structure ) . mmp-2 can degrade denatured collagen ( gelatin ) , native collagens iv , v , vi , and x , elastin , and fibronectin [ 4 , 22 ] . it has been reported that mmp-2 also degrades native collagen i , the main component of mammal scleral protein . mmp-2 has been detected in the um pathologic specimens and cell lines [ 2329 ] . mmp-2 expression is associated with higher incidence of metastatic diseases and lower survival rate [ 23 , 24 ] . it has been reported that mmp-2 may be used as a prognostic marker in um . in the present study , the inhibitory effects of zeaxanthin on the secretion of mmp-2 by um cells might cause the inhibition of cell migration and invasion of um cells by zeaxanthin . this is consistent with previous reports that various medications can inhibit the cell migration and invasion of various cancer cells through the inhibition of mmp-2 [ 19 , 20 , 30 ] . nf-b is a major transcription factor that promotes the expression of many genes involved in a variety of cellular processes . nf-b is present in the cytoplasm in an inactive nf-b complex which could be activated by various stimuli . activated nf-b translocates to the nucleus and binds to the promoter or enhancer regions of specific genes and then induces the expression of relevant genes , including various mmps [ 31 , 32 ] . the expression of nf-b in metastatic um is higher than that of the primary tumor [ 33 , 34 ] . nf-b inhibitor bay11 - 7082 markedly decreased the nuclear translocation of nf-b and inhibits the migration of human um cells . mir-9 suppresses um cell migration and invasion through downregulation of nf-b signaling pathway . in the present study , zeaxanthin inhibited the secretion of mmp-2 protein and decreased nf-b levels in nuclear extracts of the um cells , suggesting that zeaxanthin inhibits the secretion of mmp-2 via nf-b signal pathway . this is consistent with the previous reports that nf-b is the upstream of mmp-2 in various cancer cells [ 20 , 32 , 3537 ] . recently , xu et al . published their studies regarding the effects of zeaxanthin on the growth and invasion of um in nude mice eyes and revealed that zeaxanthin significantly inhibited the invasion of uveal melanoma . this in vivo invasion inhibitory effect of zeaxanthin on um was consistent with the result of our in vitro study . furthermore , wu et al . found that fibroblasts cultured with cutaneous melanoma conditioned medium showed an increase of migration . this report indicated that zeaxanthin not only influenced the migration of um as revealed by us but also inhibited factors secreted by cutaneous melanoma that stimulates the migration of fibroblast . in conclusion , this study demonstrated that , in addition to the previously reported zeaxanthin - induced apoptosis effects on um cells , zeaxanthin can also inhibit the cell migration and invasion of cultured human um cells by the decrease of secretion of mmp-2 . this effect is attributed to the inhibition of nf-b pathway in um cells by zeaxanthin . the results of this study further suggest that zeaxanthin might be a potentially therapeutic approach in the management of uveal melanoma .

zeaxanthin at nonlethal dosages ( 310 m ) significantly inhibited the cell migration of cultured uveal melanoma cells ( c918 cell line ) as determined by wound healing assay and boyden chamber assay . matrigel invasion assay showed that cell invasion of uveal melanoma cells could be significantly inhibited by zeaxanthin . secretion of mmp-2 by melanoma cells was significantly inhibited by zeaxanthin in a dose - dependent manner as measured by elisa kit . zeaxanthin also significantly inhibited the nf-b levels in nuclear extracts of the um cells , which is the upstream of the mmp-2 secretion . these results suggest that zeaxanthin might be a potentially therapeutic approach in the prevention of metastasis in uveal melanoma .

the treatment of choice for the partially edentulous patient , when all the factors are favorable , is normally a tooth supported fixed partial denture or implant supported the prosthesis . some factors , however , militate against the use of tooth supported fixed partial denture and rule in favor of removable partial denture ( rpd ) . these include the advanced age of the patient , greater length of the edentulous span , excessive bone loss , reduced periodontal support of remaining teeth , and absence of abutment teeth posterior to edentulous space . cast rpds are still a treatment option in such situations in spite of advancements in the field of dental implants . the inability to accurately adapt the framework on the cast and in the patient 's mouth has been attributed to several factors related to clinical and laboratory procedures . in routine practice , the waxed rpd refractory cast is routinely sent back to the dentist for approval of the design . this procedure could vary in the time period from 01 h to 24 h depending on the workload of the dentist and the laboratory , the proximity of the dental office to the laboratory , and the appointment schedule for the patient . in many laboratories , the waxed patterns may be stored on the shelf under variable temperatures and humidity for extended periods of time . this additional storage time could increase the distortion of the wax and the refractory cast and may lead to inaccuracies in castings . anterior - posterior palatal bar , palatal strap , and palatal plate design are commonly used in kennedy class iii modification situation since these designs provide excellent rigidity , support and patient tolerance . although rigidity is considered as one of the important structural requirement for the selection of major connector design , the adequate scientific evidence is lacking regarding the accuracy of the framework in relation to the major connector design . previous studies concentrated on rest seat adaptation , sprue design , sprue position , sprue size , investment coating method , various casting techniques , and button versus buttonless castings systems . the accuracy of the fit of the cast cobalt - chromium ( co - cr ) restoration is essential for its longevity because it allows for less accumulation of plaque and ensue easy insertion and removal with better mechanical and biological factors considering the patient health . therefore , this study was undertaken to investigate the effect of storage time of wax pattern ( 01 h , 03 h , 06 h , and 24 h ) and framework design ( anterior - posterior palatal bar , palatal strap , and palatal plate ) on the accuracy of fit of cast partial denture frameworks . the maxillary part of typodont ( columbia dentoform model m-1560 , long island , new york ) was converted into a kennedy class iii modification-1 edentulous situation by removing second premolars and first molars bilaterally . this typodont was converted into a metal dimade up of brass which served as the master die [ figure 1 ] . master die was duplicated with reversible hydrocolloid material ( castogel , bego , germany ) and 36 refractory casts were fabricated , 12 for each design with phosphate bonded investment material ( wirovest , bego , germany ) following manufacturer 's recommendations . refractory casts were divided into three groups based on the design of maxillary major connector . group i with anterior - posterior palatal bar design , group ii with palatal strap design and group iii with palatal plate design [ figure 2 ] . the wax pattern for the framework was made from prefabricated wax forms to get a uniform thickness of various components . groups i , ii , and iii were further divided into four sub groups based on the storage time of wax pattern before investing . these include ( i ) sub group a : 01 h , ( ii ) sub group b : 03 h , ( iii ) sub group c : 06 h and ( iv ) sub group d : 24 h , respectively . the storage temperature in the laboratory was maintained between 23c and 25c , with a low humidity of 2030% . after the said storage periods , spruing , investing , and casting were carried out for each wax pattern and the casts were invested following standard protocols as recommended by the manufacturers . all the castings were examined visually under magnification by using hand held magnifier lens ( 2.5 power mg82015-l , china ) before finishing and polishing for any casting defect such as surface irregularities , nodules , porosities , or incompleteness . a number of defects in each casting and location of the defects were noted and tabulated . sprues were cut - off with a high - speed grinder , finishing , and polishing carried out following manufacturers recommendations before evaluating fit on the master die . modified typodont converted to master die wax up for three groups polyvinyl siloxane addition silicone ( light body ) material ( silagum , dmg chem - pharm , hamburg , germany ) was used to evaluate the fit of the framework on master die . for the application of uniform pressure , the standardized pressure of 3 pounds / cm was applied using a hydraulic pressure application clamp ( macro dent , pune , maharashtra india ) . the thickness of an elastomeric material layer on the fitting surface of the metal framework was measured at each specific indexed grid point . the thickness at each point was measured and recorded to the nearest 0.01 mm with a digital vernier caliper micrometer guage ( model 102 - 217 , mitutoyo corporation . the measured indexed grid points [ figure 3 ] were located as follows : points l1 and l2 , 0.5 cm medial to the internal finish lines from the midpoint of the of saddle on the major connector for all three groups , point l3 , 1.2 cm posterior to the apex of interdental papilla between the central incisors on the midline at the midpoint of the anterior - posterior palatal bar ( group i ) , the palatal strap ( group ii ) and modified palatal plate ( group iii ) , and lower point l4 , 1.2 cm anterior to the posterior border of master die on the midline at the midpoint of the anterior - posterior palatal bar ( group i ) , the palatal strap ( group ii ) and modified palatal plate ( group iii ) . an additional point ( l5 ) was located in the palatal strap ( group ii ) and modified palatal plate ( group iii ) , at the center of the major connector which is about 2.5 cm anterior to the posterior border of the master die on the midline . this point was not used for the anterior - posterior palatal bar group because of the connector 's open window design . initially , thickness of the framework was measured at specific locations i.e. ( a ) . then the thickness of framework with the light body adhered was measured at corresponding specific locations i.e. ( b ) . then the thickness of the elastomeric material at each indexed grid point i.e. ( c ) was calculated by subtracting the mean thickness of the metal framework at the corresponding indexed locations . the thickness of the elastomeric material or gap discrepancy between the master die and framework ( c ) = thickness of metal and elastomeric material ( b ) thickness of metal framework alone ( a ) . measurement at specific locations mean values and standard deviations were used to describe the measured discrepancies between the fitting surface of the major connectors and the metal die for each experimental condition . repeated measures analysis of variance ( anova ) was used to analyze the data , with the distance between the fitting surface of the connectors and the metal die ( distortion ) as the outcome variable , measurement location as the within subject factor , and time and connector type as between subject factors . for statistical analysis , the statistical software samples in groups i ii , and iii exhibited gap discrepancies between the fitting surfaces of the major connectors and the master die at all locations ( l1 , l2 , l3 , l4 , and l5 ) as evidenced by the thickness of elastomeric impression material at these points . the data observed with group iii is reflected in table 1 and the same was observed in other groups . it has been found there was a gradual increase in mean values of gap discrepancies with an increase in storage time period of wax pattern irrespective of major connector designs in all the specific locations l1l5 . when with in - subject effects were tested , the location had a significant effect on the measured distortions ( p < 0.05 ) . mean values of gap discrepancy at the l4 and l5 locations were significantly higher than those at the lateral l1 and l2 sections . gap discrepancy at different locations for group iii in one - way anova analysis , it has been observed that there was gradual increase in mean gap discrepancies values for each major connector design for any given storage time of the wax pattern for each location such as l1l5 . multiple comparisons analysis between all the locations l1l5 , statistically significant deterioration of fit of the palatal major connector designs occurred at the each locations l1 l5 ( p < 0.05 for all the locations l1 l5 ) as the storage time of the wax patterns on refractory casts increased from 01 h to 24 h. for all the major connector designs , the highest inaccuracies in fit were revealed in sub group d ( wax pattern stored for 24 h ) for group i ( anterior - posterior palatal bar ) at the location l4 with mean gap discrepancies was 0.44 0.01 mm and for groups ii and iii at the location ( l5 ) of the connectors with mean gap discrepancies 0.66 0.01 mm for the palatal strap design and 0.66 0.01 mm for the palatal plate design . wax patterns in sub groups a ( stored for 01 h ) revealed better fit than those stored for 03 h , 06 h , and 24 h at all locations for all the connectors designs . the least gap discrepancies were recorded at locations l1 ( lateral section ) for this sub group a with mean values of 0.19 0.03 mm for the anterior - posterior palatal bar designs , 0.20 0.04 mm for palatal strap design and 0.34 0.02 mm at location l1 ( lateral section ) for the palatal plate connector . discrepancies in the fit increased toward the center of the palate at location l5 followed by l4 ( lower middle section ) as compared with the lateral sections l1 and l2 , in all the groups i ii and iii . clinical experience with cast co - cr alloy partial dentures have shown that a framework rarely get adapted to the oral cavity accurately without the need for some adjustment , despite the fact that some adjustments has already been performed in the laboratory to fit the framework to the master cast . this problem is related to the dimensional inaccuracies that occur during various stages ( clinical and laboratory ) of framework construction . the framework that appeared to have a good fit may have been distorted when seated on the cast or in the mouth . such distortion is possible because of the flexibility of framework , including the major connector design . distortion of the wax pattern used for the fabrication of cast rpd framework is another factor which often leads to inaccuracy of the fit of completed castings . wax has been used as a common pattern material for cast rpd frameworks . of all dental materials , waxes have the highest coefficient of thermal expansion , which may be a major contributing factor to the inaccuracy of the final restoration when it is not controlled . on cooling , inlay waxes and other pattern waxes can have a linear thermal expansion of up to 0.6% when heated from 25c to 37c . conditions may arise in dental laboratories that could lead to a delay in the casting of the wax pattern of a partial denture framework . this leads to the additional storage time of wax pattern and could increase the distortion of the wax and the refractory cast . other factors that influenced their accuracy included the mold temperature , sprue size , position , and dimension of the wax patterns . although there are enough studies regarding the accuracy of fit related to fixed partial dentures , studies related to rpds are limited . after an extensive search of the literature related to cast rpds , it was found that studies related to the storage of the wax pattern and the major connector design on the accuracy of fit were lacking . therefore , this study was taken up with the objectives to evaluate the casting defects and accuracy of fit of frameworks of frameworks fabricated from wax patterns of various maxillary major connector designs ( anterior - posterior palatal bar , palatal strap , and palatal plate ) stored at different time periods ( 1 h , 3 h , 06 h , and 24 h ) . statistical analysis of data has shown that there was significant increase in mean values of gap discrepancy with respect to increase in storage time of wax pattern irrespective of major connector designs in all the locations ( p < 0.05 ) and this was more at l5 in case of palatal strap and palatal plate design and l4 in case of anterior - posterior palatal bar design [ table 1 ] . the mean gap discrepancies in locations l1 were least followed by l2 ( midpoints in the lateral straps and lateral sides ) in all connector designs , and these mean gap discrepancies were significantly less than those measured at the middle locations l3 ( upper middle ) and l4 ( lower middle ) of the connectors . these findings are in agreement with the results of the study conducted by diwan et al . they also observed that the fit of frameworks deteriorated markedly as the storage time increased from 24 h to 1 week . the storage time of the wax pattern on the refractory cast before casting had a significant effect on the resulting distortion in the fit of the cast major connectors . in the palatal plate design , most of the distortion occurred in the first 01 h ( sub group a ) and increased slowly thereafter in sub groups b ( 03 h ) , c ( 06 h ) , and d ( 24 h ) . the anterior - posterior palatal bar design showed much less distortion within 01 h ( sub group a ) , but distortion occurred later at a comparatively higher rate ( sub groups b , c , and d ) [ figure 4 ] . connector design had a significant effect on the amount of distortion between the fitting surface and the master cast ( p < 0.05 in all the location l1l5 ) . the palatal plate design showed more distortion than the anterior - posterior palate bar design . gap discrepancy at all locations with ap bar design the amount of internal stresses induced in the wax patterns with the palatal plate ( closed ) design was significantly greater than those in the palatal strap and anterior - posterior palatal bar designs as evidenced by the greater gap discrepancy . this was most likely the result of differences in their manipulative abilities and the area of coverage by wax . for the connectors , finger pressure was used to mold or adapt the wax sheets to the surface of the refractory casts , particularly at the center of the palate . the latter variable , in addition to the increased area of coverage by wax in the palatal plate design , would have increased the induced stresses in that group of wax patterns , with a resultant contraction that was increased by aging . the palatal sections of the plate , compressed to fit the curved palate , would attempt to straighten out as the wax cooled to room temperature . it would be logical to assume that the observed distortions in the fit of castings were not solely attributed to changes in the casting wax alone . instead , the distortions resulted from a combination of dimensional changes in the wax and the refractory casts . earnshaw reported that phosphate - bonded investments removed from the mold 1 h after mixing and freely exposed to air demonstrated a decrease in setting expansion . wirovest investment material , which was used in this study , is a phosphate - bonded material . high setting expansion rates have been reported for phosphate - bonded materials , particularly when mixed with a silica sol ( special liquid ) more than with water . the setting expansion was found to be sensitive to factors such as mixing speed , water or liquid powder ratio , the presence of extra water from the duplicating gel , and age of the material . the materials are also characterized by their high thermal expansions in comparison to gypsum - bonded investments . it would be reasonable to assume that storing the waxed refractory casts for long periods would have resulted in some shrinkage . despite its high thermal expansion , the investment material when heated exhibited an insufficient shrinkage compensation that further increased the inaccuracy of the final castings . the behavior of the wax patterns for all the connector designs validates these assumptions , and the same observation was found in a study conducted by diwan et al . the other factors that could possibly affect the fit of the partial denture frameworks , such as spruing techniques and type of alloy , were controlled in this study . careful polishing of the metal framework was performed according to guidelines by stern et al . to avoid the effect of metal loss on the contact between the tooth and framework . casting defects which were evaluated by visual examination under magnification in this study were basically external defects such as distortion in the form of nodules and incomplete casting . these findings are in agreement with explanation given by rudd and rudd in their review article . in this study , only some of the major connector designs were evaluated . it is unreasonable to expect similar results with various other brands of materials and equipment used in the casting procedure . the objective of this study was only to evaluate the effect of three wax pattern framework designs ( anterior - posterior palatal bar , palatal strap , and palatal plate ) and storage time ( 1 h , 3 h , 06 h , and 24 h ) on the accuracy of fit of removable co - cr cast partial denture frameworks . the other factors such as dimensional changes and effect of different materials were not investigated . the accuracy of fit of frameworks deteriorated markedly as the storage time increased from 03 h to 24 h. minimum inaccuracies were seen with 01 h storage time and the greatest inaccuracies in fit were observed with 24 h storage time . the resulting discrepancies in fit were possibly the result of a combination of dimensional changes in the casting wax and the refractory casts . the design of the major connector had an influence on the fit of the framework . more gap discrepancies were evident with a palatal plate and palatal strap compared to an anterior - posterior palatal bar design . a number of casting defects ( nodules / incompleteness ) observed less in the frameworks fabricated from the wax pattern which were invested in 01 h or less . it is recommended that the wax patterns for rpds be invested immediately on completion of the wax procedure . for best results , the wax patterns should be started and completed in 1 h or less .

statement of problem : inaccuracies in the fit of palatal major connectors may be related to distortion of the wax pattern due to prolonged storage time and faulty major connector design.purpose:this in vitro study was carried out to find out the effect of storage time and major connector design on the accuracy of cobalt - chromium cast removable partial dentures ( rpds).materials and methods : a brass metal die with a kennedy class iii , modification 1 , the partially edentulous arch was used as a master die . thirty - six refractory casts were fabricated from the master die . the refractory casts were divided into three groups ( group i : anterior - posterior palatal bar , group ii : palatal strap and group iii : palatal plate ) based on the design of maxillary major connector and subdivided into four groups ( sub group a : 01 h , sub group b : 03 h , sub group c : 06 h , and sub group d : 24 h ) based on the storage time . for each group , 12 frameworks were fabricated . the influence of wax pattern storage time and the accuracy of the fit palatal major connector designs on the master die were compared . casting defects ( nodules / incompleteness ) of the frameworks were also evaluated before finishing and polishing . repeated measures analysis of variance was used to analyze the data.results:the gap discrepancy was least in sub group a ( 01 h ) followed by sub group b ( 03 h ) and c ( 06 h ) and most in sub group d ( 24 h ) . statistically significant differences ( p < 0.05 in all locations l1l5 ) in the fit of the framework were related to the design of the major connector . the gap discrepancy was least in group i ( anterior - posterior palatal bar ) followed by group ii ( palatal strap ) and most in group ii ( palatal plate).conclusions : it is recommended that the wax patterns for rpd to be invested immediately on completion of the wax procedure . the selection of a major connector design is crucial for an accurate fit of rpd .

nonalcoholic fatty liver disease ( nafl ) is a term applied to the accumulation of fat in the liver in the absence of alcohol consumption . nafl refers to a wide spectrum of liver damage ranging from simple steatosis to non - alcoholic steatohepatitis ( nash ) to advanced fibrosis and finally , cirrhosis . the clinical significance of nafl is derived mostly from its high prevalence in the general population and in its possible progression to liver failure . obesity , type 2 diabetes mellitus and hyperlipidemia are the major risk factors associated with nafl . a bulk of evidence suggests that insulin resistance plays a major role in the pathogenesis of nafl and nash . however with meticulous questioning , more than half would mention fatigue , right upper quadrant pain and occasional discomfort , although the significance of these symptoms is uncertainmost cases initially come to medical attention by the incidental finding of increased liver echogenicity during ultrasonography performed for other reasons . ultrasonography could be used as a non - invasive predictor of liver histology in both moderate and severe steatosis , and advanced fibrosis with acceptable sensitivity and specificity . nevertheless , gradual and sustained weight reduction and exercise are most frequently recommended for overweight nafl patients . weight reduction can not only improve symptoms , but also the risk of progression of nafl to cirrhosis . in the present study we compare the effect of a weight reduction diet on liver ultrasonographic findings in overweight nafl patients . to our knowledge , only one study has thus far researched weight reduction in nafl adults . from july 2003 to december 2005 all patients incidentally found to have fatty liver by ultrasonography who referred to radiology and gastroenterology clinics were included . fasting blood sugar ( fbs ) , and liver transaminase were checked for all patients . waist circumference was measured using a measuring tap placed in a horizontal plane around the abdomen at the level of the iliac creast . patients with body mass index ( bmi ) above 25 and of the ages 16 to 60 were included in the study . patients not consenting to the study or not able to refer for regular follow - up were also excluded . the degree of steatosis was graded by ultrasonography from 0 to 3 according to table 2 . the diet contained 50 percent carbohydrates , 30 percent fat and 20 percent protein given in three meals with a deficit of 500 calories planned to ideally reduce weight by 2 kg per month . patients were followed monthly by a nutritionist . at the end of month three , anthropometric and ultrasonographic measures before and after dieting were compared using student s paired t - test by spss version 14 . the study protocol was approved by the institutional review board and ethics committee of the digestive disease research center ( ddrc ) of tehran university of medical sciences ( tums ) . in this study , 23 patients ( 13 females , 10 males ) were enrolled . the decrease in weight , bmi , waist circumference and hip circumference were statistically significant . the ultrasonographic grade decreased in all patients ; eight had a two grade reduction and 15 patients reduced one grade ( table 4 ) . the decrease in ultrasonographic grade had a significant correlation with decrease in weight and bmi , but not with changes in waist and hip circumferences ( table 5 ) . the amount of decrease in weight and bmi was significantly greater in patients whose ultrasonographic grades improved by two scores when compared to patients who only had a one score improvement . men had a significantly greater weight loss ( p<0.01 ) , but changes in ultrasonographic grade , bmi , waist circumference and hip circumference were not significantly different among the two sexes . the treatment of nafl is controversial and even the necessity of treatment is doubted when there is no indication of liver damage . even in nash , where liver damage is well documented , there is no universally accepted treatment . when treatment is instituted , evaluation of treatment response is usually through transaminase levels or liver histology . in nafl patients , where the transaminase levels are normal to begin with , histology is the only guide to treatment . but liver biopsy is a fairly invasive procedure and is difficult to justify in subjects with normal liver transaminase levels where the prognosis is generally considered to be very good . in such cases another non - invasive method , such as ultrasonography , could be a good substitute . in this study we observed a significant improvement in ultrasonographic features of nafl by a low calorie diet . unfortunately , we did not have histologic confirmation but we believe it is safe to assume that improvement in histology parallels improvement in ultrasonography . ultrasonography has an acceptable sensitivity and specificity in evaluating liver steatosis and provides a non - invasive predictor of liver histology and degree of steatosis in nafl patients . based on the current study , we suggest ultrasonography as a guide to weight loss . we also observed that patients with a higher initial ultrasonographic grade had greater improvement . it can be concluded that more severe cases will respond better to weight loss . in our study , the diet was designed with a modest calorie deficit aiming at a maximum weight loss of 2 kg per month . the gradual weight loss is important as rapid and severe weight loss , starvation , or even total parenteral nutrition , could result in or perpetuate fatty liver disease 3 - 5 . although slightly more rapid weight loss might also be safe , a modest diet would result in better patient compliance . as mentioned above , the necessity of treatment for non - complicated nafl with no indication of liver injury is in doubt . but considering the safety and other obvious benefits of gradual weight loss , we believe it should be offered to all overweight cases of nafl . we conclude that weight loss is effective in improving the ultrasonographinc grade of steatosis and ultrasonography may be used as a non - invasive indicator of improvement of liver steatosis in patients with nafl during weight reduction .

background non - alcoholic fatty liver ( nafl ) includes a spectrum of diseases ranging from simple hepatic steatosis to nonalcoholic steatohepatitis ( nash ) and cirrhosis . nafl is typically seen in association with obesity , diabetes and hypertriglyceridaemia . in order to seek the role of diet therapy in treatment of nafl , we compared the ultrasonographic findings of patients with fatty liver disease before and after standard diet therapy . methods twenty - three overweight or obese subjects with incidental fatty liver discovered during ultrasonography were included . subjects underwent 3 months of diet therapy , and anthropometric data including weight , height , bmi , waist circumference , and hip circumference were measured . ultrasonographic findings were graded from 0 to 3 . changes in ultrasonographic findings and anthropometric data were studied . results after three months of dieting , the ultrasonographic grade of all patients decreased by one or two grades . fifteen patients decreased one grade while 8 others decreased by 2 grades . we observed a significant correlation between the decrease in ultrasonographic grade and the decrease in weight and bmi . conclusion our study indicates that standard diet therapy could be used as an effective treatment for nafl patients .

tobacco use can be considered one of the main global risk factors leading to the death of nearly 6 million people every year across the world and causing billions of dollars in economic loss . tobacco use among employee is important because of its effect on the overall performance and the work environment . establishing tobacco prevention rules not only reduce the direct use of tobacco but also decreases employee 's indirect exposure to the substance , thereby decreasing the incidence of heart diseases and relevant diseases in nonsmokers . the prevalence and overall status of tobacco use ; particularly cigarette smoking , and its gender distribution among the employees working in different countries do not follow a consistent pattern . for example , the rate of cigarette smoking in physicians from different parts of europe , africa , america , and asia was 37% , 29% , 25% , and 17.5% , respectively . in addition , the rate of cigarettes smoking was higher among male employees than among female employees in most studies . the studies conducted to date in iran on tobacco use among the employees have been more focused on their cigarette smoking and have less have investigated the pattern of tobacco products such as the water - pipe . moreover , these other studies have not investigated the overall status of tobacco use and its relationship with relevant factors . understanding the relationship between common diseases in iran , such as diabetes and heart diseases , and tobacco use among the surveyed employees can be useful . furthermore , this study aimed to determine the pattern of tobacco use on a larger scale among the employees of kermanshah province in western iran . the present cross - sectional study was conducted in 2012 on 7129 employees aged 2285 employed in kermanshah province using the census method . all employees worked in hospitals , insurance organization , telecommunication company , universities , health centers , registry offices , and judiciary . first , we sent an invitation to all organizations to participate voluntarily in this study . next , between all governmental organizations , the numbers of 7129 employees declared that are ready to participate in this study . our goal was collecting data based on the census method , but due to the rejection of our invitation from some organs , we investigated the voluntary organs using the census method . data collected pertained to kermanshah , qasr - e shirin , ravansar , javanrood , harsin , sonqor , dalahoo , and gilan - e gharb . the standardized stepwise questionnaire for noncommunicable diseases ( ncds ) risk factor surveillance of the world health organization ( including tobacco use , hypertension [ htn ] , diabetes , heart diseases , and osteoporosis ) was used for the standardization and accurate collection of data on the status of tobacco use and its relationship with other variables in question . the validated persian questionnaire obtained from iran 's health ministry and since it was used in the study of meysamie et al . in a national study on the pattern of tobacco use in iranian population we rely on this national study . in addition , the scale score reliability of alpha cronbach was estimated 0.85 in this study . the first part included demographic items on age , gender , marital status ( single or married ) and educational level ( with diploma and lower or with higher than diploma education ) , and the second part included data on tobacco use , containing items about the daily frequency of cigarette smoking ( either 19 cigarettes , 1019 or 20 and more ) , the age of starting smoking , smoking history , the age of quitting , passive smoking at home and in the workplace ( at least once a week or more than once a week ) and the current status of daily cigarette ( factory - rolled cigarettes , hand - rolled cigarettes or cigars ) and water - pipe smoking . to assess the current daily status of tobacco use , the variables of smoking cigarettes and smoking waterpipe were combined and the new variable was called general tobacco use . current use of tobacco and its related components was defined as those who currently used cigarette or water pipe continuously without considering its pattern of use and the daily use was defined as those who used one tobacco product each day of the week . the other part of the questionnaire included items with yes / no responses about htn , diabetes , heart diseases , and osteoporosis , for example , has any physician or health personnel ever warned you about the risk of developing one of the discussed conditions or not ? . to categorize the people as hypertensive , a mean systolic blood pressure of 140 mmhg and/or a diastolic blood pressure of 90 mmhg or those who reported the use of antihypertensive treatment during the previous 2 weeks were considered to have htn . in addition , diabetes was defined as having diabetes diagnosed by a physician or health personnel during last year with yes / no responses and/or those who reported the use of antidiabetic medications during the previous 2 weeks . after the research proposal was approved by the ethics committee of kermanshah university of medical sciences , depending on the respondent 's gender , female or male researchers visited the study subjects workplace and delivered the questionnaires to fill out after obtaining their consent to participate in the study and fully explaining the study objectives and ensuring them of the confidentiality of their data . to increase the accuracy of responses and freedom from job preoccupations , it was coordinated with each relevant department 's authority to provide the respondents with questionnaires during hours in which administrative visitors were scarce . the independent t - test was then used to evaluate the relationship between qualitative and quantitative variables and the chi - square test was used to assess the relationship between the qualitative variables . the odds ratio ( or ) measure was used to investigate the relationship between tobacco use and the subjects health complaints . in the hypotheses testing , p < 0.05 was considered significant . study project number and ethical approval code of study were 91255 and kums.arbc.1394.245 , respectively . the present cross - sectional study was conducted in 2012 on 7129 employees aged 2285 employed in kermanshah province using the census method . all employees worked in hospitals , insurance organization , telecommunication company , universities , health centers , registry offices , and judiciary . first , we sent an invitation to all organizations to participate voluntarily in this study . next , between all governmental organizations , the numbers of 7129 employees declared that are ready to participate in this study . our goal was collecting data based on the census method , but due to the rejection of our invitation from some organs , we investigated the voluntary organs using the census method . data collected pertained to kermanshah , qasr - e shirin , ravansar , javanrood , harsin , sonqor , dalahoo , and gilan - e gharb . the standardized stepwise questionnaire for noncommunicable diseases ( ncds ) risk factor surveillance of the world health organization ( including tobacco use , hypertension [ htn ] , diabetes , heart diseases , and osteoporosis ) was used for the standardization and accurate collection of data on the status of tobacco use and its relationship with other variables in question . the validated persian questionnaire obtained from iran 's health ministry and since it was used in the study of meysamie et al . in a national study on the pattern of tobacco use in iranian population we rely on this national study . in addition , the scale score reliability of alpha cronbach was estimated 0.85 in this study . the first part included demographic items on age , gender , marital status ( single or married ) and educational level ( with diploma and lower or with higher than diploma education ) , and the second part included data on tobacco use , containing items about the daily frequency of cigarette smoking ( either 19 cigarettes , 1019 or 20 and more ) , the age of starting smoking , smoking history , the age of quitting , passive smoking at home and in the workplace ( at least once a week or more than once a week ) and the current status of daily cigarette ( factory - rolled cigarettes , hand - rolled cigarettes or cigars ) and water - pipe smoking . to assess the current daily status of tobacco use , the variables of smoking cigarettes and smoking waterpipe were combined and the new variable was called general tobacco use . current use of tobacco and its related components was defined as those who currently used cigarette or water pipe continuously without considering its pattern of use and the daily use was defined as those who used one tobacco product each day of the week . the other part of the questionnaire included items with yes / no responses about htn , diabetes , heart diseases , and osteoporosis , for example , has any physician or health personnel ever warned you about the risk of developing one of the discussed conditions or not ? . to categorize the people as hypertensive , a mean systolic blood pressure of 140 mmhg and/or a diastolic blood pressure of 90 mmhg or those who reported the use of antihypertensive treatment during the previous 2 weeks were considered to have htn . in addition , diabetes was defined as having diabetes diagnosed by a physician or health personnel during last year with yes / no responses and/or those who reported the use of antidiabetic medications during the previous 2 weeks . after the research proposal was approved by the ethics committee of kermanshah university of medical sciences , depending on the respondent 's gender , female or male researchers visited the study subjects workplace and delivered the questionnaires to fill out after obtaining their consent to participate in the study and fully explaining the study objectives and ensuring them of the confidentiality of their data . to increase the accuracy of responses and freedom from job preoccupations , it was coordinated with each relevant department 's authority to provide the respondents with questionnaires during hours the independent t - test was then used to evaluate the relationship between qualitative and quantitative variables and the chi - square test was used to assess the relationship between the qualitative variables . the odds ratio ( or ) measure was used to investigate the relationship between tobacco use and the subjects health complaints . in the hypotheses testing , p < 0.05 was considered significant . study project number and ethical approval code of study were 91255 and kums.arbc.1394.245 , respectively . the mean and standard deviation ( sd ) age of the 7129 kermanshah province office workers was 41.5 8.5 , 73.2% of whom were male , 84.1% were married and 63.1% had higher than diploma education . overall , the daily frequency of cigarette smoking was 19 in 47.9% of the subjects ( n = 284 ) , 1019 in 26.1% ( n = 155 ) and 20 or more in 26% ( n = 154 ) . the mean and sd age of starting smoking was 23.5 7.5 in male and 21 1.4 in female gender , but the difference was not significant between the groups ( p = 0.6 ) . n = 279 ) used to smoke in the past , including 5.5% of the men ( the mean and sd age of quitting smoking was 35.5 9.6 in men and 27 11.31 in women , but the difference was not significant between the groups ( p = 0.2 ) . in terms of exposure to secondhand smoke at home , 1% of the subjects ( n = 69 ) were exposed to it at least once a week and 3.7% ( n = 263 ) more than once a week . the rate of exposure to secondhand smoke was higher in the workplace , and 1.1% of the subjects ( n = 75 ) were exposed to their colleagues secondhand smoke at least once a week and 5.9% ( n = 416 ) more than once a week . the prevalence of tobacco use was 9.9% among the subjects studied , with the rate being significantly higher in the age group over 40 ( 14.0% ) than in the age group of 40 and below ( 5.1% ) , in men ( 13.3% ) than in women ( 0.6% ) , in married individuals ( 10.8% ) than in singles ( 5.2% ) and in individuals without higher than diploma education ( 16.4% ) than in those with university education ( 6.1% ) ; ( p < 0.001 ) . although the daily tobacco use was more in the age group over 40 ( 94.7% , p = 0.24 ) , males ( 94.2% , p = 0.21 ) , singles ( 94.3% , p = 0.99 ) , and those with diploma and lower education ( 96% , p = 0.01 ) , the relationships were not significant except in the relationship between daily tobacco use and having diploma and lower education [ table 1 ] . current and daily tobacco use in the employees of kermanshah province , iran the rate of current cigarette smoking was 8.9% among the subjects studied , with the rate being significantly higher in the age group over 40 ( 13.4% ) than in the age group of 40 and below ( 3.4% ) , in men ( 12% ) than in women ( 0.3% ) , in married individuals ( 9.8% ) than in singles ( 3.7% ) , and in individuals with diploma and lower education ( 15.0% ) than in those with higher than diploma education ( 5.3% ) ; ( p < 0.001 ) . although no significant relationships were observed between daily smoking and demographic variables , the frequency of daily smoking was higher in age groups higher than 40 ( 95.3% , p = 0.8 ) , males ( 95.6% , p = 0.16 ) , singles ( 100% , p = 0.24 ) , and employees with diploma and lower education ( 96.6% , p = 0.1 ) than in their counterpart groups [ table 2 ] . current and daily smoking use in the employees of kermanshah province , iran the prevalence of current waterpipe smoking was 1.2% among the subjects studied , with the rate being significantly higher in the age group of 40 and below ( 1.8% ) than in the age group over 40 ( 0.7% , p < 0.001 ) , in men ( 1.5% ) than in women ( 0.3% , p < 0.001 ) , and in individuals with diploma and lower education ( 1.7% ) than in those with higher than diploma education ( 0.9% ) ; ( p = 0.007 ) . although the prevalence of daily waterpipe smoking was higher among single individuals ( 1.6% ) compared to married ones ( 1.1% ) , the difference was not significant ( p = 0.18 ) . in age groups 40 years ( 83.0% , p = 0.28 ) , married participants ( 79.6% , p = 0.99 ) and employees with diploma and lower education ( 87.2% , p = 0.06 ) , the frequency of daily waterpipe use was higher than their counterpart groups , but their relationships were not significant [ table 3 ] . current and daily water - pipe use in the employees of kermanshah province , iran in terms of the relationship between tobacco use and the subjects health complaints , the or of tobacco use was found significantly higher in individuals with htn , diabetes and heart diseases than in the healthy subjects ; more precisely , the or of tobacco use was 1.5 ( 95% ci : 1.21.8 ) in hypertensive subjects , 1.8 ( 95% ci : 1.22.6 ) in individuals who had diabetes and 1.7 ( 95% ci : 1.32.3 ) in those with heart diseases compared to the healthy subjects . although there was no relationship between tobacco use and the development of osteoporosis , the rate of tobacco use increased in individuals with osteoporosis compared to the healthy subjects [ table 4 ] . relationships between current tobacco use and health complaints in employees of kermanshah province , iran after adjusting for age , gender , marital status , and educational status , there was not any significant relationship between health complaints and tobacco use while age groups , gender , and educational status remained significant . the or of tobacco use in employees > 40 years was 2.2 ( 95% ci : 1.82.7 ) , in male gender was 22.0 ( 95% ci : 12.040.5 ) , and in employees with diploma and lower education was 2.1 [ 95% ci : 1.82.5 ; table 5 ] . crude and adjusted odds ratio of desired variables in employees of kermanshah province , iran tobacco use ( smoking cigarettes and water - pipe ) and cigarette smoking , taken separately , were observed in one - tenth of the employees studied , with the rate being higher in the age group over 40 and among the men compared to the others . tobacco use was significantly higher among the employees who had htn , diabetes and heart diseases . in this study , the prevalence of tobacco use ( cigarettes and water - pipe ) and cigarette smoking was 9.9 and 8.9% among the employees studied . according to the latest studies conducted among iranians , about 15% of the entire population and 16% of the medical staff tend to use tobacco . the small difference in the results obtained by the present study and the state of tobacco use among the general public might be due to the higher levels of knowledge among the employees about health issues as more than 60% of the people surveyed had a university education . in a study conducted on employees of bonab in northwestern iran , 19.5% smoked cigarettes , the higher prevalence of which might be due to the particular sample studied , in which health personnel , who are often less likely to smoke cigarettes , were not surveyed at all . in another study conducted in 2010 on the health personnel employed in kermanshah , 12% smoked , which is similar to our results . the global prevalence of tobacco use does not appear to follow a consistent pattern ; for example , the rate was higher in pakistani workers ( 37.5% ) , in poland ( 27% ) , and in finland ( 18.6% ) , but in studies conducted in china and malaysia , the rate was 10% , which is almost similar to the results obtained by the present study . the different patterns emerged might be attributed to the type of employees surveyed , the cultural differences and also tobacco prevention rules in the workplace the latter of which might have even caused underreporting on the part of the employees in an effort to avoid risking their jobs . in this study , the rate of tobacco use was higher among individuals over 40 compared to the younger individuals . . also showed a higher tendency to smoke cigarettes in the employees over 40 , which is in line with the present findings . smith et al . also found a direct relationship between employee 's increase in age and increase in smoking , except for those over the age of 60 . in terms of the age pattern , tobacco use might be said to follow an increasing trend with the increase in age among iranians just as among people of many other countries , although the pattern is starker among those over the age of 40 , which is also true for the present study . the prevalence of cigarette smoking among iranians is higher than water - pipe smoking and is higher among men ( 24.6% ) than among women ( 3.3% ) ; in the present study , 12% of the men and 0.3% of the women smoked , based on which the tobacco use pattern observed in the majority of the iranian society can also be attributed to the employees employed in kermanshah province , in which the tendency to smoke is higher in men than in women . as already mentioned , due to the differences in the education levels of the employees and the general public , and also given the former 's greater knowledge about health issues , the lower levels of tobacco use among the male and female employees surveyed compared to the entire population of the country seems reasonable . cigarette smoking is a stigma for iranian women , making under - reporting in their case very likely . confirming this argument , a study conducted in one region of iran compared tobacco use among women through both self - reports and biochemical measurements ( based on serum levels ) and found a significant difference between the actual prevalence of tobacco use in the two groups ( 1.3% vs. 6.7% , in respective order ) . in research conducted on malaysian workers , the rate of cigarette smoking in men and women was 26.5 and 0.5% , respectively . given that both iran and malaysia are muslim countries and also that tobacco use is not common among the women in these countries , it can be inferred that the prevalence of tobacco use is similar among iranian and malaysian women . the results of this study showed that in individual analysis the tobacco use was significantly higher among the employees who suffered from diabetes and heart diseases while after adjusting for demographic variables this relationships was nt significant ; the or of tobacco use was 1.8 in the diabetic and 1.7 in individuals with heart diseases compared to the healthy subjects . a link was shown in several studies between tobacco use and the risk of diabetes and heart diseases . in a study conducted to determine the incidence of cardiovascular diseases in swedish employees , an almost similar finding showed that the risk of developing cardiovascular diseases is 1.8 times greater in smokers compared to nonsmokers , and their death is thus more likely too . in a prospective study conducted on 25,464 japanese employees , a direct relationship was seen between the dose of cigarettes smoked per day and the hazard of cardiovascular diseases ; this link was found to be so strong that smoking even 110 cigarettes / day increased the risk of cardiovascular diseases among the employees . in general , according to the latest studies conducted on the risk factors of ncd in a sample of employees in kermanshah , tobacco use and other risk factors of diabetes and heart diseases were substandard , just as in other groups in the society , which necessitates further attention , as quitting smoking can prevent the development of cardiovascular diseases in the employees , the first strength of this study was its large sample size , which can be said to have covered samples from all the classes of employees in kermanshah province . in addition , given the possibility of the employee 's leave on missions , the authorities were informed in advance of the researcher 's plan for visit so as to maximize participation rates . using the standardized stepwise protocol for ncd risk factor surveillance of the world health organization as the study 's method of data collection is another point of strength that confirms the validity and reliability of the results . being a statistical report on cigarette smoking and diseases among the employees , a limitation of the present study was the possibility of the employees , especially the female employees , having under - reported and created a social desirability bias for fear of losing their job position . this limitation should be minimized in future studies , or the exact prevalence of tobacco use should be measured through clinical trials . the prevalence of tobacco use ( smoking cigarettes and water - pipe ) and each one taken separately , i.e. , smoking cigarettes and smoking waterpipe , was lower in the employees surveyed compared to the several studies conducted on iranian employees and across the world . preventive public health policies are mandatory especially in younger ages and male employees to promote their knowledge on disadvantages of tobacco use .

background : identifying the pattern of tobacco use and its related factors in employees is crucial . this study aimed to investigate the pattern of tobacco use and its related factors in employees of kermanshah province , iran.methods:in 2012 , 7129 employees were investigated in a cross - sectional study using the census method . data on tobacco use and on several chronic diseases obtained using a standardized questionnaire on noncommunicable diseases risk factors of the world health organization through face - to - face interviews . statistical analysis was performed based on the chi - square test and multivariate logistic regression.results:in general , the prevalence of tobacco use , smoking cigarettes , and smoking waterpipe was 9.9% , 8.9% , and 1.2% among the employees , respectively . tobacco use was significantly higher in the age group over 40 ( 14.0% ) , in male gender ( 13.3% ) , in married individuals ( 10.8% ) and in those with diploma and lower degree ( 16.4% ) , ( p < 0.001 ) . at the individual level , the odds ratio of tobacco use was 1.5 ( 95% confidence interval [ ci ] : 1.21.8 ) in hypertensive , 1.8 ( 95% ci : 1.22.6 ) in diabetic employees and 1.7 ( 95% ci : 1.32.3 ) in those with heart diseases , compared to healthy individuals . after adjusting for age , gender , marital status and educational level , there was not any significant relationship between tobacco use and health complaints and only the demographic variables remained significant.conclusions:preventive public health policies are mandatory especially in younger ages and male employees to promote their knowledge on disadvantages of tobacco use .

perinuclear granules in germ cells of drosophila have been named nuage ( which means cloud in french ) . the main marker and essential component of nuage in both sexes is rna - helicase vasa . proteomic content of ovarian nuage granules includes : proteins of the piwi subfamily , aubergine and argonaute 3 ; rna - helicases , vasa , spindle e and belle ; tudor domain - containing proteins , tudor , spindle e , krimper , tejas ; proteins known as components of somatic p - bodies taking part in mrna degradation , dcp1 , me31b and pacman ; and other proteins , such as putative nuclease squash and high mobility box group protein maelstrom . nuage is thought to be involved in the selection and translational control of mrnas transported from the nucleus . recent studies revealed the association of nuage with the pirna biogenesis and pirna - dependent silencing of transposons . proteins of the piwi subfamily , piwi , aubergine ( aub ) and argonaute 3 ( ago3 ) , form complexes with pirnas . these complexes recognize mrnas complementary to guide pirnas and perform rna slicing , causing target degradation . two main models of pirna processing have been suggested based on deep - sequencing analysis of ovarian pirnas . in germinal cells of the ovaries , pirnas complementary to transposon transcripts undergo amplification via the ping - pong cycle . sense transposon transcripts are targeted by the aub - containing antisense silencing complexes , which cause transcript cleavage . these sense pirnas are subsequently loaded into the ago3-containing sense silencing complexes , which presumably recognize long antisense transcripts and generate 5-ends of antisense pirnas , which are involved in the next round of the cycle . the amplification cycle produces pairs of sense and antisense pirnas which have a ten nucleotide overlap of complementary sequence in their 5-ends . nuage in nurse cells of the drosophila ovaries is considered to be a site for both the pirna maturation and the pirna - guided silencing . the third member of piwi subfamily , nuclear protein piwi , is expressed in both germline and somatic cells of the ovaries . in somatic cells in the absence of germline - specific aub and ago3 piwi - associated pirnas are produced by another mechanism , presumably via direct cleavage of long transcripts ( primary processing ) . however , piwi is essential for transposon silencing in the germline , and , according to recent data , is involved in co - transcriptional repression of telomeric retrotransposons . the first case of natural pirna - mediated silencing of endogenous genes was discovered in the drosophila testes . however , the majority of papers published since then is devoted to the pirna silencing in the ovaries , where powerful transposon activity is easily detectable in pirna pathway mutant flies . transcripts of the x - linked endogenous tandemly repeated stellate genes , but not of transposons , are shown to be the main targets of the pirna silencing in the testes of d. melanogaster . stellate gene expression is strongly repressed by the pirna machinery in wild type males . in case of a deletion of the homologous y - linked crystal or suppressor of stellate ( su(ste ) ) locus , abnormally high - level stellate expression occurs in primary spermatocytes and leads to the accumulation of protein crystals , disturbances in meiotic chromosome condensation and segregation and essentially reduced fertility . abundant anti - sense transcription of the crystal locus is responsible for the production of antisense su(ste ) pirnas complementary to stellate transcripts . nuage proteins , such as aub , ago3 , spindle e , armitage , tejas , krimper , maelstrom , vasa and squash are found to be necessary for the pirnas - mediated stellate silencing . mutations in these genes result in the loss of su(ste ) pirnas and stellate derepression . it should be noted that the proteins , which deficiencies lead to stellate derepression , are largely concentrated to nuage . piwi , the founder of piwi clade , is known to be expressed mainly in somatic cells of the testis germinal proliferative center . large - scale sequencing of testis aub - associated short rnas revealed that 70% of these pirnas were su(ste)-derived , predominately in antisense orientation . about 90% of su(ste ) pirnas were presented by a pirna of a single type , called su(ste)-4 , or its variants . this observation strongly favors the assumption that su(ste ) pirnas are non randomly produced from precursor anti - sense su(ste ) transcripts , but rather from a limited number of hotspots . however , among ago3-associated pirnas only 6% belongs to su(ste ) pirnas abundantly represented by su(ste)-4 too . only a trace amount of sense su(ste ) pirnas was found in aub and ago3 complexes . also , a few complementary pairs of su(ste ) pirnas overlapping by 5-ends ( bearing signatures of the ping - pong cycle ) were found . thus , the bulk of testis pirnas is generated by primary processing rather than the ping - pong mechanism . in spite of ago3 expression level being significantly lower in the testes than that of aub , the biogenesis of su(ste ) pirnas and stellate silencing only 54% of pirnas from the ago3-derived library and 7% from the aub - derived one belong to transposon sequences . a significant part of transposon - associated pirnas demonstrated ping - pong signatures and generated ping - pong pairs similarly to the situation in the ovaries however , contrary to their effects in the ovaries , aub and ago3 deficiencies only slightly affect transposon expression in the testes . apparently , mobilization of transposons in the testes is essentially under the control of an alternative mechanism . in our recent paper we found at least two types of perinuclear nuage granules in germinal cells of the testes : a lot of small particles of about 0.6 m that were concentrated around the nuclei , and significantly larger structures of about 2.4 m , usually one per cell . the volume of larger granules is found to be more than 50 times that of the smaller ones . large granules are enriched by the known nuage proteins : vasa , aub , ago3 , tudor , spindle e , belle , squash , cutoff and also ago1 , the principal component of the microrna pathway . since most of the identified components are known as participants of the pirna pathway , the new structure was named the ping - body ( pirna nuage giant body ) . vasa and aub are shown to be completely colocalized at the periphery of the ping - bodies , whereas ago3 is located in the central lobe . the ping - bodies appear in primary spermatocytes during active transcription period and are lost before meiotic divisions ( fig . 1 ) . mutational analysis demonstrated a strong association of ping - bodies formation with the stellate silencing . symmetrical arginine methylation of piwi clade proteins provided by arginine methyltransferase capsuleen ( dart5 ) is found to be essential for ping - body formation . capsuleen mutations leading to aub delocalization to random cytoplasmic foci induce strong stellate derepression and loss of su(ste ) pirnas . since ago1 is found to be a ping - body component , the functions of the large granules in the microrna - mediated mrna silencing can also be expected . in addition to that we detected dcp1 , a decapping enzyme and marker of somatic p - bodies , as a ping - body constituent ( kibanov , unpublished data ) . scheme of spermatogenesis in mouse and drosophila . left : germ granules in mouse gonocytes ( imc or pi - bodies , pip - bodies ) , spermatogonia , early sprematocytes ( imc ) , late spermatocytes ( imc , cb precursors ) and haploid round spermatids ( cb ) are depicted . adapted from ref . cb formation coincides with periods of active transcription ( arrows ) and emerging of abundant pachytene pirnas . in elongating spermatids there are a lot of small nuage granules , that appear early in germline stem cells , and significantly larger structures , the ping - bodies . whereas no ping - body - like large nuage structures are observed in the ovaries , a question concerning their role in the testes is raised . taking into account that the conventional nuage granules in the ovarian nurse cells appear to be enough for functioning of the ping - pong pirna silencing mechanism , the ping - bodies seem to be dispensable for the amplification cycle . we know that stellate transcription occurs in primary spermatocytes and temporarily coincides with the ping - body formation . the analysis of su(ste ) pirnas derived from the testis libraries favors their generation by primary processing rather than by the ping - pong cycle . the arranged internal structure of the ping - body and a high concentration of pirna pathway components seem to contribute to effective kinetics of the stellate silencing process . abundant transcription of antisense su(ste ) starts in spermatogonial cells , earlier than that of stellate genes . it is tempting to speculate that su(ste ) pirnas are produced before the start of stellate transcription by a variant of primary processing . however , details of stellate repression by the pirna pathway and su(ste ) pirna biogenesis remain obscure to date . the mammalian cb is another large granular organelle involved in posttranscriptional mrna processing in the testes . although it appears in late pachytene spermatocytes and finally forms in round spermatids as a single structure per cell ( fig . 1 ) , its persistence , similar to the ping - body , coincides with the strong wave of transcription . the cb contains mvh , the mammalian homolog of drosophila vasa protein ; miwi and mili , piwi clade proteins ; tudor domain - containing proteins ; dicer , the nuclease necessary for the micrornas processing . micrornas and microrna pathway proteins were found in the cbs suggesting their role in microrna - mediated expression regulation . biochemical isolation of mouse cbs reveals a high concentration of pirnas , named late or pachytene pirnas , which do not demonstrate ping - pong signatures unlike pre - pachytene pirnas that are expressed earlier in gonocytes . pachytene pirnas originate mainly from large non - repeated clusters located in non - annotated genome regions , but not from transposon - related sequences . targets of pachytene pirnas are largely unknown . although the exact roles of the cb and pachytene pirnas in mouse spermatogenesis remain to be determined , we suggest that the ping - body and cb have shared attributes and can be functionally related structures . the recent studies of the pirna pathway using drosophila testes provide important insights into the biological role of the germ granules . similar characteristics and protein content of the cb and ping - body allow using drosophila as the model organism for further investigation of molecular principles of the germ granules organization and functioning .

ribonucleoprotein - containing granules in the cytoplasm of germinal cells are known to be a common attribute of eukaryotic organisms . germ granules appear to ensure the posttranscriptional regulation of germline mrnas . recent studies specify the participation of the germ granules in genome integrity maintenance by mechanisms involving short pirnas . piwi clade proteins and associated pirnas are considered as key participants of the germline - specific pirna pathway . proteins of the piwi clade , aub and ago3 , concentrated in the germline - specific perinuclear granules called nuage , are involved in silencing of retrotransposons and other selfish repetitive elements in the drosophila genome . in drosophila testes , two types of perinuclear nuage granules are found : a large amount of small particles around the nuclei and significantly larger structures , the ping - bodies . in this mini - review , we analyze the recent published data about structure and functions of drosophila male germ granules , and especially their involvement in the pirna silencing pathway .

chronic infection with hepatitis b virus ( hbv ) affects more than 350 million people worldwide and continues to be an important cause of morbidity and mortality . the current therapy for chronic hepatitis b ( chb ) is based on the use of immunomodulators like pegylated interferon or nucleos(t)ide analogues ( nucs ) that inhibit both the priming and the elongation steps of viral dna replication [ 210 ] . the high cost , side effects , and the fact that potent antiviral response can be only achieved in a minor population of patients limit the clinical use of peg - ifn . in addition , as the off - treatment durability of response to nucs is generally low , it is required to maintain a long - term continuous therapy when patients treated with nucs . however , long - term continuous therapy with nucs carries significant risks of occurrence of viral resistance , drug toxicity as well as unsustainable cost for many of the most heavily affected countries . all of these guidelines support both nucs and peg - ifn as first - line treatment options , but the optimal choice for individual patients remains controversial . the choice of therapy is determined by many factors including the stage of the disease , serum alanine transaminase ( alt ) , hbv dna levels , and eag status of the patient . both tenofovir ( tenofovir disoproxil fumarate ) and adefovir dipivoxil are very potent and effective nucleotide analog against hbv [ 9 , 11 , 12 ] . immunologic mechanisms involved in the control of hbv replication in vivo are not yet completely understood [ 1317 ] . understanding the mechanisms of therapy - induced antiviral immune responses could further direct novel therapeutic strategies . most studies examined the functionality of hbv - specific cd4 t cells and regulatory t cells in blood of patients and found that their functionality is improved in nuc - treated chb patients [ 1922 ] . however , this effect was only transient . besides , hbv - specific t cells also natural killer ( nk ) are important effector cells during antiviral immune responses . an early rise in circulating nk cells has been documented in the incubation phase of hbv infection , suggesting that they may contribute to the initial viral containment in this setting . nk cells are innate immune cells and play important roles in the defense against viral infections . they can kill virus - infected cells directly as well as indirectly via antibody - dependent , cell - mediated cytotoxicity . nk cells are usually defined as cd3cd56 lymphocytes and are comprised of about 5%20% of peripheral blood lymphocytes . however , the frequency of nk cells in intrahepatic lymphocytes can increase to about 30%50% . nk cells are a diverse population and nk cells do not possess a single well - defined receptor to recognize antigens on target cells like t cells . instead , their function depends on the expression of activating and inhibitory receptors that recognize various classes of cell surface ligands . these ligands include classical and nonclassical mhc class i antigens , mhc - like proteins , and a variety of other self- and virus - derived molecules . they may be expressed constitutively and/or de novo on the surface of virus - infected cells . only limited information has been published on the role of nk cells in hbv infection . in acute hbv , an early rise in circulating nk cells has been documented , suggesting their contribution to the initial viral containment [ 25 , 28 , 29 ] . in the context of persistent hbv infection , nk cell studies mainly focused on nk cell induced tissue injury [ 30 , 31 ] . however , very little is known about the quality of the antiviral functions of nk cells during chronic hbv . it has recently shown that inhibition of chronic hepatitis b virus replication by antiviral therapeutic medicine such as entecavir , lamivudine , and adefovir helps to partially restore function of nk cells in peripheral blood [ 32 , 33 ] . this restoration of nk cell activity was accompanied by an enhanced frequency of ifn--producing cd56 nk cells in blood as well as normalization of the expression of the activating receptor nkg2a on circulating nk cells . controlling of viral replication by antiviral treatment can partially correct this defect but little is known about the impact of antiviral therapy on the frequency of different subsets of nk cells . to this aim , we performed this longitudinal study to examine the dynamic changes of the frequency of different subsets of nk cells in chb patients after initiation of tenofovir or adefovir therapy . we found that nk cell numbers and subset distribution differ between chb patients and normal subjects , furthermore the association was found between alt level and cd158b nk cell in hbv patients . in chb patients treatment with tenofovir , the frequency of nk cells was increased during the treatment , accompanied downregulated expression of nkg2a and kir2dl3 , which correlated with serum hbv - dna load . in chb patients treatment with adefovir , nk cell numbers did not differ during the treatment , but also accompanied downregulated expression of nkg2a and kir2dl3 . a total of 24 chb patients and 12 gender- and age - matched healthy subjects were recruited at the outpatient clinic of the department of hepatology of the first hospital of jilin university , china from may 2011 to october 2011 . individual patients with chb were diagnosed , according to the criteria of detectable hbv virions and hbeag positive or negative ( hbvdna 105 copies / ml , an interval of 14 days or more than twice elevated alt of hbeag - positive patients 2 uln(upper limit of normal ) ; hbeag - negative patients > 1 uln and 10 uln ) . there are seven hbeag - positive patients in tdf - group and eight in adv - group . individuals with a history of hepatitis c and hepatitis d , positive antibodies against hcv and hdv , human immunodeficiency virus ( hiv ) , or other inflammatory diseases , such as rheumatoid arthritis , diabetes , autoimmune hepatitis , hypertension , kidney disease , or recent infectious diseases were excluded . written informed consent was obtained from all patients , and the experimental protocol was approved by the ethics committee of the first hospital of jilin university . individual patients with chb were randomized and treated with tenofovir disoproxil fumarae ( gsk pharma uk ) 300 mg once daily . another group of patients with chb were treated with adefovir disoproxil ( gsk pharma uk ) 10 mg once daily . all of the patients met the most recent european guideline criteria for treatment of chb and were followed up for 24 weeks . peripheral edta anticoagulant blood samples were obtained from individual participants before and after the treatment longitudinally . hbvserology ( hbsag / anti - hbs , hbeag / anti - hbe , quantitative hbsag , quantitative hbeag ) were determined by microparticle enzyme immunoassay ( meia ) . the virus loads in individual plasma samples were measured by quantitative pcr using roche cobas taqman hbv test ( roche , uk ) , and the limitation of detecting hbv was 20 iu / ml.the levels of serum aspartate aminotransferase ( ast ) and alanine transaminase ( alt ) were detected by biochemistry automatic analyzer ( roche diagnostics , branchburg , usa ) . to determine the percentages of different subsets of nk cells , anticoagulated blood was incubated for 30 min with a cocktail of allophycocyanin ( apc)-conjugated cd56 ( clone b159 ) , fluorescence isothiocyanate ( fitc)-conjugated cd3 ( clone ucht1 ) , and percp - cy 5.5-conjugated cd16 ( clone 3g8 ) , and stained with pe - conjugated antibodies against cd158a ( clone hp-3e4 ) , cd158b ( clone ch - l ) , nkp30 ( clone p30 - 15 ) , nkp44 ( clone p44 - 8.1 ) , nkp46 ( clone 9e2/nkp46 , bd pharminge , san diego , usa ) , nkb1 ( clone dx9 , bd biosciences , belgium ) , kir2dl3 ( clone 180701 ) , nkg2d - pe ( clone 149810 ) , nkg2a ( clone 131411 ) , nkg2c ( clone 134591 , r&d systems , usa ) , or isotope controls , respectively . the frequency of different subsets of nk cells was characterized by flow cytometry analysis . the difference between two independent groups was analyzed by the mann - whitney u test , and the difference between paired variables by the wilcoxon matched - pairs test using the prism 5.0 ( graphpad software , usa ) . the potential correlation between two variables was analyzed by the spearman 's rank correlation coefficient test . to determine the frequency of nk cells , 24 chb patients and 12 healthy age and gender matched subjects were recruited into this study . characterization of peripheral blood nk cells by flow cytometry analysis indicated that the frequency of cd3cd56 nk cells in chb patients was lower than that in healthy controls ( figures 1 and 2 ) . furthermore , analysis of different subsets of nk cells revealed that the frequency of activating receptor nkp30 nk cells in chb patients was significantly higher than that in healthy controls while the frequency of inhibitory receptor cd158b nk cells in chb patients was found to be significantly lower than that in healthy controls(figures 1 and 3 ) . we observed no significant difference in the expression of nkp44 , nkp46 , nkg2a , nkg2c , nkg2d , nkb1 , and cd158a between the health controls and chb patients . interestingly , the concentrations of plasma alt in chb patients were negatively associated with the frequency of cd158b nk cells in chb patients ( figure 4 ) . these data indicated that alteration in the frequency of nk cells was associated with liver damage in chb patients . these patients were treated with tenofovir or adefovir . in patients treated with tenofovir or adefovir , alt , ast , and hbv dna there were 7 patients ( rate = 58% ) whose hbv dna reaches < 3log10 iu / ml in the tdf treated group while only one patient 's hbv dna reaches this level in adv treated group ( rate = 8.3% ) ( table 2 ) . < 3log10 iu / ml ) was significantly higher than adv - group at 8 weeks ( p = 0.028 , fisher test ) . in seven hbeag - positive patients at 24 weeks after treatment of tenofovir disoproxil , three cases achieved hbeag seroconversion . however , no hbeag seroconversion occurred in 8 patients with adefovir dipivoxil treatment . therefore , different treatments may yield different responses , tdf at a daily dose of 300 mg had superior antiviral efficacy compared with adv at a daily dose of 10 mg through week 24 . we found that the frequency of nk cells transiently increased in tenofovir treated group at 8 , 12 , and 24 weeks after initial treatment ( figure 5 ) . these data clearly indicated that treatment with tenofovir modulated the frequency of nk cells . given that different subsets of nk cells have different functions , we characterized the frequency of different subsets of nk cells longitudinally after treatment . treatment with tenofovir or adefovir decreased the frequency of nkg2a and kir2dl3 nk cells at 12 and 24 or 24 weeks after initial treatment in both groups of chb patients ( figure 6 ) , respectively . in contrast , treatment with adefovir significantly increased the frequency of cd158b nk cells at 24 weeks after initial treatment in chb patients ( figure 7 ) . therefore , treatment with different kinds of nucleos(t)ide analogues ( nucs ) had differential effects on modulating activating and inhibitory receptor nk cells in chb patients . in this study , we examined the frequency of different subsets of nk cells in patients with chb following nucleos(t)ide analogues ( nucs ) antiviral therapy . we found that , there was significant difference in the frequency of nk cells between chb patients and healthy controls , the frequency of nkp30 nk cells in chb patients was significantly higher than those in healthy controls . in contrast , the frequency of cd158b nk cells in chb patients was significantly lower than that in healthy controls . more interestingly , the concentrations of serum alt were negatively correlated with the percentages of cd158b nk cells in chb patients . these data indicated that a lower frequency of inhibitory receptor nk cells contributed to liver damages . apparently , a lower frequency of cd158b nk cells may be valuable for the evaluation of liver damage in chb patients . previous studies have shown controversial results on the frequency of nk cells in chb patients following standard therapies [ 33 , 35 ] . we treated chb patients with tenofovir or adefovir and characterized the frequency of different subsets of nk cells by flow cytometry analysis . we found that treatment with tenofovir transiently increased the frequency of nk cells in chb patients at 4 , 12 , and 24 weeks after initiation of treatment . in contract , the frequency of nk cells does not change significantly over the course of treatment with adefovir . these data suggest that treatment with tenofovir may promote nk cell proliferation during the early periods after treatment . maybe because of tdf had superior antiviral efficacy compared with adv . characterization of different subsets of nk cells indicated that treatment with the antiviral therapy transiently decreased the frequency of nkg2a and kir2dl3 nk cells after treatment . more importantly , the decreased percentages of nkg2a nk cells were negatively correlated with the reduced levels of hbv loads in chb patients early after treatment . these data were similar to that of previous reports in chronic hepatitis b virus infected and chronic hepatitis c virus infected patients [ 32 , 36 ] . although we could not establish significant correlations between the expression of nk cell receptors , such as nkg2a , kir2dl3 , and activation status of function , it does not exclude a role for these receptors in the regulation of nk cell activation and/or function . since nkg2a triggering have been shown to regulate ifn- production [ 37 , 38 ] , it is tempting to speculate that in chronic hbv infection , increased expression of nkg2a prohibits nk cells from being activated and from functioning . in that respect , the downregulation of nkg2a upon viral load reduction as demonstrated herein may be in part responsible for the improved nk cell function . these data suggest that nkg2a nk cells are crucial for the clearance of hbv in chb patients and that the frequency of peripheral blood nkg2a nk cells may be a valuable biomarker for the evaluation of hbv clearance in chb patients . the balance of activating signals via ncr and inhibitory signals via kir is crucial for systemic nk cell responses , and hbv infection can modulate the interplay between inhibitory and activation signals [ 39 , 40 ] . to further understand the mechanisms of therapy - induced antiviral immune responses , we characterized the frequency of different subsets of nk cells in chb patients with different nucs treatments . we found that treatment with either protocol decreased the frequency of nkg2a , kir2dl3nk cells later after treatment . apparently , treatment with nucs down - regulates inhibitory receptor expression in nk cells in chb patients . these data further indicate that downregulates inhibitory receptor expression in nk cells which can increase nk activity is associated with the clearance of hbv in chb patients . therefore , given that treatment with antiviral therapy significantly reduced the levels of plasma hbv loads and serum alt , the higher frequency of nk cells and decreased inhibitory receptors suggested that activated nk cells participated in the clearance of hbv in chb patients . we compared the different subsets between tenofovir group and adefovir group , adefovir promoted the percentage of cd158b nk cells . the frequency of cd158b nk cells significantly correlates with the alt level in chb patients before initiation of antiviral treatment . the increased percentage of cd158b nk cells may be associated with the decreased concentrations of plasma alt . several groups have studied nk cells during the antiviral treatment of chb patients , but the results regarding nk cell frequency and receptor expression are conflicting [ 32 , 40 , 41 ] . one important question is how the responses of individual patients to the antiviral therapy are associated with the change in the frequency of different subsets of nk cells . we noted a rapid decline in expression of nkg2a and kir2dl3 , but not activating receptors , following the administration of nucs . this implies that these cells have this balance altered in favour of activation . viral load reduction may be an indirect effect on nk cells due to changes in the cytokine milieu , or due to interactions with other cells of the immune system that can subsequently effect nk cell receptor expression . during the treatment of chc patients , the frequency of nkg2a and kir2dl3 nk cells in the evr group was significantly higher than those in the non - evr group . interestingly , a recent study has shown that kir2dl3 nk cells have higher degranulation activity in patients with self - limited hcv infection . different from hepatitis c treatment , besides the decrease of viral load , hbeag seroconversion was also an important standard to judge the antiviral effect . in this study , subjects of hbeag seroconversion were limited to analysing the difference frequency of nkg2a and kir2dl3 nk cells bewteen hbeag seroconversion and none - hbeag seroconversion at 24 weeks after initial treatment . therefore , the frequency of nkg2a and kir2dl3 nk cells may be a prognostic marker for the evaluation of individual responses to the standard therapy in the clinic . in summary , our data indicate that the frequency of cd3cd56 nk cells in chb patients was lower than that in healthy controls , the frequency of nkp30nk cells in chb patients was significantly higher than those in healthy controls . in contrast , the frequency of cd158b nk cells in chb patients was significantly lower than that in healthy controls . the percentages of inhibitory cd158b nk cells were negatively associated with liver damage in chb patients . treatment with the tenofovir therapy transiently increased the frequency of nk and decreased frequency of inhibitory receptor nk cells in chb patients . therefore , our findings provide a unique insight in the nk cell compartment in chb patients during tenofovir induced viral load reduction . our study demonstrates modest changes in the frequency of inhibitory receptor nk cells after successful antiviral therapy . we recognized that our study had limitations of small sample size and the lack of analysis of nk cells function and nk cells in the target tissue . thus , further studies with a large population , combined with liver tissue analysis , nk cells function , to validate the findings are warranted .

natural killer ( nk ) cells play a critical role in innate antiviral immunity , but little is known about the impact of antiviral therapy on the frequency of nk cell subsets . to this aim , we performed this longitudinal study to examine the dynamic changes of the frequency of different subsets of nk cells in chb patients after initiation of tenofovir or adefovir therapy . we found that nk cell numbers and subset distribution differ between chb patients and normal subjects ; furthermore , the association was found between alt level and cd158b+ nk cell in hbv patients . in tenofovir group , the frequency of nk cells increased during the treatment accompanied by downregulated expression of nkg2a and kir2dl3 . in adefovir group , nk cell numbers did not differ during the treatment , but also accompanied by downregulated expression of nkg2a and kir2dl3 . our results demonstrate that treatment with tenofovir leads to viral load reduction , and correlated with nk cell frequencies in peripheral blood of chronic hepatitis b virus infection . in addition , treatments with both tenofovir and adefovir in chronic hbv infected patients induce a decrease of the frequency of inhibitory receptor+ nk cells , which may account for the partial restoration of the function of nk cells in peripheral blood following treatment .

diabetes mellitus is threatening for the 21 century . it will be leading cause of morbidity and mortality in near future due to increasing incidence worldwide . herbo - mineral - metallic drugs of ayurveda having potential of decreasing blood sugar levels and found efficient on experimental animal models . medieval classical texts of ayurveda quoted that makaradhwaja is one of the best rejuvenator and aphrodisiac agent . it is prepared by using processed gold , mercury and sulfur in the ratio of 1:8:24 or 1:8:48 by sublimation in the traditional system of heating device valuka yantra . nowadays , it is prepared in modified vertical electrical muffle furnace ( modified valuka yantra ) . it is therapeutically efficient in disorders such as madhumeha ( diabetes mellitus ) , jwara ( remittent fever ) , kushta ( skin disorders ) , and raktaja vikara ( blood disorders ) . specific action on cell - mediated immunity is proved by its immune - modulator action . in experimental and clinical studies guduchi ( tinospora cordifolia linn . ) is well - known madhumehahar ( anti - hyperglycemic ) herb described throughout ayurvedic classics . it is well - known anti - oxidant , anti - hyperglycemic , immune - modulatar , and rejuvenator . its different formulations are quoted in the ayurvedic classics like juice , decoction , powder and ghana ( dried extract ) as per diseases . madhu ( honey ) is mentioned as madhumehahar ( ~anti - diabetic ) agent within classical texts of ayurveda . it is used as a vehicle drug ( yogavahi ) in the numerous herbo mineral formulations . it is mentioned in the reference to makaradhwaja as a vehicle drug . in the present study , it was used as a vehicle drug as prescribed in texts of rasashastra . the present study was planned to evaluate anti - diabetic activity of shadguna balijarita makaradhwaja ( sbm ) and t. cordifolia linn with honey in streptozotocin ( stz ) induced diabetic rats . test drug sbm was prepared as per the classical text reference in the department of rasashastra and bhaishajya kalpana , institute of post graduate teaching and research in ayurveda ( ipgt and ra ) , gujarat ayurved university , jamnagar in 2011 . raw material swarna ( gold ) was purchased from the local market , and hingula ( cinnabar ) and gandhaka ( sulfur ) were collected from pharmacy of gujarat ayurved university , jamnagar . cinnabar was processed to shodhana ( purification ) and parada ( mercury ) was procured from its sublimation by adopting nada yantra method . gandhaka ( sulfur ) was subjected to shodhana by melting it and pouring in cow milk and continuously heated in same milk for 3 h . processed gold foils , mercury and sulfur kajjali was levigated with juice of kumari ( aloe barbadensis mill . ) and japa ( hibiscus rosa - sinensis ) for 3 h consecutively . the fine powder was filled in seven - layer mud smeared cotton cloth wrapped glass bottle ( kacha kupi ) and heated for 12 h in specially designed electrical muffle furnace . the heat was provided in controlled and gradually increasing temperature in modified electrical muffle furnace ( modified valuka yantra ) . after the desired characteristic features of product preparation , the mouth of glass bottle was sealed ; furnace was switched off and subjected for self - cooling . sublimed product was procured from neck of glass bottle , it was powdered and used for further analysis and study . in analytical studies , it was observed that makaradhwaja is consisted of red sulfide of mercury and having an empirical formula of hgs ( mercury sulfide ) . inductively coupled plasma optical emission spectrometry was observed that it contains 1.2% of gold with mercury and sulfur in finished product as a major element . t. cordifolia s stems were collected from the herbal garden of gujarat ayurved university , jamnagar . these crushed pieces were cooked with 4 times of potable water ant reduced at 1/4 of the same to prepare decoction . the semisolid mass was dried in hot air oven at 45c to prepare dry extract . albino rats ( 160 - 220 g ) of either sex were selected for this study . animals were procured from the animal house of pharmacology laboratory of ipgt and ra , gujarat ayurved university , jamnagar . permission for the experiment was granted by animal ethical committee of the same institute ( iaec-06/09 - 11/02 ) . the animals were fed pellet diet and water . as per the guidelines of national institute of health s guide for the care and use of laboratory animals , tail veni - puncture method was applied for the collection of blood sample in the rats . for investigation glucometer strip was used , and reading was noted down . by adopting this procedure blood glucose level of animals was estimated , prior injection of stz , 5 , 10 , 15 , and 20 day during trials . diabetes was induced to rats by single intra peritoneal injection of stz ( 40 mg / kg ) . stz was weighed individually for each animal , according to its weight it was solubilized with 0.2 ml saline ( 154 mm nacl ) just prior to injection . after 72 h of stz injection , rats with diabetic hyperglycemia ( blood glucose more or equal to 250 mg / dl ) were selected for experiment . suspension of makaradhwaja and t. cordifolia with honey was started fed to selected diabetic rats . anti - diabetic activity was evaluated by the effect of test drugs on the ponderal and biochemical parameters . biochemical variables such as blood sugar , glycated hemoglobin ( hba1c ) , serum total cholesterol , serum high - density lipoprotein ( hdl ) , serum triglyceride , serum creatinine , blood urea , serum glutamic - pyruvic transaminase ( sgpt ) , serum glutamic oxaloacetic transaminase ( sgot ) , total protein , albumin , and globulin were estimated . sacrificed animals gross and histological appearance of vital organs ( liver , pancreas and kidney ) were examined at the end of the study . group 1 : normal control ( nc)group 2 : diabetic control ( dc)group 3 : dc + sbm and guduchi ghana with honey suspension ( sbm)group 4 : dc + glibenclamide ( reference standard [ rs ] ) group 1 : normal control ( nc ) group 2 : diabetic control ( dc ) group 3 : dc + sbm and guduchi ghana with honey suspension ( sbm ) group 4 : dc + glibenclamide ( reference standard [ rs ] ) the dose of the drug was calculated by extrapolating the therapeutic dose to rat on the basis of body surface area ratio by referring to the table of paget and barnes ( 1964 ) . powdered sbm 2.63 mg / kg rat and dried extract of t. cordifolia 42.34 mg / kg rat were grinded with honey to prepare suspension . glibenclamide , in the dose 0.45 mg / kg was administered to rs drug control group . test drug sbm was prepared as per the classical text reference in the department of rasashastra and bhaishajya kalpana , institute of post graduate teaching and research in ayurveda ( ipgt and ra ) , gujarat ayurved university , jamnagar in 2011 . raw material swarna ( gold ) was purchased from the local market , and hingula ( cinnabar ) and gandhaka ( sulfur ) were collected from pharmacy of gujarat ayurved university , jamnagar . cinnabar was processed to shodhana ( purification ) and parada ( mercury ) was procured from its sublimation by adopting nada yantra method . gandhaka ( sulfur ) was subjected to shodhana by melting it and pouring in cow milk and continuously heated in same milk for 3 h . processed gold foils , mercury and sulfur kajjali was levigated with juice of kumari ( aloe barbadensis mill . ) and japa ( hibiscus rosa - sinensis ) for 3 h consecutively . the fine powder was filled in seven - layer mud smeared cotton cloth wrapped glass bottle ( kacha kupi ) and heated for 12 h in specially designed electrical muffle furnace . the heat was provided in controlled and gradually increasing temperature in modified electrical muffle furnace ( modified valuka yantra ) . after the desired characteristic features of product preparation , the mouth of glass bottle was sealed ; furnace was switched off and subjected for self - cooling . sublimed product was procured from neck of glass bottle , it was powdered and used for further analysis and study . in analytical studies , it was observed that makaradhwaja is consisted of red sulfide of mercury and having an empirical formula of hgs ( mercury sulfide ) . inductively coupled plasma optical emission spectrometry was observed that it contains 1.2% of gold with mercury and sulfur in finished product as a major element . t. cordifolia s stems were collected from the herbal garden of gujarat ayurved university , jamnagar . these crushed pieces were cooked with 4 times of potable water ant reduced at 1/4 of the same to prepare decoction . the semisolid mass was dried in hot air oven at 45c to prepare dry extract . albino rats ( 160 - 220 g ) of either sex were selected for this study . animals were procured from the animal house of pharmacology laboratory of ipgt and ra , gujarat ayurved university , jamnagar . permission for the experiment was granted by animal ethical committee of the same institute ( iaec-06/09 - 11/02 ) . the animals were fed pellet diet and water . as per the guidelines of national institute of health s guide for the care and use of laboratory animals , tail veni - puncture method was applied for the collection of blood sample in the rats . for investigation glucometer strip was used , and reading was noted down . by adopting this procedure blood glucose level of animals was estimated , prior injection of stz , 5 , 10 , 15 , and 20 day during trials . diabetes was induced to rats by single intra peritoneal injection of stz ( 40 mg / kg ) . stz was weighed individually for each animal , according to its weight it was solubilized with 0.2 ml saline ( 154 mm nacl ) just prior to injection . after 72 h of stz injection , rats with diabetic hyperglycemia ( blood glucose more or equal to 250 mg / dl ) were selected for experiment . suspension of makaradhwaja and t. cordifolia with honey was started fed to selected diabetic rats . anti - diabetic activity was evaluated by the effect of test drugs on the ponderal and biochemical parameters . biochemical variables such as blood sugar , glycated hemoglobin ( hba1c ) , serum total cholesterol , serum high - density lipoprotein ( hdl ) , serum triglyceride , serum creatinine , blood urea , serum glutamic - pyruvic transaminase ( sgpt ) , serum glutamic oxaloacetic transaminase ( sgot ) , total protein , albumin , and globulin were estimated . sacrificed animals gross and histological appearance of vital organs ( liver , pancreas and kidney ) were examined at the end of the study . group 1 : normal control ( nc)group 2 : diabetic control ( dc)group 3 : dc + sbm and guduchi ghana with honey suspension ( sbm)group 4 : dc + glibenclamide ( reference standard [ rs ] ) group 1 : normal control ( nc ) group 2 : diabetic control ( dc ) group 3 : dc + sbm and guduchi ghana with honey suspension ( sbm ) group 4 : dc + glibenclamide ( reference standard [ rs ] ) the dose of the drug was calculated by extrapolating the therapeutic dose to rat on the basis of body surface area ratio by referring to the table of paget and barnes ( 1964 ) . powdered sbm 2.63 mg / kg rat and dried extract of t. cordifolia 42.34 mg / kg rat were grinded with honey to prepare suspension . this suspension was administered orally to test drug group sbm diabetic animals . glibenclamide , in the dose 0.45 mg / kg was administered to rs drug control group . in nc rats , during the course of 21 days , 13.90% weight was increased . insignificant decrease in body weight was observed in sbm and rs group in comparison to dc rats [ table 1 ] . in dc rats , treatment with test drug did not affect the weight of these organs to significant extent in comparison to the dc group [ table 2 ] . effect of test drug on body weight in stz diabetic wister strain albino rats the effect of test drugs on weight of liver and kidney in streptozotocin induced diabetic wistar strain albino rats initial blood sugar level was decreased by 44.27% and 44.04% in sbm and rs treated groups respectively [ table 3 ] . raised levels of hba1c were significantly attenuated by test drug sbm and rs [ table 4 ] . increased blood sugar levels were insignificantly decreased by sbm and rs test drugs . the effect of test drugs on blood sugar level in stz induced diabetic rats at various intervals the effect of test drugs on hba1c in stz induced diabetic wistar strain albino rats non - significant rise in serum cholesterol , triglyceride and hdl were moderately decreased by administration of sbm . elevated serum creatinine levels non - significantly decreased by administration of sbm which was non - significantly increased in rs group in comparison to dc group . decreased sgot parameter in dc group was significantly attenuated by sbm and rs drugs . increased levels of sgpt were decreased up to significant extent by sbm and rs drugs [ table 5 ] . the effect of test drugs on various serum biochemical parameters the accumulation of fat in liver was observed in histopathological study . sbm and rs treated animals restored the histological changes [ figure 1a - d ] . inflammation in blood vessels , increase in the thickness of bowman capsules , fat deposition , and change in size of the glomerulus were found in the kidney of diabetic rats . the treatment with sbm showed the normal histopathology of the kidney without any inflammatory vessels and fat deposition [ figure 2a - d ] . decreased islets of langerhans , smashed size of cells and extensive necrosis , fibrosis and atrophy were observed in the pancreas of diabetic rats . stz induced diabetic rat treated with sbm and glibenclamide restored the necrotic and fibrotic changes and up to moderate levels , raised the number of cells . ( a ) normal cytoarchitecture of liver in normal control group ( 1 400 magnification ) , ( b ) photomicrographs of representative section of liver . macro and micro fatty changes , cell infiltration in almost all the sections streptozotocin control group ( 1 400 magnification ) ( c ) shadguna balijarita makaradhwaja treated rats shows almost normal cytoarchitecture of liver in comparison with streptozotocin control group diabetic rats ( 1 400 magnification ) , ( d ) glibenclamide treated rat showed almost normal cytoarchitecture of liver sections in comparison with streptozotocin control group diabetic rats ( 1 400 magnification ) ( a ) normal cytoarchitecture of sections of kidney in normal control group ( b ) . ( 1 400 magnification ) , ( b ) photomicrographs of representative section of kidney . cell infiltration and micro - fatty changes in all the sections of streptozotocin control treated diabetic rats ( 1 400 magnification ) , ( c ) shadguna balijarita makaradhwaja treated rat showed almost normal cytoarchitecture in comparison with streptozotocin control group diabetic rats ( 1 400 magnification ) , ( d ) : glibenclamide treated rat showed almost normal cytoarchitecture in comparison with streptozotocin control group diabetic rats ( 1 400 magnification ) ( a ) normal cytoarchitecture in normal control group , ( b ) photomicrographs of representative section of pancreas . marked degeneration of islets of langerhans and degranulation of streptozotocin control treated diabetic rats ( 1 400 magnification ) , ( c ) sbm treated rats shows comparatively less degeneration of islets of langerhans with intact granules in comparison with streptozotocin control group diabetic rats ( 1 400 magnification ) , and ( d ) glibenclamide treated rat showed normal cyto - architecture with intact granules in comparison with streptozotocin control group diabetic rats ( 1 400 magnification ) it was observed in dc rats in comparison to normal rats [ 19 - 21 ] . treatment with sbm improved body weight to a certain extent , indicating that control over muscle wasting resulted from glycemic control . previous studies claimed that stz destructs beta cells , which leads to cells less active that makes poor utilization by tissues . this suggests that test drug may possess as insulin - like effect on peripheral tissues by inhibiting hepatic gluconeogenesis by promoting glucose uptake or metabolism . or it might be possible that test drug increases absorption of glucose into the muscles and adipose tissues by stimulation of regeneration process and revitalization of remaining beta cells . hence , the hypoglycemic activity of sbm may be due to its protective action against damaged pancreatic beta cells and possibly because of increased insulin release or secretion or regeneration of damaged beta cell . makaradhwaja is a well - known therapeutic medicine of rejuvenation in indian system of medicine . moderate but insignificant decrease in blood sugar levels were also observed in test drug - treated animals . higher levels of hba1c were observed in the diabetic rats compared with those in normal rats , it might be due to poor glycemic control . sbm treated diabetic rats significantly decreased the level of hba1c , may be glucose metabolism was improved . this action represents that sbm has an ability to prevent the development of diabetes associated complications . elevated levels of sgpt indicating impaired liver function due to hepato - cellular necrosis . due to elevated transaminase activities leads to diabetic complications like increased ketogenesis and glucogenesis , test drug significantly restored this parameter toward normal levels . elevation of urea and creatinine levels results due to renal dysfunction caused by free radical generation mediated stress in diabetes , persistent hyperglycemia , and hemo - dynamic changes within the kidney tissue [ 29 - 31 ] . administration of sbm and glibenclamide to the diabetic rats significantly reduced the creatinine and urea levels , which represent the preventive action of sbm on kidney damages in diabetic condition perhaps due to the anti - oxidant properties . blood urea level was significantly increase in diabetic rats compared to normal rats due to excessive breakdown of protein . stz induced diabetic rat s increases the level of lipid peroxidation , as an indirect evidence of production of free radical . stz induced diabetic groups treated with glibenclamide and sbm brought back the increased level of total cholesterol and triglyceride near to the normal levels . histopathological changes in liver , kidney and pancreas were well restored by the test drug in comparison with dc group . . observed results may be due to synergistic action of makaradhwaja with adjuvant t. cordifolia and honey . the present study demonstrates that sbm and dried extract of t. cordifolia with honey significantly reduces the blood glucose level and shows anti - diabetic effect . restoration histopathological changes in different organs support safe and effective anti - diabetic action of test drug . a significant decrease in glycated hemoglobin shows effect of makaradhwaja on diabetes - related complications .

background : makaradhwaja a gold containing mercurial preparation used for diabetes mellitus in indigenous system of medicine . it is a popular aphrodisiac and rejuvenator traditional medicine . it is prepared by using processed gold , mercury and sulfur in different ratios by applying intermittent heating pattern in valuka yantra.objectives:the aim of the study was to evaluate anti - diabetic effect of shadguna balijarita makaradhwaja ( sbm ) on streptozotocin ( stz ) induced diabetic rats.materials and methods : diabetes was induced to normal rats by injecting stz in dose 40 mg / kg . powdered sbm and dried extract of tinospora cordifolia were mixed with honey and administered orally for 20 days at dose 2.63 mg / kg and 42.34 mg / kg body weight , respectively . the effects of treatment on body weight changes and blood glucose levels were quantified on day 1 , 5 , 10 , 15 and 21 of the experiments . on the 21st day , animals were sacrificed and gross histopathological changes in liver , kidney and pancreas were illustrated . blood sugar level , glyacated hemoglobin , blood urea , serum cholesterol , serum creatinine , serum triglyceride and serum protein were estimated with standard methods . the study was conducted in the year 2011.results:test drug observed significant decrease ( p < 0.001 ) in glyacated hemoglobin level compared to diabetic control rats . blood sugar level of test drug group shown a significant decrease ( 279.11 57.95 ) compared with diabetic rats.conclusion:the present study demonstrates that sbm and dried extract of t. cordifolia with honey significantly reduces the blood glucose level and shows anti - diabetic effect .

when developing countermeasures against mers - cov infection , rodents and small animal models that mimic human disease hallmarks would be useful in initial screening studies before the measure is tested in larger animals ( e.g. , nonhuman primates and , potentially , camels ) . although upper respiratory tract disease develops more severely in the latter ( 11 ) , studying immune correlates of protection and vaccine efficacy in camels ( the only natural host besides bats and humans identified thus far ) may reveal vulnerabilities of mers - cov that may be exploited for human vaccine strategies . existing small animal species do not naturally express the primary receptor that mers - cov uses to infect humans , the human dipeptidyl - peptidase 4 ( hdpp4 ) receptor ( 1219 ) . this lack results in the animal s inability to sustain infection and for clinical illness to develop from mers - cov . larger animal models , such as nonhuman primates , have not yet been optimized to consistently mimic the disease patterns observed in human infection ( which is incompletely understood ) and also have associated logistical challenges because that work must be completed in biosafety level 3 facilities . although efforts have been made to adapt mers - cov itself to exhibit human disease phenotypes in rodents , greater success has been achieved through the development of specialized mouse models that express hdpp4 ( 2022 ) . mouse strains that globally express hdpp4 are susceptible to infection by mers - cov , and the mice display lower respiratory tract infection , weight loss , and increased respiratory rate , but also encephalitis , which makes the strains highly lethal . human dpp4 expression is , however , transient and limited to the lung after ad5-hdpp4 transduction by intranasal inoculation ( 21 ) . these infected transgenic mice exhibit transcriptional activation of genes encoding classic antiviral cytokines ( interferon [ ifn]- , ifn- , and mx-1 ) and pro - inflammatory cytokines ( interleukin [ il]-2 , il-6 , il-12 , p40 , il-1- , and tumor necrosis factor [ tnf]- ) , as well as chemokines ( granulocyte - colony stimulating factor [ g - csf ] , monocyte chemoattractant protein-1 [ mcp-1 ] , interferon gamma - induced protein 10 [ ip-10 ] , cxc motif ligand 1 [ cxcl-1 ] , macrophage protein 1 [ mip-1 ] , and chemokine ( c - c motif ) ligand 5 [ ccl5 or rantes ] ) , in contrast with the negligible gene activation of infected nontransgenic mice . il-1 , il-6 , tnf- , g - csf , mcp-1 , ip-10 , cxcl-1 , mip-1 , rantes , and interferon - induced gtp - binding protein ( mx-1 ) have been detected in the lungs and brains of infected transgenic mice ( 20 ) . human dpp4 dimers in transgenic mice could affect immune regulation and lead to poorly understood outcomes that could confuse the interpretation of disease natural history and vaccine efficacy . alternatively , a minimally modified version of mouse dpp4 , by mutation of 2 amino acids , can support mers - cov infection . mice with this mutation experience severe lower respiratory tract infection , although they do not exhibit brain infection ( 16 ) . in addition , pascal et al . have developed mice that express hdpp4 , under the control of its endogenous promoter and the 3 untranslated region , and show lung - specific infection and inflammation ( 22 ) . further testing may prove that vaccine evaluation in these small animal models could lead to a better understanding of immunogenicity and efficacy of vaccine candidates and the therapeutic measures being considered for evaluation in larger animals and humans . among current nonhuman primate models , rhesus macaques display mild - to - moderate clinical signs on viral challenge ( 23 ) , whereas the common marmoset is reported to exhibit more severe signs of infection ( 24,25 ) and could be a better model for the severe clinical syndrome observed in mers - cov infected persons . however , not all research groups have been able to replicate severe disease outcomes in marmosets . factors contributing to this could include variations in physical location , age , and origin of the marmosets ; challenge virus strains and stocks ; route and dose of inoculation ; and in protocols . to be able to provide robust and reproducible outcomes , camels are also being used to evaluate mers - cov infection , and findings from adney et al . showed that these animals are unique in that they experience an upper respiratory tract infection . although we do not know the efficiency of airborne versus droplet or another mode of transmission , viral shedding from the upper respiratory tract might explain the efficiency of camel camel and camel human transmission ( 11,26 ) . although camels do not display the severe disease symptoms observed in infected humans ( 26 ) , a camel infection model remains useful for understanding the disease in camels and identifying potential immune correlates of protection induced by vaccination . veterinary countermeasures could form part of a one health strategy to forestall zoonotic transmission to humans ( 1 ) . hesitation to implement animal vaccination strategies in camels once a vaccine becomes available can be attributed to the absence of severe disease in camels ( only upper respiratory tract infection with rhinitis ) and to skepticism among key groups regarding zoonotic transmission of mers - cov to humans ( e.g. , camel breeders ) . although the animal models for evaluating mers - cov infection represent progress , they do not recapitulate the pathogenesis of severe human disease . a combination of both small and large animal models should be considered for evaluation of preventive and therapeutic candidates for mers . regardless of the chosen model , comparing and interpreting results effectively and reducing discrepancies among laboratories will be crucial for researchers to agree on a set of standards with respect to experimental design , including variables for age of animals , specimen handling , route of administration , type of virus challenge , inoculation schedule , sample collection , and disease scoring algorithms . building on the experience from the closely related severe acute respiratory syndrome coronavirus ( sars - cov ) ( 27 ) , researchers have been actively working to understand mers - cov genetics to inform vaccine and therapeutic development efforts . they quickly demonstrated that the spike ( s ) protein , a viral surface glycoprotein , was essential for recognition of hdpp4 and viral entry into cells and likely represented a prime target for immunogen design for the development of vaccines and monoclonal antibodies ( 18,28,29 ) . at the workshop , we reviewed various approaches all in preclinical development and all based on the s protein or one of its components , including nanoparticles , subunit proteins and peptides , dna , various viral vectors , and live attenuated mers - cov . nanoparticles formed with mers - cov s protein , under development by novavax ( gaithersburg , maryland , usa ) , have been shown to induce virus neutralizing antibodies ( nabs ) in mice after a single injection ; proprietary adjuvants enhance this response ( 30 ) . vaccines using antigens expressed from the baculovirus platform developed by novavax have been evaluated in human subjects in the context of phase i and phase ii clinical studies for other infectious diseases without notable vaccine - related safety concerns ( 3133 ) . portions of the s protein , specifically the receptor - binding domain ( 8,29,3436 ) , are also being developed as subunit vaccines . critical neutralizing region and induce strong immune responses and nabs in mouse models ( 37,38 ) . moreover , the subunit vaccines have been shown to protect transgenic mice when challenged with mers - cov , indicating that vaccines focused on the receptor - binding domain may be sufficient for protective immunity to develop against the virus ( 39,40 ) . several viral vectors , including adenovirus ( 41,42 ) , modified vaccinia ankara ( mva ) ( 43,44 ) , and measles virus ( 45 ) , are also under development by different groups . various lengths of s protein are being expressed on these platforms and are able to generate antibodies in animals that can neutralize mers - cov in vitro and , at least for some vector platforms , also generate cellular immune responses ( 43,45 ) . for mva- and measles virus based vaccines , mva constructs , which have established safety profiles in humans , have been tested in camels and can induce protective immunity , representing a potential veterinary technology ( 46 ) . moreover , on the basis of supportive data from animal studies , these mva constructs will soon enter clinical trials . vaccines based on live attenuated viruses historically have been shown to be highly efficacious ; they are also safe and generally well tolerated . enjuanes and others reported to the group the development of 2 engineered mers - cov vaccine candidates . one candidate was based on a propagation - defective mers - cov strain , and another was a live attenuated virus with 3 safety guards that used a mers - cov infectious cdna clone ( 47 ) . an inactivated sars - cov vaccine was shown to be safe and able to induce nabs in a phase i trial ( 48 ) . dna vaccines are generally perceived as a safe , stable platform for in vivo antigen expression . a sars - cov dna vaccine , which expresses the sars - cov s protein , has been shown to induce nabs and functional t - cell responses in humans ( 49 ) . geneone ( blue bell , pa , usa ) is developing a proprietary , full - length s protein dna vaccine candidate that has been shown to induce nabs and highly functional t cells in various animal models and protect rhesus macaques from infection after mers - cov challenge when the vaccine is administered with electroporation to enhance uptake of the plasmid dna ( 50 ) . concerns remain regarding the immunogenicity of dna vaccines in humans , although the effects of using therapeutic vaccination strategies for other diseases raise the potential for dna - only approaches ( 51 ) . in addition , modjarrad reported that using a prime - boost format , a full - length s protein dna vaccine , followed by an s - protein boost , can increase nab titers , reduce the clinical severity of mers , and increase the durability of protection in macaques ( 52 ) . to complement active immunization approaches , researchers are also advancing several prophylactic or therapeutic approaches against mers - cov using nab technologies through preclinical development . because these nabs target epitopes of the s protein ( or specifically the receptor - binding domain ) , they can cause precise and potent inhibitory effects on viral entry in small and large animal models ( 53 ) . the mechanisms of neutralization have been uncovered and are typically mediated by blocking mers - cov binding to hdpp4 ( 22,52,5456 ) . as the supplementary agents of antibodies , the peptidic mers - cov fusion inhibitors targeting the conserved region in the s protein hr1 domain region are highly potent in inhibiting infection of mers - cov strains , including those resistant to nabs . intranasal administration of the peptides protected hdpp4-transgenic mice from mers - cov challenge , suggesting that , alone or in combination with nabs , these peptides could be used to prevent and treat mers - cov infection ( 37,39,57 ) . further characterization of these technologies and the potential for combination approaches are ongoing as investigators tackle questions related to viral escape ( 58,59 ) . preliminary results indicate that viruses that evade antibody neutralization have reduced viral fitness , demonstrating that escape can occur but comes at a cost to fitness . marasco noted that sequencing of circulating strains will be critical to monitor viral evolution ( 60 ) , which will only be possible with increased sample- and data - sharing . ongoing studies related to cross - reactivity with human tissue and the effects of polyclonal and nonneutralizing antibodies are also underway as passive immunotherapy becomes more accepted to prevent and treat mers - cov infection . overall , selecting specific technologies and approaches that warrant further development is difficult , given the diversity of models and readouts and the concomitant need for greater standardization in the field . although each technology presents unique advantages and deficiencies related to desired immunogenicity , safety , durability of protection , need for adjuvant , and manufacturing considerations , some technologies have a long track record in the clinic , which would potentially simplify their development and regulatory pathway . given the public health urgency , these platforms ( or combinations thereof ) should be made a priority . the experience with sars - cov offers a sobering lesson : countermeasures that advance on the basis of promising preclinical data may ultimately exacerbate disease in humans . antibody - dependent enhancement of infectivity has been observed in cell culture in which a human promonocyte cell line is used 6163 ) . in mice and hamsters vaccinated with a recombinant native full - length sars - cov s protein trimer , serum igg developed that blocked binding of the s protein to the ace2 receptor and neutralized sars - cov infection in vitro . sars - cov entered human b - cell lines in an fcrii - dependent and ace2-independent fashion , indicating that antibody - dependent enhancement of virus entry is a novel cell entry mechanism of sars - cov . vaccinated animals showed no signs of enhanced lung pathology or hepatitis , and viral load was undetectable or greatly reduced in lungs after challenge with sars - cov ( 64 ) . however , in the presence or absence of adjuvant , vaccination of mice with viruslike particles or inactivated virus induced eosinophilic immunopathologic changes in young and aged mice ( 6567 ) . the pulmonary immunopathologic features , on challenge with sars - cov , were associated with th2-type immunopathology with prominent eosinophil infiltration . although no enhancement of immunopathologic features has been observed in mers - cov vaccinated and challenged animals , future studies of mers - cov vaccines in animals and humans should consider that possibility . to date , commitment to open communication regarding mers - cov vaccine development has been haphazard , and leaders in the field are calling for a new approach that integrates resources to accelerate science and enhance biosecurity . new norms and standards are under development by the world health organization ( who ) to streamline sample collection ( type , storage and availability , quality control ) ; and information dissemination and publication . combining resources available in saudi arabia , south korea , the united states , europe , and beyond to develop countermeasures for mers - cov , an open innovation paradigm shift can maximize public sector investment , provide robust information for a systems - level approach , and deliver the necessary public health effect that is urgently needed . the saudi arabia moh , working with saudi academic institutions , who , and other stakeholders , recognizes the crucial role it has to play in defining the public health goals that will guide vaccine development efforts for mers - cov ( 68,69 ) . researchers , vaccine developers and health authorities must understand how a vaccine is expected to fit into the larger public health strategy to combat mers ( e.g. , target populations and vaccination strategies , level of efficacy , safety profile for a vaccine ) , as well as the pathway to future vaccine testing ( e.g. , design of efficacy trial ) , licensure and access . few vaccine developers in the mers arena have experience conducting preclinical and clinical research in the middle east , and the saudi moh and saudi food and drug authority have a valuable role to play in defining the expectations for future clinical studies and in educating developers on the associated regulatory pathway . the potential threat posed by mers - cov necessitates a multipronged approach to the development of effective countermeasures . accelerating the development of a vaccine requires a better understanding of mers - cov epidemiology , transmission , and pathogenesis in humans and animals . this information will help develop target product profiles for human and veterinary vaccines , which in turn will facilitate planning for efficacy trials and inform development strategies . 2 . because current animal models do not fully reflect hallmarks of severe human disease , a combination of both rodents and nonhuman primate models should be considered in evaluating and developing preventive and therapeutic candidates under standardized conditions . current vaccine development strategies involve a variety of technology platforms , primarily targeting the mers - cov s protein . given the public health urgency , platforms ( or combinations thereof ) with an established safety track record in humans should be given priority . other target species such as dromedary camels should also be considered for the development of veterinary vaccines as a one health approach . attention should be paid to lessons learned from sars - cov vaccine development efforts , particularly to signs of potential disease enhancement in various animal models . therapeutic antibodies are recognized as potentially useful tools in mers prevention and treatment , but the concern around escape mutants with increased fitness , although concern is not limited to this technology type , warrants continued investigation and surveillance . such an approach could be considered alone or in combination with vaccine approaches . as supplementary agents , an opportunity exists for greater coordination around specific technology platforms and to ensure that appropriate incentives are considered to stimulate research and development collaboration from academia , industry , nongovernmental organizations , and governments . the saudi arabia moh , working with who and other stakeholders , has a crucial role to play in defining the public health goals that will guide vaccine development efforts . funding agencies , nongovernmental organizations , and companies recognize the need for cooperation and have resolved to formalize a collaborative model . the field recognizes the opportunity to set a precedent for how it collaborates as a global community in the context of an emerging disease , building on lessons learned from the recent international response to the ebola epidemic . although still subject to consultation , key components of a partnership(s ) were identified , including coordinating funding , sharing samples / data , advancing preclinical models , beginning clinical trials in regions having outbreaks , and standardizing assays and reagents for testing . exact partnership structures remain to be determined but should at the very least allow for coordination of activities through frequent , transparent , and open discussions among funding agencies and stakeholders . future models , including a formalized consortium of players who would make a long - term commitment to advance selected products through development phases , can be contemplated once technologies are evaluated more rigorously . regardless of the final partnership structure(s ) , the core of any collaborative strategy should include sharing of data and samples and standardizing laboratory assays to ensure that everyone learns from each other , are able to compare technologies , and ultimately accelerate the development of new solutions .

middle east respiratory syndrome ( mers ) remains a serious international public health threat . with the goal of accelerating the development of countermeasures against mers coronavirus ( mers - cov ) , funding agencies , nongovernmental organizations , and researchers across the world assembled in riyadh , saudi arabia , on november 1415 , 2015 , to discuss vaccine development challenges . the meeting was spearheaded by the saudi ministry of health and co - organized by the international vaccine institute , south korea . accelerating the development of a preventive vaccine requires a better understanding of mers epidemiology , transmission , and pathogenesis in humans and animals . a combination of rodent and nonhuman primate models should be considered in evaluating and developing preventive and therapeutic vaccine candidates . dromedary camels should be considered for the development of veterinary vaccines . several vaccine technology platforms targeting the mers - cov spike protein were discussed . mechanisms to maximize investment , provide robust data , and affect public health are urgently needed .

stress cardiomyopathy ( scm ) is an acute cardiac syndrome resembling st - segment elevation myocardial infarction characterized by decreased wall motion in the apical and midportion of the left ventricle ( lv ) . these abnormalities extend beyond a single coronary distribution without significant obstructive coronary artery disease.1 case reports in the literature suggest that strong psychological or physical stress is associated with the occurrence of scm.2 we believe that the present case is the first report of scm following diffuse alveolar hemorrhage ( dah ) owing to aspiration of polyethylene glycol ( peg ) . a 37-year - old woman was transferred from a primary clinic to our emergency department because of chest pain and shortness of breath . she had undergone gastroscopy and colonoscopy in the left lateral decubitus position at the clinic that day to evaluate her complaint of constipation . during the examination , she aspirated some gastric contents with residual peg . although she received immediate first aid , her hypoxia did not resolve fully and her chest pain gradually worsened . at the time of her arrival at the emergency department , she complained of chest pain , shortness of breath , and blood - tinged sputum . her initial vital signs were as follows : blood pressure , 80/50 mm hg ; heart rate , 114 beats / minute ; respiration rate , 22 breaths / minute ; body temperature , 37.2 ; and saturation , 95% in fio2 0.32 by pulse oxymetry . laboratory tests revealed a white blood cell count of 13,280/l with 94.3% neutrophils and 0.3% eosinophils , hemoglobin of 13.0 g / dl , platelet count of 182,000/l , activated partial thromboplastin time of 30.9 s , prothrombin time of 14.2 s , c - reactive protein of 2.10 mg / dl , significantly elevated troponin - i of 3.07 ng / ml , and elevated creatine kinase - mb of 15.7 ng / ml . the total creatine kinase level was not elevated at 194 u / l , but the creatine kinase - mb / creatine kinase ratio was markedly elevated at 8% . the electrocardiogram revealed sinus tachycardia without significant st segment abnormality or t - wave inversion . chest computed tomography showed ground - glass opacities and multiple low attenuation areas in the bilateral dependent portions , especially in the left upper lobe ( fig . the transthoracic echocardiogram revealed global hypokinesia , especially in the basal and midportions of the lv ( fig . the lv ejection fraction was estimated to be approximately 30% by the a / l method , and there was no lv outflow tract obstruction , pulmonary hypertension , or mitral regurgitation . initial pharmacologic management included aspirin , clopidogrel , and antibiotics based on the suspicion of acute coronary syndrome with aspiration pneumonia . although left ventriculography and ergonovine provocation tests were not conducted , the typical echocardiography findings without significant coronary artery lesions were sufficient to confirm the diagnosis of scm . after the patient was transferred to the cardiac intensive care unit , her symptoms of hypoxia and dyspnea gradually worsened and fresh hemoptysis accompanied this worsening . while she was on 80% oxygen , her arterial blood gas measurements were as follows : ph , 7.306 ; pco2 , 26.7 mm hg ; po2 , 58.4 mm hg ; hco3 , 13.0 mmol / l ; and sao2 , 88.2% . ultimately , the patient was intubated , ventilator care was begun , and fiberoptic bronchoscopy was performed . no bronchial mucosal lesion was identified , but five sequential aliquots of bonchoalveolar lavage ( bal ) fluid with a progressively bloody appearance were observed in the airway of the left upper area . analysis of the bal fluid revealed a red blood cell count of 28,000/mm and a white blood cell count of 100/mm with 40% neutrophils and 44% macrophages , consistent with alveolar hemorrhage . the patient received ventilator care for 3 days and was treated with methylprednisolone ( starting dose of 1 mg / kg and tapering for 7 days to stop ) and antibiotics . seven days into her hospitalization , her symptoms of dyspnea , hemoptysis , and chest discomfort had fully resolved . follow - up measurements of creatine kinase and creatine kinase - mb were normalized , and troponin - i was decreased to 0.13 ng / ml . the haziness on her chest radiograph had also disappeared ( fig . six months after her discharge from the hospital , a follow - up transthoracic echocardiogram revealed a 60% improvement in lv ejection fraction by the a / l method without regional wall motion abnormality ( fig . the pathophysiologic mechanism of scm has not been clearly established , but a catecholamine - mediated mechanism has been recognized as the most reliable precipitating factor.3 dah - induced hypoxia and hypercapnia have a multiplicative effect on the output of carotid chemoreceptors , and sympathetic activation is substantially increased.4 the exaggerated sympathetic responsiveness in dah triggers myocardial stunning , multi - vessel epicardial spasm , microvascular spasm , and direct catecholamine - mediated myocyte injury , each of which has been reported to cause scm.1 dah - induced scm could be explained in the same manner , but it has not previously been reported in the literature . dah refers to pulmonary hemorrhage originating from the alveolar capillaries , arterioles , and venules and is defined by the clinical symptoms of hemoptysis and anemia , diffuse radiographic pulmonary infiltration , and hypoxemic respiratory failure.5 dah is characterized histologically by the presence of intraalveolar red blood cells , fibrin , and hemosiderin - laden macrophages , which may take up 48 to 72 hours to accumulate.5,6 although a surgical biopsy specimen is considered the gold standard for diagnosis , it is often impractical . bal is an accepted alternative for confirming the diagnosis when 20% hemosiderin - laden macrophages are present.7 according to one recent study , however , the percentage of hemosiderin - laden macrophages in bal fluid can be increased in patients with dah , but this may not be diagnostic.6 in our case , we performed bal , but prussian blue stained hemosiderin - laden macrophages were not present in the bal fluid . bronchoscopic examination was performed within 24 hours , which may have been too early in the course of the disease to detect the accumulation of hemosiderin - laden macrophages . the area of alveolar hemorrhage in this case was not extensive and the clinical course of our patient was relatively mild compared with other reported cases of dah . injury to the alveolar microcirculation is mainly associated with local lung injury or systemic disorders such as vasculitis or connective tissue disease.5 our patient did not demonstrate any clinical evidence of a systemic disorder . therefore , it seems more likely that local lung injury due to aspirated fluid followed by progression of acute respiratory distress syndrome was the cause of the dah . although a wide range of dah causes have been reported on a case - by - case basis , peg exposure is a very rare etiology . peg is a popular bowel cleansing agent because of the safety and efficacy of the solution ; however , complications such as nausea , vomiting , and abdominal bloating are frequent.8 some studies have reported esophageal rupture with vomiting or respiratory failure after peg aspiration.9 - 11 the pathophysiological mechanism of peg - induced lung injury remains unclear . according to some studies , the hyperosmotic properties of peg solution can induce intra - luminary fluid shifting within the alveolar and interstitial spaces , resulting in pulmonary edema.12,13 in this case , massive lavage could retrieve a sufficient amount of aspirated fluid , especially peg , preventing further deterioration of chemical pneumonitis and acute respiratory distress syndrome . however , peg aspiration - induced dah in young adults is very rare and only a few patients have recovered fully after retrieval of aspirated fluid with bal .

stress cardiomyopathy ( scm ) is usually precipitated by a physiologically or psychologically stressful event . although it occurs only rarely , hypoxia- and hypercapnia - induced sympathetic activation may also cause scm . we present the case of a 37-year - old woman affected with scm after a routine colonoscopy . during the procedure , she aspirated residual polyethylene glycol from her stomach . hypotension , resting dyspnea , and hemoptysis were subsequently observed . laboratory findings revealed elevated cardiac enzymes , and a transthoracic echocardiogram revealed left ventricular ( lv ) global hypokinesia . she was ultimately diagnosed with diffuse alveolar hemorrhage - associated scm . after successful treatment with a ventilator and corticosteroids , her lv systolic function and dimensions normalized and she was discharged without complications .

during the last few years , the self - assembly of ordered structures on the nanoscale has been recognized as a key issue in nanotechnology , opening novel perspectives for device applications . however , the development of structures that are confined in one or two dimensions remains a challenge that stimulates the scientific community to study and model the growth of various nanostructures , including nanowires , quantum dots , and nanocrystals . in addition to applications of inorganic nanostructures in nanomedicine and nanoelectronics , it was found that organic self - assembled nanostructures offer novel perspectives for device applications including optical sensors , waveguides , and laser sources . a recent example is parallel para - hexaphenyl ( p-6p ) nanofibers that are prepared by vacuum deposition on muscovite mica substrates ( sketched in figure 1a ) , showing strong polarized blue fluorescence , waveguiding , and random lasing if excited by uv radiation . the formation of parallel nanofibers based on rodlike molecules is linked to the epitaxial alignment of their long molecular axis ( lma ) with respect to the mirror axis of the muscovite mica substrate surface . if the lma is not perpendicular or parallel to the surface mirror axis , then multiple fiber directions form as a result of a doubling of energetically equivalent adsorption geometries . therefore , the preparation of parallel self - assembled nanofibers with significantly different optical properties ( i.e. , emitting in the visible green or red region ) is not possible via simply replacing the molecular building blocks because the adsorption geometry is likewise altered . as sketched in figure 1b for the case of sexithiophene ( 6 t ) , such a strategy typically leads to multiple fiber directions and crossing points , which reduces the length of the waveguides and , consequently , the accessible optical gain within the structures . sketch of self - assembled nanofibers prepared by vacuum deposition on muscovite mica . ( b ) nonparallel fibers consisting of 6 t molecules . ( c ) p-6p/6 t heteroepitaxial fibers prepared by the deposition of 6 t molecules on top of p-6p template fibers . 6 t forms two different structures : an interface layer ( green ) and bulk crystallites ( red ) . ( d ) detailed view of the p-6p/6 t interface showing the adaptation of the herringbone arrangement . heteroepitaxy of organic molecules can provide a solution to this problem because it influences the nucleation and ordering of organic adsorbate layers by the exploitation of templating effects . for p-6p fibers , it was demonstrated that the emission spectrum can be tuned without disturbing the advantageous morphology and structure of the self - assembled nanofibers . p-6p molecules are deposited on muscovite mica to prepare parallel crystalline structures , which act as templates for 6 t molecules deposited subsequently ( schematically depicted in figure 1 c ) . the lmas of 6 t and p-6p molecules align parallel , and an adaptation of the specific herringbone packing of the two molecular species is observed . remarkably , the photoluminescence spectrum of such heterostructures comprises not only blue p-6p and red 6 t emission but also an additional contribution in the green spectral regime , which is related to the interface layer . 6 t molecules that are in direct contact with the p-6p crystals exhibit strikingly different optical properties as compared to bulk 6 t crystals nucleating on top of p-6p fibers , with the green interfacial emission being significantly stronger than the red emission of bulk 6 t . this finding motivated the use of multilayer structures of p-6p/6 t to increase the green 6 t contribution to the emission spectrum enabling random lasing in the green spectral regime . here , we aim to identify and understand the origin of green 6 t emission by investigating the electronic structure of the p-6p/6 t interface using photoelectron spectroscopy ( pes ) because this technique is highly surface - sensitive and therefore ideal for studying submonolayer coverage as in the case of the evolvement of the p-6p/6 t interface layer . in addition , chemical interactions between molecules can be studied with high precision , which allows us to answers the following questions : ( 1 ) does intermixing of the two molecular species occur , leading to 6 t molecules embedded in a p-6p matrix , which provides a significantly different environment compared to that of bulk , crystalline 6 t ? ( 2 ) are additional interfacial electronic states present as a result of a strong interaction between p-6p and 6 t molecules ? for pes measurements , electrically conductive substrates are indispensable to avoiding charging issues , which render the insulator muscovite mica an inappropriate substrate . however , to ensure the comparability of the results , an alternative substrate should allow p-6p and 6 t crystallites to grow nanoneedles with the same contact planes as on muscovite mica ( i.e. , ( 111)6p , ( 112)6p , and ( 411)6 t ) . molecule interaction but still stabilizes p-6p molecules in a flat - lying orientation is highly oriented pyrolytic graphite ( hopg ) . consequently , hopg represents an ideal model system to replace muscovite mica in order to study the organic , we first provide evidence by x - ray diffraction ( xrd ) that p-6p/6 t crystals deposited on hopg indeed exhibit similar crystal phases and contact planes as on muscovite mica . subsequently , the morphological and optical properties of p-6p/6 t bilayers on hopg are investigated by scanning force microscopy ( sfm ) and fluorescence microscopy . finally , the interface energy levels of p-6p/6 t heterostructures are investigated by ultraviolet photoelectron spectroscopy ( ups ) and x - ray photoelectron spectroscopy ( xps ) . xrd measurements were carried out to study the growth of p-6p and 6 t on hopg ; a sketch of the samples is shown in figure 2a . ( a ) sketch of the sample structures including the symbols used for the indication of p-6p ( gray circle ) , 6 t ( gray square ) , and hopg ( black circle ) diffraction peaks . arrows and dashed lines indicate the peak positions for ( 111)p-6p , ( 112)p-6p , ( 203)p-6p , ( 411)6 t , ( 020)6 t , and ( 002)hopg , respectively ; curves are shifted vertically for clarity . the corresponding specular diffraction pattern is depicted in figure 2b(i ) as a function of the vertical component of the scattering vector ( qz ) and shows four distinct peaks . the most intense reflection at qz = 1.87 is assigned to the ( 002 ) peak of the hopg substrate . the peaks at qz = 1.38 , 1.42 , and 1.63 can be assigned to the ( 111 ) , ( 112 ) , and ( 203 ) diffraction peaks of the p-6p -phase , respectively . all three observed crystal orientations of p-6p originate from flat - lying molecules , and the more intense ones [ ( 111 ) and ( 112 ) ] are likewise present on hwe - grown films on mica . note that when taking the respective structure factors into account , ( 203 ) is clearly the minority species in the film . in the next step , 6 t ( 400 nm ) was deposited on hopg and analyzed by specular xrd . the spectrum in figure 2b(ii ) shows the presence of two reflections assigned to 6 t in its so - called low - temperature ( lt ) phase . the diffraction patterns can be well explained by crystals with ( 411 ) and ( 010 ) contact planes observed at qz = 1.42 and 1.60 , respectively . both crystal configurations are characteristic of flat - lying 6 t molecules on the substrate surface , which agrees well with earlier reports from high - resolution electron energy loss spectroscopy . no indications for upright - standing molecules are observed , which would be typically represented by a ( 100 ) contact plane . in a final step , 6t / p-6p / hopg heterostructures were fabricated by preparing a nominally 60-nm - thick p-6p template . subsequently , 6 t was deposited without breaking the vacuum by choosing the same growth parameters as used for the preparation of the pure 6 t film ; the corresponding specular xrd data is shown in figure 2b(iii ) . the presence of p-6p crystallites in the phase is confirmed , and all p-6p crystal orientations ( as discussed for pure 6p on hopg ) are observed . from 6 t , only a small contribution of the ( 411)6 t orientation is observed ( seen as a shoulder at lower qz next to the ( 112)p6p peak ) , whereas crystallites with a ( 010)6 t orientation are absent . to verify the orientation of 6 t , gracing - incidence reciprocal space maps ( rsm ) were recorded , which fully confirms our assignment ( supporting information ) . in summary , xrd provides a consistent picture that shows that p-6p crystallizes in the phase whereas 6 t molecules pack in their so - called lt phase . both p-6p and 6 t form multiple crystal orientations on hopg , which all are indicative of flat - lying molecules with respect to the substrate surface . the molecular orientations of both the pure compounds and the heterostructures on hopg are fully in line with what is observed for mica . as a consequence , hopg seem to be perfectly suitable for studying the p-6p/6 t interface with pes methods by analogy to muscovite mica . fluorescence microscopy represents an excellent method for combining morphological and optical investigations . by using an ultraviolet ( uv ) light source , the organic thin films are excited such that we can study their spatially resolved fluorescence . as indicated in figure 3 , a 60-nm - thick p-6p template layer was grown by hwe on hopg as the first step ( i ) and analyzed by fluorescence microscopy showing strong blue emission . the photoluminescence ( pl ) spectra are consistent with literature data obtained for p-6p nanofibers on mica substrates . the corresponding micrograph presented in figure 3i reveals a netlike structure of p-6p nanofibers , which homogeneously cover the hopg surface . this is consistent with our structural analysis because p-6p tends to form needlelike structures with ( 111 ) and ( 112 ) textures . the low azimuthal anisotropy , in comparison to that of parallel - aligned p-6p nanofibers on mica , is attributed to the hexagonal substrate surface unit cell and to the fiber texture of hopg . consequently , p-6p nanofibers can be expected to show random azimuthal orientations on a macroscopic length scale , leading to the formation of a netlike sample morphology . subsequently , nominally one monolayer of 6 t was deposited on top of the p-6p template ( ii ) . finally , a 400-nm - thick 6 t layer was grown on the p-6p template ( iii ) , and all samples were characterized by fluorescence microscopy and photoluminescence ( pl ) . a pl spectrum of pure 6 t bulk crystallites is plotted as a reference . to resolve the relatively weakly emitting 6 t crystallites , the red detection channel was amplified in the right panel of the color image acquired on sample iii . in step ii , nominally 0.4 nm 6 t was deposited on the p-6p / hopg template ; the 6 t layer thickness corresponds to approximately one monolayer ( ml ) . as is clearly evident from the pl spectrum ( green line in figure 3 ) , the fluorescence emission of the sample changes significantly . beside the blue p-6p emission , note that comparable spectra were reported for such heterostructures grown on mica , where the presence of a 6 t layer sensitized by the excited p-6p material via resonance - energy transfer was suggested . having established the interfacial layer , 6 t deposition was continued to nominally 400 nm of 6 t ( iii ) , and as indicated in figure 3 ( red line ) , the emission is altered again . in particular , the change in the intensity ratio of the 00 and 01 vibronic peaks ( occurring at approximately 530 and 570 nm , respectively ) was also observed in nanofibers fabricated on mica with comparable 6 t thicknesses and was explained by a superposition of crystalline and interfacial 6 t emissions . from figure 3iii , it is evident that the blue luminescence of p-6p is efficiently quenched and homogeneously green - emitting nanofibers are observed . in the right part of figure 3iii , inhomogeneously distributed structures can be resolved on top of the nanofibers , which we attribute to the nucleation of 6 t bulk crystallites emitting in the red - orange spectral range . it has to be stated that the red - orange emitting crystallites can be detected only if the red channel of the image is amplified . the weak pl emission of pure 6 t crystallites exhibits its maximum intensity at higher wavelengths ( dashed orange line in figure 3 ) , and this contribution is responsible for the increase of the 01 peak intesity of spectrum iii . in addition , scanning force microscopy ( sfm ) images of the 6t / p-6p bilayer structure are shown in figure 4a . at first glance flat regions are observed between the fibers , which can be attributed to the bare hopg substrate ( labeled a ) . structures with height levels of approximately 60 nm nicely agree with the expected height of the p-6p template fibers ( b ) , which exhibit a rectangular cross - section with a flat top , as seen in figure 4b . on top of the p-6p crystallites , 140400-nm - high entities are present ( c ) , which exhibit a triangular cross section . as indicated by a dashed line in the height profile of figure 4b , the flatter side facet of structures c exhibits an angle of 113 relative to the hopg substrate surface . recently , it was demonstrated by cross - sectional transmission electron microscopy ( tem ) that 6 t crystallites with a ( 411 ) contact plane tend to form strongly tilted lamella - like structures . this tilt was explained by an area maximization of the ( 100 ) low - energy plane , which forms the side walls of the 6 t crystallites . as sketched in figure 4c , the angle enclosing the side facet and the contact plane is given by 112.7. consequently , the experimental value agrees with that theoretically expected , which confirms that structures c reflect the morphology of ( 411)-oriented 6 t crystallites . note that previous tem investigations revealed that such sfm cross sections reproduce only one facet correctly because of the finite cone angle of the tip . ( a ) color - coded height image obtained by scanning force microscopy ( sfm ) on a nominally 400-/60-nm - thick 6t / p-6p heterostructure on hopg . the cross section depicted below is taken from the region marked by a dashed polygon , and the corresponding height profile is presented in panel b. ( c ) geometrical alignment of the ( 100 ) low - energy plane of ( 411 ) 6 t crystallites . the long needle axis ( lna ) that is almost perpendicular to the long molecular axis ( lma ) ( d ) color - coded phase image acquired at the same sample position indicating the presence of three different phase levels that are reflected by histogram peaks presented in panel e. peak positions can be correlated with the hopg substrate surface ( a ) , rectangular p-6p template fibers ( b ) , and triangularly shaped 6 t fiber structures ( c ) . phase images provide information on local variations in the mechanical properties due to material - dependent dissipative processes related to the tip sample interaction . the measurement shows a positive phase shift for the hopg ( a ) and p-6p template nanofibers ( b ) . on the contrary , structures that were assigned to ( 411)6 t crystallites cause a negative phase shift ( visualized by dark regions ) this observation is further substantiated by the phase histogram in figure 4e , indicating three dominant phase levels that can be attributed to hopg ( a ) , p-6p template fibers ( b ) , and 6 t crystallites ( c ) . after evidencing the structural comparability between the p-6p/6 t crystals on hopg and mica , we now turn to the investigation of their electronic structure by ups and xps . the measurements were carried out in the form of a thickness series , starting with a 5 -nm - thick p-6p layer and 6 t layers deposited subsequently onto this template . the ups valence band ( vb ) , the secondary electron cutoff ( seco ) spectra , and the xps core - level spectra of carbon 1s ( c 1s ) and sulfur 2p ( s 2p ) were recorded for each thickness level ( figure 5 ) . in the vb region , a peak around 3.3 ev binding energy ( be ) is observed , which is assigned to the hopg substrate . upon p-6p deposition , ( see the schematic energy - level diagram in figure 5 . ) upon 6 t deposition , a new peak emerges at 1.4 ev that originates from the 6 t homo and is clearly visible at a nominal thickness of only 0.2 nm 6 t . note that the be of 6 t homo-1 almost coincides with the homo of p-6p . with increasing 6 t thickness , the peak at 1.4 ev increases in intensity , whereas the p-6p homo-1 peak becomes significantly attenuated . this points toward a sharp interface between p-6p and 6 t because ups is a highly surface - sensitive technique with an escape depth for electrons on the order of 1 nm at the given photon energy . at a nominal 6 t thickness of 1.6 nm , homo-1 of p-6p p-6p ( 5 nm , green curve ) is deposited on the bare hopg substrate ( blue ) . layers of increasing 6 t thickness are deposited onto the p-6p buffer layer with nominal thicknesses of 0.2 ( red ) , 0.8 ( cyan ) , 1.6 ( magenta ) , 3.2 ( yellow ) , and 6.4 nm ( black ) . the left part of the figure shows the c 1s and s 2p core levels , the middle part shows the valence band region ( takeoff angle of 45 ) together with the secondary electron cutoff ( seco ) , and the right part shows a schematic energy - level diagram with energy values deduced from ups . the seco shows that all interfaces are vacuum - level aligned because in the cutoff region essentially no shifts are observed . additionally , no shifts in be are observed for either the vb region ( ups ) or the core levels ( xps ) . in combination with the results from the vb region , a schematic energy - level diagram can be drawn ( figure 5 , right ) . the homo onset positions ( with respect to the fermi level ) and the ionization potentials ( ip ) are in good agreement with previous pes studies on individual layers of 6 t and p-6p . the ips and the homo onset for 6 t ( p-6p ) are found to be at 5.4 ev ( 6.0 ev ) and 0.9 ev ( 1.7 ev ) , respectively . the observation of vacuum - level alignment and the absence of new electronic states , resulting from strong electronic coupling between the individual materials , clearly rules out that the observed green emission of a 6 t ml on top of p-6p template crystals originates from interfacial electronic states . the growth of p-6p , 6 t , and 6t / p-6p heterostructures on hopg was investigated . on the basis of x - ray diffraction measurements , it is shown that p-6p tends to crystallize in the phase whereas 6 t molecules pack in their so - called lt phase . p-6p crystallizes , when deposited on hopg , in three different geometries with ( 111 ) , ( 112 ) , and ( 203 ) contact planes parallel to the substrate surface . for 6 t crystals , ( 411 ) and although ( 411)-oriented 6 t crystallites also grow on the p-6p template , the ( 010 ) orientation vanishes . it seems that 6 t crystallizes exclusively on top of the p-6p needles where 6 t molecules adopt the herringbone arrangement of the underlying ( 111)6p surface . sfm investigations reveal three different sample morphologies , which are attributed to the hopg substrate surface , the p-6p template fibers , and the 6 t crystallites with a ( 411 ) contact plane . by combining pl and fluorescence microscopy , we demonstrate that 6t / p-6p heterostructures deposited on hopg behave analogously to 6t / p-6p nanofibers on muscovite mica . both homogeneous green - emitting interfacial 6 t phase for low 6 t coverages and red - emitting crystallites on top of p-6p structures are observed . pes measurements show that the interface between p-6p and 6 t is sharp on a molecular level , despite the reported tendency of mixed crystal formation upon vacuum codeposition . importantly , no indication of the presence of new electronic states is found in ups . vacuum - level alignment and therefore the absence of interface dipoles are observed . consequently , the 6 t molecules are physisorbed on top of p-6p crystals , and the green color of the 6 t interface layer emission is not caused by ground - state electronic coupling with p-6p at the interface but rather resembles the spectrum of isolated 6 t molecules both in solution and in the submonolayer range of 6 t on silicon dioxide . the interface layer preserves its optical emission characteristics even for large 6 t thicknesses , where red - emitting bulk 6 t crystals are formed . sexithiophene deposited on para - hexaphenyl is thus understood to coexist in two different types of aggregation as similarly reported for 6 t grown on silicon dioxide or single - crystalline cu . in the interface layer , 6 t molecules are characterized by weak intermolecular interactions , whereas in the overlying bulk crystals side - by - side interactions of 6 t molecules dominate ( h aggregation ) . h aggregates exhibit a low pl quantum yield with a forbidden 00 transition , which is perfectly in line with our observations for bulk crystals of 6 t on top of p-6p . in contrast , weakly interacting molecules feature an allowed 00 transition and a high pl quantum yield . as a consequence , an inversion of the 00 to 01 emission intensity ratio can be observed as compared to large ( 400 nm ) 6 t coverages . the growth analogy of p-6p/6 t on hopg and mica demonstrated in this study represents a straightforward approach to the investigation of the electrical properties of organic nanostructures grown on mica . in addition , it can open pathways for future optoelectronic devices based on intensively studied nanofibers of p-6p/6 t . such devices could be fabricated on transparent graphene electrodes instead of mica because the hopg surface and graphene sheets allow the formation of structurally equivalent organic nanostructures as recently demonstrated . all samples were fabricated on highly oriented pyrolytic graphite ( hopg ) ( 001 ) of zya quality , and vacuum deposition of organic molecules was performed by hot wall epitaxy ( hwe ) . immediately after being cleaved ( using scotch tape ) , the substrates were transferred via a load lock to the growth chamber , providing two separated hwe reactors equipped with p-6p ( tci ) and 6 t ( sigma - aldrich ) source material . the system was operated under high - vacuum ( hv ) conditions with a nominal pressure of 9 10 mbar . p-6p ( 6 t ) was evaporated at a temperature of 240 c ( 190 c ) , which resulted in a nominal growth rate of 1 nm / min ( 4.5 nm / min ) . to avoid temperature gradients during growth and to reduce adsorbed species on the surface , the substrate was preheated to 120 c for 30 min and the temperature was kept constant during the whole growth procedure . after depositing p-6p for 60 min ( 60 nm fiber height ) , the sample was automatically transferred under hv conditions to the 6 t source oven . subsequently , 6 t was deposited for 1 s up to 90 min ( 405 nm ) ; the nominal layer thickness is defined as the average fiber height . specular x - ray diffraction measurements were performed at synchrotron radiation source hasylab ( hamburg , germany ) using a wavelength of 1.1771 . the w1 end - station is equipped with a pseudo - z - axis goniometer and a mythen linear detector that spans 2.3 in 2. every specular scan therefore yields a rocking curve at each value of the out - of - plane component of the scattering vector ( qz ) . the reciprocal space maps ( rsm ) were measured in grazing incidence geometry with the linear detector oriented in the qz direction . an rsm represents a 2d cut of the reciprocal space , where each reflection corresponds to a ring - shaped diffraction maximum in reciprocal space , which originates from the fiber texture of the hopg substrate . the parameters of the monoclinic unit cell of p-6p ( 6 t ) used for peak assignment are a = 8.091 , b = 5.568 , c = 26.241 , and = 98.17 ( a = 44.708 , b = 7.851 , c = 6.029 , and = 90.76 ) . scanning force microscopy ( sfm ) studies were performed using a digital instruments dimension 3100 in tapping mode . the sfm characterization was performed on an area of 10 10 m with a sic tip . epifluorescence images were acquired upon sample illumination with a hg lamp spectrally narrowed in the 330360 nm band . for fluorescence spectroscopy , samples were excited over a large area of some hundreds of squared micrometers at 375 nm by a frequency - doubled ti / sapphire oscillator with an 82 mhz repetition frequency . emission was analyzed in a grating spectrometer and detected with a liquid - nitrogen - cooled detector . pes experiments were carried out at end - station suricat ( at beamline pm4 ) at bessy ii ( berlin , germany ) . the highly oriented pyrolytic graphite ( hopg ) substrate for the ups measurements was of zya quality and was preheated to 700 k for approximately 15 h. the p-6p and 6 t molecules were evaporated from a knudsen cell . the hopg substrates were kept at room temperature during evaporation , and the deposition rates were ca . 1 / min . the film thicknesses given in the text are nominal mass thickness values determined with a quartz crystal microbalance . film deposition and ups measurements were made in vacuum , and sample transfer did not break the vacuum . the pes spectra were collected with a hemispherical electron energy analyzer ( scienta ses 100 ) and an excitation energy of 18 ev at a 45 emission angle . the secondary electron cutoff ( seco ) was measured at normal emission with an applied voltage of 10 v. the c 1s and s 2p core levels were investigated by xps with a photon energy of 600 ev .

it was recently reported , that heterostructures of para - hexaphenyl ( p-6p ) and -sexithiophene ( 6 t ) deposited on muscovite mica exhibit the intriguing possibility to prepare lasing nanofibers of tunable emission wavelength . for p-6p/6 t heterostructures , two different types of 6 t emission have been observed , namely , the well - known red emission of bulk 6 t crystals and additionally a green emission connected to the interface between p-6p and 6 t . in this study , the origin of the green fluorescence is investigated by photoelectron spectroscopy ( pes ) . as a prerequisite , it is necessary to prepare structurally similar organic crystals on a conductive surface , which leads to the choice of highly oriented pyrolytic graphite ( hopg ) as a substrate . the similarity between p-6p/6 t heterostructures on muscovite mica and on hopg is evidenced by x - ray diffraction ( xrd ) , scanning force microscopy ( sfm ) , and optical spectroscopy . pes measurements show that the interface between p-6p and 6 t crystals is sharp on a molecular level without any sign of interface dipole formation or chemical interaction between the molecules . we therefore conclude that the different emission colors of the two 6 t phases are caused by different types of molecular aggregation .

we investigate the growth of graphene on polycrystalline pt foils ( 25 m , 99.99% , alfa aesar ) by cvd using in situ sem ( see the methods section ) . the samples are first annealed in h2 ( 10 mbar ) at 9001000 c for 15 min to promote pt grain growth and remove adventitious carbon from the surface of the foil and then exposed to c2h4 ( 1010 mbar ) at temperatures of 9001000 c , with sem images ( 0.1 hz frame rate ) acquired throughout . figure 1 shows se micrographs of the pt surface during c2h4 exposure at different times during the growth . prior to the introduction of the precursor ( figure 1a ) , the polycrystalline nature of the catalyst surface is apparent from the variations in contrast between different grains related to electron - channeling contrast and the topographical contrast arising from the network of grain boundaries separating them . the few small ( < 1 m ) , bright features visible within some of the pt grains are attributed to residual oxygen contamination of the pt surface ( as also observed in corresponding x - ray photoelectron spectroscopy measurements ; not shown ) and disappear early in the precursor exposure as they presumably react with carbonaceous species arriving at the surface . although the precursor pressure within the chamber is reached within 15s ( as confirmed by a residual gas analyzer ) , there is a distinct incubation period during which no graphene forms on any of the pt grains . as the precursor exposure continues , faceted graphene domains appear on several pt grains ( figure 1b ) . their darker contrast compared to the bare pt surface is related to the lower secondary electron generation of graphene . the graphene domains grow in size with time and merge with the other graphene domains upon which they impinge . meanwhile , the nucleation of new graphene domains occurs on other pt grains that show longer incubation times ( figure 1c ) . the incubation times of different pt grains vary widely , with graphene domains nucleating on several grains within 90 s of the precursor being introduced , while others show no nucleation events even after > 2500 s and only become covered with graphene due to the expansion of domains from adjacent pt grains across grain boundaries ( figure 1d ) . this is attributable to grain orientation dependent variations in the precursor dissociation rate , graphene nucleation barrier , or both , which are likely to be affected by the density of low - coordination sites such as step edges . during graphene growth , we note that ripening of the pt grains is also observed ( compare panels a and d of figure 1 ) , again highlighting the need for in situ measurements when considering the relationship between the microstructure of the catalyst and 2d material . ( a d ) sequence of in situ sem images of pt ( 25 m ) during c2h4 ( 10 mbar ) exposure at 900 c , acquired 0 s ( a ) , 150 s ( b ) , 1500 s ( c ) , or 6000 s ( d ) after precursor introduction . the approximate orientations of the pt grains determined by ebsd analysis are indicated within the respective grains in ( a ) . ( e ) plot of the areal coverage of graphene , a , with c2h4 exposure time , t , for the regions marked with red and green boxes in ( a ) . after the first graphene domain appears , the nucleation of other domains occurs within a relatively short time frame ( < 60 s ) . the first nuclei typically form near the center of a pt grain away from grain boundaries , and the nucleation density is also observed to be lower close to pt grain boundaries ( see , for example , figure 1b ) . figure 1e considers a single pt grain ( indicated by the red polygon in figure 1a ) and plots the areal graphene coverage , a , with time , t , for the entire grain ( red ) and for a region close to the center of the pt grain ( green square in figure 1a ) . in both cases , a rises rapidly following the incubation period , but the rate of increase in a reduces over time , and complete single - layer graphene coverage is only slowly approached . the jmak equation is widely applied to describe nucleation and growth during phase transformations and has previously been used to interpret ex situ graphene growth results on polycrystalline cu . the inset of figure 1e therefore plots the evolution of graphene areal coverage in terms of avrami coordinates , ln ( ln ( 1 a ) ) versus ln ( t ) ; however , the clearly nonlinear shape confirms that the jmak equation does not adequately describe the increase in the area fraction with time . in interpreting the observed growth behavior , it is instructive to consider the key processes involved in the growth of graphene on polycrystalline catalyst surfaces during cvd , as outlined in figure 2 . the dissociation of the precursor delivers carbon to the catalyst surface ( process 1 ) , which can readily diffuse on the surface ( process 2 ) . this carbon can attach to a graphene domain it encounters contributing to growth ( process 3 ) or can be removed from the surface by diffusion into the bulk ( process 4 ) or grain boundaries ( process 5 ) , which serve as more rapid pathways for diffusion . while processes 4 and 5 can also contribute to delivering carbon to the growing graphene domain , the lower activation barrier for surface diffusion means process 2 is expected to dominate.figure 2 indicates the net directions of mass transport associated with these processes for typical graphene cvd conditions , as used herein , where the catalyst bulk is not initially filled with carbon and a net flux of carbon is delivered to the catalyst surface by precursor exposure . we note , however , that the net directions of mass transport associated with each of the processes can also be reversed depending on the processing conditions , corresponding to removal of surface carbon into the gas phase by etching , shrinking of graphene domains due to carbon removal , and the diffusion of carbon out from the bulk or grain boundaries . process 4 : carbon diffusion into the bulk of the catalyst removes carbon from the surface . process 5 : grain boundary diffusion serves as a more - rapid pathway for carbon removal from the surface . while the jmak equation is found to be inadequate in describing the behavior observed in figure 1e , the evolution of a within an individual catalyst grain qualitatively resembles that obtained by consideration of an idealized single - crystalline surface with a semi - infinite bulk on which graphene growth is fed by the net flux arising from the supply and removal of carbon by processes 1 and 4 , respectively . the supply of carbon by process 1 can be modeled based on the kinetic theory of gases , as being constant for a given grain orientation , precursor partial pressure , and temperature but reducing in proportion to the bare catalyst area ( 1 a ) as graphene coverage isolates the catalyst from the precursor supply . the removal of carbon by process 4 can be modeled based on 1d fickian diffusion perpendicular to the catalyst surface . this yields the following general behavior for a catalyst whose bulk is not initially filled with carbon : upon the introduction of the precursor , the supply of carbon to the surface is matched by bulk diffusion , leading to an incubation period during which the carbon concentration close to the catalyst surface increases until the solubility limit is reached and a local supersaturation develops . this supersaturation feeds the nucleation and subsequent growth of graphene domains and is maintained by precursor dissociation on bare areas of the catalyst . as the graphene coverage increases , the supply of carbon to the surface by precursor dissociation is reduced while diffusion into the catalyst bulk still continues , meaning that growth slows and complete coverage is only gradually approached . the dependence of the area fraction on time for the entire grain ( red ; figure 1e ) deviates slightly from that obtained from just the central region ( green ; figure 1e ) , showing a slower initial growth rate and with full coverage approached more slowly . this is attributed to the contribution of process 5 in which grain boundaries serve as pathways for rapid diffusion of carbon away from the catalyst surface . this additional pathway for carbon removal also reduces the supersaturation that develops in these areas , which accounts for the lower nucleation densities observed close to grain boundaries . notably lower nucleation densities are observed close to the grain boundaries toward the top left of the grain compared to those toward the bottom right ( see figure 1b ) , consistent with the dependence of grain boundary diffusion coefficient on the structure of the grain boundary . while consideration of the balance of fluxes between processes 1 , 4 , and 5 is useful in describing how the overall graphene coverage evolves within a platinum grain , i.e. , the collective contribution of many graphene domains , this assumes process 1 to be the rate - limiting step in growth and thus does not take processes 2 and 3 into account , nor does it provide insights into the localized behavior of individual graphene domains such as how their shape and growth rate evolve . in modeling these processes , we consider the edge of a single graphene domain growing on the pt surface where there exists a flux of carbon from the pt surface to the graphene domain , jsg , and vice versa , jgs . this yields a net flux j that feeds the growth of the graphene edge , which by conservation of mass is related to the growth velocity normal to this edge , v:1cg is the concentration of carbon in graphene , and ci is the carbon concentration at the interface between the growing graphene domain and the bare pt surface . considering that attachment of carbon to the graphene edge is impeded by an energy barrier , ga , and that for growth to proceed there must be a driving force , g , for carbon attachment , we obtain the following expression ( see the supporting information for detailed derivation):2 m(, ) is the interfacial mobility and incorporates the energy barrier associated with carbon attachment , which can depend on the angle of the edge relative to the graphene lattice , , and to the orientation of the underlying metal substrate , , as we will discuss further below . (ci ) and are , respectively , the carbon chemical potentials of the pt surface at the edge of the graphene domain and the graphene itself . for the case in which (ci ) , eq 2 reveals that j m(, ) and , therefore , growth is interface - attachment - limited . this situation arises when a large supersaturation exists , such as immediately following nucleation . when m(, ) is small , j is also small , and initially the supersaturation close to the growing edge can be readily replenished , such that ci is maintained near its far - field value , and growth remains interface - attachment - limited . thus , it follows from eq 1 that v remains constant . when m(, ) is large , however , the supersaturation near the growing edge is quickly depleted and can not be replenished fast enough to maintain ci near its far - field value , and thus , (ci ) and local equilibrium is approached . the driving force for growth is reduced , such that , with ci determined by diffusion of carbon across the catalyst surface and growth becoming diffusion - limited . v is therefore now time - dependent , varying as a function of ci . to precisely determine this variation in v , the carbon diffusion field around the graphene domain would need to be calculated ( e.g. , via the phase field method ) ; however , we can nevertheless consider its general trend at different stages of growth . when the graphene domain is small , the concentration gradients around the domain are steep , and as the domain becomes larger , these gradients become smaller , meaning v will decrease with time in the diffusion - controlled limit . in the context of this model , and by measuring the interfacial velocities from the real - time data , we now consider the growth evolution of individual graphene domains in a region of the same pt grain . figure 3a shows how the graphene domains evolve across several time steps ( 160 , 170 , 180 , and 190 s ) for a region within the green square indicated in figure 1a . the growth velocities of facets growing toward the top left ( colored cyan ) are notably slower than those growing toward the bottom right ( colored red ) , as is apparent from the different spacing of facets between isochrones . figure 3b shows a histogram weighted according to facet length , revealing the angular distribution of the facets at a growth time of 170 s. the four major facets are aligned with 0 , 110 , 220 , and 290 and are found to remain dominant even as the graphene domains merge , although the histogram intensities vary somewhat , and thus , the domain morphology is self - similar between time stamps ( see video s1 ) . most significantly , the differences between the facet angles are not multiples of 30 , as might be expected if the graphene domain shapes were primarily determined by zigzag , armchair , or some other intermediate termination of the edges being most energetically favorable . therefore , as the faceted shapes of the graphene domains can not be attributed to the edge termination alone , the role of the underlying substrate must be considered . electron backscatter diffraction ( ebsd ) patterns collected postgrowth reveal the bulk orientation of the underlying pt grain whose surface lies close to the ( 522 ) crystallographic plane . previous leed studies reveal that similarly oriented surfaces remain stable , maintaining their nominal structure when clean and under vacuum conditions and when covered with graphitic carbon following precursor exposure.figure 3c therefore shows a ball model of the corresponding unreconstructed pt surface consisting of ( 111 ) terraces with ( 100)-like steps , with the step edges indicated by dashed red lines and the uphill direction indicated with an arrow . while these ( 111 ) terraces are not expected to reconstruct under the growth conditions used herein , we note that reconstruction of pt(111 ) surfaces has been reported under certain conditions , albeit while maintaining hexagonal symmetry . for other pt grain orientations , faceting , reconstruction of the surface , including changes in symmetry , or both may occur as for pt(100 ) , which is known to undergo a hexagonal reconstruction . ( a ) sequence of overlaid isochrones extracted from sem images taken 160 , 170 , 180 , and 190 s after c2h4 introduction , showing domain edges for a region within the green box marked in figure 1a . the orientations of the facet normals ( defined as pointing out from the graphene domain to the substrate ) are indicated by the line color . ( b ) plot of the angular distribution of the graphene facet normals corresponding to the image taken after 170s in ( a ) . ( c ) ball model of the unreconstructed ( 522 ) surface orientation of the underlying pt grain , determined by ebsd measurements . arrows indicate the six < 111 > directions that lie closest to the plane of the surface ( see figure s2a for other directions ) , with the four colored arrows corresponding to the similarly colored dominant graphene facet directions in ( a ) . red dashed lines highlight the step edges , with the uphill direction indicated by the labeled arrow . consideration of the low - index crystallographic directions of the pt surface reveals a clear relationship with the dominant graphene facet orientations , which all lie normal to < 111 > directions . under kinetic control , the domain shape will be dominated by the slowest growth directions . given the dependence of v on m(, ) and ci exemplified in eqs 1 and 2 , these < 111 > directions are therefore expected to correspond to directions of low interfacial mobility , slow surface diffusion , or both . it is also apparent that the growth of the slower velocity facets toward the top left of the images ( colored cyan ) corresponds with growth in the uphill direction . this slow uphill growth is consistent with various surface science studies of graphene growth on low - index surfaces of single - crystalline substrates , which reveal that the uphill graphene facets can be embedded in the step edge and thus grow by a metal - etching mechanism . the slow velocity of these uphill facets accounts for the trapezoidal shape of the graphene domains , as they will dominate over the facets perpendicular to the two adjacent < 111 > directions ( black arrows in the inset of figure 2c ) . this difference in uphill and downhill growth rate can not be attributed to the delivery of carbon across the catalyst surface , as it persists even as the uphill and downhill facets of different domains approach one another , and an asymmetry in the uphill and downhill diffusivity of carbon species would violate the onsager principle of microscopic reversibility , which holds for transport properties such as diffusion . instead , it is attributable to a larger barrier for attachment to embedded facets , which presumably relates to the need to eject metal atoms from the step for carbon to be incorporated . this confirms that the interfacial mobility , m(, ) , varies between different facets and must be considered a function of both the facet direction relative to the graphene lattice , , and to the substrate orientation , . this can account for the more - diverse ( including nonsymmetric ) domain shapes that are experimentally observed , in contrast to previous models that typically assume an epitaxial alignment between the graphene lattice and substrate orientation and thus predict domain shapes with at least 2-fold rotational symmetry . given the anisotropy in interfacial mobility that we have observed , it is insightful to consider the kinetics of each facet individually . figure 4a shows the growth evolution of a single graphene domain that was grown under conditions of higher growth temperature and lower precursor partial pressure and maintains an irregular hexagonal shape throughout ( see video s2 ) . the slow growth rate and large size of this domain , which results from the growth conditions , gives the necessary spatial and temporal resolution to more precisely consider the growth kinetics of each facet individually . a total of six major facets colored blue , navy , red , orange , green , and cyan ( clockwise from the top facet ) are apparent from early on and persist throughout the ensuing growth period . figure 4b shows the variation in velocity of each of these facets with time based on the analysis of 100 frames that were acquired 9.5 s apart ( see the methods section ) . the velocities of the red and orange facets are seen to be constant throughout the growth period , indicating that their growth is interface - attachment - limited and independent of domain size . conversely , the velocities of the blue and navy facets reduce over time as the particle grows , indicating that the growth of these facets is instead diffusion - limited . the cyan and green facets initially show constant growth velocities , but after some time , their velocities start to reduce , indicating that they transition from interface - attachment - limited to diffusion - limited growth . this clearly highlights that different facets within a single grain can show different rate - limiting steps that may evolve during growth . ( a ) sequence of isochrones ( spaced by 47.5 s ) of the domain edges obtained from sem images of pt ( 25 m ) during c2h4 ( 10 mbar ) exposure at 1000 c , colored according to the orientations of the facet normals ( defined as pointing out from the graphene domain to the substrate ) . ( b ) plot of the facet velocities with time for the six major facet orientations apparent in a. ( c ) ball model showing the unreconstructed ( 635 ) surface orientation of the underlying pt grain , determined by ebsd measurements . arrows indicate the six < 111 > directions that lie closest to the plane of the surface ( see figure s2b for other directions ) with the four colored arrows corresponding to the similarly colored dominant graphene facet directions in ( a ) . red dashed lines highlight the step edges , with the uphill direction indicated by the labeled arrow . the bulk orientation of the underlying pt grain is determined from postgrowth ebsd patterns , revealing that the surface lies close to the ( 635 ) crystallographic plane , which again corresponds to a surface orientation that is not expected to facet or undergo a surface reconstruction either when clean and under vacuum or when covered with graphitic carbon . a sketch of the corresponding unreconstructed surface is therefore shown in figure 4c , with the step edges indicated by red dashed lines . this reveals a close alignment of four of the domain s facets ( green , navy , cyan , and red ) perpendicular to certain < 111 > directions ( similarly colored arrows in the inset of figure 4c ) , similar to that noted earlier for the multiple domain growth of figure 3 . we again observe a lower growth velocity for those facets growing uphill ( green and cyan ) , i.e. , the facets expected to be embedded in pt steps , compared to those growing downhill ( red and navy ) . the navy facet is the fastest growing at the start of growth and thus corresponds to the highest mobility facet . its diffusion - limited behavior throughout growth is consistent with the local carbon supersaturation ahead of it being rapidly depleted . the uphill growing facets ( green and cyan ) show much lower growth velocities at the start of growth and have correspondingly lower mobilities consistent with there being a larger barrier for attachment to embedded graphene facets . they thus remain interface - attachment - limited for a longer time , with the carbon supersaturation developed prior to nucleation feeding their growth , and transition to diffusion - limited growth as this supersaturation becomes depleted . interestingly , the red and orange facets toward the bottom of the domain have higher mobilities but show interface - attachment - limited behavior throughout growth , suggesting that a relatively high local carbon supersaturation is maintained . conversely , the blue facet toward the top of the domain has the lowest growth velocity and yet shows a diffusion - limited growth behavior consistent with the local carbon supersaturation being rather low . while sem does not directly reveal the carbon supersaturation around the graphene domain , lower - magnification sem images ( not shown ) show that no other domains nucleate near the top - left of the domain of interest , while other domains do nucleate toward the bottom - right . this would be consistent with a gradient in carbon supersaturation existing across the pt grain increasing from the top - left to the bottom - right , which may relate to variations in the rates of carbon removal by different grain boundaries , differences in the precursor dissociation rates between adjacent pt grains , or both . alternatively , such differences in local carbon supersaturation could arise due to the shape of the graphene domain itself , as the local carbon supersaturation experienced by a facet is not only influenced by its own growth but also by the growth of neighboring facets . having considered the growth behavior of graphene domains within pt grains , we now focus on the growth across grain boundaries , which is key to forming a continuous graphene layer over a polycrystalline catalyst surface . figure 5 shows two sequences of sem images ( a e and f j ) in which graphene domains that have nucleated on different pt grains grow across pt grain boundaries onto different areas of the same pt grain , whose surface orientation is determined as ( 431 ) by ex situ ebsd measurements . for both sequences , as the initially sharp apexes of each graphene domain ( figure 5a , f ) approach the pt grain boundaries , they are seen to drastically widen in the directions parallel to the grain boundaries ( see , for example , figure 4c , h ) , leading to a change in the facet directions even before the grain boundaries have been crossed . after crossing the grain boundary , the growing domains both adopt new facet orientations , as indicated by the dotted lines in figure 5e , j . notably , the facet orientations adopted by both domains after crossing onto the same pt grain are closely aligned ( compare the red , green , and blue dotted lines ) despite the two domains nucleating on differently oriented pt grains and thus presumably having different crystallographic orientations , . this similarity in graphene domain shapes can not be attributed to the orientation of graphene lattice , i.e. , any epitaxial relationship , but instead indicates that their shapes are predominantly determined by the underlying structure of the catalyst grain on which they both end up . many of the facet normals again appear to align with certain < 111 > directions of the catalyst grains both before and after crossing the grain boundary , as indicated by the arrows colored orange in figure 5a , purple in figure 5f , and green and blue in figure 5e , j . this highlights the importance of the substrate in influencing both interfacial mobility and diffusion of carbon species , with these < 111 > directions again expected to correspond to directions of low mobility , slow diffusion , or both . it is also apparent from figure 5 that apexes of the graphene domains coincide with the positions of the pt grain boundaries , indicating fast diffusion directions parallel to these boundaries . the grain boundaries are clearly visible in all images during growth due to the topographic contrast resulting from their high local curvature . this curvature corresponds to a high density of step edges close to the grain boundary , which run approximately parallel to it , as indicated in figure 5k . the lower barrier to diffusion along the terraces compared to that of crossing step edges leads to anisotropic surface diffusion , which increases as the density of step edges increases ( see figure 5k ) . this increased anisotropy in surface diffusion accounts for the drastic widening of the graphene domains parallel to the grain boundary as it is approached . we note that for pt , which has an fcc crystal structure , no anisotropy in bulk diffusivity is expected , and thus , these observations again highlight the dominant role of surface diffusion in determining domain shape . this higher density of step edges could also lead to a local increase in hydrocarbon dissociation rate ; however , while we do not exclude this , we note that this alone can not account for the faster growth rate parallel to the grain boundary , and in any case , the rapid removal of carbon by grain boundary diffusion is likely to dominate . graphene growth across grain boundaries . ( a e ) sequence of sem images of a graphene domain ( facets indicated with orange dotted lines in ( a ) that nucleated on a pt grain with a ( 512 ) oriented surface , showing its growth across a grain boundary onto a pt grain with a ( 431 ) orientated surface . ( f j ) sequence of sem images of a graphene domain ( facets indicated with purple dotted lines in f ) that nucleated on a pt grain with a ( 632 ) oriented surface , showing its growth across a grain boundary onto a different region of the same ( 431 ) orientated pt grain as identified in ( a ) ( surrounded by cyan dashed lines in ( a ) and ( f ) ) . the red , green , and blue dotted lines in ( e ) and ( j ) indicate similar facet orientations established on this pt grain after the graphene domains have crossed from the differently oriented pt grains where they nucleated . arrows indicate the < 111 > directions of each catalyst grain ( see figure s2c e ) , with the colored arrows corresponding to those < 111 > directions that lie normal to highlighted graphene facets . ( k ) schematic of graphene growth across grain boundaries : ( 1 ) the higher barrier to surface diffusion of carbon across step edges than along terraces leads to an anisotropy in surface diffusion . ( 2 ) as a grain boundary is approached , the much - higher density of step edges increases this anisotropy in surface diffusion . ( 3 ) grain boundary diffusion serves as a rapid pathway for carbon removal from the surface , reducing the local carbon concentration and slowing the growth rate of the graphene domain as the grain boundary is approached . our data reveal that processes 15 identified in figure 2 all play an influential role in determining the final growth outcome during graphene cvd . we therefore outline the following consistent picture of how these processes contribute to the growth behavior on realistic polycrystalline catalyst surfaces observed herein , as summarized in figure 6 : carbon is delivered to the catalyst surface by precursor dissociation , whose rate may vary across differently oriented , or reconstructed catalyst grains . this carbon supply is initially matched by diffusion into the catalyst bulk , giving a notable incubation time during which the catalyst becomes locally filled with carbon close to the surface , and a supersaturation then starts to develop ( figure 6b ) . grain boundaries serve as rapid pathways for the diffusion of carbon away from the catalyst surface , leading to a lower supersaturation developing close to grain boundaries . the carbon supersaturation feeds the nucleation of graphene domains , with higher nucleation densities occurring in regions of higher supersaturation , such as the middle of catalyst grains ( figure 6c ) . initially , the ready supply of carbon from the supersaturation results in growth of the nucleated domains being interface - attachment - limited , with facets growing at constant velocities determined by the attachment barrier ( figure 6d ) . the shape of the graphene domains is thus determined by the interfacial mobility , which is a function of both the orientation of the graphene lattice and the underlying catalyst , with the lowest mobility facets persisting . over time , the local carbon supersaturation in front of a growing facet can become depleted if it is not sufficiently replenished , and growth will then transition toward being diffusion - limited ( figure 6e ) . in this regime , the interfacial mobility will still influence the growth velocity in a given direction ; however , the role of any anisotropy in surface diffusion will be increasingly dominant , and the domain shape can evolve toward having facet normals aligned with slow diffusion directions . this is exemplified close to catalyst grain boundaries where the local curvature of the surface results in a high density of step edges aligned with the grain boundary , which are barriers to surface diffusion , leading to rapid diffusion parallel to the boundary and the dramatic widening of the graphene domain in this direction ( figure 5k ) . as growth proceeds and neighboring graphene domains grow close to one another , their diffusion fields overlap , and the bare catalyst surface available for precursor dissociation reduces , leading to growth of facets becoming dissociation - limited ( figure 6f ) . ( a c ) on the initially clean catalyst surface ( a ) , carbon precursor dissociation delivers a flux of carbon , which is initially matched by diffusion into the catalyst bulk ( as indicated by red arrows ) , giving a notable incubation time ( b ) . as exposure continues , the catalyst becomes locally filled with carbon close to the surface and a supersaturation develops , which feeds the nucleation of graphene domains ( c ) . red arrows illustrate the fluxes of carbon arriving at the catalyst surface and diffusing into the bulk and grain boundaries . rapid grain boundary diffusion ( large red arrows ) lowers the supersaturation and , thus , nucleation density close to grain boundaries . ( d f ) the supersaturation developed prior to nucleation provides a ready supply of carbon that results in domain growth initially being interface - attachment - limited ( d ) , but as this supersaturation is locally depleted in front of a growing facet , surface diffusion becomes rate - limiting ( e ) . as the graphene domains grow further and begin to merge , the catalyst surface available for precursor dissociation diminishes and growth becomes dissociation - limited ( f ) . the colored arrows represent precursor dissociation , surface diffusion , and interface attachment ( processes 13 identified in figure 2 ) , with the red arrows indicating which of these processes is rate - limiting at each stage . importantly for polycrystalline catalysts , the variations in precursor dissociation rate with grain orientation and the rate of carbon removal at different grain boundaries lead to an inhomogeneous carbon distribution across the catalyst surface , meaning that the rate - limiting growth process not only varies with time but can vary across different regions of the catalyst . this is observed even on very local scales , for different graphene domains within a catalyst grain , and even for individual graphene domains where the growth of different facets can show different rate - limiting steps . this has wider implications for the interpretation of growth dynamics , where it can not necessarily be assumed that a certain process will be rate - limiting throughout growth or even across the catalyst surface . therefore , care must be taken when using global metrics ( e.g. , areal growth rate ) to quantify growth dynamics as the contributions of facets with different rate - limiting steps may be convolved , and the underlying origin of the growth behavior may only be apparent from more local measures . the inhomogeneous carbon distribution on the catalyst surface and the dependence of interfacial mobility on graphene lattice and catalyst orientation violates major assumptions of the established jmak equation for crystal growth , including that the nucleation rate must remain constant and homogeneous across the surface and that the growth rate must be constant and isotropic . indeed , our results show that even for selected regions of the catalyst surface , the jmak equation does not adequately describe growth . we therefore suggest that in modeling cvd graphene growth on polycrystalline catalysts , orientation - dependent precursor dissociation , grain boundary diffusion , and the different rate - limiting steps that can exist during growth must all be taken into account . while our results herein relate to polycrystalline pt , which has a notable carbon solubility ( 1.1 atom % at 1000 c ) at the growth temperatures used , polycrystalline cu remains the most widely used catalyst for graphene cvd and has a much lower bulk solubility ( 0.00070.0280 atom % at 1000 c ) . for both catalysts , isothermal graphene growth is observed , with the supply of carbon by precursor dissociation filling the catalyst with carbon close to its surface until a supersaturation develops that feeds graphene nucleation . the associated incubation time will depend on the catalyst s carbon solubility , the rate of carbon supply by precursor dissociation , and the rate of carbon removal into the catalyst , determined by its permeability ( the product of solubility and diffusivity ) . despite the low solubility of carbon in cu , recent literature suggests a relatively large carbon diffusivity , and thus , the permeability and therefore the rate of carbon removal from the surface of cu may not be so drastically different from that of pt . nevertheless , for all catalyst surfaces , a carbon supersaturation will develop prior to graphene nucleation , which feeds subsequent growth . the surface carbon concentration close to a graphene facet will therefore decrease with time as the facet grows , leading to time - dependent interfacial velocities and , thus , violation of a key assumption of the jmak equation . for cu in particular , the numerous observations of nonisotropic graphene domain shapes further highlights that the jmak equation is inappropriate for describing growth . instead , we emphasize that in modeling growth on cu , grain boundary and surface diffusion are expected to play important roles regardless of the precise extent of carbon removal through bulk diffusion , and thus , their influence on surface carbon distribution should be carefully considered . in conclusion , we have shown that for polycrystalline catalyst foils under realistic graphene cvd conditions , the rate - limiting steps in growth can vary throughout the process and across different regions of the catalyst surface . the dependence of precursor dissociation on catalyst grain orientation and the different diffusion pathways ( surface , grain boundary , and bulk ) that exist on polycrystalline samples are found to play key roles in the observed growth behavior , affecting the distribution of carbon species across the surface and , thus , the rate - limiting growth process . the supersaturation developed prior to graphene domain nucleation feeds an initial interface - attachment - limited growth period , which transitions to diffusion - limited growth as this supersaturation is depleted . as the domains begin to approach one another and the available bare catalyst diminishes , precursor dissociation becomes limiting . when growth is interface - attachment - limited , the graphene domain shape is defined by the interfacial mobility , which can vary as a function of both graphene lattice orientation and the catalyst grain orientation . in diffusion - limited growth , surface diffusion plays a more - dominant role in determining domain shape and is influenced by the catalyst surface morphology , including the presence of step edges and grain boundaries . this highlights that controlling the catalyst texture and surface morphology is key to controlling the domain structure of the graphene film produced . our observations and analysis provide new insights into how the structure of cvd graphene films is intimately linked to that of the underlying catalyst , and the concepts developed can serve as a general framework for understanding the growth of 2d materials on polycrystalline transition metal catalysts . in situ sem experiments are performed using a commercial environmental sem ( fei quantum 200 , base pressure of 10 mbar ) with a custom ir laser heating stage and with gas supplied through a leak valve . temperatures were measured with a type - k thermocouple spot - welded to the sample and have an estimated uncertainty of 50 c . samples were imaged using an everhart thornley detector and an acceleration voltage of 5.0 kv during pretreatment and growth , while the cvd atmosphere was monitored by a mass spectrometer ( pfeiffer omnistar ) . each full - image frame is acquired by raster scanning from top left to bottom right and takes 9.5 s to acquire . the image sequences analyzed in figures 24 correspond to smaller regions taken from full - image frames and thus have scan times of 1 , 2 , and 0.5 s , respectively . low - magnification images of the samples taken at several points during each growth experiment show that regions around the imaged area have similar extents of growth , indicating that the contribution of electron - beam induced effects does not overwhelm the dominant cvd growth behavior . the assignment of single - layer graphene based on in situ sem contrast is confirmed by extensive growth calibrations in which ex situ sem ( zeiss sigmavp , 12 kv , in - lens detector ) images of the as - grown graphene on pt are correlated with optical microscopy and raman spectroscopy ( renishaw raman invia microscope , 532 nm excitation ; see figure s3 ) measurements following transfer to sio2 ( 300 nm)/si substrates using an electrolysis - based bubbling technique , as previously described elsewhere . ebsd measurements were performed ex situ in a fei helios dual - beam microscope ( 515 kv , current of 5.5 na , working distance of 5.06.5 mm , and sample tilt of 60 with respect to the electron beam ) with an oxford instruments hkl ebsd nordlys ii detector in spot mode using channel 5 software . for quantitative analysis , the sem images were first binarized with an appropriate threshold . domain areas were determined by summing over those pixels belonging to the graphene domains . a pair of copies were made of each binary image , and these were then stacked upon one another to create a pseudo-3d structure . the height of this structure measured one unit , while the length and width were given by the image dimensions . then , the 3d structure was meshed ( represented by a sequence of triangles and vertices ) . to remove any staircasing artifacts , the mesh was smoothed by a minimal number of iterations of mean curvature flow . the normal of a given mesh triangle was given by the curl of its edge vectors , and its velocity was calculated using the nearest - neighbor approach . all codes were written in matlab r2015b and executed on a mac pro 3.5 ghz , 12 core intel xeon system with 64 gb of ram .

the dynamics of graphene growth on polycrystalline pt foils during chemical vapor deposition ( cvd ) are investigated using in situ scanning electron microscopy and complementary structural characterization of the catalyst with electron backscatter diffraction . a general growth model is outlined that considers precursor dissociation , mass transport , and attachment to the edge of a growing domain . we thereby analyze graphene growth dynamics at different length scales and reveal that the rate - limiting step varies throughout the process and across different regions of the catalyst surface , including different facets of an individual graphene domain . the facets that define the domain shapes lie normal to slow growth directions , which are determined by the interfacial mobility when attachment to domain edges is rate - limiting , as well as anisotropy in surface diffusion as diffusion becomes rate - limiting . our observations and analysis thus reveal that the structure of cvd graphene films is intimately linked to that of the underlying polycrystalline catalyst , with both interfacial mobility and diffusional anisotropy depending on the presence of step edges and grain boundaries . the growth model developed serves as a general framework for understanding and optimizing the growth of 2d materials on polycrystalline catalysts .

the immunoproteasome is a large proteolytic machine derived from the constitutive proteasome [ 1 , 2 ] and plays a critical role in homeostasis and immunity . the constitutive proteasome is expressed ubiquitously in the body , where it degrades ubiquitinated proteins including transcriptional factors and proteins required for cell cycle progression [ 3 , 4 ] . since the primary role of the immunoproteasome is to process antigens for presentation on major histocompatibility complex ( mhc ) class i molecules to cd8 t lymphocytes , the immunoproteasome degrades various proteins , including viral proteins . therefore , the immunoproteasome plays an important role during viral infection [ 6 , 7 ] . the expression of the immunoproteasome is induced by interferon- ( ifn- ) and tumor necrosis factor- ( tnf- ) under inflammatory conditions , such as infections , and autoimmune diseases when inflammatory cytokines are present . accordingly interestingly , various roles for the immunoproteasome in nonimmune cells have been reported recently [ 1416 ] , suggesting that there could still be unknown roles for the immunoproteasome . this review summarizes the roles of the immunoproteasome and recent efforts to develop novel therapeutic approaches by regulating immunoproteasome activity . the immunoproteasome is a large proteolytic machinery derived from the constitutive proteasome ( also known as the 26s proteasome ) and is expressed abundantly in immune cells , such as antigen - presenting cells [ 1719 ] . the constitutive proteasome is expressed in the cytosol and nucleus of most cells , where it degrades ubiquitinated proteins to maintain cell viability and homeostasis [ 4 , 20 ] . for example , the constitutive proteasome degrades long - lived proteins , including proteins used for cell cycle progression and gene transcription . it is a large barrel - shaped protein complex [ 21 , 22 ] composed of a catalytic 20s core proteasome and two 19s regulatory complex components located at both ends of the 20s core proteasome ( figure 1 , left panel ) . the 20s core proteasome has two pairs of outer rings consisting of seven subunits and two pairs of inner rings consisting of seven subunits . the three subunits ( 1 , 2 , and 5 ) have proteolytic activities , including caspase - like activity for 1 , trypsin - like activity for 2 , and chymotrypsin - like activity for 5 . the 20s core proteasome is usually capped at both ends by the 19s regulatory complex [ 21 , 22 ] . the 19s regulatory complex recognizes ubiquitinated proteins and transfers them into the core of the proteasome where they are degraded by proteolysis . when a cell is exposed to inflammatory stimuli , such as ifn- and tnf- , five of the proteasome subunits are substituted with more efficient subunits : 1 is replaced with i1 ( also known as large multifunctional peptidase 2 ( lmp2 ) or proteasome subunit beta type 9 ( psmb9 ) ) , 2 is replaced with i2 ( also known as lmp10 , multicatalytic endopeptidase complex - like-1 ( mecl-1 ) , or psmb10 ) , 5 is replaced with i5 ( also known as lmp7 or psmb8 ) , and the 19s regulatory complex is replaced with the 11s regulator composed of proteasome activator ( pa28 ) and pa28 ( figure 1 , right panel and table 1 ) [ 2429 ] . this modified proteasome is called the immunoproteasome and it performs its proteolytic functions more efficiently than the constitutive proteasome . for example , it degrades viral proteins for antigen presentation and also processes ubiquitinated proteins , as does the constitutive proteasome . expression of the immunoproteasome subunits can be induced in nonimmune cells stimulated by ifn- [ 13 , 16 , 31 ] . therefore , the immunoproteasome plays multiple roles , and the function of the immunoproteasome is not restricted to the immune system . the best characterized role of the immunoproteasome is the processing of proteins in order to present antigenic peptides on mhc class i molecules ( figure 2 ) . deficiency of the immunoproteasome in mice reduces cd8 t cell activation in hepatitis b virus ( hbv ) infection , lymphocytic choriomeningitis virus ( lcmv ) infection , and influenza virus infection [ 7 , 33 , 34 ] , although not in coxsackie virus b3 ( cvb3 ) infection . for example , lmp2 deficiency reduced inflammatory cytokine ( il-1 , il-6 , and tnf- ) production during influenza viral infection . inflammatory cytokines , such as type i and type ii ifns and tnf- , induce the expression of the subunits that assemble into the immunoproteasome [ 37 , 38 ] . hepatitis c viral ( hcv ) infection or poly(i : c)-stimulation ( mimicking viral infection ) induces the expression of type i ifn ( ifn- ) and the immunoproteasome subunits in hepatocytes . suppression of ifn- inhibits expression of the immunoproteasome , and type i ifn ( ifn- ) treatment induces immunoproteasome expression in hepatocytes . furthermore , keller et al . showed that murine gammaherpesvirus-68 ( mhv-68 ) infection induced expression of the immunoproteasome subunits in alveolar macrophages in the lung . thus , viral infection , ifn production , and expression of the immunoproteasome are strongly linked . it should be noted that immunity against viral infections is not completely dependent on the immunoproteasome because there are some antiviral immune responses independent of the immunoproteasome . in fact , mice lacking all of the immunoproteasome activities , generated by treating lmp2/lmp10 double - deficient mice with a lmp7-selective inhibitor , were still able to induce ifn--producing cytotoxic cd8 t cells upon lcmv infection . the immunoproteasome is involved in the pathogenesis of numerous inflammatory diseases , such as autoimmune diseases , by influencing t cell polarization , signaling through the nuclear factor-b ( nf-b ) pathway , and the production of inflammatory cytokines by macrophage [ 4045 ] . for example , kalim et al . reported that lmp7 deficiency suppressed the differentiation of nave cd4 t cells to th1 and th17 cells and instead promoted their differentiation to regulatory t cells ( figure 2 ) . reported that upregulated lmp7 expression in mouse macrophages due to lps stimulation was suppressed by treatment with immunoproteasome inhibitors , including an lmp7 inhibitor ( figure 2 ) . the immunoproteasome is essential for processing antigenic epitopes that are presented on mhc class i molecules to activate cd8 t lymphocytes . the immunoproteasome is also involved in the regulation of nf-b , which is essential for the transcription of many genes that encode inflammatory cytokines . therefore , the activity of the immunoproteasome is essential in various inflammatory scenarios that result in pathological conditions . thus , attempts were made to inhibit the immunoproteasome to identify potential treatments for inflammatory diseases . onx-0914 ( also known as pr-957 ) is a selective lmp7 inhibitor , which has been used as a treatment for autoimmune diseases in animal models . reported that onx-0914 attenuated experimental arthritis by blocking inflammatory cytokine expression . as we mentioned , this lmp7 inhibitor blocked antigen presentation by mhc class i , suppressed the proliferation and activation of cd8 t cells and th17 cells , and lowered the production of inflammatory cytokines . basler et al . showed that treatment with onx-0914 significantly attenuated the clinical symptoms of experimental colitis and encephalomyelitis in mice [ 11 , 12 ] . expression of the immunoproteasome subunits ( lmp2 , lmp7 , and lmp10 ) was upregulated in colitis lesions , which was induced in mice deficient in each of the immunoproteasome subunits . colon lesions were significantly ameliorated in each of the deficient mouse strains compared to wild - type controls , and the amelioration was associated with suppressed inflammatory cytokine expression ( tnf- , il-1 , ifn- , il-6 , il-23 , and il17 ) . then , they examined the effect of onx-0914 in experimental colitis and showed that treatment with onx-0914 significantly improved colitis lesions . although deficiency of the individual immunoproteasome subunits ( i.e. , lmp2 , lmp7 , or mecl-1 ) did not improve disease in a mouse model of experimental encephalomyelitis , treatment with onx-0914 significantly attenuated disease progression and prevented a second exacerbation . the authors mentioned that this discrepancy between immunoproteasome subunit - deficient mice and inhibitor - treated mice could be explained by the fact that endogenous chymotrypsin - like activity in monocytic cells contributes to pathogenesis and onx-0914 inhibits chymotrypsin - like activity . deficiency of a single subunit is not able to suppress all chymotrypsin - like activity in the immunoproteasome because both lmp2 and lmp7 have chymotrypsin - like activity [ 49 , 50 ] . overall , these studies suggest that onx-0914 has potential for treating autoimmune diseases . the immunoproteasome is involved in the pathogenesis of chronic thyroiditis . transgenic mice that express ifn- specifically in the thyroid develop chronic thyroiditis and hypothyroidism [ 51 , 52 ] . in this mouse model , lmp2 deficiency significantly improved inflammatory thyroid morphology and function . reported that treatment with onx-0914 improved th1-type autoimmune thyroid disease ( hashimoto 's thyroiditis ) , but not th2-type autoimmune thyroid disease ( graves ' disease ) , using mouse models . treatment with onx-0914 suppressed ifn- and il-17 expression in the thyroid , which supports basler 's results . lmp7 deficiency or treatment with onx-0914 ( a selective inhibitor of lmp7 ) seems to suppress inflammatory diseases with th1 and th17 cell - mediated inflammation . one report showed that lmp7 deficiency reduced th2 responses in an asthma model . lmp7 deficiency suppressed expression of the th2 cytokines il-4 , il-5 , and il-13 and infiltration of immune cells into the lung . because either th1 or th2 polarization is normally involved in the pathogenesis of many inflammatory diseases , it is necessary to know how the immunoproteasome influences t cell polarization in various inflammatory disease contexts in order to translate these findings to clinical studies . they found that inhibiting the immunoproteasome by short hairpin rna suppressed muscle differentiation using the mouse myoblast cell line c2c12 and human skeletal muscle myoblasts . proapoptotic proteins and apoptotic cells were upregulated by the treatment , which indicates that the immunoproteasome also regulates the degradation of proteins associated with apoptosis , as does the constitutive proteasome . zu et al . reported that the immunoproteasome regulated cardiac muscle mass in diabetic mice . streptozotocin ( stz ) is commonly used to induce diabetic conditions in the experimental animal model . they showed that lmp2 expression was decreased in the hearts of stz - injected mice . on the other hand , the expression of phosphatase and tensin homologue deleted on chromosome ten ( pten ) was upregulated , which impaired muscle regeneration . lmp2 deficiency itself also leads to loss of cardiac muscle mass , which decreased cardiac function . lmp7 has been associated with human disease , although no association has been found with the other immunoproteasome subunits ( lmp2 , lmp10 , pa28 , and pa28 ) . lmp7 mutation causes disease with autoinflammation and lipodystrophy [ 15 , 5759 ] , and the number of cases is increasing [ 60 , 61 ] . as we described above , lmp7 plays a critical role in the immune system and is involved in cytokine expression . lmp7 mutation in humans causes abnormalities in cytokine expression , as listed in table 2 . showed that il-6 expression was significantly higher in the skin lesions or sera of patients with lmp7 mutation , similar to other reports [ 57 , 60 ] . reduction of lmp7 expression by sirna suppressed adipogenesis in 3t3-l1 cells ( figure 2 ) . lmp7 might be involved in lipid metabolic disorders because lmp7 is also associated with insulin - dependent diabetes mellitus , and inflammation is involved in the pathophysiology of metabolic diseases [ 63 , 64 ] . to date , the role of the immunoproteasome in metabolic disorders and the endocrine system is poorly understood . we showed previously that overexpression of lmp2 was involved in the pathogenesis of chronic thyroid inflammation and hypothyroidism as described above . in that study , we found that lmp2 was expressed in oxyphilic thyrocytes in humans and mice , and deletion of lmp2 in mice dramatically improved thyroid function and thyrocyte morphology . in fact , keller et al . reported that immunoproteasome expression was detected in the lung parenchymal cells , for example , alveolar type i and ii cells , fibroblasts , and bronchial epithelial cells at basal levels . it is still not clear why those cells in the lung constitutively express lmp7 without infection or inflammation . considering the involvement of the immunoproteasome in cell differentiation and function , the immunoproteasome is important in nonimmune cells , too . expression of the immunoproteasome in nonimmune cells during normal conditions has been found , although its role is not fully understood . therefore , the role of the immunoproteasome in nonimmune cells should be addressed using mice deficient in the various immunoproteasome subunits , by knockdown of the immunoproteasome genes and with immunoproteasome inhibitors . as shown in the previous section , onx-0914 specifically inhibits lmp7 ( i5 ) , and it has been used in animal models and in vitro studies of inflammatory diseases [ 1012 , 46 , 53 , 65 ] . although selective inhibitors for lmp2 were not available when we reported that lmp2 deficiency suppressed thyroid inflammation and improved thyroid function , we expect that such inhibitors will be used to treat patients with chronic thyroiditis in the future . more studies are needed to analyze the mechanisms underlying the action of lmp2 on thyroid function . recently , immunoproteasome inhibitors have been investigated for application in clinical settings to treat hematopoietic neoplasms . bortezomib is an inhibitor of 5 , a component of the constitutive proteasome , and has been used to treat multiple myeloma and mantle cell lymphoma . since the proteasome is responsible for the degradation of proteins involved in cell cycle progression , inhibition of proteasome function by bortezomib results in an accumulation of undigested proteins that leads to cell death . onx-0912 is an inhibitor of both lmp7 ( i5 ) and 5 and is effective for bortezomib - resistant myelomas [ 66 , 67 ] . uk-101 and ipsi-001 selectively inhibit lmp2 and exhibit antitumor activity against malignant myelomas [ 68 , 69 ] . carfilzomib is effective for the treatment of myelomas and small cell lung cancers [ 70 , 71 ] . ( i5 ) , lmp2 ( i1 ) , and 5 have chymotrypsin - like activity . since carfilzomib is a potent inhibitor of chymotrypsin - like activity , it appears likely that chymotrypsin - like activity is important for maintaining the proliferation of hematologic tumor cells . precise differences in the chymotrypsin - like activity among the three subunits should be defined in order to understand how malignant cells acquire resistance to those proteasome inhibitors . regulating immunoproteasome expression and activity is a powerful tool for controlling cell function , which includes cell metabolism , differentiation , and immune regulation . so far , inhibitors of the immunoproteasome are widely available and applicable to the treatment of many inflammatory diseases and hematopoietic malignancies . in the near future , colitis and rheumatoid arthritis could be candidates for developing new treatments that target the immunoproteasome . in addition , metabolic diseases could provide additional candidates because the immunoproteasome is involved in both adipogenesis and inflammation of adipose tissue . as described in this review , most basic studies on the roles of the immunoproteasome in disease models have been achieved using mice ( summarized in figure 2 ) . since immunoproteasome enzymatic activity differs between species , findings from such basic studies

the immunoproteasome is a highly efficient proteolytic machinery derived from the constitutive proteasome and is abundantly expressed in immune cells . the immunoproteasome plays a critical role in the immune system because it degrades intracellular proteins , for example , those of viral origin , into small proteins . they are further digested into short peptides to be presented by major histocompatibility complex ( mhc ) class i molecules . in addition , the immunoproteasome influences inflammatory disease pathogenesis through its ability to regulate t cell polarization . the immunoproteasome is also expressed in nonimmune cell types during inflammation or neoplastic transformation , supporting a role in the pathogenesis of autoimmune diseases and neoplasms . following the success of inhibitors of the constitutive proteasome , which is now an established treatment modality for multiple myeloma , compounds that selectively inhibit the immunoproteasome are currently under active investigation . this paper will review the functions of the immunoproteasome , highlighting areas where novel pharmacological treatments that regulate immunoproteasome activity could be developed .

alpha-1 acid glycoprotein ( agp ; also known as orosomucoid ) is a 44 kda , heavily glycosylated protein synthesized primarily by hepatocytes and secreted into the plasma , where it circulates under normal conditions in humans at 830 m [ 1 , 2 ] . during the acute phase response , circulating levels of human agp are elevated over baseline values by 2- to 7-fold ; in rats , rabbits , and mice , the elevation of either circulating agp or hepatic agp mrna ranges from 10- to 200-fold [ 48 ] . the biological function of agp is unclear . suggested roles for this plasma protein include the modulation of the immune response ; the stabilization of plasminogen activator inhibitor-1 ( pai-1 ) functional activity ; and the maintenance of normal capillary permeability and selectivity . evidence from perfusion or cell culture systems supports a role for agp in maintaining capillary permselectivity . perfusion studies using isolated rat skeletal muscle or kidneys or frog mesenteric preparations initially showed that the rate of negatively charged protein loss from the perfusate ( e.g. , albumin or lactalbumin ) was reduced in the presence of agp . these findings lead to the hypothesis that agp binds to the capillary vessel wall and increases its negative charge . agp binding to endothelial cells in culture has also been demonstrated [ 1517 ] . the protein has furthermore been suggested to form part of the glycocalyx , a dynamic endothelial surface layer of glycosaminoglycans , proteoglycans , and adsorbed plasma proteins deduced by indirect examination , for instance as a red cell exclusion zone in intravital microscopy . most recently , transfused human agp was shown to exert renal effects by restoring normal glomerular filtration rates in rats rendered nephrotic by puromycin aminoglycoside administration . it has long been known that enzymatic removal of terminal sialic acid residues , and exposure of terminal galactose moieties , converts agp into a high - affinity ligand of the asialoglycoprotein receptor , leading to its rapid removal from the mammalian circulation [ 2023 ] . relatively few studies , however , have examined the in vivo clearance of the unmodified plasma glycoprotein [ 2426 ] , and none have examined the consequences of complete removal of glycans on the clearance and catabolism of agp . since agp is a relatively small protein of approximately 43 kda , with 45% of its mass being contributed by its carbohydrates , we hypothesized that removal of its sugars would render it filterable in the kidneys and accelerate its clearance from the circulation . in the current study , we tested this hypothesis and in addition investigated the consequences to agp clearance of systemic disruption of the glycocalyx . affi - gel blue chromatography resin and bio - gel ht hydroxyapatite resin were purchased from bio - rad laboratories ( hercules , ca ) . concanavalin a ( con a ) , sepharose 4b , and t4 dna ligase were from ge healthcare ( piscataway , nj ) . reverse transcription reagents rneasy and sensiscript rt kits and heat - stable hotstartaq dna polymerase were from qiagen ( chatsworth , ca ) . neuraminidase , peptide n - glycosidase : f ( pngase f ) , and phusion heat - stable dna polymerase were purchased from new england biolabs ( ipswich , ma ) . streptomyces hyaluronidase , commercial agp , goat antihuman agp antibodies , and alkaline phosphatase conjugated anti - goat igg were from sigma ( st . louis , mo ) . a glycan differentiation kit was purchased from roche applied science ( mannheim , germany ) . biotinylated hyaluronic acid binding protein was from associates of cape cod ( east falmouth , ma ) . alexa fluor 488 labeling kits , streptavidin conjugated alexa fluor 647 , alexa fluor 488-griffonia simplicifolia lectin-1b4 ( gs-1b4 ) , pichia pastoris strain x-33 and zeocin , thermalace high fidelity dna polymerase , the pcdna 3.1 vector , and e. coli dh5 cells were all purchased from invitrogen corporation ( carlsbad , ca ) . restriction and dna modification enzymes were supplied by either fermentas life sciences ( burlington , on ) , or fisher scientific ( unionville , on ) . hepg2 ( human hepatocellular carcinoma ) cells were obtained from the american type culture collection ( manassas , va ) . experiments involving animals were carried out under the terms of animal utilization protocols approved by the animal research ethics board of the faculty of health sciences of mcmaster university . rabbits ( new zealand white , 2.1 to 2.8 kg , male and female , specific pathogen - free ) were purchased from charles river ( st . constant , quebec ) , as were c57 black 6 ( c57bl/6 ) male mice of 2030 g body weight . agp was purified exactly as described by herv et al . from citrated plasma obtained from healthy volunteer donors , collected with informed consent using a protocol approved by the hamilton health sciences research ethics board . the plasma pool was combined , using equal volumes from each donor , aliquoted and frozen at 80c until use ; the same five donors ( 4 caucasian , 1 black ) were used for all preparations employed in this study . the terminal sialic acid chains of purified agp were removed by treatment with clostridium perfringens neuraminidase , using 5 units of enzyme per g of agp in 50 mm sodium citrate , ph 6.0 , overnight at 37c . entire n - linked glycan chains were removed from agp using peptide : n - glycosidase f ( pngase f ) . for electrophoretic use , agp ( 0.02 mg ) was denatured by boiling in 0.5% sds , 80 mm dithiothreitol for ten minutes , then reacted with 2500 units pngase f at 37 for one hour , after dilution into 1% np-40 , 50 mm sodium phosphate ph 7.5 . for radiolabeling and in vivo use , 0.2 mg agp in 5.0 m urea was incubated for one hour at room temperature , then diluted 1 : 1 with 10,000 units of pngase f in 0.1 m sodium phosphate ph 7.5 , and incubated overnight at 37c , prior to dialysis against phosphate buffered saline . a human agp cdna was obtained by reverse transcription / pcr of hepg2 cell mrna , employing rneasy and sensiscript rt kits ( qiagen ) and oligonucleotide primers ml13047 ( 5-gaatggatcc aaggtgactg caccctgc-3 ) and ml13048 ( 5-atcgaattcg gtacacatgt cgggttgg-3 ) . the latter plasmid was amplified using phusion polymerase under conditions recommended by the manufacturer ( new england biolabs ) , and sense oligonucleotide primer 07 - 1495 ( 5 acgtctcgaga aaagacagat cccattgtgt gccaacc-3 ) and antisense oligonucleotide primer 07 - 1493 ( 5 cagtgaattc ctagtgatgg tgatgggattccccctcctc ctgttt-3 ) . the resulting pcr product was restricted with xhoi and ecori and inserted between these sites in yeast expression vector ppicz9ssamp to form ppicz9ssagph6 . this plasmid was modified by pcr in site - directed mutagenesis reactions that altered 5 asn ( n ) codons 15 , 38 , 54 , 75 , and 85 to gln ( q ) , forming ppicz9ssagp - n(5)q - h6 . all dna constructs were verified by dna sequencing ( mobix , mcmaster university ) prior to expression and utilization of recombinant agp . plasmids ppicz9ssagph6 and ppicz9ssagp - n(5)q - h6 were separately used to transform pichia pastoris x33 yeast to zeocin resistance , and resulting cell lines were cultured and induced with methanol ; conditioned media was neutralized and secreted recombinant proteins were purified by nickel affinity chromatography , as previously described . purified plasma - derived , enzymatically treated , or recombinant forms of agp were iodinated using the iodogen method and injected into the marginal ear vein of rabbits , as previously described . at timed intervals ( 0.083 , 0.5 , 1 , 2 , 4 , 6 , 8 , 24 , 48 , 72 , 96 , and 168 hours or until the recovered radioactivity declined lower than 0.1% of the injected dose ) blood samples were taken from the marginal vein of the other ear , centrifuged to obtain plasma , and the trichloroacetic acid - precipitable radioactivity was determined by counting . for each rabbit , semilogarithmic substrate disposition graphs of residual plasma radioactivity against time were generated , and analyzed using pk solutions version 2.0 software ( summit research services , montrose , co , usa ) . briefly , the software was employed to fit the data using noncompartmental ( area ) methods based on the trapezoid rule . for this purpose , radioactive doses were converted into pmoles using the measured specific activity of radiolabeling , and molecular weights of 43 , 33 , and 23 kda for pdagp , pngase - agp , and ragp n(5)q , respectively . the specific activity of radiolabeling was similar for all three proteins , ranging from 3.94 to 7.05 x 10cpm/g . in some experiments , the tissue distribution of radioactivity 30 minutes after intravenous injection of radioiodinated agp or derivatives was measured as described ; briefly , organs were excised , rinsed in ice cold saline , weighed , and either a portion or the entire organ , depending on its size , was counted . results were expressed as a fraction of the total radioactive dose injected . in other experiments , either 4.0 g of -methyl - d - mannopyranoside ( -methyl - mannoside ) in 20 ml sterile saline , or 0.54 g of d - galactose in 10 ml sterile saline , was injected intraperitoneally immediately prior to intravenous injection of radioiodinated protein in an effort to block glycan - dependent uptake via hepatic receptors . clearance of radiolabeled human agp in c57bl/6 mice was followed as previously described [ 30 , 34 ] by measuring acid - precipitable plasma radioactivity in plasma samples . plasma radioactivity was reported as percentage of the injected dose , using as a dilution factor the plasma volume divided by the sample volume . plasma volume was calculated as the product of the weight of the mouse in grams x 0.078 ml blood volume per gram body weight x ( 1-the hematocrit ) , using a hematocrit of 0.44 ( us nih reference values from http://oacu.od.nih.gov/arac/ ) . in some experiments louis , mo , usa ) by intravenous injection of 47 u ( to deliver 30 u / ml estimated plasma volume ) of the enzyme in 0.1 ml sterile saline coinjected with iodinated human agp . anesthetized mice ( 2030 g body weight ) were cannulated via the right jugular vein , the abdomen opened , and a lobe of the liver placed on the heated plexiglas stage of a leica dmi 6000 b confocal microscope . the liver microvasculature was photographed using a hamamatsu c9100 - 12 back - thinned emccd camera attached to a leica dmi 6000 b confocal microscope using the 63x objective . either 15 g biotinylated bovine hyaluronic acid binding protein ( bhabp ) complexed to streptavidin - conjugated alexa fluor 647 ( associates of cape cod , falmouth , ma , usa ) or 40 g griffonia simplicifolia 1b4 ( gs-1b4 , ) lectin directly conjugated to alexa fluor 488 ( invitrogen , carlsbad , ca , usa ) baseline images were obtained over the next 15 minutes , then hyaluronidase was injected as described above , and images were acquired for an additional hour . in some experiments purified human agp ( 165 mg / kg body weight ) was injected after bhabp : streptavidin alexa fluor 647 administration and baseline image capture and 15 minutes prior to hyaluronidase treatment . the ability of various forms of agp to react with digoxigenin - labeled lectins was assessed following sds - page and electrical transfer of proteins to nitrocellulose ; blots were analyzed using a dig glycan differentiation kit as suggested by the manufacturer ( roche diagnostics , mississauga , on , canada ) . statistical analysis was performed using graphpad instat version 3.06 software ( graphpad software inc , san diego , ca ) , using one - way analysis of variance ( anova ) for multiple comparisons and student 's t - tests for paired comparisons . nonparametric methods were employed if data did not pass tests of normality and equivalence of standard deviation ; further details are provided in figures 16 and table 1 . the in vivo clearance of agp treated with neuraminidase to remove the terminal sialic acid residues has been widely investigated , to a greater extent than that of the unmodified protein [ 21 , 24 , 35 , 36 ] . as shown in figure 1(a ) , neuraminidase treatment increased the electrophoretic mobility of agp and eliminated its recognition by sambucus nigra agglutinin ( sna ) , which binds to sialic acid linked to galactose . five minutes after injection , 45.5 4.0% of the injected agp was detected in plasma , compared to 0.77 0.36% of neuraminidase - treated agp , a difference of 82-fold . by fifteen minutes , the proportion of agp remaining in the circulation was unchanged for native agp ( 42.0 5.5% ) but had further declined to 0.25 0.5% in the case of the neuraminidase - treated form ( figure 1(b ) ) . enzymatic and recombinant dna methods were used to reduce or eliminate the number of n - linked glycan chains attached to agp . denaturation of agp was required to obtain any significant reduction in its extent of glycosylation using pngase f , which removes glycan chains in their entirety at their point of attachment to asparagine residues on the polypeptide backbone of agp . as shown in figure 2 , transient denaturation with urea allowed the partial removal of 05 glycans per agp molecule ; full denaturation with sds removed all glycans . that the most rapidly migrating pngase f reaction product of agp was fully deglycosylated was indicated by its comigration both with sds and pngase f - treated agp , and with a form of recombinant agp mutated to abrogate n - linked glycosylation ( ragp n(5)q ) ( figure 1(a ) ) , and by the loss of recognition of all of these putatively deglycosylated species with sna lectin ( data not shown ) . in keeping with its intermediate state of deglycosylation , pngase f - treated agp exhibited more rapid clearance in rabbits than unmodified agp , but was retained in the circulation to a greater extent than ragp n(5)q ; these differences were apparent as early as 30 minutes after injection ( figure 2(b ) ) . electrophoresis and autoradiography of postinjection plasma samples revealed that the most rapidly migrating deglycosylated forms of agp ( e.g. , 1 versus 2 in figure 3(b ) ) were lost from plasma more rapidly than less rapidly migrating forms ( e.g. , 3 or 4 in figure 3(b ) ) . in terms of organ distribution , both pngase f - treated agp and ragp n(5)q were found in the kidney to a greater extent than native agp , the effect being more pronounced for the fully deglycosylated form ( figure 3(d ) ) . the differences in clearance of the three forms of agp were apparent not only on substrate disposition versus time graphs , such as those shown in figure 2 , in which the proteins were compared on the basis of residual radioactivity , but also following pharmacokinetic analysis , in which the proteins were compared based upon their dose in pmoles and their residual plasma concentration in pmol / ml ( table 1 ) . pngase - agp and ragp n(5)q exhibited decreased areas under the clearance curve , decreased mean retention times , and decreased half - lives , but the decreases were only statistically significant for ragp n(5)q . the volumes of distribution and clearance rates were significantly increased for both altered forms ( e.g. , mean cl was increased 4.9-fold for pngase - agp and 45-fold for ragp n(5)q , p < 0.001 versus pdagp in both cases ) . the disappearance of injected radiolabeled ragp - wt from the rabbit circulation , which like ragp - n(5)q , was c - terminally hexahistidinylated to facilitate purification , but which unlike the mutated agp , retained all five sites of n - linked glycosylation , was also examined . as shown in figure 4(a ) , ragp - wt was much more rapidly removed from the circulation than its mutant ragp - n(5)q counterpart . thirty minutes after injection of equal doses of either radiolabeled ragp - wt or ragp n(5)q , the residual plasma concentration of the latter exceeded the former by more than 10-fold ( figure 4(a ) ; 2.2 0.5% versus 26 3% , p < 0.0001 by unpaired t - test , welch corrected ) . coadministration of -methylmannoside , but not galactose , significantly reduced the loss of ragp - wt from the circulation ( to 6 1% , p < 0.05 by kruskal - wallis test ) ; neither sugar significantly altered the concentration of ragp n(5)q in the circulation , suggesting that the yeast glycans contained terminal mannose residues ( figure 4(a ) ) . electrophoresis showed that ragp - wt migrated more rapidly than pdagp , consistent with its modification with shorter n - linked glycans than in plasma - derived agp ( figure 4(b ) ) , and ligand blotting showed that ragp - wt , but not plasma - derived human agp , bound galanthus nivalis agglutinin ( gna ) , which is a lectin specific for glycans terminating in mannose residues ( figure 4(b ) ) . in contrast , ragp - n(5)q was unreactive with all lectins , consistent with its intended lack of glycosylation ( data not shown ) . intravenous administration of hyaluronidase prior to injection of radiolabeled agp changed both its recovery and distribution in mice for several hours after treatment . initially , the recovery of agp rose from 80.2 5.8 in the absence of hyaluronidase to 96.8 6.0 ( p = 0.0007 by two - tailed unpaired t - test ) ; as seen in figure 5 , the elevation of agp in the plasma in hyaluronidase - treated mice remained detectable until 3 hours after treatment . the area under the observed curve ( t = 0 to t = 6 hours ) was increased from 250 30%-hr to 300 30%-hr ( p = 0.037 by two - tailed unpaired t - test ) by hyaluronidase treatment . we next sought independent confirmation that hyaluronidase was having its intended effect on the murine vasculature , using intravital confocal microscopy of livers of mice treated with or without hyaluronidase . treatment with the enzyme reduced sinusoidal vessel staining with fluorescently labeled habp but left vascular binding by fluorescent gs-1b4 unchanged ( figure 6 , compare ( a ) to ( b ) and ( d ) to ( e ) ) . the distribution of habp was also altered by administration of 3.3 mg intravenous human agp ( 10 - 20 times endogenous agp levels ) without hyaluronidase treatment . this intervention left 5- to 6-fold more habp in the plasma column than in the absence of agp treatment ( figures 6(c ) and 6(f ) ) . although hyaluronidase treatment altered the clearance and distribution of agp , and agp injection increased habp retention in plasma , agp did not bind to immobilized hyaluronan in vitro in microtiter plates , unlike habp , which demonstrated avid binding ( data not shown ) . in this study we explored the effects of altered , diminished , or absent glycosylation of agp on its in vivo clearance . although neuraminidase - treated agp ( also called asialoagp or asialoorosomucoid ) has been widely employed for many years as an injectable ligand and competitor for the hepatic asialoglycoprotein receptor in vivo [ 21 , 24 , 35 , 36 ] , the clearance of glycosylated agp has been less extensively examined . reported a terminal catabolic half - life of 68.5 hours for iodinated human agp injected into a single 3.8 kg rabbit ; this value is similar to our finding of 59 4 hours ( mean sd , n = 6 , range 5365 hours , weight range 2.522.79 kg ) . some of the difference may derive from our use of noncompartmental modeling and pharmacokinetic software , as opposed to the compartmental model and manual calculation employed in the older report ; alternatively , our use of lighter rabbits may also be a contributing factor . in this regard , others employing noncompartmental analysis of agp clearance in rats reported steady state weight - adjusted volumes of distribution similar to that observed in rabbits in this study . for pdagp in rabbits , we observed 160 20 ml / kg , while others reported 150 ml / kg and 90 30 ml / kg . taken together , these comparisons suggest that our clearance findings with respect to pdagp are reasonable in light of previous reports in the literature and form a sound basis for comparison to the novel deglycosylated forms of agp that we generated . we used two strategies to reduce or eliminate entire n - linked glycans from agp : enzymatic treatment with pngase f , or mutation of the five asparagine residues to which the glycans are ordinarily attached . the enzymatic strategy was complicated by the resistance of agp to deglycosylation in the absence of treatment with sds . we elected to employ urea , since it could be removed by dialysis , promoting refolding , as opposed to sds , which binds tightly to proteins and can not readily be removed . pngase f treatment was only partially effective in altering agp clearance , likely due to the presence of some unaltered , multiply glycosylated agp in the mixture ; however , the least glycosylated forms of agp in that mixture were most rapidly removed from the circulation . a more convincing difference between native agp and nonglycosylated agp was achieved via the mutational strategy ; nonglycosylated ragp - n(5)q exhibited a 15-fold decrease in area under the clearance curve ( extrapolated to infinity ) and a 45-fold increase in clearance rate compared to plasma - derived agp . although it was not possible to control the ragp - n(5)q experiments with wild - type recombinant agp made in the same experimental system , due to the high mannose - type glycosylation typical of yeast , our results were consistent with previous data . these data were obtained by investigators who employed metabolic labeling of rat hepatocytes in the presence of an inhibitor of n - linked glycosylation ( tunicamycin ) and immunoaffinity purification to obtain nonglycosylated rat agp . although the difficulty in obtaining radiolabeled agp by this route prevented replication and kinetic analysis in this study , the 50% dose retention time was noted to decrease from 100 minutes to 5 minutes for nonglycosylated agp , as compared with native agp , consistent with our findings , as was increased renal clearance of nonglycosylated agp . having shown that appropriately terminated n - linked glycans keep agp from exhibiting accelerated clearance either via glomerular filtration or via hepatic receptors specific for abnormal glycosylation , we turned to the issue of agp interaction with the vessel wall . intravenous administration of hyaluronidase to hamsters led to a decrease in the fitc - dextran 70 permeation zone defined using intravital microscopy , one consistent with degradation of the glycocalyx , a surface layer of glycosaminoglycans , proteoglycans , and adsorbed plasma proteins [ 18 , 41 ] thought to contain agp [ 42 , 43 ] . while hyaluronidase treatment of rabbits would have been ideal in the context of this study , we found such treatment impractical in this larger laboratory animal . in mice , we found that hyaluronidase treatment decreased the initial clearance of agp , an effect consistent with an agp - glycocalyx action as a normal part of its distribution . hyaluronidase treatment appeared to be specific in that habp binding to liver sinusoidal vessels was reduced , but that of gs-1b4 , an -galactose - specific lectin that mainly binds to animal endothelial cells , was unaffected . agp administration also increased the amount of habp found in the plasma column within liver sinusoids . this increase could have occurred due to agp binding to hyaluronan in the glycocalyx , or its binding to a component of the glycocalyx that affected the access of habp to hyaluronan . we favour the second explanation because we were unable to detect agp - hyaluronan binding in vitro ; nevertheless , we can not exclude the possibility that this interaction occurs in vivo . although our primary reason for examining the liver microcirculation was technical in that this organ is amenable to intravital microscopy , it has also been shown that this microcirculatory bed is greatly enriched in hyaluronan as opposed , for instance , to those of lung or heart . our results support the suggestion that agp is a component of the glycocalyx , as previously suggested [ 17 , 42 , 47 , 48 ] . from a biotechnological point of view , our results also provide novel information with respect to targeting of recombinant agp to either renal or hepatic destinations . lipocalins bind many drugs and metabolites within a central binding pocket of the polypeptide . interestingly , in this regard lipocalin libraries have been described with engineered binding properties . our biological distribution results raise the possibility that engineered agps with defined ligand binding specificities could be directed to renal or hepatic destinations using either the n(5)q mutant , or mannosylated ragp - wt produced in yeast . in the latter instance , producing agp ( e.g. , for conjugation to dna , as has been previously reported for gene targeting [ 51 , 52 ] ) or an agp fusion protein in pichia pastoris could provide hepatic targeting in a single step , without the need for neuraminidase treatment . it would have been preferable to use homologous rabbit agp or murine agp in rabbits and mice , respectively , but our efforts to isolate rabbit agp by adapting a protocol designed for the purification of rat agp were not successful , and it was impractical to purify sufficient quantities of murine agp from murine plasma for our purposes . our study was also limited to human agp purified from the plasma of healthy individuals , and clearance was similarly investigated in healthy animals . as such , our results do not address the possibility that agp glycosylation or clearance properties are altered during inflammation , as has been suggested [ 5456 ] . our use of plasma purified from a small pool of healthy donors to purify agp was aligned with the concept that this material might be a future therapeutic product of plasma fractionation [ 57 , 58 ] . our results show that n - linked glycosylation of agp is a critical contributor to its plasma residency , in that reducing the number of glycans accelerated clearance ; this was most clearly demonstrated for a mutant agp completely lacking n - linked glycans . in this regard , agp resembles antithrombin , in which mutation of any one of four sites of n - linked glycosylation has been shown to lead to accelerated clearance in vivo in rabbits , but not albumin , in which either naturally occurring or engineered sites of n - linked glycosylation accelerate the clearance of the plasma protein . glycosylation thus contributes to maintaining a circulating pool of agp for exchange into the glycocalyx , where it may contribute to the maintenance of vascular permeability .

alpha-1 acid glycoprotein ( agp ) is a highly glycosylated plasma protein that exerts vasoprotective effects . we hypothesized that agp 's n - linked glycans govern its rate of clearance from the circulation , and followed the disappearance of different forms of radiolabeled human agp from the plasma of rabbits and mice . enzymatic deglycosylation of human plasma - derived agp ( pdagp ) by peptide : n - glycosidase f yielded a mixture of differentially deglycosylated forms ( pngase - agp ) , while the introduction of five asn to gln mutations in recombinant pichia pastoris - derived agp ( ragp - n(5)q ) eliminated n - linked glycosylation . pngase - agp was cleared from the rabbit circulation 9-fold , and ragp - n(5)q , 46-fold more rapidly than pdagp , primarily via a renal route . pichia pastoris - derived wild - type ragp differed from pdagp in expressing mannose - terminated glycans , and , like neuraminidase - treated pdagp , was more rapidly removed from the rabbit circulation than ragp - n(5)q . systemic hyaluronidase treatment of mice transiently decreased pdagp clearance . agp administration to mice reduced vascular binding of hyaluronic acid binding protein in the liver microcirculation and increased its plasma levels . our results support a critical role of n - linked glycosylation of agp in regulating its in vivo clearance and an influence of a hyaluronidase - sensitive component of the vessel wall on its transendothelial passage .

ureteritis cystica ( uc ) is a benign pathology , which develops following chronic inflammation . although a diagnosis is often made with imaging techniques , we report a case of a child in whom was discovered during a nephrectomy . to the best of our knowledge , the patient was a 12 year old child who , as a newborn , had undergone surgery for anal atresia with rectourethral fistula repair and colostomy . his postnatal ultrasound ( us ) and dimercaptosuccinic acid ( dmsa ) scan had shown a hypoplasic left kidney and bilateral minimal hydronephrosis . voiding cystourethrography ( vcu ) showed bilateral grade 5 vesicoureteral reflux . at 1 year of age , the colostomy was closed and dmsa was repeated and differential function of the left kidney was found 22% , whereas the right kidney was 78% . in the 3 year of life , a second vcu revealed clinically significant residual urine , which required clean intermittent catheterization ( cic ) . he underwent bilateral cohen ureteroneocystostomy for recurrent urinary tract infections ( utis ) under antibiotic prophylaxis . ultrasound prior to surgery showed bilateral high grade hydronephrosis . on the follow - up , dmsa scan showed 63% differential function on the right kidney . at the age of 7 , us showed persistent bilateral high grade hydronephrosis . when he became a 10-year - old , hemodialysis was initiated for the first time and he had been placed on a renal transplant waiting list . the patient was on cic 6 times a day when another urodynamic evaluation was obtained at 12 years of age . the study revealed hypocompliant bladder with decreased anatomic capacity accompanying detrusor overactivity with no demonstrable vesicoureteric reflux . due to the low functional bladder capacity , nephrectomy with ureteral augmentation cystoplasty was planned . during surgery , after left simple nephrectomy , left ureter was dissected and spatulated , but ureteral mucosa was found to be filled with polyps [ figure 1 ] . innumerable 2 - 4 mm pearly raised vesicular / polipoid lesions covering entire mucosa of the ureter histopathological examination of the ureter showed polypoid ureteritis and exuberant uc producing exophytic mucosal lesions in a background of chronically inflamed lamina propria [ figure 2 ] . large and small cysts lined by flattened urothelial cells leading to polipoid mucosal protrusions into the lumen ; some filled with eosinophilic secretion ( ( a ) h and e , 40 ; ( b ) h and e , 400 ) ureteritis cystica is a rare and benign pathology of inflammatory origin first reported by morgagni in 1761 and described by richmond and robb in 1967 . a pubmed search with keywords of ureteritis , cystica revealed 72 papers those mostly presenting case reports without any pediatric age patients . although many reports state female dominancy , menendez et al . have reported this may not be true after evaluating 34 cases and showing only 44% of them being female patients . uc is generally seen in patients during the evaluation of uti ( 82% ) , urolithiasis ( 53% ) , and hematuria ( 52% ) . the differential diagnosis includes ureteral tumors , pseudodiverticula , urolithiasis , polyps , vascular indentations , tuberculosis , utis , and submucosal hemorrhages . in the long - term , uc may result in an atrophic kidney due to obstruction . in this particular case , the etiology was thought to be persisting recurrent utis initially due to the bilateral high grade reflux and then due to the obstruction that developed following antireflux surgery . mahboubi et al . have reported uc in a patient who received formalin treatment for cyclophosphamide induced hemorrhagic cystitis . although , intravenous pyelography and retrograde urography were the preferred diagnostic tools earlier , in the last decade magnetic resonance and computed tomography urography have become more available and accurate . despite advanced technology , imaging studies may be inadequate in some cases . ureteroscopy is a definitive diagnostic approach in these cases in the present case , we did not have any imaging studies other than us since such pathology was not expected . moreover , the patient 's chronic renal failure precluded the use of imaging studies with contrast agents . therefore , in such patients with history of chronic uti , inflammation or obstruction , the possibility of this pathology should be taken into consideration and appropriate imaging modalities such as retrograde ureteropyelography or direct examination by ureterorenoscopy may be needed before reconstructive surgeries using the ureter . limited data are present in the literature regarding follow - up and malignant transformation , however follow - up is advised annually . duffin et al . have reported a case after follow - up of 17 years without malignant transformation , whereas there is a report of a case complicated with adenocarcinoma of the ureter . during the surgery we abstained from using this ureter as we did not have the facility of frozen section pathology and also had no experience of using such a ureter for augmentation . the treatment of this pathology , which is believed to be reversible , depends on the elimination of the underlying causes . ureteritis cystica is a rare pathology that should be considered in the presence of chronic inflammation and obstruction of the upper urinary tract .

ureteritis cystica ( uc ) is a benign condition . although it can often be diagnosed with imaging techniques , we report a case of a child for whom we planned nephrectomy and ureteral augmentation cystoplasty , but abandoned the cystoplasty due to extensive uc in the ureter .

atrial fibrillation ( af ) is a common cardiac rhythm disorder , which is responsible for substantial morbidity and mortality . the prevalence of nonvalvular atrial fibrillation ( nvaf ) increases with advancing age and is considered to be an important risk factor for ischemic stroke ( is ) and thromboembolism ( te).1 anticoagulation is the cornerstone for af management . however , various studies have reported the underuse of oral anticoagulation ( oac ) among elderly patients with nvaf,24 and the situation is more grim in the people s republic of china.5 both chads2 ( defined as congestive heart failure , hypertension , age 75 years , type 2 diabetes mellitus [ dm ] , previous stroke [ doubled ] ) and cha2ds2-vasc ( defined as congestive heart failure , hypertension , age 75 years [ two scores ] , type 2 diabetes mellitus , previous stroke , transient ischemic attack [ tia ] , or te [ doubled ] , vascular disease , age 6574 years , and sex category ) scores are well - validated tools for the estimation of stroke risk in patients with af . cha2ds2-vasc improves the precision of identifying low - risk patients.6 age is a very important factor of stroke , and it is unclear which score is better suited for use in elderly patients.7 the goal of the present study was to compare the utility of cha2ds2-vasc and chads2 scores in predicting is / te for the patients with nvaf aged 65 years . a retrospective study was conducted by collecting patient data available at beijing friendship hospital for the period between january 1 , 2011 , and june 30 , 2013 . it was possible to retrieve the data pertaining to individual patients as all data at our hospital are linked to a unique , permanent , and personal registration number , which is assigned to every patient . patients with nvaf aged 65 years , and not on oac for the previous 6 months , were enrolled in the study . diagnosis of af was based on electrocardiography ( 12-lead electrocardiography ) or 24-hour holter monitoring . patients with valvular af , rheumatic mitral stenosis , mechanical or bioprosthetic heart valve , and mitral valve repair and those receiving hemodialysis or on oac were excluded from the study . the date of the qualifying af diagnosis made between january 1 , 2011 , and june 30 , 2013 , was designated as the index date . data from the baseline period , which ended on the index date , were used to obtain information about each patient s medical history . follow - up was performed by going through medical records available in the hospital database . data from the follow - up period , which started from the day after the index date and ended on march 1 , 2015 , were used to assess the risk of is / te . all patients who were lost to follow - up and those who took oac during the study period were excluded . the primary end point was the development of is or te events ( ie , tia or peripheral embolism ) . is was defined as a new , sudden focal neurological deficit resulting from a presumed cerebrovascular cause that persisted > 24 hours and was not attributable to other identifiable causes , such as tumor and seizure . peripheral artery embolism was defined as abrupt vascular insufficiency associated with clinical or radiographic evidence of peripheral arterial occlusion in the absence of other likely causes . presence of vascular disease was identified from previous diagnoses , including myocardial infarction ( mi ) , peripheral artery disease , and complex aortic plaque . data were expressed as mean sd . the analyses were performed using spss 17.0 ( spss , inc . , chicago , il , usa ) , except net reclassification improvement ( nri ) , which was analyzed using sas9.2 . mean values and proportions of variables were compared using unpaired student s t - test , analysis of variance , and chi - square test . the is / te risk was assessed using cox regression analysis . the cumulative incidence curve of is / te was plotted via the kaplan meier method , with statistical significance examined using the log - rank test . we assessed the predictive accuracies of the chads2 and cha2ds2-vasc scores by calculating c - indices on the basis of receiver operating characteristic ( roc ) curves and nri . areas under the roc curves for these two scoring systems were compared using delong s test . a total of 36.8% had a history of previous stroke or tia . during the follow - up period of 1.991.29 years , 104 ( 25.2% ) patients died and 59 ( 14.3% ) patients had an is / te event . on the basis of the chads2 score , 1.7% , 10.2% , and 86.3% of patients were classified as low risk ( 0 point ) , intermediate risk ( 1 point ) , and high risk ( 26 points ) , respectively . both the chads2 and cha2ds2-vasc scores were the significant predictors of is after adjusting for age and sex . cox regression model improved from 1.286 ( 95% ci : 1.0861.523 ) to 1.438 ( 95% ci : 1.1871.743 ) when the chads2 score was used for stroke risk categorization instead of the cha2ds2-vasc score . of the components of chads2 and cha2ds2-vasc scores , cardiac failure and previous stroke / tia were strongly associated with the primary end point ( hazard ratio [ hr ] 2.253 , 95% ci : 1.2404.092 ; hr 2.555 , 95% ci : 1.4084.635 , respectively ) . age was also found to be associated with is / te during follow - up . however , hypertension , dm , vascular disease , and female sex were not found to be predictive of is / te ( tables 2 and 3 ) . among patients with the vascular disease , figure 1 shows the roc curves of chads2 and cha2ds2-vasc scores in predicting is / te . the c - indices on the basis of area under the roc curves for the chads2 and cha2ds2-vasc scores were 0.647 ( 95% ci : 0.5990.693 ) and 0.615 ( 95% ci : 0.5660.662 ) , respectively . the difference was statistically significant in favor of the chads2 score ( delong s test , p - value = 0.04980.05 , nri = 0.237 ) . the cut - off value of chads2 score was 2.5 , with a specificity of 0.537 and a sensitivity of 0.780 . meier curve of freedom from is is shown in figure 2 . patients with a chads2 score of 0 had no stroke event . patients with a chads2 score of 2 had a similar event rate to those with a chads2 score of 1 during the follow - up period ( 7.1% vs 7.8% ; p=0.887 ) . compared with a chads2 score of 1 , patients with a chads2 score of 3 , 4 , 5 , or 6 had a higher event rate ( 14.4% , 23.1% , 24.4% , and 10% , respectively ) . using a chads2 score of 1 as the reference in the cox regression analysis model , the hrs associated with the chads2 scores of 2 , 3 , 4 , 5 , and 6 were 1.09 , 2.02 , 3.32 , 3.42 , and 1.40 , respectively ( figure 3 ) . the event rates with the chads2 scores of 1 , 2 , 3 , 4 , 5 , and 6 were 7.14% , 7.81% , 14.44% , 23.08% , 20% , and 10% , respectively . these findings indicated that a chads2 score of 2 had a similar event rate to a chads2 score of 1 , and chads2 score 3 identified a cohort with a true high risk . the hr of the group with a chads2 score of 6 was 1.40 , perhaps because of its small size . a total of 36.8% had a history of previous stroke or tia . during the follow - up period of 1.991.29 years , 104 ( 25.2% ) patients died and 59 ( 14.3% ) patients had an is / te event . on the basis of the chads2 score , 1.7% , 10.2% , and 86.3% of patients were classified as low risk ( 0 point ) , intermediate risk ( 1 point ) , and high risk ( 26 points ) , respectively . both the chads2 and cha2ds2-vasc scores were the significant predictors of is after adjusting for age and sex . cox regression model improved from 1.286 ( 95% ci : 1.0861.523 ) to 1.438 ( 95% ci : 1.1871.743 ) when the chads2 score was used for stroke risk categorization instead of the cha2ds2-vasc score . of the components of chads2 and cha2ds2-vasc scores , cardiac failure and previous stroke / tia were strongly associated with the primary end point ( hazard ratio [ hr ] 2.253 , 95% ci : 1.2404.092 ; hr 2.555 , 95% ci : 1.4084.635 , respectively ) . age was also found to be associated with is / te during follow - up . however , hypertension , dm , vascular disease , and female sex were not found to be predictive of is / te ( tables 2 and 3 ) . among patients with the vascular disease , figure 1 shows the roc curves of chads2 and cha2ds2-vasc scores in predicting is / te . the c - indices on the basis of area under the roc curves for the chads2 and cha2ds2-vasc scores were 0.647 ( 95% ci : 0.5990.693 ) and 0.615 ( 95% ci : 0.5660.662 ) , respectively . the difference was statistically significant in favor of the chads2 score ( delong s test , p - value = 0.04980.05 , nri = 0.237 ) . the cut - off value of chads2 score was 2.5 , with a specificity of 0.537 and a sensitivity of 0.780 . patients with a chads2 score of 0 had no stroke event . patients with a chads2 score of 2 had a similar event rate to those with a chads2 score of 1 during the follow - up period ( 7.1% vs 7.8% ; p=0.887 ) . compared with a chads2 score of 1 , patients with a chads2 score of 3 , 4 , 5 , or 6 had a higher event rate ( 14.4% , 23.1% , 24.4% , and 10% , respectively ) . using a chads2 score of 1 as the reference in the cox regression analysis model , the hrs associated with the chads2 scores of 2 , 3 , 4 , 5 , and 6 were 1.09 , 2.02 , 3.32 , 3.42 , and 1.40 , respectively ( figure 3 ) . the event rates with the chads2 scores of 1 , 2 , 3 , 4 , 5 , and 6 were 7.14% , 7.81% , 14.44% , 23.08% , 20% , and 10% , respectively . these findings indicated that a chads2 score of 2 had a similar event rate to a chads2 score of 1 , and chads2 score 3 identified a cohort with a true high risk . the hr of the group with a chads2 score of 6 was 1.40 , perhaps because of its small size . cha2ds2-vasc is reported to be better than the chads2 score in identifying the true low - risk patients.812 however , for the regions and population where oac is frequently underused , it is more important to identify the true high - risk patients . the underuse of oac among elderly patients with nvaf has been confirmed in different settings.24 one of the most important reasons is that the treating physicians are not sure about which scoring system to follow to determine which patient requires the oac the most . therefore , it is necessary to compare the predictive value of two scores , cha2ds2-vasc and chads2 , in predicting is among patients diagnosed with nvaf aged 65 years , and to find patients with a true high risk . in the present study , this implies that every patient was added at least 1 point by the cha2ds2-vasc system , and that both chads2 and cha2ds2-vasc scores were useful parameters for predicting adverse events in patients with nvaf aged 65 years . however , the chads2 score was found to be more appropriate for patients aged 65 years for the categorization of stroke risk when compared with the cha2ds2-vasc score . consistent with the findings of our study , friberg et al13 found that the risk of is in patients with a cha2ds2-vasc score of 1 seemed to be lower than previously reported ( 0.1%0.7% ) . in the present study , cardiac failure , age , and history of previous stroke were found to be the independent predictors of is / te . although vascular disease and female sex were not associated with is / te risk , both are the additional non - chads2 risk factors that are incorporated into the cha2ds2-vasc score as per 2012 european society of cardiology guidelines.14 several studies have been conducted to assess the impact of atherosclerotic vascular disease on stroke in patients with af . peripheral arterial disease significantly increased the risk of stroke in all observational studies with the reported risk ranging from 1.3-fold to 2.5-fold.15,16 complex aortic plaque in the descending aorta has also been reported as a significant risk factor.1719 however , there is no conclusive evidence that previous mi is a predictor of is.20 in our study , vascular disease included previous mi and peripheral arterial disease . previous mi was not a significant predictor of is / te , which is consistent with the findings of lin et al.21 though female sex is another non - chads2 risk factor and has been reported to be associated with is / te in patients with af,22,23 the said association is considered as controversial . various studies have reported that female sex is associated with an increased risk of stroke in only those patients with af aged 75 years , whereas female patients aged < 65 years without other risk factors do not require anti - coagulation therapy.24,25 moreover , most of the clinical trials supporting female sex as a risk factor are from the western countries . however , studies conducted in the eastern countries have not reported similar results.26 it has been reported that female sex increases the risk for their comorbidities , such as heart and renal failures.22 in our study , which enrolled patients aged 65 years , there was no significant difference in the rate of hypertension , previous stroke / tia , dm , and chf in females when compared with males ( 73.4% vs 75.5% , 39.1% vs 37.7% , 37.5% vs 34.3% , and 23% vs 22.5% , respectively ) . in addition , the rate of is / te in females was not found to be significantly different from males ( 13.4% vs 14.6% ; p>0.05 ) . therefore , in - line with other studies , the findings of our study indicate that female sex need not be considered when deciding on the antithrombotic therapy.27 in our study , the cut - off value for a very high risk of stroke when using the chads2 score was 3 , which was determined by roc curve analysis . in fact , the event rates during the follow - up period among patients with the chads2 scores of 1 and 2 were almost the same ( 7% ) , thus indicating intermediate risk in the chads2 score of 1 . being a retrospective analysis , follow - up was performed by assessing medical records available in the hospital database only , hence some clinically relevant events may have been missed . the study had a limited number of patients , especially in the group of chads2 scores 0 and 9 . the hr associated with a chads2 score of 6 ( relative risk [ rr ] = 1.4 [ 95% ci { 0.1612.09 } ] ) is considerably lower than that with a chads2 score of rr = 5 ( 3.42 , 95% ci [ 1.0312.42 ] ) . for the size of sample . for patients with nvaf aged 65 years or older , both vascular disease and female sex were not the predictors of is / te risk . the use of the chads2 score significantly improves the classification of patients with af at high risk of stroke compared with the cha2ds2-vasc score . thus , future large - scale studies involving multiple centers are needed to further corroborate our findings .

aimthe study aims to compare the ability of cha2ds2-vasc ( defined as congestive heart failure , hypertension , age 75 years [ two scores ] , type 2 diabetes mellitus , previous stroke , transient ischemic attack , or thromboembolism [ te ] [ doubled ] , vascular disease , age 6574 years , and sex category ) and chads2 ( defined as congestive heart failure , hypertension , age 75 years , type 2 diabetes mellitus , previous stroke [ doubled ] ) scores to predict the risk of ischemic stroke ( is ) or te among patients with nonvalvular atrial fibrillation ( nvaf).methodsa total of 413 patients with nvaf aged 65 years , and not on oral anticoagulants for the previous 6 months , were enrolled in the study . the predictive value of the cha2ds2-vasc and chads2 scores for is / te events was evaluated by the kaplan meier method.resultsduring a follow - up period of 1.991.29 years , 104 ( 25.2% ) patients died and 59 ( 14.3% ) patients developed is / te . the chads2 score performed better than the cha2ds2-vasc score in predicting is / te as assessed by c - indexes ( 0.647 vs 0.615 , respectively ; p<0.05 ) . non - chads2 risk factors , such as vascular disease and female sex , were not found to be predictive of is / te ( hazard ratio 1.518 , 95% ci : 0.8322.771 ; hazard ratio 1.067 , 95% ci : 0.5991.899 , respectively ) . no differences in event rates were found in patients with the chads2 scores of 1 and 2 ( 7.1% vs 7.8% ) . it was observed that patients with a chads2 score of 3 were most in need of anticoagulation therapy.conclusionin patients with nvaf aged 65 years , the chads2 score was found to be significantly better in predicting is / te events when compared to the cha2ds2-vasc score . patients with a chads2 score of 3 were associated with high risk of is / te events .

perforation of the gall bladder represents a rare , but life - threatening complication of cholecystitis . clinical presentation may vary between severe peritonism in acute perforation and absence of symptoms in subacute or chronic progression of perforation . abdominal imaging like ultrasound or ct - scan are important tools for immediate diagnose of gall bladder perforation . we report a case of a 30-year old female patient with end - stage kidney disease treated by continuous ambulatory peritoneal dialysis ( capd ) who was admitted to the emergency room with fever and mild abdominal pain . a type ii gall bladder perforation by a solitary gall stone with development of a liver abscess was detected by abdominal ultrasound . gall bladder perforations are rare but have to be considered in patients with abdominal pain and fever . a perforation of the gall bladder represents a life - threatening complication of cholecystitis , which occurred in historical study cohorts with an incidence of up to 10 - 15% [ 1 - 3 ] during acute cholecystitis . the establishment of early cholecystectomy and improvement of antibiotic therapy regimen have reduced the risk of gall bladder perforation in acute cholecystitis to 0.8 - 3.2% today [ 4 - 6 ] . type i perforation presents as an acute disease with perforation into the free abdominal cavity , whereas type ii perforation is characterized as a subacute stage with development of a pericholecystic abscess . type iii perforation arises in chronic cholecystitis with development of bilioenteric fistulae . especially in chronic cholecystitis diagnosis of a gall bladder perforation we report on an oligosymptomatic gall bladder perforation into the liver due to cholecystolithiasis in a patient with peritoneal dialysis . a 30-year old female patient was admitted to the emergency unit with fever ( 40c ) for two days , mild pain in the right upper abdomen and deteriorated health condition . the patient was treated by dialysis since nine years because of a hemolytic - uremic syndrome , for the last seven years dialysis was done via continuous ambulatory peritoneal dialysis . the patient had a history of arterial hypertension , nephrectomy because of a hypernephroma ( pt1a ) one year ago and a solitary concrement of the gall bladder ( figure 1 ) . in the current laboratory results elevation of inflammatory parameters such as c - reactive protein ( 23 mg / dl , normal range < 0.5 mg / dl ) and white blood cell count ( 13,400 l with 78% neutrophiles ) were noticed . physical investigation solely showed mild pain in the upper abdomen by deep palpation with no clear positive murphy 's sign , but was otherwise unremarkable . large solitary concrement of the gall bladder with a maximal diameter of 27 mm , five years before onset of the gall bladder perforation . the abdominal sonography revealed ascites and a multilayered , thickened wall of the gall bladder . the gall bladder wall facing toward the liver was missing and a large intrahepatic abscess with dislocation of a single bile stone of about 25 mm in diameter into the abscess cavity was visible ( figure 2 ) . murphy 's sign remained negative despite direct palpation of the gall bladder with the ultrasound transducer . intrahepatic abscess with dislocation of the solitary concrement from the perforated gall bladder into the abscess cavity . a distinctive , hypodense intrahepatic abscess ( average 18hu ) with hyperdense margins was detectable , the dislocated gall stone presented as a circular , hyperdense structure ( figure 3 and 4 ) . an immediate cholecystectomy with debridement , stone extraction and lavage of the liver followed , concomitant antibiotic therapy was initiated . ct - scan correlating to us - images ( see figure 2 ) : the gall stone ( white arrow ) presents as a circular hyperdense structure within the intrahepatic abscess cavity ( black arrows ) . clear illustration which accentuates the extent of the abscess and intrahepatic location of the partial calcified gall stone ( white arrow ) . free intraabdominal fluid with distal end of the peritoneal catheter in right lower abdomen ( white arrowhead ) . histology showed a severe , hemorrhagic - erosive and ulcerative episode of a chronic - recurring cholecystitis with focal perforation of the gall bladder wall . microbiology specimen confirmed e. coli and candida glabrata . a prolonged convalescence developed with the need for changing the modus of dialysis from peritoneal dialysis to veno - venous hemodialysis . the size of the irregular area decreased and was no longer visible three months after operation ( figure 5 ) . a : 8 days after operation ( 46 37 mm ) , b : 34 days after operation ( 46 25 mm ) , c : 68 days after operation ( 21 19 mm ) . a perforation of the gall bladder currently arises in 0.8 - 3.2% of the cases with acute onset of cholecystitis , but there is no data about the incidence of gall bladder perforation in chronic cholecystitis . development of an intrahepatic abscess represents a rare complication and is reported in literature only by several case reports . both , perforation of the gall bladder or pyogenic liver abscess represent a life - threatening complication with mortality rates of 7% and 5.6% as shown by retrospective studies . gall bladder perforation is divided into three categories accordingg to progress ( acute - subacute - chronic ) and type of perforation ( into free abdominal cavity - development of pericystic abscess - development of fistulae ) . this classification was described first by niemeier in 1934 . with regard to the histologically proven chronic - recurring cholecystitis and the development of an intrahepatic abscess this case has to be classified as a type ii perforation . the incidence of clinical symptoms is variable and may be absent in chronic or subacute progression of disease . the performance of an abdominal ultrasound is an essential part of the work up of patients with fever and abdominal pain . in asymptomatic patients or cases with just mild abdominal pain gall bladder perforations may be diagnosed solely by imaging procedures . only two studies from 1994 and 2002 with low numbers of patients ( combined n = 31 ) compared diagnostic findings between ultrasound and computed tomography in patients with gall bladder perforation . in comparison to the ct - scan , ultrasound seems to be less sensitive with 70% vs. 80% for the detection of the perforation . nevertheless , with regard to the improvement of resolution of modern sonographic imaging equipment , better results can be expected today . ct scans are needed in cases of discrepancies between clinical symptoms and inconspicuous ultrasound as well as for better pre - operative planning subsequently to the sonographically proven perforation . ct scans have the advantage of a better representation of extensive findings because of the bigger field of view ( fov ) and may demonstrate the extension of a lesion more clearly . patients who need capd show a significant higher incidence of peritonitis in comparison to the general population . nevertheless , there is no evidence in the literature that patients with capd show a higher incidence of cholecystitis or risk of gall bladder perforation than the general population even if some studies demonstrate that the prevalence of cholelithiasis may be higher in patients with dialysis than in non - dialysed control groups [ 13 - 16 ] . analysis of the peritoneal fluid in this patient showed no white blood cells and lack of bacterial growth in culture . therefore it seems to be unlikely that the peritoneal fluid was the origin for bacterial infection of the gall bladder . the onset of an acute on chronic cholecystitis with the development of a gall bladder perforation represented an independent disease with no relation to the continuous ambulatory peritoneal dialysis . usually , palpation of the gall bladder is painful when inflamed peritoneal layers rub on each other . however , when free fluid is present - as it is in patients with peritoneal dialysis - peritoneal layers are separated and murphy 's sign may vanish . secondly , peritoneal layers may not have been affected in this patient because this was a covered perforation into the liver . in conclusion , the present case shows that life threatening gall bladder ruptures have to be considered in patients with fever and only mild abdominal symptoms . in these patients ultrasound

introductionperforation of the gall bladder represents a rare , but life - threatening complication of cholecystitis . clinical presentation may vary between severe peritonism in acute perforation and absence of symptoms in subacute or chronic progression of perforation . abdominal imaging like ultrasound or ct - scan are important tools for immediate diagnose of gall bladder perforation.case presentationwe report a case of a 30-year old female patient with end - stage kidney disease treated by continuous ambulatory peritoneal dialysis ( capd ) who was admitted to the emergency room with fever and mild abdominal pain . a type ii gall bladder perforation by a solitary gall stone with development of a liver abscess was detected by abdominal ultrasound.conclusiongall bladder perforations are rare but have to be considered in patients with abdominal pain and fever . abdominal ultrasound is a reliable tool to establish diagnosis .

the positron - emitting radiopharmaceuticals are of particular interest due to the high sensitivity and excellent resolution of the positron emission tomography ( pet ) . these radiopharmaceuticals are formulated from cyclotron - produced or generator - eluted radionuclides and should be subjected to quality control ( qc ) tests to assure their safety and efficacy before injecting to the patient . fluorodeoxyglucose ( f-18 fdg ) , a glucose analog , is the most popular pet radiopharmaceutical . o-15 , ga-68 , i-124 , and cu-64 , and so on are also being used for pet imaging . however , catalysts like kryptofix ( kryptofix 2.2.2 . ) or tetrabutylammonium ( tba ) salts are required for f-18 fdg synthesis . somatostatin peptide analogues like dotatate , dotanoc , and dotatoc have been labeled with ga for somatostatin receptor imaging . n-13 is a short - lived pet radionuclide ( t1/2 = 10 min ) and is produced in cyclotron . the proton irradiation of a natural water target o ( p , ) n is an efficient method . oxo anions of nitrogen n-13 ( n-13-no3 and n-13-no2 ) are produced from radiolytic oxidation . with the use of reducing agents such as devarda 's alloy / sodium hydroxide or titanium - chloride / hydroxide , these oxo - anions can be converted to n-13 nh3 qc parameters of n-13 nh3 were studied by various methods . the prepared radiopharmaceuticals are administered intravenously ; therefore , qc is mandatory , but there is no global consensus in relation to required quality attributes . the three major standards ph.int . , ph . eur . , and usp are available for f-18 fdg . however , there are differences in f-18fdg quality requirements among usp , ep , and int phar . in this study , the qc parameters of three pet radiopharmaceuticals , f-18 fdg , n-13 nh3 , and ga-68 dotatate are studied . pet radiopharmaceuticals , thin layer chromatography ( tlc ) scanner ( ez - scan , usa ) with multimode radiation detector , ( omni - rad ) gas chromatography ( gc ) ( varian 3900 ) with flame ionization detector ( fid ) , multichannel analyzer ( captus 3000 , capintec ) , well counter , dose calibrator ( capintec crc-25pet ) , silica gel chromatography paper , ph paper ( merck ) , lal reagents from charles river laboratories india pvt . ltd . the f-18 was produced by o ( p , n ) f reaction using 16.5 mev on - site cyclotron ( pet trace-4 , ge healthcare , milwaukee , usa ) by proton irradiation for 45 min at 40a current using o-18 enriched water . at the end of bombardment , the fluoride was transferred directly to the automatic synthesizer module ( tracer lab mxfdg , ge healthcare , milwaukee , usa ) by helium pressure . ( abx , germany ) that contained all chemicals required for the nucleophilic radiosynthesis were used . the labeled precursor was hydrolyzed under basic medium to eliminate the protecting group and sterilized by 0.22 m millipore filter . the f-18 fdg ( 16 ml ) was collected in a sterile glass vial and qc was performed . ga-68 dotatate was prepared using ge-68/ga-68 generator and iqs fluidic labeling module with in - built heater , both from itg germany . ethanol ( 30% ) was used for elution of prepared peptide ( ga-68 dotatate ) from c-18 cartridge . eluted product was passed through a 0.22 m low protein binding filter and collected in a sterile vial . n-13nh3 was produced by o ( p , ) n irradiation reaction using on - site cyclotron . oxoanions of nitrogen ( n-13 no3 , and n-13 no2 ) were produced from radiolytic oxidation . oxoanions were converted to n-13 nh3 by the use of devarda 's alloy , a reducing agent , in sodium hydroxide . n-13 nh3 vapors were collected in normal saline in a sterilized vial after passing through 0.22 m filter . a total of 25 samples each of f-18 fdg and ga-68 dotatate and n-13 nh3 were randomly selected . radionuclide purity was assessed by half - life of radionuclides ( t1/2 ) and was measured by two methods , well counter and formula method . activity of test samples ( f-18 fdg , ga-68 dotatate ) after every 10 min ( a10 ) was recorded . t1/2 was calculated from the measured values as per the formula : where , t1/2 and t are in minutes . counts / activity of f-18 fdg sample at 10 s interval was also taken to determine the impurity of n-13 in f-18 fdg . in case of n-13 nh3 a time activity curve was plotted on semilog graph and half - life ( t1/2 ) was taken as the time at which the total activity was decayed to half . for a gamma spectrum of pet radionuclides , a repeat spectrum of ga-68 point source was also obtained after 24 and 48 h to determine the ge-68 breakthrough . radiochemical purity was assessed by silica gel instant thin layer chromatography ( sg - itlc ) . a drop ( 4 - 5 l ) of test sample was placed on a sg - itlc strip ( 10 * 1 cm for f-18 fdg , 8 * 1 for ga-68dotatate and n-13 nh3 ) and air dried . acetonitrile : water ( 95:5 , v / v ) and sodium citrate was used as mobile phase for f-18 fdg and ga-68 dotatate , respectively . water : acetone : acetic acid ( 3:2:1 ) saturated with sodium chloride ( nacl ) was used as mobile phase for n-13-nh3 . the radioactivity profile and rf the amount of organic solvents present in the test samples was estimated by gc using fid detector . the temperature of detector , oven , and injector were kept constant for all pet radiopharmaceuticals . hydrogen , air flow , and nitrogen flow rate were also kept constant for all samples . reference standard of ethanol ( 4000 ppm ) and acetonitrile , ( 400 ppm ) and samples ( 2 - 3 l ) were injected into the gc column and an analysis report was generated . the concentration of ethanol and acetonitrile in the sample was calculated by the following formula : where c1 and c2 are the concentration of standard and sample . the chemical purity was calculated for f-18 fdg as kryptofix 2.2.2 ( amino polyether ) may be present in the final product of f-18 fdg . a total of 4 - 5l of f-18 fdg test sample and the reference standard of kryptofix 2.2.2 ( 0.22 mg / ml ) were developed in the mobile phase composed of methanol : ammonia ( 9:1 , v / v ) . the developed strips , after drying , were exposed to iodine vapors in a closed container of iodine crystals . robertson cooked meat medium broth ( rcmb ) was used for cultivation of aerobes and anaerobes , especially pathogenic clostridia . small inoculation was made near the bottom of the tube and incubated at 37c for 7 days . the samples were observed every day for 7 days to observe the turbidity or bubble formation by organisms . the widely used and accepted test for assessing the presence of bacterial endotoxin in a radiopharmaceutical preparation is limulus amebocyte lysate ( lal ) test . the estimation of bacterial endotoxin test is based on the formation of gel clot in the presence of endotoxin . this test was performed in randomly selected samples for each pet radiopharmaceutical ( n = 25 ) in a thermally regulated and vibration - free environment . the permissible limit of endotoxin in injectable formulation is 175 eu / v according to usp and per mlaccording to ph . the endotoxin concentration in positive water control ( pwc ) was 0.25 and 0.5 eu/ ml . each sample was diluted at two different maximum valid dilutions ( mvds , i.e. , 350 and 700 times to match with the above - mentioned dilutions of endotoxin . lal reagent water was used as negative control . after adding reagents in appropriate volume and concentration according to the protocol , the test vials were incubated for 60 min at 37 1c and were inverted to observe the formation of gel . a total of 25 samples each of f-18 fdg and ga-68 dotatate and n-13 nh3 were randomly selected . radionuclide purity was assessed by half - life of radionuclides ( t1/2 ) and was measured by two methods , well counter and formula method . the initial radioactivity ( a0 ) and activity of test samples ( f-18 fdg , ga-68 dotatate ) after every 10 min ( a10 ) was recorded . t1/2 was calculated from the measured values as per the formula : where , t1/2 and t are in minutes . counts / activity of f-18 fdg sample at 10 s interval was also taken to determine the impurity of n-13 in f-18 fdg . in case of n-13 nh3 a time activity curve was plotted on semilog graph and half - life ( t1/2 ) was taken as the time at which the total activity was decayed to half . for a gamma spectrum of pet radionuclides , a point source was prepared and placed in well counter . a repeat spectrum of ga-68 point source was also obtained after 24 and 48 h to determine the ge-68 breakthrough . radiochemical purity was assessed by silica gel instant thin layer chromatography ( sg - itlc ) . a drop ( 4 - 5 l ) of test sample was placed on a sg - itlc strip ( 10 * 1 cm for f-18 fdg , 8 * 1 for ga-68dotatate and n-13 nh3 ) and air dried . acetonitrile : water ( 95:5 , v / v ) and sodium citrate was used as mobile phase for f-18 fdg and ga-68 dotatate , respectively . water : acetone : acetic acid ( 3:2:1 ) saturated with sodium chloride ( nacl ) was used as mobile phase for n-13-nh3 . the radioactivity profile and rf the amount of organic solvents present in the test samples was estimated by gc using fid detector . the temperature of detector , oven , and injector were kept constant for all pet radiopharmaceuticals . hydrogen , air flow , and nitrogen flow rate were also kept constant for all samples . reference standard of ethanol ( 4000 ppm ) and acetonitrile , ( 400 ppm ) and samples ( 2 - 3 l ) were injected into the gc column and an analysis report was generated . the concentration of ethanol and acetonitrile in the sample was calculated by the following formula : where c1 and c2 are the concentration of standard and sample . the chemical purity was calculated for f-18 fdg as kryptofix 2.2.2 ( amino polyether ) may be present in the final product of f-18 fdg . the permissible limit for kryptofix 2.2.2 is 0.22 mg / ml . a total of 4 - 5l of f-18 fdg test sample and the reference standard of kryptofix 2.2.2 ( 0.22 mg / ml ) were developed in the mobile phase composed of methanol : ammonia ( 9:1 , v / v ) . the developed strips , after drying , were exposed to iodine vapors in a closed container of iodine crystals . robertson cooked meat medium broth ( rcmb ) was used for cultivation of aerobes and anaerobes , especially pathogenic clostridia . small inoculation was made near the bottom of the tube and incubated at 37c for 7 days . the samples were observed every day for 7 days to observe the turbidity or bubble formation by organisms . the widely used and accepted test for assessing the presence of bacterial endotoxin in a radiopharmaceutical preparation is limulus amebocyte lysate ( lal ) test . the estimation of bacterial endotoxin test is based on the formation of gel clot in the presence of endotoxin . this test was performed in randomly selected samples for each pet radiopharmaceutical ( n = 25 ) in a thermally regulated and vibration - free environment . the permissible limit of endotoxin in injectable formulation is 175 eu / v according to usp and per mlaccording to ph . the endotoxin concentration in positive water control ( pwc ) was 0.25 and 0.5 eu/ ml . each sample was diluted at two different maximum valid dilutions ( mvds , i.e. , 350 and 700 times to match with the above - mentioned dilutions of endotoxin . lal reagent water was used as negative control . after adding reagents in appropriate volume and concentration according to the protocol , the test vials were incubated for 60 min at 37 1c and were inverted to observe the formation of gel . the product of f-18 fdg , ga-68 dotatate , and n-13 nh3 , were clear , colorless , and free from particulate matter . the ph of all the samples of f-18 fdg , n-13 nh3 , and ga-68 dotatate was in the range of 5.0 - 6.5 . the half - life of radionuclide of f-18 fdg , n-13 nh3 , and ga-68 dotatate samples with graph were 110 , 10 , and 69 min , respectively [ figures 1a c ] . the calculated t1/2 ( mean ) from the measured values using the above - mentioned formula was 115.5 , 10.8 , and 67.5 min , respectively . single peak corresponding to photon energy of 511 kev was observed in the gamma ray spectrum of f-18 fdg and n-13 nh3 [ figures 2a and b ] . in gamma ray spectra of ga-68 , one prominent peak corresponding to photon energy of 511 kev and a small sum peak corresponding to 1022 kev were observed [ figure 3a ] . no peak was observed when the spectrum was recorded with ga-68 point source after 24 and 48 h [ figure 3b ] . based on half - life measurement and gamma spectra , the radionuclide purity was almost 100% . the retardation factor ( rf ) of f-18 fdg , ga-68 dotatae , and n-13 nh3 were in the range of 0.39 - 0.48 , 0.16 - 0.23 , and 0.64 - 0.73 [ figures 4a c ] . single peaks were observed in each sample of all three pet radiopharmaceuticals used which demonstrated the radiochemical purity more than 99% . graphical demonstration of time - activity curve on semilogthermic graph for determination of t1/2 of ( a ) f-18 , ( b ) n-13 , and ( c ) ga-68 spectra obtained by using mca ( a ) f-18 fdg ( b ) n-13 nh3 spectra of ga-68 obtained by using mca ( a ) after elution , ( b ) 24 h after elution instant thin layer chromatograms of ( a ) fluorine-18 fluorodeoxyglucose , ( b ) ga-68 dotatate , and ( c ) n-13 nh3 the concentration of ethanol and acetonitrile of f-18 fdg sample was in the range of 20 - 1695ppm and 3 - 57 ppm , respectively [ figure 5a , b ] . however , the concentration of ethanol in ga-68 dotatate was in the range of 294 - 1147 ppm [ figure 6a , b ] . gc was not performed for n-13 nh3 samples as organic solvents were neither used nor formed during the synthesis of n-13 nh3 . the violet - brown color was developed in a standard kryptofix strip when exposed to iodine vapors . however , no color band was visible when f-18 fdg sample strips were exposed to iodine vapors [ figure 7 ] . gas chromatograms of ( a ) ethanol and acetonitrile standard and ( b ) fluorine-18 fluorodeoxyglucosesample gas chromatograms of ( a ) ethanol standard and ( b ) ga-68 dotatate sample showing chromatograms of ( a ) kryptofix standard ( 0.22 mg / ml ) , ( b ) f-18 fdg samples , developed in methanol : ammonia ( 9:1 , v / v ) and exposed to iodine vapors ; ( c ) iodine chamber no microbial growth was observed in the samples of f-18 fdg , n-13 nh3 , and ga-68 dotatate . gel formation was not observed in the samples of f-18 fdg , n-13 nh3 , ga-68 dotatate , and in negative water control . however , gel was formed in pwc and positive product control at an endotoxin concentration of 0.25 and 0.50 eu / ml . all the results are summarized in table 1 . the visual inspection per batch of in - house synthesized pet radiopharmaceutical is important and mandatory prior to use in the patient and is also a measure of process performance and validation . presence of particulate matter in a test sample indicates possible failure at some stage of radiopharmaceutical synthesis . this may include the failure of the purification , sterilizing filtration , and inadequate environmental control during assembly of reagents in the preinstallation stage . however , a slight yellow color in the f-18 fdg preparation is acceptable according to ph . a precisely measured count at two points within a 10 min interval is sufficient to determine the physical half - life of f-18 and ga-68 . however , the counts were also taken at 10 min interval up to 2 h and half - life was calculated at which the activity / counts were reduced to half . in our tests , the gamma spectrum of a test sample demonstrated a major peak at 511 kev and a sum peak at 1022 kev . but the presence of a 511or 1022 kev peak in the g ray spectrum is not sufficient to determine radionuclidic identity . impurities such as n ( arising from o impurity in the o - water ) or other positron emitters may not be detected , as gamma peaks with an energy of 511 and 1022 kev sum peak are a common feature of positron emitters . a combination of gamma spectrum and the half - life measurement provides the best assurance of the identity and purity of the radionuclide . the measured half - life will be lower if n-13 impurity is present in fdg . as the half - life of n-13 is only 10 min therefore , activity as a measure of counts at 2 min interval is important . the ga-68 sample prepared for gamma spectra was kept for 48 h in order to decay all ga-68 present to a level that permits the detection of long lived ge-68 impurity . the gamma photons resulting from the decay of ge-68 will have energy of 511 kev and a sum peak of 1022 kev may also be observed . in our study , we could not find any energy peak at 24 and 48 h. these results demonstrated that ge-68 is not present at detectable range . the availability of nonmetallic silica based column generator eliminates the additional purification step for removal of metallic ions by cation exchange column . only single peak was observed in tlc scans of f-18 fdg , ga-68 dotatate , and n-13 nh3 . the rf of the principal peak corresponded with the studied radiopharmaceuticals [ table 1 ] . radio - tlc provides an easy and reliable means to determine radiochemical identity and purity of radiopharmaceuticals . narrow range of rf values of the principal spot in the test samples confirmed the radiochemical identity of f-18 fdg , ga-68 dotatate , and n-13 nh3 . radioactivity was measured in a dose calibrator after calibration with an appropriate reference standard , cs-137 ( 662 kev ) . the total radioactivity , volume ( mbq / ml or mci / ml ) and reference time of radiopharmaceuticals were specified on product vial label . on the basis of this information , radioactivity per patient was dispensed and exposure to the worker was also reduced . the ph of f-18 fdg , ga-68 dotatate , and n-13 nh3 fall within the range , that is , 4.5 - 8.5 . the allowed range of acceptable ph for radiopharmaceuticals is broad ; hence , ph meter was not used . a narrow range ph strip was used and the results were within the reference ph range . the ph check of n-13 nh3 is very important as the radio - labeled nitrates may be carried over during the reduction and distillation process . acetonitrile / ethanol is used during synthesis for reagent preparations and conditioning of the purification cartridges . traces of these organic solvents may potentially contaminate f-18 fdg and ga-68 dotatate and therefore should be controlled . the permissible limit of acetonitrile is 400 ( 0.04% ) and of ethanol is 4000 ppm ( 0.4% ) . ga-68 dotatate was eluted in ethanol , but the concentration of ethanol in random samples was within the permissible limit [ table 1 ] . organic solvent was not used in the preparation protocol of n-13 nh3 synthesis and thus there was no requirement of gc . no color band / spot was visualized in the chromatogram of f-18 fdg when exposed to iodine vapors after developed in methanol : ammonia ( 1:1 ) . these results demonstrated that kryptofix was not present at detectable range in f-18 fdg samples . kryptofix , a cyclic crown ether , acts as catalyst and binds the potassium ion to prevent the formation of f-18 kf , therefore , enhances the reactivity of ( f-18 ) ion . kryptofix may cause apnea and convulsions ; therefore , it must be within appropriate limits ( 0.22 mg / ml ) and conformance with these limits is to be demonstrated . currently available automatic synthesis modules have multiple removal steps to reduce the amount of kryptofix to negligible level . we have used rcmb as it has the ability to initiate growth of bacteria from very small inocula and also maintain the viability of cultures for longer duration . moreover , rcmb is routinely used in the department of microbiology , so there was no need for growing reference bacteria . the gel was not formed in any of the samples indicated the absence of endotoxin in f-18 fdg , ga-68 dotatate , and n-13 nh3 test samples . all positive controls demonstrated the gel formation even with the endotoxin concentration of 87.5eu / ml . however , negative control and samples did not show any gel formation . f-18 fdg , ga-68 dotatate , and n-13 nh3 comply with requirements for intravenous administrations . f-18 fdg , ga-68 dotatate , and n-13 nh3 conformed to various quality attributes of purity ; efficacy and safety in the samples included in this study and comply with all requirements for injectable radiopharmaceutical products .

purpose of the study : to study quality control parameters of routinely prepared positron emission tomography ( pet ) radiopharmaceuticals.materials and methods : three pet radiopharmaceuticals fluorine-18 fluorodeoxyglucose ( f-18 fdg ) , n-13 ammonia ( n-13 nh3 ) , and ga-68 dotatate ( n = 25 each ) , prepared by standardized protocols were used . the radionuclide purity , radiochemical purity , residual solvents , ph , endotoxins , and sterility of these radiopharmaceuticals were determined.results:the physical half - life of radionuclide in radiopharmaceuticals , determined by both graphical and formula method , demonstrated purity of radionuclides used . ph of all pet radiopharmaceuticals used was in the range of 5 - 6.5 . no microbial growth was observed in radiopharmaceutical preparations . the residual solvents , chemical impurity , and pyrogens were within the permissible limits.conclusions:all three pet radiopharmaceuticals were safe for intravenous administration .

posttraumatic diaphragmatic rupture was first described by sennertus in 1541 , but successful surgical treatment was described much later , by ralfi in 1886 . a study performed by carter et al . revealed that most diaphragmatic ruptures are caused by blunt injuries ( 75% ) , and the rest are the result of penetrating injuries . about 80 - 90% of diaphragmatic ruptures the defect is usually localized in the left posterolateral aspect of the muscle ( bochdalek 's foramen ) ( 85 - 90% of cases ) . right - sided congenital diaphragmatic herniation occurs in 5 - 10% of cases , and is usually associated with delayed presentation of non - specific symptoms . a 13.5-year - old girl was admitted to the pediatric surgery department from the pediatric department of the district hospital , where she was admitted the previous day , because of stomachache and vomiting . thorough medical interview revealed blunt injury of the epigastrium caused by a ball a week ago , and an episode of stomachache and emesis a few months ago . physical examination revealed tenderness of the right epigastrium , significant reduction of the vesicular murmur on the right side of the chest and no peristalsis . chest and abdomen x - ray examination revealed a loss of the right diaphragmatic outline , irregular radiolucency with a fluid level on the right side of the chest , collapsed right lung and mediastinal displacement to the left ( fig . preoperative chest x - ray the nasogastric tube was visualized inside the stomach , below the left diaphragmatic outline ( fig . scan showed a small ( several centimeters ) defect of the right diaphragm and dislocation of the intestines and greater omentum into the chest and also liver displacement to the left ( fig . preoperative chest x - ray with nasogastric tube preoperative chest ct scan aspartate transaminase ( ast ) and alanine transaminase ( alt ) activity and the total concentrations of bilirubin and crp were slightly elevated . because of persistence of stomachache and volvulus symptoms , the patient was operated on . herniation of the intestines and half of the stomach into the defect in the posterolateral part of the right dome of the diaphragm was revealed . the diaphragm was cut along the course of the right diaphragmatic artery and the volvulus of half of the stomach , the transverse and a large part of the ascending and descending colon and greater omentum was released . the diaphragmatic defect seemed oval - shaped , and the edge of the aperture was smooth ( fig . 4 ) . there were no signs of necrosis or gastrointestinal perforation or other internal organ injuries . drainage of the right pleural cavity was placed in the thorax and the lung was expanded . the diaphragmatic defect during the operation chest x - ray performed on the 3 post operative day did not show any features of the diaphragmatic hernia . most posttraumatic diaphragmatic ruptures are located on the left side of the diaphragm and are the result of lower elasticity and vulnerability of this side , and also of the liver anatomy . right - sided diaphragmatic rupture is usually associated with massive injury ( 44 - 94% ) which results in liver , splenic and renal injuries and also pelvic and long bone fractures , large blood vessel injuries and head injuries . a congenital diaphragmatic defect is usually located in the left part of the muscle . only 5 - 10% of innate diaphragmatic defects are situated on the right side , and the symptoms are often atypical [ 68 ] . in our case the abdominal injury was mild , and it did not cause any specific internal organ injuries . the episode of stomachache and emesis a few months earlier might be a symptom of temporary herniation of the intestine into the congenital diaphragmatic defect . in the case of a patient with suspicion of posttraumatic diaphragmatic rupture , x - ray examination of the chest and abdomen , performed with a nasogastric tube , , the x - ray of the chest did not exclude the possibility of right - sided diaphragmatic rupture . only ct of the chest and abdomen enabled 3 dimensional reconstruction and appropriate assessment of anatomical structures . according to the literature , the main cause of delay in diagnosis of posttraumatic hernia is no sign of dislocation of abdominal organs into the chest in radiological examination . in the literature there are reports that in 8% of cases , the diagnosis of diaphragmatic rupture is missed from 18 days up to 15 years . an innate diaphragmatic defect , which could be the cause of the diaphragmatic hernia , might remain undiagnosed , as long as there is no herniation of the abdominal organs into the chest . in our case , the small innate defect of the diaphragm became a gateway for diaphragmatic herniation and the relatively mild injury caused dislocation of abdominal contents into the thorax with volvulus of the dislocated colon . the innate diaphragmatic defect in our patient could have remained asymptomatic and undiagnosed without the posttraumatic herniation of the abdominal organs into the chest and subsequent volvulus .

we present the case of a 13.5-year - old girl who was admitted to the pediatric surgery department from the pediatric department of a district hospital , where she stayed because of stomachache and vomiting . interview revealed blunt injury of the epigastrium a week ago . chest x - ray revealed a loss of the right diaphragmatic outline , irregular radiolucency on the right side of the chest , collapsed right lung and mediastinal displacement to the left . the patient was operated on , and the surgery revealed herniation of the intestines and half of the stomach into the defect of the right dome of the diaphragm . the patient made an uneventful postoperative recovery . a small innate defect of the diaphragm can remain asymptomatic and undiagnosed as long as there is no herniation of the abdominal organs into the chest .

floral thermogenesis plays a crucial role in pollination biology , especially in plant pollinator interactions . we have recently explored how thermogenesis is related to pollinator activity and odour release in magnolia sprengeri . by analyzing flower temperatures , emission of volatiles , and insect visitation , we found that floral blends released during pistillate and staminate stages were similar and coincided with sap beetle visitation . thus , odour mimicry of staminate - stage flowers may occur during the pistillate stage and may be an adaptive strategy of magnolia species to attract pollinators during both stages , ensuring successful pollination . in addition to the biological significance of floral thermogenesis in magnolia species , we explored the underlying regulatory mechanisms via profiling mirna expression in m. denudata flowers during thermogenic and non - thermogenic stages . we identified 17 mirnas that may play regulatory roles in floral thermogenesis . functional annotation of their target genes indicated that these mirnas regulate floral thermogenesis by influencing cellular respiration and light reactions . these findings increase our understanding of plant pollinator interactions and the regulatory mechanisms in thermogenic plants .

the sedentary life style easily leads to a forward head posture ( fhp ) , and the clinical expenses related to fhp has increased1 . fhp is a poor habitual neck posture that induces biomechanical changes in the head and spinal columns2 , 3 . fhp is strongly associated with various symptoms such as neck muscle pain and fatigue , headaches , and less motilities of the neck1 , 2 , 4,5,6 . many researchers have studied fhp and its relationships with the neck muscles because of its prevalence in musculoskeletal disorders of the head and neck1 , 2 , 4,5,6,7 . however , to our knowledge , no research has reported on the neck and scapular stabilizer muscle activations according to various neck flexion and extension angles in subjects with fhps . the previous study8 have only been studied in healthy individuals or have focused on either the neck muscles or scapular stabilizer muscles in a specific neck position7 , 9,10,11 . therefore , in this study , we investigated upper trunk and neck muscle activities according to the angle of neck flexion and extension in subjects with fhps . lateral views of each subject were photographed to measure the craniovertebral angle , which was defined as the angle between the horizontal line running through the c7 spinous process and the line connecting the tragus of the external auditory meatus and the c7 spinous process . subjects with angles less than 53 were considered to have fhps10 . in this study , a telemyo 2400 ( noraxon , usa ) was used to measure the activities of the muscles surrounding the neck . the muscle activity was measured three times in each of three positions ( the neutral position , an angle of 30 , and a full rom ) in both neck flexion and extension in accordance with the protocols of the previous study8 . the electrodes were attached over the sternocleidomastoid muscle , splenius capitis and splenius cervicis muscles , upper trapezius muscle , and middle trapezius muscle8 , 10 . the purpose and procedures of this study were explained to all subjects , and they provided written informed consent prior to participation . a repeated measure anova and a post hoc lsd test were conducted to determine muscle activity according to neck movement angles . in the present study , we observed changes in neck muscle activity according to neck position . there were significant differences in the muscle activities of the sternocleidomastoid muscle and middle trapezius muscle ( p<0.05 ) ( table 1table 1.comparison of muscle activities according to the neck positionmuscleactionneutral30-degree anglefull romsternocleidomastoid muscle ( % mvic)flexion4.71 4.095.36 4.587.28 6.15 extension6.72 4.77 9.45 8.82splenius capitis & splenius cervicis ( % mvic)flexion13.37 16.6314.98 18.6714.65 13.25extension12.16 14.5713.14 13.26upper trapezius ( % mvic)flexion5.31 5.005.42 5.625.36 5.29extension5.32 5.295.23 4.93middle trapezius ( % mvic)flexion11.75 8.1112.61 9.1512.51 8.55extension11.18 7.89 10.69 7.76 values are expressed as mean sd . the activity of the sternocleidomastoid muscles showed significant differences between the 30 flexed position and the full rom position , and between the neutral position and the full rom position ( p<0.05 ) . for the activity of the middle trapezius muscle , it showed a significant reduction in the 30 extended position and the full rom position compared to the neutral position ( p<0.05 ) . this study investigated upper trunk and neck muscle activities according to the angle of neck flexion and extension . we compared three neck flexion positions : ( 1 ) neutral neck position , ( 2 ) 30 degree neck flexion ( 3 ) , and maximum neck flexion . we also compared three neck extension positions : ( 1 ) neutral neck position ( 2 ) 30 neck extension , and ( 3 ) maximum neck extension . the results showed that the sternocleidomastoid muscle and middle trapezius muscle activities are different according to neck position . the first finding of this study was that the activation of the sternocleidomastoid muscle was greatest in the full flexed position , but there were no significant differences between the neutral and middle ranged neck flexion . lee et al.8 reported that sternocleidomastoid muscle activities between the neutral and middle range neck flexion also have significant differences in healthy adults . they suggested that the mean data of activations of the sternocleidomastoid muscle in the neutral position demonstrated 3.34 2.2 , which was lower than we found in our study . therefore , we assumed that higher activations of the sternocleidomastoid muscle in the neutral position in subjects with fhp would not be able to cause significant differences between the neutral and middle range neck flexed position . we also presumed that the muscle activities of the sternocleidomastoid muscle were significantly activated in the full flexed position in subjects with fhps . cheng et al.7 reported that sternocleidomastoid muscle activities are significantly increased with the increasing flexion and extension angles , which is similar to the trends found in our study . moreover , we found that greater neck extension angles showed less muscle activation in the middle trapezius . a previous study9 reported that the activation of the middle trapezius increased significantly in the slouched sitting posture compared to the erect one . furthermore , gaffney et al.11 reported that scapular adduction was coupled with cervical extension . therefore , we estimate that the middle trapezius is reduced in cervical extension because it may lead to scapular adduction . the limitations of this study were that we did not measure the neck and scapular motion . thus , we were not able to determine the relationships between scapular movements and neck motions , which could affect the upper trunk and neck muscle activities . however , the results of this study could provide fundamental data for understanding neck and scapular muscle activation in head flexed and extended positions in subjects with fhps , which are commonly performed in daily life .

[ purpose ] this study investigated changes in neck and upper trunk muscle activities according to the angle of movement of the neck in subjects with forward head posture . [ subjects and methods ] twenty subjects with forward head postures were recruited . the activities of the sternocleidomastoid muscle , splenius capitis and splenius cervicis muscles , upper trapezius muscle , and middle trapezius muscle during flexion and extension were assessed . [ results ] the activity of the sternocleidomastoid muscle showed significant differences between the 30 flexed position and the full range of motion position , and between the neutral position and the full rom position . the activity of the middle trapezius muscle showed a significant reduction in the 30 extended position and the full rom position as compared to the neutral position . [ conclusion ] in the full flexed position , sternocleidomastoid muscle activity increased significantly , and during extension position , the middle trapezius muscle reduced its activities .

sickle cell disease ( scd ) is an inherited disorder of hemoglobin ( hbs ) leading to complications in multiple organ systems . many complications are due to either recurrent vasoocclusion or chronic hemolysis . frequently observed manifestations of hepatic and biliary tract disease in sickle cell disease patients include vaso - occlusion of hepatic sinusoids due to the sickling process , hemosiderosis from chronic transfusions , viral hepatitis , and cholelithiasis due to chronic hemolysis . in many patients acute vaso - occlusion is a common event resulting from polymerization of deoxygenated hbs leading to decreased pliability of red blood cell ( rbc ) membrane leading to sickle shaped cells , and increasing the adhesiveness of the rbc membrane to the endothelium of small vessels . when sickling occurs in the bone , these changes result in microvascular occlusions that cause ischemia which manifest as vaso - occlusive pain crises . in the liver , vasoocclusion of sickled rbcs in addition , kupffer cell hypertrophy from increased phagocytosis of the sickled rbcs contributes to further sinusoidal obstruction . this phenomenon of sickle rbc induced sinusoidal obstruction has been termed sickle cell hepatopathy . sinusoidal congestion and ischemic necrosis may lead to cirrhosis . in one study by traina et al . , among 20 scd patients with liver dysfunction who underwent liver biopsy 19 patients demonstrated sickle cell hepatopathy from intra - sinusoidal congestion and vaso - occlusion . congestion of hepatic sinusoids may manifest as a transient acute hepatic crisis associated with right upper quadrant pain , jaundice , fever , leukocytosis , increased serum aminotransferases and elevated bilirubin . however , rarely the sequestration of sickle cells in the hepatic sinusoids may lead to more severe and potentially fatal sickle cell intrahepatic cholestasis ( scic ) , which usually presents as acute hepatic failure from local ischemia . while treatment with red cell transfusions improves survival over supportive management alone , it is often ineffective with a mortality of 17% in chronic intrahepatic cholestasis . the role for orthotopic liver transplant ( olt ) in patients with scd and liver disease is not well defined . there have only been several cases of olt for sickle cell disease patients with liver failure . we describe a case of a patient with sickle cell anemia and end - stage liver disease from sickle cell cholestasis who underwent a successful olt and was maintained on perioperative transfusions with a long - term survival . our patient is a 37 year old african american male with homozygous sickle cell disease whose course included intermittent vaso - occlusive crises resulting in 1 - 2 hospitalizations per year . he has a history of cholecystectomy in 1991 and hospitalizations for acute pulmonary infiltrates in 1992 and 1998 . his estimated rbc transfusion burden was ~20 units prior to his olt . throughout his adult course aminotransferases ( ast , alt ) and bilirubin were elevated ( figure 1 ) . viral serologies for hepatitis b , hepatitis c and human immunodeficiency virus were negative and ferritin was 129 ng / ml . in 2005 , treatment with hydroxyurea 1 g daily was started and he used occasional opioids as needed . in august 2006 , 8 months prior to orthotopic liver transplant , he developed jaundice . his total bilirubin was 14.0 ng / dl , alkaline phosphatase 614 , ast 176 , alt 110 , and ferritin 237 ng / ml . liver biopsy in november 2006 showed severe cholestasis , bile ductular proliferation and cirrhosis ( figure 2 ) . rbc exchange transfusions were begun and continued every 4 - 6 weeks to achieve hgb s concentrations < 30% . one month prior to his transplant , he was maintained on simple rbc transfusions to maintain hgb > 7 g / dl . in march 2007 he was admitted to the intensive care unit with severe anemia , acute renal insufficiency , and deepening jaundice . laboratory data included hgb 5.8 g / dl , hct 17.1 , hgb s 15.7% , bilirubin 46.5 , alk phos 387 , ast 223 , alt 93 , and creatinine 4.5 . he was evaluated and listed for olt with a model for end - stage liver disease score of 40 . fourteen days later he underwent an orthotopic liver transplantation from an abo matched adult cadaveric donor . the patient was transfused with 3 units of packed rbcs , 1000 ml of 5% albumin and 3 liters of crystalloid . the donor graft appeared normal ; the cold ischemia time was 9 hours and the warm ischemia time was 28 minutes . the graft liver was placed in a standard piggyback fashion with bile duct - to - duct anastomosis . the liver explant showed cirrhosis with marked autolysis , and cholestasis with bile duct proliferation . the post - operative course was complicated by seizures and acute respiratory distress , which required intubation during the post - operative course . his hgb was maintained throughout the hospital course between 7 - 10 and hgb s < 2% with rbc transfusions . his urine output , lung function and mental status improved gradually , and he was discharged on the postoperative day 31 in stable condition . the prednisone was gradually tapered and he was maintained on mycophenolate mofetil and tacrolimus long - term . he was maintained on 2 units rbc transfusions every 4 weeks for target of hgb of 10 g / dl for one year . his ast and alt have decreased since the transplantation and liver function has improved ( figures 1 and 2 ) . he had no post - operative sickle cell related complications and 12 months after transplant rbc treatments were stopped and he has been maintained on hydroxyurea . it has been documented that intrahepatic cholestasis has a mortality of 40% without the use of exchange transfusions . in a review of 26 reported patients , khurshid et al . found that with exchange transfusion therapy , the mortality from intrahepatic cholestasis was 17% suggesting that it remains a potentially fatal condition despite medical treatment . in the patient reported here , rbc exchange transfusion therapy every 4 - 6 weeks for 3 months prior to liver transplantation was successful to maintain a target hgb s < 30% , but his liver function continued to decline . a review of the literature identified 10 adult and 5 children with sickle cell disease ( table 1 ) . in 6 of the 10 reported adult cases , liver transplantation resulted in improved function and long - term survival . of the 4 that resulted in post - olt death , 2 were from causes unrelated to the olt or liver dysfunction ( 1 from intracranial bleed 5 months post - op due to pre - existing vascular anomaly and 1 from pulmonary embolism 22 months post - op ) . nevertheless , sickle cell related allograft complications occurred in 5 of the 6 survived cases . among 3 of 5 pediatric cases , transplantation was successful . early studies show on average 10% mortality and > 50% risk of perioperative complications in sickle cell disease patients undergoing a variety of surgical procedures but this can be reduced substantially with preoperative rbc transfusion . sickle cell related complications such as intrahepatic sickling and vaso - occlusion can recur in the graft causing deterioration in function . preoperative transfusion therapy can be used to mitigate the post - op complications . the national preoperative transfusion study evaluating the risk of cholecystectomy in scd patients found that post - op complications of scd were higher in the nontransfused than the transfused group . our patient was heavily transfused in preparation for his liver transplant to decrease sickle cell related complications . notably , post - operative transfusion therapy has been utilized by a majority of the olt cases to reduce risk of long - term graft sickle cell related complications . nevertheless , the intensity and duration of transfusion therapy is not well defined and varies between studies . the experience with our patient suggests that aggressive rbc transfusion is warranted ; however , chronic transfusion therapy places patients at risk for transfusion related iron overload . liver failure secondary to sickle cell intraheptic cholestasis is a complicated clinical problem and in our case , medical management with hydroxyurea , and aggressive rbc transfusions were not able to reverse his declining liver function . olt should be considered as treatment option for sickle cell disease patients with advanced liver failure .

sickle cell disease can lead to hepatic complications ranging from acute hepatic crises to chronic liver disease including intrahepatic cholestasis , and iron overload . although uncommon , intrahepatic cholestasis may be severe and medical treatment of this complication is often ineffective . we report a case of a 37 year - old male patient with sickle cell anemia , who developed liver failure and underwent successful orthotopic liver transplantation . both pre and post - operatively , he was maintained on red cell transfusions . he remains stable with improved liver function 42 months post transplant . the role for orthotopic liver transplantation is not well defined in patients with sickle cell disease , and the experience remains limited . although considerable challenges of post - transplant graft complications remain , orthotopic liver transplantation should be considered as a treatment option for sickle cell disease patients with end - stage liver disease who have progressed despite conventional medical therapy . an extended period of red cell transfusion support may lessen the post - operative complications .

hepatic ischemia - reperfusion ( i / r ) injury is predominantly encountered during hemorrhagic shock , hepatolobectomy , hepatic transplantation , and trauma , which may cause hepatocyte necrosis , liver disfunction , and even liver failure [ 1 , 2 ] . hepatic i / r injury results in the activation of kupffer cells , neutrophils , and platelets , with subsequent inflammation and cell injury . the damage of hepatic sinusoidal endothelial cells contributes to microcirculatory disturbances that eventually exacerbate hepatic i / r injury , creating a vicious cycle . hepatic i / r injury also leads to the upregulation of various proinflammatory cytokines , such as interleukin 2 ( il-2 ) , il-6 , il-1 , tumor necrosis factor ( tnf- ) , and high mobility group box 1 ( hmgb1 ) [ 35 ] . and hepatic i / r injury has been a general and severe disease in our daily clinical work ; thus , the protection of liver against i / r injury has become increasingly important . there exist complicated mechanisms in the occurrence and development of hepatic i / r injury . it has been demonstrated that the activation of kupffer cells , production of cytokines , cell adhesion factor , and reactive oxygen species ( ros ) play a pivotal role in the pathogenesis of hepatic i / r injury [ 6 , 7 ] . the main pathological changes of hepatic i / r injury are the neutrophil infiltration and liver cell death caused by diverse factors . according to the current study , liver cell death of hepatic necrosis , a kind of nonprogrammed cell death responding to external injury , act as organelle swelling and membrane breakdown , following inflammatory reactions . apoptosis , conversely , named type i programmed cell death , was a genetically determined process that started with the activation of cell surface molecule by external factor and , ensuing the expression of related gene , finally resulted in breaking cell into small - membrane - wrapped vesicles , namely , apoptotic bodies [ 9 , 10 ] . there are several signal pathways that work in the regulation of apoptosis and are mainly divided into two interconnected mechanisms : caspase - dependent classical apoptosis and caspase - independent programmed form of cell death . as a classical pathway , caspase - dependent apoptosis is initiated either by extrinsic or intrinsic factors . and transmembrane receptors such as tnf / tnfr and fas / fasl contribute to the origination of extrinsic pathway by receiving external signals , further activating caspase 8 and other downstream caspases [ 11 , 12 ] . on the other hand , bcl-2 family is considered to have an important role in the intrinsic pathway , also called mitochondrial pathway . the representative apoptosis - inhibiting genes are bcl-2 and bcl - xl , and the others are bax and bad . it has been reported that the balance between bax and bcl-2 proteins determines the possibility of cells to survive or undergo apoptosis after a certain stimulus or injury [ 1315 ] . recently , autophagy , as a new manner of cell death , has attracted scientists ' attention worldwide . , macroautophagy is generally known as the formation of autophagosomes , which encircle deserted cellular components or impaired organelles and carry them to lysosomes to form autolysosomes . in a certain extent , autophagy keeps the stabilization of cell by recycling new cell components [ 18 , 19 ] . however , when beyond this range , autophagy will finally result in the cell death with the overweening accumulation of autophagosomes , especially under the continuous stimulation of starvation , hypoxia , and inflammation [ 2025 ] . microtubule - associated protein light chain 3 ( lc3 ) was generally recognized as a marker to monitor autophagy . when autophagy is upregulated , a cleaved cytosolic form of lc3 ( lc3-i ) is integrated to phosphatidylethanolamine to form lc3-phosphatidylethanolamine ( lc3-ii ) , which exclusively is expressed on the autophagosome . in addition , beclin-1 is also a pivotal regulatory factor in the process of autophagy . several proteins could combine with it and influence the function , such as bcl-2 and hmgb1 . except for its own regulatory mechanisms , autophagy is simultaneously controlled by upstream signal pathways , for example , pi3 k / akt , mitogen - activated protein kinase , and mammalian target of rapamycin [ 27 , 28 ] . supposed that inhibitors of caspases could attenuate to hepatic i / r injury if there existed apoptosis only ; however , there was no significant effect according to their results . therefore , it is believable that other mechanisms of cell death also existed in the process of hepatic i / r injury . and this fact was further demonstrated afterwards , especially autophagy related cell death in hepatic i / r injury [ 30 , 31 ] . in brief , there exist several mechanisms of cell death in hepatic i / r injury , including apoptosis , necrosis , and autophagy . therefore , we suspect that if we could find a new drug or method to interfere with or obstruct the process of cell death , the hepatic i / r injury may be ameliorated significantly . ethyl pyruvate , a stable and simple lipophilic ester that originates from the endogenous metabolite pyruvate , has been shown to protect against inflammation and attenuates organ dysfunction in several animal models of clinical illnesses , such as burn injury , severe sepsis , and acute pancreatitis [ 32 , 33 ] . recently , the effects of ethyl pyruvate on i / r injury have also been demonstrated by scientists worldwide . in 2012 , hu et al . reported that ethyl pyruvate reduces myocardial i / r injury by inhibiting the expression of hmgb1 protein in rats , and shen et al . demonstrated that ethyl pyruvate ameliorates hypoxic - ischemic brain injury via anticell - death and anti - inflammatory mechanisms . tsung et al . also showed that ethyl pyruvate protects against hepatic i / r injury by reducing hepatic necrosis and apoptosis . however , they just reveal that ethyl pyruvate might ameliorate hepatic i / r injury through inhibiting the external pathway of apoptosis and necrosis . whether ethyl pyruvate could affect cell death caused by the intrinsic pathway of apoptosis and autophagy was not explored , and the internal relationship was also not clarified ; therefore , we set this experiment to further explore the effect of ethyl pyruvate on hepatic i / r injury and possible mechanisms . ethyl pyruvate was purchased from sigma - aldrich ( saint louis , mo , usa ) . the antibodies used in this study included those directed against hmgb1 ( epitomics , ca ) , tlr4 ( biolegend , ca ) , il6 ( proteintech , ca ) , tnf- ( santa cruz , ca ) , bcl-2 ( cell signal technology , usa ) , bax ( cell signal technology , usa ) , lc3 ( cell signal technology , usa ) , beclin-1 ( cell signal technology , usa ) , inhibitor proteins of nf-b ( ib ) ( cell signal technology , usa ) , inhibitor proteins of nf-b ( ib ) ( cell signal technology , usa ) , and nf-b ( proteintech , ca ) . male balb / c mice ( 68 weeks old , 23 2 g ) were purchased from shanghai laboratory animal co. ltd . the mice were raised in a clean room maintained at 24 2c under a 12 h : 12 h light : dark cycle , with free access to food and water . all animal experiments were approved by the animal care and use committee of shanghai tongji university . a model of segmental ( 70% ) hepatic warm ischemia male balb / c mice fasted for 1624 h and were placed on a sterile experimental table after they had been anesthetized with 1.25% nembutal ( saint louis , mo , usa ) . all the structures in the portal triad ( hepatic artery , portal vein , and bile duct ) to the left and median liver lobes were occluded for 45 min with a metal microvascular clamp . after reperfusion , the abdominal cavity was closed with surgical thread , and the mice were placed in a warm environment until they a woke . group i ( saline only ) : 18 mice were injected with saline via the tail vein 1 h before laparotomy . group ii ( saline + i / r ) : 18 mice were injected with saline via the tail vein 1 h before they were laparotomized and then subjected to i / r for 45 min . group iii ( ep + i / r ) : 54 mice were injected with ethyl pyruvate averagely ( 20 mg / kg , 40 mg / kg , and 80 mg / kg ) via the tail vein 1 h before they were laparotomized and then subjected to i / r for 45 min . group i ( saline only ) : 18 mice were injected with saline via the tail vein 1 h before laparotomy . group ii ( saline + i / r ) : 18 mice were injected with saline via the tail vein 1 h before they were laparotomized and then subjected to i / r for 45 min . group iii ( ep + i / r ) : 54 mice were injected with ethyl pyruvate averagely ( 20 mg / kg , 40 mg / kg , and 80 mg / kg ) via the tail vein 1 h before they were laparotomized and then subjected to i / r for 45 min . six mice were randomly selected from group i and group ii , 18 mice were selected from group iii ( 6 mice in every dose of ethyl pyruvate ) , and all selected mice were killed 4 h , 8 h , and 16 h after hepatic i / r . all sera and liver tissues ( median and left lobes ) were collected and stored for further analysis . sera were collected by centrifuging all blood samples at 2000 rpm for 10 min . the serum levels of alanine aminotransferase ( alt ) and aspartate aminotransferase ( ast ) were measured with an automated chemistry analyzer ( olympus au1000 , japan ) to evaluate the hepatic parenchymal damage . when the mice were killed , their liver tissues ( median and left lobes ) were collected , incubated in 4% paraformaldehyde , and embedded in paraffin wax according to the traditional method . sections ( 4 m thick ) were cut and stained with hematoxylin - eosin ( h&e ) for observation under a light microscope . after they were dewaxed in dimethylbenzene for 10 min , the sections were dehydrated in a graded series of alcohol . antigen retrieval was then performed by microwaving the samples in citrate buffer for four cycles ( in one cycle , the citrate buffer was heated to boiling and cooled for 5 min ) . treatment with 3% h2o2 for 20 min at room temperature blocked endogenous peroxidase activity . the cell membranes were then ruptured with 0.3% triton x-100 ( saint louis , mo , usa ) for 30 min at 37c . nonspecific proteins were blocked with 5% bovine serum albumin ( bsa ) for 30 min . the sections were finally incubated overnight with anti - hmgb1 and anti - nf-b , anti - il-6 , anti - tnf- , anti - bcl-2 , anti - bax , anti - lc3 , anti - beclin-1 , and anti - tlr4 ( the membrane was not ruptured with 0.3% triton x-100 ) antibodies at 4c . on day 2 , the sections were washed with phosphate - buffered saline ( pbs ) and treated immediately with the secondary antibody ( 1 : 500 in pbs ) for another 30 min . the antibody was then visualized with a diaminobenzidine ( dab ) kit and the specimens were observed under a light microscope . fresh liver tissues collected from the mice were fixed in 4% paraformaldehyde on ice for 1 h. the fixed liver tissues were washed three times with pbs for 5 min on ice before they were dehydrated overnight in 30% sucrose ( dissolved in pbs ) at 4c . the tissues were infiltrated with oct ( sakura , usa ) for 2 h on day 2 and then frozen and stored at 80c . sections ( 5 m ) were cut with a freezing microtome and stored at 20c . before analysis , the prepared sections were dried at room temperature for 5 min , after which the oct was dissolved in pbs for 5 min . the cell membranes were ruptured with 0.2% triton x-100 at room temperature for 20 min . nonspecific antigen binding sites were blocked with 5% bsa and the sections were then incubated overnight with hmgb1 ( 1 : 1000 ) at 4c . after the samples were incubated with anti - rabbit antibody for 30 min on day 2 , the cell nuclei were stained with 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride ( dapi ) ( 1 : 1000 ) . the proteins were then incubated in boiling water for 10 min , separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis ( sds - page ) , transferred to a polyvinylidene fluoride membrane ( pvdf membrane ) , blocked with 5% milk for 1 h , and incubated overnight with anti - hmgb1 , tlr4 , nf-b , ib , ib , tnf- , il-6 , lc3 , beclin-1 , bax , and bcl-2 antibodies at 4c . after the samples were incubated with a secondary antibody for 30 min at 37c , the signal was detected with the odyssey two - color infrared laser imaging system ( li - cor biosciences , lincoln , neb ) . after that , tunel staining was performed according to the instructions for the tunel assay kit . finally , total hepatocytes and tunel - positive cells were observed under light microscopy . to observe the autophagic vesicles , liver tissues were fixed with 3% glutaraldehyde in 0.2% mol / l sodium cacodylate . and before being dissected , finally , the cells were observed under the electron microscopy ( jem1230 , japan ) . total rna was isolated from the collected liver tissues using trizol reagent ( takara japan , shiga , japan ) . the rna was reverse transcribed into cdna according to the manufacturer 's instructions ( takara ) . equal quantities of cdna were continuously amplified by pcr in a 10 l reaction volume . all results are expressed as the mean sd . comparison between groups was performed using student 's t - test and one - way analysis of variance . in all comparisons , to assess the effects of ethyl pyruvate on hepatic i / r injury , the levels of alt and ast in sera acquired from each group of mice were measured . as shown in figure 1(a ) , the levels of alt and ast increased clearly in the saline + i / r group compared with the saline group at 4 h , 8 h , and 16 h ( p < 0.05 ) . conversely , there were significant reductions in the levels of alt and ast after ethyl pyruvate ( 80 mg / kg ) treatment at all three time points ( p < 0.05 ) . however , the doses of 20 and 40 mg / kg work ineffectively ( p > 0.05 ) . the pathological features of the liver tissues from the three groups after h&e staining are also shown in figure 1(b ) . the structures of the liver tissues were completely maintained and remained ordered in the saline - only group , whereas a disordered lobular structure , marked hepatocyte necrosis , and polymorphonuclear cell infiltration were observed in the saline + i / r group at 4 h , 8 h , and 16 h. however , the administration of ethyl pyruvate ( 80 mg / kg ) clearly reduced all the pathological features apparent in the saline + i / r group . and the pathological change of ethyl pyruvate ( 20 mg / kg and 40 mg / kg ) was not obviously compared to group ii ( saline + i / r ) . as previously mentioned , apoptosis resulted in the cell death of hepatic i / r injury , causing hepatic disfunction . therefore , to explore the potential protective mechanism of ethyl pyruvate against hepatic i / r injury , we measured the changes in bcl-2 and bax at the cdna and protein levels in the three groups . in view of the ineffective doses of 20 mg / kg and 40 mg / kg , we investigated the possible mechanism with the dose of 80 mg / kg in the next experiments . the expression of bcl-2 and bax cdnas was detected with real - time pcr , as shown in figure 2(a ) . it is clear that ethyl pyruvate pretreatment significantly reduced the expression of bax at 4 h and 16 h and increased the expression of bcl-2 at 4 h and 8 h. ethyl pyruvate also reduced the expression of bax at the protein level at all three time points , and the expression of bcl-2 increased mainly at 4 h and 8 h with ethyl pyruvate treatment ( figure 2(b ) ) . in addition , there existed a similar result showed in immunohistochemistry at 8 h ( figure 2(c ) ) . the apoptotic cells were detected by tunel staining , as shown in figure 2(d ) , and a number of tunel - positive cells were observed in the saline + i / r group , however the amount in i / r + ep group was markedly decreased . it is well known that beclin-1 and lc3 play an important role in the regulation of autophagy . therefore , we examined the changes of beclin-1 and lc3 in both cdna and protein levels separately by real - time pcr and western blot . the results indicated that the levels of beclin-1 and lc3 had a significant reduction with ethyl pyruvate treatment compared to saline + i / r group no matter in cdna or protein level ( figures 3(a ) and 3(b ) ) . and this result is concordant with the change detected by immuohistochemistry at 8 h ( figure 3(c ) ) . on the other hand , the formation of autophagosomes is a pivotal process in the occurrence of autophagy ; hence , we further used the technology of electron microscopy to observe the ultrastructure of hepatic cell . it was shown that a significant ultrastructural morphological change was found in saline + i / r group ( 8 h ) , such as mitochondrial swelling , crest damage , and increase in lysosomal and autophagosome . however , with ethyl pyruvate treatment , liver nuclear chromatin was more homogenous , the structure could still be integral , with less amount of lysosomal and autophagosome ( figure 3(d ) ) . it is well known that hmgb1 is more strongly expressed after the administration of hepatic i / r and migrates to the cytoplasm where it acts . therefore , we detected the level of hmgb1 by real - time pcr and western blot ( figure 4(a ) ) . the results showed that there existed a reduction of expression of hmgb1 with ethyl pyruvate treatment compared to saline + i / r group . meanwhile , we found that hmgb1 was mostly located in nuclei by immunofluorescence in normal tissue and examined the changes in hmgb1 in the liver tissues collected from the three experimental groups using immunohistochemistry . as shown in figure 4(b ) , hmgb1 was clearly located in the nuclei and was expressed at low levels in the saline group . however , after hepatic i / r was induced , hmgb1 was expressed more strongly in the nuclei and had partly translocated to the cytoplasm . in contrast , pretreatment with ethyl pyruvate significantly reduced the expression of hmgb1 , in both the nuclei and cytoplasm . tlr4 , tlr9 , and rage , as the main receptors of hmgb1 , have been shown to contribute to the activity of the hmgb1 signaling pathway in various disease models . here , we firstly detected the expression of tlr4 , tlr9 , and rage on cdna level 8 h after reperfusion . results showed that the expression of tlr4 decreased in i / r + ep group compared to saline + i / r group at 8 h ( figure 4(c ) ) . nf-b signal pathway is activated mainly through the degradation of ib , which plays a pivotal role in promoting inflammation , and tnf- and il-6 are the main cytokines to initiate the process of apoptosis . here we found that the administration of ethyl pyruvate obviously blocked the degradation of ib and ib detected by western blotting . and results also showed that the expression of nf-b , tnf- , and il-6 was only significantly increased in saline + i / r group , as demonstrated by real - time pcr and western blotting . however , ethyl pyruvate treatment resulted in the downregulation of nf-b , tnf- , and il-6 ( figures 4(a ) and 4(c ) ) . in addition , we deeply investigated the location and expression of tlr4 , nf-b , tnf- , and il-6 by immunohistochemical staining . it was markedly to observe that all of these four indexes were expressed more strongly in saline + i / r group than in the saline group at 8 h. in contrast , after ethyl pyruvate treatment , there was a significant reduction in the specific areas in which they were expressed ( figure 4(d ) ) . hepatic i / r injury is a common clinical problem , occurring during traumatic shock , organ transplantation , and surgical operations . have demonstrated that the morbidity associated with liver transplantation and major hepatic resection is closely associated with i / r injury . hence , hepatic i / r injury has already attracted the attention of scientists worldwide . the protective effects of ethyl pyruvate , a stable lipophilic ester , have already been demonstrated in multifarious inflammatory injuries , including sepsis and hemorrhagic shock . here , we have shown that ethyl pyruvate attenuates hepatic i / r injury and that the histopathological changes caused by i / r , such as cellular necrosis , neutrophil infiltration , and cellular swelling , are clearly ameliorated by ethyl pyruvate , which are consistent with changes in alt and ast ( figure 1 ) . it is well known that bax promotes intrinsic apoptosis by forming oligomers in the mitochondrial outer membrane , participating in the release of apoptogenic molecules ; oppositely , bcl-2 inhibits mitochondrial apoptosis by blocking the release and oligomerization of bax . the balance between bax and bcl-2 proteins has also been linked with the induction of apoptosis in cell death in kidney , heart , and brain after i / r [ 4042 ] . and our results showed that the balance could not be maintained because of the increase of bax and decrease of bcl-2 in saline + i / r group , which finally resulted in the cell death . however , with ethyl pyruvate treatment , the number of tunel - positive hepatic cells had a significant decrease ; meanwhile , the balance between bax and bcl-2 trended to normal , with the upregulation of bcl-2 and downregulation of bax ( figure 2 ) . hence , we supposed that ethyl pyruvate ameliorated cell death in hepatic i / r injury by inhibiting the intrinsic pathway of apoptosis . autophagy , type ii programmed cell death , has been reported to participate in causing kinds of organs ' i / r injury , such as lung , heart , kidney , and liver , through form autophagosomes , degrade organelles and essential compositions . therefore , we investigated the effect of ethyl pyruvate on regulation of autophagy in hepatic i / r injury by detecting the expression of beclin-1 and lc3 , two pivotal regulatory genes in autophagy . we clearly found that both beclin-1 and lc3 expressed less with ethyl pyruvate treatment compared to saline + i / r group in all three time points ( figure 3 ) . and it has been demonstrated that the upregulation of beclin-1 promotes the process of autophagy ; meanwhile , lc3-ii is the only protein expressed on autophagosome . based on this , our results showed that ethyl pyruvate might attenuate to hepatic i / r injury by downregulating the process of autophagy . and we further confirmed our thinking by observing the reduction of autophagosomes in ethyl pyruvate treatment group under the electron microscope . here , we had shown that ethyl pyruvate might ameliorate hepatic i / r injury by decreasing both apoptosis and autophagy . and , in the next experiment , we tried to explore possible mechanisms included in this process . recently , hmgb1 , a dna - binding protein , has been recognized as a late inflammatory cytokine during sepsis that is actively released by monocytes and macrophages . in addition to its function in sepsis , the activity of hmgb1 in i / r injury has also been explored by scientists worldwide . in 2008 , martin et al . reported that hmgb1 plays a pivotal role in cardiac i / r injury , and similar studies of other organs have been undertaken , including the kidney , brain , and intestine . in these tissues , hmgb1 is released into the cytoplasm after i / r injury and promotes inflammation by integrating the activities of members of the toll - like receptor ( tlr ) family and the receptor for advanced glycation end products ( rage ) . and some reports had indicated that ethyl pyruvate could decrease the expression of hmgb1 in i / r injury , not including hepatic i / r injury . and as showed in our results , ethyl pyruvate also had the ability to inhibit the expression and translocation of hmgb1 in hepatic i / r injury ( figure 4(b ) ) . whereas how did ethyl pyruvate regulate autophagy by decreasing the expression of hmgb1 ? it is well known that beclin1 is an essential autophagic protein , having an important role in the initiation of autophagy . it includes three identified structural domains , named bh3 domain , central coiled - coil domain , and evolutionarily conserved domain . and antiapoptotic bcl-2 family members , mainly bcl-2 protein , relatively , if this site is competitively occupied by other molecules , the beclin-1-regulated pathway partly activates and promotes the process of autophagy . tang et al . demonstrated that hmgb1 was competed with bcl-2 for interaction with beclin-1 , finally downregulating autophagosome formation in some cell lines , such as mouse panc02 , human hct116 , and mouse raw264.7 . hence , we supposed that ethyl pyruvate might inhibit the process of autophagy in hepatic i / r injury partly because of the interaction between hmgb1 and beclin-1 . on the other hand , as set forth , with the increase of bcl-2 after ethyl pyruvate treatment , the combination between beclin-1 and bcl-2 more closely also resulted in the downregulation of autophagy ( figures 3(e ) and 5 ) . apoptosis can be regulated by cytokines such as tnf- and il-6 which can be enhanced by tlr4 and its related pathway , such as nf-b pathway during i / r injury . in addition , the receptors of hmgb1 are mostly members of the toll - like receptor ( tlr ) family and the receptor for advanced glycation end products ( rage ) . these receptors contribute to the activation of the mitogen - activated protein kinases ( mapks ) and nf-b pathway to facilitate the extracellular function of hmgb1 . importantly , nf-b acts as a transcription factor that mediates the cellular responses to a wide variety of extracellular stress stimuli . it also triggers the upregulation of cytokines such as tnf- and il-6 to initiate the inflammatory responses and process of apoptosis . firstly , we investigated which receptor played the major role to receive the signal from hmgb1 under the effect of ethyl pyruvate in our model . the results of real - time pcr showed that tlr4 decreased significantly with ethyl pyruvate treatment compared to the change of tlr9 and rage . and secondly , results showed that the degradation of ib and ib was significantly blocked by ethyl pyruvate , and the expression of nf-b was also decreased after ethyl pyruvate treatment , which uniformly demonstrated that ethyl pyruvate could downregulate nf-b signal pathway in our model . meanwhile , the expression of tnf- and il-6 was also decreased with ethyl pyruvate treatment in our model . therefore , we suspected that there existed hmgb1/tlr4/nf-b axis to execute the antiapoptotic effect of ethyl pyruvate in hepatic i / r injury ( figure 5 ) . finally , in our experiment , we demonstrated that ethyl pyruvate ameliorated hepatic i / r injury by inhibiting intrinsic pathway of apoptosis and autophagy . and ethyl pyruvate might decrease these two type programmed cell death ( apoptosis and autophagy ) separately through the downregulation of hmgb1/tlr4/nf-b axis and the competitive interaction of hmgb1 with beclin1 .

background . hepatic ischemia - reperfusion ( i / r ) injury is a pivotal clinical problem occurring in many clinical conditions such as transplantation , trauma , and hepatic failure after hemorrhagic shock . apoptosis and autophagy have been shown to contribute to cell death in hepatic i / r injury . ethyl pyruvate , a stable and simple lipophilic ester , has been shown to have anti - inflammatory properties . in this study , the purpose is to explore both the effect of ethyl pyruvate on hepatic i / r injury and regulation of intrinsic pathway of apoptosis and autophagy . methods . three doses of ethyl pyruvate ( 20 mg / kg , 40 mg / kg , and 80 mg / kg ) were administered 1 h before a model of segmental ( 70% ) hepatic warm ischemia was established in balb / c mice . all serum and liver tissues were obtained at three different time points ( 4 h , 8 h , and 16 h ) . results . alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , and pathological features were significantly ameliorated by ethyl pyruvate ( 80 mg / kg ) . the expression of bcl-2 , bax , beclin-1 , and lc3 , which play an important role in the regulation of intrinsic pathway of apoptosis and autophagy , was also obviously decreased by ethyl pyruvate ( 80 mg / kg ) . furthermore , ethyl pyruvate inhibited the hmgb1/tlr4/ nf-b axis and the release of cytokines ( tnf- and il-6 ) . conclusion . our results showed that ethyl pyruvate might attenuate to hepatic i / r injury by inhibiting intrinsic pathway of apoptosis and autophagy , mediated partly through downregulation of hmgb1/tlr4/ nf-b axis and the competitive interaction with beclin-1 of hmgb1 .

most societies have culturally specific ways of explaining disease and of treating health problems , and official western medicine often exists together with other forms of care.1 three superimposed and interconnected domains of healthcare have been identified : the informal domain , which includes lay people ; the popular domain , which includes traditional healers and so - called witch doctors ; and the professional domain , which includes legally sanctioned professionals such as western medical physicians . western scientific medicine is also known as official medicine.2 the informal domain is where disease is first recognized and where care begins . it includes self - medication ; therapeutic tips or counseling from relatives , friends , neighbors or peers ; healing practices or mutual support activities conducted by groups linked to churches , religious sects or self - help organizations ; and consultations with other lay people who have gone through similar experiences. in 1978 , estimates indicated that 70% to 90% of healthcare activities in both western and non - western societies were carried out in the informal domain.3 self - medication is a common phenomenon all over the world and is linked to the perceived quality of a country s healthcare system . 4 even in industrialized countries , many simple medications are available for routine use and are sold without a medical prescription in pharmacies , drugstores or even supermarkets.5 to quickly relieve their discomfort , or because they lack other options , patients are often compelled to use either manufactured or homemade medicines without appropriate medical supervision . a few examples of this practice include the use of lemon balm as a sleep inducer , aniseed to relieve a baby s gas , pain medication for headaches , lemon drops to clear the eyes , boric acid for eyelid edema and breast milk for conjunctivitis in newborns.6 in ocular emergencies , visual prognosis is highly dependent on first - aid measures . the use of self - medication can delay a patient s search for specialized care , aggravate his or her condition and ultimately jeopardize the patient s visual prognosis . piovesan ( 1970)7 emphasized the need to understand the cultural habits of different societies in order to comprehend individual behaviors in respect of health and disease . only then is it possible to intervene and change behavior when necessary . in our review of the literature , we have not found any data on first - aid measures used to treat ocular injuries that ultimately require emergency care . the objective of the present study was to identify self - medication practices involving homemade and manufactured preparations that were used to treat ocular disorders before patients arrived at an ophthalmology emergency care unit . we conducted a cross - sectional analytic survey of patients seen at the ophthalmology emergency unit of the university of so paulo medical school general hospital ( hc - fmusp ) during what can be assumed to be a typical week ( april 1 to april 8 , 2006).8 according to tanaka and melo ( 2001),9 the typical week is the most practical duration for collecting this kind of data . it constitutes a definite and representative time period and makes it possible to collect data that should lead to an understanding of the broader context and allow for the establishment of an assessment framework . we formed a non - probabilistic , readily accessible sample of patients who arrived at the aforementioned service at our facility . patients were enrolled in the study 24 hours a day between 6:00 a.m. on april 1 , 2006 and 6:00 a.m. on april 8 , 2006 . the study included patients who arrived directly at the unit , those who were referred to the unit , and those who were sent for consultations ; there was no prior screening of the target population . patients with communication difficulties or those under the age of 14 years were allowed the help of caregivers and/or legal representatives . patients were excluded from the study if they had a loss of consciousness , multiple traumas with severe pain or if they refused to participate . boric acid and normal saline solutions were categorized as homemade preparations by patients themselves , who described these as natural products without chemicals . the diagnoses were divided into four categories : trauma , inflammation and/or infection , degenerative disorders and other ophthalmologic pathologies.10 in this study , a fifth category was added : no ocular changes . patients seen for follow - up were mentioned but were not included in these categories . patients were asked about their availability and willingness to participate in the survey , and they understood , through a written informed consent form , that participation in the study was voluntary and would not influence their wait time before consultation ; they were also informed that their refusal to participate would not negatively affect their medical care . the data obtained were entered into a database using epidata ( version 9.0 ) software . the survey was approved by the ethics committee of the university of so paulo medical school hospital and supported by fapesp ( research support fund of so paulo ) . the sample included 561 patients , or 95.2% of all patients seen at the emergency unit during our one - week study period . the patients ages ranged from 27 days to 91 years old ( mean = 39.8 years ; sd = 20.9 ) ; 51.3% of the patients were male , and 48.7% were female . sixty - three patients ( 11.3% ) were illiterate , and 301 ( 53.9% ) had completed no more than primary education . among those who stated their monthly income , 136 ( 33.8% ) said that they had no income , and 50.0% of the patients earned less than brl311 ( us $ 182.94 according to the march 2008 exchange rate ) . three hundred three patients ( 55.2% ) were diagnosed with inflammation or infection ; 19.1% presented cases of trauma . no ocular changes were found in 3.6% of patients , and 1.1% of patients were at the er for follow - up consultations ( table 1 ) . of the patients seen at the er , 227 ( 40.5% ) reported self - medicating to treat their affliction . of these , 165 ( 29.4% ) used homemade preparations ( 13.9% referred to products like boric acid and saline solution as homemade preparations ) and 62 ( 11.1% ) used manufactured products ( figure 1 ) . the patients who self - medicated with manufactured products before they arrived at the er reported the following : 59 individuals ( 47.2% ) used drugs at their own discretion or on the recommendation of family members ; 14 ( 11.2% ) used drugs already known from previous therapies ; 7 ( 5.6% ) followed recommendations from friends and neighbors ; and 6 ( 4.8% ) used drugs recommended by the pharmacist ( multiple answers were possible ) . one hundred sixty - five patients ( 29.4% ) reported using a home remedy before arriving at the ophthalmology emergency unit of the university of so paulo medical school general hospital . in most cases , the patient decided to use the homemade product him- or herself ( table 2 ) . the most frequently used products were boric acid ( 53.3% ) and normal saline ( 35.7% ) . seventeen patients ( 10.3% ) reported that their eye condition improved after using homemade preparations . in the use of self - medication to treat ocular symptoms , no significant differences were observed between genders ( p=0.95 ) , different levels of education ( p=0.21 ) or different age groups ( p=0.14 ) ( table 3 ) . likewise , no difference was observed in the pattern of self - medication according to employment status ( p=0.15 ) or place of residence ( p=0.52 ) . while 120 patients ( 52.4% ) complaining of watery eyes used self - medication , only 39.9% of patients without this symptom pursued self - medication ( p = 0.003 ) . other complaints associated with a higher use of self - medication were foreign body in the eye ( p = 0.001 ) , chemicals in the eye ( p = 0.01 ) , red eyes ( p = 0.01 ) and itching ( p=0.02 ) ( table 4 ) . patients diagnosed with inflammation or trauma had the highest rates of self - medication ( 49.5% ) ; those with degenerative disorders exhibited the lowest rates of self - medication ( 13.6% ) ( table 5 ) . self - medication was not associated with the need to use tertiary or emergency care services ( table 6 ) . when a person becomes ill , he or she follows a hierarchy of resort in seeking treatment ; options often include self - medication , consultation with witch doctors or traditional healers , and professional medical care . health decisions are based on lay beliefs about the structure and function of the body as well as about the origin and nature of diseases . according to kleinman ( 1980),2 individuals can self - medicate in a number of ways , and many use pharmaceutical products and traditional medicines or make dietary and behavioral changes based on beliefs and superstitions . in this study , 40.5% of patients with conditions considered to be ocular emergencies reported self - medicating with homemade medicines or preparations before seeking professional emergency care . of these patients , 29.4% used homemade preparations ( 13.9% referred to products like boric acid and normal saline as homemade preparations ) , and 11.1% used industrial medical products ( fig . 1 ) . most of the patients who used homemade preparations did so either on their own initiative or based on recommendations from family members ( table 2 ) ; this highlights the influence of the socio - cultural environment on this kind of behavior . self - medication is a cultural phenomenon that is observed all over the world and encouraged by advertisements that always end with the warning : if symptoms do not disappear , please seek medical advice.lay people are instructed to first use the advertised drug and to only seek medical advice if their symptoms persist . kara - jos et al . ( 1985)11 analyzed knowledge and practices related to ocular health in a sample of the population of campinas , brazil . many patients cited their lack of understanding of healthcare and their difficulty in obtaining medical care as reasons for these practices . in this study , patients who self - medicated with industrialized medical products used drugs that had been recommended by doctors for earlier conditions ; this suggests that patients keep the eye drops or ointments they are prescribed and , when experiencing the same or similar symptoms , tend to use the same product . matos ( 2005)41 states that , when therapies prove successful , a cause and effect relationship is established ( this treats that ) and people believe that they have learned how to treat diseases . in brazil , it has been reported that quite often patients use eye drops they have at home or that have been beneficial to one of their relatives or children in the past ; apparently , it is no overstatement to say that a reasonable proportion of the population ignores the fact that eye drops have different indications and contraindications11 . the use of these substances may delay appropriate treatment of a more serious condition.12 self - medication with manufactured drugs can have a number of dangerous effects . these medications can have a cumulative effect that leads to toxicity and adverse reactions after a person uses them for a long period of time . low doses may lead to the development of bacterial resistance and loss of the drug s efficacy.13,14 some patients ( 4.8% ) used industrialized medicines before coming to the er on the advice of a pharmacist . the habit of searching for this kind of advice has already been clearly identified in brazil . one survey showed that 27.1% of patients sought advice from a pharmacist for the treatment of conjunctivitis ; 13.6% of these patients had attended college.11 the sale of eye drops without a prescription seems to be an increasingly frequent occurrence15 and has been observed in between 77.0% and 86.0% of the drugstores in brazil16,17 . so - called homemade products are also used to help relieve ocular problems . in this study , 29.4% of our patients reported using a homemade preparation before seeking care at the ophthalmology er of the university of so paulo medical school general hospital . we therefore conclude that informal care is relevant among patients with emergency conditions ( fig . we note that even those patients who had suffered trauma ( true emergency cases ) used homemade preparations or readily available drugs before seeking medical assistance at the ophthalmology er ( table 5 ) . in this context , ( 2000)18 reported practices such as rinsing the eyes with milk , oil , tap water , normal saline and boric acid after chemical trauma . other ocular complaints associated with self - medication using homemade preparations or readily available drugs included the following : sensation that a foreign body was in the eye ( p = 0.001 ) , watery eyes ( p = 0.003 ) , ocular exposure to foreign substances ( p = 0.02 ) , itching ( p = 0.02 ) and redness ( p = 0.03 ) ( table 4 ) . before seeking help at the er , 1.8% of the patients used herbal infusions applied with soaked dressings and/or lavage ( table 2 ) . the use of herbal medicines and other natural products is a centuries - old practice based on popular traditions that are almost always orally transmitted from one generation to the next.19 santos et al . ( 1995)20 concluded that 65.7% of elementary school teachers in so paulo , brazil believe that homemade remedies can treat any kind of disease ; 34.3% believe that they can treat certain diseases , and 51.4% think that they know which herbs should be used for which disease . the information taught to children by schoolteachers has an influence on the adoption of practices and behaviors and helps to perpetuate such popular beliefs . ( 1986)21 assessed the knowledge about and use of medicinal herbs and plants among the population and concluded that 95.2% of people know of and use therapeutic plants . in this study , besides ocular dressings and lavages with herbal infusions , 3.2% of patients also reported the use of water ( either faucet or well water , with salt or sugar ) , and 0.2% reported using holy water . while phytotherapeutic agents may contribute to the treatment of ocular conditions , it is well known that the habit of washing the eyes with plant - derived substances may cause irreversible damage , such as that resulting from fungal ulcers.22 the use of faucet or other potable water ( with salt or sugar ) for eye lavage is a dangerous practice that may lead to ocular infections . those who use this kind of preparation may be exposed to contamination from fungi , bacteria and parasites.23,24 in this survey , 15.7% of patients reported using boric acid , and 10.5% reported using a saline solution ( table 2 ) . the use of these products has also been mentioned in cases of acute eye injury . ( 2007)25 concluded that boric acid bottles are often handled inappropriately , leading to contamination ; in addition , many patients keep the bottle open for long periods of time , use the contents to treat several different eye conditions , and share the same bottle among several different individuals . they also found that a great many very simple problems end up in ophthalmologic emergency rooms of a tertiary hospital in so paulo.27 while saline solution is considered to be a neutral substance by the public , its use in ocular lavage also has contraindications.28 another practice identified was the use of breast milk to treat ocular conditions ( 1.4% ) ( table 2 ) . in general , the use of breast milk in the eye is related to the treatment of conjunctivitis . traditionally accepted as a natural remedy , breast milk is used in the eye and , sometimes , is even recommended by pediatricians for newborn babies with conjunctivitis . however , its use is not recommended by ophthalmologists because some forms of conjunctivitis are quite dangerous and , if not treated early , may cause blindness , as in the case of gonorrheal conjunctivitis.29 we note that 40.5% of all patients with a possibly acute eye condition used some form of self - medication as their initial approach to therapy . they used homemade preparations , industrialized products or both and used products that had treated earlier conditions or been recommended by other non - professional people . this approach was common among people of both genders and with different levels of education , and it did not depend on disease severity ( tables 3 , 5 and 6 ) . self - medication and delaying a search for professional medical care are dangerous , and educational measures are necessary to prevent the use of treatments that may cause irreversible damage to the eye . health education is the responsibility of everyone , especially professionals working in the healthcare and education sectors . it is therefore essential to understand patient behaviors following an ocular injury and to design educational projects that help patients avoid dangerous practices that can lead to a poorer prognosis.30 this practice is widespread and is not dependent on the patient s level of education , age , gender or disease severity . such procedures , especially in urgent cases , can be either directly harmful or can cause harm by delaying appropriate care .

ojectivethis study seeks to identify practices of self - medication in the treatment of ocular emergencies . we examine patients use of both homemade preparations and manufactured products before seeking specialized care.materials and methodswe conducted a cross - sectional analytic survey of consecutive patients seen in the ophthalmology emergency room of a teaching hospital.resultsthe sample included 561 subjects , 51.3% males and 48.7% females , with a mean age of 39.8 years . prior to seeking emergency care , 40.5% reported self - medicating ; 29.4% used a homemade preparation ( 13.9% referred to an industrialized product like boric acid as a homemade preparation ) , and 11.1% used a manufactured product . the most frequently used products included a boric acid solution ( 53.3% ) , a normal saline solution ( 35.7% ) , herbal infusions ( 6.1% ) and breast milk ( 4.8% ) . viral conjunctivitis was the most frequent diagnosis ( 24.4% ) , followed by the presence of a corneal foreign body ( 7.4% ) . no significant differences were found in the self - treatment of ocular injuries according to gender ( p = 0.95 ) , level of education ( p = 0.21 ) or age ( p = 0.14 ) . in addition , self - medication practices were not related to the medically judged severity of the condition.conclusionpatients often attempt to treat conditions that require ophthalmologic emergency care by self - medicating with homemade or manufactured products . the most widely used products include boric acid , normal saline , leaf infusions and breast milk . this behavior occurs independently of educational level , gender , age or the nature of the ocular condition . self - medication is a culturally driven practice that is used even in cases of acute ocular injuries .

the clinical efficacy of intra - articular injections of hyaluronic acid have been documented since the 1990s.1,2 intra - articular injections of hyaluronic acid tend to have a longer duration of action than intra - articular injections of steroids and have less severe side effects.3 intra - articular steroids can have serious systemic effects , particularly if the patient has multiple concomitant medical comorbidities , which are not uncommon in the elderly population . further , clinicians are often reluctant to use intra - articular steroids in elderly patients who are immunocompromised and/or at risk of infection , those with diminished joint position sense and peripheral neuropathy , and those who are prone to fluid retention because of renal , cardiac , or liver dysfunction . use of low - level laser dates back to the 1960s and the seminal work of endre mester . since then , further scientific research has demonstrated a positive effect of low - level laser on fibroblast4 and collagen synthesis at the cellular and molecular level , leading in recent years to use of low - level laser therapy ( lllt ) in many clinical applications.5 when managing knee osteoarthritis , most clinicians and surgeons use nonsteroidal anti - inflammatory agents and conventional physical therapy , consisting of ultrasound , transcutaneous electrical therapy , and short wave therapy . however , these conservative treatments only offer short - term symptomatic benefits , and many elderly patients do not tolerate nonsteroidal anti - inflammatory medication well . the purpose of the current prospective , randomized , double - blind , placebo - controlled cohort study was to assess whether combined use of half - yearly injections of hyaluronic acid together with lllt can impact the natural course of the degenerative process , prolong the longevity of the degenerative knee joint , and postpone knee replacement surgery , given that many elderly patients are at high surgical risk and/or are reluctant to undergo surgery . all subjects signed their informed consent before study entry , and the study followed the principles outlined in the declaration of helsinki . the study population consisted of 70 consecutive unselected elderly patients with a mean age of 75 ( range : 7080 ) years and documented radiographic changes of tricompartmental disease in the knee , with no evidence of osteonecrosis on magnetic resonance imaging and evidence of synovitis causing inflammation and pain in the affected knee joint . all of the patients had grade 3 kellgren - lawrence joint degeneration on knee radiographs . exclusion criteria included a previous history of knee joint surgery , history of sepsis in the affected joint , genu varum or genu valgum of more than 20 degrees , presence of osteonecrosis on magnetic resonance imaging of the affected knee joint , and evidence of synovial osteochondromatosis . patients who suffered from autoimmune disease such as rheumatoid arthritis and those who had chronic lower limb muscle weakness , eg , following a cerebrovascular accident , were also excluded . upon entry to the study , protocol a involved combined use of conventional physical therapy with five weekly injections of saline and sham irradiation for 180 seconds . protocol b consisted of standard physical therapy as in protocol a with half - yearly intra - articular hyaluronic acid injections and lllt with use of 810 nm wavelength lasers from an aluminum gallium arsenide semiconductor laser device with 5.4 j per point and a power density of 20 mw / cm . each treatment session lasted 180 seconds and the sham light source used in protocol a had a similar irradiation frequency and application time . at the initial visit , care was taken to document the range of motion , sites of tenderness , and presence and extent of deformity in the affected knees , and patients with significant genu varum or genu valgum were excluded . we used the well - known and validated womac ( western ontario and mcmaster universities osteoarthritis index ) score6 to assess the disability caused by osteoarthritis at the initial and all subsequent follow - up visits . all patients had bilateral knee arthritis and were treated in a randomized manner with both protocol a and protocol b. the five intra - articular doses of hyaluronic acid ( hyalgan , fida , italy ) were administered 1 week apart , on a half - yearly basis . all physical therapy , lllt , and intra - articular injections were administered by david ip to maintain a consistent application technique or nonstandard application of physical therapy machines as well as technique of hyaluronic acid injection to guard against compromising the validity of clinical results obtained . the study was conducted between 2008 and 2015 after an enrolment period of 2 years . altogether , 140 painful knees were treated with protocol a or protocol b. no side effects or discomfort were documented during either treatment regimen . any flare - ups of pain during the mean 7 years of follow - up were treated by physical therapy and lllt . the womac score was used to monitor the clinical progress of all painful joints during follow - up , and the level of pain was monitored by scores on a visual analog scale . the womac questionnaire is a well - known validated tool for assessment of pain , stiffness , physical function , social function , and emotional function in patients with osteoarthritis of the knee . the possible range of pain scores is 020 , where the maximum pain subscore is 20 , the score range for stiffness is 08 , maximum stiffness receives a subscore of 8 , and the score range for physical function is 068 . in our study , we paid particular attention to the pain and stiffness subscores because these are the symptoms most commonly warranting surgery . the five pain questions in the womac questionnaire assess pain experienced in five situations , ie , walking on a flat surface , going up or down stairs , at night while in bed , sitting or lying , and standing upright . the patient s response to each question produces a score that is then summed to derive an aggregate score for each dimension . the womac pain score can be derived using a 010 visual analog scale ( often with a score range of 050 ) , a 0100 visual analog scale ( commonly reported with a score range of 0500 ) , an 11-point numeric rating scale ( commonly reported with a score range of 050 ) , or a likert scale ( commonly reported with a score range of 020 ) . we used a likert scale in this study with a score range of 020 , where 20 represented maximum pain . pain was the most important outcome of interest in this study , with special attention paid to pain subscores . the mean womac subscore for pain upon entry to the study for the 70 knees treated with protocol a was 13 ( range : 1215 ) and the mean stiffness subscore was 6 ( range : 57 ) . the mean womac subscore for pain for the 70 knees treated with protocol b was 14 ( range : 1216 ) and the mean stiffness subscore was 5 ( range : 46 ) . after a mean follow - up of 7 ( range : 6.57.5 ) years , the mean womac subscore for pain in group b was 6 ( range : 57 ) and the mean stiffness subscore was 4 ( range : 35 ) . only one patient had early deterioration of the womac pain subscore back to 13 at the 2-year point and subsequently underwent joint replacement surgery . on the other hand , the mean womac pain subscore after a mean follow - up of 7 years for the 70 knees treated with protocol a was 11 ( range : 1012 ) and the mean stiffness subscore was 4 ( range : 35 ) . fifteen knees treated with protocol a required joint replacement surgery , and the difference in the proportions of knees requiring total joint replacement between protocol a versus b was statistically significant ( p<0.05 ) . the data in this study were roughly normally distributed , so are reported as the median without the need for nonparametric statistical methods . the level of statistical significance was calculated using the p - value obtained by means of chi square testing . the result of the current statistical analysis rejected the null hypothesis that the difference could have been arisen by pure chance at p<0.05 . hyaluronic acid is a polysaccharide composed of repeating disaccharide units , ie , 1,4-glucuronic acid and 1,3-n - acetylglucosamine . it belongs to the group of glycosaminoglycans , but unlike chondroitin sulfate or keratan sulfate , the hyaluronic acid is not sulfated . hyaluronic acid is synthesized by bioactivity of hyaluronan synthase , which has been reported to have three isoforms in humans.7 hyaluronic acid is one of the major space - filling molecules in the extracellular matrix of the articular cartilage , which has a viscoelastic function to help protect the joint during periods of loading . natural hyaluronic acid is organized within the extracellular matrix by specific interactions with other matrix macromolecules . high molecular weight hyaluronic acid at a high concentration in solution can also form entangled networks through steric interactions and self - association between and within individual molecules . they can resist rapid , short - duration fluid flow through the network , thereby having elastic properties that can distribute load or shear forces within the network.8 this type of structure is ideally suited to the dynamic periodic peak joint loading conditions to which the knee is subjected as part of the normal human gait , thereby acting as a shock absorber . in addition to having shock - absorbing and viscoelastic properties that may well help to preserve degenerative knee joints in the elderly , hyaluronic acid injections have been shown to have anti - inflammatory and analgesic properties . in previous animal models of arthritis,9 the mechanism of pain suppression was shown to be related to the effect of these injections on suppressing prostaglandin and bradykinin levels . in addition , higher molecular weight hyaluronic acid injections offer even more pain - relieving effects in arthritic joints.10 the authors are not aware of any long - term follow - up studies that have investigated whether long - term half - yearly injections of five intra - articular injections given on a weekly basis can alter the natural history of wear , pain , and inflammation of the knee joint to a point where joint replacement surgery can be postponed , particularly in the high - risk elderly . the basic science underling lllt is that it involves the use of near infrared light to alter the cellular function such as helping in normalizing the energy usage of body cells , ie biomodulation . over the years , there have been many placebo - controlled studies showing the favorable anti - inflammatory effects of lllt.11,12 standard physical therapy , such as therapeutic ultrasound , has no biomodulating or regulatory effects on the microcirculation or on the genes involved in energy metabolism and oxidative phosphorylation that stimulate increased production of adenosine triphosphate , which in turn regulates other cellular processes leading to normalization of biological function at the cellular level.13 the majority of studies of lllt in patients with knee arthritis have been short - term , and the authors are unaware of any long - term study assessing whether long - term use of lllt can decrease the need for knee joint replacement surgery . this present long - term study of combined use of chronic yearly hyaluronic acid injections coupled with lllt yielded promising results in terms of increasing the longevity of degenerative knee joints , deferring knee joint replacement , or avoiding surgery altogether . this combined long - term use of hyaluronic acid injections plus lllt has never to date been reported in the literature , let alone any assessment as to whether this improved protocol can potentially reduce the need for joint replacement . in general , any protocol that examines how to reduce health care costs , surgical risk , and patient outcomes , as demonstrated for instance by womac scores , has the potential to be useful to the health care community and cut down the tremendous financial burden faced by health care administrators , especially in countries with a rapidly aging population . the current prospective , double - blind , placebo - controlled study showed a statistically significant improvement in joint preservation in elderly patients with degenerative arthritis affecting all three compartments of the knee joint . over a mean 7 years of follow - up , we demonstrated that use of hyaluronic acid injections ( targeting inflammation in the interior of the knee joint ) combined with lllt ( targeting inflammation in the exterior of the knee joint ) is a rational method for treating symptomatic degenerative knee arthritis , which is becoming increasingly common with increasing longevity of population in many societies and placing a huge burden on health care expenditure . larger long - term studies are needed to explore whether once - yearly hyaluronic acid injections can have clinical efficacy similar to that of half - yearly injections in the management of degenerative knee joints . also , further studies need to be undertaken to ascertain whether it was lllt , the injection regimen , or a combination of the two that is most beneficial in elderly patients . finally , the possibility that the current protocol may also benefit younger middle - aged patients suffering from degenerative knee arthritis need to be explored . it should be highlighted that further studies using lasers of similar wavelength , power density , application method , and application time , are needed to make any clinical comparisons meaningful .

backgroundthis study evaluated whether half - yearly hyaluronic acid injection together with low - level laser therapy in addition to standard conventional physical therapy can successfully postpone the need for joint replacement surgery in elderly patients with bilateral symptomatic tricompartmental knee arthritis.methodsin this prospective , double - blind , placebo - controlled study , 70 consecutive unselected elderly patients with bilateral tricompartmental knee arthritis were assigned at random to either one of two conservative treatment protocols to either one of the painful knees . protocol a consisted of conventional physical therapy plus a sham light source plus saline injection , and protocol b consisted of protocol a with addition of half - yearly hyaluronic acid injection as well as low - level laser treatment instead of using saline and a sham light source . treatment failure was defined as breakthrough pain necessitating joint replacement.resultsamong the 140 painful knees treated with either protocol a or protocol b , only one of the 70 painful knees treated by protocol b required joint replacement , whereas 15 of the 70 painful knees treated by protocol a needed joint replacement surgery ( p<0.05).conclusionwe conclude that half - yearly hyaluronic acid injections together with low - level laser therapy should be incorporated into the standard conservative treatment protocol for symptomatic knee arthritis , because it may prolong the longevity of the knee joint without the need for joint replacement .

lymphoepithelioma is a term used to designate an undifferentiated malignant epithelial tumor of the nasopharynx that is histologically distinctive because of a markedly prominent lymphoid infiltrate ( 1 ) . carcinomas with similar histological features arising outside the nasopharynx are called lymphoepithelioma - like carcinoma ( lelca ) . lelca occurs in organs such as salivary glands , the uterine cervix , the thymus , the lung , the skin , the stomach , the bladder , the prostate , and the breast ( 2 ) . it is very rare that lelca occurs in the urinary system , there is one case where it occurred in the renal pelvis , and one case where it occurred in the ureter and the kidney simultaneously , but has not been reported so far in urinary bladder in korea . the author et al . have lately experienced lelca that occurred in the urinary bladder , and thus have reported the case along with philological considerations . a 78-yr - old woman presented with gross hematuria for 2 weeks on november 23 , 2009 . the patient was a non - smoker and had not been exposed to carcinogen . physical examination and vital sign were normal at the time when the patient was admitted to this hospital , numerous rbc were observed on urinalysis . there were no notable findings on blood test and chest radiography . on cystoscopy , a frond - like mass was observed at the bladder trigone , which measured about 1 cm ( fig . 1 ) . since hematuria continued , foley catheterization was performed . on computerized tomography ( ct ) of the abdomen and pelvis , the findings of enhancement and a small - sized mass were observed on the inner surface between posterior walls in the bladder trigone . the findings of perivesical infiltration and lymph node metastasis were not observed . on the authority of above findings , the authors suspected the case to be carcinoma in situ of the urinary bladder or transitional cell carcinoma , and thus transurethral resection of bladder tumor ( turbt ) on histopathological examination , it was found that 90% of lesions were lelca and a few lesions were non - invasive transitional cell carcinoma . on microscopy , syncytial growth pattern and indistinct cytoplasmic borders were observed with the severe infiltration of lymphoid cells . tumor cells were positive for cytokeratin 7 but were negative for cytokeratin 20 ( fig . the infiltrated lymphocytes were composed of abundant cd3 positive t cells and cd20 positive b cells . for leukocyte common antigen ( lca ) , the patient has been without recurrence and metastasis for 3 months after the operation , and currently is on a follow - up . ( 3 ) in 1991 , is uncommon with a reported incidence between 0.4 and 1.3% of all bladder carcinoma ( 4 ) . in the urinary tract , they typically arise in the urinary bladder , although isolated cases have been reported in the renal pelvis , ureter , and urethra ( 5 , 6 ) . as suggested by amin et al . ( 7 ) , lelca was categorized as pure ( 100% ) , predominantly ( more than 50% ) , or focal ( less than 50% ) . if other classification is applied , lelca was classified as pure when 100% of the tumor showed lymphoepithelioma - like carcinoma pattern , and mixed when associated with usual infiltrating urothelial carcinoma , adenocarcinoma , or squamous carcinoma ( 2 ) . it has been suggested that pure / predominant lelca responds to chemotherapy and may best be treated with bladder preservation therapy ( 1 , 13 ) . according to previous reports , pure and predominant lelca is more favorable than focal lelca in prognosis ( 2 , 3 , 7 ) . this case was the predominant type that lelca accounted for over 90% of lesions and was fractionally accompanied with non - invasive transitional cell carcinoma . the differential diagnosis is usually malignant lymphoma , invasive transitional cell carcinoma , squamous cell carcinoma and small cell carcinoma . ( 5 ) note that it is imperative to distinguish between lelca and malignant lymphoma , as primary bladder lymphoma is extremely rare . therefore , immunochemical staining , such as lca and keratin , may be used for differentiation . ( 8) maintained that immunochemical staining techniques were helpful to distinguish bladder lymphoma from undifferentiated carcinoma . pooly differentiated transitional cell carcinoma ( tcc ) with a lymphoid linfiltrate should be distinguishable from lelca in that the latter is characterizied by syncytia of tumor cell , vesicular nuclei and prominent nuclei ( 7 ) . the microscopic findings of lelca are characterized by the indistinct cytoplasmic border and the syncytial growth pattern with the prominent lymphocytic infiltrate . it is important to check cytokeratin in tumor cells on immunochemical staining , in order to ascertain that cells are originated from epithelial cells ( 1 ) . the principal symptoms of lelca were mostly gross hematuria , solitary mass , and tumors measured 1 to 5 cm ( 10 , 12 ) . the epstein - barr virus is regarded as one of factors of the lelca that occurred in the thymus gland ( 9 ) . however , it has not been elucidated that lelca of the urinary system is related with ebv ( 10 ) , gulley et al . ( 11 ) reported that ebv , detected from nasophayneal carcinoma , was not detected in 9 out of 11 cases of lelca . also in 9 cases of lelca reported by holmang et al . for lelca treatment , surgical therapy and chemotherapy can be applied . in the case of small tumors that measure 5 cm and less , turbt is applied , but in the case of big or invasive tumors , radical cystectomy may be applied . as nasopharyngeal lymphoepithelioma is well reacted to chemotherapy , methotrexate , vinblastine , doxorubicin and cisplatin may be applied to chemotherapy ( 7 ) . 13 ) reported that primary chemotherapy was performed on 3 patients with muscle invasive lymphoepithelioma of the bladder and as a result their bladder functions were salvaged . it is presumed that bladder lymphoepithelioma may be well reacted to radiotherapy , like nasopharyngeal lymphoepithelioma ( 14 ) . ( 12 ) applied radiotherapy to 4 patients , but could not evaluate whether the patients got cured successfully . lelca is a rare tumor , and it is important to differentiate it from other tumors .

a 78-yr - old woman presented with gross hematuria for 2 weeks . on cystoscopy , a frond - like mass was observed at the bladder trigone . transurethral resection of bladder tumor was performed for the mass . histopathological findings showed that 90% of lesions were lymphoepithelioma - like carcinoma ( lelca ) and a few lesions were non - invasive transitional cell carcinoma . on microscopy , syncytial growth pattern and indistinct cytoplasmic borders were observed with the severe infiltration of lymphoid cells . the case was followed - up for 8 months without recurrence . this is the first report of a lelca case in korea .

the transcription of structure genes is carried out by the rna polymerase ( rnap ) ii 1 - 3 . there are 12 subunits of rnap ii , with rpb5 , rpb6 and rpb8 shared by rnap i , rnap ii and rnap iii 4 . rpb5 is also an active communicating subunit which serves as targets of transcription factors 5 - 7 . hepatitis h virus ( hbv ) encodes a small x oncoprotein ( hbx ) , which is responsible for the transformation of infected hepatic cells into hepatocellular carcinoma ( hcc ) . later on , a novel gene which encodes the rpb5-mediating protein ( rmp ) was isolated from a human hcc hepg2 cdna library 9 . an unusually large member of prefoldins ( pfds ) , termed as unconventional prefoldin rpb5 interactor ( uri ) , was also identified as an alternative form of rmp , which associates with rpb5 and other small pfds 10 . although the majority of endogenous rmp / uri proteins are cytoplasmic 11 - 13 , both human and yeast uri proteins were identified as a transcriptional factor 9 , 10 , 14 , 15 . the interactions between rmp / uri and rna polymerase ii enable some rmp / uri protein associated with chromatin . polytene chromosome staining revealed that the majority of the rmp / uri positive bands are sites of active transcription 13 . as a transcriptional regulator , rmp represses the activated transcription by vp16 and hbx 9 . a large fraction of genes activated in rmp / uri depletion cells contained a consensus - binding site for gcn4p , a transcription factor related to amino acid biosynthesis . functional analysis revealed that uri is a target of nutrient signalling and involved in controlling of transcription of nutrient - sensitive genes 10 . krek and ours simultaneously uncovered that rmp / uri plays active roles in carcinogenesis 16 , 17 . rmp / uri was amplified and overexpressed in tissues and cell lines of human ovarian carcinomas 16 . the increased copy number of uri genes is selectively required for the survival of ovarian cancer cells . by constitutive binding to pp1 , uri detains pp1 in an inactive state and thus enhances the s6k1 survival signalling 12 . the release of pp1 by the phosphorylation of uri results in apoptosis and cell death . almost at the same time depletion of rmp in the hcc cells resulted in apoptosis which was enhanced by ionizing radiation . an antiapoptotic role of rmp was identified , which supports the proliferation and growth of hcc cells . further in vivo investigation has shown that rmp is required for development and growth of hcc xenograft tumours . rmp has been shown to be required for both the proliferation of hcc cells and the survival of ovarian cancer cells . then our concerns are : is rmp / uri an oncogene specifically in hcc and ovarian cancer , or is rmp / uri simply a gene required for the carcinogenesis of multiple tumours ? is rmp / uri required for the growth of not only hcc cells , but also normal hepatic cells ? or is rmp / uri virtually a gene generally required for the proliferation and development of various normal cells ? therefore it is important to address the effect of rmp on the growth of both normal and cancer cells . in this article , we show that rmp possesses distinct features in hcc cells compared with normal hepatic cells . rmp expression is increased in hcc cell lines as well as in the hcc tissues from patients , compared with normal cell lines or non - tumour tissues . depletion of rmp inhibited the proliferation of hcc cells , but not the normal hepatic cells . the expressions of apoptosis factors respond differently to rmp , which suggests a different mechanism of rmp regulation pathway in the normal and hcc cells . the plasmids pgpu6/neo - scr , pgpu6/neo - rmpi for rmp depletion and pflagcmv4-rmp for rmp overexpression were constructed as described previously 17 . all cell lines used in this article were obtained from our own laboratory of the department of cell biology at soochow university . cells were maintained in mem medium ( gibco - brl , shanghai , china ) supplemented with 10% fetal bovine serum ( fbs ) ( sino - american biotechnology co , shanghai , china ) . the annexin - v - fitc / pi apoptosis detection kit was purchased from bd biosciences ( shanghai , china ) . methyl - thiazolyl - tetrazolium ( mtt ) was purchased from sigma ( shanghai , china ) . antibodies against bax , bcl-2 , p53 and -actin were purchased from boster company ( wuhan , china ) . twenty four hours prior to transfection , a total of 210 cells were seeded into each well of a 24-well plate . these cells were transfected with lipofectamaine 2000 ( invitrogen , shanghai , china ) according to the manufacturer 's protocol . lf2000/dna complexes were allowed to form in optimem with final concentration of 10 g / ml lf2000 . selection of stably transfected cells and western blot analysis were conducted as previously described 17 , 18 mtt assays were carried out as described previously 17 , 18 . briefly , after smmc-7721 and hepg2 cells were cultured for 24 hours , 30 l of mtt ( 5 mg / ml ) was added to each well . crystals were formed and then dissolved by adding 300 l isopropanol acidified with hcl ( 0.04 n ) containing 10% triton x 100 . the plates were read at 570 nm using a microplate reader ( model 550 , bio - rad , shanghai , china ) . cells were exposed to ionising radiation ( ir ) using a co -irradiator at a dose of 2 or 6 gy . cells radiated or unradiated were then stained with annexin v - fitc and propidium iodide ( pi ) and analyzed for apoptosis according to the manufacturer 's instructions ( bd biosciences , shanghai , china ) . briefly , after two treatments with washing buffer , cells were resuspended in 400 l of dulbecco 's phosphate - buffered saline ( pbs ) . then , 100 l of this cell suspension was incubated with 10 l of pi ( 50 g / ml ) and 5 l annexin v - fitc for 15 minutes at room temperature ( rt ) in the dark . cells that stained positive for only annexin v - fitc were in the early stage of apoptosis , whereas cells that stained positive for both annexin v - fitc and pi were in the stage of late apoptosis or primary necrosis . tumor formation assay in nude mice . for the in vivo tumor formation assay , 510 hcc cells of smmc-7721 in 0.1 ml of pbs were injected subcutaneously into the right flank of 15 - 20 g female nude mice ( animal centre of soochow university ) . xenograft tumors developed in the nude mice two weeks later after injection and then the mice were divided into 4 groups , each consisting of 5 mice . the xenograft tumors of each group mice were subjected to treatment by vectors of rmp overexpression , rmp depletion . briefly , a suspension ( 25 l / mouse ) of lipofectamine 2000 ( 20 g ) was mixed with dna vectors ( 10 g ) in a final concentration of 100 g /ml and incubated for 20 min to allow them to complex . then the complex was delivered by multiple intratumor injection every other day for 2 weeks . mice were monitored daily , and tumor growth was measured by caliper every 3 days . at the end of the fourth week , tumors were dissociated and evaluated . the animal operations and procedures were approved by the committee on the use of live animals in teaching and research of soochow university . the tumor inhibition rates were calculated as follows : tumor inhibition rate ( % ) = ( 1-weight of experimental group tumor / weight of control group tumor)100% . hepatocellular carcinoma and the matched non - tumor hepatic tissues as well as clinical data were obtained from sun yat - sen university cancer center , with the approval of institutional review boards and the ethics committee of yat - sen university . total rna was extracted using the rneasy mini kit ( qiagen , shanghai , china ) following the manusfactures instructions and was reverse - transcribed using the thermoscript rt system ( invitrogen , shanghai , china ) , according to the manufacturer 's protocol . the reaction was performed in triplicate in a total volume of 20 l containing 10 l ssofast evagreen supermix ( bio - rad ) with sybr green , 2 l cdna , 2 l each of the primers , and 4 l rnase - free water . the pcr program was 94 c for 2 min , followed by 40 cycles at 94c for 15 s , 60 c for 15 s , and 72 c for 30 s. quantitative real - time pcr assay was run on a mini opticon real - time pcr instrument . taa ata ctg gaa ag -3 ' and 5'-aag gct ctg taa atg tct gc -3 ' . primers for bax were 5'- ttt tgc ttc agg gtt tca tc -3 ' and 5'- gac act cgc tca gct tct tg -3 ' . primers for bcl-2 were 5'- ggt ggg agg gag gaa gaa -3 ' and 5'- cgc aga ggc atc aca tcg -3 ' . primers for caspase-3 were 5'- aga gct gga ctg cgg tat tga g -3 ' and 5'- gaa cca tga ccc gtc cct tg -3 ' . primers for gapdh were 5'-gac ctg acc tgc cgt cta-3 ' and 5'- agg agt ggg tgt cgc tgt -3 ' . tissues from hcc patients and nude mice were subjected to formalin fixation , paraffin embedding and sectioning for immunohistochemistry assays as describe previously 17 . the slides were blocked for 30 minutes in pbst containing 3% bsa ( pbst - bsa ) at 37c and incubated overnight at 4c with mouse monoclonal antibodies ( 1:500 in pbst - bsa ) . slides were then washed 3 times in pbst ( 10 minutes at rt ) and incubated for 2 hours with the secondary antibody ( anti - mouse hrp , 1:200 ) in pbst at rt . after incubation , slides were washed three times ( 10 minutes each ) in pbst and mounted with 3 l of vectashield for further analysis . sections were examined at high power ( x 400 ) under a standard light microscope . cell staining was regard as positive if nuclear was homogeneous stained or 10% or more of cytoplasm was heterogeneously stained . student 's t - test was used to determine the significance of the difference between compared groups . , it was observed that overexpression of rmp promoted the proliferation of hcc cells , while depletion of rmp inhibited the proliferation of hcc cells 17 . wondering if rmp expression is increased in multiple cancer cells , we decided to study the rmp expression in various cancer and normal cell lines . we examined the mrna expression of rmp in 7 human cancer cell lines : hcc cells of smmc-7721 and hepg2 17 , lung adenocarcinoma a-549 cells 19 , the commonly used hela cells of cervical carcinoma , colon carcinoma hct-116 cells 20 , sgc-7901 cells , a perpetual cell line which was derived from the gastric adenocarcinoma with lymphatic metastasis21 and the breast carcinoma mcf-7 cells 22 . the mrna expression of rmp was also examined in human normal cell lines including kidney qbi-293a cells 23 , wi-38 cells of a diploid human cell culture line composed of fibroblasts from normal embryonic lung of female 24 and three normal hepatic cell lines of qsg-770125 , hl-7702 26 and l02 27 . apparently , all 7 cancer cell lines expressed higher rmp mrna level than that in 5 normal cell lines ( fig . western blot analysis was carried out with extract of cancer and normal cell lines . as shown in fig . 1b and 1c , the protein expression of rmp were increased in cervical carcinoma hela cells , human nasopharyngeal carcinoma cne-1 cells 28 , lung adenocarcinoma spc-1 cells 29 , hcc cell line smmc-7721 , small cell lung cancer h446 cells 30and caucasian larynx carcinoma squamous hep2 cells 31 , compared with human normal cell lines of qbi-293a and wi-38 . we also examined the expression of rmp in hcc tissues from 30 patients and the matched non - tumor hepatic tissues which are adjacent to carcinoma from same patients . the results by qrt - pcr showed that rmp expression in hcc was significantly higher than that in the matched non - tumor hepatic tissues ( fig.1d ) , which is consistent with the in vitro experiments . immunostaining with antibody against rmp also showed elevated expression of rmp in hccs compared with non - tumor hepatic tissues ( fig.1e ) . the cell growth is sensitive to rmp in cancer cells , but not in normal cells . as stated above , the expression of rmp is higher in cancer cells than in normal cells . then we explored the relationship between the rmp expression level and cell growth of cancer and normal cells . the effect of rmp on the cell proliferation was examined in various human cancer cell lines of hela ( fig.2a ) , mcf-7 ( fig.2b ) , sgc-7901 ( fig.2c ) , a-549 ( fig.2d ) and hct-116 ( fig.2e ) . interestingly , the growth of cancer cells was promoted by the overexpression of rmp ( rmpo ) , while depletion of rmp by rna interference ( rmpi ) dramatically reduced the proliferation of all five cancer cell lines ( fig.2a-2e ) , compared with the cells untransfected ( unt ) or transfected with vector alone ( vector ) . the overexpression of rmp promotes the proliferation of normal cell lines of wi-38 cells ( fig.2f ) and qbi-293a cells ( fig.2 g ) . however , depletion of rmp did not significantly affect the proliferation of either cell line , compared with the untransfected parent cells and cells with vector alone . we then studied the relation between the growth of hcc and normal hepatic cells and the rmp expression level . as shown in fig.2h and 2i , although the overexpression of rmp promoted the growth of normal hepatic cells , rmp depletion had little effect on the proliferation of normal hepatic cells hl-7702 and l02 . there was no significant difference between the growths of normal hepatic cells with or without rmp depletion . in contrast , the proliferation of hcc cells of hepg2 and smmc-7721 increased significantly when rmp was overexpressed , while depletion of rmp dramatically reduced the growth rate of hcc cells ( fig.2j and 2k ) . to confirm the effect of rmp on the growth hcc cells , smmc-7721 cells stably depleted of rmp ( rmpi ) were transfected back with rmp expression vector ( rmpi+rmp ) ( fig . 2k ) . the rescue transfection restored the expression of rmp in the smmc-7721 cells , as shown by the western blot analysis ( fig.2l ) . expectedly , consistent with the restoration of rmp expression , the proliferation of hcc cells originally depleted of rmp ( rmpi ) was significantly enhanced by the rmp restoration ( rmpi+rmp ) ( fig . as apoptosis is closely related to the control of cell proliferation , we examined the effect of rmp on the apoptosis of hcc cells and normal hepatic cells as well . the overexpression of rmp inhibited the apoptosis of hcc cells , but did not significantly reduce the apoptosis of normal hepatic cells ( fig.3a and 3b ) . the depletion of rmp dramatically induced the apoptosis of both hcc cells of hepg2 and smmc-7721 . however , the depletion of rmp had little effect on the apoptosis of normal hepatic cells hl-7702 and l02 ( fig.3a and 3b ) . these results indicate that hcc cells are sensitive to rmp in apoptosis , while normal hepatic cells are resistant to rmp in apoptosis , which is consistent with the effect of rmp on the cell proliferation in hcc and normal hepatic cells , as shown in fig.2 . to confirm the sensitivity of hcc cells to rmp in apoptosis , we also investigated the induced apoptosis by co -irradiation ( fig.3c and 3d ) . the hcc cells with rmp overexpression ( rmpo ) demonstrated less apoptotic cells compared with the untransfected parent cells , while rmp depletion ( rmpi ) greatly enhanced the induced apoptosis . the rescued expression of rmp in the cells depleted of rmp ( rmpi+rmp ) partially restored the resistance of smmc-7721 to the apoptosis induced by irradiation ( fig.3c and 3d ) . 4a , the hcc xenograft tumors were formed in the nude mice inoculated with smmc-7721 cells , while there was no tumor formed after inoculation with hl-7702 hepatic cells . the developed tumors were then treated with the various plasmids for rmp overexpression or rmp depletion ( fig . the results demonstrated that the overexpression of rmp ( rmpo ) significantly promoted the growth of hcc xenograft tumors , while the growth of tumors treated with rmp depletion vector ( rmpi ) was inhibited compared with controls ( fig . 4a and 4b ) . interestingly , the nucleus size of rmpo tumor cells was significantly larger than that of rmpi and controls . also more mitotic figures could be seen in rmpo tumors than in rmpi group ( fig . immunohistochemical analysis demonstrated that the expression of rmp was enhanced in the xenograft tumors from rmp - overexpressing cells ( rmpo ) , while decreased in tumors from cells depleted of rmp ( rmpi ) , compared with control tumors treated with pbs and scr ( fig . the expression of hcc marker afp and antiapoptotic factor bcl-2 were also elevated in rmpo tumors , while decreased in rmpi cells . in contrast , the expression of p53 and apoptotic factor bax increased in rmpi tumors , but decreased in the rmpo tumors ( fig . 4d and 4e ) . the expression of apoptosis factors is differentially regulated by rmp in hcc and normal hepatic cells . to investigate the mechanism of distinct responses to rmp in hcc and hepatic cells 5a , rmp was highly overexpressed in both hcc and hepatic cells when transfected with rmp expression vector ( rmpo ) . the mrna expression of apoptosis factor of both caspase-3 and bax significantly increased in the smmc-7721 cells with rmp depletion ( rmpi ) , but decreased in the cells with rmp overexpression ( rmpo ) ( fig.5b , left panel ) . in contrast , the expression of antiapoptotic factor bcl-2 dramatically increased in the hcc cells with rmpo , but decreased in the hcc cells with rmpi . interestingly , little effect of rmp could be detected on the expression of bax , caspase-3 and bcl-2 in the normal hepatic cells with either rmpo or rmpi ( fig . , it was also observed that the protein expression of bax and bcl-2 efficiently regulated by rmp in hcc cells , as demonstrated by western blot analysis and immunohistochemical assay 17 . we further examined the effect of rmp on the protein expression of apoptosis and antiapoptosis factors in the normal hepatic cells hl7702 by western blot analysis ( fig . the results showed that although rmpo or rmpi also affected the expression of caspase-3 , bax and bcl-2 , the degree of effect of rmp on these factors is slight ( fig . 5c and fig . the protein ratio of bcl-2 and bax is much lower in the normal hepatic cells transfected with rmp expression or depletion vectors , when compared with the ratio in hcc cells of our previous work 17 ( fig . rmp / uri is involved in nutrient availability with cell growth and proliferation by controlling nutrient metabolism genes 10 . rapamycin treatment and amino acid starvation in yeast results in a similar transcription response , which overlaps the expression of genes involved in the amino acid biosynthesis in favor of cell survival . yeast uri-1 has been identified to be involved in tor signaling pathway through nutrient utilization 10 . in c. elegans , uri-1 was also found to be required in the proliferation , genome stability and survival of germ cells32 . rmp / uri was previously reported to be overexpressed or amplified in ovarian cancer cells 16 . in this article the exogenous overexpression of rmp in hcc cells accelerated the cell growth and division , while depletion of rmp significantly reduced the growth rate of cultured cancer cells including hcc cells . in vivo , rmp promoted the hcc xenograft tumors in the nude mice , while depletion of rmp resulted in a retarded growth of the xenograft tumors . all these evidence support a conclusion of rmp as an oncogene in the carcinogenesis of hcc . the oncogenicity of rmp results from a fact that rmp actually is an antiapoptic factor as we reported previously 17 . overexpression of rmp inhibited the apoptosis of hcc cells ; while depletion of rmp significantly induced the apoptosis of hcc cells in vitro and in vivo . the expression of apoptotic factors , such as bax was induced by rmp depletion , and inhibited by the overexpression of rmp . in contrast , the expression of antiapoptotic factors , such as bcl-2 was increased by the rmp overexpression , and inhibited by rmp depletion . the antiapoptotic effect of rmp might be , at least partially , through regulating the expression of both apoptotic and antiapoptotic factors . in this work overexpression or depletion of rmp in cancer cells significantly increased or decreased the growth rate of hcc cells . it was also observed that overexpression or depletion of rmp significantly inhibited or promoted the apoptosis of hcc cells . rmp expression in hcc was also confirmed to be significantly higher than that in non - tumor tissues . all these observation indicates that cancer cells , including hcc cells are more sensitive to rmp than normal hepatic cells , which might also be true for other cancer cells with their normal counterparts . the detailed mechanism still remains unclear about the distinct sensitivity of hcc and normal hepatic cells to rmp . the distinct sensitivity could result from a different modification system of rmp in normal and cancer cells . however , it is clear that the expression of apoptotic factors is induced by rmp differently in normal hepatic and hcc cells . either overexpression or depletion of rmp in hcc cells and in the tissues of xenograft tumors significantly decreased or increased the expression of apoptotic factors , such as bax , caspase-3 and antiapoptotic factor bcl-2 , which was consistent with our previous work by western blot analysis 17 . however , as presented in this work , the expression of apoptosis and antiapoptosis factors is resistant to the regulation by rmp in normal hepatic cells with an unknown mechanism . the distinct rmp responses of apoptosis in normal hepatic and hcc cells should be further explored and applied in the clinic investigation and practice . the different expression levels of rmp in cells of normal hepatic and hcc cells indicate that rmp might serve as a potential biological marker for the diagnosis of hcc . the distinct sensitivity of normal hepatic and hcc cells also makes rmp a potential and exciting target for hcc therapy . specifically targeting rmp with rna interference would effectively destroy the hcc cells with increased expression of rmp and high sensitivity to rmp , but may barely damage the normal hepatic cells and tissues , although further exploration and medical trial are required for . we found a tendency of increased expression of rmp not only in hcc cells , but also in multiple cancer cells . in contrast , the expression of rmp is low in multiple normal cells , besides the normal hepatic cells . these finding suggested that rmp might also be a general oncogene for multiple cancers and thus a potential marker for the diagnosis of various cancers . the fact that the depletion of rmp significantly reduced the proliferation of many kinds of cancer cells , while had little effect on the growth of normal cells , suggests that rmp might also potentially be a specific target for the treatment of multiple cancers , although more number and varieties of cells and tissue samples require confirmation .

rmp has been shown to function in the transcription regulation through association with rna polymerase ( rnap ) ii subunit rpb5 . it also has been shown to be required for the proliferation of hepatocellular carcinoma ( hcc ) cells with an antiapoptotic property . in this article , we further demonstrate that rmp displays distinct features in hcc cells compared with normal hepatic cells . rmp expression is remarkably increased in various cancer cell lines including hcc cells when compared with normal cells . depletion of rmp could inhibit the proliferation of hcc cells , but not the normal hepatic cells . rmp significantly prevented apoptosis of hcc cells in smmc-7721 and hepg2 , but had little effect on apoptosis in the normal hepatic cells . the mechanisms of rmp 's distinct features rely on different responsive expressions of apoptosis factors induced by rmp in hcc and hepatic cells . either overexpression or depletion of rmp significantly affected the expression of apoptosis factors in hcc cells . however , normal hepatic cells showed a tendency to resist rmp for the regulation of apoptosis . in the clinical samples , the increased expression of rmp in hccs was also observed when compared with the matched non - tumor tissues from 30 hcc patients . the different expression levels of and distinct responses to rmp between hcc and hepatic cells suggest that rmp might serve as not only a biomarker for the diagnosis of hcc , but also a potential target for the hcc therapy .

wt c57bl/6 mice , csf2rb mice and the congenic strain b6.sjl-ptprc pepc / boyj ( b6.sjl ) were from the jackson laboratory . mice were maintained in our specific pathogen - free animal facility according to institutional guidelines . experiments used sex- and age - matched mice at 6 - 16 weeks of age . 1a was determined by microarrays for the long - term hematopoietic stem cell ( lt - hsc ) , flt3 multi - potent progenitor ( flt3 mpp ) , common myeloid progenitor ( cmp ) , granulocyte - macrophage progenitor ( gmp ) , common lymphoid progenitor ( clp ) , common dendritic cell progenitor ( cdp ) , bone marrow ( bm ) pre - cdc ( precdc ) , splenic pdc , splenic cd8 dc and splenic cd8 dc . in fig . 1b , lineage markers included ter119 , nk1.1 , b220 , mhcii , cd3 , and cd11b . for fig . 1c , cmp were lincd16/32-flt3ckit , cdp were lincd16/32flt3ckitcd115 , and pre - cdc were lincd16/32-flt3ckitcd11c . for fig . 1d - f , gating is as follows ; dcs , cd11cmhcii ; neutrophils ( pmn ) , ly6gcd11b ; monocytes ( mono ) , ly6ccd11bly6 g ; red pulp macrophages ( rpm ) , autofluorescent f4/80 ; nk cells nk1.1cd3 ; cd8 t cells ( cd8 t ) cd3cd8cd4 ; cd4 t cells ( cd4 t ) , cd3cd4cd8 ; and b cells , cd19b220siglech . in fig . 2 , pdcs were gated as cd11cmhcii cells ; resident dc as cd11cmhcii cells ; and migratory dcs as cd11cmhcii cells . in fig . 2c , tissues were stained spleen , b220 ( blue ) ; f4/80 ( red ) ; gfp ( green ) ; lymph node b220 ( blue ) , cd169 ( red ) and gfp ( green ) ; small intestine cd4 ( blue ) , -catenin ( red ) and gfp ( green ) ; peyer 's patch cd4 ( blue ) , b220 ( red ) and gfp ( green ) . in fig . 2d , bm cells were cultured for 9 days with flt3 ligand , treated with media , interleukin 4 ( il-4 ) , interferon gamma ( ifn- ) , granulocyte - macrophage colony - stimulating factor ( gm - csf ) , and heat - killed listeria monocytogenes egd ( hklm ) for 24 hours . wt c57bl/6 mice , csf2rb mice and the congenic strain b6.sjl-ptprc pepc / boyj ( b6.sjl ) were from the jackson laboratory . mice were maintained in our specific pathogen - free animal facility according to institutional guidelines . experiments used sex- and age - matched mice at 6 - 16 weeks of age . 1a was determined by microarrays for the long - term hematopoietic stem cell ( lt - hsc ) , flt3 multi - potent progenitor ( flt3 mpp ) , common myeloid progenitor ( cmp ) , granulocyte - macrophage progenitor ( gmp ) , common lymphoid progenitor ( clp ) , common dendritic cell progenitor ( cdp ) , bone marrow ( bm ) pre - cdc ( precdc ) , splenic pdc , splenic cd8 dc and splenic cd8 dc . in fig . 1b , lineage markers included ter119 , nk1.1 , b220 , mhcii , cd3 , and cd11b . for fig . 1c , cmp were lincd16/32-flt3ckit , cdp were lincd16/32flt3ckitcd115 , and pre - cdc were lincd16/32-flt3ckitcd11c . for fig . 1d - f , gating is as follows ; dcs , cd11cmhcii ; neutrophils ( pmn ) , ly6gcd11b ; monocytes ( mono ) , ly6ccd11bly6 g ; red pulp macrophages ( rpm ) , autofluorescent f4/80 ; nk cells nk1.1cd3 ; cd8 t cells ( cd8 t ) cd3cd8cd4 ; cd4 t cells ( cd4 t ) , cd3cd4cd8 ; and b cells , cd19b220siglech . in fig . 2 , pdcs were gated as cd11cmhcii cells ; resident dc as cd11cmhcii cells ; and migratory dcs as cd11cmhcii cells . in fig . 2c , tissues were stained spleen , b220 ( blue ) ; f4/80 ( red ) ; gfp ( green ) ; lymph node b220 ( blue ) , cd169 ( red ) and gfp ( green ) ; small intestine cd4 ( blue ) , -catenin ( red ) and gfp ( green ) ; peyer 's patch cd4 ( blue ) , b220 ( red ) and gfp ( green ) . in fig . 2d , bm cells were cultured for 9 days with flt3 ligand , treated with media , interleukin 4 ( il-4 ) , interferon gamma ( ifn- ) , granulocyte - macrophage colony - stimulating factor ( gm - csf ) , and heat - killed listeria monocytogenes egd ( hklm ) for 24 hours .

the transcription factors c - myc and n - myc encoded by myc and mycn , respectively , regulate cellular growth1 and are required for embryonic development2,3 . a third paralog , mycl1 , is dispensable for normal embryonic development but its normal biologic function has remained unclear4 . to examine the in vivo function of mycl1 , we generated an inactivating mycl1gfp allele that also reports mycl1 expression . we found that mycl1 was selectively expressed in dendritic cells ( dcs ) of the immune system and controlled by irf8 , and that during dc development , mycl1 expression was initiated in the common dc progenitor5 ( cdp ) concurrent with reduction in c - myc expression . mature dcs lacked expression of c - myc and n - myc , but maintained l - myc expression even in the presence of inflammatory signals , such as gm - csf . all dc subsets developed in mycl1-deficient mice , but several dc subsets , such as migratory cd103 + cdcs in the lung and liver , were significantly reduced at steady state . importantly , loss of l - myc by dcs caused a significant decrease in the in vivo t - cell priming during infection by listeria monocytogenes and vesicular stomatitis virus . the replacement of c - myc by l - myc in immature dcs may provide for myc transcriptional activity in the setting of inflammation that is required for optimal t - cell priming6 .

muscles carry out a modeling performance on bones and dental arches , whether at rest or during stomatognathic system function . since our bones and teeth react to forces that work on them , consequently , strong and well - developed muscles are related to bones in good shape . when these forces are unbalanced , they misact over the occlusion and the teeth loose their correct axial inclination while searching for other balanced position , thereby harming the dental arches and leading to dentofacial distortions . a good example of this process is class ii subdivision 1 ( class ii/1 ) malocclusion , in which a retrognathic skeletal profile is observed5 . in these cases , the excessive overjet makes facial muscles adapt due to abnormal contraction patterns , which may cause a larger growth of the lower facial third with consequent facial elongation25 . in addition , there is a combination of dental and skeletal factors that lead to an occlusal dissonance characterized by a deficiency between both bone bases , in a facial anteroposterior direction 5,16 . the discrepancy between bone bases leads to hypofunction and shortening of upper and lower lips , with eversion , and closure occurs on the palatal surface of the maxillary incisors , leading to mentalis muscle hyperfunction , as it contributes to the increase of the lower portion of the orbicularis oris muscle 5 . in cases of orthodontically treated maxillary protrusion , there is an upper lip muscle tension increase towards the mentalis muscle when lips are closed 3 . people with class ii/1 malocclusion usually have the effort of making lips approach during swallowing5 , with the lower lip touching the palatal surface of the maxillary incisors , which causes lip hyperfunction 5,8,23 . swallowing this way may maintain or increase the overjet , and even cause overcontraction of the mentalis muscle , in an attempt to close5 . the subject moves the jaw downwards and forwards to make the contact between lips possible5 ; however , after class ii/1 orthodontic treatment , the lower lip no longer touches the palatal surface of the maxillary incisors during the above mentioned function23 . functions like swallowing and suctioning require the effective help from labial muscles in order to make closure and labial protrusion possible24 . therefore , the analysis of these functions is of great importance so that differences in muscle activities can be identified and correlated to the occlusion . electromyography investigates muscle function by capturing the electric signals coming from the muscles , and thus constitutes an important means to study muscle dynamics during the functions of the stomatognathic system4 . in several class ii/1 patients , aiming to obtain a harmonic balance among tooth size , dental arch length and facial profile , the orthodontist measures the total bone length of each arch plus the width of teeth , and established the diagnosis with first molar extraction being part of the treatment plan . this procedure , however , can promote changes in patients with soft tissue profile3,10 due to dental retraction3,6,12,18,19 . exactly because of the intimate relationship among muscles ' actions , bones and dental arches , speech - language pathology meets dentistry , as both specialties deal with the functional balance of the stomatognathic system . therefore , the aim of this study was to assess , by clinical and electromyographic examinations , the existence of myofunctional alterations in the orbicularis oris and mentalis muscles of class ii/1 malocclusion subjects , before and after orthodontic treatment , which could endanger the long - term dental arch stability . class i malocclusion subjects served as a control group . the research protocol was independently reviewed and approved by the ethics in human research committee of the university of western so paulo state and the study design was approved ( protocol # 012/ 001 ) . thirty - four volunteers were selected and allocated to two non - randomized groups ( n = 17 ) : a treatment group ( group t ) and a control group ( group c ) . group t was treated orthodontically in the orthodontics research center ( ceo ) in presidente prudente , sp , brazil . the inclusion criteria for group t were : a ) to be from both genders ; b ) age between 13 and 30 years ; c ) to have class ii/1 malocclusion ( as determined by ceo cephalometric analysis protocol ) with need of mandibular and/or maxillary first premolar extraction . the inclusion criteria for group c were : a ) to be from both genders ; b ) age between 13 and 30 years ; c ) to have class i malocclusion without tooth crowding . the exclusion criteria for both groups were to have : a ) missing or lost tooth ; b ) high prevalence of cavitations ; c ) anterior or posterior crossbite ; d ) open bite ; e ) dental prosthesis ; f ) general health problems ; g ) do not agree with the regulations of the informed consent form for participation in human subject research . first stage - ( group c and group t , being performed after clinical examination and clinical interview and before orthodontic treatment start ) : a ) oral myofunctional evaluation , verified by visual inspection of lip posture at rest , which was defined as closed or opened ; in the latter situation , the opening length was measured with a manual caliper ( in mm ) ; b ) water swallowing ( 20 ml ) , during which it was verified the overuse of perioral muscles ( orbicularis oris and mentalis muscles ) and the presence of lower lip interposition against the maxillary incisors during swallowing ; c ) measurement in millimeters on plaster models using the arch measuring instrument ( " amigo " - the company ) for analysis of the mandibular and maxillary dental arch perimeters . for group t , data collected from this stage was treated as group t1 data ( before orthodontic treatment ) . orthodontics was performed during at least a 24-month period for each patient and the first premolars were extracted during the course of the orthodontic therapy , according to the treatment plan . second stage - ( group t only , performed 1 month before completion of the orthodontic treatment and removal of brackets ) : the oral myofunctional evaluation was repeated . data collected from this stage was treated as group t2 data ( after orthodontic treatment ) . in addition , electromyographic evaluation of the activities of the upper ( uom ) and lower ( lom ) orbicularis oris muscle was performed in both groups . data was acquired in root medium square ( rms ) and expressed as v.4 the muscle electric potential was captured by a signal- conditioning module ( scm ) ( 1000-v2 ) ( lynx electronics technologies , so paulo , sp , brazil ) to which passive electrodes were connected . the analogical signals were stored on the scm and filtered with a range of cutting frequency from 20hz to 500hz1 through a butterworth analogical filter and 600 times final gain amplification . the system had analog - to - digital ( a / d ) signal conversion plate of 12-bit resolution and support dma ( direct memory access ) with 2000 hz sampling frequency and software for data acquisition and storage ( lynx electronics ) . the volunteers were oriented to comfortably keep their backs on the chair back , maintaining their feet parallel , touching the floor , and their heads positioned with the frankfurt plan parallel to the floor . the volunteers had their skin cleaned with 70% alcoholic solution to avoid any interference that could decrease the impedance . for each studied muscle , a pair of electrodes was used with 1-cm distance between their poles . they were placed following longitudinal direction of the fibers9 and were connected to the fist anterior region of the volunteers . electric potentials of the anterior right and left a suprahyoid muscles were recorded during 2 s per procedure . recording started after stabilization of the electromyographic signal , according to the following protocol : a ) continuous water suction using a straw during recording ; b ) two - min rest between records9 ; c ) swallowing of 20 ml water after investigator 's verbal command . data normalization was performed using the formula : rms values ( v ) during swallowing / rms values ( v ) during suction x 10020 . data collected in the stage 1 were analyzed statistically by tukey - kramer test ( a evaluation ) , kruskal - wallis test ( b evaluation ) and student 's t - test ( c evaluation ) ; data collected in the stage 2 were analyzed statistically by anova and tukey - kramer , except for the cases with nonnormal data distribution , which were analyzed by kruskal- wallis non - parametric test . the tables elaboration have followed the same model as other works previously published by the same authors21 . first stage - ( group c and group t , being performed after clinical examination and clinical interview and before orthodontic treatment start ) : a ) oral myofunctional evaluation , verified by visual inspection of lip posture at rest , which was defined as closed or opened ; in the latter situation , the opening length was measured with a manual caliper ( in mm ) ; b ) water swallowing ( 20 ml ) , during which it was verified the overuse of perioral muscles ( orbicularis oris and mentalis muscles ) and the presence of lower lip interposition against the maxillary incisors during swallowing ; c ) measurement in millimeters on plaster models using the arch measuring instrument ( " amigo " - the company ) for analysis of the mandibular and maxillary dental arch perimeters . for group t , data collected from this stage was treated as group t1 data ( before orthodontic treatment ) . orthodontics was performed during at least a 24-month period for each patient and the first premolars were extracted during the course of the orthodontic therapy , according to the treatment plan . second stage - ( group t only , performed 1 month before completion of the orthodontic treatment and removal of brackets ) : the oral myofunctional evaluation was repeated . data collected from this stage was treated as group t2 data ( after orthodontic treatment ) . in addition , electromyographic evaluation of the activities of the upper ( uom ) and lower ( lom ) orbicularis oris muscle was performed in both groups . data was acquired in root medium square ( rms ) and expressed as v.4 the muscle electric potential was captured by a signal- conditioning module ( scm ) ( 1000-v2 ) ( lynx electronics technologies , so paulo , sp , brazil ) to which passive electrodes were connected . the analogical signals were stored on the scm and filtered with a range of cutting frequency from 20hz to 500hz1 through a butterworth analogical filter and 600 times final gain amplification . the system had analog - to - digital ( a / d ) signal conversion plate of 12-bit resolution and support dma ( direct memory access ) with 2000 hz sampling frequency and software for data acquisition and storage ( lynx electronics ) . the volunteers were oriented to comfortably keep their backs on the chair back , maintaining their feet parallel , touching the floor , and their heads positioned with the frankfurt plan parallel to the floor . the volunteers had their skin cleaned with 70% alcoholic solution to avoid any interference that could decrease the impedance . for each studied muscle , a pair of electrodes was used with 1-cm distance between their poles . they were placed following longitudinal direction of the fibers9 and were connected to the fist anterior region of the volunteers . electric potentials of the anterior right and left a suprahyoid muscles were recorded during 2 s per procedure . recording started after stabilization of the electromyographic signal , according to the following protocol : a ) continuous water suction using a straw during recording ; b ) two - min rest between records9 ; c ) swallowing of 20 ml water after investigator 's verbal command . data normalization was performed using the formula : rms values ( v ) during swallowing / rms values ( v ) during suction x 10020 . data collected in the stage 1 were analyzed statistically by tukey - kramer test ( a evaluation ) , kruskal - wallis test ( b evaluation ) and student 's t - test ( c evaluation ) ; data collected in the stage 2 were analyzed statistically by anova and tukey - kramer , except for the cases with nonnormal data distribution , which were analyzed by kruskal- wallis non - parametric test . the tables elaboration have followed the same model as other works previously published by the same authors21 . results from the oral myofunctional evaluation of group c will be reported comparatively to those of group t , before and after first premolar extraction . oral myofunctional evaluation demonstrated , by visual inspection of lip posture at rest , that 76.4% of group t1 had the habitual open lip posture , while 23.5% had closed lips at habitual rest . after the orthodontic treatment , 52.9% still had a habitual posture of open lips at rest , while 47.0% this group and 100% of group c had closed lip posture . the interlabial relation of groups t and c at habitual lip rest posture showed that groups t1 and t2 had statistically similar habitual lip resting posture ( p>0.05 ) , differing significantly , however , from group c ( p<0.05 ) ( table 1 ) . different letters indicate statistically significant difference at 5% ( tukey - kramer test ; d.m.s = 0.5730 ) . the evaluation of lip posture during swallowing showed that 58.8% of group t1 and a 100% group c presented lip seal , while 41.7% of group t1 presented interposition of the lower lip against the maxillary incisors . on the other hand , 100% of group t2 had lip seal during this function . comparing group c to groups t1 and t2 , data in table 2 show that group c was statistically similar to group t2 ( p>0.05 ) , but differed significantly from t1 , ( p<0.05 ) , since many of group t volunteers presented interposition of the lower lip against the maxillary incisors during swallowing . the values were statistically significant ( p<0.05 ) , when groups t1 and t2 were compared , as all volunteers presented lip seal during swallowing after the orthodontic treatment . mentalis muscle contraction was observed in 70.5% of group t1 , while 64.7% of group t2 and 100% of group c did not show this contraction during swallowing ( table 3 ) . * ns = non - significant significance at 5% level ( kruskal - wallis test ) . the maxillary and mandibular dental arch perimeters of groups c , t1 and t2 , were analyzed statistically by the student 's t - test ( table 4 and 5 ) . it was observed that the maxillary dental arch perimeter of group c was similar to that of group t1 , but differed to that of group t2 , which was the smallest one . the mandibular dental arch perimeter of group c was significantly larger from those of groups t1 and t2 , which , in turn , did not differ significantly from each other ( tables 4 and 5 ) . mac - maxillary arch group c ; mdac - mandibular arch group c ; mat1 - maxillary arch group t1 ; mdat1 - mandibular arch group t1 ; mat2 - maxillary arch group t2 ; mdat2 - mandibular arch group t2 ; ns : non - significant significant at level of 5% ( student 's t - test ) . electromyographic data from the orbicularis oris muscle during the functions of group c were compared to those of group t223 ( table 6 . ) , with no statistically significant differences ( p>0.05 ) , either in the upper or lower portions of the muscle . however , the upper portion differed significantly ( p<0.05 ) from the lower portion , both in group c and in group t2 . uom : orbicularis oris muscle upper portion ; lom : orbicularis oris muscle lower portion . the pendulum first premolar " extraction or non - extraction " is one of the most discussed subjects in orthodontics as well as great matter of concern in dentistry due to the possibility of myofunctional alterations as a limiting or etiologic factor towards the orthodontic treatment , causing a lack of stability on this treatment . the literature focuses on the intimate relationship existing between the shape and functions of the stomatognathic system , emphasizing the specific set of structural characteristics in each individual . this fact could be related to the infeasible lip seal due to the maxillomandibular unbalance and the maxillary incisor vestibule typical of class ii/1 patients5,8,17 . in addition , because of its inclination , the upper lip lays on the palatal surface of the maxillary incisors at rest , adapting to their accentuated overjet , and providing the habitual open - lip posture while at rest . however , in this study , group c presented the habitual closed lip posture typical in class i patients5 and group t2 showed a decrease on open lip posture at rest , revealing that premolar extraction can bring soft tissue improvement in some cases3,6 as a consequence of the improvement on maxillary incisor position5 . significant differences were observed between the habitual lip rest posture of groups t1 and t2 and that of group c , but the treatment groups had similar habitual lip rest posture to each other . it is due to the fact that the anterior tooth retraction value was not enough to cause lip seal in 52.9% of volunteers , modifying the soft tissue profile , while not promoting functional adequacy3,18,23 . other perpetuating factors of a poor lip posture , namely labial hypofunction5,12,17,25 , possible upper lip shortening and probable lengthening of the lower facial third25 , are common characteristics of class ii/1 malocclusion . visual lip posture inspection during swallowing showed that 41.17% of group t1 volunteers presented lower lip interposition on maxillary incisors during this function , while all groups c and t2 volunteers had lip seal during this function . this fact demonstrates that lower lip interposition on maxillary incisors is probably a posture adaptation imposed by the poor interarch relationship observed in class ii/1 malocclusion before orthodontic treatment8,23 . the clinical analysis of the mentalis muscle showed statistically significant differences among groups c , t1 and t2 , being contracted during swallowing in both treatment groups , and non - contracted in 100% of group c volunteers ( table 3 ) . the fact that statistically significant differences were not observed between groups t1 and t2 seems to suggest that the greater activation of the lower portion of the orbicularis oris muscle related to its upper portion occurs due to mentalis muscle participation during activation of the lower portion of the orbicularis oris muscle . this difference indicates that the mentalis muscle had a great contribution during lip seal in group t. even after orthodontic treatment and in cases of lip muscle hypofunction , there is major perioral muscle activation , since additional motion units are recruited to keep lip seal 8 . first premolar extraction and anterior tooth retraction allowed an excessive overjet correction in group t , making possible lip seal after treatment . after orthodontic treatment , there was a difference on dental arch perimeter ( tables 4 and 5 ) . the maxillary dental arch perimeter of group c was similar to that of group t1 . this situation can be explained by the fact that class ii/1 malocclusion can present a trend to lower facial third increase and disharmony in the apical bone bases , in an anteroposterior direction5 . this alters the maxillomandibular complex relation with the skull base16 , differing from class i. on the other hand , the maxillary arch in class i subjects typically has a u - shaped geometry while in class ii/1 malocclusion this geometry is similar to a v letter , which suggests that the difference of arch shapes does not modify their measures because there is a similar number of teeth in both arches and normally there is no crowding in the maxillary arch . this hypothesis seems to support the statistical similarity observed between the groups with respect to their maxillary dental arch perimeters . on the other hand , group t1 presented significantly smaller mandibular dental arch perimeter than group c ( table 4 and 5 ) . this result can be attributed to the fact that crowding was frequently observed in group t1 subjects and , in some cases , the lower lip caused lingual tipping of the mandibular anterior teeth , which could have decreased the arch perimeter . this condition was not observed in class i subjects ( group c ) . comparing the maxillary and mandibular dental arch perimeters of group c to t2 , and maxillary dental arch perimeters of groups t1 and t2 , statistically significant differences were observed , as shown on table 4 . the treated groups showed a decrease in arch measurements , occurred due to tooth retraction for correction of class ii/13,6 . the mandibular dental arches of groups t1 and t2 did not differ significantly ( table 4 ) because some volunteers did not have their mandibular premolars extracted during orthodontics , according to the treatment plan . on the other hand , electromyographic studies have demonstrated that the orbicularis oris muscle has a greater activity in class ii/1 subjects with incompetent lips , during suctioning and swallowing , compared to subjects who had competent lips2,11,14,24 . the findings of these studies show that subjects with longer lower facial third and/or anteroposterior maxillomandibular discrepancy are more prone to have increased perioral muscle activity and labial incompetence . subjects with atypical swallowing , during deglutition of saliva and water , have greater electromyographic activity of perioral muscles and smaller activity of masticatory muscles when compared to clinically normal volunteers . class ii/1 malocclusion subjects have been shown to present smaller activity of the upper portion of the orbicularis oris muscle during mastication and swallowing and hyperactivity of the lower portion of the orbicularis oris muscle even at rest15 . in the present study , there were no statistically significant differences between groups c and t2 regarding the electromyographic value of the lower and upper portions of the orbicularis oris muscle . the decrease of the dental arch perimeter produced by first premolar extraction seemed to benefit lip seal , unlike the findings of stormen & panchez ( 1999 ) . further research on patients with normal occlusion and malocclusion is needed to confirm these results because the mentalis muscle was not evaluated electromyographically in this study due to methodological difficulties . in view of the results hereby discussed , it seems that the perioral musculature was benefited by the orthodontic treatment , as lip seal occurred during the evaluated functions ; during habitual rest , however , these muscles remained hypoactive . these results suggest that the desired long - term orthodontic stability2,7,18,19 can be threatened by non - treated myofunctional alterations after removal of orthodontic appliances , making recurrence possible2,18 , mainly if related to the modiolus region , which is located above the premolars and is considered as force redistributing region 13 . first premolar extraction in class ii/1 malocclusion treatment caused a decrease of dental arch perimeter . class ii/1 correction by first premolar extraction seemed to motivate lip seal only during swallowing . the oral myofunctional alterations found after orthodontic treatment in class ii/1 cases seemed to jeopardize the long - term orthodontic stability , making recurrence possible . oral myofunctional evaluation and treatment supportive to orthodontics are of paramount importance to maintain or restore the myofunctional balance of the stomatognathic system .

objective : the aim of this study was to assess the presence of oral myofunctional alterations before and after first premolar extraction in class ii/1 malocclusion patients that could endanger the long - term dental arch stability.material and methods : the study was performed by means of morphological , functional and electromyographic analyses in 17 class ii/1 malocclusion patients ( group t ) and 17 class i malocclusion patients ( group c -control ) , both groups with 12 - 30-year age range ( mean age : 20.93 4.94 years).results : data analyzed statistically by student 's t - test showed a significant decrease ( p<0.05 ) in the maxillary and mandibular dental arch perimeters after orthodontic treatment , but lip posture at rest did not present statistically significant differences after treatment ( p>0.05 ) . the kruskal - wallis test analyzed data from lip posture ( orbicularis oris muscle ) at rest and during swallowing , as well as the mentalis muscle behavior during the above - mentioned function , not showing statistically significant differences ( p>0.05 ) after treatment ( groups t1 and t2 ) . however , group t differed significantly from group c ( p<0.05 ) . lip posture during swallowing showed statistically significant differences ( p<0.05 ) for subjects submitted to orthodontic therapy when compared to data acquired before the treatment . the electromyographic analysis confirmed these data.conclusions:found myofunctional alterations observed after the orthodontic treatment in class ii/1 malocclusion seemed to jeopardize the long - term orthodontic stability , making recurrence possible .

the obturator nerve arises from the anterior division of the ventral rami of the second , third , and fourth lumbar nerves in the lumbar plexus . the branch originating from the third lumbar nerve is the largest and is distributed in the skin of the abductor muscles and thigh . it descends through the psoas major muscle forming a bundle , and enters the thigh through the upper part of the obturator foramen along the inner wall of the lesser pelvis , accompanied by the obturator artery . the anterior branch is responsible for the sensory innervation of the hip joint and mid - thigh , as well as for the motor innervation of the superficial adductor muscles . the posterior branch provides sensory perception to the skin on the posterior side of the knee joints and motor function to the deep adductor muscles26 ) . obturator neuropathy ( obturator nerve entrapment syndrome ) is caused by pressure or injury to the obturator nerve on the upper part of the obturator foramen , which presents as pain or loss of sensation over the upper medial thigh with or without hip adduction weakness9 ) . if untreated , hip adductor weakness will result in a functional disorder of the hip joint14 ) . the majority of obturator neuropathy cases result from trauma , iatrogenic injuries such as orthopedic surgery ( hip arthroplasty , urologic surgery , and spine surgery via the retroperitoneal cavity ) , sports hernias , and gynecological problems such as ectopic pregnancies11217 ) . moreover , obturator neuropathy may also be associated with compressive lesions such as cysts , neurofibroma , and lipoma78 ) . diagnosing and treatment of obturator neuropathy is difficult , as it is a rare condition with which many neurosurgeons are unfamiliar . knowledge of the obturator nerve anatomy is essential for adequate surgical planning and success . with an aim to improve the accuracy of diagnosis and to prevent complications , we performed a cadaveric morphometric study to investigate the anatomical features and relationships between the obturator nerve and its surrounding anatomical landmarks . twenty - eight lower limbs from fourteen ( 12 males and 2 females ) adult cadavers with an age range of 25 - 95 years ( mean , 61.6 years ) were dissected . the cadavers were fixed with a mixture of formalin , phenol , alcohol , and glycerin . the skin was removed in the supine position to expose the pectineus muscle by carefully detaching the soft tissue from the fascia lata and the femoral artery . after the pectineus muscle was dissected , the obturator nerve was identified within the fascial layer ( fig . anatomically important structures used in this study include the anterior superior iliac spine ( asis ) , the pubic tubercle , the inguinal ligament , the femoral artery , and the adductor longus . different variables were measured in 28 specimens of 14 cadavers , as follows : point a : the distance from the asis to the obturator nerve exit zone of the foramen , and point b : the distance from the pubic tubercle to the obturator nerve exit zone of the foramen ( fig . 2 ) ; point c : the horizontal distance from the pubic tubercle to the obturator nerve exit zone of the foramen , and point d : the vertical distance from the pubic tubercle to the obturator nerve exit zone of the foramen ( fig . 3 ) ; point e : the shortest distance from the inguinal ligament to the obturator nerve exit zone of the foramen , point f : the length of the inguinal ligament from the asis to point e , point g : the length of the inguinal ligament from the pubic tubercle to point e ( fig . 4 ) , point h : the length of the obturator nerve exposed between the obturator nerve exit zone of the foramen and the adductor longus , and point i : the shortest distance from the obturator nerve exit zone of the foramen to the femoral artery ( fig . 5 ) . distances and lengths between the obturator nerve exit zone of the foramen and anatomical landmarks were measured using a standard meter and a goniometer . after exiting the obturator foramen , the obturator nerve passes below the inguinal ligament and traverses the medial side of the femoral artery . to expose the obturator nerve in the supine position , it is important that the pectineus muscle is identified following removal of the fascia lata and soft tissue . the obturator nerve is located beneath the pectineus muscle and runs medially and downwards between the adductor longus and adductor brevis muscles . table 1 shows the distance from the asis / pubic tubercle to the obturator nerve , while table 2 shows the vertical and horizontal relationships between the obturator nerve and the pubic tubercle . the mean distance from the asis to the obturator nerve exit zone of the foramen was 113.46.5 mm in the right thigh and 114.27.4 mm in the left thigh . the mean distance from the pubic tubercle to the obturator nerve exit zone was 30.54.4 mm in the right thigh and 30.35.4 mm in the left thigh . the mean horizontal and vertical distances from the pubic tubercle to the obturator nerve exit were 18.23.2 mm in the right thigh and 16.53.0 mm in the left thigh , and 27.32.2 mm in the right thigh and 26.34.2 mm in the left thigh , respectively . no statistically significant differences between the measurements obtained from the right and left thighs were obtained . the shortest distance ( point e ) between the obturator nerve and the inguinal ligament as well as the relationship and distance between the inguinal ligament and the asis / pubic tubercle and point e the shortest mean distance between the obturator nerve and the inguinal ligament was 18.53.2 mm in the right thigh and 19.75.2 mm in the left thigh . the mean length of the inguinal ligament from the asis to point e was 1064.2 mm in the right thigh and 99.67.7 mm in the left thigh , while the mean length of the inguinal ligament from the pubic tubercle to point e was 24.95.1 mm in the right thigh and 23.74.1 mm in the left thigh . when the measurements between the asis and the pubic tubercle were compared based on point e from the inguinal ligament to the obturator nerve exit zone , the shallowest point of the obturator nerve was distributed approximately one - fifth from the medial inguinal ligament . no statistically significant differences between the measurements obtained from the right and left thighs were obtained . table 3 shows the shortest distance between the obturator artery and the femoral artery , as well as the length of the obturator nerve exposed between the obturator foramen and the adductor longus . the mean length of the obturator nerve exposed between the obturator foramen and the adductor longus was 41.26.9 mm in the right thigh and 41.03.8 mm in the left thigh . the shortest mean distance between the femoral artery and the obturator nerve exit zone was 30.05.4 mm in the right thigh and 25.83.9 mm in the left thigh . no statistically significant differences between the measurements obtained from the right and left thighs were obtained . after exiting the obturator foramen , the obturator nerve passes below the inguinal ligament and traverses the medial side of the femoral artery . to expose the obturator nerve in the supine position , it is important that the pectineus muscle is identified following removal of the fascia lata and soft tissue . the obturator nerve is located beneath the pectineus muscle and runs medially and downwards between the adductor longus and adductor brevis muscles . table 1 shows the distance from the asis / pubic tubercle to the obturator nerve , while table 2 shows the vertical and horizontal relationships between the obturator nerve and the pubic tubercle . the mean distance from the asis to the obturator nerve exit zone of the foramen was 113.46.5 mm in the right thigh and 114.27.4 mm in the left thigh . the mean distance from the pubic tubercle to the obturator nerve exit zone was 30.54.4 mm in the right thigh and 30.35.4 mm in the left thigh . the mean horizontal and vertical distances from the pubic tubercle to the obturator nerve exit were 18.23.2 mm in the right thigh and 16.53.0 mm in the left thigh , and 27.32.2 mm in the right thigh and 26.34.2 mm in the left thigh , respectively . no statistically significant differences between the measurements obtained from the right and left thighs were obtained . the shortest distance ( point e ) between the obturator nerve and the inguinal ligament as well as the relationship and distance between the inguinal ligament and the asis / pubic tubercle and point e are shown in table 3 . the shortest mean distance between the obturator nerve and the inguinal ligament was 18.53.2 mm in the right thigh and 19.75.2 mm in the left thigh . the mean length of the inguinal ligament from the asis to point e was 1064.2 mm in the right thigh and 99.67.7 mm in the left thigh , while the mean length of the inguinal ligament from the pubic tubercle to point e was 24.95.1 mm in the right thigh and 23.74.1 mm in the left thigh . when the measurements between the asis and the pubic tubercle were compared based on point e from the inguinal ligament to the obturator nerve exit zone , the shallowest point of the obturator nerve was distributed approximately one - fifth from the medial inguinal ligament . no statistically significant differences between the measurements obtained from the right and left thighs were obtained . table 3 shows the shortest distance between the obturator artery and the femoral artery , as well as the length of the obturator nerve exposed between the obturator foramen and the adductor longus . the mean length of the obturator nerve exposed between the obturator foramen and the adductor longus was 41.26.9 mm in the right thigh and 41.03.8 mm in the left thigh . the shortest mean distance between the femoral artery and the obturator nerve exit zone was 30.05.4 mm in the right thigh and 25.83.9 mm in the left thigh . no statistically significant differences between the measurements obtained from the right and left thighs were obtained . obturator nerve injuries are a direct result of nerve sectioning , stretching , crushing , electrocoagulating , or ligating . identifying an isolated obturator nerve lesion can be difficult based on history and physical examination alone , because other nerve injuries in the lower abdomen and pelvic region also present with groin and thigh pain . magnetic resonance imaging ( mri ) is helpful to detect atrophy of the adductor brevis and adductor longus muscles and to identify the anatomical structures of the inguinal and surrounding areas16 ) . longer fibrillation potentials , high amplitude , and complex exercise units in the adductor brevis and adductor longus muscles are observed in patients with obturator neuropathy ; however , the iliopsoas and quadriceps muscles of the lower limb do not reveal any abnormal findings . thus , obturator neuropathy should be differentiated from lumbar plexopathy , diabetic polyneuropathy , and lumbar neuropathy . treatment for obturator neuropathy or related nerve injuries include medication , physical therapy , massage therapy , restricted exercise , and rehabilitation . surgical procedures may be considered depending on the severity of the injury , recovery , and response to conservative therapy . moreover several authors have reported that obturator block is effective for the relief of pelvic and thigh pain , as well as for the management of adductor muscle spasticity caused by spinal cord injury , traumatic brain injury , stroke , cerebral palsy , and multiple sclerosis351315 ) . the pubic approach involves the insertion of a needle perpendicular to the skin , 15 mm lateral and 15 mm inferior to the tubercle , while in the inguinal approach , the needle is inserted at the midpoint of the inguinal crease between the femoral arterial pulse and the inner border of the adductor longus tendon4 ) . in our study , the median distances between the obturator foramen and the pubic tubercle , the femoral artery , and the adductor longus muscle were 17 mm , 28 mm , and 41 mm , respectively . regarding arterial variations and postural alterations , ultrasound guidance allows for better nerve identification , and recent studies utilizing this technique for obturator nerve block have reported success rates of greater than 90% . while ultrasound guidance can be useful for diagnosis , its usefulness is limited in cases of surgical exploration . previous studies have investigated the anatomical features of the obturator nerve . according to locher et al.11 ) , the median distances between the projection of the obturator nerve on the skin to the pubic tubercle and to the symphysis were 23 mm and 51 mm , respectively , based on anatomical investigation and mri analysis of 10 cadavers . a similar value of 27 mm was obtained as the median distance between the obturator nerve and the pubic tubercle in our study . the pubic tubercle is an objective landmark and can be useful for understanding anatomical structures . understanding the relationships between various anatomical structures is essential for surgery . different critical sites that risk compressing the obturator nerve include the obturator canal , the obturator membrane , and the obturator externus muscle10 ) . many options exist for the surgical treatment of obturator neuropathy , including transabdominal , laparoscopic , inguinal , and extraperitoneal approaches9 ) . during surgical exploration , critical structures such as the femoral artery anatomical apprehension of the obturator nerve can be of aid for the accurate planning and appropriate timing of surgery . the incision can be made at inguinal crease , point approximately one - fifth medially from the asis to the pubic tubercle and the medial inguinal ligament can be a good surface landmark of the obturator nerve . then , the nerve is traced proximally by dissecting to the obturator foramen . most of obturator nerves are located in a triangle bordered by femoral artery , adductor longus muscle and inguinal ligament . so neurosurgeons should understand the anatomical relationship and the projection of the obturator nerve for saving adjacent structure . the results of our morphometric study show that the obturator nerve is located beneath the pectineus muscle , at a distance of approximately 1.7 cm and 2.7 cm vertically and horizontally , respectively , from the pubic tubercle . moreover , the shallowest portion of the obturator nerve is distributed approximately one - fifth from the medial inguinal ligament . the limitations of this study include its small sample size and the use of only two female cadavers . thus , our report can not be commonly cited to all subjects of both sexes . in addition , the supine position of cadavers may have affected the results of our study . however , knowledge concerning obturator neuropathy provided by this study will aid in more accurate diagnoses , active intervention programs , and for the minimization of complications .

objectiveobturator neuropathy is a rare condition . many neurosurgeons are unfamiliar with the obturator nerve anatomy . the purpose of this study was to define obturator nerve landmarks around the obturator foramen.methodsfourteen cadavers were studied bilaterally to measure the distances from the nerve root to relevant anatomical landmarks near the obturator nerve , including the anterior superior iliac spine ( asis ) , the pubic tubercle , the inguinal ligament , the femoral artery , and the adductor longus.resultsthe obturator nerve exits the obturator foramen and travels infero - medially between the adductors longus and brevis . the median distances from the obturator nerve exit zone ( onez ) to the asis and pubic tubercle were 114 mm and 30 mm , respectively . the median horizontal and vertical distances between the pubic tubercle and the onez were 17 mm and 27 mm , respectively . the shortest median distance from the onez to the inguinal ligament was 19 mm . the median inguinal ligament lengths from the asis and the median pubic tubercle to the shortest point were 103 mm and 24 mm , respectively . the median obturator nerve lengths between the onez and the adductor longus and femoral artery were 41 mm and 28 mm , respectively.conclusionthe obturator nerve exits the foramen 17 mm and 27 mm on the horizontal and sagittal planes , respectively , from the pubic tubercle below the pectineus muscle . the shallowest area is approximately one - fifth medially from the inguinal ligament . this study will help improve the accuracy of obturator nerve surgeries to better establish therapeutic plans and decrease complications .

inflammation is a natural protective mechanism that resolves infections and injuries of the target tissue . failure to effectively resolve the inflammation and return the affected tissue to homeostasis leads to maladaptation and precipitation of pathophysiologic consequences that often result in the development of chronic maladies , including cardiovascular diseases and diabetic complications . , it has been well established that injury - elicited inflammation in the vasculature often causes excessive proliferation of vascular smooth muscle cells within vessel walls and the subsequent expansion of the intima , leading to the eventual blockage of the vessel . although effective in combating neointima hyperplasia , current anti - inflammatory and antimitotic drugs often display significant side effects and toxicity that deem systemic applications unfeasible , and their local delivery is achieved via drug - eluting stents . , therapeutic reagents that can be administered systemically stand the benefit of providing alternative avenues for treating acute vascular injuries as well as circumventing overall chronic inflammation in the vasculature . rage is a pattern recognition receptor that recognizes multiple endogenous ligands and triggers innate and adaptive immune responses . , , , , signaling via rage has been associated with vascular inflammation and implicated in the development of cardiovascular diseases . , prior studies , have shown that administration of srage can protect against injury - mediated vascular inflammation and neointimal expansion by functioning as a rage decoy . such protection by srage , our recent study demonstrated that n - glycoform modifications of srage modulate its bioactivity : compared with srage produced in insect sf9 cells used in previous studies ( ie , 5 g / g body weight , daily injection for a week ) , a single , low dose of srage produced in chinese hamster ovary cells ( srage ) ( ie , 3 ng / g body weight ) can substantially reduce neointima growth and inflammation in a rat carotid balloon injury model . these findings render srage an attractive therapeutic candidate with clinical potential . , although previous studies assessed how srage treatment affected neointimal growth via histomorphologic analyses of postmortem vessel sections , , , direct assessment of srage action in vivo has not been performed . vessel ultrasound sonography is a technique that can be used noninvasively in clinical practice to monitor arterial structure and function . , , to further validate srage efficacy to suppress neointimal growth , and to provide a basis for future clinical applications , we performed sonograph studies on carotid balloon denudation - injured rats before histology and compared these results with those observed in histomorphologic analyses . such studies render an independent assessment of srage efficacy in vivo , and can validate its potential as a candidate therapeutic protein for treating vascular injury and inflammation . male wistar rats ( 400450 g ) were purchased from charles river laboratories ( wilmington , massachusetts ) and maintained in a vivarium fed the national institute on aging on ad libitum food diet ( nih-07 mouse / rat diet ; national institutes of health , bethesda , md ) with access to filtered water . the surgical procedure and postsurgery care have been described in detail , and have been in compliance with the national institutes of health s guide for the care and use of laboratory animals ( nih publication no . 3040 - 2 , revised 1999 ) , and with the institutional animal care and use committee approved protocol . immediately following the surgery , generation of srage , srage , and srage(n25t / n81 t ) expression vectors , as well as purification of srage recombinant protein have been described in detail . vessel ultrasound sonography was conducted on the 0 day ( ie , surgery day , before surgery ) , and on the seventh and 14th day postsurgery . rats were sedated with isoflorane ( 2% in oxygen ) via facemasks , and put in the supine position . after shaving frontal neck skin hair , an m - mode tracing was recorded at 3 points in the long - axis view : 3 and 10 mm distal to the base , and 2 mm proximal to the bifurcation . the vessel wall thickness and lumen diameter at minimal and maximal points were measured using national institutes of health image j software . the parameters from the nonoperated right carotid artery of the same rat were used as control . parameters from the nonoperated right side of the carotid artery of the same subjects were used as the normal control relative to the balloon - injured left side of the carotid artery . allocation concealment was applied to balloon denudation surgery , sonographic studies , and histomorphologic analyses . investigators involved in the procedure were also blinded in respect to srage types and dose administered . male wistar rats ( 400450 g ) were purchased from charles river laboratories ( wilmington , massachusetts ) and maintained in a vivarium fed the national institute on aging on ad libitum food diet ( nih-07 mouse / rat diet ; national institutes of health , bethesda , md ) with access to filtered water . the surgical procedure and postsurgery care have been described in detail , and have been in compliance with the national institutes of health s guide for the care and use of laboratory animals ( nih publication no . 3040 - 2 , revised 1999 ) , and with the institutional animal care and use committee approved protocol . immediately following the surgery , rats were administered the designated dose of srage via intraperitoneal injection . generation of srage , srage , and srage(n25t / n81 t ) expression vectors , as well as purification of srage recombinant protein have been described in detail . vessel ultrasound sonography was conducted on the 0 day ( ie , surgery day , before surgery ) , and on the seventh and 14th day postsurgery . rats were sedated with isoflorane ( 2% in oxygen ) via facemasks , and put in the supine position . after shaving frontal neck skin hair , an m - mode tracing was recorded at 3 points in the long - axis view : 3 and 10 mm distal to the base , and 2 mm proximal to the bifurcation . the vessel wall thickness and lumen diameter at minimal and maximal points were measured using national institutes of health image j software . the parameters from the nonoperated right carotid artery of the same rat were used as control . parameters from the nonoperated right side of the carotid artery of the same subjects were used as the normal control relative to the balloon - injured left side of the carotid artery . allocation concealment was applied to balloon denudation surgery , sonographic studies , and histomorphologic analyses . investigators involved in the procedure were also blinded in respect to srage types and dose administered . our previous studies had demonstrated that administration of srage immediately after arterial injury is most therapeutically effective . to monitor srage effects in live rats with carotid arterial injury , we performed the ultrasound sonography procedure on rats before the surgery , and at 1 and 2 weeks postsurgery . although at 1 week postsurgery the maximal vessel lumen diameter of injured vessels treated by srage is clearly distinguishable from that of placebo - treated vessels ( figure 1a ) , the measurement of average vessel wall thickness of these 2 groups was not clearly differentiated until 2 weeks postsurgery ( figure 1b ) , suggesting that sufficient time ( ie , at least 1 week ) is required to assess the benefits of srage treatment in a live animal model . to test the correlation of sonographic data with that obtained from postmortem histologic measurement , we plotted the data from the 2 independent measurements , using the lowest effective dose ( ie , 0.5 ng / g body weight ) . despite the shrinkage of vessel cross - sections during the histologic process , reasonably high correlations between the data from the 2 measurements were apparent in the scatter plots ( lumen diameter : r = 0.72 ; vessel wall thickness : r = 0.76 ) ( figure 2a and 2b ) , suggesting that the effect of srage treatment can be independently , and perhaps reliably monitored in vivo ( figure 2c ) . on the basis of timing and correlation with histologic results shown in figure 1 , figure 2 , we also measured lumen diameter and vessel wall thickness at 2 weeks postsurgery in rats treated with srage at lower ( 0.51.5 ng / g body weight ) ( figure 3a and 3b ) and higher doses ( 1.56 ng / g body weight ) ( figure 3c and 3d ) . when vessel wall thickness was measured , 1.5 ng / g and higher doses of srage treatment appeared to be statistically similar to those of nonoperated vessels ( figure 3a and 3c ) . however when lumen diameter was measured , dose - dependent improvement in groups treated with 0.5 to 3 ng / g srage was detected ( figure 3b and 3d ) , suggesting that the latter parameter may be more sensitive . our previous work showed that specific n - glycoform modifications are a key determinant of srage bioactivity , and that not only n - glycosylation , but also mammalian cell - specific , complex - type n - glycosylation is critical for the observed high therapeutic efficacy of srage . independent assessment using sonography ( figure 4 ) with an established optimal dose of srage further confirmed a significantly higher efficacy of srage relative to that of nonglycosylated srage ( n25t / n81 t ) and srage produced in insect sf9 cells . our previous studies had demonstrated that administration of srage immediately after arterial injury is most therapeutically effective . to monitor srage effects in live rats with carotid arterial injury , we performed the ultrasound sonography procedure on rats before the surgery , and at 1 and 2 weeks postsurgery . although at 1 week postsurgery the maximal vessel lumen diameter of injured vessels treated by srage is clearly distinguishable from that of placebo - treated vessels ( figure 1a ) , the measurement of average vessel wall thickness of these 2 groups was not clearly differentiated until 2 weeks postsurgery ( figure 1b ) , suggesting that sufficient time ( ie , at least 1 week ) is required to assess the benefits of srage treatment in a live animal model . to test the correlation of sonographic data with that obtained from postmortem histologic measurement , we plotted the data from the 2 independent measurements , using the lowest effective dose ( ie , 0.5 ng / g body weight ) . despite the shrinkage of vessel cross - sections during the histologic process , reasonably high correlations between the data from the 2 measurements were apparent in the scatter plots ( lumen diameter : r = 0.72 ; vessel wall thickness : r = 0.76 ) ( figure 2a and 2b ) , suggesting that the effect of srage treatment can be independently , and perhaps reliably monitored in vivo ( figure 2c ) . on the basis of timing and correlation with histologic results shown in figure 1 , figure 2 , we also measured lumen diameter and vessel wall thickness at 2 weeks postsurgery in rats treated with srage at lower ( 0.51.5 ng / g body weight ) ( figure 3a and 3b ) and higher doses ( 1.56 ng / g body weight ) ( figure 3c and 3d ) . when vessel wall thickness was measured , 1.5 ng / g and higher doses of srage treatment appeared to be statistically similar to those of nonoperated vessels ( figure 3a and 3c ) . however when lumen diameter was measured , dose - dependent improvement in groups treated with 0.5 to 3 ng / g srage was detected ( figure 3b and 3d ) , suggesting that the latter parameter may be more sensitive . our previous work showed that specific n - glycoform modifications are a key determinant of srage bioactivity , and that not only n - glycosylation , but also mammalian cell - specific , complex - type n - glycosylation is critical for the observed high therapeutic efficacy of srage . independent assessment using sonography ( figure 4 ) with an established optimal dose of srage further confirmed a significantly higher efficacy of srage relative to that of nonglycosylated srage ( n25t / n81 t ) and srage produced in insect sf9 cells . the therapeutic value of srage has been well recognized and tested in various animal models , including arterial injury models . , , , administration of srage , a decoy of rage , can reduce injury - associated , rage signal - mediated chronic inflammation and minimize maladaptation and remodeling in vasculature , thus decreasing the risk of cardiovascular diseases and other vessel - associated complications . although previous studies discovered that srage can be used to block neointimal growth and formation of atherosclerotic plaques in animal models , to achieve the blockage , a high dose and multiple administrations of srage produced in insect sf9 cells were employed . , , , , our recent study demonstrated that specific n - glycoform modifications are the key determinant underlying srage bioactivity and therapeutic efficacy : a low , single dose of srage produced in cho cells can significantly reduce injury - associated inflammation and neointimal growth . in addition to the observed low efficacy , glycoforms from insect cells are also immunogenic in mammals , and therapeutic glycoproteins must be produced from mammalian sources . previous studies , including ours , had evaluated therapeutic effects of srage mainly based on postmortem histomorphologic analyses of the vessel cross - sections and in vitro bioactivity assays . although these assessments , especially histologic studies , provided important and direct information of the vessel condition , including inflammation and formation of the neointima , these approaches can not be used for clinical evaluation of treatment . the present study demonstrates that injury of the vessel as well as the therapeutic effects of srage can be independently evaluated via vessel sonographic assessment . similar to the results obtained from histology shown in our previous study , current sonographic studies also showed a degree of dose - dependent attenuation of vessel lumen diameter , although this was less apparent in measured vessel wall thickness ( figure 3 ) . consistent with histology , sonography also showed that paucimannose - glycan modified srage and the nonglycosylated srage(n25t / n81 t ) were ineffective when used in the same dose ( 3 ng / g ) as srage ( figure 4 ) . previous studies , showed that srage administered immediately after arterial injury was most effective to restrict neointimal expansion . the manifested beneficial effects of srage are not readily detectable in vivo until at least 1 week after surgery and treatment , and the therapeutic outcome becomes apparent 2 weeks after surgery and treatment ( figure 1 ) . these observations suggest that blocking rage alarmin ligands immediately after injury circumvents rage - mediated inflammatory signaling , and allows the injured vessel to undergo a repair process with less , or controlled , inflammation leading to a healing course with reduced remodeling . compared with our previously published histology results , vessel ultrasound sonography appears to be less sensitive to discern the difference between nonoperated vessels and vessels operated on with treatment when a higher dose of srage ( 3 ng / g ) was used ( figure 4a ) , whereas such difference was discernable by histology . when a lower dose of srage was used ( 0.5 ng / g ) , the difference between treated and nonoperated vessels is clearly discernable and there was a better correlation between sonography and histology ( figure 2 ) . this is likely due to the fact that 0.5 ng / g is not an optimal dose , and that remodeling of the vessel wall by balloon denudation was not suppressed as much as that in a situation when a higher dose was administered . these observations suggest that sonographic data should serve as a reference for application , and that the exaggerated benefits observed in higher srage doses should be taken into consideration to determine a proper dose for the best treatment outcome . our research using vessel sonography to monitor srage effects in live rats reaffirmed that specific n - glycoform - modified srage , produced in cho cells is highly effective in vivo to attenuate neointimal growth after arterial injury , compared with that produced in insect cells . this in vivo approach also provides a basis for monitoring srage effects in future clinical applications . the authors have indicated that they have no conflicts of interest regarding the content of this article .

objectivewe aimed to assess the therapeutic efficacy of differentially modified soluble receptor for advanced glycation end products ( srage ) in vivo using vessel ultrasound sonography and to compare the sonography data with those from postmortem histomorphologic analyses to have a practical reference for future clinical applications.methodsvessel ultrasound sonography was performed in a srage - treated rat carotid artery balloon injury model at different time points after the surgery , and therapeutic efficacy of different doses of srage produced in chinese hamster ovary cells and with different n - glycoform modifications were assessed.resultsvessel ultrasound sonography found that srage produced in chinese hamster ovary cells with complex n - glycoform modifications is highly effective , and is consistent with our recent findings in the same model assessed with histology . we also found that sonography is less sensitive than histology when a higher dose of srage is administered.conclusionssonograph results are consistent with those obtained from histology ; that is , srage produced in chinese hamster ovary cells has significantly higher efficacy than insect cell - originated srage cells .

maintenance of peri - implant bone support is one of the most important criteria for implant therapy success . during the first year of implant function , crestal bone loss in peri - implant is 0.9 to 1.6 mm and the mean annual bone loss decreases to 0.05 to 0.13 mm [ 25 ] . a clinical study shows that a progressive bone loss around the implant occurs when it undergoes functioning and may lead to implant failure . carl e. misch ascribed this to poor oral hygiene , non - passive super structures , partially retained restoration , poor bone quality and quantity , inadequate osseointegrated surface area and other biomechanical factors that unfavorably apply stress on the bone implant interface . the greatest stress after the osseointegration healing period occurs at the crest [ 810 ] . excessive functional load or traumatic occlusion may overstress the implant system and lead to peri - implant marginal bone loss [ 1113 ] . the change of crestal bone around the implant could affect esthetic aspects of the dental implant . manz reported that crestal bone loss after successful bone integration was related directly to the bone density if the stresses applied to an implant exceeds the physiological limitation of bone density around the implant , implant failure may occur . some authors defined three types of loading : non - loading , non - functional loading and functional loading . implants between natural teeth with a short core and two - stage implants are two clinical situations of non - loading . functional loading takes place when the prosthesis receives full occlusal contact and the force is directly transmitted to the implant . for the first time in 1980 carl e. misch proposed the concept of progressive or gradual bone loading based on empirical information . this idea suggests that gradual loading causes bone maturation , improves bone density and quality , decreases crestal bone loss and early implant failure . the loading was controlled by time intervals , soft diet , occlusion prosthesis design and occlusal material [ 7,1820 ] . in the literature , only few scientific evidences were found to support the effectiveness of progressive loading.21 in 1996 and 2005 , appleton et al . concluded that crestal bone loss was reduced by progressive implant loading , and bone density increased over time . the aim of this study was to compare the effectiveness of progressive loading and conventional loading around single osseointegrated implants in the posterior maxilla . in 2005 , appleton et al . concluded that crestal bone loss was reduced by progressive implant loading , and bone density increased over time . a prospective randomized controlled trial study was designed to determine whether a difference existed between the outcomes of treatment when implants of the astra system were loaded according to two different loading protocols : progressive and conventional . the patients were selected from the department of implantology of the faculty of dentistry at tehran university of medical sciences , tehran , iran . the ethics board approved the research protocol , including inclusion / exclusion criteria , and the treatment procedures . the selected subjects were limited to patients with bilateral single edentulous or unilateral with pier abutment in the posterior region of the maxilla , canine guidance occlusion , d3 or d4 bone density by surgeon diagnosis , and good oral hygiene . in addition , opposing occlusion was chosen to be natural teeth or tooth - borne fixed partial denture . patients with systemic diseases ( such as diabetes , osteoporosis and radiotherapy ) , periodontal diseases , bruxism or clenching habits and smoking were excluded from the study . all the details of this study were explained to the patients and they were asked to sign the consent form . the two implants were randomly assigned to an experimental ( progressive loading ) and control group ( conventional loading ) . after oral and radiographic examination , implant surgery was performed according to the manufacturer s recommendation and use of surgical template . a crestal incision was made , and the mucoperosteal flap was reflected on the buccal and lingual sides . the implants with a 4.5 mm diameter and 11 mm height ( micro thread - osseospeed ; astra tech , mlndal , sweden ) were placed . after 4 weeks of healing period , all implants were uncovered and after 6 weeks from surgery , prosthetic procedures were launched . profile bi abutment ( astra tech , mlndal , sweden ) were placed onto all control implants and the abutment screws were torqued to 25 n / cm . eight weeks after surgery , the control group implants were restored with cemented metal ceramic crowns ( definitive restorations ) and the experimental group implant underwent a progressive loading protocol . for each implant in the experimental group , three temporary heat cured acrylic resin crowns ( meliodent bayer dental germany ) were made . four restorative stages were done in the experimental group ( progressive loading ) as follows : two months after surgery , the first acrylic temporary crown was placed into 2 mm infraocclusion . the patient was asked to use soft diet.four months after surgery , the second acrylic temporary crown was placed on the implant and occlusal contact was adjusted by 40 articulation foil ( arti - folbousch kln germany ) and a firmer diet was recommended for the patient.six months after surgery , the last acrylic temporary crown was placed into full occlusion . full occlusion was adjusted by 12 articulation foil and the patient was permitted a regular diet.eight months after surgery , the last temporary crown was replaced by a cemented metal ceramic crown with mutually occlusal contact . two months after surgery , the first acrylic temporary crown was placed into 2 mm infraocclusion . four months after surgery , the second acrylic temporary crown was placed on the implant and occlusal contact was adjusted by 40 articulation foil ( arti - folbousch kln germany ) and a firmer diet was recommended for the patient . six months after surgery , the last acrylic temporary crown was placed into full occlusion . full occlusion was adjusted by 12 articulation foil and the patient was permitted a regular diet . eight months after surgery , the last temporary crown was replaced by a cemented metal ceramic crown with mutually occlusal contact . for evaluation of the passive fit , all frames were checked by fit checker and x - ray . during these four stages ( 2 , 4 , 6 and 8 months after surgery ) and 12 months after surgery , peri apical radiographs were taken by rvg ( radio visio graphy ) imaging system ( trophy , marne - la vallee , france ) from both progressive and conventional loaded implants . in order to repeat the radiographic images in the same position , a customized occlusal stent made of putty ( speedex coltene swiss ) was constructed and a paralleling beam - aiming device , xcp ( extended cone parallel , rinn corp , elgin , il , usa ) , was utilized . x - ray parameters were 63kvp , 8ma , 0.08 seconds and the exposure distance was 10 cm . the changes in the alveolar crestal bone height and bone density around the implants were measured by eigentool ( eigentool , henry ford health system , detroit , mi , usa ) software [ 2427 ] . to measure the crestal vertical bone loss , the implant shoulder , the first contact of the alveolar crestal and the apex of the implant the first contact of the alveolar crestal bone and the implant on the mesial and distal area were marked as b and d ( fig 2 ) , respectively . bcorresponded to the crestal bone loss on the mesial and referred to as ab that was calculated by ab=(xb - xa)2+(yb - ya)2 , where x and y are the x- and y - axis components of the points on rvg image coordinates . using similar formula , the distal crestal bone loss ( cd ) ) the height of the implant was 11 mm for all subjects , a constant that was used to compensate for different image scaling , called normalization . the height of the implant can be measured on rvg images as the distance between the midpoint of f in fig 2 ) and e where the x- and y - axis components of f were calculated by xf = ( xa + xc)/2 , and yf = ( ya + yc)/2 . using the above measured implant height ( mih ) and the absolute height of the implant ( 11 mm ) the crestal bone loss on the mesial and distal area ( ab and cd ) were normalized longitudinally and across the patients . using the following formula , the normalized crestal bone loss ( ncbl ) can be computed : ncbl = ( 11 mcbl / mih ) , where mcbl stands for measured crestal bone loss . the average of the height of crestal bone loss on the mesial and distal area at months 2 , 4 , 6 , 8 and 12 after surgery was calculated for both groups . to measure the changes of bone density around the implants ( fig 3 ) , nine regions - of - insert ( roi ) each with an area of 1 mm were considered . to avoid the effect of implant on intensities of neighboring pixels in close proximities of the implant astra tech implants used in this study have two portions , micro - thread on the coronal portion and macro - thread on the apical . nine rois include immediately apical to the bone - implant contact on the mesial and distal area of the implant ( marked as a and h in fig 3 ) , in the middle of micro - thread on the mesial and distal of the implant ( marked as b and g in fig 3 ) , on the contact point of micro - thread to the macro - thread on the mesial and distal area of the implant ( marked as c and f in fig 3 ) , the apical area of the implant on the mesial and distal area ( marked as d and e in fig 3 ) and the ninth and the last roi was on the body of the implant in the distal shoulder ( marked as the last roi ( ref roi ) represented an approximately constant density that can be used to normalize the average intensity measurements from the rest of rois and related them to the bone density . the underlying concept is that a higher normalized average intensity ( nai ) of an roi suggests a higher bone density . therefore , the bone density is proportional to nai , where nai = avg ( mints)/avg ( mref ) , and avg ( mints ) and avg ( mref ) are the average intensity of a given roi and ref roi , respectively . bone density of peri - implant was divided into three areas , crestal ( average of a , b , g and h rois ) , middle ( average of c and f rois ) and apical ( average of d and e rois ) . bone density was calculated for each group in five points in time over the course of this study ( 2 , 4 , 6 , 8 and 12 months after the surgery ) . the crestal bone height changes in each group and between experimental and control groups were analyzed by friedman and wilcoxon - sign rank tests , respectively . repeated measure anova was also used for evaluating density changes.the significance level was set at 0.05 ( = 0.05 ) for all comparisons . based on the inclusion - exclusion criteria , a total of 11 patients were initially enrolled into the study . one patient was left out due to pregnancy resulting in a total of 10 patients , 8 females and 2 males , with an average age of 40.5 years . a total of 100 rvg radiographs were exposed to evaluate the 20 implants over one year . the average crestal bone loss of conventional and progressive loading is shown in table 1 . in progressive loading , crestal bone loss was stopped after 6 months and revealed some bone filling after 12 months ( values are shown in table 1 ) , but these valueswere not statistically significant ( p=0.791 ) . the crestal bone loss value of conventional loading was statistically significant after 12 months ( p=0.012 ) . the comparison between the two groups revealed that the progressive loading had significantly less crestal bone loss than the conventional loading ( control group ) after 12 months ( p=0.021 ) . statistical analysis of bone density changes for the experimental and control groups revealed a significant difference between the 2nd month and 4th , 6th , 8th and 12th months after surgery in all areas ( crestal , middle and apical ) within each group ( p<0.001 ) ( values are shown in tables 2 & 3 ) . between group comparison showed that progressive loaded implants had higher bone density in all areas than conventional loaded implants . the purpose of the presented study was to compare the progressive and conventional loading effects on single osseointegreated implants in the posterior maxilla . the posterior maxilla was selected because it presents the poorest bone quality in the jaws , and if progressive loading has positive effects on bone quality and quantity , posterior maxilla would benefit from these effects . both experimental and control implants were used in one patient to eliminate effects of occlusion , biting force , diet and habit factors between the two groups.the findings of this study support rejection of the null hypothesis . conventional loaded implants showed significantly larger bone loss than progressive loaded implants after 12 months ( p<0.05 ) . progressive loaded implants showed some bone formation after 12 months , but not statistically significant ( p>0.05 ) . appleton et al . in 2005 evaluated bone changes around single dental implants in response to progressive loading . twenty three implants ( omniloc or threadloc , calcitek inc , carlsbad , ca , usa ) were placed in 20 patients . after 5 months healing period , the control group implants were restored with a metal ceramic crown and the experimental group implants were loaded progressively with an acrylic resin crown . progressive and conventional loading were applied in different patients and did not provide similar condition ( diet , occlusal force and habits ) for both groups . after 12 months , the mean crestal bone loss for the progressive and conventional loaded implants was 0.2 mm and 0.59 mm , respectively . the difference between the two groups ( conventional vs. progressive ) was statistically significant ( p 0.05 ) . the healing period in the our study was shorter compared to that of appleton et al ; 2 months vs. 5 months , respectively . the micro - thread on the coronal region of the implant might reduce the crestal bone loss . implants with micro - thread were not used in appleton s experiment . since they did not use a stent to guide the radiography procedure , the produced radiographs were not reproducible and comparable . to remedy the above limitations , a prospective randomized controlled trial study was designed . in comparison with appleton s study , the crestal bone loss of both groups in the present study was smaller after 12 months . this difference may have occurred because of the short healing period ( 2 months after surgery ) of this study and the use of micro - thread implants . suggested that micro - thread on the coronal portion of the fixture reduced marginal bone loss around the implants . after the healing period ( 3 months in the mandible and 6 months in the maxilla ) , he loaded all implants conventionally . after 12 months , the crestal bone loss in astra tech implants ( tapered micro - thread ) was 0.14 mm . [ 9also , when compared to the conventional loaded implants of the present study , the crestal bone loss was high ( 0.36 mm ) after 12 months . this difference in crestal bone loss could be because of the bone type . in the study conducted by lee et al . , the implants were inserted in both jaws , but in the present study , the implants were placed only in the maxilla and compared to the mandible , the maxilla has poor bone quality and quantity . compared the reaction of marginal bone in astra tech and branemark system after one year . when comparing lee and astrand studies with both loadings of the present study , the lowest crestal bone loss for astra tech system after one year was in the progressive loaded implants ( 0.11 mm ) . this can potentially show that progressive loading improves crestal bone loss around inserted implants by controlling the level of stress transmitted to the crestal bone . peri - implant bone density in all areas ( crestal , middle and apical ) of progressive loaded implants was higher than conventional loaded implants ; however , this difference was not statistically significant ( p>0.05 ) . it is recommended that progressive loading studies should be carried out in high sample size , long term follow up , compromised bone regions and long span prosthesis . within the limitations of this study , the following conclusions were drawn : the progressively loaded group demonstrated less crestal bone loss around single osseointegrated implants than the conventionally loaded group . peri- implant bone density showed continuous increase in crestal , middle and apical areas in progressive loading overtime . overall , this study suggested that gradual loading led to the stimulation of bone growth and maturation .

objective : crestal bone loss is a biological complication in implant dentistry . the aim of this study was to compare the effect of progressive and conventional loading on crestal bone height and bone density around single osseointegrated implants in the posterior maxilla by a longitudinal radiographic assessment technique.materials and methods : twenty micro thread implants were placed in 10 patients ( two implants per patient ) . one of the two implants in each patient was assigned to progressive and the other to conventional loading groups . eight weeks after surgery , conventional implants were restored with a metal ceramic crown and the progressive group underwent a progressive loading protocol . the progressive loading group took different temporary acrylic crowns at 2 , 4 and 6 months . after eight months , acrylic crowns were replaced with a metal ceramic crown . computer radiography of both progressive and conventional implants was taken at 2 , 4 , 6 , and 12 months . image analysis was performed to measure the height of crestal bone loss and bone density.results:the mean values of crestal bone loss at month 12 were 0.11 ( 0.19 ) mm for progressively and 0.36 ( 0.36 ) mm for conventionally loaded implants , with a statistically significant difference ( p < 0.05 ) using wilcoxon sign rank . progressively loaded group showed a trend for higher bone density gain compared to the conventionally loaded group , but when tested with repeated measure anova , the differences were not statistically significant ( p > 0.05).conclusion : the progressive group showed less crestal bone loss in single osseointegrated implant than the conventional group . bone density around progressively loaded implants showed increase in crestal , middle and apical areas .

apart from use in operative cases and cardiac laboratories , transesophageal echocardiography ( tee ) in now being increasingly used in critical care units . the complications with its use are primarily related to gastrointestinal , cardiovascular , and respiratory systems along with some miscellaneous problems related to probe insertion , drugs , and inexperience of the operator . our case report does not describe a complication due to tee per se , but a unique clinical situation , which has not been reported previously . a 55-year - old male , with chronic liver disease , long - standing diabetes mellitus , and obesity ( body mass index of 30 ) , was admitted to the intensive care unit ( icu ) with altered sensorium , upper gastrointestinal bleed , and hemodynamic instability . his hemoglobin was stabilized to 12 g% after transfusion of packed red blood cells . despite control of bleed , he developed a temperature of 39c ( axillary temperature ) with circulatory shock and increasing lactate levels . his 24 h culture ( blood , urine , and mini bronchoalveolar lavage ) reports sent on icu admission were sterile . his bedside echocardiogram showed a very poor window with a provisionally normal report . in view of long - standing diabetes mellitus , obesity , and poor transthoracic images , a bedside tee was planned to rule out a cardiac cause of poor hemodynamics . after appropriate consent , the transesophageal probe ( mylab 30gold esaote , te 022 ) was inserted orally into the esophagus . it was examined physically for any defects before insertion . within seconds of the probe insertion , the examination was withheld and a cold saline lavage was given through the nasogastric tube to reduce the local temperature . the lavage reduced the local temperature down to 38c after which examination was resumed . after obtaining images for 5 min , there was a rise in temperature and the above procedure was repeated twice before we could satisfactorily complete the examination . esophageal heating and potential injury can occur from piezoelectric crystal vibration within the transesophageal probe tip or by direct tissue heating from absorbed ultrasound energy . esophageal thermal injury has been reported in patients with severe atherosclerotic cardiovascular disease in whom the esophageal circulation was presumed to be compromised . therefore , tee probes have a thermocouple to monitor transducer tip temperature and an automatic shutdown mechanism when a critical preset temperature ( 42 - 46c ) has been reached . tee has been described in literature in patients with fever , most commonly in suspected bacterial endocarditis . the manufacturer guide does mention that the thermal limit can be reached in patients with fever . however to our knowledge , this is the first case report describing shutdown of the probe due to increased body temperature of the patient . in our patient , the probe stopped functioning immediately on entering the esophagus in the presence of high temperature and resumed functioning after a cold saline lavage . the stomach lies in close proximity to the liver and inferior vena cava , gastric lavage is a reasonable method to rapidly cool hyperthermic patients . a core temperature reduction of approximately 0.15c / min can be achieved using this method . we could complete our examination because of intermittent cold saline lavages which were given through the nasogastric tube . it would have been ideal if we had anticipated such a problem before probe insertion . active measures would have reduced the body temperature , and we could have completed our examination within a shorter period of time . we would recommend that tee in a critically ill patient with fever should consider such a possibility and appropriate preventive measures should be taken . future attempts should be made for refinement of probe technology so that the machine is able to differentiate in temperature rise within the probe versus the surroundings .

the use of transesophageal echocardiography ( tee ) has been increasing over the past few years . it is considered a semi - invasive monitor and a safe diagnostic device . though complications are rare , they must be known to operators who frequently perform tee . tee probes are known to cause tissue heating and damage on prolonged use . in this case report , we describe shutdown of the transesophageal probe in our patient with high - grade fever .

we received deidentified information on the health outcomes from 3 large administrative data sets in victoria . out - of - hospital cardiac arrests were identified from the victorian ambulance cardiac arrest registry ( vacar ) , which captures data on all cardiac arrest patients attended by ambulance personnel ( prehospital setting ) in victoria . vacar is one of the largest prehospital cardiac arrest registries in the world.38 the registry is based on internationally recognized data variables and definitions.39 hospital admissions ( unscheduled visits ) and ed visits for cardiovascular end points were obtained from the victorian admitted episodes dataset ( vaed ) and the victorian emergency minimum dataset ( vemd ) , respectively . both vaed and vemd are comprehensive administrative data sets maintained by the health department of victoria documenting deidentified demographic and clinical information on ed visits and hospital admissions from hospitals in victoria . deidentified information included event date , home postcode , age , sex , event location ( eg , house , work , street ) , principal diagnosis according to the international classification of diseases , version 10 ( icd-10 ) codes for cvd conditions ( icd-10am , i00 to i99 ) , and a unique event identifier . victoria is a second most populous state in southeast australia . according to the australian bureau of statistics , approximately 3.6 million people resided in metropolitan melbourne , and 1.5 million resided in rural or regional areas . we included people from both metropolitan and rural or regional areas of victoria ( those whose residential postcodes fell within the boundary of the state of victoria ) . years because adverse cardiovascular events such as cardiac arrest in younger people are mainly due to nonischemic causes ( eg , structural abnormalities such as cardiomyopathy , congenital heart defects , inherited rhythm disorders [ eg , long qt syndrome]).40 the study period included 2 months of intense wildfires in victoria ( december 1 , 2006 , to january 31 , 2007 ) . landscape , climate ( mild moist winters followed by hot dry summers ) , vegetation ( dry eucalypt forests , vast grasslands ) , and protracted droughts make victoria one of the most fire - prone regions in the world . the 20062007 wildfire was the longest running collection of fires that burned 1 million hectares of land in victoria and lasted for > 60 days . this wildfire event was characterized by a few highly active fire days interspersed with days of low fire activity . the air quality during this period was substantially diminished , with elevated surface concentrations of pm2.5 found for most of the wildfire event . the maximum daily ( 24-hour ) concentration of pm2.5 measured during the wildfire event was 100 g / m . this concentration greatly exceeded the allowable air - quality standards for pm2.5 set by regulatory bodies worldwide ( in australia , the advisory standard is 25 g / m for a 24-hour period ; in the united states , it is 35 g / m for a 24-hour period ) . the long duration of these wildfires led to widespread smoke dispersion over a wide geographic area . a large population was exposed to smoke from these fires for a long period of time . this provided us with a unique opportunity to investigate acute health impacts in the community . smoke dispersion modeling for the 20062007 victorian wildfire was undertaken using the atmospheric dispersion model called the air pollution model ( tapm ) coupled with a chemical transport model.41 the modeling technique was developed by scientists from the commonwealth scientific and industrial research organization ( csiro ) marine and atmospheric research organization located in victoria . the chemical transport model is a 3-dimensional model with the capability of modeling the emission , transport , chemical transformation , and deposition of gaseous and aerosol species . it predicts regional air quality from a defined inventory of pollutant sources . for meteorology , the chemical transport model used the synoptic weather model predictions for australia provided by the bureau of meteorology and downscaled by tapm to the region of interest . dynamic downscaling generates high - resolution meteorological fields within a regional area from lower resolution continental or global data from numerical weather models . downscaling reliably predicted the meteorological parameters at the required spatial resolution ( 99 km ) for this study . of the many meteorological variables , temperature and humidity were among those most accurately predicted . the accuracy of the air pollution model for downscaling temperature and humidity has been presented in numerous papers and reports.4143 for this study , the tapm chemical transport model was configured with a complete emissions inventory that included industrial , domestic , transportation , and natural sources of aerosol in addition to smoke from the wildfire event . of these sources , however , only wildfires contributed significant amounts of pm2.5 above the natural background concentration ( 5 to 10 g / m ) . mean daily surface pm2.5 concentrations were computed for each 99-km cell in an 8080 grid domain centered on melbourne . this covered all victoria except for small areas at the extreme eastern and western boundaries . model validation , accuracy , and spatial variation have been tested extensively and discussed in detail elsewhere.4446 model accuracy was confirmed by comparing the modeled pm2.5 values with observed pm2.5 at all stations of the victorian environmental protection authority pollution - monitoring network during the wildfire event.44,46 the correlation coefficient between daily predicted pm2.5 and daily observed pm2.5 concentrations was > 0.5 . the daily observed pm2.5 data were obtained either directly from teoms ( tapered element oscillating microbalance ; thermo fisher scientific ) located at the monitoring stations or from surrogate aerosol observations . for monitoring stations that were not equipped with pm2.5 teoms , the backscattering coefficient was obtained from nephelometers located at each station . for this study , a very high correlation was found between pm2.5 and backscattering coefficient ( r=0.966).this enabled pm2.5 to be estimated with a high level of confidence when monitoring stations were not equipped with pm2.5 teoms . comprehensive observations of smoke composition ( including aerosol chemical composition , plume aging , and secondary aerosol formation ) were also made at the csiro air - quality monitoring station in melbourne during the wildfire event . size , characterization , and chemical composition of smoke aerosol are also detailed in a report by meyer et al.47 both the aerosol composition and the detailed trajectory analysis confirmed that the only significant source of pm2.5 during the pollution events was the wildfires . the smoke aerosol was composed of organic content , inorganic carbon content , mineral ion content , and anhydrous sugar levoglucosan . levoglucosan is a unique tracer for wood burning and is produced in high concentrations in biomass smoke.22 pm2.5 contribution from other nonwildfire sources ( eg , industry , transportation , sea salt , windblown dust ) during this wildfire period was negligible . the smoke composition during biomass combustion was relatively consistent and stable and did not change significantly over a 24-hour time period.47 modeled daily average temperature , relative humidity , and ground - level pm2.5 for the study period were matched by postcodes . a time - stratified case - crossover study design4850 was applied to investigate the association between wildfire - related pm2.5 air pollutant and cardiovascular health outcomes using conditional logistic regression models . in this study design , the pm2.5 exposure on the day of the health event ( eg , out - of - hospital cardiac arrest ; case day ) was compared with pm2.5 exposure on several nonevent days ( referent ; control days ) . the referent exposure days were selected by time - stratified sampling and were matched for day of the week , month , and year of the health event ( eg , exposure on the day of an event on monday in january was compared with exposures on all other mondays in january ) . this resulted in 3 or 4 control periods for each case period . because the matching referent periods were close in time and on the same day of the week as the event day , this study design automatically controlled for time - dependent risk factors such as day of the week and monthly , seasonal , and long - term trends.5153 moreover , because the persons who experienced the health event also served as their own controls , time - independent factors such as age , sex , smoking , socioeconomic status , preexisting health conditions , and other individual risk factors were controlled for with this approach.48,52,54 the primary outcome measures in our study were cvd end points : out - of - hospital cardiac arrests , hospital admissions , and ed visits for ihd ( icd10-am , i20 to i25 , i46 , i49 ) , ami ( i21 ) , and angina ( i20 ) . the primary exposure measure was modeled wildfire - derived pm2.5 ( daily average ) concentrations . we conducted a subgroup analysis by age group ( 35 to 64 years , 65 years ) and by sex . various lag periods were also investigated : lag 0 ( exposure concentrations on the day of event ) , lag 1 ( exposure concentrations 1 day before the event ) , lag 2 ( exposure concentrations 2 days before the event ) , and 2-day lagged moving average ( lag 0 to 1 : averages of exposure concentrations on the day of the event and exposure concentrations 1 day before the event ) . the models were adjusted for lag 0 to lag 2 of temperature and relative humidity . the overall results are presented as an increase in interquartile range for daily average pm2.5 concentrations and the associated percentage change in the risk of cvd end points after controlling for temperature and relative humidity at various lag periods . the data were analyzed using the statistical package stata ( version 12.1 ; statacorp ) . we received deidentified information on the health outcomes from 3 large administrative data sets in victoria . out - of - hospital cardiac arrests were identified from the victorian ambulance cardiac arrest registry ( vacar ) , which captures data on all cardiac arrest patients attended by ambulance personnel ( prehospital setting ) in victoria . vacar is one of the largest prehospital cardiac arrest registries in the world.38 the registry is based on internationally recognized data variables and definitions.39 hospital admissions ( unscheduled visits ) and ed visits for cardiovascular end points were obtained from the victorian admitted episodes dataset ( vaed ) and the victorian emergency minimum dataset ( vemd ) , respectively . both vaed and vemd are comprehensive administrative data sets maintained by the health department of victoria documenting deidentified demographic and clinical information on ed visits and hospital admissions from hospitals in victoria . deidentified information included event date , home postcode , age , sex , event location ( eg , house , work , street ) , principal diagnosis according to the international classification of diseases , version 10 ( icd-10 ) codes for cvd conditions ( icd-10am , i00 to i99 ) , and a unique event identifier . victoria is a second most populous state in southeast australia . according to the australian bureau of statistics , approximately 3.6 million people resided in metropolitan melbourne , and 1.5 million resided in rural or regional areas . we included people from both metropolitan and rural or regional areas of victoria ( those whose residential postcodes fell within the boundary of the state of victoria ) . years because adverse cardiovascular events such as cardiac arrest in younger people are mainly due to nonischemic causes ( eg , structural abnormalities such as cardiomyopathy , congenital heart defects , inherited rhythm disorders [ eg , long qt syndrome]).40 the study period included 2 months of intense wildfires in victoria ( december 1 , 2006 , to january 31 , 2007 ) . landscape , climate ( mild moist winters followed by hot dry summers ) , vegetation ( dry eucalypt forests , vast grasslands ) , and protracted droughts make victoria one of the most fire - prone regions in the world . the 20062007 wildfire was the longest running collection of fires that burned 1 million hectares of land in victoria and lasted for > 60 days . this wildfire event was characterized by a few highly active fire days interspersed with days of low fire activity . the air quality during this period was substantially diminished , with elevated surface concentrations of pm2.5 found for most of the wildfire event . the maximum daily ( 24-hour ) concentration of pm2.5 measured during the wildfire event was 100 g / m . this concentration greatly exceeded the allowable air - quality standards for pm2.5 set by regulatory bodies worldwide ( in australia , the advisory standard is 25 g / m for a 24-hour period ; in the united states , it is 35 g / m for a 24-hour period ) . the long duration of these wildfires led to widespread smoke dispersion over a wide geographic area . a large population was exposed to smoke from these fires for a long period of time . this provided us with a unique opportunity to investigate acute health impacts in the community . smoke dispersion modeling for the 20062007 victorian wildfire was undertaken using the atmospheric dispersion model called the air pollution model ( tapm ) coupled with a chemical transport model.41 the modeling technique was developed by scientists from the commonwealth scientific and industrial research organization ( csiro ) marine and atmospheric research organization located in victoria . the chemical transport model is a 3-dimensional model with the capability of modeling the emission , transport , chemical transformation , and deposition of gaseous and aerosol species . , the chemical transport model used the synoptic weather model predictions for australia provided by the bureau of meteorology and downscaled by tapm to the region of interest . dynamic downscaling generates high - resolution meteorological fields within a regional area from lower resolution continental or global data from numerical weather models . downscaling reliably predicted the meteorological parameters at the required spatial resolution ( 99 km ) for this study . of the many meteorological variables , temperature and humidity were among those most accurately predicted . the accuracy of the air pollution model for downscaling temperature and humidity has been presented in numerous papers and reports.4143 for this study , the tapm chemical transport model was configured with a complete emissions inventory that included industrial , domestic , transportation , and natural sources of aerosol in addition to smoke from the wildfire event . of these sources , however , only wildfires contributed significant amounts of pm2.5 above the natural background concentration ( 5 to 10 g / m ) . mean daily surface pm2.5 concentrations were computed for each 99-km cell in an 8080 grid domain centered on melbourne . this covered all victoria except for small areas at the extreme eastern and western boundaries . model validation , accuracy , and spatial variation have been tested extensively and discussed in detail elsewhere.4446 model accuracy was confirmed by comparing the modeled pm2.5 values with observed pm2.5 at all stations of the victorian environmental protection authority pollution - monitoring network during the wildfire event.44,46 the correlation coefficient between daily predicted pm2.5 and daily observed pm2.5 concentrations was > 0.5 . the daily observed pm2.5 data were obtained either directly from teoms ( tapered element oscillating microbalance ; thermo fisher scientific ) located at the monitoring stations or from surrogate aerosol observations . for monitoring stations that were not equipped with pm2.5 teoms , the backscattering coefficient was obtained from nephelometers located at each station . for this study , a very high correlation was found between pm2.5 and backscattering coefficient ( r=0.966).this enabled pm2.5 to be estimated with a high level of confidence when monitoring stations were not equipped with pm2.5 teoms . comprehensive observations of smoke composition ( including aerosol chemical composition , plume aging , and secondary aerosol formation ) were also made at the csiro air - quality monitoring station in melbourne during the wildfire event . size , characterization , and chemical composition of smoke aerosol are also detailed in a report by meyer et al.47 both the aerosol composition and the detailed trajectory analysis confirmed that the only significant source of pm2.5 during the pollution events was the wildfires . the smoke aerosol was composed of organic content , inorganic carbon content , mineral ion content , and anhydrous sugar levoglucosan . levoglucosan is a unique tracer for wood burning and is produced in high concentrations in biomass smoke.22 pm2.5 contribution from other nonwildfire sources ( eg , industry , transportation , sea salt , windblown dust ) during this wildfire period was negligible . the smoke composition during biomass combustion was relatively consistent and stable and did not change significantly over a 24-hour time period.47 modeled daily average temperature , relative humidity , and ground - level pm2.5 for the study period were matched by postcodes . a time - stratified case - crossover study design4850 was applied to investigate the association between wildfire - related pm2.5 air pollutant and cardiovascular health outcomes using conditional logistic regression models . in this study design , the pm2.5 exposure on the day of the health event ( eg , out - of - hospital cardiac arrest ; case day ) was compared with pm2.5 exposure on several nonevent days ( referent ; control days ) . the referent exposure days were selected by time - stratified sampling and were matched for day of the week , month , and year of the health event ( eg , exposure on the day of an event on monday in january was compared with exposures on all other mondays in january ) . this resulted in 3 or 4 control periods for each case period . because the matching referent periods were close in time and on the same day of the week as the event day , this study design automatically controlled for time - dependent risk factors such as day of the week and monthly , seasonal , and long - term trends.5153 moreover , because the persons who experienced the health event also served as their own controls , time - independent factors such as age , sex , smoking , socioeconomic status , preexisting health conditions , and other individual risk factors were controlled for with this approach.48,52,54 the primary outcome measures in our study were cvd end points : out - of - hospital cardiac arrests , hospital admissions , and ed visits for ihd ( icd10-am , i20 to i25 , i46 , i49 ) , ami ( i21 ) , and angina ( i20 ) . the primary exposure measure was modeled wildfire - derived pm2.5 ( daily average ) concentrations . we conducted a subgroup analysis by age group ( 35 to 64 years , 65 years ) and by sex . various lag periods were also investigated : lag 0 ( exposure concentrations on the day of event ) , lag 1 ( exposure concentrations 1 day before the event ) , lag 2 ( exposure concentrations 2 days before the event ) , and 2-day lagged moving average ( lag 0 to 1 : averages of exposure concentrations on the day of the event and exposure concentrations 1 day before the event ) . the models were adjusted for lag 0 to lag 2 of temperature and relative humidity . the overall results are presented as an increase in interquartile range for daily average pm2.5 concentrations and the associated percentage change in the risk of cvd end points after controlling for temperature and relative humidity at various lag periods . the data were analyzed using the statistical package stata ( version 12.1 ; statacorp ) . the descriptive characteristics for out - of - hospital cardiac arrests and ihd events ( ed visits and hospital admissions ) are shown in table1 . of the 457 cases of out - of - hospital cardiac arrests during the study period , the largest percentage was for patients aged 65 years ( 67% ) , and most were male ( 67% ) rather than female ( 33% ) . of the 2106 cases of ed attendance for ihd , the largest percentage was for patients aged 65 years ( 62% ) , and most were male ( 63% ) rather than female ( 37% ) . of the 3274 cases of hospital admissions for ihd , the largest percentage was for those aged 65 years ( 64% ) , and most were male ( 64% ) rather than female ( 36% ) . the ed attendance data also indicated 788 cases of ami and 1131 cases of angina , and hospital admissions data indicated 1554 cases of ami and 1534 cases of angina . table2 provides an overview of modeled daily average pm2.5 concentration , temperature , and relative humidity during the study period . descriptive characteristics of out - of - hospital cardiac arrests and ihd events in victoria , australia ( december 1 , 2006 , to january 31 , 2007 ) values are number ( percentage ) . descriptive summary of daily average air exposure data ( modeled , december 2006 to january 2007 ) iqr indicates interquartile range ( values are calculated for a change in pm2.5 levels from the 25th to the 75th percentile ) ; pm2.5 , particulate matter ; rh , relative humidity . an interquartile range increase in pm2.5 of 9 g / m over the 2-day moving average ( lag 0 to 1 ) was associated with an increase in risk for out - of - hospital cardiac arrests of 6.98% ( 95% ci 1.03% to 13.29% ) after adjusting for temperature and relative humidity . an association of 4.55% ( 95% ci 0.54% to 8.72% ) was also observed on the day of the exposure ( lag 0 ) , although this was not as strong as that observed over the 2-day exposure period . percentage change % ( 95% ci ) in risk of out - of - hospital cardiac arrests , hospital admissions , and ed visits for ihd , ami , and angina for an iqr increase in pm2.5 by 9 g / m at various lag days statistics reflect the adjustment for temperature and relative humidity . ami indicates acute myocardial infarction ; ed , emergency department ; ihd , ischemic heart disease ; pm2.5 , fine particulate matter . when we conducted the subgroup analysis by age and sex , we found those aged 65 years to be at higher risk by 7.25% ( 95% ci 0.24% to 14.75% ; p=0.04 ) compared with younger participants ( aged 35 to 64 years : 5.8% ; 95% ci 5.04% to 17.89% ; p=0.30 ) and men to be at higher risk by 9.05% ( 95% ci 1.63% to 17.02% ; p=0.01 ) compared with women ( 3.19% ; 95% ci 6.4% to 13.84% ; p=0.53 ) ( figure1 ) . percentage increase in risk ( and 95% ci ) of out - of - hospital cardiac arrests by age and by sex for interquartile range increase in pm2.5 by 9 g / m after adjusting for temperature and relative humidity for lag 0 to 1 ( lag 0 to 1 : averages of exposure concentrations on the day of the event and exposure concentrations 1 day before the event ) . ohca indicates out - of - hospital cardiac arrests ; pm2.5 , fine particulate matter . after adjusting for temperature and relative humidity , an interquartile range increase in pm2.5 of 9 g / m was associated with an increase in risk of hospital admissions for ihd by 1.86% ( 95% ci 0.35% to 3.44% ) and for ami by 2.34% ( 95% ci 0.06% to 4.67% ) at lag 2 . although we presented our results for lag periods ( lag 0 , 1 , 2 , 0 to 1 ) , we extended our analysis for hospital admissions to include lag periods of up to 5 days but did not find any significant effect ( data not shown ) . after adjusting for temperature and relative humidity , an interquartile range increase in pm2.5 of 9 g / m was associated with an increase in risk of ed attendance for ihd by 2.07% ( 95% ci 0.09% to 4.09% ) at lag 2 . when we conducted the subgroup analysis by age and sex , we found a higher risk of ihd - related hospital admissions for those aged 65 years by 2.41% ( 95% ci 0.54% to 4.31% ; p=0.01 ) compared with younger participants ( aged 35 to 64 years : 0.26% ; 95% ci 2.37% to 2.98% ; p=0.84 ) and for women by 3.21% ( 95% ci 0.82% to 5.67% ; p=0.02 ) compared with men ( 0.99% ; 95% ci 0.94% to 2.9% ; p=0.33 ) ( figure2 ) . percentage increase in risk ( and 95% ci ) of hospital admission for ihd ( by age and by sex ) for an interquartile range increase in pm2.5 by 9 g / m after adjusting for temperature and relative humidity at lag 2 ( exposure concentrations 2 days before the event ) . an interquartile range increase in pm2.5 of 9 g / m over the 2-day moving average ( lag 0 to 1 ) was associated with an increase in risk for out - of - hospital cardiac arrests of 6.98% ( 95% ci 1.03% to 13.29% ) after adjusting for temperature and relative humidity . an association of 4.55% ( 95% ci 0.54% to 8.72% ) was also observed on the day of the exposure ( lag 0 ) , although this was not as strong as that observed over the 2-day exposure period . percentage change % ( 95% ci ) in risk of out - of - hospital cardiac arrests , hospital admissions , and ed visits for ihd , ami , and angina for an iqr increase in pm2.5 by 9 g / m at various lag days statistics reflect the adjustment for temperature and relative humidity . ami indicates acute myocardial infarction ; ed , emergency department ; ihd , ischemic heart disease ; pm2.5 , fine particulate matter . when we conducted the subgroup analysis by age and sex , we found those aged 65 years to be at higher risk by 7.25% ( 95% ci 0.24% to 14.75% ; p=0.04 ) compared with younger participants ( aged 35 to 64 years : 5.8% ; 95% ci 5.04% to 17.89% ; p=0.30 ) and men to be at higher risk by 9.05% ( 95% ci 1.63% to 17.02% ; p=0.01 ) compared with women ( 3.19% ; 95% ci 6.4% to 13.84% ; p=0.53 ) ( figure1 ) . percentage increase in risk ( and 95% ci ) of out - of - hospital cardiac arrests by age and by sex for interquartile range increase in pm2.5 by 9 g / m after adjusting for temperature and relative humidity for lag 0 to 1 ( lag 0 to 1 : averages of exposure concentrations on the day of the event and exposure concentrations 1 day before the event ) . ohca indicates out - of - hospital cardiac arrests ; pm2.5 , fine particulate matter . when we conducted the subgroup analysis by age and sex , we found those aged 65 years to be at higher risk by 7.25% ( 95% ci 0.24% to 14.75% ; p=0.04 ) compared with younger participants ( aged 35 to 64 years : 5.8% ; 95% ci 5.04% to 17.89% ; p=0.30 ) and men to be at higher risk by 9.05% ( 95% ci 1.63% to 17.02% ; p=0.01 ) compared with women ( 3.19% ; 95% ci 6.4% to 13.84% ; p=0.53 ) ( figure1 ) . percentage increase in risk ( and 95% ci ) of out - of - hospital cardiac arrests by age and by sex for interquartile range increase in pm2.5 by 9 g / m after adjusting for temperature and relative humidity for lag 0 to 1 ( lag 0 to 1 : averages of exposure concentrations on the day of the event and exposure concentrations 1 day before the event ) . ohca indicates out - of - hospital cardiac arrests ; pm2.5 , fine particulate matter . after adjusting for temperature and relative humidity , an interquartile range increase in pm2.5 of 9 g / m was associated with an increase in risk of hospital admissions for ihd by 1.86% ( 95% ci 0.35% to 3.44% ) and for ami by 2.34% ( 95% ci 0.06% to 4.67% ) at lag 2 . although we presented our results for lag periods ( lag 0 , 1 , 2 , 0 to 1 ) , we extended our analysis for hospital admissions to include lag periods of up to 5 days but did not find any significant effect ( data not shown ) . after adjusting for temperature and relative humidity , an interquartile range increase in pm2.5 of 9 g / m was associated with an increase in risk of ed attendance for ihd by 2.07% ( 95% ci 0.09% to 4.09% ) at lag 2 . when we conducted the subgroup analysis by age and sex , we found a higher risk of ihd - related hospital admissions for those aged 65 years by 2.41% ( 95% ci 0.54% to 4.31% ; p=0.01 ) compared with younger participants ( aged 35 to 64 years : 0.26% ; 95% ci 2.37% to 2.98% ; p=0.84 ) and for women by 3.21% ( 95% ci 0.82% to 5.67% ; p=0.02 ) compared with men ( 0.99% ; 95% ci 0.94% to 2.9% ; p=0.33 ) ( figure2 ) . percentage increase in risk ( and 95% ci ) of hospital admission for ihd ( by age and by sex ) for an interquartile range increase in pm2.5 by 9 g / m after adjusting for temperature and relative humidity at lag 2 ( exposure concentrations 2 days before the event ) . after adjusting for temperature and relative humidity , an interquartile range increase in pm2.5 of 9 g / m was associated with an increase in risk of hospital admissions for ihd by 1.86% ( 95% ci 0.35% to 3.44% ) and for ami by 2.34% ( 95% ci 0.06% to 4.67% ) at lag 2 . although we presented our results for lag periods ( lag 0 , 1 , 2 , 0 to 1 ) , we extended our analysis for hospital admissions to include lag periods of up to 5 days but did not find any significant effect ( data not shown ) . after adjusting for temperature and relative humidity , an interquartile range increase in pm2.5 of 9 g / m was associated with an increase in risk of ed attendance for ihd by 2.07% ( 95% ci 0.09% to 4.09% ) at lag 2 . when we conducted the subgroup analysis by age and sex , we found a higher risk of ihd - related hospital admissions for those aged 65 years by 2.41% ( 95% ci 0.54% to 4.31% ; p=0.01 ) compared with younger participants ( aged 35 to 64 years : 0.26% ; 95% ci 2.37% to 2.98% ; p=0.84 ) and for women by 3.21% ( 95% ci 0.82% to 5.67% ; p=0.02 ) compared with men ( 0.99% ; 95% ci 0.94% to 2.9% ; p=0.33 ) ( figure2 ) . percentage increase in risk ( and 95% ci ) of hospital admission for ihd ( by age and by sex ) for an interquartile range increase in pm2.5 by 9 g / m after adjusting for temperature and relative humidity at lag 2 ( exposure concentrations 2 days before the event ) . when we conducted the subgroup analysis by age and sex , we found a higher risk of ihd - related hospital admissions for those aged 65 years by 2.41% ( 95% ci 0.54% to 4.31% ; p=0.01 ) compared with younger participants ( aged 35 to 64 years : 0.26% ; 95% ci 2.37% to 2.98% ; p=0.84 ) and for women by 3.21% ( 95% ci 0.82% to 5.67% ; p=0.02 ) compared with men ( 0.99% ; 95% ci 0.94% to 2.9% ; p=0.33 ) ( figure2 ) . percentage increase in risk ( and 95% ci ) of hospital admission for ihd ( by age and by sex ) for an interquartile range increase in pm2.5 by 9 g / m after adjusting for temperature and relative humidity at lag 2 ( exposure concentrations 2 days before the event ) . this study found a positive association between pm2.5 air - pollutant exposure and acute chd events during the 20062007 wildfire period in victoria . specifically , associations were observed for out - of - hospital cardiac arrests , hospital admissions , and ed visits for ihd after 2 days of exposure to wildfire smoke at pm2.5 concentrations . this association was observed mainly in older adults ( aged 65 years ) , with men showing a higher risk of out - of - hospital cardiac arrests events and women showing a higher risk of ihd - related hospital admissions . sustained effects of wildfire smoke exposure and cumulative biological effects could be responsible for a delayed effect of pm2.5 exposure on acute chd events.55 from a mechanistic point of view , exposure to pm2.5 from wildfire smoke 2 days before the events may amplify the pathobiological processes in the body ( induce an inflammatory cascade ) and lead to ischemic events , plaque rupture , and development of arrhythmias . multiple pathways ( possibly interlinked ) have been postulated4,17,20,3436,56,57 by which pm2.5 could instigate adverse cardiac events including ( 1 ) induction of systemic pulmonary inflammation and oxidative stress , leading to increased levels of inflammatory markers ( eg , c - reactive protein , prothrombotic and inflammatory cytokines ) ; ( 2 ) direct translocation into blood , leading to increase in blood viscosity , thrombus formation , plaque erosion , and rupture and acceleration of the atherosclerotic process ; and ( 3 ) dysregulation of the cardiac autonomic system ( increase in heart rate and decrease in heart rate variability ) , leading to arrhythmias and cardiac arrests . some of these potential mechanisms , however , must be seen as somewhat speculative . a convincing explanation of how wildfire - related pm2.5 air pollutants might induce different biological responses to non wildfire - related pm2.5 remains an area of research . it is conceivable that the difference in the magnitude of the inflammatory response could occur because of variation in the duration and intensity of exposure to particulate matter.20 unlike pm2.5 derived from urban pollution , wildfire - related pm2.5 concentrations can become extreme with variations in the duration of exposure to smoke events.25,58 the difference in biological response could also be due to the variation in the chemical composition of particulate matter . some studies have suggested that the chemical components present in pm2.5 pollutant ( eg , transition metals ) from urban pollution can catalyze an oxidative stress reaction in the lungs , leading to inflammatory lung injury and arrhythmias.5,5961 in contrast , a study by weggser et al30 ( using mouse bioassay ) showed that pm2.5 from wildfires was particularly toxic to the lungs , especially to the alveolar macrophages , compared with pm2.5 exposure from urban pollution . other less known and studied possibilities for the delayed impact of wildfire pm2.5 exposure could be due to behavioral , cultural , social , and environmental conditions that determine a person s use of health services during such extreme events.62 similar to respiratory health points , the cvd health points at various lags may be influenced by individual perceptions and decisions to seek medical care during wildfire episodes.63 people may delay deciding to go to the hospital , for example , until symptoms become too severe during the wildfire event.55 this important possibility needs further exploration . only a limited number of studies to date have investigated the effect of fine particulate matter exposure on out - of - hospital cardiac arrests . these studies6,1619 reported an increase in the risk of out - of - hospital cardiac arrests by 4% to 10% for an increase in pm2.5 concentrations by 5 to 10 g / m , and this is consistent with our findings . nonetheless , it is noted that some studies have not shown an increase in implantable cardioverter - defibrillator discharges , which typically reflect occurrences of life - threatening ventricular arrhythmias at times of significant air pollution.6466 only a few epidemiological studies have investigated cardiovascular health impact and exposure to wildfire smoke - related particulate matter.55,58,63,6772 most studies investigated the impact on ihd - related hospital admissions and found null or inconsistent results.55,58,63,6770 in contrast , numerous studies have investigated the association between cardiovascular health impact and exposure to particulate matter pollutants from urban sources ( eg , vehicular emissions).20 studies have reported a 2% to 20% increase in risk of acute ihd - related morbidity for a 10 g / m increase in pm2.5 levels.3,4,7,11,31,73 some challenges are involved in investigating the health impacts of wildfire smoke exposure . wildfires are episodic and short - lived events ; therefore , the brief periods of pm2.5 exposure may not be enough to detect all but the most sensitive health outcomes.74 moreover , many wildfire smoke affected areas ( especially rural or regional areas ) do not have routine air - quality monitoring programs . consequently , exposure assessment is challenging in these areas.75 our study is unique in 3 respects : ( 1 ) use of spatially resolved pm2.5 air pollutant data obtained from a novel air - quality modeling technique , ( 2 ) wildfire pm2.5 estimates derived from areas with lack of monitoring facilities ( eg , rural or regional areas outside a major city ) , and ( 3 ) extensive and long duration of a wildfire event with widespread pm2.5 particulate dispersion affecting a large population . given that the burden of chd remains high globally ( chd accounts for 64% of all cvd deaths ) and is predicted to remain so for the next 20 years,76 further research is required to understand the role of wildfire - related pm2.5 as a triggering factor for acute chd events . years were at higher risk for cardiac events due to pm2.5 exposure , similar to the findings observed in other studies.6,16,55,63,67,70 given that older adults may already suffer from multiple comorbidities including atherosclerosis ( often asymptomatic ) , exposure to pm2.5 may attenuate any underlying ihd , thereby triggering potentially fatal coronary events.2 similar to our findings , 2 studies showed that men had a higher risk of out - of - hospital cardiac arrests due to pm exposure.16,19 the reason for different outcomes between men and women is still unclear . it has been suggested that women suffer cardiac arrests half as often as men of the same age.77 pathobiological processes other than atherosclerosis ( eg , coronary vasospasm , valvular heart disease ) may also be more common in women.78 limited studies have shown women to be at increased risk of chd morbidity due to pm exposure.7982 this is consistent with our findings , in which we observed women to be at increased risk of ihd . although the evidence is sparse , it has been hypothesized that hormonal alteration , increase in inflammatory biomarkers ( eg , c - reactive protein ) , poor coronary circulation due to microvascular coronary dysfunction ( more plaque erosion and distal embolization , small arterial size ) , and endothelial dysfunction in women may be factors contributing to female - specific ischemic disease.83 concentrations of the inflammatory biomarker c - reactive protein are also known to increase due to pm exposure.20,84,85 this could explain the increase in risk of ihd in women during wildfire episodes , when pm2.5 levels are significantly high . difference in acute cardiac events between men and women during wildfire smoke exposure is an area needing further research . the main strength of our study was the use of novel modeling techniques to estimate air exposure data during the wildfire period . modeled data had an advantage in that they provided fine temporal and spatial resolution and wider coverage of areas with no monitoring facilities , especially rural or regional victoria . this is in contrast to studies using monitored data , in which exposure information is obtained only from limited areas ( in and around the monitors).this means that the monitored data might not adequately represent the smoke impact in areas that lack monitoring facilities ( rural or regional areas ) , thereby limiting the ability to detect associations that might be present.86 another important strength of this study was that the majority of the pm2.5 pollutant included in the air pollution model was derived from wildfires . this allowed us to directly analyze the contribution of smoke - sourced pm2.5 levels to increased risk of chd events . the wide spread and long duration of the 20062007 wildfire event provided us with an opportunity to assess the health impacts of protracted exposure to uncontaminated biomass combustion . in australia , air - quality exceedance in rural areas is associated mostly with biomass combustion from either domestic wood burning or wildfires.27,47,87 in these areas , most pollution events are biomass combustion aerosol largely uncontaminated from other pollutant types . moreover , towns are widely separated , and for the most part , the air quality is determined by local pollutant sources ( particularly domestic wood heaters ) ; advection of pollutant plumes from other towns or cities is rare . consequently , australian cities and especially regional areas provide a rare test bed for investigating the impacts of biomass combustion aerosol uncontaminated by other anthropogenic sources of pm2.5 . we used comprehensive statewide health data sets to obtain information relevant for the purposes of the study . access to health information from such large registries further reduced the risk of selection bias and strengthened case ascertainment . a limitation of our study was the lack of information on personal risk factors such as socioeconomic status , smoking , obesity , and underlying health conditions ; however , the case - crossover study design controls for confounding factors because the participants serve as their own controls.48 we also lacked data on indoor pm2.5 concentrations during wildfire episodes . research has shown that during major wildfires , the impact of outdoor air quality on indoor air quality can be severe.27 although we did not adjust for the coarser fraction of particulate matter air pollutant ( pm10 ) in the study , the bulk of the pm10 emitted during wildfires is pm2.5.22,88 on average , 87% of pm10 due to wildfires consists of pm2.5.89 a strong positive correlation has been observed between wildfire pm10 and pm2.5 ( r=0.9).47 we also performed many tests that could have resulted in increased probability of obtaining spurious associations . we acknowledge that we were unable to account for repeated health events because we obtained only deidentified health data . robust evidence - based research is required to fill the knowledge gaps that currently exist in this important area of public health . novel air exposure modeling techniques to improve forecasting , effective spatial coverage , and health impact assessment of at - risk groups ( eg , women , children , and older adults ) are areas of significant need . moreover , health impacts of wildfire smoke exposure in rural or regional communities remain largely unknown and urgently require understanding . pathophysiology and pathways that trigger acute cardiac events due to pm2.5 exposure ( short and long term ) remains speculative and need further evidence . importantly , the variation in pm2.5 exposure ( duration and intensity ) from wildfire episodes and from urban air pollution on cardiovascular health end points requires understanding . detailed analysis of chemical composition of wildfire particulates is also needed to understand toxicity of source - specific fractions of pm2.5 on clinical outcomes . information is currently insufficient to determine a safe pm2.5 exposure threshold during wildfire episodes below which there are no adverse health impacts . improvement in the understanding of these priority areas is needed so that effective and timely public health strategies can be developed and implemented to reduce the burden of disease during wildfire events . this will have further implications for setting appropriate air - quality standards , enhancing health care infrastructure , and improving timely risk communication and health advice during wildfires . the results from our study suggest that pm2.5 exposure from wildfire smoke may be an important determinant of out - of - hospital cardiac arrest and ihd ( ed visits and hospital admissions ) and that susceptible persons such as older adults may be at higher risk during such extreme events . given the increased incidence and frequency of wildfires recently and the increased number of people at risk of smoke exposure , future research is required to investigate the role of fine particulate matter exposure from wildfire smoke in triggering acute coronary events . the knowledge and evidence resulting from such research will inform policy and practice and help build capacity in the understanding and management of adverse cardiovascular health impacts in vulnerable communities during wildfire episodes . this research was funded by bushfire cooperative research centre ( bushfire crc ) now a part of bushfire & natural hazards cooperative research centre , melbourne , victoria , australia .

backgroundepidemiological studies investigating the role of fine particulate matter ( pm2.5 ; aerodynamic diameter < 2.5 m ) in triggering acute coronary events , including out - of - hospital cardiac arrests and ischemic heart disease ( ihd ) , during wildfires have been inconclusive.methods and resultswe examined the associations of out - of - hospital cardiac arrests , ihd , acute myocardial infarction , and angina ( hospital admissions and emergency department attendance ) with pm2.5 concentrations during the 20062007 wildfires in victoria , australia , using a time - stratified case - crossover study design . health data were obtained from comprehensive health - based administrative registries for the study period ( december 2006 to january 2007 ) . modeled and validated air exposure data from wildfire smoke emissions ( daily average pm2.5 , temperature , relative humidity ) were also estimated for this period . there were 457 out - of - hospital cardiac arrests , 2106 emergency department visits , and 3274 hospital admissions for ihd . after adjusting for temperature and relative humidity , an increase in interquartile range of 9.04 g / m3 in pm2.5 over 2 days moving average ( lag 0 - 1 ) was associated with a 6.98% ( 95% ci 1.03% to 13.29% ) increase in risk of out - of - hospital cardiac arrests , with strong association shown by men ( 9.05%,95%ci 1.63% to 17.02% ) and by older adults ( aged 65 years ) ( 7.25% , 95% ci 0.24% to 14.75% ) . increase in risk was ( 2.07% , 95% ci 0.09% to 4.09% ) for ihd - related emergency department attendance and ( 1.86% , 95% ci : 0.35% to 3.4% ) for ihd - related hospital admissions at lag 2 days , with strong associations shown by women ( 3.21% , 95% ci 0.81% to 5.67% ) and by older adults ( 2.41% , 95% ci 0.82% to 5.67%).conclusionpm2.5 exposure was associated with increased risk of out - of - hospital cardiac arrests and ihd during the 20062007 wildfires in victoria . this evidence indicates that pm2.5 may act as a triggering factor for acute coronary events during wildfire episodes .

gastric cancer is the second leading cause of cancer - related death worldwide . in western countries , the incidence of gastric cancer has been decreasing , whereas it remains a main cause of cancer - related death in korea . the incidence of ovarian metastasis or krukenberg tumor after curative resection of gastric cancer is approximately 0.3%-6.7% ; however , some autopsy studies have reported incidence rates ranging from 33% to 41% . one of the most important causes of treatment failure for gastric cancer is an ovarian relapse . however , the underlying mechanism of the intratumor heterogeneity of gastric cancer has not been clearly established . furthermore , the prognostic factors and treatment guidelines for patients diagnosed with krukenberg tumor of gastric origin are insufficient . although systemic chemotherapy is the optimal treatment strategy for recurrent or metastatic gastric cancer , it has not provided significant survival benefits . therefore , several treatment strategies have been investigated to improve overall survival ( os ) in metastatic gastric cancer patients with oligometastases or limited metastasis . several local treatments including metastasectomy , radiofrequency ablation , and stereotactic body radiation therapy have shown impressive results . additionally , resection of metastatic lesions has been shown to increase os in colorectal cancer ( crc ) patients with operable liver and lung metastases [ 9 - 12 ] . therefore , national comprehensive cancer network guidelines recommend metastasectomy for operable lung and liver lesions in crc . however , the survival benefit of metastasectomy has not been clearly validated for krukenberg tumors in gastric cancer . most krukenberg tumors are diagnosed metachronously , and only a few patients with krukenberg tumor are clinically diagnosed synchronously . in most hospitals , patients . however , there is limited clinical data available regarding the survival benefit of ovarian metastasectomy in patients with advanced gastric cancer . moreover , controversies regarding the best treatment strategy for krukenberg tumor in gastric cancer have caused confusion among physicians . therefore , we investigated the survival benefit of ovarian metastasectomy in synchronous or metachronous krukenberg tumor in gastric cancer . of 27,103 patients who were diagnosed with gastric cancer between march 2004 and february 2012 at yonsei university medical center , 9,217 ( 34% ) were women . among female gastric cancer patients , 216 with krukenberg tumor detected by abdominal - pelvis computed tomography ( ct ) or gynecologic ultrasonography were included in this study and reviewed retrospectively ( severance hospital , n=172 ; gangnam severance hospital , n=44 ) . patient information was obtained from outpatient clinical or admission records and information regarding patient survival was obtained from the korean national statistics registry database . the protocols were approved by the yonsei university health system institutional review board . in general therefore , for data analysis , patients were divided into two groups according to initial gastric cancer stage : stage i - iii and stage iv . patients suspected of having krukenberg tumor underwent imaging studies to confirm disease resectability . however , 87% of patients ( 93/107 ) who underwent oophorectomy had disease that already extended beyond the ovary , in which case oophorectomy was performed for palliative symptom control . the residual disease state of each patient was documented as the presence or absence of gross residual disease , which was classified as negative resection margins ( r0 ) , microscopic tumor infiltration ( r1 ) , and macroscopic residual tumor ( r2 ) . r0 resection was achieved in only 38% ( 41/107 ) of patients who underwent oophorectomy . overall , 125 patients were initially diagnosed with stage iv gastric cancer and 91 with recurrent krukenberg tumor after they underwent curative resection of gastric cancer . among the patients initially diagnosed with stage iv gastric cancer , krukenberg tumors were detected synchronously and metachronously in 84 patients and 41 patients , respectively . to compare os , patients with initial stage iv gastric cancer ( n=125 ) were divided into two arms according to treatment modality . patients with recurrent krukenberg tumor ( n=91 ) were assigned to arm a2 or arm b2 . arm a2 comprised 58 patients who received chemotherapy and metastasectomy for recurrent krukenberg tumor , and arm b2 comprised 33 patients who received chemotherapy alone . in arms a1 and b1 , os was defined as the time from the date of pathologic diagnosis of gastric cancer to the date of death or last follow - up . in arms a2 and b2 , os was defined as the time from the date of krukenberg tumor diagnosis by imaging to the date of death or last follow - up . two - tailed student t tests were used to compare the demographic and clinical characteristics between patient arms . for discrete variables , survival rates and 95% confidence intervals ( cis ) were calculated using the kaplan - meier method . the influence of the covariates on survival length between treatment arms was assessed using the log - rank test . significant variables in the univariate analysis were entered into multivariate analysis using the cox proportional hazards model . of 27,103 patients who were diagnosed with gastric cancer between march 2004 and february 2012 at yonsei university medical center , 9,217 ( 34% ) were women . among female gastric cancer patients , 216 with krukenberg tumor detected by abdominal - pelvis computed tomography ( ct ) or gynecologic ultrasonography were included in this study and reviewed retrospectively ( severance hospital , n=172 ; gangnam severance hospital , n=44 ) . patient information was obtained from outpatient clinical or admission records and information regarding patient survival was obtained from the korean national statistics registry database . the protocols were approved by the yonsei university health system institutional review board . in general therefore , for data analysis , patients were divided into two groups according to initial gastric cancer stage : stage i - iii and stage iv . patients suspected of having krukenberg tumor underwent imaging studies to confirm disease resectability . however , 87% of patients ( 93/107 ) who underwent oophorectomy had disease that already extended beyond the ovary , in which case oophorectomy was performed for palliative symptom control . the residual disease state of each patient was documented as the presence or absence of gross residual disease , which was classified as negative resection margins ( r0 ) , microscopic tumor infiltration ( r1 ) , and macroscopic residual tumor ( r2 ) . r0 resection was achieved in only 38% ( 41/107 ) of patients who underwent oophorectomy . overall , 125 patients were initially diagnosed with stage iv gastric cancer and 91 with recurrent krukenberg tumor after they underwent curative resection of gastric cancer . among the patients initially diagnosed with stage iv gastric cancer , krukenberg tumors were detected synchronously and metachronously in 84 patients and 41 patients , respectively . to compare os , patients with initial stage iv gastric cancer ( n=125 ) were divided into two arms according to treatment modality . patients with recurrent krukenberg tumor ( n=91 ) were assigned to arm a2 or arm b2 . arm a2 comprised 58 patients who received chemotherapy and metastasectomy for recurrent krukenberg tumor , and arm b2 comprised 33 patients who received chemotherapy alone . in arms a1 and b1 , os was defined as the time from the date of pathologic diagnosis of gastric cancer to the date of death or last follow - up . in arms a2 and b2 , os was defined as the time from the date of krukenberg tumor diagnosis by imaging to the date of death or last follow - up . all statistical analyses were performed using ibm spss ver . 20.0 ( ibm co. , armonk , ny ) . for continuous variables , two - tailed student t tests were used to compare the demographic and clinical characteristics between patient arms . for discrete variables , a chi - square test was used . survival rates and 95% confidence intervals ( cis ) were calculated using the kaplan - meier method . the influence of the covariates on survival length between treatment arms was assessed using the log - rank test . significant variables in the univariate analysis were entered into multivariate analysis using the cox proportional hazards model . the median follow - up duration for all patients was 30.0 months until the os data cutoff date ( june 30 , 2013 ) , at which time 90% of the patients had discontinued treatment . the median age of patients at krukenberg tumor diagnosis was 43.4 years ( range , 21 to 78 years ) and the average size of metastatic ovarian tumors was 6.8 cm ( range , 1.5 to 24 cm ) . the clinical characteristics of patients with initial stage iv gastric cancer ( n=125 ) are listed in table 1 . patients were divided into two arms according to treatment modality : arm a , metastasectomy plus chemotherapy ; arm b , chemotherapy alone . comparison of the patients who received chemotherapy plus metastasectomy revealed they had significantly larger krukenberg tumors ( median size , 7.99 cm vs. 5.76 cm ; p=0.004 ) , fewer metastases outside the ovaries ( 85.7% vs. 97.4% ; p=0.028 ) , and a more normal range of serum cancer antigen ( ca ) 19 - 9 level ( 65.3% vs. 39.5% ; p=0.009 ) than patients who received chemotherapy alone . the clinical characteristics of patients with recurrent krukenberg tumor of gastric origin ( n=91 ) are listed in table 2 . patients who received chemotherapy plus metastasectomy had significantly higher frequency of bilateral tumors ( 72.4% vs. 48.5% ; p=0.022 ) , and a more normal range of serum ca 19 - 9 level ( 65.6% vs. 45.5% ; p=0.035 ) than those who received chemotherapy alone . the median os of patients with initial stage iv gastric cancer was 12.0 months ( 95% ci , 9.7 to 14.3 months ) . the median os of arm a1 and arm b1 was 18.0 months ( 95% ci , 15.2 to 20.8 months ) and 8.0 months ( 95% ci , 6.6 to 9.4 months ) , respectively . therefore , patients in the chemotherapy plus metastasectomy arm had a significantly better os than patients in the chemotherapy arm ( p < 0.001 ) ( fig . the median os of patients with recurrent krukenberg tumors was 15.0 months ( 95% ci , 12.7 to 17.3 months ) . the median os time of arm a2 and arm b2 was 19.0 months ( 95% ci , 14.4 to 23.6 months ) and 9.0 months ( 95% ci , 6.2 to 11.8 months ) , respectively . patients in the chemotherapy plus metastasectomy arm had a significantly better os than patients in the chemotherapy alone arm ( p=0.002 ) ( fig . 2 ) . upon univariate analysis of all patients , metastasectomy , signet - ring cell pathology , presence of peritoneal carcinomatosis , gastrectomy , and elevated serum levels of carcinoembryonic antigen ( cea ; > 5 ng / ml ) , ca 19 - 9 ( > 24 u / ml ) , and ca-125 ( > 35 u / ml ) were prognostic factors associated with survival . after adjusting for covariates in multivariate analysis , metastasectomy ( hazard ratio [ hr ] , 0.458 ; 95% ci , 0.287 to 0.732 ; p=0.001 ) , signet - ring cell pathology ( hr , 1.583 ; 95% ci , 1.057 to 2.371 ; p=0.026 ) , and presence of peritoneal carcinomatosis ( hr , 3.081 ; 95% ci , 1.610 to 5.895 ; p=0.001 ) were independent predictors of os ( table 3 ) . it was difficult to statistically analyze survival differences between patients in whom metastasis was limited to the ovary and those who have metastasis beyond the ovary because only 8% of patients showed metastasis limited to the ovary . a few patients who showed metastasis to other sites were subjected to additional surgery with oophorectomy , such as total hysterectomy and bowel resection . as shown in fig . 3 , the r0 resection group ( n=41 ) had a significantly longer os ( hr , 0.405 ; 95% ci , 0.254 to 0.646 ; log - rank p < 0.001 ) than the r1 , r2 resection group ( n=66 ) . the median os was 30.0 months ( 95% ci , 24.0 to 36.0 ) in the r0 resection group and 15.0 months ( 95% ci , 13.6 to 16.4 ) in the r1 , r2 resection group . oophorectomy was found to still be beneficial when other unresectable metastasis were present , for both metastatic and recurrent disease . analysis of all cases except single ovarian metastasis revealed that the median os time of arm a1 and arm b1 was 16.0 months ( 95% ci , 13.7 to 18.3 months ) and 8.0 months ( 95% ci , 6.6 to 9.4 months ; p < 0.001 ) , respectively . additionally , the median os time of arm a2 and arm b2 was 16.0 months ( 95% ci , 12.5 to 19.5 months ) and 8.0 months ( 95% ci , 5.8 to 10.2 months ; p=0.039 ) , respectively . the frequencies and response rates of chemotherapy regimens initially used after ovarian metastasis diagnosis were also analyzed ( table 4 ) . overall , 111 patients were treated with chemotherapy for ovarian metastasis , with platinum ( n=43 ) , taxane ( n=26 ) , and irinotecan ( n=8 ) chemotherapy regimens being the most frequently used . patients who received chemotherapy for ovarian metastasis were evaluated using the response evaluation criteria in solid tumors ver . the response rates for the chemotherapy regimens were as follows : platinum , 26% ; irinotecan , 25% ; and taxane , 12% . the median follow - up duration for all patients was 30.0 months until the os data cutoff date ( june 30 , 2013 ) , at which time 90% of the patients had discontinued treatment . the median age of patients at krukenberg tumor diagnosis was 43.4 years ( range , 21 to 78 years ) and the average size of metastatic ovarian tumors was 6.8 cm ( range , 1.5 to 24 cm ) . the clinical characteristics of patients with initial stage iv gastric cancer ( n=125 ) are listed in table 1 . patients were divided into two arms according to treatment modality : arm a , metastasectomy plus chemotherapy ; arm b , chemotherapy alone . comparison of the patients who received chemotherapy plus metastasectomy revealed they had significantly larger krukenberg tumors ( median size , 7.99 cm vs. 5.76 cm ; p=0.004 ) , fewer metastases outside the ovaries ( 85.7% vs. 97.4% ; p=0.028 ) , and a more normal range of serum cancer antigen ( ca ) 19 - 9 level ( 65.3% vs. 39.5% ; p=0.009 ) than patients who received chemotherapy alone . the clinical characteristics of patients with recurrent krukenberg tumor of gastric origin ( n=91 ) are listed in table 2 . patients who received chemotherapy plus metastasectomy had significantly higher frequency of bilateral tumors ( 72.4% vs. 48.5% ; p=0.022 ) , and a more normal range of serum ca 19 - 9 level ( 65.6% vs. 45.5% ; p=0.035 ) than those who received chemotherapy alone . the median os of patients with initial stage iv gastric cancer was 12.0 months ( 95% ci , 9.7 to 14.3 months ) . the median os of arm a1 and arm b1 was 18.0 months ( 95% ci , 15.2 to 20.8 months ) and 8.0 months ( 95% ci , 6.6 to 9.4 months ) , respectively . therefore , patients in the chemotherapy plus metastasectomy arm had a significantly better os than patients in the chemotherapy arm ( p < 0.001 ) ( fig . the median os of patients with recurrent krukenberg tumors was 15.0 months ( 95% ci , 12.7 to 17.3 months ) . the median os time of arm a2 and arm b2 was 19.0 months ( 95% ci , 14.4 to 23.6 months ) and 9.0 months ( 95% ci , 6.2 to 11.8 months ) , respectively . patients in the chemotherapy plus metastasectomy arm had a significantly better os than patients in the chemotherapy alone arm ( p=0.002 ) ( fig . 2 ) . upon univariate analysis of all patients , metastasectomy , signet - ring cell pathology , presence of peritoneal carcinomatosis , gastrectomy , and elevated serum levels of carcinoembryonic antigen ( cea ; > 5 ng / ml ) , ca 19 - 9 ( > 24 u / ml ) , and ca-125 ( > 35 u / ml ) were prognostic factors associated with survival . after adjusting for covariates in multivariate analysis , metastasectomy ( hazard ratio [ hr ] , 0.458 ; 95% ci , 0.287 to 0.732 ; p=0.001 ) , signet - ring cell pathology ( hr , 1.583 ; 95% ci , 1.057 to 2.371 ; p=0.026 ) , and presence of peritoneal carcinomatosis ( hr , 3.081 ; 95% ci , 1.610 to 5.895 ; p=0.001 ) were independent predictors of os ( table 3 ) . it was difficult to statistically analyze survival differences between patients in whom metastasis was limited to the ovary and those who have metastasis beyond the ovary because only 8% of patients showed metastasis limited to the ovary . a few patients who showed metastasis to other sites were subjected to additional surgery with oophorectomy , such as total hysterectomy and bowel resection . as shown in fig . 3 , the r0 resection group ( n=41 ) had a significantly longer os ( hr , 0.405 ; 95% ci , 0.254 to 0.646 ; log - rank p < 0.001 ) than the r1 , r2 resection group ( n=66 ) . the median os was 30.0 months ( 95% ci , 24.0 to 36.0 ) in the r0 resection group and 15.0 months ( 95% ci , 13.6 to 16.4 ) in the r1 , r2 resection group . oophorectomy was found to still be beneficial when other unresectable metastasis were present , for both metastatic and recurrent disease . analysis of all cases except single ovarian metastasis revealed that the median os time of arm a1 and arm b1 was 16.0 months ( 95% ci , 13.7 to 18.3 months ) and 8.0 months ( 95% ci , 6.6 to 9.4 months ; p < 0.001 ) , respectively . additionally , the median os time of arm a2 and arm b2 was 16.0 months ( 95% ci , 12.5 to 19.5 months ) and 8.0 months ( 95% ci , 5.8 to 10.2 months ; p=0.039 ) , respectively . the frequencies and response rates of chemotherapy regimens initially used after ovarian metastasis diagnosis were also analyzed ( table 4 ) . overall , 111 patients were treated with chemotherapy for ovarian metastasis , with platinum ( n=43 ) , taxane ( n=26 ) , and irinotecan ( n=8 ) chemotherapy regimens being the most frequently used . patients who received chemotherapy for ovarian metastasis were evaluated using the response evaluation criteria in solid tumors ver . the response rates for the chemotherapy regimens were as follows : platinum , 26% ; irinotecan , 25% ; and taxane , 12% . many studies have shown that the median survival after krukenberg tumor diagnosis is 7 - 11 months . in the past recently , the development of diagnostic tools has increased early detection of krukenberg tumors and their curative resectability . our study showed that patients with krukenberg tumor of gastric origin who underwent both chemotherapy plus metastasectomy had longer os than those who underwent chemotherapy alone , regardless of stage . the difference in os was actually underestimated because the os in arms a2 and b2 was determined from the date of recurrent krukenberg tumor diagnosis and not the date of the initial gastric cancer diagnosis . despite the small proportion of r0 resections , a prolonged os was observed in the chemotherapy plus metastasectomy arm . in our study , one patient in arm a1 survived more than 9 years after the initial diagnosis of gastric cancer , while one patient in arm a2 survived more than 7.5 years after resection of metachronous krukenberg tumor . some studies have reported the survival benefit of metastasectomy for krukenberg tumor ; however , most of these included a small number of patients ( approximately 50 patients ) and krukenberg tumors of different origins , including gastric , colon , and breast cancers . many reports have suggested that metastasectomy provides a better survival benefit for krukenberg tumors of crc origin [ 15 - 17 ] . among studies of the survival benefit of metastasectomy for krukenberg tumor , ours is the largest conducted to date and the only one that investigated krukenberg tumors of gastric cancer origin exclusively . a few studies have demonstrated that metastasectomy of metachronous recurrent krukenberg tumor of gastric origin provided longer os [ 18 - 20 ] . based on our results , metastasectomy should be performed in stage iv gastric cancer patients diagnosed synchronously or metachronously with krukenberg tumor . , the prognostic factors associated with survival in patients with krukenberg tumor of gastric origin were analyzed . metastasectomy , signet - ring cell pathology , and peritoneal carcinomatosis were identified as significant prognostic factors . several studies have also shown that metastasectomy is a prognostic factor for better os in patients with krukenberg tumors . in the present study , absence of peritoneal carcinomatosis was associated with better prognosis , which is consistent with the results of a previous study that showed limited disease extent as a prognostic factor . complete resection is easily achieved when the extent of disease is limited ; therefore , active krukenberg tumor metastasectomy should be conducted in patients who are not expected to have residual disease after operation . adenocarcinomas composed of signet ring cells tend to metastasize to the ovaries more frequently than adenocarcinomas of other histologic types . signet ring cell features have not been well established as a prognostic factor for krukenberg tumors ; however , in the present study , they were a poor prognostic factor for krukenberg tumors of gastric cancer origin . published studies of the role of chemotherapy in the treatment of krukenberg tumors have included only small patient numbers or case reports . in the present study , response rates to chemotherapy regimens were analyzed in 111 patients diagnosed with krukenberg tumor , and response rates ranged from 12% to 26% . in most of our cases , therefore , at the time of krukenberg tumor diagnosis , patients have already received standard first - line chemotherapy for advanced or metastatic gastric cancer . in our experience , early detection of ovarian metastases is important to successful treatment . in the present study , serum cea , ca 19 - 9 , and ca-125 level were not useful predictors of krukenberg tumor . despite continual efforts to develop a practical biomarker that can predict relapse or metastasis of ovary metastasis with gastric cancer , thus , identifying diversity in the molecular profile of gastric cancer that governs the clinical behavior of tumors could lead to new and more effective clinical strategies . recent studies of gastric cancer have identified genes that differ according to histologic factors and age , as well as those useful for gastric cancer prognosis prediction . it should be noted that several factors may have affected the decision of surgery for treatment of the patients evaluated in the present study , including the extent of metastasis , possibility of curative surgery , surgeon s opinion , etc . additionally , the difference in the chemotherapy regimen between arm a and arm b may have influenced patient survival or toxicity . ct was used to identify patients who would benefit from the curative resection of krukenberg tumors . although imaging modalities , including ct scanning , have been developed to detect intraperitoneal metastasis , ct has been shown to only have a 50% accuracy for detecting intraperitoneal metastatic cancers . therefore , peritoneal carcinomatosis is difficult to diagnosis by ct scan . laparoscopic examination has shown better accuracy in detecting peritoneal carcinomatosis ; however , this procedure is invasive and can result in complications . in conclusion , we demonstrated that metastasectomy was associated with longer survival in patients with krukenberg tumors in gastric cancer . therefore , metastasectomy should be performed in stage iv gastric cancer patients diagnosed synchronously or metachronously with krukenberg tumor . our data also suggest that metastasectomy plus chemotherapy may play a role in the treatment of krukenberg tumors of gastric origin . furthermore , we found that metastasectomy , signet ring cells , and peritoneal carcinomatosis were prognostic factors for krukenberg tumors . future prospective randomized trials are needed to confirm our findings and will be important in establishing standard treatment guidelines for patients with krukenberg tumor in metastatic gastric cancer .

purposethis study was conducted to validate the survival benefit of metastasectomy plus chemotherapy over chemotherapy alone for treatment of krukenberg tumors from gastric cancer and to identify prognostic factors for survival.materials and methodsclinical data from 216 patients with krukenberg tumors from gastric cancer were collected . patients were divided into two arms according to treatment modality : arm a , metastasectomy plus chemotherapy and arm b , chemotherapy alone.resultsoverall survival ( os ) was significantly increased in arm a relative to arm b for patients initially diagnosed with stage iv gastric cancer ( 18.0 months vs. 8.0 months ; p < 0.001 ) and those with recurrent krukenberg tumors ( 19.0 months vs. 9.0 months ; p=0.002 ) , respectively . metastasectomy ( hazard ratio [ hr ] , 0.458 ; 95% confidence interval [ ci ] , 0.287 to 0.732 ; p=0.001 ) , signet - ring cell pathology ( hr , 1.583 ; 95% ci , 1.057 to 2.371 ; p=0.026 ) , and peritoneal carcinomatosis ( hr , 3.081 ; 95% ci , 1.610 to 5.895 ; p=0.001 ) were significant prognostic factors for survival.conclusionmetastasectomy plus chemotherapy offers superior os when compared to palliative chemotherapy alone in gastric cancer with krukenberg tumor . prolonged survival applies to all patients , regardless of gastric cancer stage . metastasectomy , signet - ring cell pathology , and peritoneal carcinomatosis were prognostic factors for survival . future prospective randomized trials are needed to confirm the optimal treatment strategy for krukenberg tumors from gastric cancer .

advanced chronic periodontitis often coexists with poorly controlled diabetes , such that diabetes is considered to be a risk factor for periodontitis . many studies conducted among adults have reported a significant positive two - way association between diabetes ( both type-1 and type-2 ) and periodontal disease that is , diabetes increases risk of developing periodontitis and worsens preexisting periodontitis and periodontitis may raise the risk of diabetes . periodontal infection can increase systemic inflammation , which in turn may induce a chronic state of insulin resistance , contributing to the cycle of hyperglycemia and advanced glycation end product - protein binding accumulation . therefore , it can amplify the classical pathway of connective tissue degradation , destruction and proliferation in diabetes . moreover , studies have also shown that treating periodontitis in diabetic patients has a beneficial effect on their blood glucose control . on the other hand , poorly controlled diabetes is an important risk factor for periodontitis , and gingivitis , and sometimes periodontitis is the first sign that a diabetic patient presents with . the impact of periodontitis on the diabetes - related inflammatory status has also been studied . it has been indicated that the cytokine induced inflammatory state in periodontitis can contribute to the overall low grade inflammation that occurs in diabetes . a recent study investigated the relationship between chronic periodontitis , impaired fasting glucose ( ifg ) , and diabetes in the us population and found chronic periodontitis to be positively associated in a linear relation with ifg and diabetes in us adults . studies evaluating the relationship between impaired glucose tolerance ( igt ) and periodontal disease among japanese population suggest that periodontal disease is positively associated with igt , but other studies found no such association . obesity and impaired lipid profile are other strong risk factors for type-2 diabetes , which in turn is a risk factor for periodontal disease . the extent of coronary atherosclerosis is positively correlated with pro - atherogenic lipids , that is , total cholesterol , low - density lipoprotein ( ldl ) cholesterol and triglycerides ( tg ) , and negatively correlated with anti - atherogenic high density lipoprotein ( hdl ) cholesterol . the high prevalence of cardiovascular disease and periodontitis in individuals with diabetes may be attributed to an increased inflammatory response leading to atherosclerosis as compared to those without diabetes . though there are many studies that have evaluated the interrelationship between the diabetic status of an individual with his / her periodontal status ; the authors however could not find studies / research reports that evaluated relationship between various biochemical parameters like lipid profile and oral glucose tolerance test ( ogtt ) with periodontal health / disease status , in both healthy and diabetic patients . hence , this study was designed to investigate the association between chronic periodontitis and diabetes by taking dental plaque index ( dpi ) and community periodontal index ( cpi ) score as periodontal health / disease dependent variables and lipid profile and ogtt as biochemical parameters in healthy , diabetic and igt subjects . this study began in 2008 in the department of biochemistry and the department of periodontics at baba jaswant singh dental college hospital and research institute , ludhiana with the subjects reporting to the opd of the department of periodontics . all patients reporting to the department of periodontics were interviewed and questioned about their diabetic / lipid profile status . any patient reporting a known self or family history of deranged lipid / diabetic profile was provisionally selected for this study . of these , a group of 120 patients who were willing to form a part of the study were finally selected and were sent for blood and periodontal examination . the subjects undertaken also fulfilled the following criteria - community periodontal index ( cpi ) score of 2 or more [ table 1 ] and cpi loss of attachment score of 0 and above [ table 2 ] . community periodontal index cpi loss of attachment score subjects with community periodontal index loss of attachment score 0 underwent a periodontal examination to determine mean periodontal pocket depth and attachment loss . for the biochemical analyses , the reports of ogtt and lipid profile tests were analyzed as per who criteria for the diagnosis of diabetes that is , normal glucose tolerance ( ngt ; fasting and 2 h postchallenge plasma glucose levels < 110 mg / dl and < 140 mg / dl , respectively ) , diabetes ( fasting or 2 h postchallenge plasma glucose levels 126 mg / dl or 200 mg / dl , respectively ) and igt ( igt ; all others with some glucose tolerance impairment including impaired fasting glucose ( ifg ) , that is , with one of the two glucose tolerance levels between normal and diabetic values and the other below the diabetic level ) . the samples of venous blood were taken in the fasting state for ogtt and lipid profile analysis . immediately after , 75 g glucose dissolved in 300 ml water was given to be ingested in about 5 min and sample of blood was again collected at an interval of 30 min for a period of 3 h for glucose tolerance test ( gtt ) analysis . data obtained was tabulated , compared and statistically analyzed using z - test to know the correlation between lipid profile test values , type 2 diabetes mellitus and periodontitis . subjects with community periodontal index loss of attachment score 0 underwent a periodontal examination to determine mean periodontal pocket depth and attachment loss . for the biochemical analyses , the reports of ogtt and lipid profile tests were analyzed as per who criteria for the diagnosis of diabetes that is , normal glucose tolerance ( ngt ; fasting and 2 h postchallenge plasma glucose levels < 110 mg / dl and < 140 mg / dl , respectively ) , diabetes ( fasting or 2 h postchallenge plasma glucose levels 126 mg / dl or 200 mg / dl , respectively ) and igt ( igt ; all others with some glucose tolerance impairment including impaired fasting glucose ( ifg ) , that is , with one of the two glucose tolerance levels between normal and diabetic values and the other below the diabetic level ) . the samples of venous blood were taken in the fasting state for ogtt and lipid profile analysis . immediately after , 75 g glucose dissolved in 300 ml water was given to be ingested in about 5 min and sample of blood was again collected at an interval of 30 min for a period of 3 h for glucose tolerance test ( gtt ) analysis . data obtained was tabulated , compared and statistically analyzed using z - test to know the correlation between lipid profile test values , type 2 diabetes mellitus and periodontitis . subjects with community periodontal index loss of attachment score 0 underwent a periodontal examination to determine mean periodontal pocket depth and attachment loss . for the biochemical analyses , the reports of ogtt and lipid profile tests were analyzed as per who criteria for the diagnosis of diabetes that is , normal glucose tolerance ( ngt ; fasting and 2 h postchallenge plasma glucose levels < 110 mg / dl and < 140 mg / dl , respectively ) , diabetes ( fasting or 2 h postchallenge plasma glucose levels 126 mg / dl or 200 mg / dl , respectively ) and igt ( igt ; all others with some glucose tolerance impairment including impaired fasting glucose ( ifg ) , that is , with one of the two glucose tolerance levels between normal and diabetic values and the other below the diabetic level ) . the samples of venous blood were taken in the fasting state for ogtt and lipid profile analysis . immediately after , 75 g glucose dissolved in 300 ml water was given to be ingested in about 5 min and sample of blood was again collected at an interval of 30 min for a period of 3 h for glucose tolerance test ( gtt ) analysis . data obtained was tabulated , compared and statistically analyzed using z - test to know the correlation between lipid profile test values , type 2 diabetes mellitus and periodontitis . of 120 subjects undertaken for study , 35 patients were found to be periodontally healthy and 85 periodontally diseased ; 48 subjects had igt , and 17 had diabetes and the rest of the subjects that is , 55 had ngt . all subjects were assessed for their periodontal condition by taking dpi [ table 3 ] and cpi scoreas parameters . when dpi score ( suggesting periodontal condition of the patient ) and ogtt results were compared and studied , it was observed that dpi for ngt , igt and diabetic patients were 1.05 0.5 , 1.16 0.7 , and 1.65 0.8 , respectively [ table 4 ] . when cpi score ( suggesting periodontal condition of the patient ) and ogtt results were studied , it was observed that cpi score for ngt , igt , and diabetics were 1.33 0.4 , 1.67 0.5 , and 2.33 0.8 , respectively [ table 4 ] . a similar correlation was found between ldl levels and ogtt results , that is , ldl levels in patients with ngt and igt were within normal range , while it was higher than normal in patients with diabetes [ table 5 ] . mean total cholesterol and mean hdl values were within normal range for all ogtt patient types [ table 5 ] . in a correlation table of various biochemical analyses and periodontal parameters , [ table 6 ] it is evident that out of 85 periodontally diseased patients 35 showed abnormal fasting blood sugar levels and 61 showed abnormal post prandial blood sugar levels which potrays a non - significant co - relation . of the 85 periodontally diseased patients 77 patients showed abnormal total serum cholesterol level , 65 showed abnormal ldl cholesterol level and 71 showed abnormal tg levels . these findings suggest that worsening lipid profile test values can be positively correlated with increased severity of periodontal disease [ highly significant p < 0.001 ] . dental plaque index ( sillness and loe , 1964 ) periodontal condition of subjects in relation to their biochemical status association of participants diabetic status ogtt and lipid profile tests correlation between periodontal condition and various biochemical parameters the results of this study show that in patients having poor periodontal condition poor ogtt score was observed . it is also clear that as the periodontal condition and ogtt scores worsen , the tg levels and ldl levels also worsen . it has been shown that diabetes is one of the predisposing factors for the development of periodontal disease . the inter relationships between periodontitis and diabetes provide an example of systemic disease predisposing to oral infection , and once that infection is established , oral infection exacerbates the systemic disease . it has been shown that diabetic patients are prone to elevated ldl cholesterol and tgs even when blood glucose levels were well controlled . this is significant ; as our study indicated that hyperlipidemia may be one of the factors associated with periodontitis . the results of the study suggest that periodontitis itself may lead to elevated ldl / tg levels . within this context , it may be put forth that in addition to effects of diabetes , periodontitis may contribute to elevated serum lipids and potentially to systemic disease arising from chronic hyperlipidemia . in a recent study in women subjects , periodontal disease was shown to be associated with later development of impaired glucose metabolism with a prior history of gestational diabetes . therefore , treating periodontal disease may in addition to controlling and or improving the diabetic status of the patient may also improve the deranged lipid profile in a patient . when seen in this context , treating periodontal disease may also have a significant impact on improving the systemic health of the patient as both diabetes and a deranged lipid profile are known risk factors for several life - threatening diseases and conditions . as this study has demonstrated that the lipid profile can be a determinant of diabetes and periodontitis and vice versa many cases of diabetes and deranged lipid profile may remain undiagnosed , and screening of patients in dental clinics may lead to a diagnosis of these in some cases . it is evident from this study that abnormal levels of total serum cholesterol , ldl cholesterol , and tgs can be positively correlated with periodontally diseased conditions . as evidence of close link between periodontal disease , diabetes and deranged lipid profile is seen , treating and preventing recurrence of periodontal disease in patients with diabetes and deranged lipid profile values should be considered an important component of the treatment and management of patients suffering from diabetes and deranged lipid profile .

objective : a two - way relationship between diabetes and periodontal disease has been suggested ; whereas obesity and impaired lipid profile are risk factors for type-2 diabetes mellitus . this study examined the relationship between lipid profile , oral glucose tolerance test ( ogtt ) with periodontal health / disease dependent variables in healthy , diabetic and impaired glucose tolerance subjects.materials and methods:120 patients were selected for the study and were determined to be periodontally healthy or diseased . all these patients underwent biochemical tests for ogtt and lipid profile analysis and data was compared using z-test.results:the ogtt results deteriorated with deteriorating periodontal condition . a similar correlation was also observed between worsening lipid profile test values , ogtt score , and periodontal condition.conclusion:this study indicates that hyperlipidemia may be one of the factors associated with periodontitis and that periodontitis may itself lead to abnormal serum lipid levels . therefore , in addition to effects on diabetes , periodontitis may contribute to elevated serum lipid levels and therefore potentially to systemic disease arising from chronic hyperlipidemia .

nonpolio afp case - patients showing signs of acute onset of focal weakness or paralysis characterized as flaccid ( reduced muscle tone ) and preceded by fever were considered for npev analysis . august 2010 from children < 15 years of age who had afp symptoms were analyzed by using a modified world health organization ( who ) method ( 4,5 ) . human rhabdomyosarcoma and l20b ( mouse fibroblast cells expressing the poliovirus receptor ) cell lines used for virus isolation were observed for cytopathic effect ( cpe ) . the positive isolates with ( enterovirus - like ) cpe were tested by using pan - poliovirus and pan - ev rt - pcr ( 4 ) . all poliovirus isolates characterized according to who algorithm were excluded from the analysis presented here . viral rna was extracted from the first - pass rhabdomyosarcoma cell suspension with the viral rna mini kit ( qiaamp , qiagen , hilden , germany ) . genotyping was done by rt - pcr of a portion of the vp1 gene and sequencing as described ( 2,6 ) . distance matrices of the nucleotide and amino acid sequences were analyzed with the megalign program in the lasergene software package ( dnastar , madison , wi , usa ) . of 347 fecal samples analyzed , 73 ( 21% ) cell cultures tested positive by pan - ev 5 nontranslated region rt - pcr . nineteen ( 5% ) were pan - poliovirus positive , leaving 54 ( 16% ) nonpolio hevs for analysis . genotyping of 45 ( 83% ) evs by partial vp1 sequencing followed the criteria of oberste et al . cpe was observed in rhabdomyosarcoma cells in the first passage for 33 samples , of which 27 were pan - ev positive , identified as e13 ( 21 [ 64% ] ) , e7 ( 2 [ 6% ] ) , e4 ( 1 [ 3% ] ) , e33 ( 1 [ 3% ] ) , and ev75 ( 2 [ 6% ] ) ; 6 isolates remained untypeable . of the 21 samples that did not yield cpe in rhabdomyosarcoma cells in the first passage , 18 were pan - ev positive , identified as e25 ( 4 [ 19% ] ) , e13 ( 9 [ 43% ] ) , coxsackievirus b3 ( cvb3 ; 3 [ 14% ] ) , cvb6 ( 2 [ 10% ] ) . three isolates could not be identified because of poor quality sequence data . because e13 has rarely been isolated in india , we analyzed the uttar pradesh e13 isolates for march august 2010 from 5 adjoining districts of western uttar pradesh ( lakhimpur - kheri , sitapur , lucknow , raebareli , and hardoi ) . clinical findings ( table 1 ) showed that 20 ( 67% ) of the 30 patients had asymmetric paralysis at onset , including 3 afp case - patients with fever at onset of paralysis and residual paralysis mimicking poliolike illness ; however , when compared with other etiologies , no conclusion was inferred ( table 2 ) . * afp , acute flacid paralysis ; lno , lucknow ; stp , sitapur ; kri , lakhimpur - kheri ; hdo , hardoi ; rbl , raebareli ; ,absence of clinical feature ; + presence of clinical feature . district of afp patient . * afp , acute flacid paralysis , e , echovirus;ev , enterovirus ; cb , coxsackievirus b ; , absence of clinical feature . the 244-nt partial vp1 gene sequence of all the uttar pradesh e13 isolates shared 75.4%79.9% nt identity and 87.7%93.8% aa identity with the prototype e13 strain , del carmen ( genbank accession no . phylogenetic analysis indicated the existence of 2 different uttar pradesh ev13 clades in the neighbor - joining tree ( figure ) . uttar pradesh 2010 ev13 viruses in the largest clade segregated into 3 groups ( labeled a c , figure ) , whereas the second large 2010 uttar pradesh ev13 clade was monophyletic ( labeled d , figure ) . partial vp1 sequences of uttar pradesh ev13 clade a shared 96.5%100% nt identity ( 100% aa identity ) with one another . clade b shared 89.4%90.7% nt identity ( 95.5%98.8% aa identity ) with clade a and 84.2%84.5% nt identity ( 97.5% aa identity ) with clade c. clade c shared 88.9%88.1% nt identity ( 95.5%98.8% aa identity ) with clade a. uttar pradesh ev13 clade d shared 73%76% nt identity ( 90.1%93.5% aa identity ) with clades a , b , and c. although variation exists among the partial vp1 sequences of ev13 strains from india , the ev13 clades a , b , and c appear to be closely related to earlier india isolates ( 2007 and 2008 ) followed by the isolates from pakistan ( 2009 ) , bangladesh ( 2000 ) , and the republic of georgia ( 2004 ) . the ev13 d clade was genetically more distant and grouped together with year 2000 strains from india and bangladesh ( isolated in 1999 ) , and 1 isolate from georgia ( isolated in 2004 ) . phylogenetic tree based on alignments of partial viral protein 1 gene sequences of echovirus 13 ( e13 ) constructed by the neighbor - joining method implemented in mega version 5.05 software ( 7 ) by using the kimura-2 parameter nucleotide substitution model . clusters are labeled a , b , c , and d. square indicates uttar pradesh e13 from fecal samples . all uttar pradesh e13 isolates on the tree are identified by using the same numbers listed in table 1 . we demonstrated the utility of a modified who laboratory protocol by combining classical and molecular methods for rapid detection and identification of nonpolio hev ( 2,46 ) . identifying the ev in mixed ev infections is challenging when this protocol is used , but on balance , pan - ev testing followed by vp1 rt - pcr and sequencing delivers rapid results and more efficient use of labor and resources than does the traditional method and enables identification of newer ev types . numerous reports have described afp patients infected with evs , coxsackieviruses , and newer numbered evs ( 3,8 ) . although nonpolio hevs can be isolated from asymptomatic children , few studies have compared the nonpolio hev serotypes found in afp case - patients and in healthy children . identifying nonpolio hev serotypes associated with afp in india provides useful ev surveillance data and should be explored further in conjunction with virologic evaluation of appropriate community controls and additional clinical specimens from afp case - patients ( cerebrospinal fluid , throat swab samples , serum ) , which could indicate the nonpolio hev type causing paralytic disease . we identified 8 nonpolio hev serotypes ( e4 , e7 , e13 , e25 , e33 , ev75 , cvb3 , and cvb6 ) . e13 , the predominant serotype , has been isolated rarely ( 3,10 ) ; however , nonpolio hevs have been reported from india in connection with sporadic and epidemic meningitis / encephalitis cases ( 11,12 ) . a wide spectrum of illnesses have been reported with e13 ( 13 ) , so finding e13-associated afp cases mimicking poliomyelitis ( 14 ) is not surprising . the global aseptic meningitis epidemic caused by ev13 during 20002003 was associated with a single e13 genotype ( 15 ) ; however , our findings indicate that several different and genetically diverse e13s have been cocirculating in india . the uttar pradesh e13 partial vp1 gene sequences are most closely related to recent e13 strains from central and southern asia . the high genetic diversity among the uttar pradesh e13 isolated from patients in a local area over 6 months implies a continuous pattern of circulation . high - density human populations , immunologically susceptible cohorts , and nonhygienic environmental conditions probably facilitated the e13 genetic heterogeneity in our study . although we report a high prevalence of e13 infection in afp case - patients , our study is restricted by the modest number of cases from a small geographic area sampled over a short period . the epidemiologic and nonpolio hev genetic information gathered warrants further studies in larger groups of children to gain better insight into afp caused by nonpolio hev and to identify the etiologic nonpolio hev type(s ) associated with sporadic or epidemic afp as india nears the goal of polio elimination .

nonpolio acute flaccid paralysis is increasing in india . to determine viral causes , we conducted cell culture and molecular analysis identification of nonpolio human enteroviruses associated with acute flaccid paralysis during march august 2010 in northern india . the predominant nonpolio enterovirus found was echovirus 13 , a serotype rarely isolated in india .

seroma is one of the most bothersome events that disturbs both the patient and surgeon with multiple visits that delay starting the adjuvant therapy and cause great patients ' discomfort with a possibility of increased surgical site infection [ 13 ] . postmastectomy seroma can be defined as a collection of serous fluid just under the skin flaps or in the axillary pace immediately following mastectomy with axillary dissection that can be detected either clinically or sonographically [ 4 , 5 ] . seroma is graded 1 if asymptomatic ( only diagnosed by ultrasound ) , graded 2 if symptomatic but can be managed either medically or by simple aspiration , and graded 3 if symptomatic and requires surgical or radiologic intervention . the incidence of seroma following mastectomy and axillary clearance varies in reports from 25% to 60% , with even higher incidences being reported . despite the extensive investigation [ 715 ] , the exact pathogenesis of postmastectomy seroma is still not fully understood . however a significant correlation was discovered with the volume of drainage in the first three postoperative days [ 8 , 16 ] , especially when exceeding 500 ml . in a controlled randomized study that was carried out by lumachi et al . in 2004 , the total amount of drainage was independently correlated with seroma formation . in this important study the use of the ultrasonic dissector significantly reduced seroma formation . on the other hand , in another important controlled randomized study that was done by porter et al . in 1998 , the use of electrocautery was significantly associated with increased seroma formation when compared with flap elevation and dissection of the fascia by the scalpel . other implicated factors have been described in the evidence based search by kuroi et al . and a systematic review by van bemmel et al . the first research group to report the concept of flap fixation to significantly reduce the development of seroma was chilson et al . in 1992 . table 1 shows summary of studies that utilized this technique with a significant reduction in the incidence of seroma [ 3 , 5 , 13 , 2123 ] . the aim of the current study was to evaluate the efficacy of mastectomy with quilting of flaps and obliteration of the axillary space in reducing postmastectomy seroma . a planned number of 120 operable female patients who were candidates for total mastectomy and axillary clearance were enrolled in this study . patients with inoperable disease , those who received prior chemotherapy or breast irradiation , those with prior breast surgery , those with morbid obesity , those with collagen disease , those with poorly controlled diabetes , and those with history of long term use of steroids were excluded from this study . a randomized controlled study was carried out in the period from february 2012 to september 2014 . all required ethical approvals from ethical committees at the mansoura university hospital and mansoura oncology center ( ocmu ) , patients were randomized into equal two groups using a computer generated random number . in the first ( intervention ) group ( n = 60 ) , mastectomy was done using the scalpel with cautery of the bleeding points only with quilting suture of both the upper and lower flaps to the underlying pectoral fascia together with obliteration of the axillary space as well while , in the second ( control ) group ( n = 60 ) , mastectomy was done in the same way without quilting . using vicryl 2/0 suture , we started the quilting technique in the upper flap from medial to lateral by a continuous suture that fixes the undersurface of the upper flap to the pectoral fascia with care to avoid entangling the dermis which results in unsightly dimpling . the second row was done by the same continuous suture from lateral to medial till the medial angle . lastly the axilla was obliterated by suturing its lateral wall to the fascia of the serratus anterior and medial axillary wall ( figure 1 ) . an 18 french tube drain was inserted in the axilla in all cases of the study . all patients were followed up routinely for immediate and late complications including hemorrhage , flap necrosis , and wound sepsis . patients were typically discharged at the second postoperative day with instructions for home drain care , assisted by regular visits for recording of the total drainage volume before drain removal , the amount of drainage fluid in the first 3 days , the amount of drainage in the last 3 days before removal , and the duration till drain removal ( drain was removed when the 24-hour effluent was less than 50 ml ) . seroma was recorded when detected either clinically or sonographically ( on routine postoperative ultrasound evaluation ) . if seroma was diagnosed , we recorded the number of aspirations till resolution , the total aspirated volume , and the number of days before complete resolution . data were presented as frequencies and percentages for categorical data and mean , standard deviation ( sd ) , and range for continuous data . the difference in mean values of continuous data was examined using independent - samples t - test . the mean age of the quilting ( study ) group was 46 7 years ( range 3865 ) , while in the control group it was 44 8 with ( range 3766 ) , with a nonsignificant difference ( p value = 0.14 ) . similarly , no significant differences were detected between the two study groups as regards the baseline body mass index , tumor size , pathologic type , and pathologic grade ( table 2 ) . the operative outcome among the two study groups is shown in ( table 3 ) . the operative time was prolonged in the quilting group by around 20 minutes ( p < 0.001 ) . the duration before drain removal was shorter in the intervention group ( 9 days , range 720 ) than the control group ( 11 days , range 918 ) , and the difference was highly significant ( p < 0.001 ) . similarly , compared to the control group , the intervention groups had smaller total drainage volume ( 710 ml versus 1160 ml , p < 0.001 ) , smaller amount of effluent in the first three days ( 230 ml versus 425 ml , p < 0.001 ) , and smaller output in the last three days ( 180 ml versus 231 ml , p = 0.02 ) . additionally , the average number of aspirations till disappearance of the seroma and the average number of days till seroma disappearance were smaller in the intervention group compared with the control groups ( 2.1 versus 4.7 aspirations and 2.3 versus 10 days , resp . , p < 0.001 for each ) . there were no significant differences between the two groups as regards the postoperative hematoma and flap necrosis ( table 3 ) . the incidence of seroma in the intervention group was 20% ( 12/60 patients ) compared to 78.3% ( 47/60 patients ) in the control group , and the difference was highly significant ( p < 0.001 ) . we are reporting the efficacy of the use of mastectomy with quilting of flaps and obliteration of the axillary space in reducing the postmastectomy seroma using a randomized design . several trials used adhesive glues and sclerosant agents to reduce the postmastectomy seroma . however , a recent meta - analysis showed that such preventive techniques are still not convincing . as electrocautery was associated with a higher incidence of seroma formation , there was a trend towards the use of scalpel mastectomy or harmonic shear . the concept of suturing the skin flaps to the underlying muscle and obliteration of the axillary space is not new . actually , closure of the dead space especially in the axilla was recommended by van bemmel et al . . table 1 shows most of the trials that used fixation of the skin flaps to the underlying muscles and fascia . however most of these studies were nonrandomized [ 13 , 2123 ] . in our study the incidence of seroma in the quilting group was 20% versus 78.6% in the control group ( table 3 ) . this was in line with that described by coveney ec and his coworkers in 1993 who described an incidence of 25% in the suture group versus 85% in the control group . a similar figure was reported by sakkary ma in 2012 in a small study ( 20 patients per each arm ) with an overall incidence of 20% in the intervention group versus 50% in the control group ( p = 0.047 ) . in a more recent study by ten wolde and his coworkers in 2014 , there was a decrease of seroma from 80.5% in the control group to 22.5% in the quilting group ( p < 0.01 ) . the quilting maneuver in the current study had significantly decreased the total drainage volume ( from a mean of 1160 to a mean of 710 ) ( table 3 ) . similar results were reported by sakkary with a mean decrease from 2017.8 ml in the control group to 524.8 in the intervention group ( p < 0.001 ) . additionally , the quilting in the current study significantly reduced the mean duration of drainage from 11 days in the control group to 9 in the intervention group ( p < 0.001 ) . a similarly significant finding the quilting in the current study was found to significantly decrease the mean days to seroma disappearance , the total aspirated volume , and the number of aspirations ( table 3 ) . this was similar to that reported by ten wolde and his coworkers , which is a decrease of mean number of aspirations from 4.86 to 2.40 ( p = 0.015 ) and the volume of aspirations from 1660 ml to 611 ml ( p = 0.05 ) . there was a significant correlation between the extent of mastectomy and seroma formation being more significant with modified radical mastectomy than with breast conserving surgery [ 10 , 11 ] . it was not a surprise to find that this maneuver prolongs the operative time significantly ( table 3 ) and we consider this the expense for reduction of postmastectomy seroma and all its sequels . similar to our findings , neither the number of dissected axillary lymph nodes nor the extent of dissection influenced seroma formation significantly [ 12 , 13 ] . however purushotham et al . demonstrated in a controlled randomized study that the incidence of seroma was significantly lower with sentinel lymph node ( slnb ) axillary approach than with conventional axillary dissection . neither the number of drains nor the nature of the drain ( suction or passive ) significantly influenced the seroma formation . the use of mastectomy with quilting of flaps and obliteration of the axillary space is an efficient method to significantly reduce the postoperative seroma in addition to significantly reducing the duration and volume of wound drainage . therefore we recommend quilting of flaps as a routine step at the end of any mastectomy .

background . postmastectomy seroma causes patients ' discomfort , delays starting the adjuvant therapy , and may increase the possibility of surgical site infection . objective . to evaluate quilting of the mastectomy flaps with obliteration of the axillary space in reducing postmastectomy seroma . methods . a randomized controlled study was carried out among 120 females who were candidates for mastectomy and axillary clearance . the intervention group ( n = 60 ) with quilting and the control group without quilting . all patients were followed up routinely for immediate and late complications . results . there were no significant differences between the two groups as regards the demographic characteristics , postoperative pathological finding , and the immediate postoperative complications . the incidence of seroma was significantly lower in the intervention group compared with the control group ( 20% versus 78.3% , p < 0.001 ) . additionally , the intervention group had a shorter duration till seroma resolution ( 9 days versus 11 days , p < 0.001 ) and a smaller volume of drainage ( 710 ml versus 1160 ml , p < 0.001 ) compared with the control group . conclusion . the use of mastectomy with quilting of flaps and obliteration of the axillary space is an efficient method to significantly reduce the postoperative seroma in addition to significantly reducing the duration and volume of wound drainage . therefore we recommend quilting of flaps as a routine step at the end of any mastectomy .

most orthodontic patients are adults , especially women . because of their professions and other reasons ( such as social interaction ) , these patients require less visible and more esthetic treatment . because the color of ceramic brackets is close to that of natural teeth , they have become the first choice among these patients.12 bracket irregularities can result in increased dental plaque formation , thus inducing enamel demineralization and other complications.34 recent investigations determined that the incidence of white spot lesions was 7395% in the orthodontic populations studied.5 gorelick et al.6 showed that fixed orthodontic appliances induced a rapid increase in the volume of dental plaque . furthermore , chatterjee and kleinberg7 showed that the plaque of orthodontic patients had a resting ph lower than that of non - orthodontic subjects . a rapid shift was reported in the bacterial flora of plaque after introducing orthodontic appliances.8 scheie et al.9 observed significantly elevated levels of streptococcus mutans in plaque and saliva after the insertion of orthodontic appliances . photocatalytic tio2 has been widely applied in the pollution removal , environmental protection , and biomedical fields because of its great chemical stability,10 biocompatibility,111213 and self - cleaning ability14 since fujishima and honda15 reported the photo - induced and electrochemically assisted decomposition of water in 1972 . the photo - killing of bacteria by exposure to photocatalytic tio2 has also drawn much attention.161718 tio2 becomes strongly oxidative when illuminated by ultraviolet ( uv ) light at wavelengths less than 385 nm , which generates holes and hydroxyl radicals in the valence band , and electrons and superoxide ions in the conduction band . by illuminating tio2 , photocatalysts can decompose organic compounds by participating in a series of oxidation reactions leading to the formation of carbon dioxide.19 a variety of techniques have been used for the preparation of tio2 films including sputtering,20 chemical vapor deposition,21 physical vapor deposition,22 and electron beam evaporation.23 among the many preparation techniques , the sol - gel method fulfills the requirements for nanostructured tio2 and has numerous advantages , including purity , homogeneity , and stoichiometry control.242526 it is suitable for coating large and complex areas composed of many fine particles at low process costs , and offers numerous possibilities to vary film properties by changing the composition of the solution.27 we prepared a tio2 thin film by using the radio frequency ( rf ) magnetron sputtering method in our previous study.28 however , the greatest drawback of this type of modified bracket is the change in color . after a series of experiments , we finally concluded that the color change of the thin film caused by the rf magnetron sputtering method could not be eliminated , despite changing the parameters and substrate . our main consideration was to determine a method to modify a bracket without changing any of its original properties . therefore , after studying the literature , we decided to prepare tio2 thin films by using the solgel method . while ensuring the brackets ' esthetic appearances would not be affected by the coatings , we aimed to ( 1 ) prepare tio2 thin films on the surfaces of ceramic brackets using the sol - gel dip coating method ; ( 2 ) characterize surface morphology by scanning electron microscopy , examine crystalline structure by x - ray diffractometer , and evaluate film thickness by surface ellipsometer ; ( 3 ) test photocatalytic ability via methylene blue ( mb ) decomposition ; and ( 4 ) evaluate antibacterial activity against a common oral microbes . ceramic brackets were provided by a manufacturer of orthodontic brackets ( standard mbt monocrystal ceramic brackets , br212 - 33 ; hangzhou xingchen 3b dental instrument material co. , ltd . the substrates were ultrasonically cleaned in 99.5% acetone , 99% ethanol , and deionized water for 30 minutes in each , and then dried in nitrogen . tio2 acetylacetone ( acac ) was added as a chelating agent to decrease the reactivity and stabilize the sol . acetic acid ( ac ) briefly , a tio2 sol was prepared by dropping proportional amounts of tetrabutyl titanate and acac into ethanol . after stirring for 30 minutes , the molar ratio of the tio2 sol was 1:0.3:0.2:34 for ti / acac / ac / ethanol . the solution was continually stirred for 2.5 hours and subsequently aged for 24 hours at ambient temperature in room air . the thickness of the tio2 films could be adjusted by repeating the dipping cycle . just after coating , finally , dried gel films were annealed at different temperatures for 2 hours ( table 1 ) . the surface morphology was examined by scanning electron microscopy ( sem ; hitachi s-4800 , hitachi high - technologies corporation , tokyo , japan ) . the crystalline structure of the prepared thin films was identified by using a d / max-2400 x - ray diffractometer ( xrd ; rigaku , tokyo , japan ) with ni - filtered cu k radiation . the thickness of the film was measured with a surface ellipsometer ( nanomap500ls ; aep technology , santa clara , ca , usa ) . the photocatalytic activities of the uv - illuminated brackets coated with tio2 thin films were evaluated by measuring the degradation ratio of mb . the thin film was immersed in the mb solution and the suspension was placed in the dark for 40 minutes before irradiation to ensure the establishment of an adsorption - desorption equilibrium . a 500-w high - pressure hg lamp with the main wavelength at 365 nm was employed as the uv light irradiation source and positioned 20 cm away from the reactor to trigger a photocatalytic reaction . , franksville , wi , usa ) and the absorbance at 664 nm was recorded . candida albicans ( atcc 10231 ) and lactobacillus acidophilus ( atcc 4356 ) were chosen as standard microbes and the colony counting method was used in our experiment . separate suspensions of microbes were prepared , each at a concentration of 1.5 10 colony - forming units ( cfu)/ml . then , 100 l of each suspension was added to 3 ml of liquid medium in tubes . the test substrates ( coated with tio2 thin films ) and control substrates ( undoped substrates ) were placed into the tubes , which were incubated at 25 and 37 for 1 hour under uv - a light irradiation ( tld15w/08 , f15t8/blb ; philips electronics , blue bell , pa , usa ) . c. albicans was cultured on sabouraud medium ( guidechem , shanghai , china ) ; l. acidophilus was cultured on tpy ( tryptone yeast ) medium ( guidechem ) . after incubation , 10 l of each suspension was diluted in 10 ml of sterile water . then , 10 l of the dilution was added to cool ( 55 ) solid medium , which was slightly shaken and then poured into a petri dish . c. albicans was cultured at 25 , while l. acidophilus was cultured at 37 for 24 hours , after which the numbers of colonies on each plate were determined by a colony counter . chicago , il , usa ) and are expressed as the mean standard deviation . the antimicrobial activity rate was calculated using the following formula : antimicrobial activity rate ( % ) = ( colony count of the control group - colony count of the test group)/colony count of the control group 100 . statistically significant differences between groups were determined by a one - way analysis of variance ( anova ) , and the least significant difference ( lsd ) test was used for multiple comparisons . ceramic brackets were provided by a manufacturer of orthodontic brackets ( standard mbt monocrystal ceramic brackets , br212 - 33 ; hangzhou xingchen 3b dental instrument material co. , ltd . the substrates were ultrasonically cleaned in 99.5% acetone , 99% ethanol , and deionized water for 30 minutes in each , and then dried in nitrogen . tio2 acetylacetone ( acac ) was added as a chelating agent to decrease the reactivity and stabilize the sol . acetic acid ( ac ) briefly , a tio2 sol was prepared by dropping proportional amounts of tetrabutyl titanate and acac into ethanol . after stirring for 30 minutes , the molar ratio of the tio2 sol was 1:0.3:0.2:34 for ti / acac / ac / ethanol . the solution was continually stirred for 2.5 hours and subsequently aged for 24 hours at ambient temperature in room air . the thickness of the tio2 films could be adjusted by repeating the dipping cycle . just after coating , finally , dried gel films were annealed at different temperatures for 2 hours ( table 1 ) . the surface morphology was examined by scanning electron microscopy ( sem ; hitachi s-4800 , hitachi high - technologies corporation , tokyo , japan ) . the crystalline structure of the prepared thin films was identified by using a d / max-2400 x - ray diffractometer ( xrd ; rigaku , tokyo , japan ) with ni - filtered cu k radiation . the thickness of the film was measured with a surface ellipsometer ( nanomap500ls ; aep technology , santa clara , ca , usa ) . the photocatalytic activities of the uv - illuminated brackets coated with tio2 thin films were evaluated by measuring the degradation ratio of mb . the initial concentration of the mb solution was 5 mg / l . the thin film was immersed in the mb solution and the suspension was placed in the dark for 40 minutes before irradiation to ensure the establishment of an adsorption - desorption equilibrium . a 500-w high - pressure hg lamp with the main wavelength at 365 nm was employed as the uv light irradiation source and positioned 20 cm away from the reactor to trigger a photocatalytic reaction . , franksville , wi , usa ) and the absorbance at 664 nm was recorded . the photocatalytic activities of the uv - illuminated brackets coated with tio2 thin films were evaluated by measuring the degradation ratio of mb . the thin film was immersed in the mb solution and the suspension was placed in the dark for 40 minutes before irradiation to ensure the establishment of an adsorption - desorption equilibrium . a 500-w high - pressure hg lamp with the main wavelength at 365 nm was employed as the uv light irradiation source and positioned 20 cm away from the reactor to trigger a photocatalytic reaction . , franksville , wi , usa ) and the absorbance at 664 nm was recorded . candida albicans ( atcc 10231 ) and lactobacillus acidophilus ( atcc 4356 ) were chosen as standard microbes and the colony counting method was used in our experiment . separate suspensions of microbes were prepared , each at a concentration of 1.5 10 colony - forming units ( cfu)/ml . then , 100 l of each suspension was added to 3 ml of liquid medium in tubes . the test substrates ( coated with tio2 thin films ) and control substrates ( undoped substrates ) were placed into the tubes , which were incubated at 25 and 37 for 1 hour under uv - a light irradiation ( tld15w/08 , f15t8/blb ; philips electronics , blue bell , pa , usa ) . c. albicans was cultured on sabouraud medium ( guidechem , shanghai , china ) ; l. acidophilus was cultured on tpy ( tryptone yeast ) medium ( guidechem ) . after incubation , 10 l of each suspension was diluted in 10 ml of sterile water . then , 10 l of the dilution was added to cool ( 55 ) solid medium , which was slightly shaken and then poured into a petri dish . c. albicans was cultured at 25 , while l. acidophilus was cultured at 37 for 24 hours , after which the numbers of colonies on each plate were determined by a colony counter . chicago , il , usa ) and are expressed as the mean standard deviation . the antimicrobial activity rate was calculated using the following formula : antimicrobial activity rate ( % ) = ( colony count of the control group - colony count of the test group)/colony count of the control group 100 . statistically significant differences between groups were determined by a one - way analysis of variance ( anova ) , and the least significant difference ( lsd ) test was used for multiple comparisons . the results of the xrd analysis ( figures 1 and 2 ) show that tio2 thin films annealed at 300 were in an amorphous phase , since there is no obvious peak at all . it can be clearly seen that thin films annealed at 500 show a weak anatase peak . however , those annealed at 700 were characterized by 2 major peaks centered at 2 = 25.4 and 37.8 , corresponding to the ( 101 ) and ( 200 ) reflections of the anatase phase , with no sign of the rutile or brookite phase . figures 3 and 4 show sem images of tio2 thin films with different numbers of coating layers after a 700 calcination . the film morphologies consisted of agglomerates of nano - sized grains or particulates distributed on the substrate surface . it can be clearly seen that the surfaces of all films are covered in fine grains . moreover , the number of coating layers did not affect the microstructures of thin films calcined at the same temperature . the film thicknesses from different numbers of coatings were measured by surface ellipsometer ( films annealed at 700 were selected ) . , the thickness of the film increased along with an increased number of coating layers . the increase in thickness of the tio2 thin films showed a linear relationship with the number of coats . figure 5 shows the photocatalytic activity of tio2 thin films annealed at different temperatures under uv light irradiation . from figure 5a , we can see that the group of films annealed at 300 showed no photocatalytic activity . figure 5b shows the degradation curves of the mb solution degraded by the tio2 thin film after a 500 calcination . after a 180-minute photocatalytic reaction , tio2 thin films with 5 coating layers showed the greatest photocatalytic activity , as 60% of the mb molecules were decomposed within 180 minutes . figure 5c shows the mb solution degradation curves from a tio2 thin film annealed at 700 , and we can see that photocatalytic activity increased as the thickness increased . films with 5 coating layers had the greatest degradation rate ; nearly 90% of the mb solution was decomposed . figure 5d demonstrates mb solution degradation curves from a tio2 thin film annealed at 900. after a 180-minute photocatalytic reaction , degradation efficiency increased as the thickness increased . it is obvious that the tio2 thin film with 5 layers exhibited the greatest photocatalytic activity among these test samples , as 20% of the mb molecules were decomposed within 180 minutes . after comparing the degradation rates of mb solution by tio2 thin films with 5 coating layers annealed at different temperatures , it was observed that thin films annealed at 700 showed the greatest photocatalytic activity , as 90% of the mb molecules were decomposed within 180 minutes . compared with the others , thin films annealed at 300 had the least photocatalytic activity . the photocatalytic activity of the thin film annealed at 500 under uv light irradiation showed greater photocatalytic activity than films annealed at 300 and 900. photocatalytic activity is directly proportional to the antibacterial ability of a catalyst . thus , films annealed at 700 , which showed the greatest photocatalytic activity , were chosen for the photocatalytic antibacterial test under uv - a light irradiation , and the results are shown in figure 6 . the cell viability of a ceramic substrate on a bare petri dish in the dark was set as 100% . it can be clearly seen that the thin film with 5 coating layers showed the lowest cell viability at 8% for l. acidophilus and 15% for c. albicans , which exhibited the best antimicrobial performance against both microbes compared with the rest of the samples . the results of the xrd analysis ( figures 1 and 2 ) show that tio2 thin films annealed at 300 were in an amorphous phase , since there is no obvious peak at all . it can be clearly seen that thin films annealed at 500 show a weak anatase peak . however , those annealed at 700 were characterized by 2 major peaks centered at 2 = 25.4 and 37.8 , corresponding to the ( 101 ) and ( 200 ) reflections of the anatase phase , with no sign of the rutile or brookite phase . figures 3 and 4 show sem images of tio2 thin films with different numbers of coating layers after a 700 calcination . the film morphologies consisted of agglomerates of nano - sized grains or particulates distributed on the substrate surface . it can be clearly seen that the surfaces of all films are covered in fine grains . moreover , the number of coating layers did not affect the microstructures of thin films calcined at the same temperature . the film thicknesses from different numbers of coatings were measured by surface ellipsometer ( films annealed at 700 were selected ) . the results are shown in table 2 . as can be seen , the thickness of the film increased along with an increased number of coating layers . the increase in thickness of the tio2 thin films showed a linear relationship with the number of coats . figure 5 shows the photocatalytic activity of tio2 thin films annealed at different temperatures under uv light irradiation . from figure 5a , we can see that the group of films annealed at 300 showed no photocatalytic activity . figure 5b shows the degradation curves of the mb solution degraded by the tio2 thin film after a 500 calcination . after a 180-minute photocatalytic reaction , tio2 thin films with 5 coating layers showed the greatest photocatalytic activity , as 60% of the mb molecules were decomposed within 180 minutes . figure 5c shows the mb solution degradation curves from a tio2 thin film annealed at 700 , and we can see that photocatalytic activity increased as the thickness increased . films with 5 coating layers had the greatest degradation rate ; nearly 90% of the mb solution was decomposed . figure 5d demonstrates mb solution degradation curves from a tio2 thin film annealed at 900. after a 180-minute photocatalytic reaction , degradation efficiency increased as the thickness increased . it is obvious that the tio2 thin film with 5 layers exhibited the greatest photocatalytic activity among these test samples , as 20% of the mb molecules were decomposed within 180 minutes . after comparing the degradation rates of mb solution by tio2 thin films with 5 coating layers annealed at different temperatures , it was observed that thin films annealed at 700 showed the greatest photocatalytic activity , as 90% of the mb molecules were decomposed within 180 minutes . compared with the others , thin films annealed at 300 had the least photocatalytic activity . the photocatalytic activity of the thin film annealed at 500 under uv light irradiation showed greater photocatalytic activity than films annealed at 300 and 900. thus , films annealed at 700 , which showed the greatest photocatalytic activity , were chosen for the photocatalytic antibacterial test under uv - a light irradiation , and the results are shown in figure 6 . the cell viability of a ceramic substrate on a bare petri dish in the dark was set as 100% . it can be clearly seen that the thin film with 5 coating layers showed the lowest cell viability at 8% for l. acidophilus and 15% for c. albicans , which exhibited the best antimicrobial performance against both microbes compared with the rest of the samples . crystalline structure is a significant factor that affects the photocatalytic performance of tio2.29 it has been demonstrated that the photocatalytic activity of the anatase structure is greater than that of the rutile structure . moreover , annealing temperature has the greatest influence on the crystalline structure of tio2.30 in our study , 4 annealing temperatures were tested to determine optimal calcination conditions . the results of the calcinations are mentioned above . according to the xrd patterns , the films annealed at 500 and 700 were in anatase form ; the greatest photocatalytic activity was observed in thin films annealed at 700. additionally , with an increase in annealing temperature , crystallinity improves . the sem images also illustrate that with an increase in annealing temperature , the grain size increases . the results show that films annealed at 300 had no ability to decompose mb solution . this is mainly because the films were still amorphous in structure after the 300 calcination . it can be explained that the poor crystallinity of the films annealed at 300 resulted in their low photocatalytic activities . therefore , the high photocatalytic activities of the 700 films can be ascribed to synergetic effects of good crystallization , appropriate phase composition , and a slower recombination rate of photo - generated charge carriers . thin films annealed at 500 showed a certain amount of antibacterial activity . however , compared to thin films annealed at 700 , the diffraction peak was weaker because of the low calcination temperature . after a 900 calcination , tio2 thin films transformed from anatase to rutile phase , as described in the xrd analysis an investigation of the influence of different numbers of coating layers showed that prepared thin films with 5 coating layers demonstrated the greatest photocatalytic activity when calcination temperatures were equal . when the thickness of the film is low , light can pass through the film easily , and the efficiency of the light energy is lower ; thus , the photocatalytic efficiency of the film can be enhanced with greater thicknesses.32 the main mechanism for the inactivation of microbes by tio2 photocatalysis was a hydroxyl radical attack and lipid peroxidation reaction.33 maness et al.34 proposed a detailed mechanism for the bactericidal effect of the tio2 photocatalytic reaction . they pointed out that the initial oxidative damage takes place on the cell wall , where the tio2 photocatalytic surface makes first contact with intact cells . however , cells with damaged cell walls are still viable . after eliminating the protection of the cell wall , photocatalytic action progressively increases cell permeability , and subsequently allows the free efflux of intracellular contents that eventually leads to cell death.353637 zyldsz38 reported the high antibacterial ability of tio2-coated ceramic brackets against s. mutans and c. albicans under uv - a irradiation . shah et al.39 reported that tio2-modified orthodontic brackets showed a statistically significant decrease in the survival rate of lactobacilli under uv - a light irradiation . several studies report that transparent thin films can be achieved by using the sol - gel method.40414243 moreover , the transmittance rate of the thin film could exceed 80%.44 our main purpose was to prepare tio2 thin films on ceramic brackets without affecting the esthetics of the brackets , and to improve antimicrobial activity . in our study , transparent thin films were also prepared by the sol - gel method and demonstrated similar results to previous studies . 1 ) tio2 thin films were successfully prepared on the surfaces of ceramic bracket substrates using the solgel dip coating method . 2 ) tio2 thin films annealed at 700 showed higher photocatalytic activity with increased thickness . tio2 thin film brackets with 5 coating layers annealed at 700 showed the greatest photocatalytic activity in the decomposition of mb solution under uv light irradiation . 3 ) additionally , the films with 5 coating layers and annealed at 700 exhibited the greatest antibacterial activity against l. acidophilus and c. albicans under uv - a light irradiation . therefore , tio2 thin films can be used for further study and continuing development , and we offer a theoretical basis for their practical use .

objectivedifferent methods have been utilized to prevent enamel demineralization and other complications during orthodontic treatment . however , none of these methods can offer long - lasting and effective prevention of orthodontic complications or interventions after complications occur . considering the photocatalytic effect of tio2 on organic compounds , we hoped to synthesize a novel bracket with a tio2 thin film to develop a photocatalytic antimicrobial effect.methodsthe sol - gel dip coating method was used to prepare tio2 thin films on ceramic bracket surfaces . twenty groups of samples were composed according to the experimental parameters . crystalline structure and surface morphology were characterized by x - ray diffraction and scanning electron microscopy , respectively ; film thickness was examined with a surface ellipsometer . the photocatalytic properties under ultraviolet ( uv ) light irradiation were analyzed by evaluating the degradation ratio of methylene blue ( mb ) at a certain time . antibacterial activities of selected thin films were also tested against lactobacillus acidophilus and candida albicans.resultsfilms with 5 coating layers annealed at 700 showed the greatest photocatalytic activity in terms of mb decomposition under uv light irradiation . tio2 thin films with 5 coating layers annealed at 700 exhibited the greatest antimicrobial activity under uv - a light irradiation.conclusionsthese results provide promising guidance in prevention of demineralization by increasing antimicrobial activities of film coated brackets .

in andhra pradesh , on the basis of the reports obtained from the local primary health centers , we selected mallela village ( 2006 population : 1,965 ) of kadapa district . in tamil nadu , we investigated the outbreak in gowripet area ( 2006 population : 2,649 ) of avadi , a suburban locality of chennai city where a large number of persons with fever and joint pain were reported in june 2006 . in both settings , we conducted a door - to - door search of all households for case - patients who had acute onset of febrile illness and joint pain . we also collected blood samples from consenting asymptomatic persons in mallela village to assess the incidence of subclinical infections . we tested serum samples for immunoglobulin ( ig ) m antibodies against chik virus using igm - capture elisa at the national institute of virology , pune ( 1 ) . for the larval survey in mallela , we selected a representative sample of households after stratifying the village by attack rates ; in avadi , we surveyed all households . we calculated house index ( hi ) , the proportion of houses having containers with larvae , and the breteau index ( bi ) , the number of containers positive for mosquito larvae per 100 houses . in avadi , we mapped all the case households using a geographic positioning system device ( arcgis version 8.02 ; esri , redlands , ca , usa ) . we divided the area into 200-m grids to determine correlation between bi and attack rates . we identified 242 case - patients meeting the case definition in mallela ( attack rate : 12% ; no deaths ) and 575 case - patients in avadi ( attack rate 22% ; no deaths ) . the median number of joints affected in mallela and avadi was 3 and 4 , respectively . the most common joints involved were ankle , knee , wrist , and small joints of hands in both settings . in addition to fever and joint pain , 59 ( 10% ) and 28 ( 12% ) case - patients in mallela and avadi , respectively , reported a rash . case - patients were bed - ridden for an average of 6 to 7 days in both settings . attack rates were higher among persons > 15 years of age and females in both settings ( table ) . in mallela , cases began occurring during december 2005 and peaked during the first week of march 2006 ( figure 1 ) . in avadi , cases began occurring during may 2005 and peaked during the third week of june 2006 before declining . in mallela , attack rates in different areas of the village ranged between 0% and 21% . neighborhoods where persons of lower socioeconomic status resided in households with a single room and no water storage facility had the lowest attack rates . in contrast , neighborhoods where people lived in pucca houses ( houses made with brick and mortar ) with plenty of water storage containers had higher attack rates . both outbreaks occurred during the summer months with temperatures ranging from 30c to 44c in mallela and 27c and 37c in avadi . * chikungunya cases by week of the onset , mallela village , kadapa district , andhra pradesh , india , 20052006 . we conducted a larval survey in 56 houses in mallela and all 657 households in avadi . in both settings , water was scarce and residents used a variety of water storage containers , including plastic / earthen pots , plastic drums , and cement cisterns . the hi and bi were 30% ( 17/56 ) and 39% ( 22/56 ) , respectively , in mallela . the hi and bi were 23% ( 148/657 ) and 35% ( 228/ 657 ) , respectively , in avadi . we observed a weak but significant correlation between attack rates by 200-m grids and bi ( r = 0.37 , p = 0.04 ) ( figure 2 ) . immature mosquitoes , gowripet , avadi , chennai , tamil nadu , india , 2006 . in avadi , 5 of the 9 blood samples collected from the case - patients were positive for igm antibodies . in mallela , 90 ( 67% ) of the 134 blood samples collected from case - patients were positive for igm antibodies . in mallela , we included 100 asymptomatic volunteers for serologic testing ( median age 25 years , range 670 ) ; 33 were < 15 years of age and 51 were female . there was no significant difference in the prevalence of igm antibodies between age groups > 15 years of age and < 15 years of age ( 16% vs. 12% ; p = 0.40 ) or between sexes ( 16% in males vs. 14% in females , p = 0.47 ) . the key finding of our chikungunya outbreak investigation was a high attack rate , particularly among adults and females . the outbreak occurred nearly 32 years after the last reported outbreak of chik in 1973 and was characterized by a prolonged duration . our findings also suggest a considerable number of subclinical infections during the outbreak . the explosive nature of the outbreak with high attack rates might be due to the absence of herd immunity to the central / east african genotype of the chik virus isolated in india and other countries in indian ocean region . chik outbreaks reported in the 1960s and 1970s from india were related to the asian genotype of the virus ( 1 ) . unlike with dengue fever , we observed higher attack rates among adults than among children . we observed higher attack rates in females as observed in other countries ( 57 ) . the epidemic curves observed in both study sites indicated that transmission was ongoing for a considerably long period . the short flight range of the vector likely resulted in gradual transmission of infection among hosts in both communities . however , in both areas , bi was higher than 5 ( 35%39% ) , which is the threshold for dengue transmission per the guidelines of the national institute of communicable diseases , india ( 8) . the weak positive correlation between attack rate and bi in avadi could be due to high vector density , which might distort the association between vector indices and clinical chik . the limitations of our study were the lack of uniform methods for investigating 2 outbreaks and the convenient sampling method used to estimate incidence of subclinical infection . aegypti mosquitoes in the form of water storage containers that were used in the absence of regular water supply and acute water scarcity . most of these containers were either uncovered or partially covered and were not cleaned at regular intervals . thus , a regular water supply that negates the need for water storage , education of the public for safe water storage measures , and environmental control are much needed public health measures to combat future chik outbreaks .

we investigated chikungunya outbreaks in south india and observed a high attack rate , particularly among adults and women . transmission was facilitated by aedes aegypti mosquitoes in peridomestic water containers , as indicated by a high breteau index . we recommended vector control measures and health education to promote safe water storage practices .

the use of herbal / botanical products worldwide enjoys increasing popularity.1,2 it is known that the great variety of plant secondary metabolites are excellent sources for components such as polyphenols , which exhibit antioxidant , anticarcinogenic , antimutagenic , and anti - inflammatory effects.35 the understanding of the cellular and molecular mechanisms involved in the inflammatory process has increased in recent decades , and this has permitted the discovery of many promising targets for the development of new bioactive compounds to treat chronic inflammatory diseases.6 arctium lappa ( al ) , commonly known as burdock , has anti - inflammatory,7 free radical scavenging,8 antioxidant,9 and liver10 and skin11 protective effects . on lipopolysaccharide ( lps)-stimulated macrophages , arctigenin exhibited potent inhibitory effects on the production of nitric oxide ( no ) and the release of tumor necrosis factor ( tnf ) and interleukin 6 ( il6 ) , but not cyclooxygenase 2 ( cox2 ) expression or cox2 activity.12 camellia sinensis ( cs ) , as green tea , is a species of plant whose leaves and leaf buds are used to produce the popular tea beverage . it is widely known for its anti - inflammatory effect , and there is growing interest in its cardiovascular health benefits.13 green tea and its major ingredient , epigallocatechin gallate , effectively inhibited the release of high mobility group box 1 ( hmgb1 ) in lps - induced macrophage cultures14 by promoting its aggregation and autophagic degradation in these cells.15 echinacea spp . plant preparations are claimed to have several pharmacological effects , such as immune enhancement , anti - inflammation , and prevention of common cold.16 numerous reports have demonstrated that echinacea spp . constituents have inflammation - related bioactivities such as stimulation of cytokine production17 or inhibition of cox1 or cox2 activity in vitro.18 hou et al,19 in murine macrophages , demonstrated that alkamides significantly inhibited cox2 activity and the lps - induced expression of cox2 , inducible no synthase ( nos2 ) , and specific cytokines or chemokines . eleutherococcus senticosus ( es ) is used as an immunological modulator in oriental medicine.20 it has been used to treat stress - induced physiological changes and various allergic disorders.2123 however , it is still unclear how it inhibits allergic responses and how effective it is in experimental models . on activated murine macrophage raw264.7 cells , es downregulated nos2 expression , showing pro - inflammatory action by blocking activation of jnk and akt signaling pathways.20 the beneficial effects of panax ginseng ( pg ) , have been attributed to the biological activities of its constituents , the ginsenosides . ginseng extracts and ginsenosides have been reported to have anti - inflammatory properties.24 ginseng can modulate the generation of inflammatory mediators ( such as no , synthesized by the activity of noss25 ) and the phagocytic activity of macrophages.26 vaccinium myrtillus ( vm ) was one of the most frequently used antidiabetic remedies before the discovery of insulin.27 however , hou et al28 demonstrated that delphinidin , one of the five anthocyanidins present in bilberry , suppressed cox2 by blocking mapk - mediated pathways with the attendant activation of nuclear factor b ( nfb ) , activator protein 1 ( ap1 ) , and ccaat - enhancer - binding protein delta ( c / ebp ) in lps - activated murine macrophage raw264.7 cells . moreover , gene expression profiling of inflammatory cell model raw264.7 treated with bilberry extract was provided , showing that bilberry extracts affected genes related to inflammation and defense.29 a broad range of roles of secondary plant metabolites has been identified for several inflammatory cells and for a large number of inflammatory mediators in important pathologies not previously known to be linked to inflammation , such as obesity , atherosclerosis , and cancer.30,31 however , evidence exists that nutraceuticals can modulate various inflammatory mediators ( eg , cytokines ) , the production and/or action of second messengers ( cgmp , camp , protein kinases ) , the expression of transcription factors ( ap1 , nfb ) , and the expression of key proinflammatory molecules such as nos2 , cox2 , interleukin 1 ( il1 ) and tnf , neuropeptides ( substance p ) , and proteases ( matrix proteases).6 moreover , whereas the nfb plays an important role as transcription factor in coordinating the expression of proinflammatory genes , the peroxisome proliferator - activated receptor ( ppar ) plays an important role in controlling various diseases based on its anti - inflammatory properties.32,33 in this regard , expression of ppar is not restricted to adipocytes , but is also found in immune cells , such as b and t lymphocytes , monocytes , macrophages , dendritic cells , and granulocytes.34 all this evidence suggests a role of ppar in the control of the inflammatory response with potential therapeutic applications in inflammation - related diseases.35 it has been shown that nuclear factor e2-related factor 2 ( nfe2l2 ) is responsible for both constitutive and inducible expression of antioxidant response element - regulated genes,36 indicating an important protective role in regulating antioxidant and anti - inflammatory cellular responses . in this regard , the aim of this research was to investigate the molecular activity of al , cs , echinacea angustifolia ( ea ) , es , pg , and vm extracts on cell model raw264.7 , in order to investigate their effect in modulating messenger ( m)rna expression of genes involved in the inflammatory process : tnf , cox2 , il1 , nfb1 , nfb2 , nos2 , nfe2l2 , and ppar. raw264.7 cells were pre - stimulated with h2o2 to mimic inflammatory conditions and then treated with plant extracts . all the extracts were obtained from commercial companies , standardized for the content of bioactive compounds ( table 1 ) . ( milan , italy ) , and cs , ea , es , pg , and vm were provided by acef s.p.a . ( piacenza , italy ) . the extracts ( 50 mg ) were dissolved in 1 ml of 10% dimethyl sulfoxide ( dmso ) , passed through 0.22 m pore - sized membrane filter ( emd millipore , billerica , ma , usa ) , and kept in the dark at 20c until further analysis . raw264.7 murine macrophages ( american type culture collection [ atcc ] , manassas , va , usa ) were cultured in dulbecco s modified eagle s medium supplemented with 10% heat - inactivated fetal bovine serum , 2 mm l - glutamine , 100 u / ml penicillin , and 100 g / ml streptomycin . for all experiments , the cells were grown to approximately 70%90% confluence and culture medium with 2% heat - inactivated fetal bovine serum was used.37 a preliminary assay was performed by treating macrophages with different final concentrations of h2o2 ( 50 , 100 , and 200 m ) diluted in phosphate - buffered saline ( pbs ) and further diluted in culture medium . the control cells ( ctrl ) were incubated for 24 hours with the same final amount of < 0.1% dmso in the culture medium . this assay was used to identify the concentration of h2o2 that would be used to induce an inflammatory condition in the subsequent experiments . cell viability was measured after 30 and 60 minutes of incubation with h2o2 ( 50 , 100 , and 200 m ) . to test the effect of plant extracts on macrophages , cells were washed with pbs and treated with different doses of plant extract ( 1 , 10 , 100 , and 200 g / ml ) in a final concentration of < 0.1% dmso in the culture medium for 24 hours . in addition , a combined effect of each plant extract and h2o2 was assayed by incubating cells for 60 minutes with h2o2 ( 200 m ) and , after washing with pbs , with the specific dose of each plant extract in a final concentration of < 0.1% dmso in the culture medium for 24 hours . the ctrl were incubated for 24 hours with the same final amount of < 0.1% dmso in the culture medium . to ascertain the cytotoxic effect of h2o2 and plant extracts , viability of raw264.7 cells was measured by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) colorimetric assay.11,38 for the assay , cells were seeded in a 96-well plate at a density of 210 cells / well and left to grow for 24 hours . per well , 10 l of mtt reagent was added and the mixture was further incubated for 3 hours . next , the mixture in each well was removed , and formed formazan crystals were dissolved in 100 l of dmso . optical density measurement of the mixture was performed in a microplate reader ( tecan genios , mnnedorf , switzerland ) at 550 nm . cell viability was expressed as percentage of each treatment versus the ctrl . to determine the modulation of h2o2 on mrna expression of il1 , nfe2l2 , nfb1 , nfb2 , ppar , nos2 , cox2 , and tnf , qrt - pcr was preliminarily performed on macrophages treated with 50 , 100 , and 200 m h2o2 for 30 and 60 minutes . in addition , macrophages were treated with 10 g / ml of each extract for 24 hours after a pre - stimulation using 200 m h2o2 for 60 minutes . to determine whether plant extracts had an effect on h2o2 pre - stimulated cells , the mrna expression of the same genes was analyzed . after treatment , cells were washed with cold pbs before total rna extraction using the rneasy plus mini kit ( qiagen nv , venlo , the netherlands ) , according to the manufacturer s instructions . then , complementary ( c)dna was synthesized from the same purified rna samples according to improm - ii reverse transcription system ( promega corporation , fitchburg , wi , usa ) and using random and oligo(dt)15 primers . briefly , 1 g of the purified total rna was denatured by incubating at 70c for 5 minutes and then placed at 25c for 5 minutes , 42c for 60 minutes , and 70c for 15 minutes . primer3 input software ( whitehead institute for biomedical research , cambridge , ma , usa)39 was used to design the primer sequences encoding for actin ( actb ) , glyceralde - hyde-3-phosphate dehydrogenase ( gapdh ) , il1 , nfe2l2 , nfkb1 , nfkb2 , ppar , nos2 , cox2 , and tnf ( table 2 ) . the relative qrt - pcr was performed in triplicate with the platinum sybr green qpcr supermix - udg with rox ( life technologies , carlsbad , ca , usa ) on cfx96 real - time pcr detection system ( bio - rad laboratories inc . reaction mixes were prepared with 200 nm of each primer pair ( table 2 ) and the cdna ( 10 ng ) added last . differences between samples and controls were calculated using the 2 method,40,41 where 2 represents the difference of a given target gene in h2o2-treated cells versus the ctrl ( table 3 ) and each sample treated with plant extract versus h2o2-treated cells ( figure 1 ) . the expression of target genes was normalized using actb and gapdh , and cts were calculated by the difference between ct of the gene target and the geometric mean of the two housekeeping genes . the n - fold expression of a given target gene was calculated as log2 ( 2 ) . cell viability data related to h2o2 treatments and computed as % mean standard error ( se ) , were analyzed using the analysis of variance ( anova ) model to assess the significance of doses ( 50 , 100 , and 200 m h2o2 ) and time of treatments ( 30 minutes and 60 minutes ) . the differences in cell viability were analyzed among doses ( 1 , 10 , 100 , and 200 g / ml ) of each extract . means were compared adjusting the p - values with bonferroni correction for multiple comparisons ( statistical package for the social sciences [ spss ] version 16.0 ; spss inc . , relative gene expression data , after h2o2 treatments , were analyzed using the general linear model to assess the significance of doses ( 50 , 100 , and 200 m h2o2 ) and time of treatments ( 30 minutes and 60 minutes ) . means were compared adjusting p - values with bonferroni correction for multiple comparisons ( spss version 16.0 ; spss inc . ) . the effect of plant extracts on gene expressions , computed as log2(n - fold ) , were checked by the general linear model . data were reported as mean of log2(n - fold ) se . for mean comparisons , the p - values were adjusted with bonferroni correction for multiple comparisons ( spss version 16.0 ; spss inc . ) . all the extracts were obtained from commercial companies , standardized for the content of bioactive compounds ( table 1 ) . ( milan , italy ) , and cs , ea , es , pg , and vm were provided by acef s.p.a . ( piacenza , italy ) . the extracts ( 50 mg ) were dissolved in 1 ml of 10% dimethyl sulfoxide ( dmso ) , passed through 0.22 m pore - sized membrane filter ( emd millipore , billerica , ma , usa ) , and kept in the dark at 20c until further analysis . raw264.7 murine macrophages ( american type culture collection [ atcc ] , manassas , va , usa ) were cultured in dulbecco s modified eagle s medium supplemented with 10% heat - inactivated fetal bovine serum , 2 mm l - glutamine , 100 u / ml penicillin , and 100 g / ml streptomycin . for all experiments , the cells were grown to approximately 70%90% confluence and culture medium with 2% heat - inactivated fetal bovine serum was used.37 a preliminary assay was performed by treating macrophages with different final concentrations of h2o2 ( 50 , 100 , and 200 m ) diluted in phosphate - buffered saline ( pbs ) and further diluted in culture medium . the control cells ( ctrl ) were incubated for 24 hours with the same final amount of < 0.1% dmso in the culture medium . this assay was used to identify the concentration of h2o2 that would be used to induce an inflammatory condition in the subsequent experiments . cell viability was measured after 30 and 60 minutes of incubation with h2o2 ( 50 , 100 , and 200 m ) . to test the effect of plant extracts on macrophages , cells were washed with pbs and treated with different doses of plant extract ( 1 , 10 , 100 , and 200 g / ml ) in a final concentration of < 0.1% dmso in the culture medium for 24 hours . in addition , a combined effect of each plant extract and h2o2 was assayed by incubating cells for 60 minutes with h2o2 ( 200 m ) and , after washing with pbs , with the specific dose of each plant extract in a final concentration of < 0.1% dmso in the culture medium for 24 hours . the ctrl were incubated for 24 hours with the same final amount of < 0.1% dmso in the culture medium . to ascertain the cytotoxic effect of h2o2 and plant extracts , viability of raw264.7 cells was measured by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) colorimetric assay.11,38 for the assay , cells were seeded in a 96-well plate at a density of 210 cells / well and left to grow for 24 hours . per well , 10 l of mtt reagent was added and the mixture was further incubated for 3 hours . next , the mixture in each well was removed , and formed formazan crystals were dissolved in 100 l of dmso . optical density measurement of the mixture was performed in a microplate reader ( tecan genios , mnnedorf , switzerland ) at 550 nm . to determine the modulation of h2o2 on mrna expression of il1 , nfe2l2 , nfb1 , nfb2 , ppar , nos2 , cox2 , and tnf , qrt - pcr was preliminarily performed on macrophages treated with 50 , 100 , and 200 m h2o2 for 30 and 60 minutes . in addition , macrophages were treated with 10 g / ml of each extract for 24 hours after a pre - stimulation using 200 m h2o2 for 60 minutes . to determine whether plant extracts had an effect on h2o2 pre - stimulated cells , after treatment , cells were washed with cold pbs before total rna extraction using the rneasy plus mini kit ( qiagen nv , venlo , the netherlands ) , according to the manufacturer s instructions . then , complementary ( c)dna was synthesized from the same purified rna samples according to improm - ii reverse transcription system ( promega corporation , fitchburg , wi , usa ) and using random and oligo(dt)15 primers . briefly , 1 g of the purified total rna was denatured by incubating at 70c for 5 minutes and then placed at 25c for 5 minutes , 42c for 60 minutes , and 70c for 15 minutes . primer3 input software ( whitehead institute for biomedical research , cambridge , ma , usa)39 was used to design the primer sequences encoding for actin ( actb ) , glyceralde - hyde-3-phosphate dehydrogenase ( gapdh ) , il1 , nfe2l2 , nfkb1 , nfkb2 , ppar , nos2 , cox2 , and tnf ( table 2 ) . the relative qrt - pcr was performed in triplicate with the platinum sybr green qpcr supermix - udg with rox ( life technologies , carlsbad , ca , usa ) on cfx96 real - time pcr detection system ( bio - rad laboratories inc . reaction mixes were prepared with 200 nm of each primer pair ( table 2 ) and the cdna ( 10 ng ) added last . differences between samples and controls were calculated using the 2 method,40,41 where 2 represents the difference of a given target gene in h2o2-treated cells versus the ctrl ( table 3 ) and each sample treated with plant extract versus h2o2-treated cells ( figure 1 ) . the expression of target genes was normalized using actb and gapdh , and cts were calculated by the difference between ct of the gene target and the geometric mean of the two housekeeping genes . the n - fold expression of a given target gene was calculated as log2 ( 2 ) . cell viability data related to h2o2 treatments and computed as % mean standard error ( se ) , were analyzed using the analysis of variance ( anova ) model to assess the significance of doses ( 50 , 100 , and 200 m h2o2 ) and time of treatments ( 30 minutes and 60 minutes ) . the differences in cell viability were analyzed among doses ( 1 , 10 , 100 , and 200 g / ml ) of each extract . means were compared adjusting the p - values with bonferroni correction for multiple comparisons ( statistical package for the social sciences [ spss ] version 16.0 ; spss inc . , chicago , usa ) . relative gene expression data , after h2o2 treatments , were analyzed using the general linear model to assess the significance of doses ( 50 , 100 , and 200 m h2o2 ) and time of treatments ( 30 minutes and 60 minutes ) . means were compared adjusting p - values with bonferroni correction for multiple comparisons ( spss version 16.0 ; spss inc . ) . the effect of plant extracts on gene expressions , computed as log2(n - fold ) , were checked by the general linear model . data were reported as mean of log2(n - fold ) se . for mean comparisons , the p - values were adjusted with bonferroni correction for multiple comparisons ( spss version 16.0 ; spss inc . ) . to analyze the effect of dose and time of h2o2 exposure , a preliminary cell viability assay was performed by treating macrophages with increasing doses of h2o2 from 1 to 200 m at two times of incubation ( 30 minutes and 60 minutes ) . cell viability ( % versus ctrl ) after exposure for 30 minutes and 60 minutes slowly decreased , remaining at over 60% ( p<0.001 ) up to 200 m ( 67.89%1.66% ) ( table 4 ) . the dose of 200 m of h2o2 was chosen to evoke inflammation for 60 minutes without affecting the cell viability ( see also the next paragraph ) . in addition , cells were treated for 24 hours with plant extracts ( table 5 ) . a concentration of 10 g / ml of each al , cs , ea , es , pg , and vm significantly ( p<0.001 ) reduced cell viability in comparison to the ctrl , remaining , nevertheless , over 80% . on the contrary , concentrations of 100 and 200 g / ml led to a strong decrease ( p<0.001 ) in viability . based on this evidence , as shown in table 3 , the h2o2 treatment induced the upregulation of all genes , except ppar , at both incubation times . in particular , the mrna expression of nfkb1 , nfkb2 , cox2 , and nfe2l2 significantly increased ( p<0.001 ) after 60 minutes of incubation . the mrna expression of cox2 was also significantly ( p<0.001 ) upregulated in a concentration - dependent manner . the mrna expression of tnf , nfkb1 , nfkb2 , and nfe2l2 showed a similar trend , at p<0.01 . the interaction between time and dose of incubation was significant in the expression of cox2 ( p<0.001 ) and nfkb2 , nos2 , and nfe2l2 ( p<0.05 ) . the relative expression of il1 and ppar did not present any significant variation between doses , times of incubation , or in the interaction between time and dose . taken together , these results show that 60 minutes of exposure and a concentration of 200 m were significantly more effective than the other times or concentrations in stimulating the mrna expression , and therefore were chosen for the further experiments . as shown in figure 1 , all of the treatments significantly ( p<0.001 ) modulated the mrna expression of each gene , but with some specific effect . al showed an increase of nos2 , nfe2l2 , and ppar expression , while depressing the expression of tnf , il1 , cox2 , nfkb1 , and nfkb2 . cs stimulated cox2 , nfe2l2 , and ppar , and negatively modulated tnf , il1 , nos2 , nfb1 , and nfb2 . ea and es upregulated all genes except il1 and ppar. pg and vm caused a decreased expression of all genes apart from nfe2l2 and ppar , which were stimulated . to analyze the effect of dose and time of h2o2 exposure , a preliminary cell viability assay was performed by treating macrophages with increasing doses of h2o2 from 1 to 200 m at two times of incubation ( 30 minutes and 60 minutes ) . cell viability ( % versus ctrl ) after exposure for 30 minutes and 60 minutes slowly decreased , remaining at over 60% ( p<0.001 ) up to 200 m ( 67.89%1.66% ) ( table 4 ) . the dose of 200 m of h2o2 was chosen to evoke inflammation for 60 minutes without affecting the cell viability ( see also the next paragraph ) . in addition , cells were treated for 24 hours with plant extracts ( table 5 ) . a concentration of 10 g / ml of each al , cs , ea , es , pg , and vm significantly ( p<0.001 ) reduced cell viability in comparison to the ctrl , remaining , nevertheless , over 80% . on the contrary , concentrations of 100 and 200 g / ml led to a strong decrease ( p<0.001 ) in viability . based on this evidence , as shown in table 3 , the h2o2 treatment induced the upregulation of all genes , except ppar , at both incubation times . in particular , the mrna expression of nfkb1 , nfkb2 , cox2 , and nfe2l2 significantly increased ( p<0.001 ) after 60 minutes of incubation . the mrna expression of cox2 was also significantly ( p<0.001 ) upregulated in a concentration - dependent manner . the mrna expression of tnf , nfkb1 , nfkb2 , and nfe2l2 showed a similar trend , at p<0.01 . the interaction between time and dose of incubation was significant in the expression of cox2 ( p<0.001 ) and nfkb2 , nos2 , and nfe2l2 ( p<0.05 ) . the relative expression of il1 and ppar did not present any significant variation between doses , times of incubation , or in the interaction between time and dose . taken together , these results show that 60 minutes of exposure and a concentration of 200 m were significantly more effective than the other times or concentrations in stimulating the mrna expression , and therefore were chosen for the further experiments . as shown in figure 1 , all of the treatments significantly ( p<0.001 ) modulated the mrna expression of each gene , but with some specific effect . al showed an increase of nos2 , nfe2l2 , and ppar expression , while depressing the expression of tnf , il1 , cox2 , nfkb1 , and nfkb2 . cs stimulated cox2 , nfe2l2 , and ppar , and negatively modulated tnf , il1 , nos2 , nfb1 , and nfb2 . ea and es upregulated all genes except il1 and ppar. pg and vm caused a decreased expression of all genes apart from nfe2l2 and ppar , which were stimulated . epidemiological studies have provided convincing evidence that natural dietary compounds possess many biological activities against various chronic inflammatory diseases.42,43 in the present study , we evaluated the effect of al , cs , ea , es , pg , and vm extracts on the expression of relevant genes involved in inflammatory response . the analyses were performed on macrophages , key cells of immunity mechanisms.44 in particular , these cells are essential in the shift of the immune response from the so - called type 1 response with cytotoxic effector cells toward the type 2 response that is characterized by antibody production . previous studies have been commonly conducted on lps - induced macrophages , while , in this paper , macrophages were stimulated by direct addition of h2o2 . in fact , h2o2 acts as a secondary messenger in diverse stimuli , which are also not infective , that activate nfb.45 in this study , the data demonstrated that 200 m of h2o2 affects cell viability similarly to lower doses . moreover , the choice of 200 m h2o2 is a good compromise between the doses that activate inflammatory mediators , such as nfb , and those naturally produced in the inflammatory process.46 in fact , the addition of 200 m h2o2 for 60 minutes on raw264.7 cells significantly stimulated the transcription of tnf , cox2 , nfkb1 , nfkb2 , nos2 , and nfe2l2 . interestingly , no differences were found between times of exposure and doses in il1 and ppar expression . h2o2 clearly stimulated the expression of nfb - dependent genes in raw264.7 cells , likely induced by proinflammatory cytokine tnf , as already observed in mcf-7 cells.47,48 moreover , it is known that several proteins can be oxidized and thus modified by h2o2 . these redox - regulated proteins include transcription factors such as p53 , jun , fos , and the p50 subunit of nfb ( nfkb1 ) . the oxidation of these proteins can either prevent ( p53 , jun , fos ) or stimulate ( p50 ) the transcriptional activity of these genes.49 the plant extract treatments on pre - stimulated macrophages showed an anti - inflammatory action , downregulating inflammatory genes that typically can activate nfb1 and nfb2 pathways , as previously observed.12,50 flavonoids , which specifically affect the modulation of inflammatory gene expression and the function of enzymes critically involved in inflammation,51,52 are also present in al,53 cs,54 pg,55 and vm.56 zhao et al,12 using lps to stimulate raw264.7 cells , demonstrated a block in no production after addition of the active compound arctigenin . moreover , the major polyphenol in cs extracts , epigallocatechin gallate , has been recently found to suppress nos2 mrna and protein expression in macrophages57 through the inhibition of the activation of nfb.58 in the present study , nos2 was upregulated by al , and by up to twofold by ea and es , in comparison to the control . cs downregulated nos2 expression related to the control , possibly through inhibition of nfb1 and nfb2 , but without any significant difference compared to other compounds . in general , controversial data could be due to the different extraction solvent , stimulant ( lps or h2o2 ) , and different active compounds present in the extract . anthocyanins , from bilberry ( vm ) , constitute the major bioactive components responsible for the observed downregulating effects on genes involved in inflammatory response , as already observed in a microarray study.29 among the tested extracts , vm showed the highest anti - inflammatory activity , as also reported in lps - stimulated human monocytic cell line by downregulating all the proinflammatory genes , in particular cox2 and nos2.59 it has previously been shown that , in murine raw264.7 cells , anthocyanidins inhibited lps - induced cox2 expression by blocking mapk pathways with the attendant activation of nfb , c / ebp , and ap1.28 ea and es seem to act as immunostimulating agents , downregulating il1 only . plant extract has been used for immunomodulation,60 but the evidence supporting its therapeutic potential is still controversial . in vitro studies have shown that the commercial preparations of echinacea spp . extract stimulate cytokine production by human peripheral blood macrophages17 and enhance nk cell function and antibody - dependent cytotoxicity of peripheral blood mononuclear cells.61,62 in the present study an enhanced release of cytokines ( such as tnf and interferon- ) in response to echinacea spp . components was also detectable in rat spleen macrophage.60 the existing results suggest that the echinacea spp . preparations are potentially effective in stimulating an in vitro and in vivo nonspecific immune response.63,64 similarly to ea , es downregulated il1 only . previous reports indicated that the isolated compounds from es inhibit the nos2 as well as cox2 expression.65,66 however , it has also been shown that 80% ethanol extract from es attenuated lps - induced nos2 expression but not cox2 expression.20 dissimilar results may be due to efficacy according to concentration between whole extract and its derived compounds . on the other hand , ea and es are the only extracts that downregulated the expression of ppar , therefore promoting the expression of inflammatory mediators . the ppar , a member of the nuclear hormone receptor superfamily , is essential for adipocyte differentiation and glucose homeostasis . ppar has been found to regulate macrophage activation in response to mitogens and inflammation,67 and it was recognized as a negative regulator of the inflammatory activation of both macrophage and t - cells.68 christensen et al69 demonstrated that , on 3t3-l1 adipocytes , various fatty acids and alkylamides from the flowers of echinacea purpurea at high concentrations activated ppar. an involvement of ppar in the inhibition of il2 secretion by t - cells in response to ea alkylamides has also been observed.70 interestingly , only ea and es did not stimulate the expression of ppar , and this was in agreement with the attendant overexpression of the proinflammatory genes . ea and es , as well as al , cs , pg , and vm , upregulated nfe2l2 , a transcriptional regulator of antioxidant enzymes with an important role in attenuating oxidative stress associated with diseases.71 cs has been shown to activate nfe2l2 in hl-1 murine cardiomyocytes and to induce phase ii enzymes through the antioxidant response element and concomitant protection against h2o2.72 furthermore , echinacoside , one of the major active compounds in ea,73 resulted in strong activation of nfe2l2 in hacat cells , providing a potential skin protection.74 interestingly , in the present study , phytochemical treatments modulated the nfe2l2 expression , which was increased by the oxidant treatment . although the important role that h2o2 plays as an intracellular messenger is not well understood , it is known that local h2o2 concentration in extracellular fluids during inflammatory processes are sufficient to activate the nfb pathway , thereby allowing induction of the synthesis of cytokines and other inflammatory mediators . the stimulation of h2o2 on raw264.7 cells induced the transcription of proinflammatory mediators , showing that this could be an applicable system by which to activate macrophages . the extracts from al , cs , pg , and vm decreased the expression of proinflammatory genes on h2o2-induced raw264.7 cells in vitro , while ea and es , on the contrary , promoted these inflammatory mediators . the promising anti - inflammatory molecular mechanisms of plant extracts in macrophages of murine raw264.7 cells require validation in future in vivo dietary intervention studies .

backgroundarctium lappa ( al ) , camellia sinensis ( cs ) , echinacea angustifolia , eleutherococcus senticosus , panax ginseng ( pg ) , and vaccinium myrtillus ( vm ) are plants traditionally used in many herbal formulations for the treatment of various conditions . although they are well known and already studied for their anti - inflammatory properties , their effects on h2o2-stimulated macrophages are a novel area of study.materials and methodscell viability was tested after treatment with increasing doses of h2o2 and/or plant extracts at different times of incubation to identify the optimal experimental conditions . the messenger ( m)rna expression of tnf , cox2 , il1 , nfb1 , nfb2 , nos2 , nfe2l2 , and ppar was analyzed in macrophages under h2o2 stimulation . the same genes were also quantified after plant extract treatment on cells pre - stimulated with h2o2.resultsa noncytotoxic dose ( 200 m ) of h2o2 induced active mrna expression of cox2 , il1 , nfe2l2 , nfb1 , nfb2 , nos2 , and tnf , while ppar was depressed . the expression of all genes tested was significantly ( p<0.001 ) regulated by plant extracts after pre - stimulation with h2o2 . cox2 was downregulated by al , pg , and vm . all extracts depressed il1 expression , but upregulated nfe2l2 . nfb1 , nfb2 , and tnf were downregulated by al , cs , pg , and vm . nos2 was inhibited by cs , pg , and vm . ppar was decreased only after treatment with e. angustifolia and e. senticosus.conclusionthe results of the present study indicate that the stimulation of h2o2 on raw267.4 cells induced the transcription of proinflammatory mediators , showing that this could be an applicable system by which to activate macrophages . plant extracts from al , cs , pg , and vm possess in vitro anti - inflammatory activity on h2o2-stimulated macrophages by modulating key inflammation mediators . further in vitro and in vivo investigation into molecular mechanisms modulated by herbal extracts should be undertaken to shed light on the development of novel modulating therapeutic strategies .

titanium plates have been used for over two decades to achieve internal rigid fixation of mandibular fractures . many advantages such as bio - compatibility , rigidity , ease of application , and few reported complications have achieved reliable results3 . one advantage of a resorbable plating system over a conventional titanium plating system is that resorbable plates do not require subsequent removal , and thus a second surgery is not needed5 . unlike titanium plating systems , resorbable plating systems have not been used on a large scale for the fixation of mandibular fractures . although studies have evaluated the efficacy of resorbable plating on isolated mandibular angle and symphysis fractures7,8,9 , no studies have specifically evaluated the effectiveness of a resorbable plating system in the treatment of combined angle and symphysis fractures . the purpose of this study was to compare the resorbable plating system with the conventional titanium plating system for treatment of combined fractures in the mandibular angle and symphysis in terms of fracture union , restoration of function , frequency of complications , and specific technical challenges . this study was conducted at the oral and maxillofacial surgery department of gachon university gil medical center , incheon between january 2011 and december 2012 . based on the retrospective observational nature of the study and the operaexclusion of private personal information of protected health information from the data set , this study was exempt from institutional review board 's review . patients with combined fractures of the mandibular angle and symphysis were included , while patients with contraindications to general anesthesia , comminuted fractures , metabolic bone disorders , or pathologic fractures were excluded . the data recorded included patient gender , age , etiology , state of bone union , and various complications . we evaluated radiographs with respect to the condition of the reduction , dislocation , and fracture union . panoramic x - ray views and computed tomography scans were carried out along with the baseline investigations . the surgery was carried out by the same surgical team and the operation technique was the same for most patients . after access and identification of the fracture , fixation of the bone segments was obtained through two 4-hole miniplates on the symphysis area and a single 4-hole miniplate on the angle area , as described in champy et al.10.(figs . 1 , 2 ) intermaxillary fixation ( imf ) using an arch bar or a skeletal anchorage system was carried out in both groups . after surgery , patients were admitted to the ward facilities for two or three days on average . follow - up visits were carried out at 1 week , 2 weeks , 1 month , and 3 months after surgery with periodic panoramic x - ray views.(figs . the primary variables for this comparative analysis are the union of the fracture and return to normal function . secondary variables included the incidence of complications such as infection , soft tissue dehiscence , screw fracture rates , operative time , and specific technical challenges . the data were analyzed using statistical software ( spss statistics version 17.0 ; spss inc . , chicago , il , usa ) . a p - value of < 0.05 was considered significant . thirteen patients were in the experimental ( r ) group , where 39 resorbable plates ( inion cps system [ inion ltd , tampere , finland ] and biosorb fx system [ linvatec biomaterial ltd , tampere , finland ] ) were utilized . the control ( t ) group consisted of 16 patients who received 48 titanium plates ( osteo - fit [ gssem , seoul , korea ] and synthes [ synthes , paoli , pa , usa ] ) . the mean age in the r and t groups was 24.236.87 years and 28.2912.91 years , respectively . falls were the leading mechanism of injury ( 62.5% ) , followed by interpersonal assaults ( 37.5% ) and traffic accidents ( 0% ) . in the r group , interpersonal assault ( 53.8% ) was the leading mechanism of injury , followed by falls ( 38.5% ) and traffic accidents ( 7.7%).(table 2 ) nonunion or malunion were not observed in any fracture site on radiography and clinical assessment in either the r or t group during the follow - up period . clinical and radiographic evaluation indicated clinical union of all fractures at the 1 month and 3 months follow - up visits . all patients in both groups recovered immediate function such as eating a normal textured diet after the follow - up periods . there are 4 cases of wound dehiscence and 1 case of infection in the t group . in r group , there were 2 cases of wound dehiscence and 1 case of infection.(table 3 ) the incidence of postoperative complications was 31.2% in the t group and 23.0% in the r group , but this difference was not significant . all infections occurred within 1 month after surgery , and all affected patients were treated immediately upon presentation . all infected sites responded well to local antibiotic therapy and fully resolved by 1 week after presentation with symptoms and signs of infection . there was no significant association between the stability of fractured segments and the type of plate used ( p<0.05 ) . we observed the breakage of 2 screws during the perioperative period in the r group , while no screws broke in the t group.(table 3 ) this represents a 15.4% incidence of specific technical problems . all fractured screws were removed and the previously drilled osteotomy site was re - drilled through the remnant of the previous screw shank . the operation time was 113.12 minutes in the t group and 119.61 minutes in the r group.(table 4 ) the imf period was 2.38 days in the t group and 2.56 days in the r group.(table 4 ) more time was spent in the r groups , but there was no significant difference in the operation time and imf period between the groups . the treatment goal of mandible fractures allows the patient to have mandibular function and to achieve a normal diet earlier . rigid fixation of fracture segments in an anatomic bony union is necessary for optimal healing . rigid internal fixation with metallic materials is a standard technique in use for the last 30 years , and is performed to align bone segments during healing periods3 . the disadvantages of titanium plates include the possibility of hardware removal4 , and resorbable plates and screws were developed to avoid this5 . several studies have investigated resorbable plating systems for mandibular fractures . in oral and maxillofacial surgery , biodegradable materials were used in animal studies11 and later in humans for fixation of fractures and in orthognathic surgery12 . resorbable plating systems have allowed the development of a biocompatible , resorbable material suitable for the treatment of facial fractures7,8,9 . in 1997 , bessho et al.13 introduced a poly l - lactic acid ( plla ) miniplate fixation system for fixation of facial fractures and osteotomies . in a sheep model , kallela et al.14 showed that resorbable plates and screws are biocompatible and have high potential for fixation in oral and maxillofacial surgeries . wittwer et al.15 reported that resorbable materials and titanium fixation were not significantly different with respect to fracture healing and postoperative complications . however , other studies16,17 showed that resorbable plating systems do not provide the optimal rigidity to counteract the masticatory forces of the mandibular angle region , resulting in higher rates of delayed union compared to traditional titanium based systems . ellis18 reported that patients with double mandibular fractures have different fixation requirements than those with isolated fractures of the mandible . double fractures require that at least one of the fractures undergoes rigid fixation to decrease the incidence of complications . in this retrospective study , all cases had a reduction of the symphyseal area with rigid fixation . on the angle area , fixation was performed through the lateral border of the external oblique ridge by champy 's technique10 . our study focused on the rigidity and efficacy of the resorbable plating system with the combined mandibular angle and symphysis area . we did not observe any mobility problems or severe malocclusion requiring re - operation to remove hardware in either group . the imf period for stabilizing bone fragments was slightly longer in the r group ( p<0.853 ) . resorbable plating systems , despite having less strength than metallic plates , provide sufficient strength to support the occlusal force during the postoperative healing period . observed postoperative complications included inferior alveolar nerve hypoesthesia , wound dehiscence , infection , and perioperative screw breakage . the average rate of infection in cases of mandibular fractures treated with titanium plates ranges from 5% and 10%19 . we observed 4 cases of wound dehiscence and 1 case of infection in the t group . in the r group , there were 2 cases of wound dehiscence and 1 case of infection . the incidence of complications was 31.6% in patients with titanium metal plates and 23.1% in those with resorbable plates , but difference was not significant . in this study , all infections occurred within 1 month after surgery , and all affected patients underwent antibiotic therapy . incision and drainage were not needed in any patients . the fixation plates were not removed , and the infection resolved within 5 to 7 days after local antibiotic therapy . wound dehiscence and infections occurred mostly in the vestibule of the symphysis area . the resorbable plates were transparent , so it was difficult to distinguish between the plate and screw holes , especially at the mandibular angle area . care had to be taken while drilling or tapping in order to avoid grinding the screw holes . there were significantly more screw breakages of the head of the screw in the r group . this may have been due to under - tapping of the screw holes or use of excessive torque while tightening . this can be avoided by thorough tapping to the full length of the hole according to the length of the screw . more careful screw tightening can be achieved by using the thumb and index finger instead of using the palm . use of the thumb and fingers generates more controlled force and can help to reduce the frequency of screw breakage20 . when screw breakage occurs , the same holes can be re - drilled and reused with new screws , and plates do not need to be relocated . there was an increase in operation time for r group patients for two potential reasons . the plates had to be heated and then bent according to the mandible 's anatomy , and screw tapping before insertion is technically difficult , especially at the mandibular angle area , which requires extra time . on average , more time was spent in the r group , but there was no significant difference in operation time between the groups . more experience for the surgeons and more careful patient selection may reduce the incidence of screw breakage and decrease operation time . the resorbable plates which were used in this study were inion cps system and biosorb fx series . the inion cps system consisted of an amorphous injection - molded copolymer of l - lactide / d - lactide / trimethylene carbonate . the biosorb fx series are made of self - reinforced poly - l / dl lactic acid copolymer in a ratio of 70% l - lactide and 30% d - lactide ( sr - pldla ; biosorb fx system ) . further study is needed to compare the efficacy and effectiveness of the each resorbable plating system for the treatment of mandibular fractures . both resorbable plating systems provided satisfactory stability to enable bone healing during the initial phase . studies have been published that have evaluated the efficacy of these resorbable plating systems using on the isolated mandible fractures . this study focused on the rigidity and efficacy of the resorbable plating system for treatment of mandible fractures with combined symphysis and angle . the clinical outcome of the resorbable plating systems applied for treatment of combined mandibular symphysis and angle was comparable with outcomes from titanium plating systems . resorbable plates can be used as an alternative to titanium plates in combined mandibular angle and symphysis fractures . in our cases series we found that the use of resorbable plates is an effective method of internal fixation not only to establish bony healing of the fracture but also restoration of the original occlusion when stabilizing combined mandibular angle and symphysis fractures .

objectiveswe compared resorbable plates with titanium plates for treatment of combined mandibular angle and symphyseal fractures.materials and methodspatients with mandibular angle and symphysis fractures were divided into two groups . the control ( t ) group received titanium plates while the experimental ( r ) group received resorbable plates . all procedures were carried out under general anesthesia using standard surgical techniques . we compared the frequency of wound dehiscence , development of infection , malocclusion , malunion , screw breakage , and any other technical difficulties between the two groups.resultsthirteen patients were included in the r group , where 39 resorbable plates were applied . the t group consisted of 16 patients who received 48 titanium plates . the mean age in the r and t groups was 28.29 and 24.23 years , respectively . primary healing of the fractured mandible was obtained in all patients in both groups . postoperative complications were minor and transient . moreover , there were no significant differences in the rates of various complications between the two groups . breakage of 3 screws during the perioperative period was seen in the r group , while no screws or plates were broken in the t group.conclusionresorbable plates can be used to stabilize combined mandibular angle and symphysis fractures .

because the anatomy of the pelvis is complex , extensile exposure is a surgical challenge and there is a need to identify and preserve major neurovascular structures . reconstructive surgery about the pelvis is complex , so restoring anatomy for the hip and retaining function for the muscles is not simple and requires more time and ingenuity than procedures in other anatomic sites . involvement of the iliac and sacroiliac joint with tumours is not uncommon ; treatment is difficult due to the anatomy of the pelvis . resection of the tumour mass must be extensive in order to achieve safe margins , but this may lead to instability and poor results . several reconstruction options have been proposed , including massive allograft , allograft prosthesis composite , custom - made endoprosthesis combined with hip arthroplasty , saddle prosthesis or a modular hemipelvic prosthesis , with its advantages and limitations [ 14 ] . however , these different methods have been fraught with a high complication rate ; complications include loosening , dislocation , non union and infection , which can lead to failure of reconstruction and subsequent removal of the allograft or prosthesis . partial resection of the pelvis or sacroiliac joint is an uncommon procedure , typically performed in the setting of tumours , severe infections or trauma . the resultant defects , depending on the size and location , may cause significant postoperative morbidity or functional impairment . it is therefore essential that the surgeon be aware of all reconstructive options available and implement the most appropriate option . reported the mean survival for patients with high - grade malignant pelvic tumours to be approximately 50% ; the type of surgical treatment appeared to make little difference in patient outcome , so appropriate reconstruction methods must warrant the lowest complication rate and rapid rehabilitation . johnson advocated reconstruction of a pelvic defect with a prosthesis and cement , and satcher reported the reconstruction using steinmann pins with bone cement filling in areas of bone loss , in combination with total hip arthroplasty , with excellent functional outcome and lower complication rate . we modified these methods with the pedicle screw - rod system augmented with autologous bone graft , which is easy to use in surgery following a primary pelvic tumour resection ( fig . furthermore , this procedure could be used in defect reconstruction due to type iv sacroiliac joint tumour resection without preoperative customisation . the purpose of this study was to assess the functional outcome and complication rate following treatment with the uss pedicle screw - rod system to reconstruct the sacroiliac joint after resection of a sacroiliac joint tumour , and further to provide an effective and simple procedure of sacroiliac joint reconstruction . we retrospectively reviewed 16 patients who had hemipelvic prosthesis reconstruction using the pedicle screw - rod system after pelvic resection for primary sacroiliac joint tumours at the first affiliated hospital of xinjiang medical university between 2000 and 2012 . data from the current study were referred from hospital records , maintained oncological files and clinical examination at followup . these data included the type of surgical resection , the achieved surgical curative effect according to the of the msts system , any complications or need for reoperation , incidence of local recurrence and distant metastases , the current oncological status and the functional outcome . follow up ranged from 3 months to 80 years ( mean : 35 months ) . the diagnoses included chondrosarcoma in 4 patients ( 25% ) , osteosarcoma in three patients ( 18.8% ) , and giant cell tumour in three patients ( 18.8% ) . we found one case of each of the following diagnoses : angiosarcoma , plasmacytoma , synovial sarcoma , malignant fibrous histiocytoma , adenocarcinoma and transitional cell carcinoma ( surgical biopsy was preoperatively performed in all patients ) . fourteen tumours were classified as stage - iib lesions and two as stage - iiia lesions according to the system of the musculoskeletal tumour society . one ( 6.3% ) patient had adenocarcinoma that was derived from liver metastatic progression and one ( 6.3% ) patient had transitional cell carcinoma that was derived from kidney metastatic progression . this included one patient ( 6.3% ) who had postoperative radiotherapy and one patient ( 16.7% ) who had preoperative and postoperative radiotherapy , included primary focal : 4060 gy per four to six weeks and lymph node metastases 4050 gy . this included five patients ( 32.2% ) who had postoperative radiotherapy , and three patients ( 18.8% ) who had preoperative and postoperative radiotherapy . chemotherapy drugs included : adriamycin , cisplatin , methotrexate ( mtx ) , cyclophosphamide , doxorubicin , actinomycin d , vp-16 , cisplatin , dtic , alanine nitrogen mustard and etoposide . preoperative staging and assessment of tumour resectability were accomplished with computed tomography scans ( fig . the extraosseous component of the tumour was assessed for resectability and to address possible pelvic organ involvement . twelve ( 75% ) had type iv ( sacroiliac joint ) pelvic resections , one ( 6.25% ) had types i + ii + iv ( ilium and periacetabular and sacroiliac joint ) pelvic resections , two ( 12.5% ) patients had types iv + i ( sacroiliac joint and ilium ) pelvic resections and one ( 6.25% ) had types iii + iv ( pubis and sacroiliac joint ) pelvic resections . preoperative staging and assessment of tumor resectability computed tomography scan preoperative staging and assessment of tumor resectability magnetic resonance imaging functional outcome was determined using the msts system at three months after surgery or the latest followup . the msts system score measures patient activity , including pain , function , emotional acceptance , support , walking ability and gait . each of these six variables was assessed on a 5-point scale , giving a maximum score of 30 points , which we recorded as 100% [ 9 , 10 ] . the complications , including surgery - related complications and mechanical failures , were determined at the final followup . abductor function was assessed by noting the absence or presence of the trendelenburg sign on gait and stance , and by palpation during voluntary muscle contraction . fisher 's exact test was used to compare the surgical margins obtained and the incidence of local recurrence and metastases . patients were placed in floating position to allow forward and backward movement of the patient during the procedure . the dissection was carried over the iliac crest subperiosteally to the major sciatic notch and to the sacroiliac joint posteriorly . the iliac wing was exposed medially to the major sciatic notch and the tumour was exposed . two or three polyaxial pedicle screws with 6.57 mm diameter were inserted transversely into the sacrum and lumbar 5 . two or three polyaxial pedicle screws , also 6.5 mm in diameter , were inserted into the remaining pubic and ischial bone , respectively , after making a pathway with a pedicle finder and checking it with a probe to make sure there was no breech or fracture . sacral and pelvic screws were connected by two rods . in the next step , a strut bone graft was harvested from the ipsilateral fibula or the remaining ilium and was placed between the rods so that it would bridge the shortest distance between the sacrum and acetabular dome ( fig . a split mesh was placed around the implants and was filled with 60 ml of bone chip allograft in order to build up an artificial ilium - like bony mass . four suction drains were placed into the surgical area . the procedure ended with closure of the wound . a strut bone graft placed between the rods so that it would bridge the shortest distance between the sacrum and acetabular dome twelve of sixteen patients started to mobilise with crutches and partial weight - bearing for 48 weeks followed by full weight - bearing ( not including four patients who died ) . patients were placed in floating position to allow forward and backward movement of the patient during the procedure . the dissection was carried over the iliac crest subperiosteally to the major sciatic notch and to the sacroiliac joint posteriorly . the iliac wing was exposed medially to the major sciatic notch and the tumour was exposed . two or three polyaxial pedicle screws with 6.57 mm diameter were inserted transversely into the sacrum and lumbar 5 . two or three polyaxial pedicle screws , also 6.5 mm in diameter , were inserted into the remaining pubic and ischial bone , respectively , after making a pathway with a pedicle finder and checking it with a probe to make sure there was no breech or fracture . sacral and pelvic screws were connected by two rods . in the next step , a strut bone graft was harvested from the ipsilateral fibula or the remaining ilium and was placed between the rods so that it would bridge the shortest distance between the sacrum and acetabular dome ( fig . a split mesh was placed around the implants and was filled with 60 ml of bone chip allograft in order to build up an artificial ilium - like bony mass . four suction drains were placed into the surgical area . the procedure ended with closure of the wound . a strut bone graft placed between the rods so that it would bridge the shortest distance between the sacrum and acetabular dome twelve of sixteen patients started to mobilise with crutches and partial weight - bearing for 48 weeks followed by full weight - bearing ( not including four patients who died ) . the mean operative blood loss was 1337.5 ml ( range : 7002300 ml ) and the mean operative time was 182.5 minutes ( range : 100290 minutes ) . resection margins were wide in eleven patients ( 68.7% ) , marginal in four patients ( 25% ) and intralesional in one patient ( 6.3% ) . the average survival from the time of diagnosis was 35 months ( range : 380 months ) . at latest followup , six patients ( 37.5% ) had no evidence of disease , four patients ( 25% ) died of their primary tumours and six patients ( 37.5% ) were continuously disease - free . local recurrence occurred in four patients ( 25% ) : two patients with a surgical procedure of marginal margin ( 50% ) , and two patients with a surgical procedure of wide margin ( 18.1% ) . there was no significant difference between the incidence of local recurrence and the achieved surgical margin ( p > 0.05 ) . in four patients with local recurrence , one had additional resection , one died of his primary tumour and two were observed without treatment . two patients with osteosarcoma had metastases after local recurrence and died of disease 19 and 45 months after surgery , respectively . one patient with malignant fibrous histiocytoma had lung metastases and subsequent local relapse and died of disease 30 months after surgery . one of 16 patients ( 6.25% ) showed metastatic progression deriving from the liver ( alive with disease 3 months after surgery ) , and one of 16 patients ( 6.25% ) showed metastatic progression deriving from the kidney ( died of disease 30 months after surgery ) . there was no significant difference between the incidence of metastasis and the achieved surgical margin ( p > 0.05 ) . in addition , it was not possible to demonstrate a correlation between metastasis and the zones of tumour involvement . the average msts score was 26.5 at three months after surgery or the latest followup . the average rating of emotional acceptance was 3.9 out of 5 points ( 78% ) , the average score for support was 4.9 out of 5 points ( 98% ) , the average score for walking was 4.7 out of 5 points ( 94% ) , the average score for gait was 4.4 out of 5 points ( 88% ) , and the average score for function was 4.7 out of 5 points ( 94% ) . eleven ( 68.8% ) patients had no complications perioperatively or during the followup period . of the remaining five patients , four patients were treated non - operatively : one patient with sciatic nerve palsy who recovered completely after six months postoperatively ; two patients with infection and one with skin necrosis , who recovered completely after being treated with antibiotics , regular dressing and physiotherapy ( range : two to four weeks ) . one patient with complications had additional surgery : wound dehiscence treated with debridement and resection of a portion of the anterior iliac crest to decrease the skin tension , and healed uneventfully . there was no screw loosening or deep vein thrombosis occurring in this series ( tables 1 and 2 ) . the extended regional venous drainage pattern , especially in the sacroiliac and presacral regions , may play an additional role in the poor prognosis of pelvic malignancies , facilitating development of distant metastases . the second area of concern is the ilium or sacrum as the site of the proximal margin of resection . although magnetic resonance imaging ( mri ) provides an excellent approximation of the proximal extent of the disease , it is difficult to translate this information into a complex three - dimensional operative anatomy of the pelvis . to achieve wide resection margins in the bone , the use of a three - dimensional model of the pelvis has proven to be a useful tool . regarding tumour extent in mri the sites of osteotomy were marked on the model , which allowed better orientation during surgery , providing healthy wide margins in patients . however , the 3d model was more suitable for tumour resection and reconstruction in the bone . for this reason , in our study all of the patients underwent mri and ct ( computed tomography ) three - dimensional reconstruction . complication rates are reportedly as high as 60% , with 40% of patients needing one or more repeat surgeries . complications may occur during the tumour excision , or they can be induced by an ill - designed prosthesis and poor reconstructive technique . an appropriately designed prosthesis can help reduce surgical risk and the duration of surgery and produce quite good functional recovery . for large tumours , it is difficult to have tumour - free margins , even with a hindquarter amputation , which could produce a relatively high recurrence rate . in this study , all of the patients used the uss pedicle screw - rod system to reconstruct the sacroiliac joint after resection of a tumour . because the pedicle screw - rod system has a simple design , an uncomplicated procedure and can obviously shorten the operation time , we use it to reconstruct sacroiliac joints and to reduce the incidence of complications . most of these complications consist of local infections or wound - healing problems , such as skin necrosis or sinus haematoma [ 14 , 15 ] . in our study , wound - healing difficulties arose in one patient , one had skin margin necrosis of the incision and two had necrosis of the subcutaneous tissue ( i.e. the two patients with infections ) . such large transfusions increase the risk of wound - healing problems , and they may account for the rapid local recurrence and metastasis . infection remains a frequent complication of reconstruction with hemipelvic allografts or autoclaved grafts and prosthesis after internal hemipelvectomy , with reported rates varying from 12% to 47% [ 1 , 7 , 17 , 18 ] . these infections may be attributed to the immunosuppression caused by preoperative chemotherapy , as reported by some authors . the following factors contribute to the high risk of infection : the prolonged surgical time necessary to resect pelvic tumours , the proximity of the rectum and genitourinary tract , the large dead space after pelvic bone resection and the large amount of foreign material implanted in the surgical wound [ 1921 ] . it is reported that the use of vancomycin in the cement spacer gives better local control in infected reconstructions after resection for bone tumours . buchholz and gartmann reported local levels of antibiotic 200-times higher than those achieved by systemic administration . some authors suspected that local high concentrations of antibiotic released from antibiotic - impregnated cement is the most important factor in the prevention of occurrence of infection [ 23 , 24 ] . in our study , it is important in ilium resection to transfer the shear stress to compressional stress between the pedicle screw - rod system and the sacrum ; otherwise , shear stress could induce loosening and displacement . it has been shown that the ischium plays a role in the loading transfer both in standing and in sitting , so the prosthesis should be fixed on the remaining branch of the ischium ; an additional ischial tubercle should be considered while the ischium is resected . one patient in our study had pubic symphysis subluxation seven months after surgery ( fig . we also considered the following reasons : walking too early ; excessive weight ; the uss pedicle screw - rod system radian not being firmly secured enough ; or the sacroiliac joint , hip and pubic symphysis forming a lever , leading to pubic symphysis dislocation upon application of weight . it is advantageous to use the uss pedicle screw - rod system for reconstruction after type i+iv pelvic resection because it saves mobile lumbar segments . the uss pedicle screw - rod construction augmented with autologous bone graft has the advantage of allowing flexibility of reconstruction of sacroiliac joint tumours . this is a simple reconstructive procedure without tedious preoperative customisation , lower infection rates and decreased concentration of stress by multi - point fixation of screws . the current study shows that reconstruction with the pedicle screw - rod after resection of sacroiliac joint tumours is a safe method that has the advantages of rapid rehabilitation and short hospital stays , lower complication rates and favourable functional results with most patients achieving independent ambulation and excellent cosmetics . the characteristics of using the pedicle screw - rod system augmented with autologous bone graft to reconstruct sacroiliac joints after resection of sacroiliac joint tumours are as follows : ( 1 ) the pedicle screw - rod system can allow appropriate pressure on autologous bone , which can promote planting bone healing and pelvic ring stability , and belongs to the biological reconstruction . however , there are some problems , especially allograft nonunion , allograft not healing and rejection and infection risk . ( 2 ) the surgical indications of using the pedicle screw - rod system augmented with autologous bone graft to reconstruct a sacroiliac joint after resection of a sacroiliac joint tumour : i or i+iv areas of pelvic primary tumour ; isolated metastasis tumour ; reserving the top of the acetabulum of the pubis and sciatic after tumour excision ; especially the survival period of patients , which is expected to be more than half a year . but this method is technology contraindicated to the isolated areas ii or iii of pelvic primary tumours because often it can not guarantee the stability of the pedicle screw - rod system or complete cutting edge after resection of the tumour . in conclusion , use of a pedicle screw - rod after resection of a sacroiliac joint tumour is an acceptable method of pelvic reconstruction because of its lower rate of complications and satisfactory functional outcome , as well as its feasibility of reconstruction for type iv pelvis tumour resection without elaborate preoperative customisation . it is a practical operation for reconstruction of the sacroiliac joint by the pedicle screw - rod system after resection of a sacroiliac joint tumour .

hemipelvic resections for primary bone tumours require reconstruction to restore weight bearing along anatomic axes . however , reconstruction of the pelvic arch remains a major surgical challenge because of the high rate of associated complications . we used the pedicle screw - rod system to reconstruct the pelvis , and the purpose of this investigation was to assess the oncology , functional outcome and complication rate following this procedure . the purpose of this study was to investigate the operative indications and technique of the pedicle screw - rod system in reconstruction of the stability of the sacroiliac joint after resection of sacroiliac joint tumours . the average msts ( musculoskeletal tumour society ) score was 26.5 at either three months after surgery or at the latest follow - up . seven patients had surgery - related complications , including wound dehiscence in one , infection in two , local necrosis in four ( including infection in two ) , sciatic nerve palsy in one and pubic symphysis subluxation in one . there was no screw loosening or deep vein thrombosis occurring in this series . using a pedicle screw - rod after resection of a sacroiliac joint tumour is an acceptable method of pelvic reconstruction because of its reduced risk of complications and satisfactory functional outcome , as well as its feasibility of reconstruction for type iv pelvis tumour resection without elaborate preoperative customisation.level of evidence : level iv , therapeutic study .

postoperative adhesions by occurring in approximately 90% of patients undergoing abdominal surgery determine postoperative morbidity and mortality [ 1 , 2 ] . they are connective bridges between adjacent portions of the peritoneum and develop following an extensive inflammatory process within the tissue that involves mediators of inflammation or not . adhesions recognize their genesis in mesothelial cells , stimulated by the trauma surgery , which promote the conversion of fibrinogen into fibrin , releasing thromboplastin . fibroblasts lay collagen fibrils whereas there is fibrin , and so becoming adhesions . due to the putative molecular mechanisms underlying the postsurgical peritoneal adhesions , various strategies these passed from the use of laparoscopic surgery , pharmacological prevention with drugs acting on fibrinolysis , interferons , and medical anaesthetic gases [ 410 ] . in addition an important component of the adhesion formation is the inflammatory response occurring within the peritoneum [ 4 , 11 , 12 ] . however , a nonspecific approach using an oxygen / ozone gas mixture might lead to clinical benefit in patients with postsurgical peritoneal adhesions . such an approach seeks to attenuate the inflammatory response in the unfolding process of adhesions . in this context , our study evaluated whether the application of a medical gaseous mixture of oxygen / ozone during the surgery can be suggestive of a reduction of the inflammatory events that in cascade lead the postsurgical peritoneal adhesions formation . all experimental procedures and protocols used in this study were approved by the animal care ethical committee of the 2nd university of naples . male sprague - dawley rats ( n = 15 ) were marked with a pencil as 1 to 15 , anesthetized with urethane ( 1.2 g / kg ip ) , subjected to midline laparotomy . a sample of parietal peritoneal tissue was taken , and an enterotomy was performed at the level of the ileum . the surgical incision was sutured with absorbable surgical wire 4/0 in order to induce an inflammatory peritoneal insult . all of the surgical procedure was then ended by a nonabsorbable suture , and the rats were placed in the recovering room for awakening . ten days after the surgery ( time t1 ) the rats were subjected to another laparotomy having particular attention to keep always the same rat numbering , had a new tissue sample taken , and were assayed for the development of peritoneal adhesions by means of qualitative and quantitative evaluation . a score from 1 to 6 was established , and it was given as follows : 1 to the presence of poor and lapse adhesions in a limited peritoneal zone , 2 to the presence of poor adhesions in an extended zone , 3 to the presence of several lapse adhesions into the peritoneum , 4 to the presence of localized dense adhesions , 5 to the presence of extended dense adhesions with access to peritoneal cavity , and 6 to the presence of extended dense adhesions and impossible access to peritoneal cavity . biopsies of peritoneal tissue were snap frozen and used to determine levels and activity of the ups system . the study was conducted on male sprague - dawley rats ( 46 months old and weighing 250 g ) divided into the following experimental groups : group a ( n = 15 ) induced with the surgical procedure + oxygen ( 100% o2 , 3 ml / rat , injected in the abdominal cavity ) and group b ( n = 15 ) induced with surgical procedure + oxygen / ozone mixture ( 95%o2/5%o3 , 3 ml / rat equivalent to 300 g / kg ozone injected in the abdominal cavity ) . both of the groups were first treated with half volume 1 hour before surgery ; a second injection with the other half volume was given 1 hour after the surgical procedure ( total volume and doses as specified ) . the frozen tissue samples were homogenized in 50 mm tris - hcl ( ph 7.2 ) containing leptin 1 m , pepstatin a 1 m , and phenyl methyl sulfonyl fluoride 200 m and centrifuged for 10 min at 10,000 g at 4c . 200 l of homogenate was used to determine total protein according to the bradford 's method . the levels of ubiquitin were quantified by commercial elisa kit ( wuhan eiaab science co. , wuhan , china ) for the quantitative measurement of the 20s proteasome , a specific sds activation kit ( boston biochem , usa ) was used following the instructions of the manufacturer . continuous variables were compared among the groups of rats with one - way analysis of variance ( anova ) for normally distributed data and the kruskal - wallis test for nonnormally distributed data . when differences were found among the groups , starting from day 10 after surgery , the rats treated with the 3 ml / rat 100% oxygen showed a high score for the development of peritoneal adhesions ( data not shown ) . after 10 days from surgery , 7 of the 15 rats treated with oxygen 3 ml had the highest score assigned for the presence of peritoneal adhesions . they showed presence of dense adhesion and impossible access to peritoneal cavity with a score of 6 assigned to them ( table 1 ) . three rats were assigned to a score of 5 with a presence of adhesion disseminated within the peritoneum but still keeping the peritoneal access ( table 1 ) . the other rats showed overall lapse adhesions in limited peritoneal zones and gained a score from 1 to 4 ( table 1 ) . in parallel with the development of peritoneal adhesions , there was an increase in the levels of ubiquitin and the 20s proteasome within the adhered tissue . for both of the markers , this increase was significant ( p < 0.01 versus time t0 ) 10 days after surgery ( time t1 ) ( figures 1(a ) and 1(b ) ) . treatment of rats with 300 g / kg oxygen / ozone mixture prior to the induction of the surgical peritoneal insult resulted in reduced score for formation of postsurgical peritoneal adhesions and reduced levels of ubiquitin and 20s proteasome within the adhered tissue . the evaluation of the peritoneal adhesions score , as shown in the table 1 , indicates a substantial decrease of adhesions in the group of rats treated with 300 g / kg oxygen / ozone mixture . this was accompanied by a significant reduction of the levels of both ubiquitin and proteasome 20s ( p < 0.01 versus time t0 ) in the peritoneal tissue 10 days after surgery ( figures 1(a ) and 1(b ) ) . until few years ago to prevent the formation of adhesions , the focus was mainly posed on the procedures to be implemented during the surgery . it is worth mentioning in this regard , as there is considerable consensus on the laparoscopic surgery as a procedure associated with less development of adhesions compared to open surgery in the international arena [ 4 , 5 ] . however , in recent years , numerous studies have been aimed at a likely pharmacological prevention of postsurgical adhesion formation as , for example , some authors proposed the use of statins as they are considered able to increase the peritoneal fibrinolysis . other authors have suggested that interferon - gamma is a possible therapeutic target to prevent the formation of adhesions , due to its crucial role in the differential regulation of pai-1 and t - pa , which are involved in this process . however , other ones suggest the use of antitack agents such as carboxymethylcellulose and hyaluronic acid resorbable membranes . finally , it is also alleged the possible use of propofol . here , we show that a mixture of oxygen / ozone applied to rats prior to the induction of peritoneal injury exerts a protective action against the formation of postsurgical peritoneal adhesions . experimental and clinical evidences have proved advantageous effects of oxygen / ozone therapy in several pathologies characterized by a cellular oxidative and inflammatory burden , including renal injury , cardiopathy , atherosclerosis and septic shock [ 1419 ] . recent data imply that ozone is located in atherosclerotic arteries , and it has been proposed that it may be important in additional human inflammatory diseases . not last , oxygen / ozone administration has been shown beneficial in the prevention / reduction of the myocardial tissue damage which follows an ischemic event . it protects the heart from acute myocardial infarction through a series of local events that include , among the others , increase of enos activity and endothelial progenitor cells recruitment . therapeutic efficacy against wound healing and limb salvage in patients with critical limb ischemia are also due to oxygen / ozone . in a previous research , di filippo et al . found that postsurgical peritoneal adhesions occur in rats strictly related to the time from the surgery and have severity depending on the inflammatory response occurring within the peritoneal specimens , which deteriors the peritoneal matrix . during this phase , leukocytes , cytokines , chemokines , and cell adhesion molecules alters the initial tissutal equilibrium predisposing it to the formation of adhesions . in the present study , we show an involvement of the ubiquitin - proteasome system ( ups ) in the tissutal alterations that follows a surgical intervention and development of peritoneal adhesions . this latter relates to the severity of the adhesion ; animals that show high levels of ups activity also have severe adhesions , whilst animals that show low levels of ups have moderate adhesions . ups , generally known as the major pathway for nonlysosomal intracellular protein degradation in eukaryotic cells , was discovered in the eighties by the pioneering work of goldberg , hershko , and their collaborators , using reticulocyte lysates [ 2426 ] . first , the substrate is covalently modified by addition of a polyubiquitin chain , through an enzymatic cascade that involves three classes of factors : e1 , the ubiquitin- ( ub- ) activating enzyme , e2 , a member of the family of ub carriers , and e3 , a member of the very large family ( several hundred members ) of the so - called ub ligases , which specifically recognizes and recruits the substrate of the ubiquitylation reaction . second , the ubiquitylated protein is usually addressed to and degraded by the 26s proteasome , a giant multisubunit and multicatalytic protease . due to its multiple roles , the proteasome is essential in eukaryotes , and its dysfunction has deleterious effects for the cell or the organism as a whole . in humans , ups deregulation has been implicated in a number of pathologies such as cancer , autoimmune diseases , neurodegenerative diseases , or viral infections . as a consequence , the proteasome is seen as a potential therapeutic target in many pathologies , including inflammation and now tissue degeneration . the present study demonstrates that the activity of the ups system , measured on adhesions biopsies , is modulated by the treatment with the oxygen / ozone mixture . following oxygen / ozone treatment , the expression and the activity of this system is diminished . an intriguing and somewhat imaginative scenario would suggest that oxygen / ozone may be able to inhibit the ups activity in adhered tissue , possibly leading to reduced local inflammatory boost and adhesions formation . in conclusion , the absolute novelty of this study is that an oxygen / ozone mixture reduces the peritoneal adhesions associated with a reduction of the ubiquitin - proteasome system activity within the adhered tissue .

we have investigated whether an oxygen / ozone ( 95%o2/5%o3 ) mixture would have potential against the formation of experimental postsurgical peritoneal adhesions . in two groups of rats , one control intraperitoneally injected with 3 ml / rat of o2 and one intraperitoneally injected with oxygen / ozone mixture ( 3 ml / rat equivalent to 300 g / kg ozone ) , we induced a midline laparotomy and an enterotomy at the level of the ileum to encourage the formation of peritoneal adhesions . samples were taken from the parietal peritoneal tissue to assess the formation of adhesions 0 and 10 days after the surgical procedure and to assess the levels of ubiquitin and 20s proteasome . we found decreased formation of postsurgical peritoneal adhesions after treatment of the rats with 300 g / kg ozone associated with a decreased levels of ubiquitin and 20s proteasome subunit within the adhered tissue . oxygen / ozone mixture is potentially useful for approaching the post - surgical peritoneal adhesions , and the ups system is involved in this .

propylthiouracil ( ptu ) , a thiourea derivative , is widely used for the treatment of graves disease . the adverse effects of ptu include rash , arthralgia , fever , and transient leukocytopenia . although elevated transaminases are usually transient by discontinuing medication , severe liver dysfunction is reported in some cases . autoimmune hepatitis ( aih ) is generally a progressive chronic hepatitis with increased immunoglobulins and auto antibodies , which primarily responds to immunosuppression . some cases with graves disease concomitant with aih have been reported in the literature . and she was admitted to a nearby hospital three years ago , and diagnosed with graves disease . she started methimazole ( mmi ) at first , which was discontinued in one month due to elevation of serum transaminase . a drug - stimulated lymphocyte test ( dlst ) showed positive for mmi , and drug - induced hepatitis by mmi was suspected . mmi was discontinued , and she was further treated by ptu . during the following month , liver function test results returned to normal , and ptu administration was continued . as her thyroid function was within the normal range , ptu administration was discontinued , and her transaminases returned to the normal range at that time , suggesting liver injury was induced by ptu . as her transaminases increased further even after discontinuing ptu administration , drug - induced liver injury was not suspected ( fig . 40 mg / day oral prednisolone was started after liver biopsy , and her liver function test results decreased immediately ( fig . the histologic features of liver biopsy were compatible with aih , and the diagnosis of aih was confirmed by the criteria of the international autoimmune hepatitis scoring system . while some cases of aih are associated with autoimmune diseases , such as rheumatoid arthritis and sjogren s syndrome , aih associated with graves disease is rare . on the other hand , certain drugs , including methyldopa , interferon , minocycline , and atorvastatin are known to induce hepatocellular injury that mimics aih . while the pathogenesis of ptu - induced liver injury is not known , immunologic mechanisms have been suspected to be responsible . at this point , the pathogenesis of ptu - induced liver damage and aih are thought to be similar , and it is difficult to make a differential diagnosis between the two . however , rechallenge of ptu worsened liver function again , and was not reversed by discontinuing ptu a second time . thus , drug - induced liver injury was not suspected . given a compatible histologic picture , the diagnosis of aih is based on characteristic clinical and biochemical findings , circulating autoantibodies , and abnormal levels of serum globulins . in our patient , elevation of serum igg concentration and high titer of anti - nuclear antibody are characteristic laboratory features of aih . such features are not explained by drug - induced liver injury , and the histological findings of high activity hepatitis ( a3 ) obtained by liver biopsy 2 months after quitting medication , were not similar to drug - induced liver injury . as shown in figure 2 , although these are different from diagnostic criteria and the findings may suggest that allergic response might play an important role of pathogenesis as usual , manns et al . demonstrated that plasma cells and eosinophils may be present in the histological sample of an aih patient . our patient was then diagnosed with aih , suggesting the possibility that ptu - induced liver injury triggered aih . b ) explant reveals bridging necroses and inflammatory infiltration , including lymphocytes , plasma cells and some eosinophils . when treating patients with ptu , occasional monitoring of liver function is needed , and if liver injury is suspected , it is important to promptly discontinue ptu therapy .

abstracta 58-year - old woman was referred to our hospital because of liver dysfunction . her serum levels of ast ( 619 iu / l ) and alt ( 603 iu / l ) had increased . histological findings in the liver biopsy were compatible to autoimmune hepatitis ( aih ) , and the diagnosis of aih was confirmed by the diagnostic criteria . she was admitted to a nearby hospital 3 years ago , and diagnosed with graves disease . she received methimazole ( mmi ) at first , which was discontinued due to liver injury in one month , then propylthiouracil ( ptu ) was administered . one year later , transaminase increased and was decreased by stopping ptu administration . ptu was restarted after her transaminase decreased , but a recurrence of hepatotoxicity was observed , and she was referred to our hospital . oral prednisolone decreased liver function immediately . in this case , ptu - induced liver injury was suspected as a possible trigger of aih . while ptu remains a commonly used drug in the treatment of hyperthyroidism , severe liver injury is reported in some cases . if liver injury is observed in patients treated with ptu , rechallenge is not recommended in order to avoid severe hepatotoxicity .

primary meningiomas arising outside the intracranial compartment account for 1% to 2% of all meningiomas . reportedly , these meningiomas occur in the calvaria , scalp , orbit , paranasal sinuses , oropharynx , nasopharynx , neck , and skin10 ) . the subset of extradural meningiomas that arise in bone are called primary intraosseous meningiomas15 ) . the vast majority of intraosseous meningiomas arise in cranial bones , although there are a few reported cases in which the tumor originated in the mandible12 ) . these have a wider range of presenting symptoms and appear more prone to develop malignant features than do intracranial meningiomas as reported 2% incidence of intracranial meningiomas with malignant features , compared to 11% of extradural meningiomas11,16 ) . our two cases of primary intraosseous meningioma represent 0.3% of the 504 meningioma cases diagnosed at our department from 2004 to 2009 . we report here two cases of primary osteolytic intraosseous meningioma with atypical / malignant pathology , which metastasized to whole skull and the spine . a 68-year - old man presented with a 1-year history of a soft , enlarging mass in the right parietal region . on admission , his neurological examination was within normal ranges . skull x - rays and a computed tomogram ( ct ) of the head showed a bony , destructive lesion abutting the scalp and dura in the right parietal bone ( fig . 1a ) . magnetic resonance imaging ( mri ) revealed a heterogeneously - enhancing , bony expansile mass in the right parietal bone , extending into intracranial epidural space ( fig . the scalp and subcutaneous tissues were normal and the outer table of the skull was destroyed by the well - encapsulated , soft mass . the tumor appeared to arise extradurally . peeling off the outer layer of the dura and inspecting the dura 's inner surface the permanent section of the specimen showed cellular whorl formation , frequent mitosis ( 5 mitoses per 10 high - power fields ) , and necrosis . the biopsy confirmed the tumor as an atypical ( who grade ii ) meningioma ( fig . 2 ) . the adjuvant treatment was not done because the mass was totally removed . follow - up brain mri revealed multiple variable sized nodules and masses in whole skull , causing epidural and subgaleal extraosseous mass formations ( fig . biopsy was confirmed as the same pathology and the patient did not want further treatment for these lesions . a 74-year - old woman presented with a 5-month history of a soft mass on the left frontal area . skull x - rays and head ct showed a bony , destructive lesion extending to the scalp and displacing the dura at the left frontal bone ( fig . 4a ) . mri revealed a 4-centimeter , multilobulated , strongly - enhancing mass on the left frontal bone . the mass was located intra- and extra - cranially , with thickening of the adjacent scalp and meninges ( fig . biopsy showed a papillary ( who grade iii ) meningioma with papillary pagrowth pattern and the immunohistochemistry for epithelial membrane antigen was positive ( fig . subsequently , at 19- and again at 45-months later , the patient underwent reoperations for recurrent lesions on scalp and skull . follow - up brain mri showed a 1 cm , homogenously - enhancing , recurred lesion on her skull , adjacent to the previous lesion ( fig . five years later after the first surgery , the patient experienced back pain that slowly progressed for 4 months . spine mri showed an osteolytic lesion on the body and posterior element of the 11th thoracic vertebra ( fig . the patient received corpectomy and posterior fusion , with a diagnosis of metastatic papillary meningioma . a 68-year - old man presented with a 1-year history of a soft , enlarging mass in the right parietal region . on admission , his neurological examination was within normal ranges . skull x - rays and a computed tomogram ( ct ) of the head showed a bony , destructive lesion abutting the scalp and dura in the right parietal bone ( fig . 1a ) . magnetic resonance imaging ( mri ) revealed a heterogeneously - enhancing , bony expansile mass in the right parietal bone , extending into intracranial epidural space ( fig . the scalp and subcutaneous tissues were normal and the outer table of the skull was destroyed by the well - encapsulated , soft mass . the tumor appeared to arise extradurally . peeling off the outer layer of the dura and inspecting the dura 's inner surface the permanent section of the specimen showed cellular whorl formation , frequent mitosis ( 5 mitoses per 10 high - power fields ) , and necrosis . the biopsy confirmed the tumor as an atypical ( who grade ii ) meningioma ( fig . 2 ) . the adjuvant treatment was not done because the mass was totally removed . follow - up brain mri revealed multiple variable sized nodules and masses in whole skull , causing epidural and subgaleal extraosseous mass formations ( fig . biopsy was confirmed as the same pathology and the patient did not want further treatment for these lesions . a 74-year - old woman presented with a 5-month history of a soft mass on the left frontal area . skull x - rays and head ct showed a bony , destructive lesion extending to the scalp and displacing the dura at the left frontal bone ( fig . 4a ) . mri revealed a 4-centimeter , multilobulated , strongly - enhancing mass on the left frontal bone . the mass was located intra- and extra - cranially , with thickening of the adjacent scalp and meninges ( fig . biopsy showed a papillary ( who grade iii ) meningioma with papillary pagrowth pattern and the immunohistochemistry for epithelial membrane antigen was positive ( fig . subsequently , at 19- and again at 45-months later , the patient underwent reoperations for recurrent lesions on scalp and skull . follow - up brain mri showed a 1 cm , homogenously - enhancing , recurred lesion on her skull , adjacent to the previous lesion ( fig . five years later after the first surgery , the patient experienced back pain that slowly progressed for 4 months . spine mri showed an osteolytic lesion on the body and posterior element of the 11th thoracic vertebra ( fig . the patient received corpectomy and posterior fusion , with a diagnosis of metastatic papillary meningioma . by definition , in a primary extradural meningioma , the tumor 's growth either proceeds from outside the dura to inside or demonstrates exclusive involvement of the dura 's outer layer with an extracranial main mass10 ) . these tumors are classified according to calvarial involvement and location in relation to the base of the skull . the most common skull base sites are in the middle ear / temporal bone region ( 18% ) , the paranasal sinuses ( 15% ) , the sphenoid bone ( 9% ) , and the infratemporal fossa ( 4% ) . lang et al.10 ) proposed a classification system for primary extradural meningioma , as follows : tumors that are purely extra - calvarial are type i , purely calvarial tumors are type ii , and calvarial tumors with extracranial extensions are type iii . crawford et al.3 ) , in a review of the literature , found that radiographic evidence of hyperostosis appeared in 59% of these meningiomas , whereas 32% showed osteolytic changes in the surrounding bone , and 6% revealed mixed features of both osteolysis and hyperostosis . the bone expansion and hyperdense skull lesions of this type of intraosseous meningioma may appear radiologically similar to en plaque meningioma , osteoma , osteosarcoma , paget 's disease , and fibrous dysplasia4,9 ) . differential diagnosis of an osteolytic skull lesion includes chondroma , epidermoid cyst , osteogenic sarcoma , myeloma , and metastatic cancer6,13 ) . diagnosing intraosseous meningioma preoperatively seems difficult to clinicians even if the patient 's symptoms include a gradually expanding mass . although meningioma is rare , differential diagnosis of any intraosseous osteolytic lesion should be included . although , in general , intraosseous meningiomas are reportedly slow - growing , histologically benign lesions , there have been frequent reports of atypical and malignant histological subtypes10 ) . recent studies indicate that intraosseous meningiomas have a higher incidence of malignant features than intradural meningiomas have7,14,17 ) . one report reviewed 65 published cases of intraosseous meningioma , assessed during the ct era , and found that 17 ( 26% ) had atypical or malignant histological features10 ) . osteolytic lesions , although a more rare form of intraosseous meningioma , have a greater likelihood of atypical or malignant features compared to osteoblastic tumors . our two cases had osteolytic lesions that showed atypical / malignant pathologies . wide surgical excision of an intraosseous meningioma is the treatment of choice and is potentially curative , if the surgery is even possible , because 26% of these tumors show evidence of atypical or malignant changes3,8 ) . clinicians may consider patients with such lesions as stronger candidates for adjuvant therapy , depending on the clinical circumstances . some authors recommend adjuvant radiation therapy for patients with lesions that are not completely resectable , if the residual lesion is symptomatic or shows radiographic evidence of progression3,10,14 ) . of the cases of benign meningiomas found in the literature , 22% experienced recurrence , and basally - located , primary extradural meningiomas showed a higher rate of recurrence than primary extradural meningiomas located along the convexity10 ) . this study reviewed atypical and malignant tumor death rates ( 29% ) as compared to benign tumors ( 4.8% ) . out of total 9 patients , 3 harbored atypical or malignant tumors , 2 of which recurred ( 67% ) and metastasized to a distant site ; despite aggressive therapy , both patients died . our one case with papillary meningioma showed frequent recurrences and distant metastasis to the spine , and the other showed the metastasis to the whole skull . two cases of osteolytic intraosseous meningiomas had atypical / malignant pathologies , which metastasized to whole skull and the spine .

we report here two cases of primary intraosseous meningioma with aggressive behavior . a 68-year - old man presented with a one year history of a soft , enlarging mass in the right parietal region . magnetic resonance image ( mri ) revealed a 6 cm sized , heterogeneously - enhancing , bony expansile mass in the right parietal bone , and computed tomograph ( ct ) showed a bony , destructive lesion . the tumor , including the surrounding normal bone , was totally resected . dural invasion was not apparent . diagnosis was atypical meningioma , which extensively metastasized within the skull one year later . a 74-year - old woman presented with a 5-month history of a soft mass on the left frontal area . mri revealed a 4 cm sized , multilobulated , strongly - enhancing lesion on the left frontal bone , and ct showed a destructive lesion . the mass was adhered tightly to the scalp and dura mater . the lesion was totally removed . biopsy showed a papillary meningioma . the patient refused adjuvant radiation therapy and later underwent two reoperations for recurred lesions , at 19 and at 45 months postoperative . the patient experienced back pain 5 years later , and mri showed an osteolytic lesion on the 11th thoracic vertebra . after her operation , a metastatic papillary meningioma was diagnosed . these osteolytic intraosseous meningiomas had atypical / malignant pathologies , which metastasized to whole skull and the spine .

a lipid - rich diet has been associated with obesity and a reduced lifespan from drosophila to humans ( birse et al . , 2010 ; driver and cosopodiotis , 1979 ; reilly and kelly , 2011 ; szendroedi and roden , 2009 ; van herpen and schrauwen - hinderling , 2008 ; wagener et al . , 2013 ) . this represents a worldwide concern as societal changes have led to an increase in dietary lipid intake . lipid - rich diets and obesity are associated with worldwide epidemics of cardiovascular diseases , type 2 diabetes , cancer , and inflammatory diseases in humans ( alikhani et al . , 2013 ; biswas and mantovani , 2012 ; kroenke et al . diseases associated with lipid - rich diets share common general features that include activation of the innate immune system , and in particular of macrophages , and the disruption of homeostasis ( biswas and mantovani , 2012 ; jin and flavell , 2013 ; moore and tabas , 2011 ; szendroedi and roden , 2009 ; van herpen and schrauwen - hinderling , 2008 ) . macrophage activation via innate pattern recognition receptors such as toll - like receptor 4 ( tlr4 ) and nuclear factor kappa - light - chain - enhancer of activated b cells ( nf-b ) and the production of cytokines such as tumor necrosis factor - alpha ( tnf- ) , interleukin-1 ( il-1 ) , and interleukin-6 ( il-6 ) is proposed to mediate insulin resistance and other complications of obesity ( arkan et al . , 2005 ; biswas and mantovani , 2012 ; jin and flavell , 2013 ; moore and tabas , 2011 ; olefsky , 2009 ; reilly et al . , 2013 ) . nevertheless , the effects of the genetic deletion of toll - like receptors such as tlr4 on insulin resistance are controversial ( jin and flavell , 2013 ; orr et al . , 2012 ; saberi et al . , 2009 ; tanti et al . , 2012 ) , and fat uptake by murine macrophages in vivo was also associated with suppression , rather than activation , of nf-b - dependent inflammatory gene expression ( spann et al . , 2012 ) . the cjun nh2-terminal kinase ( jnk ) , in macrophages , was also recently shown to be important for the establishment of diet - induced inflammation and insulin resistance in mice ( han et al . , 2013 ; hirosumi et al . , comprehensive genetic studies in mice are also arduous , in part due to their long duration , given rodent lifespans ( robertson et al . , 2011 ) , and difficulties in the interpretation of conventional knockout and cell depletion experiments ( clementi et al . , 2009 ; feng et al . , 2011 ; jin and flavell , 2013 ; orr et al . , 2012 ; saberi et al . , 2009 ; tanti et al . , therefore , the causative role of macrophages and the basic molecular mechanisms that may underlie their contribution to the disruption of homeostasis and lifespan reduction remain difficult to elucidate . in contrast , drosophila melanogaster is well suited to genetic analyses and survival studies ( dionne et al . , 2006 ; driver and cosopodiotis , 1979 ; heinrichsen and haddad , 2012 ) and is an excellent model to explore homeostatic responses to stress , and in particular metabolic responses to diet ( birse et al . , 2010 ) . drosophila has also proven to be a powerful model to decipher conserved mechanisms of innate immunity in metazoans ( lemaitre et al . , 1996 ) , and the adult fruit fly has a simple and genetically tractable myeloid immune system consisting of phagocytic macrophages , termed plasmatocytes ( agaisse et al . , 2003 ; charroux and royet , 2009 ; gold and brckner , 2014 ; holz et al . , 2003 ; , 2000 ; meister , 2004 ) , allowing for genetic analysis of macrophage functions . we thus reasoned that drosophila may be a favorable model to dissect evolutionarily conserved immune pathway(s ) that may be at play in the macrophage response to excess dietary lipids and metabolic stress in vivo and to identify the roles of macrophages in longevity , glucose homeostasis , and fat storage . we found that shorter lifespan , increased fat storage , reduced insulin sensitivity , and hyperglycemia were associated with systemic activation of the janus kinase and signal transducer and activator of transcription ( jak - stat ) pathway , but not of the nf-b pathway , in drosophila maintained under a lipid - rich diet , while drosophila macrophages became foamy and produced the type 1 cytokine unpaired3 ( upd3 ) , which activates the jak - stat pathway . using a combination of genetic approaches , we found that the production of upd3 by macrophages required the scavenger receptor croquemort ( crq ) and jnk and was responsible for the systemic jak - stat activation , decreased insulin sensitivity , and the reduced lifespan of flies maintained on a lipid - rich diet . these data demonstrate a causal role of macrophages in reducing insulin sensitivity and lifespan in flies maintained on a lipid - rich diet , via a pathway conserved in vertebrates . extending earlier studies on the effect of dietary fat on metabolism and longevity in drosophila melanogaster ( birse et al . , 2010 ; driver and cosopodiotis , 1979 ; heinrichsen and haddad , 2012 ) , we found that wild - type w and oregon - r drosophila fed diets supplemented with lard and maintained at either 25c or 29c start dying 1520 days earlier than flies on a control diet and thus show a decrease in lifespan of 30% ( figure 1a ; figures s1a and s1b ) . ( al - anzi and zinn , 2010 ) indicated that the total triglyceride content of lipid - rich diet - fed flies was increased compared to controls ( figure 1b ) , whereas food consumption was comparable ( figure s1c ) . drosophila also presented with a progressive increase in glucose / trehalose , which doubled after 30 days of lipid - rich diet exposure ( figure 1c ) . ilp2 , ilp3 , and ilp5 ( encoding insulin - like peptides ) transcripts were unchanged ( figure s1d ) , but we observed a blunted phosphorylation of akt in response to insulin , indicating that the lipid - rich diet resulted in impaired insulin sensitivity ( figure 1d ; figure s1e ) . lipid - rich diet was also associated with an early and sustained increase of the cytokine upd3 detectable at the whole - fly level ( figure 2a ) and increased expression of the endogenous jak - stat target gene socs36e ( figure 2b ) . systemic jak - stat activation was confirmed by the analysis of 10xstat92e - gfp flies ( bach et al . , 2007 ) where increased gfp expression was detected in muscle ( figure 2c ) and midgut ( figure 2d ; figures s2a and s2b ) . in contrast , we did not detect activation of the transcriptional targets of the toll and imd nf-b pathways in whole flies , although both the toll and imd pathways were responsive to sterile and septic injury ( figures 2e and 2f ; figure s2c ) . these data indicated that reduced lifespan and impaired glucose metabolism are associated with a systemic jak - stat activation in response to a lipid - rich diet in drosophila . drosophila macrophages , termed plasmatocytes , are found throughout tissues of the adult fly ( meister , 2004 ; figure 3a ) and are left over from embryonic and larval hematopoiesis ( holz et al . , 2003 ; krzemie et al . they express lectins and scavenger receptors such as hemolectin ( hml ) ( goto et al . , 2001 ) and crq , a fly cd36 homolog ( franc et al . , 1999 ; stuart et al . , 2005 ; figure s3 ) . their numbers were not modified as a result of the diet ( figure 3c ) , but analysis of fluorescence - activated cell sorting ( facs)-sorted plasmatocytes indicated they become foamy , accumulating neutral triglycerides and lipids within large oil red o - positive lipid vacuoles ( figure 3d ) , a feature also typical of the tissue macrophage response to a lipid - rich diet in vertebrates ( li and glass , 2002 ) . whole - genome expression array analysis indicated that expression of a large number of genes was upregulated or downregulated in macrophages from flies on a lipid - rich diet after 30 days , in comparison to cells from control diet - fed flies ( figure 3e ) . transcription - factor binding site representation analysis ( clark et al . , 2013 ) identified an overrepresentation of ap-1 , fox , and atf - creb binding sites , but not nf-b binding sites , in the vicinity of upregulated genes ( figure 3f ) . a qpcr analysis of facs - sorted plasmatocytes did not detect activation of the transcriptional targets of the toll and imd nf-b pathways , drosomycin ( drs ) and diptericin , but indicated that macrophages from flies on a lipid - rich diet produced the jak - stat activating cytokine upd3 , but not upd and upd2 ( figure 3 g ) . upd , upd2 , and upd3 share a common gp130-like receptor , domeless ( dome ) , that signals via a single jak ( hop ) and a single stat ( stat92e ) ( agaisse and perrimon , 2004 ; binari and perrimon , 1994 ; brown et al . , 2001 ; hou et al . , 1996 ; yan et al . , 1996 ) . these data indicated that lipid - rich diet promotes drosophila macrophage activation characterized by the production of upd3 . upd3 was previously shown to be produced by macrophages in response to infection ( agaisse et al . , 2003 ) , but upd3 is also produced by several other cell types and tissues in drosophila , including midgut epithelial cells , where it plays an essential role in gut infection and homeostasis ( buchon et al . , 2009 ; jiang et al . to investigate whether upd3 produced by macrophages or from other sources might be responsible for the phenotype of flies under a lipid - rich diet , we generated tissue - specific upd3 knockdown flies . silencing of upd3 in the midgut or muscle did not rescue fly longevity ( figures s4a and s4b ) . however , silencing of upd3 in macrophages improved fly longevity ( figure 4a ) and decreased upd3 induction in response to lipid - rich diet at whole - fly level ( figure 4b ) . furthermore , macrophage - specific upd3 knockdown also decreased glucose / trehalose almost to control concentrations ( figure 4c ) , and restored akt phosphorylation in response to insulin ( figure 4d ; figures s4c ilp2 , ilp3 , and ilp5 transcription was stable ( figure 4e ) , and plasmatocyte numbers were unchanged ( figure s4f ) . in addition , macrophage - specific upd3 knockdown did not affect fly fat content ( figure 4f ) . these data suggested that drosophila macrophages were responsible for reduced lifespan and the disruption of glucose homeostasis , via their production of upd3 . to confirm whether the production of upd3 was indeed responsible for systemic jak - stat activation and for the survival and metabolic phenotypes , we examined drosophila genetically deficient for upd3 ( upd3 null ) ( osman et al . , 2012 ) . the lifespan of upd3 null drosophila was identical on control and lipid - rich diets ( figure 5a ) . upd3 null flies did not present with increased jak - stat activation in the course of a lipid - rich diet ( figure 5b ) and did not develop hyperglycemia ( figure 5c ) , although they stored triglycerides when fed lipid - rich diets ( figure 5d ) . plasmatocyte - specific expression of upd3 in upd3 null flies reduced their lifespan on a control diet ( figure s5 ) , and ectopic inducible expression of upd3 or of upd2 , in plasmatocytes or in the fat body , was also sufficient to reduce drosophila lifespan ( figure 5e ) . altogether , these data suggested that , in drosophila maintained on lipid - rich diet , macrophages are a major source of upd3 production , which is responsible for systemic activation of the jak - stat pathway , reduced lifespan , and the disruption of glucose homeostasis . to further challenge this hypothesis , we generated inducible macrophage - depleted adult flies ( charroux and royet , 2009 ) . cell death was triggered in adult flies by inducible expression of the proapoptotic protein reaper ( rpr ) ( white et al . , 1996 ) in macrophages under the control of hml combined with a temperature - specific repressor ( mcguire et al . , 2004 ) . injected fluorescent lipids ( dii - ldl ) are rapidly scavenged by plasmatocytes , and there was a strong correlation between the dii and hml cells 1 hr after injection ( figure 6a ) . furthermore , expression of upd3-gfp increased in plasmatocytes of flies injected with dii - ldl ( figure 6b ) . following rpr induction , macrophage depletion was complete as assessed by the absence of lipid scavenging in the flies ( figure 6c ; figure s6a ) . macrophage depletion extended the longevity of flies on lipid - rich diet ( figure 6d ) , and decreased upd3 and socs36e expression ( figure 6e ) . macrophage - depleted flies were also protected from hyperglycemia in comparison to controls ( figure 6f ) . macrophage depletion did not affect the triglyceride content of the flies ( figure 6 g ) , and ilp2 , ilp3 , and ilp5 transcription remained stable ( figure s6b ) . our data thus indicated that macrophages are responsible for the reduced lifespan of drosophila under lipid - rich diet , via the production of upd3 . we thus screened the fly genome for putative scavenger receptors involved in lipid uptake and expressed by macrophages ( figure s7a ) and tested their roles in upd3 production and survival . plamatocyte - specific knockdown of two scavenger receptors , a fly cd36 homolog crq ( franc et al . , 1999 ; stuart et al . , 2005 ) and the egf - like repeat containing scavenger receptor nimrod c1 ( nimc1 ) ( kurucz et al . , 2007 ) ( figures s7a and s7b ) , resulted in a 30%40% reduction in macrophage lipid uptake ( figure 7a ) . knockdown of crq decreased upd3 and socs36e expression in the whole fly ( figure 7b ) and extended drosophila lifespan ( figure 7c ; figure s7c ) , yet ilp2 , ilp3 , and ilp5 transcription was not significantly changed ( figure s7d ) . however , knockdown of nimc1 in macrophages did not influence the lifespan of flies on a lipid - rich diet ( figure s7e ) . the lack of effect of nimc1 knockdown on survival despite its effect on lipid uptake suggested that the effect of crq knockdown on survival may be linked to signaling . we thus investigated the roles of signaling pathways that may be involved in the expression of upd3 by macrophages . silencing of myeloid differentiation primary response gene 88 ( myd88 ) , immune deficiency ( imd ) , and tgf--activated kinase 1 ( tak1 ) in macrophages ( figure 7d ) did not rescue drosophila lifespan on lipid - rich diet . these data were in accordance with the lack of detectable nf-b activation in macrophages ( see figures 2e , 2f , 3f , and 3 g ) . in contrast , we found that silencing of jnk ( bsk ) in macrophages ( hml-gal4 > bsk - ir ) extended the longevity of flies maintained under a lipid - rich diet ( figure 7e ) and decreased expression of upd3 ( figure 7f ) and socs36e ( figure 7 g ) in the whole fly , but did not affect plasmatocyte numbers ( figure s7f ) . this result was consistent with the observed overrepresentation of ap-1 but not nf-b binding sites in the vicinity of genes upregulated in plasmatocytes from lipid - rich diet - fed flies ( figure 3f ) . additionally , silencing of signal - transducer and activator of transcription protein at 92e ( stat92e ) in macrophages did not rescue drosophila longevity on lipid - rich diet ( figure 7d ) , suggesting that jnk acts downstream of crq , but upstream of upd3 ( figure s7h ) . indeed , regulation of the jnk transcriptional target puckered ( puc ) on a lipid - rich diet was lost in crq knockdown flies ( figure s7 the regulation of upd3 expression by jnk in macrophages is reminiscent of the previously described regulation of upd3 expression by jnk ( jiang et al . , 2009 ) but not nf-b signaling ( buchon et al . , 2009 ) in enterocytes from the drosophila midgut . collectively , our observations in a simple model organism demonstrate an essential role of macrophages in the loss of glucose homeostasis and lifespan reduction caused by a chronic lipid - rich diet , via the prolonged production of the type 1 cytokine upd3 that activates the jak - stat pathway . further , we identify a genetic crq - jnk - upd3 cassette in macrophages critical for the longevity of obese flies . our findings suggest that scavenging of excess lipids via crq , a cd36 analog ( stuart et al . , 2005 ) , results in the activation of a jnk - mediated stress response in macrophages , which in turn drives their production of upd3 , activating the jak - stat pathway , which controls insulin sensitivity and lifespan in drosophila . it is interesting to note that this response is distinct from a nf-b - dependent immune response , since reduced longevity and insulin resistance due to lipid - rich diet were not caused by transcription of nf-b target genes in the whole fly or in macrophages . these data are consistent with recent evidence that lipid uptake by murine macrophages does not activate nf-b ( spann et al . , 2012 ) . it is also noteworthy that the lipid storage phenotype was not affected by macrophage depletion or genetic reduction of upd3 production and jak - stat signaling . this suggests that , in the fly , the macrophage stress response mediated by cytokine production causes disease , rather than lipid storage itself . the jak - stat pathway and upd3 in drosophila are involved in the maintenance of tissue homeostasis and tissue repair in conditions of acute stress and infection via the control of stem cell proliferation in the drosophila gut , testis , ovary , and kidney ( jiang et al . , 2009 ; kohlmaier and edgar , 2008 ; osman et al . , 2012 ; singh et al . , 2007 ) ; the inhibition of apoptosis ( betz et al . , 2008 ) ; and the regulation of ilp secretion ( rajan and perrimon , 2012 ) and insulin signaling ( karpac et al . , 2011 ) . reducing insulin - tor activity in drosophila decreases cardiac dysfunction induced by short - term lipid - rich diet ( birse et al . , 2010 ) . paradoxically , we found here that sustained production of upd3 in response to chronic excess dietary lipid caused impaired glucose metabolism and decreased lifespan . thus jak - stat activation may contribute to the regulation of energy storage , at least in part through insulin receptor signaling , a protective effect that may nevertheless affect host fitness and cause pathogenesis , depending on its magnitude and duration ( jamieson et al . , 2005 ) , and activates jnk ( baranova et al . , 2008 ; rahaman et al . , 2006 ) , while mice with jnk - deficient macrophages present with decreased production of cytokines , including il-6 , and are protected against insulin resistance ( han et al . , 2013 ) therefore , we hypothesize that a conserved mechanism by which excess lipids activate a chronic stress response mediated by macrophage scavenger receptors , jnk , and type 1 cytokine production may cause dysregulated metabolic homeostasis and reduced lifespan and represents a target for therapeutic interventions . lipid - rich diets were prepared using the control diet as a base recipe and adding lard ( protein , nil ; carbohydrates , nil ; saturated fat , 44% ; monounsaturated , 42% ; polyunsaturated , 9.5% ; salt , nil ; fiber , nil ; sainsbury s basics lard ) in a weight - for - volume manner as described by birse et al . ( birse et al . , 2010 ) , at either 6.3% or 15% . all experiments were carried out using the 15% lard - enriched diet except for experiments shown in figures 3b and 3d , where a 6.3% lard - enriched diet was used . male flies were collected soon after eclosion , and groups of approximately 2030 age - matched flies per genotype were placed on the given control and lipid - rich diets . all survival experiments were conducted at 25c or 29c . for temperature - sensitive plasmatocyte - depleted survival assays , fly crosses flies were collected soon after eclosion and were then placed at 29c for 48 hr to initiate the inhibition of gal80 , and therefore the transcription of reaper , to induce plasmatocyte cell death in adult flies . once the plasmatocytes had been depleted in these flies , they were put in groups , per genotype , and placed on the given diets , and the survival assay was carried out at 25c . in all other experiments utilizing gal80 , flies were collected soon after eclosion over 23 days and were placed at 29c for the entire survival assay , in order to ensure the overexpression or knockdown of upd3 was maintained throughout the fly lifespan . in all survival assays carried out , vials were checked each day for any fly deaths , which were recorded . food vials were kept on their sides to minimize the possibility of fly death from becoming stuck to the food , and vials were changed for fresh food every other day . plasmatocyte cell death was triggered in adult flies by inducible expression of the proapoptotic protein reaper ( rpr ) ( mcguire et al . rpr expression was controlled by the temperature - sensitive driver tubulin - gal80 and the plasmatocyte - expressed driver hml-gal4 . in these flies the ubiquitous tub - gal80 promoter represses gal4 activity in all tissues at temperatures below 29c . flies were injected with 50 nl of pbs or insulin - resuspended in pbs at a high dose ( 6.4 g / ml ) and a low dose ( 1.28 g / ml ) . flies from each condition were smashed in groups of three , in triplicate , 10 min postinjection in 75 l of 2x laemmli loading buffer ( 100 mm tris [ ph 6.8 ] , 20% glycerol , 4% sds , 0.2 m dtt ) . antibodies used were as follows : from rabbit , anti - s505-phosphorylated drosophila akt ( cst # 4054 , 1:1,000 ) and anti - pan - akt ( cst # 4691 , 1:1,000 ) ; from mouse , anti--tubulin ( 12g10 developmental studies hybridoma bank , used as an unpurified supernatant at 1:10,000 ) . secondary antibodies were hrp anti - rabbit igg ( cst # 7074 ) and hrp anti - mouse igg ( kpl ) , both used at 1:5,000 . proteins were detected with supersignal west pico chemiluminiscent substrate ( thermo scientific ) using a biorad molecular imager , and band densitometry was analyzed using bio - rad image lab software . flies were starved for 1 hr before being smashed in 75 l te + 0.1% triton x-100 ( groups of three flies per genotype and per diet were smashed per sample ) . samples were thawed when required and incubated at 90c for 20 min to inactivate fly enzymes . a total of 5 l of sample was loaded per condition into flat - bottom 96-well tissue culture plates . each fly sample was run three times , first alongside water for calculation of background fly absorbance , second with glucose reagent ( alere ) for glucose , and third with glucose reagent plus trehalase for trehalose and glucose measurement . plates were then incubated at 37c for 1 hr before reading with a wallac spectrophotometer at 490 nm . approximately 90 adult male drosophila ( w;hml-gal4,uas-2xegfp ) were homogenized through a 70 m cell strainer ( bd biosciences ) with ice - cold 1x pbs - edta ( 2 mm ) into a 50 ml falcon . the filtered sample was then centrifuged at 4c for 15 min at 150 g , the supernatant was discarded , and the pellet was resuspended in 5 ml of pbs - edta ( 2 mm ) and passed once again through a 70 m cell strainer ; this wash step was repeated . gfp - positive hml-positive plasmatocytes were sorted through a 100 m nozzle at 20 psi pressure using a facs aria ii . for every sort , a gfp - negative sample was first analyzed in order to calibrate the sorter for detection of gfp - positive cells . cells were sorted into rlt buffer from the rneasy plus micro kit ( qiagen ) in order to extract rna for cdna generation and perform rt qpcr , or cells were sorted into pbs in order to fix and stain them for imaging . plasmatocytes were isolated from w;hml-gal4,uas-2xegfp flies that were either kept for 30 days on lard - supplemented food or normal food as described above . five thousand to ten thousand gfp - positive plasmatocytes were facs sorted from five independent samples per group and sorted directly into 6.4 l preheated superamp lysis buffer ( miltenyi ) . samples were incubated for 10 min at 42c according to the manufacturer s guidelines and stored at 20c until shipping . for each of the cdnas , 250 ng was used as template for cy3 labeling according to the manufacturer s protocol . the cy3-labeled cdnas were finally hybridized to an agilent whole drosophila genome oligo microarrays custom 8x60k . the agilent feature extraction software ( fes ) was used to read out and process the microarray image files . the software determines feature intensities ( including background subtraction ) , rejects outliers , and calculates statistical confidences . normalized data sets were compared using an unpaired t test ( p < 0.01 ) and a fold change > 2 between normal diet and lard - supplemented food . heat map of differentially regulated genes represents the log2 of the fold change between normal diet and lard - supplemented diet . for real - time quantitative pcr , tlc and the colorimetric assay for glucose and trehalose levels standard sets an unpaired t test was used to calculate statistical significance for all experiments , excluding survival assays , where log - rank and wilcoxon tests were performed using graphpad prism . transcription factor - binding site analysis on plasmatocyte microarray data was performed using clover precisely as previously described ( clark et al . , 2013 ) . all genes up- or downregulated more than 2-fold and with p < 0.01 were used in this analysis .

summarylong - term consumption of fatty foods is associated with obesity , macrophage activation and inflammation , metabolic imbalance , and a reduced lifespan . we took advantage of drosophila genetics to investigate the role of macrophages and the pathway(s ) that govern their response to dietary stress . flies fed a lipid - rich diet presented with increased fat storage , systemic activation of jak - stat signaling , reduced insulin sensitivity , hyperglycemia , and a shorter lifespan . drosophila macrophages produced the jak - stat - activating cytokine upd3 , in a scavenger - receptor ( crq ) and jnk - dependent manner . genetic depletion of macrophages or macrophage - specific silencing of upd3 decreased jak - stat activation and rescued insulin sensitivity and the lifespan of drosophila , but did not decrease fat storage . nf-b signaling made no contribution to the phenotype observed . these results identify an evolutionarily conserved scavenger receptor - jnk - type 1 cytokine cassette in macrophages , which controls glucose metabolism and reduces lifespan in drosophila maintained on a lipid - rich diet via activation of the jak - stat pathway .

in regenerative medicine , the methods based on autologous subcutaneous white adipose tissue ( wat ) transfer are widely used . in regenerative surgical procedures using autologous wat , the choice of the donor site is generally based on empirical considerations , due to the absence of specific data about the different sites , obtained with modern methods of wat analysis . data concerning the choice of the donor site should derive from the follow up of clinical trials , but knowledge of the different types of wats could be relevant in the setting up of a harvesting protocol for the correction of the different pathologies . at the present , data about each single fat depot are scarce . in addition , the knowledge about adipose stem niches , which play an important role in the healing processes based on autologous wat , is particularly defective . there are no specific studies on the microvascular compartments containing the niches in the fat depots that are common wat donor sites ( e.g. the trochanteric fatty pad or other wat depots in the limbs ) . it is generally believed that there are no significant morphologic differences between these depots and the abdominal subcutaneous wat , even if no comparative study specifically aimed at verifying such features has ever been performed . as a matter of fact , while the abdominal wat represents essentially a site of triglycerides storing , the limbs depots also play mechanical functions as they are often associated to articular interlines or sites of particular mechanic stress . possible morphologic differences in the adipocyte , microvascular or stem compartment could be related to different functional roles and biochemical differences among the fat depots . the stem cell compartment could be especially sensitive to the cellular turnover problems aroused by stress elements on the delicate adipose cells . among the depots of wat located in the limbs , first of all , it plays such a high aesthetic role , especially in female individuals , to often require plastic surgery ; in addition , it is one of the privileged sources of autologous wat and can be considered a common donor site . this depot can be considered as a true organ with clear anatomic delimitations and a vascular peduncle . this depot has a mechanic function linked to hip motility and the trochanteric shear stress exclude its role as a mere metabolic storing site . despite such reasons for interest , the studies about the trochanteric depots are these data could be important also to explain the general biology of wat , which recently revealed unexpected complexity and plasticity , which must be taken into account in the perspective of possible complications . in particular , it would be interesting to elucidate why such depots do exhibit so profitable properties in adipose tissue transplantation . the present study was therefore performed on the trochanteric depots using light and electron microscopy in order to describe the morphology of the adipocytes and microcirculation , with particular reference to the stem niches . fat was harvested , after informed consent , from twelve female patients ranging in age from 45 to 60 years ( average age : 52.7 years ) , who underwent fat harvesting from september to march 2010 for autologous fat implant . a mixture of 0.5% xylocaine + epinephrine 1:200,000 in saline solution was injected before suction . fat harvesting was performed by a 3 mm cannula ( 1-hole , bullet tip ) connected to a 10 cc syringe for vacuum ; fat was then gently washed in saline and decanted . we used wat removed from other locations ( abdomen n=26 , flank n=9 , thorax n=6 , limbs n=7 ) . for transmission electron microscopy ( tem ) , parts of the specimens were immediately fixed in 2.5% glutaraldehyde in sorensen buffer ph 7.4 for 2 h , postfixed in 1% osmium tetroxide in sorensen buffer for 1 h , dehydrated in graded acetones ( 60100% ) , embedded in epon - araldite and cut with an ultracut e ultramicrotome ( reichert , wien , austria ) . ultrathin sections were stained with lead citrate and observed in an electron microscope morgagni 268d ( fei - philips , eindhoven , the netherlands ) . the semithin sections were stained with toluidine blue . for scanning electron microscopy ( sem ) , the specimens were fixed in 2.5% glutaraldehyde in sorensen buffer for 2 h , postfixed in 1% osmium tetroxide in sorensen buffer for 1 h , and dehydrated in graded acetone ( fluka ) ; the specimens were then treated by a critical point dryer ( cpd 030 ; balzers union ltd . , balzers , liechtenstein ) and coated by gold , mounted on stubs and observed in an xl 30 esem ( fei - philips ) . data about adipocyte size were obtained during sem examination using scandium sem imaging platform ( olympus ) . after removal , the pad is characterized by a high degree of fluidity and subsequent histological and ultrastructural evaluations were aimed at clarifying the tissutal basis of this organoleptic feature that makes this wat deposit a preferred source for operation of adipose - based connective restructuring . light and electron microscopy examinations showed that the trochanteric pad is composed of a peculiarly organized wat . according to sbarbati et al . , it can be classified as a variety of structural wat ( swat ) , which is abundant in the limbs , thorax and flanks . as in the other types of swat , in the trochanteric pad as well an adipocyte compartment and a stromal compartment can be recognized ( figures 1 , 2 , 3 and 4 ) . the adipocyte compartment mainly consists of mature adipose cells , whose mean diameter is 86.91 + 15.85 ; these cells are slightly smaller than the adipocytes found in the large metabolic depots of the abdominal region ( 97.69 + 15.61 ) , although the difference found in the present study was not statistically significant . the morphology of the mature adipose cells of the trochanteric pad is similar as in the other swat depots ( figure 1 , a c ) : adipose cells show a thin rim of cytoplasm , in which micro - pinocytotic vesicles are the most common structures ( figure 1d ) . the mesenchymal - like stroma is visible . note the scarcity of collagen fibres and the presence of stromal elements . in panel d , isolated bundles of collagen fibers are present around an adipocyte . a , adipocyte ; v , blood vessel ; s , stromal connective ; c , collagen fibers . human trochanteric white adipose tissue . ( a ) light microscopy . the mesenchymal - like stroma is visible . note the scarcity of collagen fibres and the presence of stromal elements . in panel d , isolated bundles of collagen fibers are present around an adipocyte . a , adipocyte ; v , blood vessel ; s , stromal connective ; c , collagen fibers . ( a , b ) at low magnification , collagen bundles in the stroma are visible ; ( c ) at medium enlargement , the basket around each adipocyte is visible ; ( d ) at high magnification , a network of collagen fibers among the adipocytes is visible . a , adipocyte ; c , collagen fibers . human trochanteric white adipose tissue . ( a , b ) at low magnification , collagen bundles in the stroma are visible ; ( c ) at medium enlargement , the basket around each adipocyte is visible ; ( d ) at high magnification , a network of collagen fibers among the adipocytes is visible . the collagen fibers form an incomplete basket around the adipocytes ; ( b ) the panel shows an adipocyte in which the periadipocytic basket has been removed . the plasma membrane appears to be regularly smooth ; ( c , d ) high magnification of the periadipocytic basket . in these elements , the morphology of the basket , which is composed of a loose network of isolated collagen fibers is visible . the collagen fibers form an incomplete basket around the adipocytes ; ( b ) the panel shows an adipocyte in which the periadipocytic basket has been removed . the plasma membrane appears to be regularly smooth ; ( c , d ) high magnification of the periadipocytic basket . in these elements , the morphology of the basket , which is composed of a loose network of isolated collagen fibers is visible . ( a , b ) perivascular elements are wrapped by an external lamina and show a poorly differentiated organular pattern . ( c ) at high magnification , the external lamina wrapping these elements is visible . a , adipocyte ; v , blood vessel ; arrows , basal lamina . ( a , b ) perivascular elements are wrapped by an external lamina and show a poorly differentiated organular pattern . ( c ) at high magnification , the external lamina wrapping these elements is visible . a , adipocyte ; v , blood vessel ; arrows , basal lamina . the main characteristic of the trochanteric fat is surely represented by its stromal component ( figure 2 ) . at light microscopy ( figure 1a ) , the stroma appears to be less dense than in the other swats located in the limbs or in the thorax ; in the perivascular spaces among the adipocytes , the cellular elements are scarce ( figure 1b ) and generally have a high nucleus - to - cytoplasm ratio and a cytoplasm poor in organelles . the intra - parenchymal collagen stroma ( figure 2 a , b ) is poor , and the extracellular compartment shows rather large spaces filled with light material , in which only collagen bundles and isolated cells are present . at tem , the intercellular spaces appear to be filled with material characterized by very low electron - density , and are crossed by robust connective bundles made of tightly packed collagen fibers . at sem , it is possible to note that these bundles form a tridimensional network in which the adipocytes are embedded ( figure 2d ) . the collagen bundles do not appears to be in particular relation with the blood capillaries ; instead , they are often strictly associated to the adipocytes which are wrapped by a structure that has never been previously described and therefore deserves an accurate description . the mature adipocytes are covered by connective sheaths composed by a network of collagen fibers ( figures 2 c and 3 ) . in general , these connective sheaths are extremely thin when compared to the sheaths present in other subcutaneous adipose tissues . in fact , high - resolution sem images ( figure 3 c , d ) reveal that this structure , which could be called natural basket of the adipocytes , is composed by a very loose network of isolated collagen fibers in contact with the plasmalemma , as it can be easily observed at both tem and sem examinations . moreover , the collagen basket that wraps these cells appears relatively easy to detach allowing the visualization of a smooth plasmalemma ( figure 3b ) . at tem capillary vessels are frequent and often show large lumina ; they are surrounded by peculiar perivascular elements when compared to those in other subcutaneous adipose tissues . these cells are large , long and thin , and are surrounded by an external lamina ; they often contact the vascular wall , but sometimes this connection is not visible ; their cytoplasm contains few organelles among which polyribosomes are the most frequent . control specimens , removed from deposits of wat located in different regions ( i.e. abdomen , flanks , thorax and limbs ) , revealed light and electron microscopic features according to those reported in the literature ( figure 5 ) . when compared to the trochanteric pad , these adipose tissues are characterized by differences in particular in the stromal compartment . briefly , the collagenic stroma and the natural basket of the adipocytes appear regularly thicker than those visible in the trochanteric pad . on the contrary , the walls of the microvascular elements are generally thinner and the capillary walls are generally made of endothelial cells only . a c , scanning electron microscopy ; the robust network of collagen fibers is visible at different magnifications ; d , transmission electron microscopy ; the thin wall of a capillary vessel is visible . a , adipocyte ; v , blood vessel ; c , collagen fibers . a c , scanning electron microscopy ; the robust network of collagen fibers is visible at different magnifications ; d , transmission electron microscopy ; the thin wall of a capillary vessel is visible . to date , despite the well - known usefulness of the trochanteric fat pad in plastic surgery reconstructions , histological and ultrastructural studies about this depot are not available . in particular , it recently emerged the use of this tissue in regenerative procedures based on the coleman method or its variations . in this case too , despite some anecdotic reports , to our knowledge no morphologic study has ever been performed before on the isolated or implanted wat . the present work describes for the first time in detail the histology and ultrastructure of the trochanteric wat depot and provides evidence to explain the behaviour of the trochanteric fat in regenerative procedures . the ultrastructural studies allowed us to ascertain some interesting differences between this tissue and the subcutaneous wat harvested from other sites and in particular from the abdominal area . in general , the trochanteric fat showed similarities with structural wats , such as those located in other sites of the lower limb ( e.g. the tight or the inner knee ) , while major differences were found with respect to the metabolic wat found in the abdominal region.15 however , also when compared with the other structural wat deposits , the trochanteric wat displays some structural and ultrastructural characteristics that must be remarked . in the trochanteric pad , the small size of the adipocytes and the morphology of the collagenic basket surrounding these cells could explain its vitality in the course of surgical isolation and transplant ; moreover , adipocytes from the trochanteric wat adhere loosely each other due to the thin network of the collagen in the stroma , and this explains why these cells may be easily dissociated . the capillaries are often covered by pericytic elements , often rich in cytoplasm , that overlap the endothelium : these duplications of the capillary basal membrane are often visible and suggest a high traffic through these elements toward the stroma . the microcirculation features suggest a structural sturdiness and a noteworthy regenerative potential linked to the richness in stem niches . all these aspects ( resistance , dissociability , sturdiness of the microvascular weft and high regenerative potential ) suggest that trochanteric wat might be a good harvesting source for autologous adipose tissue based procedures . because of these specific feature of its microcirculation , it seems possible that the potential of differentiation of adipose - derived stem cells isolated from the adipose tissue of the trochanteric fat pad might be particularly suited for regenerative procedures based on the use of autologous fat . in conclusion , the main evidence emerging from the present work , i.e. the structural peculiarity of the trochanteric pad as compared to other wat deposits and in particular to the abdominal fat , calls into question a concept of medicine that seemed to be untouchable : the structural identity of wat . the idea that only one variant of subcutaneous wat exists seems not to withstand when rigorous studies with adequate methodologies are performed . in surgical procedures , despite the fact that the two tissues are widely considered equivalent , the differences between abdominal and trochanteric wat should not be underestimated . the data emerging from the present study should therefore be considered when approaching reconstructive procedures or transplants based on autologous adipose tissue . in this case , the material used is not only a common filler , but it is a living tissue employed to perform a true regeneration procedure , whose final result could depend on which tissue source had been selected . therefore the harvesting site should not be chosen randomly , but based on evidence . the present research suggests that follow up studies are required to assess possible differences between surgical procedures performed using wat removed from different donor sites . in such a context , the knowledge of the differences among adipose tissues surely represents an important step toward the optimization of reconstructive procedures .

technological developments based on the use of autologous white adipose tissue ( wat ) attracted attention to minor fat depots as possible sources of adipose tissue . in plastic surgery , the trochanteric fatty pad is one of the most used wat depots for its location and organoleptic characteristics that make it particularly suitable for reconstructive procedures . despite its wide use in clinic , the structure of this depot has never been studied in detail and it is not known if structural differences exist among trochanteric fat and other subcutaneous wat depots . the present study was performed on trochanteric fat pad with the aim to clarify the morphology of its adipocytes , stroma and microcirculation , with particular reference to the stem niches . histological and ultrastructural studies showed that the main peculiar feature of the trochanteric fat concerns its stromal component , which appears less dense than in the other subcutaneous wats studied . the intra - parenchymal collagen stroma is poor and the extracellular compartment shows large spaces , filled with electron - light material , in which isolated collagen bundles are present . the adipocytes are wrapped in weak and easily detachable collagen baskets . these connective sheaths are very thin compared to the sheaths in other subcutaneous wat depots . the capillaries are covered by large , long and thin elements surrounded by an external lamina ; these perivascular cells are poor in organelles and mainly contain poly - ribosomes . in conclusion , when compared to other wat deposits , the trochanteric fatty pad shows structural peculiarities in its stroma and microcirculation suggesting a high regenerative potential . resistance , dissociability , microvascular weft and high regenerative potential make the trochanteric fatty pad a privileged source for harvesting in autologous wat - based regenerative procedures .

thyroid dysgenesis ( td ) refers to the developmental defects of the thyroid gland that include aplasia , hypoplasia and ectopia , and accounts for majority of the cases of permanent congenital hypothyroidism ( ch ) in iodine sufficient regions ( 1 ) . although most cases of td are sporadic , familial occurrence in about 2% , higher prevalence in certain ethnic groups like hispanics and caucasians , and in babies with down syndrome suggest the possibility of a role of genetic factors in some cases ( 1 , 2 ) . genetic mutations known to be associated with td ( tshr , pax8 , nkx2 - 1 , foxe1 , nkx2- 5 and pax9 ) are , however , detected in only 2% of all cases ( 2 ) . a possible role of factors like sexual dimorphism , parental consanguinity and advanced maternal age has also been proposed in some studies ( 3 , 4 ) . in the present study , we aimed to see if gender and maternal age have an association with td in our patient cohort . a retrospective evaluation of medical records of patients with ch due to td followed up between 2004 and 2014 in the pediatric endocrinology clinic of advanced pediatric center , chandigarh located in northwest india , was performed . these children were referred from the general outpatient department of the hospital after obtaining a thyroid profile for symptoms suggestive of ch . data related to age at diagnosis , gender , parental age , family history , thyroid scintigraphy , ultrasonography and thyroid hormonal levels were recorded . the diagnosis of td was based on the findings of technetium-99 m pertechnetate thyroid scintiscan and thyroid ultrasonograms done at the time of initial evaluation of ch . the diagnosis of hypothyroidism was based on low serum total t4 levels and elevated serum tsh levels according to reference ranges ( 5 ) . those having subclinical hypothyroidism , autoimmune thyroiditis or syndromic diagnosis like down syndrome ( ds ) were excluded . maternal and paternal ages at the time of child birth were determined by subtracting the child s age from the parental ages at the time of diagnosis . maternal ages were compared with the normative data presented in a previous indian study ( 6 ) . the logistic regression analysis was performed to find out the independent predictive ability of maternal age for the binary outcome of td . pearson s correlation was used to analyse correlations among various quantitative study variables investigated . comparisons of maternal ages with normative data were made by the student s independent t - test . all the statistical analyses were performed on statistical package for social sciences ( spss inc . , complete information on thyroid scintigraphy and ultrasonography was available in 80 out of 310 children referred to our pediatric endocrinology clinic with a diagnosis of ch over the study period . majority ( 63 , 78.7% ) had agenesis of thyroid gland followed by ectopic gland in 12 ( 15% ) and hypoplasia in 5 ( 6.2% ) patients . in ultrasound , agenesis was detected in 70 ( 87.5% ) and ectopia and hypoplasia each in 5 ( 6.2% ) patients . there were 40 ( 50% ) boys and 40 ( 50% ) girls ( male to female ratio 1:1 ) . their mean age ( sd ) at diagnosis was 2.65 ( 2.81 ) yrs ( range 2 mo to 11 yrs ) . the mean initial total t4 and tsh concentrations in these children were 2.705 2.384 g / dl ( range 0.018.9 ) and 293.48 289.81 mean maternal age ( sd ) of 25.87 ( 4.17 ) yrs ( range 1935 yrs ) was significantly higher as compared with the mean maternal age ( sd ) of 23.87 ( 3.34 ) yrs ( range 1839 yrs ) in a reference population ( p < 0.0001 ) ( 6 ) . although majority ( 82.5% ) of mothers were less than 30 yrs of age at the time of birth of the child with td , 17.5% were older than 30 yrs as compared to only 6.1% in the cited reference ( table 1table 1age distribution of mothers of thyroid dysgenesis patients as compared to a reference population * ) . odds of being older than 30 yrs were 3.23 times higher in mothers of children with td as compared to mothers of normal children ( or 3.23 ; 95% ci : 1.546.44 ) ( p - value 0.0003 ) . this gives an attributable fraction of 12% in population which means that 12% of td can be eradicated by eliminating risk factor of older maternal age ( > 30 years ) at childbirth . however , the mean maternal age in the present study was lower than the mean maternal age ( 27.8 5.4 yrs , range 1843 yrs ) of our cohort of children with thyroid dysfunction associated with ds ( 7 ) . mean paternal age in our patients was similar to a reference population of a previous study from india ( 29.60 4.33 yrs , range 2238 yrs versus 29.3 5.4 yrs , range 20.042.0 yrs , p - value 0.65 ) ( 8) . the present study aimed to investigate the association of gender and maternal age with td , the commonest cause of ch in our set up . no gender differences were observed in our patient cohort similar to a previous study ( 4 ) . gender differences have been suggested to modulate thyroid gland development during fetal period probably involving molecular mechanisms ( 3 ) . the higher prevalence of td in girls , however , has not been consistently reported ( 2 ) . these findings are similar to a previous study in turkish patients ( 4 ) . although advanced maternal age is a risk factor for numerous maternal and fetal conditions ( 9 ) , the reasons for its association with td are presently unknown . age - related decreases in meiotic cohesins leading to increased segregation errors and oocyte aneuploidy are associated with several congenital birth defects ( 10 ) . however , oocyte aneuploidy does not appear to be a factor in our study as children with chromosomal abnormalities were excluded . in a previous study , it was proposed that advanced maternal age may increase the risk of mutations in genes encoding some transcription factors associated with thyroid gland development ( 4 ) . but acquisitions of intragenic mutation are more frequently observed in the paternal allele , and the frequencies of the events generally correlate with paternal age . in this context , further large studies are required to confirm the observed association with advanced maternal age and then elucidate the underlying mechanisms contributing to td . in conclusion , our study shows that advanced maternal age is more prevalent in children with td and this may be one of the several risk factors associated with thyroid developmental defects .

abstracta retrospective review of medical records of 80 children with thyroid dysgenesis ( td ) was conducted to determine the association of gender and maternal age with td . the study subjects were attending the pediatric endocrinology clinic of our hospital which is a large tertiary care multispecialty pediatric center located in chandigarh , northwest india . there were no gender differences ( boys to girls ratio 1:1 ) . mean maternal age of 25.87 4.17 yrs ( range 1935 yrs ) was significantly higher as compared to the mean maternal age of 23.87 3.34 yrs ( range 1839 yrs ) of a reference group ( p < 0.0001 ) . odds of being older than 30 yrs were higher in mothers of children with td as compared to mothers of normal children ( or 3.23 ; 95% ci : 1.546.44 ) ( p - value 0.0003 ) . in conclusion , our data shows that advanced maternal age is more prevalent in children with td .

testicular calculus is an extremely rare case with unknown etiology and pathogenesis . to our knowledge , here we report the third case of testicular calculus . a 31-year - old man was admitted to our clinic with painful solid mass in left testis . after diagnostic work - up for a possible testicular tumour , he underwent inguinal orchiectomy and histopathologic examination showed a testicular calculus . in young adults with painful and solid testicular mass with hyperechogenic appearance on scrotal ultrasonography , testicular calculus must be kept in mind in differential diagnosis . further reports on this topic may let us do more clear recommendations about the etiology and treatment of this rare disease . a 31-year - old man was admitted to our clinic with left testicular pain for a month . he did not report testicular trauma and/or tuberculosis in his past medical history and no accompanying urinary tract symptoms were present in his query . scrotal examination showed a 2 cm painful and solid mass in left testis , whereas right testis was normal . vital signs were in normal ranges and no other pathology was seen in systemic physical examination . tumour markers were within normal limits ( -hcg : 1 miu / ml , afp:1.14 ng/ ml , ldh:314 scrotal doppler ultrasonograpy was performed and an eggshell shaped hyperechogenic 16x12 mm solid mass was determined in the middle of left testis . microscopically , this mass was composed of ossified tissue and there was minimal mononuclear inflammatory cells focally next to the ossification ( figure-2 ) . intratubular germ cell neoplasia or dysgenetic changes were not seen near or far away from the mass . these histopathological features revealed the diagnosis of testicular calculus . to rule out tuberculosis , three early morning urine samples and polymerase chain reaction assays for mycobacterium tuberculosis the patient is on follow - up for 42 months and did not face any other pathologic finding during this period . testicular calcification / ossification may evolve due to tuberculosis , haematoma resorption or after trauma ; however none of these conditions were present in our patient . to our knowledge there were only two case reports for testicular calculus in the existing literature presenting with similar symptoms and age interval for testicular cancer ( 1 , 2 ) . our case also mimics a testicular cancer considering the presenting symptoms and age , so work - up consisted of a testicular mass approach . definition of the calculus is a concretion formed in any part of the body , most commonly in the passages of the biliary and urinary tracts ; usually composed of salts of inorganic or organic acids , or of other material such as cholesterol . localized bone formation in extraskeletal sites is a known disease and many of these are called as osteoma cutis but they are not true neoplasias . there is only one case report of testicular osteoma ( 3 ) , but we believe this case is not a true osteoma . the two cases described in english literature are similar cases to any etiological factors as in our case ( 1 , 2 ) . we believe all these three cases to have developed under metaplastic processes , and either calculus or stone terminology is appropriate according to the nature of the lesion . testicular calcification / ossification may evolve due to tuberculosis , haematoma resorption , or after trauma . no hemosiderin pigment was seen and no trauma history was present excluding the other possible etiologies . ellis and hutton ( 1 ) reported that their patient was diagnosed on routine medical examination with no testicular pain or discomfort in his past medical history , whereas dayanc et al . scrotal magnetic resonance imaging ( mri ) is a useful tool for differentiating between benign and malignant intratesticular masses , but high costs limit its use in daily clinical practice ( 4 ) . organ sparing surgery with frozen - section examination could be an option for this patient ( 57 ) . however ; central location of the mass , suspicion of a testicular tumour and healthy contralateral testis kept us from this option . we can conclude that in young adults with painful and solid testicular mass with hyperechogenic appearance on scrotal ultrasonography , testicular calculus may be kept in mind in differential diagnosis . further imaging with mri and testicular sparing surgery with the availability of frozen - section examination may be opted in proper cases . further reports on this topic may let us do more clear recommendations about the etiology and treatment of this rare disease .

abstractbackground : testicular calculus is an extremely rare case with unknown etiology and pathogenesis . to our knowledge , here we report the third case of testicular calculus . a 31-year - old man was admitted to our clinic with painful solid mass in left testis . after diagnostic work - up for a possible testicular tumour , he underwent inguinal orchiectomy and histopathologic examination showed a testicular calculus.case hypothesis : solid testicular lesions in young adults generally correspond to testicular cancer . differential diagnosis should be done carefully.future implications : in young adults with painful and solid testicular mass with hyperechogenic appearance on scrotal ultrasonography , testicular calculus must be kept in mind in differential diagnosis . further reports on this topic may let us do more clear recommendations about the etiology and treatment of this rare disease .

to report the case of a patient with large - angle hypertropia of an intramuscular hemangioma of the right superior rectus muscle ( sr ) . a 63-year - old man with progressive vertical deviation of the right eye for the past 6 months visited our strabismus department ; his condition was not painful . an examination indicated that he had 60pd of right hypertropia at distance and near in primary gaze . additionally , a significant limitation of his downgaze was noted . the right eye appeared mildly proptotic , and the upper and lower eyelids were slightly edematous . orbital magnetic resonance imaging ( mri ) studies revealed fusiform enlargement of the right superior rectus muscle , with prominent but irregular enhancement following gadolinium administration . incisional biopsy revealed an intramuscular hemangioma in the superior rectus muscle with cavernous - type vessels . this case demonstrates that intramuscular hemangioma should be considered in the differential diagnosis of isolated extraocular muscle enlargement and unusual strabismus . a 63-year - old man with progressive vertical deviation of the right eye presented to our strabismus department ( fig . 1a ) , noting that the ocular motility problem had been present for the past 6 months and was not associated with pain . physical examination indicated that corrected visual acuity and intraocular pressure were 20/20 and 18 mmhg , respectively , in both eyes . there was a 3mm - proptosis of the right eye compared with the left eye , and the upper and lower eyelids were slightly edematous , but with no chemosis or hyperemia ; pulsation or bruit was not noted . he could fix objects with his right eye only when his left eye was occluded . 1a ) orbital magnetic resonance imaging ( mri ) studies revealed fusiform enlargement of the right superior rectus muscle , with prominent but irregular enhancement following gadolinium administration . 2a , b ) all other structures in the right orbit were normal except an incidental middle cranial artery ( mca ) aneurysm in the left hemisphere , which was clipped by a neurosurgeon ; the neurosurgeon indicated that the mca aneurysm was not associated with the tumor . a biopsy through the infrabrow was performed under general anesthesia with a subperiosteal approach to the midsuperior orbit . upon incision of the superior periorbita and levator muscles , the right sr appeared considerably thickened , and was dark purple and tense ; the tendinous region was normal . the patient underwent a right superior rectus recession of approximately 15 mm by a hang - back technique and a 4-mm right inferior rectus resection with a conjuctival approach . the elasticity of the right sr was markedly reduced , and posterior portions were two or three times thicker than their normal size . light microscopy of these sections revealed several blood - filled vessels of variable size surrounding muscle fibers and islands of fibrofatty deposits . 3a ) capillary proliferation was not present , and there was no evidence of fibrotic intimal thickening or mitotic figures . an immunohistochemical study with antismooth muscle actin antigen ( clone 1a4 at 1/25 titration , dako monoclonal , denmark ) demonstrated the presence of smooth muscle cells in the walls of blood vessels . 3b ) biopsy results revealed an intramuscular hemangioma in the superior rectus muscle with cavernous - type vessels . systemic corticosteroids were utilized for four weeks postoperatively to ameliorate swelling , not to shrink the tumor . mild ptosis and 15 pd of right hypertropia has since been noted in the patient 's primary gaze . intramuscular hemangioma ( imh ) classification is based on the size of the predominant vessel , as suggested by allen and enzinger.6 the frequency of imhs are 50% , 29% , and 21% for capillary , cavernous , and mixed type , respectively.3 christensen et al.4 reported the case of a 21-year - old woman with a 10-year history of proptosis , where exenteration showed four extraocular muscles affected by mixed capillary - cavernous hemangioma , all except the inferior rectus and inferior oblique muscles . kiratli et al.5 described two cases of isolated primary imhs of the extraocular muscles , one in the lateral rectus of a 3-year - old boy , and one in the medial rectus of a 40-year - old man . the three cases described above presented with gradual proptosis or lid swelling ; abnormal ocular motility was apparently not present . the subject of this study likely represents the first reported case of an isolated primary imh of pure carvenous type associated with large - angle strabismus . in our case , we assumed that the progressive fibrotic process of cavernous hemangioma caused the unusual hypertropia . the most common cause of extraocular muscle ( eom ) enlargement in adults is graves ' disease;7 both graves ' disease and myositis are associated with many inflammatory indicators . orbital metastases of breast carcinoma and cutaneous melanoma have a predilection for eoms and are a focal enhancement sign.8 lymphoma may also cause significant enlargement of eoms , and tends to frequently affect the superior rectus and levator palpebra complex ; lymphoma usually shows minimal enhancement under contrast studies.9 arteriovenous malformation consists of dilated muscularized blood vessel with fibrotic intimal thickening and displays both arterial and venous characteristics . clinical symptoms and signs include loss of vision , chemosis , episcleral venous congestion , elevated intraocular pressure ; it is associated with cranial nerve palsy . due to the rarity of ocular imhs , we were unable to exclude all of the preceding diagnostic possibilities in our patient before biopsy results were obtained . however , the imaging characteristics of skeletal imhs are well documented as a combination of large vessels with stagnant blood and nonvascular tissue within the tumors produce a typical serpiginous pattern , septated - striated high signal intensity , and curvilinear areas of low signal intensity.10 similar features were observed in our patient . the optimum management strategy appears to be total excision , whereby the mass must be excised beyond gross visible limits.2,3 in the present study , the patient complained only of hyperdeviation of the right eye because of cosmetic problems . he had minimal proptosis and lid swelling , normal visual acuity , and experienced no pain . total excision was not considered a viable treatment option for the patient , as surgical results were unpredictable and may have created a potentially irreversible motility disturbance . moreover , in cases of incomplete excision , there is an 18% risk of recurrence.3 in our case , establishing the diagnosis by biopsy and treating with strabismus surgery was at the very least potentially justified . systemic corticosteroids can decrease the bulk of the tumor , but imhs of the extraocular muscles are insensitive to systemic corticosteroids because of encapsulation and the presence of cavernous elements which are resistant to corticosteroids.11 this case demonstrates that imhs can occur in extraocular muscles , even causing ocular motility disturbances . therefore , this type of tumor should be considered in the differential diagnosis of isolated extraocular muscle enlargement and unusual strabismus .

purposeto report the case of a patient with large - angle hypertropia of an intramuscular hemangioma of the right superior rectus muscle ( sr).methodsa 63-year - old man with progressive vertical deviation of the right eye for the past 6 months visited our strabismus department ; his condition was not painful . an examination indicated that he had 60pd of right hypertropia at distance and near in primary gaze . additionally , a significant limitation of his downgaze was noted . the right eye appeared mildly proptotic , and the upper and lower eyelids were slightly edematous . corrected vision was 20/20 in both eyes.resultsorbital magnetic resonance imaging ( mri ) studies revealed fusiform enlargement of the right superior rectus muscle , with prominent but irregular enhancement following gadolinium administration . incisional biopsy revealed an intramuscular hemangioma in the superior rectus muscle with cavernous - type vessels.conclusionsthis case demonstrates that intramuscular hemangioma should be considered in the differential diagnosis of isolated extraocular muscle enlargement and unusual strabismus .

a 24-year - old man was diagnosed at birth with coarctation of the aorta and a patent ductus arteriosus and subsequently diagnosed with a bicuspid aortic valve ( bav ) and a sub - aortic membrane . at the age of one month he had repair of the coarctation and closure of the ductus . in 1993 the bav was noted on echocardiogram with a small sub - aortic membrane and a peak velocity of 1.6 m / s . repeat echocardiogram showed a bav and sub - aortic membrane with no significant aortic regurgitation or aortic stenosis . surprisingly , the cmr demonstrated a sinus of valsalva aneurysm ( sva ) , which had not been apparent on the echo images because it was outside standard imaging planes ( figure 1a , 1b ; supplementary files 1 and 2 ) . there was aneurysmal dilatation of the right coronary sinus with a maximum dimension across the aortic sinus of 5.7 cm . on cmr flow was directed eccentrically by the domed posterior leaflet of the bav into the right coronary sinus ( figure 1d ; supplementary file 3 ) . the jet impacts on the supero - lateral wall of the right coronary sinus ( figure 1c ) . the jet eccentricity was also demonstrated on echo ( figure 2 ; supplementary file 4 ) . the sub - aortic membrane may also contribute to the eccentricity of the jet ( figure 2 ) by directing flow towards the belly of the posterior leaflet rather than more centrally . figure 1a ) cmr short axis view using true - fisp demonstrating bicuspid aortic valve with a large postero - medial leaflet and smaller anterior leaflet ( arrow ) . b ) cmr short axis view ( true - fisp ) obtained just above the aortic valve plane demonstrating sinus of valsalva aneurysm with aneurysmal dilatation of the right coronary sinus ( arrow ) . c , d ) an eccentric jet of flow directed eccentrically by the domed aortic valve leaflet ( black arrow ) into the right coronary sinus ( white arrow ) . a ) cmr short axis view using true - fisp demonstrating bicuspid aortic valve with a large postero - medial leaflet and smaller anterior leaflet ( arrow ) . b ) cmr short axis view ( true - fisp ) obtained just above the aortic valve plane demonstrating sinus of valsalva aneurysm with aneurysmal dilatation of the right coronary sinus ( arrow ) . c , d ) an eccentric jet of flow directed eccentrically by the domed aortic valve leaflet ( black arrow ) into the right coronary sinus ( white arrow ) . figure 22-dimensional ( a ) and colour doppler ( b)echocardiography in an apical 5-chamber view demonstrating an eccentric jet of flow directed through the aortic valve towards the right coronary sinus . the sub - aortic membrane ( arrow ) appears to contribute to the eccentric direction of lv outflow . 2-dimensional ( a ) and colour doppler ( b)echocardiography in an apical 5-chamber view demonstrating an eccentric jet of flow directed through the aortic valve towards the right coronary sinus . the sub - aortic membrane ( arrow ) appears to contribute to the eccentric direction of lv outflow . he underwent successful repair of the sva and resection of the sub - aortic membrane and remained well when followed up in clinic . congenital aneurysms are often caused by weakness at the junction of the aortic media and the annulus fibrosus . acquired aneurysms are caused by conditions affecting the aortic wall , such as infections , degenerative diseases ( atherosclerosis , connective tissue disorders or cystic medial necrosis ) or trauma . the presence of bav is associated with ascending aortic dilatation due to associated cystic medial necrosis . recently provided new insights into the pathophysiology underlying aortic dilatation in bav patients using cmr . the authors found a significant correlation between the systolic lv outflow jet angle with the aortic root channel and dilatation at the levels of the sva , sinotubular ( st ) junction , and the ascending aorta which could be important in the formation of aortic dilatation in bav . our case describes the formation of sva associated with an lv outflow jet which is eccentrically directed by a sub - aortic membrane through the bav and into the right coronary sinus . it is probable that the asymmetric sinus dilatation is the result of many years of lv outflow impacting on the congenitally abnormal wall of the right coronary sinus . because it is out of the normal echocardiogram planes , the sva may have been developing over many years but it has not been noted previously . cmr proves to be a valuable imaging modality in demonstrating the sva and the likely mechanism of its development . cmr is useful in defining the three - dimensional anatomy of the aneurysm more precisely , including variations of flow direction during cardiac cycle . in addition , cmr may also provide better evaluation of aneurysm wall thickness or presence of thrombus , and better detection of small perforations .

cardiac magnetic resonance imaging ( cmr ) demonstrated a sinus of valsalva aneurysm ( sva ) with severe dilatation of the right coronary sinus in association with a congenital bicuspid aortic valve ( bav ) and sub - aortic membrane . the sva had not been apparent on echocardiography as the dilatation was outside standard echo image planes . on both cmr and echo , blood flow was eccentrically directed into the right coronary sinus by the domed posterior leaflet of the bav . the impact of the aortic jet on the wall of the right coronary sinus is probably important in the aetiology of the sinus dilatation . cmr proved valuable in demonstrating the sva and understanding its aetiology .

it is well known that there is an increased burden of cardiovascular disease and its risk factors among patients with lower socioeconomic status ( ses ) . in the last decade , eliminating disparities in healthcare delivery in the united states has been governed largely by the healthy people 2010 initiative , which has aimed to improve cardiovascular health among all citizens . the ultimate goal of stelevation myocardial infarction ( stemi ) care should be to achieve optimal and equitable outcomes for one and all , regardless of their residential status . in this context , a number of cultural , clinical , economic , geographic , and accessrelated issues could influence the time from symptom onset to first medical contact . while these variables are difficult to individually quantify , residential zipcodebased classification of ses may reflect the aggregate characteristics of its residents and the prevailing healthy and unhealthy habits , which serves to provide an insight into environmental attributes ( like available healthcare resources ) that may have a direct or indirect impact on its residents ' health . although there has been research demonstrating the negative impact of low ses upon outcomes following acute coronary syndromes , most of these studies belong to the era where primary percutaneous intervention ( pci ) was not the mainstay of treatment of stemi and the emphasis on doortoballoon time optimization was just beginning . to that end , we aimed to evaluate the disparities and outcomes in patients presenting with stemi according to the ses , in the contemporary era where expeditious reperfusion forms the mainstay of stemi management . data were obtained from the nationwide inpatient sample ( nis ) database from 2003 to 2011 . the nis is sponsored by the agency for healthcare research and quality as a part of healthcare cost and utilization projection . the nis contains discharge level data from 8 million hospitalizations annually from about 1000 hospitals across the united states . this database is designed to represent a 20% stratified sample of all hospitals in the country . criteria used for stratified sampling of hospitals into the nis include location ( urban or rural ) , teaching status , geographic region , patient volume , and hospital ownership . the nis database provides up to 15 diagnoses and 15 procedures for each hospitalization record for the years 20032009 . the number of diagnoses coded in the database was expanded to 25 for the years 20102011 . all these have been coded using the standard international classification of diseases , ninth edition , clinical modification ( icd9 cm ) codes . the first diagnosis in the database is referred to as the principal diagnosis and is considered the primary reason for admission to the hospital . these were identified using icd9 cm codes of 410.0x , 410.1x , 410.2x , 410.3x , 410.4x , 410.5x , 410.6x , and 410.8x . we used the healthcare cost and utilization projection clinical classification software to identify patient comorbidities and procedures . clinical classification software has been developed by the agency for healthcare research and quality for clustering patient diagnoses and procedures into a manageable number of clinically meaningful categories . we identified patients undergoing diagnostic coronary angiography with the clinical classification software code of 47 that corresponds to icd9 cm codes of 37.21 to 37.23 and 88.52 to 88.57 . patients undergoing pci were identified using the clinical classification software code of 45 ( corresponding to icd9 cm codes of 00.66 , 36.01 , 36.02 , and 36.05 ) along with icd9 cm codes of 36.06 and 36.07 . baseline characteristics available for analysis included age , gender , race , primary source of payment , weekday versus weekend admission , elixhauser comorbidities defined by agency for healthcare research and quality along with other clinically relevant comorbidities ( smoking , family history of coronary artery disease , prior mi , and dyslipidemia ) . hospital characteristics such as region ( northeast , midwest , south , west ) , bed size ( small , medium , large ) , location ( rural , urban ) , and teaching status were also included . the primary variable of interest was the ses assessed using patient 's residential zip code . the nis has classified each zip code into quartiles based on median household income of each zip code . these quartiles are the following : quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more . residential zipcodebased classification of ses is known to reflect aggregate characteristics of its residents and an insight into environmental attributes ( such as available healthcare resources ) that may have a direct or indirect impact on its residents ' health . although a composite measure of ses that includes several variables such as directly measured household income , education , race , and residential zip code might provide incremental information regarding individual ses , we chose to utilize the residential zipcodebased classification . this is because of its successful validation in prior studies along with the fact that it reflects aggregate characteristics over individual characteristics , which often govern healthcare delivery . besides this , several characteristics that may be useful in defining composite measures of ses such as education and household income were not available in the administrative database of nis . since the time to pci or thrombolysis was available in calendar days only , all patients who underwent pci or thrombolysis on day 0 of the hospitalization were assumed to have undergone timely reperfusion . in addition to these primary outcomes , several secondary outcomes were analyzed including utilization of an intraaortic balloon pump ( iabp ) ( icd9 cm code : 37.61 ) , percutaneous assist devices ( icd9 cm code : 37.68 ) , and swan ganz catheterization ( icd9 cm codes : 89.64 , 37.21 , 37.23 ) . besides these outcomes , we also analyzed the differences in cost of hospitalization stratified by residential zip code quartile . the nis database provides the total charges associated with each hospital stay that were claimed by the respective hospital . the total charges of each hospital stay were converted to cost estimates using the group average allpayer inhospital cost and charge information from the detailed reports by hospitals to the centers of medicare and medicaid services . all costs and charges were converted to projected estimates for the year 2011 , after accounting for annual inflation rates based on consumer price index data available from the bureau of labor statistics . we conducted a sensitivity analysis by comparing the primary outcomes between the study groups after removing all patients who presented as a transfer from another healthcare facility . in addition , we compared the primary outcomes between several patient strata including males versus females , whites versus nonwhites , and elderly ( age 75 years ) versus nonelderly ( age < 75 years ) patients . continuous variables are presented as meansd , and categorical variables are presented as proportions . for comparing the means of continuous variables between 3 or more categories survey statistics traditionally used to analyze complex semirandom survey designs were employed to analyze these data . since the data from nis represent a collection of scattered hospital clusters , analysis was structured to account for a complex , multistage , probability sampling . nis recommends the use of strata for constructing analysis clusters , which include geographic census region , hospital ownership , teaching status , urban / rural location , and bed size . furthermore , the analysis is further stratified into individual hospitals , which serve as primary sampling units for the analysis . in the nis database , discharge weight that can be utilized to calculate projected national estimates for all hospitalrelated outcomes , after accounting for the hierarchical structure of the dataset . multivariable hierarchical logistic regression analysis was utilized to compare outcomes between the zipcode quartiles . for this analysis nis_straum as the strata , variable hospid as the primary sampling unit ( clustering variable ) , and the variable discwt as the sampling weight . the analysis of all primary outcomes has been presented after adjusting for age , gender , race , 29 elixhauser comorbidities , other relevant comorbidities including smoking , prior mi , dyslipidemia , family history of coronary artery disease , and hospital characteristics . the highest zipcode quartile ( quartile 4 ) has been used as the reference category for all comparisons . adjusted logistic regression analysis of secondary outcomes of intraaortic balloon pump / percutaneous assist device use and swan ganz catheterization was further adjusted for presence of cardiogenic shock , cardiac arrest , and ventricular fibrillation . furthermore , multivariable logistic regression analysis for comparing cost between the study groups was further adjusted for primary payment source and inhospital mortality . all statistical analyses were performed using the statistical software stata v 13.0 ( statacorp , college station , tx ) . due to the deidentified nature of this publicly available administrative database , an institutional review board review was not necessary for the conduct of this study . data were obtained from the nationwide inpatient sample ( nis ) database from 2003 to 2011 . the nis is sponsored by the agency for healthcare research and quality as a part of healthcare cost and utilization projection . the nis contains discharge level data from 8 million hospitalizations annually from about 1000 hospitals across the united states . this database is designed to represent a 20% stratified sample of all hospitals in the country . criteria used for stratified sampling of hospitals into the nis include location ( urban or rural ) , teaching status , geographic region , patient volume , and hospital ownership . the nis database provides up to 15 diagnoses and 15 procedures for each hospitalization record for the years 20032009 . the number of diagnoses coded in the database was expanded to 25 for the years 20102011 . all these have been coded using the standard international classification of diseases , ninth edition , clinical modification ( icd9 cm ) codes . the first diagnosis in the database is referred to as the principal diagnosis and is considered the primary reason for admission to the hospital . these were identified using icd9 cm codes of 410.0x , 410.1x , 410.2x , 410.3x , 410.4x , 410.5x , 410.6x , and 410.8x . we used the healthcare cost and utilization projection clinical classification software to identify patient comorbidities and procedures . clinical classification software has been developed by the agency for healthcare research and quality for clustering patient diagnoses and procedures into a manageable number of clinically meaningful categories . we identified patients undergoing diagnostic coronary angiography with the clinical classification software code of 47 that corresponds to icd9 cm codes of 37.21 to 37.23 and 88.52 to 88.57 . patients undergoing pci were identified using the clinical classification software code of 45 ( corresponding to icd9 cm codes of 00.66 , 36.01 , 36.02 , and 36.05 ) along with icd9 cm codes of 36.06 and 36.07 . baseline characteristics available for analysis included age , gender , race , primary source of payment , weekday versus weekend admission , elixhauser comorbidities defined by agency for healthcare research and quality along with other clinically relevant comorbidities ( smoking , family history of coronary artery disease , prior mi , and dyslipidemia ) . hospital characteristics such as region ( northeast , midwest , south , west ) , bed size ( small , medium , large ) , location ( rural , urban ) , and teaching status were also included . the primary variable of interest was the ses assessed using patient 's residential zip code . the nis has classified each zip code into quartiles based on median household income of each zip code . these quartiles are the following : quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more . residential zipcodebased classification of ses is known to reflect aggregate characteristics of its residents and an insight into environmental attributes ( such as available healthcare resources ) that may have a direct or indirect impact on its residents ' health . although a composite measure of ses that includes several variables such as directly measured household income , education , race , and residential zip code might provide incremental information regarding individual ses , we chose to utilize the residential zipcodebased classification . this is because of its successful validation in prior studies along with the fact that it reflects aggregate characteristics over individual characteristics , which often govern healthcare delivery . besides this , several characteristics that may be useful in defining composite measures of ses such as education and household income were not available in the administrative database of nis . inhospital mortality and timely reperfusion therapy were treated as coprimary outcomes . since the time to pci or thrombolysis was available in calendar days only , all patients who underwent pci or thrombolysis on day 0 of the hospitalization were assumed to have undergone timely reperfusion . in addition to these primary outcomes , several secondary outcomes were analyzed including utilization of an intraaortic balloon pump ( iabp ) ( icd9 cm code : 37.61 ) , percutaneous assist devices ( icd9 cm code : 37.68 ) , and swan ganz catheterization ( icd9 cm codes : 89.64 , 37.21 , 37.23 ) . besides these outcomes , we also analyzed the differences in cost of hospitalization stratified by residential zip code quartile . the nis database provides the total charges associated with each hospital stay that were claimed by the respective hospital . the total charges of each hospital stay were converted to cost estimates using the group average allpayer inhospital cost and charge information from the detailed reports by hospitals to the centers of medicare and medicaid services . all costs and charges were converted to projected estimates for the year 2011 , after accounting for annual inflation rates based on consumer price index data available from the bureau of labor statistics . we conducted a sensitivity analysis by comparing the primary outcomes between the study groups after removing all patients who presented as a transfer from another healthcare facility . in addition , we compared the primary outcomes between several patient strata including males versus females , whites versus nonwhites , and elderly ( age 75 years ) versus nonelderly ( age < 75 years ) patients . continuous variables are presented as meansd , and categorical variables are presented as proportions . for comparing the means of continuous variables between 3 or more categories , we utilized 1way anova . in cases of significant differences detected using anova survey statistics traditionally used to analyze complex semirandom survey designs were employed to analyze these data . since the data from nis represent a collection of scattered hospital clusters , analysis was structured to account for a complex , multistage , probability sampling . nis recommends the use of strata for constructing analysis clusters , which include geographic census region , hospital ownership , teaching status , urban / rural location , and bed size . furthermore , the analysis is further stratified into individual hospitals , which serve as primary sampling units for the analysis . in the nis database , discharge weight that can be utilized to calculate projected national estimates for all hospitalrelated outcomes , after accounting for the hierarchical structure of the dataset . multivariable hierarchical logistic regression analysis was utilized to compare outcomes between the zipcode quartiles . for this analysis nis_straum as the strata , variable hospid as the primary sampling unit ( clustering variable ) , and the variable discwt as the sampling weight . the analysis of all primary outcomes has been presented after adjusting for age , gender , race , 29 elixhauser comorbidities , other relevant comorbidities including smoking , prior mi , dyslipidemia , family history of coronary artery disease , and hospital characteristics . the highest zipcode quartile ( quartile 4 ) has been used as the reference category for all comparisons . adjusted logistic regression analysis of secondary outcomes of intraaortic balloon pump / percutaneous assist device use and swan ganz catheterization was further adjusted for presence of cardiogenic shock , cardiac arrest , and ventricular fibrillation . furthermore , multivariable logistic regression analysis for comparing cost between the study groups was further adjusted for primary payment source and inhospital mortality . all statistical analyses were performed using the statistical software stata v 13.0 ( statacorp , college station , tx ) . all statistical tests were 2tailed ; a p<0.05 was considered significant . due to the deidentified nature of this publicly available administrative database , over a 9year period ( 20032011 ) , a total of 372 984 discharges with a principal diagnosis of stemi were analyzed . table 1 demonstrates the baseline characteristics of the entire study population , stratified by the ses quartiles . there was a progressive reduction in the proportion of females when moving from the lowest to the highest quartile ( p<0.001 ) . similarly , 70.6% of all stemi patients residing in the lowest ses quartile were whites as compared to 82.8% of patients in the highest ses quartile ( p<0.001 ) . in addition , patients in the highest ses quartile were more likely to have private insurance as the primary payment source as compared to the lower quartiles ( p<0.001 ) . baseline characteristics stratified by zipcodebased socioeconomic status quartile all quartiles were based on median household income of the respective zip code . cad indicates coronary artery disease ; ses , socioeconomic status ; usd , us dollars . the differences in the distribution of traditional cardiovascular risk factors between the different ses quartiles are also illustrated in table 1 . there were small but statistically significant decreases in the prevalence of diabetes , hypertension , smoking , peripheral vascular disease , and chronic renal failure when moving up the ses quartile ( p<0.001 for all comparisons ) . in addition , we noted that there was a significantly higher prevalence of alcohol abuse and drug abuse among residents of lower ses quartiles as compared to higher quartiles ( p<0.001 for both comparisons ) . figure 1 demonstrates the incidence and adjusted odds ratio for the primary outcomes across the ses quartiles . the incidence of inhospital mortality was 7.8% , 7.5% , 7.0% , and 7.1% across quartiles 1 to 4 , respectively ( ptrend<0.001 ) . on adjusted analysis , there were significantly higher odds of inhospital mortality among the lowest ses quartile as compared to the highest quartile ( odds ratio [ 95% ci ] : 1.11 [ 1.06 to 1.17 ] ) . similarly , there was a highly significant trend indicating a progressively reduced timely reperfusion among patients from lower ses quartiles , as compared to those from higher quartiles . the utilization of thrombolysis across the 4 ses quartiles was 3.4% , 3.7% , 3.7% , and 3.6% , respectively ( ptrend=0.44 ) . although the utilization of thrombolysis was similar across the ses quartiles , there was a significantly greater utilization of pci in the higher ses quartiles as compared to the lower ses quartiles . the prevalence of timely pci across the 4 ses quartiles was 47.0% , 49.6% , 53.6% , and 56.1% , respectively ( ptrend<0.001 ) . the figure demonstrates the percent incidence and adjusted odds ratio ( or ) for inhospital mortality , timely reperfusion , use of percutaneous assist devices / intraaortic balloon pump ( iabp ) , and swan ganz catheterization , stratified by zipcodebased socioeconomic quartiles . quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more . sensitivity analysis was performed by comparing the primary outcomes between the study groups after removing all patients who presented as a transfer from another healthcare facility . there was no significant change in the trend of the incidence of the primary outcomes across the ses quartiles with this sensitivity analysis ( figure 2 ) . figure 1 also demonstrates the utilization of percutaneous assist / intraaortic balloon pump and swan ganz catheterization , stratified by ses quartiles . as seen in this figure , there was a progressively reduced utilization of both modalities among patients from lower ses quartiles as compared to higher quartiles . the incidence of cardiogenic shock accompanying stemi in ses quartiles 1 to 4 was similar at 8.4% , 8.3% , 8.4% , and 8.8% , respectively ( ptrend : 0.08 ) . the percent incidence and adjusted odds ratio ( or ) for inhospital death and timely reperfusion , stratified by zipcodebased socioeconomic quartiles after eliminating all patients who were transferred from an outside healthcare facility . quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more . the impact of timely reperfusion on inhospital mortality and long hospital stay was investigated by stratifying these outcomes according to the timeliness of the reperfusion therapy . figure 3 demonstrates the incidence and adjusted odds ratio for inhospital mortality across the ses quartiles , stratified by timeliness of reperfusion . the incidence of inhospital mortality was significantly higher among patients who had delayed or no reperfusion therapy as compared to those who underwent timely reperfusion ( p<0.001 ) . however , there was no significant difference in the incidence of inhospital mortality across the ses quartiles among those who did not undergo timely reperfusion . on the contrary , among those who underwent timely reperfusion , the incidence of inhospital death was significantly higher for the lower ses quartiles as compared to the higher quartiles . the percent incidence and adjusted odds ratio ( or ) for inhospital death for various socioeconomic quartiles stratified by the timing of reperfusion therapy . patients undergoing delayed / no reperfusion are shown in the top panel and those undergoing timely reperfusion are shown in the bottom panel . quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more . the mean ( sd ) cost of hospitalization was $ 23 529 ( $ 22 983 ) , $ 23 999 ( $ 23 625 ) , $ 25 800 ( $ 25 391 ) , and $ 28 060 ( $ 28 657 ) among ses quartiles 1 to 4 , respectively . after adjustment for baseline demographic and clinical characteristics including primary payment source , the adjusted costs of hospitalization of patients from ses quartiles 2 , 3 , and 4 were significantly higher when compared to the cost of hospitalization of patients from ses quartile 1 ( p0.001 for all comparisons ) . as compared to quartile 1 , mean adjusted cost of hospitalization for patients from quartile 4 was higher by $ 4070 ( 95% ci : $ 2877 to $ 5263 ) . similarly , the mean adjusted cost of hospitalization for patients from quartiles 2 and 3 were higher by $ 913 ( 95% ci : $ 380 to $ 1447 ) and $ 2140 ( 95% ci : $ 1391 to $ 2888 ) as compared to the costs of hospitalization of patients from ses quartile 1 . subgroup analyses demonstrating the differential impact of gender , race , and age on inhospital death and timely reperfusion have been demonstrated in tables 2 and 3 , respectively . the inhospital mortality rates were noted to be significantly higher among females as compared to males for all ses quartiles ( p<0.001 for all comparisons ) . in addition , the inhospital mortality among females as well as males from the lowest ses was significantly higher than their counterparts in the higher ses quartiles . furthermore , males and females from the lower ses quartiles were significantly less likely to undergo timely reperfusion as compared to their counterparts from the higher ses quartiles . percent incidence and odds ratio for inhospital death according to zipcodebased socioeconomic quartiles stratified by gender , race , or age all quartiles were based on the median household income of the respective zip code . quartile 1 : $ 1 to $ 38 999 ; quartile 2 : $ 39 000 to $ 47 999 ; quartile 3 : $ 48 000 to 63 000 ; quartile 4 : $ 63 000 or more . percent incidence and odds ratio for timely reperfusion therapy according to zipcodebased socioeconomic quartiles stratified by gender , race , or age quartile 1 : $ 1 to $ 38 999 ; quartile 2 : $ 39 000 to $ 47 999 ; quartile 3 : $ 48 000 to 63 000 ; quartile 4 : $ 63 000 or more . on stratification of the study population into whites and nonwhites , we did not observe any significant differences in the incidence of inhospital mortality and timely reperfusion between these 2 racial groups . in both racial strata , we observed a statistically significant trend of an increase in inhospital mortality and a reduction in timely reperfusion among patients belonging to lower ses quartiles as compared to higher ses quartiles . furthermore , the incidence of inhospital mortality and delayed / no reperfusion therapy was significantly higher among elderly patients ( 75 years ) as compared to their younger counterparts ( p<0.001 for all comparisons ) . although inhospital mortality among the elderly did not seem to be affected by the ses quartile , elderly from the 2 lowest ses quartiles were less likely to undergo a timely reperfusion ( table 3 ) . in the younger cohort , there was a significantly higher incidence of inhospital mortality and a reduced incidence of timely reperfusion among patients from lower ses as compared to those from higher ses quartiles . there were several differences in the baseline characteristics between the elderly patients and their younger counterparts , which could potentially explain these differences ( table 4 ) . comparison of baseline characteristics of young ( < 75 y ) and old ( 75 y ) patients from the lowest socioeconomic status data are expressed as number ( percentage ) except where specified . we have evaluated the impact of residential zipcodebased classification of ses upon adverse events following stemi utilizing a large representative nationwide sample in the united states . we observed a progressive increase in the absolute and adjusted inhospital mortality after stemi with a progressive decline in the median household income of a patient 's residential zip code . besides this , there was a highly significant trend indicating a progressively reduced timely reperfusion among patients from lower ses quartiles , as compared to those from higher quartiles . we did not observe any significant difference in the inhospital mortality among patients who did not undergo timely reperfusion therapy . however , the mortality among these patients was significantly higher than those who underwent timely reperfusion in all ses strata . despite a higher occurrence of inhospital mortality among patients from a lower ses quartile , there was a progressively reduced utilization of mechanical circulatory support among patients from lower ses quartiles as compared to higher quartiles . in addition , the cost of hospitalization of patients from the lower ses quartiles was less as compared to those from higher ses quartiles . whether this represents an underutilization of resources for patients from lower ses zip codes or this represents an overutilization of resources for patients from higher ses zip codes is not completely clear from this analysis . however , our analysis has demonstrated a significant disparity in both inhospital outcomes as well as resource utilization for stemi patients , depending on residential zip code . the differences in ses have been consistently associated with variations in cardiovascularrelated morbidity and mortality . individuals residing in neighborhoods with a lower ses have a higher prevalence of cardiovascular risk factors such as hypertension , diabetes , obesity , and smoking accounting for the observed association between the contextual factors and outcomes following stemi . however , these statistically significant yet clinically underwhelming differences in cardiovascular risk factors are unlikely to be a sole explanation for differences in clinical outcomes . in addition , the differences in clinical outcomes between the ses quartiles persist despite adjustment for baseline cardiovascular risk factors , suggesting that other factors in healthcare access and delivery likely play a role . lower ses has been demonstrated to limit access to medical care and to bias these patients to present to smaller , lowvolume hospitals without invasive cardiac procedures and with lower utilization of evidencebased therapies . the differences in outcome in our analysis , however , persisted despite adjustment for hospital characteristics . it is possible that an unmeasured prehospital variable clustered by ses may account for the mortality differences noted . these include timely activation and performance characteristics of the local emergency medical services systems , inappropriate triage , and transport to nonreperfusion hospitals . other novel variables including functional capacity and autonomic functions such as heart rate recovery have been previously shown to differentially impact outcomes according to ses . there is a large body of literature that has evaluated the existence and impact of racial disparities on outcomes following acute mi . although we found a significant higher proportion of nonwhites in the lower socioeconomic strata , socioeconomic disparity and racial disparity are hardly interchangeable terms . it has been demonstrated that if all patients with stemi were treated with an identical protocol for primary pci , there would be no racial disparity in clinical outcomes . hence , although it is convenient to label patients by race , factors that relate to ses such as income , education , housing , and social awareness are probably more important in healthrelated outcomes . socioeconomic position has been speculated to be a greater impediment to optimal cardiovascular health rather than biologically implausible surrogates of race and sex . despite a breadth of evidence spanning the relationship of racial disparities with adverse cardiovascular outcomes , relatively fewer studies have exclusively evaluated the role of ses on cardiovascular outcomes following stemi . using administrative data from canada , alter et al demonstrated that a progressive improvement in the ses , measured using neighborhood median income level , predicted a greater use of coronary angiography , shorter waiting times for heart catheterization , and lower shortterm mortality following acute mi . these findings from this seminal study published 15 years ago are likely not easily extrapolated to the current us population , where there may be greater disparities in the distribution and the utilization of healthcare resources along with a greater degree of economic segregation as compared to canada . furthermore , these studies belong to an era when primary pci was not the mainstay of treatment of stemi and the emphasis on doortoballoon time optimization was just beginning . over the last decade , we have made remarkable progress in the delivery of optimal reperfusion for patients with stemi . there is ample evidence to demonstrate a major reduction in doortoneedle times and doortoballoon times over the past few years . however , the time between the symptom onset and the first medical contact among stemi patients has hardly changed . we believe that socioeconomic parameters have a small impact on the doortoballoon times after a patient presents to a healthcare facility . however , a greater degree of impact of ses probably occurs on the duration between symptom onset and first medical contact . several socioeconomic and sociocultural factors including education , access to healthcare resources , income , and awareness might play important roles in determining the overall total ischemic time following stemi , thereby directly impacting the outcome . further , one could argue that the impact of environment , substituted by an aggregate zip code income , might provide a greater degree of insight into society health dynamics and interactions than individual household income . in addition to detailed perspective on relationship of ses with adverse outcomes after stemi , our study also provides some additional data that might form the basis of future studies . this is in keeping with earlier findings from multiple studies . whether these genderbased outcome differences reflect true biological differences or are more indicative of differing socioeconomic profiles that render female gender a surrogate for poor outcome is a matter of speculation at this time similarly , elderly patients with stemi have been traditionally believed to possess a guarded prognosis due to multiple comorbidities , more delay in seeking care , atypical presentations , and a higher degree of hemodynamic compromise compared to younger patients . we observed that the ses mortality association was stronger for the younger population than the elderly . this is in conjunction with earlier findings where the association between ses and cardiovascular mortality appeared to be less marked among older patients . although the mechanisms underlying these associations are not completely clear , potential hypotheses include improved coping skills among elderly , perhaps attributable to having lived longer under adverse socioeconomic circumstances along with an increased access to healthcare resources due to public insurance programs available to older individuals . first , nis is an administrative database , which may be subject to errors in coding of diseases or procedures . however , in administrative databases , the diagnosis of acute mi using icd9 cm coding has been demonstrated to possess a specificity of 99.5% , sensitivity of 72.4% , negative predictive value of 96.1% , and a positive predictive value of 95.9% . second , this is a retrospective observational study , which may be subject to traditional biases of observational studies such as selection bias . however , these limitations might be partially compensated for , due to a large size of nis database and a uniform representation of all regions of the united states . third , the definition of timely reperfusion included all patients who underwent reperfusion on day 0 of admission to the hospital , due to lack of availability of hourly data . this definition might lend itself to slight overinclusion of patients who may not have undergone timely reperfusion by strict stemi standards . a further limitation might result from the fact that we utilized median household income of the entire zip code to the capability of an individual measure like the median household income of the residential zip code , rather than a composite measure , to directly relate to the ses of each patient may be somewhat limited . however , the inaccuracy resulting from the misclassification of personal ses based on ses of the surrounding neighborhood ( so called ecologic fallacy ) may be completely offset by the lack of occurrence of an individualistic fallacy , whereby there is an incorrect assumption that the health of an individual subject is not affected by the neighborhood that they reside in . in addition , inhospital mortality may be affected by numerous variables including availability of pci facilities with relevant expertise , provider volume , hospital infrastructure , and surgical backup , which are not always available consistently in the nis database . first , nis is an administrative database , which may be subject to errors in coding of diseases or procedures . however , in administrative databases , the diagnosis of acute mi using icd9 cm coding has been demonstrated to possess a specificity of 99.5% , sensitivity of 72.4% , negative predictive value of 96.1% , and a positive predictive value of 95.9% . second , this is a retrospective observational study , which may be subject to traditional biases of observational studies such as selection bias . however , these limitations might be partially compensated for , due to a large size of nis database and a uniform representation of all regions of the united states . third , the definition of timely reperfusion included all patients who underwent reperfusion on day 0 of admission to the hospital , due to lack of availability of hourly data . this definition might lend itself to slight overinclusion of patients who may not have undergone timely reperfusion by strict stemi standards . a further limitation might result from the fact that we utilized median household income of the entire zip code to the capability of an individual measure like the median household income of the residential zip code , rather than a composite measure , to directly relate to the ses of each patient may be somewhat limited . however , the inaccuracy resulting from the misclassification of personal ses based on ses of the surrounding neighborhood ( so called ecologic fallacy ) may be completely offset by the lack of occurrence of an individualistic fallacy , whereby there is an incorrect assumption that the health of an individual subject is not affected by the neighborhood that they reside in . in addition , inhospital mortality may be affected by numerous variables including availability of pci facilities with relevant expertise , provider volume , hospital infrastructure , and surgical backup , which are not always available consistently in the nis database . there was a higher incidence of inhospital death among patients residing in low ses zip codes , as compared to those who live in high ses zip codes . besides this , there was a reduced prevalence of timely reperfusion among patients from low ses zip codes . the use of mechanical circulatory support devices was paradoxically lower among those who belonged to the low ses zip codes as compared to the higher ses zip codes , despite a higher mortality in the low ses quartiles . furthermore , the absolute as well as adjusted cost of hospitalization was significantly higher for those who belonged to a high ses zip code as compared to those who belonged to low ses zip code . these data suggest that there are widespread differences in timely access and provision of optimal stemi care based on socioeconomic differences , which may be responsible for adverse health outcomes in those that reside in low ses areas .

backgroundsocioeconomic status ( ses ) as reflected by residential zip code status may detrimentally influence a number of prehospital clinical , accessrelated , and transport variables that influence outcome for patients with stelevation myocardial infarction ( stemi ) undergoing reperfusion . we sought to analyze the impact of ses on inhospital mortality , timely reperfusion , and cost of hospitalization following stemi.methods and resultswe used the 20032011 nationwide inpatient sample database for this analysis . all hospital admissions with a principal diagnosis of stemi were identified using icd9 codes . ses was assessed using median household income of the residential zip code for each patient . there was a significantly higher mortality among the lowest ses quartile as compared to the highest quartile ( or [ 95% ci ] : 1.11 [ 1.06 to 1.17 ] ) . similarly , there was a highly significant trend indicating a progressively reduced timely reperfusion among patients from lower quartiles ( or [ 95% ci ] : 0.80 [ 0.74 to 0.88 ] ) . in addition , there was a lower utilization of circulatory support devices among patients from lower as compared to higher zip code quartiles ( or [ 95% ci ] : 0.85 [ 0.75 to 0.97 ] ) . furthermore , the mean adjusted cost of hospitalization among quartiles 2 , 3 , and 4 , as compared to quartile 1 was significantly higher by $ 913 , $ 2140 , and $ 4070 , respectively.conclusionspatients residing in zip codes with lower ses had increased inhospital mortality and decreased timely reperfusion following stemi as compared to patients residing in higher ses zip codes . the cost of hospitalization of patients from higher ses quartiles was significantly higher than those from lower quartiles .

plants infested with herbivores release specific volatile compounds that are involved in the attraction of natural enemies of these herbivores ( dicke and van loon 2000 ; sabelis et al . it is well established that the composition of the blends of volatiles depends on the species of herbivore ( sabelis and van de baan 1983 ; de moraes et al . 1998 ) and the degree of infestation ( du et al . 1998 ; maeda and takabashi 2001 ; nachappa et al . therefore , the hypothesis was put forward that herbivore - induced plant volatiles may serve the natural enemies , such as predatory mites , as a signal of prey presence ( dicke and sabelis 1988 ; dicke and van loon 2000 ; kessler and baldwin 2001 ; janssen et al . however , a single herbivore species may induce qualitatively and quantitatively different volatile blends on different plant species ( van den boom et al . . moreover , in natural settings the blends of volatiles produced by plants infested with various herbivore species will mix ( shrder and hilker 2008 ) . these results beg the question whether predators can extract a signal of prey presence from the variation in the blends of herbivore - induced plant volatiles . adaptive learning may serve to update predator preferences for specific volatiles ( or their mixtures ) if these are experienced in the presence of suitable prey ( drukker et al . 2000 ; de boer and dicke 2004a , de boer et al . 2005 ; takabayashi et al . moreover , a genetically determined response to specific volatiles may evolve by natural selection if these volatiles are consistently associated with the presence of suitable prey and genetic variation in predator response to these volatiles exists ( allison and hare 2009 ) . we studied the response to selection imposed within iso - female lines established from a population of the predatory mite phytoseiulus persimilis athias - henriot ( acari : phytoseiidae ) that was collected in the field . in particular , we asked whether it is possible to obtain lines of p. persimilis expressing contrasting responses to a specific plant volatile , methyl salicylate ( mesa ) . mesa is consistently part of the blend of volatiles induced by feeding of the herbivorous mite tetranychus urticae koch ( acari : tetranychidae)the prey of p. persimilis on a variety of plant species ( van den boom et al . phytoseiuluspersimilis is attracted to a range of concentrations of mesa presented in pure form ( dicke et al . ( 2010 ) dramatically reduced the emission of mesa in tomato plants infested with t. urticae without changing the induced emission of the remaining volatiles and found that p. persimilis no longer differentiated between the infested and uninfested plants . together , the evidence supports the hypothesis that the response of p. persimilis to mesa may aid the predator in its search for prey and thus influence its fitness , although evidence for life - time fitness benefits under natural settings is yet to be shown . furthermore , natural populations of p. persimilis harbour genetic variation in their response to mesa when offered as a pure compound , against a background of volatiles from uninfested plants ( sznajder et al . 2010 ) , as well as genetic variation in the response to the blends of plant volatiles induced by two - spotted spider mites on lima bean plants ( margolies et al . 1997 ; jia et al . 2002 ) . thus , there is potential for the evolution of predator responses to mesa through natural selection . we imposed purifying selection for contrasting responses of p. persimilis to mesa when offered as a pure compound . the selection was performed on individuals within iso - female lines and two groups of iso - female lines were established where in one group the lines were propagated via females that showed a preference for mesa , whereas in the second group the lines were propagated via females that avoided mesa . this procedure aimed at setting apart and fixing genotypes distinct with respect to predator response to mesa in genetically homozygous lines . lines were thus purified in six rounds of selection , and the response to mesa was measured after three and six rounds . the base population and the iso - female lines of p. persimilis were maintained in a climate room ( 25c , 70% humidity , and light : dark = 16:8 ) on a diet of t. urticae offered on detached leaves of lima bean plants . fresh leaves of lima bean plants infested by two - spotted spider mites were provided on a daily basis to each individual population . the base population originated from a sample of predators collected in 2002 at different locations throughout sicily ( partinico , scopella , trappeto , terrasini , siculiana , laghetto , menfi , trabia , alcamo ) . thus , it was presumably genetically variable , although local populations of p. persimilis are generally considered to be inbred under natural settings ( helle and overmeer 1973 ) . previous work ( sznajder et al . 2010 ) showed that variation among iso - female lines in their mean response to mesa is greater when the predators are starved . these were obtained by food deprivation applied for 24 h prior to a selection test . during the period of food deprivation females were kept in an eppendorf vial at 18c with water provided in a strip of wet filter paper . the vial had a gauze - covered opening to allow for airflow but was otherwise sealed . the iso - female lines were established by mated females selected from the base population in the first round of selection ( a single binary choice - test for mesa vs. clean air ; the details of this choice - test follow in the next section ) as illustrated in fig . 1 . typically in haplodiploid arthropods such lines are obtained through mating between a virgin female and her sons . however , p. persimilis is pseudo - arrhenotokous , i.e. sons and daughters arise from fertilized eggs and male zygotes become haploid due to paternal genome inactivation and elimination during embryogenesis ( helle et al . hence , mating is a prerequisite for producing eggs destined to become females as well as males . therefore , in order to establish iso - female lines we selected females that had already mated , instead of virgin females , and maintained these lines by brother - sister mating . by doing so we did not control for the genetic contribution of males to the next generation . however , assuming additive genetic variation for the selected trait and random mating , the confounding effect of the genetic contribution via unknown males was expected to be eradicated in the course of the selection rounds.fig . 1selection within iso - female lines is illustrated on the example of the singleline a and its descendinglines during the first three selection episodes ( see selection within iso - female line for details ) . note that the label of the iso - female line carries information on relatedness among the lines , i.e. first letter / number indicates the identity of the female selected in the first round of selection ( i.e. founder ) , second letters / numbers indicate the identity of her daughters selected to continue the line by each establishing a new line , and so on selection within iso - female lines is illustrated on the example of the singleline a and its descendinglines during the first three selection episodes ( see selection within iso - female line for details ) . note that the label of the iso - female line carries information on relatedness among the lines , i.e. first letter / number indicates the identity of the female selected in the first round of selection ( i.e. founder ) , second letters / numbers indicate the identity of her daughters selected to continue the line by each establishing a new line , and so on in the first selection round ( fig . 1 ) we established two groups of iso - female lines originating either from ( 1 ) the females that showed a preference for mesa ( 15 lines , referred to as plus lines ) or ( 2 ) the females that showed an avoidance of mesa ( 9 lines , referred to as minus lines ) . the females selected in the first round are further referred to as founders of the iso - female lines ( or founders for shorthand ) . each iso - female line was further propagated via females whose responses were consistent with the response of the founder of their line . propagation of the lines was performed on the basis of single choice - tests ( see next section ) and the females that made the same choice as the founder of their line were placed each in a separate petri dish to establish descendant iso - female lines . the developmental time from egg to adult in p. persimilis is about 7 days ( sabelis 1981 ) and a female lays about 3 eggs per day under laboratory conditions prevailing in this study . thus , by applying selection round every 2.5 weeks we ensured there were at least about 10 mated females available for continued selection on each iso - female line . in total however , using the above procedure the number of lines would grow exponentially with every selection round ( even though some lines failed to establish ) . therefore , after three selection rounds we temporarily halted the experiment in order to evaluate the responses of already established lines . the mean responses of these lines were evaluated relative to the mean response of the base population measured at the start of the selection experiment . selection was continued in plus lines where the mean proportion of individuals choosing mesa was not lower than in the base population ( i.e. 0.64 ) , and in minus lines where the mean proportion was not higher than in the base population . based on this criterion we resumed selection in four plus lines and in three minus lines . thus , after another three rounds of selection we established 19 plus lines and 14 minus lines . genetic exchange among the iso - female lines was prevented by maintaining each line in a sealed large petri dish with a small opening covered with gauze ( mesh width = 0.07 mm , average adult predator size = 0.5 mm , average predator egg size = 0.2 mm , thus the mesh width is small enough to prevent immigration and emigration ) to allow for airflow . a rearing was accessed by opening the petri dish on an alcohol - cleaned surface . prior to opening and after re - sealing , the outside surface of the petri dish was cleaned with an alcohol - soaked cloth . we used a choice - test between mesa in pure form and clean air to ( 1 ) select individual females with respect to their response to mesa within iso - female lines , and to ( 2 ) evaluate the mean responses of these lines after three and six rounds of selection . we used a single choice - test to determine the behaviour of the predator in order to exclude the possibility that the experience with the presentation of mesa in the experimental set - up influenced its response to mesa . individuals that chose to walk towards the clean air source were interpreted as avoiding mesa , while individuals that chose to walk towards the mesa source were interpreted as having a preference for mesa . the responses of the iso - female lines were calculated as the mean proportion of females choosing mesa ( the number of adult females per replicate experiment varied between 17 and 25 ) . the choice - test was conducted in a so - called i - tube olfactometer : a single straight glass tube ( length 20 cm , 0.5 cm ) with a small opening ( 2 mm ) in the middle to introduce the predatory mites ( here we give an abbreviated description of this setup ; for a full description see sznajder et al . this olfactometer was provided with a trap at the end of either arm of the i - tube to collect predators . opposite the entrance hole , another opening ( 0.5 cm ) was present which was gauze - covered and served as an air - outlet . at the ends of the i - tube there were plastic trap vials ( 30 mm , height 55 mm ) which in turn were connected to jars that either contained a capillary with mesa or not . the traps were designed as an easy - to - enter - yet - difficult - to - exit vial , and were provided with a water source ( wet cotton wool ) . l / h through the jars , the vials and the arms of the glass tube , leaving the system through the opening in the middle of the i - tube . at release in the middle of the i - tube , a predatory mite finds itself in air streams coming from right and left , i.e. one with mesa and the other without . subsequently , it can move left or right in the i - tube and ultimately it enters one of the trap vials or it stays in the i - tube . after release of the test animals , pilot experiments showed that the i - tube olfactometer produces results consistent with our knowledge of the responses of p. persimilis to herbivore - induced plant volatiles ( van wijk , unpublished data ) . within a single replicate experiment a group of females was released sequentially into the i - tube , i.e. the individuals were released in the olfactometer one after the other . visual cues play no role in predator orientation as the predator is blind and orients itself by means of chemical cues . previous studies using a y - tube set - up showed that there is no effect of possible residues deposited along the path taken by an individual on the choices of subsequent individuals ( sabelis and van de baan 1983 ; van wijk et al . after 25 min , the number of mites in each of the two trap vials was counted . the number that remained in the i - tube , was scored as no choice . for each replicate of a line , a new clean i - tube was used and the side of the arm containing air with mesa was interchanged to exclude any effects of unforeseen asymmetries in the experimental set - up . synthetic mesa ( sigma aldrich fluka , pure ; assay 99% ) was offered undiluted in a small capillary ( 9 l , 0.60 mm , omnilabo ) placed in one of the jars connected to the i - tube . the air flow through the set - up was started at least 2 h before the start of the test . the mesa evaporation rate was 30 g / h . this evaporation rate was chosen based on the responses elicited in the general population . in particular , in order to increase our chances of detecting selection for both and increased and decreased response to mesa we used the concentration that elicits neutral responses ( 50:50 ) in the base population . we hypothesized that the propagation of iso - female lines through individuals that exhibited either preference for mesa or aversion to mesa would lead to a shift in the mean responses of those lines towards , respectively , preference for mesa or aversion to mesa . therefore , we asked whether there was a significant difference in the mean response to mesa between the plus lines and the minus lines after three and ( or ) six rounds of selection . moreover , we wished to make inferences about the sources of random variation due to iso - female line . to this end , we constructed a mixed - effects model ( pinheiro and bates 2000 ; venables and ripley 2002 ) that included the fixed effects of ( 1 ) the selection treatment ( two levels : selection for a preference for mesa , selection for an aversion to mesa ) , ( 2 ) the time point at which the average responses of the iso - female lines were determined ( two levels : after the 3rd round of selection , after the 6th round of selection ) and ( 3 ) the proportion of no - choice individuals as a covariate . the model assesses the effect of these factors on the proportion of individuals choosing mesa calculated for each replicate . the random effect consisted of the factor iso - female line nested in the factor founder ( where founder was the female selected in the first round of selection , see selection ) . such a grouping structure reflected relatedness among the iso - female lines as determined by the first common founder of these lines . the diagnostics plots for the untransformed response variable showed that the assumptions of the mixed - effects model were satisfied ( the random variables were normally distributed with mean zero and independent for different groups , and the within - group errors were independent and normally distributed around a mean of zero ) . for this reason the analysis was performed on untransformed data , using splus 6.2 software ( pinheiro and bates 2002 ) . the significance of the fixed effects , their interaction and the significance of the random effect was tested using likelihood ratio tests ( pinheiro and bates 2000 ; venables and ripley 2002 ) . the base population and the iso - female lines of p. persimilis were maintained in a climate room ( 25c , 70% humidity , and light : dark = 16:8 ) on a diet of t. urticae offered on detached leaves of lima bean plants . fresh leaves of lima bean plants infested by two - spotted spider mites were provided on a daily basis to each individual population . the base population originated from a sample of predators collected in 2002 at different locations throughout sicily ( partinico , scopella , trappeto , terrasini , siculiana , laghetto , menfi , trabia , alcamo ) . thus , it was presumably genetically variable , although local populations of p. persimilis are generally considered to be inbred under natural settings ( helle and overmeer 1973 ) . previous work ( sznajder et al . 2010 ) showed that variation among iso - female lines in their mean response to mesa is greater when the predators are starved . these were obtained by food deprivation applied for 24 h prior to a selection test . during the period of food deprivation females were kept in an eppendorf vial at 18c with water provided in a strip of wet filter paper . the vial had a gauze - covered opening to allow for airflow but was otherwise sealed . the iso - female lines were established by mated females selected from the base population in the first round of selection ( a single binary choice - test for mesa vs. clean air ; the details of this choice - test follow in the next section ) as illustrated in fig . 1 . typically in haplodiploid arthropods such lines are obtained through mating between a virgin female and her sons . however , p. persimilis is pseudo - arrhenotokous , i.e. sons and daughters arise from fertilized eggs and male zygotes become haploid due to paternal genome inactivation and elimination during embryogenesis ( helle et al . hence , mating is a prerequisite for producing eggs destined to become females as well as males . therefore , in order to establish iso - female lines we selected females that had already mated , instead of virgin females , and maintained these lines by brother - sister mating . by doing so we did not control for the genetic contribution of males to the next generation . however , assuming additive genetic variation for the selected trait and random mating , the confounding effect of the genetic contribution via unknown males was expected to be eradicated in the course of the selection rounds.fig . 1selection within iso - female lines is illustrated on the example of the singleline a and its descendinglines during the first three selection episodes ( see selection within iso - female line for details ) . note that the label of the iso - female line carries information on relatedness among the lines , i.e. first letter / number indicates the identity of the female selected in the first round of selection ( i.e. founder ) , second letters / numbers indicate the identity of her daughters selected to continue the line by each establishing a new line , and so on selection within iso - female lines is illustrated on the example of the singleline a and its descendinglines during the first three selection episodes ( see selection within iso - female line for details ) . note that the label of the iso - female line carries information on relatedness among the lines , i.e. first letter / number indicates the identity of the female selected in the first round of selection ( i.e. founder ) , second letters / numbers indicate the identity of her daughters selected to continue the line by each establishing a new line , and so on in the first selection round ( fig . 1 ) we established two groups of iso - female lines originating either from ( 1 ) the females that showed a preference for mesa ( 15 lines , referred to as plus lines ) or ( 2 ) the females that showed an avoidance of mesa ( 9 lines , referred to as minus lines ) . the females selected in the first round are further referred to as founders of the iso - female lines ( or founders for shorthand ) . each iso - female line was further propagated via females whose responses were consistent with the response of the founder of their line . propagation of the lines was performed on the basis of single choice - tests ( see next section ) and the females that made the same choice as the founder of their line were placed each in a separate petri dish to establish descendant iso - female lines . the developmental time from egg to adult in p. persimilis is about 7 days ( sabelis 1981 ) and a female lays about 3 eggs per day under laboratory conditions prevailing in this study . thus , by applying selection round every 2.5 weeks we ensured there were at least about 10 mated females available for continued selection on each iso - female line . however , using the above procedure the number of lines would grow exponentially with every selection round ( even though some lines failed to establish ) . therefore , after three selection rounds we temporarily halted the experiment in order to evaluate the responses of already established lines . the mean responses of these lines were evaluated relative to the mean response of the base population measured at the start of the selection experiment . selection was continued in plus lines where the mean proportion of individuals choosing mesa was not lower than in the base population ( i.e. 0.64 ) , and in minus lines where the mean proportion was not higher than in the base population . based on this criterion we resumed selection in four plus lines and in three minus lines . thus , after another three rounds of selection we established 19 plus lines and 14 minus lines . genetic exchange among the iso - female lines was prevented by maintaining each line in a sealed large petri dish with a small opening covered with gauze ( mesh width = 0.07 mm , average adult predator size = 0.5 mm , average predator egg size = 0.2 mm , thus the mesh width is small enough to prevent immigration and emigration ) to allow for airflow . a rearing was accessed by opening the petri dish on an alcohol - cleaned surface . prior to opening and after re - sealing , the outside surface of the petri dish was cleaned with an alcohol - soaked cloth . we used a choice - test between mesa in pure form and clean air to ( 1 ) select individual females with respect to their response to mesa within iso - female lines , and to ( 2 ) evaluate the mean responses of these lines after three and six rounds of selection . we used a single choice - test to determine the behaviour of the predator in order to exclude the possibility that the experience with the presentation of mesa in the experimental set - up influenced its response to mesa . individuals that chose to walk towards the clean air source were interpreted as avoiding mesa , while individuals that chose to walk towards the mesa source were interpreted as having a preference for mesa . the responses of the iso - female lines were calculated as the mean proportion of females choosing mesa ( the number of adult females per replicate experiment varied between 17 and 25 ) . the choice - test was conducted in a so - called i - tube olfactometer : a single straight glass tube ( length 20 cm , 0.5 cm ) with a small opening ( 2 mm ) in the middle to introduce the predatory mites ( here we give an abbreviated description of this setup ; for a full description see sznajder et al . this olfactometer was provided with a trap at the end of either arm of the i - tube to collect predators . opposite the entrance hole , another opening ( 0.5 cm ) was present which was gauze - covered and served as an air - outlet . at the ends of the i - tube there were plastic trap vials ( 30 mm , height 55 mm ) which in turn were connected to jars that either contained a capillary with mesa or not . the traps were designed as an easy - to - enter - yet - difficult - to - exit vial , and were provided with a water source ( wet cotton wool ) . after purification by activated carbon filters , air was flowing at 20 l / h through the jars , the vials and the arms of the glass tube , leaving the system through the opening in the middle of the i - tube . at release in the middle of the i - tube , a predatory mite finds itself in air streams coming from right and left , i.e. one with mesa and the other without . subsequently , it can move left or right in the i - tube and ultimately it enters one of the trap vials or it stays in the i - tube . after release of the test animals , pilot experiments showed that the i - tube olfactometer produces results consistent with our knowledge of the responses of p. persimilis to herbivore - induced plant volatiles ( van wijk , unpublished data ) . within a single replicate experiment a group of females was released sequentially into the i - tube , i.e. the individuals were released in the olfactometer one after the other . visual cues play no role in predator orientation as the predator is blind and orients itself by means of chemical cues . previous studies using a y - tube set - up showed that there is no effect of possible residues deposited along the path taken by an individual on the choices of subsequent individuals ( sabelis and van de baan 1983 ; van wijk et al . after 25 min , the number of mites in each of the two trap vials was counted . the number that remained in the i - tube , was scored as no choice . for each replicate of a line , a new clean i - tube was used and the side of the arm containing air with mesa was interchanged to exclude any effects of unforeseen asymmetries in the experimental set - up . synthetic mesa ( sigma aldrich fluka , pure ; assay 99% ) was offered undiluted in a small capillary ( 9 l , 0.60 mm , omnilabo ) placed in one of the jars connected to the i - tube . the air flow through the set - up was started at least 2 h before the start of the test . the mesa evaporation rate was 30 g / h . this evaporation rate was chosen based on the responses elicited in the general population . in particular , in order to increase our chances of detecting selection for both and increased and decreased response to mesa we used the concentration that elicits neutral responses ( 50:50 ) in the base population . we hypothesized that the propagation of iso - female lines through individuals that exhibited either preference for mesa or aversion to mesa would lead to a shift in the mean responses of those lines towards , respectively , preference for mesa or aversion to mesa . therefore , we asked whether there was a significant difference in the mean response to mesa between the plus lines and the minus lines after three and ( or ) six rounds of selection . moreover , we wished to make inferences about the sources of random variation due to iso - female line . to this end , we constructed a mixed - effects model ( pinheiro and bates 2000 ; venables and ripley 2002 ) that included the fixed effects of ( 1 ) the selection treatment ( two levels : selection for a preference for mesa , selection for an aversion to mesa ) , ( 2 ) the time point at which the average responses of the iso - female lines were determined ( two levels : after the 3rd round of selection , after the 6th round of selection ) and ( 3 ) the proportion of no - choice individuals as a covariate . the model assesses the effect of these factors on the proportion of individuals choosing mesa calculated for each replicate . the random effect consisted of the factor iso - female line nested in the factor founder ( where founder was the female selected in the first round of selection , see selection ) . such a grouping structure reflected relatedness among the iso - female lines as determined by the first common founder of these lines . the diagnostics plots for the untransformed response variable showed that the assumptions of the mixed - effects model were satisfied ( the random variables were normally distributed with mean zero and independent for different groups , and the within - group errors were independent and normally distributed around a mean of zero ) . for this reason the analysis was performed on untransformed data , using splus 6.2 software ( pinheiro and bates 2002 ) . the significance of the fixed effects , their interaction and the significance of the random effect was tested using likelihood ratio tests ( pinheiro and bates 2000 ; venables and ripley 2002 ) . the mean proportion of individuals choosing mesa was 0.64 at the start ( se = 0.15 , n = 57 ) as well as at the end of the selection experiment ( se = 0.13 , n = 101 ) . in contrast , after three rounds of selection the mean responses of the selected iso - female lines were variable and include preference and aversion in both the plus and the minus lines ( fig . this variation among the iso - female lines was slightly lower after six rounds of selection ( fig . however , the variation in the mean responses of the minus lines was shifted in the direction opposite to the selected criterion , as compared to the mean responses shown by their ancestral lines after three rounds of selection.fig . 2the responses of the iso - female lines selected to prefer mesa ( labelled with letters ) and the lines selected to avoid mesa ( labelled with numbers ) obtained after a three and b six rounds of selection . the empty circle represents the proportion of individuals choosing mesa per replicate ( n = 1525 individuals ) calculated excluding the no - choice individuals . the filled circles indicate the mean proportions of individuals choosing mesa calculated per iso - female line . the dotted vertical line indicates the response of the base population at the start of the selection . a were selected past the third selection round ( see selection ; fig . 3 ) . note that the relatedness among the lines is indicated by the labels of the lines ( see also fig . 1 ) . hence , e.g. the linesfaafac and fba share their great grandmother f ( i.e. the founder ) , and the linesfaa and fac share also their grandmother a the responses of the iso - female lines selected to prefer mesa ( labelled with letters ) and the lines selected to avoid mesa ( labelled with numbers ) obtained after a three and b six rounds of selection . the empty circle represents the proportion of individuals choosing mesa per replicate ( n = 1525 individuals ) calculated excluding the no - choice individuals . the filled circles indicate the mean proportions of individuals choosing mesa calculated per iso - female line . the dotted vertical line indicates the response of the base population at the start of the selection . note that not all the lines presented in fig . note that the relatedness among the lines is indicated by the labels of the lines ( see also fig . 1 ) . hence , e.g. the linesfaafac and fba share their great grandmother f ( i.e. the founder ) , and the linesfaa and fac share also their grandmother a we did not find a significant difference in the mean responses to mesa between the plus and minus lines ( likelihood ratio test pselection = 0.09 , table 1 ) . this was the case after three rounds of selection as well as after six rounds of selection ( likelihood ratio test ptime - point = 0.21 , table 1 ) . however , we found an interaction between the selection and the time - point at which the responses of the lines were measured ( likelihood ratio test , pselection : time - point = 0.02 , table 1 ) . given the non - significant effect of the selection and the time - point factors , this interaction indicates that there was a significant difference between the plus and minus lines at the end of the selection ( but not half - way through the selection ) and this difference was due to a change in behaviour of the minus lines but not the plus lines . figure 2 reveals that the change in the response of the minus lines was opposite to the direction selected . after six rounds of selection the minus lines shifted their average responses towards a preference for mesa , when compared to the responses of their ancestor lines measured after three episodes of selection.table 1mixed - effects model of predator response to mesa in the two - choice test : mesa versus clean aireffectlikelihood ratio ( df1 , df2)sdp valuerandom founder(9 , 8)0.080.02 iso - female line(9 , 8)0.00040.10 residual0.29fixed selection treatment(8 , 7)0.09 time point(8 , 7)0.21covariate proportion no choice(8 , 7)0.25interaction selection treatment : time point(9 , 8)0.02the random effect consists of the iso - female line nested in the founder . fixed effects include the selection ( levels : plus , minus ) , the number of selection rounds imposed on the lines ( levels : three , six ) and the proportion of individuals making no choice added as covariate . the amount of variation explained by grouping with respect to founder , iso - female line and the residual variance is presented in the form of standard deviations ( sd ) mixed - effects model of predator response to mesa in the two - choice test : mesa versus clean air the random effect consists of the iso - female line nested in the founder . fixed effects include the selection ( levels : plus , minus ) , the number of selection rounds imposed on the lines ( levels : three , six ) and the proportion of individuals making no choice added as covariate . the amount of variation explained by grouping with respect to founder , iso - female line and the residual variance is presented in the form of standard deviations ( sd ) the analysis was performed on data including the responses of the iso - female lines that were not subject to selection past the third round ( see selection and statistical analysis ) . in order to further explore the responses of the lines as a function of the behaviour of their ancestor lines we plotted the mean responses of the lines obtained after six rounds of selection as a function of the behaviour of their ancestor lines that were measured after three rounds of selection . 3 showing a shift in mean responses of the minus lines but also an equivalent shift in the responses of the plus lines ( albeit weaker ) . this result for the plus lines was not detected in the above analysis using the mixed - effects model presumably due to the greater variation among the plus lines.fig . 3mean responses of the descendant lines after six rounds of selection ( y - axis ) as a function of the responses of their ancestral lines after three rounds of selection ( x - axis ) . only the names of the ancestral lines are shown ; letter labels refer to the lines selected for the preference of mesa ( plus lines ) while number labels refer to the lines selected for the aversion of mesa ( minus lines ) . the circles represent the mean proportions of individuals choosing mesa calculated per line ( for the responses of individual replicates see fig . 2 ) . successful directional selection for extreme responses to mesa would result in a positive correlation between these proportions such that the descendantplus lines would lie either on or above the dotted diagonal line , while the descendant minus lines would lie on or below the diagonal line mean responses of the descendant lines after six rounds of selection ( y - axis ) as a function of the responses of their ancestral lines after three rounds of selection ( x - axis ) . only the names of the ancestral lines are shown ; letter labels refer to the lines selected for the preference of mesa ( plus lines ) while number labels refer to the lines selected for the aversion of mesa ( minus lines ) . the circles represent the mean proportions of individuals choosing mesa calculated per line ( for the responses of individual replicates see fig . 2 ) . successful directional selection for extreme responses to mesa would result in a positive correlation between these proportions such that the descendantplus lines would lie either on or above the dotted diagonal line , while the descendant minus lines would lie on or below the diagonal line we found a significant effect of founder ( likelihood ratio test pfounder = 0.02 , table 1 ) , i.e. the grouping with respect to founder ( between - founder variation ) explained a significant amount of variation in the behaviour of the lines . this confirms that there was genetic variation in predator responses to mesa in the base population and the founder effect indicates a genetic background that was frozen within the iso - female lines at the start of the selection experiment . adding the iso - female line effect ( nested in the founder effect ) did not explain more variation in predator responses to mesa ( likelihood ratio test pline = 0.10 , table 1 ) . the variation explained by the iso - female line effect was smaller ( by orders of magnitude ) than the variation explained by the founder effect ( table 1 ) . the iso - female line effect represents the deviation in the behaviour of individual lines from the mean response of the group of lines that shared a founder ( within - founder variation ) . thus , the non - significant effect of the iso - female line indicates that there was little within - founder variation among the lines while controlling for the effect of the main factors selection treatment and time point . moreover , we observed a relatively large amount of residual variance that represents the deviation of the individual replicates from the average response of the iso - female lines ( the within - line variability , table 1 ) . thus , there was a substantial environmentally determined component in predator responses to mesa as measured in the olfactory test used in this study . the covariate representing the proportion of individuals that made no choice in the olfactory test was not significant ( likelihood ratio test pproportion no - choice = 0.25 , table 1 ) , i.e. there was no relationship between the mean response to mesa in a single replicate test and the number of individuals that made no choice in this replicate . we showed that the amount of variation in predator responses to mesa explained by the founders of the iso - female lines was significantly different from zero , thus confirming that the responses of p. persimilis to mesa have a genetic component ( sznajder et al . however , we have not found expected differences in the behaviour between the iso - female lines maintained via individuals that chose mesa ( plus lines ) and the lines maintained via the individual that avoided mesa ( minus lines ) . instead , we observed a shift in the mean response to mesa in the direction opposite to the selection criterion , i.e. the responses of the minus lines at the end of selection were significantly shifted towards preference of mesa as compared to the responses of their ancestor lines half way through the selection ( fig . our experiment aimed at purifying the responses of individual lines and to this end we repeatedly re - established the lines via single mated females that expressed the behaviour in question ( i.e. either preference of mesa or avoidance of mesa ) . therefore , this procedure led to obtaining genetically homozygous lines . such lines can be further used to study the genetic determination of predator response to mesa ; the analysis of reciprocal crosses between iso - female lines test , for example , whether more extreme responses to mesa can be observed in heterozygous genotypes . inbreeding in the lines of p. persimilis was less likely to be associated with inbreeding depression because in haplodiploids deleterious alleles are immediately expressed in haploid males and therefore can be purged by natural selection ( crozier 1985 ; werren 1993 ; henter 2003 ; charlesworth and willies 2009 , unless these alleles have female - limited effect ; saito et al . re - establishing the lines via single mated females creates conditions favourable for random genetic drift . if in this study random genetic drift was stronger than selection within iso - female line then the genetic differences between and within the plus and minus lines would become fixed by chance . in particular , random genetic drift is expected to overcome selection if nes < 1 , i.e. the product of the effective population size and selection coefficient is less than unity ( hartl and clark 1989 ) . to illustrate this relationship , suppose that predator response to mesa is determined by a single gene that has two alleles : an allele for preference of mesa and an allele for the avoidance of mesa . hence , in this study selection would be effective if the selection coefficient was s > 0.67 ( given that the population is started by a single mated female and ne in a haplo - diploid system is given by ( 9*nfnm)/(2nf + 4 nm ) ; hedrick and parker 1997 ) . in this experiment , in the lines selected for preference of mesa , the genotypes that showed avoidance of mesa were eliminated , hence their fitness was assumed to be w = 0 , and their selection coefficient s = 1 ( in the lines selected for avoidance of mesa the selection coefficient of the genotype showing preference for mesa s = 1 ) . in reality the selection was performed on phenotypes in a single selection test and it can not be expected that these phenotypes always reflected their genotypes . therefore , the correct genotypes may not have been always selected for , and in such situations the selection coefficient of the out - selected genotypes would have been less than one . however , in this theoretical system , for the selection coefficient to be lower than 0.67 the rate of selecting a phenotype inconsistent with its genotype ( e.g. a phenotype that shows preference of mesa while its genotype would avoid mesa ) must be equal to or more than 0.33 ( s = 1w = 1pa / pa , where px is the probability of genotype x contributing to the next generation ) . the above analysis serves as an illustration only because the details of the genetic architecture of the response to mesa in p. persimilis are not know ; in fact this study is among the first ( sznajder et al . 2010 ) to provide evidence that there is a genetic basis for this behaviour ( for similar findings in the predatory mite neoseiulus womersleyi , see maeda 2006 ) . therefore , the number of loci influencing this trait ( and hence the appropriateness of the above model ) or the magnitude of the error in selecting wrong genotypes based on their phenotypes are yet unknown . thus , we can not exclude the possibility that random genetic drift may have played a role in some of the selection episodes . it is informative to discuss other factors that may have contributed to the differences in the average responses to mesa among the plus and minus lines in this experiment . in particular , the genetic component for a trait inferred from the differences among iso - female lines [ as in this study and in sznajder et al . this role of non - additive versus additive effects in the genetic determination of predator response to mesa may be explored by analysis of reciprocal crosses between iso - female lines that are different with respect to this trait ( e.g. carton et al . for the correct interpretation of a change in the behaviour of iso - female lines due to an experimental treatment the influence of general environmental effects that pertain to common rearing conditions must be minimised ( david et al . however , in order to explain the results of this study , such general environmental effects would have to influence the plus lines and minus lines in a consistently different way . moreover , their effect would have to change between the mid - point ( after three rounds of selection ) and the end - point ( after six rounds of selection ) of the experiment . finally , environmental effects would most likely be also reflected in a shift of the mean response of the base population ( as this population was maintained in the same climate room as the selection lines but physically separated ) . the mean responses to mesa of the base population , however , did not change as measured between the start and the end of the selection experiment ( although fluctuations in the responses of the base population in - between the measurements can not be ruled out ) . based on these results we conclude that general environmental effects may have played only a minor role . in this study the selection was performed on mated females , i.e. for practical considerations the females were allowed to mate in the culture and , thus , prior to the selection test . therefore , the responses to mesa of the males were not subject to selection and the genetic contribution of the males to the next generation was not controlled . assuming additive genetic variance for the selected trait and random mating this effect of uncontrolled genetic contribution of the males should be eradicated in the course of selection rounds . suppose , however , that mating is non - random such that , for example , females that show preference for mesa mate more often with males that avoid mesa . the resulting disassortative mating may lead to responses of the selected lines fluctuating within the spectrum between preference and aversion as observed in different generations of our selection experiment . any form of non - random mating would hinder directional selection and it may possibly be realized with respect to a trait correlated with olfactory responses , rather than with respect to the response to mesa itself . virgin females were shown to mate more readily with unrelated mates in no - choice mating experiments ( although no such preference for non - kin mates was found in choice experiments , enigl and schausberger 2004 ) . moreover , p. persimilis may be able to recognize individuals based on familiarity , as shown for juvenile predators ( schausberger 2005 , 2007 ) . a relationship between mating preference and olfactory responses of the partners could provide an explanation for the observed shift in the behaviour of the selected lines in our experiment . if such a relationship holds , then selection on the olfactory responses of p. persimilis requires that the mating is ensured to take place among individuals exhibiting the same olfactory response . uncovering any such relationship requires that we study the olfactory responses of males as well as females and their mating preferences with respect to this behaviour . mesa presented in a pure form without a background of volatiles was a novel experience to the predators in the sense that the predators had not perceived it prior to the selection test . however , the predators were reared on detached leaves of plants infested with t. urticae . therefore , they had experience with the full blend of plant volatiles released by t. urticae infested plants and this full blend does include mesa . this experience may influence predator responses in selection , however evidence to date shows that predator responses to pure compounds does not explain subsequent responses to mixtures of these compounds and , conversely , predator attraction to the full volatile blend induced by t. urticae is not due to attraction to all individual compounds constituting this blend ( van wijk 2007 ; van wijk et al . there is evidence that experience acquired during rearing on infested plants may influence subsequent predator responses to full volatile blends of these plants when uninfested ( takabayashi and dicke 1992 , but see also van den boom et al . in general , exposing p. persimilis to full blends of volatiles ( drukker et al . unpublished manuscript ) that are coupled with the presence of t. urticae resulted in increased predator preference for these compounds . in line with these results , suppose that prior experience of predators with the full blend of volatiles did increase predator responsiveness to mesa in the selection test . in this scenario , predators that showed a preference for mesa may have acquired this behaviour due to learning . therefore , the selection would not change the mean behaviour of the lines established from selecting such individuals ( because the learned responses masked the genetically determined behaviour and no change in the mean trait value between generations could be obtained ) . alternatively , the selection could further increase the preference of mesa in those lines because the set - up would effectively select for improved learning of mesa , provided that there is genetic variation in learning ability in this population . furthermore , according to this hypothesis , selected predators that avoided mesa should be interpreted as poor learners presumably revealing their genetically determined response to mesa . hence , selection via these individuals would lead to stronger aversion to mesa exhibited in the descendant selection lines . as can be seen in fig . 3 , these predictions are not consistent with the results of this study . although we can not exclude the possibility that the experience prior to the selection tests did not influence the predator responses , current knowledge on how experience shapes predator responses to herbivore - induced plant volatiles does not provide a straightforward explanation for the results obtained in this study . finally , the role of maternal effects shaping predator responses to mesa ( i.e. non - mendelian transmission of a trait from mother to offspring ) was not addressed in this study . maternal effects may influence the magnitude as well as the direction of population responses to selection ( kirkpatrick and lande 1989 , lande and kirkpatrick 1990 ) . they encompass a diversity of effects deriving from parental influence during rearing ( various forms of parental care or the choice of oviposition sites ) or cytoplasmic effects pertaining to inheritance of cytoplasmic factors passed on to the egg during oogenesis . to the best of our knowledge there is no parental care in p. persimilis , and an effect of oviposition in an environment characterized by different volatile profiles can also be excluded ( as all lines were reared on lima bean leaves infested with t. urticae ) . our results confirm that the responses of p. persimilis to mesa have a genetic component . future studies should address the response to mesa ( or other herbivore - induced plant volatiles ) of males as well as females and thus help explain whether any correlation between predator mating preferences and the response to mesa may contribute to the outcome of selection .

the responses of the predatory mite p. persimilis to herbivore - induced plant volatiles are at least partly genetically determined . thus , there is potential for the evolution of this behaviour by natural selection . we tested whether distinct predator genotypes with contrasting responses to a specific herbivore - induced plant volatile , i.e. methyl salicylate ( mesa ) , could be found in a base population collected in the field ( sicily ) . to this end , we imposed purifying selection on individuals within iso - female lines of p. persimilis such that the lines were propagated only via the individual that showed either a preference or avoidance of mesa . the responses of the lines were characterized as the mean proportion of individuals choosing mesa when given a choice between mesa and clean air . significant variation in predator responses was detected among iso - female lines , thus confirming the presence of a genetic component for this behaviour . nevertheless , we did not find a significant difference in the response to mesa between the lines that were selected to avoid mesa and the lines selected to prefer mesa . instead , in the course of selection the lines selected to avoid mesa shifted their mean response towards a preference for mesa . an inverse , albeit weaker , shift was detected for the lines selected to prefer mesa . we discuss the factors that may have caused the apparent lack of a response to selection within iso - female line in this study and propose experimental approaches that address them .

one social problem accompanying the rapid aging of society is the falling among the elderly , which results in serious complications . external wounds and fractures caused by falls lower elderly people s daily life activity capability , and results in psychological trauma due to easy falling syndrome , further restricting their activities1 . a major factor causing elderly people to fall is a decline in the standing balance , including dynamic balance ability , which often occurs during aging2 . methods of evaluating dynamic balance ability , such as the functional reach test ( frt)3 , timed up and go test ( tug)4 , and maximum walking speed ( mws)5 , have been confirmed to be reliable and suitable and can be easily performed ; hence , they are widely used in rehabilitation clinics and community health classes for elderly people . kyphosis of the spine , which is mainly an increase in the thoracic vertebrae kyphotic angle , deflects a person s center of mass backwards6 ; hence , they are more likely to fall backwards . other changes in the spine caused by aging include degeneration of the vertebral bodies themselves due to osteoporosis , a loss of muscle power of the erector spinae , and degenerative changes in the anterior and posterior longitudinal ligaments and other tissues supporting the spine7 , 8 . these aging changes presumably impact the mobility of the entire spine , which consists of vertebral bodies , or in other words , impairs the flexibility of the trunk . the purpose of this study was to clarify the correlation between the range of spinal mobility on the sagittal plane and the dynamic balance ability of elderly people living in communities . the persons studied were 31 healthy elderly people living in the community ( 16 females and 15 males ) . the average age was 72.4 5.1 years ; average height , 157.1 5.1 cm ; and average weight , 58.4 9.8 kg . the purpose of the experiment was explained to all the test participants , and their written agreements were obtained . the study was approved by the research ethics committee of chiba prefectural university of health sciences . the range of mobility of the participants spines in the sagittal plane was measured by using a spinal mouse ( idiag ag , volketswil , switzerland ) that can be used to measure the range of mobility of each vertebral body from outside the body s surface . during measurement , the participants stood with the bottom of both feet opened to about their shoulder width to maintain a stable posture , with their arms crossed over their chest . the sensor of the spinal mouse was moved from the head to the cauda of each subject along the side of the spur of the spine from the seventh cervical vertebra to the third sacral vertebra , to measure the sagittal angle between vertebral bodies . the range of mobility of the thoracic vertebrae was calculated as the sum of the range of flexion and extension from the first to the twelfth thoracic vertebrae . the range of mobility of the lumbar vertebrae was calculated as the sum of the range of flexion and extension from the first to the fifth lumbar vertebrae . in addition , to measure the range of mobility of the entire spine , the angle formed by a line connecting the first sacral vertebra to the first thoracic vertebra during maximum flexion forward and extension of the trunk to the same line during quiet standing was calculated . the range of mobility of the entire spine includes the angle of inclination of the pelvis ( leaning forward and leaning backwards ) . frt measured the distance that could move arm forward without moving the foot , which was the base of support . tug measured the time a subject takes to stand up from a chair , walk around a target 3 m away , and then return to the chair ; mws measures the maximum walking speed over a 10-m course . statistical processing was performed to study the correlation between the spinal range of mobility and dynamic balance ability ( frt , tug , and mws ) by applying pearson s product - moment correlation coefficient to analyze the correlation between these . the resulting range of spinal mobility in the sagittal plane and dynamic balance indices are shown in table 1table 1.average values of spinal mobility in the sagittal plane and dynamic balance indicesrange of spinal mobilitydynamic balance indicesflexion ( )extension ( )frt ( cm)tug ( s)mws ( m / s)thoracic lumbarinclinationthoracic lumbarinclination16.0 8.237.0 11.590.8 21.810.3 7.97.8 6.622.8 12.231.0 5.36.3 0.81.9 0.2mean sd . frt : functional reach test , tug : timed up and go , mws : maximum walking speed . the results of the correlation analysis of the range of spinal mobility and dynamic balance indices are shown in table 2table 2.pearson correlation between the range of spinal mobility and dynamic balance indicesflexionextensionthoracic lumbarinclinationthoracic lumbarinclinationfrt0.186 0.469 * 0.1440.4430.1410.277tug0.0510.2620.1170.542*0.0360.427mws0.2240.1870.0260.2090.2190.507**significant correlation p<0.01 . frt : functional reach test , tug : timed up and go , mws : maximum walking speed . a significant positive correlation between the flexion range of the lumbar vertebrae and the fr distance was identified , and a significant negative correlation between the range of extension of the thoracic vertebrae and the time required for tug was also observed . in addition , a significant positive correlation between the range extendibility of the entire spine , including the backward inclination of the pelvis and mws , was evident . frt : functional reach test , tug : timed up and go , mws : maximum walking speed * significant correlation p<0.01 . frt : functional reach test , tug : timed up and go , mws : maximum walking speed a significant positive relationship between the flexion range of the lumbar vertebrae and the fr distance was recognized . frt is an index of the ability of a person on a fixed supporting foundation to move the center of mass of his body forward3 . it is reported that a movement control strategy used by the elderly when voluntarily moving their center of mass is to quickly change from an ankle strategy with their ankles as the axis of motion to a hip strategy with their hip joint as the axis of motion9 . the present results suggested that during the frt , they bend their lumbar vertebrae in cooperatively with the flexion of their hip joint , clearly showing that the range of flexion of the lumbar vertebrae contributes to the distance they move their center of mass forward . a significant negative correlation between the range of extension of the thoracic vertebrae and the time required by tug was identified . a characteristic posture of elderly people is a kyphotic posture of the spine consisting mainly of kyphotic deformity of the thoracic vertebrae7 . maintaining flexibility of the thoracic vertebrae the tug is an index of balance and walking ability when a person stands up from or sits down on a chair or changes direction , and it is reported that it is also correlated with the falling among elderly people10 . in results of our research , it is very interesting that a significant correlation between tug , which has been shown to be correlated with falling , and flexibility of thoracic vertebrae extendibility , which is considered to have an important role in preventing kyphosis of elderly people , was identified . this result shows the importance of training to maintain and improve extendibility of the thoracic vertebrae of elderly people . in addition , a significant correlation between the range of extendibility of the entire spine , including the backward inclination of the pelvis , and mws , was shown . mws is an index of the decline in the walking ability as a person ages , and it is reported that it is also related to the survival rate of elderly people11 . the step length is cited as a factor related to mws . the hip joint extension during the terminal stance of a gait cycle , or in other words , the positions of the backward incline of the pelvis and extension of the trunk relative to the femur , moves the swing leg forward . the range of extendibility of the entire spine , which was the index for this research , shows the total extendibility of the trunk , which is the extendibility range of the thoracic vertebrae and lumbar vertebrae plus the backward inclination of the pelvis . therefore , it is assumed that the larger the range of extendibility of the entire spine , the wider the stride while walking , and as a result of this , a significant correlation with mws was recognized . the results of this research have clarified that mobility of the spine in the sagittal plane is clearly correlated with dynamic balance ability , which is related to falling . it also shows that instruction in exercises intended to improve the health and prevent nursing care of elderly people must be provided , guided by an awareness of the maintenance and improvement of spinal mobility in the sagittal plane .

[ purpose ] the purpose of this study was to clarify the correlation between the range of spinal mobility on the sagittal plane and the dynamic balance ability of elderly people living in communities . [ subjects and methods ] the persons studied were 31 healthy elderly people living in the community ( 16 females and 15 males ) . the range of mobility of the participants spines in the sagittal plane was measured by using a spinal mouse. balance ability was evaluated by using functional reach ( fr ) , timed up and go ( tug ) , and maximum walking speed ( mws ) . [ results ] a significant positive correlation between the flexion range of the lumbar vertebrae and the fr distance was identified , and a significant negative correlation between the extension range of the thoracic vertebrae and the time required for tug was also identified . in addition , a significant positive correlation between the extension range of the entire spine and mws , was identified . [ conclusion ] the result of this study have clarified that mobility of the spine in the sagittal plane is associated with dynamic balance ability , which is related to falling .

cervicofacial actinomycosis is an uncommon chronic suppurative and granulomatous disease caused by actinomycetes that are normal inhabitants of the oral cavity . it spreads to contiguous tissues following disruption of anatomical barriers by trauma , surgery or infection . it presents as chronic suppurative or indurated mass with draining sinuses overlying the mandible or as an acute painful swelling in the submandibular region . we report an unusual case of cervicofacial actinomycosis clinically resembling lymphangioma circumscriptum without the characteristic draining sinuses or granules , with the demonstration of actinomycotic granule on histology and confirmed subsequently with an excellent response to penicillin . a 22-year - old farmer from jalgaon was referred to us for asymptomatic spongy red raised lesions on the right side of his chin since 3 months . it started as a single red raised lesion resembling an insect bite which gradually increased in size and firmness . on reaching the size of a one rupee coin , numerous solid and fluid filled small lesions started developing on the plaque in close proximity to each other . they would rupture spontaneously to release scanty , viscid , odorless , clear fluid , and occasionally blood . there was no history of preceding congenital anomaly , trauma , dental infection , use of dentures , or plant twig for brushing teeth . one and half month later , he noticed similar lesions on the mucosal aspect of the chin corresponding to the external lesions discharging similar clear , odorless , and salty fluid . examination revealed an ill defined , nontender , indurated dusky red plaque measuring 4 5 cm on the right side of the chin extending vertically from the angle of the mouth to the lower border of the mandible and horizontally from the mentum to 6 cm laterally [ figure 1 ] . overlying the indurated area were multiple spongy papulovesicles and sessile nodules of variable size , closely grouped giving a frogspawn appearance and on rupturing discharged clear , viscid , odorless fluid without granules , pus or bony particles . these lesions extended to the corresponding buccal mucosa as smaller white papules with difficulty to insinuate a finger between the mucosa and mandible . grouped translucent pink spongy papulovesicular and nodular lesions simulating lymphangioma a differential diagnosis of lymphangioma circumscriptum , lymphangiosarcoma , lupus vulgaris , actinomycosis , and deep fungal infection were considered on clinical findings . routine hematological investigations were normal , and local radiological examination did not reveal bony involvement or retained tooth . repeated samples of the discharge subjected to gram staining for actinomycetes , potassium hydroxide mount for fungus and ziehl nelson staining for nocardia and mycobacterium were negative . skin biopsy was subjected to histology and cultures for aerobes , anaerobes , mycobacterium , and fungus . histology revealed a hyperkeratotic and acanthotic epidermis with the deep dermis showing slender - beaded gram - positive filaments crowded at the center and radiating parallely along the border suggestive of actinomycotic granule . phenomenon [ figure 2 ] . however , repeated cultures did not grow any organism . on the basis of histopathological demonstration of grain , a final diagnosis of cervicofacial actinomycosis was made , with the clinical presentation masquerading as lymphangioma circumscriptum . the patient was treated with injection crystalline penicillin 4 million units intravenously thrice daily for 6 weeks with tablet cotrimoxazole 960 mg twice daily . after 6 weeks , the intravenous route was to oral penicillin g 400 mg twice daily with continuation of cotrimoxazole . there was significant reduction in the size of the entire plaque and individual lesions within the first month of therapy and complete clinical resolution by 4 months [ figures 3 and 4 ] . h and e stain ; 100 showing basophilic granule with peripheral eosinophilic ray - like projections suggestive of actinomycotic granule . resolving papulovesicular lesions after 4 weeks of treatment complete clinical resolution after 4 months of therapy cervicofacial actinomycosis presents in two distinct morphological patterns ; first lumpy jaw , a slow enlarging , fluctuant painless swelling over the lower border of mandible and second , more painful and widespread , simulating an acute pyogenic infection affecting the submandibular area . other variants include chronic osteitis , osteolytic lesion , hard nodule on the tongue , lockjaw , parapical , or paradental abscess . lymphangioma circumscriptum is a hamartomatous malformation of the lymphatic system of deep dermis and subcutaneous tissue clinically characterized by clusters of thin - walled vesicles giving a frog spawn appearance . they occur as congenital abnormality or as acquired damage to lymphatic channels typically seen in post - radiation . the most common sites affected are head and neck , differentials in this region include plunging ranula , hemangioma , branchial cleft cyst , thyroglossal duct cyst , varix , lipoma , schwannoma , parotid cyst , malignant tumors or metastases , herpes simplex , angioma serpiginosum , lymphangiectasia , angiokeratoma corporis circumscriptum , etc . however , actinomycosis has never been reported to mimic this condition in the literature excepting a case report in a study where fungal infection was observed to cause acquired lymphangioma circumscriptum of the oral cavity . maxillofacial trauma in any form is an important risk factor for cervicofacial actinomycosis which was not noted in our case . this history can not be elicited in 40% of cases . in 28 cases of cervicofacial actinomycosis described by weese and smith , 89% had palpable mass , 61% had visible sinus tract or fistula , 54% had both , and 40% had lymphadenopathy . the classic formation of draining sinus tracts with sulfur granules is seen in approximately 40% of cases . our patient had palpable mass with regional lymphadenopathy but no sinus tracts or sulfur granules . cultures are positive in less than 50% cases due to fastidious nature of the organism . diagnosis is often based on the morphology of granules , seen as basophilic masses with a granular center and a radiating fringe of club - shaped protrusions on histology which was noted in our case . however , in our case , no histological correlation could be established for the vesicular nature of the skin lesions noted clinically and that remains elusive . ct and mri yield only quantitative information such as localization , borders , invasion of surrounding organs , and homogeneity of lesion . the current recommended therapy includes 4 weeks of high - dose iv penicillin followed by a 3 to 6 month course of oral penicillin , continuing treatment even after total resolution of symptoms .

primary cutaneous actinomycosis caused by actinomyces israelii occurs most commonly in the cervicofacial area . it commonly presents as lumpy jaw with draining sinuses which discharge the characteristic sulfur granules . a low index of suspicion and a low sensitivity in culturing the organism , due to its fastidious nature often delays the diagnosis . an atypical clinical presentation mimicking lymphangioma circumscriptum with grouped papulovesicular and nodular lesions along the lower jaw extending from skin to the inner buccal mucosa , confirmed on histology and an excellent therapeutic response to penicillin is reported .

anterior inferior cerebellar artery ( aica ) aneurysms account for less than 1.0% of all intracranial aneurysms , and distal aica aneurysms are even more rare and constitute only about 0.1% . most aica aneurysms are found after rupture , and in such situations , it is not always easy to detect the presence of thrombus in the dome preoperatively from computed tomography ( ct ) and digital subtraction angiography ( dsa ) findings . in the presence of intra - aneurysmal thrombus , neck clipping of the aneurysm sometimes becomes difficult , necessitating an alternative treatment strategy such as trapping . we report two rare cases of ruptured partially thrombosed distal aicaposterior inferior cerebellar artery ( pica ) variant aneurysms , in one of which , preservation of the occipital artery ( oa ) as a donor artery for revascularization was helpful in avoiding ischemic complications . head ct showed the presence of subarachnoid hemorrhage distributed dominantly in the posterior fossa and clot packing the fourth ventricle ( fig . dsa was performed , and left vertebral angiogram showed a hypoplastic pica and a 2-mm saccular aneurysm on the distal portion of the left aica , which was also supplying the distribution of the pica ( fig . general anesthesia , left lateral suboccipital craniotomy was performed following a hockey stick - shaped skin incision . after dural incision , the facial , vestibulocochlear , and lower cranial nerves were identified , and the aneurysm was exposed , which was partially thrombosed and much larger ( 10 mm in diameter ) than noted on preoperative dsa . the neck of the aneurysm was clipped successfully , and there developed no ischemic lesion in the distribution of the parent artery ( figs . acomputed tomography scan ( ct ) on admission showing subarachnoid hemorrhage distributing dominantly in the posterior fossa associated with clot packing the fourth ventricle . bleft vertebral angiograms : ( 1 ) anteroposterior view , ( 2 ) lateral view , and ( 3 ) right anterior oblique view demonstrating a 2-mm saccular aneurysm ( arrow ) on the distal portion of the left anterior inferior cerebellar arteryposterior inferior cerebellar artery variant . cintraoperative photograph showing the neck of the aneurysm ( arrow ) . * : left lower cranial nerves . dpostoperative three - dimensional computed tomographic angiography demonstrating obliteration of the aneurysm ( arrow ) with a patent parent artery . his gcs score was e3v5m6 , and he had mild right hemiparesis , mild right facial paralysis , right abducens nerve palsy , and dysarthria . dsa was performed , and left vertebral angiogram showed a hypoplastic pica and a 4-mm saccular aneurysm on the distal portion of the right aica , which was also supplying the distribution of the pica ( fig . right lateral suboccipital craniotomy was performed following a hockey stick - shaped skin incision . the aneurysm was partially thrombosed and much larger ( 13 mm in diameter ) than noted on the preoperative dsa . because of thrombus , the neck of the aneurysm was hard and not amenable to clipping . therefore , an oaaica anastomosis was performed , and the aneurysm was trapped ( fig . postoperative magnetic resonance imaging demonstrated the thrombosed aneurysm clearly in the right cerebellomedullary cistern and absence of ischemic lesions in the cerebellum ( fig . 2e ) . in the subacute period , his right hemiparesis showed some improvement and his right abducens nerve palsy remained unchanged , so he was transferred to a rehabilitation hospital with his modified rankin scale score of 3 . b(1 ) right vertebral angiogram , anteroposterior view , showing that the right anterior inferior cerebellar artery ( aica ) is an aicaposterior inferior cerebellar artery variant ; ( 2 ) left vertebral angiogram , anteroposterior view , demonstrating a 4-mm saccular aneurysm ( arrow ) on the distal portion of the right aica . cintraoperative schema showing anatomical location and appearance of the aneurysm ; the aneurysm was partially thrombosed and its diameter was about 13 mm . dpostoperative magnetic resonance images ; ( 1 ) t2-weighted image showing the real size of the thrombosed aneurysm ( arrow ) . head ct showed the presence of subarachnoid hemorrhage distributed dominantly in the posterior fossa and clot packing the fourth ventricle ( fig . dsa was performed , and left vertebral angiogram showed a hypoplastic pica and a 2-mm saccular aneurysm on the distal portion of the left aica , which was also supplying the distribution of the pica ( fig . general anesthesia , left lateral suboccipital craniotomy was performed following a hockey stick - shaped skin incision . after dural incision , the facial , vestibulocochlear , and lower cranial nerves were identified , and the aneurysm was exposed , which was partially thrombosed and much larger ( 10 mm in diameter ) than noted on preoperative dsa . the neck of the aneurysm was clipped successfully , and there developed no ischemic lesion in the distribution of the parent artery ( figs . acomputed tomography scan ( ct ) on admission showing subarachnoid hemorrhage distributing dominantly in the posterior fossa associated with clot packing the fourth ventricle . bleft vertebral angiograms : ( 1 ) anteroposterior view , ( 2 ) lateral view , and ( 3 ) right anterior oblique view demonstrating a 2-mm saccular aneurysm ( arrow ) on the distal portion of the left anterior inferior cerebellar arteryposterior inferior cerebellar artery variant . cintraoperative photograph showing the neck of the aneurysm ( arrow ) . * : left lower cranial nerves . dpostoperative three - dimensional computed tomographic angiography demonstrating obliteration of the aneurysm ( arrow ) with a patent parent artery . a 62-year - old man presented with occipital headache and nausea . on admission , his gcs score was e3v5m6 , and he had mild right hemiparesis , mild right facial paralysis , right abducens nerve palsy , and dysarthria . dsa was performed , and left vertebral angiogram showed a hypoplastic pica and a 4-mm saccular aneurysm on the distal portion of the right aica , which was also supplying the distribution of the pica ( fig . right lateral suboccipital craniotomy was performed following a hockey stick - shaped skin incision . the aneurysm was partially thrombosed and much larger ( 13 mm in diameter ) than noted on the preoperative dsa . because of thrombus , the neck of the aneurysm was hard and not amenable to clipping . therefore , an oaaica anastomosis was performed , and the aneurysm was trapped ( fig . postoperative magnetic resonance imaging demonstrated the thrombosed aneurysm clearly in the right cerebellomedullary cistern and absence of ischemic lesions in the cerebellum ( fig . his right hemiparesis showed some improvement and his right abducens nerve palsy remained unchanged , so he was transferred to a rehabilitation hospital with his modified rankin scale score of 3 . b(1 ) right vertebral angiogram , anteroposterior view , showing that the right anterior inferior cerebellar artery ( aica ) is an aicaposterior inferior cerebellar artery variant ; ( 2 ) left vertebral angiogram , anteroposterior view , demonstrating a 4-mm saccular aneurysm ( arrow ) on the distal portion of the right aica . cintraoperative schema showing anatomical location and appearance of the aneurysm ; the aneurysm was partially thrombosed and its diameter was about 13 mm . dpostoperative magnetic resonance images ; ( 1 ) t2-weighted image showing the real size of the thrombosed aneurysm ( arrow ) . most aica aneurysms are located at the proximal portion , and distal aica aneurysms are very rare , constituting only about 0.1% . to the best of our knowledge , only a few partially thrombosed distal aica aneurysms have been reported in the english literature ( table 1 ) . most aica aneurysms are found after rupture . in cases of non - ruptured aica aneurysms , patients present with headache , facial hypesthesia , trigeminal neuralgia , hearing disorder , or facial paralysis , and an intrameatal aneurysm may be diagnosed as a tumor involving the internal auditory canal preoperatively . reported cases of partially thrombosed anterior inferior cerebellar artery aneurysms aica : anterior inferior cerebellar artery , n.a . : not available , oa : occipital artery aica aneurysms have been treated by microsurgery , endovascular therapy , or a combination of the two . occlusion of the aica may lead to ataxia , nystagmus , dysarthria , trigeminal sensory impairment , lateral gaze palsy , facial palsy , hearing loss , and motor weakness . on the other hand , some authors have reported that therapeutic occlusion of the aica resulted in no deficits . factors affecting these neurological outcomes include the site of parent artery occlusion , the volume of blood supply from the collateral circulation , and involvement of nerve - related branches such as the labyrinthine artery , the recurrent perforating arteries , and the subarcuate artery . for example , if the lesion is located distal to the meatal loop or a supplementary aica is present , hearing preservation may be possible after occlusion of the affected site . it has been reported that the size of the infarcted area due to aica occlusion is inversely related to the sizes of the pica and superior cerebellar artery . in both of our cases , ruptured aneurysms were located in the distal portion of the aicapica variant , suggesting preservation of the parent artery was necessary to avoid serious cerebellar infarction . as in case 2 , it is sometimes difficult to place a clip appropriately across the neck of a partially thrombosed aneurysm . in such a case , trapping of the aneurysm with an oaaica anastomosis trapping of aica aneurysms or dissection in combination with oaaica anastomosis has been reported by several authors . another option for revascularization of the aica is aneurysm excision with end - to - end anastomosis of the aica . depending on the situation , the former may be easier than the latter because of a more shallow site of anastomosis . we also think that building a good anastomosis may have an advantage to maintain enough distal tissue circulation in case of vasospasm in the proximal portion of the parent artery . neurological deficits at the time of discharge in case 2 were mostly related to the first impact of hemorrhage . in conclusion , when treating aicapica variant aneurysms surgically , it is safer to preserve enough length of the oa in a hockey stick - shaped musculocutaneous flap as a donor for oaaica anastomosis in case of partially thrombosed aneurysms that necessitate trapping for obliteration . the authors have no personal , financial , or institutional interest in any of the drugs , materials , or devices presented in this article . all authors who are members of the japan neurosurgical society ( jns ) have registered online using the self - reported coi disclosure statement forms through the website for jns members .

abstractaneurysms arising from the distal anterior inferior cerebellar artery ( aica ) are very rare . when the parent artery is an aicaposterior inferior cerebellar artery ( pica ) variant , occlusion of the artery , even distal to the meatal loop , leads to a significant area of cerebellar infarction . we report two cases of ruptured partially thrombosed distal aica aneurysms . in both cases , the parent artery was an aicapica variant . the aneurysms were clipped in one case and trapped following occipital artery ( oa)aica anastomosis in another case . it is important to keep the oa as a donor artery for revascularization in the treatment of the aicapica variant aneurysms , especially when the absence of intra - aneurysmal thrombus is not comfirmed preoperatively .

to understand the underlying mechanism and treatment of cardiac rhythm disorders , it is essential to correctly localize regional cardiac electrical activity and to delineate its activation and recovery sequence . the standard 12-lead surface ekg is commonly used , though it provides insufficient information about the accurate localization of the site of origin ( soo ) of pvc or focal vt . in clinical practice , the soo of cardiac arrhythmias and the sequence of cardiac excitation are commonly determined using invasive 3d electroanatomical mapping systems . however , these mapping systems may face significant limitations in addition to their invasive nature , in particular in patients presenting with non - sustained or haemodynamically intolerant arrhythmias . in recent years , great progress has been made to develop a method that provides extensive information on cardiac electrical activity on the basis of potentials observed from the body surface . simultaneous acquisition of 3d anatomical and ekg data obtained by computed tomography ( ct ) or magnetic resonance imaging ( mri ) and multi - channel body - surface egg recordings , the latter processed by mathematical algorithms in order to solve the inverse problem of electrocardiography , allows for non - invasive imaging of human cardiac electrical activity . recently , non - invasive mapping of both epicardial and endocardial surfaces , applying novel numerical algorithms , has been introduced into clinical practice . the aim of the present study was to evaluate the feasibility of a novel non - invasive epicardial and endocardial electrophysiology system ( neees , ep solutions sa , yverdon - les - bains , switzerland ) for the diagnosis of focal ventricular arrhythmias . pre - procedural examination included a baseline 12-lead surface ekg , a 24-h holter monitor , and transthoracic echocardiography . nineteen patients presented with monomorphic pvcs ( n = 16 ) or vt ( n = 3 ) . one patient presented with two different pvc morphologies . in one patient , a left ventricular diverticulum was present . the study was approved by the institutional review board . written informed consent was obtained from all patients . the methodology of non - invasive imaging using the neees has been previously described in detail . briefly , up to 28 custom - made vertical arrays incorporating 8 unipolar ekg electrodes each ( for a maximum of 224 mri or ct compatible electrodes ) were placed onto the patient 's torso , followed by same - day contrast mri ( magnetom avanto , 1.5 t , siemens , germany ) or ekg - gated ct ( somatom definition flash 128 , siemens , germany ) scanning of the heart and thorax . computed tomography or mri data imported in the dicom format were automatically processed by the neees to render a realistic 3d reconstruction of the torso geometry and surface electrodes positions . the 3d heart model was plotted semi - automatically , and segmentation was performed using custom 3d editor software as part of the neees . following heart and torso segmentation and volume reconstruction , the surfaces of the torso and cardiac chambers were triangulated and polygonal meshes were built . non - invasive mapping was completed at the patient 's bedside before the invasive procedure . the electrode arrays were connected to the neees multi - channel ekg amplifier , and 4 pvc / vt beats were recorded using a bandwidth of 0.05500 hz , a sampling rate of 1000 samples / s , and an optional notch filter of 50 hz . data from the body - surface ekg were processed by the neees using its inverse problem solution software in combination with anatomical data derived from mri or ct of the heart and torso ( figure 1 ) . a brief description of the numerical algorithms applied is provided as supplementary material online , file s1 . figure 1consecutive procedural steps during the non - invasive endo- and epicardial electrophysiology study . the resulting epicardial and endocardial isopotential maps were reconstructed on the 3d volume and polygonal cardiac model and displayed as individual frames or activation movies . isopotential maps of a minimum of four pvc / vt beats of identical morphology were analysed to determine the earliest zone of electrical activation . the centre of the zone of negative potentials spreading in a centrifugal fashion during early depolarization was considered the soo . in some patients , electric potentials varied from 1 to 2 mv , a range comparable with the expected level of noise of the reconstructed electrograms . conversely , a negative potential level exceeding 8 mv corresponded to a later stage of myocardial activation . therefore , electric potentials from 3 to 8 mv were considered as the window of interest to localize the soo . to enhance visualization of the activation sequence , isochronal and propagation maps all patients underwent invasive mapping using a 3d electroanatomical mapping system ( carto 3 , biosense webster , diamond bar , ca , usa ) . catheter ablation was performed using an irrigated - tip catheter ( thermocool navistar , biosense webster ) applying a power of 3050 w. if ablation was performed at the coronary cusps , energy delivery was limited to a maximum of 30 w. acute procedural success was defined as freedom from recurrent clinical pvc / vt either occurring spontaneously or provoked by intravenous isoproterenol infusion during a 30-min waiting period that followed the last energy application . a 12-lead surface ekg and 24-h holter monitor the day before , the day after , and 6 months following the ablation procedure was completed in each patient . late recurrence was defined as 1000 monomorphic pvcs on 24-h holter monitoring or documentation of sustained monomorphic vt . during the initial step , foci were displayed on separate non - invasive isopotential maps , the latter of which were based on anatomical data derived from ct or mri . in a second step , all non - invasively determined foci were marked on the same cardiac model and the distance between each was measured using the the left ventricle ( lv ) was divided into 16 segments : right coronary cusp ( rcc ) , left coronary cusp ( lcc ) , aorto - mitral continuity ( amc ) , anterior mitral valve ( mv ) , septal mv , posterior mv , lateral mv , basal anterior lv , basal septal lv , basal posterior lv , basal lateral lv , mid - anterior lv , mid - septal lv , mid - posterior lv , mid - lateral lv , and apical lv . the right ventricle ( rv ) was divided into 18 segments : anterior rv outflow tract ( rvot ) , lateral rvot , posterior rvot , septal rvot , anterior tricuspid valve ( tv ) , lateral tv , posterior tv , septal tv , parahisian ( ph ) rv , basal anterior rv , basal lateral rv , basal posterior rv , basal septal rv , mid - anterior rv , mid - lateral rv , mid - posterior rv , mid - septal rv , and apical rv ( figure 2 ) . preceding the invasive electrophysiology study , the neees data were analysed and the pvc / vt was categorized as rv or lv in origin and then subcategorized according to the rv / lv segment . during invasive mapping , the soo was localized using the carto 3 system and compared with the soo predicted by the neees . pre - procedural examination included a baseline 12-lead surface ekg , a 24-h holter monitor , and transthoracic echocardiography . nineteen patients presented with monomorphic pvcs ( n = 16 ) or vt ( n = 3 ) . one patient presented with two different pvc morphologies . in one patient , a left ventricular diverticulum was present . the study was approved by the institutional review board . written informed consent was obtained from all patients . the methodology of non - invasive imaging using the neees has been previously described in detail . briefly , up to 28 custom - made vertical arrays incorporating 8 unipolar ekg electrodes each ( for a maximum of 224 mri or ct compatible electrodes ) were placed onto the patient 's torso , followed by same - day contrast mri ( magnetom avanto , 1.5 t , siemens , germany ) or ekg - gated ct ( somatom definition flash 128 , siemens , germany ) scanning of the heart and thorax . computed tomography or mri data imported in the dicom format were automatically processed by the neees to render a realistic 3d reconstruction of the torso geometry and surface electrodes positions . the 3d heart model was plotted semi - automatically , and segmentation was performed using custom 3d editor software as part of the neees . following heart and torso segmentation and volume reconstruction , the surfaces of the torso and cardiac chambers were triangulated and polygonal meshes were built . non - invasive mapping was completed at the patient 's bedside before the invasive procedure . the electrode arrays were connected to the neees multi - channel ekg amplifier , and 4 pvc / vt beats were recorded using a bandwidth of 0.05500 hz , a sampling rate of 1000 samples / s , and an optional notch filter of 50 hz . electrocardiogram recording was performed during unrestricted breathing because some patients had only rare pvcs . data from the body - surface ekg were processed by the neees using its inverse problem solution software in combination with anatomical data derived from mri or ct of the heart and torso ( figure 1 ) . a brief description of the numerical algorithms applied is provided as supplementary material online , file s1 . figure 1consecutive procedural steps during the non - invasive endo- and epicardial electrophysiology study . the resulting epicardial and endocardial isopotential maps were reconstructed on the 3d volume and polygonal cardiac model and displayed as individual frames or activation movies . isopotential maps of a minimum of four pvc / vt beats of identical morphology were analysed to determine the earliest zone of electrical activation . the centre of the zone of negative potentials spreading in a centrifugal fashion during early depolarization was considered the soo . in some patients , electric potentials varied from 1 to 2 mv , a range comparable with the expected level of noise of the reconstructed electrograms . conversely , a negative potential level exceeding 8 mv corresponded to a later stage of myocardial activation . therefore , electric potentials from 3 to 8 mv were considered as the window of interest to localize the soo . to enhance visualization of the activation sequence , isochronal and propagation maps all patients underwent invasive mapping using a 3d electroanatomical mapping system ( carto 3 , biosense webster , diamond bar , ca , usa ) . catheter ablation was performed using an irrigated - tip catheter ( thermocool navistar , biosense webster ) applying a power of 3050 w. if ablation was performed at the coronary cusps , energy delivery was limited to a maximum of 30 w. acute procedural success was defined as freedom from recurrent clinical pvc / vt either occurring spontaneously or provoked by intravenous isoproterenol infusion during a 30-min waiting period that followed the last energy application . a 12-lead surface ekg and 24-h holter monitor the day before , the day after , and 6 months following the ablation procedure was completed in each patient . late recurrence was defined as 1000 monomorphic pvcs on 24-h holter monitoring or documentation of sustained monomorphic vt . during the initial step , consecutive ectopic beats were analysed to reproducibly define the focal soo . foci were displayed on separate non - invasive isopotential maps , the latter of which were based on anatomical data derived from ct or mri . in a second step , all non - invasively determined foci were marked on the same cardiac model and the distance between each was measured using the the left ventricle ( lv ) was divided into 16 segments : right coronary cusp ( rcc ) , left coronary cusp ( lcc ) , aorto - mitral continuity ( amc ) , anterior mitral valve ( mv ) , septal mv , posterior mv , lateral mv , basal anterior lv , basal septal lv , basal posterior lv , basal lateral lv , mid - anterior lv , mid - septal lv , mid - posterior lv , mid - lateral lv , and apical lv . the right ventricle ( rv ) was divided into 18 segments : anterior rv outflow tract ( rvot ) , lateral rvot , posterior rvot , septal rvot , anterior tricuspid valve ( tv ) , lateral tv , posterior tv , septal tv , parahisian ( ph ) rv , basal anterior rv , basal lateral rv , basal posterior rv , basal septal rv , mid - anterior rv , mid - lateral rv , mid - posterior rv , mid - septal rv , and apical rv ( figure 2 ) . preceding the invasive electrophysiology study , the neees data were analysed and the pvc / vt was categorized as rv or lv in origin and then subcategorized according to the rv / lv segment . during invasive mapping , the soo was localized using the carto 3 system and compared with the soo predicted by the neees . a total of 21 different types of pvc / vt in 20 patients were targeted for ablation . catheter ablation was successful in 19 of the 20 ( 95% ) patients . at 6-month follow - up off aad , 19 of the 20 ( 95% ) patients were free from recurrent pvc / vt . in all patients , the non - invasively predicted soo for consecutive pvc / vt beats was localized within the same cardiac segment . the distance between any two foci during consecutive pvc / vt beats was 6 mm . the pvc / vt soo for all patients are summarized in table 1 . in 12 of the 21 ( 57% ) patients , the pvc / vt emanated from the rv ; 6 of the 21 ( 29% ) patients pvc / vt originated from the rvot ; and 6 of the 21 ( 29% ) patients pvc / vt arose from other rv sites . one patient had two ectopic foci originating from the posterolateral wall of the rvot and the mid - lateral rv wall . this latter case is illustrated in figures 36 and in supplementary material online , videos s1s4 . table 1patient characteristics , origin of ventricular arrhythmias , correlation between neee / s and invasive carto 3 mapping system , and acute catheter ablation outcomeno.sexagediagnosistype of tachycardiaimaging modalitylocation ( carto 3)location ( neees)results ( carto 3 vs. neees)acute procedural outcomeventriclesiteventriclesiteventriclesite1male67idiopathicpvcmrilvlateral mvlvlateral mvidenticalidenticalsuccessful2male65idiopathicpvcmrirvposterolateral rvotrvposterolateral rvotidenticalidenticalsuccessfulpvcrvmid - lateral rvrvlateral rv apexidenticalidenticalsuccessful3male79idiopathicvtctlvposterior mvlvposterior mvidenticalidenticalsuccessful4female36idiopathicpvcmrirvlateral rvotlvright coronary cusperrorerrorsuccessful5male54idiopathicpvcmrilvaortomitral continuitylvaortomitral continuityidenticalidenticalsuccessful6male18idiopathicpvcctlvmid - septallvmid - septalidenticalidenticalfailed7female53idiopathicpvcctrvanterior rvotrvlateral rvotidenticalerrorsuccessful8male31idiopathicpvcctrvanterior rvotrvanterior rvotidenticalidenticalsuccessful9male31idiopathicpvcctrvanterior rvotrvanterior rvotidenticalidenticalsuccessful10female39idiopathicpvcctrvposterior tvrvposterior tvidenticalidenticalsuccessful11female60idiopathicpvcctlvmid - posteriorlvmid - posterioridenticalidenticalsuccessful12male32idiopathicpvcctlvmid - laterallvmid - lateralidenticalidenticalsuccessful13female27idiopathicpvcctrvapicalrvapicalidenticalidenticalsuccessful14female53idiopathicpvcctlvseptal mvlvseptal mvidenticalidenticalsuccessful15male32idiopathicpvcctlvmid - anteriorlvmid - anterioridenticalidenticalsuccessful16male47idiopathicpvcctrvmid - septalrvmid - posterioridenticalerrorsuccessful17male62idiopathicpvcctrvseptal tvrvseptal tvidenticalidenticalsuccessful18female33idiopathicpvcctrvmid - septalrvmid - septalidenticalidenticalsuccessful19male46diverticlumvtctlvapicallvapicalidenticalidenticalfailed ; surgical ablation successful20female23idiopathicvtctrvseptal rvotrvseptal rvotidenticalidenticalsuccessfulpvc , premature ventricular contraction ; vt , ventricular tachycardia ; lv , left ventricle , rv , right ventricle ; rvot , right ventricular outflow tract ; tv , tricuspid valve ; mv , mitral valve ; rfa , radiofrequency ablation ; ct , computed tomography ; mri , magnetic resonance imaging.pvc recurrence at 3-month follow-up.figure 312-lead surface ekg demonstrating two different pvc morphologies.figure 4non - invasive reconstruction of epicardial and endocardial isopotential maps superimposed on the polygonal models of the ventricles at the beginning of the qrs complex of pvc # 1 . the earliest activation originates from the posterolateral wall of the rvot.figure 5non - invasive reconstruction of epicardial and endocardial isopotential maps superimposed on the polygonal models of the ventricles at the beginning of the qrs complex of pvc # 2 . the earliest activation originates from the mid - lateral wall of the rv.figure 6invasive 3d carto 3 model of the rv . shown are the location of successful rf ablation ( red dots ) for pvc # 1 at the posterolateral wall of the rvot and pvc#2 at the mid - lateral wall of the rv . patient characteristics , origin of ventricular arrhythmias , correlation between neee / s and invasive carto 3 mapping system , and acute catheter ablation outcome pvc , premature ventricular contraction ; vt , ventricular tachycardia ; lv , left ventricle , rv , right ventricle ; rvot , right ventricular outflow tract ; tv , tricuspid valve ; mv , mitral valve ; rfa , radiofrequency ablation ; ct , computed tomography ; mri , magnetic resonance imaging . non - invasive reconstruction of epicardial and endocardial isopotential maps superimposed on the polygonal models of the ventricles at the beginning of the qrs complex of pvc # 1 . non - invasive reconstruction of epicardial and endocardial isopotential maps superimposed on the polygonal models of the ventricles at the beginning of the qrs complex of pvc # 2 . are the location of successful rf ablation ( red dots ) for pvc # 1 at the posterolateral wall of the rvot and pvc#2 at the mid - lateral wall of the rv . left ventricular pvc / vt originated from the amc in one , the mid - septal lv in one , the mid - posterior lv in one , the mid - anterior lv in one , the lateral ma in one , the septal mv in one , the posterior mv in one , and the lateral lv in one patient , respectively . in one patient , the neees correctly identified the chamber of interest in 20 of the 21 ( 95% ) pvc / vts and the respective ventricular segment in 18 of the 21 ( 86% ) pvc / vts . in 3 of the 21 ( 14% ) pvc / vts , the neees failed to provide the correct soo . in the first case , the neees predicted the soo at the rcc , but successful ablation was performed within the rvot . in the second case , the predicted origin of pvc was from the lateral wall of the rvot , while successful ablation was achieved targeting the anterior aspect of the rvot . in the third case , the predicted pvc soo was from the mid - lateral segment of the rv , but ablation was successful at the mid - posterior segment of the rv . in the latter case , acute procedural success the neees and carto 3 mapping system indicated that the vt originated from the diverticulum at the lv apex , but catheter ablation was unsuccessful . table 1 compares the results of the neees and invasive mapping and details the outcome of catheter ablation . in all patients , the non - invasively predicted soo for consecutive pvc / vt beats was localized within the same cardiac segment . the distance between any two foci during consecutive pvc / vt beats was 6 mm . the pvc / vt soo for all patients are summarized in table 1 . in 12 of the 21 ( 57% ) patients , the pvc / vt emanated from the rv ; 6 of the 21 ( 29% ) patients pvc / vt originated from the rvot ; and 6 of the 21 ( 29% ) patients pvc / vt arose from other rv sites . one patient had two ectopic foci originating from the posterolateral wall of the rvot and the mid - lateral rv wall . this latter case is illustrated in figures 36 and in supplementary material online , videos s1s4 . table 1patient characteristics , origin of ventricular arrhythmias , correlation between neee / s and invasive carto 3 mapping system , and acute catheter ablation outcomeno.sexagediagnosistype of tachycardiaimaging modalitylocation ( carto 3)location ( neees)results ( carto 3 vs. neees)acute procedural outcomeventriclesiteventriclesiteventriclesite1male67idiopathicpvcmrilvlateral mvlvlateral mvidenticalidenticalsuccessful2male65idiopathicpvcmrirvposterolateral rvotrvposterolateral rvotidenticalidenticalsuccessfulpvcrvmid - lateral rvrvlateral rv apexidenticalidenticalsuccessful3male79idiopathicvtctlvposterior mvlvposterior mvidenticalidenticalsuccessful4female36idiopathicpvcmrirvlateral rvotlvright coronary cusperrorerrorsuccessful5male54idiopathicpvcmrilvaortomitral continuitylvaortomitral continuityidenticalidenticalsuccessful6male18idiopathicpvcctlvmid - septallvmid - septalidenticalidenticalfailed7female53idiopathicpvcctrvanterior rvotrvlateral rvotidenticalerrorsuccessful8male31idiopathicpvcctrvanterior rvotrvanterior rvotidenticalidenticalsuccessful9male31idiopathicpvcctrvanterior rvotrvanterior rvotidenticalidenticalsuccessful10female39idiopathicpvcctrvposterior tvrvposterior tvidenticalidenticalsuccessful11female60idiopathicpvcctlvmid - posteriorlvmid - posterioridenticalidenticalsuccessful12male32idiopathicpvcctlvmid - laterallvmid - lateralidenticalidenticalsuccessful13female27idiopathicpvcctrvapicalrvapicalidenticalidenticalsuccessful14female53idiopathicpvcctlvseptal mvlvseptal mvidenticalidenticalsuccessful15male32idiopathicpvcctlvmid - anteriorlvmid - anterioridenticalidenticalsuccessful16male47idiopathicpvcctrvmid - septalrvmid - posterioridenticalerrorsuccessful17male62idiopathicpvcctrvseptal tvrvseptal tvidenticalidenticalsuccessful18female33idiopathicpvcctrvmid - septalrvmid - septalidenticalidenticalsuccessful19male46diverticlumvtctlvapicallvapicalidenticalidenticalfailed ; surgical ablation successful20female23idiopathicvtctrvseptal rvotrvseptal rvotidenticalidenticalsuccessfulpvc , premature ventricular contraction ; vt , ventricular tachycardia ; lv , left ventricle , rv , right ventricle ; rvot , right ventricular outflow tract ; tv , tricuspid valve ; mv , mitral valve ; rfa , radiofrequency ablation ; ct , computed tomography ; mri , magnetic resonance imaging.pvc recurrence at 3-month follow-up.figure 312-lead surface ekg demonstrating two different pvc morphologies.figure 4non - invasive reconstruction of epicardial and endocardial isopotential maps superimposed on the polygonal models of the ventricles at the beginning of the qrs complex of pvc # 1 . the earliest activation originates from the posterolateral wall of the rvot.figure 5non - invasive reconstruction of epicardial and endocardial isopotential maps superimposed on the polygonal models of the ventricles at the beginning of the qrs complex of pvc # 2 . the earliest activation originates from the mid - lateral wall of the rv.figure 6invasive 3d carto 3 model of the rv . shown are the location of successful rf ablation ( red dots ) for pvc # 1 at the posterolateral wall of the rvot and pvc#2 at the mid - lateral wall of the rv . patient characteristics , origin of ventricular arrhythmias , correlation between neee / s and invasive carto 3 mapping system , and acute catheter ablation outcome pvc , premature ventricular contraction ; vt , ventricular tachycardia ; lv , left ventricle , rv , right ventricle ; rvot , right ventricular outflow tract ; tv , tricuspid valve ; mv , mitral valve ; rfa , radiofrequency ablation ; ct , computed tomography ; mri , magnetic resonance imaging . non - invasive reconstruction of epicardial and endocardial isopotential maps superimposed on the polygonal models of the ventricles at the beginning of the qrs complex of pvc # 1 . non - invasive reconstruction of epicardial and endocardial isopotential maps superimposed on the polygonal models of the ventricles at the beginning of the qrs complex of pvc # 2 . are the location of successful rf ablation ( red dots ) for pvc # 1 at the posterolateral wall of the rvot and pvc#2 at the mid - lateral wall of the rv . left ventricular pvc / vt originated from the amc in one , the mid - septal lv in one , the mid - posterior lv in one , the mid - anterior lv in one , the lateral ma in one , the septal mv in one , the posterior mv in one , and the lateral lv in one patient , respectively . in one patient , the neees correctly identified the chamber of interest in 20 of the 21 ( 95% ) pvc / vts and the respective ventricular segment in 18 of the 21 ( 86% ) pvc / vts . in 3 of the 21 ( 14% ) pvc / vts , the neees failed to provide the correct soo . in the first case , the neees predicted the soo at the rcc , but successful ablation was performed within the rvot . in the second case , the predicted origin of pvc was from the lateral wall of the rvot , while successful ablation was achieved targeting the anterior aspect of the rvot . in the third case , the predicted pvc soo was from the mid - lateral segment of the rv , but ablation was successful at the mid - posterior segment of the rv . in the latter case , acute procedural success the neees and carto 3 mapping system indicated that the vt originated from the diverticulum at the lv apex , but catheter ablation was unsuccessful . table 1 compares the results of the neees and invasive mapping and details the outcome of catheter ablation . a variety of non - invasive imaging systems to display electrical cardiac activity have been used as diagnostic tools in clinical cardiac electrophysiology . the method of non - invasive electrocardiographic imaging ( ecgi ) has demonstrated significant clinical relevance , allowing non - invasive reconstruction of local unipolar electrograms ( eg ) on the epicardial surface of the heart . advanced processing of reconstructed eg provides information on the cardiac activation sequence , the soo of abnormal cardiac excitation and details about the arrhythmogenic substrate . data from a randomized trial demonstrated that the soo of focal pvc could be detected in 95% of cases . cakulev et al . reported that in 8 of the 10 ( 80% ) patients with pvcs , the ecgi correctly identified the ventricular soo , as confirmed by successful ablation at these sites . wang et al . were able to predict the soo of focal ventricular arrhythmias in 10 of the 11 ( 91% ) rv and 11 of the 12 ( 92% ) lv sites . reported an accuracy of 96% in predicting non - invasively the focal soo of ventricular arrhythmias . however , none of the aforementioned studies utilized an ecgi capable of mapping both the endocardial and the epicardial surfaces of the heart . in a validation study , the neees was able to identify with sufficient ( < 10 mm ) accuracy the site of rv and lv pacing from various endocardial as well as epicardial sites . in the present study , the neees was able to reproducibly localize the soo over a series of consecutive recorded ectopic beats . the neees correctly diagnosed the respective ventricular segment in 86% of pvc / vt cases , thus establishing its value as an accurate diagnostic tool to identify the soo of ventricular arrhythmias . knowledge of the location of the earliest site of activation before an invasive procedure , particularly in patients presenting with an ambiguous 12-lead surface ekg where the area of interest may be difficult to verify , should be of great value to the treating physician . the additional information provided by the neees may facilitate the planning of an appropriate invasive ablative strategy . furthermore , from a single ectopic beat the complete activation sequence can be processed by the neees , facilitating successful mapping even in patients with haemodynamically intolerant or non - sustained arrhythmias . one major limitation of the standard 12-lead surface ekg is its low resolution in terms of localizing the soo of ventricular ectopics . multiple existing algorithms , often complex and difficult to apply , attempt to predict the earliest site of activation in ventricular arrhythmias , but many are hampered by their low specificity . its use as a non - invasive diagnostic tool relies on the anatomical data derived from mri or ct resulting in a highly accurate delineation of the true cardiac activation sequence . in addition , the neees can provide important information regarding the underlying mechanism of arrhythmia using a single ectopic beat , even if recording rare clinical pvcs would require pre - procedural monitoring at the patient 's bedside over an extended period of time . finally , the use of ct scanning , as part of the non - invasive electrocardiographic imaging procedure , will expose patients to radiation . the neees allows data processing from cardiac mri to complete heart and torso reconstruction , which eliminates the need for radiation . the present study provides no comparison between the neees and alternative methods to localize the soo of pvc / vt , such as diagnostic algorithms based on information from the 12-lead surface ekg or invasive pace mapping . since patients included in the current study had no clinical indication for invasive epicardial mapping or ablation , epicardial breakthrough patterns could not be assessed . in addition , no quantitative measures are given regarding the accuracy in localizing the ectopic foci . the current study compared ventricular segments to define successful catheter ablation , which as a reference has limited precision . the results of the present study underscore the need for further research on the accuracy of the neees . one area of improvement involves the complex anatomical region surrounding the left and right ventricular outflow tract . differentiating pvc origin from the aortic sinus cusps and the rvot is critical for the successful ablation outcome . on two occasions , the present study provides no comparison between the neees and alternative methods to localize the soo of pvc / vt , such as diagnostic algorithms based on information from the 12-lead surface ekg or invasive pace mapping . since patients included in the current study had no clinical indication for invasive epicardial mapping or ablation , epicardial breakthrough patterns could not be assessed . in addition , no quantitative measures are given regarding the accuracy in localizing the ectopic foci . the current study compared ventricular segments to define successful catheter ablation , which as a reference has limited precision . the results of the present study underscore the need for further research on the accuracy of the neees . one area of improvement involves the complex anatomical region surrounding the left and right ventricular outflow tract . differentiating pvc origin from the aortic sinus cusps and the rvot is critical for the successful ablation outcome . on two occasions , the novel non - invasive epicardial and endocardial electrophysiology mapping system accurately defines the site of focal pvc / vt origin and may facilitate planning of a successful ablation strategy . combining anatomical data from mri with information from the body - surface ekg eliminates the need for radiation exposure during the non - invasive diagnostic procedure . this study was in part funded by a grant from the german federal ministry for education and research international bureau ; and by the russian foundation for assistance to small innovative enterprises ( bmbf / ib - fasie award # 14 - 1-h2.15 - 0001 - 7-p ) . funding to pay the open access publication charges for this article was provided by ep solutions sa , yverdon - les - bains , switzerland .

aimsthe aim of the present study was to estimate the accuracy of a novel non - invasive epicardial and endocardial electrophysiology system ( neees ) for mapping ectopic ventricular depolarizations.methods and resultsthe study enrolled 20 patients with monomorphic premature ventricular contractions ( pvcs ) or ventricular tachycardia ( vt ) . all patients underwent pre - procedural computed tomography or magnetic resonance imaging of the heart and torso . radiographic data were semi - automatically processed by the neees to reconstruct a realistic 3d model of the heart and torso . in the electrophysiology laboratory , body - surface electrodes were connected to the neees followed by unipolar ekg recordings during episodes of pvc / vt . the body - surface ekg data were processed by the neees using its inverse - problem solution software in combination with anatomical data from the heart and torso . the earliest site of activation as denoted on the neees 3d heart model was compared with the pvc / vt origin using a 3d electroanatomical mapping system . the site of successful catheter ablation served as final confirmation . a total of 21 pvc / vt morphologies were analysed and ablated . the chamber of interest was correctly diagnosed non - invasively in 20 of 21 ( 95% ) pvc / vt cases . in 18 of the 21 ( 86% ) cases , the correct ventricular segment was diagnosed . catheter ablation resulted in acute success in 19 of the 20 ( 95% ) patients , whereas 1 patient underwent successful surgical ablation . during 6 months of follow - up , 19 of the 20 ( 95% ) patients were free from recurrence off antiarrhythmic drugs.conclusionthe neees accurately identified the site of pvc / vt origin . knowledge of the potential site of the pvc / vt origin may aid the physician in planning a successful ablation strategy .

john graunt , the seventeenth - century statistician and one of the founders of modern demography , was highly sceptical of the veracity of the numbers of deaths caused by lunacy recorded in the london bills of mortality , observing they were but few , viz . 158 in 229250 ; many cases , except those in the bethlem lunatic hospital , were unreported or deliberately misdiagnosed for some other disease ( graunt , 1662 : 22 ) . this reported under - representation of insanity as a cause of death may not have been surprising to graunt s contemporaries . death by lunacy was included in his list of those more formidable , and notorious diseases , along with sudden death , seizures , epilepsy , and death on the operating table , of which many persons live in great fear , and apprehension conditions that would have prevented an adult meeting their maker in a suitable frame of mind ( graunt , 1662 ) . dr william black , the london physician and medical statistician , believed that insanity was an equally unwelcome companion to death in the eighteenth century . for black , many lunatick deaths in london are not reported , from their being interred in dissenting and unregistered burying grounds , or in other places of interment without the verge of the bills , with some deaths from lunacy intentionally suppressed , and a considerable remnant , perhaps as many more , sunk amongst the suicides and drowned ( black , 1789 : 1289 ) . lunacy could disrupt a good deathbed performance through which the pious , and often impious , would prepare for salvation after death , though itself considered of diminishing importance in the eighteenth century ( houlbrooke , 1998 ) . those making wills usually thanked god for being of sound mind , memory and understanding . lunatics , those clearly of unsound mind , were of course unable to make valid wills , and signs of mental incapacity were cited frequently in probate disputes by hopeful claimants ( burn , 1767 : 43 , 45 ; see also : bonfield , 1997 ; houlbrooke , 1998 : 80 , 90 , 21819 ) . although there is an extensive literature on the care of insane in the eighteenth - century metropolis , few scholars have investigated the concerns of graunt and black ( andrews and scull , 2001 , 2003 ; murphy , 2001a , 2001b ; smith , 2007 ; suzuki , 1991 , 1992 , 1998 ) . this article addresses these contemporary fears of the under - representation of lunacy as cause of death in seventeenth- and eighteenth - century london and shows , initially , that insanity being ascribed as a cause of death had a distinctive chronology in this period . it argues that the process of the reporting of the cause of death in the bills of mortality was vulnerable to outside influence , which in turn could determine what diagnoses would be recorded . andrews ( 1991 : 499505 ) and macdonald ( 1981 : 1456 ) have expressed the possibilities of confusion in the diagnoses and recording of the cause of death of the insane in the eighteenth century . we argue that , to a significant extent , this misdiagnosis , and misreporting , was deliberate , in order to avoid the stigma of the dead being labelled lunatic at the time of death , or the cause of death being ascribed as lunacy. furthermore , it was the pauper insane and those who died in metropolitan institutions who were most likely ( though not always ) to be characterized as being insane at death , or their mortality being brought on by insanity . just as andrews and scull ( 2001:11941 ) have identified that the wealthy could have the treatment of their insane family members and friends obscured to avoid any stigma or dishonour that the diagnosis of the insanity may have caused , we explore the extent to which those of the insane dead , or their friends and relatives who possessed greater wealth or social position , could often influence the reporting of cases of lunacy such that the cause of death was hidden or disguised . contemporary diagnoses and reporting of the death of the insane did not always distinguish between lunacy as a direct cause of death , and the death of a lunatic , whether caused by lunacy or some other illness ( andrews , 1991 : 5023 ) . this is particularly apparent among the parochial burial records . in the st martin in the fields sexton s day books and the st luke old street parish burial registers , for example , the terms lunatick and lunacy appear to be interchangeable in defining the cause of death of the insane throughout the eighteenth and early nineteenth centuries ( cowac , sdb , 17471812 ; lma , bbr , 17471812 ; lma , br , 180727 ) . similarly , in the parish burial registers of st botolph bishopsgate and st stephen coleman street the insane were recorded as having died lunatic in bedlam , but others are said to have died of lunacy in bedlam. in contrast , the bills of mortality define only lunacy as a cause of death ( andrews , 1991 : 502 ) . in our study we will try to avoid any ambiguity in analysis that these factors may cause . the starting point for any examination of the suppression , or not , of the reporting of death caused by insanity must begin with the statistics contained in the bills of mortality ( marshall , 1832 ) . figure 1 demonstrates the degree to which lunacy was recorded as a cause of death in the london bills of mortality between 1629 and 1831 . reported deaths from lunacy gradually increased from the mid - seventeenth century until the 1730s , doubled between the 1730s and the early 1760s , fell back somewhat in the 1780s and 1790s , and then dramatically increased . by the second and third decades of the nineteenth century it was common for more than 200 dead lunatics to appear in the london bills in any one year . although london had been growing rapidly from the middle of the eighteenth century , the dramatic increase in reported death by lunacy can not be explained simply by the growth of the population . death rates across the metropolis were falling from the late eighteenth century , and an increasing number of the capital s dead were being interred in places and grounds not covered by the bills of mortality . to understand the meaning behind the incidence of deaths from lunacy requires an in - depth investigation of the treatment of lunatics at the end of their life . we need to start with how , and to what extent , the badge of lunacy was applied to the metropolitan dead in the london parishes . we will proceed to examine the deaths from lunacy in london s two public hospitals for the insane , before investigating the treatment of the insane and the recording of their deaths in the large and socially varied west end parish of st martin in the fields , using the databases generated by the ongoing pauper biographies project . lunacy in the london bills of mortality , 16291831 ( source : marshall , 1832 ) how one was supposed to have died could matter a great deal in the eighteenth century ( dobson , 1997 : 22386 ) . causes of death that carried implications about the behaviour and reputation of the deceased might be concealed with euphemisms . in the reporting of other deaths such as executions , claimed one authority , the london bills of mortality were particularly shamefully erroneous and defective. alternatively some diseases were seen as signifying an elevated life - style . life - style causes of death , notably deaths from foul disease and gout , are known to have been attributed almost exclusively to particular social groups ( porter and rousseau , 1998 ) . almost all those reported as dying of foul , that is venereal , disease , turn out to have been paupers buried from the parish workhouse ( siena , 2004 : 136 , 1702 , 17780 , 260 ) . those lacking resources or family members able to intervene were especially vulnerable to such shaming or contentious labelling post - mortem . conversely , it was extremely rare for those dying of gout , a condition commonly associated with high - status over - consumption , to be drawn from the ranks of the poor . gout was a sort of inverse status symbol : those reported as dying of the condition paid some of the highest burial fees in the parish ( black , 1789 : 87 ; see also : boulton and schwarz , 2012 ; razzell and spence , 2006 ) . each death in london , and its cause , was to be reported initially by searchers . the searchers , usually two elderly women licensed by the bishop of london , in receipt of parish aid and often ex - parish nurses or midwives , viewed each body and returned the cause of death among other details to the parish clerk , who in turn would transmit the information to the london parish clerk s company ( siena , 2011:1303 ) . through a process of questioning any medical attendants who witnessed the death , talking to the friends and family of the deceased , and their own experience of physiological symptoms , searchers had to distinguish the cause of death ( graunt , 1662 : 11 ) . the searchers were supposed to receive a small fee ( a groat , 4d . ) for this service from the family of the deceased . the parish of st martin s paid its two searchers a monthly salary of 13s . to view the corpses of the poor in the later eighteenth century . one would expect that those paying fees were more likely to be able to influence the return . most of those who wrote about the london bills assumed searchers were bribed routinely to conceal or misreport deaths and that in some cases they did not even view the corpse . william black was especially dismissive about what he called this ceremony of inspection by the searchers , asserting they would negligently enquire from the relations the name of the disease , adding the age and sex : or sometimes they are stopped in the hall , and dismissed without any scrutiny ( black , 1789 : 2545 ) . graunt , over 100 years earlier , questioned the numbers reported by parish clerks as having died from venereal disease . he contended that searchers would often ignore obvious physiological signs of death caused by venereal disease , under the influence of bribes of money or alcohol , and would misdiagnose some other disease as responsible for the death ( graunt , 1662 : 24 ) . before the onset of civil registration in 1837 , relatives and friends of the deceased in london could therefore influence the reported cause of death by bribing , pressurizing or misinforming parish searchers . on the face of it , the poor would have been less able to influence returns in this way and were , therefore , less able to resist stigmatizing reports . the ability to control the process by which the cause of death was recorded must sometimes explain the clear social biases in the reporting of particular conditions noted above . the number of lunatics dying in london s two public hospitals for the insane did not account for the fluctuations in the numbers reported in the bills . figure 2 shows that even if all lunatics from st luke s found their way into the bills , that hospital could not have fuelled either the overall number of lunatics returned , or the increase in lunatic mortality from the late eighteenth century . simultaneously , a decreasing number of lunatics from bethlem died over the eighteenth century . an average of 36 lunatics per year died at bethlem during 174362 , 28 p.a . in the following 20 years , 10 p.a . during 17831802 , just 6 p.a . during 18031822 and 11 p.a . during 182342 . many of these died from a range of conditions , including infectious diseases such as smallpox ( webster , 1843 ; see also andrews , briggs , porter , tucker and waddington , 1997 : 3401 ) . the marked growth in lunacy in the london bills after the 1780s was caused by deaths from private madhouses . their number grew significantly in this period , with 17 licensed madhouses in london in 1806 and 24 by 1816 . most parish pauper lunatics were kept in four large private madhouses ( green , 2010:152 ; murphy , 2001a : 2726 ) . the numbers returned in the bills depended on the extent to which lunacy was returned as cause of death by metropolitan parishes , but often these were unclear and were influenced by the social status of those returned lunatic . we need to examine the distorting filters which intervened between the incidence of lunacy at death , and a parish searcher s final return . numbers of deaths from st luke s hospital 17511826 ( broken line ; sources : lma , bbr , 17471809 ; lma , br , 18071826 ) and caused by lunacy in the london bills of mortality ( solid line ; source : marshall , 1832 ) many of those who died as lunatics were cared for through private funding provided by family or friends , rather than at the expense of the parish authorities . those cared for at the expense of the parish were only a minority of the lunatic population . those who were buried as lunatics , or were insane towards the end of their life , comprised both parish paupers and also the much larger group of the privately - funded insane . between 1747 and 1824 in st martin in the fields , of 112 individuals buried as lunatics , 61 were paupers . the parish began sending most of its poor to a new burial ground in camden town after 1806 , and the registers of that place do not supply cause of death or burial fee . if the above figures are adjusted for the omission of camden town burials , 43 lunatics were charged for their burial , therefore not paupers , and 61 were paupers , suggesting that no less than 58.7 per cent of all those dying as lunatics were buried at parish expense in the eighteenth century . pauperism and workhouse residence was thus associated very strongly with an ascription of lunacy at burial . as expected , it was the poor , especially the workhouse poor , who most lacked the ability to defend their relatives from shaming or stigmatizing labels at burial . many of these lunatics , too , might have lacked available kin or friends who might otherwise have seen to their burial . we thus need to know more about the experience of the insane parish pauper in st martin s , and in particular the extent to which lunacy was ascribed as a cause of death to individuals who died during their insanity . st martin s treatment of pauper lunatics seems fairly typical of other parishes in the metropolis ( murphy , 2001b : 41126 ) . throughout the eighteenth and early nineteenth centuries the parish sent relatively few pauper lunatics to london s public hospitals for the insane : bethlem ( occasionally bedlam in the parish records ) and st luke s ( opened 1751 ) . pauper lunatics were cared for in the workhouse , relieved as outdoor poor , boarded - out to people to whom they had no family ties , or their care was contracted out to a series of large private madhouses which served the london area ( murphy , 2001b ; suzuki , 1992 ) . like most london parishes , st martin s parish contracted with a series of private madhouse keepers in the eighteenth and early nineteenth centuries . between 1728 and march 1746 the st martin s workhouse discharge registers record sending paupers to dr wrights who kept a private madhouse in bethnal green ( cowac , oa , 172728 : 292 , 297 ; see also andrews and scull , 2003 : 911 , 121 n.10 , 160 n.30 ) . from 1746 to 1751 lunatics between 1751 and 1755 no proprietor at bethnal green is listed . from 1755 a mr robert cope , who took over the running of the bethnal green private madhouse from mrs wright , is listed as taking in parish lunatics ( andrews and scull , 2003 : 160 , n.30 ) . from 1765 to 1776 surviving accounts show that the parish paid well over 100 pounds a year to cope to care for pauper lunatics , a service he is known to have performed for many parishes in the metropolitan area . in 1776 the parish ceased sending lunatics to cope s ( cowac , oa , 176568 ; 177176 ) . harrison cared for parish lunatics until 1784 , when , in an unusual move which reflected the growing capacity and medicalization of the workhouse , and probably a desire to save money , all parish lunatics were brought back from harrison s and cared for in - house . on 25 mar . 1784 , for example , at least 14 lunatics were returned from harrison s to the workhouse . until the first few years of the nineteenth century very few paupers were sent to private madhouses from the workhouse ( cowac , oa , 1797 , 1801 ) . there was some limited use made of bethlem and st luke s during this period of workhouse provision . in 1805 there was a reversal of this policy , with the more recalcitrant and difficult lunatics sent , initially , to a private madhouse run by a mr turney and after 1805 to the large private madhouses run by warburton & co. of bethnal green , with 166 pauper lunatics sent to warburton s from the workhouse between 1805 and 1824 ( boulton and schwarz , 2012 ; murphy , 2001a : 2506 ) . lunatics sent by the parish for treatment were monitored by the parish authorities throughout the eighteenth century , with regular sums expended on visits , clothing and tips to servants . on occasion , expert medical help was brought in by the parish to confirm a diagnosis of insanity ( cowac , oa , 1790 ; also suzuki , 1998 : 155 ) . the next section analyses the role the workhouse played in the care and treatment of pauper lunatics , how lunatics were disposed of post - mortem , and what causes of death were ascribed to the dead insane ; it also identifies the factors that helped to obfuscate the reporting of lunacy as a cause of death by the parish authorities . cured. lunacy might not be treated as a valid cause of death , the condition might be covered up or an alternative diagnosis might be applied by searcher , doctor , friend or relative ( black , 1789 : 13640 ; see also : andrews , 1991 ; andrews and scull , 2003 : 5881 ) . thus , the insane londoner might not always appear in the historical record or , if so , was only sporadically labelled as insane . this means , of course , that the incidence of lunacy must always be understated in the historical record . however , the experience of lunacy may be best understood over the life - course . case studies of known pauper lunatics in st martin s are therefore a good way to illustrate the various factors that influenced the labelling of lunatics at death in the eighteenth century . taylor with a parish settlement in st martin in the fields ( cowac , seb , 17501 : 181 ) , was first admitted to the parish workhouse in october 1750 . from this date until october 1757 , he was an inmate of the workhouse 11 times . a pattern was established of steventon being sent to , or returned from , what was certainly a private madhouse in bethnal green , in which he often stayed for substantial periods . however , it was only on his admittance to the workhouse in october 1757 , his eleventh admission , that he was labelled in the workhouse register as a lunatick. after staying for over two years in the workhouse , he was again sent to mr robert cope at bethnal green in december 1759 . . admitted ( without any label of lunacy ) in february 1761 at the age of 55 , he seems to have stayed there for about four years until his death in february 1765 . withers was buried from the workhouse at the stated age of 59 in february 1765 with a cause of death ascribed to drop[sy] ( cowac : alpw , 17465 : 27686 ; 175258 : 73 , 76 , 185 ; 175763 ; bb , 175567 ; coa , 172627 : 55 ; 175560 : 55 ) . macdonald and murphy ( 1990 : 1215 , 133 , 365 ) have observed that by the latter decades of the eighteenth century coroners juries described the overwhelming majority of those who took their own lives as being lunatics . the westminster coroners inquests , which survive complete from 1760 , commonly ascribed lunacy to virtually all those who committed suicide . these cases can be linked to the relevant individuals in st martin s . in only a handful of such cases , however , was the legal verdict of insanity recorded by the parish searchers . joseph bladzer , said to be a teenager at his death in 1760 and returned as a lunatick by the parish searchers , was reported to have hanged himself in a cellar in long acre , not being of sound mind memory and understanding but lunatick and distracted ( cowac , bb , 175567 ; cowc , ci , 14 feb.31 dec . most of those buried as lunatics in the parish did not have their deaths investigated by a coroner . this suggests that such lunatics were not suicides and that the circumstances of their deaths were not seen as suspicious or unexpected . only 9 out of 112 deaths of lunatics listed in the sexton s books are recorded as involving a coroners warrant , compared with 53 out of 68 cases of suicide . those killing themselves included just 5 cases where the searcher returned individuals who had hanged themselves being lunatic ( cowac : bb , 175567 ; sdb , 174755 ) . although most of those who were identified as committing suicide were routinely described as lunatic by coroners juries , relatively few suicides were returned as lunatics by the parish searchers . it is not always clear why a return of lunacy by the searchers was made in one case and not in another . henry danker aged 69 , a dane , was admitted to the parish workhouse on 4 aug . paul chatain s stable in castle street ( corn - chandler). at his interment on 19 mar . , the searchers recorded that he hanged himself ( cowac : alpw , 175763 : 168 ; bb , 175567 ) . the coroners jury found that danker had hanged himself , being a lunatick. a witness who found the body reported that he had known the deceased about half a year and appeared to [ the ] deponent to be of a melancholly disposition. another witness who had known him for five years confirmed the mental effects of danker s social descent . paul chatain had had the impoverished danker admitted to the workhouse , and noted he was disordered in his mind on account of his unhappy circumstances. henry smith , a workhouse servant , confirmed danker s lunacy throughout his 10-month stay in the workhouse ( cowc , ci , 8 jan . however , no reference to lunacy was made by the parish searchers when reporting his cause of death . perhaps the fact that dankers had significant social connections and had been respectable led to the concealment of his lunacy . our case studies suggest the messy historical context that lay behind any one diagnosis of lunacy as cause of death . a key question is where were the parish lunatics actually buried . of the 112 individuals labelled as lunatics at their burial in the parish , 14 were stated to have been brought back to the parish for burial from other places : 5 were brought back from bethnal green , probably mostly from private madhouses , 3 from shoreditch ( which contained harrison s madhouse at hoxton ) and 6 from other metropolitan parishes . corpses of pauper lunatics who died at private madhouses were sometimes returned direct to the workhouse and then recorded as having died at that institution . copes ye following day. her discharge entry was later annotated to the effect that she died 29 janry 1771 , presumably at cope s . nonetheless her burial , supposedly from the workhouse , was recorded in the local sexton s books without any cause of death at all ( cowac : alpw , 176469 : 10 ; sdb , 177172 ) . more straightforward was the case of the 36-year - old john pratt . admitted for the only time to the parish workhouse on 21 july 1783 , he was sent to mr harrison at hoxton 25th july 83 , died augt 23/83. his burial entry on 26 aug . 1783 duly records him as dying a lunatic at parish expense , and his given residence ( very unusually ) was said to be in the madhouse , workhouse ( cowac : alpw , 178287 : 265 ; sdb , 177984 ) . since the workhouse discharge registers give the details of 75 individuals who were discharged to hospitals and madhouses and subsequently died there , it is possible to determine the extent to which such in - patients were returned for local interment . contrary to what one might suppose , almost all those sent from the workhouse and who died at private madhouses before the end of the eighteenth century were returned for local burial . in most cases they were returned as from the workhouse. without the workhouse discharge register , in other words , there would be no evidence that these individuals had died in a hospital . of 45 workhouse inmates sent to a madhouse , and who were stated to have died there before 1805 , 40 ( 89 per cent ) can be found in the sexton s books in the appropriate place . most of those dying in private madhouses were brought back for local interment , and this probably applies to most of those dying in london s public hospitals as well . all this changed after 1805 : not one of 30 paupers sent to private mad farms , and noted to have died there , seems to have been returned for local interment . further work on the parish register of st matthew bethnal green tells us more about the interment of madhouse inmates during this period . very few lunatics can be found buried from local madhouses in the bethnal green parish register in the eighteenth century . however , from 1813 a staggering 15 per cent of all burials listed in the parish register were from local madhouses . in total there were no less than 912 dead lunatics interred out of 6038 burials recorded in the st matthew bethnal green register between 1813 and 1825 . if in all these cases lunacy as cause of death was returned to the london bills , bethnal green alone would have contributed just under one - third of all those who were recorded as having died from lunacy in this period it may be , too , that those sent to public hospitals for the insane ( st luke s and bethlem ) were far less likely to be returned to their home parish for interment . the greater majority of those who died insane in bethlem before 1677 were buried in the bethlem churchyard in st botolph bishopsgate , and after that date , when the hospital moved to moorfields , dead patients were interred in the new bethlem churchyard at st stephen s coleman street ( andrews , 1991 : 499505 ) . the sexton s burial books show no person was apparently returned for burial from either of london s public hospitals for the insane , even though a handful of parish paupers are known to have died there . just one workhouse inmate , george baker , was recorded as having been brought back dead from bethlem ( in 1798 ) after being admitted to the workhouse insane in september of that year . lunatic interment in november ( cowac : alpw , 17951811 : 23 , 26 ; sdb , 17971803 : 241 ) . of 11 as having died , links can only be made to two interments in st martin s . both were private patients ; one was said to have died of fever and the other was carried out of the parish for burial without any cause of death given . neither entry mentioned st luke s . neither the rest of the curable patients , whether private or pauper , nor the four private incurables of st martin s who died at the hospital , seem to have been returned to the parish for interment ( lma : cmb , 175074 ; cpb , 17511826 ) . it would appear that , as andrews ( 1991 : 499505 ) has observed , parishes paid hospitals to bury the insane dead , though the bodies of private patients were more likely to be recovered . how were pauper lunatics treated in the parish , and what can we learn about their causes of death ? since we have just over 400 cases where lunatics were explicitly admitted to the workhouse , the question obviously arises as to how many who died following their admission were returned as lunatics by searchers . readers should note that the workhouse admission books do not give reasons for admittance for most paupers admitted to the institution . for this reason many lunatics were probably not identified as such on admission . however , given the intermittent nature of the condition in the majority of cases , it is best not to inflate the existing figures with those re - admitted after a spell in a private madhouse or those known to have been lunatics at other times in their life - course . in some cases lunacy only became apparent after admission , and sometimes it was a response to admission . to establish what known lunatics were reported to have died of , the first ( see table 1 ) matched those admitted as lunatics who subsequently died from the workhouse to available burial records ( in the period 17471824 this was limited to 45 cases ) . of the 45 potential links , only 12 , just over a quarter , were described as lunatics at interment ; 5 of the remaining 33 seem to have been buried outside the parish ; 8 had no causes of death and the remainder died from a range of causes from smallpox , to fever , dropsy , consumption and cancer . the symptoms of some fevers and those associated with lunacy , of course , could be mistaken in the seventeenth- and eighteenth - century medical mind ( graunt , 1662 : 22 ; see also : andrews , 1991 : 503 ; macdonald , 1981 : 1458 ) . causes of death of those admitted to the workhouse as lunatics and subsequently dying there ( data from cowac , sdb , 17471812 ) the second exercise ( table 2 ) matched those stated to have died in private madhouses to the same local burial register . again , lunacy was only given as a cause of death for about a quarter of those parishioners dying in such institutions . this suggests that the number of those dying in a lunatic state returned in the bills should be multiplied by four to get at the true incidence of insanity at or around the point of death . those dying , and reported as lunatics , grossly underestimate the number of those who actually died in that state ( black , 1789 : 1289 ; graunt 1662 : 22 ) . causes of death of those who were said to have died in madhouses 17471812 ( data from cowac , sdb , 17471812 ) the apparently simple label of lunacy as cause of death returned by london s searchers , and recorded in the bills of mortality , hides a complex story . it is likely that the bulk of those returned were paupers , buried from london s public hospitals and particularly from its increasing number of private madhouses . detailed analysis revealed often contradictory paths to a label of lunacy at death . social status and the possession of some wealth tended to mean , at least for some of the deceased , that lunacy might be concealed at death intentionally suppressed as black ( 1789 : 1289 ) suspected and reported as something else . it was comparatively rare for those committing suicide to be reported as lunatics , despite the relative universality of coroners verdicts to that effect . many of those dying lunatic , as contemporaries were well aware , were reported to have been killed by other diseases and conditions . our figures suggest that only a quarter of those dying lunatic actually had lunacy ascribed as a cause of death by parish searchers . over time , lunacy as cause of death was reported more frequently in the london bills ( black , 1789 : 128 ) . in particular , there was a dramatic surge in reported lunacy towards the end of the eighteenth century . this latter must reflect the growth of private madhouses in the metropolitan area at that time and a growing readiness to return deaths of their patients as lunatics . also , although we have limited evidence of this at present , it might well be that more of those dying as lunatics were being interred in the parish where they died rather than being returned to parishes . those dying from madhouses in bethnal green might all have been returned as lunatics to the bills . the surge in lunacy in the london bills towards the end of the eighteenth century might also reflect a greater toleration and understanding of lunacy as a condition and a consequent diminishing hostility to the application of that term as a cause of death , but further research would be needed to establish this .

dying insane provoked great fear , and apprehension in the minds of men and women . death as a lunatic disrupted deathbed performance and rendered the victim incapable at law . this article examines lunacy as a cause of death in the metropolis between 1629 and 1830 . it draws on new material from the admission registers of st luke s hospital , existing data from bethlem and the london bills of mortality and unique biographical data on pauper lunatics dying in the parish of st martin in the fields . the article argues that lunacy being ascribed as a cause of death had a distinctive chronology in this period . those most vulnerable to the stigma of lunacy at death were those dying as parish paupers and those who inhabited metropolitan institutions .

leishmaniasis is a major world health problem , with an annual incidence of 1 - 1.5 million cases ( 90% occurring in the old world , including southern europe , the middle east , parts of southwest asia , and africa ) resulting in 70,000 deaths each year , with 350 million individuals at risk ( 1 ) . it is also endemic in some parts of iran , and its prevalence has been reported to vary from 1.8% to 37.9% in different provinces of the country ( 2 - 4 ) . the most common type of the disease is cutaneous leishmaniasis ( cl ) which is caused by several species of leishmania , especially l. major . pentavalent antimonials ( sodium stibogluconate or meglumine antimoniate ) are still the choice of treatment for leishmaniasis . these medications are widely used despite their toxicity , high cost , and difficult administration . other treatment options include topical paromomycin ( 5 ) , topical amphotericin b ( 6 ) , oral miltefosine ( 7 ) , and additional immunomodulators , including topical imiquimod ( 8 , 9 ) and human granulocyte macrophage colony - stimulation factor ( gm - csf ) ( 10 ) , which have been shown to be effective in the treatment of cl ( 11 , 12 ) . however , as cl is a health problem mostly in developing countries and therefore does not offer enough commercial motivation for pharmaceutical companies to develop cheaper effective anti - leishmaniasis medications , there is no effective drug or vaccine against it . opioids , including morphine , have been shown to have immunoregulatory effects through their receptor interactions with immune cells , and can thus be classified as part of the cytokine family ( 13 ) . it seems that the molecular basis for this effect is due to the modulation of cytokines and altered expression of cytokine receptors ( 13 , 14 ) . low doses of morphine , administered subcutaneously in l. donovani - infected balb / c mice or hamsters , significantly suppressed or even sterile - cleared the infection ; paradoxically , high doses exacerbated the infection ( 15 , 16 ) . on the other hand , 17 ) have shown that morphine hastens the healing process of ischemic wounds by stimulating nitric oxide ( no ) via the opioid receptor , thus promoting vasodilation . it can be hypothesized that morphine may induce the healing process of cutaneous leishmaniasis ( 18 ) . therefore , the aim of this study was to study the efficacy of topical morphine in the treatment of l. major - infected balb / c mice . healthcare corporation , cherry hill , nj , usa ) was added to the ointment base in our laboratory . the ointment base consisted of cetomacrogol 1000 , vaseline , liquid paraffin , methylparaben , and propylparaben ( sigma - aldrich , prague , czech republic ) , cetostearyl alcohol , and water . after completely cleaning the wounds with sterile normal saline , the ointment was topically applied to the wound area twice per day ( 16 , 19 ) . a total of 40 balb / c mice ( female , 6 - 8 weeks old ) were obtained from the pasteur institute of iran in tehran , each weighing ~20 g at the time of infection . the rats were maintained under controlled environmental conditions ( 12-hour light / dark cycle at 23c ) . the first group received the parasite plus placebo for two months , while the second group simultaneously received parasite and morphine ointment twice daily for two months . the third group received the parasite , and after the occurrence of wounds ( ulcers ) , the placebo was applied twice daily for eight weeks . the fourth group received the parasite , and after the occurrence of ulcer wounds , morphine ointment was applied twice daily for two months . the experiments were performed in accordance with the regulations specified by the institute s animal ethics committee , and conformed to national guidelines on the care and use of laboratory animals in iran . amastigotes of l. major ( mhom / ir/76/er ) were taken from previously infected balb / c mice . the parasites were made into a final concentration of 10 - 10 cell / ml , and 200 l of this solution was used for each inoculation . the mice were subcutaneously infected in the tail area ( 0.2 ml ) with 10 - 10 late - stage l. major mhom / ir/76/er amastigotes . cutaneous lesions were measured weekly for eight weeks using analog rulers , and compared with the untreated controls to evaluate the therapy . all statistical analyses were performed using the statistical package for social sciences , version 15.0 ( spss inc . , a power of 0.8 was expected for the present study , and the level of significance was set at p < 0.05 . healthcare corporation , cherry hill , nj , usa ) was added to the ointment base in our laboratory . the ointment base consisted of cetomacrogol 1000 , vaseline , liquid paraffin , methylparaben , and propylparaben ( sigma - aldrich , prague , czech republic ) , cetostearyl alcohol , and water . after completely cleaning the wounds with sterile normal saline , the ointment was topically applied to the wound area twice per day ( 16 , 19 ) . a total of 40 balb / c mice ( female , 6 - 8 weeks old ) were obtained from the pasteur institute of iran in tehran , each weighing ~20 g at the time of infection . the rats were maintained under controlled environmental conditions ( 12-hour light / dark cycle at 23c ) . the first group received the parasite plus placebo for two months , while the second group simultaneously received parasite and morphine ointment twice daily for two months . the third group received the parasite , and after the occurrence of wounds ( ulcers ) , the placebo was applied twice daily for eight weeks . the fourth group received the parasite , and after the occurrence of ulcer wounds , morphine ointment was applied twice daily for two months . the experiments were performed in accordance with the regulations specified by the institute s animal ethics committee , and conformed to national guidelines on the care and use of laboratory animals in iran . amastigotes of l. major ( mhom / ir/76/er ) were taken from previously infected balb / c mice . the parasites were made into a final concentration of 10 - 10 cell / ml , and 200 l of this solution was used for each inoculation . the mice were subcutaneously infected in the tail area ( 0.2 ml ) with 10 - 10 late - stage l. major mhom / ir/76/er amastigotes . cutaneous lesions were measured weekly for eight weeks using analog rulers , and compared with the untreated controls to evaluate the therapy . all statistical analyses were performed using the statistical package for social sciences , version 15.0 ( spss inc . , chicago , il , usa ) . a power of 0.8 was expected for the present study , and the level of significance was set at p < 0.05 . over the 2 - 3 weeks after inoculation of balb / c mice with 10 - 10 amastigotes of l. major ( mhom / ir/76/er ) into the base of the tail , nodules developed in groups 1 , 3 , and 4 . two weeks later ( after four weeks of study ) , the nodules transformed into ulcers . at this stage , placebo or morphine ointment was applied to groups 3 and 4 , respectively . the diameter of the lesions increased over time . on the first day of treatment , the lesions measured approximately ~1.5 mm in diameter in all groups . during the eight weeks of evaluation of the lesions , their sizes differentiated . as figure 1 shows , lesions in the animals treated with topical morphine after inoculation did not expand as much as in the other groups . the lesions treated with topical morphine after lesion presentation had smaller diameters compared to both placebo groups . the wound areas of the lesions treated with morphine ointment were smaller in size and did not ulcerate compared to the control groups . the sizes of the lesions in the four study groups after eight weeks are shown in table 1 . after eight weeks , the diameters increased to 8.9 mm and 4.8 mm , respectively , in the placebo and morphine groups that were treated after inoculation ( p = 0.0001 ) . similarly , after eight weeks of evaluation , the sizes of the lesions treated after their presentation were significantly greater in the placebo group compared to the morphine group ( 10.8 6.32 mm vs. 7.81 4.22 mm ; p = 0.003 ) . administration of morphine ointment after parasite inoculation significantly reduced the lesion size compared to administration of morphine ointment after wound occurrence ( 4.81 3.22 mm vs. 7.81 4.22 mm ; p = 0.028 ) . topical morphine administration after wound occurrence had no extra advantage in reducing lesion size compared to placebo administration at the time of parasite inoculation ( 7.81 4.22 mm vs. 8.95 5.71 mm ; p = 0.087 ) . from the fifth week of the study , the lesion size became significantly smaller in both morphine groups ( groups 2 and 4 ) compared to the controls ( groups 1 and 3 ) ( table 1 ) . group 1 , placebo after inoculation ; group 2 , morphine ointment after inoculation ; group 3 , placebo after lesions present ; group 4 , morphine after lesions present . p value < 0.05 is considered significant . using independent student s t - test . over the 2 - 3 weeks after inoculation of balb / c mice with 10 - 10 amastigotes of l. major ( mhom / ir/76/er ) into the base of the tail , nodules developed in groups 1 , 3 , and 4 . two weeks later ( after four weeks of study ) , the nodules transformed into ulcers . at this stage , placebo or morphine ointment was applied to groups 3 and 4 , respectively . the diameter of the lesions increased over time . on the first day of treatment , the lesions measured approximately ~1.5 mm in diameter in all groups . during the eight weeks of evaluation of the lesions , their sizes differentiated . as figure 1 shows , lesions in the animals treated with topical morphine after inoculation did not expand as much as in the other groups . the lesions treated with topical morphine after lesion presentation had smaller diameters compared to both placebo groups . the wound areas of the lesions treated with morphine ointment were smaller in size and did not ulcerate compared to the control groups . the sizes of the lesions in the four study groups after eight weeks are shown in table 1 . after eight weeks , the diameters increased to 8.9 mm and 4.8 mm , respectively , in the placebo and morphine groups that were treated after inoculation ( p = 0.0001 ) . similarly , after eight weeks of evaluation , the sizes of the lesions treated after their presentation were significantly greater in the placebo group compared to the morphine group ( 10.8 6.32 mm vs. 7.81 4.22 mm ; p = 0.003 ) . administration of morphine ointment after parasite inoculation significantly reduced the lesion size compared to administration of morphine ointment after wound occurrence ( 4.81 3.22 mm vs. 7.81 4.22 mm ; p = 0.028 ) . topical morphine administration after wound occurrence had no extra advantage in reducing lesion size compared to placebo administration at the time of parasite inoculation ( 7.81 4.22 mm vs. 8.95 5.71 mm ; p = 0.087 ) . from the fifth week of the study , the lesion size became significantly smaller in both morphine groups ( groups 2 and 4 ) compared to the controls ( groups 1 and 3 ) ( table 1 ) . group 1 , placebo after inoculation ; group 2 , morphine ointment after inoculation ; group 3 , placebo after lesions present ; group 4 , morphine after lesions present . few studies have been conducted on problems with topical treatments used for any form of leishmaniasis , although these treatments are commonly used for topical bacterial , viral , and fungal infections . indications for topical treatment of cl include a lack of risk of developing mucosal lesions , old world cl , l. mexicana cl , small and single lesions , and absence of lymph node metastasis ( 20 ) . the present study attempted to develop a new topical treatment for cl by examining the simple question of whether topically - applied morphine accelerates the wound - healing process of cl lesions in mice . previously , it was shown that opioids , including morphine , act as analgesics for pain relief in peripheral ulcers ( 21 ) . in addition , receptors of the opioid are present at the site of the wound and can even be activated ( 22 ) . of relevance , opioids , such as morphine and -endorphin , stimulate production of interleukin ( il)-6 in animal models ( 23 , 24 ) , which would be suggestive for enhancing wound - healing . previous studies revealed that the process of wound - healing is significantly delayed in il-6-deficient transgenic mice ( 25 - 27 ) . therefore , the faster healing observed in the present study of cl lesions with topical morphine application is consistent with all of the above effects of opioids on peripheral tissues . therefore , the major effect of morphine in the present study was to shorten the lag phase during the wound - healing process . these results can have direct implications in the healing of cl lesions , which have a long lag phase in the initial healing process . thus , the direct availability of opioids at the site of injury is probably required for the healing of cl lesions . moreover , endogenous opioid receptor agonists via peripheral opioid receptors may be involved in the healing process . opioids have been applied topically for pain management and have not caused any side - effects , such as dependence and tolerance , when used peripherally at low doses ( 21 ) . these experiments on balb / c mice infected with l. major indicate that topical formulations of morphine delay the progression of these lesions . several factors should be taken into account that can alter the efficacy of the medication . for example , the timing of the start of treatment can influence the outcome . in the present study , after eight weeks of evaluation , treatment that was started immediately post - infection had a more significant effect on lesion progression compared to treatment started after wound occurrence ( p = 0.028 ) . on the other hand , topical morphine administration after wound occurrence did not have any extra advantage in reducing lesion size compared to placebo administration at the time of parasite inoculation ( p = 0.087 ) . however , treatment with topical morphine after wound occurrence significantly delayed wound progression compared to the controls ( p = 0.003 ) . a previous study investigated the effect of subcutaneous administration of morphine on l. donovani lesions . similar to our study , the results revealed that low doses of morphine can suppress the infection and increase the number of monocytes , while high doses exacerbate the infection in animal models . previous investigations have shown different penetration levels of medications in human versus mouse skin ( 28 , 29 ) . consequently , an ointment formulation that has been optimized for an animal model will probably have different outcomes on human skin . thus , it seems that human studies are needed in order to evaluate the effect of topical morphine on leishmania lesions . first , this was a preliminary study and lacked certain additional variables , including the parasite burden of the lesions or the drainage of lymph nodes , as well as pathologic evaluations of the lesions . future studies should include these variables in order to better determine the effects of morphine . will lead to a better understanding of the mechanism of action of topical morphine for cl treatment . thirdly , we did not include a group of mice receiving conventional treatment , including topical paromomycin or topical imiquimod . it is likely that a combination of morphine with a substance active against leishmaniasis ( such as 15% paromomycin plus 12% methylbenzethonium chloride ) would give better results than each substance alone . further investigations are needed in order to clarify the effectiveness of morphine on leishmania lesions and its probable side effects , so that it can be applied in human studies . the above data suggest that topical application of morphine may accelerate the healing of cl wounds . therefore , we optimistically suggest that topical morphine can be used clinically for potentiating cl wound - healing . more studies , preferably on humans , should be performed in order to clarify the effects of topical morphine on the wound - healing process in cl . the above data suggest that topical application of morphine may accelerate the healing of cl wounds . therefore , we optimistically suggest that topical morphine can be used clinically for potentiating cl wound - healing . more studies , preferably on humans , should be performed in order to clarify the effects of topical morphine on the wound - healing process in cl .

backgroundpentavalent antimonials remain the choice of treatment for leishmaniasis , despite their toxicity , high cost , and difficult administration . as an alternative , morphine may induce the healing process of cutaneous leishmaniasis by its immunoregulatory characteristics.objectivesto study the effect of morphine on the wound - healing process of cutaneous leishmaniasis ( cl ) in a mouse model.materials and methodsthis was an experimental study in which 40 balb / c mice ( female , 6 - 8 weeks ) were divided into four groups ( each n = 10 ) who received either placebo alone ( group 1 ) , morphine ointment after parasite inoculation ( group 2 ) , morphine ointment after wound occurrence ( group 3 ) , or placebo after wound occurrence ( group 4 ) . wound size was measured weekly for eight weeks.resultson the first day of treatment , the lesions measured ~1.5 mm in diameter . after eight weeks of treatment , the wound size was significantly smaller in the mice who received morphine ointment ( 4.81 3.22 mm ) compared to those who received placebo after parasite inoculation ( 8.95 5.71 mm ; p = 0.0001 ) or placebo after wound occurrence ( p = 0.028).conclusionsthe above data suggest that topical application of morphine accelerates the healing process of cl wounds . we are cautiously optimistic that the results of this study can be used clinically for potentiating cl wound - healing .

hyperglycemia , glucose intolerance , and insulin resistance are common features of critically ill patients , especially in patients with sepsis or septic shock , even in those without preexisting diabetes mellitus [ 13 ] . in patients with obesity , metabolic syndrome , and type 2 diabetes , several adipocytokines have been identified that mediate agonistic and antagonistic effects on insulin resistance [ 4 , 5 ] . a link between adipocytokines , inflammation , and systemic insulin resistance has been established in obese and diabetic patients . in critically ill patients , little is known about the actions of the different adipokines , especially about their potential impact on insulin resistance . since its identification in 1994 leptin , a 16-kilodalton hormone , has been investigated for its role in signalling food intake , glucose homeostasis , and energy expenditure through hypothalamic pathways [ 68 ] . circulating leptin levels directly reflect adipose tissue mass and recent nutritional status in noncritically ill individuals . the mechanisms of leptin expression are unclear , possibly insulin - stimulated glucose metabolism and peroxysome proliferator - activated receptor gamma ( ppar ) are involved in adipocyte leptin induction [ 10 , 11 ] . leptin exerts its various actions on glucose metabolism and energy expenditure via binding to the leptin - receptor in the brain and peripheral tissues as pancreas , liver , adipose tissue , and in the immune system . in clinical settings , free - circulating leptin as well as soluble leptin - receptors that form complexes with circulating leptin are used to understand the pathogenetic role of leptin in regulating the inflammatory - metabolic response . various animal and human studies have shown that administration of endotoxin , tnf , and other cytokines as inducers of severe systemic inflammation result in a significant elevation of serum leptin concentrations [ 14 , 15 ] . our study investigated serum leptin and leptin - receptor serum concentrations in a large cohort of critically ill patients ( septic and nonseptic patients ) from a medical icu in order to understand the potential involvement of leptin and leptin - receptor in the pathogenesis of insulin resistance in critical illness , its regulation in severe systemic inflammation , and its potential clinical use as a biomarker in icu patients . the study was approved by the local ethics committee . written informed consent was obtained from the patient , his or her spouse , or the appointed legal guardian . a total of 137 patients ( 85 male , 52 female with a median age of 63 years ; range 1881 years ) was studied ( table 1 ) . patients were included consecutively upon admission to the icu , if they were admitted to the medical icu of the university hospital aachen due to critical illness . patients were not included in this study , if they were expected to have a short - term ( < 72 hours ) intensive care treatment due to postinterventional observation or acute intoxication . the control group consisted of 26 healthy nondiabetic blood donors ( 17 male , 9 female , with a median age of 56 years ; range 2466 years ) with normal values for blood counts , c - reactive protein , and liver enzymes . among the 137 critically ill patients enrolled in this study , 95 patients conformed to the criteria of bacterial sepsis , according to the criteria of the american college of chest physicians & the society of critical care medicine consensus conference committee for severe sepsis and septic shock . in the majority of sepsis patients , non - sepsis patients did not differ in age or sex from sepsis patients and were admitted to the icu due to cardiopulmonary disorders ( myocardial infarction , pulmonary embolism , and cardiac pulmonary edema ; n = 17 ) , decompensated liver cirrhosis ( n = 14 ) , or other critical conditions ( n = 11 ) . in sepsis patients , significantly higher levels of laboratory indicators of inflammation ( i.e. , c - reactive protein , procalcitonin , white blood cell count ) were found than in non - sepsis patients ( table 1 , and data not shown ) . nevertheless , both groups did not differ in apache ii score , vasopressor demand , or laboratory parameters indicating liver or renal dysfunction ( data not shown ) . among all critical care patients , 29.9% died at the icu and 51.8% of the total initial cohort died during the overall follow - up of 900 days ( table 1 ) . in sepsis and non - sepsis patients , no significant differences in rates of death and survival were observed ( data not shown ) . the patients in the sepsis and non - sepsis groups were compared by age , sex , body mass index ( bmi ) , preexisting diabetes mellitus , and severity of disease using the apache ii score at admittance . intensive care treatment like volume therapy , vasopressor infusions , demand of ventilation and ventilation hours , antibiotic and antimycotic therapy , renal replacement therapy , and nutrition were recorded , alongside a large number of laboratory parameters that were routinely assessed during intensive care treatment . intraassay ( interassay ) coefficient of variation ( cv ) ranged from 4.2% to 7.6% ( n = 8) ( 4.4%6.7% ( n = 6 ) ) . human leptin - receptor concentrations in serum were determined using a commercially available elisa ( cat . intraassay ( interassay ) coefficient of variation ( cv ) ranged from 7.1% to 7.3% ( n = 8) ( 6.2%9.8% ( n = 6 ) ) . due to the skewed distribution of most of the parameters , differences between two groups are assessed by mann - whitney - u - test and multiple comparisons between more than two groups have been conducted by kruskal - wallis - anova and mann - whitney - u - test for post hoc analysis . they display a statistical summary of the median , quartiles , range , and extreme values . the whiskers extend from the minimum to the maximum value excluding outside and far out values which are displayed as separate points . an outside value ( indicated by an open circle ) is defined as a value that is smaller than the lower quartile minus 1.5-times interquartile range , or larger than the upper quartile plus 1.5-times the interquartile range . a far out value is defined as a value that is smaller than the lower quartile minus three times interquartile range , or larger than the upper quartile plus three times the interquartile range . correlations between variables have been analysed using the spearman correlation tests , where values of p < .05 were considered statistically significant . the prognostic value of the variables was tested by univariate and multivariate analysis in the cox regression model . all statistical analyses were performed with spss version 12.0 ( spss , chicago , il , usa ) . it had been reported that circulating leptin levels were low in critically ill patients upon admission to the icu , possibly due to an acute stress response , with lowest levels in patients with sepsis . we therefore tested free leptin and soluble leptin - receptor serum concentrations in 137 critically ill patients upon admission to our medical icu . surprisingly , we did not observe significant differences in icu patients as compared to healthy controls ( figure 1 ) . moreover , when we compared patients with sepsis ( n = 95 ) and patients without sepsis ( n = 42 ) , no significant difference for either leptin or leptin - receptor concentrations could be detected ( figures 1(b ) and 1(d ) ) . additionally , we performed subgroup analyses comparing patients with sepsis of pulmonary origin to those with abdominal or other septic focuses . however , leptin and leptin - receptor serum concentrations did not differ between these subgroups ( data not shown ) . leptin is a cytokine mainly derived from adipose tissue and its concentrations directly reflect adipose tissue mass and the current nutritional status in noncritically ill individuals . consequently , we observed a close correlation between the patients ' body - mass indices ( bmi ) and their leptin serum concentrations ( r = 0.478 , p < .001 , spearman rank correlation test ; figure 2(a ) ) . by grouping the patient cohort to different bmi classes ( < 20 , 2025 , 2530 , 3035 , > 35 ) , a clear increase in serum leptin with the bmi can be demonstrated ( figure 2(b ) ) . in line , an inverse association between bmi and the circulating leptin - receptor could be revealed , with lowest leptin - receptor concentrations in obese patients with a bmi > 35 kg / m ( figures 2(c ) and 2(d ) ) . patients with a preexisting diabetes ( n = 46 ) had significantly higher serum leptin levels ( median 8.8 ng / ml ) than patients without diabetes ( n = 91 , median leptin 4.9 ng / ml , p = .013 ; figure 2(e ) ) . however , leptin - receptor serum concentrations did not differ in critically ill patients with or without diabetes ( figure 2(f ) ) . leptin has been functionally linked to inflammatory proteins as it may directly interact with c - reactive protein . we observed an inverse correlation between leptin and procalcitonin , but not to c - reactive protein or interleukin-6 ( table 2 ) . with respect to organ dysfunction in the critically ill patients , we could not detect a significant correlation between leptin and renal function ( e.g. , glomerular filtration rate , cystatin c , creatinine ; data not shown ) . however , the hepatic biosynthetic capacity was closely associated with serum leptin concentrations , as evidenced by significant correlations to serum protein , albumin , prothrombin time , antithrombin iii , and pseudocholinesterase activity ( table 2 ) . several observations in mouse models suggested that the actions of leptin on glucose homeostasis are independent of its effects on food intake , but associated with proper function of hypothalamic leptin - receptors [ 19 , 20 ] . we observed a close correlation of insulin and c - peptide with leptin and an inverse correlation with leptin - receptor ( table 2 ) . furthermore , markers of lipid metabolism , for example , total cholesterol , hdl cholesterol , and ldl cholesterol were closely associated with leptin serum concentrations ( table 2 ) . in contrast to leptin , a correlation between serum leptin - receptor concentrations and metabolic parameters could not be found ( table 2 ) . an association between leptin - receptor and procalcitonin as well as insulin could be observed , but not with other inflammatory or metabolic parameters ( table 2 , and data not shown ) . interestingly , leptin - receptor showed significant correlations to various parameters reflecting cholestasis such as bilirubin , conjugated bilirubin , gamma - glutamyltranspeptidase , and alkaline phosphatase activity ( table 2 ) . this might indicate that biliary excretion could be possibly involved in leptin - receptor clearance . cox regression analyses and kaplan - meier curves were used to assess the impact of leptin and leptin - receptor on icu and overall survival during a nearly three - year follow - up among critically ill patients . no significant association between leptin and the icu- or overall - survival of the patients could be identified using uni- and multivariate cox regression analysis ( data not shown ) . remarkably , leptin - receptor serum concentrations upon admission to the medical icu were an unfavourable indicator of icu survival ( p = .047 ) as well as of overall survival ( p = .034 , cox regression analysis ) . using a cut - off value for leptin - receptor of 32 ng / ml , kaplan - meier curves were plotted to display mortality ( log rank 6.77 ; figure 3(a ) ) . in line , surviving patients had significantly lower leptin - receptor concentrations ( median 26.8 ng / ml ) than nonsurvivors ( median 34.5 ng / ml , p = .037 , u - test ; figure 3(b ) ) . hyperglycemia and insulin resistance are common in critically ill patients and have been identified as adverse prognostic predictors in icu patients . in obesity and type 2 diabetes , adipocytokines are critical mediators linking chronic inflammatory conditions to systemic insulin resistance . the best studied adipocytokine in critical illness at present is resistin , which was suggested to serve as an acute - phase component as it is strongly upregulated in patients with severe sepsis and septic shock [ 21 , 22 ] . very little is known about the potential role of leptin in this clinical condition . in a recently published study , it has been reported that serum leptin concentrations are low in all critically ill patients on admission to the icu , with lowest levels in sepsis patients . as a possible mechanism , reduced synthesis or increased removal either by extravasation due to capillary leakage in sepsis or , the sofa score on admission was statistically significantly higher in sepsis patients as compared to nonseptic patients . moreover , a prior study demonstrated decreased plasma leptin levels due to trauma which were explained to be partly related to the initial fasting conditions , because refeeding elevated serum leptin concentrations to normal levels . in our study , the leptin and leptin - receptor concentrations did not differ in patients with critical illness from healthy controls . subgroup analysis revealed no significant difference in sepsis and non - sepsis patients as well ( figure 1 ) . this difference might very likely be related to our cohorts of septic and nonseptic patients , which were very homogenous in terms of severity of illness as reflected by apache ii and sofa score . moreover , our study population had a slightly higher median bmi and therefore possibly a better nutritional status in the subgroups of patients with and without proven sepsis . however , in contrast to prior observations , our data indicate that circulating leptin and leptin - receptor levels are not severely dysregulated in critically ill patients at the point of admission to the icu . leptin has various peripheral and central targets , including cells of the brain , pancreas , liver , adipose tissue , and immune system . in animal models , deletion of the cerebral leptin - receptor leads to obesity and elevated plasma levels of leptin , glucose , and insulin . leptin deficiency in humans either due to an absolute shortage of leptin or due to leptin - receptor mutations causes severe early onset obesity , hyperphagia , hyperinsulinemia , hypogonadism , and impaired t cell function . in individuals with leptin - receptor defects , the features of leptin deficiency appear ameliorated , which might give a hint for the existence of alternative , leptin - receptor independent , leptin signalling pathways . in line with the current view of leptin as being a cytokine , mainly derived from adipose tissue and reflects adipose tissue mass , we found a close association to the patients ' bmi ( figures 2(a ) and 2(b ) ) . accordingly , an inverse association could be observed for the circulating leptin - receptor ( figures 2(c ) and 2(d ) ) , which is expressed by various tissues and serves as a binding partner for leptin in the circulation . the regulation of glucose metabolism by leptin is likely independent of its effect on food intake and energy expenditure . hypothalamic expression of leptin - receptor in animal model resulted in modest reduction of food intake and body fat mass , but in normalized blood glucose and insulin levels . the present data suggest the existence of two leptin signalling pathways : the leptin - receptor mediated jak - stat ( janus kinase signal transducers and activators of transcription ) signalling for regulation of food intake and body weight , and pi3k ( phosphoinositide-3 kinase ) pathway for regulation of glucose metabolism [ 19 , 20 , 27 ] . these experimental findings might very well explain why we did not only observe a strong association between patients ' bmi and leptin , but also between glucose metabolism ( e.g. , insulin secretion ) and serum leptin levels in critically ill patients . it has been reported that human c - reactive protein ( crp ) inhibits the binding of leptin to its specific receptor and blocks signal transduction in cultured cells and mouse models ; thus , it might attenuate the physiological function of leptin and contribute to the concept of leptin resistance . in our study , we could demonstrate an inverse correlation between leptin and procalcitonin and a direct correlation between leptin - receptor and procalcitonin , but not with possibly , acute bacterial inflammation , as displayed by procalcitonin , in critically ill patients contributes to the state of leptin resistance , yet the clinical impact of leptin resistance in critical illness is still unsettled . furthermore , we analyzed the association of leptin with markers of organ function in icu patients . leptin did not correlate with renal function as reflected by glomerular filtration rate , cystatin c , and creatinine . we observed that the hepatic biosynthetic capacity was closely related to leptin levels ( table 2 ) . this finding in critically ill patients is in contrast to reports from patients with liver cirrhosis , in which leptin levels are rather upregulated [ 13 , 28 ] . remarkably , leptin - receptor serum concentrations upon admission to the medical icu were an unfavourable indicator of icu survival ( p = .047 ) as well as of overall survival ( p = .034 ) ( figures 3(a ) and 3(b ) ) . this observation was highly unexpected , especially since leptin - receptor was not an obvious surrogate marker for other alterations , for example , inflammation , organ failure , in critically ill patients . the association with survival was independent from other parameters by multivariate regression analysis ( data not shown ) . the exact functional contribution of soluble leptin - receptor or free leptin in the pathogenesis of critical illness or sepsis is currently unclear , and additional studies in experimental models are warranted . it is also important to note that future studies should incorporate longitudinal measurements of leptin and leptin receptor during the course of critical illness , as this might help to clarify the potential pathogenic contributions at different phases of initiation and recovery from acute illness . however , the association of leptin - receptor with survival raises the possibility that including serum leptin - receptor concentrations might improve the validity of prognostic assessments in critically ill patients upon admission to the icu . although leptin and leptin - receptor serum concentrations do not differ in patients with critical illness or in the subgroups of patients with and without sepsis from healthy controls , serum leptin in critically ill patients is closely correlated with the patients ' bmi and metabolic alterations . the possible functional role of leptin in the pathogenesis of severe illness warrants further studies . however , soluble leptin - receptor turned out to be an independent prognostic marker at admission to the medical icu , thereby emphasizing the impact of the complex metabolic alterations on the clinical outcome of critically ill patients .

the adipocyte - derived cytokine leptin was implicated to link inflammation and metabolic alterations . we investigated the potential role of leptin components in critically ill patients , because systemic inflammation , insulin resistance , and hyperglycemia are common features of critical illness . upon admission to medical intensive care unit ( icu ) , free leptin and soluble leptin - receptor serum concentrations were determined in 137 critically ill patients ( 95 with sepsis , 42 without sepsis ) and 26 healthy controls . serum leptin or leptin - receptor did not differ between patients or controls and were independent of sepsis . however , serum leptin was closely associated with obesity and diabetes and clearly correlated with markers of metabolism and liver function . leptin - receptor was an unfavourable prognostic indicator , associated with mortality during three years follow - up . our study indicates a functional role of leptin in the pathogenesis of severe illness and emphasizes the impact of complex metabolic alterations on the clinical outcome of critically ill patients .

application of chemotherapeutic agents bound to magnetic nanoparticles is a promising approach for site specific drug deposition . magnetic - drug - targeting ( mdt ) is intended to elevate the drug concentration in the region of interest , because the drug loaded particles are enriched by a focused external magnetic field to defined body compartments after application [ 14 ] . this method can lead to both higher potency of antitumor treatments and reduction of negative side effects . in our model , drug loading was realized with mitoxantrone ( mto ) ( figure 1 ) , an anthracendion derivative which inhibits the dna and rna synthesis and causes dna strand breaks by intercalation [ 5 , 6 ] . this agent is used extensively in clinical trials to treat fatal diseases including leukemia , lymphoma , cancers of the breast and prostate , and to treat multiple sclerosis [ 8 , 9 ] . the applicability of this technique for the quantification of ferrofluids ( ff ) in tissue has been demonstrated previously for an extracted tumor slice model , a specific artery model , and is even in process for the whole body distribution . mto enrichment might be different , so we are interested in developing an easy multifunctional method to quantify the amount of mto , especially if it is bound to coated nanoparticles . various methods have been described to extract mto from blood plasma [ 1216 ] and tissues on its own . moreover there are established protocols to determine mto by hplc measurements in context of drug delivery systems like liposome carriers and nanosphere vehicles . protein precipitation with 0.5 m hydrochloric acid : acetonitrile ( 90 : 10 , v / v ) , as described by johnson et al . , leads to a recovery of pure mto in porcine muscle tissue of more than 85% ( table 1 ) . nevertheless , measurement of mto bound to iron oxide nanoparticles is more difficult , and extracting whole organs of white new zealand rabbits this way was unfeasible . lu et al . developed a helpful method to determine mto , which has been applied in the form of bovine serum albumin ( bsa ) nanospheres and revealed also promising results in our context . but in order to reliably capture even trace amounts of mto , an optimization of the extraction mode has been necessary , as well as the development of a subsequent solid phase extraction ( spe ) method . here we present a newly developed method to determine mto in different tissues and of different binding statuses . the analytical grade solvent , methanol , acetonitrile , chloroform were obtained from carl roth , germany and merck , germany . other chemicals were either delivered by merck , germany ( formic acid , sodium formate , phosphoric acid , potassium dihydrogen phosphate , and citric acid ) , carl roth , germany ( trichloroacetic acid and sodium citrate dihydrate ) , or sunlife , germany ( ascorbic acid ) . mto was delivered by neocorp pharma ( lot : 82056305 , expiration date : 05/2010 ) , germany ( test sample , a concentrate ( 2 mg / ml ) to produce an injection solution ) . the hplc analyses were performed by a waters alliance model consisting of a separation module ( 2695 series ) and a dual wavelength absorbance detector ( 2487 series ) . the separation was carried out using a 3.0 100 mm x - bridge phenyl column ( waters , germany ) with a particle diameter of 3.5 m ; the guard column consisted of the same material and was 3.0 20 mm of size . the column temperature was 55c , the mobile phase was made up of buffer ( 80 nm sodium formate and formic acid , ph 3.0 ) and methanol ( 80 : 20 v / v ) . flow was 1 ml / min , the injection volume was 50 l at room temperature . all measurements were performed after an hplc - method validation including selectivity , linearity , limit of quantification , precision , accuracy , recovery rate , and stability according to a validation protocol [ 21 , 22 ] . prior to the sample measurements , a calibration curve with mto - concentrations of 10 ng / ml20 000 ng / ml was done . for the extraction experiments , we used porcine muscle tissue and liver tissue which were doped with defined amounts of pure mto or mto bound to ff . this occurred by adding dissolved mto at defined values ( see tables 1 and 2 ) to tissue homogenates and incubating overnight at room temperature . due to the complexity of liver tissue and the successful determination here and moreover in muscle tissue , this method could be suitable to perform a complete biodistribution of mto in rabbits . liver or muscle tissue , doped with mto , was homogenized for 1 minute using an ultra turrax apparatus ( ika , staufen , germany ) to lyse the cell membranes prior to sonication . several extraction mixtures containing hydrochloric acid or phosphoric acid in combination with meoh were tested for extraction efficiency and their compatibility with the spe procedures ( see tables 1 and 3 ) . for the extraction , simple shaking for 4 or 24 hours was compared to vortex mixing and 1 to 4-fold ultrasonic treatment with a duration of 1 hour each using an ultrasonic bath ( us ) ( bandelin sonorex tk 52 , berlin , germany , without temperature control ) ( table 2 ) . an alternatively performed accelerated solvent extraction ( ase ) was done with ase 200 ( dionex , idstein , germany ) at temperatures of 40c and 80c according to a protocol of klejdus et al . . the cycle time was 10 minutes and just one cycle for each sample was performed . to sum up , each 0.5 g mto - containing tissue was treated 4 times for 1 hour with ultrasound in the extraction mixture ( 500 l water , 50 l ascorbic acid ( 20% ) in citrate buffer ( ph 3.0 ) 200 l methanole ( meoh ) , 200 l formic acid , 100 l , 20% trichloroacetic acid , 400 l chloroform ) followed by centrifugation for 10 minutes at 8000 g ( jouan mr 23 i , germany ) . the combined supernatant was concentrated via a bond elut plexa ( 200 mg , 6 ml , varian , darmstadt , germany ) cartridge after conditioning with acetonitrile ( mecn ) and 2% formic acid in water . the analyte was eluted with 5 ml 2% formic acid in mecn and dried under airstream . the water resolved residue was measured by hplc as described above to display the efficiency of the extraction . in terms of drug delivery with nanoparticles , only traces of mto are embedded in different tissues so that the whole organ has to be processed . the extraction of mto using 1 n hydrochloric acid ( hcl ) , meoh/1 n hcl ( 50 : 50 v / v ) , or 1 n hcl / mecn ( 90 : 10 v / v ) was efficient for extracting pure mto ( table 1 ) . when it was bound to ff , the yield decreased significantly . since a one - phase - extraction led to turbid , protein - rich supernatants , protein precipitation by trichloroacetic acid ( tca ) as well as carrez - clearing a new point of view offered the extraction mode of lu et al . with a two - phase - extraction system to separate interfering lipophilic substances in organs , especially liver tissue . this method gave also the possibility to precipitate the protein fraction and save mto from decomposition . nevertheless , we modified this method because more tissue and less mto required an optimization . we used homogenization for 1 minute via ultra turrax ( ika ) to dehisce the cell membranes prior to sonication . simple vortexing and just one single extraction cycle obtained only 26% recovery ( table 2 ) . ultrasonic extraction was superior to simple vortexing , and multistep - extraction even increased the efficiency . a 4-fold extraction each for 1 hour was nearly quantitative ( 88 4% ) ( figure 2 ) . of course , the accelerated solvent extraction ( ase ) ( table 2 ) method led to high extraction rates in short time but this is very expensive . moreover , ase tends to require also a useful spe processing afterwards . to quantify the mto amount of a whole organ , a useful spe method was necessary . unfortunately all the extraction modes described in table 1 lead to turbid , protein - rich supernatants clogging the spe cartridge . using the rp-18 cartridge ( sep - pak - plus c18 , 360 mg , waters ) and a standard elution procedure with water and meoh , recovery of mto was not sufficient although pretesting with pure mto gave promising results ( > 90% ) ( table 3 ) . a recovery rate of 76% by extraction of mto in porcine liver tissue with phosphoric acid was adequate ( table 3 ) . it is also possible to extract , fixate , and elute mto bound to ff when using phosphoric acid or phosphate ; but in the presence of liver tissue , the recovery of mto connected to ff was scarce after the elution from the cartridge . in that case , the ff dissolved under these conditions and interestingly only traces of mto could be detected , no matter what kind of conditioning mode was used for the spe . most of the tested cartridges perform the fixation and elution of released mto bound to ff , but in presence of liver tissue only varian bond elut plexa gave appropriate yields with more than 80% recovery ( table 4 ) . to sum up , the whole method entails a 1-hour ultrasonic extraction repeated 3 of tissue with the 2-phase extraction - solution followed by concentration and purification via varian bond elut plexa cartridge and the consecutive hplc measurement ( figure 3 ) . chromatograms obtained from processed blank liver tissue did not show interfering peaks at the retention time of pure mto measured by hplc as seen in figure 4 . selectivity was proved from 6 blank animals using their liver , lung , kidneys and muscle tissue . kidney , lung , and muscle tissue show a baseline chromatographic resolution of at least 1.5 from all other sample components and can be declared as fully separated . this criterion can not be achieved for liver . the deficient baseline resolution could influence the analyte response . experiments were performed to evaluate to what extend the impurity peak will affect the final assay result . 6 extraction solutions doted with mto at the same amount , as the impurity peak is responding to ( 100 ng / ml ) , were concomitant analysed with identical amount of 100 ng / ml mto in mobile phase solution . t - test of these 2 different population means gave the result that the impurity peak influences the respond significantly . to meet the specific criteria that nonseparable impurity peaks influence the result at most for 0.5% mto , amounts more than 250 ng / ml can seriously be quantified . 5 independent sets of calibration standards including blank samples have been prepared comprising values from 10 ng / ml to 20000 ng / ml pure mto ( 0 , 10 , 20 , 50 , 100 , 1000 , 2000 , 5000 , 10000 , 20000 ng / ml ) ; the 10 ng / ml standard was detected as the lowest limit of quantification ( lloq ) . the maximum deviation of the back calculated values for the lloq was 11.8% and 13.4% for reading points unlike the lloq . the deviation of each reading point meets the fda specification for linearity of 15% ( lloq 20% ) . goodness of fit was not evaluated , because the correlation coefficient with more than 0.999 guarantees a sufficient linear correlation between mto concentration and analytical response over the whole range ( figure 5 ) . the lloq was determined according to the guidelines of fda for bioanalytical method validation and is defined as the 5-time response compared to blank samples . intraassay precision is determined for 3 concentrations of pure mto ( 5000 ; 10000 and 15000 ng / ml ) . the level for 5000 ng / ml gave 1.0% relative standard deviation , the according data for the 10000 ng / ml and 15000 ng / ml levels are 0.9% and 1.0% , respectively . interassay precision was performed on 5 different days for the same values mentioned for intraassay . the relative standard deviations were : 1.4% for 5000 ng / ml , 8.6% for 10000 ng / ml and 2.4% for 15000 ng / ml . intraassay accuracy is determined for 3 concentrations of unbound mto ( 5000 , 10000 , and 15000 ng / ml ) . the level for 5000 ng / ml gave a deviation of the mean from the true value of 1.4% ; for 10000 ng / ml measurements gave 1.7% and 1.8% for 15000 ng / ml , respectively and so meet the criteria which are 80120% for the target concentration . the accuracy values ( deviation of the mean from the true value ) were 2.1% for 5000 ng / ml , 5.6% for 10000 ng / ml , and 0.3% for 15000 liver tissue was used exemplarily to evaluate the recovery rate with variable tissue and mto amounts . the recovery rate of mto in 5 g liver tissue was evaluated for 3 different mto concentrations . series a was doped with 25 g , series b contained 2.5 g , and series c 0.25 g mto bound to ff . the total recovery rate ( extraction and spe ) for mto in liver tissue for series a ( 5000 ng / g ) was 76 2% for series b ( 500 ng / g ) 67 5% and for series c ( 50 ng / g ) 68 4% . the experiments were performed for 3 independent samples keeping in mind that the recovery can be different when using other tissues than liver . for biodistribution , recovery depends on the total weight of organs . the bigger the organs are the more mto can be extracted in comparison to smaller organs having the same drug concentration . processing the mto - containing samples , the extraction from tissue material and spe afterwards can lead to fragmentation of the analyte . we proved the stability of mto by treating mto and mto bound to ferrofluids in the extraction solution ( 12500 ng mto / ml ) for 3 hours in an ultrasonic bath . reprocessing using bond elut plexa ( varian ) cartridges lead to recovery of 85 1% ( n = 3 ) in case of pure mto samples and 89 1% ( n = 3 ) in case of ferrofluid - bound mto samples . we used the method , described above with 4 1 hour ultrasonic extraction ( figure 3 ) , to measure the biodistribution of mto in rabbits ( new zealand white , charles river corp . new zealand white rabbits were used in accordance with the responsible authority ( regierung von mittelfranken , request : 54 - 2531.31 - 27/06 approved in april 2007 ) . the animals , weighing about 4.55.2 kg , were treated with ferrofluid - bound mto containing a drug amount of 10% to the regular systemic dose which requires 10 mg mto / m body surface . complete organs of liver , lung , kidneys , and a muscle tissue sample were processed and treated in a 100 ml glass flask ( duran , germany ) with the respective amount of extraction solution increased to the amount for the weight of the entire organ as described above followed by spe . the application of this newly developed method has been proven suitable in a starting in vivo pilot study with new zealand white rabbits . first experiments with ferrofluid - bound mto showed that the highest enrichment could be found in the kidneys . the results exhibited the wide range of mto amounts in different tissues and proved the suitability of the method for different kinds of biological materials ( table 5 ) . to the best of our knowledge , none of the existing protocols , concerning the analysis of mitoxantrone in tissues , have been feasible for our approach of ferrofluid - bound mto . moreover , there is especially a lack of techniques to detect small amounts in large scaled tissues . with our method connecting efficient extraction procedures with enrichment strategies towards detectable extraction solutions , we are able to perform biodistribution studies . monitoring mto enrichment in different tissues in case of ff - bound drug delivery and overlapping the results with magnetorelaxometric measurements , complex biodistribution patterns after application of mto - bound iron oxide nanoparticles become low hanging fruits . current developments in chemotherapy increasingly base on nanoscaled delivery systems . nanoparticles , liposomes , encapsulations , micelles , and other nanostructures carrying chemotherapeutics require newly developed or modulated analytical methods . with this protocol in hand further detailed analytical instructions can be developed for adsorptive drug delivery systems using well - established and prevalent applied hplc . here we present an easy - to - perform and versatile applicable new method to determine even small amounts of mitoxantrone , regardless if it is in pure or ferrofluid - bound condition in tissues or other biological matrices . established procedures have not been useful in our context to detect mitoxantrone , especially in presence of ff and contained in tissue samples weighing more than 100 g which especially is necessary for medical application studies in cancer research . we applied this method to evaluate the biodistribution of mto in rabbit tissue . within first experiments , we could easily perform the measurements of whole organs and showed the applicability of this new method and its widespread possibilities and analytical applications .

in medicine , superparamagnetic nanoparticles bound to chemotherapeutics are currently investigated for their feasibility in local tumor therapy . after intraarterial application , these particles can be accumulated in the targeted area by an external magnetic field to increase the drug concentration in the region of interest ( magnetic - drug - targeting ) . we here present an analytical method ( hplc - uv ) , to detect pure or ferrofluid - bound mitoxantrone in a complex matrix even in trace amounts in order to perform biodistribution studies . mitoxantrone could be extracted in high yields from different tissues . recovery of mitoxantrone in liver tissue ( 5000 ng / g ) was 76 2% . the limit of quantification of mitoxantrone standard was 10 ng / ml 12% . validation criteria such as linearity , precision , and stability were evaluated in ranges achieving the fda requirements . as shown for pilot samples , biodistribution studies can easily be performed after application of pure or ferrofluid - bound mitoxantrone .

brucellosis , a primarily contagious disease of domestic animals , is caused by small , fastidious gram - negative coccobacilli of the genus brucella . there are four important species pathogenic to humans : b. melitensis , found primarily in goats , sheep and camels ; b. abortus in cows ; b. suis in pigs ; and b. canis in dogs . the brucella species differ in degree of virulence and invasiveness with b. melitensis being the most invasive and most severe disease while b. abortus is the least invasive . in saudi arabia , human infection with b. melitensis is common ( 80 - 100% ) while infection with b. abortus is less frequent . humans are commonly infected through ingestion of raw milk , cheese or meat , or through direct contact with infected animals , products of conception or animal discharges ( e.g. , among shepherds , farmers and veterinarians ) , and through inhalation of infectious aerosols ( e.g. , by workers in abattoirs and microbiology laboratories ) . human brucellosis can be an acute or a chronic febrile illness and presents with a variety of manifestations after an incubation period , which can vary from 1 to 6 weeks or several months . brucellosis may be difficult to distinguish clinically from a number of other infections such as typhoid fever , tuberculosis , infective endocarditis , and acute rheumatic fever . the symptoms of acute illness are fever , chills , headache , muscle and joint pains , malaise , nausea , night sweats and loss of appetite persisting 3 to 6 weeks . the bm and spleen are commonly involved , and such involvement may result in a hypoplastic pattern on a peripheral blood smear . hematological complications of brucellosis are common and can be multifactorial due to the pathogen s tropism for central organs ( e.g. , bm ) and peripheral organs ( e.g. , spleen ) of the reticuloendothelial system ( res ) . changes in the hematological parameters are observed in most patients , but pancytopenia is rare . hemophagocytosis , hypersplenism or granulo - matous changes in the bm may be responsible for pancytopenia in brucellosis . additionally , bm involvement due to simultaneous presentation of malignant diseases with brucellosis rarely leads to pancytopenia . although the presentation of acute brucellosis with mesenteric lymphadenitis and pancytopenia is rare , it must be considered in patients in endemic areas . the aim of this study was to estimate the relative frequency of pancytopenia in saudi children with brucellosis . this study was conducted at al - khafji joint operations hospital , saudi arabia , from august 2011 to october 2012 . all children suffering from fever for more than 5 days , without clinically evident cause for fever , with symptoms suggestive of brucellosis such as weight loss , weakness , anorexia and polyarthalgia were screened for brucellosis by a rapid slide serum agglutination test using plasmatic stained febrile antigens reagent code number fa/018 for b. abortus and fa/020 for b. melitensis . if a positive result was obtained , tube agglutination test was performed . titer of 1/20 up to 1/360 was done for each serum to avoid prozone effects . titer of 1/160 or more and rising antibody titers were considered to be positive . of the positive cases , by slide agglutination test , 10 ml blood samples and/or bone marrow aspirates were obtained under complete aseptic procedures , inoculated and mixed on hemoline performance diphasique , biomerieux blood culture system and oxoid signal blood culture system code bc0100 . the medium was designed to create pressure in the sealed bottle when organisms were growing . a positive result is signaled when the blood / broth mixture rises above the green locking sleeve of the growth indicator device . positive growth was subcultured on blood , chocolate and macconkey s agar media , both aerobically in 5% co2 atmosphere and anaerobically . gram stain , oxidase , catalase , urease and other biochemical reactions were performed for identification of brucella species . all children with positive tube agglutination test or positive blood or bm cultures were enrolled in the current study . baseline data were collected including demographic data , documented family history of brucellosis , ingestion of raw milk , cheese or meat or contact with infected animals or their products , and history of hematological disorders . laboratory workup included completed blood count ( cbc ) , erythrocyte sedimentation rate ( esr ) , and c - reactive protein ( crp ) . when indicated , coagulation profiles , including prothrombin time ( pt ) , activated partial thromboplastin time ( aptt ) and plasma fibrinogen level , were assayed . pancytopenia was considered if age - corrected white blood cell count , platelet count and hemoglobin were low . in cases with bicytopenia and pancytopenia , data entry and statistical analysis were performed by application of the statistical package for the social sciences ( spss ; ibm , inc . demographic and clinical characteristics of 60 children diagnosed as having brucellosis , presented as number ( n ) and percentage ( % ) none of the screened children with titer < 1:160 had positive blood or bm culture for brucellosis . sixty children , diagnosed as brucellosis whose titer 1:160 by tube agglutination method , were enrolled in this prospective study . age of the enrolled children ranged between 5 - 16 years ( meansd : 7.61.8 ) , of which 43 ( 71.7% ) were males . table 2 summarizes the hematological manifestations , cultures , and agglutination titers among the 60 children suffering brucellosis . among the 23 ( 38.3% ) patients with positive blood culture , b. melitensis was isolated in 21 ( 35% ) cases and b. abortus in only 2 ( 3.3% ) cases . out of all patients with brucellosis , 11 patients ( 18.3% ) had pancytopenia at diagnosis of which 6 ( 55% ) patients had petechiae , pupura and/or bleeding . the majority of patients with pancytopenia ( 72.7% ) had an agglutination titer of 1/320 - 1/640 or more . interestingly , blood culture was positive for b. melitensis in all patients with pancytopenia ( table 3 ) . hematological manifestations , cultures and agglutination titres among 60 study children , presented as number ( n ) and percentage ( % ) . the source of infection is likely to be fresh unpasteurized milk or milk products consumption or via direct contact with infected animal tissues . although brucellosis has been controlled in many developed countries , it remains an important health problem in developing countries , particularly in the mediterranean region , middle east and west asian countries . . however , other hematological abnormalities such as severe thrombocytopenia , pancytopenia , acute hemolytic anemia , and disseminated intravascular coagulation are not infrequent . in the current study , out of 133 patients with fever lasting more than 5 days , 60 children were diagnosed as having acute brucellosis based on tube agglutination test method . the majority ( 83% ) of patients declared raw animal milk / raw dairy products consumption while 45% had a positive family history of brucellosis . al - eissa reported that brucellosis in saudi population presents in both genders and all ages and that the main form of acquiring disease is through ingestion of raw milk and milk products obtained mainly from infected goats or camels , a traditional custom fostered by the nomadic heritage and dietary habits of the people . patients with brucellosis usually present with fever , chills , malaise , weight loss , joint involvement , hepatosplenomegaly and lymphadenopathy . in the current study , the main symptoms at presentation in 60 children with brucellosis were excessive sweating ( 68% ) , bone aches ( 62% ) and chills ( 55% ) . the main signs in these patients were arthritis / arthralgia ( 32% ) , hepatomegaly ( 18% ) and splenomegaly ( 15% ) . hematological dyscrasias in study children with brucellosis included anemia ( 43% ) , leukopenia ( 38% ) , leukocytosis ( 20% ) and pancytopenia ( 18% ) . these findings were in accordance with other reports conducted in both pediatric and adult patients with proven brucellosis . similarly , in south - western saudi arabia , benjamin and annobil have reported an incidence of leucopenia in 38% , anemia in 64% , and thrombocytopenia in 28% of brucellosis candidates . many other studies of hematological changes during the active course of brucellosis showed that leukopenia occurred in 33% of patients , anemia in 44% , thrombocytopenia in 5% and pancytopenia in 14% . the relative frequency of pancytopenia with brucellosis varies from 2% to 14% in previous studies , being relatively higher in adults than in children . the possible mechanisms suggested for pancytopenia include hypersplenism , granuloma formation in the bm , phagocytosis of formed elements by reticuloendothelial cells or bm depression due to associated septicemia . although anemia in brucellosis is expected to be due to bm involvement , numerous other pathogenetic mechanisms can be ( and have been ) implicated . bourantas et al reported that brucellosis induced an autoimmune process , culminating in autoimmune hemolysis . in this study , blood culture was positive for brucellosis in 23 children ( 21 for b. melitensis and 2 for b. abortus ) . the majority ( 63% ) of children with brucellosis had serum agglutination titers of 1/160 - 1/320 . in this study , the most common symptoms and signs in 11 children with pancytopenia included bone aches and weakness ( 82% ) , sweating and chills ( 64% ) , petechiae and purpura ( 55% ) , hepatomegaly and splenomegaly ( 46% ) . the majority ( 73% ) of children with pancytopenia had agglutination titers of 1:320 - 1:640 or more . furthermore , all cases with pancytopenia had positive blood culture , a finding which was nearly consistent with that obtained by other investigators . in conclusion , despite pancytopenia being an infrequent sequel of brucellosis in most of the literature , it was frequently seen in the current study . thus , brucellosis should always be considered in the differential diagnosis of pancytopenia , particularly in endemic areas such as saudi arabia . surveillance , testing and massive immunization of animals in endemic areas as well as an organized national brucellosis control program are prerequisites to eradicate the disease and its complications . m. koumi : concept / design , acquisition of data , data analysis and interpretation , drafting of the manuscript and critical revision of the manuscript . m. afiffy : data analysis and interpretation , drafting of the manuscript and critical revision of the manuscript s. al zahrani : data analysis and interpretation , drafting of the manuscript and critical revision of the manuscript all authors approved final version of the paper .

abstractobjectivehematological complications of brucellosis are common . pancytopenia , although mainly reported in adults , has also been described in children with brucellosis . this investigation was conducted to estimate the relative frequency of pancytopenia in children with brucellosis.methodsthe current study was conducted in al - khafji joint operations hospital , saudi arabia . sixty patients with brucellosis were enrolled in the study . complete blood count ( cbc ) and blood culture were performed for all cases . bone marrow ( bm ) aspiration was considered only in those with pancytopenia.findingsout of 60 children with brucellosis , 50 ( 83% ) ingested raw animal milk and 27 ( 45% ) had a positive family history of brucellosis . the common presenting symptoms and signs included : excessive sweating ( 68% ) , bone aches ( 62% ) , chills ( 55% ) , arthritis ( 32% ) , hepatomegaly ( 18% ) and splenomegaly ( 15% ) . the main hematological manifestations included : anemia ( 43% ) , leukopenia ( 38% ) and leukocytosis ( 20% ) . pancytopenia was detected in 11 ( 18% ) patients . blood culture for brucella was positive in 38% ( 23 patients ) . b. melitensis from 21 patients was cultured in vitro . out of 9 bm aspirate cultures , 3 were positive for b. melitensis . out of 11 patients with pancytopenia , 9 ( 82% ) patients had bone aches and weakness , 7 ( 64% ) patients sweating and chills , 6 ( 55% ) patients petechiae and purpura.conclusionthe current study concludes that although pancytopenia is an uncommon complication of brucellosis in children , it does occur . therefore , brucellosis should be considered in the differential diagnosis of pancytopenia in children , particularly in endemic areas such as saudi arabia .

, ventilator - associated pneumonia is the second most common nosocomial infection in the us.1 it is also the deadliest hospital - acquired infection in children and adults , affecting 23% of all patients receiving mechanical ventilation for more than 24 hours ( approximately 250,000 annually).2 the staphylococcus aureus bacterium is responsible for 25% of all ventilator - associated pneumonia infections and is of great concern to clinicians due to its multidrug resistant strain , ie , methicillin - resistant s. aureus ( mrsa).3 ventilator - associated pneumonia can also be very costly for both patients and hospitals , adding an estimated $ 40,000 dollars to each hospital admission due to the extra intensive care required for treatment.4 inadvertent exposure to bacteria infects up to 54% of all endotracheal tubes.5 these intubated tubes provide a conduit for bacterial access from the extracorporeal environment to the more sterile area of the lungs . through cell division and biochemical recruitment of extracellular dna , proteins , and exopolysaccharides , ventilation through these infected endotracheal tubes , or even condensation of humidified air , breaks off pieces of the biofilm , causing gross and micro aspiration of bacteria into the distal bronchi , followed by bacterial proliferation and parenchymal invasion.68 endotracheal tube intubation also thwarts the cough reflex and compromises mucociliary clearance , making it nearly impossible to expel contaminated secretions.9,10 the current techniques for preventing ventilator - associated pneumonia , ie , sterilization of equipment , better hospital practices , systemic antibiotic administration , and re - engineering of the endotracheal tube , have not proven to be efficacious . as a result , the most promising and straightforward strategy for decreasing ventilator - associated pneumonia is to fabricate endotracheal tubes with antibacterial agents that resist bacterial attachment . however , currently used materials , such as silver and silver compounds , eg , silver sulfadiazine , have been shown to be ineffective at preventing bacterial attachment in the long term.1113 moreover , the use of these silver - coated endotracheal tubes is contraindicated for persons who are allergic to silver;14 silver is also not naturally found in the body . adults require 5570 g of selenium per day , with an upper tolerable limit of 400 g , to make selenoproteins , which play a vital role in the human antioxidant defense system , redox control of cell reactions , and thyroid hormone metabolism . studies of these antibacterial properties have demonstrated that elemental selenium - enriched probiotics15 and organoselenium compounds16,17 have antibacterial effects in vitro and in vivo against escherichia coli and s. aureus , respectively . furthermore , studies have demonstrated that selenium nanoparticles reduce s. aureus adhesion and proliferation on commercial endotracheal tubes by over 99%.18 overall , the bactericidal action of selenium is due to its ability to catalyze the oxidation of intracellular thiols , causing death of bacteria.1820 symptoms of selenium toxicity ( called selenosis ) include gastrointestinal disorders , alopecia , fatigue , and irritability.21 the chronic dose of selenium that results in extreme cases of toxicity is very high , at approximately 2400 g / day.21 studies on the toxicity of elemental selenium have been promising in demonstrating that its use will be benign.22 regarding toxicity of selenium nanoparticles , studies have shown that selenium nanoparticles have an efficacy comparable with that of selenium compounds as an antioxidant , but have a greatly reduced risk of toxicity.23,24 however , studies investigating the toxicity of selenium have focused on systemic toxicity in vivo and have not focused on in vitro toxicity to mammalian cells central to endotracheal tube intubation , such as fibroblasts . thus , the objective of this study was to ascertain the cytotoxic effect of selenium nanoparticles on fibroblasts in vitro . pvc samples ( 6 mm 3 mm 1 mm ) were cut from commercial endotracheal tubes ( hudson rci , research triangle park , nc ) using a fiskars rectangular hole punch ( fiskars corporation , helsinki , finland ) . the pvc samples were then rinsed in increasing concentrations of ethanol ( 30% , 50% , 70% , and 100% ) for 10 minutes each and then air - dried in a sterile laminar flow hood for 12 hours . the cleaned and sterilized pvc were used as controls and base substrates for the colloidal precipitation with four different concentrations of selenium nanoparticles , ie , 46.5 g / ml ( ultrahigh ) , 31 g / ml ( high ) , 15.5 g / ml ( medium ) , and 7.8 g / ml ( low ) . for the ultrahigh concentration , 6.25 ml of deionized water ( dih2o ) and 6.25 ml of 100 mm glutathione ( reduced form , alfa aesar , ward hill , ma ) were added to a 50 ml conical tube containing the pvc samples , followed by 17.5 ml of 25 mm sodium selenite ( na2seo3 , alfa aesar ) . after gentle mixing , 2 ml of 1 m sodium hydroxide ( alfa aesar ) was added to bring the ph of the mixture into the alkaline range . the same reagents and methodology were used for the high , medium , and low concentrations , albeit the reagent amounts changed . for the high concentration , 7.5 ml of dih2o , 7.5 ml of glutathione , 15 ml of na2seo3 , and 2 ml of sodium hydroxide were used . for the medium concentration , 10 ml of dih2o , 10 ml of glutathione , 10 ml of na2seo3 , and 2 ml of sodium hydroxide were used . for the low concentration , 12.5 ml of dih2o , 12.5 ml of glutathione , 5 ml of na2seo3 , and 2 ml of sodium hydroxide were used ( table 1 ) . in all reactions , the reduction of sodium selenite by glutathione immediately formed selenium nanoparticles , which were precipitated onto the pvc samples as visualized by a color change of the reactant solution from clear to milky red.18 for each concentration , the conical tubes were left untouched for 30 minutes to allow the selenium nanoparticles to precipitate onto the pvc samples both intraluminally and extraluminally . the substrates were then removed and rinsed in 10 ml of dih2o for 24 hours . the uncoated ( control ) and selenium nanoparticle - coated substrates were immersed in 70% ethanol for 30 minutes . the ethanol was then removed and the substrates were sterilized in a laminar flow hood under ultraviolet light for 24 hours . for material surface characterization studies , the pvc samples were sputter - coated with a thin layer ( approximately 90 ) of gold and observed under scanning electron microscopy ( leo 1530vp fe-4800 ) at 5 kv . for chemical characterization , energy dispersive x - ray spectroscopy with an acceleration voltage of 20 kv was employed . contact angles easily and quickly identified the hydrophobicity / hydrophilicity of a proposed material for medical applications , which is of paramount importance for the interaction between the substrate and biological entities in the body . to measure the hydrophobicity / hydrophilicity of uncoated and selenium nanoparticle - coated pvc , a drop shape analysis system ( dsa-10 , kruss , hamburg , germany ) with analysis software ( dsa1 v 1.80 ) was used . a 2 l drop of water was placed onto the substrates , and contact angles were recorded within 10 seconds at room temperature . all characterization measurements were repeated nine times for each sample . to investigate cytotoxicity via cell adhesion and proliferation of pvc coated with selenium nanoparticles , a cell line of rat dermal fibroblasts was obtained from the american type culture collection ( crl-1213 , manassas , va ) . the fibroblasts were grown in eagle s minimum essential medium ( atcc ) supplemented with 10% fetal bovine serum ( hyclone , rockford , il ) , and 1% penicillin - streptomycin ( hyclone ) in a standard cell culture incubator ( 37c , humidified , 5% co2 , 20% o2 environment , nonshaking ) . every 24 hours the old medium was removed , the cells were cleaned three times with phosphate - buffered saline , and new medium was added . after confluence was reached ( approximately 72 hours ) , the cells were seeded at a density of approximately 5000 cells / cm in sterile 24-well plates that contained a pvc sample coated with the high , medium , or low concentration of selenium nanoparticles ; uncoated pvc samples were used as controls . the samples were incubated in a standard cell culture incubator for 4 hours for the cell adhesion assay and 24 and 72 hours for the proliferation assays . the reduction of tetrazolium salts in a colorimetric mtt assay is now widely accepted as a reliable method for examining cell adhesion and proliferation.25,26 for the mtt assay , a celltiter 96 nonradioactive assay ( atcc ) was used and the absorbance , which corresponded to total cell number , was recorded using a microplate spectrophotometer ( 570 nm , spectramax , molecular devices , sunnyvale , ca ) . to ascertain the ic50 value , the ic50 value is a quantitative measurement that indicates the concentration of selenium nanoparticles needed to inhibit a biological process ( ie , fibroblast viability ) by half . the samples were incubated in a standard cell culture incubator for 72 hours and then a mtt assay was used to determine cell viability . data were collected , and significant differences were assessed using the probability associated with one - tailed student s t - tests . pvc samples ( 6 mm 3 mm 1 mm ) were cut from commercial endotracheal tubes ( hudson rci , research triangle park , nc ) using a fiskars rectangular hole punch ( fiskars corporation , helsinki , finland ) . the pvc samples were then rinsed in increasing concentrations of ethanol ( 30% , 50% , 70% , and 100% ) for 10 minutes each and then air - dried in a sterile laminar flow hood for 12 hours . the cleaned and sterilized pvc were used as controls and base substrates for the colloidal precipitation with four different concentrations of selenium nanoparticles , ie , 46.5 g / ml ( ultrahigh ) , 31 g / ml ( high ) , 15.5 g / ml ( medium ) , and 7.8 g / ml ( low ) . for the ultrahigh concentration , 6.25 ml of deionized water ( dih2o ) and 6.25 ml of 100 mm glutathione ( reduced form , alfa aesar , ward hill , ma ) were added to a 50 ml conical tube containing the pvc samples , followed by 17.5 ml of 25 mm sodium selenite ( na2seo3 , alfa aesar ) . after gentle mixing , 2 ml of 1 m sodium hydroxide ( alfa aesar ) was added to bring the ph of the mixture into the alkaline range . the same reagents and methodology were used for the high , medium , and low concentrations , albeit the reagent amounts changed . for the high concentration , 7.5 ml of dih2o , 7.5 ml of glutathione , 15 ml of na2seo3 , and 2 ml of sodium hydroxide were used . for the medium concentration , 10 ml of dih2o , 10 ml of glutathione , 10 ml of na2seo3 , and 2 ml of sodium hydroxide were used . for the low concentration , 12.5 ml of dih2o , 12.5 ml of glutathione , 5 ml of na2seo3 , and 2 ml of sodium hydroxide were used ( table 1 ) . in all reactions , the reduction of sodium selenite by glutathione immediately formed selenium nanoparticles , which were precipitated onto the pvc samples as visualized by a color change of the reactant solution from clear to milky red.18 for each concentration , the conical tubes were left untouched for 30 minutes to allow the selenium nanoparticles to precipitate onto the pvc samples both intraluminally and extraluminally . the substrates were then removed and rinsed in 10 ml of dih2o for 24 hours . the uncoated ( control ) and selenium nanoparticle - coated substrates were immersed in 70% ethanol for 30 minutes . the ethanol was then removed and the substrates were sterilized in a laminar flow hood under ultraviolet light for 24 hours . for material surface characterization studies , the pvc samples were sputter - coated with a thin layer ( approximately 90 ) of gold and observed under scanning electron microscopy ( leo 1530vp fe-4800 ) at 5 kv . for chemical characterization , energy dispersive x - ray spectroscopy with an acceleration voltage of 20 kv was employed . contact angles easily and quickly identified the hydrophobicity / hydrophilicity of a proposed material for medical applications , which is of paramount importance for the interaction between the substrate and biological entities in the body . to measure the hydrophobicity / hydrophilicity of uncoated and selenium nanoparticle - coated pvc , a drop shape analysis system ( dsa-10 , kruss , hamburg , germany ) with analysis software ( dsa1 v 1.80 ) was used . a 2 l drop of water was placed onto the substrates , and contact angles were recorded within 10 seconds at room temperature . to investigate cytotoxicity via cell adhesion and proliferation of pvc coated with selenium nanoparticles , a cell line of rat dermal fibroblasts was obtained from the american type culture collection ( crl-1213 , manassas , va ) . the fibroblasts were grown in eagle s minimum essential medium ( atcc ) supplemented with 10% fetal bovine serum ( hyclone , rockford , il ) , and 1% penicillin - streptomycin ( hyclone ) in a standard cell culture incubator ( 37c , humidified , 5% co2 , 20% o2 environment , nonshaking ) . every 24 hours the old medium was removed , the cells were cleaned three times with phosphate - buffered saline , and new medium was added . after confluence was reached ( approximately 72 hours ) , the cells were seeded at a density of approximately 5000 cells / cm in sterile 24-well plates that contained a pvc sample coated with the high , medium , or low concentration of selenium nanoparticles ; uncoated pvc samples were used as controls . the samples were incubated in a standard cell culture incubator for 4 hours for the cell adhesion assay and 24 and 72 hours for the proliferation assays . the reduction of tetrazolium salts in a colorimetric mtt assay is now widely accepted as a reliable method for examining cell adhesion and proliferation.25,26 for the mtt assay , a celltiter 96 nonradioactive assay ( atcc ) was used and the absorbance , which corresponded to total cell number , was recorded using a microplate spectrophotometer ( 570 nm , spectramax , molecular devices , sunnyvale , ca ) . to ascertain the ic50 value , the ic50 value is a quantitative measurement that indicates the concentration of selenium nanoparticles needed to inhibit a biological process ( ie , fibroblast viability ) by half . the samples were incubated in a standard cell culture incubator for 72 hours and then a mtt assay was used to determine cell viability . data were collected , and significant differences were assessed using the probability associated with one - tailed student s t - tests . visual characterization by scanning electron microscopy of the coating density of pvc coated and not coated with selenium nanoparticles can be seen in figure 1 . the morphology in the high - magnification tilted scanning electron microscopic image ( figure 2 ) strongly suggests that the selenium nanoparticles were bonded ( by physicochemical forces , not covalently ) to the substrate . in fact , previous studies have tried to remove the adherent selenium nanoparticles using sonication , but could not.18 the surface coverage of selenium nanoparticles for the medium concentration ( determined from scanning electron microscopic images using an image processing program , ie , imagej , national institutes of health , bethesda , md ) was approximately 10% , or about 300 g . selenium peaks were observed in the area coated with selenium nanoparticles , which confirmed that the nanoparticles were in fact elemental selenium ( figure 3 ) . contact angle measurements demonstrated that selenium nanoparticles reduced the contact angles , or made the pvc more hydrophilic ( figure 4 ) . the viability of fibroblasts as determined by mtt assays after the 4-hour ( adhesion ) time point showed that the number of live cells on pvc coated with selenium nanoparticles was significantly higher than the number of live cells on pvc not coated with selenium nanoparticles . the number of live cells also increased as the final concentration of selenium in the colloidal synthesis solution increased . furthermore , the viability of fibroblasts as determined by mtt assays after the 24-hour and 72-hour ( proliferation ) time points was significantly higher on pvc coated with selenium nanoparticles as compared with the pvc not coated with selenium nanoparticles . the number of cells proliferating on the pvc coated with selenium nanoparticles between the 24-hour and 72-hour time points neither significantly increased nor decreased . the number of live cells adhering and proliferating on pvc not coated with selenium nanoparticles from 4 hours to 72 hours also did not significantly increase ( figure 5 ) . results from the ic50 studies revealed that the concentration of selenium nanoparticles coated on pvc needed to inhibit fibroblast viability by half was approximately 46.5 g / ml . this is because 52% of the fibroblasts died when exposed to this ultrahigh concentration of selenium nanoparticles , or 2% more than the concentration needed to ascertain the ic50 value ( figure 6 ) . visual characterization by scanning electron microscopy of the coating density of pvc coated and not coated with selenium nanoparticles can be seen in figure 1 . the morphology in the high - magnification tilted scanning electron microscopic image ( figure 2 ) strongly suggests that the selenium nanoparticles were bonded ( by physicochemical forces , not covalently ) to the substrate . in fact , previous studies have tried to remove the adherent selenium nanoparticles using sonication , but could not.18 the surface coverage of selenium nanoparticles for the medium concentration ( determined from scanning electron microscopic images using an image processing program , ie , imagej , national institutes of health , bethesda , md ) was approximately 10% , or about 300 g . selenium peaks were observed in the area coated with selenium nanoparticles , which confirmed that the nanoparticles were in fact elemental selenium ( figure 3 ) . contact angle measurements demonstrated that selenium nanoparticles reduced the contact angles , or made the pvc more hydrophilic ( figure 4 ) . the viability of fibroblasts as determined by mtt assays after the 4-hour ( adhesion ) time point showed that the number of live cells on pvc coated with selenium nanoparticles was significantly higher than the number of live cells on pvc not coated with selenium nanoparticles . the number of live cells also increased as the final concentration of selenium in the colloidal synthesis solution increased . furthermore , the viability of fibroblasts as determined by mtt assays after the 24-hour and 72-hour ( proliferation ) time points was significantly higher on pvc coated with selenium nanoparticles as compared with the pvc not coated with selenium nanoparticles . the number of cells proliferating on the pvc coated with selenium nanoparticles between the 24-hour and 72-hour time points neither significantly increased nor decreased . the number of live cells adhering and proliferating on pvc not coated with selenium nanoparticles from 4 hours to 72 hours also did not significantly increase ( figure 5 ) . results from the ic50 studies revealed that the concentration of selenium nanoparticles coated on pvc needed to inhibit fibroblast viability by half was approximately 46.5 g / ml . this is because 52% of the fibroblasts died when exposed to this ultrahigh concentration of selenium nanoparticles , or 2% more than the concentration needed to ascertain the ic50 value ( figure 6 ) . visual characterization by scanning electron microscopy showed that the coating density of pvc coated with selenium nanoparticles as compared with pvc not coated with selenium nanoparticles . the morphology in the high - magnification tilted scanning electron microscopic image strongly suggest that the selenium nanoparticles were bonded to the substrate . coupled with the fact that cleaning of the pvc samples before coating with the selenium nanoparticles was found to be crucial for the deposition of selenium nanoparticles on the substrate surface , it is speculated that the selenium nanoparticles were formed through a nucleation process . the nucleation sites on the pvc surfaces , eg , defects and impurities , may have also served as high - energy regions for the selenium nucleation process to occur . determination of the surface coverage of selenium nanoparticles by scanning electron microscopy for all concentrations was approximately 10% ( about 300 g per endotracheal tube ) , or approximately 100 g less than the upper tolerable limit . energy - dispersive x - ray spectra were used to confirm the chemistry of the selenium nanoparticles . selenium peaks were observed in the area coated with selenium nanoparticles , which confirmed that the nanoparticles were in fact elemental selenium . contact angle measurements demonstrate the hydrophobicity / hydrophilicity of a medical implant , which is of the utmost importance for potential use in the human body . if the implanted material is water - repelling ( ie , hydrophobic ) , a water drop on the surface of a material will have a contact angle greater than 90. otherwise , if the material is water - attracting ( ie , hydrophilic ) , the contact angle will be less than 90. contact angle measurements demonstrated that selenium nanoparticles reduced the contact angles , or made the pvc more hydrophilic . this is significant because not only is wettability crucial for ultimate use in a human subject , but hydrophilic surfaces have also been shown to decrease free - swimming bacteria adherence as compared with hydrophobic surfaces.27 the viability of fibroblasts as determined by mtt assays after the 4-hour ( adhesion ) time point indicates that the number of live cells on pvc coated with selenium nanoparticles was significantly higher than the number of live cells on pvc not coated with selenium nanoparticles . furthermore , the number of live cells also increased as the final concentration of selenium in the colloidal synthesis solution increased . the viability of fibroblasts as determined by mtt assays after the 24-hour and 72-hour ( proliferation ) time points was also significantly higher on the pvc coated with selenium nanoparticles as compared with the pvc not coated with selenium nanoparticles . this indicates that fibroblasts may preferentially grow on pvc coated with selenium nanoparticles , indicating that elemental selenium may have a protective , healthy effect on mammalian cells . results from the ic50 studies revealed that the concentration of selenium nanoparticles coated onto pvc needed to inhibit fibroblast viability by half was approximately 46.5 g / ml , because 52% of the fibroblasts died when exposed to this ultrahigh concentration of selenium nanoparticles , which is 2% more than the concentration needed to ascertain the ic50 value . this work demonstrates the potential of using selenium nanoparticles as a nontoxic , antibacterial agent for pvc - related medical devices , particularly endotracheal tubes . specifically , it has been shown using techniques such as scanning electron microscopy , energy dispersive x - ray spectroscopy , and contact angle measurements , that four different concentrations of elemental selenium nanoparticles can be successfully coated onto samples cut from commercial pvc endotracheal tubes . first , the surface coverage of selenium nanoparticles was found to be approximately 300 g . this is critical for the ultimate use in an intubated patient because , even if all of the selenium nanoparticles were to elute from the coated endotracheal tube at once , it would not reach the suggested upper tolerable intake level of 400 g / day . second , contact angle measurements revealed that coating pvc with selenium nanoparticles made the pvc more hydrophilic . this is significant because hydrophilicity is of the utmost importance for ultimate use in a human subject . the cytotoxicity of selenium nanoparticles in terms of fibroblast viability was assessed and it has been determined that no cytotoxic effect was elicited after 72 hours . results from the ic50 studies revealed that a concentration of selenium 1.5 times greater than the high concentration inhibited fibro - blast viability by half . despite the potential cytotoxicity of selenium nanoparticles , these results are significant , as the concentration of selenium nanoparticles to be used to coat an endotracheal tube for antibacterial purposes could likely be the low or medium concentration , given that both have been shown to reduce s. aureus adhesion and proliferation by over 99%.18 thus , by using one of these concentrations , the toxic level of selenium would never be reached . for the first time , to the authors knowledge , nanoparticulate elemental selenium has been shown not to have a cytotoxic effect on mammalian cells in vitro , ie , fibroblasts , central to endotracheal tube intubation . these results suggest that selenium nanoparticles have great selectivity for discriminating between bacteria and healthy cells , and display a viable option for coating endotracheal tubes in order to prevent ventilator - associated pneumonia , or any other medical device made of pvc that instigates a hospital - acquired infection .

background : ventilator - associated pneumonia is a deadly nosocomial infection caused by contaminated endotracheal tubes . it has been shown that polyvinyl chloride ( pvc , the endotracheal tube substrate ) coated with elemental selenium nanoparticles reduces bacterial adherence and proliferation on pvc by over 99% . however , it is not known if selenium nanoparticles elicit a cytotoxic effect in vitro . the purpose of this study was to investigate the cytotoxic effects of pvc coated with selenium nanoparticles on fibroblasts , which are mammalian cells central to endotracheal tube intubation.methods:different concentrations of selenium nanoparticles were precipitated onto the pvc surface by reduction of selenium salts using glutathione . characterization of pvc coated with selenium nanoparticles was done by scanning electron microscopy , energy dispersive x - ray , and contact angle measurements . for the cytotoxicity experiments , fibroblasts were seeded at a density of 5000 cm2 onto pvc coated with three different concentrations of selenium nanoparticles ( high , medium , low ) and incubated for 4 hours ( adhesion ) as well as for 24 hours and 72 hours ( proliferation ) . the half - maximal inhibitory concentration ( ic50 ) value was determined after 72 hours using an ultrahigh concentration . mtt assays were used to assess cell viability at the indicated time points.results:the three concentrations of selenium nanoparticles did not elicit a cytotoxic effect after 72 hours ( p < 0.01 , n = 3 ) . it was found that the ic50value was at the ultrahigh concentration of selenium nanoparticles . the nanoparticulate elemental selenium concentration previously shown to decrease the function of bacteria was shown not to cause a cytotoxic effect on fibroblasts in vitro.conclusion:these findings demonstrate great selectivity between bacteria and healthy cells , and are a viable option for coating endotracheal tubes in order to prevent ventilator - associated pneumonia .

this study was a cross - sectional hospital - based study the study covered both ever - married men and women , attending the dhiraj general hospital . out of the total sample size , an equal number of participants were selected from three sources 1 ) hospital staff 2 ) spouses of non - psychiatric patients and 3 ) spouses of psychotic patients in the dhiraj general hospital . based on the prevalence of domestic violence ( 27% ) from the pilot study , with a confidence level of 95% and absolute precision of 5 , the samples required were : 303 participants . three participants refused to participate thus , samples of 300 were obtained ( i.e. sample of 100 participants from three groups ) . ever - married subjects above 18 years of agesubjects not having any psychiatric illness at presentsubjects not having serious medical illness at present . ever - married subjects above 18 years of age subjects not having any psychiatric illness at present subjects not having serious medical illness at present . perception of the participants regarding domestic violence was studied on the basis of their response to a set of questions for four main variables of domestic violence ( physical , emotional , sexual and economic ) . participants were also asked whether their spouse had committed violence against them at any time in their life , and if experienced , then in what form , its outcome and whether reported to anyone . they were asked whether influence of alcohol was a contributor to their spouse perpetrating violence . the questionnaires were piloted to check appropriateness , clarity and flow of questions among 10 participants before the initiation of the study , and these participants were not included in the study . the study protocol was approved by the local institutional review board at the dhiraj general hospital . interviews took place in a private place of the hospital to maintain privacy and confidentiality . participants were assured of the confidentiality of their responses . to attain all these , care was taken to establish rapport with every participant prior to interviews . individual verbal informed consent was obtained from all participants by explaining the purpose of the study . four principal domestic violence outcome variables considered in our analysis were : physical violence , psychological violence , sexual violence and economic violence . if a woman / man ( as a victim ) gave a positive response to any of the questions in a set , it was considered as violence of that category . in addition , the fifth variable , i.e. any form of domestic violence was derived . if at least one of the four forms of domestic violence ( physical and/or psychological and/or sexual and/or economic ) was present , it was considered as the presence of any form of domestic violence . during logistic regression analyses , these outcome variables were dichotomized into presence and absence of violence , for each type of violence . data was entered into ms excel sheet and exported to epi info ( version 3.5.1 , developed by who cdc ) and spss ( 15.0 version ) and further analysis was carried out . multivariate logistic regression was carried out to study association between occurrence of domestic violence ( dependent variable ) and demographic characteristics ( independent variables ) such as age , sex , education , occupation , income , religion , family type and domicile . the odds ratio ( or ) is the value by which odds of the event ( occurrence of violence ) change when the independent variable increases by one unit / step . and a p value of less than 0.05 was considered as the minimum level of significance . the study covered both ever - married men and women , attending the dhiraj general hospital . out of the total sample size , an equal number of participants were selected from three sources 1 ) hospital staff 2 ) spouses of non - psychiatric patients and 3 ) spouses of psychotic patients in the dhiraj general hospital . the sample size was calculated based on the available estimated prevalence of domestic violence . based on the prevalence of domestic violence ( 27% ) from the pilot study , with a confidence level of 95% and absolute precision of 5 , three participants refused to participate thus , samples of 300 were obtained ( i.e. sample of 100 participants from three groups ) . ever - married subjects above 18 years of agesubjects not having any psychiatric illness at presentsubjects not having serious medical illness at present . ever - married subjects above 18 years of age subjects not having any psychiatric illness at present subjects not having serious medical illness at present . subjects not willing to give written informed consentsubjects below 18 years of age . perception of the participants regarding domestic violence was studied on the basis of their response to a set of questions for four main variables of domestic violence ( physical , emotional , sexual and economic ) . participants were also asked whether their spouse had committed violence against them at any time in their life , and if experienced , then in what form , its outcome and whether reported to anyone . they were asked whether influence of alcohol was a contributor to their spouse perpetrating violence . the questionnaires were piloted to check appropriateness , clarity and flow of questions among 10 participants before the initiation of the study , and these participants were not included in the study . the study protocol was approved by the local institutional review board at the dhiraj general hospital . interviews took place in a private place of the hospital to maintain privacy and confidentiality . participants were assured of the confidentiality of their responses . to attain all these , care was taken to establish rapport with every participant prior to interviews . individual verbal informed consent was obtained from all participants by explaining the purpose of the study . four principal domestic violence outcome variables considered in our analysis were : physical violence , psychological violence , sexual violence and economic violence . if a woman / man ( as a victim ) gave a positive response to any of the questions in a set , it was considered as violence of that category . in addition , the fifth variable , i.e. any form of domestic violence was derived . if at least one of the four forms of domestic violence ( physical and/or psychological and/or sexual and/or economic ) was present , it was considered as the presence of any form of domestic violence . during logistic regression analyses , these outcome variables were dichotomized into presence and absence of violence , for each type of violence . four principal domestic violence outcome variables considered in our analysis were : physical violence , psychological violence , sexual violence and economic violence . if a woman / man ( as a victim ) gave a positive response to any of the questions in a set , it was considered as violence of that category . in addition , the fifth variable , i.e. any form of domestic violence was derived . if at least one of the four forms of domestic violence ( physical and/or psychological and/or sexual and/or economic ) was present , it was considered as the presence of any form of domestic violence . during logistic regression analyses , these outcome variables were dichotomized into presence and absence of violence , for each type of violence . data was entered into ms excel sheet and exported to epi info ( version 3.5.1 , developed by who cdc ) and spss ( 15.0 version ) and further analysis was carried out . multivariate logistic regression was carried out to study association between occurrence of domestic violence ( dependent variable ) and demographic characteristics ( independent variables ) such as age , sex , education , occupation , income , religion , family type and domicile . the odds ratio ( or ) is the value by which odds of the event ( occurrence of violence ) change when the independent variable increases by one unit / step . and a p value of less than 0.05 was considered as the minimum level of significance . most of the study population / participants belonged to the 20 - 30 years age group ( 46.3% ) and those from extremes of age groups ( i.e.-<20 years and > 50 years ) were the least ; 47.3% of participants were males and 52.7% were females . participants were selected almost equal to avoid selection bias between the two groups and the majority of the participants were hindu ( 85.7% ) . the majority of the participants ( 62% ) had studied till school ( i.e. either primary or secondary or higher secondary ) . most of the participants ( 83.3% ) were from middle socioeconomic status and 24.7% were from lower socioeconomic strata . out of the total study population of 300 individuals , the majority ( 94.7% ) was presently staying with spouse , 2.7% were divorced or separated and another 2.7% were widow / widower . almost equal number of participants belonged to nuclear and joint family whereas half ( 53% ) the participants were from the rural area . on asking the participants about their awareness pertaining to domestic violence , without probing them , 57% of the study population was aware about domestic violence and that it existed in society ; 42.7% of the participants had never heard the words domestic violence . a major finding is that after introducing the subjects to the definition of domestic violence , almost all the participants , i.e.99.7% admitted that it existed in society [ table 1 ] . awareness about existence of domestic violence before and after probing , among the study population out of the different acts of domestic violence , among the physical violence group , overburdening with work was considered as domestic violence by 65% of the population , which is the least perceived form in the physical violence group . maximum number of participants ( 99.3% ) considered an attempt to kill as domestic violence . within the emotional violence subgroup , half the population studied believed - taunting , restricting freedom of choice , not giving equal opportunity , ignoring / indifference / not communicating , and deprivation of sexual relation as domestic violence . as regards sexual violence , all the study participants considered pressure to go for prostitution and forced sexual relation with other family member as domestic violence , while 18.3% participants believed that forced sexual intercourse by spouse is not domestic violence . in the study population , for the items categorized as economic violence , maximum number of participants ( 84.0% ) believed that demanding dowry is domestic violence , followed by act of taking away belongings ( 73.7% ) , followed by not providing sufficient finances ( 71.3% ) , followed by not allowing to have control over one 's income ( 56.0% ) ; the least number of participants believed that non - involvement in financial decisions is domestic violence ( 41.8% ) [ table 2 ] . perception about different acts as domestic violence among the study population among the four main variables of domestic violence , occurrence of physical violence was found to be 19.6% , emotional violence in 25.3% , financial violence in 11.3% and sexual violence in 2% of victims [ table 3 ] . prevalence of overall and individual type of domestic violence in the three subgroups of study population there was no significant difference found in the prevalence of domestic violence ( neither overall nor in individual type ) among the three subgroups of study participants , i.e. general population , spouses of non - psychiatric patients and spouses of psychotic patients [ table 3 ] . some additional findings of our study were that among the participants who had experienced domestic violence , 41.2% had experienced it when the spouse was under the influence of alcohol . of the study population who had experienced domestic violence , 47.42% had never reported it or disclosed it to anyone . the most common reason for not reporting was fear of social stigma ( in 63.4% ) . among those who had reported , only 1.96% had reported it to the police , the remaining majority of the population had only shared it with relatives or friends . sixty - six percent of the population studied preferred to compromise with the situation , 14.4% left the house , 10.3% negotiated with the family members , 6.6% took help of community members for reconciliation , 2.1% retaliated ( reciprocal domestic violence ) and 1% took the help of the police . out of the different demographic characteristics of the study population , the occurrence of domestic violence was significantly associated with the sex of the participants in the study group . the or of occurrence of domestic violence in relation to the sex of the participant was 0.2666 ( with 95% c.i . 0.1431 - 0.4966 and p value 0.0000 ) , inferring that the female sex had highly significant association with occurrence of domestic violence [ table 4 ] . association of various demographic details with the occurrence of domestic violence on applying multivariate logistic regression , the present study demonstrated that domestic violence is not significantly associated with age , domicile , education , occupation , family income , religion and type of family . on applying multivariate logistic regression , the present study demonstrated that domestic violence is not significantly associated with age , domicile , education , occupation , family income , religion and type of family . violence against women is a major public health problem , which affects physical , mental and reproductive health . apart from the high prevalence of domestic violence in the present era , it is evident from the study that the participants perception / knowledge about domestic violence was rather low and a simple discussion in person easily helped the respondents identify domestic violence . with regard to perception or awareness about domestic violence , findings were similar to that found in the national family health survey ( nfhs ) , where 41% of women thought that husbands were justified in slapping their wives if the latter showed disrespect to their in - laws , and a substantial 35% of women thought they deserved a brutal beating at the hands of their spouses if they neglected doing the household chores or looking after their children . a study demonstrates that a large percentage of nigerian women agreed that a man is justified in beating or hitting his wife ; 66.4% and 50.4% of ever - married and unmarried women respectively expressed consent for wife - beating . the overall prevalence of domestic violence in our study population was found to be 32.3% . this is almost similar to the findings of many studies with 3756% women reporting domestic violence in india . in the present study we also found that domestic violence had a significant association with female gender and younger age it is due to male patriarchy , which is defined as a system of male dominance legitimated within the family and the society through superior rights , privileges , authority and power . no significant association was found with any of the other demographic characteristics of the study participants . conversely , some community - based study from india observed that prevalence of domestic violence was more in women who were employed and in the lower socioeconomic strata . on comparing the prevalence of different forms of domestic violence in our findings to many population - based studies , the prevalence of physical violence was found to be the same , i.e. around 1434% in other studies , while that of sexual and emotional violence was found to be less , i.e. prevalence of emotional violence was around 52% and sexual violence around 25% . hence domestic violence is a worldwide public health problem existing in all communities . regarding alcohol influence among participants who experienced domestic violence , a similar inference was drawn from other studies which found that physical ( 44.86 ) and psychological ( 68.22% , p<0.001 ) abuse was significantly higher and sexual abuse was 10.28% in wives of alcohol - dependent males as compared to 28.4% , 27.10% and 4.67% respectively in wives of abstainers . the findings of the study refute once again the general myth in the community that psychotic patients are largely violent . even though the national commission for women and the active role of state governments in publicizing the problems of domestice violence , the study findings suggest that these have disseminated poorly . we would recommend to develop a better program to be developed for bringing about wider awareness in general population . however , a larger sample size should be taken in order to have a proper idea about differences between the groups .

background : domestic violence is a major contributor to physical and mental ill health of the victim , and it is evident to some degree , in every society of the world.objectives:1 ) to study perception about domestic violence in the study population . 2 ) to compare prevalence of domestic violence within the three subgroups of the study population ( i.e. spouses of psychotic patients , spouses of non - psychiatric patients and hospital staff).materials and methods : a cross - sectional study was conducted among married men and women coming to dhiraj general hospital . interviews were conducted using a semi - structured questionnaire . inquiry was done about their perception regarding domestic violence , own experience any time in their life , and about the form of violence . data was entered and analyzed using spss.results:42.7% of study participants had never heard the words domestic violence . the overall prevalence of any form of violence in the study population as a whole was 32.3% . there was no significant difference found in the proportion of domestic violence among the three groups . the prevalence of physical , emotional , sexual and economic domestic violence was 16.3% , 25.3% , 2% and 11.3% respectively . younger age group and female sex were significantly associated with the occurrence of domestic violence.conclusion:apart from the high prevalence of domestic violence in the present era , it is evident from the study that the participants perception about domestic violence was low . efforts should be made to raise public consciousness and reporting of domestic violence and its attendant consequences .

percutaneous nephrolithotomy ( pcnl ) is a minimally invasive endoscopic surgery usually performed under general anaesthesia ( ga ) . however , there are several concerns related to ga such as stress response during induction , prone positioning , post - operative nausea and vomiting ( ponv ) and respiratory complications . regional anaesthesia ( ra ) is associated with lower morbidity and mortality than ga and can be an alternative to ga . pcnl surgeries have been conducted under spinal anaesthesia ( sa ) and combined spinal - epidural ( cse ) anaesthesia and only epidural anaesthesia ( ea ) . it limits sympathetic and motor block which could probably avoid hypotension and aid in easy positioning in pcnl surgery . considering the potential advantages , the basis of the current study was to selectively block thoracic epidural segments from t6 to t12 for pcnl surgery . in this randomised controlled trial , our aim was to compare sea and ga for pcnl with overall patient satisfaction as the primary end point . this prospective , randomised controlled single blind study was conducted from may 2012 to april 2013 after institutional ethics committee approval . ninety american society of anesthesiologists ( asa ) physical status grade i / ii patients of either sex , between 18 and 60 years were included . exclusion criteria were body mass index > 30 , contraindication to ea , allergy to local anaesthetics and undilated pelvicalyceal system . the visual analogue scale ( vas ) for quantification of pain was explained . patients were randomly divided into two equal groups , group ga and group sea on basis of computer generated randomisation scheme . random group assigned was enclosed in a sealed opaque envelope to ensure concealment of allocation sequence . the sealed envelope was opened by the anaesthesiologist conducting the case to administer either ga or sea . the anaesthesiologist conducting the case could not be blinded owing to different techniques of anaesthesia . intramuscular atropine 0.6 mg was administered half hour prior to surgery in the preoperative holding area . in the operation theatre routine monitoring included electrocardiogram , oxygen saturation , non - invasive blood pressure and capnography . intravenous access was secured and pre - loading with crystalloid solution at 5 ml / kg was started . intravenous ( iv ) pantoprazole 40 mg and ondansetron 0.08 mg / kg was given . group ga patients received iv midazolam 0.02 mg / kg and fentanyl 2 g / kg . induction of anaesthesia was performed with iv thiopentone sodium up to 5 mg / kg , vecuronium 0.1 mg / kg and maintenance with 60% nitrous oxide in oxygen , intermittent vecuronium and propofol infusion 50150 g / kg / min titrated to maintain heart rate ( hr ) and blood pressure 20% of baseline . at the end of the surgery iv paracetamol 1 g and local infiltration with after adequate antagonism of neuromuscular blockade and tracheal extubation , patients were shifted to pacu . in group sea , the epidural space was located with the patient in the sitting position at t12-l1 or t11t12 space using the loss of resistance to saline technique . the epidural catheter ( epidural minipack , system 1 , portex , kent , uk ) was inserted 5 cm cephalad in the epidural space ( tip approximately at t8 ) . epidural catheter was fixed at the site of insertion using transparent medical dressing ( 3m tegaderm , usa ) , to maintain sterility . the remaining length of the catheter was fixed 5 cm parallel to the spine up to the shoulder , contralateral to the side of the surgery to ensure stability . test dose of 3ml of lignocaine 2% with adrenaline 5 g / ml was administered . patients were then made supine and loading dose of 0.75% ropivacaine ( ropin , neon , mumbai , maharashtra , india ) 11.5 ml / segment depending on the height of the patient was injected to achieve an epidural block of t6t12 segments . the sensory block level was checked , and if the desired level was not achieved then an additional dose of ropivacaine , 1 ml / spared segment was given . in spite of additional ropivacaine ( maximum up to 16 ml ) , if the sensory block was still below t6 , then it was considered a block failure and ga was administered . the surgical procedure consisted of inserting a ureteric catheter in the lithotomy position for retrograde pyelography . was accomplished using perurethral 2% water soluble lignocaine jelly , and if required iv propofol was administered . for patients who required propofol for ureteric catheterisation , prone position was given only when ramsay sedation score of 2 ( cooperative , tranquil ) was achieved . the patients had their head and neck rotated to one side on a gel - based head ring . a breathing circuit with mask , oropharyngeal airway and a proseal laryngeal mask airway ( lma ) was kept ready as rescue airway devices . the segmental level of anaesthesia was checked after prone position was given . the total number of segments blocked and the volume of drug required was also noted . one hour after the initial epidural drug administration , sensory level was checked at t6 level every 15 min using an ether swab . if the level was below t6 , epidural top - ups ( 3 ml 0.75% ropivacaine ) were given till the completion of surgery . the protocol specified 3 mg / kg or 150 mg ( 20 ml ) , whichever was lesser as the maximum dose limit of ropivacaine for the entire surgery . in spite of an adequate level , if the patient complained of pain , then iv fentanyl 1g / kg was given and if the patient was anxious , midazolam 0.02 mg / kg was given , up to a maximum of two rescue doses for each . motor blockade of the lower limbs was also checked and noted at three - time intervals , i.e. , before lithotomy , before prone and at the end of the surgery using bromage scale ( 0- no loss of movement at hip , knee and ankle , 1 loss of movement at the hip,2 loss of movement at hip and knee,3 loss of movement at the hip , knee and ankle ) . at the end of the surgery , 8 ml of 0.125% ropivacaine with 2g / kg buprenorphine if the irrigation and lithotripsy time exceeded two hours , or if more than three percutaneous renal access punctures were required to remove the stone load in either group , or if the upper limit of protocol specified dose of ropivacaine or rescue drugs was reached , then the surgery would have been completed in two sittings . the nephrostomy tube would be kept in situ and remaining stones would be removed in the next sitting . intraoperative haemodynamic and respiratory parameters were noted every ten minutes till the end of surgery . bradycardia ( hr < 45 bpm ) was treated with iv atropine sulphate 0.01 mg / kg . hypotension ( drop in systolic blood pressure > 20% of baseline ) was treated with fluid replacement and if needed , iv ephedrine hydrochloride . at the end of the surgery surgical characteristics pertaining to stones were noted . in the pacu , patients were monitored for 2 h. time to reach aldrete 's score of 9 was noted . time of administration of the first rescue analgesic ( iv tramadol 1 mg / kg given at vas > 3 ) was documented . vas scores were noted at 1 , 4 , 6 , 12 , 24 , 48 and 72 h. along with tramadol , ondansetron 8 mg iv on day 1 and orally on day 2 and 3 was administered . post - operative haemoglobin was done on day 2 and the difference from pre - operative level was noted . surgeons were asked to opine regarding ease of patient positioning , locating pelvicalyceal system and overall comfort using a rating of good , fair or poor , immediately after surgery . similarly , patients were asked to rate their overall satisfaction and overall comfort on a numerical scale ( numeric rating scale 010 ) on post - operative day 3 in the surgical ward . scores ranging from 0 to 2 were considered very poor , 3 to 5 poor , 6 to 8 fair and 9- to 10 were considered good . a. ) z - score normality tests were applied to assess whether variables were normally distributed . normally , distributed continuous variables were evaluated using unpaired t - test for intergroup and paired t - test for intragroup comparisons . sample size calculation was based on the primary outcome parameter i.e. the overall patient satisfaction . sample size was calculated based on the reported patient satisfaction in laparoscopic cholecystectomy under sa in comparison to ga where the population standard deviation was 1.1 . to detect a difference of satisfaction score of 1 between the groups , with the power of the study at 80% and keeping alpha error at 5% , 43 patients were needed per group . to accommodate for dropouts all of them underwent their planned surgical procedure and received their allocated mode of anaesthesia . the patient 's demographic characteristics were comparable between the two groups [ table 1 ] . the mean dose of ropivacaine required for the entire surgery was 70.27 17.02 mg . three patients complained of pain mainly in the shoulder region , and after confirming adequate sensory level iv fentanyl was administered . none of the patients had bromage score more than two at any point of surgery , and most of the patients could position themselves in the prone position on their own , with minimal assistance . patient characteristics segmental epidural block characteristics baseline haemodynamics were comparable in both groups . intergroup comparison with respect to hr showed significant difference ( p = 0.001 ) between the two groups from 0 min upto 120th min ; with mean hr in group ga ( 90.13 2.19 beats / min ) being higher than group sea ( 78.62 2.27 beats / min ) [ figure 1 ] . after induction , group sea had a fall in map ( 4 - 15% ) from its baseline value which was statistically significant ( p=0.01 ) , but the patients were clinically stable [ figure 2 ] . inter - group comparison of map at similar time intervals showed no significant difference ( p = 0.24 ) between the two groups , except at 70100 min , where group ga had higher map . one patient in group sea developed bradycardia at the time of dilatation of puncture site which responded to iv atropine . eight patients ( 18% ) had hypertension in group ga in comparison to none in group sea ( p = 0.0001 ) . time ' 0 ' intubation/ epidural drug injection . data expressed as mean ( standard deviation).*p<0.05 . time ' 0 ' intubation/ epidural drug injection . data expressed as mean ( standard deviation)*p<0.05 post - operative data are mentioned in table 3 . time to reach aldrete 's score of 9 was significantly shorter in group sea ( p = 0.0001 ) . patient satisfaction score was higher in group sea than ga ( p = 0.007 ) . more number of patients in sea group reported satisfaction as good , as compared to ga group . reasons for fair ( 15 patients ) and poor ( 4 patients ) satisfaction in group ga was mainly due to ponv and pain . on the other hand , five patients in group sea reported fair satisfaction due to discomfort during epidural space location , and one patient with poor satisfaction had discomfort during surgery . surgeon satisfaction was good for all cases except for one case in sea group , where the patient had discomfort . post - operative recovery , analgesia and satisfaction scores pain scores were significantly lower in sea group than in ga group at 1 , 4 , 6 , 12 , 24 and 48 h. total tramadol requirements were significantly higher in ga group . patients in ga group had significantly higher incidence of nausea ( p = 0.02 ) . although more number of patients in ga group experienced vomiting , the difference was not statistically significant . one patient in ga group had pleural injury which was managed with an intercostal drain and was discharged on day 5 . based on the results , sea appears to have few merits in terms of haemodynamic stability , faster recovery , better pain scores , lesser ponv , better patient satisfaction but also has notable demerits in terms of supplemental ga requirement , unprotected airway , intraoperative discomfort and possibility of patient movement . ga carries its own risks in terms of stress response during induction , during lithotomy and prone position , intraoperative awareness , extubation response , post - operative restlessness and agitation . a previous study also observed that ea is better than ga for open renal surgeries in the lateral position . cse may also lead to haemodynamic instability , as peripheral pooling of blood does occur . authors comparing ga with cse for pcnl reported that 21% of patients in cse group required phenylephrine . patient positioning would also be a concern in sa and cse , like in ga cases . in the current study , eight patients had hypertension in group ga , mainly at the time of serial dilatation of the percutaneous renal access site . this was observed inspite of titration of propofol infusion to protocol specified upper limit . in the absence of depth of anaesthesia monitors in our set up , it was treated with additional propofol boluses . the sea technique aimed to block only the t6t12 segments ; thereby eliminating lower limb motor blockade ( median bromage 0 ) and hypotension , ease of surgical positioning , having the advantage of prolonging the block through epidural catheter and avoiding the potential problem of headache caused by dural puncture . however it can be argued that with the sea technique , there is always a risk of patient movement during surgery . we did not experience such a situation , probably because the patients were adequately counseled and experienced surgeons were performing the surgery . bleeding is an important risk during pcnl and injury to renal calyces is possible with patient movement . so the advantage of easy positioning is offset with the possibility of patient movement during surgery . moreover , patients with good motor blockade are likely to be more comfortable as compared to those with no blockade . as sea blocked only t6t12 segments , the protocol included propofol for ureteric catheterisation . out of the 34 patients who had level it could also be because of blockade of thinly myelinated fibres , which carry afferents from bladder and ureter . however , the fact that propofol was necessary for these 5 patients during ureteric catheterisation , means that standalone sea is not useful and supplemental ga is required . even though prone position was given in these patients only when ramsay sedation score of 2 was achieved , there is a chance of change in sedation levels which could jeopardise positioning , haemodynamics and airway . ea does not block proprioception which may cause discomfort to patients in spite of an adequate sensory blockade . propofol infusion has been used for sedation for pcnl performed under ea in a recent study . in the current study , most of the patients were comfortable in prone position without any sedation , probably because they were adequately counselled . monitoring of adequacy of respiration in prone position was done clinically as well by nasal capnography . breathing circuit with mask , oropharyngeal airway and proseal lma were kept ready as rescue airway devices , and as the patient 's head was turned to one side , there was easy access to airway . proseal lma is a suitable alternative rescue airway and can be inserted easily in prone position by experienced users . a previous study which compared ga , ea and paravertebral block for pcnl inserted the epidural catheter at l3l4 level and injected 25 ml of 0.5% bupivacaine . authors reported lower map in lumbar epidural group requiring vasopressors . a recent study evaluating ea for pcnl , used continuous epidural infusion ( at l1l2 level ) with levobupivacaine at 5 ml / h . a meta - analysis in 2015 confirmed the potential advantages of ra over ga in terms of efficacy and safety in pcnl . a recent study comparing sea and sa for pcnl concluded sea technique is better in terms of haemodynamics , positioning , postoperative analgesia , patient satisfaction and ponv . however , the authors found the sea technique difficult to execute in terms of epidural space location . the reasons for fair and poor satisfaction in ga group were due to pain and ponv . the fair satisfaction in sea group was due to discomfort in epidural space location and highlights the importance of anaesthesiologists experience in thoracic epidural for this technique . one patient with poor satisfaction complained of intraoperative discomfort , which highlights the limitation of sea technique . the epidural catheter was removed at the end of surgery , as surgeons in our set up are not comfortable with epidural catheters in the busy surgical ward . this could mainly be due to the pre - emptive analgesic effect of neuraxial anaesthesia . in spite of removal of epidural catheter , this could be explained because neuronal hypersensitivity and nociception after incision are maintained primarily by sensitised nociceptors during the perioperative period . higher incidence of nausea in ga group was probably due to nitrous oxide , opioids and higher tramadol consumption . higher patient satisfaction in sea group was mainly due to lesser postoperative pain and ponv . lack of access to airway halfway into the procedure , with critical surgical situation is a limitation of ra , even though rescue airway devices are kept ready . hypothermia is a risk in pcnl and there is a greater risk with central neuraxial blockade . we used irrigation solutions at 37c and forced air warmer to keep the patients warm . however a long duration surgery under sea may render the patient hypothermic as well as uncomfortable . these shortcomings may limit the use of sea routinely , and can be only be used for short duration cases with prior discussion with the surgeons . the main limitation of the study was that it included a selected group of patients and experienced surgeons only . we excluded patients with undilated pcs because surgeons in our setup find it difficult to locate the pcs in these cases , as a precise puncture is required . hence , there could have been an error in evaluating the incidence of hypertension in the ga group that had been encountered . this could be a confounder for analysing results pertaining to haemodynamic comparisons between the two groups . future research options could include use of additives to sea to obtain better patient comfort and planned studies recruiting high risk patients where a combination of sea and ga could be evaluated . sea is possible for percutaneous nephrolithotomy in selected patients , for short duration surgery , with experienced surgeons and anaesthesiologists working in coordination .

background and aims : neuraxial anaesthesia has recently become popular for percutaneous nephrolithotomy ( pcnl ) . we conducted a study comparing general anaesthesia ( ga ) with segmental ( t6t12 ) epidural anaesthesia ( sea ) for pcnl with respect to anaesthesia and surgical characteristics.methods:ninety american society of anesthesiologists physical status - i and ii patients undergoing pcnl randomly received either ga or sea . overall patient satisfaction was the primary end point . intraoperative haemodynamics , epidural block characteristics , post - operative pain , time to rescue analgesic , total analgesic consumption , discharge times from post - anaesthesia care unit , surgeon satisfaction scores and stone clearance were secondary end points . parametric data were analysed by student 's t - test while non - parametric data were compared with mann whitney u-test.results:group sea reported better patient satisfaction ( p = 0.005 ) . patients in group ga had significantly higher heart rates ( p = 0.0001 ) and comparable mean arterial pressures ( p = 0.24 ) . postoperatively , time to first rescue analgesic and total tramadol consumption was higher in group ga ( p = 0.001 ) . group sea had lower pain scores ( p = 0.001 ) . time to reach aldrete 's score of 9 was shorter in group sea ( p = 0.0001 ) . the incidence of nausea was higher in group ga ( p = 0.001 ) ; vomiting rates were comparable ( p = 0.15 ) . one patient in group sea developed bradycardia which was successfully treated . eight patients ( 18% ) had hypertensive episodes in group ga versus none in group sea ( p = 0.0001 ) . one patient in ga group had pleural injury and was managed with intercostal drain . stone clearance and post - operative haemoglobin levels were comparable in both groups.conclusion:pcnl under sea has a role in selected patients , for short duration surgery and in expert hands .

an important step in the analysis of positron emission tomography ( pet ) data is the definition of regions of interest ( roi ) . for brain studies in man and large mammals , like primates and pigs , it becomes more common practice to use magnetic - resonance- ( mr- ) based templates [ 14 ] . for brain studies in small animals , for example , rats , several methods to define roi have been proposed , for example , spatial normalization to an mr brain atlas , predefined pet templates [ 6 , 7 ] , direct roi definition on pet images , roi definition using a coregistered segmented rat brain atlas ( based on autoradiography ) , and probabilistic atlases based on pet data ( e.g. , [ f]fdg , [ f]fect , and [ c]raclopride ) for voxel - based functional mapping . in case of small animals , automated image coregistration of pet data with mr templates is difficult , because of the relatively large difference in spatial resolution between mr and pet . in this study , small animal imaging was performed on a high - resolution pet scanner ( i.e. , ecat high - resolution research tomograph , hrrt ) with a spatial resolution of 2.5 to 3 mm and an mr scanner with a spatial resolution of 0.1 mm , resulting in an mr to pet difference of at least 25 in one direction , and 25 in all directions . furthermore , mr - pet coregistration techniques require a certain level of morphological correspondence between both images , that is , there should be sufficient mutual information in both types of images to allow automatic coregistration . consequently , characterization of new pet tracers with highly specific uptake patterns can hamper direct coregistration of an mr template to a pet image , either manually or automatically . a possible way to obtain anatomical information is to perform an additional [ f]naf scan , which can be acquired immediately following an experimental pet study and which can then be used for coregistration to the mr template . as experiments are performed under anaesthesia and head fixation device , an implicit registration between both pet data sets can be assumed . [ f]naf scans provide anatomical ( skull ) information , as uptake of [ f]naf in bone is high with much lower uptake in brain tissue [ 1113 ] . the outline of the skull in an [ f]naf scan provides an image that , indirectly , is also available from an mr scan , where the skull can be visualized by inverting the image colour scale and setting this scale to maximum intensity . this provides a two - step method for mr - based roi analysis of pet images in rat brains . the purpose of the present study was to investigate the reproducibility of mr - based roi analysis using a standard mr template , coregistered with an additionally acquired [ f]naf scan . [ c]af150(s ) is a functionally selective agonist radioligand with moderate affinity for the muscarinic acetylcholine receptor m1 ( m1ach - r ) in vitro and is currently evaluated as a potential pet ligand for central nerve system imaging . pet experiments were performed using 10 male wistar rats ( 274 24 g ; harlan netherlands b.v . , horst , the netherlands ) , who were kept in conditioned housing under a regular light / dark cycle ( 12/12 h ) , allowing food and water ad libitum . all animal experiments were performed in compliance with dutch laws and were approved by the university animal ethics committee ( vu university amsterdam , the netherlands ) . [ f]naf was prepared by passing an [ f]fluoride solution in water over a waters quaternary methyl ammonium ( qma ) light anion exchange cartridge ( waters chromatography b.v . , etten - leur , the netherlands ) , followed by elution from the qma cartridge with 1 ml 1.4% ( w / v ) of nahco3 in sterile h2o . this solution was collected in 10 ml of saline containing 7.09 mm nah2po4 . subsequently , the whole mixture was passed over a sterile millex gv 0.22 m filter ( millipore b.v . , amsterdam , the netherlands ) , yielding a sterile and pyrogen - free solution with radiochemical purity > 99.9% and a ph of 7 . quality control of the [ f]naf solution was performed using an analytical high - performance liquid chromatography ( hplc ) system consisting of a jasco pu-2080 hplc pump ( jasco , ishikawa - cho , japan ) , a rheodyne 7724i injector ( idex health & science , wertheim - mondfeld , germany ) with a 20 l loop , a bio - rad aminex fermentation monitoring column 150 7.8 mm ( bio - rad , hercules , ca , usa ) with a jasco uv-2075 plus uv detector ( jasco , ishikawa - cho , japan ) and a nai radioactivity detector ( raytest , straubenhardt , germany ) . the purity of the product was determined using this analytical hplc system eluted with water containing 0.001 m sulphuric acid at a flow rate of 0.8 mlmin . briefly , [ c]af150(s ) was obtained via methylation of af400 with [ c]ch3i . an incorporation yield of 90% of the product was purified by hplc , recovered by solid phase extraction and subsequently passed over a sterile millex gv 0.22 m filter , yielding an isotonic , sterile , and pyrogen - free solution . the final solution of [ c]af150(s ) was obtained with a decay corrected overall yield of 69 12% ( n = 26 ) , corresponding to 32007000 mbq at the end of the synthesis ( i.e. , 50 5 min ) . radiochemical purity was > 99% , and specific activity at the end of synthesis was 23118 gbqmol . pet measurements were performed using an ecat hrrt ( cti / siemens , knoxville , tn , usa ) . the ecat hrrt is a dedicated human brain pet scanner , with design features that enable high spatial resolution combined with high sensitivity , making it also suitable for small animal imaging . this scanner has a transaxial field of view of 312 mm and an axial field of view of 250 mm . the spatial resolution ranges from 2.3 to 3.2 mm full width at half maximum ( fwhm ) in transaxial direction and from 2.5 to 3.4 mm fwhm in axial direction . first a transmission scan was performed using a 740 mbq 2d fan - collimated cs rotating point source . following this transmission scan , a 3d emission acquisition of 45 min was initiated immediately after an intravenous tail vein injection of 9.9 0.6 mbq [ c]af150(s ) . after the [ c]af150(s ) scan , an intravenous dose of 14.2 3.5 mbq [ f]naf was administered , followed 30 min later by a 3d emission of 30 min . acquired data were stored in 64-bit list mode format and , for [ c]af150(s ) , subsequently histogrammed into 21 time frames ( 7 10 , 1 20 , 2 30 , 2 60 , 2 150 , and 7 300 s ) . data were reconstructed using 3d ordered subsets weighted least squares ( 3d - oswls ) using 7 iterations and 16 subsets . all data were normalized and corrected for attenuation , randoms , scatter , decay , and dead - time . all images were reconstructed into a matrix of 256 256 207 voxels with a voxel size of 1.218 1.218 1.218 mm . mr data were provided by the image sciences institute of the university medical center utrecht and consisted of a typical wistar rat brain image , obtained by averaging single mr images of 8 wistar rat brains ( mean weight 305 g ) acquired on a 4.7 tesla mr system ( varian , palo alto , ca , usa ) using a 3d fast spin echo sequence ( tr / te = 1500/10 ms , 128 128 128 voxels , 32 40 32 mm ) . final image dimensions were 144 112 152 voxels with voxel dimensions of 0.125 0.125 0.156 mm . voxel dimensions of the mr image were scaled to 0.1 0.1 0.13 mm , as brain size did not correspond with that in the present study . as an index of brain size , the distance between left and right dorsal lateral sides of the tympanic bulla was used . this distance was 14.4 mm in the original average mr image and 11.4 0.1 mm for rats used in the present study ( as was calculated from the [ f]naf images ) . the mr template was generated by defining roi on this average mr image using amide ( version 0.9.1 ; http://amide.sourceforge.net ; ) . roi was defined from the beginning of the striatum until the end of the medulla oblongata , corresponding to plates 13 to 130 from the paxinos and watson atlas of the rat brain . using amide , the [ f]naf image of each individual animal was coregistered manually with the mr template image by three different observers according to a predefined protocol . an overview of the steps involved in this manual image coregistration is depicted in figure 1 . briefly , the centre of an [ f]naf image was moved until it roughly overlaid the mr template . next , rotational settings were adjusted until the [ f]naf image paralleled the mr template , and , finally , the centre was adjusted again until the image fitted the mr template . mr template and [ f]naf image fits were considered successful when ( a ) the medial surface of the cranial case was aligned and the hemispheres were distributed ipsilaterally in a coronal cross - section , ( b ) tympanic bullae and frontal bones of the anterior part of the cranial cavity were aligned in a transverse cross - section , and ( c ) the surface of the cranial case and the articulation of parietal and occipital bones were aligned in a sagittal cross - section , as illustrated in figure 2 . finally , dynamic [ c]af150(s ) data were coregistered by directly applying the ( rotational ) settings obtained from the corresponding [ f]naf coregistration . roi of the mr template was projected onto two simulated pet images that consisted of voxels with a theoretical content of either 0 or 1 kbq , arranged in a 3d checkerboard pattern . one image had voxel dimensions equal to the mr image , whereas the other had voxel dimensions equal to the pet image . since there is a considerable difference in spatial resolution with a factor of 1390 difference in voxel volumes , the purpose of this simulation was to check whether roi volumes and mean roi activity were similar for both images . for roi analysis of experimental data , the mr template was projected onto the coregistered [ c]af150(s ) images , using the corresponding [ f]naf image . the percentage injected dose per gram tissue ( % id / g ) was calculated for each brain region using the following equation : ( 1)%idg = regional radioactivity concentration ( kbq / ml)(injected dose ( kbq)density brain tissue ( g / ml ) ) 100% in which a mean brain tissue density of 1.045 g / ml was used . interobserver variability of the image coregistration method was investigated by comparing results of the three independent observers for all brain regions specified . the reproducibility of image coregistration was assessed by considering the variability within subjects not attributable to possible systematic differences between observers . it was assumed that the within - subject variability was the same for all subjects when there were no statistically significant differences , and it was estimated by calculating the standard deviation of the between - observer differences recorded for each subject . expressed as a coefficient of variation ( cov ) , this standard deviation provides a dimensionless measure of reproducibility . reliability between the 3 observers was quantified using the intraclass correlation coefficient for absolute agreement ( icca ) and consistency ( iccc ) . validity of the image coregistration method was verified comparing pet derived % id / g data with previously obtained measurements of % id / g in ex vivo biodistribution studies . briefly , 5 groups of 4 of rats received an intravenous injection of [ c]af150(s ) and were sacrificed at 5 , 10 , 15 , 30 , or 60 min after injection . all brain regions were weighed and counted for radioactivity using an automatic gamma counter ( wallac 1282 compugamma cs , lkb wallac , turku , finland ) , and the % id / g was calculated as percentage of total radioactivity injected , divided by the weight of the tissue . all statistical analyses were performed using spss statistics ( version 17.0 ; spss inc . , the shapiro - wilk test was used to confirm that all data were normally distributed . a two - tailed paired student 's t - test was used for roi analysis of the checkerboard simulation study . the correlation between roi results ( roi volume and mean roi activity concentration ) of mr and pet checkerboard images was assessed using squared pearson 's correlation . a two - way anova with bonferroni posttest was used for comparison of % id / g measures obtained by the various observers who delineated roi for [ c]af150(s ) pet data and for the comparison of pet and ex vivo derived % id / g values . the interobserver reliability for [ c]af150(s ) pet data ( mean roi % id / g ) was computed by intraclass correlation coefficient using a two - way mixed effects model for absolute agreement ( icca ) and consistency ( iccc ) . icc scores range from 0 to 1 , representing a level of agreement : 0.40 poor to fair , 0.410.60 moderate , 0.610.80 substantial , 0.811.00 almost perfect . data are reported as mean sd , and differences were considered significant at a level of p < 0.05 . table 1 provides an overview of the roi defined on the mr image . both roi volumes and mean roi activity concentrations in left and right striata , posterior cortex , and medulla oblongata were slightly lower for the pet than for the mr resolution checkerboard images . the opposite was true for hippocampus , frontal cortex , and cerebellum , as shown in table 2 . more importantly , both roi volumes and mean roi activities derived from mr and pet checkerboard images were not significantly different from each other . correlation analysis of mean roi activity concentrations in mr and pet resolution checkerboard images yielded a slope of 0.982 , an intercept of 0.173 , and an r of 0.998 ( figure 3 ) . quantitative reproducibility of image coregistration was assessed using [ c]af150(s ) data by comparing % id / g data between observers at five different time points ( table 3 ) . the shapiro - wilk test confirmed that these data were consistent with the normal distribution ( w statistic 0.936 , p 0.511 ) . the comparison of % id / g data revealed that for each time point none of the observations were significantly different from each other ( p > 0.722 ) . in addition , cov values were not significantly different between the 3 observers ( p > 0.467 ) . interobserver reliability of the image coregistration method was assessed by calculating icca and iccc of mean uptake in each region , as derived by the 3 observers . these results are summarized in table 4 and , for all regions , show almost perfect agreement ( icca > 0.856 ) between observers . in addition , for all regions , there was almost perfect consistency ( iccc > 0.939 ) between observers . observed regional brain uptake of [ c]af150(s ) was compared between pet and ex vivo studies . the shapiro - wilk test ( w statistic 0.885 , p 0.361 ) confirmed that these data were consistent with the normal distribution . a graphical overview for the various time points is given in figure 5 , indicating no significant differences between both datasets at any of the time points , except for cerebellum at 5 min and hippocampus at 10 min . the proposed generic method for roi analysis of pet data acquired in rats is based on the acquisition of an additional [ f]naf scan . in the present study , the additional acquisition time was 30 min , starting 30 min after injection of ~14 mbq of [ f]naf . this time frame , however , can be adapted according to experimental design in future studies . in order to determine effects of different spatial resolutions ( 1390 mr voxels correspond with one pet voxel ) on roi analyses , calculation of average roi values and volumes was validated using a simulated checkerboard scan . in general , less than 7% difference in volumes and less than 5% in mean roi activity values were observed between pet images with pet and mr resolution ( table 2 ) and none of these differences were significant . in addition , mean roi activity values derived from both images showed near perfect correlation ( r > 0.998 ; slope = 0.982 ) . therefore , applying mr - based roi onto pet images is reproducible with respect to both roi volumes and mean roi activity values . all three observers successfully coregistered all ten [ f]naf images with the mr brain template , following the procedure as outlined in figure 1 . derived uptake of [ c]af150(s ) was not significantly different between observers for any brain region and any time point . following image coregistration of [ c]af150(s ) scans , interobserver agreement ( icca and iccc ) of uptake was excellent for all brain regions . the minor differences at 10 min for hippocampus and at 5 min for cerebellum might be ascribed to individual variability in combination with the relatively small groups of animals . interestingly , both pet and ex vivo biodistribution results indicate that [ c]af150(s ) uptake is highest in striatum , followed by hippocampus , then cortex and then cerebellum , closely following the distribution of m1ach - r in rat brain . clearly , some user - dependent uncertainty may remain in the coregistration of mr template and [ f]naf images . based on the good interobserver correspondence in the manual procedure , semiautomatic or fully automatic image coregistration methods could be investigated for easier and faster roi analysis of small animal pet studies . although several methods are available for pet coregistration in small animals [ 57 , 9 , 10 ] , reproducibility was not assessed for all those methods . in two previous small animal studies reproducibility of brain uptake has been investigated [ 8 , 22 ] using direct roi definition on pet images or predefined pet templates for [ c]raclopride scans . these values are similar to the reproducibility of [ c]af150(s ) uptake observed in the present study ( average cov of 17% ) , suggesting that there is no additional uncertainty due to application of the presently described two - step method of roi analysis . the advantage of the present method is that it allows exact localization of the brain , independent of radioligand and pet scanner used , and without the need to perform an individual mr scan for each rat . in the near future the presently available combined pet / ct small animal scanners do have certain notable shortcomings , that is , the inability to perform simultaneous data acquisition and lesser contrast among soft tissues compared to mr . nevertheless , the ct component of pet / ct images may be used to coregister these images with mr . ultimately , the emerging role of hybrid pet / mr small animal imaging may provide better means for tracer - independent data analysis of rat brain studies and should be further investigated . reproducible analysis of pet data is possible using coregistration of an mr - based roi template with an additional [ f]naf scan . this method can serve as a reliable and reproducible two - step method for tracer - independent data analysis of rat brain studies , as demonstrated for [ c]af150(s ) data .

background . an important step in the analysis of positron emission tomography ( pet ) studies of the brain is the definition of regions of interest ( roi ) . image coregistration , roi analysis , and quantification of brain pet data in small animals can be observer dependent . the purpose of this study was to investigate the feasibility of roi analysis based on a standard mr template and an additional [ 18f]naf scan . methods . [ 18f]naf scans of 10 wistar rats were coregistered with a standard mr template by 3 observers and derived transformation matrices were applied to corresponding [ 11c]af150(s ) images . uptake measures were derived for several brain regions delineated using the mr template . overall agreement between the 3 observers was assessed by interclass correlation coefficients ( icc ) of uptake data . in addition , [ 11c]af150(s ) roi data were compared with ex vivo biodistribution data . results . for all brain regions , icc analysis showed excellent agreement between observers . reproducibility , estimated by calculation of standard deviation of the between - observer differences , was demonstrated by an average of 17% expressed as coefficient of variation . uptake of [ 11c]af150(s ) derived from roi analysis closely matched ex vivo biodistribution data . conclusions . the proposed method provides a reproducible and tracer - independent method for roi analysis of rat brain pet data .