article
stringlengths 0
328k
| abstract
stringlengths 261
2.35k
|
|---|---|
root canal treatment consists of chemo - mechanical preparation and obturation , followed by adequate restoration.1 because root canal - treated teeth often have significantly damaged coronal tooth structures , they commonly require posts to support the core material and promote retention of the final restoration.2 - 4 fiber posts are generally preferred to metal posts for coronally damaged teeth to reflect the elastic modulus of the dentin , providing better adhesion between the dentin and fiber post and permitting more uniform stress distribution along the root dentin.4,5 the proportion of oval - shaped canals in human dentition is high , even in the apical region.6 oval fiber posts have been introduced to prevent inappropriate post - space preparation in oval root canals .
oval fiber posts reduce the resin cement thickness and increase post - retention strength , as they anatomically reproduce the oval form of root canals.7 several potential advantages of oval fiber posts over circular fiber posts have been reported , including reduced resin cement thickness,8 better open dentin tubule scores , and increased adhesion.9 instead of using a rotary instrument to prepare the post space , a minimally invasive diamond - coated ultrasonic tip is used for the ellipson oval fiber post ( ellipson tip ; rtd / satelec , merigcac , france).7 although studies have demonstrated that oval fiber posts are more successful in oval root canals,7,10 no study has compared the stress distribution of oval and circular fiber post systems . the photoelastic technique and finite element analysis
have been used to evaluate post failure in root canals in vitro and in vivo.11,12 the most frequent causes of post failure in core restorations are fracture and debonding.13 the main causes of bonding failure are especially inadequate bonding in the apical third of the root canal , interfacial gaps in the hybrid layer , microleakage and polymerization shrinkage stress ( c factor ) .
the only method of analysis that eliminates operator factors and uses materials under ideal conditions is the finite element model ( fem).11,12 in the fem , digitally modeled tooth structures are divided into simple geometric models , called elements , whose tips aggregate to generate nodes .
each modeled element layer has specific elastic constants , such as young 's elastic modulus ( e ) and poisson 's ratio ( v).14 thus , the fem has become a reliable method for dental applications that enables the calculation of load distributions and the influence of model parameter variations once an accurate three - dimensional model is created.12 the purpose of the present study was to compare the stress distribution of circular and oval fiber posts in restored teeth using finite element analysis .
a 22 mm long mandibular premolar with a 7 mm crown height and a 15 mm root length was modeled for this study.12 the ansys software program ( ver 12.1 ; ansys inc .
, canonsburg , pa , usa ) was used to model the restored tooth and surrounding tissues .
two models of a restored tooth composed of a porcelain crown , dentin , composite core , crown - core adhesive layer , dentin - post adhesive layer , cortical bone , spongy bone , root canal gutta - percha filling , and oval and circular fiber posts , respectively , were created ( fig . 1 and fig .
material properties are listed in table 1.12 using an optimization process based on convergence analyses , three - dimensional meshes ( mean size , 0.5 mm ) were created through 10 nodes of tetrahedral elements with quadratic displacement shape functions and three degrees of freedom per node .
numerical models comprised about 262,160 elements and 401,161 nodes for oval fiber posts , and 263,443 elements and 402,608 nodes for circular fiber posts ; the continuity of displacement fields through material interfaces was imposed ( fig .
d.t . light circular fiber posts ( bisco inc . , schaumburg , il , usa ) with apical diameters of 1.1 mm and ellipson oval fiber posts ( rtd / satelec , merigcac , france ) with apical diameters of 1.1 mm were used in this study .
the thickness of the luting material was assumed to be 200 m between the post and root dentin and between the core and porcelain crown .
an oblique force of 300 n was applied at angle of 45 to the occlusal plane , oriented toward the buccal side ( fig .
4).12 the gingiva served as a fixed support for the boundary condition of the model ( fig .
the periodontal ligament was eliminated from the model because its thin structure can distort of the elements12 all materials were considered to be homogeneous , isotropic , and linearly elastic .
the applicable stress representation criterion was chosen based on an evaluation of the predicted potential for failure in the analysis performed .
the von mises ( equivalent stress ) energetic criterion was chosen as the best representation of a multi axial stress state .
three regions of the oval and circular fiber posts were evaluated : a ) along the apical extent of the post ( post tip ) , b ) the core - root dentin interface from the labial to the palatal side , and c ) 3 mm - above b , from the labial to the palatal side ( fig .
the maximum distribution of von mises stress occurred in the luting materials of oval and circular fiber posts . within the luting material ,
the stress concentration of the circular fiber post was greater than that of the oval fiber post ( fig .
von mises stress in the root dentin was greater for the circular fiber post ( 426.81 mpa ) than for the oval fiber post ( 346.34 mpa ) ( fig . 7 and fig .
von mises stresses were concentrated in the coronal third of root dentin , close to the post space .
the stress distributions of circular and oval fiber posts were evaluated using three - dimensional elastic finite element analysis .
the results show that the oval fiber post system provides better stress distribution than the circular fiber post system .
the major shortcomings of standard fracture or stress studies are related to the use of different tooth structures , such as different dentin thicknesses and root canal shapes .
differences in tooth structure prevent the standardization of resin cement thickness and post - space preparation . thus , the main advantage of this study was the use of fems , which provided the maximum level of standardization .
another advantage of this study is that the post space in the oval - shaped mandibular premolar model was prepared according to the manufacturers ' directions , thereby avoiding operator errors that can occur in in vivo and in vitro studies.11,12 the aim of this study was to evaluate stress distribution in a tooth model using posts made of the same fiber material but with different geometrical shapes .
thus , linear fem analysis adequately described von mises stress distribution in this study . to validate the fems ,
after the convergence test , the two models were composed of 262,160 - 263,443 elements and 401,161 - 402,608 nodes .
these large numbers of elements and nodes in the current fems provide more reliable results than achieved in previous studies.11,12,14,15 maceri et al.14 stated that oblique loads are more hazardous than vertical loads on endodontically restored teeth .
thus , an oblique load was used in this study to reflect parafunctional loads related to bruxism and to limit the chewing conditions in the case of very tough foods . when the mandibular premolar was subjected to 45 occlusal loading ,
stress was concentrated on the coronal side of the root dentin.12 in a finite model of a mandibular premolar with a fiber post restoration , boschian pest et al.11 observed the highest level of von mises stress between the luting material and root dentin under the 486 n chewing force .
in addition , the authors showed that stress was concentrated in the coronal part of the root.11 the stress fields were also non - homogeneous in the coronal region of the root , as reported in previous fem studies of simulated crowns and ferrules in teeth restored with fiber posts and composite resin cores.16 - 18 in an fem study , hsu et al.12 applied 300 n force at an angle of 45 to the palatal surface of maxillary central incisor with a fiber post restoration , and reported that the maximum stress was concentrated between the root dentin and adjacent cortical bone .
in the current study , maximum von mises stress values were observed between the luting material and root dentin ; these results are compatible with boschian pest et al.11 but differ from those of hsu et al.12 the discrepancy in results among these studies may be due to the use of different tooth models , resulting in differences in loading points and distributions . in this study , we found that fiber post geometry may affect stress distribution .
in contrast , de castro albuquerque et al.15 found that post geometry and material did not affect stress distribution in an analysis of tapered , cylindrical , and two - stage cylindrical posts made of three different materials .
this difference may be due to the use of different loading forces ( 100 n ) , tooth models ( two - dimensional central incisor ) and materials with different geometrical designs .
aggarwal and garg19 used an fem to evaluate stress concentrations in endodontically treated maxillary central incisors restored with three fiber post systems : d.t .
light , luscent anchor ( dentatus , ny , usa ) , relyx ( 3 m espe , st .
paul , mn , usa ) fiber posts with a double - tapered , parallel shape , tapering of the last 1.8 mm of the apical end , and uni - tapering ( 8% ) in the middle third of the post , respectively .
the authors found that the relyx post generated the least amount of stress and attributed the results to the material ( glass fiber ) and the parallel placement of the fibers.19 however , the authors did not consider that the different geometrical designs of the post systems may also have affected the results.19 in our study , we used the ellipson oval fiber post and d.t .
light fiber post because they are composed of quartz fiber , and have the same young 's modulus and poisson 's ratio ; thus , they differ only in geometrical design , allowing evaluation of the effect of post geometry on stress distribution . within the limitations of this study , circular fiber posts generated more stress than oval fiber posts .
in the present study , circular fiber posts generated more stress than did oval fiber posts in a mandibular premolar .
this suggests that post geometry has very important effect on stress distribution at the post - dentin interface .
interfacial stresses can be higher in post - core restorations using circular fiber posts than in those with oval fiber posts .
the adhesive and cohesive interfacial failure risks are thus greatly reduced in oval fiber post - core restorations , which showed greater durability ( less fatigue ) under cyclic loading . | purposethe aim of the present study was to evaluate the effects of posts with different morphologies on stress distribution in an endodontically treated mandibular premolar by using finite element models ( fems).materials and methodsa mandibular premolar was modeled using the ansys software program .
two models were created to represent circular and oval fiber posts in this tooth model .
an oblique force of 300 n was applied at an angle of 45 to the occlusal plane and oriented toward the buccal side .
von mises stress was measured in three regions each for oval and circular fiber posts.resultsfem analysis showed that the von mises stress of the circular fiber post ( 426.81 mpa ) was greater than that of the oval fiber post ( 346.34 mpa ) .
the maximum distribution of von mises stress was in the luting agent in both groups .
additionally , von mises stresses accumulated in the coronal third of root dentin , close to the post space in both groups.conclusionoval fiber posts are preferable to circular fiber posts in oval - shaped canals given the stress distribution at the post - dentin interface . |
a recent community survey showed that quality of life ( qol ) decreases progressively with age in the general population : the elderly were shown to perceive their qol as much lower than young people .
the presence of chronic inflammatory , endocrine and degenerative diseases is associated with reduced qol ; the association of such diseases with mood disorders may be a determining factor amplifying this reduction .
physical activity and exercise have recently been shown to improve qol in elderly people with neurodegenerative diseases and depressive disorders .
exercise is associated with better qol in elderly people with major depressive disorder living in the community , and there are strong evidence that physical training improve daily living performance and qol in frail elderlies long - term care institutionalized
decreases in sleep and motility are common risk factors for psychological distress in old age , related to poorer qol .
a recent survey revealed a positive chronic association between exercise and time of waking after sleep onset , as well as a small positive acute association between exercise and general sleep quality rating in elderly people .
thus , physical activity not only appears to affect the qol of older people with chronic diseases , but also physical factors such as sleep , which can be considered a general indicator of well - being and a prodromal symptom of physical and mood disorders in people without chronic disease or depression .
moreover , long - term exercise in aging adults has been shown to provide , besides musculoskeletal and cardiovascular positive effects , also a improvement on cognitive functions , such as memory , attention and executive functions [ 14 , 15 ] .
prevention programs for the elderly , for example against falls , stressed the importance of the effect of physical exercise on psychosocial variables closely related to perceived qol .
it has been suggested that a high perceived qol is an important motivational factor in preventive programs against chronic vascular diseases in the elderly , and it has been shown that long - term physical activity , even in elderlies with chronic diseases and without a clear relationship with a dose - response effect , is related to positive effects on qol by postponing disability and enhancing independent living .
thus , if chronic illnesses and depression can affect qol , it is also conceivable that a good perceived qol might be considered a preventive factor against these same disorders in the elderly .
a senior who feels well takes better care of himself and eats better , leading to more careful routine clinical examinations .
the present study aims to verify the effect on qol of an intensive fitness program in an elderly sample without depression as compared to a lighter postural - type fitness program .
the study was carried out as part of the a chentannos in salude ( a typical sardinian saying , which could be translated as
i hope you ll live a hundred years in good health ) trial , a prospective population - based study for seniors carried out by the italian olympic committee ( coni ) in sardinia , approved by coni sardinia and conducted at the italian olympic committee in cagliari , italy , aiming to verify the physiological modifications induced by exercise in the elderly .
participants were recruited by an announcement in a local newspaper , by medical doctors , and by flyers in pharmacies .
approximately 350 people aged 65 or older were invited to participate and were contacted by phone to inform them about the study . more or less 180 people indicated their interest in participating in the study and were added to the list of inclusion - exclusion criteria , established by the doctors on the team .
inclusion required at least one criteria between sedentary and dysmetabolism according to a medical check - list .
in particular , sedentary was defined by an expenditure of energy of less than 1.5 metabolic equivalents ( mets ) , corresponding to remain sitting , reclined , or lying during most of the day ; according to the physical activity guidelines for older adults , we considered sedentary subjects that performed less than 30 minutes per day of moderate physical activity on five or fewer days per week . according to the american hearth association criteria
, dysmetabolism was defined by the presence of at least one among : basal glycaemia 100 mg / dl , systolic blood pressure 130 mmhg and/or diastolic blood pressure 85 mmhg , high - density lipoprotein plasma cholesterol 40 mg / dl ( men ) or 50 mg / dl ( women ) , low - density lipoprotein plasma cholesterol 160 mg / dl ( men ) or 150mg / dl ( women ) , plasma triglycerides 150 mg / dl , waist circumference 102 cm ( men ) or 88 cm ( women ) , or a waist circumference of 94 cm ( men ) or 80 cm ( women ) in presence of 2 other criteria among the precedents .
exclusion criteria were the presence of : any disease that could be a contraindication to performing a stress test ( such as unstable ischemic heart disease , uncontrolled hypertension , severe arrhythmia , valvular heart disease ) ; any osteoarticular pathology incompatible with exercise ( severe osteoporosis , acute connective tissue diseases , recent fractures , etc . ) ; neurological diseases or outcomes of debilitating neurological disorders ( stroke , dementia , neurodegenerative diseases , etc . ) ; neoplasms in place or disabling outcomes of cancer ; moderate to severe anemia ( hb<10 mg / dl ) ; obesity with bmi > 35 .
moreover , subjects were included only if they did not have difficulty in reaching the gym where the trial was performed .
all participants selected underwent a detailed medical examination , including anthropological measures ; electrocardiogram , blood pressure , and spirometry at rest and under stress test ; blood sampling for complete blood count ( cbc ) , glycaemia , total cholesterol , hdl and ldl cholesterol , triglycerides , azotemia , creatinine , cortisol .
participants were randomly assigned in a 1:1 fashion to two different groups : vag ( vigorous activity group ) and pgg ( postural gymnastic group ) .
the study was a 12-week randomized controlled trial with fitness sessions 3 times a week , 36 sessions in all , each session lasting 1 hour .
participants continued their regular activity level and dietary habits and were instructed not to engage in any other physical program while participating in the study .
the study started in april 2013 ( t0 ) and ended in july 2013 ( t1 ) .
data were collected and included in the analysis only for subjects that completed 90% of the sessions with a maximum absence of 3 non - consecutive days .
twelve weeks later , subjects were again assessed ( t2 ) , in order to measure wellbeing after the program and the potential persistence of results . according to acsm guidelines , physical activity ( pa )
was established as 60% to 84% of the heart rate reserve ( hrr ) and monitored continuously during activity with the heart - rate monitor polar t31 codedand also transmitted by a telemetry system ( hosand ) to the fitness professionals .
the individual hrr for each participant was assessed according to the estimated maximal heart rate formula , where hrmax = 206.9- ( 0.67 x age ) .
baseline hr was registered for all participants for three days , in the morning immediately after waking up , and the mean data was utilized .
pa for the vag consisted of three phases : 1 ) warm up , up to 10-min , up to 60% of hrr 2 ) active phase , 45-min , from > 60% to 84% hrr 3 ) cool down , up to 10-min , < 60% of hrr .
the active phase was designed as a mixture of aerobic and anaerobic exercises . the protocol design integrated drills of life movements , strength and balance .
warm up phase , up to 60% of hrr , was designed with slow , dynamic movements using large muscle groups of the lower , middle and upper body , moving through full range of motion .
subjects began with simple walks around the room with various arms movements , including some static and dynamic balance exercises and stretching for principal muscular groups .
60% to 84% hrr , was designed with dynamic exercises with and without the use of a platform ( step ) , continuous exercise with gradual increase of the difficulty and the intensity , departing from the walk around the step alternated to the basic step ( step up and down from the base with alternate footstep ) to reach the alternate lifts with inferior limbs flexes , extended out or flexed behind ( knee lift , side leg , leg curl ) , creating some brief and easy sequences to repeat .
the last part of the active phase we have been introduced integrated multiple plane exercises for upper and lower limbs using elastic resistances ( xertube ) . cool down phase , < to 60% of hhr , it included cardio respiratory cool - down exercises followed by relaxation , postural control and spine mobility exercises in prone position ( knee - wrist ) in support on the platform , exercises of static equilibrium on 4 and 2 supports , with open and closed eyes and with activation of the cores muscles .
it also included some post - stretch exercises to return muscles to a pre - exercises length for the muscular groups mostly involved during the workout .
pa for the pgg was designed to maintain the heart rate to 40% of hrr .
it included static and dynamic exercise for postural control and spine mobility exercise in a prone position ( knee - wrist ) with support on the platform and static equilibrium exercises on 4 and 2 supports , with eyes open and closed and with activation of core muscles .
pa was conducted by fitness professionals with degrees in sports and physical education and continuously monitored by a supervisor responsible for the hrr activity level .
depressive symptoms in the two groups were measured at the three steps in the study by means of the patient health questionnaire ( phq9 ) .
this self - administered questionnaire is a brief , field - tested screening for depression .
the assessment is fast and easy , helping clinicians in the diagnosis and treatment of depression .
a score between 10 and 15 indicates the presence of relevant depressive symptoms , while a score higher than 15 allows the diagnosis of major depressive disorders .
the sf-12 is a self - evaluation in the previous month of : physical activity , limitations due to physical problems on roles or activities , pain , emotional and general health status , vitality , social activities and mental health .
comparison of phq9 scores between groups was carried out by means of anova 1-way statistics .
the scores for the sf-12 in the two groups were compared with the normative score for a large national sample standardized by age and sex , drawn from a national survey in italy by anova 1-way statistics . to test differences between the two groups ( vag and pgg ) on the sf-12 and phq9 over time
, we conducted a multivariate analysis of variance ( manova ) , with group as the between - subjects factor .
each subject in the study was identified with a code number not amenable to their name by researchers .
the study was approved by the board of the comitato olimpico nazionale italiano ( coni ) of the sardinia region .
the study was carried out as part of the a chentannos in salude ( a typical sardinian saying , which could be translated as
i hope you ll live a hundred years in good health ) trial , a prospective population - based study for seniors carried out by the italian olympic committee ( coni ) in sardinia , approved by coni sardinia and conducted at the italian olympic committee in cagliari , italy , aiming to verify the physiological modifications induced by exercise in the elderly .
participants were recruited by an announcement in a local newspaper , by medical doctors , and by flyers in pharmacies .
approximately 350 people aged 65 or older were invited to participate and were contacted by phone to inform them about the study . more or less 180 people indicated their interest in participating in the study and were added to the list of inclusion - exclusion criteria , established by the doctors on the team .
inclusion required at least one criteria between sedentary and dysmetabolism according to a medical check - list .
in particular , sedentary was defined by an expenditure of energy of less than 1.5 metabolic equivalents ( mets ) , corresponding to remain sitting , reclined , or lying during most of the day ; according to the physical activity guidelines for older adults , we considered sedentary subjects that performed less than 30 minutes per day of moderate physical activity on five or fewer days per week . according to the american hearth association criteria
, dysmetabolism was defined by the presence of at least one among : basal glycaemia 100 mg / dl , systolic blood pressure 130 mmhg and/or diastolic blood pressure 85 mmhg , high - density lipoprotein plasma cholesterol 40 mg / dl ( men ) or 50 mg / dl ( women ) , low - density lipoprotein plasma cholesterol 160 mg / dl ( men ) or 150mg / dl ( women ) , plasma triglycerides 150 mg / dl , waist circumference 102 cm ( men ) or 88 cm ( women ) , or a waist circumference of 94 cm ( men ) or 80 cm ( women ) in presence of 2 other criteria among the precedents .
exclusion criteria were the presence of : any disease that could be a contraindication to performing a stress test ( such as unstable ischemic heart disease , uncontrolled hypertension , severe arrhythmia , valvular heart disease ) ; any osteoarticular pathology incompatible with exercise ( severe osteoporosis , acute connective tissue diseases , recent fractures , etc . ) ; neurological diseases or outcomes of debilitating neurological disorders ( stroke , dementia , neurodegenerative diseases , etc . ) ; neoplasms in place or disabling outcomes of cancer ; moderate to severe anemia ( hb<10 mg / dl ) ; obesity with bmi > 35 .
moreover , subjects were included only if they did not have difficulty in reaching the gym where the trial was performed .
all participants selected underwent a detailed medical examination , including anthropological measures ; electrocardiogram , blood pressure , and spirometry at rest and under stress test ; blood sampling for complete blood count ( cbc ) , glycaemia , total cholesterol , hdl and ldl cholesterol , triglycerides , azotemia , creatinine , cortisol .
participants were randomly assigned in a 1:1 fashion to two different groups : vag ( vigorous activity group ) and pgg ( postural gymnastic group ) .
the study was a 12-week randomized controlled trial with fitness sessions 3 times a week , 36 sessions in all , each session lasting 1 hour .
participants continued their regular activity level and dietary habits and were instructed not to engage in any other physical program while participating in the study .
the study started in april 2013 ( t0 ) and ended in july 2013 ( t1 ) .
data were collected and included in the analysis only for subjects that completed 90% of the sessions with a maximum absence of 3 non - consecutive days .
twelve weeks later , subjects were again assessed ( t2 ) , in order to measure wellbeing after the program and the potential persistence of results .
according to acsm guidelines , physical activity ( pa ) was established as 60% to 84% of the heart rate reserve ( hrr ) and monitored continuously during activity with the heart - rate monitor polar t31 codedand also transmitted by a telemetry system ( hosand ) to the fitness professionals .
the individual hrr for each participant was assessed according to the estimated maximal heart rate formula , where hrmax = 206.9- ( 0.67 x age ) .
baseline hr was registered for all participants for three days , in the morning immediately after waking up , and the mean data was utilized .
pa for the vag consisted of three phases : 1 ) warm up , up to 10-min , up to 60% of hrr 2 ) active phase , 45-min , from > 60% to 84% hrr 3 ) cool down , up to 10-min , < 60% of hrr .
the protocol design integrated drills of life movements , strength and balance .
warm up phase , up to 60% of hrr , was designed with slow , dynamic movements using large muscle groups of the lower , middle and upper body , moving through full range of motion .
subjects began with simple walks around the room with various arms movements , including some static and dynamic balance exercises and stretching for principal muscular groups .
active phase , from > 60% to 84% hrr , was designed with dynamic exercises with and without the use of a platform ( step ) , continuous exercise with gradual increase of the difficulty and the intensity , departing from the walk around the step alternated to the basic step ( step up and down from the base with alternate footstep ) to reach the alternate lifts with inferior limbs flexes , extended out or flexed behind ( knee lift , side leg , leg curl ) , creating some brief and easy sequences to repeat .
the last part of the active phase we have been introduced integrated multiple plane exercises for upper and lower limbs using elastic resistances ( xertube ) . cool down phase , < to 60% of hhr , it included cardio respiratory cool - down exercises followed by relaxation , postural control and spine mobility exercises in prone position ( knee - wrist ) in support on the platform , exercises of static equilibrium on 4 and 2 supports , with open and closed eyes and with activation of the cores muscles .
it also included some post - stretch exercises to return muscles to a pre - exercises length for the muscular groups mostly involved during the workout .
pa for the pgg was designed to maintain the heart rate to 40% of hrr .
it included static and dynamic exercise for postural control and spine mobility exercise in a prone position ( knee - wrist ) with support on the platform and static equilibrium exercises on 4 and 2 supports , with eyes open and closed and with activation of core muscles .
pa was conducted by fitness professionals with degrees in sports and physical education and continuously monitored by a supervisor responsible for the hrr activity level .
depressive symptoms in the two groups were measured at the three steps in the study by means of the patient health questionnaire ( phq9 ) .
this self - administered questionnaire is a brief , field - tested screening for depression .
the assessment is fast and easy , helping clinicians in the diagnosis and treatment of depression .
a score between 10 and 15 indicates the presence of relevant depressive symptoms , while a score higher than 15 allows the diagnosis of major depressive disorders .
the sf-12 is a self - evaluation in the previous month of : physical activity , limitations due to physical problems on roles or activities , pain , emotional and general health status , vitality , social activities and mental health .
comparison of phq9 scores between groups was carried out by means of anova 1-way statistics .
the scores for the sf-12 in the two groups were compared with the normative score for a large national sample standardized by age and sex , drawn from a national survey in italy by anova 1-way statistics . to test differences between the two groups ( vag and pgg ) on the sf-12 and phq9 over time
, we conducted a multivariate analysis of variance ( manova ) , with group as the between - subjects factor .
each subject in the study was identified with a code number not amenable to their name by researchers .
the study was approved by the board of the comitato olimpico nazionale italiano ( coni ) of the sardinia region .
21 subjects were assigned to treatment with the vag ( 12 males , 9 females ) , mean age 69.243.94 ; 21 subjects were assigned to treatment with the pgg ( 14 males and 7 females ) , mean age 70.05.374 ) . in the vag ,
3 subjects reported at least one previous depressive episode , one of them being treated with antidepressant drugs .
two other subjects were receiving benzodiazepines . in the pgg , one person reported at least one previous depressive episode .
11 subjects were receiving pharmacological treatment , in 7 cases multiple drug treatment . in the pgg
, 15 subjects were taking medication , in11 cases multiple drugs . in the vag ,
concomitant organic diseases were : hypertension ( 8 subjects ) , hypercholesterolemia ( 3 subjects ) and osteoporosis ( 2 subjects ) ; in the pgg , 8 subjects were suffering from hypertension , 5 from diabetes mellitus ( type 1 in one case ) , 4 from hypercholesterolemia , 4 from non - severe heart disease ( heart failure , atrial fibrillation , aorto - coronary bypass ) , 3 from thyroid diseases ( post - surgical hypothyroidism , hashimoto 's thyroiditis ) and 2 from musculoskeletal diseases ( arthritis , osteoporosis ) . two subjects in the vag group and one in the pgg group dropped out of the study .
table 1 shows the score on the phq9 at t0 , t1 , and t1 . both the vag and pgg showed low phq9 scores at t0 , ( anova 1 way : vag : f=0.004 ; p=0.996 ; df 1 , 57,59 ; pgg : f= ; 0.078 ; p=0.925 ; df 1 , 54,56 ) , and scores did not change considering the two factors of time and group ( see table 1 .
manova phq9 : time f=0.865 ; p=0.431 ; df 2 , 32 ; group f=0.284 ; p=0.598 ; df 1 , 33 ; time*group f=1.689 ; p=0.201 ; df 2 , 32 ) .
table 2 shows sf-12 scores at t1 and t2 for the vag , pgg and a normative sample . at the end of the study ( t1 ) , the level of qol measured by means of sf-12 scores was better in both the vag and the pgg groups than in the normative standardized sample .
sf-12 scores for the two groups decreased slightly 12 weeks after the end of the trial ( t2 ) , with no significant differences considering the two factors of time and group ( see table 3 .
manova sf-12 : time f=1.386 ; p=0.247 ; df 1 , 35 ; group f=0.246 ; p=0.623 ; df 1 , 35 ; time*group f=0.026 ; p=0.872 ; df 1 , 35 ) .
however , the difference between the vag and the normative sample remained statistically significant ( anova 1 way : f=5.52 ; p=0.019 ; df 1 , 703 , 704 ) , while the level of qol in the pgg group did not differ from the normative sample ( anova 1 way : f=3.10 ; p=0.079 ; df 1 , 703 , 704 ) .
the results of the study indicate that a sample of elderly people undergoing either a demanding exercise program or a light postural gymnastic program for 12 weeks had a subjective level of appreciation in their qol , at the end of the trial , higher than the average for individuals of the same age and sex living in the community .
the scores for perceived qol tended to decrease 12 weeks after the end of the trial , although the difference between the scores at the end of the trial and the 12-weeks - later scores did not significantly differ between groups and time . nevertheless , while the sample of subjects in the pgg group did not differ as compared with the general population , the sample in the vag group maintained a higher level of qol than the normative score for a community sample .
previous evidence from the literature stated the effectiveness of exercise in improving mental wellbeing in older people , particularly with a group - based physical activity supervised by trained leaders , with a minimum of two weekly exercise sessions of 45 minutes each .
the concept of mental well - being as positive psychological functioning encompassing happiness , life satisfaction and self - esteem [ 27 , 28 ] is quite different from that represented by quality of life , a notion including a more general concept regarding all relevant aspects of life .
our findings suggest that exercise might be associated with a wide range of components of wellbeing , such as subjective satisfaction in life .
notably , the training group in the present study performed vigorous mixed aerobic / anaerobic physical activity , while most of the trials carried out on healthy elderly people consisted of mild to moderate mixed or aerobic exercise . nevertheless , the drop - out rate in the vag group was low ( 9.5% ) , confirming demanding pa to also be appropriate for elderly people , who are able to adapt and respond to both endurance and strength training .
the role of physical activity as a clinical management strategy for depression in the elderly has been widely debated .
a recent review of the literature concluded that evidence from high - quality studies was generally positive , but that the effect on depression was minimal .
it was argued that participation in physical recreational activities might lead to better qol outcomes , and this effect has been shown as well in patients suffering from treatment - resistant depression [ 32 , 33 ] .
qol has become an important outcome criterion for psychiatric intervention , particularly in chronic disorders .
patients suffering from either current depressive disorder or milder depressive symptoms have been showed to have worse physical , social , and role functioning , and to feel more physical pain than patients without chronic depressive conditions . moreover , a high qol has been shown to be related to positive outcomes in preventive intervention in healthy elderly people , like healthy nutrition and physical activity behavior , recognized as reducing the risk of premature lethality from myocardial infarction , arterial hypertension , colon cancer , type 2 diabetes , osteoporosis and obesity .
recently , it has been highlighted the role of exercise in enhancing metabolic , structural and functional dimensions of the aging brain , determining neuroprotection and preserving cognitive performance .
the neurotrophic effect of exercise , which is well known in animals , has been shown in humans and hypothesized to be related to the increase of neurotrophic factors , such as the brain - derived neurotrophic factor ( bdnf ) , mainly in the hippocampus , involved in memory and mood disorders .
this effect of exercise on old people s brain could be an important mediator for the improvement on qol , and it could protect against a cognitive decline and the loss of autonomy .
conversely , it might be also argued that a high qol in elderly people could be a strong motivation to follow a healthy lifestyle , acting as preventive intervention per se . nevertheless , some methodological problems affected the assessment of qol .
there is a possible measurement overlap between qol and psychopathology , especially depression , which may invalidate research results .
recently , the longitudinal investigation of depression outcomes ( lido ) trial pointed out that measures of physical and mental health functioning , and qol showed significant longitudinal associations with measures of depressive symptoms . moreover , during a current major depressive disorder , mental health - related measurements tended to get worse , while those for physical health changed the least , with measurement of change in qol in depression being intermediate . in our study , the result regarding qol can not have been influenced by a depressive condition , as it was absent in both samples before , during and after the trial .
this independence of results might suggest that the improvement in qol due to physical exercise may be one of the protective factors against depression in old age .
elderlies suffering from chronic conditions tend to do less physical activity , thus determining a decrease in motility and functional limitations that could affect overall wellbeing .
the issue of loneliness is particularly important for older people , and social contacts might positively influence qol .
moreover , qol improved in both the vag and pgg groups after exercise , proving that qol is a construct modifiable with health promotion behavior .
this research was not specifically designed to prove our hypothesis ; the sample is small and the association between high qol and physical activity at the end of the trial might be due to a subject - selection bias , in particular as regards their wellbeing before exercise .
. however , the tendency of scores for the normative sample to decrease to the average of scores for the national sf-12 twelve weeks after the end of the trial is a convincing argument regarding the exercise as determinant of the improve in qol .
a 12-week high - intensity program of aerobic / anaerobic physical activity in a sample of subjects aged 65 and over was shown to be associated with higher qol than a lighter program of a postural type , as compared to the qol for a normative sample .
after 12 weeks of de - training , the group that trained at high intensity maintained a higher level of self - rated qol as compared to both the low - intensity exercising group and the normative sample .
quality of life tends to decrease with age , particularly in presence of chronic diseases and depression .
physical activity improves several features related to quality of life , such as sleep and motility .
we show that a high - intensity program of aerobic / anaerobic exercise results associated with a higher quality of life in a sample of elderlies , and this finding is maintained after 12 weeks of de - training .
a high quality of life associated with physical activity might be a protective factor against chronic conditions in old age .
| introduction : quality of life ( qol ) tends to decrease with age .
exercise has been shown to be effective in improving
some psychosocial features related to qol .
we carried out a randomized controlled trial to verify the long - term
efficacy of an intensive fitness program versus a lighter program on the qol of an elderly sample , compared to qol of a
large normative sample.methods:participants aged 65 years were randomly assigned in a 1:1 fashion either to a vigorous
physical activity program group ( vag ) or to a postural gymnastic group ( pgg ) .
depressive symptoms were screened
by phq-9 .
qol assessment was done by sf-12 .
multivariate analysis of variance ( manova ) was conducted to test
differences between the two groups over time .
comparison with the normative sample was carried out by means of
anova 1-way.results:both vag and pgg showed low phq9 scores at the beginning and at the end of the trial ,
indicating the absence of depressive symptoms . at the end of the study
, both groups had a higher level of qol , measured
by means of sf-12 , than the normative standardized sample .
while sf-12 scores for both groups decreased slightly 12
weeks after the end of the trial , only the vag group maintained significantly - higher scores than those of the normative
sample.conclusions:a vigorous physical activity program group might be associated with better maintenance of results
over time as compared to a postural gymnastic program .
these results require future confirmation by further studies on
large samples . |
fetal pleural effusions are uncommon and are detected prenatally with an incidence rate of approximately 1 in 10,000 to 15,000 pregnancies .
they are a nonspecific sign and are frequently associated with congenital malformations , chromosomal abnormalities , chylothorax , anemia , heart defects , cardiac arrhythmias , and viral infections.1 congenital diaphragmatic hernia ( cdh ) has an incidence of 1 per 2,000 to 3,500 deliveries .
left - sided cdh commonly contain stomach , bowel , and spleen and is associated with a generalized pulmonary hypoplasia.2 the clinical presentation depends on the extent of pulmonary hypoplasia and may vary from cyanosis and respiratory distress immediately after birth to late presentation of respiratory distress in the first few days of life when the herniated bowel loop fills with air and compresses the ipsilateral lung parenchyma.2 typical signs include abnormally sited cardiac impulse , absent breath sounds , and scaphoid abdomen .
medical management consists of initial resuscitation with a view to avoid face mask ventilation , preoperative stabilization , and ventilatory care aiming in reducing the risk of volutrauma and persistent pulmonary hypertension of the newborn , while the surgical treatment consists of reduction of the herniated contents and closure of the diaphragmatic defect .
the mother was a 38-year - old , gravida iii , para ii with an uncomplicated previous obstetric history .
early anomaly ultrasound scan in a quaternary level fetal medicine unit demonstrated hydrothorax with bilateral pleural effusions . at 18 weeks of gestation
a repeat ultrasound scan at 33 weeks of gestation showed increased amniotic fluid with a deepest vertical pool of 9 cm ; suspicion of oesophageal atresia was raised .
subsequent ultrasound scan performed at 34 weeks demonstrated mediastinal shift with the heart axis deviated to the right and loops of the small bowel and the stomach were visualized in the chest cavity .
the increased amniotic fluid did not warrant amniodrainage . planned delivery was booked at 38 weeks ; however , delivery was performed at 36 weeks of gestation by emergency caesarean section because of spontaneous onset of labor .
a male infant was born in good condition , cried at birth , and was intubated at 4 minutes of age .
the right - sided thoracoamniotic shunt had spontaneously fallen out in utero , whereas the left - sided device was still in situ and immediately clamped to avoid development of a pneumothorax .
a wide bore nasogastric tube was inserted , and the infant was electively intubated and transferred to the neonatal intensive care unit .
blood gas analysis revealed a cord arterial ph of 7.44 with a base excess of 1.0 mmol / l and cord venous ph of 7.38 with a base excess of 0.8
mmol / l . umbilical arterial and venous catheters were inserted and intravenous antibiotics were initiated .
the initial chest and abdominal x - ray that was performed to confirm umbilical catheters positions showed a general opacification of the left hemithorax , interspersed with areas of air , and a solitary dilated loop of bowel below the stomach that contained a wide bore nasogastric tube , with no evidence of perforation .
a further abdominal radiograph performed at 14 hours of age revealed dilated central loops of bowel with bubbles of gas suggestive of intramural gas and suspicious for pneumatosis intestinalis ( fig .
the left - sided prenatally inserted chest drain was removed at 15 hours of age and the wound closed and dressed as per surgical advice .
echocardiography was performed at 17 hours of age and it revealed a structurally normal neonatal heart with no evidence of persistent pulmonary hypertension .
chest and abdomen radiograph at 14 hours of age , showing dilated bowel loops with overlying gas bubbles .
the square radio - opacity over the 11th rib represents the steel tip at the end of the in utero inserted shunt . in view of a developing metabolic acidosis with a base excess of
8.9 mmol / l , abnormal bowel gas pattern , and possible intramural gas on the abdominal radiograph , the infant was taken to theater at 21 hours of age for exploratory laparotomy , reduction of bowel from the thoracic cavity , and closure of left congenital diaphragmatic defect . during operation , the entire small bowel was found to be located in the chest , and there was a large radial defect in the left hemidiaphragm .
the findings were not typical of a cdh that is usually characterized by a defect in the foramen of bochdalek ( a transverse postero - lateral defect ) .
there was no hernial sac , and the lung tissue did not look hypoplastic following reduction of the intestinal contents back into the abdominal compartment .
the bowel was matted and coated in prenatal intestinal contents in a manner similar to that seen in meconium peritonitis ( but in the chest ) , the adhesions were sufficient to be causing a high obstruction of the bowel , accounting for the postnatal intestinal obstruction .
the surgical procedure consisted of separation of all adhesions , pulling down of the intestine in the abdominal cavity and closure of the diaphragmatic defect .
postoperatively , sedation and paralysis were gradually discontinued , ventilatory support was weaned as tolerated , and the infant was subsequently extubated on the 4th day of life .
he was discharged home at day 30 and was followed up in clinic . by 6 months of age , he was clinically well with no recurrent respiratory symptoms .
his follow - up chest x - ray exhibited extensive bilateral consolidation with possible cavitation .
prenatal interventions aiming at draining pleural effusions into the amniotic cavity can be undertaken in utero to allow for normal lung growth and development and to prevent caval compression and development of hydrops fetalis.3 fetal thoracoamniotic shunting involves the insertion of a drainage tube though the fetal chest wall into the fetal pleural cavity allowing continued drainage of fluid from the pleural effusion into the amniotic cavity .
effective drainage leads to lung expansion and resolution of hydrops and polyhydramnios.4 recognized intrauterine complications include unilateral arm edema,5 intrathoracic displacement of the shunt , preterm birth and fetal loss.4
neonatal intestinal perforation might happen spontaneously or secondary to preexisting gastrointestinal pathology such as duodenal atresia , pyloric atresia , malrotation , tracheoesophageal fistula or diaphragmatic abnormalities such as diaphragmatic eventration.6 intestinal perforation complicating cdh is a rare condition .
when it occurs , it usually represents late - presenting cases that happen during childhood or early adult life.7 manning et al8 have reported a series consisting of five cases of cdh presenting with gastrointestinal complications , one of whom presented in the neonatal period with intestinal perforation .
a case of a fetus with gastric perforation associated with cdh has also been reported.6 it has been speculated that the mechanical activation of the gastrointestinal tract and swallowing of air that occur after birth might lead to deterioration of blood supply to the herniated bowel by enlargement of the bowel volume , thus damaging the bowel wall by means of ischemia and mechanical pressure.6 findings of meconium peritonitis , characterized by calcifications , fetal ascites , and pseudocyst are generally attributed to prenatal intestinal perforation .
the presence of bilateral pleural effusions at anomaly scan might have been an initial sign of diaphragmatic hernia , which can be visualized by ultrasound before other signs arise .
alternatively , the operative findings raise the suspicion that the prenatal intervention might have resulted in a traumatic diaphragmatic perforation on the left - hand side .
this was then possibly complicated by bowel migrating up through the defect into the left hemithorax resulting in intestinal perforation , and possible meconium peritonitis . on the contrary , gastric or intestinal perforation due
several cases have been reported in the literature.6
9
10
11
clearly , it is impossible to distinguish whether these findings should be attributed to a mechanical complication of diaphragmatic hernia or to an intrauterine intervention , as no published data have been found in the literature linking intrauterine thoracoamniotic shunting to intestinal perforation or diaphragmatic penetration .
the authors think that it is important to highlight the potential differential diagnosis that might result in the context of prenatal thoracoamniotic shunting and cdh . | a fetus was diagnosed by prenatal ultrasound with bilateral intrauterine pleural effusions that were subsequently drained in utero by insertion of bilateral thoracoamniotic shunts .
serial prenatal ultrasound scans were consistent with a left - sided diaphragmatic hernia . on the first day of life
, the infant underwent an exploratory laparotomy for intestinal obstruction , with radiographic findings of pneumatosis intestinalis .
intraoperative findings were suggestive of prenatal bowel and diaphragm perforation , which might have occurred as a complication of thoracoamniotic shunting . |
date is one of the nutritious foodstuffs used significantly worldwide , especially in tropical and middle east areas . in iran
, date cultivation has a long history , and nowadays date is one of the most important agricultural productions of iran .
iran is one of the largest producers of dates with an average production of more than one million tons per year ( about 13% of global production ) . in fresh phase ( rotab ) of shahani date , the meat completely sticks to the skin and has high nectar and is considered to be of best quality . due to high moisture level
there is an increased risk of fermentation and spoilage and at normal temperature ( about 20c 25c ) ; therefore , dates should be stored at low temperatures .
to increase the shelf life , dates should be protected from risk factors such as microorganisms and other environmental factors .
one of the most commonly used chemicals for decreasing date microbial load and storage pests is methyl bromide ( ch3br ) .
although , methyl bromide is an effective pesticide , it is known to be harmful for the ozone layer . according to montreal protocol in 1992 ,
methyl bromide was listed as an ozone depleting substance and was banned in all developing countries until 2015 .
nowadays , researchers follow alternate methods for disinfection and insect control of date and other agricultural products .
the main reason for the ban of methyl bromide is its damaging effect on the environment .
over 50% of methyl bromide eventually enters the atmosphere during or after the process of fumigation .
bromine ( br2 ) released into the atmosphere then reacts with ozone molecules and destroys the protective ozone layer in the stratosphere .
phosphine ( ph3 ) is another chemical compound used for date disinfection and insect control .
according to the studies conducted by international assemblies in america and europe phosphine may be included in the list of toxic chemicals used illegally .
treatment of food products with active oxygen gas ( ozone ) has been considered by food product manufacturers as the alternate disinfection method . in 1886
, dehmitenz discovered the capability of ozone for disinfecting contaminated water . in 1982 , use of ozone for bottled water was approved by food and drug administration of united stated of america ( us fda ) and in 1997 , us fda included it in the generally recognized as safe
also , in june 26 , 2001 us fda approved the use of active oxygen as an antibacterial agent in food industries . in december 21 , 2001 the food safety and inspection service of u.s .
department of agriculture ( usda / fsis ) approved use of ozone for meat and poultry , from raw to fresh cooked and pre - packed products .
use of active oxygen in food industries and drinking water was approved by food and drug deputy of ministry of health and education of islamic republic of iran in november 29 , 2003 .
american national institute of health ( nih ) restricted exposure to ozone and determined 0.1 ppm and 0.3 ppm ozone concentration per day for long - term and short - term exposure , respectively .
definition of long - term and short - term is inhalation of ozone at work for 8 hours and 5 days per week and inhalation of ozone for 15 minutes , respectively .
ozone treatment can destroy spores , yeasts , and other pathogens on fruits and vegetables and their products .
washing strawberry with ozonized water for 2 minutes decreases aerobic mesophile bacteria , mold and yeast up to 92.3% and 91% , respectively .
strawberry ozonization for 2 days at 2c , decreases mold and yeast growth level up to 15% .
however , after transition of ozonized samples to 20c , microbial load of molds and yeasts increased . it was observed that in peaches and grapes that were ozonized at 0.3 ppm concentration at 5c for 28 days , mold and yeast microbial load was less than the load in the non - ozonized samples , and ozone had no adverse effects on the fruits .
however , after 14 days , mold and yeast level were equal in both samples . in another study , ozonization at 5 ppm for 3 hours decreased fig mesophile bacteria , mold and yeast up to 72% .
moreover , emer et al . , showed that ozonization of pepper for 120 , 240 , and 360 minutes decreased escherichia coli colonies and bacterial activity without any change in the organoleptic properties of the pepper and without any significant difference in its bitterness percentage , taste , flavor , color and palatability . in their study , liew and prange found that ozonization of carrot at 60 ppm within 28 hours reduced sclerotinia sclerotorum load by 50% .
storage of carrot at 15 ppm ozone concentration could reduce microbial load without any adverse effect on physical specifications .
on the basis of the results obtained in different studies , it can be summarized that controlled use of ozone could decrease food microbial load and help increase the shelf life of food products .
the present study was performed to investigate the possibility of replacing common conventional disinfectants with ozone for date disinfection and microbial load reduction .
shahani dates were used for the experimental study . ozone generator machine ( mog-10 gh model ) was from arda green technology company . the oxygen delivery machine was from bnp ozone technology co. , ltd .
produced oxygen gas pressure was 1 - 1.2 kg / cm and its rate was 0.5 - 1 liter / minute .
this machine was set up to produce ozone with 5 g / h and 10 g / h concentrations when oxygen entrance rate was 1 and 2 liters per minute , respectively .
the ozone concentrations of 5 g / h and 10 g / h were equal to 2335 and 4670 ppm , respectively .
first , as a pilot study , 72 samples were divided into three groups ( i.e. , 0.2 g , 5 g , and 10 g ) and 3 samples of each group were ozonized for eight intervals ( i.e. , 1 , 2 , 3 , 4 , 5 , 6 , 22 , and 28 hours ) to attain best concentration and time period of ozonization based on maximum microbial load reduction .
then , on the basis of results and experiments conducted by other researchers , considering the time period effect on microorganisms , and observing the microbial , mold and yeast load results of examined dates in previous studies , two time periods ( 3 and 5 hours ) and two concentrations ( 5 and 10 g / h ) were chosen for the main study .
samples were ozonized for 3 and 5 hours with 5 g / h and 10 g / h concentrations and were packed under vacuum in two - layer polyethylene and polypropylene bags that were sterilized by microwave irradiation .
then , samples were transferred to the laboratory of health faculty of baqiyatallah university of medical sciences .
g / h for 3 and 5 hours ) and the non - ozonized samples were then placed in an incubator maintained at 25c and 40c for 9 months . microbial load ( total count ) ,
mold and yeast of ozonized and non - ozonized samples taken as control group were examined and compared at baseline and every 3 months based on national standard of iran no .
post hoc tests were used to compare the two groups at baseline and follow - up examination .
the present study showed that bacterial count in samples ozonized with 10 g / h concentration within 3 hours was less than the bacterial count in samples ozonized with 5 g / h concentration within 3 and 5 hours ( p < 0.05 ) .
ozonization with 10 g / h concentration within 3 hours reduced bacterial count up to 98.5% .
there was no significant difference between bacterial total count in samples ozonized with 10 g / h concentration within 3 hours and bacterial total count in samples ozonized with 10 g / h concentration within 5 hours [ figure 1 ] .
effect of ozone concentration and duration of ozonization on bacterial count of samples at baseline examination ozonization at baseline with 10 g / h concentration for 3 hours was more effective than ozonization with 5 g / h concentration and reduced mold and yeast count up to 52% .
there was no significant difference between mold and yeast count of samples ozonized with 10 g / h concentration for 3 hours and samples ozonized with 10 g / h concentration for 5 hours [ figure 2 ] .
also , there was no significant difference between mold and yeast count of samples ozonized with 5 g / h concentration for 3 hours and samples ozonized with 5 g / h concentration for 5 hours .
effect of ozone concentration and duration of ozonization on mold and yeast count of samples at baseline examination bacterial count in samples ozonized with 10 g / h concentration within 3 hours after 3 month reduced by about 50% ( p < 0.05 ) compared with baseline examination .
entirely , ozonization at baseline reduced bacterial count by 98.5% ( p < 0.05 ) and this reduction continued until final examination ( after 9 months ) and finally ozonized samples had less microbial load than non - ozonized samples [ figure 3 ] .
bacterial count variations of samples maintained at 25c for 9 months in ozonized samples with 10 g / h concentration , mold and yeast count after 3-month maintenance at 25c reduced ( p < 0.05 ) although mold and yeast count after 6 months increased , but nonsignificantly . mold and yeast count of ozonized samples after 3 , 6 and 9 months of maintenance at 25c
reduced by 75% , 74% , and 87% , respectively ( p < 0.05 ) . in non - ozonized samples , mold and yeast count after 3 , 6 and 9 months of maintenance at 25c
reduced significantly ( p < 0.05 ) . however , at each phase , mold and yeast count was higher than ozonized samples ( p < 0.05 ) [ figure 4 ] .
mold and yeast count variations of samples maintained at 25c for 9 months bacterial count after 3-month maintenance at 40c reduced by 93% compared with baseline examination . however , bacterial count after 6-month maintenance at 40c increased nonsignificantly compared with previous examination . due to sever moisture level reduction and high temperature and damage of the samples after 6 months , examination after 9 month at 40c was not performed .
however , mold and yeast count after 6-month maintenance at 40c increased nonsignificantly compared with previous examination because of high temperature of incubation [ figure 5 ] .
the present study showed that ozonization reduced microbial load of date samples in various phases of examination .
it means that after ozonization , mold and yeast count of samples reduced by 52.5% .
after 3 and 9 months of maintenance at 25c , mold and yeast count of samples reduced by 88% and about 94% ( 1 10 cfu / g ) compared with the mold and yeast count of non - ozonized samples ( 1.6 10 cfu / g ) at baseline examination .
this decrease during maintenance may be due to anaerobic condition of date package , because mold can proliferate only in aerobic mode .
these findings are consistent with results of the study on dates by habibi najafi and haddad khodaparast and results of the study by palou et al .
, in which they observed the ozonization effect on blue and green molds of fruits stored in cold storage .
it was found that ozonization reduced not only the mold and yeast count of ozonized samples but also the bacterial count of the ozonized samples by 98.5% compared with the non - ozonized samples .
in addition to study of ozonization effect on reduction of microbial load , it is necessary to determine ozone concentration and duration of ozonization for maximum saving of time and consumption of ozone in industrial processes .
this study showed that ozonization with 5 g / h for 5 hours and 10 g / h for 3 hours was more effective in reducing microbial load compared with other concentrations ( p < 0.05 ) .
however , there was no significant difference between ozonization with 10 g / h and 5 g / h in reducing mold and yeast count , whereas there was significant difference between bacterial counts of samples ozonized with 10
there was no significant difference between ozonization with 10 g / h for 5 hours and 10 g / h for 3 hours in reducing microbial load .
however , reduction of mold , yeast , and bacterial count in samples ozonized with 10
thus , based on these results , the best and most appropriate ozone concentration and duration for date ozonization was found to be 10 g / h for 3 hours and ozonization more than 3 hours is not necessary and increased process costs .
these results are consistent with results of the study by zorlugen et al . they found that ozonization reduced fig mesophile bacteria ( i.e. , escherichia coli and bacillus cereus ) and mold and yeast count by 72% .
our findings are consistent with results of the study on black pepper by emer et al .
, in which they recorded the antibacterial effect of ozonization ( for 120 minutes , 240 minutes and 360 minutes ) .
microbial load of samples maintained at 40c for 3 months decreased significantly ( p < 0.05 ) .
however , after 6-month maintenance , despite the moisture level reduction , microbial load increased slightly , and finally samples dried and deteriorated and had to be excluded from the study .
all types of dates should be kept in cold storage to save them from decomposing and spoilage . in this study ,
temperature higher than cold storage temperature is used to calculate the shelf life of dates at refrigerator temperature ( c-5c ) .
our experience showed that temperature higher than 25c should not be used for shelf life determination because of the physicochemical characteristics of dates .
the limitation of this study , as we mentioned above , was maintenance of dates at 40c , which destroyed the date samples and the effect of ozonization could not be studied for longer period .
the results of the present study showed that date ozonization decreased the microbial load in the samples .
however , increasing duration of ozonization ( more than 3 hours ) had no incremental effect on microbial load reduction .
according to results of microbial examination of samples maintained at 25c for 9 months and q10 of chemical and biochemical reaction of food stuffs , ozonization of dates is an appropriate method for microbial load reduction and leads to increased shelf life of dates . | background : date is one of the foodstuffs that are produced in tropical areas and used worldwide .
conventionally , methyl bromide and phosphine are used for date disinfection .
the toxic side effects of these usual disinfectants have led food scientists to consider safer agents such as ozone for disinfection , because food safety is a top priority .
the present study was performed to investigate the possibility of replacing common conventional disinfectants with ozone for date disinfection and microbial load reduction.materials and methods : in this experimental study , date samples were ozonized for 3 and 5 hours with 5 and 10 g / h concentrations and packed .
ozonized samples were divided into two groups and kept in an incubator which was maintained at 25c and 40c for 9 months . during this period ,
every 3 month , microbial load ( bacteria , mold , and yeast ) were examined in ozonized and non - ozonized samples.results:this study showed that ozonization with 5 g / h for 3 hours , 5 g / h for 5 hours , 10 g / h for 3 hours , and 10 g / h for 5 hours leads to about 25% , 25% , 53% , and 46% reduction in date mold and yeast load and about 6% , 9% , 76% , and 74.7% reduction in date bacterial load at baseline phase , respectively .
appropriate concentration and duration of ozonization for microbial load reduction were 10 g / h and 3 hours.conclusion:date ozonization is an appropriate method for microbial load reduction and leads to an increase in the shelf life of dates . |
birdshot chorioretinopathy ( bscr ) is an uncommon cause of chronic posterior uveitis , most frequently affecting caucasian women in the fifth and sixth decades of life [ 1 , 2 ] .
the most common clinical signs are vitritis and multiple bilateral , hypopigmented inflammatory lesions in the post - equatorial fundus [ 35 ] .
the aetiology of bscr remains unclear , although a relationship exists with the human leukocyte antigen ( hla ) -a29 ; therefore , an autoimmune mechanism has been proposed [ 57 ] . due to the variety of clinical manifestations observed in bscr ,
the diagnosis may be elusive , especially early in the course of the disease , prior to the evolution of the characteristic hypopigmented spots in the fundus [ 8 , 9 ] . additionally , the diffuse pigmentary loss noted through time in the typical choroidoretinal lesions of bscr is not a reliable marker of disease activity .
furthermore , some studies suggest that the retinal vascular leakage observed by fluorescein angiography ( fa ) may not be sufficient to decide on treatment . different techniques and ancillary testing are crucial in patients with bscr , not only for diagnostic purposes but to guide adequate follow up and treatment monitoring as well .
an extensive clinical history and ophthalmic examination accompanied by fundus photography along with fa and electroretinography , remain invaluable to the management of these patients .
fundus autofluorescence photography ( faf ) is a relatively new retinal assessment technique which capitalizes on the presence of lipofuscin , an important substance found in the retinal pigment epithelial ( rpe ) cells , allowing us to obtain unique information about the structure and function of the rpe .
faf may better assess the presence of the typical inflammatory lesion observed in fundus of patients with bscr , and facilitate its visualization in patients with blond fundus .
this retrospective case series study was approved by the institutional review board of the massachusetts eye and ear infirmary , and adheres to the tenets of the declaration of helsinki .
all patients with bscr seen at the massachusetts eye research and surgery institution ( mersi ) , from july 2008 to october 2008 , who underwent faf imaging , were included in the analysis .
those patients in whom macular oedema was clinically suspected , the central macular thickness ( cmt ) was recorded by time domain optical coherence tomography ( oct - stratus iii , carl zeiss , meditec , dublin , ca ) .
data were obtained through review of the electronic medical records of each patient ( nextgen , horsham , pa ) and entered into excel ( microsoft corporation , redmond , washington ) data entry worksheets .
general data included age , gender , presence of the hla - a29 haplotype , and current therapeutic regimen . to evaluate the clinical status of the disease ,
a complete ophthalmic examination was performed with the use of slit lamp biomicroscopy , noncontact fundus lens , and indirect ophthalmoscopy .
the ocular inflammatory status was judged according to the standardization of uveitis nomenclature ( sun ) working group criteria , as well as findings on the fa .
active inflammation was defined as 1 + anterior chamber cell / flare and/or 1 + vitreous haze .
fa signs considered indications of active disease included hyperfluorescence of the optic disc , leakage of dye from capillaries and venules during the late phase , and delayed arterial filling time .
faf was performed using a fundus camera ( topcon medical systems , paramus , nj
spectrotech ) with an excitation filter peak at 560 nm ( bandwidth , 535585 nm ) and a barrier filter centered at 655 nm ( bandwidth , 605705 nm ) .
eighteen eyes of 9 patients met the inclusion criteria and were included in the analysis .
the most common treatment regimen employed was mycophenolate mofetil , and cyclosporine alone or combined in five ( 56% ) patients .
daclizumab was employed in two patients ; adalimumab and intravenous immunoglobulin were employed in one patient each .
four ( 22% ) eyes presented with active inflammation characterized by optic nerve leaking and/or retinal vasculitis assessed by fa .
three ( 17% ) eyes presented with macular oedema confirmed both by fa and oct .
full correspondence of the lesions noted in the colour fundus photograph was observed in 3 ( 17% ) eyes of 2 patients ; however , they were more easily identified with the faf . in 15 eyes ( 83% ) ,
fundus lesions were more numerous and more easily identified in the faf than in the colour fundus photograph .
these fundi had the typical bscr lesions , peripapillary chorioretinal atrophy characterized as a circumferential hypoautofluorescence around the optic nerve , and in 3 ( 17% ) eyes a linear hypoautofluorescence pattern along the retinal vessels was noted ( figures 1 and 2 ) .
despite recent advances in diagnostic imaging , the diagnosis of bscr remains a challenge .
oct is extremely valuable in the quantification and monitoring of macular oedema , the most common complication resulting in vision loss in bscr [ 5 , 6 , 10 , 11 , 13 ] . despite the limitations of fa
these techniques are augmented by full field electroretinogram ( erg ) in which an important correlation between the progression of the disease has been found with the flicker implicit time and bright scotopic b - wave amplitude [ 1416 ] .
indocyanine green angiography and visual field testing ( especially with sita - swap protocol ) are valuable tools in the care and longitudinal monitoring of these patients with bscr [ 17 , 18 ] .
more recently , faf , a relatively new technique , has been employed to evaluate the characteristics of the chorioretinal lesions in bscr .
this new technology was first used in the care of patients with dry age related macular degeneration , and more recently in patients with different types of posterior uveitis including multifocal choroiditis and bscr [ 20 , 21 ] .
the typical bscr fundi lesions did not necessarily correspond to the areas of rpe atrophy shown with the faf . in 3 eyes , full correspondence of the bscr lesions was observed .
the remaining eyes ( 15 eyes ) showed more areas of rpe atrophy in the faf than in the colour photograph .
lesions were significantly easier to identify in the faf than in the colour photograph , especially in those eyes with light fundus pigmentation in which the visualization of bscr lesions can be challenging .
figure 3 shows the right eye of a 69-year - old female with a well - confirmed bscr diagnosis of almost 2 years , with hla - a29 haplotype . at the moment of the faf , she presented with a visual acuity of 20/25 and was in treatment with intravenous immunoglobulin .
note in the colour photograph ( figure 3(a ) ) the hypopigmented lesions nasal to the optic nerve and around the arcades ; however due to the poor fundus pigmentation , these lesions are difficult to visualize .
note the striking difference with the faf in which areas of rpe atrophy are significantly more numerous and clear than in the colour photograph . a perivascular linear faf pattern shown in figures 2 and 3
this finding was previously described by koizumi et al . and led his group to postulate a possible role of inflammation induced damage of the rpe .
some authors support the idea that birdshot is a chorioretinopathy , while others believe that it is a retinochoroidopathy .
this lack of correspondence between the colour fundus photograph and the faf , as suggested by other authors , may indeed be explained by two separate mechanisms of damage of the choroid and the rpe , which may vary in each patient .
faf testing provides valuable insight into the metabolic state of the pr / rpe complex ; we find it useful as a noninvasive diagnostic tool in patients with posterior uveitis , when the outer retina - rpe choriocapillaries complex is involved .
limitations for this study include the small sample size and the inherent bias of its retrospective nature . | objective . to describe the diverse patterns observed with the use of autofluorescence fundus photography ( faf ) in patients with birdshot chorioretinopathy ( bscr )
. methods . a chart review of patients with bscr seen at the massachusetts eye research and surgery institution , who had autofluorescence fundus photography .
the data obtained included age , gender , presence of the hla - a29 haplotype , and current treatment . results . eighteen eyes with hla - a29 associated bscr were included .
four eyes presented with active inflammation .
correspondence of the lesions noted in the colour fundus photograph was observed in 3 eyes which were more easily identified with the faf .
fifteen eyes had fundus lesions more numerous and evident in the faf than in the colour fundus photograph .
conclusion .
because faf testing provides valuable insight into the metabolic state of the pr / rpe - complex , it may serve as a useful noninvasive assessment tool in patients with posterior uveitis in which the outer retina - rpe - choriocapillaries - complex is involved . |
sayur asin , spontaneously fermented mustard ( brassica juncea ( l. ) czem ) , is commonly consumed in many areas in indonesia in particular in east java province ( 1 ) .
fermentation of sayur asin is performed over 37 days at ambient temperature ( 2830 c ) in the presence of brine and coconut water and an anaerobic treatment of the mustard ( 2 ) .
salt addition to the mustard results to the growth of epiphytic lactic acid bacteria ( lab ) and fermentation until developing acidic and unique charateristics within the mustard ( 3 ) .
the quality and food safety is related to the development of microbes during fermentation procedure .
puspito and graham reported slight variations in manufacturing of mustard fermentation in some regions in indonesia ( 1 ) .
it was probably due to the diverse topographies , tropical climate and other physical condition of indonesia .
therefore , local fermented mustard from different regions in indonesia become an interesting source for exploration of indigenous lab diversity .
in other regions , many new species have been reported from fermented foods including fermented mustard .
for example , four new species of lab were reported in taiwan from fermented mustard ( 4 ) and different new species of lactobacillus from kimchi was also found in korea ( 5 ) and tiongkok ( 6 ) .
the genetic variability and high diversity of lab from fermented foods were possibly caused by divergence in manufacturing processes , varying conditions of concentration of salts , anaerobiosis , moisture levels and temperature .
these factors can determine and select the composition and community structure of lab in the fermentation final product .
information regarding microbiology and diversity of lab species in fermented mustard from different regions in indonesia is still limited and is mainly obtained from a study applied conventional methods in identification of lab ( 1 ) .
current lab taxonomy and identification studies involve combination of phenotypic ( physiological and biochemical ) and genotypic ( dna sequence ) analyses .
molecular identification method is more accurate , sensitive , rapid , reproducible , and reliable which is not influenced by environmental factors ( 7 ) .
this method supports the phenotypic methods suffer from lack of reproducility due to its specific conditions such as its association to the culture and the diversity of strains ( 8) . in bacteria , nucleotide sequences related to the 16s rdna have been useful and informative to provide information about the genus and species .
the lenght of this region is relatively large enough ( approximately 1540 bp ) for genetic based identification and characterization purposes ( 9 , 10 ) .
the aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in sayur asin of indonesia .
four samples ( contain fermenting liquor and fermented mustard ) were collected from traditional manufactures located at tulung agung ( ta ) and kediri ( kdr ) in east java province , indonesia ( table 1 ) .
sayur asin from two manufactures was prepared by spontaneous fermentation of brassica juncea ( l. ) czern at room temperature ( 2830 c ) for 37 days .
samples were collected twice at different periods of the harvesting time . for the analyses of sayur asin ,
samples were taken aseptically and packaged into a plastic bag and stored at 4 c in ice boxes .
profile of sayur asin collected from tulung agung and kediri ( east java ) in this study salinity of fermenting liquor was determined as described previously ( 11 ) .
one gram fermented crushed mustard or 1 ml fermenting liquor was mixed with 9 ml 0.85% ( w / v ) nacl solution .
the serial dilutions were spread directly on the surface of mrs agar plates supplemented with 1% caco3 , 1% nacl and 6% nacl ( for halophilic lactic acid bacteria ) .
samples were incubated under anaerobic conditions in anaerobic jar at 28 c for 4 days ( 2 , 12 ) .
colonies of acid - producing bacteria with distinct morphologies in terms of color , shape and size were further purified by streaking at least twice on mrs agar plates containing 1% nacl ( 4 ) . only gram - positive , catalase - negative strains were selected ( 13 ) .
the selected strains were stored at 80c in mrs broth containing 10% glycerol ( 145 ) .
genomic dna from each lab strain was isolated according to the method described before ( 15 ) .
amplification of 16s rdna was carried out using primer pair of 27f ( 5-agagtttgatcctggctcag-3 ) and 1492r ( 5-ggttaccttgttacgactt-3 ) ( 16 ) .
each reaction mixture contained 25 l go taq green master mix ( 2x ) ( promega ) , 4 l each primer ( 10 m ) and 1 l dna template ( 10100 ng ) .
the amplification program was set as follows : 94 c ( 90 sec ) , 30 cycles of 95 c ( 30 sec ) , 50 c ( 30 sec ) , 72 c for ( 90 sec ) and a final extension at 72c for 5 min .
pcr products were electrophorized on 1% aga - rose gels at 100 v for 20 min and stained by ethidium bromide and visualized using uv transilluminator .
full - length sequencing of 16s rdna was performed with the following universal primers : 27f , 518f , 800r , and 1492r .
homology of the sequences was examined by comparing the obtained 16s rdna sequences with those available in the nucleotide databases of the genbank ( http://www.ncbi.nlm.nih.gov/blast
) using the basic local alignment search tool ( blast ) program .
sequence from type material was selected in the blast option to find the homolog sequences only from the type strains materials .
about new sequences of lab strains from sayur asin were aligned with eight sequences of the lab seqeunces from type strains using multiple sequence comparison by log - expectation ( muscle ) implemented in mega ( molecular evolutionary genetics analysis ) version 5.2 ( 17 ) .
phylogenetic analysis was performed using the neighbor - joining method ( 18 ) in mega .
the stability of the tree was assessed by bootstrap method ( 20 ) using 100 replications .
phylogenetic tree generated from nj analysis of 16s rdna sequences from representative lab isolates from sayur asin collected in tulung agung and kediri ( east java ) .
bootstrap values 50% have been shown below the branch length and the scale bar represents 0.05 sequence divergence .
four samples ( contain fermenting liquor and fermented mustard ) were collected from traditional manufactures located at tulung agung ( ta ) and kediri ( kdr ) in east java province , indonesia ( table 1 ) .
sayur asin from two manufactures was prepared by spontaneous fermentation of brassica juncea ( l. ) czern at room temperature ( 2830 c ) for 37 days .
samples were collected twice at different periods of the harvesting time . for the analyses of sayur asin ,
samples were taken aseptically and packaged into a plastic bag and stored at 4 c in ice boxes .
profile of sayur asin collected from tulung agung and kediri ( east java ) in this study
one gram fermented crushed mustard or 1 ml fermenting liquor was mixed with 9 ml 0.85% ( w / v ) nacl solution . each sample was serially diluted ( 10 to 10 ) .
the serial dilutions were spread directly on the surface of mrs agar plates supplemented with 1% caco3 , 1% nacl and 6% nacl ( for halophilic lactic acid bacteria ) .
samples were incubated under anaerobic conditions in anaerobic jar at 28 c for 4 days ( 2 , 12 ) .
colonies of acid - producing bacteria with distinct morphologies in terms of color , shape and size were further purified by streaking at least twice on mrs agar plates containing 1% nacl ( 4 ) . only gram - positive , catalase - negative strains were selected ( 13 ) .
the selected strains were stored at 80c in mrs broth containing 10% glycerol ( 145 ) .
genomic dna from each lab strain was isolated according to the method described before ( 15 ) .
amplification of 16s rdna was carried out using primer pair of 27f ( 5-agagtttgatcctggctcag-3 ) and 1492r ( 5-ggttaccttgttacgactt-3 ) ( 16 ) .
each reaction mixture contained 25 l go taq green master mix ( 2x ) ( promega ) , 4 l each primer ( 10 m ) and 1 l dna template ( 10100 ng ) .
the amplification program was set as follows : 94 c ( 90 sec ) , 30 cycles of 95 c ( 30 sec ) , 50 c ( 30 sec ) , 72 c for ( 90 sec ) and a final extension at 72c for 5 min .
pcr products were electrophorized on 1% aga - rose gels at 100 v for 20 min and stained by ethidium bromide and visualized using uv transilluminator .
full - length sequencing of 16s rdna was performed with the following universal primers : 27f , 518f , 800r , and 1492r .
homology of the sequences was examined by comparing the obtained 16s rdna sequences with those available in the nucleotide databases of the genbank ( http://www.ncbi.nlm.nih.gov/blast
) using the basic local alignment search tool ( blast ) program .
sequence from type material was selected in the blast option to find the homolog sequences only from the type strains materials .
about new sequences of lab strains from sayur asin were aligned with eight sequences of the lab seqeunces from type strains using multiple sequence comparison by log - expectation ( muscle ) implemented in mega ( molecular evolutionary genetics analysis ) version 5.2 ( 17 ) .
phylogenetic analysis was performed using the neighbor - joining method ( 18 ) in mega .
the stability of the tree was assessed by bootstrap method ( 20 ) using 100 replications .
phylogenetic tree generated from nj analysis of 16s rdna sequences from representative lab isolates from sayur asin collected in tulung agung and kediri ( east java ) .
bootstrap values 50% have been shown below the branch length and the scale bar represents 0.05 sequence divergence .
our study demonstrated different profiles of sayur asin produced by two traditional manufacturers , tulung agung and kediri .
salinity of fermenting liquor from four samples ranged from 3.60 to 5.67% ( w / v ) .
lab colony counts based on the total plate count ( tpc ) method in four samples of sayur asin was also variable from 20 10 to 26 10 cfu / ml .
the highest lab population was found on the sayur sain sample from tulung agung ( ta2 ) ( 26 10 cfu / ml ) while the lowest colony count was found in the sayur asin from kediri ( kdr1 ) . all sayur asin samples from tulung agung ( ta1 and ta2 ) had lower salinity and higher ph than those from kediri ( kdr1 and kdr2 ) .
a total of 172 lab strains were succesfully isolated from sayur asin origin east java .
based on the 99% cut off homology similarity , 32 isolates were determined as l. farciminis , four isolates as l. fermentum 15 isolates as l. namurensis , 118 isolates as l. plantarum and a single isolate as l. parafarraginis .
strain d5-s-2013 showed 98% similarity to l. paralimentarius while lactobacillus sp . strain b4-s-2013 showed 97% dna sequence similarity to l.composti . according to the results of a published study ( 20 ) ,
if the rate of similarity between 16s rdna sequences of two organisms is lower than 98.799.0% they will belong to separate species .
due to the observed similarity rates lower than 99% , the isolates in the present study could be classified into novel species .
lactic acid bacteria ( lab ) composition and assemblage in four samples of sayur asin have been presented in tabel 2 .
lactobacillus plantarum and l. farciminis were found as common lab used in sayur asin origin from east java .
strain d5-s-2013 and b4-s-21 ) were found in sayur asin from tulung agung and kediri , respectively .
culturable l. plantarum was found to predominate sayur asin ta ( 82.292.3% ) , whereas spread evenly lab species was recognized in sayur asin kdr .
l. namurensis were found in both samples ta and kdr but not always appeared at the time of harvesting time of sayur asin .
distribution of lab assemblage in four samples of sayur asin from a total 172 isolated lab strains from sayur asin , 27 representative 16s rdna sequences were selected for phylogentic studies .
the remaining 145 lab sequences were excluded from the analyses due to their high similarity with 27 representative lab sequences ( data not shown ) .
full - length 16s rdna sequence analysis was performed for lactobacillus sp . strains b4-s-2013 and d5-s-2013 .
the generated phylogenetic tree showed that isolated lab strains could be divided into 7 independent clades , viz , l. plantarum ( orla - jensen ) bergeys et al .
( 99% bs ) , l. parafarraginis endo and okada ( 100% bs ) , l. namurensis scheirlinck et al .
( 100% bs ) , l. fermentum beijerinck ( 99% bs ) , l. farciminis reuter ( 95% bs ) , l. composti ( 100% bs ) , and l. paralimentarius ( 90% bs ) .
sequences categorized within l. plantarum , l. parafarraginis , l. namurensis , l. fermentum and l. farciminis clades showed almost identical sequences in each clade which is represented by the length of each branch ( no difference was observed in the branch length within these clades ) . however in the l. composti and l. paralimentarius
our study demonstrated different profiles of sayur asin produced by two traditional manufacturers , tulung agung and kediri .
salinity of fermenting liquor from four samples ranged from 3.60 to 5.67% ( w / v ) .
lab colony counts based on the total plate count ( tpc ) method in four samples of sayur asin was also variable from 20 10 to 26 10 cfu / ml .
the highest lab population was found on the sayur sain sample from tulung agung ( ta2 ) ( 26 10 cfu / ml ) while the lowest colony count was found in the sayur asin from kediri ( kdr1 ) . all sayur asin samples from tulung agung ( ta1 and ta2 ) had lower salinity and higher ph than those from kediri ( kdr1 and kdr2 ) .
a total of 172 lab strains were succesfully isolated from sayur asin origin east java .
based on the 99% cut off homology similarity , 32 isolates were determined as l. farciminis , four isolates as l. fermentum 15 isolates as l. namurensis , 118 isolates as l. plantarum and a single isolate as l. parafarraginis .
strain d5-s-2013 showed 98% similarity to l. paralimentarius while lactobacillus sp . strain b4-s-2013 showed 97% dna sequence similarity to l.composti . according to the results of a published study ( 20 ) ,
if the rate of similarity between 16s rdna sequences of two organisms is lower than 98.799.0% they will belong to separate species . due to the observed similarity rates lower than 99% ,
lactic acid bacteria ( lab ) composition and assemblage in four samples of sayur asin have been presented in tabel 2 .
lactobacillus plantarum and l. farciminis were found as common lab used in sayur asin origin from east java .
strain d5-s-2013 and b4-s-21 ) were found in sayur asin from tulung agung and kediri , respectively .
culturable l. plantarum was found to predominate sayur asin ta ( 82.292.3% ) , whereas spread evenly lab species was recognized in sayur asin kdr .
l. namurensis were found in both samples ta and kdr but not always appeared at the time of harvesting time of sayur asin .
from a total 172 isolated lab strains from sayur asin , 27 representative 16s rdna sequences were selected for phylogentic studies .
the remaining 145 lab sequences were excluded from the analyses due to their high similarity with 27 representative lab sequences ( data not shown ) .
full - length 16s rdna sequence analysis was performed for lactobacillus sp . strains b4-s-2013 and d5-s-2013 .
the generated phylogenetic tree showed that isolated lab strains could be divided into 7 independent clades , viz , l. plantarum ( orla - jensen ) bergeys et al .
( 99% bs ) , l. parafarraginis endo and okada ( 100% bs ) , l. namurensis scheirlinck et al .
( 100% bs ) , l. fermentum beijerinck ( 99% bs ) , l. farciminis reuter ( 95% bs ) , l. composti ( 100% bs ) , and l. paralimentarius ( 90% bs ) .
sequences categorized within l. plantarum , l. parafarraginis , l. namurensis , l. fermentum and l. farciminis clades showed almost identical sequences in each clade which is represented by the length of each branch ( no difference was observed in the branch length within these clades ) . however in the l. composti and l. paralimentarius clades a significant branch length was observed between lactobacillus sp .
the microbiology of mustard fermentation is similar to the other fermented vegetables because the microorganisms responsible for this fermentation process are mainly belonging to lab ( 1 , 21 ) .
activity of lab during fermentation can cause a decrease in ph value of the fermented vegetables .
the final ph resulted from the fermentation process is possibly related to the incubation time .
our data showed that average ph of sayur asin from tulung agung and kediri were different .
sayur asin samples from kediri possessed in more acidic conditions than those from tulung agung ( table 1 ) .
although the incubation time of sayur asin fermentation process in tulung agung and kediri was 3 days but sayur asin in kediri was maintained by backslopping and the acidic conditions from the previous batch probably will affect the ph .
any changes in ph of sayur asin by the labs can also be considered as one of the main indicators for a good fermentation .
a previous study has reported that the variety of lab population in the fermented mustard was influenced by different fermentation processes and treatments especially the salt concentration ( 4 ) . in this study
it seems that low salt concentration can be supportive for the growth of lab strains in sayur asin than higher salt concentration . during the fermentation process ,
lab are initially present in low numbers , however , they immediately proliferate because the growth of other microorganisms are inhibited by the initial addition of salt
. rapid growth of lab strains decreases the ph of the medium which result to the slow growth of other microorganisms ( 21 ) .
the growth of lactic acid bacteria is also influenced by the nutrient movement from plant material into the surrounding liquid ( 3 ) . among lab species found in this study
, l. plantarum was found predominant which is probably due to its acid tolerance and in particular because of its ability in transportation and metabolism of different carbohydrates ( 22 ) .
phylogenetic analyses of a total 172 16s rdna sequences showed that these lab strains belong to a single genus , lactobacillus , and five species ( l. farciminis , l. fermentum , l. namurensis , l. plantarum and l. parafarraginis ) .
these five species have been found in different fermented foods ( 23 ) , reported as non pathogenic bacteria for humans or animals ( 24 ) .
identification of five lactobacillus species from sayur asin is not unpredictable since members of lactobacillus have commonly been found and used in various fermentation processes in developing various foods and drinks .
genus lactobacillus has been known as the largest group of lactic acid bacteria with over than 145 recognized species ( 25 ) .
members of this genus are also very heterogenous , encompasing species with a large variety of phenotypic , biochemical and physiological properties .
many species have been found in many spontaneous lactic fermentation procedures such as vegetable and silage fermentations ( 26 ) .
the phylogenetic affinity of lab from sayur asin showed a close relationship among particular lab species ( fig .
this clade formed a monophyletic clade with l. plantarum and l. composti clades ( 74% bs ) .
this data indicates that l. parafarraginis , l. namurensis , l. plantarum and l. composti were originated from recent common ancestor species .
lactobacillus parafarraginis and l. composti were firstly described from compost of sochu ( 27 , 28 ) while l. namurensis from sourdoug ( 29 ) and l. plantarum from fermented vegetables ( 30 ) .
in addition members of l. farciminis formed a sister clade to l. paralimentarius with 75% bs while l. fermentum formed independent clade closed to the large clade containing l. parafarraginis , l. namurensis , l. plantarum and l. composti clades .
lactobacillus farciminis was originated from sausage while l. paralimentarius was isolated from sourdough ( 31 ) .
the phylogenetic analysis of lactobacillus 16s rdna sequences showed that there is no relationship between these species based on the source of isolation .
species from the same source such as l. parafarraginis and l. composti from sochu compost and l. namurensis and l. paralimentarius from sourdough nested in distantly related clades ( fig .
has revised the previous report ( 1 ) in which l. confusus sharpe et al . , l. curvatus abo - elnaga and kandler , and l. plantarum as members of lab from sayur asin in indonesia .
( 1 ) , have been determined in the current study which included l. farciminis , l. fermentum , l. namurensis and l. parafarraginis .
it showed that sayur asin is potential resource for the exploration of unique and distinct species of lab in indonesia .
diversity of labs from central java reported by others ( 2 ) is higher than those from east java , eleven species of lab viz , l. farciminis , l. fermentum , l. namurensis , l. plantarum , l. helveticus , l. brevis , l. versmoldensis , l. casei , l. rhamnosus , l. fabifermentans and l. satsumensis .
five distinct species of lactobacillus were determined from sayur asin collected from tulung agung and kediri ( east java provinces , indonesia ) based on phylogenetic analysis of 16s rdna sequences .
these species include l. farciminis , l. fermentum , l. namurensis , l. plantarum and l. parafarraginis .
two lactobacillus isolates ( strains d5-s-2013 and b4-s-2013 ) showed slightly lower similarity rates of lower than 99% and had clade with significant branch length in phylogenetic tree which was observed with their closely related species , viz , l. paralimentarius and l. composti , respectively suggesting that they may be classified into novel species . | background and objectives : lactic acid bacteria ( lab ) play important roles in processing of sayur asin ( spontaneously fermented mustard ) .
unfortunately , information about lab in indonesian sayur asin , prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety , is unclear .
the aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in sayur asin of indonesia.materials and methods : four sayur asin samples ( fermentation liquor and fermented mustard ) were collected at harvesting times ( 37 days after fermentation ) from two traditional manufactures in tulung agung ( ta ) and kediri ( kdr ) , east java provinces , indonesia .
lab strains were isolated by using mrs agar method supplemented with 1% caco
3
and characterized morphologically .
identification of the strains was performed basedon 16s rdna analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains.results:different profiles were detected in total count of the plates , salinity and ph of fermenting liquor of sayur asin in ta and kdr provinces .
a total of 172 lab isolates were successfully isolated and identified based on their 16s rdna sequences .
phylogenetic analysis of 27 representative lab strains from sayur asin showed that these strains belonged to 5 distinct species namely lactobacilus farciminis ( n=32 ) , l. fermentum ( n=4 ) , l. namurensis ( n=15 ) , l. plantarum ( n=118 ) and l. parafarraginis ( n=1 ) .
strains d5-s-2013 and b4-s-2013 showed a close phylogenetic relationship with l. composti and l. paralimentarius , respectively where as the sequence had slightly lower similarity of lower than 99% , suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences .
lactobacillus plantarum was found being dominant in all sayur asin samples.conclusion:lactobacilli were recognized as the major group of lactic acid bacteria in sayur asin including 5 known and 2 novel candidate species .
the distribution of lab species was associated with the manufactures where sayur asin is produced . |
the prevalence of type 2 diabetes mellitus ( t2 dm ) in korea is estimated to be 7.3% ( in those over 20 years of age ) , and it has increased about 5-fold over the past 30 years according to a report of the korea national health and nutrition examination survey ( knhnes iii , 2005 ) . the number of patients with t2 dm is expected to increase dramatically from about 3.2 million in 2011 ( 8.8% of the national population ) to about 4.25 million ( 11.1% ) by 2030 .
this enormous increase in the number of t2 dm patients will inevitably be accompanied by chronic diabetic microvascular or macrovascular complications . among the diabetic complications , diabetic peripheral neuropathy ( dpn )
is the most prevalent and troublesome complication in patients with diabetes mellitus ( dm ) .
diabetic neuropathy ( dn ) , which may be focal or diffuse , is diagnosed when diabetic patients complain of symptoms and/or show signs of peripheral nerve dysfunction after the exclusion of other etiologies .
peripheral neuropathic pain in diabetic patients is defined as pain arising as a direct consequence of abnormalities in the peripheral somatosensory system in people with diabetes .
the symptoms can be present as severe numbness , paresthesia , or hyperesthesia , however , dpn may be asymptomatic in about 50% of patients . as the dpn progresses , the painful symptoms usually disappear .
in addition , dpn is also associated with substantial morbidity , which includes not only a susceptibility to foot or ankle fractures and ischemic ulceration leading to lower - limb amputations , but also depression [ 11 - 13 ] . according to the seattle diabetic foot study , which included 749 diabetic patients
, there were a number of findings that independently increase the risk for dm foot ulcer , including certain foot deformities , reduced foot arterial perfusion , and both sensory and autonomic neuropathy .
diabetic patients with critical limb ischemia have high risks of lower limb amputation and death .
in addition to its influence on morbidity and mortality , painful symptoms in dpn have a significant detrimental impact on quality of life as the condition limits daily activities and interferes with sleep [ 16 - 18 ] .
considering the health - related economic viewpoint , diabetic foot disease significantly increases the health care costs in patients with dm . according to a retrospective study that analyzed insurance costs in the united states ,
the cost of care for patients with a foot ulcer is 5.4 times higher in the year after the first ulcer episode , but 2.8 times higher in the second year compared with that of diabetic patients without foot ulcers .
therefore , early detection and prompt intervention for dpn must be performed for patients with t2 dm .
the prevalence of dpn is generally estimated to be 10% to 50% in patients with t2 dm , and the incidence increases with age and duration of dm . the reported prevalence of dn in korea is variable , from 14.1% to 54.5% depending on the study population and the diagnostic method ( table 1 ) [ 21 - 24 ] . in the diabcare - asia 1998 study , which included 230 dm centers from 12 countries ( n=24,317 ) ,
the frequencies of retinopathy , microalbuminuria , and neuropathy were 21% , 39% , and 34% , respectively .
the prevalence of those complications was significantly higher in those patients with higher hemoglobin a1c ( hba1c ) levels .
a nationwide survey performed in 2006 by the committee of the korean diabetes association on the epidemiology of diabetes mellitus ( n=5,652 ) showed that the prevalence of dpn defined by neurologic symptoms or nerve conduction velocity abnormalities was 44.7% .
this prevalence was higher than the prevalence of microalbuminuria or retinopathy . in a prospective observational study among 508 korean t2 dm patients , diabetic foot disease occurred in 32 patients ( 6.3% ) , and the incidence of diabetic foot disease increased when peripheral neuropathy was present ( odds ratio [ or ] , 2.949 ; 95% confidence interval [ ci ] , 1.075 to 8.090 ) .
while chronic neuropathic pain is present in 13% to 26% of dm patients , it can be found not only in diabetic subjects , but also in impaired glucose tolerance ( igt ) or impaired fasting glucose individuals . according to a community - based cross - sectional study from the united kingdom , chronic dpn is common and often severe but frequently unreported and
interestingly , they showed that 12.5% of patients had never reported their symptoms to their doctors , and 39.3% never received treatment .
there are some studies about the relationships between dpn and other diabetic complications in korean t2 dm patients .
reported that the prevalence of cardiovascular disease ( cvd ) was higher in patients with dpn . in their multivariate analysis ,
dpn was independently associated with cvd ( or , 1.801 ; 95% ci , 1.009 to 3.214 ) in t2 dm patients ( n=1,041 ) , with a 52.8% prevalence determined by neurophysiologically diagnosing peripheral polyneuropathy based on electroneuromyographic findings .
a close relationship between peripheral sensory neuropathy and peripheral vascular disease was also reported independent of glucose level and other microvascular complications , in particular , retinopathy in t2 dm .
the association between cardiovascular risk factors and development of large - fiber nerve dysfunction , which was measured by vibration perception threshold , was reported in type 1 dm patients ( n=1,407 ) in the eurodiab prospective complication study .
hyperglycemia not only activates the sorbitol accumulation with a subsequent increase in cellular osmolarity , but it also shunts to the hexose pathway , producing oxidative stress and the formation of advanced glycation end products ( table 2 ) .
this damage leads to hyperexcitability in central neurons and the generation of spontaneous impulses within the axons as well as the dorsal root ganglion of these peripheral nerves .
most of the clinical practice guidelines , including those from the korean diabetes association , recommend that dpn screening should begin at the initial diagnosis of t2 dm and should be performed at least annually thereafter [ 34 - 36 ] .
the exclusion of non - diabetic causes of neuropathy , including alcoholism , vitamin b12 deficiency , endocrinopathies , vasculitides , heavy metal exposure , drug use , and malignancy , is important because these may account for 10% of the cases of neuropathy in people with dm .
though the symptoms can exist without signs , the severity of painful symptoms can be reliably assessed by the visual analogue scale or the numerical rating scale ( 0 , no pain ; 10 , worst possible pain ) .
in addition , validated scales and questionnaires such as the neuropathic pain symptoms inventory , the brief pain inventory , and the neuropathic pain questionnaires are widely used ( table 3 ) .
however , the nerve conduction study remains the most reliable , accurate , and sensitive method to evaluate peripheral nerve function , and it has been adopted as the gold standard .
this approach is not only time - consuming , expensive , and insensitive for the detection of small - fiber neuropathy , but also it is impractical to perform in an outpatient clinic setting .
however , the semmes - weinstein monofilament ( swmf ) test is simple to use as a screening tool to identify patients at risk for diabetic foot complication in the primary care setting .
the inability to sense the 10 g force pressure is considered as insensate and an independent predictor for higher risk of foot ulceration .
considered the swmf test as a useful screening tool for dpn . the nerve conduction study ( ncs )
was used as a gold standard to compare the sensitivity and the specificity of the swmf test .
the results were considered as abnormal if the patient could not perceive the 5.07/10 g swmf at more than four of ten sites ( 37 t2 dm outpatients ) . the sensitivity and
the specificity at two sites ( the third and fifth metatarsal head sites ) were 93.1% and 100% , the same as at the ten sites .
it is likely that the two - site swmf test is a useful screening test for dpn as is the ten - site test . in a study of 126 diabetic patients ,
41% complained of dpn symptoms , and swmf and vibration perception were more impaired in patients with subjective sensory symptoms . in 82 diabetic patients , the medial plantar sensory ncs provided a more sensitive diagnosis of dpn , even in patients with normal range measurements in the sural nerve .
the medial plantar sensory nerve action potential was abnormal in 46.7% of the symptomatic and 14.3% of the asymptomatic diabetic patients with normal routine ncs in this study .
the medial plantar sensory ncs may be helpful in the diagnosis of subclinical dpn in the asymptomatic diabetic patient .
compared to the single test , the combinations of tests have a greater than 87% sensitivity in detecting dpn .
the aims of dpn treatment are to decrease the painful symptoms , to treat the specific pathogenic mechanism , and to prevent progression or subsequent complications .
most of all , strict diabetic control and correction of metabolic risk factors should be initiated .
the lifestyle intervention that improves glycemic control and decreases blood pressure with lipid profiles improves both the painful neuropathic symptoms and the intra - epidermal nerve fiber density .
these findings suggest that early diagnosis and prompt intervention may be of significant clinical benefit . for pharmacological treatment ,
first line therapy consists of tricyclic antidepressants ( tca ) , duloxetine , pregabalin or oxycodone ( table 4 ) .
if the pain is not controlled with first - line therapy , second - line therapy or combination therapy can be used , for which the potential side effects and possible drug interactions must be considered . topical treatment with a 5% lidocaine plaster or capsaicin is also considered .
randomized controlled trials have been performed for the treatment of dpn in korean patients with t2 dm using alpha - lipoic acid , pregabalin , or tramadol / acetaminophen combination treatment .
the neuropathic symptom score , assessed by the total symptom score , was improved after intravenous alpha - lipoic acid treatment at a dose of 600 mg / day for 14 days in 19 t2 dm patients compared to 13 control subjects ( p<0.05 ) .
open - label study with oral thioctic acid 600 mg once daily for 8 weeks ( n=61 ) also improved dpn symptoms without serious adverse effects in korean diabetic patients . in an open , randomized , comparative study conducted in 163 t2 dm subjects with dpn ,
tramadol / acetaminophen ( ultracet ) treatment ( n=79 ) for 6 weeks was as effective as gabapentin ( n=84 ) for the decrease of pain intensity , an increase in the quality of life , an increase in mood , and a decrease in sleep disturbance in the treatment of painful dn .
ten weeks of pregabalin treatment for patients with neuropathic pain ( dpn [ type 1 or 2 diabetes , n=18 ] , postherpetic neuralgia [ n=146 ] , or posttraumatic neuropathic pain [ n=76 ] ; n=162 pregabalin , n=78 placebo ) showed a significant reduction in the daily pain rating scale score with improvement in anxiety and a decrease in sleep disturbance . despite the improvement in treatment modalities for chronic pain in recent years , patients with dpn still continue to be inadequately treated .
the dramatic increase in the prevalence of t2 dm with its acute or chronic complications are a major health concern in korea .
screening of high risk individuals , early detection , and proper management of dpn in patients with t2 dm is urgently needed .
careful foot examination , active application of outpatient screening tools including the assessment of pedal pulses , and an organized diabetic foot - care program are needed . despite the improvement in treatment modalities for chronic pain in recent years ,
therefore , active pharmacologic treatment should be considered to relieve neuropathic pain and improve the quality of life in patients with t2 dm . | diabetic peripheral neuropathy ( dpn ) , a common and troublesome complication in patients with type 2 diabetes mellitus ( t2 dm ) , contributes to a higher risk of diabetic foot ulcer and lower limb amputation .
these situations can negatively impact the quality of life of affected individuals . despite its high prevalence and clinical importance , most diabetes mellitus patients
not only do not recognize the presence of diabetic neuropathy , but also do not report their symptoms to physicians or other health care providers .
therefore , dpn is usually under diagnosed and undertreated . for early detection and appropriate intervention for dpn ,
a careful history , physical with neurologic examination , and prompt treatment are needed in t2 dm patients . |
tuberculosis ( tb ) continues to be an important public health problem worldwide and according to world health organization reports there were about 8.8 million new cases and 1.6 million deaths from the disease in 2005 . without treatment ,
about two - thirds of smear - positive pulmonary cases die within five to eight years . according to east mediterranean regional office ( emro ) records , the estimated incidence of tuberculosis in iran in 2004 was 1324 per 100.000 .
the notification rate of tb in iran is estimated to be less than 70%[2 , 3 ] .
this means that considerable numbers of patients are missed in the early stages of disease .
tuberculin skin testing ( tst ) has been used for a long time as a diagnostic test for latent tuberculosis infection and at present it remains the only routinely available method for the diagnosis of tuberculosis .
it is an easily applied and low cost test that can determine annual risk of tuberculosis infection .
tst positivity differs among bacillus calmette - guerin ( bcg ) vaccinated and unvaccinated populations[5 , 6 ] .
tuberculin - positive children from high prevalence countries are regularly given treatment for latent tb infection in the united states .
such treatment is seldom recommended in the absence of other risk factors like recent contact with smear positive pulmonary tb in young children or immunodeficiency conditions because about 90% of patients who developed tb in some countries were infected ten years before[8 , 9 ]
. however , infection with mycobacterium other than mycobacterium tuberculosis and previous bcg vaccination also cause reaction to tuberculin , though in a bcg vaccinated patient positive skin tests with indurations of 10 mm are more likely to be the result of tuberculosis infection rather than vaccination[1012 ] . in many countries
iran is an example where for the past 40 years , bcg vaccine has been given to all newborns with a coverage rate of about 99% .
partly as a result of widespread neonatal bcg vaccination , the 15 mm cut - off point for purified protein derivative ( ppd ) test has been consistently used in our study .
the purpose of our study was to determine the rate of tst positivity and prevalence of tb infection in 7- to 11-year - old children and determine active tb disease during a five - year period in kermanshah in western iran .
primary school children ( age range 7 - 11 years ) were eligible for this study which was done in kermanshah , iran from january to may 2002 .
selection of the subjects was achieved using cluster random sampling . in each school a classroom from each grade ( grades 1 - 5 ) was selected . then , all the students of selected classrooms were evaluated . using this method ,
a total number of 10.184 students ( 3.892 boys and 6.292 girls ) were studied .
tst was performed by intradermal injection of 0.1 ml of 5 tuberculin units ( 5tu ) of ppd from mycobacterium tuberculosis that was supplied by razi institute administered by mantoux technique .
after 72 hours the result for the biggest diameter of indurations ( in millimeters ) was recorded by trained healthcare workers .
the tuberculin positive rates at the cut - off points of 10 and 15 mm for different sexes and ages were recorded .
the results of the tuberculin skin test were interpreted in the context of the patient 's risk of m. tuberculosis infection and cut - off point 15 mm was considered as tuberculosis infection .
in addition to tst results , additional data was collected using school records and checklists .
the data were age , sex , history of bcg vaccination , presence of bcg scar , risk factors of tuberculosis infection such as close contact with a person who has active pulmonary tuberculosis , or immune - compromising conditions . students with positive tst
history and physical examination were performed to determine the presence of symptoms of tb disease and chest radiography to exclude active tb disease . during the five - year period of follow - up ,
periodic history taking , physical examinations , and if necessary chest radiography and sputum examination were done in tst - positive cases .
for comparison of categorical variables , the chi - squared test was used . to assess the independent effects of sex and age on the positive tuberculin response at different cut off points ,
multiple logistic regression model was used . a p - value of < 0.001 was considered statistically significant .
positive tst results were observed in 830 students ; 529 ( 5.2% ) cases had an induration equal to or more than 15 mm and the remaining 301 ( 2.96% ) cases had an induration of 1014 mm .
distribution of tuberculin skin test results ( with ppd ) at different cut - off points in both genders the mean induration in males measured 8.7 mm , slightly more than 7.8 mm induration in females ( p=0.1 , table 1 ) . at the cutoff point 5 mm ,
40.3 percent ( 95% ci : 39.341.2 ) of girls had positive tuberculin test compared with 43.8 percent ( 95% cl : 42.844.8 ) of boys and at the ppd5 induration 10 mm , 7.9 percent ( 95% ci : 7.48.4 ) of girls and 8.7 percent ( 95% ci : 8.29.2 ) of boys had positive tst . at the cut - off point l5
mm the corresponding rates of tst positivity were 5.1 percent ( 95% ci : 4.75.5 ) and 5.5 percent ( 95% ci : 5.15.9 ) respectively ( p=0.014 ) .
a significant linear trend was found between the rate of tst positivity and age at all cut off points which persisted when the two sexes were analyzed separately . by using trend chi - squared test , we found that increasing age was significantly associated with positive tst reactions ( p<0.001 ) ( table 2 ) ,
distribution of tuberculin skin test induration in different genders and ages about 99.2% of participants had history of bcg vaccination at birth and 96% of them had bcg scar . of 529 children with tst 15 mm ,
480 ( 90% ) cases presented for follow up after one year and 457 ( 86% ) cases after two years , but only 290 ( 55% ) subjects completed the five - year follow - up .
they did not have any risk factors for tb such as close contact with a person with active pulmonary tuberculosis , or immune - deficiency conditions .
further evaluation was done using the medical records of tb registry of kermanshah province that records all forms of tb in the province . according to these records
, none of the studied children in this study had been diagnosed as active tuberculosis .
our study found the rate of 8.15% tst positivity with no new case of active tuberculosis detected within 5-year follow - up .
mass school screening in new york and boston showed less than 3% and 5.1% to 8.9% rates of tst positivity , respectively . in southeast asian teenagers ,
pong et al found rates of 12.8 and 24 percent in two american high schools . at cut - off point of 5 mm , about 40% of our patients had positive tst .
this is in contrast to the observation by sakha et al in tabriz , where only 4.66% of children had such a rate . in south iran and kerala , india
this rate has been reported as 6.1% and 5% respectively , which are lower than ours . according to the current findings
, there were no significant differences between tst positivity rate between boys and girls at any induration cut - off point .
this observation is similar to two former studies from san diego and canada being in contrast to a report from hong kong that showed female predominance regarding tst positivity and two other reports which showed male predominance in norway and philippines[21 , 22 ] .
it was observed that increasing age after 9 years is significantly associated with increasing rate of tst positivity at cut - off point of 15 mm in both genders .
this finding resembles those of san diego and hong kong studies but is in contrast to some other studies that have shown reduction in the tuberculin response in younger children who had been vaccinated at birth[24 , 25 ] .
this might mean that reduction in the bcg effect has either stopped or been masked by a higher rate of tuberculin conversion due to tuberculosis infection or exposure to non - tuberculosis mycobacterium in our cases .
in this study bcg vaccination coverage rate was 99.2% and 96% of children had bcg scar .
however , in a report from delhi , india bcg vaccination coverage was 90% in urban and 84.7% in rural areas . according to kumar study ,
about 81% of the children had bcg scar . in sri lanka , despite having 97% bcg scar , 80% had tuberculin anergy
( 0l mm ) and there was no correlation between scar size and mantoux response .
mean tuberculin indurations in our study were 8.7 mm and 7.85 mm in male and female respectively ; this is in contrast to a turkish study with 2.72.96 mm in 57 years age group .
the lifetime risk of tuberculosis reactivation for a person with a positive tuberculin skin test is usually estimated to be 5 to 10 percent , half of which is in the first year after infection[23 , 27 , 28 ] . in our study school children with positive ppd 15 mm
no case of active tb also was recorded in the tb registry of kermanshah province .
if we assume that the lifetime risk of tuberculosis reactivation for a person with a positive tuberculin skin test usually is 5 to 10 percent and half of which occurs in the first year[27 , 29 , 30 ] we should have detected many cases of active tb .
the great majority of infants who have received bcg vaccination would lose reactive skin test by 5 years of age and reactions of 10 mm induration are in favor of mycobacterial infection than vaccination or other mycobacterial infections[32 , 33 ] .
so at the cut - off point of 15 mm among school children in this study , reaction is due to infection with mycobacterium tuberculosis but none of them developed active disease .
we conclude that the developing of disease is less than 5 to 10% in kermanshah , iran . in a study in singapore , 17% of school children who were vaccinated at birth had a tst 10 mm at 12 years of age .
these children were followed for 4 years and found to have a 5 to 48-fold increased risk of developing tb disease when compared with children whose tst had been < 5 mm at 12 years of age . among
school children incidentally found to have a tuberculin reaction at 20 mm or more , the annual incidence of active tb was as high as 341 per 100.000 . even in low - prevalence areas ,
tb has been diagnosed in 55% of immigrants within the first 5 years of arrival . in many countries with high tb prevalence , neonatal bcg vaccination
is regularly performed , this may have effect on tuberculin skin test but results of our and other studies[12 , 36 ] suggest that the effect of bcg on tuberculin response may be more complex than was previously assumed .
parents of the students , who did not complete follow - up , when contacted by phone , said they believed their child did not have any particular disease and there was no need for presentation to physician .
we found tst positivity rate of 8.15% in 7- to 11-year - old students , and during 5 years follow - up no case of active disease was diagnosed . | objectivetuberculosis ( tb ) is an important infectious disease worldwide
. tuberculin skin test ( tst ) is the standard test for diagnosis of tuberculosis infection ; bacillus calmette - guerin ( bcg ) vaccination at birth has effects on this test .
the aim of this study was to determine the prevalence of positive tst cases among 7- to 11-year - old primary school children and also to follow test - positive individuals for a five - year period.methodstst was performed on 10.184 children aged 711 years sampled by cluster random method in kermanshah , west iran .
those who had a positive test result ( i.e. an induration of 15 mm following 72 hours of injecting 0.1 ml of 5 tuberculin units of purified protein derivative from mycobacterium tuberculosis ) were followed for five years to determine the presence of active tb . also tuberculin positive rates at cut - off points of 10 mm and 15 mm for boys and girls and at different ages were derived and compared using the chi - squared test.findingsof 10.184 studied subjects , 830 ( 8.15% ) cases showed positive tst .
this rate was 8.7% in boys and 7.8% in girls ( p=0.1 ) .
a significant linear trend was found between the tuberculin positive rates and age at all cut - off points ( p<0.001 ) .
no active tb was detected during 5-year follow-up.conclusionthe rate of positive tst cases in primary school children in kermanshah , iran was 8.15% with no new cases of active tuberculosis detection within five - year follow - up . |
increased insulin resistance in type 2 diabetes is known to cause high risk in developing cardiovascular disease ( cvd ) [ 13 ] .
metabolic syndrome ( ms ) is an important cluster of metabolic abnormalities associated with insulin resistance and cvd [ 4 , 5 ] . despite the different definitions of ms proposed , high fasting plasma glucose level is one of the ms components [ 6 , 7 ] .
a high prevalence ( 35%60% , depending on ethnicity , gender , and definition ) of ms was found among type 2 diabetic patients [ 815 ] .
many studies have reported insulin resistance as the key pathogenic factor for the development of hyperlipidemia , glucose intolerance , hypertension , and obesity , all of which are ms components [ 1623 ] , while insulin resistance is not [ 6 , 7 ] .
hence , the relationship between the components of ms and insulin resistance in type 2 diabetes merits further investigation .
different severities or conditions of type 2 diabetes might lead to different degrees of insulin resistance . to understand the different impacts of ms components on insulin resistance in type 2 diabetes , and to avoid undetectable confounders and bias ,
this study enrolled subjects from a chinese adult homogenous cohort aged between 3075 years , who have had type 2 diabetes for more than one year and have been taking gliclazide and metformin for more than six months .
we hypothesized that there would be different impacts of ms components on insulin resistance among type 2 diabetes after controlling for other factors in the homogenous diabetes cohort .
this study also compared the characteristics among different numbers of ms components in this cohort .
the trial was conducted from july 2005 through june 2006 in taipei hospital , taiwan . a total of 1356 registered diabetic patients were screened and 186 met the following criteria : ( 1 ) age between 30 and 75 years old , ( 2 ) being chinese , ( 3 ) having been type 2 diabetes for more than one year , and ( 4 ) having been taking gliclazide and metformin for more than six months without taking other antidiabetic medication or insulin injection .
the exclusion criteria include ( 1 ) got , gpt > 80 u / l , serum creatinine > 2.0 mg / dl , ( 2 ) lactation or pregnancy , ( 3 ) heart failure with new york heart association ( nyha ) class > i , acute myocardial infarction , stroke , and that caused disabilities , and ( 4 ) any other conditions not suitable for trial as evaluated by the physician . after giving extensive oral and written information , a written informed consent form was obtained from the subjects before commencing any study - related activity .
the protocol was approved by the human ethics committee of taipei hospital . according to atp iii asian ( chinese ) definition ,
the components of ms are ( 1 ) large waist circumference ( lwc ) 80 cm in female and 90 cm in male , ( 2 ) high triglyceride ( htg ) 150 mg / dl , ( 3 ) low hdl - cholesterol ( lhdl ) < 40 mg in male and < 50 mg in female , and ( 4 ) high blood pressure ( hbp ) 130/85 mg or on medication [ 6 , 7 ] . subjects with a number of ms components < 2 were classified as the nms group , those with a number of ms components = 2 were grouped under msa , and those with a number of ms components > 2 were grouped under msb . homeostasis model assessment for insulin resistance ( homa index ) ( fasting glucose ( mmol / l ) fasting insulin ( ui / l)/22.5 ) was employed for evaluating insulin resistance [ 24 , 25 ] .
all subjects were assigned to one of the homa index categories according to the following quartiles : quartile 1 ( < 25% ) , quartile 2 ( 25%49% ) , quartile 3 ( 50%75% ) , and quartile 4 ( > 75% ) for further assessment and comparison .
the main outcome evaluated is the ors of different ms components on homa index quartile 4 , which were assessed using multiple logistic regression analysis .
the characteristics in homa index quartiles and groups of nms , msa , and msb were also evaluated .
anthropometric measurements including blood pressure , fasting glucose , hba1c , insulin , adiponectin and triglyceride , cholesterol , cholesterol - hdl ( hdl ) , and cholesterol - ldl ( ldl ) were taken .
waist circumference ( wc ) was measured midway between the lateral lower rib margin and the iliac crest , while hip circumference ( hc ) was measured at the levels of the major trochanters through the pubic symphysis .
height was measured with a wall - mounted stadiometer to the nearest 0.1 cm , weight was measured on a calibrated balance beam scale to the nearest 0.1 kg , and bmi was calculated ( bmi = body weight / height ( kg / m ) ) . a mercury sphygmomanometer with standard cuff
was employed to measure the indirect auscultatory arterial blood pressure taken from the right arm with subjects in seated position .
a sample of whole blood was drawn and centrifuged at 4c , and a 1-ml aliquot of serum was rapidly frozen ( 80c ) for subsequent hormone analysis .
the plasma adiponectin concentration was measured by a radioimmunoassay kit ( linco research , inc . ,
this kit employs the double - antibody / polyethylene glycol technique using i - lableled adiponectin and a multispecies adiponectin rabbit antiserum .
plasma insulin levels were measured using a commercially available radioimmunoassay ( linco research inc . ) .
one - way analysis of variance ( anova ) and linear trend test were employed to evaluate the trend among the homa index quartile groups and among groups of nms , msa , and msb .
chi - square test was used for comparison of gender ( male / female ) , family history of type 2 diabetes , and the percentage of ms component among groups .
multiple logistic regression analysis was employed for analysis among different ms components and groups of nms , msa , and msb on the highest homa insulin resistance index quartile 4 , with other factors adjusted .
all p values were two - tailed and level of significance was set at 0.05 .
among the 1356 screened patients , 186 met the inclusion criteria and 144 ( 77.4% ) agreed to participate .
there are 79 females ( age 59.0 8.7 years ) and 65 males ( age 56.3 11.7 years ) .
there is no significant gender difference in means of age , bmi , wc , blood pressure , hba1c , fasting glucose , cholesterol , triglycerol , insulin , homa index , aminotransferases alanine , aminotransferases aspartate , and creatinine .
as can be seen , the means of homa index quartile 4 and all the subjects are 9.3 ( 3.2 ) and 4.8 ( 3.3 ) .
results of linear trend test show significant difference in % lwc ( p < 0.001 ) , % htn ( p = 0.006 ) , % htg ( p = 0.001 ) , bmi ( p < 0.001 ) , wc ( p < 0.001 ) , hc ( p = 0.002 ) , diastolic blood pressure ( p = 0.002 ) , fasting glucose ( p < 0.001 ) , hba1c ( p = 0.001 ) , adiponectin level ( p = 0.006 ) , triglyceride level ( p = 0.01 ) , and cholesterol level ( p = 0.03 ) , but no statistical difference in family history of type 2 diabetes , gender ratio , % lhdl , and dose of metformin and gliclazide taken among quartiles of homa index .
table 2 displays the demographic and biochemical characteristics among the nms , msa , and msb groups .
as can be seen , 64.6% of the subjects met the atp iii asian ( chinese ) definition of having ms ( msa 36.2% and msb 28.5% ) .
results of linear trend test show significant difference in means of homa index , bmi , wc , hc , blood pressure , percentage of all ms components , and insulin level ( all the above having p < 0.001 ) , but no statistical difference in family history of type 2 diabetes , hba1c , and dose of metformin and gliclazide taken among the three groups .
table 3 shows the ors of different ms groups , gender , family history of type 2 diabetes , different bmi categories , and hba1c groups on the highest homa index group ( quartile 4 ) , after adjustment of age , gender , family history of type 2 diabetes , and dose of metformin and gliclazide taken .
the results showed that both msa and msb groups had higher ors ( 5.9 and 13.8 times , resp . ) than the nms group , obese subjects ( bmi 27 ) had higher ors ( 2.8 times ) than nonobese subjects , and high hba1c subjects ( > 9.0 ) had higher ors ( 3.6 times ) than control groups in developing higher homa index .
table 4 shows the ors of different ms components ( lwc , htn , htg , and lhdl ) , gender , family history of type 2 diabetes , different bmi categories , and hba1c groups on the poor homa index group ( quartile 4 ) , after adjusting the age and dose of metformin and gliclazide taken .
significant difference can be seen in subjects with lwc , htg , and high hba1c having higher ors , but not those with htn and lhdl .
our initial findings evidenced different impacts of ms components on insulin resistance in type 2 diabetes . subjects with lwc and htg have higher ors ( 6.1 and 2.6 times , resp . ) in developing higher insulin resistance than subjects with normal wc and tg .
the results also reveal that subjects with greater number of ms components have higher ors in developing higher insulin resistance than the nms group in this type 2 diabetic cohort .
different severity or condition of type 2 diabetes might result in different insulin resistance , and taking different oral hypoglycemia agents might also influence insulin sensitivity [ 2629 ] .
hence , we enrolled a homogenous adult chinese cohort of 3075 years old with type 2 diabetes for more than one year and having been taking gliclazide and metformin for more than six months to avoid undetectable confounders and bias .
reaven reported insulin resistance as the central pathophysiological feature of the cluster of metabolic abnormalities , which has been associated with ms in many subsequent reports .
many evidences also support the association between insulin resistance and vascular disease , and this has led to wide acceptance of the clustering of hyperlipidemia , glucose intolerance , hypertension , and obesity , all of which are ms components [ 30 , 31 ] .
since there is still intense controversies among the definition of metabolic syndrome by atpiii and its value as a cvd risk marker , we tried to figure out different impacts of the clustering ms components on insulin resistance of type 2 diabetic patients which has been proven to cause elevated risk of atherosclerosis .
our results have reconfirmed the strong positive relationship between homa index and wc , bmi , hc , hba1c , yes % of lwc , htn htg , and serum levels of glucose , triglyceride , and cholesterol ( table 1 ) .
all the above variables are the risk factors of developing complications in type 2 diabetes .
it is interesting that yes % of lhdl , although being an ms component , shows no statistical significance in the trend test .
the data have also demonstrated a negative relationship between the level of adiponectin and homa index in this homogenous type 2 diabetes cohort .
many studies have reported that adiponectin has both antiatherogenic and antidiabetic properties [ 3436 ] .
previous research has shown that adiponectin levels are significantly lower in type 2 diabetes [ 3 , 37 , 38 ] .
subjects with hypoadiponectin level might have higher risk of developing cardiovascular disease [ 39 , 40 ] .
adiponectin levels are positively correlated with insulin sensitivity and negatively with insulin resistance [ 34 , 36 , 40 ] .
the findings in this study support that high homa index of type 2 diabetes has lower adiponectin level , which might lead to higher risk of developing cardiovascular disease in the future .
our data also revealed that both msa and msb groups have higher ors in developing higher insulin resistance than the nms group in this type 2 diabetes cohort .
moreover , subjects with greater number of ms components have higher ors in developing higher insulin resistance ( table 3 ) .
although insulin resistance is not an ms component , the above finding has reconfirmed the association between insulin resistance and the number of ms components in type 2 diabetes , which corresponds to the observation of hsieh et al . in the early onset
we have a reason to believe that the greater the number of ms components in type 2 diabetes , the higher the risk in developing increased insulin resistance will be , and both of them lead to higher risk of cvd .
the finding in table 4 also showed that groups with higher hba1c ( 9.0 ) have higher ors ( 3.6 times ) in developing higher insulin resistance than the control group .
difference in bmi did not reach statistical significance . this may be because bmi can be fully predicted by waist circumference in this type 2 diabetes cohort .
previous studies have demonstrated that wc can be employed to predict insulin resistance , and some studies showed that wc is a better predictor of risk factors than bmi [ 43 , 44 ] .
changes in bmi can be due to changes in skeletal muscle rather than body fat , whereas variations in wc are attributed mainly to changes in abdominal fat .
demonstrated that central abdominal fat is positively associated with insulin resistance . according to previous studies
, lipid and fatty acids may induce insulin resistance by blunting insulin sensitivity through inhibition of glycolysis at key points .
this explains the correlation of obesity , hyperlipidemia , and insulin resistance found in our study . from the results
, we have a reason to believe that central obesity , hypertriglyceride , and long - term glucose control are the most important factors associated with insulin resistance in type 2 diabetes . in conclusion
, this study indicates the different impacts of ms components on insulin resistance in type 2 diabetes .
type 2 diabetic patients with greater number of ms components have higher ors in developing higher insulin resistance .
central obesity and hypertriglyceride are the most important ms components associated with insulin resistance in type 2 diabetes . | objective . to examine the different impacts of ms components on insulin resistance in type 2 diabetes
. methods . a number of subjects ( 144 ) who met the criteria of ( 1 ) age between 30 and 75 years , ( 2 ) had type 2 diabetes for more than one year , and ( 3 ) taking gliclazide and metformin for more than 6 months were enrolled .
all subjects were assigned to one of the four homa index categories .
the homa index quartile 4 denotes the highest insulin resistance .
the main outcome evaluated is the odds ratios ( ors ) of different ms components on homa index quartile 4 .
the characteristics in homa index quartiles and groups of nonmetabolic syndrome ( nms ; number of components < 2 ) , metabolic syndrome a ( msa ; number of components = 2 ) , and metabolic syndrome b ( msb ; number of components > 2 ) were also evaluated .
results .
the results showed that both msa and msb groups had higher ors ( 5.9 and 13.8 times , resp . ) than the nms group ; and that subjects with large waist circumference ( lwc ) and high triglyceride ( htg ) level have higher ors ( 6.1 and 2.6 times , resp . ) in developing higher insulin resistance than normal control subjects .
conclusion .
type 2 diabetic patients with greater number of ms components have higher ors in developing increased insulin resistance . |
normally , physical training is often associated with a type of tissue trauma called adaptive microtrauma . with adequate recovery ,
helping the body adapt to higher - intensity stimuli , therefore , is important for physical training [ 2 , 3 ] .
however , overtraining can lead to overtraining syndrome , which is often accompanied by physiological , biochemical , immunological , and psychological symptoms .
margonis et al . found that 37% of professional athletes in all types of sports have suffered from overtraining syndrome at least once in their careers .
many studies indicate that exercises stimulate the body producing changes in the metabolite levels of athletes , regardless of whether the exercise follow acute or chronic , planned or unplanned protocols [ 5 , 6 ] , even in strength - endurance sports .
previous studies utilized invasive methods and focused on single diagnostic metabolites , like lactate , phosphocreatine , or certain hormones .
however , variations in some of these indicators were not observed through detection of target biochemicals such as serum cortisol , testosterone , or creatine kinase . following the development of omics techniques ,
the use of metabonomics has increased rapidly in the past decade . as nicholson et al
. stated , metabonomics is a measurement of the dynamic metabolic response of living systems to stimuli or modification .
metabonomics approaches can detect changes in the levels of many small molecules that arise as a response to cells or an organism to endogenous or exogenous stimuli , such as disease , development , environmental changes , or nutrient availability .
the reason is that there are many technical barriers , such as identifying plenty of metabolites and interpreting acquired data through advanced multivariate statistical analysis .
hence , metabolomics is conducted by using sensitive analytical techniques , such as liquid chromatography - mass spectrometry ( lc - ms ) , gas chromatography - mass spectrometry ( gc - ms ) , and nuclear magnetic resonance ( nmr ) spectroscopy . to date , many studies have analyzed metabolite profiles or conducted metabolite fingerprinting .
recent metabolomics studies of physical training have focused on blood serum or plasma in human and animal models .
these studies have studied the effects of strenuous endurance exercises , strength - endurance training , specific diets , or ingestion of different beverages after exercise [ 1417 ] .
the effects of acute and chronic exercise and different types of exercise on the human urine metabolome have also been studied [ 6 , 18 ] .
several studies have used saliva to assess the levels of metabolites in response to exercise and training or to evaluate physical performance [ 7 , 19 ] .
. detected changes in the concentration of 11 metabolites after exercise by using h nmr analysis of urine from female athletes and nonathletes . generally , previous studies have shown that exercise with a variety of forms and levels could cause metabolic changes in the body 's biological fluids , such as blood , urine , and saliva .
the test subjects in majority of studies were under strict requirements ( diets , fasting , specific training plans with rest intervals , etc . ) to obtain variations of key metabolites , aiming for hypotheses testing regarding specific biochemical pathways .
however , under actual circumstances , athletic training follows schedules , which was a combination of exercises in various forms .
it is important to control the amount and intensity of physical exercise so as to obtain positive effects without fatigue .
thus , the present study uses traditional monitoring methods and nmr - based metabonomics to determine changes in the levels of small - molecule metabolites in urine during training process .
we describe nontargeted h nmr - based metabonomics analyses of urine samples obtained from professional snowboarders after weekly physical training .
the aim of this work was to explore how physical exercise broadly impacts and changes metabolite profiles .
furthermore , we determined the feasibility of using metabonomics to assess and monitor periodic physical exercise .
twelve professional half - pipe snowboarders between the ages of 2125 years with an average body mass index ( bmi ) of 21.7 1.5 kg / m participated in this study .
all athletes had a standard diet and none used pharmaceutical products or tobacco during the training period . physical training consisted of typical waist and abdominal strength and endurance and trampoline exercises , which were divided into three stages ( stages i , ii , and iii ; see figure 1 ) . before the three - week training
all urine and blood samples were collected before breakfast on monday morning . at the beginning of formal training , subjects completed strength , endurance , and trampoline exercises of a predefined level for one week .
the next week , the amount and intensity of exercise were both increased by about 10% ( warm up and stretch are not included in intensity calculation ) . since there is an individual difference in the athletes , especially the gender difference ,
the changes of training level were quantitatively estimated according to the heart rate of athletes and the professional coach 's personalized training . during the third week , the training intensity is the same as the second week , but the amount of exercise was reduced by about 15% .
nine urine samples were collected for stage i , and ten samples were collected for stage ii .
supernatant aliquots of 300 l were transferred to standard 5 mm nmr tubes and mixed with 300 l phosphate buffer ( ph 7.4 ) and 50 l d2o containing sodium 3-(trimethylsilyl)-1-propanesulfonate ( dss , 0.1% w / v in d2o ) .
routine blood tests were used to analyze wbc , lym , mxd , neut , rbc , hgb , hct , mcv , and plt .
h nmr acquisition was performed using a bruker drx-500 spectrometer equipped with a bbfo probe with z - axis gradients maintained at 298 k. one - dimensional nmr spectra were recorded using a standard 1d noesy pulse sequence with water suppression .
a total of 256 scans were collected in 32 k data points with a spectral width of 8012.8 hz .
the acquisition time was 2.04 s , and relaxation delay was 2 s. all spectra were processed using mestrenova software ( v. 8.1.2 ; mestrelab research sl , santiago de compostela , spain ) .
spectra were manually referenced to the chemical shift of dss before manual phase and baseline correction . on the purpose of identification ,
dqf - cosy and hsqc spectrum of representative sample were acquired ( see figures 1s , 2s , and 3s in supplementary material available online at http://dx.doi.org/10.1155/2015/315217 ) .
the spectral region of 0.510 ppm of all spectra was segmented into 0.02 ppm portions , excluding the 4.26.2 ppm region .
signal intensity was then normalized to the total spectral area and imported into matlab ( r2010a ; mathworks , inc . , natick , ma , usa ) .
multivariate data analysis of nmr data was performed using pls toolbox ( eigenvector research , inc . , manson , wa , usa ) . a principal component analysis ( pca )
model was applied to determine the distribution and separation trends . to enlarge the difference and
determine which variables contribute to separation , a partial least squares projection to latent structures and discriminant analysis ( pls - da ) model were then constructed .
cross - validation was conducted to ascertain the predictive ability of the model using the leave - one - out method .
r represents the variance captured by the model and q represents the prediction ability of the model .
furthermore , a permutation test was applied to validate whether models were overfit . to identify important biomarkers ,
the clinical parameters of three groups were analyzed by student 's t - test . a nonparametric version of one - way anova test was also performed on nmr data of identified metabolites .
hierarchical clustering analysis was used to assemble all variables into a single hierarchical tree and cluster relatively homogeneous elements together . in this study
there were no significant differences in the concentrations of testosterone , cortisol , creatine kinase , bun , wbc , lym , or neut between the first two stages .
the concentrations of mxd , rbc , mcv , and plt between the first two stages were significantly different , as were the hgb values in samples from male individuals .
however , most of the clinical parameters , such as mxd and rbc did not significantly differ between the second and third groups .
mcv , plt , and hgb concentrations from male individuals reached levels of statistical significance in the last two groups . comparing the levels of mcv , plt , and hgb ( m ) in these three groups , the hgb ( m ) level rose in the second stage and decreased in the third stage , whereas mcv and plt values showed decreased levels in the second stage with higher levels approaching initial values in the third stage ( table 1 ) .
a representative h nmr spectrum of a urine sample from an athlete is shown in figure 2 .
peaks of major metabolites could be observed in the spectra and were identified by comparing with a database and data reported in the literature [ 6 , 23 ] . with the urine samples , the pca model was used to observe the distribution and the separation trends ( figure 3 ) .
a clear separation was found in the score plot of the pca model based on the first two stages . to enlarge the difference and detect important variables ,
the pls - da model was established using one predictive component with r = 0.734 and q = 0.671 , as shown in figure 4(a ) .
as figure 4 showed , q value of model was much higher than any other q from permutated model .
this result indicated that the model with satisfied predictability was not overfitted . since the pca model of nmr data from stages
two and three did not show clear separation ( figure 3 ) , pls was applied with q = 0.288 , which indicates an unsatisfied model with low predictive ability .
figure 4(b ) displays a loading plot of the pls - da model from the first two stages .
concentrations of major metabolites , including tmao , taurine , and hippurate , were higher in urine samples from the relatively higher training intensity and amount group , whereas creatinine , glycine , and an unknown signal at 3.68 ppm , which falls in the spectral region of sugars , polyols , and amino acid ch - groups , were obviously higher in the first stage group . to validate this trend and explore other metabolites that contribute to variations between the two groups , an integral value of identified metabolites
was compared using the significance test . decreased urinary lactate , alanine , trimethylamine , malonate , taurine , and glycine levels , and increased urinary tmao and phenylalanine levels ,
were observed in samples from the higher training intensity and amount stage ( table 2 ) . these urinary metabolites with statistically significant levels could be used as potential biomarkers contributing to metabolic changes in athletes in different physical states .
in addition to those mentioned above , other metabolites , such as succinate , dimethylamine , creatinine , and an unknown signal in the region of 3.53.7 ppm , were close to the margin of statistical significance .
the levels of these metabolites were decreased in urine samples from stages one to two .
the observed trends from the significance test were in agreement with those from the pls loading plot . to determine
the relationships among major metabolites , correlation analysis and hierarchical clustering analysis were performed on nmr data and illustrated by a dendrogram and heat map ( figure 6 ) .
three clusters were clearly observed : ( 1 ) dimethylamine ( 2.71 ) and creatinine ( 3.03 ) ; ( 2 ) acetate ( 1.91 ) , alanine ( 1.47 ) , lactate ( 1.32 ) , citrate ( 2.53 ) , succinate ( 2.39 ) , and glycine ( 3.55 ) ; and ( 3 ) taurine ( 3.42 ) , tmao ( 3.26 ) , phenylalanine ( 7.42 ) , and hippurate ( 7.84 ) .
as a routine examination , blood test was accomplished each week through the entire training program . during this period ,
hormone concentrations in serum , such as testosterone and cortisol , did not show significant variance because of one - day rest before sampling .
this result is in accordance with a previous study . as a sensitive indicator of training ,
the average value of creatine kinase concentration of first - stage samples was 620.3 1007.7
u / l , which is much higher than the other two sample sets . by inspecting the original data ( 298 , 228 , 332 , 125 , 338 , 171 , 60 , 745 , 1011 , 83 , 3842 , and 210
u / l ) , three values are out of the normal range ( < 400 u / l ) . however , the abnormal creatine kinase values returned to normal in the next training stage , which illustrates adaptation to training from the so - called repeated - bout effect .
mononuclear cell counts decreased markedly at first but then increased along with the amount reduction of training , whereas other leukocytes ( lymphocytes and neutrophils ) did not show significant changes during training .
the normal range of hemoglobin values was different between male and female samples , indicating that it depends on gender .
the significant variations in the hemoglobin values in male samples suggest a reasonable training program for the athletes . in this study ,
the urinary metabolic profiles of professional half - pipe snowboarders were investigated and multivariate analysis was performed on the datasets to detect variations in metabolites that are caused by changes in the amount and intensity of training . after performing high - throughput metabolomics analyses , the dynamic metabolic profiles of urine samples from the athletes were recorded .
variation between the first two training stages was clearly observed , which reflects changes of physical states of the athletes .
in contrast , differences in the metabolic profiles between the last two training stages were not significant based on the pls model . by analyzing the differential metabolites caused by training level , they were related to each other through metabolic pathways and are depicted in figure 7 .
the tricarboxylic acid ( tca ) cycle was considered an important pathway related to energy generation in exercise science research . as an intermediate in the tca cycle ,
the decreased levels of succinate between stages one and two indicate that the tca cycle could be affected by long - term training based on different exercise loads .
based on the heat map in figure 6 , lactate ( peak at 1.32 ppm ) exhibits a positive correlation with alanine ( peak at 1.47 ppm ) .
this result is in accordance with expectation because both of them served as substrates in gluconeogenesis [ 26 , 27 ] .
the concentration of creatinine also showed a distinct trend toward significance in the pls model .
it displayed a decreased level after one week training of higher level compared to the initial week .
from here we could presume that the storage ability of phosphagen in muscle was improved , and consequently the level of excreted creatinine decreased after the second stage .
in contrast , the level of trimethylamine - n - oxide ( tmao ) which is synthesized from endogenous trimethylamine increased . because tmao level could be elevated by consuming seafood which was included in the daily diet , the increased level of tmao in urine samples may be due to increased food intake with high physical consumption during the second training stage .
tmao concentration also displayed remarkable variations in urine samples collected before and after exercise in some studies [ 6 , 17 , 18 ] .
thus , regulation of one - week training could be another reason why concentration level changed .
in addition , hippurate and its precursor phenylalanine displayed a high correlation in hierarchical cluster analysis .
as an essential amino acid , phenylalanine plays an important role in the synthesis of neurotransmitters .
the increased level indicates metabolic adaption in the athlete as a response to the increased training load .
the present study evaluated changes in the urinary metabolic profiles of half - pipe snowboarders as a result of training , using a metabolomics strategy .
the pca score plot showed the tendency to separate athletes with different training amounts and intensities .
furthermore , pls model was established to explore the differential metabolites caused by internal metabolic changes .
these results proved the perturbations of related pathway and demonstrated that organisms reach a relatively stable physical state to adapt to the training load after long - term training .
the study of metabolic adaption to different training level could help reveal the influence of long - term exercise on physiological status and provide useful information for formulating training programs . | monitoring physical training is important for the health and performance of athletes , and real - time assessment of fatigue is crucial to improve training efficiency . the relationship between key biomarkers and exercise has been reported .
the aim of this study was to determine the effects of different levels of training exercises on the urine metabolome .
1h nmr - based metabolomics analysis was performed on urine samples from half - pipe snowboarders , and spectral profiles were subjected to pca and pls - da .
our results show that metabolic profiles varied during different stages of exercises .
lactate , alanine , trimethylamine , malonate , taurine , and glycine levels decreased while tmao and phenylalanine levels increased in the stage with higher amount and intensity of exercise .
although the amount of exercise was reduced in subsequent stage , no significant variations of metabolic profile were found .
metabolic changes induced by training level were analyzed with related metabolic pathway .
studying metabolome changes can provide a better understanding of the physiology of athletes and could aid in adjusting training . |
benign paroxysmal positional vertigo ( bppv ) is a common disorder wherein brief episodes of vertigo and nystagmus are produced by certain changes of head position ( 1 - 3 ) .
dislodged otolithic debris may cause this disorder by attaching to the cupula and rendering it sensitive to head position ( cupulolithiasis)(4 ) , or by entering one of the semicircular canals and inducing endolymph flow by head motion ( canalolithiasis ) ( 5,6 ) .
the diagnosis of bppv depends on characteristic history of positioning vertigo and on typical patterns of nystagmus induced by the positional changes including hallpike maneuver or turning the head side to side in the supine position ( head turning test ) .
the nystagmus of the posterior canal type of bppv ( pc - bppv ) is typically torsional upbeating with the torsional component beating toward the lowermost ear ( 1 ) .
the nystagmus in the horizontal canal type of bppv ( hc - bppv ) may beat toward the ground ( geotropic ) ( -9 ) or away from the ground ( apogeotropic ) ( 10 ) while the head is turned to either side in the supine position .
the geotropic type of hc - bppv has been explained by canalolithiasis while the apogeotropic type has been ascribed to cupulolithiasis .
recently , torsional downbeat nystagmus during hallpike maneuver has been invoked to explain bppv from the anterior semicircular canal ( ac - bppv ) ( 11 - 14 ) . as the canalith repositioning maneuvers ( crm ) can result in rapid resolution of the symptoms and different maneuvers
should be applied to each patient depending on the canal involved ( 15 ) , delineation of the affected canal is very important in the diagnosis of bppv . to characterize demographic features , patterns of canal involvement , and response to crm in bppv , we retrospectively analyzed the profiles of the patients , who had been diagnosed as having bppv by trained neuro - otologists in seven dizziness clinics in korea .
we reviewed the records of patients with a diagnosis of bppv from seven dizziness clinics , and identified 1,692 patients who met the criteria of brief episodes of positional vertigo , and characteristic paroxysmal positional nystagmus confirmed by the neuro - otologists or recorded with oculography .
recruitment of the patients had been done from may 1997 to september 2003 , with the recruitment periods varying from 13 to 76 months among the clinics .
diagnosis of pc - bppv was made by the torsional upbeating nystagmus with the torsional component toward the lowermost ear during hallpike maneuver ( 1 ) .
hc - bppv was subdivided into canalolithiatic ( geotropic ) and cupulolithiatic ( apogeotropic ) types according to the nystagmus direction induced by head turning while lying down ( 7 - 10 ) .
paroxysmal torsional downbeating nystagmus with typical patterns of bppv during hallpike maneuver was classified into ac - bppv ( 11 - 15 ) . in cases of the nystagmus suggesting that two or more canals were involved ( different patterns of the nystagmus depending on the provoking positional maneuvers ) , the mixed type of bppv was diagnosed .
patients who reported a typical history suggestive of bppv but did not exhibit positional nystagmus during the positioning maneuvers were excluded . in most patients with ac - bppv and mixed type bppv ,
when the repeated crm did not result in resolution of the symptoms and signs , brain imaging was performed to rule out central pathologies .
the patients with paroxysmal positional nystagmus accompanied by related cns lesions were also excluded . for pc - bppv ,
modified epley procedure was advocated by most of the neuro - otologists . in canalolithiatic type of hc - bppv
, barbecue rotation maneuver was applied in most clinics . however , in some clinics and in a few patients with limitation in motion or without response even with repetitive rotation maneuvers , forced prolonged position was applied ( 16,17 ) . in patients with cupulolithiatic type of hc - bppv , most clinics performed head shaking maneuver first , which was followed by crm if transition to canalolithiasis was noted . in a few clinics , vibratory stimuli on the mastoid process were also tried . in some patients with ac - bppv ,
modified epley maneuver was tried after hallpike maneuver with an assumption that the otolithic debris were in the anterior canal of the ear toward the torsional component of the positioning nystagmus beat . in view of the frequent spontaneous resolution
, responses to crm were determined in only the patients who had the follow - up examination within 2 days after the initiation of crm .
study of demographic and clinical characteristics was focused on the type of bppv and response to crm .
statistical analyses included chi - square test for dichotomous variables and anova for continuous variables for comparison among the clinics .
we used pearson or spearman correlation analysis to seek the correlation between the proportion of the involved canals and variables .
we reviewed the records of patients with a diagnosis of bppv from seven dizziness clinics , and identified 1,692 patients who met the criteria of brief episodes of positional vertigo , and characteristic paroxysmal positional nystagmus confirmed by the neuro - otologists or recorded with oculography .
recruitment of the patients had been done from may 1997 to september 2003 , with the recruitment periods varying from 13 to 76 months among the clinics .
diagnosis of pc - bppv was made by the torsional upbeating nystagmus with the torsional component toward the lowermost ear during hallpike maneuver ( 1 ) .
hc - bppv was subdivided into canalolithiatic ( geotropic ) and cupulolithiatic ( apogeotropic ) types according to the nystagmus direction induced by head turning while lying down ( 7 - 10 ) .
paroxysmal torsional downbeating nystagmus with typical patterns of bppv during hallpike maneuver was classified into ac - bppv ( 11 - 15 ) . in cases of the nystagmus suggesting that two or more canals were involved ( different patterns of the nystagmus depending on the provoking positional maneuvers ) , the mixed type of bppv was diagnosed .
patients who reported a typical history suggestive of bppv but did not exhibit positional nystagmus during the positioning maneuvers were excluded . in most patients with ac - bppv and mixed type bppv ,
when the repeated crm did not result in resolution of the symptoms and signs , brain imaging was performed to rule out central pathologies .
for pc - bppv , modified epley procedure was advocated by most of the neuro - otologists . in canalolithiatic type of hc - bppv
, barbecue rotation maneuver was applied in most clinics . however , in some clinics and in a few patients with limitation in motion or without response even with repetitive rotation maneuvers , forced prolonged position was applied ( 16,17 ) . in patients with cupulolithiatic type of hc - bppv , most clinics performed head shaking maneuver first , which was followed by crm if transition to canalolithiasis was noted . in a few clinics , vibratory stimuli on the mastoid process were also tried . in some patients with ac - bppv ,
modified epley maneuver was tried after hallpike maneuver with an assumption that the otolithic debris were in the anterior canal of the ear toward the torsional component of the positioning nystagmus beat . in view of the frequent spontaneous resolution
, responses to crm were determined in only the patients who had the follow - up examination within 2 days after the initiation of crm .
study of demographic and clinical characteristics was focused on the type of bppv and response to crm .
statistical analyses included chi - square test for dichotomous variables and anova for continuous variables for comparison among the clinics .
we used pearson or spearman correlation analysis to seek the correlation between the proportion of the involved canals and variables .
bppv was more common in female irrespective of the subtypes ( female to male ratio of 2.1:1 ) .
the patients ' mean age was 54.814.0 yr . there was no difference in the mean age between women and men , and among the subtypes .
the mean time interval between the onset of the symptoms and the first visit to the clinics was 13.8120.0 days .
eighty - nine percents of the patients visited the clinics within 14 days after the symptom onset . the posterior canal was involved in 1,031 patients ( 60.6% , table 1 ) .
hc - bppv was found in 539 ( 31.9% ) patients . of hc - bppv ,
ac - bppv was identified only in 38 ( 2.2% ) , and mixed types in 84 ( 5.0% ) patients . among the mixed types , the combination of pc - bppv and hc - bppv was the most common ( 79.8% ) .
there was significant difference in the distribution of involved canals among the clinics ( p<0.05 ) .
we observed significant negative correlation between the proportion of hc - bppv of each clinic and the mean time interval from the symptom onset to the first visit to the clinic ( r=-0.841 , p<0.05 ) .
in contrast , significant positive correlation was noted between the proportion of pc - bppv and the mean time interval ( r=0.845 , p<0.05 ) .
however , no correlation was present between the mean age or sex proportion of the patients in each clinic and the proportion of each subtypes of bppv . in 78.7% of the patients ,
geotropic type of hc - bppv was most responsive ( 92.0% ) while ac - bppv was most refractory ( 76.2% ) .
our study showed demographic features of bppv similar to those reported previously in other countries ; higher incidence in women and mean age of 54.814.0 yr ( 1,16,18 ) .
there was no difference in the age between women and men , and among the subtypes .
higher incidence in women was found in all the subtypes of bppv . as in the previous studies , the posterior canal was most
however , the proportion of hc - bppv was higher ( 31.9% ) than previously reported .
most of the previous studies reported the proportion of hc - bppv between 5 and 20% ( 19 - 22 ) . considering that the proportion of hc - bppv was more than 25% in all the clinics except for one
, the higher proportion of hc - bppv in our study can not be ascribed to an incidental finding or diagnostic bias .
the reason for this high proportion of hc - bppv in our study remains to be elucidated . due to the relatively unrestricted medical referral system in korea
, patients can visit the neurootologic clinics readily without delay . actually , most of the patients in our study visited the clinic within 14 days after the symptom onset .
if the hc - bppv has higher rate of spontaneous resolution compared with other types of bppv ( 8,23 ) , the delayed diagnosis would result in lower proportion of hc - bppv , even though the exact interval from the symptom onset to the diagnosis was not available in most of the previous studies .
this seems to be reasonable if one considers the spatial orientations of each semicircular canal . in upright head posture
, the posterior canal hangs inferiorly and has its cupular barrier at its shorter , more dependent end .
any debris entering the canal essentially becomes trapped within it . in contrast , the horizontal canal slopes up and has its cupular barrier at the upper end .
therefore , free - floating debris in the horizontal canal would tend to drift back into the utricle more easily .
this explanation is also supported by the highest proportion of hc - bppv in the clinic ( clinic 1 ) which had the shortest time interval from the symptom onset to the clinic visit ( table 1 ) . a recent study with a mean interval of 124 days from the symptom onset to the treatment ,
much longer than ours , reported the proportion of hc - bppv at 8% ( 19 ) .
another study in japan also showed higher proportion of hc - bppv ( 30% ) as in korea ( 24 ) .
however , due to the interval from the symptom onset to the diagnosis was not available in that study , we could not determine whether the similar distribution originated from the ethnic origin or time interval from the symptom onset to the diagnosis .
the diagnosis of ac - bppv and mixed type of bppv is challenging , and central pathologies should be ruled out appropriately ( 25,26 ) .
previously , the proportion of ac - bppv has been reported up to 12% ( 11 ) . in our study , the mean proportion of ac - bppv was 2.2% with the highest being 5.3% .
concurrent involvements of more than one canal had also been recognized , with the combination of pcand hc - bppv being the most common ( 79.8% ) . in view of the frequent spontaneous resolution of bppv , we adopted a time window of 2 days to determine the efficacy of crm , and demonstrated high efficacy of this maneuver , irrespective of the subtypes of bppv . according to the previous studies ,
the epley maneuver has been effective in 70 to 100% of patients suffering from this disorder ( 27 - 29 ) . in our study , most neuro - otologists advocated modified epley maneuver for the treatment of pc - bppv , which showed resolution of the symptoms and signs in 87.8% of patients .
geotropic type of hc - bppv also showed resolution in 92% of patients with the barbeque rotation maneuver or force prolonged posture . in spite of the debates on the efficacy of head shaking or mastoid vibration before and during crm , those were applied to the patients with presumed cupulolithiatic type of bppv in some clinics . | benign paroxysmal positional vertigo ( bppv ) is characterized by episodic vertigo and nystagmus provoked by head motions . to study the characteristics of bppv in a large group of patients in korea
, we retrospectively analyzed clinical features of 1,692 patients ( women : 1,146 , 67.7% ; men : 54.6 , 32.3% ; mean age : 54.814.0 yr ) , who had been diagnosed as bppv by trained neuro - otologists dizziness clinics .
the diagnosis of bppv was based on typical nystagmus elicited by positioning maneuvers .
posterior semicircular canal was involved in 60.9% of the patients , horizontal canal in 31.9% , anterior canal in 2.2% , and mixed canals in 5.0% .
the horizontal canal type of bppv ( hc - bppv ) comprised 49.5% of geotropic and 50.5% of apogeotropic types
. we could observe significant negative correlation between the proportion of hc - bppv of each clinic and the mean time interval between the symptom onset and the first visit to the clinics ( r = -0.841 , p<0.05 ) .
most patients were successfully treated with canalith repositioning maneuvers ( 86.9% ) .
the high incidence of hc - bppv in this study may be explained by relatively shorter time interval between the symptom onset and visit to the dizziness clinics in korea , compared with previous studies in other countries . |
miller fisher syndrome ( mfs ) is characterized by the acute onset of external ophthalmoplegia , ataxia of cerebellar type , and the loss of tendon reflexes .
it is considered a variant of guillain - barr syndrome ( gbs ) , because some patients who present with mfs progress to gbs . in contrast , patients who show drowsiness , brisk reflexes , extensor plantar responses and hemisensory disturbance are usually considered to have bickerstaff 's brainstem encephalitis ( bbe ) rather than mfs . the fact that bbe and mfs share a common autoantibody suggests that they are closely related .
bickerstaff and cloake speculated that the etiology of bbe is similar to that of gbs because they found areflexia and cerebrospinal fluid albuminocytologic dissociation ; however , a case of overlapping mfs , gbs and bbe has not been fully reported .
a 72-year - old woman developed diplopia and unsteady gait in the morning ( day 1 ) a week after an upper respiratory infection .
she was admitted to our hospital due to weakness of both upper limbs on day 3 . on admission ,
the general physical examination was normal . on neurological examination , she had bilateral blepharoptosis .
her eyeballs were fixed in the central position . she had weakness of both upper limbs .
hematological investigation showed an elevated white blood cell count of 9,500/l ( segmented leukocytes , 86.5% ; lymphocytes , 10.5% ) , and her cerebrospinal fluid ( csf ) showed 2/l ( 100% mononuclear cells ) and 30 mg / dl protein . magnetic resonance imaging ( mri ) showed a normal brain .
we diagnosed mfs on day 1 , and she developed gbs on day 3 . on day 5 , she became drowsy , with a worsened respiratory status and weakness in all four limbs .
this condition was considered to be overlapping bbe . on day 12 , electroencephalography ( eeg ) showed background activity at 78 hz with no epileptiform discharges . on day 21
, a nerve conduction study of the right median nerve showed abnormal amplitude reductions in both the forearm and upper arm .
motor nerve conduction velocity in the left median nerve was decreased ( 44.3 m / s ) .
the sensory nerve action potential amplitude in both median nerves was reduced , and sensory nerve conduction velocity was normal . on day 51 ,
anti - gm1 igg , gd1a igg , gq1b igg , and gt1a igg antibodies were positive , and anti - gq1b igg antibody titer was the highest .
she underwent intravenous immunoglobulin therapy from day 3 to 7 and seven sessions of immunoadsorption therapy from day 14 to 28 . on day 30
we added intravenous immunoglobulin therapy from day 34 to 38 . on day 40 , she began to open her eyelids and move both eyeballs . on day 54 ,
her consciousness became alert . on day 56 , she was taken off the respirator . on day 63 , she could stand up , but the ataxic gait remained . on day 90 , she changed hospital for rehabilitation ( fig .
we report a case of overlapping mfs , gbs and bbe during the course of illness .
neurologically , the responsible lesions were suggested as the pyramidal tract , nuclear or infranuclear of the ocular motor nerves , brainstem reticular formation , cerebellum and peripheral nerves of the limbs .
we diagnosed her with mfs on day 1 , gbs on day 3 and overlapping bbe on day 5 .
overlapping mfs / gbs and bbe / gbs syndromes have been reported [ 3 , 4 , 5 , 6 , 7 , 8 , 9 ] ; however , only two case reports have described overlapping mfs / gbs / bbe syndrome ( table 1 ) .
arai et al . described a patient with bbe on day 1 , mfs on day 2 and gbs on day 5 in the presence of anti - gq1b antibody .
stevenson et al . described a patient with bbe on day 1 , gbs on day 9 , and mfs on day 10 in the presence of anti - gm1 antibody .
although these two patients underwent plasma exchange and intravenous immunoglobulin therapy , respectively , our patient required mechanical ventilation and underwent immunoadsorption therapy and two courses of intravenous immunoglobulin therapy .
anti - gm1 igg , gd1a igg , gq1b igg , and gt1a igg antibodies were positive in our case .
the abundant and synaptic - specific binding of anti - gq1b , -gt1a , and -gd1b ganglioside antibodies and the rich capillary supply in the human extraocular muscles may partly explain the selective paralysis of these muscles in mfs .
some large neurons of the dorsal root ganglia were immunostained with anti - gq1b monoclonal antibody .
gq1b also exists in nerve endings near the skeletal muscle spindle and anti - gq1b igg antibody may thus be associated with ataxia as well as ophthalmoplegia .
our case supports a previous proposal by odaka et al . that bbe , mfs , gbs and acute ophthalmoparesis are all part of a continuous clinical spectrum , which is an antibody - mediated process .
anti - gq1b antibody is detected in gbs , fs and bbe , so it is called anti - gq1b igg antibody syndrome , and is useful for understanding the etiological relationships among those illnesses .
because of the similarities in the clinical presentation and autoimmune etiology of mfs and bbe , a terminology fisher - bickerstaff syndrome may be helpful for nosology .
although the clinical picture , neurophysiology , and csf findings are usually sufficient to indicate therapies , the presence of antiganglioside antibodies is a useful guide to diagnose this group of conditions .
| we report a 72-year - old woman with overlapping miller fisher syndrome ( mfs ) , guillain - barr syndrome ( gbs ) and bickerstaff 's brainstem encephalitis ( bbe ) .
she developed diplopia and unsteady gait a week after an upper respiratory infection on day 1 .
she had weakness of both upper limbs on day 3 and became drowsy , and her respiratory status worsened on day 5 .
neurologic examination revealed ophthalmoplegia , ataxia , symmetrical weakness , areflexia , and consciousness disturbance .
we diagnosed her with mfs on day 1 , gbs on day 3 and overlapping bbe on day 5 .
she underwent immunoadsorption therapy and two courses of intravenous immunoglobulin therapy .
ten months after onset , her symptoms had fully recovered .
anti - gm1 igg , gd1a igg , gq1b igg , and gt1a igg antibodies were positive .
our case supports the notion that mfs , gbs , and bbe are all part of a continuous clinical spectrum , which is an antibody - mediated process . |
in the latter part of the 1990s , an alternative treatment for prostate cancer emerged where interstitial high dose rate ( hdr ) brachytherapy was applied as a boost in combination with external beam radiation therapy ( ebrt ) [ 15 ] . this brachytherapy treatment technique is also used for mono - therapy of prostate cancer for multiple fractions per implant or one fraction per implant [ 69 ] . since 2004 ,
the treatment technique has gradually been developed including major advances , such as the use of appropriate treatment planning systems [ 1012 ] .
the introduction of the new treatment planning system oncentra prostate ( elekta ab , stockholm , sweden ) , gave the possibility , in combination with trans - rectal ultrasound ( trus ) to in real time optimise the needle configuration and the dose distribution in an optimal 3d conformal way during the procedure .
all necessary corrections of needle displacement , movements , and/or deformation of clinical target volume ( ctv ) and organs at risk ( oars ) after placement of the needles in the fixed treatment geometry , can be performed for each fraction if one fraction per implant is used .
interstitial brachytherapy is an old radiation treatment technique based on an extended implanted volume of the ctv in order to reach optimal dose coverage .
even with the modern techniques of stepping source and dose optimization , there is a need for some over - implantation , especially with an ellipsoidal shaped volume like the prostate gland . at our department , the standardized activation of source dwell positions , including over - implantation , are localized 5 mm outside the ctv surface .
a possible consequence of the over - implantation is radiation damage to normal tissue close to the prostate gland .
a perfect dose coverage is crucial in mono - brachytherapy treatment , where only 1 - 3 fractions with very high dose are more commonly used .
therefore , there is an important balance in interstitial hdr brachytherapy treatment of prostate regarding the over - implantation by the active dwell positions outside ctv , and the possible damage on the adjacent normal tissue .
the aims of this study were : 1 ) to evaluate the possibility of activating dwell positions closer to the ctv surface , while maintaining the same dose distribution based on our dose constraints , and thereby minimise the extent of treating normal tissue around the ctv ; 2 ) to investigate the robustness of the dose distribution , in terms of known geometrical uncertainties .
thirty - seven patients were included into this retrospective study , who had received brachytherapy treatment for prostate cancer as a mono - therapy during 2010 - 2011 .
they had been treated according to two different treatment schedules : 2 14 gy and 3 11 gy .
the main setting - up of the first dwell position was 5 mm from the base - plane .
the relative dose constraint v100 for ctv as a volume , which is defined by 100 percentage of the prescribed dose was : v100 , ctv 97% .
the dose constraints for normal tissue , as a percentage of the prescribed reference dose , for both treatment schedules were : dmax , urethra 110% and d10 rectal mucosa 65% .
this study was approved by the local ethic committee ( dnr 2012/177 ) . the treatment technique involved a stepper unit with a needle template trus ( pro focus , bk medical , herlev , denmark ) and a treatment planning system oncentra prostate version 3.2.2/4.0.7 , ocp ( elekta ab , stockholm , sweden ) which was later integrated with ultrasound prosius ( elekta ab , stockholm , sweden ) .
a foley catheter was inserted into the bladder and an x - ray marker was placed into the catheter .
two anchor needles were placed into the prostate to prevent or minimise the longitudinal movement of the prostate gland .
a series of transversal us - images with a 1 mm slice thickness were acquired and converted to a 3d - volume .
a base plan was defined at the base of the prostate , as a longitudinal reference .
the ctv ( prostate capsule without a margin ) and urethra were outlined , and a simulated needle configuration was manually created , referred to as the pre - plan in ocp .
one inside the prostate gland 3 - 5 mm from the surface of the largest ctv - structure and the other was set to cover the apex and the base plane ( fig .
the first needle was placed with the tip positioned 25 mm above the pre - base plane ( the 1 dwell position is possible 10 mm from the needle top ) .
this takes into account , from our experience , a longitudinal movement of the prostate gland .
moreover , it allows to activate the first dwell position 5 mm above the base plane . after the determination of the insertion length of the first needle , the other needles were prepared to the same length .
an example of a virtual needle positioning , formed as a ring just inside ctv ( red solid line ) and one ring around urethra ( yellow ) if the prostate displacement was more than 10 mm , a correction was made of the needle length by pushing in all the needles an additional 10 mm .
sometimes it was not possible to achieve this , and the first dwell position will end up closer than 5 mm from the base which can result in an under dosage of the ctv . during the needle insertion , a needle position was corrected if necessary
. a needle can be added depending on the situation , e.g. interference from bones or due to real time circumstances .
after the needles were placed , a new baseplane was defined , reflecting the real longitudinal displacement of prostate gland and a new us - scan ( live scan ) was generated with the needles in place , defining the treatment geometry .
the us - probe was placed at the base plane and two orthogonal x - ray images were taken . in this reconstructed volume , new structures for ctv and oars were outlined .
corrections were made for the longitudinal and radial displacement of the needles , compared to the pre - plan , by reconstructing the needles .
the position of the needle tip in relation to the base plane was determined from the geometry , the lateral x - ray image , and the us scans in order to minimize the geometrical uncertainties in the longitudinal direction .
dwell positions were virtually activated in the needles , up to 5 mm outside the ctv .
finally , a dose distribution was obtained , based on inverse and graphical optimization , according to local dose constraints .
the evaluation was based on dose volume histogram ( dvh ) parameters . during the analyses ,
new dose optimizations were simulated for the given treatment geometry for different source dwell activations outside the ctv : 3 mm , 2 mm , 1 mm , and 0 mm . the dwell positions were activated according to the rules in the treatment planning system ( fig .
inverse optimization , followed by graphical optimization were used , trying to reach the relative dose constraints with the following priority ( a - c ) : ( a ) dmax , urethra 110% , ( b ) d10 rectal mucosa 65% , ( c ) v100 , ctv 97% . in order to evaluate the variations in the treated normal tissue volume outside the ctv ,
the normal tissue volume with a dose higher or equal to 100% can be calculated according to the following expression.1v100,normal tissue = v100,large - v100,ctv - v100,urethra
an example of needle configuration with dwell activation with and without 100%-isodose , 5 mm outside ctv surface ( a , c ) , and on the surface ( b , d ) .
the red surfaces show the outlined prostate ( ctv ) and the green surfaces illustrates the volumes where the dose constraint v100 were fulfilled dose volume histogram data was used to compare the simulated dose distributions with the original dose distribution .
the following dvh parameters were determined and described : ctv : v100 , v150 , v200 , d98 , d90 ; urethra : dmax , d10 ; rectal mucosa : d10 ; conformal index ( coin ) .
coin - index reflects the relation between the dose coverage of the ctv and the amount of irradiated normal tissue outside the ctv .
geometrical uncertainties in this treatment technique are mainly connected with the longitudinal direction of the needles .
these uncertainties include the reconstruction of the first dwell position , i.e. the needle tip ( 1.5 mm ) , mechanical positioning of the source in the needle ( 1 mm ) , and the length of a stainless needle ( 1 mm ) .
the intra - fraction movements of needles and prostate gland in this study was estimated to be in order of 1 mm , based on the work of milickovic et al . .
calculating an absolute error of these uncertainties will give an estimated total longitudinal geometrical uncertainty of 2.3 mm .
there is also an uncertainty of approximately 0.5 mm in the radial direction from the needle , which is not included in the analyses of this study . in analysis 1
, dwell positions were placed closer to the ctv surface for the simulated dose distributions then for the real one .
this will probably cause a dose distribution , which is more sensitive to organ and needle movements , i.e. less robust .
the patient geometries and their simulated dose distributions were used to simulate longitudinal displacements of the needles by retracting the needles and the dose distribution in relation to the ctv and oar : s ( fig .
the simulated displacements of 1 mm , 2 mm , 3 mm , and 4 mm were calculated in order to estimate the uncertainties .
an estimation of extent to which the robustness of the dose distribution will be changed by using dvh - data was performed . a 3d - image showing a visual relationship between ctv ( red ) and the reference dose ( green ) for : ( a ) no simulated needle displacement and ( b ) a simulated displacement of 4 mm .
blue region shows the position of the rectal mucosa the data from each group , with different dwell positioning in analysis 1 and for the simulated geometrical uncertainties in analysis 2 was tested for normality using the shapiro - wilk test .
all groups were then checked for significance ( p < 0.05 ) , both with paired students t - test if the data had a normal distribution ( parametrical test ) and wilcoxon signed - ranks test ( non - parametrical test ) for data not having a normal distribution .
thirty - seven patients were included into this retrospective study , who had received brachytherapy treatment for prostate cancer as a mono - therapy during 2010 - 2011 .
they had been treated according to two different treatment schedules : 2 14 gy and 3 11 gy .
the main setting - up of the first dwell position was 5 mm from the base - plane .
the relative dose constraint v100 for ctv as a volume , which is defined by 100 percentage of the prescribed dose was : v100 , ctv 97% .
the dose constraints for normal tissue , as a percentage of the prescribed reference dose , for both treatment schedules were : dmax , urethra 110% and d10 rectal mucosa 65% .
the treatment technique involved a stepper unit with a needle template trus ( pro focus , bk medical , herlev , denmark ) and a treatment planning system oncentra prostate version 3.2.2/4.0.7 , ocp ( elekta ab , stockholm , sweden ) which was later integrated with ultrasound prosius ( elekta ab , stockholm , sweden ) . between 15 and 20 stainless needles were used depending on the prostate volume .
a foley catheter was inserted into the bladder and an x - ray marker was placed into the catheter .
two anchor needles were placed into the prostate to prevent or minimise the longitudinal movement of the prostate gland .
a series of transversal us - images with a 1 mm slice thickness were acquired and converted to a 3d - volume .
a base plan was defined at the base of the prostate , as a longitudinal reference .
the ctv ( prostate capsule without a margin ) and urethra were outlined , and a simulated needle configuration was manually created , referred to as the pre - plan in ocp .
one inside the prostate gland 3 - 5 mm from the surface of the largest ctv - structure and the other was set to cover the apex and the base plane ( fig .
the first needle was placed with the tip positioned 25 mm above the pre - base plane ( the 1 dwell position is possible 10 mm from the needle top ) .
this takes into account , from our experience , a longitudinal movement of the prostate gland .
moreover , it allows to activate the first dwell position 5 mm above the base plane .
after the determination of the insertion length of the first needle , the other needles were prepared to the same length .
an example of a virtual needle positioning , formed as a ring just inside ctv ( red solid line ) and one ring around urethra ( yellow ) if the prostate displacement was more than 10 mm , a correction was made of the needle length by pushing in all the needles an additional 10 mm .
sometimes it was not possible to achieve this , and the first dwell position will end up closer than 5 mm from the base which can result in an under dosage of the ctv . during the needle insertion , a needle position was corrected if necessary .
a needle can be added depending on the situation , e.g. interference from bones or due to real time circumstances .
after the needles were placed , a new baseplane was defined , reflecting the real longitudinal displacement of prostate gland and a new us - scan ( live scan ) was generated with the needles in place , defining the treatment geometry .
the us - probe was placed at the base plane and two orthogonal x - ray images were taken . in this reconstructed volume , new structures for ctv and oars were outlined .
corrections were made for the longitudinal and radial displacement of the needles , compared to the pre - plan , by reconstructing the needles .
the position of the needle tip in relation to the base plane was determined from the geometry , the lateral x - ray image , and the us scans in order to minimize the geometrical uncertainties in the longitudinal direction .
dwell positions were virtually activated in the needles , up to 5 mm outside the ctv .
finally , a dose distribution was obtained , based on inverse and graphical optimization , according to local dose constraints .
the evaluation was based on dose volume histogram ( dvh ) parameters . during the analyses ,
new dose optimizations were simulated for the given treatment geometry for different source dwell activations outside the ctv : 3 mm , 2 mm , 1 mm , and 0 mm . the dwell positions were activated according to the rules in the treatment planning system ( fig .
inverse optimization , followed by graphical optimization were used , trying to reach the relative dose constraints with the following priority ( a - c ) : ( a ) dmax , urethra 110% , ( b ) d10 rectal mucosa 65% , ( c ) v100 , ctv 97% . in order to evaluate the variations in the treated normal tissue volume outside the ctv , a new volume ( called large ) encompassing the 100%-isodose
the normal tissue volume with a dose higher or equal to 100% can be calculated according to the following expression.1v100,normal tissue = v100,large - v100,ctv - v100,urethra
an example of needle configuration with dwell activation with and without 100%-isodose , 5 mm outside ctv surface ( a , c ) , and on the surface ( b , d ) .
the red surfaces show the outlined prostate ( ctv ) and the green surfaces illustrates the volumes where the dose constraint v100 were fulfilled dose volume histogram data was used to compare the simulated dose distributions with the original dose distribution .
the following dvh parameters were determined and described : ctv : v100 , v150 , v200 , d98 , d90 ; urethra : dmax , d10 ; rectal mucosa : d10 ; conformal index ( coin ) .
coin - index reflects the relation between the dose coverage of the ctv and the amount of irradiated normal tissue outside the ctv .
geometrical uncertainties in this treatment technique are mainly connected with the longitudinal direction of the needles .
these uncertainties include the reconstruction of the first dwell position , i.e. the needle tip ( 1.5 mm ) , mechanical positioning of the source in the needle ( 1 mm ) , and the length of a stainless needle ( 1 mm ) .
the intra - fraction movements of needles and prostate gland in this study was estimated to be in order of 1 mm , based on the work of milickovic et al . .
calculating an absolute error of these uncertainties will give an estimated total longitudinal geometrical uncertainty of 2.3 mm .
there is also an uncertainty of approximately 0.5 mm in the radial direction from the needle , which is not included in the analyses of this study . in analysis 1 ,
dwell positions were placed closer to the ctv surface for the simulated dose distributions then for the real one .
this will probably cause a dose distribution , which is more sensitive to organ and needle movements , i.e. less robust .
the patient geometries and their simulated dose distributions were used to simulate longitudinal displacements of the needles by retracting the needles and the dose distribution in relation to the ctv and oar : s ( fig .
the simulated displacements of 1 mm , 2 mm , 3 mm , and 4 mm were calculated in order to estimate the uncertainties .
an estimation of extent to which the robustness of the dose distribution will be changed by using dvh - data was performed . a 3d - image showing a visual relationship between ctv ( red ) and the reference dose ( green ) for : ( a ) no simulated needle displacement and ( b ) a simulated displacement of 4 mm .
the data from each group , with different dwell positioning in analysis 1 and for the simulated geometrical uncertainties in analysis 2 was tested for normality using the shapiro - wilk test .
all groups were then checked for significance ( p < 0.05 ) , both with paired students t - test if the data had a normal distribution ( parametrical test ) and wilcoxon signed - ranks test ( non - parametrical test ) for data not having a normal distribution . the spss software was used for the statistical analyses .
the matrix in figure 4 summarize the results in terms of fulfilling the dose constraint v100 , ctv 97% for the different dwell activation positions and longitudinal displacements . in the case of no longitudinal displacement ,
the dose constraint v100 , ctv 97% was fulfilled for 30 patients with a dwell activation 3 mm from the ctv surface , 20 patients for 2 mm , 2 patients for 1 mm , and none for 0 mm . as the longitudinal needle displacement increased from 1 mm to 4 mm ,
the original dose distribution decreased for all dwell positions outside the ctv . for the dwell position of 5 mm outside the ctv , the v100 , ctv decreased significantly from 98.6% ( no displacement ) to 95.4% for a displacement of 4 mm . for a displacement of 3 mm , the mean value of v100
, ctv also decreased to a value lower than the dose constraint of 97% , but the difference was not significant .
the mean values for v100 , ctv and number of patients fulfilling v100 , ctv > 97% for dwell activation at 3 mm , 2 mm , 1 mm , and 0 mm from the ctv surface in combination with the simulated needle displacement of 1 mm to 4 mm in the longitudinal direction .
green surfaces where v100 , ctv 97% and red surfaces where v100 , ctv 95%
figure 5 shows an individual example of dvh curves from the different simulations .
the dashed curves shows how the dvh changes compared to the original dvh ( solid line ) when the most distal dwell positions coincides with the surface of ctv ( fig .
dvh curves for ctv : ( a - d ) ( ---------------- ) dwell positions placed 5 mm from the ctv surface , ( b - d ) ( - - - - - - - ) in combination with the dwell positions placed on the ctv surface ( b ) , simulated needle displacement of 4 mm in the longitudinal direction ( c ) with dwell positions placed on the ctv surface and simulated needle displacement of 4 mm in the longitudinal direction ( d ) the dose volume parameters obtained from the simulations are presented in table 1 .
the dose constraints , dmax , urethra 110% , and d10 rectal mucosa 65% were fulfilled in almost all the simulations .
the mean values for the different dwell activation were for dmax , urethra and d10 , mucosa 109.9% , and 56% , respectively .
the dose to rectal mucosa was almost not affected by the simulations as can be seen from the mean value .
mean values ( m ) , standard deviation and range for dose volume parameters from simulated dose distributions for different distances of dwell positioning from ctv surface .
the asterix ( * ) indicates group comparisons where no statistical difference ( p < 0.01 ) occurred the mean prostate volume for the patients included in this study was 36 cm ( range : 21 - 58 cm ) .
the mean values of the normal tissue volume around the ctv given a dose of 100% or higher ( v100 , normal tissue ) for source dwell activations of 5 to 0 mm from the ctv surface were 17 cm to 9 cm .
the results for v150 , normal tissue and v200 , normal tissue for the same dwell activations varied from 3.0 cm to 1.7 cm , and from 1.0 cm to 0.7 cm . when comparing the dwell activation groups 5 - 3 , 3 - 2 , 2 - 1 , 1 - 0
, there were a significant difference between the groups for normal tissue , ctv , and coin - index ( p < 0.01 ) , except for a few values indicated with an asterix ( * ) in table 1 .
there are several decisions that have to be considered when treating prostate cancer with brachytherapy .
this study has focused on geometrical uncertainties and the positioning of the dwells relative to the ctv , and the surrounding normal tissue .
the results of analysis 1 showed that it is possible to reduce the treated normal tissue around the prostate gland by reducing source dwell activations outside the prostate gland .
the mean value of the volume v100 , normal tissue with dwell activation at 5 mm from the prostate surface ( clinical situation ) was 17 cm , whilst for 2 - 12 cm ( simulation ) .
if these volumes instead were related to an added radius on the prostate gland by approximating the prostate gland volume ( 36 cm ) to a sphere , the radius would be 3 mm and 2.5 mm , respectively .
the results also showed a decrease in v150 , normal tissue and v200 , normal tissue when going from source dwell activation at 5 mm to dwell activation on the ctv surface , but v150 , ctv and v200 , ctv was increasing .
this means that these volumes , v150 , ctv and v200 , ctv are gradually increasing within the prostate gland and the risk of interference with the urethra is increased . in recent review studies [ 17 , 18 ] ,
the uncertainties in brachytherapy has been investigated . for the treatment technique used in this study (
trus guided 3d conformal interstitial brachytherapy hdr of prostate cancer ) , the geometrical uncertainty has been estimated to be in order of 1.5 mm .
found in a phantom study a geometrical uncertainty for a stainless needle , of 1 - 3 mm depending on different us - transducers and different us - modes ( transversal and sagittal ) .
investigated for a similar treatment technique the effect of patient movement and anatomy change on needle and organ dislocation during treatment , and found under these conditions a geometrical shift less than 1 mm .
they also pointed out the importance of a good qa to be able to keep the geometrical uncertainties as low as possible by keeping the planning geometry fixed during the treatment procedure . in this study ( analysis 2 ) we demonstrated that with the geometrical uncertainty of approximately 2 mm and with dwell activation 2 mm outside the ctv , none of the patients reached or exceeded the dose constraints . in order to fulfil the dose constraints for 95% of the patients , source dwell activation needs to be 5 mm outside the ctv as a dosimetric margin .
even if this treatment technique has very small geometric uncertainties of around 2 mm or less , there is a need for a margin on the ctv to guarantee that the dose constraints are met .
if a geometrical margin is chosen , there is a need to define a ptv ( planning target volume ) from the ctv .
the results shown in this study are of course dependent on the chosen dose constraints .
changing the dose constraints for a lower v100 , ctv , higher dmax , urethra , and d10 rectal mucosa would probably decrease the dosimetric margin . in a similar simulation study , ikk kolkman - deurloo et al
. showed that for a treatment technique with multiple fractions per implant , a 3 mm displacement implied that none of the patients reached the dose constraint v100 93% . applying the results in this study based on geometrical uncertainties and a treatment technique with a single fraction per implant , to the same dose constraint used would imply that the dosimetric margin would be in the order of 1 - 2 mm and still the v100 93% would be achieved . clinical outcome from other studies with different dose constraints
there is only a small increase in the coin - index when going from dwell positioning of 5 mm to 0 mm from the ctv surface .
this is probably due to the decrease of the coverage ( v100 ) of ctv when the irradiated normal tissue outside the ctv is decreasing .
as could be seen in table 1 , d90 is not decreasing for the simulation of dwell positioning down to 2 mm , it is actually increasing when going from 5 mm ( 107.3% ) to 3 mm ( 108.3% ) with p < 0.001 . at our hospital
we are not using d90 as a dose constraint , since it is regarded as too insensitive compared to v100 when analysing dose distributions .
it is possible to reduce the treated normal tissue volume by reducing the dwell activation to 3 mm from the surface and still maintain the dose constraints .
however , in combination with the estimated geometrical uncertainties , a dwell activation 5 mm from the surface is needed to maintain an accurate dose distribution with a v100 , ctv 97% .
this might be seen as a dosimetric margin which could be converted to a geometrical margin and would be evaluated in future work .
| purposedose coverage is crucial for successful treatment in mono - brachytherapy .
since few and very high dose fractions are used , there is an important balance between dwell positioning outside the clinical target volume ( ctv ) and possible damage on adjacent normal tissue .
the purpose of this study was to evaluate the possibility of having dwell positions close to the ctv surface , while maintaining an acceptable dose distribution , and to investigate the robustness in terms of known geometrical uncertainties of the implant.material and methodsthis study included 37 patients who had received brachytherapy for prostate cancer as a monotherapy with the following schedules : 2 14 gy or 3 11 gy , each fraction separated by two weeks .
the source dwell positions were activated 5 mm outside ctv .
new optimizations were simulated for dwell positions at 3 , 2 , 1 , and 0 mm .
inverse and graphical optimization were applied according to the relative dose constraints : v100 ctv 97% , dmax , urethra 110% , and d10 rectal mucosa 65% .
the v100 , normal tissue outside ctv was used to evaluate dose variations caused by different dwell positions .
prostate geometries and dose distributions for the different dwell positions outside the ctv were used to investigate the impact on the ctv dose distribution due to geometrical uncertainties.resultsboth v100 , ctv , and v100 , normal tissue decreased , 98.6% to 92.2% , and 17 cm3 to 9.0 cm3 , for dwell activation from 5 mm to 0 mm .
the evaluation of both simulated longitudinal geometrical uncertainties and different source dwell activations implied that v100 , ctv ranged from 98.6% to 86.3%.conclusionsit is possible to reduce the v100 , normal tissue by decreasing the source dwell positions outside the ctv from 5 to 3 mm , while maintaining dose constraints . in combination with the estimated geometrical uncertainties , however
, the source dwell positions need to be 5 mm from the surface in order to maintain a robust implant . |
ischemic stroke is the third leading cause of death and the first leading cause of disability in adults around the globe .
stroke is accompanied by a robust inflammatory response , glutamate mediated excitotoxicity , release of reactive oxygen species and the initiation of apoptosis(1 ) .
malignant middle cerebral artery infarction is the most common cause of death during the first week after an ischemic stroke ( 2 ) .
it is defined as a brain infarction affecting most or all of the mca territory , accompanied within days by a massive brain edema causing increased intracranial pressure ( icp ) , clinical deterioration and transtentorial herniation .
the therapeutic window of acute ischemic stroke for thrombolysis drug usage is short and has side effects including higher risk of intracranial hemorrhage ( ich ) ( 3 ) . because of this and other complications ,
use of thrombolysis drug like recombinant tissue plasminogen activator ( rt - pa ) is limited . some experimental research and clinical works
have reported the neuroprotective effect of mild hypothermia ( mh ) and moderate hypothermia ( 4 - 6 ) .
stabilization of the blood brain barrier , down regulation of cerebral metabolism , decrease of excitatory transmitter release and decrease generation of free radicals are of some neuroprotective mechanisms of hypothermia ( 7 , 8) .
several excellent articles have reviewed the protective effects of hypothermia as function of onset time , duration , and depth of hypothermia , as well as its underlying protective mechanisms ( 9 - 11 ) .
this procedure is induced by different methods including : surface - cooling blankets and adhesive pads , the use of an endovascular cooling system and sometimes cold intravenous fluids .
prolonged systemic hypothermia however has some side effects including myocardial arrhythmia , dehydration and blood hypercoagulability ( 12 ) .
there are some experimental and clinical studies indicate that decompressive craniectomy ( dc ) significantly reduced mortality and improved clinical outcomes ( 13 - 16 ) . as an alternative therapy , surgical decompression techniques ( large hemicraniectomy with durotomy ) have been proposed to relieve the high intracranial pressure ( 17 - 19 ) . on the other hand ,
combined general hypothermia and dc yield significant additional benefit including infarct size and neurological scores compared with singular effect of them ( 20 ) .
the combination of mh and minocycline had a small but not significantly additional effect over the single treatments after focal cerebral ischemia in the rat ( 21 ) .
although it has been shown that selective brain hypothermia was neuroprotective in experimental stroke ( 22 ) but , to our knowledge , there are no data available indicating therapeutic effect of direct local cerebral hypothermia with craniectomy in acute ischemic stroke .
therefore , we investigated whether a combination of dc with the local hypothermia , may provide more neuroprotection during the permanent mcao ( middle cerebral artery occlusion ) model of stroke in rats .
male wistar rats were anesthetized with halothane 1% to 1.2% under spontaneous respiration in an air - oxygen mixture .
rectal temperature was maintained between 37c and 37.5c with a thermostat - controlled heating pad .
the right femoral artery was cannulated and physiological parameters including rectal temperature , mean blood pressure , ph , po2 , and pco2 , were monitored .
forty eight male wistar rats ( weighing 220 to 300 g ) were allocated to 4 treatment groups of 12 animals each ( 8 for infarct volume and neurological outcomes and 4 for evans blue ) as following : control , decompressive craniectomy ( dc ) , local hypothermia ( lh ) , hypothermia combined with craniectomy ( hc ) .
focal cerebral ischemia was induced using a modified intraluminal suture method as described previously ( 23 ) . in brief , the bifurcation of right common carotid artery was exposed through a midline incision .
the internal carotid artery and external carotid artery were distally dissected , free from the surrounding tissues under an operating microscope .
after ligation of the external and common carotid arteries , a 30 silicon rubber - coated monofilament was gently inserted through the common carotid artery into the internal carotid artery to 18 - 20 mm beyond the carotid bifurcation at the base of the middle cerebral artery .
then , the distal end of monofilament was tied up and the wound was closed using the surgical suture . the cerebral blood flow ( cbf ) in parietal cortex
the filament was advanced until laser doppler flowmetry indicated adequate mca occlusion by a sharp decrease in ipsilateral blood flow .
the rat was considered as a successful occlusion when its cbf reduced at least to 30% of initial flow .
was made and the parietal and temporal bone was exposed entirely . then the scalp was kept cold for 15 min by pouring 4c normal saline ( two drops per second ) over it .
contralateral temporalis muscle temperature has been reported to approximate closely to the intraparenchymal brain temperature ( 24 ) .
dc was performed in animals by creating a bone flap ( 10 5 mm ) in the temporal and parietal bone with the use of a dental drill .
additional bone was removed under microscopic control with the use of microscissors ( 14 , 20 ) .
no cortical resection of infracted brain was attempted . at the end of the procedure ,
the temporalis muscle and skin flap were adapted and sutured in place . at 48 hr after stroke
, rats were decapitated ; brains removed and cut in to 2 mm coronal sections using a rat brain matrix .
infarct volume was quantified in sections stained with 2% 2,3,5-triphenyltetrazolium chloride using image j analyzer ( nih image , version 1.61 ) ( 25 ) .
the total volume of each hemisphere and infarction was determined by integration of distance of the 6 sections .
infarctions were adjusted to the size of contralateral hemisphere by applying the following formula : infarct volume = ( volume of left hemisphere- ( volume of right hemisphere - measured infarct volume))/volume of left hemisphere ( 26 ) . for these analyses ,
rats were trained on the adhesive removal test of sensorimotor function ( 27 ) , daily for 3 days before stroke .
animals were then tested before surgery and
at 24 and 48 hr post - stroke .
time taken to touch and remove each stimulus from the limb was recorded during 3 trials and averaged .
neurological deficits were recorded at 24 and 48 hr after stroke and determined with a modified 6-point scoring system of bederson and coworkers ( 28 ) as follows : 0 , no observable deficit ; 1 , forelimb flexion ; 2 , forelimb flexion plus decreased resistance to lateral push ; 3 , unidirectional circling ; 4 , unidirectional circling plus decreased level of consciousness ; and 5 , death .
endurance in the wire - hanging test was measured on a horizontal steel wire ( 1 mm ) stretched horizontally 50 cm above a foam pad . for the pole test
, the rat was placed head upward on the top of a vertical wooden rough - surfaced pole ( diameter 1 cm , height 50 cm ) .
each rat was habituated on the day before testing then allowed to descend 5 times on a single session .
the total time needed to turn completely head downward ( time - to - turn ) and the time until the animal reached the floor with its 4 paws ( time - to - come - down ) was recorded .
bbb permeability was determined using evans blue dye ) eb ) extravasation technique , as described earlier ( 30 , 31 ) .
briefly , a catheter was placed into the jugular vein through which 4 ml / kg of eb solution ( 2% evans blue in normal saline , sigma , germany ) was infused into the animal during 5 min period . then , the animal was allowed to completely recover for at least 30 min . after killing the animal with an overdose of sodium thiopental and opening the chest , a catheter was placed into the left ventricle to infuse 300 ml of warm normal saline ( 37c ) for 15 min in order to washout the remains of eb from general circulation . following decapitation , the brain was gently excised
, its cerebellum and olfactory bulb were separated , and the rest was divided into the right and left hemispheres with a brain matrix . each hemisphere was carefully weighed and absorption was measured by a spectrophotometer ( uv7500 , spectro lab , england ) at 620 nm .
physiological parameters and behavioral tests were compared by two - way anova and individual differences determined by tukey s test .
infarct volume and bbb permeability were compared by one - way anova followed by tukey s test . a value of p < 0.05 was considered to be significant .
male wistar rats were anesthetized with halothane 1% to 1.2% under spontaneous respiration in an air - oxygen mixture .
rectal temperature was maintained between 37c and 37.5c with a thermostat - controlled heating pad .
the right femoral artery was cannulated and physiological parameters including rectal temperature , mean blood pressure , ph , po2 , and pco2 , were monitored .
forty eight male wistar rats ( weighing 220 to 300 g ) were allocated to 4 treatment groups of 12 animals each ( 8 for infarct volume and neurological outcomes and 4 for evans blue ) as following : control , decompressive craniectomy ( dc ) , local hypothermia ( lh ) , hypothermia combined with craniectomy ( hc ) .
focal cerebral ischemia was induced using a modified intraluminal suture method as described previously ( 23 ) . in brief , the bifurcation of right common carotid artery was exposed through a midline incision .
the internal carotid artery and external carotid artery were distally dissected , free from the surrounding tissues under an operating microscope .
after ligation of the external and common carotid arteries , a 30 silicon rubber - coated monofilament was gently inserted through the common carotid artery into the internal carotid artery to 18 - 20 mm beyond the carotid bifurcation at the base of the middle cerebral artery .
then , the distal end of monofilament was tied up and the wound was closed using the surgical suture . the cerebral blood flow ( cbf ) in parietal cortex
the filament was advanced until laser doppler flowmetry indicated adequate mca occlusion by a sharp decrease in ipsilateral blood flow .
the rat was considered as a successful occlusion when its cbf reduced at least to 30% of initial flow .
was made and the parietal and temporal bone was exposed entirely . then the scalp was kept cold for 15 min by pouring 4c normal saline ( two drops per second ) over it .
contralateral temporalis muscle temperature has been reported to approximate closely to the intraparenchymal brain temperature ( 24 ) .
dc was performed in animals by creating a bone flap ( 10 5 mm ) in the temporal and parietal bone with the use of a dental drill .
additional bone was removed under microscopic control with the use of microscissors ( 14 , 20 ) .
no cortical resection of infracted brain was attempted . at the end of the procedure ,
at 48 hr after stroke , rats were decapitated ; brains removed and cut in to 2 mm coronal sections using a rat brain matrix .
infarct volume was quantified in sections stained with 2% 2,3,5-triphenyltetrazolium chloride using image j analyzer ( nih image , version 1.61 ) ( 25 ) .
the total volume of each hemisphere and infarction was determined by integration of distance of the 6 sections .
infarctions were adjusted to the size of contralateral hemisphere by applying the following formula : infarct volume = ( volume of left hemisphere- ( volume of right hemisphere - measured infarct volume))/volume of left hemisphere ( 26 ) . for these analyses ,
rats were trained on the adhesive removal test of sensorimotor function ( 27 ) , daily for 3 days before stroke .
animals were then tested before surgery and
at 24 and 48 hr post - stroke .
time taken to touch and remove each stimulus from the limb was recorded during 3 trials and averaged .
neurological deficits were recorded at 24 and 48 hr after stroke and determined with a modified 6-point scoring system of bederson and coworkers ( 28 ) as follows : 0 , no observable deficit ; 1 , forelimb flexion ; 2 , forelimb flexion plus decreased resistance to lateral push ; 3 , unidirectional circling ; 4 , unidirectional circling plus decreased level of consciousness ; and 5 , death .
endurance in the wire - hanging test was measured on a horizontal steel wire ( 1 mm ) stretched horizontally 50 cm above a foam pad . for the pole test
, the rat was placed head upward on the top of a vertical wooden rough - surfaced pole ( diameter 1 cm , height 50 cm ) .
each rat was habituated on the day before testing then allowed to descend 5 times on a single session .
the total time needed to turn completely head downward ( time - to - turn ) and the time until the animal reached the floor with its 4 paws ( time - to - come - down ) was recorded .
bbb permeability was determined using evans blue dye ) eb ) extravasation technique , as described earlier ( 30 , 31 ) .
briefly , a catheter was placed into the jugular vein through which 4 ml / kg of eb solution ( 2% evans blue in normal saline , sigma , germany ) was infused into the animal during 5 min period .
after killing the animal with an overdose of sodium thiopental and opening the chest , a catheter was placed into the left ventricle to infuse 300 ml of warm normal saline ( 37c ) for 15 min in order to washout the remains of eb from general circulation . following decapitation ,
the brain was gently excised , its cerebellum and olfactory bulb were separated , and the rest was divided into the right and left hemispheres with a brain matrix . each hemisphere was carefully weighed and absorption was measured by a spectrophotometer ( uv7500 , spectro lab , england ) at 620 nm .
physiological parameters and behavioral tests were compared by two - way anova and individual differences determined by tukey s test .
infarct volume and bbb permeability were compared by one - way anova followed by tukey s test . a value of p < 0.05 was considered to be significant .
there were no statistically significant differences between groups for intra operative physiological indices ( table 1 ) .
infarct volume in control group was 307.34 18.09 mm and the difference between control and hypothermia ( 82.05 12.86 mm ) , craniectomy ( 137.88 30.38 mm ) and hc ( 27.40 17.61 mm ) groups were statistically significant ( p < 0.001 ; figure 1 ) .
combination therapy with lh and dc were more neuroprotective than dc alone ( p<0.01 ; figure 1 ) .
data of hanging test showed that only hc significantly increased endurance time at 24 or 48 hr after ischemia ( p<0.01 ) , but neither lh nor dc showed any significant difference ( figure 2 ) . while compared to the control group , sticky tape test ( p<0.05 at 24 hr ; p<0.001 at 48 hr ; figure 3 ) showed better behavioral performance only in hc , bederson test showed improved behavioral functions of both lh ( p<0.05 at 24 hr and p<0.01 at 48 hr ) and hc animals ( p<0.01 ) .
neurological deficits were also decreased in lh ( p<0.05 ) or hc ( p<0.05 at 24 hr ; p<0.01 at 48 hr ) groups compared to the dc group at the same times ( figure 4 ) .
absorption values in control , dc , lh and hc were 0.42 0.11 , 0.11 0.01 , 0.10 0.02 and 0.05 0.01 , respectively . compared to the control group , dc ( p<0.05 ) lh and hc ( p<0.01 ) significantly decreased absorption ( figure 5 ) .
although mean absorption were more decreased in combination therapy , there were no significant differences between it and the other groups .
contralateral temporal muscle temperatures were measured by a temporal probe . as expected , there was no significant difference in brain temperature between the control and dc groups . in both lh ( p<0.01 ) and hc ( p<0.001 ) groups ,
brain temperature decreased compared to the control group . compared to the dc group , lh and
infarct volume in control group was 307.34 18.09 mm and the difference between control and hypothermia ( 82.05 12.86 mm ) , craniectomy ( 137.88 30.38 mm ) and hc ( 27.40 17.61 mm ) groups were statistically significant ( p < 0.001 ; figure 1 ) .
combination therapy with lh and dc were more neuroprotective than dc alone ( p<0.01 ; figure 1 ) .
data of hanging test showed that only hc significantly increased endurance time at 24 or 48 hr after ischemia ( p<0.01 ) , but neither lh nor dc showed any significant difference ( figure 2 ) . while compared to the control group , sticky tape test ( p<0.05 at 24 hr ; p<0.001 at 48 hr ; figure 3 ) showed better behavioral performance only in hc , bederson test showed improved behavioral functions of both lh ( p<0.05 at 24 hr and p<0.01 at 48 hr ) and hc animals ( p<0.01 ) .
neurological deficits were also decreased in lh ( p<0.05 ) or hc ( p<0.05 at 24 hr ; p<0.01 at 48 hr ) groups compared to the dc group at the same times ( figure 4 ) .
absorption values in control , dc , lh and hc were 0.42 0.11 , 0.11 0.01 , 0.10 0.02 and 0.05 0.01 , respectively . compared to the control group , dc ( p<0.05 ) lh and hc ( p<0.01 ) significantly decreased absorption ( figure 5 ) . although mean absorption were more decreased in combination therapy , there were no significant differences between it and the other groups .
contralateral temporal muscle temperatures were measured by a temporal probe . as expected , there was no significant difference in brain temperature between the control and dc groups . in both lh ( p<0.01 ) and hc ( p<0.001 ) groups ,
brain temperature decreased compared to the control group . compared to the dc group , lh and
to the best of our knowledge , there are no available data for the effect of directly local brain hypothermia through craniectomy on stroke in rodents .
thus , the novelty of the current study is that we investigated delayed effect of direct brain hypothermia , by opening the scalp , on permanent focal cerebral ischemia in rat .
we observed that both late decompressive craniectomy and local hypothermia decrease infarct volume but combination of them has more neuroprotective effects .
some studies showed that early decompressive craniectomy could significantly decrease infarct volume and mortality rates ( 24 , 32 ) , that were parallel with our study .
many investigators have reported that general hypothermia decreases infarct volume in different models of stroke in rat ( 4 , 8) . on the other hand ,
neuroprotective effect of focal brain hypothermia through scalp has been reported ( 33 ) and mentioned it as a effectual , simple , cost - effective and safe hypothermia method in rats . since neurological evaluations have more clinical importance in stroke patients , we used batteries of neurological tests in the current study .
quantitive neurological evaluations including sticky tape or hanging - wire tests showed that only combination of both craniectomy and local hypothermia improved behavioral functions .
on the other hand , bederson s neurological deficits test showed that local hypothermia alone or its combination with craniectomy is neuroprotective .
only a few studies have examined the influence of hypothermia on delayed reperfusion after ischemic injury . in parallel with our findings , it has been suggested that general hypothermia also improved neurological performances in temporary middle cerebral artery occlusion ( 5 ) .
more interestingly , when applied up to 6 hr after ischemia insult , general hypothermia has decreased neurological deficits after stroke ( 34 ) .
furthermore , we observed that both craniectomy and local hypothermia prevent bbb disruption and although combination of them was more effective , this difference was not significant .
it has been recently reported that combination of general hypothermia and minocycline may also prevent bbb disruption through matrix metalloproteinase ( mmp ) inhibition in focal cerebral ischemia ( 21 ) .
different neuroprotective mechanisms for hypothermia have been postulated including : stabilization of the blood brain barrier , down regulation of cerebral metabolism , elimination of excitatory transmitter release and reduction of free radical generation ( 7 , 8 , 35 ) .
it has been suggested that the attenuation of oxidative dna damage and dna damage triggered pro - death signaling events can be an important mechanism for neuroprotective effect of mild hypothermia in cerebral ischemia ( 36 ) .
protection of basal lamina , reduction in infarct volume and hemorrhage , and reduction in proteolytic enzymes are some of other neuroprotective mechanisms of hypothermia ( 37 ) .
reduction of neuronal inflammation was also mentioned as a main contributor in neuroprotective effects of post - ischemic mild hypothermia ( 38 ) . despite of these advantages of general hypothermia ,
some adverse effects have been limited its using such as myocardial arrhythmia , hypotension , blood hypercoagulability , and hemodynamic instability ( 12 , 39 ) .
a comparison between different methods of hypothermia including intracarotid cold saline infusion , ice cap , and systemic cooling was investigated showing that the former was more effective than other methods ( 40 ) .
hence , these findings suggest that methods like intracarotid cold saline infusion and our current method of directly exposed brain cooling are strategies that not only reveal more neuroprotective effects of hypothermia but also prevent the side effects of general hypothermia . combinations of hypothermia with other methods have been evaluated in some studies .
one study reported that combination therapy of hypothermia with mgso4 reduced infarct volumes at 2 hr and 4 hr after permanent mcao but there was no therapeutic effect at 6 hr or in hypothermia and mgso4 groups singularly ( 41 ) .
another study showed that combination of citicoline with hypothermia suppressed apoptotic processes that are more effective than using each of them lonely ( 42 ) .
jieyong et al showed that the combination between craniectomy and mild hypothermia reduce the infarction size ( 43 ) .
doerfler et al ( 2001 ) showed that combination of decompressive craniectomy at 4 hr after mcao with mild hypothermia have diminished the infarct volume and improved neurological outcomes ( 20 ) .
we increased the therapeutic window of cerebral ischemia to 6 hr by directly local cerebral hypothermia through combination of craniectomy and using of cold saline .
in contrast with the above , we used direct local cerebral hypothermia for 15 min in our experiment .
the brain temperature was decreased to 31.5c in local hypothermia group and 28.5c in combination therapy group , while body temperature was maintained at normal range by warm pad ( 36.5 - 37c ) .
this temperature is lesser than the mild hypothermia which used in most studies ( 33c ) ( 20 , 39 ) .
therefore , we decreased the complication of general hypothermia whereas we increased the depth of hypothermia .
the end point of our study was 48 hr because the animals were become sick and they loosed weight .
our findings reveal that although late decompressive craniectomy and local hypothermia decrease infarct volume , delayed directly brain hypothermia , by opening the scalp , is more neuroprotective in stroke therapy .
further studies are needed to evaluate the best starting time of hypothermia , durations as well as its exact neuroprotective mechanisms . | objective(s ) : hypothermia and decompressive craniectomy ( dc ) have been shown to be neuroprotective .
this study was designed to evaluate neuroprotective effects of delayed singular or combination of dc and local hypothermia on stroke .
materials and methods : cerebral ischemia was induced in 48 wistar rats assigned to 4 groups : control , decompressive craniectomy ( dc ) , local hypothermia ( lh ) , combination of hypothermia and craniectomy ( hc ) .
infarct size and bbb disruption were measured 48 hr after ischemia insult .
neurological deficits were assessed at 24 and 48 hr after stroke by using sticky tape test , hanging - wire test and bederson s scoring system .
bbb disruption was measured by evans blue dye leakage .
results : although infarct size was significantly reduced in lh , dc and hc groups ( p<0.001 ) , combination therapy was more neuroprotective compared to craniectomy alone ( p<0.01 ) .
bbb disruption was significantly reduced in dc ( p < 0.05 ) and lh and hc ( p < 0.01).while sticky tape test ( p<0.05 at 24 hr ; p<0.001 at 48 hr ) and hanging - wire test ( p<0.05 ) showed better behavioral performance only in hc , bederson test showed improved behavioral functions of both lh ( p<0.05 at 24 hr and p<0.01 at 48 hr ) and hc animals ( p<0.01 ) .
neurological deficits were also decreased in lh ( p<0.05 ) or hc ( p<0.05 at 24 hr ; p<0.01 at 48 hr ) groups compared to the dc group at the same time . conclusion : based on our data , although both delayed local hypothermia and craniectomy are protective after stoke , combination therapy of them is more neuroprotective than given alone . |
epidermal inclusion cyst ( eic ) is a benign cystic lesion , which occurs due to proliferation and implantation of epidermal elements within a circumscribed space in the dermis .
such cysts usually occur on the scalp , skin of head and neck , back and extremities .
eic occurring in the breast is very rare ; to date less than 40 cases have been reported in the english literature . when eic occurs as a subcutaneous nodule in the skin of breast
; clinical diagnosis may be easy ; but when occurs within the breast parenchyma , correct clinical diagnosis is usually not possible .
cytological diagnosis of eic in the breast is even rarer and there are only eleven published reports in the cytological literature . here
, we present a case of eic of breast primarily diagnosed by fine - needle aspiration cytology ( fnac ) , which is confirmed by histopathological examination .
a 30-year - old female attended to the fnac clinic of our hospital with a lump in the right breast associated with pain .
she had a history of pain in the same site 6 months back , but relieved by taking medication after consultation with a local physician .
physical examination revealed a lump in the upper and lower outer quadrant of the right breast measuring 3 cm 2 cm with glistening overlying skin .
the lump was mobile and no axillary lymphadenopathy was detected . based on the history and physical examination findings ,
smears examined show many anucleate squames and few benign nucleated squamous cells in a background containing inflammatory infiltrate along with few clusters of ductal epithelial cells with preserved myoepithelial component .
occasional foreign body type giant cells were also scattered in the smears [ figure 1a and b ] . based on these findings ,
a cytological diagnosis of infected eic of breast was made and was advised for resection of the lump after a course of antibiotic therapy .
fine - needle aspiration cytology showing ( a ) many anucleate squames and few nucleated benign squamous cells in a background containing neutrophils .
note the presence of benign ductal epithelial cells with myoepithelial component ( may - grnwald - giemsa , 200 ) , ( b ) anuclete squames , few nucleated benign squamous cells and neutrophils along with foreign - body type giant cell ( arrow ) ( mgg , 200 ) patient was put on cefpodoxime , a third generation cephalosporin at a dose of 200 mg twice daily for 7 days . after 2 weeks of completion of course of antibiotics , surgical excision of the lump was done and sent for histopathological examination .
histopathology of the lump showed typical features of eic with squamous lining and the cyst cavity filled with lamellated keratin [ figure 2 ] .
patient was followed - up for a period of 1 year and no recurrence was found during this period .
section showing a cyst cavity lined by keratinized squamous epithelium and contents of cyst comprising of lamellated keratin .
note the presence of foreign - body type giant cell ( arrow ) ( h and e , 100 )
eic is a common benign cystic lesion that involves mainly head and neck region , trunk and the extremities .
they can develop due to various mechanisms that may result in damage to epidermis , which gets implanted within the breast tissue ; such as congenital development of cyst secondary to obstructed hair follicles or pores , post - trauma , reduction mammoplasty , following squamous metaplasia of columnar cells within a dilated duct in cases of fibrocystic disease or within fibroadenoma or phyllodes tumors . in our case , as there is no history of previous trauma , surgery or lump ; the etiology of eic appears to be an obstruction of the hair follicle .
as breast contains flexible fat and mammary gland tissue under its skin , eic in breast grows deep inside the subcutaneous tissue making both clinically and radiologically difficult to distinguish from a breast tumor . in elderly , it may mimic duct carcinoma while in younger patients ; it is commonly mistaken as fibroadenoma .
however secondary inflammation in eic of the breast can also give a wrong clinical diagnosis of mastitis as occurs in our case .
as the patient had previous and present history of pain associated with glistening overlying skin , we have mistaken it as recurrent mastitis , possibly due to tuberculosis .
thus , radiological examination is not sufficient to diagnose eic of breast as other lesions such as fibroadenoma , phyllodes tumor or even low - grade malignant lesions like mucinous carcinoma may give similar findings . here
, the role of fnac comes as it is simple , easy to perform , quickly and gives the result with a reliable accuracy .
however if secondary infection occurs , aspirates usually become turbid and shows inflammatory cells such as neutrophils and histiocytes . due to the intrapenchymal nature of eic occurring in breast
, fine - needle aspirates may include adjacent normal breast epithelial cells and adipocytes . in our case , we have aspirated normal breast ductal epithelial cells and neutrophils along with anucleate squames and nucleated benign squamous cells , making a diagnosis of infected eic of breast possible .
cytological differential diagnosis of eic includes dermoid cyst , branchial cyst , pilomatrixoma , thyroglossal cyst , etc .
smears of dermoid cyst are cytological similar to eic however ; it may also contain skin appendageal elements like hair shafts .
the most important point to differentiate with eic is the site of presentation , which is the lateral side of the neck .
the content of thyroglossal cyst may sometimes be mucinous and mucin secreting and/or ciliated columnar epithelial cells may be present in the smears .
pilomatrixoma may sometimes mimic eic on aspirates when only anucleate squames and nucleated benign squamous cells are aspirated .
failure to aspirate basaloid cells and shadow cells usually gives the wrong cytological diagnosis in pilomatrixoma .
surgical excision and histopathological examination in these cases are necessary to establish the correct diagnosis .
eic of the breast can cause severe complications , which includes spontaneous rupture leading to inflammation and abscesses .
however , as the overall incidence of eic of the breast is less , reports are variable on its malignant transformation ; thus the actual percentage is uncertain . again
, paget 's disease can rarely occur in the eic arising from nipple / peri - nipple epidermis .
although some author believes that asymptomatic cases can be followed - up radiologically and clinically , we recommend surgical excision in these cases to prevent any potential complication that may arise in the future .
this case also highlights the role of fnac in arriving at a correct pre - operative diagnosis . | epidermal inclusion cyst ( eic ) is a benign lesion , which occurs due to proliferation and implantation of epidermal elements within a circumscribed space in dermis .
they usually occur in the head and neck region , trunk and extremities .
eic occurring in the breast is very rare . in this study
, we are presenting a rare case of eic occurring in the breast ; which was diagnosed by fine - needle aspiration cytology ( fnac ) .
later on , histopathology confirmed the diagnosis .
we are presenting this case not only because of its rare site of presentation , but also to highlight the role of fnac in diagnosing this benign lesion . |
carpal tunnel syndrome ( cts ) represents the most common compressive peripheral neuropathy , predominantly presenting as a tingling sensation , pain and numbness in the distribution of the median nerve and it is estimated to affect about 1% of the population33,37 ) .
cts is usually diagnosed on the basis of the patient 's history and clinical findings , and confirmed by electrophysiological studies .
recently , ultrasonography and/or magnetic resonance imaging can also be used to evaluate the median nerve and surrounding structures to complement electrophysiological study in diagnosing cts12,35 ) .
when conservative treatment including medications , splinting or local injection of steroid into carpal tunnel fails , simple decompression of the median nerve by division of the transverse carpal ligament is indicated as an effective surgical treatment . as surgical technique
, open carpal tunnel release ( octr ) has been the gold standard method . since the introduction of endoscopic technique by okutsu et al.32 ) in 1987 for treatment of cts ,
endoscopic carpal tunnel release ( ectr ) has been widely used as a minimally - invasive carpal tunnel surgery22 ) .
ectr techniques are divided into two categories depending on the number of skin incision used to access carpal tunnel : single - portal vs. dual - portal techniques .
ectr has advantage over octr such as less postoperative pain and more rapid postoperative recovery but there is still major controversy between the two procedures regarding the outcome and the complication rates5,22,31,41 ) .
successful results after endoscopic carpal tunnel decompression have been reported with range from 92 to 98%10,22,40 ) . in most cts patients with successful postoperative outcome ,
preoperative tingling sensation and pain decreased significantly within 1 - 7 days after ectr and completely resolved by one - postoperative month31,41 ) . however , a small number of patients showed delayed improvement after 1 month following ectr .
although various studies have reported preoperative prognostic indicators of the outcome of carpal tunnel release8,23,30,43,44 ) , to the knowledge of the authors , there have been no studies that have analyzed the delayed improvement patients after endoscopic carpal tunnel surgery .
we analyzed patient subpopulation with the delayed improvement after ectr to investigate the characteristics of those patients and to determine the predictable factors of delayed improvement .
we retrospectively reviewed databases of cts patients who underwent ectr at our hospital from 2002 to 2011 .
the preoperative assessment included a detailed history , symptoms and physical examination and all patients undergoing ectr had electrodiagnostic studies confirming compression of the median nerve at the level of the transverse carpal ligament . however , small number of patients with severe symptoms underwent ectr even though electrodiagnostic studies did not reveal any abnormalities , compatable with cts .
patients with postoperative period more than 12 months were analyzed and patients with prior carpal tunnel surgery or patients with diabetes or an underlying disease , related to cts were excluded from the study .
the clinical findings in the patient group were classified into 3 grades according to the consistency and severity of symptoms as follows17 ) .
grade i : intermittent symptoms with paresthesia at night grade ii : persistent symptoms throughout the day with hypesthesia in the finger of the median nerve distribution grade iii : constant symptoms with weakness or thenar muscle atrophy the electrophysiological study was performed using a cadwell sierra wave ( cadwell laboratories , kennewick , wa , usa ) .
the study consisted of motor and sensory median nerve conduction tests using standard techniques according to the practice parameters for the electrodiagnosis of cts of the american association of electrodiagnostic medicine , the american academy of neurology , and the american academy of physical medicine and rehabilitation3 ) .
the electrophysiological abnormalities were classified into three grades according to stevens ' classification as follows39 ) .
mild : prolonged median sensory distal latency moderate : prolonged median sensory and motor distal latency severe : abnormal needle electromyography other than the above two abnormalities , or no response in sensory and motor distal latency the modified menon 's single - portal method25 ) was applied to all of the 793 patients as a means of ectr by the same neurosurgeon .
ectr was carried out under monitored anesthetic care by intravenous injection of propofol without endotracheal intubation .
after exsanguination of the arm and inflation of a tourniquet up to 250 mm hg , a 1.0-cm transverse incision is made along the proximal wrist crease in the ulnar side of the palmaris longus tendon .
subligamentous dissection toward the fourth finger is carried out to reflect the synovial tissue from the undersurface of the transverse carpal ligament ( tcl ) and to create a space for the endoscopic device with a synovial elevator .
a washboard sensation could be felt in the undersurface of the tcl with the elevator and its tip could be felt on the palm while it passes the distal part of the tcl .
a slotted cannula is introduced into the carpal tunnel and a rigid 30-angled 2.7-mm endoscope is inserted through the cannula .
manifestation of reduced transillumination could be observed in the palm while the endoscope is under the tcl .
white transversely running fibers of tcl and a fat pad distal to the distal edge of the tcl can be seen on the endoscopic view . after ensuring that there are no intervening structures in the operative field
after the tcl is completely cut out , both an escape of palmar fat into the carpal tunnel and retraction of cut edges of the tcl out of the endoscopic view could be observed as well as increased transillumination through the palm .
a right - angled probe is used to palpate the divided tcl . the tourniquet is released .
wound closure is accomplished in layers following hemostasis and a bulky compressive dressing is applied . clinical severity and electrodiagnostic abnormality
were compared between groups using chi - square test and demographic data including age and duration of symptoms was compared using pearson 's correlation analysis .
all analyses were performed using spss , version 19.0 , commercially available software package ( spss inc . , chicago , il , usa ) .
we retrospectively reviewed databases of cts patients who underwent ectr at our hospital from 2002 to 2011 .
the preoperative assessment included a detailed history , symptoms and physical examination and all patients undergoing ectr had electrodiagnostic studies confirming compression of the median nerve at the level of the transverse carpal ligament . however , small number of patients with severe symptoms underwent ectr even though electrodiagnostic studies did not reveal any abnormalities , compatable with cts .
patients with postoperative period more than 12 months were analyzed and patients with prior carpal tunnel surgery or patients with diabetes or an underlying disease , related to cts were excluded from the study .
the clinical findings in the patient group were classified into 3 grades according to the consistency and severity of symptoms as follows17 ) .
grade i : intermittent symptoms with paresthesia at night grade ii : persistent symptoms throughout the day with hypesthesia in the finger of the median nerve distribution grade iii : constant symptoms with weakness or thenar muscle atrophy
the electrophysiological study was performed using a cadwell sierra wave ( cadwell laboratories , kennewick , wa , usa ) .
the study consisted of motor and sensory median nerve conduction tests using standard techniques according to the practice parameters for the electrodiagnosis of cts of the american association of electrodiagnostic medicine , the american academy of neurology , and the american academy of physical medicine and rehabilitation3 ) .
the electrophysiological abnormalities were classified into three grades according to stevens ' classification as follows39 ) .
mild : prolonged median sensory distal latency moderate : prolonged median sensory and motor distal latency severe : abnormal needle electromyography other than the above two abnormalities , or no response in sensory and motor distal latency
the modified menon 's single - portal method25 ) was applied to all of the 793 patients as a means of ectr by the same neurosurgeon .
ectr was carried out under monitored anesthetic care by intravenous injection of propofol without endotracheal intubation .
after exsanguination of the arm and inflation of a tourniquet up to 250 mm hg , a 1.0-cm transverse incision is made along the proximal wrist crease in the ulnar side of the palmaris longus tendon .
subligamentous dissection toward the fourth finger is carried out to reflect the synovial tissue from the undersurface of the transverse carpal ligament ( tcl ) and to create a space for the endoscopic device with a synovial elevator .
a washboard sensation could be felt in the undersurface of the tcl with the elevator and its tip could be felt on the palm while it passes the distal part of the tcl .
a slotted cannula is introduced into the carpal tunnel and a rigid 30-angled 2.7-mm endoscope is inserted through the cannula .
manifestation of reduced transillumination could be observed in the palm while the endoscope is under the tcl .
white transversely running fibers of tcl and a fat pad distal to the distal edge of the tcl can be seen on the endoscopic view . after ensuring that there are no intervening structures in the operative field , the tcl is incised proximally to distally with a forward - facing knife . after the tcl is completely cut out ,
both an escape of palmar fat into the carpal tunnel and retraction of cut edges of the tcl out of the endoscopic view could be observed as well as increased transillumination through the palm .
wound closure is accomplished in layers following hemostasis and a bulky compressive dressing is applied .
clinical severity and electrodiagnostic abnormality were compared between groups using chi - square test and demographic data including age and duration of symptoms was compared using pearson 's correlation analysis .
all analyses were performed using spss , version 19.0 , commercially available software package ( spss inc . , chicago , il , usa ) .
single - portal ectrs were performed in 1194 hands of 793 patients with electrodiagnostically - proven idiopathic cts from 2002 to 2011 . among 1194 hands , 570 hands of 388 patients with minimal 1-year postoperative follow - up
mean age of the patients was 53 years ( range , 24 - 82 years ) and mean follow - up period was 23.6 months ( range , 12 - 160 months ) .
patients ' clinical outcomes were assessed with postoperative improvement of tingling sensation , pain and numbness at 1 , 3 , 6 , and 12 months postoperatively . among 570 operated hands , 545 hands ( 95.6% )
we divided the 545 satisfied hands into early ( group a ) and delayed ( group b ) improvement group according to improvement period of 1 month .
the mean age of group a was 53 years ( range , 24 - 82 years ) .
the mean age of group b was 52 years ( range , 32 - 71 years ) . mean symptom duration was 42.4 months in group a and 33.4 months in group b. table 1 shows the baseline characteristics of the study groups . in group b , 11 hands improved in postoperative 2-months , 15 hands in postoperative 3-months and 9 hands in postoperative 6-months , respectively . in group
a / b , according to clinical severity , 60/1 hands were graded to i , 345/24 hands to ii , 105/10 hands to iii ( table 2 ) . in group
a / b , based on electrodiagnostic abnormality , 57/3 hands were divided to mild group , 221/11 hands to moderate group and 222/21 hands to severe group with normal findings in 10 hands of group a ( table 3 ) .
statistical analysis of these results between groups did not reach significance ( clinical severity : p=0.191 , electrodiagnostic abnormality : p=0.294 ) but severity of electrodiagnostic abnormalities or clinical severity had a tendency to affect on delayed response .
in addition , age and duration of symptoms did not affect the postectr improvement period ( age : p=0.478 , duration of symptoms : p=0.1 ) .
classic symptoms of cts include tingling sensation , pain and numbness in the median nerve distribution of the hand comprising the thumb , index finger , middle finger and radial half of the ring finger .
however , sensory symptoms do not always involve the entire median nerve distribution of the hand . in some patients
the primary pathophysiologic mechanism of cts development is known as an increase in interstitial pressure in the carpal tunnel , leading to median nerve compression . the normal interstitial pressure in the carpal tunnel is known to be 2.5 mm hg with the wrist in neutral position and it increases to approximately 30 mm hg with the wrist in either maximum flexion or maximal extension26 ) .
symptoms of the median nerve compression including tingling sensation develop when carpal tunnel interstitial pressure increases above 30 mm hg , leading to a reduction of epineural blood flow , development of epineural edema and block in axonal transport26 ) . with prolonged compression of the median nerve at higher carpal tunnel interstitial pressure ,
manifestations of the median nerve compression generally progress over a period of months to years to develop more severe sensory symptoms and even thenar muscle weakness .
there are numerous causes of this increase in carpal tunnel pressure but most cases of cts do not have identifiable cause42 ) .
however , idiopathic cts is believed to be caused by combination of an anatomically small carpal tunnel and changes in the tenosynovium of the flexor tendons in the carpal tunnel such as edema , vascular sclerosis and fibrous hypertrophy26 ) .
secondary causes of cts include neuropathic factor with diabetes , metabolic and physiologic factor such as hypothyroidism , rheumatoid arthritis and pregnancy , and space - occupying lesion with tumor or cyst42 ) .
in addition , risk factors in the general population that contribute to cts include repetitive movement of wrist extension and flexion , obesity , rapid dieting , short height , hysterectomy without oophorectomy and recent menopause11 ) .
we excluded the cases with secondary cts from the study because the predisposing conditions of an identifiable cause that contribute to cts may affect the surgical outcome , other than known preoperative prognostic indicators8,23,30,43,44 ) .
decompression of the carpal tunnel is recommended when symptomatic discomfort interferes with work or activity of daily living despite conservative treatment or advanced cts with thenar muscle weakness even when sensory symptoms are not disabling . in these cases ,
decompression of the carpal tunnel can be used to improve clinical symptoms and physical findings of cts , to prevent progression and loss of hand function and to eventually minimize loss of time from work .
two different types of surgical procedures are in use for the treatment of cts : open and endoscopic release of the transverse carpal ligament .
octr is the traditional option and is easy to perform with good symptomatic improvement and a low complication rate . since the introduction of a less invasive carpal tunnel surgery using surgical endoscope by okutsu et al.32 ) in 1987 ,
endoscopic procedures have been widely used as an alternative treatment to octr , and single - portal agee technique1 ) and two - portal chow9 ) technique are the two most commonly used procedures .
we used modification of single - portal menon technique25 ) using a forward - facing knife to divide the transverse carpal ligament .
it is beyond the scope of this study to describe details of each technique so we do not discuss it in this article . since the introduction of endoscopic carpal tunnel surgery in the late 1980s , thereis still controversy regarding the efficacy , safety and complication rate of open and endoscopic procedures .
jimenez et al.22 ) reported that ectr surgery offer similar success and complication rate compared to open surgery in an extensive review of published articles on ectr surgery covering six different types of techniques .
in addition , he described patients undergoing ectr experienced less postoperative pain and earlier return to work or activity of daily living but endoscopic technique need a learning curve and surgical experience for a successful outcome .
ashwoth5 ) also described in a critical review of 57 review articles regarding ectr that ectr surgery , compared to open surgery , seemed equally effective at improving symptoms and hand function in short and long outcome , and it may be more effective at reducing time to return to work .
endoscopic surgery was reported to have more transient nerve injuries such as neuropraxia , numbness and paresthesia but open surgery to have more wound problems including scar tenderness , hypertrophic scar and infection .
he also reported endoscopic surgery is more resource - intensive and demands a higher surgical skill than open technique .
several studies have reported preoperative prognostic factors , affecting the outcome after surgical release of transverse carpal ligament and preoperative predictors included duration and severity of symptoms , grade of electrodiagnostic abnormalities , worker 's compensation and work activity8,23,30,43,44 ) .
good outcome has been associated with preoperative tingling other than anesthesia or weakness as well as good response to corticosteroid injection into carpal tunnel and poor result has been correlated with preoperative weakness or atrophy , associated diseases such as diabetis and thyroid disease , worker 's compensation and heavy or repetitive work activity13,18,23,24,29,36,43,44 ) .
the finding of delayed improvement in our series demonstrates late postoperative improvement group had more proportion of patient with severe clinical grade , but clinical severity did not differ significantly between early and late improvement groups .
even though we can expect poor outcome in patients with severe clinical grade of cts , it is recommended that postoperative follow - up up to 6 months is necessary in idiopathic cts patient without improvement .
the duration of cts has been shown to have no significant correlation with clinical outcome in patients undergoing carpal tunnel surgery19,43 ) , whereas , other studies found worse outcome with longer duration2,13,24,27,29,30,44 ) .
pauda et al.34 ) reported that the main positive prognostic factors of idiopathic cts without treatment are short duration of symptoms and young age .
our study has indicated that the chronicity of cts did not affect the time of improvement following ectr .
the role of ncs in predicting the outcome of carpal tunnel surgery is not clearly determined2,4,8,21,27,44 ) .
schrijver et al.38 ) noted that ncs improved significantly at postoperative 12 months but only a modest correlation existed between relief of preoperative symptoms after surgery and the improvement of ncs .
however , other studies showed that ncss improve after surgery28 ) . in severe cts cases ,
nerve conduction studies results may not correlate with the clinical findings due to the varying nature of the impairment in different nerve fibers .
in addition , nerve conduction studies will not accurately predict the recovery following release of the carpal tunnel , though neither do any of the other investigations predict this with any certainty6 ) . our study has shown that grade of electrophysiologic abnormalities
does not correlate with the time course of improvement after carpal tunnel surgery , which means ncss are not helpful to predict the improvement period .
several studies demonstrate that improvements after carpal tunnel release decreased in older patients who were at risk of severe cts , compared to a younger population14,15,16,20 ) .
therefore , we can expect older patients to show a more delayed improvement than younger patients but we found no significant differences in the time of improvement following ectr between early and delayed improvement group .
in addition , worker 's compensation can affect postoperative outcome and worker 's compensation group showed diminished outcome , compared to patients without worker 's compensation19 ) . in our study ,
worker 's compensation did not affect postoperative improvement period but we think it may delay postoperative improvement period .
therefore , worker 's compensation status can be considered as a possible factor of delayed postoperative improvement in patients with worker 's compensation .
endoscopic decompression of carpal tunnel is effective as a primary or alternative surgical technique for the treatment of cts , demonstrating symptomatic improvement within postoperative one - month in most patients .
therefore , it is advised that postoperative observation for at least 6 months is necessary in the patients without symptomatic improvement to expect the delayed response . | objectivein most patients with carpal tunnel syndrome ( cts ) , pain and/or paresthesia disappeared or decreased in a month after endoscopic carpal tunnel release ( ectr ) .
however , subpopulation of patients showed delayed improvement following ectr .
we analyzed the delayed improvement hands to investigate the characteristics of those patients and to determine the predictable factors of delayed improvement.methodssingle-portal ectrs were performed in 1194 hands of 793 cts patients from 2002 to 2011 .
five - hundred seventy hands with minimal 1-year postoperative follow - up were included .
we divided the 545 satisfied hands into early ( group a ) and delayed ( group b ) groups according to improvement period of 1 month .
demographic data , clinical severity and electrodiagnostic abnormality were compared between groups.resultsgroup a included 510 hands and group b included 35 hands . in group b , 11 hands improved in 2 months , 15 hands in 3 months and 9 hands in 6 months , respectively . in group
a / b , according to clinical severity , 60/1 hands were graded to i , 345/24 hands to ii , 105/10 hands to iii . in group
a / b , based on electrodiagnostic abnormality , 57/3 hands were classified to mild , 221/11 hands to moderate and 222/21 hands to severe group .
statistical analysis between groups did not reach significance but electrodiagnostic or clinical severity had a tendency to affect the delayed response.conclusionit is difficult to predict the factors contributing to postoperatively - delayed response in subpopulation of cts patients .
however , we recommend that postoperative observation for at least 6 months is necessary in patients without symptomatic improvement . |
nevertheless , it is commonly misdiagnosed , which leads to a poor prognosis and more aggressive treatments .
subungual squamous cell carcinoma ( sscc ) is a rare entity with an extremely varied clinical presentation .
the lack of awareness among physicians , its indolent natural history , and the higher prevalence of other benign conditions on the ungual apparatus are responsible for delay in its diagnosis .
we have reported here four cases of sscc with a previous mistaken diagnosis of a benign process unsuccessfully treated for years .
figure 1 shows the different clinical presentation of cases herein reported . the first patient presented with involvement of two digits .
radiological studies did not reveal alterations , except for an incidental osteochondroma in the fourth patient .
histological examination revealed sscc in all cases , but immunostaining for human papillomavirus ( hpv ) was only positive in the first patient , who presented with deeper tissue involvement [ figure 2 ] .
all surgical procedures resulted in free - margin tumoral excisions , without recurrences or nodal involvement during follow - up between 5 and 30 months .
clinical and histological data of the four study patients a ) keratotic and verrucous lesion below the nail plate mimicking a viral wart ( case 1 ) , ( b ) crusted subungual lesion ( case 2 ) , ( c ) erythematous and eroded lesion covered by crusts and keratotic material ( case 3 ) , ( d ) prominent onycholysis and fleshy nodular lesion ( case 4 ) ( a ) positive immunostaining for hpv in case 1 ( arrows)hpv immunostaining , 200 ) , ( b ) moderately differentiated subungual squamous cell carcinoma in the second patient .
( h and e , 100 ) , ( c and d ) well - differentiated squamous cell carcinoma in third and fourth patients .
lobular aggregations of slightly atypical keratinocytes and incipient horn pearl formation ( arrows)(h and e , 100 )
tumors located in subungual tissues include squamous cell carcinoma ( scc ) , bowen 's disease , melanoma , basal cell carcinoma , and keratoacanthoma among others .
usually , sscc affects a single digit , the thumb and the great toe being the most frequently involved .
multiple fingers involvement has also been described . the incidence is higher in men between the fifth and seventh decades of life .
the proposed aetiologies of the disease include chronic infection , chemical or physical microtrauma , genetic disorders such as congenital ectodermal dysplasia , radiation , tar , arsenic or exposure to minerals , sun exposure , immunosuppression , and previous hpv infection .
hpv involvement has gained importance , as hpv dna was recovered from 60% to 90% of cases of sscc and > 60% were related to hpv 16 .
genital - digital transmission has been suggested as a plausible pathogenetic factor in sscc , as hpv 16 is the most frequent serotype found in genital warts .
however , there are probably other factors implicated in malignancy , as viral warts in hands are very common and the development of sscc remains rare . in
the cases herein reported , all potential causative factors of sscc were excluded with the clinical history data and the physical examination .
the clinical features may be variable and include chronic pain and swelling , onycholysis , or nail plate dyschromia .
the most frequent presentation consists of wart - like appearance involving the nail bed and periungual areas in association with nail dystrophy .
viral warts , onychomycosis , or chronic paronychia remain the most commonly mistaken entities . besides , the tumor masked by the nail plate , lack of awareness , and overlying secondary infections lead to misdiagnosis for an average of 4 - 40 years . therefore , exploratory nail plate removal and subsequent biopsy are advised in all patients with chronic nail conditions that fail to respond to conventional treatment . in patients with recurrent nail infections or chronic ulcerations , tissue culture is also needed .
imaging studies may be done to assess possible bone involvement . as a result of delayed diagnosis , most patients with sscc present with invasive disease , with bony involvement ranging from 16% to 66% .
sscc is considered a low - grade malignancy and less aggressive than scc arising elsewhere .
the tendency to recurrence is higher on the nail unit than in other anatomic areas .
this fact can probably be due to residual hpv in surrounding areas or , more frequently , due to incomplete tumor removal .
wide local excision and simple excision have also been proven effective , the former being preferred because of the lower recurrence rate .
amputation of the distal phalanx is usually the recommended treatment for patients with bone infiltration .
radiation therapy has also been reported to be effective . in conclusion , a high index of suspicion for sscc is required .
therefore , an early biopsy in chronic persistent or recurrent nail lesions , and subsequent early sscc diagnosis may prevent more aggressive treatments and assures a favourable prognosis .
human papillomavirus infection probably has an important role in the development of subungual squamous cell carcinoma.subungual squamous cell carcinoma has a high recurrence rate .
human papillomavirus infection probably has an important role in the development of subungual squamous cell carcinoma . | subungual tumors are rare in general . of all tumors , subungual squamous cell carcinoma ( sscc )
is the most frequent one .
protean clinical presentations and the lack of awareness of the disease are responsible for an incorrect or delayed diagnosis and subsequent delayed treatment . we have reported here four patients with sscc who were previously wrongly diagnosed with a benign process and treated unsuccessfully for years .
we would like to highlight the need of a biopsy in chronic or recurrent nail lesions that fail to respond to a previous conservative treatment in order to rule out sscc . |
tuberculosis ( tb ) is a major health problem with a global mortality ranging from 1.6 to 2.2 million cases per annum . according to the who estimates ,
mycobacterium tuberculosis can involve any organ , and clinical features depend on the organ system involved .
liver involvement in tb , though common both in pulmonary and extrapulmonary tb , is usually clinically silent . in developing countries where the burden of tb is high , there are asymptomatic patients with hepatic tb .
however , due to lack of acquaintance with this condition , many cases are missed or diagnosed inaccurately .
the final diagnosis of hepatic tb rests on histopathologic evidence of caseating granulomas , demonstration of acid - fast bacilli ( afb ) on smear or isolation of mycobacterium by culture of biopsy specimen . to establish the specific diagnosis of tb , one has to demonstrate the afb in the specimen or isolate the mycobacterium by culture .
many a times , direct demonstration of afb is not possible due to low sensitivity of ziehl neelsen ( zn ) staining in extrapulmonary cases .
fine - needle aspiration cytology ( fnac ) has shown a varying positivity of afb , epithelioid granuloma , and caseation necrosis in 059% , 80100% , and 3083% of cases , respectively . although culture is considered to be a gold standard , it is time - consuming and reported to have a low sensitivity , especially in paucibacillary extrapulmonary conditions . for unknown reasons ,
the results of afb demonstration in liver tissue in studies reported from india have not been rewarding .
thus , diagnosing liver tb still remains a challenge , and the present study was carried out to evaluate the utility of polymerase chain reaction ( pcr ) targeting the is6110 on archival samples of ultrasonography - fnac collected over a period of 6 years in a tertiary care hospital of north india .
this was a retrospective study comprising a total of 17 ultrasound - guided fnac samples from patients having hepatic space - occupying lesions ( sols ) .
samples were collected over a period of 6 years ( from january 2005 to january 2011 ) .
approval from the institute 's ethics committee was sought , but informed consent from patients could not be taken as it was a retrospective study .
giemsa ( mgg ) stain , hematoxylin and eosin stain , zn stain , and periodic acid - schiff 's stain .
the stained smears were retrieved from the archives of the department and were reviewed for the cytomorphologic features . on cytology , the cases were divided into four categories :
category 1 - cases with necrotizing inflammation and zn stain for afb positivecategory 2 - cases with granulomatous inflammation with / without necrosis , positive for afbcategory 3 - cases with granulomatous inflammation with / without necrosis , negative for afbcategory 4 - cases with occasional epithelioid cell collections and/or giant cells , negative for afb .
category 1 - cases with necrotizing inflammation and zn stain for afb positive category 2 - cases with granulomatous inflammation with / without necrosis , positive for afb category 3 - cases with granulomatous inflammation with / without necrosis , negative for afb category 4 - cases with occasional epithelioid cell collections and/or giant cells , negative for afb .
mgg - stained air - dried smears from the archival material were assessed for the representative material in the form of epithelioid granulomas and giant cells .
one to two mgg smears from each case were destained and the material was scraped to extract dna .
dna was extracted by commercially available dna extraction kit according to manufacturer 's instruction ( qiagen ) .
the positive control was the dna of h37rv , and negative control included pcr grade water .
identification of m. tuberculosis was done using a specific pair of primers designed to amplify is6110 in the m. tuberculosis complex , and the expected band size was about 123 bp .
the sequence of primers used was isi : 5 cctgcgagcgtaggcgtccg 3 and is - ii : 5 ctcgtccagcgccgcttcgg3 ' , respectively .
a 25 l reaction contained 10 assay buffer ( bangalore genei , bangalore , india ) , 10 mm dntps ( bangalore genei ) , 10 pmole of each primer , 2.5 units taq dna polymerase ( bangalore genei , bangalore , india ) , and 5 l of extracted dna .
amplification was carried out in a thermal cycler , which involved 35 cycles including denaturation at 95c for 4 min , annealing of primers at 63c for 1 min , and primer extension at 72c for 1 min .
the samples showing the presence of 123 bp band under ultraviolet transillumination were considered positive .
results were compared with positive ( dna of h37rv strain ) and negative ( pcr grade water ) control .
the 100 bp ladder was used as a molecular marker . the sensitivity , specificity , positive predictive value , and the negative predictive value were calculated .
dna was extracted by commercially available dna extraction kit according to manufacturer 's instruction ( qiagen ) .
the positive control was the dna of h37rv , and negative control included pcr grade water .
identification of m. tuberculosis was done using a specific pair of primers designed to amplify is6110 in the m. tuberculosis complex , and the expected band size was about 123 bp . the sequence of primers used was isi : 5 cctgcgagcgtaggcgtccg 3 and is - ii : 5 ctcgtccagcgccgcttcgg3 ' , respectively .
a 25 l reaction contained 10 assay buffer ( bangalore genei , bangalore , india ) , 10 mm dntps ( bangalore genei ) , 10 pmole of each primer , 2.5 units taq dna polymerase ( bangalore genei , bangalore , india ) , and 5 l of extracted dna .
amplification was carried out in a thermal cycler , which involved 35 cycles including denaturation at 95c for 4 min , annealing of primers at 63c for 1 min , and primer extension at 72c for 1 min .
the samples showing the presence of 123 bp band under ultraviolet transillumination were considered positive .
results were compared with positive ( dna of h37rv strain ) and negative ( pcr grade water ) control .
the sensitivity , specificity , positive predictive value , and the negative predictive value were calculated .
the age of the patients ranged from 3 to 61 years with a median age of 41 years . among 17 patient samples ,
12 were from males and 5 from females with a male : female ratio = 2.4:1 .
patients presented with solitary / multiple liver sols . on review of cytology smears , 17 cases were segregated into the following categories as described previously : category 1 : n = 3 ( 17.64% ) , category 2 : n = 2 ( 11.76% ) , category 3 : n = 10 ( 58.82% ) , and category 4 : n = 2 ( 11.76% ) .
pcr positivity was noted in 8/10 cases ( including four afb smear positive cases ) , confirming a diagnosis of tb [ figure 1 and table 1 ] .
gel photograph of polymerase chain reaction for mycobacterium tuberculosis ( is6110primers ) polymerase chain reaction results in cases with adequate dna ( n=10 )
the most common form is the diffuse involvement of the liver which can be seen along with pulmonary and/or military tb .
the second is granulomatous hepatitis and third form presents as focal tuberculoma or an abscess , which is a rare form of clinical manifestation . if diagnosed early then it can be cured with antitubercular treatment .
however , the definitive diagnosis of liver tb based on histological evidence of granulomatous inflammation with caseation necrosis is seen only in one - third of cases .
the conventional methods such as zn staining for the direct demonstration of mycobacteria are not sensitive methods in extrapulmonary tb as shown in previously published studies .
the culture is considered to be a gold standard , but it is tedious and time - consuming .
pcr for the detection of tb is considered to be having a good diagnostic value with high sensitivity and specificity .
is6110 is the most common region used in pcr due to its multiple copy number .
thus , the present study was planned to evaluate pcr assay for the detection of m. tuberculosis in fnac samples obtained from cases reported as hepatic granulomatous inflammation and/or tb . in our study , 17 fnac samples were analyzed . among 17 cases , 3 ( 17.64% )
granulomatous inflammation with / without necrosis but positive for afb was seen in 2 samples ( 11.76% ) .
ten samples ( 58.82% ) showed granulomatous inflammation with / without necrosis which were found to be negative for afb .
occasional epithelioid cell collections and/or giant cells were seen in two samples ( 11.76% ) which were negative for afb . among the diagnosed granulomatous lesions in fnac samples of liver , microscopy for afb was positive in 29.41% samples .
tai et al . in their 15 years of experience have shown a similar positivity of 20% among pathologically proven hepatic tb .
alcantara - payawal et al . have reported an overall positivity of 12% by conventional methods to detect the mycobacteria among patients with hepatic granuloma .
studied 32 biopsy samples of granulomatous hepatitis and all were found to be negative by zn staining .
the low positivity of afb has been attributed to paucibacillary nature of extrapulmonary tb and poor sensitivity of zn staining .
tb - pcr is a rapid and useful tool in the diagnosis of hepatic tb . in the literature ,
the diagnostic sensitivities of tb - pcr in detecting culture - confirmed and clinically diagnosed tb infection are 75.9% and 81.3% , respectively .
the specificity of tb - pcr in diagnosing tb infection is 100% . in the present study ,
there was one case which was positive for afb but negative for tb - pcr .
this may be due to the predominance of necrosis which might have hindered the extraction of dna .
diaz et al . reported that over 50% of hepatic tb patients had positive tb - pcr but popper et al . , ghossein et al . , and tai et al .
reported that almost all patients with pathologic confirmation of hepatic tb had positive tb - pcr .
thus , pcr is a rapid method of identifying m. tuberculosis to the species level in clinical specimens . in the present study ,
pcr was positive for tb in 80% ( 8/10 ) cases as compared to fnac with afb smear positivity in 29.4% ( 5/17 ) cases .
our previously published data have also shown a very good sensitivity and specificity at other extrapulmonary tuberculosis sites .
thus , pcr targeting is6110 can be used as a rapid diagnostic tool in the diagnosis of smear and culture negative cases of tuberculosis . in future ,
multiplexing by targeting more than one gene can be used to increase the sensitivity of pcr .
the limitation of the present study is the small sample size , and a large number of samples are required to be analyzed in fresh tissue samples so that pcr can be utilized for routine patient care .
pcr can provide strong evidence to the clinicians and pathologists where there is a dilemma about the cause of hepatic granuloma or sols of liver .
early initiation of antitubercular treatment can save lives of many patients in whom conventional techniques fail to diagnose the tb .
to give appropriate credit to each author of paper , the individual contributions of all authors to the manuscript have been specified . according to the international committee of medical journal editors ( icmje http://www.icmje.org ) , author
is generally considered to be someone who has made substantive intellectual contributions to a published study .
authorship credit is based on ( 1 ) substantial contributions to conception and design , acquisition of data , or analysis and interpretation of data ; ( 2 ) drafting the article or revising it critically for important intellectual content ; and ( 3 ) final approval of the version to be published .
we declare that each author has participated sufficiently in the work to take public responsibility for appropriate portions of the content .
all authors of this article declare that they qualify for authorship as defined by the icmje .
each author has participated sufficiently in the work and takes public responsibility for appropriate portions of the content of this article .
ks , kg , and ng were instrumental in the collection of material , doing pcrs and interpretation of data .
we reviewed all smears and follow - up with culture and pcr reports to come to the conclusion .
clinical data and final interpretation were done by ng , kg , ks , and ar .
initial acquisition of data , pubmed search , and modification in the manuscript were done by ng , kg , and ks , respectively . as and akd provided the clinical samples and clinical and follow - up details of the patients .
final review and approval were done by ar , ng , and ks . all authors read and approved the final manuscript .
this study was conducted with approval from the institutional review board of the institution associated with this study as applicable .
afb acid - fast bacilli fnac fine - needle aspiration cytology mgg - may grnwald giemsa pas - periodic acid - schiff 's pcr - polymerase chain reaction sols space - occupying lesions usg - ultrasonography who - world health organization
to ensure the integrity and highest quality of cytojournal publications , the review process of this manuscript was conducted under a double - blind model ( authors are blinded for reviewers and vice versa ) through automatic online system . | background : tubercular involvement of the liver is uncommon , but is a serious consideration in differential diagnosis of granulomatous conditions , especially in endemic regions like india.objective:to assess the role of polymerase chain reaction ( pcr ) done on archival cytological material in diagnosing tuberculosis ( tb ) in cases reported as granulomatous inflammation / tb in liver lesions.materials and methods : this was a retrospective study including a total of 17 cases of liver space - occupying lesions ( sols ) reported as granulomatous inflammation ( n = 12 ) and tb ( n = 5 ) .
the smears were retrieved from the archives of the department and were reviewed for the cytomorphologic features .
air - dried smears stained with may grnwald giemsa ( mgg ) stain were assessed for the representative material in the form of epithelioid granulomas and giant cells .
one / two mgg smears from each case were destained and the material was used for performing pcr for mycobacterium tuberculosis by amplification of 123 bp fragment of the is6110 insertion element.results:the age of the patients ranged from 3 to 61 years .
there were 12 females and 5 males .
the patients presented with solitary / multiple liver sols .
dna could be extracted from 10/17 cases from archival mgg smears .
pcr positivity was noted in 8/10 cases ( including four acid - fast bacilli smear - positive cases ) , confirming a diagnosis of tb.conclusion:cytomorphology alone may not be sufficient for differentiating various granulomatous lesions reported in liver sols .
dna can be extracted from the archival cytological mgg - stained smears .
pcr should be carried out if ziehl
neelsen staining is negative in granulomatous lesions , especially when material has not been submitted for culture . |
the patient 's history is not easily obtained and often reported incompletely by the patient 's parents , but it is essential for making the right decisions about appropriate diagnostic tools .
careful physical examination is time consuming in children though it is warranted in order to distinguish between potentially harmful cardiac syncopes and neurocardiogenic spells with a more favorable prognosis .
furthermore , the small size of children limits certain diagnostic procedures such as exercise testing or electrophysiological testing . on
the other hand syncope occurs in around 15% of children up to the age of 18 years12 and is therefore a complaint frequently encountered in pediatric outpatient clinics as well as in pediatric cardiology clinics .
one of the most valuable procedures in testing for syncope is the head - up tilt test.3 as it is done as an additional examination in the adult patient with normal results of cardiac testing by physical examination , resting ecg and resting blood pressure monitoring , its usefulness in the pediatric age is limited for several reasons .
patient collaboration is poor in a test lasting at least 45 minutes and , in order to improve sensitivity of 35% - 85%,4 sometimes requiring intravenous pharmacological stimulation .
it is also often difficult to persuade children 's parents to give their consent to bend their child on a tilt table and tilt it up until a syncope happens . and finally , there is limited value of the results by monitoring only ecg and blood pressure during this long lasting test and neglecting any information about cardiac output , total peripheral vascular resistance and stroke volume .
we used a new device for head - up tilt testing which links beat - to - beat blood pressure monitoring with impedance cardiography in order to improve our diagnostic capability .
the patient was a 12 year old girl suffering from three near - syncope faints in the past .
a 12-year - old girl presented at our institution with three episodes of near syncope .
the patient 's family history was negative for syncopes as well as for other inheritable disorders and she was not on any medication .
she could perform moderate aerobic sports ( cycling , hiking , swimming ) without any problems .
by echocardiography a discrete prolapse of the mitral valve with trivial mitral regurgitation was diagnosed .
head - up - tilt table testing was performed in a quiet room at 9 am after a light breakfast with enough fluid intake in order to avoid dehydration as a cause for positive testing .
the patient was positioned supine on the tilt table without a venous line for 20 minutes . as
the patient relaxed and power spectral analysis of heart rate variability showed an increasing vagal tonus , the tilt table was set in the upright position of 60 degrees within 10 seconds according to the guidelines.2 the test was to be continued until symptoms would arise or to a maximum length of 45 minutes of upright position .
the monitoring device ( task force monitor , cns systems , graz , austria ) consisted of a central computer driving several monitoring systems working independently from each other .
beat - to - beat blood pressure was measured by a finger cuff measuring online beat - to - beat blood pressure on the 2 and 3 finger of the left hand and using the so called vascular unloading technique .
the pulse signal with its variables is measured for every heartbeat and transformed into a pulse waveform similar to that obtained by invasive arterial blood pressure monitoring .
the waveform is displayed on the master screen giving the relative values of beat - to - beat blood pressure .
calibration of this system occurs through a conventional non - invasive blood pressure cuff positioned on the right upper arm and is performed every five minutes .
we obtained a standard 6-lead - ecg from the patient 's chest giving its signal to the central monitoring device , which in turn measures beat - to - beat heart rate and consecutive r - r - intervals .
every r - r - interval is displayed in milliseconds and correlated online with the changes in beat - to - beat blood pressure given in millimetres of mercury . at this point
, baroreceptor sensitivity can be calculated according to the sequence method . by analysing online the heart rate variability it was possible to gain a power spectral analysis delineating the low - frequency band ( 0,1 hz , lf ) and high frequency band ( 0.3 hz , hf ) .
thus , sympathetic ( lf ) and parasympathetic ( hf ) dominance of the autonomous nervous system can be shown during the test and a lf / hf ratio of greater 2 was used for defining a prominent sympathotonus .
three electrodes were positioned on the right and left lateral chest wall immediately adjacent to the xiphoid as well as in the neck , respectively . a fourth , reference electrode ,
the relative changes in chest impedance measured by these electrodes are transmitted to the central device and transformed into an online waveform signal shown on the monitor giving the beat - to - beat stroke volume and its changes over time and within the cardiac cycle . by multiplying stroke volume and heart rate
we obtain the cardiac output in absolute values and standardized for body surface area ( cardiac index ) . from the two variables of cardiac output and mean arterial blood pressure it is possible to calculate total peripheral vascular resistance and its changes during the tilt test .
during head - up tilt table testing the patient 's haemodynamic parameters were within normal limits when the girl was in the supine position .
however , four minutes after tilting , we noticed an increase in heart rate to a maximum of 110/min compensating the fall in stroke volume from 49 ml to 39 ml due to venous pooling and reduced cardiac preload .
the cardiac output was maintained at the same level of 3.6 l / min as before .
together with the patient 's complaint of dizziness we noted a dramatic decrease in heart rate to 36/min followed by an asystolic period of seven seconds .
the beat - to - beat blood pressure dropped down to 62/34 mmhg . immediately after tilting back to the supine position the patient recovered fully .
the ecg - signal showed a stable sinus rhythm of 70/min without any rhythm or conduction disturbances , the blood pressure returned to normal values and stroke volume and cardiac output followed .
therefore , the diagnosis of neurocardiogenic syncope of the cardioinhibitory type with asystolia was made .
the patients haemodynamic parameters before tilting : two ecgtracings , the pulse - form of the beat - to - beat blood pressure and the impedance signal with their respective absolute values on the right of the display . the same parameters during asystolia : a seven - seconds period without any stroke volume .
power spectral analysis of heart rate variability during the test : note the dramatic increase in the low frequency band ( 0.1 hz ) immediately before syncope .
since the differential diagnosis in syncope of unknown origin is widely spread , there have been many attempts to rationalize and improve the diagnostic procedures.2 beyond physical examination and careful medical history nearly every diagnostic procedure could be considered .
especially time- and money - consuming procedures such as eeg , cranial mri or electrophysiological studies have to be reviewed on the basis of their contribution to the diagnosis.5 for paediatricians the benefit of such evaluations for the child has to be much more pronounced . dealing with scared parents
therefore there have been many attempts to improve the sensitivity of head - up tilt testing in paediatrics without pharmacological stimulation or invasive monitoring , because putting a venous or arterial line in a child means not only frightening the patient but also falsifying the test 's results .
the new device we used in our patient allows us to monitor several haemodynamic variables online during the test and therefore provoking a syncope is not necessary any more .
as we showed , relaxation of the given patient is quantifiable when the ratio of low frequency ( lf ) and high frequency ( hf ) can be calculated progressively during the first test phase
. a ratio of < 2 is considered as dominant vagotonus , according to the literature.67 as in our patient , we were able to start tilting as soon as relaxation occurred without the need for strict time periods given by a tilt table protocol.238 during the tilt phase , the ratio lf / hf increased as an indicator of the girl 's activated sympathetic tone , and immediately before the syncope the ratio raised markedly supporting the pathophysiological model of excessive sympathotonus leading to reactive vagotonus and vasodilatation and/or cardioinhibition . by considering these changes during the tilt phase , an increasing ratio of lf / hf is a strong predictor of an upcoming syncopal event confirmed by a rapid decline in heart rate or blood pressure .
beat - to - beat blood pressure monitoring by the finger pulse cuff is a precious tool in tilt - table - testing as it shows the real decline of blood pressure without the blind 20 seconds period usually given by the conventional riva - rocci method : in our patient the pulse signal weakened during bradycardia and stopped during asystolia , the real blood pressure level could be measured and would have been probably missed using a conventional arm cuff with a measure time of at least 20 seconds .
this fact showed once again the need for beat - to - beat blood pressure monitoring during tilt tests as requested by the guidelines.23 by ecg the diagnosis of a bradycardia of 40/min followed by an asystolia of 7 seconds leads to the classification of this syncope as a cardioinhibitory type iib.234 except for that the patient was in stable sinus rhythm and we could therefore exclude any structural cardiac disease .
what about impedance cardiography ? it has been shown that the method which had been abandoned in past for poor correlation with the real situation9 nowadays offers better results in adults.10 the newly designed electrodes together with a fast data processing computer allows us to sample the measured stroke volume of each heart beat , and by calculating the mean value over a given period inherent confounding errors such as intrathoracic air content can be excluded .
it is questionable whether smaller stroke volumes are scanned properly and if higher breathing frequencies falsify the results .
there is , however , certainly a great potential in this method because it allows monitoring the tendency of tpvr , stroke volume and cardiac output in a given patient during the test .
as we saw in our 12-year - old girl , stroke volume decreased due to venous pooling during the tilt phase .
so , beyond any concern about the reliability of this method , this new device for head - up tilt - table testing is probably a useful tool and offers new perspectives in haemodynamic testing of children .
the trend of haemodynamic changes in the individual is shown in real time and correlates with the signs and symptoms during the test .
the specific changes before neurocardiogenic syncopes such as excessive sympathotonus together with normal stroke volume and peripheral vascular resistance can be monitored in real time . provoking a syncope is therefore unnecessary if the trend fits the pathophysiological pattern .
so the conventional tilt test protocol of 45 minutes can be shortened , and as provoking a syncope is not necessary any more the test itself becomes less dangerous and frightening for patients , parents and medical staff .
a limitation of this method is the up to now unproven correlation of the absolute values given by the impedance cardiography method to invasive testing in children and therefore further studies are warranted . | the head - up - tilt - test in pediatric patients for the evaluation of syncope shows a sensitivity of 35 - 85% and often requires pharmacological stimulation in order to improve its diagnostic value .
we used a new device for beat - to - beat blood pressure monitoring combined with impedance cardiography in a 12-year - old girl during tilt testing .
a seven seconds asystolia was provoked .
the haemodynamic parameters showed clearly the drop in heart rate as well as in cardiac output , and returned to normal values after tilting back the patient . with the help of this new monitoring device
, the sensitivity and specificity of head - up - tilt - testing can probably be improved . |
sukhera sheikh made substantial contributions to literature review , drafting the article and final approval of the version to be published .
inithan ganesaratnam made substantial contributions to literature review , revising it critically for important intellectual content and final approval of the version to be published .
haider jan made substantial contributions to literature review , drafting the article and revising it critically for important intellectual content and final approval of the version to be published this article was submitted by the authors and peer reviewed by rosol hamid
sukhera sheikh made substantial contributions to literature review , drafting the article and final approval of the version to be published .
inithan ganesaratnam made substantial contributions to literature review , revising it critically for important intellectual content and final approval of the version to be published .
haider jan made substantial contributions to literature review , drafting the article and revising it critically for important intellectual content and final approval of the version to be published
| operative vaginal delivery has been described since the middle ages . during this time ,
however , labour would be sustained over several days and intrapartum death almost inevitable . in these circumstances ,
intervention involving the use of surgical instruments or even kitchen utensils would serve purely as an attempt to avoid maternal mortality .
the establishment of forceps - assisted delivery as a means of avoiding both maternal and neonatal morbidity was initiated in the 16th century by the chamberlen family and later developed over several centuries by leading obstetricians of the time including simpson , barnes and keilland .
the evolution of forceps is a fascinating story which is rich in history . despite the development of ventouse and the increasing use of caesarean section for difficult delivery
, forceps remain an integral part of obstetric practice .
the striking resemblance of modern day forceps to the original instruments used by the chamberlens is a testament to both the family 's ingenuity and enterprise as well as the subsequent pioneering obstetricians who followed in their footsteps . |
in the past few decades , the synthesis of new heterocyclic compounds has been a subject of great interest due to their wide applicability
. the importance of multicomponent reactions in organic synthesis has been recognized , and considerable efforts have been focused on the design and development of one - pot procedures for the generation of libraries of heterocyclic compounds [ 1 , 2 ] .
multicomponent reactions ( mcrs ) have emerged as an important tool for building of diverse and complex organic molecules through carbon - carbon and carbon - heteroatom bond formations taking place in tandem manner . particularly , in the last three decades a number of three- and four - component reactions have been developed [ 46 ] .
xanthene derivatives are very important heterocyclic compounds and have been widely used as dyes and fluorescent materials for visualization of biomolecules and in laser technologies .
they have also been reported for their agricultural bactericide activity and anti - inflammatory and antiviral activity .
these compounds are also utilized as antagonists for paralyzing action of zoxazolamine and in photodynamic therapy . due to their wide range of applications ,
a wide variety of methods for the preparation of the xanthenes have been reported [ 1319 ] . however , many of these methods are associated with several shortcomings such as long reaction times ( 16 h to 5 days ) , expensive reagents , harsh conditions , low product yields , and use of toxic organic solvents .
diazabicyclo[2.2.2]octane ( dabco ) is an inexpensive , nontoxic , and commercially available catalyst that can be used in laboratory without special precautions [ 2022 ] .
but , it has not been used as a catalyst in xanthene synthesis ; only a few reports are therein the literature [ 2325 ] .
this prompted us to develop a new synthetic method for heteroaryl substituted xanthenes using dabco as a catalyst ( see scheme 1 ) . with our continued interest in the synthesis of heterocyclic systems and application of dabco as a catalyst in organic synthesis herein
, we wish to report a facile condensation of heteroarylaldehyde , 5,5-dimethyl-1,3-cyclohexanedione ( dimedone ) , in the presence of catalytic amount of dabco to produce a variety of 1,8-dioxo - octahydroxanthenes derivatives 1(a f ) ( scheme 2 ) .
in order to optimize the reaction conditions , the synthesis of compound 1d was used as a model reaction .
therefore , a mixture of 3-methyl thienaldehyde ( 1 mmol ) , 5,5-dimethyl cyclohexane-1,3-dione ( 2 mmol ) in h2o was refluxed for an appropriate time as indicated by tlc using different amounts of dabco ( table 1 ) .
traces of the product could be detected in the absence of this catalyst ( entry 1 ) , while good results were obtained in the presence of dabco .
the optimal amount of the catalyst was 10 mmol% ( entry 6 ) ; the higher amount of the catalyst did not increase the yield noticeably ( entry 7 ) .
the synthesized products 1(a f ) in scheme 2 were further treated with malononitrile to obtain corresponding alkylidenes 2(a f ) by the knoevenagel reaction .
the reaction involves the attack of malononitrile on two carbonyl groups ( c = o ) of xanthene derivatives to form alkylidene malononitrile within 60 min . using dabco as an organic catalyst ( scheme 3 ) . in order to extend the range of substrates , we employed a wide range of aldehydes in the presence of 10 mmol% dabco under similar conditions . it was found that this method is effective with a variety of substituted heteroarylaldehydes independent of the nature of the substituent on the heteroaromatic ring and obtained satisfactory results ( table 2 ) .
the formation of the products 1(a f ) was assumed to proceed via formation of a knoevenagel product which on addition of 2nd molecule to give the michael adduct intermediate was followed by cyclization reaction ( scheme 4 ) .
an ,-bis(arylidene)cycloalkanone a was first condensed with dimedone to afford the b on addition of 2nd molecule of dimedone ; this step can be regarded as a michael addition reaction .
the intermediate b was cyclized by nucleophilic attack of the oh group on the c = c moiety and gave the expected products 1(a f ) .
in summary , we have reported an efficient , simple , convenient , and straightforward practical one - pot procedure for the synthesis of 1(a f ) in aqueous media .
reaction of malononitrile on the synthesized products 1(a f ) gave corresponding alkylidene derivatives 2(a f ) in good yields .
, there is no need for dry solvents or protecting gas atmospheres . using dabco as a catalyst offers advantages including simplicity of operation , easy workup , time minimizing , and high yields of products .
the procedure is very simple and can be used as an alternative to the existing procedures .
the chemicals used in the synthesis of the octahydroxanthene-1,8-diones were obtained from the merck and aldrich chemical co. all chemicals and solvents used for the synthesis were of analytical reagent grade .
reactions were monitored by thin layer chromatography on 0.2 mm silica gel f-252 ( merck ) plates .
melting points were determined by open capillary method and were uncorrected.h ( 400 mhz ) and c ( 200 mhz ) spectra were recorded on bruker 3000 nmr spectrometer in cdcl3/dmso - d 6 ( with tms for h and cdcl3 as internal references ) unless otherwise specified stated . a mixture of 5-membered , heteroarylaldehyde ( 1 mmol ) , 5,5-dimethylcyclohexane-1,3-dione ( 2 mmol ) , and dabco ( 10 mmol% ) in h2o ( 20 ml ) was refluxed for 30 min .
after completion of the reaction , the mixture was cooled to room temperature , and the solid was filtered off and washed with h2o .
a mixture of heteroaryl substituted xanthenes ( 1 mmol ) , malononitrile ( 2 mmol ) , and dabco ( 10 mmol % ) in h2o ( 20 ml ) was stirred for 60 min .
after completion of the reaction , the mixture was cooled to room temperature and the solid was filtered off and washed with h2o .
the crude product was purified by column chromatographic technique using hexane : ethyl acetate .
h nmr ( 400 mhz , cdcl3 ) : 1.014 ( s , 6h , 2ch3 ) , 1.084 ( s , 6h , 2 ch3 ) , 2.235 ( s , 4h , 2 ch2 ) , 2.425 ( s , 4h , ch2 ) , 4.941 ( s , 1h , ch ) , 6.1596.181 ( m , 2h , ar - h ) , 7.1337.139 ( d , 1h , ar - h ) ; ir : 3078 cm ( ar - h ) , 2865 cm ( aliph .
h ) , 1730 cm and 1673 cm ( c = o ) , 1602 cm ( c = c ) , 1180 cm ( c o c ) .
calcd for c21h24o4 : c 74.09 , h 7.11 ; found c 74.03 , h 7.07 .
h nmr ( 400 mhz , cdcl3 ) : 1.039 ( s , 6h , 2 ch3 ) , 1.109 ( s , 6h , 2 ch3 ) , 2.109 ( s , 4h , 2 ch2 ) , 2.551 ( s , 4h , ch2 ) , 4.832 ( s , 1h , ch ) , 6.1086.226 ( m , 2h , ar - h ) , 3.228 ( s , 3h , ar - ch3 ) ; ir : 3109 cm ( ar - h ) , 2905 cm ( alih .
h ) , 1722 cm and 1688 cm ( c = o ) , 1630 cm ( c = c ) , 1172 cm ( c o c ) .
calcd for c22h26o4 : c 74.55 , h 7.39 ; found c 75.28 , h 6.88 .
h nmr ( 400 mhz , cdcl3 ) : 1.208 ( s , 12h , 4 ch3 ) , 2.109 ( s , 4h , 2 ch2 ) , 2.401 ( s , 4h , 2 ch2 ) , 4.622 ( s , 1h , ch ) , 6.554 ( d , 1h , ar - h ) , 6.828 ( d , 1h , ar - h ) , 7.298 ( dd , 1h , ar - h ) ; ir : 3135 ( ar - h ) , 2920 cm ( aliph .
h ) , 1716 cm ( c = o ) , 1648 cm and 1620 cm ( c = c ) , 1108 cm ( c o c ) .
calcd for c21h24o3s : c 70.75 , h 6.79 , s 8.99 ; found c 71.33 , h 6.28 , s 8.49 .
h nmr ( 400 mhz , cdcl3 ) : 1.100 ( s , 12h , 4 ch3 ) , 3.035 ( s , 3h , ar - ch3 ) , 2.281 ( s , 4h , 2 ch2 ) , 2.544 ( s , 4h , 2 ch2 ) , 4.875 ( s , 1h , ch ) , 6.478 ( d , 1h , ar - h ) , 6.824 ( d , 1h , ar - h ) ; ir : 3042 cm ( ar - h ) , 2963 cm ( c h ) , 1730 cm ( c = o ) , 1607 cm and 1588 cm ( c = c ) , 1150 cm ( c o c ) .
calcd for c22h26o3s : c 71.32 , h 7.07 , s 8.65 ; found c 71.28 , h 7.09 , s 8.69 .
h nmr ( 400 mhz , cdcl3 ) : 1.288 ( s , 12h , 4 ch3 ) , 2.988 ( s , 3h , ar - ch3 ) , 2.448 ( s , 4h , 2 ch2 ) , 2.722 ( s , 4h , 2 ch2 ) , 4.658 ( s , 1h , ch ) , 6.234 ( d , 1h , ar - h ) , 6.775 ( d , 1h , ar - h ) ; ir : 3090 cm ( ar - h ) , 2882 cm ( aliph .
h ) , 1716 cm ( c = o ) , 1632 cm and 1610 cm ( c = c ) , 1148 cm ( c o c ) .
calcd for c22h26o3s : c 71.32 , h 7.07 , s 8.65 ; found c 71.54 , h 7.68 , s 9.14 .
h nmr ( 400 mhz , cdcl3 ) : 1.0181.146 ( m , 12h , 4 ch3 ) , 2.154 ( br s , 8h , 4 ch2 , 5.601 ( s , 1h , ch ) , 6.9576.970 ( s , 1h , ar - h ) , 6.6986.710 ( d , 1h , ar - h ) , 6.162 ( dd , 1h , ar - h ) , 9.570 ( br s , 1h , nh ) ; ir : 3397 cm , 3328 cm ( n h ) , 3065 cm ( ar - h ) , 2978v ( aliph .
c h ) , 1680 cm ( c = o ) , 1604 cm and 1469 cm ( c = c ) , 1145 cm ( coc ) .
calcd for c21h25no3 : c 74.31 , h 7.42 , n 4.13 ; found c 74.26 , h 7.46 , n 4.15 .
h nmr ( 400 mhz , cdcl3 ) : 1.016 ( s , 6h , 2 ch3 ) , 1.128 ( s , 6h , 2 ch3 ) , 2.246 ( s , 4h , 2 ch2 ) , 2.665 ( s , 4h , ch2 ) , 4.941 ( s , 1h , ch ) , 6.1546.188 ( m , 2h , ar - h ) , 7.1387.144 ( d , 1h , ar - h ) ; ir : 3078 cm ( ar - h ) , 2865 cm ( aliph .
c h ) , 2224 cm ( cn ) , 1716 cm and 1684 cm ( c = o ) , 1620 cm ( c = c ) , 1154 cm ( c o c ) .
calcd for c27h24n4o2 : c 74.29 , h 5.54 , n 12.84 ; found c 73.82 , h 5.69 , n 12.09 .
h nmr ( 400 mhz , cdcl3 ) : 0.986 ( s , 6h , 2 ch3 ) , 1.235 ( s , 6h , 2 ch3 ) , 2.244 ( s , 4h , 2 ch2 ) , 2.658 ( s , 4h , ch2 ) , 4.988 ( s , 1h , ch ) , 6.1596.181 ( m , 2h , ar - h ) , 3.286 ( s , 3h , ar - ch3 ) ; ir : 3058 cm ( ar - h ) , 2944 cm ( aliph .
c h ) , 2224 cm ( cn ) , 1714 cm and 1682 cm ( c = o ) , 1622 cm ( c = c ) , 1144 cm ( c o c ) .
calcd for c28h26n4o2 : c 74.65 , h 5.82 , n 12.44 ; found c 75.11 , h 6.08 , n 11.88 .
h nmr ( 400 mhz , cdcl3 ) : 1.029 ( s , 6h , 2 ch3 ) , 1.208 ( s , 6h , 2 ch3 ) , 2.248 ( s , 4h , 2 ch2 ) , 2.659 ( s , 4h , ch2 ) , 4.745 ( s , 1h , ch ) , 6.6866.789 ( m , 2h , ar - h ) , 7.2527.263 ( d , 1h , ar - h ) ; ir : 3078 cm ( ar - h ) , 2988 cm ( aliph .
c h ) , 2224 cm ( cn ) , 1710 cm and 1688 cm ( c = o ) , 1626 cm ( c = c ) , 1164 cm ( c o c ) .
calcd for c27h24n4os : c 71.65 , h 5.35 , n 12.84 , s 7.09 ; found c 71.18 , h 5.74 , n 12.12 , s 7.83 .
h nmr ( 400 mhz , cdcl3 ) : 1.044 ( s , 6h , 2 ch3 ) , 1.301 ( s , 6h , 2 ch3 ) , 2.144 ( s , 4h , 2 ch2 ) , 2.656 ( s , 4h , ch2 ) , 4.886 ( s , 1h , ch ) , 6.1366.172 ( m , 2h , ar - h ) , 3.114 ( s , 3h , ar - ch3 ) ; ir : 3098 cm ( ar - h ) , 2898 cm ( aliph .
h ) , 2224 cm ( cn ) , 1710 cm and 1682 cm ( c = o ) , 1663 cm ( c = c ) , 1156 cm ( c o c ) .
calcd for c28h26n4os : c 72.07 , h 5.62 , n 12.01 , s 6.87 ; found c 71.12 , h 5.28 , n 12.84 , s 7.15 .
h nmr ( 400 mhz , cdcl3 ) : 1.022 ( s , 6h , 2 ch3 ) , 1.308 ( s , 6h , 2 ch3 ) , 2.224 ( s , 4h , 2 ch2 ) , 2.538 ( s , 4h , ch2 ) , 4.908 ( s , 1h , ch ) , 6.1086.191 ( m , 2h , ar - h ) , 3.257 ( s , 3h , ar - ch3 ) ; ir : 3086 cm ( ar - h ) , 2910 cm ( aliph .
h ) , 2224 cm ( cn ) , 1728 cm and 1692 cm ( c = o ) , 1605 cm ( c
calcd for c28h26n4os : c 72.07 , h 5.62 , n 12.01 , s 6.87 ; found c 71.43 , h 5.12 , n 12.77 , s 7.25 .
h nmr ( 400 mhz , cdcl3 ) : 1.022 ( s , 6h , 2 ch3 ) , 1.063(s , 6h , 2 ch3 ) , 2.268 ( s , 4h , 2 ch2 ) , 2.569 ( s , 4h , ch2 ) , 4.858 ( s , 1h , ch ) , 6.1686.198 ( m , 2h , ar - h ) , 7.1247.138 ( d , 1h , ar - h ) , 8.986 ( br s , 1h , nh ) ; ir : 3064 cm ( ar - h ) , 2936 cm ( aliph .
c h ) , 2224 cm ( cn ) , 1710 cm and 1678 cm ( c = o ) , 1619 cm ( c = c ) , 1166 cm ( coc ) .
calcd for c21h24o4 : c 74.46 , h 5.79 ; found c 74.12 , h 6.08 . | the reaction of 5,5-dimethylcyclohexane-1,3-dione with various heteroarylaldehydes afforded the corresponding heteroaryl substituted xanthene derivatives 1(a f ) .
the reaction proceeds via the initial knoevenagel , subsequent michael , and final heterocyclization reactions using 1,4-diazabicyclo[2.2.2]octane ( dabco ) as a catalyst in aqueous media .
the synthesized heteroaryl substituted xanthenes 1(a f ) reacted with malononitrile to obtain different alkylidenes 2(a f ) .
short reaction time , environmentally friendly procedure , avoiding of cumbersome apparatus , and excellent yields are the main advantages of this procedure which makes it more economic than the other conventional methods . |
the potential for genomics to contribute to clinical care has long been recognized , and many optimistic scenarios for clinical use of information about a patient 's genome have been proposed . the pace of realizing this potential has appeared slow to some , although clinical adoption of scientific discoveries has been estimated to take up to 17 years and a recent genetic example required 18 years after the initial 1991 report . indeed ,
phenotype associations for common , complex diseases only began to become available around 2005 . yet
several academic medical centers and integrated health systems have already begun programs for implementing genomic medicine , which we define here as using an individual patient 's genotypic information in his or her clinical care .
this definition encompasses both mendelian and multigenic complex diseases , and at present probably focuses most on single mendelian variants of large effect , although emphasis is expected to shift soon to assaying and using multiple variants simultaneously in clinical care .
this is not only because of an expanding knowledge base but also because the logistic complexities and costs of assessing genomic variation on a large scale are approaching those of one - at - a - time testing of individual variants , permitting a more holistic approach to incorporating genomic findings into clinical care .
these initial and separate forays have encountered similar obstacles and developed many of the same nascent solutions , often quite independently . in expectation that sharing of lessons learned in these efforts can facilitate broader and more effective implementation of genomic medicine , the national human genome research institute in collaboration with several leaders in this area ( r.l.c .
. , and r.wilson ) brought together about 20 groups working to implement genomic medicine for a genomic medicine colloquium in june 2011 .
this article summarizes the projects described by these groups , describes challenges they have encountered in implementation , identifies common infrastructure and research needs , and outlines an implementation framework for introducing similar genomic medicine programs more broadly .
participating sites reported a broad range of genomic medicine activities , both in pilot and full implementation forms ( table 1 ) . these included genotyping ( used here and throughout to refer to the detection of genetic variants by single - nucleotide polymorphism assay , sequencing , or other technologies ) of somatic mutations in malignant tumors to guide treatment decisions .
the expanding scope and growing acceptance of such techniques places tumor genotyping at the forefront of genotype - directed care .
all the participating sites ( and most cancer centers nationwide ) conduct tumor genotyping of cancers such as melanoma and those of the breast , colon , and lung for the targeting of therapy .
several also use genotyping to select patients for interventional protocols , but the main focus here was on the use of genomics outside of cancer diagnosis and treatment .
several centers have begun targeted screening for highly penetrant germline mutations for lynch syndrome and in brca1/2 to identify genetically at - risk individuals . with appropriate immunohistochemical or other evidence suggestive of germline mutations ,
patients can be actively sought and counseled regarding the importance of genomic testing for their own treatment and for potential preventive care of their relatives .
direct outreach to patients at the cleveland clinic , for example , increased the uptake of germline testing in patients with colorectal cancer by nearly sixfold from 14% with information provided directly to surgeons to 80% with a genetic counselor seeing patients at follow - up examinations ( c.e . , unpublished data ) .
highly penetrant variants such as these provide robust , evidence - based paradigms to help move a clinical site toward implementing broader genomic medicine approaches .
more important , perhaps , successful implementation of screening programs at early adopter sites provides valuable lessons and refined approaches that may be adopted elsewhere .
self - reported family history information can also be used in risk assessment for individual patients with documented clinical validity and utility , despite its potential weaknesses such as incomplete or inaccurate reporting .
family history is generally not difficult to collect , especially with electronic data collection tools such as the surgeon general 's my family health portrait , although integrating the information into an independent electronic medical record ( emr ) is not trivial . clinicians are generally familiar with family history and appreciate its importance , and evidence - based guidelines are available for several conditions . a duke university pilot project , for example ,
is collecting three - generation family history information on 48 diseases using a web - based computerized tool .
patient - entered information is integrated into the medical record and generates a pedigree , tabular family history , and reports for the patient and clinician , as well as decision support information for four conditions ( breast , ovarian , and colorectal cancer and venous thrombosis ) .
outcomes being assessed include patient and clinician satisfaction and ease of use ; changes in patient behaviors such as diet and smoking ; changes in physician behaviors such as screening and referral ; and estimates of sensitivity , specificity , net reclassification , and cost .
similarly , a cleveland clinic prototype collects three - generation family histories for the assessment of all inherited cancer syndromes .
intermountain healthcare has also deployed a patient - entered family tool ( our family health ) in their electronic patient portal .
pharmacogenomics provides additional opportunities in genomic medicine , particularly if appropriate decision support tools present relevant data to clinicians only when needed . patients
genetically unable to activate prodrugs such as clopidogrel , tamoxifen , and codeine , for example , do not need their genetic data presented to their clinicians unless and until these drugs are about to be prescribed .
although reactive genotyping for pharmacogenomic variants can be ordered at many sites , turnaround is often slow and uptake low . to address this , the vanderbilt university medical center and st .
jude children 's research hospital have both implemented programs to conduct preemptive genotyping in patients very likely to receive medications with relevant genetically based dosing algorithms . at vanderbilt , for example , selected patients , including those undergoing coronary angiography for acute coronary syndromes receive genotyping on a 184-variant platform that includes cyp2c19 alleles before being prescribed clopidogrel , based on a review of available evidence of poorer outcomes in persons with variant cyp2c19 alleles . at st .
jude children 's research hospital , array - based testing for 225 genes is performed , and results for those genes with the strongest clinical evidence are placed in the emr .
clinical pharmacogenomic testing is expanding to several sites affiliated with the pharmacogenomics research network ( pgrn ) with a goal of implementing proactive genotyping of a large number of variants , such as those identified by pharmgkb or the us food and drug administration ( fda ) .
preemptive testing , embedding this information into the emr with appropriate decision support , and then seamlessly presenting it at the point of care when needed , rather than requiring tests to be ordered each time a relevant medication is prescribed , could help to minimize delay , cost , lack of follow - through , and duplicate testing .
this is a testable hypothesis and one that is likely to be explored in programs such as the electronic medical records and genomics ( emerge ) network .
preemptive pharmacogenomic information could be even more useful were informed patients able to access it and work proactively with their clinicians in making treatment decisions .
putting patients in control of their genomic information is another potential strategy for genomic medicine implementation that needs evaluation .
such implementation strategies could be evaluated by measuring improvement , or lack thereof , in efficiency , cost , and health outcomes .
whole - exome ( protein - coding exons plus other highly conserved regions ) and whole - genome sequencing are beginning to be used for identifying genetic causes of rare , unknown conditions , particularly those presenting in childhood or in strongly affected pedigrees for which novel mutations are more easily detected .
the recent cases of a young boy with severe , atypical , refractory inflammatory bowel disease and of three families with severe arterial calcifications demonstrate the potential for this approach to detect novel disease - causing mutations and point the way toward appropriate therapies .
the medical college of wisconsin and children 's hospital of wisconsin have implemented a genome sequencing program to which clinicians can nominate patients who remain undiagnosed after appropriate clinical evaluation and testing .
nominations are reviewed by a multidisciplinary patient selection committee chaired by the hospital 's chief medical officer .
sequencing is provided by a commercial laboratory certified by the college of american pathologists ( cap ) laboratory accreditation program and the clinical laboratory improvement amendments ( clia ) program .
the detected variants are analyzed using an in - house , validated software package , focusing first on specific candidate genes nominated by the referring clinicians to limit the chances of incidental , potentially unrelated findings .
potentially relevant variants are confirmed by an independent method , and those results are placed in the medical record .
the baylor college of medicine has implemented a whole genome laboratory with in - house sequencing and analysis of variants in a clia / cap environment with review and sign - out by a board - certified clinical molecular geneticist .
a number of other centers ( geisinger clinic , partners healthcare , washington university ) and commercial laboratories such as ambry genetics , genedx , and seqwright are also now offering whole - genome sequencing that can be used in clinical care . these four briefly described applications tumor - based screening , family history directed decision support , pharmacogenomics , and diagnostic genome sequencing demonstrate that genomic medicine is no longer on the threshold ; it has arrived .
although much of this work is being pursued as part of research programs , some has been adopted institutionally and offered in a clia - certified laboratory environment as part of regular clinical care .
evaluating the impact of such programs and expanding their reach to diverse settings and populations is a high priority within the national human genome research institute 's research agenda and mission .
information from such programs is helping to provide a needed evidence base to support more widespread implementation and reimbursement .
consideration of the barriers encountered and strategies used to surmount them by early adopter
genomic medicine sites may help speed their evaluation and facilitate their expansion to the mainstream of clinical care .
numerous challenges and barriers have been encountered in launching genomic medicine projects and many common solutions have emerged ( table 2 ) . the greatest challenge may be the lack of appreciation by clinicians , health - care institutions , and payers of the potential for genomics to improve patient care , as compelling evidence of clinical validity and utility is limited at present . even for genomic applications with proven validity and utility , such as family history , there is lack of adoption and implementation , suggesting the lack of evidence is far from being the only barrier .
cost concerns and institutional inertia typically demand convincing arguments and hard data before clinical practice is changed , yet the genome - wide nature of results to be expected by incorporating dense genotyping technologies into clinical care will soon force clinicians and institutions to deal with genomic information for which evidence may be quite limited .
evidentiary thresholds may thus need to be aligned with the intended use of the information , as the impact of genotype - driven care on morbidity and mortality can not be tested for every variant .
institutions have frequently relied on expert panels and local committees to evaluate available evidence and recommend particular new initiatives in genomic medicine , such as testing for specific pharmacogenomic variants or estimating risk to carriers .
such panels have tended to work in isolation from institution to institution , surveying the same evidence and often coming to similar conclusions .
far better would be to harness the collective knowledge of these groups in a more systematic way , distributing among them the genomic medicine issues for which evidence is compiled and evaluated , such as antidepressant therapy , coronary disease risk assessment , or risk in relatives of patients with colorectal cancer .
these groups could then use a mutually accepted protocol for evaluation , with conclusions of each process shared among all .
this is similar to the approach taken by the centers for disease control and prevention 's evaluation of genomic applications in practice and prevention ( egapp ) , the clinical pharmacogenomics implementation consortium , and by some early adopter institutions in developing committees of their own .
given the rapid spread of diagnostic sequencing and direct - to - consumer testing , it may be appropriate to begin to identify an intermediate category of actionable variants , for which evidence is insufficient to establish unequivocal clinical utility but is sufficient to determine how already available information could be used .
consideration should be given to tailoring of required levels of evidence to the risk / benefit ratio of the specific clinical setting at issue ; development of consensus on evidence needed in different scenarios would be a valuable contribution .
recommendations for drastic or irreversible interventions such as genotype - driven mastectomy or salpingo oophorectomy , for instance , should require far stricter evidence than should low - risk interventions such as modifying choice between two proven , roughly equivalent medications such as codeine and hydromorphone . for more modest interventions ,
the risks are more likely to involve factors such as burden to clinicians and patients in obtaining , interpreting , and managing the result , including learning of incidental findings not sought by clinician or patient ; cost of testing ; and psychological impact of the information on patients or their families .
the first two of these can be addressed in part by improving the accessibility and lowering the costs of obtaining genomic information suitable for clinical use , which is occurring rapidly with expanding certification of genomic technologies and laboratories under clia and cap .
testing fees can be substantial , especially when individual genetic variants are assayed sequentially , and indeed are soon likely to rival the cost of obtaining an entire genome sequence . for a genetically heterogeneous condition , such as charcot - marie - tooth disease , that is potentially due to variation at one or more of over 40 genetic loci , for example , whole - exome sequencing can already be performed for less than half the price of the current clinically available multigene panel .
third - party reimbursement of these costs is thus crucial for ensuring uptake by institutions and patients . integrating effective clinical decision support tools into the emr , to query a patient 's genomic data as care is being delivered , will be needed to present relevant variants and recommendations only when they are indicated .
such real - time , genomically driven clinical decision support can help avoid alert fatigue and relieve the clinician of trying to sift through the massive amount of genomic information without impeding clinical workflow .
sharing the effort of following up actionable genetic variants and at - risk family members with a dedicated genomic medicine team , with the primary physician 's agreement and in ways that do not compete for the patient , can also minimize burden on patients and clinicians and increase efficiency .
looking to the future , the potential to update emrs automatically as new discoveries are made and their clinical utility validated provides exciting possibilities for rapid implementation of research advances . growing knowledge and understanding , however , mean that variants that are today of uncertain importance may tomorrow be found to be of great clinical relevance and vice versa .
the responsibility of the clinician to recontact the patient with this new information is uncertain and could pose a major burden as well as medico - legal risks .
psychological impact on patients and their families has traditionally been addressed by the informed consent process and genetic counseling , but expanding genomic medicine efforts will likely soon outstrip the available supply of genetic counselors .
innovative models utilizing ancillary personnel or social media tools to provide counseling and education , along with broad - ranging educational campaigns to increase familiarity with genomic medicine among practitioners , patients , and payers , will have the greatest impact if they can be linked to early successes and readily observable local efforts .
reports of successes such as reduced hospitalization rates following genotype - driven adjustments in warfarin dosing , e.g. , or symptomatic improvement or reduced adverse effects after genotype - driven selection of antidepressants , can help stimulate discussion of the potential for genomic medicine to improve outcomes and shift an institution 's culture to embrace genotype - guided care , although even these examples need a more complete evidence base and remain controversial .
genomic medicine programs share needs for basic informational and policy infrastructure as well as evidence and outcomes produced through research ( table 3 ) . key infrastructure needs include a comprehensive knowledge base that captures sequence variants and their phenotypic associations and is openly accessible to clinical groups attempting to interpret sequence data .
such a knowledge base would have enormous value for research as well , particularly to the degree that it entails a careful curation and consensus process to reduce error and promote consistency . here again , many genomic medicine groups appear to be doing this in isolation , capturing and reviewing such information internally but finding themselves constrained in sharing it outside their institutions . the policy aspects of establishing such a knowledge base , ensuring the accuracy of associations to be reported within it , and providing wide access to it are far from trivial and involve patient privacy and confidentiality of health information . linking to appropriate supporting evidence and providing frequent updates are also daunting tasks , given the rapid pace of discovery , but are tasks that could readily be distributed among collaborating groups .
perhaps an even greater informational need addressable by data sharing among genomic medicine groups and other genome sequencing projects is the ability to determine whether a newly discovered variant has been reported before .
this is currently done by surveying available large - scale databases , such as the 1000 genomes project , the exome variant server , and local institutional catalogs , on the presumption that a patient with a very rare or undiagnosed condition likely has a private or even unique variant .
far better than individual small cohorts of sequenced patients would be to aggregate cohorts and make their data widely available to qualified clinicians and researchers .
sequence variants in these databases should also be linked to phenotypic information , when possible , rather than forcing the assumption that all available sequenced individuals are free of the disease under consideration .
the recently initiated centers for mendelian genomics will identify variants responsible for a great number of rare disorders and make this information widely available , which should help in this regard .
the nascent clinvar database of the national center for biotechnology information and the international standards for cytogenomic arrays database available in dbgap and dbvar are two open - access databases that can provide valuable phenotypic information associated with rare sequence variants and structural variation . placing all this information in a single queryable source , regardless of where the actual data reside , would be a substantial advance in interpreting the three million or more differences from the human reference sequence identifiable per individual .
genomic sequencing , in contrast to genotyping microarray technology , reveals rare or even unique alleles lacking scientific literature support for physiological effects .
computational approaches to predicting function may need to be incorporated into clinical decision support methods in trying to determine the implications of such variants for clinical care .
such analyses would be greatly facilitated by standard formats for reporting the data produced by individual sequencing groups rather than expecting individual clinicians and clinical sites to handle and interpret multiple different formats .
the centers for disease control and prevention are currently working to develop performance specifications for next - generation sequencing .
access to accurate , low - cost genome sequencing in cap / clia - certified environments will remain a major limiting factor in utilizing sequencing in clinical care across diverse settings .
provision of genome sequencing as a commodity service in national or regional hubs , including interpretation of potential clinical relevance of identified variants , could be a major advance .
appropriate professional organizations that can develop genomic medicine practice guidelines , such as the american college of medical genetics and genomics , the college of american pathologists , and the association of molecular pathologists , as well as regulatory agencies such as the fda and centers for medicare and medicaid services , should be involved in developing evidentiary standards tailored to specific interventions under consideration and criteria for reimbursement . targeted education for active practitioners should also be tailored to specific settings and delivered as succinctly as possible at the point of care for maximum uptake and value , whereas broader educational efforts can capture clinicians earlier in their training .
fellowships in pharmacogenomics and genomic medicine will be needed to develop specialists ( perhaps clinical genomicists , akin to radiologists or pathologists ) capable of interpreting patients ' genomic information and advising clinicians on appropriate actions to be taken for a given set of variants in a given clinical setting .
given the broad range of possible genomic medicine applications , the training of physicians and scientists enrolled in certified programs of the american board of medical genetics and genomics and the american board of pathology in clinical genetics , molecular genetics , biochemical genetics , and cytogenetics is particularly relevant .
consideration should be given to the potential for expanding the curricula of these programs to include more genomic medicine content or providing fellowships within these specialties that focus on genomic medicine .
other educational modes such as seminars , slide sets , webinars , and videos need to be developed and shared across institutions doing similar types of work . expanded emr capabilities to permit querying of sequence or other dense genomic data , and incorporation of family history , are readily addressable .
emrs also have the ability to deliver context - specific educational information at the point of care during an eminently teachable moment , with a clinical conundrum at hand , as well as more sophisticated clinical decision support to aid clinicians in the appropriate use of genomic information .
challenges in implementing point - of - care tools need to be recognized , however , including the potential for overwhelming clinicians with alerts leading to alert fatigue . here again , consideration should be given to the evidence needed for implementing such tools in genomic medicine and for ensuring the consistent adoption of point - of - care interventions for high priority health - care targets with the best risk / benefit ratio and strongest evidence , whether genomic or nongenomic .
research is acutely needed to generate , collect , and make widely available the evidence needed for determining which variants are actionable , in whom , and in what clinical situations .
intermediate steps are needed that lie between genomic discovery research and routine clinical implementation to generate the evidence base to justify implementation .
consensus should be sought on the levels of evidence needed to justify the introduction of genomic medicine interventions , taking into account the degree of complexity or cost ( such as family history vs. whole - genome sequencing ) and risk / benefit ( lynch syndrome screening vs. universal colonscopy ) involved , and the comparisons and outcome measures needed to answer these questions . generating clear evidence of benefit for genomic interventions will remain challenging , however , in part because the rarity of many genomic markers of risk means large samples must be studied to accrue benefit / risk data in the small subsets of patients affected .
even with large samples , there can be controversy about the interpretation of the evidence , as shown by the data on the relationship between cyp2c19 variants and failure of antiplatelet efficacy of clopidogrel . in one meta - analysis that included only patients with acute coronary syndromes ,
there was strong evidence for an effect of variant alleles on outcomes , whereas another analysis that included trials with different indications ( and in which the efficacy of clopidogrel itself appears to be less ) reported a much smaller effect of genetic variation on outcome .
thus , the evidence supporting an effect of pharmacogenomic variants on variable drug outcomes may also depend on indication , substantially increasing the complexity of generating and evaluating evidence .
they should facilitate association analysis and assessment of actionability and influence on outcomes from available data .
given that it is impossible , however , to perform prospective studies of the impact of all potentially important variants on clinical outcomes , comprehensive strategies will be needed to generate the necessary data .
real - world studies quantifying the impact of implementing genomic medicine programs on patient outcomes , cost and acceptability of care , and clinician and patient satisfaction are needed to promote adoption and dissemination of genomic medicine .
such studies fall under the rubric of implementation research , defined as the study of methods to promote the systematic uptake of proven interventions into routine practice .
comparative effectiveness research assessing the added value of genomic information , such as genomic variants added to family history added to clinical risk factors , and consensus on the outcomes and evidence needed to answer such questions , would help to define priorities for collecting and using such information in a cost - effective way .
informed consents for genomic research should be broadened to include return of results , where desired and appropriate , so that lack of such consent ( or indeed , consent forms declaring no results will ever be returned ) does not become an obstacle , if not an excuse , for failing to report actionable findings .
the consent process should also explicitly address deposition of data in the emr or research databases and sharing of variant information among researchers and clinicians .
assembling early adopters of genomic medicine into a confederation or community should facilitate addressing the many infrastructure and research needs outlined here .
collaborative projects such as those of the pgrn can facilitate dissemination and testing of genomic medicine approaches in diverse settings to maximize their generalizability and usefulness .
such projects can help develop best practices for complex tasks such as implementation and dissemination , defining and collecting outcomes of implementation , and delivering genomic information to clinicians and patients .
a clearinghouse of successful implementation projects , with detailed protocols addressing steps needed for patients , clinicians , laboratories , departments , and institutions , would go a long way toward disseminating this work beyond early adopter sites . indeed , a critical question to ask is whether and how approaches developed at highly specialized and resourced tertiary care centers can be adopted in less resource - intensive settings .
incorporating genomic results into clinical care is as much a cultural and political exercise within a given institution as a scientific one , although a firm scientific grounding is essential to convincing the various stakeholders to accept an implementation project , particularly the first one ( figure 1 ) .
such grounding can be obtained from a comprehensive review of the available scientific literature , recommendations of expert groups , and examination of ongoing successful projects at other institutions .
available policy or institutional guidelines on implementing changes to clinical care must also be considered .
critical in choosing an initial implementation project is the pragmatic issue of identifying a group of ready adopters or clinical champions , such as a subspecialty group or local practice , willing to try a new approach .
indeed , selection of a pilot project among several possibilities may hinge upon the availability of an enthusiastic group of clinicians . identifying and engaging the myriad stakeholders within an institution , including those needed to conduct genetic testing , interpret it , integrate it with the emr , provide results and recommendations to the clinician , and pay for it , require that senior leaders who are familiar with the institution and its culture be on the genomic medicine team .
it also often requires patience , persistence , and sufficient standing within the organization to convince skeptics and overcome institutional inertia .
some programs have found it simpler to begin at smaller affiliated hospitals or practices rather than at dominant academic medical centers .
engagement and support from institutional leadership is obviously crucial , and most successful programs have involved them directly in decision making , as chairs of committees selecting interventions to implement , for example , or evaluating their impact .
funding may be provided through local institutional support , in anticipation perhaps of eventual reimbursement by major payers , or through foundation or research funding , including national institutes of health supported projects such as the clinical translational science awards and the pgrn .
institutional stakeholders are key in developing practical and efficient clinical workflows for obtaining testing and providing results .
development and testing of streamlined educational tools , which may be as simple as a pop - up window with appropriate links for the clinician and letters or brochures for patients , will be essential both for initiating a program and encouraging its acceptance .
once launched , careful monitoring of initial cases for adherence to established workflows and unanticipated barriers permits tailoring of procedures as needed .
outcome data related to ease of use , adherence , patient and clinician satisfaction and behaviors , cost , and , where possible , measures of morbidity and mortality can be used to modify the program and inform design and implementation of future efforts .
evaluation of the effectiveness of an implementation project should focus on outcomes of the implementation itself rather than the outcomes of treatment .
multiple institutions are actively engaged in using patients ' genomic information in their clinical care , either as pilot demonstration and research projects or as part of clinical care as a reimbursable service .
the genomic medicine colloquium revealed that much of this work is being done in isolation and would benefit from more structured collaboration and sharing of approaches across groups and institutions .
implementation of genomics in medicine would also benefit from establishing common infrastructure , such as a catalog of variants observed across large numbers of sequenced individuals to date , an updatable database of actionable variants , evidentiary standards tailored to benefits and risks , common clinical decision support tools including point - of - care educational materials , and collaborative projects to pool resources and identify best practices .
systematic and timely incorporation of advances in genomic research related to somatic and germline dna , as well as consideration of rna , protein , and epigenomic applications , will also be needed .
the national human genome research institute , in collaboration with several other national institutes of health institutes and in accord with its recent strategic plan , is currently exploring approaches for facilitating the research needed to implement genomic medicine on an ever - widening scale .
such efforts should also take full advantage of the extant momentum , information , and experience of early adopters across the united states , as well as the tools of implementation science to address the cultural barriers described above . the substantial national institutes of health investment in basic genomic research has yielded and will continue to yield new insights into the role of genetic variants in health and disease . it is now time to ensure those results are translated and used to the maximum benefit of patients by periodically convening relevant stakeholders and building on the vanguard of nationwide genomic medicine implementation projects . bringing these groups together in this way is anticipated to increase their diffusion , efficiency , and , ultimately , their value to patients and health care .
c.e . is an unpaid member of the external scientific advisory board of mymercury.com and of the genomic medicine advisory board of complete genomics , inc . | although the potential for genomics to contribute to clinical care has long been anticipated , the pace of defining the risks and benefits of incorporating genomic findings into medical practice has been relatively slow .
several institutions have recently begun genomic medicine programs , encountering many of the same obstacles and developing the same solutions , often independently . recognizing that successful early experiences can inform subsequent efforts
, the national human genome research institute brought together a number of these groups to describe their ongoing projects and challenges , identify common infrastructure and research needs , and outline an implementation framework for investigating and introducing similar programs elsewhere .
chief among the challenges were limited evidence and consensus on which genomic variants were medically relevant ; lack of reimbursement for genomically driven interventions ; and burden to patients and clinicians of assaying , reporting , intervening , and following up genomic findings .
key infrastructure needs included an openly accessible knowledge base capturing sequence variants and their phenotypic associations and a framework for defining and cataloging clinically actionable variants .
multiple institutions are actively engaged in using genomic information in clinical care .
much of this work is being done in isolation and would benefit from more structured collaboration and sharing of best practices.genet med 2013:15(4):258267 |
successful endodontic therapy depends on thorough cleaning and shaping followed by obturation of the root canal system . during obturation ,
root canal sealers serve to fill irregularities between the dentinal walls and the gutta - percha core , act as lubricants , fill lateral or accessory canals , and bond to gutta - percha and dentin11 .
numerous root canal sealers and intracanal pastes are commercially available and contain different components , including epoxy resin , zinc oxide - eugenol and calcium hydroxide .
sealers and pastes are materials used in the root canal system , and may induce inflammatory reaction when they extrude through the apical foramen and contact periradicular tissues . the calcium hydroxide - based paste l&c paste is claimed to induce apexification by stimulating the periapical tissues to promote apical mineralization , and it is also indicated to stimulate mineralization during perforation repair14 .
the iso standards establish general guidelines for the investigation of dental materials9 . for studies dealing with endodontic sealers ,
depending on the materials tested and its thickness , the ratio of sealer surface area to culture medium should be between 0.5 to 6.0cm/ ml .
this in vitro study aimed to assess the cytotoxicity of an epoxy - resin sealer ( ah plus ) , a zinc oxide - eugenol sealer ( fill canal ) , and a commercial calcium hydroxide - based paste ( l&c ) on thp-1 cells , measuring cell viability by trypan blue dye exclusion method .
a monocyte cell line thp-1 derived from acute monocyte leukemia was obtained from fundao oswaldo cruz ( rio de janeiro , brazil ) .
louis , mo , usa ) supplemented with 10% fetal bovine serum , penicillin ( 100 u / ml ) and streptomycin ( 100 u / ml ) .
cell cultures were maintained at 37c in a humidified atmosphere of 5% co.
figure 1 shows the tested materials and their compositions .
materials were mixed according to the manufacturer 's instructions and 0.4 g of each sample was applied to the bottom of a round plastic petri dish ( 35 mm 10 mm ) yielding a free specimen surface area of 55 mm , according to iso10993 - 59 standard . to prevent contamination ,
thereafter , each specimen was covered with 4 ml of rpmi 1640 cell culture medium ( sigma - biosciences ) supplemented with penicillin ( 100 u / ml ) , streptomycin ( 100 u / ml ) and sodium bicarbonate ( 2
g / l ) at 37c for a total period of 24 h. the supernatants were filtered through a 0.22m membrane ( millipore express plus membrane , millipore inc . ,
serial dilutions from the crude extract ( 100% ) were made to obtain dilutions of 10% , 1% , 0.1% , 0.01% , 0.001% , and 0.0001% in supplemented rpmi medium .
thp-1 cells were plated onto 24-well plates ( fal&con , 3072 , becton dickinson , oxford , uk ) at a density of 3.5 10 cells / well . after 24 h , 1 ml of extract for each serial dilution
was added to each well and incubated for 24 h at 37c in a humidified air atmosphere containing 5% co2 .
after incubation for 10 min at room temperature , the effect of the different materials on thp-1 cells was evaluated by 0.2% ( final concentration ) trypan blue dye exclusion analysis .
briefly , the cell number was determined by counting the viable cells in a hemocytometer .
the percentage of viable cells from each well after incubation with material extracts was obtained by applying the following equation : % viable cells = ( vc / tc ) x 100 , where vc = viable cells counted and tc = total cells counted ( stained plus unstained cells ) .
the difference between the control and experimental groups was analyzed statistically by the kruskal - wallis and mann - whitney tests ( spss version 10.0 ; spss inc .
a monocyte cell line thp-1 derived from acute monocyte leukemia was obtained from fundao oswaldo cruz ( rio de janeiro , brazil ) .
louis , mo , usa ) supplemented with 10% fetal bovine serum , penicillin ( 100 u / ml ) and streptomycin ( 100 u / ml ) .
materials were mixed according to the manufacturer 's instructions and 0.4 g of each sample was applied to the bottom of a round plastic petri dish ( 35 mm 10 mm ) yielding a free specimen surface area of 55 mm , according to iso10993 - 59 standard . to prevent contamination ,
thereafter , each specimen was covered with 4 ml of rpmi 1640 cell culture medium ( sigma - biosciences ) supplemented with penicillin ( 100 u / ml ) , streptomycin ( 100 u / ml ) and sodium bicarbonate ( 2
g / l ) at 37c for a total period of 24 h. the supernatants were filtered through a 0.22m membrane ( millipore express plus membrane , millipore inc . ,
serial dilutions from the crude extract ( 100% ) were made to obtain dilutions of 10% , 1% , 0.1% , 0.01% , 0.001% , and 0.0001% in supplemented rpmi medium .
thp-1 cells were plated onto 24-well plates ( fal&con , 3072 , becton dickinson , oxford , uk ) at a density of 3.5 10 cells / well . after 24 h ,
1 ml of extract for each serial dilution was added to each well and incubated for 24 h at 37c in a humidified air atmosphere containing 5% co2 .
after incubation for 10 min at room temperature , the effect of the different materials on thp-1 cells was evaluated by 0.2% ( final concentration ) trypan blue dye exclusion analysis .
briefly , the cell number was determined by counting the viable cells in a hemocytometer .
the percentage of viable cells from each well after incubation with material extracts was obtained by applying the following equation : % viable cells = ( vc / tc ) x 100 , where vc = viable cells counted and tc = total cells counted ( stained plus unstained cells ) .
the difference between the control and experimental groups was analyzed statistically by the kruskal - wallis and mann - whitney tests ( spss version 10.0 ; spss inc .
the cytotoxic effects of the epoxy - resin - based sealer ( ah plus ) , zinc oxide - eugenol - based sealer ( fill canal ) and calcium hydroxide - based paste ( l&c ) are shown in figure 2 .
crude and 10% extracts of all materials reduced significantly cell viability when compared to the control groups ( p<0.05 ) .
ten - fold dilutions of l&c , fill canal and ah plus killed 24 , 35 and 61% of thp-1 cells respectively .
dilutions of sealer extracts of 1% and lower caused minimal cell death as compared to the control groups ( p>0.05 ) , except for 1% l&c paste extract , which was significantly different from control ( p<0.05 ) ( figure 2 ) .
thp-1 cells were chosen because they may differentiate into phagocytes22 , which are the predominant cells in a chronic inflammatory response .
extrusion of intracanal materials , such as sealers or pastes , beyond the apical foramen resulting in direct contact with periapical tissues is undesirable .
chronic inflammatory diseases of tooth - supporting structures are one of the most significant causes of tooth loss in adults and the most prevalent form of bone pathology in humans , in addition to acting as a modifying factor of patients ' systemic health6 . procedures to induce apexogenesis , apexification and repair of perforations and resorptions usually involve direct contact of materials with tissue , which makes relevant the study of cytotoxicity of sealers and calcium hydroxide pastes . the aim of this investigation was to evaluate the cytotoxicity of two brands of root canal sealers and one commercial calcium hydroxide - based paste on a monocyte cell line thp-1 , derived from acute monocyte leukemia . in this study , using a standardized cytotoxicity assay , it was determined that ah plus and fill canal were highly toxic to thp-1 cells , whereas l&c had relatively lower toxicity .
this cell line was selected due to the fact that macrophages are the major phagocytes for the elimination of bacteria , cellular debris and foreign materials that reach periradicular tissues .
moreover , studies have reported that the behavior of primary human fibroblasts do not differ significantly from that of immortalized cell lines in response to toxic challenge of endodontic materials20 .
some studies have questioned the clinical relevance of cell cultures used to test sealer toxicity since any material can be toxic to mammalian cells in vitro when a large surface area is exposed1,10 .
however , it has been reported that the surface area and shape of a material exposed to test cells should resemble the conditions found under clinical conditions .
recently , camps and about2 compared cytotoxic testing by iso methods and a new root - dipping technique .
they showed that while sealapex exhibited a highly cytotoxic effect causing cell death ranging from 91% to 96% when evaluated according to iso standards , the cytotoxicity of sealapex ranged from 0% to 9% using the root - dipping technique .
this discrepancy between the testing methods is more striking because they choose the lowest ratio between the surface of the sample and the volume of culture medium given by iso standards ( 0.5 cm / ml ) .
trypan blue dye exclusion technique was chosen for the present experiment because it is easy to perform and allows for distinguishing non - viable from viable cells by microscopic analysis .
although accurate procedures for determination of cell viability are reported in literature3 , the analysis by trypan blue assay reveals the disruption of cell membrane integrity .
trypan blue staining of non - viable cells is a common procedure used in cell culture research , and it relies on the premise that vital cells will not allow the stain to penetrate through cell membranes5,18 .
a previous scanning electron microscopic study23 designed to verify the accuracy of trypan blue in distinguishing vital and non - vital cells showed that cells permeated by the stain ( non - vital cells ) presented disruption of organelles , whereas vital cells presented integrity of membranes and organelles , as confirmed by ultra structural analysis . in the present study , freshly mixed materials were analyzed because previous reports have shown that the cytotoxicity of sealers is higher immediately after mixing4,17 .
schwarze , et al.19 reported that different sealers had a moderate to severe effect on human fibroblasts , periodontal ligament cells and immortal 3t3 fibroblasts immediately and 24 h after mixing .
ah plus formulation is similar to that of ah26 , except for the formaldehyde release21 . in this investigation ,
these results did not support the findings of camp and about2 , tai , et al.21 , schwarze , et al.19 and eldiniz , et al.4 , but corroborate the findings of willerhausen , et al.24 .
the differences could be accounted to the use of different cells types ( l9292 , v79 , bf , gf21 , 3t3 , pdl19 and hgf4 , and distinct methodologies ( mtt2,4,19,21 , trypan blue4 ) .
as observed in the present study , a previous study using neutral red assay for cytotoxicity found that ah plus was cytotoxic immediately after mixing7 , but its cytotoxicity decreased 4 h after mixing .
this suggested a dose - dependent cytotoxic effect , even using freshly prepared extracts . with regard to ah plus extracts ,
a previous study has shown only a moderate toxic effect up to one hour after mixing , whereas extracts obtained 5 and 24 h after mixing showed no toxic effect on mitochondrial activity19 . in the same investigation ,
apexit , a calcium hydroxide - based sealer , did not show toxic effects on pdl and 3t3 fibroblast cells , as observed in this study for l&c paste on thp-1 cells .
in agreement with our results , zinc oxide - eugenol - based sealers have been shown to be cytotoxic , which has been attributed to the eugenol present in different formulations15,16 .
lee , et al.12 demonstrated that eugenol suppressed il-1 and tnf production in lps - treated macrophages . those authors12 believed that this inhibition of cytokine production may contribute to decreasing the impact of cytokine - mediated host destructive process during pulp and periapical infection .
thus , eugenol - based sealers may have a potential anti - inflammatory effect from a clinic point of view .
further studies are necessary to ensure that the clinical use of root canal sealers are well tolerated by periapical tissues , produce the low cytotoxic effects and facilitate successful clinical endodontic outcomes .
based on the results of this study , it may be concluded that the calcium hydroxide paste ( l&c ) crude extract was less cytotoxic than the epoxy - resin sealer ( ah plus ) or zinc oxide - eugenol sealer ( fill canal ) crude extracts . | objective : the aim of this investigation was to evaluate the cytotoxicity of two brands of root canal sealers , epoxy - resin based and zinc oxide - eugenol based , and one commercial calcium hydroxide paste on a monocyte cell line thp-1.material and methods : undiluted ( crude extract ) and diluted extracts to 10% , 1% , 0.1% , 0.01% , 0.001% and 0.0001% of the sealers were tested for cytotoxicity to thp-1 cells using the trypan blue assay .
extracts were obtained according to iso standard .
data were analyzed statistically by the kruskal - wallis and mann - whitney tests at 5% significance level.results:crude extract of ah plus and fill canal killed approximately 90% of thp-1 cells versus 36% of thp-1 cells killed by l&c crude extract ( p<0.05 ) .
ten - fold dilutions of l&c , fill canal and ah plus killed 24 , 35 and 61% of thp-1 cells ( p<0.05 ) , respectively .
dilutions lesser than 1% caused minimal cell death as compared to the control groups ( p>0.05 ) , except for l&c 1% extract.conclusions:the results revealed that the l&c paste crude extract was less cytotoxic to thp-1 cells than ah plus or fill canal crude extracts . |
concomitant left atrial myxoma and patent foramen ovale ( pfo ) is a rare occurrence that presumably predisposes a patient to the evolution of a cerebrovascular event .
this would entail an immediate intervention to abate the progression of symptoms and to prevent deleterious complications associated with this risk factor for a stroke .
a 48-year - old female with no known medical illnesses nor previous surgeries , non - contributory family history , and unremarkable social profile presented to the hospital because of an acute onset of left facial and hand numbness .
she initially began having symptoms 4 days prior in the midst of her yoga class when she developed mild numbness in her face and entire left hand which she initially thought was a pinched nerve .
she subsequently aborted her class and took a nap and woke up still with numbness in her left hand .
she consulted her primary care physician in which a magnetic resonance imaging was done which reportedly demonstrated an acute stroke .
she denied any headache , dizziness , chest pain , palpitations , focal weakness , dysarthria , or dysphagia during this time .
neurologic examination revealed normal mentation and orientation , intact cranial nerves , preserved motor strength and tone symmetrically with no drift , and normal cerebellar function but has decreased sensation around 15% on the left palmar region to light touch and pin prick .
hemogram , comprehensive metabolic panel , lipid panel , and glycosylated hemoglobin were within normal .
transthoracic echocardiogram revealed a mass in the left atrium measuring 3.7 2 cm that appears adherent to the interatrial septum but prolapses into mitral valve inflow without evidence of obstruction ( fig .
1 ) . the left atrial mass did not appear to have a have uniform echodensity , suggesting the possibility of a superimposed thrombus .
a bubble study was done which showed no evidence of right - to - left shunting .
cranial computed tomography did not show any focal intracranial lesion , mass , hemorrhage or hydrocephalus .
magnetic resonance angiography of the brain revealed no hemodynamically significant stenosis and aneurysm in the major intracranial and neck vasculature .
carotid duplex scan showed no evidence of hemodynamically significant stenosis in the left carotid system .
cardiac computed tomography showed filling defect in the left atrium measuring 3 cm which could represent a thrombus ( fig .
2 ) . transthoracic echocardiography revealing a heterogeneous mass measuring 37 20 mm in the left atrium that is adherent to the interatrial septum . cardiac computed tomography showing the mass in the left atrium that is likely attached to the interatrial septum .
patient underwent cardiac surgery and noted the left atrial tumor to be attached near the intra - atrial septum but more affixed on the left atrium just superior to an obvious pfo and has a relatively broad - base .
histopathologic analysis of the resected atrial mass revealing myxomatous stroma with spindle - shaped mesenchymal cells .
there was no recurrence of the initial symptoms or development of new neurologic deficits on regular ambulatory health maintenance evaluation .
she did not complain of any difficulties in performing her activities of daily living including yoga to this date .
cerebrovascular ischemia is a consequence of inadequate perfusion and oxygenation to the brain to meet metabolic demand and is precipitated by a thromboemboli from central vessel or from the heart usually from the left cardiac chamber .
cardioembolic stroke from atrial myxoma and pfo has been elucidated and described in literature ; however , the concurrent existence of both in a patient is very seldom .
the coexistence of this congenital cardiac lesion and primary cardiac tumor might aggravate the occurrence and worsen the severity of an acute cerebrovascular event , thus , will require a different management strategy compared to the standard treatment modality .
primary tumors of the heart are extremely rare with an incidence of less than 0.1% , and in which myxomas are the most frequent in 70% of primary cardiac tumor in adults
. left atrial myxoma accounts for 75 - 90% of the cardiac myxomas and occurs from 30 to 60 years of age with women slightly vulnerable than men with male to female ratio of 1:2 .
ninety percent of atrial myxomas are sporadic with unknown etiology while 10% have been attributed to an autosomal dominant pattern known as carney complex caused by prkar1 gene mutation located on the long arm of chromosome 17 ( region 17q22 - 24 ) , characterized by multiple tumors , including atrial and extracardiac myxomas , non - myxomatous extracardiac tumors as well as cutaneous spotty pigmentation , schwannomas and various endocrine tumors [ 6 , 7 ] .
arterial embolism is the initial sign of left atrial myxoma , owing to a lack of cardiac manifestations in one - third of patients .
the atrial myxoma s polypoid and grape - like components can detach easily which is a nidus for tumor fragment embolization to the blood stream .
aneurysm formation can occur which is triggered by endothelial thinning and reduced elasticity presumably effected by vascular wall growth of deposited embolic myxoma in infarcted arteries .
neurologic complications are associated in 12% of patients with cardiac myxoma frequently presenting with cerebral infarction and in these patients , 22% had evidence of systemic myxomatous tumor embolization in addition to their neurologic manifestations .
pfo is a flap - like orifice between the atrial septa primum and secundum located at the fossa ovalis that remain after 1 year of age , and may linger frequently in adulthood .
it has been recognized as a likely risk factor for a cerebrovascular event through paradoxical embolism , and has been occurring in more than 50% of young patients with cryptogenic stroke ; however , pfo solely is not correlated with an increased risk of recurrent stroke .
the available data were very scarce regarding the concomitant existence of left atrial myxoma and pfo in which either might have been the etiology of the cerebral ischemic event ; however , it may also be an additive or synergistic effect to the evolution of the cerebrovascular event .
current literature unraveled a solitary case of combined myxoma , papillary fibroelastomas , and pfo as the inciting etiologies in a patient presenting with an ischemic stroke . in our case
, we considered that the cerebrovascular event was attributed from the left atrial myxoma and the concomitant pfo was an isolated incidental finding which was likely non - contributory to the event .
atrial myxoma was evident on transthoracic echocardiogram but the pfo was not detected on our patient .
the role of transesophageal echocardiogram intraoperatively may have detected the pfo which has been a common incidental diagnosis .
the incidental finding of pfo intraoperatively dictated an additional surgical approach to manage such case though consensus on incidental pfo surgical closure has not been standardized .
there is no additional advantage in short - term perioperative results or in long - term longevity rates in patients with repaired or unrepaired incidental pfo .
patients subjected to cardiothoracic surgery commonly have an incidental pfo but are not linked with increased perioperative complications ; however , surgical closure likely unrelated to long - term survival and demonstrated a 2.47 times greater odds of postoperative stroke compared with those unrepaired .
there is no evidence to suggest that pfo closure is of any clinical benefit and offers no greater advantage than medical therapy .
evaluation for venous thromboembolism in young patients with cryptogenic stroke and pfo has been recommended by the current guidelines for stroke prevention by the american heart association ( aha)/american stroke association ( asa ) in which anticoagulation has been advocated if it is confirmed . on the other hand , the current guideline by the american college of chest physicians recommends antiplatelet therapy for patients with cryptogenic stroke who have a pfo irrespective of venous thromboembolism .
expeditious resection is required once a possible diagnosis of myxoma has been conceived from imaging modalities because of the high embolization risk or sudden cardiac death .
surgical resection outcome has been very satisfactory with a mortality rate of 2 - 6% [ 23 - 25 ] .
myxoma recurrence risk occurs in 2 - 5% of cases [ 26 , 27 ] .
potential alternatives for the management of recurrent atrial myxoma include cardiac transplantation or autotransplantation [ 28 , 29 ] .
our clinical vignette highlights a rare combination of left atrial myxoma and an incidental intraoperative finding of pfo , which either or in synergy could have been the culprit to the evolution of a cerebrovascular event .
early recognition and evaluation of atrial myxoma and pfo in a patient presenting with a cerebrovascular event would initiate timely and appropriate intervention to halt the evolution of an impending stroke and eventual prevention of deleterious complications .
early recognition and evaluation of atrial myxoma and pfo in a patient presenting with a cerebrovascular event would initiate timely and appropriate intervention to halt the evolution of an impending stroke and eventual prevention of deleterious complications .
| we report a case of a 48-year - old female who presented initially with an abrupt onset of left facial and hand numbness after her routine yoga with no associated syncope , palpitation , chest pain or dyspnea .
she consulted her primary care physician and recommended hospital care for possible stroke . on the day of admission
, she complained of left facial and hand hemiparesthesia .
cranial imaging and angiography were unremarkable but echocardiography and cardiac computed tomography revealed left atrial mass .
she underwent resection of the left atrial mass with an incidental finding of patent foramen ovale intraoperatively .
the left atrial mass was confirmed to be an atrial myxoma .
patient s neurologic complaints resolved towards the end of her hospital course .
she was discharged stable with no recurrence of neurologic symptoms on health maintenance evaluation . |
diagnosis of chronic inflammatory syndrome ( cis ) is often a challenge in patients with chronic kidney disease .
this condition also increases the risk of resistance to recombinant human erythropoietin ( rhuepo ) .
a 72-year - old male with nephroangiosclerosis was on maintenance hemodialysis ( three sessions per week ) for 10 years .
his medications included : furosemide 500 mg in non - dialysis day , oral folic acid and vitamin b12 , and monthly 75 - 150 g of methoxy - polyethylene - glycol epoetin - beta .
biological monitoring revealed episodic elevations of c - reactive protein ( crp ) ranging from 1 mg / l to 60 mg / l associated with a decrease of hemoglobin ( hb ) levels without any other obvious cause of resistance to rhuepo [ figure 1 ] .
serum ferritin , intact parathyroid hormone and aluminum levels were within the normal ranges . the mean kt / v was 1.15 .
history of inflammation , hemoglobin , and recombinant human erythropoietin doses physical examination found no evidence for any local or systemic cause of this inflammation .
his vital signs were : temperature 37c , pulse 74 beats / min , blood pressure 128/68 mmhg and respiratory rate 20 breaths / min . biological tests including liver parameters and serum protein electrophoresis were normal .
serology for hepatitis b virus showed negative hepatitis b surface ( hbs ) antigen , positive anti - hbs , and anti - hepatitis b core antibodies with no current biological or morphological signs of chronic hepatitis .
transthoracic echocardiogram , blood culture , abdominal and pelvic ultrasound , eso - gastric endoscopy , and colonoscopy showed no abnormalities .
as part of a screening study of vascular calcifications in hemodialysis , our patient underwent a lateral abdominal x - ray , which demonstrated diffuse calcifications of the abdominal aorta and a large aneurysm extending from the second to the fourth lumbar vertebra [ figure 2 ] .
multislice spiral computed tomography - angiography with 3d - reconstruction showed a saccular dilatation of the infrarenal segment of the abdominal aorta measuring 70 mm in height , 41 mm of anteroposterior diameter and 40 mm in transverse diameter with diffuse calcification of both anterior and posterior wall of the aorta extending to the primitive iliac arteries [ figure 3 ] .
the diagnosis of cis complicating a partially thrombosed aneurysm of the abdominal aorta was then made .
antiplatelet therapy by lysine acetylsalicylate 160 mg / day was introduced to prevent embolic complications .
follow - up over last 6 months showed regression of inflammation , improvement of hb level , and reduction of rhuepo doses [ figure 1 ] .
lateral abdominal x - ray : aneurysm of the abdominal aorta 3d reconstruction of multislice computed tomography angiography : extensive calcification of the abdominal aorta extending to the primitive iliac arteries contrast enhanced multislice computed tomography angiography cross section : partial thrombosis of the abdominal aorta wall
most patients with crf achieve the desired target hb level when supplemented with rhuepo and parenteral iron . about a quarter of the dialysis patients ; however , have a poor response and need higher doses to reach the target hb level .
iron deficiency , underdialysis , infection and inflammatory conditions may all play a significant role in causing a poor response to rhuepo therapy .
less common causes of resistance to rhuepo include blood loss , hyperparathyroidism , aluminum toxicity , vitamin b12 or folic acid deficiency , hemolysis , marrow dysfunction , hemoglobinopathies , concomitant angiotensin converting enzyme inhibitor therapy , carnitine deficiency , and antibodies against the erythropoietin molecule .
there is a well - demonstrated relationship between resistance to rhuepo therapy and the inflammatory response .
activation of the immune system during the inflammatory process diverts iron traffic from erythropoiesis to storage sites within the reticuloendothelial system , inhibits erythroid progenitor proliferation and differentiation , suppresses erythropoietin production , and blunts response to erythropoietin . in clinical practice ,
the diagnosis of partially thrombosed aneurysm of the abdominal aorta was made during a screening study and provided an explanation to this cis .
long duration on hemodialysis , advanced age , hypertension , dyslipidemia , and smoking are significant risk factors in our patient for atherosclerosis and vascular calcifications as reported in hemodialysis population .
the infrarenal abdominal aorta is prone to the development of atherosclerotic plaque and its complications including obstruction , ulceration , thrombus formation , and potentially , aneurysmal degeneration .
indeed , the smooth muscle cell in the artery wall can undergo inflammatory activation when exposed to thrombin and products of thrombosis .
for example , thrombin stimulation causes smooth muscle cells to produce interleukin ( il)-6 abundantly .
platelet - derived growth factor , released from platelet alpha granules during thrombosis , can also markedly augment il-6 production by smooth muscle cells .
il-6 , in turn , can induce the cute inflammatory phase response and increase plasma concentrations of fibrinogen , and the inflammatory marker crp as in our patient .
thereby , antithrombotic treatment may suppress inflammation and help break the vicious cycle by limiting the local and systemic amplification loops between inflammation and thrombosis . accelerated atherosclerosis and vascular calcifications are frequent , but ominous , complications in hemodialysis patients .
the development of an aneurysm of the abdominal aorta is highly favored in this particularly exposed population .
our case alerts physicians on this rare etiology of cis and highlights the importance of screening for vascular calcification in the early stages of kidney disease and during the hemodialysis follow - up . | diagnosis of chronic inflammatory syndrome is often a challenge . in dialysis patients , this condition leads to resistance to recombinant human erythropoietin ( rhuepo ) . we here report a case of a 72-year - old male undergoing chronic hemodialysis and developed rhuepo resistance without any obvious etiology .
investigations showed a partially thromosed aneurysm of the infrarenal aorta .
antiplatelet therapy was started with a satisfactory outcome . |
information comes from the first follow - up assessment of the peru migrant study , an ongoing prospective cohort designed to assess the magnitude of differences between rural , rural - to - urban migrant and urban groups in specific cardiovascular risk factors .
san jose de secce , a village located in ayacucho was selected as the rural study site .
ayacucho , an andean region , was one of the most affected areas during the period of conflict ( 19881993 ) in peru . the area
las pampas de san juan de miraflores in lima , the capital of peru , was selected as the urban area for the study .
both urban and rural - to - urban migrant participants were selected from this periurban area in the south of lima . at baseline , study groups
were defined using a single random sampling in participants aged 30 years and over from the rural site of ayacucho , the urban site of lima , and rural - to - urban migrants from ayacucho now residing in lima .
rural and urban subjects had always lived in their respective settings . for this evaluation , participants were re - contacted in the same setting where they were originally enrolled .
since participants were re - contacted where they were at baseline , we assumed they did not move and particularly the migrant group did not go back to their rural birthplace .
the exposure of interest was study group , defined as rural , migrant and urban according to the baseline assessment .
other exposures assessed at baseline and part of this analysis were : binge drinking , defined as two or more nights of alcohol consumption in the month before the assessment and having ever drunk 6 or more drinks at a time ; current daily smoking , defined as the self - report of smoking 1 cigarette per day ; low physical activity levels defined in accordance with the international physical activity questionnaire ( ipaq ) protocol , thus , the categorical physical levels were coded based on total days of physical activity and metabolic equivalent ( met ) in minutes / week ; high total cholesterol , defined as fasting total cholesterol 200 mg / dl ; obesity , defined as body mass index ( bmi ) 30kg / m ; high waist circumference , defined according to international diabetes federation cutoffs for south american populations ; and type 2 diabetes , defined as any of the following conditions : fasting glucose 126 mg / dl , self - report of physician diagnosis and currently receiving anti - hyperglycemic drugs .
baseline fasting blood samples were obtained and analyzed in a single facility and the quality of assays was checked with regular external standards and internal duplicate assays monitored by biorad ( www.biorad.com ) .
total cholesterol was measured on serum , whereas glucose was measured in plasma using an enzymatic colorimetric method ( god - pap , modular p - e / roche - cobas , germany ) .
other variables of interest , also assessed at baseline , included as potential confounders were : sex , age ( 3049 and 50 + years ) , education level ( none / some primary school , complete primary , and some secondary ) , and socioeconomic status , using a wealth index based on assets and household facilities and categorized separately into tertiles for study group , and merged into a single variable .
the outcome of interest was the occurrence of hypertension , defined as the presence of high blood pressure levels ( systolic blood pressure 140 mmhg or diastolic blood pressure 90 mmhg ) according to international guidelines or current use of anti - hypertensive medication prescribed by a physician .
blood pressure was assessed in triplicate , after a 5-minute resting period , using an automatic monitor omrom hem-780 ( omron , tokyo , japan ) previously validated for adult population .
in addition , pre - hypertension was accordingly defined as a systolic blood pressure from 120 to 139 mmhg or diastolic blood pressure from 80 to 89 mmhg .
participants originally enrolled in the peru migrant study , from 2007 to 2008 , were re - contacted from 2012 to 2013 in the same setting where they were enrolled at baseline .
fieldworkers in rural areas were fluent in spanish and quechua , and they administered the survey to those with poor literacy .
statistical analysis was conducted in stata 13 for windows ( stata corp , college station , tx , usa ) .
chi squared test was used to compared categorical variables , whereas continuous variables were compared using analysis of variance test .
incidence rates per 100 person - years of follow - up and 95% confidence intervals ( 95%ci ) were calculated excluding those having hypertension at baseline .
generalized linear models , assuming poisson distribution , were utilized to determine the strength of association , i.e. relative risks ( rr ) , between study groups and hypertension , controlling for several potential confounders .
in addition , post - hoc analyses were also performed in the migrant group using only migration surrogates ( age at migration and years lived in urban area ) .
crude and adjusted models were also generated to determine rr of well - established risk factors for hypertension by study group .
given the number of confounder variables , variance inflation factor was used to determine collinearity . finally ,
population attributable fractions ( paf ) were determined by using the punaf command for stata . ethical approval for baseline and follow - up phase
was granted by the institutional review board at universidad peruana cayetano heredia in lima , peru .
participants provided verbal informed consent due to major illiteracy rates , especially in rural areas .
at baseline , data from 988 participants was analyzed , mean age was 47.9 ( sd : 12.0 ) years , 522 ( 52.8% ) females , and according to study group , 201 ( 20.4% ) , 589 ( 59.5% ) , and 199 ( 20.1% ) were rural , rural - to - urban migrant and urban participants , respectively .
regarding the migrant group , mean age at first migration was 14.7 ( sd : 9.0 ) years ; in addition , mean time lived in an urban area was 32.0 ( sd : 10.5 ) years .
overall prevalence of hypertension was 16.1% ( 159/988 ; 95%ci 13.8%18.4% ) and prevalence estimates varied by study group : hypertension was more common among urban population , but pre - hypertension was more prevalent among rural group ( p<0.001 ) .
moreover , of all participants with hypertension , 50% of rural dwellers , 77.6% of migrants , and 47.5% of urban individuals were previously diagnosed by a physician ( p = 0.001 ) . of the 988 participants enrolled at baseline , 60 ( 6.1% )
thus , of the 895 ( 90.6% ) re - contacted , 133 ( 14.9% ) were further excluded from incidence calculations because hypertension diagnosis at baseline .
mean time of follow - up was 5.2 ( sd : 0.6 ) years , completing a total of 3,962 person - years of follow - up .
a total of 66 new cases of hypertension were found with an overall incidence of 1.73 ( 95%ci 1.362.20 ) per 100 person - years ( 5-year cumulative incidence : 8.65% ) . at follow - up ,
systolic and diastolic blood pressure means were similar according to study group ( online supplement , e - table 1 ) . according to study group ,
hypertension incidence was 2.44 ( 95%ci 1.623.67 ) in the rural group , 1.60 ( 95%ci 1.152.22 ) in the rural - to - urban migrant group , and 1.11 ( 95%ci 0.532.33 ) in the urban group ( p<0.001 ) .
in addition , of all new cases , 91.3% of rural dwellers , 75.0% of migrants , and 100% of urban individuals reported to be diagnosed of hypertension by a physician in the previous five years of the follow - up ( p = 0.19 ) .
hypertension incidence according to population characteristics and study group at baseline are shown in table 2 . of note ,
incidence of hypertension due to pre - hypertension was highest among rural than migrant or urban participants .
having the urban group as reference , rural participants had higher risk of hypertension and the magnitude of rr increased with further adjustment .
after controlling for demographic and behavioral confounders , and compared to the urban group , rural participants were four times more likely to have hypertension ( rr = 3.58 ; 95%ci 1.42 9.06 ) .
the migrant group was also at high risk of hypertension ; however , results were not significant .
details are shown in table 3 . using data from migration surrogates and after controlling for several confounders ,
those migrants living 30 years or more in the urban setting were at lower risk of hypertension when compared to those living less than 30 years ; however , results were not significant ( rr = 0.85 ; 95%ci 0.35 2.03 ) .
similarly , when the age at migration was used , those who reported migrating at 15 years or over were at greater risk of developing hypertension when compared to those migrating at age below 15 years but results were not significant ( rr = 1.04 ; 95%ci 0.53 2.04 ) .
as shown in table 4 , in multivariable models , of all risk factors explored , current daily smoking ( rr 4.26 ) and high waits circumference ( rr 2.68 ) were found to be associated with increased risk of hypertension among the rural group ; and only pre - hypertension increased the risk among migrant population ( rr 2.98 ) . in the same vein ,
only type 2 diabetes at baseline ( rr 7.10 ) increased the risk of hypertension among urban population .
population attributable fractions were also calculated by study groups ( online supplement e - table 2 ) and showed considerable heterogeneity in terms of its magnitude between study groups .
many of the estimates were under 10% among rural and migrant groups , except high waist circumference ( 19.1% and 27.9% , respectively ) and pre - hypertension ( 31.3% and 40.6% , respectively ) .
on the other hand , obesity , high waist circumference , type 2 diabetes , and pre - hypertension were markedly important in the urban group ( 52.6% , 45.8% , 24.5% , and 37.9% , respectively ) .
this prospective ongoing cohort study included different study groups and was explicitly designed to ascertain whether differential risks for ncds exist around rural - urban migrant and non - migrant groups .
the risk of hypertension was almost four times greater among rural subjects relative to their urban counterparts .
although the migrant group had also an increased risk compared to urban individuals , this was not significant .
factors associated with hypertension incidence in the multivariate model differed by study group : high waist circumference and daily smoking in rural , pre - hypertension in rural - to - urban migrant , and type 2 diabetes in urban group . in addition , using estimates of population attributable fractions , obesity - related markers ( i.e. body mass index , but especially high waist circumference ) were the leading factors increasing the risk of hypertension in the three population group but particularly in urban individuals .
our results are consistent with a higher risk of hypertension among rural when compared to urban group .
this observation is supported by the high proportion of rural individuals found with pre - hypertension at baseline , but also for the high incidence rate of hypertension during follow - up .
although hypertension was markedly higher in the urban group , at baseline , a third of the rural and migrant populations had pre - hypertension .
this information highlights the diversity of scenarios where hypertension evolves , signaling major risks in specific groups .
this approach of identifying different risk magnitudes in low - resource settings suggests that other non - communicable conditions may also portray similar complexities , particularly in many lmic in ( epidemiological and nutritional ) transition .
high pre - hypertension rates at baseline in our rural group as well as low health standards associated with living in rural settings , i.e. poverty , malnutrition , poor hygiene as well as inadequate health care , might be potential explanations for these findings .
thus , these broader contextual variables applicable to rural settings , paired with ongoing nutritional transition , may potentially increase the risk of fast acquiring negative lifestyles profiles , especially obesity and then hypertension .
in addition , despite of removing the effect of different sociodemographic and lifestyles factors , our study lacked information about dietary patterns , a key determinant of cardiovascular outcomes .
diet in population from andean regions , as involved in this study , has changed over time .
energy from carbohydrates has had moderate declines regarding cereals especially , but sugars , as energy contributors have increased .
in addition , cholesterol intake has also increased , whereas vegetables , starchy roots and fruit intake have considerably reduced . as people living in rural areas had much higher levels of physical activity as shown in this study and a previous report , we believe much of the effect seen in this study might be explained by diet .
however , further studies are needed to evaluate the impact of diet on hypertension in these study groups .
since the urbanization phenomenon in rural areas dates back to the last decades , another possible explanation for the higher hypertension incidence in the rural group is a period effect : higher incidence of hypertension in this population is a rather new feature .
this gives a window opportunity to implement prevention strategies before all pre - hypertensive rural subjects meet criteria for hypertension .
early reports on this topic were performed in 1990s in kenya and china , showing an increment of blood pressure due to rural - to - urban migration .
these findings are contrary to our results perhaps because these past studies were conducted when travel and communication between rural and urban areas were more difficult and urban lifestyle were less likely adopted by rural dwellers . as a result ,
there is still limited longitudinal information available regarding the impact of migration on hypertension as many of the published studies report changes in blood pressure means instead of hypertension rates and compared migrants versus non - migrant groups , instead of urban , rural - to - urban migrants , and rural populations .
thus , our findings expand on previous knowledge demonstrating a higher hypertension risk among rural population .
migrant populations have been thought to be potentially more affected by unhealthy practices acquired from living in a new setting , especially among those more acculturated .
for example , a previous study suggested that some migration surrogates may directly influence broader social determinants of disease , and hence , reduce the possibility to acquire cardiovascular outcomes .
many of these findings , nevertheless , come from cross - sectional studies and involved migrants who moved from developing to developed countries instead of rural - to - urban within - country migrants . in a post - hoc analysis
, we tried to model the effect of migration surrogates ( age at migration and years of urban exposure ) but results were not conclusive . in terms of blood pressure as continuous variable ,
previous cross - sectional studies have shown non - significant differences in blood pressure levels among migrants when compared to rural groups , and a pattern of significantly lower systolic and diastolic blood pressure in migrant compared to urban groups .
our study found differences in mean systolic and diastolic blood pressure levels by study group at baseline , but not after 5 years of follow - up .
one of them found systolic blood pressure of migrants significantly higher that rural controls ; whereas the other one found that both systolic and diastolic blood pressure were higher compared to non - migrants , but only in men . although cardiovascular risk factors are well known , global policies require local adaptation according to population profiles . for priority purposes ,
it is important to understand the local burden of disease including within - country heterogeneity of ncd distribution and their risk factors .
for example , considering benefits and feasibility , reduction in tobacco is recommended as one of the best initiative , but in our study , a small proportion ( < 5% ) were daily smokers and , thus , the potential impact of an intervention focused on this risk factor would be almost negligible as highlighted by results of population attributable fractions . according to our results , special attention needs to be paid to obesity , as bmi and waist circumference , showed a different distribution according to study group .
in addition , type 2 diabetes was also another key factor among urban participants and a natural consequence of the increasing burden of obesity .
our results are compatible with the need of a reduction of central obesity , which might reduce , more than any other factor , the risk of hypertension in the three populations , but especially among urban people .
these results can also reflect the fact that different regions and populations within a same country are at different stages of the nutritional transition .
therefore , interventions to prevent ncd increase in our context should be focused on reduction of obesity rates by improving the balance of intake ( diet ) and expenditure ( physical activity ) of energy .
the case of pre - hypertension deserves more attention as was present in almost one third of all the study groups at baseline .
this is probably the stage at which interventions need to be more incisive and extensive to tackle the progress towards hypertension .
according to population attributable fraction , hypertension would be reduced in 30% in all study groups if a reduction of blood pressure under 120/80 mmhg was guaranteed .
strength of this study includes the calculation of hypertension incidences over a 5 years period in well - defined rural , migrant and urban populations .
although the fact that our study population migrated due to different reasons than socioeconomic mobility is a novelty of the study , it could also be regarded as a limitation in terms of external generalizability .
migration is mostly driven by socioeconomic upward mobility , which comes along with different risk factors ( e.g. sedentarism or unhealthy diets ) .
our study population did not move because they had achieved better socioeconomic standards , and thus our results may not fully represent the new migration waves across the world .
first , although the rate of attrition during follow - up was relatively low ( < 10% ) , results might be affected by selection bias , especially in the urban setting for data collection involving both , migrants and urban subjects .
as previously published , response rates of the baseline study were low in migrants ( 77.7% ) and urban ( 56.8% ) when compared to rural group ( 84.8% ) , and therefore participants originally enrolled might have other characteristics compared to those who rejected to participate .
second , although the definition of rural , migrant or urban population can change over time , we assumed this was not the case and did not affect our estimations as all of the participants were re - contacted in the same area where originally were enrolled .
third , power could be an issue as many well - recognized factors were not associated with the progression towards hypertension .
however , as population attributable fractions assess the contribution of a risk factor to a disease , they can provide a better understanding of the role of these factors in the study populations .
finally , results could also reflect the effect of unmeasured confounders like chronic kidney disease .
unfortunately , we did not collect data about this condition at baseline ; yet at follow - up we asked if the participant has been diagnosed with chronic kidney disease in the past five years showing a prevalence of less than 1% .
in addition , a previous report in the urban study area found that about 20% of the population presented some degree of chronic kidney disease , and 19% of subjects with chronic kidney disease had hypertension as well . despite of these findings
our results showed such a strong hypertension risk given the different population groups included as the exposure variable , that it is hard to think the risk would be completely explained by chronic kidney disease .
the extent at which chronic kidney disease confound , or explain , the association of interest must be addressed by future studies , particularly as the burden of chronic kidney disease is rather neglected in rural resource - limited settings . in conclusion ,
the incidence of hypertension was high in rural populations when compared to migrant and urban groups .
risk factors for hypertension were different according to study group , and almost one third of the three populations had pre - hypertension at baseline .
obesity , assessed by waist circumference and body mass index , was the leading risk factor for hypertension in the three groups evaluated .
results suggest that interventions to tackle hypertension need to focus in the reduction of obesity , especially in urban settings .
urbanization affects health population due to changes in diet and physical activity patterns , thus increasing cardiovascular diseases ( cvd ) .
impact of migration on cvd and risk factors , such as hypertension , is derived from cross - sectional studies only .
in this prospective study , the risk of developing hypertension was about four times higher in rural compared with urban individuals .
after 5.2 years of follow - up , migrating from rural to urban areas did not carry significant risk of hypertension compared to stay living in urban areas .
obesity , as waist circumference and body mass index , was the leading risk factor for hypertension development in the three study groups . | urbanization is a hazardous process because it affects health population due to changes in diet and physical activity patterns .
this study aimed to determine the effect of migration on the incidence of hypertension .
participants of the peru migrant study , i.e. rural , urban , and rural - to - urban migrants were re - evaluated after five years from baseline .
the outcome was incidence of hypertension ; and the exposures were study group and other well - known risk factors .
incidence rates , relative risks ( rr ) , and population attributable fractions were calculated . at baseline , 201 ( 20.4% ) , 589 ( 59.5% ) , and 199 ( 20.1% ) were rural , rural - to - urban migrant and urban subjects , respectively .
overall mean age was 47.9 ( sd12.0 ) years , and 522 ( 52.9% ) were females .
hypertension prevalence at baseline was 16.0% ( 95% ci 13.7%18.3% ) , being more common in urban group ; whereas pre - hypertension was more prevalent in rural participants ( p<0.001 ) .
follow - up rate at 5 years was 94% , 895 participants were re - assessed and 33 ( 3.3% ) deaths were recorded .
overall incidence of hypertension was 1.73 ( 95%ci 1.362.20 ) per 100 person - years .
in multivariable model and compared to the urban group , rural group had a greater risk of developing hypertension ( rr=3.58 ; 95%ci 1.429.06 ) .
population attributable fractions showed high waist circumference as the leading risk factor for the hypertension development in rural ( 19.1% ) , migrant ( 27.9% ) , and urban ( 45.8% ) participants .
subjects from rural settings are at higher risk to develop hypertension relative to rural - urban migrant or urban groups .
central obesity was the leading risk factor for hypertension incidence in the three population groups . |
rudolf virchow , wegener and frazer attempted an anatomico pathological classification , which does not help in clinical decision making . a classification based on embryologic characteristics of the vasculature helped to differentiate haemangiomas from arteriovenous malformations .
mulliken described haemangiomas as true tumours that present in the first 4 weeks of life .
biological classification proposed by mulliken and glowacki in 1975 was based on the cellular features , and correlated the findings with physical examination and natural history .
further studies confirm that the system of classification is also based on radiological , haemodynamic and immuno histochemical characteristics .
rapid growth during the neonatal period is the hallmark of haemangioma at a rate beyond the child 's growth .
haemangiomas never appear in the later part of life in contrast to vascular malformations , which result from anomalous development of the embryonic vascular system .
vascular differentiation occurs between the fourth and 10th weeks of intrauterine life , which becomes evident and symptomatic during later development .
the characteristics that distinguish haemangiomas from vascular malformation during infancy and childhood are summarised in table 1 .
between 1990 and 2010 , we have treated 104 patients with vascular anomalies of the upper limb . of these , 62 were females and 42 were males .
excision and skin grafting was carried out in seven patients out of 10 as a primary procedure .
fifty - two patients of venous malformations were seen , and 30 of them involving the hand were primarily excised .
patients with arteriovenous malformations can present themselves as late as in the age group of 3040 years .
one of these patients later required shortening and closure of his left thumb following gangrene .
eight patients with lymphangiomas affecting the fingers were seen , and all were primarily excised .
only one female child with extensive port wine stain involving the left upper limb was seen .
all these patients were routinely investigated for blood coagulation profile . beside this , specific investigations like plain x - ray were done to look for pheliboliths , calcification and skeletal changes .
contrast computed tomography ( ct ) or magnetic resonance imaging ( mri ) was performed to delineate the extent and plane of the lesion and for post - operative evaluation .
although angiogram was performed in the earlier cases , contrast ct proved to be a very useful tool in arriving at the diagnosis .
however , lasers , as a modality , have widely been acclaimed to ablate these lesions .
scarification , tattooing and cosmetic cover - up have all been tried with variable results .
on the other hand , in the case of upper extremity haemangiomas , early excision of the lesion was found to provide a better outcome as these lesions are exposed to the risk of injury and the tendency of the children to bite , scratch and , otherwise , meddle with these lesions . with tumescent infiltration , which reduces the risk of bleeding and
florid lesion haemangioma florid lesion after excision haemangioma after excision venous malformations ,
[ figures 510 ] present as soft compressible swelling , and phleboliths could be palpated or seen in the x - ray , and are pathognomonic of venous malformations .
the skin overlying the venous malformation may appear normal , although , more often , there is a bluish hue .
calcification of these may happen following repeated trauma with bleeding leading to dystrophic calcification of the lesion .
excision venous malformation function after excision use of sclerosing agents in managing these lesions leads to occlusion of the arterial inflow , often causing necrosis of the overlying skin and adjacent tissues .
intralesional sclerotherapy by the direct percutaneous route is an old modality that presently appears to have an expanding role .
muir et al . reported complete resolution or significant improvement in 80% of the lesions , which comprised of haemangiomas , venous malformations , cystic hygromas and lymphatic malformations .
venous malformations in the hand [ figure 9,10 ] were mostly localized and , in one - third of the cases , involvement of the small muscles of the hand was found .
careful planning and operative procedure in the salvage of the muscle is possible . in such cases ,
total excision of venous anomaly is usually extensive , and surgical removal must be restrained by anatomical considerations , both aesthetic and functional .
subtotal resection always carries a risk of post - operative expansion of the remaining malformed channels , often mistaken for recurrence .
sometimes , subtotal resection is employed for the purpose of :
( a)reducing the bulk(b)improving the contour(c)better function
improving the contour the use of magnification makes a tremendous difference to the identification and preservation of normal neurovascular structures .
the use of pneumatic tourniquet and complete exanguination enable the surgeon to visualize normal and abnormal structures clearly .
tumescent infiltration technique is of immense help in achieving a bloodless field and relief of post - operative pain
embolisation is the preferred method of managing arteriovenous malformations , [ figures 1114 ] a double - edged weapon , and needs an experienced team
it is used alone as a single modality or as a pre - operative measure to devascularise the operative field , preferably 4872 h before surgery .
after embolization lymphangiomas usually present themselves as a painless swelling and keep increasing progressively in their size .
lymphatic malformation the following lesions are to be differentiated from the vascular birth marks :
pyogenic granulomatraumatic arteriovenous fistula [ figure 16]pigmented tumours
traumatic arteriovenous fistula [ figure 16 ] pyogenic granulomas have a history of recent - onset , often following an injury .
the discharging granulation tissue and the history will prove the diagnosis [ figures 1618 ] .
false aneurysm function after excision traumatic arteriovenous fistula will mimic an av malformation in its colour and signs , like transmitted pulsation bruit , etc .
vascular anomalies need not be considered as a confounding problem . the challenges in the management of vascular anomalies of the upper limb have been overcome by proper clinical examination and diagnosis .
of all the investigations , we feel that the 64-slice ct scan and mri will pinpoint the diagnosis and help in decision making and follow - up .
the tumescent technique helps in providing a good avascular plane for dissection and prevention of blood loss , in addition to effective post - operative pain relief .
the various treatment modalities preferred for the different types of vascular birthmarks are summaried in table 2 . to sum up the treatment modalities in a nut shell treatment
is optimized by a team approach that includes a plastic surgeon , interventional radiologist and anaesthesiologist . | vascular anomalies of the upper extremity are a surgical challenge to the hand surgeons .
the treatment modality varies with respect to the presentation , extent of the lesion , progression and their complications .
based on our experience in treating patients with vascular malformations , a protocol has been formulated for their management , which we have found to be very useful and successful . with the use of the tumescent technique and good planning , haemangiomas are best excised in infancy or early childhood .
investigations like contrast computed tomography and magnetic resonance imaging have been found to be a useful tool in the diagnosis and planning of surgery for venous malformations .
embolisation seems to be a safe option in arteriovenous malformations . |
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | cell - to - cell communication is fundamental to multicellular life . for this to occur effectively there must be pathways and dynamic networks for communication .
these might depend upon electrical or chemical signals or the mass transfer of molecules between adjacent cells .
molecular communication occurs either via an extra - cellular pathway or through physical structures , called plasmodesmata , that connect the cytoplasm of neighboring cells .
plasmodesmata bridge the rigid physical barrier presented by the cell wall to extend the symplasm from single cells to tissue domains that have functional importance for tissue growth , development , and defense .
although recent years have seen advances in our knowledge of the physical nature of pd , the trafficked molecules , and of the wider processes they affect , our knowledge of pd structure and function is still relatively rudimentary .
this article will consider the technical / experimental difficulties hindering pd research and suggest priorities in the future research effort that might advance the field at a significantly faster rate . |
indirect restorations play an important role in clinical dentistry . whilst clinicians often spend considerable time choosing materials or type of restorations , the cementation process is often considered less important and manufacturer 's instructions modified or ignored .
luting materials are necessary to retain such restorations on teeth and to prevent leakage at their margins .
one such material is zinc phosphate cement which is used routinely by almost one - third of uk practitioners .
clinically , the cement is presented as powder and liquid components which must be mixed together prior to application to the restoration or the tooth . often the proportions of the two elements used are measured by eye or with operator - dependent measuring systems .
they are then mixed together in varying environments ( temperature and humidity ) under differing mixing conditions time and manipulation technique . while low - grade mixing errors ( < 1020% ) may not have serious implications regarding the integrity of traditional luting agents , there is concern regarding high - grade errors .
such errors are likely to occur with less experienced operators , such as undergraduate dental students and inexperienced dental nurses . as a measure of mechanical integrity of the set cement ,
compressive strength has been found to increase with the amount of powder mixed with a constant amount of liquid [ 48 ] .
in addition , diametral tensile strength ( dts ) is a well - established and reproducible measure of mechanical integrity in very brittle materials such as zinc phosphate cement and has been extensively used in the testing of appropriate dentally related materials [ 911 ] .
the aim of this study was to ( a ) investigate whether high - grade powder - liquid proportioning errors might occur in a cohort of inexperienced dental undergraduate students mixing zinc phosphate cement and ( b ) determine the effect of any such variability on the diametral tensile strength of the set material .
the null hypotheses were that ( a ) the powder - liquid mixing ratios observed would not differ from the manufacturer 's recommended ratio and ( b ) dts of the set cement samples using the extreme powder / liquid ratios observed would not differ from those made using the manufacturer 's recommended ratio .
the entire third year undergraduate dentistry class from a dental school in ireland was invited to participate in the study .
thirty four students contributed to the experiment , none of whom had previous experience of working with zinc phosphate cement but had experience of mixing other dental materials including glass ionomer cement in the clinical environment .
each student received verbal and written directions in measuring powder and liquid components according to the manufacturer 's instructions ( fleck 's cement , mizzy , cherry hill , nj , usa ) . the instructions stated that 0.8 g of powder should equate with 2 fillings to the shoulder of the powder cap dome and 0.3 ml liquid should equate with 12 drops of liquid
the students measured the powder and liquid using the powder cap and liquid dropper onto a preweighed plastic container and the mass of each was recorded ( mettler ae 100 balance , mettler instruments ag , greifensee , zurich ) .
a calibrated pipette was used to determine the density of the cement liquid yielding the mass equivalent of the manufacturer 's recommended volume of 0.3 mls and a powder / liquid ratio ( m / m ) of 1.718 .
the observed maximum ( 2.386 ) and minimum ( 1.018 ) powder / liquid ratios , together with the manufacturer 's recommended ratio ( m / m ) , were used subsequently by a single experienced dental clinician to prepare cylindrical samples ( n = 3 34 ) , of nominal dimensions 6 mm 3 mm , using a stainless steel split mould .
the samples were hand mixed on a chilled glass slab and the mix transferred and packed into the split mould .
the samples were left to initially mature ( 60 mins ) before being removed from the mould .
the specimens were further matured in deionised water ( 37 2)c for 48 hours . before testing , each specimen was dried gently on all sides using soft tissue paper and the diameter and height measured using a micrometer gauge .
compression across a diameter was carried out using a universal testing machine , h10ks ( tinius olsen ) , at a constant crosshead speed of 0.75 mm / min .
failure load data were converted to dts using the expression = 2p/dl ( = diametral tensile strength , p = load at failure , d = diameter of cylinder , and l = height of cylinder ) .
the null hypotheses were that ( a ) the powder - liquid mixing ratios observed would not differ from the manufacturer 's recommended ratio and ( b ) dts of the set cement samples would not differ from those made using the manufacturer 's recommended ratio .
statistical analyses ( = 0.05 ) were by student 's t - test in the case of powder / liquid ratio and one - way anova and tukey hsd for for pair - wise comparisons of mean dts ( r version 2.8.0r foundation for statistical computing ) .
the extreme powder / liquid mixing ratios ( m / m ) observed from the student cohort , together with the manufacturer 's recommending ratio , and corresponding data regarding dts are presented in table 1 .
the mean powder / liquid ratio obtained for the student cohort was not significantly different from the manufacturer 's recommended value ( p = 0.189 ) .
the mean dts values recorded for the maximum and minimum ratios for the student cohort were significantly different from that obtained from the manufacturer 's recommended powder / liquid ratio ( p < 0.001 ) and from each other ( p < 0.001 ) .
it is clear that high - grade powder - liquid proportioning errors were observed in this cohort of dental undergraduate students in the sense that the extreme powder - liquid ratios resulted in significant impacts on dts .
these proportioning errors have occurred notwithstanding explicit verbal and written instructions given immediately before the mixing process . while it is attractive to attribute this effect to inexperience , as might be relevant to undergraduate dental students and inexperienced dental nursing staff , more substantial and quantifiable concerns must address the mixing methodology . ideally , the mixing process should be fail safe in that it should only be possible to mix material correctly , or not at all . in this regard , a number of opportunities for error present .
the volume of powder delivered using volume dispensation is very operator dependent and variations can be common due to the differences in cement powder packing densities when filling the scoop [ 12 , 13 ] . for dispensing the liquid the opportunity for inaccuracy is potentially even greater .
the amount of liquid expressed is dependent on the manner in which the bottle is held and the force exerted on it .
excessive force can cause a stream of liquid to be expressed rather than a series of drops and air bubbles can further complicate measurement .
operators often tend to mix cements and other restorative materials by experience , adding extra powder or liquid to gain the consistency or properties they desire . a report quoted relatively good intraoperator consistency in mixing zinc phosphate cement ( single commercial product ) among a cohort of 40 qualified dental nurses in the uk but little intra - operator consistency .
clearly , such a report is not conducive to the expectation of acceptable performance among inexperienced operators and begs the overall question of whether an alternative approach should be used in the manner of a standard operating protocol per product .
a plausible solution to addressing variability in powder / liquid ratio ( and presenting the possibility of consistent mixing ) is the encapsulation of cement components ( single - use capsules ) which certain manufacturers have done with zinc phosphate and other luting cements such as glass ionomer . encapsulation would also remove the problem of solvent evaporation from the cement liquid with possible phosphate deposition yielding the liquid unusable .
it is , however , unclear what parameters the manufacturer 's recommended powder / liquid address .
presumably , the resultant mixture is required to be sufficiently thin to wet the adherend but with the ability to yield acceptable strength on setting . a report on the effect of powder / liquid ratio on the clinical performance of resin - modified glass ionomer
cement indicates that higher powder / liquid ratios compromise surface wetting with an increased incidence of subsequent retention failures when used as a tooth restorative . the reported mean value for dts , mixed according to the manufacturer 's ratio , was generally consistent with previously reported values for other brands of zinc phosphate cement relating to similar specimen dimensions and storage [ 18 , 19 ]
this would suggest that the observed low value obtained from the minimum powder / liquid ratio may be generalised as inappropriate proportioning .
the value was less than 38% of the strength associated with the manufacturer 's mixing ratio and must raise concerns regarding mechanical adequacy of the set material .
apart from concerns regarding compromised mechanical properties , there are likely clinical consequences to the use of an inappropriate powder to liquid ratio .
for example , incorporation of too much powder into the luting cement may result in a thick mix of cement which could make complete seating an indirect restoration difficult .
this could result in open margins and/or a high restoration which could cause patient discomfort in the short term and the failure of the restoration in the long term .
while the use of encapsulated products might appear attractive to obviate arbitrary mixing ratios with attendant problems , a reported comparison of an encapsulated zinc phosphate cement with a hand - mixed analogue highlighted certain deficiencies in the encapsulated material [ 21 , 22 ] no significant advantages in terms of reliability or strength were observed in the encapsulated product .
in addition , the latter was observed to be more porous than the hand - mixed material , most likely due to the entrapment of air during the relatively vigorous mechanical trituration .
high - grade proportioning errors relating to fleck 's cement , for a luting consistency , were observed among a cohort of dental undergraduate students .
these errors resulted in significant differences between the dts values of the set cement and those which relate to the manufacturer 's recommended ratio .
apart from compromised mechanical performance resulting from inappropriate proportioning , incorporation of too much powder into the luting cement may result in a thick mix of cement which could make complete seating an indirect restoration difficult .
routine encapsulation of zinc phosphate cement components , in the form of single - use disposable capsules , is suggested as a method of addressing variability in proportioning powder - liquid cements especially amongst inexperienced operators . | aim . to investigate ( a ) variability in powder / liquid proportioning and ( b ) effect of variability on diametral tensile strength ( dts ) , in a zinc phosphate cement .
statistical analyses ( = 0.05 ) were by student 's t - test in the case of powder / liquid ratio and one - way anova and tukey hsd for pair - wise comparisons of mean dts .
the null hypotheses were that ( a ) the powder - liquid mixing ratios would not differ from the manufacturer 's recommended ratio ( b ) dts of the set cement samples using the extreme powder / liquid ratios would not differ from those made using the recommended ratio .
methodology .
34 dental students dispensed the components according to the manufacturer 's instructions .
the maximum and minimum powder / liquid ratios , together with the manufacturer 's recommended ratio , were used to prepare samples for dts testing .
results . powder / liquid ratios ranged from 2.386 to 1.018 .
the mean ratio ( 1.644 ) was not significantly different from the recommended value of 1.718 ( p = 0.189 ) .
dts values for the maximum and minimum ratios were both significantly different from each other ( p < 0.001 ) and from the mean value obtained from the recommended ratio ( p < 0.001 ) .
conclusions .
variability exists in powder / liquid ratio for hand dispensed zinc phosphate cement
. this variability can affect the dts of the set material . |
since time immemorial herbal systems of medicines are the major curatives in traditional system of medicine have been used in ancient medicinal practices .
the importance of the traditional herbal medicinal system has gained vital importance in developed and developing countries .
these practices are continuing until today because of its biomedical benefits as well as its cultural belief in many parts of the world . according to the world health organization about 80% of people in developing countries are still depending on traditional medicine and currently the demand is increasing eventually .
medicinal plants are an important source of bioactive compounds and 25% of pharmaceutical prescriptions in the united states contain at least one plant - derived ingredient .
india is an oldest , the richest and most diverse cultural traditions associated with the use of medicinal plants in the form of traditional systems of medicine including ayurveda , homeopathy , siddha and unani .
india is a botanical garden of the world and a goldmine of well recorded and traditionally well - practiced knowledge of herbal medicine .
more than 6000 plants in india are use in traditional folk and herbal medicine representing about 75% of the medical needs of third world countries .
indians rely chiefly in these systems of medicine and had been practiced for 5000 years .
it is officially recognized that 2500 plant species have medicinal value while over 6000 plants are estimated to be explored in traditional , folk and herbal medicine . presently , this plant based traditional medicinal systems continue to provide the primary health care to more than three - quarters of the world population .
ethnobotany is the study of the interaction between plants and people with a particular emphasis on traditional tribal cultures . which play an important role on a collection of medicinal use of plants , based on the knowledge on plants by the local people and their usefulness by a particular ethnic group and information concerning particular plant varies from one ethnic group to another .
the use of medicinal herbs is still a tradition adopted by ethnic communities who are living in undulating plains and at the foothills of dense forest .
these types of ethnomedicinal studies play an important role for the conservation and documentation of sustainable use and importance of medicinal knowledge of particular area / civilization .
previously , ethnomedicinal studies or documentation of traditional knowledge of tribal people on medicinal plants from surrounding areas of chittoor district was carried out by a number of ethnobotanists [ 13 - 18 ] . however , omitted the chandragiri and gopalapuram villages of chandragiri reserve forest area . because of its high altitudinal geography , strict tribal beliefs and lack of proper transport . in these villages , medicinal knowledge on herbal treatments is passed from generation to generation from their ancestors . nowadays lack of interest among younger generations to carry out
these two villages have a high abundance of flora and disappearance traditional healers dwindling rapidly .
this is the reason behinds and the right time to document at least the remaining knowledge of this tribe .
hence , the present objective of this study is to document the medicinal knowledge of yanadi tribe , explore and support their medicinal significance to compare their claims with dr .
the chadragiri and gopalapuram village forest areas are belonging to chadragiri reserve forest area of chandragiri mandal , chittoor district , andhra pradesh , india with the geographical coordination s like 13 33 37.62
elevation from sea level , having 31 2c day temperatures with 900 mm of average annual rainfall [ figure 1 ] .
the protected area is proclaimed national land with distinct boundaries they are managed under the authority of vana samrakshana samithi .
this reserve forest area comes under the vegetation of dry deciduous forest having timber yielding , thorny , bushy trees along with herbaceous flora , covers 202 acres of land comes under seshachalam hill region of eastern ghats . to document the ethnomedicinal knowledge
, the inhabitants belongs to the yanadi tribe of chandragiri reserve forest area is selected for documentation of their traditional knowledge on medicinal plants during the months of july to february of 2014 - 2015 period .
the information obtained from traditional herbal healers like muniah ( 60 y ) , subramanyam ( 44 y ) , nagaraju ( 56 y ) and rajendra ( 40 y ) , who are the people practicing traditional herbal treatments is interviewed and short discussion was made in their dialect .
chandragiri and gopalapuram are medium sized tribal villages in the chandragiri reserve forest area with the inhabitants of nearly 70 families and have a population of 190 people , of which 55 males , 69 females and 66 children s are residing .
the families of these tribal peoples lived in thatched houses , thatched huts and as well as roofed houses .
the tribal people in these villages depend mainly on agriculture , dairy and get wage from surrounding villages for doing labor works .
a very little quantum of people practicing herbal treatments to cure their daily ailments mainly the knowledge gets from their ancestors . a structured questionnaire was used to elicit information from them and methodology used based on the methods available in the literature . during the study
the information collected with the help of structured questionnaire with main headings like details of tribe , name of the disease , number of diseases cured , data on the plant , description of the drug , therapeutic indications , and reasons of the plant for considering as medicine were recorded along with many more sub headings [ figure 2 ] .
proforma for collecting field data on medicinal plants the collected plant species and claimed medicinal values of yanadi tribe is cross checked with gamble volumes , local floras as well as herbaria deposited in dept . of botany , sri venkateswara university , tirupati .
the information collected from healers is documented on data sheets and herbariums were prepared with a voucher specimen number , deposited in sri venkateswara university , tirupati .
the medicinal values claimed by these healers were cross checked with ethnomedicinal data on medicinal plants from dr .
the chadragiri and gopalapuram village forest areas are belonging to chadragiri reserve forest area of chandragiri mandal , chittoor district , andhra pradesh , india with the geographical coordination s like 13 33 37.62
elevation from sea level , having 31 2c day temperatures with 900 mm of average annual rainfall [ figure 1 ] .
the protected area is proclaimed national land with distinct boundaries they are managed under the authority of vana samrakshana samithi .
this reserve forest area comes under the vegetation of dry deciduous forest having timber yielding , thorny , bushy trees along with herbaceous flora , covers 202 acres of land comes under seshachalam hill region of eastern ghats .
to document the ethnomedicinal knowledge , the inhabitants belongs to the yanadi tribe of chandragiri reserve forest area is selected for documentation of their traditional knowledge on medicinal plants during the months of july to february of 2014 - 2015 period .
the information obtained from traditional herbal healers like muniah ( 60 y ) , subramanyam ( 44 y ) , nagaraju ( 56 y ) and rajendra ( 40 y ) , who are the people practicing traditional herbal treatments is interviewed and short discussion was made in their dialect .
chandragiri and gopalapuram are medium sized tribal villages in the chandragiri reserve forest area with the inhabitants of nearly 70 families and have a population of 190 people , of which 55 males , 69 females and 66 children s are residing .
the families of these tribal peoples lived in thatched houses , thatched huts and as well as roofed houses .
the tribal people in these villages depend mainly on agriculture , dairy and get wage from surrounding villages for doing labor works .
a very little quantum of people practicing herbal treatments to cure their daily ailments mainly the knowledge gets from their ancestors . a structured questionnaire was used to elicit information from them and methodology used based on the methods available in the literature . during the study
the information collected with the help of structured questionnaire with main headings like details of tribe , name of the disease , number of diseases cured , data on the plant , description of the drug , therapeutic indications , and reasons of the plant for considering as medicine were recorded along with many more sub headings [ figure 2 ] .
the collected plant species and claimed medicinal values of yanadi tribe is cross checked with gamble volumes , local floras as well as herbaria deposited in dept . of botany , sri venkateswara university , tirupati . the information collected from healers is documented on data sheets and herbariums were prepared with a voucher specimen number , deposited in sri venkateswara university , tirupati .
the medicinal values claimed by these healers were cross checked with ethnomedicinal data on medicinal plants from dr . duke s phytochemical and ethnobotanical database .
the study revealed that the yanadi tribal practitioners were using 48 medicinal plants belonging to 26 families to treat 53 types of ailments [ table 1 and figure 3 ] .
the medicinal data collected and a brief discussion was made in their local language . the herbalists prepare most of their medicines in fresh form like juice , paste and some of the medicines were stored as capsules , decoctions , dried root bulbs , seeds and powders . among the documented data most of the medicinal plants materialized from asclepiadaceae by 05 species followed by euphorbiaceae by 04 species , acanthaceae , caesalpiniaceae , fabaceae , malvaceae by 03 species and finally capparidaceae , mimosaceae , rhamnaceae , verbenaceae , vitaceae by 02 species . while rest of the families represented only by 01 species each .
the collected materials from medicinal plants , most of the herbal medications prepared from shrubs ( 15 ) followed by herbs ( 14 ) , climbers ( 11 ) , trees ( 07 ) , and lianas ( 01 ) [ figure 4 ] .
these medicines were prepared mostly from leaf ( 40% ) part of the plant followed by root ( 17% ) , root tuber ( 12% ) , stem bark ( 13% ) , flower ( 8% ) , whole plant ( 6% ) , and fruit ( 4% ) [ figure 5 ] .
they commonly prepared herbal medicines in the form of a paste ( 33% ) followed by powder ( 25% ) , juice ( 15% ) , capsule ( 10% ) , natural form ( 6% ) , crushed form ( 4% ) , decoction ( 4% ) , fumes ( 2% ) , and latex ( 2% ) [ figure 6 ] .
tribal people of the chandragiri reserve forest area preferred the administration of their herbal medicines through oral ( 58% ) followed by topical ( 40% ) and inhalation ( 02% ) through the nostrils [ figure 7 ] .
duke s phytochemical and ethnobotanical database , most of the plants , i.e. , 30 are correlated out of 48 plants at least by one ethnomedicinal use .
enumeration of ethnomedicinal data from yandi tribe of chandragiri reserve forest area list of important medicinal plants used by yanadi tribe of chandragiri reserve forest area life form of medicinal plants used for the preparation of herbal medicines by yanadi tribe percentage of plant parts used for preparation of herbal medicines by yanadi tribe percentage of different forms of medicines used for preparation of herbal medicines by yanadi tribe percentage of administration of herbal medicines by yanadi tribe
previously a number of ethnobotanists studied ethnomedicinal knowledge of the yanadi tribe in different parts of chittoor district .
however , no more ethnomedicinal study is carried out in chadragiri and gopalapuram village areas of chadragiri reserve forest area .
the usage of medicinal plants from plant families like asclepiadaceae is the most preferred by this tribe .
our findings regarding most utilization of this family are due to wide distribution of these family plants in the study area and known number of traditional uses .
this type of wide documentation of asclepiadaceae members was observed in yanadi tribe of kavali district .
shrubs are most utilized plants in these areas for preparation of herbal formulations due to easily available and made easy for collection of these plants .
this type of results was found in medicinal plants used by the local people in kailasakona sacred grove area of chittoor district .
leaf part of plants is most preferable for preparation of herbal medicine in this areas .
the common use of leaf in the preparation of remedies could partly due to the relative ease of finding of this plant part .
the same type of results was observed in yanadi tribe and local villagers of veyilingalakona sacred grove of chittoor district .
the herbal preparation in the form paste and oral administration of medicine is the most preferable in these areas ; it may due to most of the plant parts were brought fresh from nearby forests and taken orally may be due to the effective exoneration of ailments .
this type of results was observed in the tribal people of east godavri district and japali hanuman theertham sacred grove area of chittoor district .
the way of disease treatment , formulation , combination , ingredients used and administration of herbal medicines in these areas claimed was entirely different from the previous studies . the use of hot water for oral administration of medicines prepared from abrus precatorius , clerodendrum phlomidis , dichrostachys cinerea , glycyrrhiza glabra , hemidesmus indicus and tribulus subramanyamii .
use of hot water is due to easy uptake for oral administration and it avoids any microbial organisms which contaminate the medicine . in the case of cassytha filiformis , dodonaea viscosa , tragia involucrata milk is preferred .
milk is an excellent medium for oral administration of drugs and strengthens the patients as nutritionally .
admixtures of sweeteners like jaggery and sugar in the case of andrographis serpyllifolia , asparagus racemosus , croton bonplandianum , digera arvensis , and maerua oblongifolia .
these sweeteners avoid the bitterness of medicines and provide cumulative interest to patients to take medicines at regular intervals .
an addition of spices like turmeric powder in the case of cassia auriculata , cissus quadrangularis , euphorbia antiquorum , justicia tranquebariensis , malvastrum coromandelianum , pithecellobium dulce , polygala arvensis and wattakaka volubilis . as the turmeric powder elevates the performance of actual drug and its acts as excellent antimicrobial agent on different disease causative microorganisms .
addition of lubricants like castor oil , gingelly oil and honey was in the case of sida acuta , c. quadrangularis , scutia myrtina , flacourtia indica , p. dulce , and t. involucrata .
admixture of curd in the case of d. viscosa , limestone in the case of martynia annua , p. arvensis , camphor in the case of w. volubilis , urine in the case of p. dulce .
admixtures like curd and limestone improves overall performance of actual medicine , camphor provides excellent relief from rheumatic pains .
there is no scientific reason behind the amalgamation of urine in the case of p. dulce , only the people of these areas believes about to heal the disease . in the preparation of medicines they admixture ,
not only the ingredients , but also combination of medicinal plants were used to prepare medicines such as curcuma aromatica and piper longum .
this type of utilization of the ingredients or combination of medicinal plants for the preparation of herbal formulations was recorded in chenchu tribe of mahabubnagar district .
this type of combination and admixture of ingredients is used in preparation of herbal medicines are recorded in our study area is very scant .
this documented information is transferred from generations to generations , especially to the elder son of their family .
the younger generations are not interested to learn and practice this system of traditional medicine system .
they are inconvenient with this system and desires immediate relief from their afflictions , due to this cumulative reduction of interest on herbal treatments , which become extinct nearby future .
the ethnomedicinal data of 48 medicinal plants enumerated from the yanadi tribe of chadragiri reserve forest area , among them medicinal uses of 30 plants are correlated to dr .
but the medicinal plants like c. phlomidis , gynandropsis pentaphylla , pachygone ovata and s. myrtina having medicinal value in the database but it s not correlated with this study . the medicinal plants like a. serpyllifolia , bauhinia racemosa , caralluma attenuata , cassia hirsuta , ceropegia juncea , c. bonplandianum , diplocyclos palmatus , m. oblongifolia , melhania incana , pandanus fascicularis , p. arvensis , tribulus subramayamii , w. volubilis and ziziphus xylopyrus are not appearing at least by one ethnomedicinal use in the database . based on this database
, we concluded that the medicinal values claimed by the yanadi tribe of chadragiri reserve forest area are high significance towards curing of different ailments in a traditional way with their unique nature of selection and preparation of herbal medicines from medicinal plants .
the tribal people of chadragiri reserve forest area have vast knowledge on medicinal values of plants in their surrounding forest .
the study revealed that 48 medicinal plants belonging to 26 families are used to treat 53 types of ailments .
the plant species belonging to asclepiadaceae are most used for the preparation of herbal medicine and shrubs of life form , leaf part of plant , paste form of medicine , oral administration of medicines are most preferred characters of these study areas .
selection , preparation , addition of ingredients , and combination of medicinal plants for the preparation of herbal formulations is unique and no more documentation was made previously in these areas .
tribal people along with local people of surrounding villages attracted to this traditional medicine , because of its cost - effective and easy to get from local traditional healers .
most of the data claimed in these areas is only get from the above age of 40 - 60 years and the people of younger generations are not interested in practicing the same .
hence , this is the right time to document the disappearing ethnomedicinal uses of this tribe and to explore this data to globe .
novel information on the preparation of herbal medicines from medicinal plants in this study will be useful for future generations to discover novel drugs . | aim : ethnomedicinal studies on medicinal plants used by yanadi tribe of chandragiri reserve forest area are documented during the period of 2014 - 2015 . the study is mainly focused on medicinal importance of plants used by yanadi tribe to treat various ailments.materials and methods : the information collected on treated ailments , part used , preparation , combination , and addition of ingredients to prepare herbal medicines with the help of standard questionnaire.results:during the study , 53 types of ailments were treated using 48 medicinal plants belongs to 26 families were documented . among the medicinal plants , shrubs ( 15 )
were most using life form of plants for the preparation of herbal medicines .
leaf part ( 40% ) , paste form ( 33% ) , and oral administration ( 63% ) of herbal medicines were most preferable .
the documented ethnomedicinal importance of this tribe was cross - checked with dr .
duke s phytochemical and ethnobotanical database shows most of the plants were correlated with this database.conclusion:there is no record of traditional medicinal knowledge of these villages so far , hence the present study is aimed to document the information on medicinal plants used by yanadi tribe in chandragiri reserve forest area .
the correlation of ethnomedicinal uses with dr .
duke s phytochemical and ethnobotanical database clearly indicates the high medicinal significance of claimed data of this yanadi tribe . |
the extent to which the genome of one cell differs from that of any other cell from the same body is unclear .
dna replication errors , mitotic recombination , aneuploidy , and transposable element activity can cause somatic mosaicism during ontogenesis and senescence . in humans , the consequences of somatic mosaicism are most apparent in disease , including cancer and developmental syndromes ( youssoufian and pyeritz , 2002 ) .
the impact of mosaicism among normal cells is relatively undefined beyond the notable exception of v(d)j recombination and somatic hypermutation intrinsic to lymphocyte antigen recognition ( hozumi and tonegawa , 1976 ) .
reports of retrotransposition ( baillie et al . , 2011 ; coufal et al . , 2009 ; evrony et al . , 2012 ;
perrat et al . , 2013 ) and other genomic abnormalities ( cai et al .
, 2014 ; gole et al . , 2013 ; mcconnell et al . ,
2013 ) in animal neurons may therefore be important given that , as for immune cells , mosaicism is a plausible route to neuron functional diversification .
of approximately 500,000 line-1 ( l1 ) copies present in the human genome , only 100 members of the l1-ta and pre - ta subfamilies remain transposition - competent ( beck et al .
l1 mobilization primarily occurs via target primed reverse transcription ( tprt ) , a process catalyzed in cis by two proteins , orf1p and orf2p , translated from the bicistronic 6 kb l1 mrna .
l1 orf2p encodes endonuclease ( en ) and reverse transcriptase ( rt ) activities essential to l1 retrotransposition and also responsible for trans mobilization of alu and sva retrotransposons ( dewannieux et al .
, 2003 ; hancks et al . , 2011 ; raiz et al . ,
a typical tprt - mediated l1 insertion involves a degenerate l1 en recognition motif ( 5-tt / aaaa ) ,
an l1 poly - a tail and , crucially , produces target site duplications ( tsds ) ( jurka , 1997 ; luan et al . , 1993 ) .
various host defense mechanisms suppress l1 activity ( beck et al . , 2011 ) , including via methylation of the cpg - rich l1 promoter .
neural progenitors and other multipotent cells can nonetheless permit l1 promoter activation ( coufal et al .
, 2009 ; garcia - perez et al . , 2007 ; wissing et al . ,
2012 ) , a pattern accentuated in the hippocampus , likely due to its incorporation of the neurogenic subgranular zone ( baillie et al . , 2011 ;
this coincidence of neurogenesis , l1 activity , and mosaicism has elicited speculation that l1 mobilization could impact cognitive function rooted in the hippocampus ( richardson et al . , 2014 ) . despite extensive evidence of somatic retrotransposition in the brain ,
the rate of l1 mobilization in the neuronal lineage is , for instance , a major unresolved issue .
estimates range from < 0.1 to 80 somatic l1 insertions per neuron ( coufal et al .
experiments using engineered l1 reporter systems have shown that l1 mobilization is likely to occur via tprt in neuronal precursor cells and may be altered by neurological disease ( coufal et al . , 2011 ; coufal et al .
2010 ) . however , it is unknown whether endogenous l1 retrotransposition in hippocampal neurons adheres to these predictions .
most importantly , it is unclear whether somatic l1 insertions influence neuronal phenotype or endow carrier neuronal progenitor cells with a selective advantage or disadvantage in vivo . to address these questions
, we applied single - cell retrotransposon capture sequencing ( rc - seq ) to hippocampal neurons and glia , as well as cortical neurons , and found that l1 retrotransposition is a major endogenous driver of somatic mosaicism in the brain .
several biological and technical factors hinder accurate calculation of somatic l1 mobilization frequency using bulk dna extracted from tissue , as well as subsequent pcr validation and structural characterization of individual somatic l1 insertions ( richardson et al . , 2014 ) .
we therefore developed a single - cell rc - seq protocol to detect somatic l1 insertions in individual neurons .
briefly , neun hippocampal nuclei were purified by fluorescence activated cell sorting ( facs ) ( figures 1a and s1 ) , with single nuclei isolated using a self - contained microscope and micromanipulator ( figure 1b ) .
whole - genome amplification ( wga ) was achieved through an extensively optimized version of the quasi - linear multiple annealing and looping based amplification cycles ( malbac ) protocol ( zong et al . , 2012 ) and was followed by illumina library preparation ( figures 1c and 1d ) .
libraries were then subjected to low - coverage ( 0.35 ) whole - genome sequencing ( wgs ) as a quality control step to assess amplification bias and , in parallel , hybridized and processed by rc - seq ( figures 1e and 1f ) .
rc - seq utilizes sequence capture to enrich dna for the junctions between retrotransposon termini and adjacent genomic regions , followed by paired - end sequencing , alignment , and clustering , to reveal l1 insertions absent from the reference genome . here , we replaced previous rc - seq sequence capture pools ( baillie et al . , 2011 ; shukla et al . ,
2013 ) with two locked nucleic acid ( lna ) probes respectively targeting the extreme 5 and 3 ends of l1-ta .
these probes capture typical l1 insertions at a 3 l1-genome junction , and full - length or heavily 5 truncated l1 insertions at a 5 l1-genome junction ( figure s2 ) , and delivered a 15-fold improvement in l1 enrichment compared with previous rc - seq applied to brain ( baillie et al . , 2011 ) .
contig enabled computational identification of molecular chimeras and removal of pcr duplicates , and provided single - nucleotide resolution of l1 integration sites by fully spanning l1-genome junctions ( figure s2 ) . prior to single - cell rc - seq , we performed deep coverage ( 80 ) rc - seq on bulk dna extracted from the post - mortem hippocampus and matched liver samples of four individuals ( identifiers ctrl-36 , ctrl-42 , ctrl-45 , and ctrl-55 ) without evidence of neurological disease ( table s1 ) .
bulk rc - seq on average detected 97.5% of 960 annotated reference genome l1-ta copies ( evrony et al .
as expected , we detected 210 polymorphic l1-ta insertions absent from the reference genome , per individual ( tables s1 and s2 ) .
this defined the polymorphic ( germline ) l1-ta insertion cohort for each individual and provided a positive control for subsequent single - cell rc - seq analyses .
next , 92 individual neuronal nuclei were isolated from the aforementioned hippocampi , subjected to wga and analyzed by wgs . globally
, wgs revealed that 4,226/4,232 ( 99.9% ) chromosomes amplified ( figure 2a ) with recurring wga bias largely limited to telomeres ( figures s3 , s4a and s4b ) .
higher - resolution copy - number variation ( cnv ) analysis based on the division of the genome into adjustable - width bins with an average size of 600 kb revealed five non - telomeric deletions larger than 5 mb .
the largest and third largest of these occurred on chromosome 6 of ctrl-45 hippocampal neuron 2 ( ctrl-45-hn-#2 ) and were 16.2 mb and 9.4 mb in length ( figure 2b ) . an alternative cnv analysis using 60 kb bins indicated the presence of numerous subregions in the 16.2 mb example where chromosomal copy number was 2 ( figure s4c ) , depicting a region of highly variable wga performance and , arguably , contraindicative of a genuine deletion in vivo .
genome - wide , allelic dropout ( ad ) and locus dropout ( ld ) respectively affected 8.0% and 0.7% of bins at 600 kb resolution ( figure 2c , table s1 ) , indicating efficient amplification across > 90% of the genome .
importantly , we optimized wga parameters to not deplete l1-ta copies from amplified dna , with the mean ratio of wgs reads aligned to reference l1-ta 5 or 3 l1-genome junctions at 0.81 and 1.28 of expected values , respectively ( figures s4d and s4e ; table s1 ) .
these results show robust wga for individual neurons , without significant loss of reference genome l1-ta copies .
single - cell rc - seq applied to each of the 92 libraries analyzed by wgs detected 61.3% of reference genome l1-ta copies ( figure 2d , table s1 ) and 49.0% of polymorphic l1-ta insertions in each neuron ( figure 2e ) , as defined by the earlier bulk rc - seq experiments .
a total of 2,782 putative somatic l1-ta and pre - ta insertions ( figure 2f , table s2 ) were identified in at least one hippocampal neuron , were not detected in any bulk liver rc - seq library or more than one hippocampus by single - cell or bulk rc - seq , and were absent from existing l1 polymorphism databases ( ewing and kazazian , 2010 , 2011 ; iskow et al . , 2010 ; shukla et al .
, 2013 ; wang et al . , 2006 ) . of these insertions , 1,024 ( 36.8% ) and 34 ( 1.2% )
twelve ( 0.4% ) somatic l1 insertions were detected at both their 5 and 3 l1-genome junctions , 760 ( 27.3% ) at only a 5 junction , and 2,010 ( 72.3% ) at only a 3 junction .
notably , nine somatic l1 insertions detected by single - cell rc - seq were also detected and annotated as somatic in the corresponding hippocampus bulk rc - seq library , and 13 were detected by single - cell rc - seq in more than one neuron from the same hippocampus .
of somatic l1 insertions , 98.2% belonged to the l1-ta subfamily , and 1.8% were annotated as pre - ta .
although at 5 l1-genome junctions rc - seq captures only full - length and very heavily truncated l1s ( figure s2 ) , we found 123 full - length l1 insertions , representing 4.4% of all events and including two instances of 5 transduction .
of those insertions detected at their 3 l1-genome junction , 151 ( 7.5% ) carried a putative transduced 3 flanking sequence ( moran et al . , 1999 ) .
this l1 3 transduction rate was lower than reported for germline l1 retrotransposition ( goodier et al . , 2000 ) , likely due to assay design not encompassing 3 transductions longer than 100 bp , as reported elsewhere ( goodier et al .
2013 ) . to determine the true positive rate of single - cell rc - seq
, we randomly selected 20 somatic l1 insertions detected at only a 3 l1-genome junction and pcr amplified the opposing 5 l1-genome junction .
this enabled detection of tprt sequence hallmarks that distinguish wga artifacts from most genuine l1 integration sites ; specifically a tsd , an l1 en target motif and an l1 poly - a tail ( jurka , 1997 ; luan et al . , 1993 ) .
through pcr and sequencing , 5 l1-genome junctions were identified for nine insertions and , when combined with the corresponding 3 l1-genome junctions described by rc - seq , indicated tsds and polya - tails in all cases , and plausible l1 en motifs for 7/9 ( 77.8% ) examples ( tables s2 and data s1 ) .
pcr validated insertions included full - length ( figure 3a ) and variably 5 truncated ( figures 3b f ) l1s .
intronic l1 insertions were found sense oriented to two genes expressed in brain , zfand3 ( figure 3b ) and usp33 ( table s2 ) .
one l1 insertion incorporated a 3 transduction and was detected by pcr in two neurons of ctrl-42 ( figure 3d ) .
further , pcr applied to the full panels of analyzed neurons from each individual revealed that two other l1 insertions were present in 10/21 and 2/21 neurons , respectively ( figures 3e and 3f ) .
these experiments showed that nearly half of somatic l1 insertions detected by single - cell rc - seq at a 3 l1-genome junction could be confirmed as genuine tprt - mediated retrotransposition events .
by contrast , pcr validation for 10 randomly selected exonic l1 insertions detected at a 5 l1-genome junction by single - cell rc - seq failed to find the opposing 3 l1-genome junction in all cases ( table s2 ) .
this was consistent with the l1 polya - tail obstructing pcr amplification of somatic l1 insertion 3 ends ( baillie et al . , 2011 ) and arguably did not resolve whether l1 insertions detected only at a 5 l1-genome junction were false positives .
finally , we selected 4 l1 insertions found at both their 5 and 3 l1-genome junctions by single - cell rc - seq ; all four were confirmed by pcr and presented tprt hallmarks , including one with a 92 bp tsd ( table s2 ) .
nearly 75% of somatic l1 insertions found by single - cell rc - seq were detected only at a 3 l1-genome junction ( figure s2 ) .
given this preponderance , we sought to ascertain why the matching 5 l1-genome junction could not be identified by pcr for 11/20 selected examples of this type .
pcr amplification failure was potentially due to rc - seq false positives , structurally exotic l1 insertions ( gilbert et al . , 2005 ) or , alternatively , wga inconsistently amplifying the 5 l1-genome junctions of insertions detected at a 3 l1-genome junction by single - cell rc - seq .
to model the latter possibility , we randomly selected 12 polymorphic l1 insertions detected by bulk rc - seq and confirmed as heterozygous by genotype pcr .
we performed pcr using bulk dna to confirm each insertion was detectable at its 5 l1-genome junction and then selected 100 random examples in individual neurons where these polymorphic l1s were detected at only a 3 l1-genome junction by single - cell rc - seq ( table s2 ) .
we attempted pcr amplification of the corresponding 5 l1-genome junction for each neuron , hence recapitulating the validation process for somatic l1 insertions , and confirmed 50/100 examples .
this assay indicated the maximum pcr validation rate ( 50.0% ) for somatic l1 insertions detected at only a 3 l1-genome junction by single - cell rc - seq and , given the validation rate reported above ( 9/20 , 45% ) , implied a true positive rate potentially as high as 9/10 ( 90.0% ) .
single - cell rc - seq identified mean somatic l1 insertion counts of 48.4 , 27.5 , 30.5 , and 14.8 per hippocampal neuron in ctrl-36 , ctrl-42 , ctrl-45 , and ctrl-55 , respectively , yielding an overall mean count of 30.4 ( figure 2f ) . to estimate the overall true positive mean
, we incorporated the pcr validation rate ( 45.0% ) calculated above , leading to a conservative rate calculation of 13.7 somatic l1 insertions per hippocampal neuron .
if , more conservatively , only l1 insertions detected at a 3 l1-genome junction were considered , the true positive mean was 9.9 .
conversely , if all l1 insertions were considered , we generously incorporated the maximum pcr validation rate calculated above ( 90% ) and we corrected for assay sensitivity in terms of polymorphic l1 insertions detected ( 49.0% ) , the estimated true positive mean was greatly increased to 55.8 .
thus , given a true positive mean of 13.7 somatic l1 insertions per neuron , and the detection of at least one event in every neuron ( figure 2f ) , we concluded that l1 mosaicism was ubiquitous among the hippocampal neurons studied .
prior in vitro experiments based on an engineered l1 reporter indicated that glia may support far less l1 mobilization than neurons ( coufal et al . , 2009 ) .
to evaluate glial lineage endogenous l1 retrotransposition in vivo , we performed single - cell rc - seq upon 22 glial nuclei ( neun / ki67 ) isolated from ctrl-42 , ctrl-45 , and ctrl-55 hippocampi , and detected 316 putative somatic l1 insertions ( figures 4a and s5 ) .
this produced a mean true positive estimate of 6.5 insertions per glial cell , based on the pcr validation rate determined for hippocampal neurons ( 45.0% ) .
this rate was 52.6% lower than the estimated 13.7 insertions for hippocampal neurons , a significant difference ( p < 0.005 , two - tailed t test , df = 112 ) .
interestingly , four insertions were found in both glial and neuronal cells by single - cell rc - seq , with one of these instances detected at both its 5 and 3 l1-genome junctions , revealing a 12 bp tsd ( table s2 ) .
we concluded that l1 insertions can arise in proliferating neural stem cells prior to glial or neuronal commitment , while glia otherwise support less l1 mobilization than neurons . a recent single - cell genomic analysis of 300 cortex and caudate nucleus pyramidal neurons elucidated < 0.1 somatic l1 insertions per cell , and concluded that l1 was not a major driver of neuronal diversity ( evrony et al . , 2012 )
however , the biological or technical reasons for such disparate results compared with prior data from the hippocampus were unclear .
we therefore performed single - cell rc - seq upon 35 neun nuclei isolated from ctrl-42 , ctrl-45 and ctrl-55 cortex tissue , including seven pyramidal neurons , and identified 1,262 putative somatic l1 insertions ( figures 4b and s5 ) .
this provided a true positive mean estimate of 16.3 insertions per cortical neuron , a figure higher than hippocampal neurons , but not significantly different . an estimated 10.7 insertions occurred per cortex pyramidal neuron , a rate substantially lower than the remaining cortical neurons but a difference that fell short of statistical significance ( p < 0.16 , two - tailed t test , df = 33 ) .
these data elucidate l1 mosaicism in cortical neurons and exclude a biological explanation for inconsistency with the previous study .
pcr validation including tsd discovery underpins accurate calculation of l1 mobilization frequency and reflects experimental veracity independent of methodology ( richardson et al . , 2014 ) .
first , rc - seq reads fully span l1-genome junctions ( figure s2 ) , enabling bioinformatic identification of molecular chimeras before pcr validation .
the earlier work by contrast followed a design ( ewing and kazazian , 2010 ) that typically did not resolve l1-genome junctions , prohibiting computational removal of chimeric reads . instead , the authors maintained that artifacts , including those generated by wga and illumina library preparation , should present lower read depth than genuine l1 insertions , and essentially adhered to the same principle in a very recent study applying wgs to a smaller number of neurons ( evrony et al . , 2015 ) .
this assumption is crucial as , at least in single - cell rc - seq libraries , putative chimeras are disproportionately likely to amplify efficiently and accrue high read depth ( figures 5a and 5b ) .
selected candidates for pcr validation effectively as a function of high read count and not at random ( figure 5c ) .
this approach would strongly enrich for artifacts if applied to single - cell rc - seq data ( figure 5b ) .
it follows that , without the capacity to filter artifacts a priori , the previous study resolved numerous molecular chimeras after pcr and capillary sequencing of putative l1 insertions , substantially reducing the reported validation rate .
by contrast , we selected pcr validation candidates at random ( figure 5d ) .
these factors plausibly explain why our validation rate of 9/20 ( 45.0% ) was significantly higher than the rate of 1/96 ( 1.0% ) reported by the earlier work ( p < 1 10 , chi - square test , df = 1 ) , as well as the disparate estimates of somatic l1 retrotransposition made by each study .
recent qpcr based estimates of l1 cnv in human tissue , as well as in vitro l1 reporter assays , indicate l1 mobilization may be pronounced in a range of neurodevelopmental and psychiatric diseases ( richardson et al . ,
ags is a rare , severe neurodevelopmental condition , characterized by mutations in several genes thought to inhibit reverse transcription , including samhd1 ( zhao et al . , 2013 ) . to address whether samhd1 deficiency in ags patients increases neuronal l1 mobilization , we first applied bulk rc - seq to the post - mortem hippocampus and fibroblasts of an ags patient ( identifier ags-1 ) carrying two loss - of - function samhd1 mutations .
we then performed single - cell rc - seq upon 21 neuronal nuclei from ags-1 hippocampus and identified 373 putative somatic l1 insertions ( figures 4c and s5 ) , leading to a true positive mean estimate of 8.0 insertions per ags-1 neuron .
this figure was significantly ( p < 0.03 , two - tailed t test , df = 112 ) lower than the 13.7 somatic l1 insertions found for control hippocampal neurons . a more significant difference was observed when ags-1 neurons were compared only with the age ( 18 years ) and gender ( female ) matched hippocampal neurons of ctrl-36 ( p < 0.0001 , two - tailed t test , df = 44 ) .
as corollary , l1 qpcr also indicated significantly lower ( p < 0.002 , two - tailed t test , df = 23 ) l1 copy number in ags-1 hippocampus versus controls ( figure 4d ) . finally , the results of the l1 cnv assay were strongly correlated ( r = 0.93 ) with the mean somatic l1 insertion frequencies estimated by single - cell rc - seq ( figure 4e ) .
as the 13 total somatic l1 insertions detected by single - cell rc - seq and validated by pcr generally followed the tprt model , we next assessed whether somatic l1 insertions detected by bulk rc - seq also carried tprt signatures .
rc - seq separately applied to dna extracted from the four control hippocampus samples elucidated 318,866 putative somatic l1 insertions ( table s1 ) . again exploiting l1-genome junction resolution by rc - seq reads ( figures 6a and 6b and s2 )
, we found a strong enrichment for the l1 en motif ( figure 6c ) , a typical tsd size range of 535 nt ( figures 6d and s6 ) and a median l1 poly - a tail length of 33 nt for somatic l1 integration sites identified by bulk rc - seq .
we also identified a substantial group of insertions with tsds > 40 bp in length ( figure s6 ) .
thus , single - cell rc - seq and rc - seq applied to bulk dna both elucidated the hallmark sequence features of tprt - mediated retrotransposition .
substrate dna chromatinization modulates l1 en target site nicking in vitro ( cost et al . , 2001 ) . as such , dynamic changes to chromatin state during neurogenesis may impact the associated genome - wide pattern of l1 mobilization .
an intersection of somatic l1 insertion sites detected by hippocampus bulk rc - seq with refseq gene coordinates revealed significant ( p < 1.0 10 , fisher s exact test , bonferroni correction ) depletion for insertions in exons and promoters versus random sampling and significant ( p < 3.8 10 ) enrichment for introns versus polymorphic insertions ( table s3 )
. exons and introns carrying gene ontology ( go ) terms relevant to neurobiology were however enriched for somatic l1 insertions ( tables s4 and s5 ) compared with random sampling performed by gene identifier or by genomic coordinate ( p < 4.5 10 and p < 0.03 , respectively , fisher s exact test , benjamini - hochberg correction ) .
the latter result indicated enrichment for l1 insertions in genes expressed in the brain , despite taking into account that their length is on average > 50% greater than that of other genes . by considerable margin ,
the most enriched go term found ( table s5 ) was regulation of synapse maturation
( p < 1.7 10 , fisher s exact test , benjamini - hochberg correction ) .
genome - wide patterns for somatic l1 insertions detected in glia and neurons by single - cell rc - seq typically corroborated those found by bulk rc - seq , including enrichment in introns and depletion from promoters and exons ( table s3 ) and even stronger enrichment in neurobiology genes annotated by go term ( tables s4 and s5 ) .
intriguingly , in ags-1 hippocampal neurons we did not observe enrichment for l1 insertions in neurobiology genes ( table s4 ) , whereas enrichment was observed for control hippocampal neurons , even if each individual was analyzed separately . as a control experiment , from the liver bulk
rc - seq data we identified a set of 175 potential liver - specific l1 insertions ( see extended experimental procedures ) that collectively presented a clear l1 en consensus motif ( figure s6d ) and , owing to the sensitivity of bulk rc - seq , were unlikely to represent incorrectly annotated polymorphic l1 insertions ( table s1 ) .
notably , these liver - specific l1 insertions exhibited no enrichment for neurobiology genes ( table s4 ) .
we concluded that somatic l1 retrotransposition in neural cells preferentially occurs into the euchromatic regions of the genome contributing to neurobiology .
open chromatin is a typical prerequisite for efficient transcription ( neph et al . , 2012 ) .
with this in mind , we used single - molecule cap analysis of gene expression ( cage ) transcriptome profiling data from the fantom5 consortium ( forrest et al . , 2014 ) to test whether genes strongly transcribed in the hippocampus were specifically enriched for somatic l1 insertions in hippocampal neurons .
we first identified genes differentially upregulated in hippocampus , cortex , caudate nucleus , liver , or heart tissue surveyed by cage and then intersected these gene lists with the cohort of intragenic somatic l1 insertions detected by single - cell rc - seq applied to hippocampal neurons .
only those genes upregulated in hippocampus versus heart , and hippocampus versus liver , were significantly enriched ( p < 0.05 , fisher s exact test , benjamini - hochberg correction ) for insertions ( figure 7a , table s6 ) .
somatic l1 insertions in hippocampal glia were also most enriched in genes upregulated in the hippocampus ( p < 0.07 ) . no enrichment was observed for cortical neurons while , intriguingly , the liver - specific l1 insertion cohort exhibited enrichment ( p < 0.11 ) in genes upregulated in liver versus hippocampus ( figure 7a ) . finally , we calculated the significance of enrichment for hippocampal neuron l1 insertions in genes upregulated in hippocampus while incrementally introducing putative artifacts described in figure 5b .
we found that statistical significance was no longer achieved once the dataset contained 15% or more artifacts ( figure 7b ) , hence demonstrating how experimental noise reduced in single - cell rc - seq analyses would otherwise obscure genome - wide enrichment .
these experiments altogether reveal context - dependent , preferential l1 mobilization into strongly transcribed loci . noting that euchromatin is also a signature of active enhancer elements
, we intersected our list of somatic l1 insertions detected by hippocampus bulk rc - seq with an extensive fantom5 catalog of transcribed constitutive and cell - type specific enhancers defined by histone modifications and cage - delineated transcriptional activity ( andersson et al . , 2014 ) .
globally , no substantial difference was observed in the rate of l1 insertions in all enhancers versus random expectation .
however , of 47 cell - type specific enhancer sets , only neuronal stem cell enhancers were significantly enriched for somatic l1 insertions , compared with random expectation ( p < 0.01 , fisher s exact test , bonferroni correction ) and compared with the union of the remaining 46 cell - type specific enhancer sets ( figure 7c ; p < 1.0 10 , fisher s exact test ) .
this enrichment was highest for l1 insertions within 100 nt of an enhancer , and was observed up to 500 nt from defined enhancer boundaries ( figure 7d ) .
no enrichment was observed for astrocytes or for other cells not of the neuronal lineage , such as hepatocytes ( figure 7d ) .
the smaller cohorts of somatic l1 insertions detected by single - cell rc - seq and liver bulk rc - seq were insufficient to perform meaningful statistical analyses of l1 insertional preference with regards to enhancers . nonetheless , hippocampus bulk rc - seq indicated that neuronal stem cell - specific enhancers were the most highly enriched genome functional element in absolute terms ( 1.8-fold ) for somatic l1 insertions .
this reinforced the view that l1 mobilization during neurogenesis impacts regulatory and protein - coding loci specifically active in the hippocampus .
de novo germline l1 insertions can be highly deleterious to gene function , and commonly undergo purifying selection ( boissinot et al .
the l1 orf2 segment of sense oriented intronic l1 insertions particularly hinders rna polymerase processivity ( han et al . , 2004 ; lee et al . ,
2012 ) . hence , while sense and antisense intronic l1 insertions are assumed to occur with equal frequency in the germline , sense insertions are selected against more strongly and tend to be eliminated from the population .
it follows that an estimated 43.3% of recent intronic l1-ta insertions are sense oriented , versus only 34.1% of fixed l1-ta insertions and 39.7% of all polymorphic l1-ta insertions ( ewing and kazazian , 2010 ) .
by contrast , sense oriented intronic l1 insertions are not depleted in tumors ( lee et al . , 2012 ) .
among the control individuals examined here , we found that , as expected , 42/101 ( 41.6% ) of intronic , polymorphic germline l1 insertions were sense oriented to their host gene .
surprisingly , 406/1,024 ( 39.6% ) of intronic somatic l1 insertions detected in hippocampal neurons by single - cell rc - seq were also sense oriented , significantly less than the expected 50% ( p < 0.0001 , exact binomial test ) .
this proportion was 47/136 ( 34.6% ) and 166/503 ( 33.0% ) for glia and cortical neurons , respectively .
adhering to the prevailing germline model of l1 evolutionary selection , we concluded that some somatic l1 insertions may arise sufficiently early in neurogenesis to impact neural progenitor cell fitness , as indicated by a depletion of sense oriented events in mature neurons and glia .
our experiments firmly establish that l1-driven mosaicism pervades the hippocampus and is mediated by tprt . that we found 13.7 somatic l1 insertions per hippocampal neuron was unexpected given a prior estimate of < 0.1 insertions per cortical neuron ( evrony et al . , 2012 ) .
by discovering here a myriad of l1 insertions in cortical neurons , we exclude a biological explanation for this discrepancy and instead propose that the process by which the earlier work selected insertions for validation led to a significant underestimate of l1 retrotransposition frequency . indeed , the mobilization rate reported here much more closely resembles an earlier estimate of 80 somatic l1 insertions per brain cell , calculated via l1 qpcr ( coufal et al . , 2009 ) .
beyond this , our data demonstrate that l1 insertions in hippocampal neurons and glia are preferentially found in protein - coding genes highly transcribed in the hippocampus .
transcribed enhancers active in neuronal stem cells are also enriched for somatic l1 insertions , indicating likely l1 perturbation of regulatory elements .
l1 insertions in cortical neurons were however not significantly enriched in genes highly transcribed in the cortex .
we speculate that this could be due to cortical neurogenesis primarily occurring during fetal development ( spalding et al . , 2005 ) , which presents a genome - wide transcriptional profile different to that of the adult cortex .
although l1 mobilization was not increased in ags-1 hippocampal neurons , the pattern of l1 insertions was prospectively different to that of controls , the reasons for which are presently unclear .
the most obvious caveat of this analysis is that , due to the extreme rarity of the disease , only one ags patient hippocampus was studied .
nonetheless , this experiment serves as a proof - of - principle demonstration that single - cell rc - seq could be used in the future to assess abnormal l1 mobilization in neurological disease .
finally , we noted that somatic l1 insertions in neurons bore substantially longer tsds on average than polymorphic l1 insertions , corroborated by structural characterization of l1 integration sites found by single - cell rc - seq .
unusually long tsds have previously been identified using an engineered l1 reporter system in hela cells ( gilbert et al . , 2005 ) .
as also hypothesized in that context , pervasive euchromatinization in neural progenitor cells may promote the formation of long tsds .
although the vast majority of somatic l1 insertions detected by single - cell rc - seq were found in one cell each , a small proportion of l1s were detected in multiple cells , including examples found in both glia and neurons , indicating l1 mobilization in a common multipotent progenitor cell .
three somatic l1 insertions were validated by pcr in multiple neurons , including one example found in nearly 50% of the neurons assayed .
thus , although most l1 insertions may occur in one or a handful of neurons , a substantial number appear to arise during early neurogenesis .
indeed , the signature of potential selection against somatic l1 insertions sense oriented to host gene introns suggests that many retrotransposition events precede terminal neural cell maturation .
we speculate that depletion of these events could be explained by preferential l1 integration into neurogenesis genes , thereby impacting the survival or differentiation potential of neural progenitor cells .
it also can not be excluded that somatic l1 integration primarily occurs antisense to host gene introns , though we currently lack a mechanistic explanation for this preference .
other than transposable element activity , recent studies have reported localized and chromosome - wide cnv in normal neurons ( cai et al . , 2014 ; gole et al . , 2013 ; mcconnell et al . ,
we find no definitive evidence of these events in our data , though it must be noted that our cnv analyses were expressly geared to discern genomic deletions caused by wga failure or variability .
however , it must be noted that we found consistent wga inefficiency at telomeres , while others have reported that most apparent small genomic deletions occur close to telomeres ( mcconnell et al . , 2013 ) .
l1 mosaicism may also occur outside of the brain , for instance during early embryogenesis ( garcia - perez et al .
, 2007 ; kano et al . , 2009 ) or , as we previously reported for a single l1 insertion , in the liver ( shukla et al . ,
however , some cell types present practical and technical challenges not posed by neural cells . for example , hepatocytes are frequently multinucleated and sustain aneuploidy and polyploidy , greatly complicating single - cell genomic analysis . thus , although the liver - specific l1 insertions detected here by bulk rc - seq consistently bore l1 en motifs and were enriched in genes differentially upregulated in liver , we were unable to corroborate these findings with single - cell rc - seq or downstream pcr validation .
future methodological advances will therefore likely be required to elucidate l1 mosaicism in the liver , and elsewhere in the body .
the capacity to locate somatic l1 insertions in individual neural cell genomes is a major step toward determining whether mosaicism impacts neurobiological function .
limitations in assaying the transcriptome and genome of the same cell however currently prohibit functional assays of individual somatic l1 insertions .
nonetheless , given the frequency of these events , their mutagenic potential for protein - coding and regulatory regions and an apparent preference for euchromatic dna linked to neurobiological function , it is not unreasonable to predict that l1-driven somatic mosaicism may alter the functional properties of the brain .
tissues were obtained post - mortem from ags-1 with ethical approval to be used as described .
ags-1 carried samhd1 mutations c.646 - 647 delat ( p.met216fs ) and c.1223g > c ( p.arg408pro ) .
neun ( neuronal ) and neun / ki67 ( glial ) nuclei were isolated via facs from brain tissue , individually picked under microscope and subjected to linear wga .
products were split into three exponential pcr reactions utilizing two different kits , and then combined for library preparation and downstream pcr validation .
multiplexed illumina libraries were pooled and sequenced ( 2 150-mer reads ) to assess allelic dropout and l1-genome junction depletion , then hybridized separately to two lna probes respectively matching the 5 and 3 ends of l1-ta .
post - enrichment , rc - seq libraries were sequenced ( 2 150-mer reads ) , computationally processed , filtered to exclude artifacts , and finally used to call polymorphic and somatic l1 insertions .
twenty somatic l1 insertions detected by single - cell rc - seq at a 3 l1-genome junction were selected at random for structural characterization by pcr amplification and sequencing of the corresponding 5 l1-genome junction .
for each example , initial pcr template dna consisted of wga material from the relevant neuron .
as the extent of l1 5 truncation was unknown , primers oriented antisense to l1 were designed approximately every 500 bp through the l1-ta consensus and combined with an insertion site primer unique to each locus .
5 l1-genome junctions were identified by pcr and sequencing and then separately pcr amplified again using wga material from the selected neuron , wga material from other single neurons from the same individual , as well as matched bulk dna . amplified material was stored and handled separately to bulk dna . extended experimental procedureshuman tissue samplessnap frozen hippocampus and liver tissue from four post - mortem individuals ( ids : ctrl-36 , ctrl-42 , ctrl-45 , ctrl-55 ) without neurological disease was provided to p.m.b . by the edinburgh sudden death brain and tissue bank with ethical approval to be used as described in the study ( east of scotland research ethics service , reference : lr/11/es/0022 ) .
matched snap frozen frontal cortex tissue was also obtained for ctrl-42 , ctrl-45 and ctrl-55 .
snap frozen hippocampus tissue and fibroblasts were obtained post - mortem from an ags patient ( i d : ags-1 ) in the context of a joint study between m.s.v.d.k and a.v . with ethical approval to be used as described ( children s national medical center irb , reference : pro00000082 ) .
further ethics approvals were provided by the mater health services human research ethics committee ( reference : 1915a ) and the university of queensland medical research ethics committee ( reference : 2013001113 ) .
age and gender information for each de - identified individual is provided in table s1 .
ags-1 carried samhd1 mutations c.646 - 647 delat ( p.met216fs ) and c.1223g > c ( p.arg408pro ) . from each sample
dna was re - suspended in 75 l te , dissolved overnight at 4c , diluted 10-fold and quantified by nanodrop and by qubit hs dna fluorometer ( life technologies carlsbad , ca).purification and isolation of neural cell nucleifor each individual , intact nuclei were purified from 5 mg hippocampus tissue and labeled with an anti - neun antibody , as described previously ( jiang et al . , 2008 ; okada et al . , 2011 ) .
frozen samples were first gently dounce homogenized for 2 min in 2 ml nuclei extraction buffer ( neb ) with 0.1% triton x-100 .
brain homogenates were then filtered through a 40 m cell strainer and centrifuged at 3,000 rpm for 7 min .
following centrifugation , a block buffer with 10% goat serum was added to the nuclei pellet and incubated for 10 min without disturbing the pellet . to immuno - tag
neuronal nuclei , anti - neun ( millipore # mab377 ) and mouse igg1 apc ( abcam # ab130786 ) antibodies were co - incubated for 10 min at 4c .
the nuclei solution was added to the mixed antibodies and incubated for one hour at 4c .
prior to facs , samples including unlabeled controls were stained for 5 min on ice with sytox blue dead cell stain ( life technologies : # s34857 ) at 1/400 dilution to eliminate debris and collect only intact nuclei ( figure s1 ) .
neun nuclei were sorted with a moflo astrios high speed cell sorter ( beckman coulter ) into 1.5 ml collection tubes and re - analyzed to confirm purity ( figure s1e ) .
purified nuclei were then picked using an olympus ix71 inverted microscope , with an eppendorf transferman 2 micromanipulator and eppendorf cell tram . after picking
, nuclei were washed in pbs , transferred to individual uv sterilized 0.2 ml pcr tubes and snap frozen .
negative ( washed pbs aliquots ) , positive ( gdna and 1 l nuclei solution ) and no template controls were also included for each batch , with two of each control type included ( 8 total ) . to isolate hippocampal glia
, we followed the above protocol with the exception that intact nuclei were incubated with anti - neun antibody and a conjugated ki67 antibody ( ebioscience#50 - 5698 - 80 ) for one hour at 4c . before facs , samples were again stained with sytox blue for 5 min .
neun cortical nuclei were purified as per hippocampal neurons , instead using matched cortex tissue .
pyramidal neurons were identified as a sorted population of large neun nuclei , as performed previously ( evrony et al .
, 2012).single - cell whole - genome amplificationwhole genome amplification ( wga ) was performed following extensive optimization of the malbac protocol ( zong et al . , 2012 ) .
nuclei were denatured at 95c for 2 min in 15 l denaturation buffer ( 20% bst2.0 buffer , 0.4 m dntps , 0.3 m bst primer ( gtg agt gat ggt tga ggt ctt gtg gag nnn nnn nn ) ) , then transferred to an ice slurry . 5 l bst2.0 ( neb m0537l )
enzyme mix was then added ( 10% bst2.0 buffer , 10% bst2.0 ) and reactions were placed on an eppendorf procycler s thermal cycler and amplified using the following program : 4c 10 sec , 1% ramp to 65c 5 min , then 4 cycles of 94c 10 sec , 4c 10 sec , 1% ramp to 65c 5 min , then 80c 20 min with a 4c hold .
one reaction was performed using expand long range enzyme blend ( roche cat # 04829069001 ) ( 0.6x buffer 2 , 5% dmso , 0.5 m dntps , 0.3 m pcr primer ( gtg agt gat ggt tga ggt ctt gtg gag ) , 2.2 units expand long range enzyme blend ) with the following program : 92c 2 min , 10 cycles of 92c 30 sec ,
62c 30 sec , 68c 6.5 min , then 15 cycles of 92c 30 sec ,
62c 30 sec , 68c 6.5 min + 20 sec / cycle , then 68c 10 min , followed by a 10c hold .
the remaining two reactions were performed with kapa robust polymerase ( kapa biosystems , kk5525 ) ( 0.6x buffera , 1x enhancer , 0.2 m dntps , 0.3 m pcr primer ( gtg agt gat ggt tga ggt ctt gtg gag ) , 2 units kapa robust polymerase ) with the following program : 94c 30 sec , 25 cycles of 94c 30 sec ,
62c 30 sec , 72c 5 min , then 72c 5 min , 10c hold .
dna from pcr amplification was quantified using a qubit hs dsdna kit ( invitrogen ) .
highest yielding reactions with even amplification across kapa and expand reactions were selected , with one of each reaction pooled together using a 1:2 ( weight : weight ) mix of expand and kappa reactions .
these pools were then used for illumina library preparation and later pcr validation experiments.illumina library constructionmultiplexed illumina libraries were prepared from bulk input dna following a previous method ( shukla et al . , 2013 ) with the following modifications : 1 g input dna quantified using a qubit hs dna fluorometer was sonicated using a covaris m220 ( covaris woburn , massachusetts ) with the following settings : peak power 50 , duty factor 20 , cycles per burst 200 , and time 120 sec .
dna was end repaired , a - tailed , and ligated following the illumina truseq library preparation protocol .
pre - hybridization ligation mediated pcr ( lmpcr ) consisted of one reaction per library with 50 l phusion high - fidelity master mix with hf buffer
( neb ipswich , ma ) , 1 l of 100 m truseq forward primer ( ts - f ) 5-aatgatacggcgaccaccgaga , 1 l of 100 m truseq reverse primer ( ts - r ) 5-caagcagaagacggcatacgag , and molecular grade water to 100 l .
cycling conditions were : 98c for 45 sec followed by 8 cycles of : 98c for 10 sec , 60c for 30 sec , and 72c for 30 sec , ending with 72c for 5 min and held at 4c until sample clean up .
samples were cleaned with ampure xp beads ( beckman coulter brea , ca ) following manufacturer instructions , except using a 1:1.1 ratio of dna to beads .
samples were eluted in molecular grade water and quantified using the bioanalyzer dna 1000 chip ( agilent technologies santa clara , ca ) following manufacturer s instructions.single-cell illumina libraries were prepared as described for bulk input dna with the following modifications : dna input consisted of 500 ng of wga material , with expand and kapa pcr products mixed at a 1:2 ratio , and sonication time was reduced to 90 sec to account for shorter fragments generated by wga . for end repair , a - tailing and ligation
single - cell libraries were barcoded , pooled , and subjected to illumina whole genome sequencing ( wgs ) for qc purposes and copy - number analysis , prior to rc - seq hybridization.single-cell copy - number variation analysiswe assessed allelic dropout ( ad ) and locus dropout ( ld ) in single - cell libraries using low coverage wgs , as well as wgs performed on matched bulk samples .
7/120 single hippocampal neuron libraries ( ctrl-42-hn-#7 , ctrl-42-hn-#8 , ctrl-42-hn-#9 , ctrl-45-hn-#14 , ags-1- hn-#6 , ags-1-hn-#21 , ags-1-hn-#24 ) , 1/36 single cortical neuron libraries ( ctrl-55-cn-#5 ) and 2/24 single hippocampal glial cell libraries ( ctrl-45-hg-#5 , ctrl-55-hg-#1 ) were excluded from analysis due to low concentration before or after pooling .
the remaining 170 libraries were illumina sequenced ( ambry genetics , usa ; macrogen , south korea ) , generating 1,097,474,654 2x150-mer read pairs ( table s1 ) .
matched bulk wgs for all 5 individuals ( liver for controls , fibroblast for ags-1 ) were also illumina sequenced , generating 37,601,911 2x150-mer read pairs .
read pairs were first trimmed from their 5 and 3 ends to remove any bases with quality < 10 , then assembled into contigs using flash ( mago and salzberg , 2011 ) and default parameters .
read contigs were then sequentially aligned to amplification primers by blast ( parameters -m 8 -a 4 -f f , minimum score 22 ) to trim reads of these sequences , then to the reference genome ( hg19 ) using soap2 ( li et al . , 2009 ) ( parameters -m 4 -v 2 -r 1 -p 8) .
unmapped reads were then aligned to hg19 using last ( kiebasa et al . , 2011 ) ( parameters s 2 l 11 d 30 q 3 e 30 ) to allow for soft clip alignments .
bulk liver and fibroblast libraries were not subjected to wga and therefore were not trimmed of amplification primers by blast .
m uniquely mapped read pairs were produced per single - cell wgs library ( table s1 ) . on average , wgs generated 0.35x genome coverage for single - cell wgs libraries and 0.49x genome coverage for bulk wgs libraries.to identify instances of ad and ld , we first divided the genome into 5,000 variable size bins with an average size of 600 kb , following established methods ( evrony et al . , 2012 ; navin et al . , 2011 ) .
this strategy was chosen to avoid false positives due to variation in read mappability across the genome , as demonstrated elsewhere ( navin et al . , 2011 ) .
reads mapping to each bin were then counted , with an average of 916 reads per bin in each single - cell library and 1,270 reads per bin in each bulk library . following established statistical methods ( evrony et al . , 2012 ; mcconnell et al . ,
2013 ) to correct for gc bias in illumina sequencing , we divided the bin counts for each single - cell library by the median count of all bins in the same decile of gc content for that library . for each chromosome , copy number
was grossly calculated by separately totaling the normalized bin counts in each library and then dividing by the median of the total values for that chromosome .
autosome and female library ( ctrl-36 , ags-1 ) chromosome x total values were then multiplied by two , with male and female sex chromosome data processed separately .
for each chromosome , we then divided the normalized bin counts by the median normalized bin count across all libraries for that chromosome , multiplied by 2 for autosomes and female chromosome x to calculate copy number , and calculated the median absolute difference ( mad ) .
bins with a normalized count 1.5 mads or less below the median chromosomal copy number were annotated as ad or ld , defined as a normalized count 1/2 or 1/16 the median , respectively .
any bin called as ad or ld in a bulk liver library was not considered for analysis of ad or ld in the matched single - cell libraries , to exclude putative germline structural variants .
these analyses revealed six examples of chromosome - wide ad ( table s1 ) , where > 50% of bins were annotated as ad or ld . to find localized , high - confidence examples of ad or ld , such as those described elsewhere ( mcconnell et al . , 2013 ) , and distinct to underlying amplification variability as shown in figure s3 , we sought genomic segments in each library where > 8 bins ( 5 mb ) in a row were found to be ad or ld in only one individual and more than 10 bins away from a telomere , revealing 7 such regions ( table s1 ) , two of which are highlighted in figure 2b .
for these two examples , on chromosome 6 of ctrl-45 hippocampal neuron 2 ( ctrl-45-hn-#2 ) , we repeated the above analysis using a genome divided into 50,000 variable size bins to achieve a higher resolution ( 60 kb ) view of each dropout region ( figure s4c).during early optimization we noted that wga in some cases depleted amplified material of l1-ta 5 and 3 ends . to overcome this , we optimized the bst and pcr reaction parameters ( temperature and cycling conditions ) and used combined expand and kapa pcr products for library generation , noting that the former kit provided superior genome - wide coverage , and the latter superior detection of l1-ta insertions ( data not shown ) . in the final method presented here , analysis of wgs
reads from single - cell libraries revealed negligible average depletion , or even slight enrichment , for l1-ta 5 and 3 ends versus bulk liver wgs ( figure s4d , figure s4e , table s1 ) , where normalization was performed against a set of 10 220 bp sequences randomly sampled from the human reference genome.rc-seq hybridization reactionsthe same single - cell libraries analyzed by wgs were also subjected to rc - seq .
first , 20 l seqcap easy developer reagent ( roche nimblegen madison , wi ) , 20 l of 100 m blocking oligo ( aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatc/3 ddc/ ) analogous to the universal end of the illumina adaptor , and 20 l of 100 m blocking oligo corresponding to the index specific adaptor used for each library ( seqcap ez he - oligo kits a and b , roche nimblegen ) was added to each pool .
we then added an additional 10 l of a 100 m stock of blocking oligo 5-gtgagtgatggttgaggtcttgtggag to single - cell pool hybridizations to block the wga primer .
all blocking oligos were 3 terminated with a dideoxy cytosine to prevent priming during post - hybridization lmpcr.each tube containing library , developer reagent , and blockers was mixed , spun down briefly , and split into two 1.5 ml tubes of equal volume , with each tube used for separate reactions targeting the 5 and 3 end of an l1-ta consensus sequence ( dombroski et al . , 1993 ) .
for each end , a single locked nucleic acid ( lna ) ( exiqon vedbaek , denmark ) probe was identified with high melting temperature and high specificity to l1-ta .
/ ag+a+tgac+a+c+attagtgggtgc+a+gcg targeted the 3 end ( + denotes lna positions within each probe ) .
probes were biotinylated at their 5 end for capture with strepdavidin beads . prior to hybridization with these lna probes ,
sample pools were dried down in a speedvac at 60c for 30 min . to the dried samples , 7.5 l of hybridization buffer and 3 l of component a ( roche nimblegen madison , wi ) were added .
samples were vortexed and briefly spun down then placed on a heat block at 95c for 5 min .
each halved library pool was then added to a 0.2 ml pcr tube containing 4.5 l lna capture probes normalized to 10 m .
these hybridization cocktails were placed into a pre - heated thermocycler at 95c for 2 min , then transferred directly to a pre - heated thermocycler at 47c with heated lid set to 57c and incubated for 3 days.following incubation , hybridization cocktails were washed following the seqcap sr user s guide ( roche nimblegen ) and eluted in 50 l water .
post - hybridization lmpcr was identical to pre - hybridization lmpcr with two exceptions : two lmpcr reactions were used for each sample , and then combined , and the number of pcr cycles was increased to 10 .
reactions were cleaned with a minelute column ( qiagen ) and eluted in 15 l eb heated to 60c .
l1 5 and 3 capture pools were then combined , with 70% of the final mass of each pool comprising 3 captured dna and 30% 5 captured dna .
single - cell capture pools were sequenced with an illumina miseq to verify successful l1-ta enrichment ( data not shown).bulk rc - seq analysispost - enrichment , bulk rc - seq library pools were illumina sequenced , generating 462,031,340 2x150-mer read pairs ( table s1 ) .
read contigs were then aligned to hg19 using soap2 ( li et al . , 2009 )
( parameters -m 4 -v 2 -r 1 -p 8) . as for wgs data ,
only uniquely aligned reads were retained and pcr duplicates were removed if they shared the genomic coordinates of another read .
unmapped reads were then aligned to a set of potentially active human retrotransposon consensus sequences listed elsewhere ( baillie et al . , 2011 ) , using
last ( kiebasa et al . , 2011 ) ( parameters s 2 l 11 d 30 q 3 e 30 ) . reads aligned at > 95% identity to l1-ta , l1-pre - ta or l1pa2 families were retained if this alignment spanned 33 nt of one contig end .
the computational pipeline for alignment , filtering , and clustering then followed an existing strategy ( shukla et al . ,
2013 ) including alignment to hg19 with soap2 and last , with the main exception being that clusters needed to only contain a single aligned read to be reported .
this reduction in reporting threshold led us to include an additional step , with reference to our earlier strategy ( shukla et al .
, 2013 ) , to exclude molecular chimeras by removing any read with an alignment of its non - retrotransposon section plus 5 nt to the genome , rather than 10 nt .
we also extracted , in silico , 1 kb from the reference genome extending downstream from an aligned non - retrotransposon section and aligned the full read contig against this region with blat and default parameters , to exclude genomic rearrangements ( e.g. , deletions ) involving nearby l1 copies .
rc - seq reads processed in this way were used to determine bulk rc - seq sensitivity , as well as l1-ta enrichment and sequencing depth , with reference to 960 l1-ta copies annotated in hg19 ( evrony et al . , 2012 ) .
sensitivity was also assessed based on how many polymorphic l1-ta insertions were found per sample .
polymorphic l1-ta insertions were called as present in an individual if they met a stringent reporting threshold of having at least 8 rc - seq reads in at least one sample from that individual , were detected in both hippocampus and liver ( or ags-1 fibroblast ) from that individual , and the read count for at least one sample from that individual exceeded > 0.1x the max number of reads in any bulk rc - seq library . l1
insertions found only in one bulk hippocampus library by 1 rc - seq reads , and absent from any bulk liver rc - seq library or previous publications ( ewing and kazazian , 2010 , 2011 ; iskow et al . , 2010 ; shukla et al . , 2013 ; wang et al . , 2006 ) , were annotated as somatic hippocampal insertions .
similarly , a control cohort of 175 liver - only l1 insertions were annotated as for hippocampal insertions , instead with a reporting threshold of 4 rc - seq reads intended to detect possible somatic l1 mobilization events early in liver organogenesis .
notably , the bulk hippocampus rc - seq libraries detected 97.7% of reference genome l1-ta copies on average ( table s1 ) , indicating that these annotated liver - only l1 insertions were very unlikely to be mis - annotated polymorphic l1 insertions .
ambiguous rc - seq clusters not annotated as either polymorphic or somatic were discarded.single-cell rc - seq analysisnine single - cell rc - seq pools ( ctrl-36 , ctrl-42 , ctrl-45 , ctrl-55 and ags-1 hippocampal neurons ; ctrl-42 , ctrl-45 and ctrl-55 hippocampal glia ; ctrl-42 , ctrl-45 and ctrl-55 cortical neurons ) were illumina sequenced , generating a total of 3,494,481,909 2x150-mer read pairs ( table s1 ) . computational analysis then proceeded using the method outlined above for bulk rc - seq , with additional filtering of reads pre- and post - clustering to remove potential artifacts generated by wga and illumina library preparation .
pre - clustering , each read was re - aligned to hg19 using blast ( parameters -m 8 -a 4 -f f , minimum score 22 ) to find the corresponding best alignments for the non - retrotransposon and retrotransposon segments , genome - wide .
reads corresponding to a 5 l1-genome junction involving an overlap of non - retrotransposon and retrotransposon segments of > 2 bp , or a 3 l1-genome junction with an overlap of > 10 bp , were removed as putative chimeras .
reads corresponding to 3 l1-genome junction with a non - retrotransposon / retrotransposon segment overlap of 610 bp were removed if the proportion of adenosine nucleotides in this overlap was < 50% .
removal of chimeric reads at 3 l1-genome junctions was complicated by the priming of l1 reverse transcription typically requiring hybridization in vivo of the l1 polya - tail with genomic thymine residues proximal to a site nicked by the l1 en domain ( feng et al . , 1996 ; jurka , 1997 ; luan et al . , 1993 ) ,
the known location of the rc - seq lna probes , and a known library insert size , allowed us to remove reads indicating 5 l1-genome junctions > 40 nt and < 5,700 nt , or > 5,930 nt , away from the l1-ta 5 end as probable artifacts . reads indicating truncations of > 5 nt from the l1-ta 3 end
were removed , as a polya - tail is an established feature of most retrotransposition - competent l1 copies ( moran et al . , 1996 ) .
prospective l1 3 transduced regions were also required to terminate with a polya - tail of at least 10 bp and 50% adenosine .
any reads where the retrotransposon segment aligned within 5 kb of the non - retrotransposon segment on the genome were also removed , to filter out potential wga artifacts involving the formation of loops between reference l1-ta copies and nearby regions of microhomology .
post - filtering , clusters overlapping a repeatmasker annotated primate - specific l1 insertion ( l1h and l1p ) or an alu were also removed , due to expected difficulty in validating these events , and their high potential to generate wga artifacts .
polymorphic and somatic l1 insertions were annotated as for bulk rc - seq , with 1 single - cell rc - seq reads required to annotate the latter category.we assessed the sensitivity of single - cell rc - seq by selecting polymorphic insertions detected by at least 40 reads in the corresponding bulk rc - seq , representing a cohort of gold - standard variants likely to approximate a true positive rate of 100% based on prior experiments ( shukla et al . , 2013 ) , and determined how many of these polymorphic insertions were detected in the corresponding single - cell libraries .
thus , using detection of polymorphic l1 insertions as a measure of sensitivity for detection of somatic l1 insertions may underestimate somatic retrotransposition.structural characterization and validation of somatic l1 insertionstwenty somatic l1 insertions detected by single - cell rc - seq at a 3 l1-genome junction were selected at random for validation and structural elucidation ( tables s2 and data s1 ) , each requiring resolution of the corresponding 5 l1-genome junction by insertion site pcr and sequencing .
insertion site primers , as denoted by an symbol in figure 3 and listed in table s2 , were first designed by primer3 , or by hand where a primer was not initially identified within 200 bp of the integration site .
as the extent of l1 5 truncation was unknown , primers oriented antisense to l1 ( denoted by a symbol in figure 3 ) were designed approximately every 500 bp through l1-ta .
pcrs were performed using invitrogen platinum taq dna polymerase high fidelity with the following conditions : 1x high fidelity pcr buffer , 2 mm mgso4 , 0.2 mm dntps , 0.2 m primers , 7.5u polymerase and 10 ng template dna .
thermal cycling was performed as follows : initial denaturation at 94c for 3 min , then 27 cycles of 94c for 30 sec , 57c for 30 sec , 68c for 30 sec , followed by final extension at 68c for 10 min , then hold at 10c .
pcr products were quantified using a qubit hs dsdna kit following the manufacturer s protocol .
amplicons were then combined in equimolar ratios to give 500 ng of pooled dna .
illumina libraries were then prepared using the nebnext ultra library preparation kit with the following modifications : an initial size selection was performed using 1:0.6 then 1:3 sample to ampure xp bead ratios .
reads were then interrogated using custom python scripts to identify sequences corresponding to a full - length or truncated l1 5 end and also aligning to one of the 20 putative integration sites .
5 l1-genome junctions identified in this manner were then validated by pcr followed by standard agarose gel electrophoresis using the same amplification conditions as described above . in some instances ,
nested primers were required , and nested pcr was performed using 27 cycles , then 35 cycles of amplification .
ten l1 insertions detected only at a 5 l1-genome junction were also tested , although as we have previously encountered ( baillie et al . , 2011 ) ,
pcr amplification of the corresponding 3 l1-genome junction was extremely challenging , and none of these examples were confirmed ( table s2 ) .
four l1 insertions detected at both their 5 and 3 ends were however confirmed by pcr ( table s2).5 l1-genome junction amplification analysispolymorphic l1 insertions detected at their 3 l1-genome junction by single - cell rc - seq from ctrl-42 , ctrl-45 and ctrl-55 ( four l1s from each individual ) were confirmed as heterozygous by empty / filled site pcr using template bulk hippocampus dna ( table s2 ) .
pcr involved the following reagents : 1u mytaq dna polymerase ( bioline , australia ) , 1x mytaq reaction buffer , 2 m primers and 10 ng template dna .
thermal cycling was performed as follows : initial denaturation at 95c for 1 min , then 35 cycles of 95c for 30 sec , 57c for 15 sec , 72c for 10 sec , followed by final extension at 72c for 10 min , then hold at 10c .
insertion site and l1 primers were then combined to amplify the 5 l1-genome junction for each heterozygous l1 again using bulk hippocampus dna as template and the same reagent mixture and cycling conditions as for the empty / filled site assay above .
once the 5 l1-genome junctions were confirmed , targets were re - amplified using the wga material from 8 randomly selected neurons for each insertion where the 3 l1-genome junction was already identified by single - cell rc - seq . for this pcr , we used the following reagent mixture : 1u mytaq dna polymerase , 1x mytaq reaction buffer , 2 m primers and 50 ng wga template dna .
thermal cycling was performed as follows : initial denaturation at 95c for 1 min , then 37 cycles of 95c for 30 sec , 57c for 15 sec , 72c for 10 sec , followed by final extension at 72c for 10 min , then hold at 10c .
twelve heterozygous polymorphic l1s were analyzed across 100 neurons in total , with a 5 l1-genome junction found in exactly 50 instances ( table s2 ) , indicating that the maximum possible estimated validation rate with tsds was 50%.taqman qpcr l1 cnv assay1 g dna from each hippocampus sample was run on a 0.7% agarose gel .
bands 10 kb in size were selected by excision to exclude any possible l1 cdna and subjected to gel purification using a qiagen gel purification kit ( # 28606 ) .
this high molecular weight genomic dna was then used as input for qpcr , using the orf2 # 1 combination first used to assay l1 cnv by coufal et al .
( coufal et al . , 2009 ) , with -satellite repetitive elements ( sata ) as an immobile control . incorporating minor modifications made by baillie
( baillie et al . , 2011 ) , experiments were performed using roche taqman master mix ( # 04707494001 ) and run on a lightcycler 480 ( roche ) .
the ratio of l1 orf2 to sata in each hippocampal dna sample was finally normalized to the signal for ctrl-36.insertion enrichment analysesto determine whether somatic l1 insertions were enriched in genes differentially expressed in the same spatiotemporal context , we downloaded single - molecule cage data published by fantom5 ( forrest et al . , 2014 ) ,
including hippocampus , caudate nucleus , frontal cortex , liver , and heart cage experiments .
cage tag clusters within 1 kb of , and on the same strand as , the annotated 5 end of refseq genes ( available from the ucsc table browser ) were used to compile a table of expression for each gene , with expression normalized to tags - per - million .
pairwise comparisons were then performed between each tissue ( as displayed in figure 7a ) to identify genes differentially upregulated in each tissue .
differential expression was defined by edger ( robinson et al . , 2010 ) , using an exact negative binomial test with bonferroni correction .
overexpressed genes were ranked by p - value , with the most significant 5% of genes selected as a differentially expressed cohort in each pairwise comparison . for each list , we then calculated enrichment for somatic l1 insertions versus what proportion of insertions were expected based on a random selection of 1x10 genomic points .
significance testing involved two - tailed fisher s exact tests , with benjamini - hochberg correction.to assess whether somatic l1 insertions were enriched in enhancer elements , we first downloaded .bed tracks for robust and permissive bidirectionally transcribed enhancers defined by fantom5 ( andersson et al . , 2014 ) , as well as 47 .bed tracks for cell - type specific enhancer elements .
we then intersected the genomic coordinates of l1 insertions with those of each enhancer class , requiring an l1 insertion to be within 100 nt of an enhancer to record an intersection , as for figure 7c . in figure 7d , this window was extended to assess how l1 insertion frequency progressively decreased as the distance to the nearest nsc - specific enhancer increased .
observed values were compared with values expected from random sampling using two - tailed fisher s exact tests with bonferroni correction.meta-analysis of l1-ip datasingle - neuron l1 insertion profiling ( l1-ip ) reads were downloaded , trimmed , and then aligned as per evrony et al .
( langmead et al . , 2009 ) . reads less than 500 bp apart and on the same strand were clustered into peaks containing a minimum of a single read and annotated using the repeatmasker track from human genome build hg19 and locations of known non - reference elements .
peaks with consistent orientations and overlapping locations 500 bp were merged , and counts were summed across samples using bedtools version 2.20.1 - 4-gb877b35 .
snap frozen hippocampus and liver tissue from four post - mortem individuals ( ids : ctrl-36 , ctrl-42 , ctrl-45 , ctrl-55 ) without neurological disease was provided to p.m.b . by the edinburgh sudden death brain and tissue bank with ethical approval to be used as described in the study ( east of scotland research ethics service , reference : lr/11/es/0022 ) .
matched snap frozen frontal cortex tissue was also obtained for ctrl-42 , ctrl-45 and ctrl-55 .
snap frozen hippocampus tissue and fibroblasts were obtained post - mortem from an ags patient ( i d : ags-1 ) in the context of a joint study between m.s.v.d.k and a.v . with ethical approval to be used as described ( children s national medical center irb , reference : pro00000082 ) .
further ethics approvals were provided by the mater health services human research ethics committee ( reference : 1915a ) and the university of queensland medical research ethics committee ( reference : 2013001113 ) .
age and gender information for each de - identified individual is provided in table s1 .
ags-1 carried samhd1 mutations c.646 - 647 delat ( p.met216fs ) and c.1223g > c ( p.arg408pro ) . from each sample
dna was re - suspended in 75 l te , dissolved overnight at 4c , diluted 10-fold and quantified by nanodrop and by qubit hs dna fluorometer ( life technologies carlsbad , ca ) . for each individual
, intact nuclei were purified from 5 mg hippocampus tissue and labeled with an anti - neun antibody , as described previously ( jiang et al . , 2008 ; okada et al . , 2011 ) .
frozen samples were first gently dounce homogenized for 2 min in 2 ml nuclei extraction buffer ( neb ) with 0.1% triton x-100 .
brain homogenates were then filtered through a 40 m cell strainer and centrifuged at 3,000 rpm for 7 min .
following centrifugation , a block buffer with 10% goat serum was added to the nuclei pellet and incubated for 10 min without disturbing the pellet . to immuno - tag
neuronal nuclei , anti - neun ( millipore # mab377 ) and mouse igg1 apc ( abcam # ab130786 ) antibodies were co - incubated for 10 min at 4c .
the nuclei solution was added to the mixed antibodies and incubated for one hour at 4c .
prior to facs , samples including unlabeled controls were stained for 5 min on ice with sytox blue dead cell stain ( life technologies : # s34857 ) at 1/400 dilution to eliminate debris and collect only intact nuclei ( figure s1 ) .
neun nuclei were sorted with a moflo astrios high speed cell sorter ( beckman coulter ) into 1.5 ml collection tubes and re - analyzed to confirm purity ( figure s1e ) .
purified nuclei were then picked using an olympus ix71 inverted microscope , with an eppendorf transferman 2 micromanipulator and eppendorf cell tram . after picking
, nuclei were washed in pbs , transferred to individual uv sterilized 0.2 ml pcr tubes and snap frozen .
negative ( washed pbs aliquots ) , positive ( gdna and 1 l nuclei solution ) and no template controls were also included for each batch , with two of each control type included ( 8 total ) . to isolate hippocampal glia
, we followed the above protocol with the exception that intact nuclei were incubated with anti - neun antibody and a conjugated ki67 antibody ( ebioscience#50 - 5698 - 80 ) for one hour at 4c . before facs , samples were again stained with sytox blue for 5 min .
neun cortical nuclei were purified as per hippocampal neurons , instead using matched cortex tissue .
pyramidal neurons were identified as a sorted population of large neun nuclei , as performed previously ( evrony et al . , 2012 ) . whole genome amplification ( wga )
was performed following extensive optimization of the malbac protocol ( zong et al . , 2012 ) .
nuclei were denatured at 95c for 2 min in 15 l denaturation buffer ( 20% bst2.0 buffer , 0.4 m dntps , 0.3 m bst primer ( gtg agt gat ggt tga ggt ctt gtg gag nnn nnn nn ) ) , then transferred to an ice slurry . 5 l bst2.0 ( neb m0537l ) enzyme mix was then added ( 10% bst2.0 buffer , 10% bst2.0 ) and reactions were placed on an eppendorf procycler s thermal cycler and amplified using the following program : 4c 10 sec , 1% ramp to 65c 5 min , then 4 cycles of 94c 10 sec , 4c 10 sec , 1% ramp to 65c 5 min , then 80c 20 min with a 4c hold .
one reaction was performed using expand long range enzyme blend ( roche cat # 04829069001 ) ( 0.6x buffer 2 , 5% dmso , 0.5 m dntps , 0.3 m pcr primer ( gtg agt gat ggt tga ggt ctt gtg gag ) , 2.2 units expand long range enzyme blend ) with the following program : 92c 2 min , 10 cycles of 92c 30 sec ,
62c 30 sec , 68c 6.5 min , then 15 cycles of 92c 30 sec ,
62c 30 sec , 68c 6.5 min + 20 sec / cycle , then 68c 10 min , followed by a 10c hold .
the remaining two reactions were performed with kapa robust polymerase ( kapa biosystems , kk5525 ) ( 0.6x buffera , 1x enhancer , 0.2 m dntps , 0.3 m pcr primer ( gtg agt gat ggt tga ggt ctt gtg gag ) , 2 units kapa robust polymerase ) with the following program : 94c 30 sec , 25 cycles of 94c 30 sec ,
62c 30 sec , 72c 5 min , then 72c 5 min , 10c hold .
dna from pcr amplification was quantified using a qubit hs dsdna kit ( invitrogen ) .
highest yielding reactions with even amplification across kapa and expand reactions were selected , with one of each reaction pooled together using a 1:2 ( weight : weight ) mix of expand and kappa reactions .
multiplexed illumina libraries were prepared from bulk input dna following a previous method ( shukla et al . , 2013 ) with the following modifications :
1 g input dna quantified using a qubit hs dna fluorometer was sonicated using a covaris m220 ( covaris woburn , massachusetts ) with the following settings : peak power 50 , duty factor 20 , cycles per burst 200 , and time 120 sec .
dna was end repaired , a - tailed , and ligated following the illumina truseq library preparation protocol .
pre - hybridization ligation mediated pcr ( lmpcr ) consisted of one reaction per library with 50 l phusion high - fidelity master mix with hf buffer ( neb ipswich , ma ) , 1 l of 100 m truseq forward primer ( ts - f ) 5-aatgatacggcgaccaccgaga , 1 l of 100 m truseq reverse primer ( ts - r ) 5-caagcagaagacggcatacgag , and molecular grade water to 100 l .
cycling conditions were : 98c for 45 sec followed by 8 cycles of : 98c for 10 sec , 60c for 30 sec , and 72c for 30 sec , ending with 72c for 5 min and held at 4c until sample clean up .
samples were cleaned with ampure xp beads ( beckman coulter brea , ca ) following manufacturer instructions , except using a 1:1.1 ratio of dna to beads .
samples were eluted in molecular grade water and quantified using the bioanalyzer dna 1000 chip ( agilent technologies santa clara , ca ) following manufacturer s instructions .
single - cell illumina libraries were prepared as described for bulk input dna with the following modifications : dna input consisted of 500 ng of wga material , with expand and kapa pcr products mixed at a 1:2 ratio , and sonication time was reduced to 90 sec to account for shorter fragments generated by wga . for end repair ,
single - cell libraries were barcoded , pooled , and subjected to illumina whole genome sequencing ( wgs ) for qc purposes and copy - number analysis , prior to rc - seq hybridization .
we assessed allelic dropout ( ad ) and locus dropout ( ld ) in single - cell libraries using low coverage wgs , as well as wgs performed on matched bulk samples .
7/120 single hippocampal neuron libraries ( ctrl-42-hn-#7 , ctrl-42-hn-#8 , ctrl-42-hn-#9 , ctrl-45-hn-#14 , ags-1- hn-#6 , ags-1-hn-#21 , ags-1-hn-#24 ) , 1/36 single cortical neuron libraries ( ctrl-55-cn-#5 ) and 2/24 single hippocampal glial cell libraries ( ctrl-45-hg-#5 , ctrl-55-hg-#1 ) were excluded from analysis due to low concentration before or after pooling .
the remaining 170 libraries were illumina sequenced ( ambry genetics , usa ; macrogen , south korea ) , generating 1,097,474,654 2x150-mer read pairs ( table s1 ) . matched bulk wgs for all 5 individuals ( liver for controls , fibroblast for ags-1 ) were also illumina sequenced , generating 37,601,911 2x150-mer read pairs .
read pairs were first trimmed from their 5 and 3 ends to remove any bases with quality < 10 , then assembled into contigs using flash ( mago and salzberg , 2011 ) and default parameters .
read contigs were then sequentially aligned to amplification primers by blast ( parameters -m 8 -a 4 -f f , minimum score 22 ) to trim reads of these sequences , then to the reference genome ( hg19 ) using soap2 ( li et al . , 2009 )
unmapped reads were then aligned to hg19 using last ( kiebasa et al . , 2011 ) ( parameters s 2 l 11 d 30 q 3 e 30 ) to allow for soft clip alignments .
bulk liver and fibroblast libraries were not subjected to wga and therefore were not trimmed of amplification primers by blast .
m uniquely mapped read pairs were produced per single - cell wgs library ( table s1 ) . on average , wgs generated 0.35x genome coverage for single - cell wgs libraries and 0.49x genome coverage for bulk wgs libraries . to identify instances of ad and ld
bins with an average size of 600 kb , following established methods ( evrony et al . , 2012 ; navin et al . , 2011 ) .
this strategy was chosen to avoid false positives due to variation in read mappability across the genome , as demonstrated elsewhere ( navin et al . , 2011 ) .
reads mapping to each bin were then counted , with an average of 916 reads per bin in each single - cell library and 1,270 reads per bin in each bulk library . following established statistical methods ( evrony et al . , 2012 ;
mcconnell et al . , 2013 ) to correct for gc bias in illumina sequencing , we divided the bin counts for each single - cell library by the median count of all bins in the same decile of gc content for that library .
for each chromosome , copy number was grossly calculated by separately totaling the normalized bin counts in each library and then dividing by the median of the total values for that chromosome .
autosome and female library ( ctrl-36 , ags-1 ) chromosome x total values were then multiplied by two , with male and female sex chromosome data processed separately .
for each chromosome , we then divided the normalized bin counts by the median normalized bin count across all libraries for that chromosome , multiplied by 2 for autosomes and female chromosome x to calculate copy number , and calculated the median absolute difference ( mad ) .
bins with a normalized count 1.5 mads or less below the median chromosomal copy number were annotated as ad or ld , defined as a normalized count 1/2 or 1/16 the median , respectively .
any bin called as ad or ld in a bulk liver library was not considered for analysis of ad or ld in the matched single - cell libraries , to exclude putative germline structural variants .
these analyses revealed six examples of chromosome - wide ad ( table s1 ) , where > 50% of bins were annotated as ad or ld . to find localized , high - confidence examples of ad or ld , such as those described elsewhere ( mcconnell et al . , 2013 ) , and distinct to underlying amplification variability as shown in figure s3 , we sought genomic segments in each library where > 8 bins ( 5 mb ) in a row were found to be ad or ld in only one individual and more than 10 bins away from a telomere , revealing 7 such regions ( table s1 ) , two of which are highlighted in figure 2b .
for these two examples , on chromosome 6 of ctrl-45 hippocampal neuron 2 ( ctrl-45-hn-#2 ) , we repeated the above analysis using a genome divided into 50,000 variable size bins to achieve a higher resolution ( 60 kb ) view of each dropout region ( figure s4c ) . during early optimization
we noted that wga in some cases depleted amplified material of l1-ta 5 and 3 ends . to overcome this , we optimized the bst and pcr reaction parameters ( temperature and cycling conditions ) and used combined expand and kapa pcr products for library generation , noting that the former kit provided superior genome - wide coverage , and the latter superior detection of l1-ta insertions ( data not shown ) . in the final method presented here , analysis of wgs
reads from single - cell libraries revealed negligible average depletion , or even slight enrichment , for l1-ta 5 and 3 ends versus bulk liver wgs ( figure s4d , figure s4e , table s1 ) , where normalization was performed against a set of 10 220 bp sequences randomly sampled from the human reference genome .
the same single - cell libraries analyzed by wgs were also subjected to rc - seq .
first , 20 l seqcap easy developer reagent ( roche nimblegen madison , wi ) , 20 l of 100 m blocking oligo ( aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatc/3 ddc/ ) analogous to the universal end of the illumina adaptor , and 20 l of 100 m blocking oligo corresponding to the index specific adaptor used for each library ( seqcap ez he - oligo kits a and b , roche nimblegen ) was added to each pool .
we then added an additional 10 l of a 100 m stock of blocking oligo 5-gtgagtgatggttgaggtcttgtggag to single - cell pool hybridizations to block the wga primer .
all blocking oligos were 3 terminated with a dideoxy cytosine to prevent priming during post - hybridization lmpcr .
each tube containing library , developer reagent , and blockers was mixed , spun down briefly , and split into two 1.5 ml tubes of equal volume , with each tube used for separate reactions targeting the 5 and 3 end of an l1-ta consensus sequence ( dombroski et al . , 1993 ) .
for each end , a single locked nucleic acid ( lna ) ( exiqon vedbaek , denmark ) probe was identified with high melting temperature and high specificity to l1-ta .
/ ag+a+tgac+a+c+attagtgggtgc+a+gcg targeted the 3 end ( + denotes lna positions within each probe ) .
probes were biotinylated at their 5 end for capture with strepdavidin beads . prior to hybridization with these lna probes ,
sample pools were dried down in a speedvac at 60c for 30 min . to the dried samples , 7.5 l of hybridization buffer and 3 l of component a ( roche nimblegen madison , wi ) were added .
samples were vortexed and briefly spun down then placed on a heat block at 95c for 5 min .
samples were mixed to ensure all dna was dissolved and then quickly spun . each halved library pool
was then added to a 0.2 ml pcr tube containing 4.5 l lna capture probes normalized to 10 m .
these hybridization cocktails were placed into a pre - heated thermocycler at 95c for 2 min , then transferred directly to a pre - heated thermocycler at 47c with heated lid set to 57c and incubated for 3 days . following incubation ,
hybridization cocktails were washed following the seqcap sr user s guide ( roche nimblegen ) and eluted in 50 l water .
post - hybridization lmpcr was identical to pre - hybridization lmpcr with two exceptions : two lmpcr reactions were used for each sample , and then combined , and the number of pcr cycles was increased to 10 .
reactions were cleaned with a minelute column ( qiagen ) and eluted in 15 l eb heated to 60c .
l1 5 and 3 capture pools were then combined , with 70% of the final mass of each pool comprising 3 captured dna and 30% 5 captured dna .
single - cell capture pools were sequenced with an illumina miseq to verify successful l1-ta enrichment ( data not shown ) .
post - enrichment , bulk rc - seq library pools were illumina sequenced , generating 462,031,340 2x150-mer read pairs ( table s1 ) .
read contigs were then aligned to hg19 using soap2 ( li et al . , 2009 )
( parameters -m 4 -v 2 -r 1 -p 8) . as for wgs data ,
only uniquely aligned reads were retained and pcr duplicates were removed if they shared the genomic coordinates of another read .
unmapped reads were then aligned to a set of potentially active human retrotransposon consensus sequences listed elsewhere ( baillie et al . , 2011 ) , using last ( kiebasa et al . , 2011 ) ( parameters s 2 l 11 d 30 q 3 e 30 ) . reads aligned at > 95% identity to l1-ta , l1-pre - ta or l1pa2 families were retained if this alignment spanned 33 nt of one contig end .
the computational pipeline for alignment , filtering , and clustering then followed an existing strategy ( shukla et al . ,
2013 ) including alignment to hg19 with soap2 and last , with the main exception being that clusters needed to only contain a single aligned read to be reported .
this reduction in reporting threshold led us to include an additional step , with reference to our earlier strategy ( shukla et al . , 2013 ) , to exclude molecular chimeras by removing any read with an alignment of its non - retrotransposon section plus 5 nt to the genome , rather than 10 nt .
we also extracted , in silico , 1 kb from the reference genome extending downstream from an aligned non - retrotransposon section and aligned the full read contig against this region with blat and default parameters , to exclude genomic rearrangements ( e.g. , deletions ) involving nearby l1 copies .
rc - seq reads processed in this way were used to determine bulk rc - seq sensitivity , as well as l1-ta enrichment and sequencing depth , with reference to 960 l1-ta copies annotated in hg19 ( evrony et al . , 2012 ) .
sensitivity was also assessed based on how many polymorphic l1-ta insertions were found per sample .
polymorphic l1-ta insertions were called as present in an individual if they met a stringent reporting threshold of having at least 8 rc - seq reads in at least one sample from that individual , were detected in both hippocampus and liver ( or ags-1 fibroblast ) from that individual , and the read count for at least one sample from that individual exceeded > 0.1x the max number of reads in any bulk rc - seq library . l1
insertions found only in one bulk hippocampus library by 1 rc - seq reads , and absent from any bulk liver rc - seq library or previous publications ( ewing and kazazian , 2010 , 2011 ; iskow et al . , 2010 ; shukla et al . , 2013 ;
wang et al . , 2006 ) , were annotated as somatic hippocampal insertions .
similarly , a control cohort of 175 liver - only l1 insertions were annotated as for hippocampal insertions , instead with a reporting threshold of 4 rc - seq reads intended to detect possible somatic l1 mobilization events early in liver organogenesis .
notably , the bulk hippocampus rc - seq libraries detected 97.7% of reference genome l1-ta copies on average ( table s1 ) , indicating that these annotated liver - only l1 insertions were very unlikely to be mis - annotated polymorphic l1 insertions .
nine single - cell rc - seq pools ( ctrl-36 , ctrl-42 , ctrl-45 , ctrl-55 and ags-1 hippocampal neurons ; ctrl-42 , ctrl-45 and ctrl-55 hippocampal glia ; ctrl-42 , ctrl-45 and ctrl-55 cortical neurons ) were illumina sequenced , generating a total of 3,494,481,909 2x150-mer read pairs ( table s1 ) . computational analysis then proceeded using the method outlined above for bulk rc - seq , with additional filtering of reads pre- and post - clustering to remove potential artifacts generated by wga and illumina library preparation .
pre - clustering , each read was re - aligned to hg19 using blast ( parameters -m 8 -a 4 -f f , minimum score 22 ) to find the corresponding best alignments for the non - retrotransposon and retrotransposon segments , genome - wide . reads corresponding to a 5 l1-genome junction involving an overlap of non - retrotransposon and retrotransposon segments of > 2 bp , or a 3 l1-genome junction with an overlap of > 10 bp , were removed as putative chimeras .
reads corresponding to 3 l1-genome junction with a non - retrotransposon / retrotransposon segment overlap of 610 bp were removed if the proportion of adenosine nucleotides in this overlap was < 50% .
removal of chimeric reads at 3 l1-genome junctions was complicated by the priming of l1 reverse transcription typically requiring hybridization in vivo of the l1 polya - tail with genomic thymine residues proximal to a site nicked by the l1 en domain ( feng et al . , 1996 ; jurka , 1997 ; luan et al . , 1993 ) ,
the known location of the rc - seq lna probes , and a known library insert size , allowed us to remove reads indicating 5 l1-genome junctions > 40 nt and < 5,700 nt , or > 5,930 nt , away from the l1-ta 5 end as probable artifacts . reads indicating truncations of > 5 nt from the l1-ta 3 end
were removed , as a polya - tail is an established feature of most retrotransposition - competent l1 copies ( moran et al . , 1996 ) .
prospective l1 3 transduced regions were also required to terminate with a polya - tail of at least 10 bp and 50% adenosine .
any reads where the retrotransposon segment aligned within 5 kb of the non - retrotransposon segment on the genome were also removed , to filter out potential wga artifacts involving the formation of loops between reference l1-ta copies and nearby regions of microhomology .
post - filtering , clusters overlapping a repeatmasker annotated primate - specific l1 insertion ( l1h and l1p ) or an alu were also removed , due to expected difficulty in validating these events , and their high potential to generate wga artifacts .
polymorphic and somatic l1 insertions were annotated as for bulk rc - seq , with 1 single - cell rc - seq reads required to annotate the latter category .
we assessed the sensitivity of single - cell rc - seq by selecting polymorphic insertions detected by at least 40 reads in the corresponding bulk rc - seq , representing a cohort of gold - standard variants likely to approximate a true positive rate of 100% based on prior experiments ( shukla et al . , 2013 ) , and determined how many of these polymorphic insertions were detected in the corresponding single - cell libraries .
thus , using detection of polymorphic l1 insertions as a measure of sensitivity for detection of somatic l1 insertions may underestimate somatic retrotransposition .
twenty somatic l1 insertions detected by single - cell rc - seq at a 3 l1-genome junction were selected at random for validation and structural elucidation ( tables s2 and data s1 ) , each requiring resolution of the corresponding 5 l1-genome junction by insertion site pcr and sequencing .
insertion site primers , as denoted by an symbol in figure 3 and listed in table s2 , were first designed by primer3 , or by hand where a primer was not initially identified within 200 bp of the integration site .
as the extent of l1 5 truncation was unknown , primers oriented antisense to l1 ( denoted by a symbol in figure 3 ) were designed approximately every 500 bp through l1-ta .
pcrs were performed using invitrogen platinum taq dna polymerase high fidelity with the following conditions : 1x high fidelity pcr buffer , 2 mm mgso4 , 0.2 mm dntps , 0.2 m primers , 7.5u polymerase and 10 ng template dna .
thermal cycling was performed as follows : initial denaturation at 94c for 3 min , then 27 cycles of 94c for 30 sec , 57c for 30 sec , 68c for 30 sec , followed by final extension at 68c for 10 min , then hold at 10c .
pcr products were quantified using a qubit hs dsdna kit following the manufacturer s protocol .
amplicons were then combined in equimolar ratios to give 500 ng of pooled dna .
illumina libraries were then prepared using the nebnext ultra library preparation kit with the following modifications : an initial size selection was performed using 1:0.6 then 1:3 sample to ampure xp bead ratios .
reads were then interrogated using custom python scripts to identify sequences corresponding to a full - length or truncated l1 5 end and also aligning to one of the 20 putative integration sites .
5 l1-genome junctions identified in this manner were then validated by pcr followed by standard agarose gel electrophoresis using the same amplification conditions as described above . in some instances ,
nested primers were required , and nested pcr was performed using 27 cycles , then 35 cycles of amplification .
ten l1 insertions detected only at a 5 l1-genome junction were also tested , although as we have previously encountered ( baillie et al . , 2011 ) ,
pcr amplification of the corresponding 3 l1-genome junction was extremely challenging , and none of these examples were confirmed ( table s2 ) .
four l1 insertions detected at both their 5 and 3 ends were however confirmed by pcr ( table s2 ) .
polymorphic l1 insertions detected at their 3 l1-genome junction by single - cell rc - seq from ctrl-42 , ctrl-45 and ctrl-55 ( four l1s from each individual ) were confirmed as heterozygous by empty / filled site pcr using template bulk hippocampus dna ( table s2 ) .
pcr involved the following reagents : 1u mytaq dna polymerase ( bioline , australia ) , 1x mytaq reaction buffer , 2 m primers and 10 ng template dna .
thermal cycling was performed as follows : initial denaturation at 95c for 1 min , then 35 cycles of 95c for 30 sec , 57c for 15 sec , 72c for 10 sec , followed by final extension at 72c for 10 min , then hold at 10c .
insertion site and l1 primers were then combined to amplify the 5 l1-genome junction for each heterozygous l1 again using bulk hippocampus dna as template and the same reagent mixture and cycling conditions as for the empty / filled site assay above .
once the 5 l1-genome junctions were confirmed , targets were re - amplified using the wga material from 8 randomly selected neurons for each insertion where the 3 l1-genome junction was already identified by single - cell rc - seq . for this pcr , we used the following reagent mixture : 1u mytaq dna polymerase , 1x mytaq reaction buffer , 2 m primers and 50 ng wga template dna .
thermal cycling was performed as follows : initial denaturation at 95c for 1 min , then 37 cycles of 95c for 30 sec , 57c for 15 sec , 72c for 10 sec , followed by final extension at 72c for 10 min , then hold at 10c .
twelve heterozygous polymorphic l1s were analyzed across 100 neurons in total , with a 5 l1-genome junction found in exactly 50 instances ( table s2 ) , indicating that the maximum possible estimated validation rate with tsds was 50% .
1 g dna from each hippocampus sample was run on a 0.7% agarose gel .
bands 10 kb in size were selected by excision to exclude any possible l1 cdna and subjected to gel purification using a qiagen gel purification kit ( # 28606 ) .
this high molecular weight genomic dna was then used as input for qpcr , using the orf2 # 1 combination first used to assay l1 cnv by coufal et al .
( coufal et al . , 2009 ) , with -satellite repetitive elements ( sata ) as an immobile control . incorporating minor modifications made by baillie
( baillie et al . , 2011 ) , experiments were performed using roche taqman master mix ( # 04707494001 ) and run on a lightcycler 480 ( roche ) .
the ratio of l1 orf2 to sata in each hippocampal dna sample was finally normalized to the signal for ctrl-36 . to determine whether somatic l1 insertions were enriched in genes differentially expressed in the same spatiotemporal context , we downloaded single - molecule cage data published by fantom5 ( forrest et al . , 2014 ) ,
including hippocampus , caudate nucleus , frontal cortex , liver , and heart cage experiments .
cage tag clusters within 1 kb of , and on the same strand as , the annotated 5 end of refseq genes ( available from the ucsc table browser ) were used to compile a table of expression for each gene , with expression normalized to tags - per - million .
pairwise comparisons were then performed between each tissue ( as displayed in figure 7a ) to identify genes differentially upregulated in each tissue .
differential expression was defined by edger ( robinson et al . , 2010 ) , using an exact negative binomial test with bonferroni correction .
overexpressed genes were ranked by p - value , with the most significant 5% of genes selected as a differentially expressed cohort in each pairwise comparison . for each list , we then calculated enrichment for somatic l1 insertions versus what proportion of insertions were expected based on a random selection of 1x10 genomic points .
significance testing involved two - tailed fisher s exact tests , with benjamini - hochberg correction . to assess
whether somatic l1 insertions were enriched in enhancer elements , we first downloaded .bed tracks for robust and permissive bidirectionally transcribed enhancers defined by fantom5 ( andersson et al . , 2014 ) , as well as 47 .bed tracks for cell - type specific enhancer elements .
we then intersected the genomic coordinates of l1 insertions with those of each enhancer class , requiring an l1 insertion to be within 100 nt of an enhancer to record an intersection , as for figure 7c . in figure 7d , this window was extended to assess how l1 insertion frequency progressively decreased as the distance to the nearest nsc - specific enhancer increased .
observed values were compared with values expected from random sampling using two - tailed fisher s exact tests with bonferroni correction .
single - neuron l1 insertion profiling ( l1-ip ) reads were downloaded , trimmed , and then aligned as per evrony et al .
( langmead et al . , 2009 ) . reads less than 500 bp apart and on the same strand were clustered into peaks containing a minimum of a single read and annotated using the repeatmasker track from human genome build hg19 and locations of known non - reference elements .
peaks with consistent orientations and overlapping locations 500 bp were merged , and counts were summed across samples using bedtools version 2.20.1 - 4-gb877b35 .
| summarysomatic line-1 ( l1 ) retrotransposition during neurogenesis is a potential source of genotypic variation among neurons . as a neurogenic niche ,
the hippocampus supports pronounced l1 activity .
however , the basal parameters and biological impact of l1-driven mosaicism remain unclear . here , we performed single - cell retrotransposon capture sequencing ( rc - seq ) on individual human hippocampal neurons and glia , as well as cortical neurons .
an estimated 13.7 somatic l1 insertions occurred per hippocampal neuron and carried the sequence hallmarks of target - primed reverse transcription .
notably , hippocampal neuron l1 insertions were specifically enriched in transcribed neuronal stem cell enhancers and hippocampus genes , increasing their probability of functional relevance .
in addition , bias against intronic l1 insertions sense oriented relative to their host gene was observed , perhaps indicating moderate selection against this configuration in vivo .
these experiments demonstrate pervasive l1 mosaicism at genomic loci expressed in hippocampal neurons . |
alzheimer 's disease ( ad ) is characterized by progressive cognitive , functional , and behavioral impairment , which evolves into a dramatic loss of most cortical and subcortical functions and , ultimately , death .
demographic changes and the rise in life expectancy have resulted in the growth recorded in the number of individuals affected by ad .
it is forecast that the worldwide number of elderly people suffering from dementia will rise to 63 million in 2030 and to 114 million in 2050 .
the socioeconomic impact associated with the global ad burden that can not be estimated raises the need to find preventive and palliative means of treatment for sufferers .
deficiency of the neurotransmitter acetylcholine at the synaptic cleft coupled with cholinergic decline in the hippocampal and cortical regions of the brain is associated with cognitive decline observed in ad , a situation which is further aggravated by deposition of amyloid proteins observed in senile plaques in the extracellular matrix of the brain .
there is evidence that cholinesterase inhibitors ( cheis ) may slow disease progression and hippocampal atrophy and may have disease - modifying effects .
furthermore , treatments with cheis have been found to have a positive correlation with improved cognitive abilities with modest and significant therapeutic effects .
thus , restoring the level of acetylcholine through inhibition of both major forms of cholinesterases , acetylcholinesterase ( ache ) , and butyrylcholinesterase ( buche ) is considered to be a useful therapeutic approach [ 7 , 8 ] .
while all approved cheis ( donepezil , rivastigmine , and galantamine ) inhibit both forms of cholinesterases , however , continued search among natural products has intensified due to adverse side effects associated with these drugs .
furthermore , the mammalian brain is particularly sensitive towards oxidative damage , a result of the high oxygen demand and the high content of unsaturated lipids in the central nervous system coupled with the reduced access to the antioxidant defense system and the high amount of redox - active transition metal ions [ 10 , 11 ] .
oxidative stress in the central nervous system is an underlying cause of neurodegeneration and neural dysfunction .
this has resulted in considerable research efforts being put towards reducing the risks and event of oxidative stress with the use of antioxidants .
peppers ( capsicum spp . ) , a genus of related plants , belong to the family solanaceae and have a worldwide distribution .
they are important as vegetable foods and spice and are considered an important source of nutrients in the human diet which are grown in tropical , subtropical , and temperate regions [ 1315 ] .
various species and varieties occurring within the capsicum genus depending on their shape , size , flavor , and hotness include capsicum annum , capsicum frutescence , and capsicum chinense .
previous studies [ 16 , 17 ] have highlighted some of the health benefits associated with the consumption of capsicum spp . therefore , this study sought to assess the ability of pepper fruits to interact with some enzymes ( acetylcholinesterase and butyrylcholinesterase ) which are implicated in ad pathology vis - - vis the antioxidant capacity of the pepper fruits .
accuminatum ) and ata rodo ( capsicum chinense ) were collected from farm settlements around akure metropolis , nigeria .
authentication of the samples was carried out at the department of biology , federal university of technology , akure , nigeria .
the samples were washed and homogenized in distilled water ( 1 : 20 w / v ) .
these were later centrifuged at 4000 rpm for five minutes , and the supernatant was collected which was stored at 4c until further analysis .
chemicals and reagents used such as thiobarbituric acid ( tba ) , 1,10-phenanthroline , deoxyribose , gallic acid , and folin - ciocalteau 's reagent were procured from sigma - aldrich , inc .
( st louis , mo ) , trichloroacetic acid ( tca ) was sourced from sigma - aldrich , chemie gmbh ( steinheim , germany ) , dinitrophenylhydrazine ( dnph ) was sourced from acros organics ( new jersey , usa ) , and hydrogen peroxide , methanol , acetic acid , thiourea , cuso45h2o , h2so4 , hcl , sodium carbonate , alcl3 , potassium acetate , tris - hcl buffer , sodium dodecyl sulphate , feso4 , potassium ferricyanide , and ferric chloride were sourced from bdh chemicals ltd .
approval was obtained from the relevant departmental ethics committee responsible for the use of laboratory animals .
the handling and the use of the animals were in accordance with nih guide for the care and use of laboratory animals .
adult male wistar strain albino rats were purchased from the department of biochemistry , university of ilorin .
all animals were given ad libitum access to commercial diet and maintained on a 12 h light / dark cycle .
all ethical standards regarding the use of animals in experimental procedures were strictly adhered to .
the total phenol content was determined according to the method of singleton et al . .
briefly , appropriate dilutions of the aqueous extracts were oxidized with 2.5 ml 10% folin - ciocalteau 's reagent ( v / v ) and neutralized by 2.0 ml of 7.5% sodium carbonate .
the reaction mixture was incubated for 40 min at 45c and the absorbance was measured at 765 nm in the jenway uv - visible spectrophotometer .
2,2
-azino - bis(3-ethylbenzthiazoline-6-sulphonic acid ) ( abts ) radical scavenging ability .
the abts scavenging ability of the extracts was determined according to the method described by re et al . .
the abts was generated by reacting an ( 7 mmol / l ) abts aqueous solution with k2s2o8 ( 2.45 mmol / l , final concentration ) in the dark for 16 h and adjusting the absorbance at 734 nm to 0.700 with ethanol .
0.2 ml of appropriate dilution of the extract was added to 2.0 ml abts solution and the absorbance was measured at 734 nm after 15 min in the jenway uv - visible spectrophotometer .
the reducing property of the extracts was determined by assessing the ability of the extract to reduce fecl3 solution as described by oyaizu .
2.5 ml aliquot was mixed with 2.5 ml 200 mm sodium phosphate buffer ( ph 6.6 ) and 2.5 ml 1% potassium ferricyanide .
the mixture was incubated at 50c for 20 min , and then 2.5 ml 10% trichloroacetic acid was added .
. 5 ml of the supernatant was mixed with an equal volume of water and 1 ml 0.1% ferric chloride .
the absorbance was measured at 700 nm in the jenway uv - visible spectrophotometer .
the rats were decapitated under mild diethyl ether anaesthetic conditions and the whole brain tissue was quickly isolated and placed on ice and weighed .
the tissue was subsequently homogenized in cold saline ( 1/10 w / v ) with about 10 up - and - down strokes at approximately 1200 rev / min in a teflon glass homogenizer .
the homogenates were centrifuged for 10 min at 3000 rpm to yield pellets that were discarded , and a low - speed supernatant ( s1 ) fraction was kept for lipid peroxidation assay .
the lipid peroxidation assay was carried out using the modified method of ohkawa et al . .
briefly 100 l s1 fraction was mixed with a reaction mixture containing 30 l of 0.1 m ph 7.4 tris - hcl buffer extract ( 0100 l ) and 30 l of 250 m freshly prepared feso4 ( the procedure was also carried out using 5 mm sodium nitroprusside and 15 mm quinolinic acid ) .
the volume was made up to 300 l by water before incubation at 37c for 1 h. the colour reaction was developed by adding 300 l 8.1% sodium dodecyl sulphate ( sds ) to the reaction mixture containing s1 , and this was subsequently followed by the addition of 500 l of acetic acid / hcl ( ph 3.4 ) mixture and 500 l 0.8% thiobarbituric acid ( tba ) .
this mixture was incubated at 100c for 1 h. thiobarbituric acid reactive species ( tbars ) produced were measured at 532 nm in the jenway uv - visible spectrophotometer and the absorbance was compared with that of standard curve using malondialdehyde ( mda ) .
the ache inhibitory activity was determined according to the method of ellman et al . in a reaction mixture containing 200 l of ache solution in 0.1 m phosphate buffer , ph 8.0 , 100 l of a solution of 5,5-dithiobis-(2-nitrobenzoic ) acid ( 3.3 mm dtnb in 0.1
m phosphate buffered solution , ph 7.0 , containing 6 mm nahco3 ) , 100 l of a solution of the inhibitor , and 500 l of phosphate buffer , ph 8.0 .
after incubation for 20 min at 25c , 0.05 mm of acetylthiocholine iodide ( 100 l ) was added as the substrate , and ache activity was determined by uv - visible spectrophotometer from the absorbance changes at 412 nm for 3 min at 25c .
100 l of 0.05 mm butyrylthiocholine iodide was used as a substrate to assay buche enzyme activity while all the other reagents and conditions were the same .
the results of the three replicates were pooled and expressed as mean standard deviation ( std ) . a two - way analysis of variance ( anova ) and the least significant difference ( lsd ) were also determined .
the results for the total phenol content of the aqueous extract of ripe and unripe fruits of capsicum annuum var .
accuminatum ( sm ) and capsicum chinense ( ro ) are presented in table 1 .
there was no significant difference ( p > 0.05 ) in the total phenol contents of the unripe ( sm ( 14.09 mg / g ) ; ro ( 14.17 mg / g ) ) and ripe ( sm ( 13.28 mg / g ) ; ro ( 13.66 mg / g ) ) capsicum spp . extracts .
the abts scavenging ability reported as trolox equivalent antioxidant capacity ( teac ) is presented in figure 1 .
there was no significant difference ( p > 0.05 ) in the scavenging ability of the ripe and unripe sm samples , while unripe ro extracts showed a significantly higher ( p < 0.05 ) scavenging ability than the ripe .
the ferric reducing ability of the aqueous extracts reported as ascorbic acid equivalent as presented in figure 2 revealed that the ripe sm and ro extracts had significantly higher ( p < 0.05 ) ferric reducing properties than the unripe extracts of the two varieties .
incubation of rats ' brain homogenate with 25 m fe resulted in a significant ( p < 0.05 ) increase in brain mda content ( 122.80% ) as presented in figure 3(a ) .
varieties were able to significantly ( p < 0.05 ) lower the brain mda content in a dose - dependent manner in the concentration range of 0.78 mg / ml3.13 mg / ml . the unripe sm extracts ( 3.43 mg / ml ) had higher inhibitory ability than the ripe extracts ( 3.63 mg / ml ) , while the ripe ro extracts ( 3.07 mg / ml ) had higher inhibitory effect than the unripe ( 3.92 mg / ml ) ( table 2 ) .
furthermore , the ability of the aqueous extract from pepper fruits to inhibit quinolinic acid ( qa ) induced lipid peroxidation was assessed and presented in figure 3(b ) .
incubation of rats brain homogenate with qa resulted in a significant ( p < 0.05 ) increase in brain mda content ( 256.67% ) .
aqueous extracts from the capsicum spp . were also able to significantly ( p < 0.05 ) lower the brain mda content in dose - dependent manner .
table 2 revealed that the ripe samples ( sm ( 4.87 mg / ml ) ; ro ( 4.70 mg / ml ) ) had significantly higher inhibitory effect than the unripe samples ( sm ( 5.70 mg / ml ) ; ro ( 7.24 mg / ml ) ) .
the cholinesterase inhibitory activities of the pepper samples are presented in figures 4 and 5 and table 3 .
ripe ( 3.27 mg / ml ) and unripe ( 3.19 mg / ml ) samples from sm had significantly higher ache inhibitory abilities than ro ( ripe ( 3.72 mg / ml ) ; unripe ( 4.27 mg / ml ) ) samples , while there was no significant difference in the buche inhibitory abilities of the unripe ( sm ( 3.01 mg / ml ) ; ro ( 3.19 mg / ml ) ) and ripe ( sm ( 3.22 mg / ml ) ; ro ( 3.38 mg / ml ) ) .
oxidative damage caused by free radicals has been implicated in the development of neurodegenerative conditions [ 24 , 25 ] .
antioxidant capacity of the ripe and unripe pepper varieties was studied using a moderately stable nitrogen - centered radical species - abts radical [ 19 re ] .
the abts scavenging properties of the extracts show their ability to prevent the initiation of oxidation chain reaction that ensues upon free radical generation . furthermore the extracts were also able to reduce fe to fe which is indicative of the reducing power of the extracts
. the reversed reaction , which is the oxidation of fe to fe , is a process by which iron can induce hydroxyl radicals generation in fenton reaction .
the antioxidant properties of the pepper extracts could be linked to their phenolic content as the correlation between phenolic content and antioxidative properties has been established in studies involving a wide range of fruits and vegetables [ 2931 ] .
the antioxidant effects of phenolic compounds are attributed to the redox properties of their hydroxy groups achieved through several mechanisms including the scavenging of free radicals , chelation of transition metals serving as prooxidants , activation of antioxidant enzymes , and inhibition of oxidases [ 32 , 33 ] .
the higher phenolic content of the unripe capsicum spp . under study may suggest that there could be a decline in the phenolics synthesis with the event of ripening .
evidence for the contribution of lipid peroxidation in the brain to the development of neurodegenerative conditions has been found in postmortem brain tissue and patients suffering from alzheimer 's disease .
the high amount of polyunsaturated fatty acids and low antioxidant contents of the brain makes it susceptible to lipid peroxidation .
lipid peroxidation is associated with loss of membrane fluidity and increase in permeability ultimately resulting in loss of membrane structure and function . the increase in mda content in the rat brain
homogenates incubated with fe could be as result of the generation of hydroxy radicals generated from fenton reaction .
the decrease in brain mda content by capsicum spp . may be due to their ability to scavenge the hydroxyl radicals so generated .
quinolinic acid ( qa ) had been reported to activate neurons expressing nmda receptors and glutamate - type excitotoxicity .
the mechanism through which qa induces lipid peroxidation has been linked to free radical generation resulting from overstimulation of nmda receptors .
increases in qa concentration are known to be associated with several neurodegenerative diseases including alzheimer 's disease .
free radical scavengers and antioxidant enzyme inducers can protect neuronal tissue against the oxidotoxicity of qa under in vitro and in vivo conditions [ 38 , 39 ] .
thus the mechanism by which extracts from the capsicum spp . were able to lower the increased generation of mda in brain tissues could have been through scavenging of free radicals implicated in the overstimulation of nmda receptors .
so far , inhibition of cholinesterases has proven to be the most effective approach in clinical management of ad .
acetylcholinesterase ( ache ) and butyrylcholinesterase ( buche ) are the two cholinesterases present in the brain with acetylcholinesterase being the most dominant making up about 80% while the remaining 20% represents butyrylcholinesterase .
acetylcholine , a neuronal signaling molecule , is found to be depleted in ad brain and has been linked to decline in cognitive function observed in ad sufferers ; hence acetylcholinesterase inhibitors ( achei ) have become important in the regulation of ache and prolonging the acetylcholine levels at the synaptic clefts .
the ache inhibition by the pepper extracts used in this study agrees with previous studies where some plants and their products were found useful as acetylcholinesterase inhibitors ( achei ) , some of which include ginkgo biloba and quisqualis indica linn .
furthermore , inhibition of buche is also considered as a therapeutic strategy , in the ad brain , as it has been implicated in the aggregation of amyloid beta peptides associated with neurodegenerative processes and observed clinical dementia .
the ratio of buche to ache changes drastically from about 0.5 to as high as 11 .
this increase in buche and decline in ache suggest that buche could be a more important therapeutic target .
it is therefore noteworthy that the extracts showed a higher inhibition for buche than ache .
this study has shown that aqueous extract from capsicum spp . have strong antioxidant capacity .
the ripe fruits however displayed a more potent antioxidant capacity compared to their unripe counterparts .
furthermore , these extracts were also able to inhibit the two cholinesterases linked to ad .
this is indicative of possible nutritional strength of capsicum spp . as a possible dietary source of palliative / preventive targets for ad | background . this study sought to investigate antioxidant capacity of aqueous extracts of two pepper varieties ( capsicum annuum var .
accuminatum ( sm ) and capsicum chinense ( ro ) ) and their inhibitory effect on acetylcholinesterase and butyrylcholinesterase activities . methods .
the antioxidant capacity of the peppers was evaluated by the 2,2-azino - bis(3-ethylbenzthiazoline-6-sulphonic acid ) ( abts ) radical scavenging ability and ferric reducing antioxidant property .
the inhibition of prooxidant induced lipid peroxidation and cholinesterase activities in rat brain homogenates was also evaluated . results .
there was no significant difference ( p > 0.05 ) in the total phenol contents of the unripe and ripe capsicum spp .
extracts .
ripe and unripe sm samples had significantly higher ( p < 0.05 ) abts * scavenging ability than ro samples , while the ripe fruits had significantly higher ( p < 0.05 ) ferric reducing properties in the varieties . furthermore , the extracts inhibited fe2 + and quinolinic acid induced lipid peroxidation in rats brain homogenates in a dose - dependent manner .
ripe and unripe samples from sm had significantly higher ache inhibitory abilities than ro samples , while there was no significant difference in the buche inhibitory abilities of the pepper samples .
conclusion .
the antioxidant and anticholinesterase properties of capsicum spp . may be a possible dietary means by which oxidative stress and symptomatic cognitive decline associated with neurodegenerative conditions could be alleviated . |
in this work ,
we demonstrate
the concept of a sers - nanoreactor cluster using the capability of
cb[n ] vessels to bind aunps creating
precisely separated hot - spot nanojunctions for sensitive sers .
the
cb[n ] sequesters reactants in its internal cavity
and their optimal location within these sers - active cluster nanojunctions
enables photochemical reactions in the cavity to be tracked both in
situ and in real - time . through choice of the smaller and larger homologues
cb and cb ,
respectively , the internal volume of the cb[n ] nanoreactors allows us to obtain direct evidence for
photoisomerization and photodimerization using sers .
in addition ,
we are able to exploit the sers - nanoreactor motif to explore the role
of ph on das cb host guest complexation and resultant
photoreactions .
the flexibility and versatility of the sers - nanoreactor
concept is likely to provide great utility for studying and quantifying
different chemical reactions that complex with cb[n ] and possess distinct raman spectra . | we demonstrate a powerful sers - nanoreactor
concept composed of
self - assembled gold nanoparticles ( aunp ) linked by the sub - nm macrocycle
cucurbit[n]uril ( cb[n ] ) .
the cb[n ] functions simultaneously as a nanoscale reaction vessel ,
sequestering and templating a photoreaction within , and also as a
powerful sers - transducer through the large field enhancements generated
within the nanojunctions that cb[n]s define . through
the enhanced raman fingerprint
, the real - time sers - monitoring of a
prototypical stilbene photoreaction is demonstrated . by choosing the
appropriate cb[n ] nanoreactor ,
selective photoisomerism
or photodimerization is monitored in situ from within the aunp - cb[n ] nanogap . |
the words " chemical and biological weapons " ( cbw ) send a shiver down most spines these days . with the end of the cold war ,
the possibility of a massive nuclear confrontation appears remote , so today many popular doomsday scenarios center on the aggressive use of chemical or biological warfare by rogue nations or terrorist groups . as exaggerated as some of the accounts are , with cbw cast as the latest unseen , unstoppable enemy
, the threat posed by these weapons is all too real , and growing.imagesp931-a |
|
kikuchi disease ( kd ) ( also known as kikuchi fujimoto disease , necrotizing histiocytic lymphadenopathy ) is an uncommon , benign , enigmatous , self - limiting , rarely fatal , disease of young caucasian females , presenting with firm , tender , unilateral cervical lymphadenopathy .
kikuchi , and fujimoto et al . reported it , independently , almost simultaneously , in 1972 from japan .
etiology is not completely understood / controversial ; however , mainly viral origin ( ebv , hhv 6 and 8) and autoimmune mechanisms have been suggested .
strong association has been found with systemic lupus erythematosus ( sle ) , mixed connective tissue disorders and leaking silicone breast - implants .
the technique of fine - needle aspiration cytology ( fnac ) in good hands with a keen eye on clinical examination shall give a reliable diagnosis in most cases , thus it obviates the need for excision .
a 27-year - old female presented to the physician with a two - week history of rigors , night sweats , right axillary tenderness and 3.5-kg weight loss .
she denied any previous medical history , regular medications , cigarette or alcohol use , foreign travel or infectious contacts .
physical examination revealed pyrexia ( temperature 38.8c ) and a tender , palpable left cervical lymph node .
laboratory investigations and examination of the blood film revealed pancytopenia with normocytic red cell indices ( hb 8.2 g / dl ; mcv 93.2 fl ) ; and a relative lymphopenia .
erythrocyte sedimentation rate ( esr ) was 88 mm fall at the end of first hour and c - reactive protein was 29
fine - needle aspiration cytology ( fnac ) showed crescentic histiocytes , plasmacytoid monocytes , extracellular ( karyorrhectic ) debris and necrosis and a diagnosis of kikuchi 's disease was made on cytological examination [ figures 1 , 2 and 3a , b ] .
kikuchi disease : fnac smear showing crescentic histiocytes , plasmacytoid monocytes and extracellular ( karyorrhectic ) debris ( h and e , 400 ) kikuchi disease : fnac smear showing predominately crescentic histiocytes , plasmacytoid monocytes and extracellular ( karyorrhectic ) debris ( h and e , 400 ) ( a ) shows plasmacytoid monocytes in the background of necrosis surrounded by karyorrhectic debris , ( b ) shows a characteristic crescentic histiocyte on the insistence of clinician , to further confirm the diagnosis , a lymph node biopsy was performed , which demonstrated focal necrosis surrounded by karyorrhectic debris , histiocytes and plasmacytoid lymphocytes [ figure 4 ] .
kikuchi disease : histopathologic section showing focal necrosis surrounded by karyorrhectic debris , histiocytes and plasmacytoid lymphocytes ( h and e , 400 ) the patient made a full recovery after 21 days of supportive care .
kikuchi disease is an uncommon , benign , rarely fatal , disease , reported independently , almost simultaneously , by kikuchi and fujimoto et al . , in the year 1972 from japan.initially , bacterial agents , such as yersinia , bartonella and protozoan toxoplasma were thought to cause the disease , recently atypical mycobacterium szulgi has been isolated from thailand , brucella has also been reported .
systemic lupus erythematosus ( sle ) shows the strongest association , among autoimmune disorders with kd , and it has been seen that 33% of pre or post - sle adenitis is true kd .
lab evaluation for kd reveals nonspecific findings including lymphopenia , neutropenia , with atypical lymphocytes , anemia , raised esr , elevated levels of serum lactogen dehydrogenase ( ldh ) and transaminases .
radiological investigation including computed tomography ( ct ) , ultrasonography and magnetic resonance imaging scan give nonspecific findings ; ct scan reveals enlarged nodes on an average 15 mm and radiological impression overlapping with findings of malignant lymphoma , thus necessitating the role of pathological investigations , including fnac and excision biopsy . although excisional biopsy , revealing effaced architecture , islands of hyperplasia and zonal necrosis , gives an accurate diagnosis , fnac on the other hand , can give firm diagnosis in majority of cases , un - necessitating the need for excisional biopsy , and since medical treatment with corticosteroids gives good results , the need for surgical excision is obviated .
fine - needle aspiration cytology of kd reveals abundant crescentic histiocytes , plasmacytoid monocytes , variable lymphocytes , along with abundant karyorrhectic debris ; neutrophils are characteristically absent and plasma cells are scarce / absent .
fine - needle aspiration cytology in patients with typical clinical presentation diagnoses the disease without much difficulty , overall accuracy being around 57% .
recent studies have indicated that complementing fnac with immunocytochemical evaluation of the aspirate can increase the diagnostic accuracy to around 8590% . according to kuo , cell types
isolated might vary with the stage of disease ; crescentic histiocytes , plasmacytoid monocytes and atypical lymphocytes , along with karyorrhectic debris in proliferative stage ; eosinophilic necrosis , karyorrhectic debris , variable lymphoid cells abundant histocytes and plasmacytoid monocytes in necrotizing adenitis ; minimal or no necrosis along with karyorrhectic debris and foamy histiocytes in xanthomatous stage .
necrotizing stage accounts for the most of the cases diagnosed , thus the synonym , necrotizing histiocytic lymphadenitis .
karyorrhexis is one of the exclusive features of kikuchi fujimoto disease , and the process might explode into the peri - nodal areas as well .
fine - needle aspiration cytology , if necessary , should be repeated to increase the diagnostic outcome , thus increasing the potential of procedure .
it has been said ; however , that surgical biopsy would be unnecessary if using fnac could make a firm diagnosis .
thus , results from two studies including histologic sections and excisional biopsy specimens led to the conclusion that in patients with typical clinical features and characteristic cytologic findings in lymph node aspirates , fnac alone would suffice for diagnosing kd . currently , immunostaining studies including immunocytochemical staining is been carried - out , to zero on the diagnosis , and it has been found that there is proliferation of cd8 + cells in the lesions , which initiate a killer / chemotactic mechanism responsible for apoptotic sand in the lesions .
transmission electron microscopy has revealed apoptotic changes in nuclear membrane , such as thickening of nuclear membrane , apoptotic bodies and finger - like network of apoptotic process in most of the cases .
treatment of the disease like etiology is also enigmatic ; various drug therapies ranging from antibiotics , non - steroidal anti - inflammatory drugs ( nsaids ) and corticosteroids have been used , nevertheless , steroids are mainstream , and show a good response .
surgical treatment involves excision of nodes , which is the only treatment for recurring disease .
the following diseases should line up as differentials : ( 1 ) malignant lymphoma : it can masquerade kd both radiologically and pathologically , thus a diagnosis should be given with caution .
( 2 ) nodal metastasis of adenocarcinoma : signet cells with mucus , are present in place of karyorrhectic material .
( 3 ) kawasaki disease : in which the necrosis is geographic and neutrophilic infiltrate is present . ( 4 )
nodal extension of aml : variable lymphocytic population without histiocytes is present . ( 5 ) infectious adenitis : typically atypical mycobacteria might present like kikuchi disease . keeping in view the above discussion , it is clear that fnac has a greater role in the diagnosis of kd , it is able to diagnose firmly in most of the cases , repeating the procedure shall further increase diagnostic outcome , thus decreasing the need for unnecessary excisional biopsy ; however , excision may be the only choice in recurring disease . with good hands at aspiration and
keen eyes atop the lens , the procedure shall make out a firm diagnosis of kd . | kikuchi disease ( kd ) is an enigmatous , self - limiting , rarely fatal , disease of young females .
the self - limiting disorder usually occurs in asian women in their late 20s or early 30s .
typically it runs a benign course and appears to resolve spontaneously one to six months after definitive diagnosis .
we report a 27 years old lady presenting with cervical lymphadenopathy .
fine needle aspiration cytology of the node clinched the diagnosis revealing crescentic histiocytes , plasmacytoid monocytes , extracellular ( karyorrhectic ) debris and necrosis .
the diagnosis was subsequently confirmed by histopathology . |
supplementary material is available for this article at 10.1007/s13659 - 013 - 0026 - 7 and is accessible for authorized users .
| chemical investigation of the whole plants of phyllanthus cochinchinensis ( euphorbiaceae ) led to the isolation of five new sucrose benzoyl esters , 3,6-di - o - benzoylsucrose ( 1 ) , 3,6-di - o - benzoyl-2-o - acetylsucrose ( 2 ) , 3,6-di - o - benzoyl-4-oacetylsucrose ( 3 ) , 3,6-di - o - benzoyl-3-o - acetylsucrose ( 4 ) and 3-o - benzoyl-6-o-(e)-cinnamoylsucrose ( 5 ) , together with two known secoiridoid glycosides , jasminoside ( 6 ) and jaslanceoside b ( 7 ) .
their structures were established on the basis of detailed spectroscopic analysis and chemical method .
electronic supplementary materialsupplementary material is available for this article at 10.1007/s13659 - 013 - 0026 - 7 and is accessible for authorized users . |
glanzmann 's thrombasthenia ( gt ) is an autosomal recessive inherited platelet functional defect characterized by normal platelet count , prolonged bleeding time and abnormal clot retraction .
gt occurs in a small fraction of the population ; however , a high percentage persists in confined geographic areas within certain ethnic groups ( indians , iranians , iraqi jews , french gypsies , palestinians , arabs and jordanian arabs ) in which marriage is practiced among descendants of a common ancestor .
gt is due to severe reduction in or absence of platelet aggregation in response to adenosine 5-diphosphate ( adp ) , epinephrine , collagen , or thrombin because of abnormalities of platelet glycoprotein ( gp ) iib and/or gpiiia .
the iib - iiia gp complex is an integrin receptor for fibrinogen , which helps in platelet aggregation .
such gps form calcium - dependent complexes that change conformation under activation and allow the fibrinogen binding necessary for this aggregation .
the two genes , encoding for gpiib ( itga2b ) and gpiiia ( itgb3 ) are closely associated at chromosome 17q21 .
patients with gt generally present in infancy or early childhood with the clinical complications of lifelong bleeding with easy bruising , gingival bleeding , epistaxis , menorrhagia , and gastrointestinal bleeding .
platelet aggregation in the presence of ristocetin and absence of platelet aggregation in the presence of adp , epinephrine , collagen and thrombin will confirm the diagnosis of gt .
flow cytometry can also be used in gt to detect the presence of the iib - iiia gp complex , gpiib ( cd41 ) , gpiiia ( cd61 ) and fibrinogen using monoclonal antibodies . in this case study , a 22-year - old gt patient who also developed human immunodeficiency virus ( hiv ) infection after sometime is reported .
the importance of early detection , supportive care and communication between the general and oral physician in management of the disease is discussed .
the present case report is about a 22-year - old indian female patient who presented to the department of oral medicine and radiology with the complaints of enlarged , bleeding and bluish discolored gums and burning sensation in the mouth .
enlarged gums were first noticed approximately 4 weeks prior to presentation and progressed since then to the present state .
the burning sensation in the mouth was present since 12 - 16 weeks while taking hot and spicy foods .
the patient 's medical history revealed recurrent episodes of epistaxis since 4 years after birth , recurrent episodes of menorrhagia since the age of 13 years , occasional petechiae over the mouth and lower limbs , gingival bleeding and continuous fatigue . at the age of 20 , she was admitted to the department of general medicine , nizam 's institute of medical sciences , hyderabad , for the treatment of menorrhagia .
a diagnosis of gt was made and multiple blood transfusions were given to control menorrhagia .
patient was discharged after 5 days in stable condition and advised for follow - up every month .
the patient visited a dental clinic at the same time and underwent oral prophylaxis and post oral prophylaxis bleeding was controlled by local application of tranexamic acid paste .
personal history revealed patient was from a low socio - economic background and lack of education .
family history revealed she is the only child from her parent 's non - consanguineous marriage . upon general physical examination ,
patient was of moderate built ; had mild pallor of the skin and multiple ( 8 - 10 ) petechiae on the left lower limb ; and all vital signs were in normal limits except for the increased radial pulse ( 88 beats / min ) .
extra oral examination showed palpable two rights and one left submandibular lymph nodes , all were measuring approximately 1 cm 1 cm , mobile , firm and tender .
intraoral examination showed generalized pallor of the mucosa , two petechiae on the lower labial mucosa and generalized gingival enlargement [ figure 1 ] .
gingiva was blue in color , enlarged , soft to firm in consistency with spontaneous bleeding from the gingival sulcus .
laboratory findings were shown in table 1 and peripheral smear showed red blood cells : microcytic hypochromic and macrocytosis with few late normoblasts , white blood cells : normal limits with no immature forms and platelets : decreased with no hemoparasites . considering the past medical history , clinical examination and laboratory studies the patient was diagnosed as gt associated with gingival hyperplasia , dimorphic anemia and thrombocytopenia .
clinical photograph of glanzmann thrombasthenia patient showing gingival enlargement and two petechiae on the lower labial mucosa laboratory findings of glanzmann thrombasthenia patients at the time of dental visit the patient was referred to department of general medicine , for further evaluation and definitive treatment .
the liver function tests were normal except for the increased total bilirubin levels ( 4.2 mg / dl ) .
tests for hepatitis b , immunoglobulin m and immunoglobulin g for dengue and smear for malaria parasite were negative .
platelet aggregometry ( ristocetin ) test was carried out using labor aggregometer ( bad homburg , germany ) aggregometer , hamburg , vi.2 version and results showed markedly diminished adp , collagen and epinephrine induced and normal ristocetin induced platelet aggregation confirming gt [ figure 2 ] . by considering the past medical history , hematological investigations and platelet aggregometry ( ristocetin ) test , the final diagnosis of gt with pancytopenia was given .
patient was admitted and given intravenous ( iv ) fluids , 40 units of human leukocyte antigen matched platelet transfusions on day 1 , 10 units of ab + whole blood transfusions on day 2 and 40 units of platelet transfusions plus 10 units of whole blood transfusions on day 3 .
the patient 's blood picture was monitored regularly ; there was no improvement in the platelet ( 30,000/cu / mm ) and red cell ( 0.9 million / cu / mm ) counts .
patient developed fever ( 101 f ) and was given oral paracetamol ( 650 mg 3 times daily ) on day 4 .
the next day patient developed cough , vomiting and cutaneous clots and was given iv antibiotic augmentin ( 1.2 g twice daily ) , iv ondansetron ( 2 mg 3 times daily ) , iv ceftriaxone sodium ( 2 g twice daily ) , oral paracetamol ( 650 mg 3 times daily ) and combination of heparin 5000iu and benzyl nicotinate 0.2 g/100 g topical application along with platelet and whole blood transfusions on day 5 and 6 .
patient developed hypoxia secondary to pancytopenia with no response to therapy and expired due to cardio - pulmonary arrest on day 7 .
( b - d ) markedly diminished adenosine 5-diphosphate , collagen and epinephrine induced platelet aggregation
gt is seen relatively high in populations with consanguineous marriages whereas in the present case she is the only child from parent 's non - consanguineous marriage .
george et al . divided the gt patients into three groups based on the platelet fibrinogen content and clot retraction ; type 1 : with <
5% gpiib / iiia and absent clot retraction ; type 2 : with 10 - 20% gpiib / iiia and minimal clot retraction ; and type 3 : a variant form of qualitative platelet defects , with abnormal function despite normal or near - normal levels of gpiib / iiia . the present case is classified as type 2 gt 1 with values of gpiib - iiia was measured between 9.1 and 14.5% respectively .
some clinical observations have shown no correlation between the amounts of platelet gpiib - iiia and the severity of hemorrhage disease .
the present case showed severe clinical symptoms with relatively mild degree of gpiib - iiia deficiency ( type 2 ) . however a report of patients presenting with neonatal purpura had severe gpiib - iiia deficiency ( type 1 ) , so the degree of gpiib - iiia abnormality appears to be related to severity of clinical symptoms .
several authors reported extensive gingival bleeding in gt and used local hemostatic measures to control post - operative hemorrhage .
bleeding is exaggerated due to presence of local irritants in gt patients rather than spontaneous bleeding . in the present case
, there was a bluish colored gingival hyperplasia and no such presentation is presently reported in the literature .
this gingival hyperplasia in the present case could be attributed to exaggeration due to poor oral health .
a single case of gt with hiv infection in 1996 was reported in the english literature from 1956 to 2011 , in which the patient exposed to blood transfusions from 20 donors as supportive treatment for his bleeding episodes who were hiv - negative .
the source of hiv transmission was identified as one of the donor who developed anti - hiv 3 months later , attributing to a large inoculum of hiv virus in the window period of infectivity of the newly infected donor .
the source of hiv transmission could be attributed probably to prior blood transfusions given to control menorrhagia .
hematological abnormalities such as anemia , thrombocytopenia and pancytopenia are commonly observed in hiv infected people . in the present case ,
, epistaxis continues in adulthood and is the most common cause for bleeding of clinical significance . at present
, there is no known cure and has proven to have very good prognosis for gt .
supportive care and platelet transfusions before invasive procedure or in cases of heavy bleeding episodes are critical in management of gt patients . in the present case ,
the clinical significance of recurrent episodes of epistaxis , seen since the age of 4 years and recurrent episodes of menorrhagia , seen since its onset at the age of 13 years was neglected by her parents owing partly to their lack of education and access to healthcare facilities .
diagnosis of gt was made only at the age of 20 years when patient visited the hospital for the management of menorrhagia .
post diagnostic critical supportive care as a part of the gt treatment was not followed .
patient also had continuous fatigue , and pancytopenia . in spite of being referred to critical care unit , patient developed cardio - pulmonary arrest resulting in her death , signifying the importance of early diagnosis and regular supportive care in gt patients .
in this study , a case of delayed diagnosis of gt subsequently complicated by hiv infection after sometime is reported .
the importance of awareness , early detection and appropriate supportive care in the management and prognosis of gt is discussed . | glanzmann 's thrombasthenia ( gt ) is an autosomal recessive inherited platelet function defect characterized by normal platelet count , prolonged bleeding time and abnormal clot retraction .
this disease typically presents in infancy or early childhood and has proven to have very good prognosis . in this case study , a 22-year - old gt patient who also developed human immunodeficiency virus ( hiv ) infection after
sometime is reported .
the patient showed oral manifestations of gingival hyperplasia and petechial lesions .
unfortunately the detection of both thrombasthenia and hiv were done at considerably late stages which contributed to a poor prognosis .
the patient died of cardiopulmonary arrest secondary to hiv , thrombasthenia and thrombocytopenia .
the importance of early detection , supportive care and communication between the general and oral physician in management of the gt is also discussed . |
food irradiation is now permitted in more than 55 countries for hundreds of different raw and processed food products to enhance hygienic quality , extend shelf - life , and reduce risk of food - borne diseases .
health safety concerns have been properly addressed through intensive research of many decades resulting endorsement from major health authorities .
however , general consensus over this wholesome technology requires delivery of scientific based information to the consumer . considering consumer right of choice and regulatory requirements , proper labeling is mandatory for irradiated products .
the genus panax ( araliaceae family ) consists of more than 10 species which are most famous and important medicinal plants .
the root of panax ginseng meyer , mainly cultivated in korea and northeast china , has been heat - processed to improve its medicinal efficacy in korea .
ginseng is a medicinal herb and part of a different functional food in far - eastern asian countries .
it is usually available in the form of red ginseng ( steamed and dried ) , dried white ginseng roots and powder , extracts , tea , and liquid drinks .
likewise other herbs , ginseng and ginseng products have potential risk of microbial and insect attack and require an effective sterilization technique with the least compromise on quality attributes .
different scientists reported notable results for the improvement of hygienic quality of ginseng products using irradiation treatment .
the korean food and drug administration has approved irradiation of ginseng ( maximum dose 7 kgy ) .
panax ginseng has solid international market , which may be enhanced by providing better quality products using irradiation .
however , for international trade of irradiated products , reliable identification methods have key importance . electron spin resonance ( esr ) analysis is an effective technique to characterize irradiated food on the basis of radiation - induced radicals .
reported effective identification of red ginseng using esr spectroscopy however ; limited studies are available in the case of raw ginseng roots and white dried ginseng .
especially raw ginseng roots need detailed esr study after effective sample drying technique due to their high moisture content . in literature , freeze - drying and alcoholic - extraction methods
delincee and soika reported the improvement in radiation - induced esr signal of fresh and dried products using alcoholic - extraction .
recently , we observed the improved esr signal in the identification of irradiated sauces by including the water washing step . in this study ,
improved esr - based identification of radiation - induced radicals was attempted using different sample pretreatments .
the results were compared and discussed to develop better esr - based identification method for different ginseng products .
effect of different origin and age at the time of harvesting on radiation - induced esr signals was also investigated .
fresh ginseng , white ginseng ( dried ) , red ginseng ( dried and powdered ) were cultivated in punggi and geumsan regions of south korea and harvested at the age of 4 to 6 years .
the samples were irradiated ( 0 , 1 , 4 , and 7 kgy ) using a co-60 gamma - ray source ( dose rate 1.5 kgy/ h ; aecl , ir-79 , mds nordion international , ottawa , on , canada ) at the korean atomic energy research institute , in jeongeup , korea .
alanine dosimeters with a diameter of 5 mm ( bruker instruments , rheinstetten , germany ) were used to confirm the applied dose , and the free - radical signals were measured by a bruker ems 104 epr analyzer ( bruker instruments ) . after treatment , all samples were stored at room temperature .
three different sample pretreatments were employed before esr measurements : 1 ) fd : freeze - drying ( bondiro ; ilsin bio base , yangju , korea ) of all samples .
2 ) ad : alcoholic - extraction of fresh roots , dried white and red ginseng samples to reduce moisture content and improve esr signals as described by delincee and soika .
3 ) wad : mixing ( 20 min ) of ground / powdered sample with distilled water and insoluble residues were used after alcoholic - extraction as described above .
approximately 0.1 g of the pulverized ( < 1 mm ) sample was placed in a quartz esr tube ( 5 mm dia . ) .
the tube was then sealed with a plastic film , and stored in the dark in a desiccator at 40 5% relative humidity .
esr signals were measured as described in the european standard ( en 1787 , 2000 ) . the x - band esr spectrometer ( jes - te 300 ; jeol co. , tokyo , japan ) was used at room temperature under the conditions given in table 1 .
measuring conditions for the electron spin resonance analysis of the sauces after different sample pretreatments measurements were performed three times ( n=3 ) , and mean values ( standard deviation ) were reported .
the results were analyzed using microsoft excel ( microsoft office 2010 package ; microsoft , redmond , wa , usa ) and origin ver .
fresh ginseng , white ginseng ( dried ) , red ginseng ( dried and powdered ) were cultivated in punggi and geumsan regions of south korea and harvested at the age of 4 to 6 years .
the samples were irradiated ( 0 , 1 , 4 , and 7 kgy ) using a co-60 gamma - ray source ( dose rate 1.5 kgy/ h ; aecl , ir-79 , mds nordion international , ottawa , on , canada ) at the korean atomic energy research institute , in jeongeup , korea .
alanine dosimeters with a diameter of 5 mm ( bruker instruments , rheinstetten , germany ) were used to confirm the applied dose , and the free - radical signals were measured by a bruker ems 104 epr analyzer ( bruker instruments ) . after treatment , all samples were stored at room temperature .
three different sample pretreatments were employed before esr measurements : 1 ) fd : freeze - drying ( bondiro ; ilsin bio base , yangju , korea ) of all samples .
2 ) ad : alcoholic - extraction of fresh roots , dried white and red ginseng samples to reduce moisture content and improve esr signals as described by delincee and soika .
3 ) wad : mixing ( 20 min ) of ground / powdered sample with distilled water and insoluble residues were used after alcoholic - extraction as described above .
approximately 0.1 g of the pulverized ( < 1 mm ) sample was placed in a quartz esr tube ( 5 mm dia . ) .
the tube was then sealed with a plastic film , and stored in the dark in a desiccator at 40 5% relative humidity .
esr signals were measured as described in the european standard ( en 1787 , 2000 ) .
the x - band esr spectrometer ( jes - te 300 ; jeol co. , tokyo , japan ) was used at room temperature under the conditions given in table 1 .
measuring conditions for the electron spin resonance analysis of the sauces after different sample pretreatments measurements were performed three times ( n=3 ) , and mean values ( standard deviation ) were reported .
the results were analyzed using microsoft excel ( microsoft office 2010 package ; microsoft , redmond , wa , usa ) and origin ver .
a single central signal ( g=2.0040 ) was observed in all nonirradiated samples irrespective of sample type and pretreatment ( fig .
various researchers also reported similar central signals in different foods of plant origins [ 13 - 18 ] and were attributed to organic ( semiquinone ) radicals [ 13,19 - 21 ] . upon different sample pretreatments , the intensity of this signal was the lowest in alcoholic extracted samples while the highest in water treated samples , however qualitative appearance was the same without any change in g - value ( g=2.0040 ) .
the central signal intensity was similar in sample of different origins , however variable results were observed for samples harvested at different ages of the plant . upon irradiation ,
all samples showed a dose - dependent increase in the intensity of the central signal .
the radiation- induced two side peaks ( g=2.0201 and g=1.9851 ) started appearing in all 4 kgy - irradiated samples , which were most prominent in 7 kgy - irradiated samples .
the radiation - induced side peaks were equally spaced at about 3 mt from the main signal and were associated with the radicals produced by irradiation in cellulose - containing foods .
different drying techniques ( fd , ad , and wad ) were employed to get improved intensity of side peaks with minimum effect of mn , resulting in easy and clear identification of irradiation treatment . in case of fresh ginseng samples ( fig .
2 ) , results were most promising with clear side peaks and the lowest effects of mn when core samples were used for the esr analysis after alcoholic - extraction ( ad ) .
however , comparable results were observed in the case of fd and ad samples for both skin and core samples ( fig .
wad samples showed a high intensity of central signal but results were not as valuable as the side peaks were not clear . in dried white ginseng and red ginseng powder ( fig .
the effect of alcoholic - extraction was most clear in red ginseng samples with clear side signals .
however , the signal appearance was similar in all studied samples where the lowest intensity of side peaks was recorded in wad samples .
the distance ( g1- g2=6.0330.057 mt ) and g - values ( g1=2.02420.0003 and g2=1.98660.0003 ) of two side peaks did not vary considerably regarding the change in the sample type and pretreatments . the same trend was found by jesus et al . in fruit pulp samples with different sample pretreatments .
however , there was a general increasing trend in esr intensity of harvested irradiated samples aged at 4 , 5 , and 6 years except 4 kgy - irradiated sample of geumsan origin harvested in year 4 ( figs . 4 and 5 ) . in conclusion ,
the non - irradiated samples provided the single central signal whose intensity increased upon irradiation with the emergence of two side peaks of radiation- induced cellulose radicals . in fresh ginseng samples , alcoholic - extraction provided better esr signals especially when the ginseng core was used for the analysis . in dried samples ,
however , the effect of mn was reduced that made signals more clear . samples of different origins provided similar results , however the age at harvest showed effects on radiation - induced esr signal .
a single central signal ( g=2.0040 ) was observed in all nonirradiated samples irrespective of sample type and pretreatment ( fig .
various researchers also reported similar central signals in different foods of plant origins [ 13 - 18 ] and were attributed to organic ( semiquinone ) radicals [ 13,19 - 21 ] . upon different sample pretreatments , the intensity of this signal was the lowest in alcoholic extracted samples while the highest in water treated samples , however qualitative appearance was the same without any change in g - value ( g=2.0040 ) .
the central signal intensity was similar in sample of different origins , however variable results were observed for samples harvested at different ages of the plant .
upon irradiation , all samples showed a dose - dependent increase in the intensity of the central signal .
the radiation- induced two side peaks ( g=2.0201 and g=1.9851 ) started appearing in all 4 kgy - irradiated samples , which were most prominent in 7 kgy - irradiated samples .
the radiation - induced side peaks were equally spaced at about 3 mt from the main signal and were associated with the radicals produced by irradiation in cellulose - containing foods .
different drying techniques ( fd , ad , and wad ) were employed to get improved intensity of side peaks with minimum effect of mn , resulting in easy and clear identification of irradiation treatment . in case of fresh ginseng samples ( fig .
2 ) , results were most promising with clear side peaks and the lowest effects of mn when core samples were used for the esr analysis after alcoholic - extraction ( ad ) .
however , comparable results were observed in the case of fd and ad samples for both skin and core samples ( fig .
wad samples showed a high intensity of central signal but results were not as valuable as the side peaks were not clear . in dried white ginseng and red ginseng powder ( fig .
the effect of alcoholic - extraction was most clear in red ginseng samples with clear side signals .
however , the signal appearance was similar in all studied samples where the lowest intensity of side peaks was recorded in wad samples . the distance ( g1- g2=6.0330.057 mt ) and g - values ( g1=2.02420.0003 and g2=1.98660.0003 ) of two side peaks did not vary considerably regarding the change in the sample type and pretreatments . the same trend was found by jesus et al . in fruit pulp samples with different sample pretreatments .
however , there was a general increasing trend in esr intensity of harvested irradiated samples aged at 4 , 5 , and 6 years except 4 kgy - irradiated sample of geumsan origin harvested in year 4 ( figs . 4 and 5 ) . in conclusion ,
the non - irradiated samples provided the single central signal whose intensity increased upon irradiation with the emergence of two side peaks of radiation- induced cellulose radicals . in fresh ginseng samples , alcoholic - extraction provided better esr signals especially when the ginseng core was used for the analysis . in dried samples , little improvement was observed upon alcoholic treatment .
samples of different origins provided similar results , however the age at harvest showed effects on radiation - induced esr signal . | fresh ( raw roots ) , white ( dried ) , and red ( steamed - drid ) ginseng samples were gamma - irradiated at 0 to 7 kgy .
electron spin resonance ( esr ) technique was used to characterize the irradiation status of the samples , targeting the radiation - induced cellulose radicals after different sample pretreatments .
all non - irradiated samples exhibited a single central signal ( g=2.006 ) , whose intensity showed significant increase upon irradiation .
the esr spectra from the radiation - induced cellulose radicals , with two side peaks ( g=2.0201 and g=1.9851 ) equally spaced ( 3 mt ) from the central signal , were also observed in the irradiated samples . the core sample analyzed after alcoholic - extraction produced the best results for irradiated fresh ginseng samples . in the case of irradiated white and red ginseng samples , the central ( natural ) and
radiation - induced ( two - side peaks corresponding to cellulose radical ) signal intensities showed little improvement on alcoholic - extraction .
the water - washing step minimized the effect of mn2 + , but reduced the intensity of side peaks making them difficult to indentify .
the effect of different origins was negligible , however harvesting year showed a clear effect on radiation - induced esr signals . |
it has long been known that axonal signals control the induction and maintenance of the schwann cell myelin sheath that surrounds the large - diameter axons in peripheral nerves . however , until very recently , the nature of these signals has remained obscure .
in contrast , the identity of the transcription factors in schwann cells that organise the myelination programme is much better characterised .
well - established transcriptional regulators of this programme include krox-20 ( early growth response gene 2 , or egr-2 ) and its associated proteins , nab ( nucleic acid - binding protein ) 1 and 2 , sox-10 , oct-6 and brn1 and brn2 .
current knowledge of the mechanisms by which these factors exert their effects on myelination has recently been reviewed . unlike most other cell types , schwann cells can readily dedifferentiate .
thus , when myelinating schwann cells are deprived of axonal contact in injured nerves , they adopt a molecular and morphological phenotype that is similar , though not identical , to the phenotype of immature schwann cells prior to myelination . depending on circumstances , therefore , schwann cells either provide support for mature axons by elaboration of a myelin sheath or provide an environment through which axons can regrow after injury and subsequently remyelinate .
we are just beginning to form a more comprehensive picture of how schwann cells transit between these two phenotypes , with an emerging picture of a mechanism involving cross - inhibitory interactions between positive and negative transcriptional regulators of myelination .
an important advance in our understanding of axonal signalling mechanisms that control myelination has occurred in the past five years .
several papers have shown that the axonal surface protein neuregulin 1 ( type iii1 ) , acting via its receptors erbb2 and erbb3 , controls the thickness of the schwann cell myelin sheath and is part of the mechanism that controls the expression of myelin genes and the induction of myelination [ 3 - 7 ] .
this factor also controls the survival of schwann cell precursors and is a potent mitogen for schwann cell precursors and schwann cells .
it remains a challenge to understand the mechanism by which the schwann cell switches its response to neuregulin from a non - myelinating proliferative phase to a non - proliferative myelination mode .
some evidence suggests that a balance between erk ( extracellular signal - related kinase ) 1/2 and jnk ( c - jun n - terminal kinase)/c - jun ( pro - dedifferentiation ) and pi3 kinase ( phosphatidyl inositol-3 kinase)/akt ( pro - myelination ) signalling may be involved , but the picture is far from clear [ 8 - 12 ] . to add complications , soluble neuregulin isoforms at high concentrations can also promote demyelination .
although neuregulin is required in peripheral nervous system myelination , it is not required for myelination by oligodendrocytes in the central nervous system .
recent evidence suggests that neuregulin 1 type iii expressed by axons also regulates the formation of mature non - myelinating schwann cells ( remak bundles ) .
genetic inactivation of neuregulin 1 type iii in small - calibre unmyelinated c - fibres , using nav1.8-cre mice , results in aberrant remak fibres that contain abnormally large numbers of axons , and the altered morphology is reflected in a reduced response to noxious pressure stimulation . in these mice ,
this resulted in an increase in the number of axons in this size category which remained unmyelinated , despite achieving a 1:1 relationship with schwann cells .
this is in line with earlier evidence that neuregulin 1 type iii promotes myelination , as discussed above . despite the altered morphology ,
one of the ways in which neuregulin signalling is likely to control myelination is by increasing the ca level in schwann cells .
this activates the phosphatase calcineurin , which dephosphorylates nuclear factor of activated t cells ( nfat ) c3 and c4 , resulting in translocation to the nucleus .
kao and colleagues show that deleting calcineurin b specifically in the schwann cell lineage results in defects in radial sorting and hypomyelination in newborn mice . because the mice die shortly after birth , it is not possible to say whether the hypomyelination is transient or permanent .
lack of calcineurin b prevents neuregulin - induced dephosphorylation and activation of nfat c3 and c4 .
furthermore , nfat c4 complexes with sox-10 , a transcription factor required for myelination , to activate the promoter and myelin - specific enhancer of the krox-20 gene , which globally regulates peripheral myelination [ 11,18 - 20 ] , and also with the promoter of the myelin protein zero ( p0 ) gene , all of which underline the involvement of nfat proteins in myelination .
it has long been known that elevation of intracellular cyclic amp levels induces cultured schwann cells to express myelin proteins and adopt many other aspects of the myelinating schwann cell phenotype , suggesting that camp is part of the signalling system that promotes myelination .
a recent paper now provides important in vivo evidence for this proposition . in experiments using mutant zebrafish
, the authors found that the g protein - coupled receptor gpr126 is essential for myelination in the peripheral nervous system and that the defect is confined to signalling within schwann cells rather than axons .
significantly , treatment of the developing mutant fish with forskolin , which elevates intracellular camp levels , restores myelination , suggesting that this orphan receptor acts by controlling schwann cell camp levels . because levels of neuregulin and erbb3 receptors remain normal in the mutant fish , it is likely that gpr126 functions independently of neuregulin to regulate myelination .
additional evidence for the involvement of camp and camp - dependent protein kinase a ( pka ) in myelination comes from studies of the transcription factor nuclear factor - kappa - b ( nf-b ) . in schwann cell - dorsal root ganglion ( drg )
co - cultures , inhibition of nf-b activation inhibits proper association of schwann cells with axons and myelination , and co - cultures using cells from mice lacking the p65 active subunit of nf-b show marked inhibition of myelination .
significantly , phosphorylation of the p65 subunit by pka increases transcriptional activity but not dna binding and is required for upregulation of oct-6 by camp . although the experiments remain to be confirmed in vivo , the results suggest that this factor transduces camp signals within schwann cells and promotes myelination at early stages of myelin induction . linking these findings to those from zebrafish
, it may also be significant that there are two binding sites for nf-b within the gpr126 promoter .
cell - cell interactions between axons and schwann cells are vital to the process of myelination .
two recent papers reveal new roles for nectin - like cell adhesion molecules ( necls ) , members of the immunoglobulin superfamily of cell adhesion molecules , at the onset of myelination .
necl2 and necl4 are expressed in schwann cell membranes , principally in the internodal region and in schmidt - lanterman incisures while necl1 and necl2 are expressed by axons .
knockdown of necl4 by shrna ( short hairpin rna ) severely inhibits myelination in drg - schwann cell co - cultures . although schwann cells can line up along the axons and even enclose them , they fail to make even 1.5 turns around the axons , pointing to a requirement for these proteins at the early stages of myelination to ensure proper wrapping and spiralling of the schwann cell membrane .
in addition , levels of the transcription factors oct-6 and krox-20 remain low in these co - cultures .
it remains to be determined , however , whether this phenotype will be reproduced by knockout of necl4 in vivo .
in addition to transcription factors that promote myelination , such as nfat , nf-b , sox-10 , krox-20 and oct-6 ( discussed above ) , there is increasing evidence that myelin differentiation is subject to negative transcriptional regulation . in vivo ,
selective inactivation of notch 1 in schwann cells accelerates myelination while overexpression of the active intracellular domain of notch ( nicd ) delays it , indicating that myelination is negatively controlled by notch signalling .
the major role of negative regulation is likely to be that of driving schwann cell demyelination / dedifferentiation .
nicd levels rise rapidly in injured nerves , and the resulting demyelination is slower if the nicd elevation is prevented .
another transcription regulator , c - jun , is similarly elevated in the schwann cells of injured nerves , and as with notch 1 , demyelination is delayed when this elevation is prevented .
c - jun is also required for the generation of the characteristic molecular and morphological phenotype of the dedifferentiated cell . other transcription factors that negatively regulate myelin differentiation in cell culture include sox2 and id2 and id4 .
lipids form major components of the myelin sheath and we are just beginning to explore how myelin lipid synthesis is synchronised with that of the myelin proteins [ 30 - 32 ] .
the pathways activated by established schwann cell signals , such as camp and neuregulin , are actively being clarified as exemplified by the work on gpr126 and nf-b mentioned above and by the recent identification of bace1 ( -site app cleaving enzyme ) , the pdz ( post - synaptic density 95-discs large - zonula occludens 1 ) domain protein erbin and the tyrosine phosphatase shp2 ( src homology 2 domain - containing protein tyrosine phosphatase 2 ) as participants in neuregulin signalling and myelination [ 33 - 36 ] . the downstream targets of novel schwann cell signalling molecules ( for example , the necl proteins ) will also have to be determined .
we can expect to learn more about the role of epigenetic mechanisms in myelination and to understand more about how positive and negative transcriptional regulators of myelination are integrated at the molecular level and how they exert control over the promoter regions , intronic elements and downstream elements of myelin genes .
the mechanisms that control radial sorting and the generation of the pro - myelin cell , a prerequisite for myelination , are the focus of extremely active investigation outside the scope of this commentary .
surprisingly , recent work shows that normal prion protein is involved in the control of myelin maintenance .
ablation of this prion protein in mice results in a chronic demyelinating neuropathy , although myelin is initially formed normally .
the authors show that depletion of prion protein in neurons but not schwann cells triggers the neuropathy , and that cleavage of the protein at the amino terminal end is required .
it remains to be determined whether axonal prion protein interacts directly with schwann cells or whether this protein affects myelin maintenance indirectly .
| schwann cells ensheath all axons of peripheral nerves . only around large - diameter axons
do they elaborate myelin , forming insulating sheaths that are vital for fast conduction of axon potentials .
a series of recent papers has illuminated some of the ways in which the process of myelination is controlled , both by signals from axons and by positive and negative transcriptional mechanisms within the schwann cells themselves . |
there are growing numbers of people with chronic conditions with a particularly rapid rise in the number with multiple care needs .
the complex needs of people with multiple chronic conditions require the development of delivery systems that bring together a range of professionals and skills from both the cure and care sectors to meet those needs . despite this
, service delivery has developed in ways that have tended to fragment care , both within and between sectors , through for example structural and financial barriers dividing providers at the primary / secondary care and at the health and social care interface ; distinct organizational and professional cultures ; and differences in terms of governance and accountability .
a substantial number of evaluations have been carried out of interventions designed to improve the integration or coordination of care .
a systematic review based on 21 reviews and 85 primary studies showed that many of these initiatives were effective in improving care , though many fewer resulted in a reduction in healthcare costs ( table 1 ) .
one of the conclusions of this and other reviews is that the effectiveness of attempts to provide better integrated care is highly dependent on the context in which the intervention takes place .
interventions can not be seen separated from the context in which they are introduced , and this has been an important guiding principle in the evaluation described in this paper . in response to concerns that the needs of the aging population for well - integrated care were increasing , the uk department of health for england announced in 2008 that a number of integrated care pilots would be established . healthcare purchasers and providers
there was no specification as to the form that such integration should take , or client groups who should receive the intervention .
there were over 100 applications , and after a two - stage selection process , the department of health selected 16 pilots .
the localities of selected pilots and the main focus of each are described in annex 1 .
a team from rand europe , ernst and young llp and the university of cambridge were appointed to carry out a three - year evaluation that was augmented by the inclusion in the evaluation of experts from the nuffield trust .
the evaluation aims to answer the following questions : what approaches to integration have been employed by the pilots ?
what approaches to integration work well and in what contexts ? who benefits from integration , in what ways , and with what consequences for equity ?
what resources are required to make integration succeed and how can these be efficiently used ? in delivering integrated care in the english national health service , what policies and practices are : most likely to deliver the intended outcome , most capable of being implemented and most acceptable to patients , users , clinicians , managers and the wider public .
a mixed methods approach was adopted including interviews with staff and patients , non - participant observation of meetings , structured written feedback from sites , questionnaires to service users and staff , and analysis of routinely collected hospital utilisation data for patients / users who had been recruited into the pilots .
our approach to understanding the context in which integration takes place is based on two classifications relating to structure and function . at the start of the evaluation
these classifications were deliberately general to avoid focusing too early on very specific approaches to integrated care .
we wanted to accommodate the fact that that the pilots themselves were still refining their approaches .
integration can be seen as occurring at three levels [ 4 , 5 ] micro - level integration activities .
these promote integration among individual practitioners within a single organisation ( e.g. between doctors and nurses in a primary care practice setting ) . meso - level integration activities .
these promote integration among practitioners working in different organisations ( e.g. between gps and specialists ) .
this might include co - location of services , which could occur with or without macro - level activities , such as pooled budgets .
these promote integration designed to facilitate organisation - to - organisation working , e.g. across different sectors .
examples of these are pooled budgets or joint budget holding between health and social care services , employment of care staff in a single organisation , or structural changes to facilitate work across two or more organisations .
integration can be classified in terms of organisational integration , where organisations are brought together by mergers or by structural change .
service integration , where different clinical services or support / back - office functions are integrated .
this classification will guide our analysis of the data , and our testing of the various hypotheses which arose during the course of the study .
these included hypotheses that integrated care would lead to the development of new organisational structures to support integration , changes in staff roles , increased staff job satisfaction , fewer unscheduled emergency hospital admissions , reduced length of hospital stay , increased patient satisfaction , and reduced cost .
it should be noted that the evaluation was designed and funded prior to the appointment of the integrated care pilots , so these hypotheses were developed during the first six months of the evaluation as a result of detailed interaction with the sites .
this unusual research design allowed for the evaluation to be tailored to the aims of the sites which were not known at the time the evaluation team was appointed .
our approach to understanding the context in which integration takes place is based on two classifications relating to structure and function . at the start of the evaluation
these classifications were deliberately general to avoid focusing too early on very specific approaches to integrated care .
we wanted to accommodate the fact that that the pilots themselves were still refining their approaches .
integration can be seen as occurring at three levels [ 4 , 5 ] micro - level integration activities .
these promote integration among individual practitioners within a single organisation ( e.g. between doctors and nurses in a primary care practice setting ) . meso - level integration activities .
these promote integration among practitioners working in different organisations ( e.g. between gps and specialists ) .
this might include co - location of services , which could occur with or without macro - level activities , such as pooled budgets .
these promote integration designed to facilitate organisation - to - organisation working , e.g. across different sectors .
examples of these are pooled budgets or joint budget holding between health and social care services , employment of care staff in a single organisation , or structural changes to facilitate work across two or more organisations .
integration can be classified in terms of organisational integration , where organisations are brought together by mergers or by structural change .
service integration , where different clinical services or support / back - office functions are integrated .
this classification will guide our analysis of the data , and our testing of the various hypotheses which arose during the course of the study .
these included hypotheses that integrated care would lead to the development of new organisational structures to support integration , changes in staff roles , increased staff job satisfaction , fewer unscheduled emergency hospital admissions , reduced length of hospital stay , increased patient satisfaction , and reduced cost .
it should be noted that the evaluation was designed and funded prior to the appointment of the integrated care pilots , so these hypotheses were developed during the first six months of the evaluation as a result of detailed interaction with the sites .
this unusual research design allowed for the evaluation to be tailored to the aims of the sites which were not known at the time the evaluation team was appointed .
the evaluation described here adopts the approach of the embedded evaluator. the evaluation activities form a distinct strand within the integrated care pilot programme , helping to co - produce the successful delivery of the programme , rather than a completely separate study focused solely on contributing to the scientific understanding of integrated care .
however , it is equally important that the evaluation contributes to scientific understanding and that it generates valid and independent evidence to support decision - making in the future .
the approach combines systematically collecting and synthesizing evidence from across all the pilots together with a deeper investigation of a smaller number of pilots in order to gain more detailed understanding of the structures , processes , costs and outcomes of integration .
integrated care pilots use a variety of integrating activities ( ranging from influencing , creating incentives , sharing information , creating new information systems and so forth ) and have a variety of objectives ( including improving the effectiveness and efficiency of services , enhancing patient reported outcomes and delivering measurable health improvements . in this context
, the research approach is multi - method in order to understand both the activities pursued and the outcomes achieved . the evaluation is based on six approaches to data collection and analysis : systematic qualitative data collection from all sites ( through a living document which is a semi - structured document completed regularly by each pilot site ) . in - depth case studies of six sites ( deep dives ) including interviews with staff and patients / service users and non - participant observation of meetings [ see section systematic qualitative data collection from all sites ( the living document ) for more on why we decided to use case studies ] .
difference in differences analysis of data on hospital utilization comparing patients / service users enrolled in pilots with control data .
analysis of costs ( combining data from qualitative case studies and quantitative data on service utilization ) .
evaluation involves a number of activities leading to an exercise of judgement [ 7 , 8 ] . in evaluating the complex set of activities which broadly sit under the heading of
integrated care pilots we also seek to arrive at judgements which are seen to be legitimate by the stakeholders involved .
this requirement for legitimacy is one of the many ways in which pure research is distinct from evaluation .
this legitimacy potentially involves five steps ( similar to those identified by scriven ): understand from those delivering the pilots and from those funding the initiative the criteria they consider to be applicable .
assess the contribution made by the agency / activity in achieving these standards and outcomes .
these steps protect the evaluators from the accusation of being arbitrary or otherwise non - rational , but an important part of the logic of the evaluation is to develop a set of hypotheses based on the theory of change offered up by the pilots themselves . implicitly or explicitly , many evaluations of complex interventions use a theory of change approach .
these evaluations aim not only to understand the contribution made by a programme or activity to achieving outcomes , but also to interrogate evidence and communicate findings to support both learning and accountability .
our approach takes as its starting point the argument of weiss [ 11 , p. 6667 ] that : the concept of grounding evaluation in theories of change takes for granted that social programmes are based on explicit or implicit theories about how and why the programme will work the evaluation should surface those theories and lay them out in as fine detail as possible , identifying all the assumptions and sub - assumptions built into the programme . the evaluators then construct methods for data collection and analysis to track the unfolding assumptions .
the aim is to examine the extent to which programme theories hold the evaluation should show which of the assumptions underlying the programme are best supported by the evidence . in this sense , theories of change
is a guiding approach rather than a methodology , and its successful delivery requires harnessing a range of methodologies , such as those outlined elsewhere in this paper .
first the approach requires us to not only look at the outcomes of the programme but to pay equal attention to processes .
this contrasts with more classical evaluation approaches which tend to look at outcomes first and then to look for evidence to support attribution .
embedded evaluator where the evaluator works closely with policy makers , practitioners and end users to understand and elaborate a sometimes changing theory of change . without losing their independence
, successful evaluators will understand the world of the policy makers , practitioners and service users , including an understanding of what motivates their behaviour .
thirdly , the approach requires an ability to reconstruct and represent the sequence of events connecting actions to each other and how these contributed to the outcomes identified , reconstructing at least the sequence of events and statistical co - variations , but preferably also identifying the causal mechanisms at work .
fourthly , the approach is sensitive to the possibility that during the life of a programme or intervention , initial theories of change may alter in response to learning or to exogenous events and that the evaluation needs to capture these changing understandings and actions .
fifthly , it will also be sensitive to the fact that different and potentially conflicting theories of change might be simultaneously pursued within any one programme .
collectively , these precepts describe an interest not only in causal effects ( what happens when an independent variable changes ) but also causal mechanisms ( what connects causes to their effects ) ; not only what officials say they do but what the evidence shows they do ; and not only what contribution stories practitioners tell themselves and others but also what really contributes to benefit .
therefore , theory building and testing is an important part of the approach taken but it does not start with a priori theoretical claims or assumptions .
the living document involves semi - structured data collection from all integrated care pilots at approximately six - monthly intervals during the evaluation .
a lead person is designated in each site to collate responses in the living document , but in most cases , this individual draws on a variety of sources in collating responses , and there is an expectation that the views of a wide range of stakeholders will be represented in the completion of the document .
the data collected in the living document are organised into a series of broad questions : development of the pilot and background information .
. who is doing what ? identifying the main people and organisations involved , and their roles in implementing the pilot .
processes identifying the intended processes , and processes which have been implemented so far .
a description of progress to date , an assessment of progress against plan , and an outline of what has facilitated / prevented progress . sustainability .
an assessment of how much difference is really being made by the pilot itself , in the context of other health policy initiatives which are taking place concurrently .
resource implications of the pilot . without attempting to provide a precise monetary value to the outcomes of the pilot , an assessment of the costs of the pilot , and whether benefits might have been achieved more easily in other ways .
after each round of data collection , data from the living document are analysed , and feedback is given in two ways . first , limited feedback is given to each site , including the opportunity to specify where more detailed information is needed in future rounds of living document completion .
second , the overall themes emerging from the living document are analysed , and these are fed back in a single document to all sites after each round of data collection .
this analysis also contributes to learning events ( conferences and teleconferences to address different issues of relevance to pilots ) which are being run by the department of health throughout the pilot period , and subsequent rounds of the living document are adapted in light of feedback from the sites .
we selected a range of types of pilots for in - depth case study to reflect the range of approaches in the pilots and then select a sample from these reflecting the need for variety and site s ability to support a more detailed evaluation .
for the depth case studies in six sites , we will structure the evaluation using an approach that combines logic modeling with process mapping of the patient journey .
these methods will complement each other in creating a full picture of the integration pathways .
logic models provide a brief summary of the key elements of an intervention ( or programme , or project ) and organize inputs , processes , outputs and outcomes systematically .
they facilitate a focus on the causal links in the chain connecting the allocation of resources to the intended outcomes . as such
, they are well suited to supporting an understanding the theory of change underpinning the activity and simultaneously identifying the sorts of data that might support or weaken that theory
. this approach will provide both a way to describe and communicate the different interventions but also to provide a basis for what , causally , is happening .
it will provide the framework for understanding how the inputs of a pilot are related to its outcomes and impacts .
they are especially helpful in developing a shared understanding of a process between stakeholders and serve as a reference point for stakeholders in the initiative or programme .
process mapping the service user experience , by contrast , involves understanding the motivations , experiences and outcomes of the various interactions between the service user and the ( integrated ) service . using these case studies
, we will address the following questions : what approaches to integration have been employed by the pilots ?
this will provide a richer description of models than is possible in the overall national evaluation by exploring experiences , motivations , relationships , processes and costs in more detail .
this will generate data linking putative causes to observed effects i.e. understanding causal mechanisms . who benefits from integration and in what ways ( what definitions are there of
success ) ? this will identify how benefits are distributed and with what implications for equality .
what resources are required to make integration succeed and how can these be efficiently used ?
this will identify the descriptive categories of costs , establishing their dimensions , estimating overall costs , and suggesting how generalisable these findings might be .
the living document will help identify what types of costs become apparent at various stages of development of a project .
how the development of integrated care is facilitated or impeded by other current policies , e.g. payment by results , practice - based commissioning etc . from these analyses ,
we aim to identify what policies and practices are most suitable ( i.e. fit for purpose and likely to deliver the intended outcome ) ; most feasible ( i.e. capable of being implemented given the existing architecture of delivery and accountability ) ; and most acceptable ( i.e. likely to generate the support of the people who use services , clinicians and other professionals , managers and the wider public ) .
there will be three key data collection methods : semi - structured interviews with professionals and patients / service users , documentary analysis , non - participant observation of meetings . the qualitative data collection in the deep dive sites
will also be used to collect data for the economic analysis ( see below ) .
interviews with staff will concentrate on the experience of delivering care , interactions with other professional groups and organizations within the integrated care pilot , and understanding of implications for the wider care system .
interviews with patients and users will focus on the patient / user journey and experience and its relationship to changes in the integrated care pilots . in analysing data on service utilisation
, we will focus principally on hospital admissions as a key variable , as many of the sites have a focus on reducing such admissions .
data will be taken from hospital episode statistics ( he s ) , both for outpatient referrals , accident and emergency attendances and inpatient stays .
these will enable analyses of changes in a number of measures of hospital use including overall rates of emergency admissions , admissions for ambulatory sensitive conditions ( see annex 2 ) , and length of stay .
we derived the list of ambulatory sensitive conditions from ahrq and purdy et al . .
information will be available for the individuals enrolled in any intervention , and also for the whole populations of general practices which are participating in the integrated care pilot .
the data will be at person level but anonymised so that the research team can not identify sensitive personal information or individual identities . the nhs information centre for health and social care will act a trusted third party to handle any confidential information and create the anonymised linked fields for use by the research team .
one of the key challenges in undertaking analyses of changes in hospital use for complex interventions is that individuals may be selected for an intervention because they have a high use of health services .
the problem is that any subsequent fall in utilisation in this group may simply be due to regression to the mean that is people reverting to a normal level of use irrespective of the intervention .
one way round this is to use an approach that allows us to standardise for differences in the risk of future admissions .
first , we will assess the impact of the intervention on individuals enrolled in the integrated care pilots .
information on the prior patterns of diagnoses and hospital utilisation will be used to stratify cases according to the risk of admission .
the actual level of utilisation before and after the agreed starting point in each pilot will be compared . in this way
we will be able to track levels of hospital use for cohorts of people for 23 years before they became part of the pilot .
these control cases will be matched on a number of variables including risk of admission ( or other hospital use ) ; major diseases recorded ; history of hospital use ; and characteristics of the area of residence , such as levels of deprivation .
trends in hospital use within the groups of selected control cases will then be used as a test of observed differences in those enrolled in the integrated care pilots .
second , we will quantify the effect of the interventions on wider groups of patients ( e.g. practice populations ) by matching utilization data to that from to similar practice populations in national he s datasets .
the population level analysis will assess whether the intervention might not only have an impact on individual patients but also upon the wider population .
both of these approaches to analysis are required as there might be an impact of the interventions on individuals ( e.g. a reduction in admissions ) which could not be demonstrated in the wider population .
this might be because resources were simply redistributed between groups at equal risk of admission , or because the numbers enrolled in the pilots were too small to show an effect on the wider population .
sample size calculations suggest that few of the integrated care pilot sites will enroll sufficient numbers for data from individual sites to be analysed .
we therefore intend to pool data from sites which have similar aims and are providing broadly comparable interventions .
it is not possible to say which sites will provide data that can be pooled , as all sites are still developing their interventions . however , it looks likely , for example , that several sites will be using a form of case management of high - risk patients with the aim of reducing hospital admission , and we will be able to pool data from such sites .
data will also be analysed on primary and social care utilisation ( from patient questionnaires ) .
however , these data are being collected primarily for the economic analysis , as none of the sites has reduction in primary care utilisation as their main goal .
our analysis strategy is built around a generalized difference - of - differences regression approach at the person level .
regression models appropriate for each of the outcome measures ( e.g. emergency admissions ) will be developed .
these may be poisson models , negative binomial models , or gamma models as required by the form of the measure .
each individual will contribute one or more time periods to the dataset in both the pre- and post - intervention periods .
these models will use covariates including basic demographics and historical utilization to control for potential differences between the intervention and control cases .
person level random effects will also be included in the models to adjust standard errors for the repeated measures within person .
in addition to the traditional covariate adjustment in the difference - of - differences model we will use propensity score based methods . in a combined dataset of intervention cases and
non - intervention controls a propensity score model will be fitted that uses available covariates to predict intervention vs. control status .
we may also use the propensity scores to produce analysis weights which can be combined with covariate adjustment to support
doubly robust estimation combined with difference - of - differences modeling will provide intervention effect estimates that control for both observed differences between intervention and control groups as well controlling for unobserved but fixed person characteristics .
the aim of identifying risk - matched controls and using propensity score analysis is to allow so far as possible for unmeasured patient and system effects and therefore to increase our ability to draw conclusions about likely cause and effect from what inevitably remains observational data .
we are conducting two surveys to assess the experience of service users in 11 of the 16 pilots .
the survey is being administered in autumn / winter 2009 and will be repeated on the same sample of service users in autumn 2010 .
the questionnaire was developed using the intended outcomes identified by pilot sites in their applications to join the scheme .
this identified a number of domains which were common to most pilots and were therefore included in the questionnaire .
frequency of certain critical events ( notes unavailable , test duplicated , wrong medication or wrong dose of medication prescribed , no follow - up arrangements after hospital discharge ) .
in addition , a question on service usage was included to contribute to the analysis of health service costs ( see below ) .
the questionnaire is available from the authors . in selecting items to represent these domains , we drew questions were possible from existing validated instruments .
in particular we drew a substantial number of questions from the english national gp patient survey which is currently sent annually to 5.5 million randomly sampled patients ( www.gp-patient.co.uk ) . by matching the socio - demographic and health questions to this survey also , we will be able to conduct a difference in differences analysis with individual control patients drawn from responders to the national survey . for five pilot sites it was not appropriate to collect patient information using this questionnaire because of the nature of the intervention and/or the population group targeted by the intervention ( for example
questionnaires are being sent to up to 500 service users in each site . where the site has identified more that 500 service users by autumn 2009 , a random sample of 500 will be taken . where fewer than 500 service users have been identified by march 2010
where a site is enrolling patients / service users sequentially during autumn 2009/spring 2010 , all patients receive a questionnaire until 500 have been enrolled .
those individuals who receive a questionnaire in autumn 2009/spring 2010 will receive a second questionnaire in autumn 2010 .
for all service users , the site identifies the start data of any intervention , so that we can determine whether questionnaires returned have been completed before or after the start of the intervention .
we are conducting two cross - sectional staff surveys within the 16 pilot sites , involving health and social care staff ( including community nurses , gps and social workers ) , in spring 2010 , and repeated in spring 2011 .
the staff questionnaire has substantial sections for free text to allow staff to describe their experience of the pilot in more detail , and these sections will be transcribed for qualitative analysis .
the questionnaire includes sections on : job changes since the introduction of the integrated care pilot .
the first are staffs who are closely involved in the development of the pilot ( e.g. employed by the pilot ) .
the additional 3545 will be sent to stratified random samples of practitioners whose work might be altered by the pilot
the first is to estimate costs in order to provide decision - makers in the health and social care systems with a basis for understanding the categories and potential range of costs associated with the integrated care pilots .
this will provide a sense of how much the approach might cost if it were implemented elsewhere . an important part of this will be through data collection in the deep dive sites where we will use the logic model , process maps , key informant interviews , and documentary evidence to produce estimates of the costs of providing integrated care .
this will enable us to identify the categories of cost and the scale of resources required to deliver different models of integration .
we aim to produce a clear understanding of the main categories of cost ( staff by grade , equipment , building , travel etc . ) , the likely range of costs within each category , and subsequently estimate best , worst and most likely case scenarios .
we will also distinguish between set - up costs and running costs , although in a fluid , adaptive and improving system it may be difficult to draw this distinction . for both of these
we need to distinguish between the costs associated with participating in the dh programme ( including , for example , participation in events , reporting , contributing to the national evaluation ) and the costs solely required to deliver the integrated care programme .
we also aim to gather data through time that can show how costs have altered in response to actual service delivery or in order to overcome changing circumstances etc .
we propose only to look at costs internal to the health and social care system ( including private sector partners ) but we will be aware that costs could potentially be externalised onto service users and carers and we will ask service users and staff to comment on their sense of the types and magnitudes of these costs . across the integrated care pilots where we are collecting quantitative data on hospital utilisation , data on hospital admissions and length of stay will be costed using standard nhs costs , and included in the controlled difference in differences analysis described in above .
the evaluation described here adopts the approach of the embedded evaluator. the evaluation activities form a distinct strand within the integrated care pilot programme , helping to co - produce the successful delivery of the programme , rather than a completely separate study focused solely on contributing to the scientific understanding of integrated care .
however , it is equally important that the evaluation contributes to scientific understanding and that it generates valid and independent evidence to support decision - making in the future .
the approach combines systematically collecting and synthesizing evidence from across all the pilots together with a deeper investigation of a smaller number of pilots in order to gain more detailed understanding of the structures , processes , costs and outcomes of integration .
integrated care pilots use a variety of integrating activities ( ranging from influencing , creating incentives , sharing information , creating new information systems and so forth ) and have a variety of objectives ( including improving the effectiveness and efficiency of services , enhancing patient reported outcomes and delivering measurable health improvements . in this context
, the research approach is multi - method in order to understand both the activities pursued and the outcomes achieved . the evaluation is based on six approaches to data collection and analysis : systematic qualitative data collection from all sites ( through a living document which is a semi - structured document completed regularly by each pilot site ) . in - depth case studies of six sites ( deep dives ) including interviews with staff and patients / service users and non - participant observation of meetings [ see section systematic qualitative data collection from all sites ( the living document ) for more on why we decided to use case studies ] .
difference in differences analysis of data on hospital utilization comparing patients / service users enrolled in pilots with control data .
analysis of costs ( combining data from qualitative case studies and quantitative data on service utilization ) .
evaluation involves a number of activities leading to an exercise of judgement [ 7 , 8 ] . in evaluating the complex set of activities which broadly sit under the heading of
integrated care pilots we also seek to arrive at judgements which are seen to be legitimate by the stakeholders involved .
this requirement for legitimacy is one of the many ways in which pure research is distinct from evaluation .
this legitimacy potentially involves five steps ( similar to those identified by scriven ): understand from those delivering the pilots and from those funding the initiative the criteria they consider to be applicable .
assess the contribution made by the agency / activity in achieving these standards and outcomes .
these steps protect the evaluators from the accusation of being arbitrary or otherwise non - rational , but an important part of the logic of the evaluation is to develop a set of hypotheses based on the theory of change offered up by the pilots themselves . implicitly or explicitly , many evaluations of complex interventions use a theory of change approach .
these evaluations aim not only to understand the contribution made by a programme or activity to achieving outcomes , but also to interrogate evidence and communicate findings to support both learning and accountability .
our approach takes as its starting point the argument of weiss [ 11 , p. 6667 ] that : the concept of grounding evaluation in theories of change takes for granted that social programmes are based on explicit or implicit theories about how and why the programme will work the evaluation should surface those theories and lay them out in as fine detail as possible , identifying all the assumptions and sub - assumptions built into the programme . the evaluators then construct methods for data collection and analysis to track the unfolding assumptions .
the aim is to examine the extent to which programme theories hold the evaluation should show which of the assumptions underlying the programme are best supported by the evidence . in this sense , theories of change
is a guiding approach rather than a methodology , and its successful delivery requires harnessing a range of methodologies , such as those outlined elsewhere in this paper .
first the approach requires us to not only look at the outcomes of the programme but to pay equal attention to processes .
this contrasts with more classical evaluation approaches which tend to look at outcomes first and then to look for evidence to support attribution .
embedded evaluator where the evaluator works closely with policy makers , practitioners and end users to understand and elaborate a sometimes changing theory of change . without losing their independence
, successful evaluators will understand the world of the policy makers , practitioners and service users , including an understanding of what motivates their behaviour .
thirdly , the approach requires an ability to reconstruct and represent the sequence of events connecting actions to each other and how these contributed to the outcomes identified , reconstructing at least the sequence of events and statistical co - variations , but preferably also identifying the causal mechanisms at work .
fourthly , the approach is sensitive to the possibility that during the life of a programme or intervention , initial theories of change may alter in response to learning or to exogenous events and that the evaluation needs to capture these changing understandings and actions .
fifthly , it will also be sensitive to the fact that different and potentially conflicting theories of change might be simultaneously pursued within any one programme .
collectively , these precepts describe an interest not only in causal effects ( what happens when an independent variable changes ) but also causal mechanisms ( what connects causes to their effects ) ; not only what officials say they do but what the evidence shows they do ; and not only what contribution stories practitioners tell themselves and others but also what really contributes to benefit .
therefore , theory building and testing is an important part of the approach taken but it does not start with a priori theoretical claims or assumptions .
the living document involves semi - structured data collection from all integrated care pilots at approximately six - monthly intervals during the evaluation .
a lead person is designated in each site to collate responses in the living document , but in most cases , this individual draws on a variety of sources in collating responses , and there is an expectation that the views of a wide range of stakeholders will be represented in the completion of the document .
the data collected in the living document are organised into a series of broad questions : development of the pilot and background information .
. who is doing what ? identifying the main people and organisations involved , and their roles in implementing the pilot .
a description of progress to date , an assessment of progress against plan , and an outline of what has facilitated / prevented progress . sustainability .
an assessment of how much difference is really being made by the pilot itself , in the context of other health policy initiatives which are taking place concurrently .
resource implications of the pilot . without attempting to provide a precise monetary value to the outcomes of the pilot , an assessment of the costs of the pilot , and whether benefits might have been achieved more easily in other ways .
after each round of data collection , data from the living document are analysed , and feedback is given in two ways .
first , limited feedback is given to each site , including the opportunity to specify where more detailed information is needed in future rounds of living document completion .
second , the overall themes emerging from the living document are analysed , and these are fed back in a single document to all sites after each round of data collection .
this analysis also contributes to learning events ( conferences and teleconferences to address different issues of relevance to pilots ) which are being run by the department of health throughout the pilot period , and subsequent rounds of the living document
we selected a range of types of pilots for in - depth case study to reflect the range of approaches in the pilots and then select a sample from these reflecting the need for variety and site s ability to support a more detailed evaluation .
for the depth case studies in six sites , we will structure the evaluation using an approach that combines logic modeling with process mapping of the patient journey .
these methods will complement each other in creating a full picture of the integration pathways .
logic models provide a brief summary of the key elements of an intervention ( or programme , or project ) and organize inputs , processes , outputs and outcomes systematically .
they facilitate a focus on the causal links in the chain connecting the allocation of resources to the intended outcomes .
as such , they are well suited to supporting an understanding the theory of change underpinning the activity and simultaneously identifying the sorts of data that might support or weaken that theory . this approach will provide both a way to describe and communicate the different interventions but also to provide a basis for what , causally , is happening .
it will provide the framework for understanding how the inputs of a pilot are related to its outcomes and impacts .
they are especially helpful in developing a shared understanding of a process between stakeholders and serve as a reference point for stakeholders in the initiative or programme .
process mapping the service user experience , by contrast , involves understanding the motivations , experiences and outcomes of the various interactions between the service user and the ( integrated ) service . using these case studies
, we will address the following questions : what approaches to integration have been employed by the pilots ?
this will provide a richer description of models than is possible in the overall national evaluation by exploring experiences , motivations , relationships , processes and costs in more detail .
this will generate data linking putative causes to observed effects i.e. understanding causal mechanisms . who benefits from integration and in what ways ( what definitions are there of
success ) ? this will identify how benefits are distributed and with what implications for equality .
what resources are required to make integration succeed and how can these be efficiently used ?
this will identify the descriptive categories of costs , establishing their dimensions , estimating overall costs , and suggesting how generalisable these findings might be .
the living document will help identify what types of costs become apparent at various stages of development of a project . how the development of integrated care is facilitated or impeded by other current policies , e.g. payment by results , practice - based commissioning etc . from these analyses , we aim to identify what policies and practices are most suitable ( i.e. fit for purpose and likely to deliver the intended outcome ) ; most feasible ( i.e. capable of being implemented given the existing architecture of delivery and accountability ) ; and most acceptable ( i.e. likely to generate the support of the people who use services , clinicians and other professionals , managers and the wider public ) .
there will be three key data collection methods : semi - structured interviews with professionals and patients / service users , documentary analysis , non - participant observation of meetings . the qualitative data collection in the deep dive sites
will also be used to collect data for the economic analysis ( see below ) .
interviews with staff will concentrate on the experience of delivering care , interactions with other professional groups and organizations within the integrated care pilot , and understanding of implications for the wider care system .
interviews with patients and users will focus on the patient / user journey and experience and its relationship to changes in the integrated care pilots .
in analysing data on service utilisation , we will focus principally on hospital admissions as a key variable , as many of the sites have a focus on reducing such admissions .
data will be taken from hospital episode statistics ( he s ) , both for outpatient referrals , accident and emergency attendances and inpatient stays .
these will enable analyses of changes in a number of measures of hospital use including overall rates of emergency admissions , admissions for ambulatory sensitive conditions ( see annex 2 ) , and length of stay .
we derived the list of ambulatory sensitive conditions from ahrq and purdy et al . .
information will be available for the individuals enrolled in any intervention , and also for the whole populations of general practices which are participating in the integrated care pilot .
the data will be at person level but anonymised so that the research team can not identify sensitive personal information or individual identities .
the nhs information centre for health and social care will act a trusted third party to handle any confidential information and create the anonymised linked fields for use by the research team .
one of the key challenges in undertaking analyses of changes in hospital use for complex interventions is that individuals may be selected for an intervention because they have a high use of health services .
the problem is that any subsequent fall in utilisation in this group may simply be due to regression to the mean that is people reverting to a normal level of use irrespective of the intervention .
one way round this is to use an approach that allows us to standardise for differences in the risk of future admissions .
first , we will assess the impact of the intervention on individuals enrolled in the integrated care pilots .
information on the prior patterns of diagnoses and hospital utilisation will be used to stratify cases according to the risk of admission .
the actual level of utilisation before and after the agreed starting point in each pilot will be compared . in this way
we will be able to track levels of hospital use for cohorts of people for 23 years before they became part of the pilot .
these control cases will be matched on a number of variables including risk of admission ( or other hospital use ) ; major diseases recorded ; history of hospital use ; and characteristics of the area of residence , such as levels of deprivation .
trends in hospital use within the groups of selected control cases will then be used as a test of observed differences in those enrolled in the integrated care pilots .
second , we will quantify the effect of the interventions on wider groups of patients ( e.g. practice populations ) by matching utilization data to that from to similar practice populations in national he s datasets .
the population level analysis will assess whether the intervention might not only have an impact on individual patients but also upon the wider population .
both of these approaches to analysis are required as there might be an impact of the interventions on individuals ( e.g. a reduction in admissions ) which could not be demonstrated in the wider population .
this might be because resources were simply redistributed between groups at equal risk of admission , or because the numbers enrolled in the pilots were too small to show an effect on the wider population .
sample size calculations suggest that few of the integrated care pilot sites will enroll sufficient numbers for data from individual sites to be analysed .
we therefore intend to pool data from sites which have similar aims and are providing broadly comparable interventions .
it is not possible to say which sites will provide data that can be pooled , as all sites are still developing their interventions .
however , it looks likely , for example , that several sites will be using a form of case management of high - risk patients with the aim of reducing hospital admission , and we will be able to pool data from such sites . data will also be analysed on primary and social care utilisation ( from patient questionnaires ) . however , these data are being collected primarily for the economic analysis , as none of the sites has reduction in primary care utilisation as their main goal .
our analysis strategy is built around a generalized difference - of - differences regression approach at the person level .
regression models appropriate for each of the outcome measures ( e.g. emergency admissions ) will be developed .
these may be poisson models , negative binomial models , or gamma models as required by the form of the measure .
each individual will contribute one or more time periods to the dataset in both the pre- and post - intervention periods .
these models will use covariates including basic demographics and historical utilization to control for potential differences between the intervention and control cases .
person level random effects will also be included in the models to adjust standard errors for the repeated measures within person .
in addition to the traditional covariate adjustment in the difference - of - differences model we will use propensity score based methods . in a combined dataset of intervention cases and
non - intervention controls a propensity score model will be fitted that uses available covariates to predict intervention vs. control status .
we may also use the propensity scores to produce analysis weights which can be combined with covariate adjustment to support
doubly robust estimation combined with difference - of - differences modeling will provide intervention effect estimates that control for both observed differences between intervention and control groups as well controlling for unobserved but fixed person characteristics .
the aim of identifying risk - matched controls and using propensity score analysis is to allow so far as possible for unmeasured patient and system effects and therefore to increase our ability to draw conclusions about likely cause and effect from what inevitably remains observational data .
we are conducting two surveys to assess the experience of service users in 11 of the 16 pilots .
the survey is being administered in autumn / winter 2009 and will be repeated on the same sample of service users in autumn 2010 .
the questionnaire was developed using the intended outcomes identified by pilot sites in their applications to join the scheme .
this identified a number of domains which were common to most pilots and were therefore included in the questionnaire .
frequency of certain critical events ( notes unavailable , test duplicated , wrong medication or wrong dose of medication prescribed , no follow - up arrangements after hospital discharge ) .
in addition , a question on service usage was included to contribute to the analysis of health service costs ( see below ) .
the questionnaire is available from the authors . in selecting items to represent these domains , we drew questions were possible from existing validated instruments .
in particular we drew a substantial number of questions from the english national gp patient survey which is currently sent annually to 5.5 million randomly sampled patients ( www.gp-patient.co.uk ) . by matching the socio - demographic and health questions to this survey also , we will be able to conduct a difference in differences analysis with individual control patients drawn from responders to the national survey . for five pilot sites it was not appropriate to collect patient information using this questionnaire because of the nature of the intervention and/or the population group targeted by the intervention ( for example
questionnaires are being sent to up to 500 service users in each site . where the site has identified more that 500 service users by autumn 2009 , a random sample of 500 will be taken . where fewer than 500 service users have been identified by march 2010
where a site is enrolling patients / service users sequentially during autumn 2009/spring 2010 , all patients receive a questionnaire until 500 have been enrolled .
those individuals who receive a questionnaire in autumn 2009/spring 2010 will receive a second questionnaire in autumn 2010 .
for all service users , the site identifies the start data of any intervention , so that we can determine whether questionnaires returned have been completed before or after the start of the intervention .
we are conducting two cross - sectional staff surveys within the 16 pilot sites , involving health and social care staff ( including community nurses , gps and social workers ) , in spring 2010 , and repeated in spring 2011 .
the staff questionnaire has substantial sections for free text to allow staff to describe their experience of the pilot in more detail , and these sections will be transcribed for qualitative analysis .
the questionnaire includes sections on : job changes since the introduction of the integrated care pilot . perceived changes to the care that patients / service users receive .
the first are staffs who are closely involved in the development of the pilot ( e.g. employed by the pilot ) .
the additional 3545 will be sent to stratified random samples of practitioners whose work might be altered by the pilot
the first is to estimate costs in order to provide decision - makers in the health and social care systems with a basis for understanding the categories and potential range of costs associated with the integrated care pilots .
this will provide a sense of how much the approach might cost if it were implemented elsewhere . an important part of this will be through data collection in the deep dive sites where we will use the logic model , process maps , key informant interviews , and documentary evidence to produce estimates of the costs of providing integrated care .
this will enable us to identify the categories of cost and the scale of resources required to deliver different models of integration .
we aim to produce a clear understanding of the main categories of cost ( staff by grade , equipment , building , travel etc . ) , the likely range of costs within each category , and subsequently estimate best , worst and most likely case scenarios .
we will also distinguish between set - up costs and running costs , although in a fluid , adaptive and improving system it may be difficult to draw this distinction .
for both of these we need to distinguish between the costs associated with participating in the dh programme ( including , for example , participation in events , reporting , contributing to the national evaluation ) and the costs solely required to deliver the integrated care programme .
we also aim to gather data through time that can show how costs have altered in response to actual service delivery or in order to overcome changing circumstances etc .
we propose only to look at costs internal to the health and social care system ( including private sector partners ) but we will be aware that costs could potentially be externalised onto service users and carers and we will ask service users and staff to comment on their sense of the types and magnitudes of these costs . across the integrated care pilots where we are collecting quantitative data on hospital utilisation , data on hospital admissions and length of stay will be costed using standard nhs costs , and included in the controlled difference in differences analysis described in above .
selecting evaluation frameworks always involves a degree of compromise to meet conflicting demands within a finite budget .
we have opted to balance the collection of data from across all the pilots with more detailed data from six deep dive sites .
we have also opted to focus the evaluation on what the pilots themselves told us they were seeking to achieve .
the benefit of this is that we will be in a position to provide an evaluation which is grounded firmly in what the pilots are seeking to do .
however , it also means that some theoretical propositions will be under - explored and that attention may be directed more towards intended outcomes than unintended outcomes .
however , we are satisfied that this risk is managed by independent data collection ( for example on service utilisation , service user surveys and staff surveys ) and by the iterative way of working with those responsible for running each project . in planning to assess the evidence produced by this evaluation , we have been influenced by the principles of realistic evaluation in which the mechanism ( the intervention ) acts in context to produce the outcome . if there is a single lesson from previous evaluations of attempts to integrate or coordinate care , it is that the context in which an intervention is introduced is crucially important to its success or failure .
so , in this evaluation , we have committed substantial resources to the qualitative evaluation , knowing that these analyses will be critical to interpreting the results of quantitative analyses .
our approach is to understand not only the dose , frequency and effect but to identify the way pilots learn , respond and evolve and to take into account the expectations and motivations of staff and patients to understand how complex and evolving projects might have lessons for others seeking to do related things in different contexts .
policy makers , professionals , managers , carers and patients are all part of an emergent process
. we do not expect to measure precisely all effects but we do expect to understand the likely scope of benefits and the scale of efforts required , to contribute to the analysis of health service interventions and so reduce decision - makers uncertainties about integrated care .
this evaluation will produce a portfolio of evidence including interviews , surveys , cost estimations and service utilisation data aimed at strengthening the evidence base for integrated care , and in particular identifying the context in which interventions are likely to be effective .
these data will support a series of evaluation judgements but it is important to recognise that they can not be arrived at by simple aggregation of data .
rather , the process locates the new data within the existing body of research and forms judgements about what is added and how compelling this additional evidence is , thus reducing uncertainties about the role of integrated care in improving the efficient and effective delivery of healthcare .
julius centre for patient oriented research , the university medical centre utrecht , the netherlands nick goodwin , phd , senior fellow , policy directorate , king 's fund , london , uk ingrid mur , dr .
( associate professor ) , department of health organisation , policy and economics ( h.o.p.e . ) , faculty of health sciences , university of maastricht , the netherlands | backgroundin response to concerns that the needs of the aging population for well - integrated care were increasing , the english national health service ( nhs ) appointed 16 integrated care pilots following a national competition .
the pilots have a range of aims including development of new organisational structures to support integration , changes in staff roles , reducing unscheduled emergency hospital admissions , reduced length of hospital stay , increasing patient satisfaction , and reducing cost .
this paper describes the evaluation of the initiative which has been commissioned.study design and data collection methodsa mixed methods approach has been adopted including interviews with staff and patients , non - participant observation of meetings , structured written feedback from sites , questionnaires to patients and staff , and analysis of routinely collected hospital utilisation data for patients / service users .
the qualitative analysis aims to identify the approaches taken to integration by the sites , the benefits which result , the context in which benefits have resulted , and the mechanisms by which they occur.methods of analysisthe quantitative analysis adopts a difference in differences approach comparing health care utilisation before and after the intervention with risk - matched controls .
the qualitative data analysis adopts a theory of change approach in which we triangulate data from the quantitative analysis with qualitative data in order to describe causal effects ( what happens when an independent variable changes ) and causal mechanisms ( what connects causes to their effects ) .
an economic analysis will identify what incremental resources are required to make integration succeed and how they can be combined efficiently to produce better outcomes for patients.conclusionthis evaluation will produce a portfolio of evidence aimed at strengthening the evidence base for integrated care , and in particular identifying the context in which interventions are likely to be effective .
these data will support a series of evaluation judgements aimed at reducing uncertainties about the role of integrated care in improving the efficient and effective delivery of healthcare . |
alzheimer 's disease ( ad ) is a progressive neurodegenerative disease that is characterized by memory loss and personality changes .
the age of onset in ad may vary widely and this is the basis for the classification into early- and late - onset , with 60 or 65 yr being the usual cutoff point ( 1 , 2 ) .
there are currently three known causative genes in early - onset ad ( eoad ) : the amyloid precursor protein gene ( app ) on chromosome 21 at 21q21.1 ( 3 ) ; the presenilin-1 gene ( psen1 ) on chromosome 14 at 14q24.3 ( 4 ) ; and the presenilin-2 gene ( psen2 ) on chromosome 1 at 1q42.1 ( 5 , 6 ) .
in addition , the apolipoprotein e ( apoe ) 4 allele has been reported to be a susceptibility gene for the development of familial and/or sporadic early- and late - onset ad ( 7 - 9 ) .
mutations in the psen1 gene account for 18 - 55% of familial eoad ( 1 , 10 ) .
psen2 mutations are much rarer causes of familial eoad with 19 families being reported , including the volga - german kindred where a founder effect was demonstrated ( 1 , 2 , 5 , 6 , 11 ) .
twenty - seven different app mutations have been reported in 74 families and all mutations are clustered in or adjacent to the amyloid ( a ) peptide sequence , the major component of the amyloid plaques ( 12 ) .
psen1 mutations , along with app mutations , are believed to be pathogenic by altering app processing to change the a40:a42 ratio ( 13 , 14 ) . in the korean population
, there has been only a single report on a mutation in the psen1 gene in a pedigree of a 36-yr - old familial ad ( 15 ) . in this study ,
mutation analysis of the app , psen1 , and psen2 genes was performed to determine the contribution of these genes in the genetic background of eoad patients in korea .
six patients were evaluated by a neurologist and were diagnosed of having ad according to the national institute of neurological and communicative disorders and stroke - alzheimer 's disease and related disorders association ( nincdsadrda ) criteria ( 16 ) .
computed tomography ( ct ) , magnetic resonance image ( mri ) , and/or positron emission tomography ( pet ) were performed to rule out other causes of dementia .
a family history was obtained from the patients or their relatives . after obtaining informed consent , screening for mutations in the app , psen1 , and
all coding exons and their flanking intronic sequences were analyzed for psen1 and psen2 genes but selected exons ( exons 16 and 17 ) were tested for app .
genomic dna was extracted from peripheral blood leukocytes using a wizard genomic dna purification kit according to the manufacturer 's instructions ( promega , madison , wi , u.s.a . ) .
each exon was amplified by polymerase chain reaction ( pcr ) using the primers designed by the authors ( available on request ) .
direct sequencing was performed using a bigdye terminator cycle sequencing ready reaction kit ( applied biosystems , foster city , ca , u.s.a . ) on an abi prism 3100 genetic analyzer ( applied biosystems ) .
apoe genotyping was performed with a commercial kit using the multiplex amplification refractory mutation system ( bio - core apoe kit , bio - core , seoul , korea ) .
six patients were evaluated by a neurologist and were diagnosed of having ad according to the national institute of neurological and communicative disorders and stroke - alzheimer 's disease and related disorders association ( nincdsadrda ) criteria ( 16 ) .
computed tomography ( ct ) , magnetic resonance image ( mri ) , and/or positron emission tomography ( pet ) were performed to rule out other causes of dementia .
after obtaining informed consent , screening for mutations in the app , psen1 , and psen2 genes were performed in the patients with eoad .
all coding exons and their flanking intronic sequences were analyzed for psen1 and psen2 genes but selected exons ( exons 16 and 17 ) were tested for app .
genomic dna was extracted from peripheral blood leukocytes using a wizard genomic dna purification kit according to the manufacturer 's instructions ( promega , madison , wi , u.s.a . ) .
each exon was amplified by polymerase chain reaction ( pcr ) using the primers designed by the authors ( available on request ) .
direct sequencing was performed using a bigdye terminator cycle sequencing ready reaction kit ( applied biosystems , foster city , ca , u.s.a . ) on an abi prism 3100 genetic analyzer ( applied biosystems ) .
apoe genotyping was performed with a commercial kit using the multiplex amplification refractory mutation system ( bio - core apoe kit , bio - core , seoul , korea ) .
the mean age of onset was 43.6 yr ( range , 34 to 62 yr ) , and all patients except patient 3 had a family history of dementia ( fig .
patient 1 was diagnosed as definite ad by a neuropathology study that showed neuritic plaque , amyloid deposits and neurofibrillary tangles in the brain .
pet imaging of the glucose metabolism in all patients except patient 4 revealed severe hypometabolism in all patients ( fig .
an eeg study was done in patients 1 and 2 and mild to moderate diffuse cerebral dysfunction was observed .
two different mutations of the psen1 gene were detected ( g206s and m233 t ) in patients 3 and 2 with an age of onset of 34 and 35 yr , respectively . in the app gene ,
one mutation was detected ( v715 m ) in patient 1 with the age of onset of 41 yr . all were missense mutations and have been described previously .
psen2 gene analysis was performed in three patients without a mutation within either psen1 or app , but no mutation was detected .
two of them carried the apoe 4/4 allele , and their age of onset was relatively late ( 62 and 55 yr ) compared with the mutation positive patients and had affected families with late - onset ad .
after identification of psen1 and app mutations in the patients , we tried to perform genetic analysis in the family members of the patients but failed due to either absence of living affected relatives or refusal of genetic analysis .
the mean age of onset was 43.6 yr ( range , 34 to 62 yr ) , and all patients except patient 3 had a family history of dementia ( fig .
patient 1 was diagnosed as definite ad by a neuropathology study that showed neuritic plaque , amyloid deposits and neurofibrillary tangles in the brain .
pet imaging of the glucose metabolism in all patients except patient 4 revealed severe hypometabolism in all patients ( fig .
an eeg study was done in patients 1 and 2 and mild to moderate diffuse cerebral dysfunction was observed .
two different mutations of the psen1 gene were detected ( g206s and m233 t ) in patients 3 and 2 with an age of onset of 34 and 35 yr , respectively . in the app gene ,
one mutation was detected ( v715 m ) in patient 1 with the age of onset of 41 yr . all were missense mutations and have been described previously .
psen2 gene analysis was performed in three patients without a mutation within either psen1 or app , but no mutation was detected .
two of them carried the apoe 4/4 allele , and their age of onset was relatively late ( 62 and 55 yr ) compared with the mutation positive patients and had affected families with late - onset ad .
after identification of psen1 and app mutations in the patients , we tried to perform genetic analysis in the family members of the patients but failed due to either absence of living affected relatives or refusal of genetic analysis .
in this study , we found two mutations in the psen1 gene , g206s and m233 t , and one mutation in the app gene , v715 m , in three unrelated korean patients .
the v715 m mutation in the app gene is the first mutation identified in this gene in korean patients with eoad .
this mutation was previously detected in a french family and the age of onset of the proband in the french family was 41 yr , which is same as the onset age in our patient ( 10 ) .
in addition , the other family members ( two paternal uncles ) developed dementia at ages 52 and 60 , respectively .
however , the family members of our patient ( the father and one paternal uncle ) developed ad earlier at ages 45 and around the 5th decade , respectively .
the g206s mutation in the psen1 gene has been reported in two families ( 17 , 18 ) , and their age of onset was 30 to 35 yr , which is similar to that in our patients .
the m233 t mutation was previously identified in french and australian families with 3 - 5 affected individuals in each family and the mean age of onset of 35 yr ( 10 , 17 , 19 ) . and
, it is of note that our patient showed rapidly progressive course by worsening the korean mini - mental state examination ( k - mmse ) score from 20 at 2 yr after the first symptom into 4 at 2 yr later , which might be due to the presence of the apoe 4 allele .
no mutations in the psen1 , psen2 , and app genes were found in 3 patients .
interestingly , the age of onset in these patients was more than 20 yr later ( 55 - 62 yr old ) than those with identified mutations ( 34 - 42 yr old ) .
two of the three patients were homozygous carriers for apoe 4 allele that could be classified into the ad type 2 ( mim 104310 ) . in a korean population , it is reported that the frequency of apoe 4 allele is 0.09 - 0.128 ( 20 - 22 ) and that of genotype 4/4 was as low as 0.006 - 0.009 ( 20 , 21 , 23 ) . up to now , 27 mutations of the app gene , 159 mutations in the psen1 gene , and 11 mutations in the psen2 gene have been reported in eoad worldwide ( www.molgen.ua.ac.be/admutations ) . in previous reports , mutational analysis of three genes in 96 autosomal dominant eoad families led to the conclusion that 77% of cases in these families could be attributed to mutations within the psen1 and app genes ( 10 , 17 , 24 ) .
in korea , there was only one report of genetically confirmed case of eoad ( 15 ) .
however , although the number of study subjects was small , this study shows that psen1 or app gene mutations exist in other korean patients with eoad and few reports on the eoad patients confirmed by genetic analysis might be due to under - utilization of genetic tests .
therefore , we suggest that screening for psen1 and app gene mutations should be provided in korean patients with eoad , especially in patients with age of onset < 55 , not only for the molecular diagnosis of the patients but also for the appropriate genetic counseling of the patients and their family members . in addition , apoe genotype might be also important to rule out familial ad in koreans . | although mutations in three genes , amyloid precursor protein ( app ) , presenilin 1 ( psen1 ) , and presenilin 2 ( psen2 ) , have been identified as genetic causes of early - onset alzheimer 's disease ( eoad ) , there has been a single report on a psen1 mutation in koreans . in the present study
, we performed a genetic analysis of six korean patients with eoad .
direct sequencing analysis of the app , psen1 and psen2 genes revealed two different mutations of the psen1 gene ( g206s and m233 t ) and one mutation of the app gene ( v715 m ) in three patients with age - at - onset of 34 , 35 , and 42 yr , respectively .
in addition , two patients with age - at - onset of 55 and 62 yr , respectively , were homozygous for apoe 4 allele .
one woman had no genetic alterations .
these findings suggest that psen1 and app gene mutations may not be uncommon in korean patients with eoad and that genetic analysis should be provided to eoad patients not only for the identification of their genetic causes but also for the appropriate genetic counseling . |
neovascular glaucoma ( nvg ) complicated by vitreous hemorrhage ( vh ) is commonly caused by retinal ischemia secondary to central retinal vein occlusion ( crvo ) , branch retinal vein occlusion ( brvo ) , and/or proliferative diabetic retinopathy ( pdr ) [ 13 ] .
vision can be severely affected by nvg , which often causes permanent damage to the optic nerve secondary to high intraocular pressures associated with angle closure .
hypoxia caused by crvo , brvo , and pdr induces production and release of vascular endothelial growth factor ( vegf ) and inflammatory mediators .
these neovascular vessels are leaky and fragile and can cause vh and nvg and are also associated with leakage of inflammatory molecules which can cause macular edema .
nvg is one of the most recalcitrant glaucoma types to treatment and has one of the worst outcomes of the many types of glaucoma .
the standard of early treatment once nvg occurs is panretinal photocoagulation ( prp ) , which destroys ischemic retina and decreases the production of proangiogenic factors such as vegf .
glaucoma drainage implants , trabeculectomy with mitomycin c , cyclocryotherapy , or diode laser coagulation of the ciliary body is another treatment option available for the treatment of recalcitrant and end - stage nvg [ 46 ] .
pars plana vitrectomy ( ppv ) combined with glaucoma drainage implantation can produce good control of intraocular pressure ( iop ) in nvg patients with pdr [ 7 , 8 ] .
antivascular endothelial growth factor ( anti - vegf ) molecules have been used for many ocular diseases , including nvg .
a number of studies have evaluated the use of anti - vegf agents as stand - alone or adjunctive treatment for nvg .
iop lowering surgery combined with prp or intravitreal injection of anti - vegf antibodies aids in regression of neovascularization and stabilization of vision [ 10 , 11 ] .
the optimal approaches to treating nvg with vh are to provide patients with an individualized management plan according to etiology , stage of disease , and visual potential among other factors .
ppv combined with prp can reduce the occurrence of nvg and increases visual acuity ( va ) in crvo with vh . in this retrospective study , we investigated the long term surgical outcomes , including va and iop of nvg eyes complicated with vh , after treatment with 23-gauge vitrectomy combined with phacoemulsification , prp , and trabeculectomy without use of anti - vegf agents .
we suggest that this is an effective method for the treatment of nvg induced by retinal vessel occlusion and pdr .
the study was approved by tianjin medical university general hospital medical ethics committee and complies with the declaration of helsinki , including current revisions , and with the good clinical practice guidelines .
the procedures followed were in accordance with institutional guidelines ; all the subjects provided their written informed consent for sampling according to the declaration of helsinki .
eighteen eyes of 18 consecutive patients who had nvg and vh underwent 23-gauge vitrectomy combined with phacoemulsification , prp , and trabeculectomy without use of anti - vegf agents from january 2012 to june 2014 .
the age ranged from 58 to 76 years with a mean of 62 6 years .
three patients were with hypertension , 7 patients were with diabetes mellitus complicated with hypertension , and 8 patients were with diabetes mellitus complicated with renal failure .
eight eyes had a history of crvo , 6 eyes had pdr complicated with brvo , and 4 eyes had pdr alone ( table 1 ) .
the rubeosis iridis conditions were present in 18 nvg eyes preoperatively ( figure 1 ) .
the preoperative iop ranged from 38 to 64 mmhg with a mean of 54 8 mmhg .
the average follow - up was 14.5 3 months with a range from 12 to 24 months .
eyes with a prior history of intravitreal injection of steroids or anti - vegf agents , vh without retinal vessels occlusion and pdr , ocular trauma , ocular tumors , and corneal opacity precluding prp , or cataract extraction before nvg was diagnosed were excluded .
pre- and postoperative examinations included va , slit - lamp examination , gonioscopy , indirect ophthalmoscopy , iop , and b - scan .
the eye received retrobulbar and peribulbar 2% lidocaine for anesthesia , and the eye was then prepared for a standard three - port 23-gauge vitrectomy .
after the infusion cannula was placed , the cataract was extracted by phacoemulsification through a clear corneal incision approach .
the posterior capsule was preserved in 10 eyes and was completely resected in 8 eyes . during ppv ,
posterior hyaloid separation was induced by suction using the vitreous cutter over the optic nerve head in eyes without posterior vitreous detachment . in each case , the meticulous shaving of the vitreous base under a wide - angle viewing system with assisted sclera depression was performed to remove as much residual blood as possible . after the vh was completely removed , any fibrovascular tissue present was removed using the microvitrector tip .
hemostasis was maintained by raising the iop through the infusion fluid or by using endodiathermy intraoperatively .
prp was performed in all eyes , and subsequent peripheral retinal cryotherapy was given only in severe nvg eyes during the surgery . a 4
3 mm lamellar sclera flap was created in the superior region to the limbal border , and then a mitomycin c trabeculectomy was performed .
postoperative examinations were completed at 1 , 2 , and 3 days , 1 , 2 , 3 , and 12 weeks , and 1 year after the surgery .
paired student 's t - test was used to analyze changes in pre- and postoperative iop .
after the combined surgery , the conjunctival incisions healed well , and the conjunctival flap was formed significantly .
rubeosis iridis has regressed in all eyes 1 week postoperatively ( figure 1 ) . at the final follow - up
the postoperative va increased in 14 eyes with the bcva ranging from 0.02 to 0.4 and was stable relative to the preoperative vision in 4 eyes at the final follow - up .
the bcva significantly increased within three months postoperatively compared with the preoperative bcva ( p < 0.05 ) and then remained stable ( p > 0.05 ) .
the mean iop was 12 3 mmhg , 15 2 mmhg , 16 3 mmhg , 23 5 mmhg , 28 4 mmhg , 22 5 mmhg , 17 3 mmhg , and 19 4 mmhg at 1 , 2 , and 3 days , 1 , 2 , 3 , and 12 weeks , and 1 year , postoperatively .
the iop was significantly lower at three months compared to the preoperative baseline iop ( p < 0.05 ) and then remained stable to the final follow - up ( p > 0.05 ) ( figure 3 ) .
iop was not in normal range in 8 eyes 1 month postoperatively , and 2% carteolol hydrochloride was used twice a day for 1 month in 5 eyes and combined with brinzolamide 3 times a day for 1 month in 3 eyes for making iop to normal range .
postoperative complications mainly included fibrosis exudates in the anterior chamber ( 7 eyes ) , temporary iop elevation at 2 weeks postoperatively ( 2 eyes ) , and postoperative suprachoroidal hemorrhage ( 1 eye ) .
a cyclodestructive method or glaucoma drainage surgery is frequently the final option for treatment of severe nvg , but the postoperative va rarely increases , and iop is sometimes poorly controlled after aggressive treatment [ 4 , 5 ] .
we treated nvg using 23-gauge vitrectomy combined with phacoemulsification , prp , and trabeculectomy without use of anti - vegf agents and obtained predictable results .
nvg develops secondary to extensive ischemic retinal changes , such as occurring with pdr and crvo . in crvo , when the retinal vein is occluded , the ischemic retina releases vegf and inflammatory cytokines into the vitreous cavity , posterior chamber , anterior chamber , and anterior chamber angle .
the vegf in the anterior chamber stimulates neovascularization of the iris and the angle , restricts aqueous outflow , and results eventually in the development of nvg .
wakabayashi et al . reported high intraocular vegf level at the time of primary vitrectomy in patients with pdr , which was identified as a significant risk factor for postoperative early vh .
goto et al . reported that the risk factors for nvg after vitrectomy in eyes with pdr are independently associated with male sex , younger age , higher baseline iop , preoperative neovascularization in the angle , and nvg in the fellow 's eye . in this study , 8 patients had hypertension complicated with crvo , 6 patient had hypertension complicated with brvo , and 4 patients had pdr .
therefore , the main reason resulting in nvg was either crvo or brvo . in our experience , nvg caused by crvo or brvo occurs more quickly than by diabetic retinopathy . in patients with crvo or brvo , the observation of iop , rubeosis irides , and retinal neovascularization should be emphasized , and prp should be performed for decreasing the risk of developing nvg .
phacoemulsification , vitrectomy , prp , and trabeculectomy were adopted to treat nvg complicated with vh according to the different treatment mechanisms .
phacoemulsification to remove a cataract can improve the view so vitrectomy and prp can be performed more easily . in patients without a posterior capsule preserved after phacoemulsification , the postoperative iop may be lowered significantly because of the free communication of aqueous humor between the anterior chamber and vitreous cavity .
however , postoperative suprachoroidal hemorrhage occasionally occurred because of sudden decrease of postoperative iop or simultaneously ocular trauma . in this study , 1 eye without posterior capsule preservation developed suprachoroidal hemorrhage because of ocular trauma 3 days postoperatively and were treated with drainage of suprachoroidal hemorrhage through sclerotomies and placement of 30% c3f8 into the vitreous cavity .
the benefits of vitrectomy for nvg complicated by vh are as follows : ( 1 ) vitrectomy removes vh and clears the vitreous cavity which can increase va , ( 2 ) vitrectomy removes and may reduce the expression of vegf , which is a vital factor for neovascularization , ( 3 ) vitrectomy to remove vh can prevent hemolytic or ghost cell glaucoma , and ( 4 ) prp can be performed completely and easily after ppv . in nvg with vh , performing complete prp is often difficult even in cases with minimal vh .
prp , the standard of care for treating nvg in ischemic crvo and pdr , decreases oxygen consumption and production of vegf and aids in the regression of rubeosis irides . in patients with previous partial retinal laser treatment , additional laser photocoagulation
can be performed intraoperatively because it is conducted under anesthesia and patient feels no or minimal pain which allows for more complete prp along with the greater peripheral retinal view for additional prp .
rubeosis iridis does not regress immediately after prp , and effect on iop can be minimal or delayed after prp .
therefore , in patients with open angle nvg , trabeculectomy is effective in decreasing the iop temporarily as , in patients with angle closure nvg , trabeculectomy is used to decrease the iop for a longer term . in recent years ,
anti - vegf agents have been widely applied for the treatment of ischemic retinopathy , including retinal vessel occlusion and pdr .
anti - vegf agents used in pdr can reduce intra- and postoperative hemorrhage associated with the surgical removal of vh .
although very little information about the role of anti - vegf treatment in nvg complicated with vh exists , trabeculectomy combined with injection of anti - vegf agents into the vitreous body for nvg has been documented .
however , the long term effect of decreasing the iop does not appear to be significant compared with trabeculectomy alone .
anti - vegf agents can cause temporary regression of iris neovascularization , but the long term use for anti - vegf agents for nvg is not as clear as it is for age - related macular degeneration .
additionally , long term use of anti - vegf agents for nvg can be very expensive .
treated nvg with vitrectomy combined with prp , direct laser coagulation of ciliary processes , and silicone oil tamponade .
the iop normalized in 59% of eyes at 6 months postoperatively and in 72% of eyes after 1 year .
chuang et al . reported 56 eyes with crvo complicated by vh which underwent ppv combined with prp , and the most important result was a lower incidence of nvg development and va improvement .
reported ppv combined with lensectomy with anterior capsule preservation , endophotocoagulation , and silicon oil tamponade for nvg .
the iop decreased from 29 19 mmhg to 17 6 mmhg 1 year postoperatively with a success rate of 69.2% .
luttrull and avery reported the treatment of nvg with vitrectomy combined with pars plana glaucoma drainage implant , and all patients had normal iops 1 year postoperatively .
wallsh et al . reported pars plana placement of ahmed valved glaucoma drainage implants in combination with ppv in the treatment of nvg .
jeong et al . reported pars plana ahmed gdi placement combined with 23-gauge vitrectomy for nvg in dr , and iop decreased from 35.9 6.3 mmhg to 13.3 3.2 mmhg at the last visit .
reported the effect of intravitreal bevacizumab injection before ahmed glaucoma valve implantation in nvg and the surgical success rate was 79% . in this study ,
the iop was normal in 71.4% during postoperative follow - up , and the neovascularization of the iris disappeared in all eyes .
preoperative use of bevacizumab may be to have a better result when our combined surgery is not practical or feasible . in conclusion ,
vitrectomy combined with phacoemulsification , prp , and trabeculectomy without use of anti - vegf agents is a safe and effective method in treating nvg complicated with vh . in some cases ,
this combined surgery may be considered as a first treatment option for nvg complicated vh , and the long term effects of the combined surgery should be investigated . | purpose . to evaluate the outcomes of 23-gauge vitrectomy combined with phacoemulsification , prp and trabeculectomy without use of anti - vegf - agents for nvg
. methods .
eighteen eyes of 18 patients with nvg underwent 23-gauge vitrectomy combined with phacoemulsification , prp and trabeculectomy without use of anti - vegf agents .
the preoperative bcva ranged from light perception to 0.2 .
the preoperative iop ranged from 38 mmhg to 64 mmhg with a mean of 54 8 mmhg .
the average follow - up time was 14.5 3 months with a range from 11 to 24 months .
results .
the postoperative va increased in 14 eyes and was stable in 4 eyes at the final follow - up .
the mean iop was 12 3 mmhg at postoperative day 1 .
the mean iop was 15 2 mmhg , 16 3 mmhg , 23 5 mmhg , 28 4 mmhg , 22 5 mmhg , 17 3 mmhg , and 19 4 mmhg at postoperative days 2 and 3 , 1 , 2 , 3 , and 12 weeks , and 1 year postoperatively , respectively , with a range from 10 to 30 mmhg at the final follow - up time point of one year .
the iop was significantly lower than the preoperative one 12 weeks postoperatively ( p < 0.05 ) . conclusion .
23-gauge vitrectomy combined with phacoemulsification , prp , and trabeculectomy without use of anti - vegf - agents is a safe and effective method in treating nvg . |
one of the prominent challenges of the post - human - genome sequence era is to generate a detailed understanding of inheritable differences in the human genome .
structural and functional genetic differences in humans can take the form of single nucleotide polymorphisms ( snp ) , copy number variations ( cnvs ) , and epigenetic or gene expression modifications.[35 ] these inherited inter - individual variations in dna sequence contribute to phenotypic variation , influencing an individual 's anthropometric characteristics , risk of disease and response to the environment . characterizing genetic variation
may bring improved understanding of differential susceptibility to disease , differential drug response , and the complex interaction of genetic and environmental factors , which go to produce each phenotype .
studying outcomes due to inter - individual differences requires classifying human populations into genotypic or phenotypic cohorts .
using demographic background to cluster human populations according to phenotype - representing - genotype has proved challenging .
consequently , the design of large scale genotyping projects such as the international hapmap initiative , and their ( future ) applications illustrate the complexities and ambiguities associated with use of group labels in genomic research .
attempts to correlate phenotype characteristics associated with ethnicity , geographical division , or disease to genotypes have only had limited success .
using ethnicity or race as a basis for phenotypic variation is controversial ; no current approach to identifying phenotypes associated with haplotypes is considered adequate .
ayurveda , the traditional system of indian medicine , traditional chinese medicine and korean medicine all have well - defined systems of constitutional types used in prescribing medication bearing distinct similarities to contemporary pharmacogenomics .
an interdisciplinary approach integrating genomics and traditional medicine is therefore worth exploring as a search for phenotypes that may collectively be considered for genotyping .
this review summarizes research applying a genomic approach to investigate constitutional differences in various traditional systems of medicine from asia .
in its holistic foundation , ayurveda uses a threefold classification known as tridosha theory consisting of vata , pitta and kapha dosha for determining a person 's mind - body classification .
tridosha theory introduces principles known as vata - related to motion , pitta - related to metabolism and kapha - related to lubrication and structure , to classify phenotypic groupings .
elements of vata , pitta and kapha are present in all people , but with differing degrees of predominance .
vata ( v ) has kinetic functions , and is manifested in mental functions such as enthusiasm , concentration etc . and physical functions such as respiration , circulation , voluntary actions etc . in modern physiology ,
mental functions such as intelligence , clear conception and physical phenomena like digestion ; assimilation , heat production , hormones , enzymes and metabolism are attributed to pitta ( p ) .
kapha ( k ) manifests in mental functions such as courage , and bodily functions such as tissue building , body strength , immunity , resistance and anabolic activity .
v , p and k constitute regulatory systems respectively controlling input / output , turnover and storage making them universal properties of all living systems .
doshas are fundamental regulatory principles responsible for maintaining organism functioning and manifesting those characteristics typifying each individual . in the natural state of equilibrium ,
all derived ayurvedic concepts concerned with physiology , pathology , diagnosis , prognosis , medicine and therapeutics , are based on the fundamental concepts of v , p , and k dosha phenotypes and their combinations at any given moment .
it is held to remain unaltered during the lifetime , having been mostly determined at conception , with contributions from environmental factors including maternal diet and lifestyle .
, the prakriti classification of an individual 's constitution is based on differences in physical , physiological and psychological characteristics , and is independent of racial , ethnic or geographical considerations .
many individuals can be categorized into one of the three extreme prakriti types , vata , pitta and kapha .
subtle combinations of the three v , p , k. prakriti types are as specific and individualized as the dna sequence - based genetic makeup .
prakriti specific treatment including medicine , diet and lifestyle is a distinctive feature of ayurveda .
we hypothesize that ( 1 ) prakriti has a genetic connotation that can provide a tool for classifying human populations based on broad phenotype clusters , and ( 2 ) the human phenome based on ayurveda can provide a genetic basis for the three major constitutions or prakriti .
better characterization of the human genome has improved the scientific basis for understanding individual variation .
permutations and combinations of v , p , k attribute characters along with other host factors such as tissue status ( dhatusarata ) , twenty gunas , digestive capacity and metabolic power ( agni ) , psychological nature ( manas prakriti ) , habitat ( desha ) , and season ( kaala ) , lead to sufficient numbers of variants to define a unique constitution for every individual .
the importance of such individual variations in assessing states of health and disease was underlined as an important basic principle by charaka some 4000 years ago : every individual is different from every other and should therefore be considered a different entity ; as many variations are there in the universe , all are seen in human beings .
the concept of prakriti plays a central role in understanding health and disease in ayurveda , in a very similar way to the pharmacogenetics that is expected to become the basis of designer medicine .
the fundamental principles of the ayurvedic system of medicine can be used to create designer medicines . identifying a genetic basis for
functionally , it will involve creating three organized databases capable of intelligently communicating with each other to give a customized prescription , human constitution ( genotype ) , disease constitution ( phenotype ) and drug constitution .
the golden triangle of ayurveda , modern medicine and modern science will converge to form a real discovery engine that can result in newer , safer , cheaper and effective therapies .
individuality , genotypes associated with phenotypes , and so classify human populations is therefore important .
current classification of human populations is broadly based on ethnicity ; geographical location , language or self reported ancestry .
however , such commonly used ethnic labels are inaccurate representations of genetic clusters , and do not reflect underlying genetic makeup . identifying specific phenotypic features and correlating them with genotypes constitutes the major program of phenomics .
however there is no consensus on how to define phenotypes , or which phenotypic features are to be included in the database .
ayurveda has been investigated for this purpose , based on the hypothesis that prakriti types ( v , p and k ) may offer phenotypic datasets suitable for analysis of underlying genetic variation . as a proof of concept ,
a first study evaluated 76 subjects both for their prakriti and hla drb1 types , finding significant correlations in support of it .
the study concluded that ayurveda based phenomes may provide a model to study multigenic traits , possibly offering a new approach to correlating genotypes with phenotypes for human classification .
to prove this hypothesis , more scientific exploration is required ; differential gene expression analysis using micro arrays to identify up and down regulated genes in major prakriti types .
such genes could be used for further analysis of dna polymorphism , snp analysis and gene expression in large populations of different ethnic groups .
the three major constitution types described in ayurveda have unique putative metabolic activities , k being slow , p fast , while v is considered to have variable metabolism .
we hypothesized that this might relate to drug metabolism and genetic polymorphism of drug metabolizing enzymes ( dme ) .
inter - individual variability in drug response can be attributed to polymorphism in genes encoding different drug metabolizing enzymes , drug transporters and enzymes involved in dna biosynthesis and repair .
poor metabolizer ( pm ) have high plasma concentration of the drug for longer periods and so retain drugs in the body for longer times .
extensive metabolizers ( em ) retain drugs in the body for the least time , plasma concentrations being high for shorter periods .
metabolic variability in different prakriti types was studied using the drug metabolizing enzymes cyp2c19/cyp2c9 gene polymorphism model .
the distribution of cyp2c19 and cyp2c9 genotypes was investigated in 132 healthy individuals of different prakriti classes .
em genotypes were predominant in p prakriti while pm genotypes were highest in k. it is interesting to note that * 1/*3 genotype specific to the extensive metabolizer group was present only in p , while the * 2/*3 genotype typical of the poor metabolizer group was observed in k as expected .
similarly , in case of gene polymorphism we observed that the occurrence of em genotypes was significantly higher in p prakriti .
our study thus demonstrated a probable genomic basis for metabolic differences attributable to prakriti , possibly providing a new approach to pharmacogenomics .
genome - wide expression and biochemical differences between ayurveda - based prakriti types have also been studied , revealing differentially expressed genes related to biological processes across different prakriti types . over - expression of genes related to immune response
was seen in pitta , whereas the vata group showed differences in expression of genes related to cellular processes .
a number of hub genes like tlr-4 , fas , and hla - dqb1 linked to complex diseases , and a few genes like dpyd , abcc1 , and ftl , associated with outcome of cancer treatment , were present in data - sets of genes differentially expressed among prakriti types . despite limitations like small sample size , objectivity in prakriti assessment , use of extreme prakritis and homogenous subject group
, this study provides evidence that differences exist across different extreme constitutional types at gene expression level .
an attempt was made to integrate ayurveda with functional genomics to identify pathways associated with activity of crude and active components of ashwagandha , a herb used in cancer treatment .
sasang constitution medicine ( scm ) is an integral part of traditional korean constitution - based medicine .
it recognizes four human constitutions : tae - eum , so - yang , so - eum , tae - yang , into which every human being is categorized , based on physical and physiological attributes .
although traditional korean medicine is influenced by traditional chinese medicine , scm emphasizes sociological as well as biological attributes in determining constitutional types .
symptomatic observation like healthy state , disease - specific symptoms , major diseases and common symptoms are integral parts of scm diagnosis .
individualized medicine is based on assumptions of variations in a. susceptibility to a particular pathological condition , and b. treatment response , similar to the way constitutional medicine is practiced in ayurveda .
assumptions include an invariant constitution determined at birth , specific criteria for identifying sasang constitution , and phenotypic variation predicting an underlying genetic basis for scm .
genome wide linkage analysis has identified genetic loci on chromosome 8q11.2223 and 11q22.13 , which include 14 labeled genes associated with sasang constitution . further examining the candidate gene loci would help to identify gene variations associated with particular sasang constitutions . to study association of genetic polymorphism in mdr1 with sasang constitution
, 270 individuals were genotyped for mdr1 c1236 t , mdr1 g2677t / a and c3435 t .
heterozygous mutants for mdr1 c1236 t ( c / t ) occurred with highest frequency for so - eum followed by so - yang .
this indicated that individuals with c / t genotype were more likely to be so - eum type . similarly in mdr1 g2677t / a polymorphism wild type allele g was found to be associated with tae - eum type .
these results are suggestive of diagnostic value of constitutional types , but further studies are required to examine the effect of these associations on drug metabolism and thus drug response . according to scm
, there is inter - individual difference in susceptibility of an individual to a particular disease and response to a drug .
an important finding of one study was that sasang constitution is an independent risk factor for diabetes .
prevalence of diabetes was higher in tae - eum ( 11.4% ) followed by so - yang ( 5.0% ) and so - eum ( 1.7% ) .
multiple regression showed that tae - eum individuals were at greater risk of developing diabetes than so - eum individuals .
angiotensin converting enzyme gene ( ace ) , a candidate gene for cerebral infarction , was studied in different sasang constitutions .
although there was no significant association between ace gene polymorphism and cerebral infarction , tae - eum has a higher susceptibility to cerebral infarction than other constitutions , so - eum seems to protect against cerebral infarction .
the unique characteristics of scm determination of constitution , based on physical , psychological , symptomatic observation , as well as constitution - based medicine , are in agreement with individualized medicine .
further studies using modern technology - based genetic approaches could help establish scm as an alternative to modern personalized medicine .
there are several similarities between ayurveda and traditional chinese medicine ( tcm ) including their holistic , individual classification systems .
similar to other constitutional medicines , differentiation of constitution is based on differences in physical , physiological and clinical observations .
tcm recognizes seven constitutions : normality , yin - deficiency , qi - deficiency , yang - deficiency , phlegm - wetness , wetness - heat , and blood stasis .
it assumes five elements in the material world , earth , water , fire , metal , and wood , movement between which is governed by two opposed qualities of chi energy , yin and yang . a human being is considered a connection between space and earthly elements , while individual health is determined by the state of equilibrium between the two energies , maintained by qi , blood , moisture and essence , the four humors and internal organs .
its theory of personalized medicine is a fundamental aspect of tcm , and medicines are prescribed in accordance with a patient 's constitution .
tcm recognizes that both susceptibility to disease , and drug response depend on individual constitution .
genetic , scientific evidence for tcm 's system of constitution has been elucidated , specifically for associations between different tcm constitutions and polymorphism in hla class ii genes drb1 , dpb1 and dqb1 .
frequencies of alleles dpb*0501 were significantly associated with yin - deficiency , drb1 * 09012 with phlegm - wetness , and dqb1 * 03032 allele with the qi - deficiency and phlegm - wetness groups .
serological analysis of hla alleles revealed an association between dr*04 and the blood - stasis group , and between dq*09 and the qi - deficiency and phlegm - wetness constitutions .
other studies have attempted to address the relationship between traditional medicine constitutions , and hla polymorphism .
tcm is found to be effective in treating various complex diseases like diabetes , cancer , alzheimer 's disease , metabolic syndrome , and chronic fatigue syndrome.[3841 ] in parallel to constitution - genomic studies , are those of effects of chinese herbal medicines on genetic regulation .
ginseng is considered to be one of the most effective drugs against angiogenesis and related diseases .
microarray data revealed the rg1 category of ginsenosides to up - regulate a set of genes responsible for adhesion , and migration processes related to angiogenesis .
pharmacogenomic studies are required to investigate genomic pathways involved in physiological effects of ginseng , and other tcm herbal medicines .
similarly more studies should be undertaken to investigate possible associations between different genetic markers and constitution .
such studies would help make tcm better understood in terms of modern bioscience , promoting more effective integration with modern medicine .
traditional japanese medicine has been used for 1500 years and includes kampo - yaku ( herbal medicine ) , acupuncture and acupressure ( shiatsu ) .
kampo is now widely practiced in japan and is fully integrated into the modern healthcare system . throughout the history of tcm and kampo , the basic theories and
western medicine uses disease - based diagnosis , while tcm and kampo emphasize patient - based diagnosis .
it can be characterized as a simplified , positivistic and pragmatic version of chinese herbal medicine .
the main theories of kampo are the three substances ( qi , blood , water ) , the eight categories , the five parenchymatous viscera and the six stages of disease .
kampo uses a treatment formulation corresponding to sho ; sho is the patient 's symptoms at a given moment .
sho comes from the zheng of tcm , but is simpler because of the simplified kampo theory .
sho analyzes a patient 's symptoms terms of qi ( well - being , energy , illness , vigour ) , blood and water ; the eight categories ( yin yang , hypo- and hyper- function , hot and cold , superficies and interior ) ; the five parenchymatous viscera ; and the six stages of the disease viz . :
taiyang , shaoyang , yangming , taiyin , shaoyin , & jueyin . sho may be broadly defined as kampo diagnosis in the epistemic framework of the kampo view of illness .
kakkonto sho , denoting symptomatic treatment with kakkonto , to describe sho more precisely . in kampo medicine , the process of diagnosis and treatment is called formulation corresponding to sho. when treating a patient , kampo practitioners use the sho diagnosis to identify the most suitable formula .
the relationship between these steps is compared to that of a lock and key . in this way , every pathological condition is related to its most appropriate prescription .
japanese practitioners regard their work as assessing symptoms to identify the disease , so that they can then choose the correct kampo drugs .
kampo medicine emphasizes the relationship between the human body and its social and natural environment , and regard any disease state as one of imbalance , which its treatment should correct , by helping patients return to their equilibrium state .
it has been reported that exclusively western research models are used to study kampo , and that the approach is compatible with conventional western disease nosology and conventional immunology .
hence , it has been proposed that evidence - based kampo medicine should be easily accepted in the west .
in contrast to ayurveda , tcm and scm there is a scarcity of literature on genomics and japanese kampo medicine .
more studies and further evidence are needed for further integration of understanding of kampo medicine with modern medicine .
the traditional systems of medicine in asia ( ayurveda , tcm , scm , kampo ) are considered great living traditions. they are all closely related to each other .
all identify unique qualities of each individual , and state the necessity of developing personalized medicine in order to obtain optimal response to treatment .
this is similar to the science of pharmacogenomics , which tries to identify individual differences between patients connected to drug metabolism , efficacy and toxicity at the genomic level .
in addition to genotype variations , there may be differential expression of genes , copy number variations ( cnvs ) or epigenetic modifications leading to phenotypic variation .
omics is focusing on the polygenic approach using high throughput technology rather than the single gene approach .
systems biology is an emerging field that aims at system - level understanding of biology through network analyses and molecular interactions .
systems biology therefore constitutes a means of bridging the gap between reductionist medicine and traditional medicine at least partially . using systems biology tools
may therefore offer an attractive way to begin to approach the holism of traditional medicine . despite the growing enthusiasm of increasing numbers of western trained doctors for the practice of oriental systems of integrative medicine
, there is still a shrill and often vociferous minority , which claims that because the traditional systems do not ( sufficiently yet ) have an adequate empirical or theoretical base , they must be invalid , inconsequential twaddle .
traditional systems have to use systematic scientific approach to dismiss these accusations . as regards the human prakriti , or physiological type ,
the series of experiments reviewed in this paper now demonstrate that it can be empirically validated at the genomics level . at the same time , it is important to acknowledge that the correlations so far observed do almost nothing to prove that individual physiologies have the properties claimed for them in the ancient traditions .
obtaining the necessary evidence will require a vastly greater amount of data on thousands of genes for large sample sizes .
it could initiate a plethora of scientific projects that will answer crucial questions about the foundations of human physiology , and lay out strategies for developing scientifically validated approaches to preventive medicine , chronic disease care and treatments . under the scheme
, the office of principal scientific advisors to government of india , has initiated an ambitious project on genomic variation analysis and gene expression profiling , using principles of ayurveda .
this initiative supports robust research with scientific precision , to further elucidate fundamental concepts of ayurveda . not only should it prove valuable in moving the field forward
, it may well pioneer the trend for ayugenomics and related traditional medicine research internationally and globally for coming decades . | omics developments in the form of genomics , proteomics and metabolomics have increased the impetus of traditional medicine research .
studies exploring the genomic , proteomic and metabolomic basis of human constitutional types based on ayurveda and other systems of oriental medicine are becoming popular .
such studies remain important to developing better understanding of human variations and individual differences .
countries like india , korea , china and japan are investing in research on evidence - based traditional medicines and scientific validation of fundamental principles .
this review provides an account of studies addressing relationships between traditional medicine and genomics . |
agonists
of liver x receptors ( lxr ) and are important
regulators of cholesterol metabolism , but agonism of the lxr
subtype appears to cause hepatic lipogenesis , suggesting lxr-selective
activators are attractive new lipid lowering drugs . in this work ,
pharmacophore modeling and shape - based virtual screening were combined
to predict new lxr-selective ligands .
out of the 10 predicted
compounds , three displayed significant lxr activity .
two activated
both lxr subtypes .
the third compound activated lxr 1.8-fold
over lxr. |
|
chemicals at-56 was a generous gift from taiho
pharmaceutical company ( saitama , japan ) .
at-56 was dissolved in dmso for
in vitro experiments and in 0.5% methylcellulose for oral
administration to mice , due to its high lipophilicity . in aqueous solution ,
the maximum solubility of at-56 was determined to be 90 m in
saline containing 1% dmso and 260 m in 10% dmso , as determined
by uv absorption at 287 nm .
other reagents were purchased from sigma or wako
( osaka , japan ) , unless otherwise specified .
purification of human csf l - pgds ( -trace ) and
recombinant mouse l - pgds
human csf l - pgds ( -trace ) was
purified from human csf , which was donated by dr .
m. mase ( nagoya city
university hospital ) , as reported
( 36 ) .
the full - length cdna for mouse l - pgds , which is composed of 189 amino acid
residues ( genbank accession number x89222 ) , was ligated into the
bamhi - ecori site of the expression vector pgex-2 t plasmid ( ge healthcare ) .
the
n - terminal 22-amino acid residues of the signal peptide were deleted , and the
c89a / c186a- and w54a - substituted recombinant enzymes were expressed in
escherichia coli dh5 ( toyobo , osaka , japan ) .
site - directed
mutagenesis was performed by using a quikchange site - directed mutagenesis
kit ( stratagene , la jolla , ca ) .
the recombinant enzymes retained pgds activity
comparable with that of the wild - type enzyme and were stable for long term
use . the mutated l - pgds was expressed as a gsh transferase fusion protein ,
purified by column chromatography with gsh - sepharose 4b ( ge healthcare ) , and
eluted from the column by incubation with thrombin ( 100 units/100 l of
resin ) , as reported previously
( 44 ) .
the recombinant protein
was further purified to apparent homogeneity by gel filtration chromatography
with superdex 75 in 5 mm tris / hcl ( ph 8.0 ) .
fluorescence quenching assays13-cis - retinoic acid
and at-56 were dissolved in dmso to give a 2 mm stock solution .
various concentrations of 13-cis - retinoic acid and at-56 in 10 l
of dmso were added to the l - pgds solution in 990 l of 5 mm
tris / hcl ( ph 8.0 ) .
after incubation at room temperature for 60 min , the
intrinsic tryptophan fluorescence was detected with an fp-750
spectrofluorometer ( jasco , tokyo , japan ) at an excitation wavelength at 282 nm
and an emission wavelength at 338 nm , as reported previously
( 44 ) .
enzyme activity assays enzyme activities of l - pgds
( 45 ) , h - pgds
( 46 ) , and microsomal pge
synthase ( m - pges-1 ( 47 ) ) were
measured with 10 m [ 1-c]pgh2 as a
substrate in 100 mm tris - hcl , ph 8.0 , in the presence of 1
mm gsh , 0.1 mg / ml igg , and 10% dmso .
the activities of cox-1 and
cox-2 were measured as described earlier
( 48 ) with 50 m
[ 1-c]arachidonic acid ( perkinelmer ) used as a substrate in 100
mm tris - hcl , ph 8.0 , containing 2 m hematin , 5
mm l - tryptophan , 0.1 mg / ml igg , and 10% dmso .
the conversion rate from
c - labeled substrate to c - labeled products was
calculated by using an imaging plate system ( fuji film , tokyo , japan ) .
the
kinetic constants were determined by lineweaver - burk plots prepared with
sigmaplot software ( version 10.0 for windows ; systat software , inc . ) .
nmr titration experiment the nmr samples of mouse l - pgds
were prepared in a mixture of 50 mm sodium phosphate in 75%
h2o , 15% d2o , 10% dmso at ph 7.0 , as reported previously
( 49 ) .
the protein
concentration was adjusted to 1 mm in a 5-mm microcell nmr
tube ( shigemi , tokyo , japan ) for nmr experiments .
nmr experiments were
performed at 27.5 c by using an inova600 spectrometer ( varian , palo alto ,
ca ) equipped with shielded gradient triple resonance probes
( 49 ) .
the binding of l - pgds to at-56 was monitored by nmr titration of
n - labeled l - pgds with unlabeled ligands by using
h - n heteronuclear single quantum correlation
experiments .
the combined h and n chemical shift
changes over the range of the titration from 0 to 2.0 equivalents of at-56
were plotted .
the composite chemical shift differences were calculated
according to the empirical equation tot =
{ ( hn whn ) +
( n
wn ) } , where
hn and n are the chemical
shift changes of h and n , respectively .
l - pgds - expressing human
medulloblastoma te-671 cells and h - pgds - possessing human megakaryoblastic
meg-01s cells were purchased from american type culture collection .
te-671 ( 1
10 cells / well ) and meg-01s ( 5 10/well )
cells were seeded into multiplates and cultured in dulbecco 's modified eagle 's
medium supplemented with 10% heat - inactivated fetal bovine serum , 4 mm
l - glutamine , 4.5 g / liter glucose , 100 units / ml penicillin , and 100
g / ml streptomycin sulfate under a 5% co2 atmosphere at 37
c .
meg-01s cells were caused to differentiate by treatment with
12-o - tetradecanoylphorbol-13-acetate to express h - pgds and cox-1 , as
described previously ( 50 ) .
after the cells had been cultured for 1 day , at-56 was added to them at
different doses ranging from 0 to 100 m , and the cells were
then incubated at 37 c for 10 min .
thereafter , they were stimulated with
a calcium ionophore , a23187 ( 5 m ) , at 37 c for 15 min .
the
culture media were harvested and centrifuged at 10,000 g for
5 min to remove the cells , and the supernatant was removed and stored at
80 c until the measurements of pgs could be made . in some
experiments ,
these cells were prelabeled with [ 1-c]arachidonic
acid ( 3.7 kbq / well ) for 12 h before the assay .
pgd2 ,
pge2 , and pgf2 in the culture medium were
quantified as described below .
the protocols used
for all animal experiments in this study were approved by the animal research
committee of the osaka bioscience institute .
h - pgds ko mice ( 1416-week - old males or females weighing 2530
g , c57bl/6 strain ) ( 2 ,
51 ) containing only l - pgds
were used for the stab injury model of the brain .
at-56 of various doses ( 1 ,
3 , 10 , and 30 mg / kg body weight ) was administered orally to h - pgds ko mice 1 h
before the stab wound injury .
under pentobarbital ( 50 mg / kg ) anesthesia , a
25-gauge needle was inserted into the frontal cortex of the brain of h - pgds ko
mice at a position 2 mm caudal to the bregma , 2 mm lateral to the sagittal
suture , and 1 mm deep .
after the needle had been withdrawn , the brains were
harvested , immediately frozen in liquid nitrogen , and stored in a deep freezer
( 80 c ) until the measurements of pg contents could be made .
measurement of pg contents the amounts of pgs in the cell
culture media and brain tissues were determined as described previously
( 22 ) . in brief , the cell
culture media and the frozen brain tissues were homogenized in ethanol
containing 0.02% hcl at ph 2.0 and [ h]pgd2 ,
[ h]pge2 , and [ h]pgf2
( perkinelmer life sciences ) as tracers to estimate the recovery during the
purification procedure .
after centrifugation at 500 g for 20
min , the ethanol extracts were applied onto sep - pak c18 cartridges ( waters
associates , milford , ma ) , washed with hexane , eluted with ethyl acetate , and
fractionated by reverse - phase high performance liquid chromatography .
the
amounts of pgd2 , pge2 , and pgf2 were
measured by using their respective enzyme immunoassay kits ( cayman chemical ,
ann arbor , mi ) , according to the manufacturer 's instructions .
human
l - pgds - overexpressing tg mice ( 1416-week - old males weighing 2530
g , fvb strain ( 22 ) ) were
actively sensitized by an intraperitoneal injection of 10 g of ovalbumin
( sigma ) in 0.2 ml of aluminum hydroxide gel ( serva , heidelberg , germany ) on
days 0 and 14 and then exposed to aerosolized ovalbumin ( 50 mg / ml in sterile
saline ) for 20 min on day 21
( 52 ) . at 2 days after the
ovalbumin challenge , the bronchoalveolar lavage fluid was collected as
reported previously ( 52 ) .
total and differential cell counts ( 500 cells ) were obtained based on standard
morphologic criteria after the cells had been cytospun onto glass slides and
stained with diff - quik ( dade diagnostics ) .
pharmacokinetics of at-56male c57bl/6 mice ( 7 weeks old ,
weighing 2226 g ; japan slc , shizuoka , japan ) were given a single oral
dose of 10 mg / kg at-56 or a single intravenous dose of 2 mg / kg at-56 .
plasma
was collected after euthanasia from 3 mice / group at 30 min and 1 , 2 , 4 , 8 , and
24 h for oral administration and 5 and 30 min and 1 , 2 , 4 , 8 , 12 , and 24 h
after intravenous dosing .
concentrations of at-56 in plasma were determined by high performance
liquid chromatography coupled to mass spectrometry .
samples were separated by
chromatography with a cadenza hs - c18 column ( 2 mm 150 mm ; imtact
corp . ,
kyoto , japan ) at a column temperature of 33 c with a 590%
acetonitrile gradient in 0.02% formic acid at a flow rate of 0.2 ml / min for 12
min .
at-56 was detected by mass spectrometry
with the system ( waters associates ) composed of the 2695 separation module ,
996 photodiode array detector , and zq-4000 mass spectrometry detector with an
electrospray ionization source .
the electrospray ionization interface was
operated at a source temperature of 115 c and a desolvation temperature
of 350 c .
cone gas and desolvation gas flow were 124 and 606 liters / h ,
respectively .
cone voltage for at-56 was positive 33 v for
m / z = 398 .
pharmacokinetic parameters were calculated using
noncompartmental analysis with winnonlin , version 5.0.1 ( pharsight , mountain
view , ca ) . statistics
comparisons were analyzed for statistical
significance by dunnett 's multicomparison test using sigmaplot ( systat
software , ca ) .
inhibition of the l - pgds activity by at-56at-56 inhibited
the pgds activity of both -trace purified from human csf and purified
recombinant mouse l - pgds c89a / c186a mutant in a concentration ( 10250
m)-dependent manner .
the l - pgds activity of both preparations
was inhibited to 30% with 250 m at-56 , and the ic50
value was calculated to be 95 m . however , the activities of the
purified cox-1 , cox-2 , m - pges-1 , or h - pgds in the arachidonate cascade were
not significantly affected by at-56 up to 250 m
( fig .
kinetic experiments revealed that at-56 inhibited the recombinant l - pgds in
a competitive manner against the substrate pgh2 , as shown in
lineweaver - burk plots ( fig .
2b ) , in which the vmax value remained
unchanged but the km value increased when the at-56
concentration was increased ( 0120 m ) .
the apparent
ki value of at-56 was calculated to be 75
m , which was 5.3-fold higher than the km
value of the l - pgds activity for pgh2 ( 14 m ) in the
presence of 10% dmso .
figure 2.specific inhibition of l - pgds by at-56 . a , human csf l - pgds
( -trace ) , the recombinant mouse l - pgds
c89a / c186a mutant , the purified
m - pges-1 , and h - pgds were incubated with 10 m pgh2
and 1 mm gsh at 25 c for 30 s in the presence of 0250
m at-56 in 10% dmso .
the purified cox-1 and cox-2 were
incubated with 50 m arachidonic acid in the presence of
0250 m at-56 .
recombinant mouse l - pgds c89a / c186a mutant was incubated with various
concentrations of pgh2 ( 320 m ) , 100
mm tris - hcl ( ph 8) , and 1 mm dithiothreitol in the
presence of 0 ( ) , 40 ( ) , 100 ( ) , or 120 m
( ) at-56 in 10% dmso .
specific inhibition of l - pgds by at-56 . a , human csf l - pgds
( -trace ) , the recombinant mouse l - pgds
c89a / c186a mutant , the purified
m - pges-1 , and h - pgds were incubated with 10 m pgh2
and 1 mm gsh at 25 c for 30 s in the presence of 0250
m at-56 in 10% dmso .
recombinant mouse l - pgds c89a / c186a mutant was incubated with various
concentrations of pgh2 ( 320 m ) , 100
mm tris - hcl ( ph 8) , and 1 mm dithiothreitol in the
presence of 0 ( ) , 40 ( ) , 100 ( ) , or 120 m
( ) at-56 in 10% dmso . binding interaction between l - pgds and at-56 analyzed by
nmr we have previously determined the nmr structure of the mouse
l - pgds c89a / c186a mutant ( 49 ) .
the interaction sites of l - pgds with at-56 were determined by the chemical
shift perturbation method ( 53 )
based on the two - dimensional h - n heteronuclear single
quantum correlation nmr spectra of l - pgds after the successive addition of
at-56 ( fig .
binding , large changes ( > 0.08 ppm ) of chemical shift were observed at
several amino acid residues of l - pgds ( i.e. ser ,
thr , met , and his )
( fig .
these
residues are located at the upper part of the central cavity of the
-barrel structure of the l - pgds molecule ( protein data bank code 2e4j ;
fig .
3b ) , in which the
pgh2-binding site containing the catalytic center of
cys is located
( 49 ) . however
, the at-56
binding did not cause any significant chemical shift in the regions of the
retinoic acid - binding pocket at the lower part of the central cavity of l - pgds
( 49 ) .
fluorescence quenching study on l - pgds after binding of
at-56to confirm the mode of binding of at-56 to l - pgds , we
examined the fluorescence quenching of intrinsic trp residues of mouse l - pgds
after incubation with at-56 .
mouse l - pgds contains two tryptophan residues , at
positions 43 and 54 , the former of which is located at the bottom of barrel
and the latter in the ab - loop at the entrance of the central cavity of l - pgds
( 49 ) .
the c89a / c186a mutant of
mouse l - pgds showed fluorescence quenching by the addition of at-56
( fig .
4a ) in a
concentration - dependent manner , and the fluorescence intensity was decreased
to about 60% in the presence of 10 m at-56 . on the other hand ,
the w54a / c89a / c186a mutant showed about 60% of the tryptophan fluorescence of
the c89a / c186a mutant in the absence of at-56 and did not show the
fluorescence quenching in the presence of 10 m at-56
( fig .
the
c89a / c186a mutant showed fluorescence quenching by the addition of
13-cis - retinoic acid in a concentration - dependent manner , with the
fluorescence intensity being decreased to about 8% in the presence of 10
m 13-cis - retinoic acid
( fig .
the
c89a / c186a mutant in the presence of 10 m at-56 and the
w54a / c89a / c186a mutant showed about 60% of the fluorescence intensity of the
c89a / c186a mutant in the absence of 10 m at-56 . in both cases ,
the fluorescence intensity was decreased by the addition of
13-cis - retinoic acid in a concentration - dependent manner to < 10%
in the presence of 10 m 13-cis - retinoic acid , giving
the same fluorescence quenching curves even in the presence of 10
m at-56 .
these results indicate that at-56 binds near
trp in the ab - loop of l - pgds but not to the trp
residue in the retinoid - binding pocket , being consistent with the results
obtained by nmr titration analysis . inhibition of pgd2 production in l - pgds - expressing human
medulloblastoma te-671 cells by at-56human medulloblastoma te-671
cells constitutively express l - pgds
( 54 ) .
we pretreated te-671
cells for 10 min with 0 to 30 m at-56 , stimulated them with
calcium ionophore a23187 ( 5 m ) at 37 c for 15 min , and
then determined the production of pgd2 , pge2 , and
pgf2 by enzyme immunoassay to investigate the effects of
at-56 on pg production by these cells .
at-56 dose - dependently inhibited the
production of pgd2 without affecting the production of
pge2 and pgf2
( fig .
dose - dependent inhibition of the a23187-induced pgd2 production
by at-56 ( 3100 m ) was also confirmed by using
[ 1-c]arachidonic acid - prelabeled te-671 cells
( fig .
however ,
the production of other c - labeled metabolites was not inhibited
by at-56 up to 100 m .
moreover , at-56 had no effect on the
production of pgd2 by human h - pgds - expressing meg-01s cells
( 50 ) .
h - pgds - specific
inhibitor , hql-79 , inhibited pgd2 production from meg-01s cells but
not from te-671 cells .
these results indicate that at-56 selectively inhibits
pgd2 production catalyzed by l - pgds without affecting the
production of other prostanoids .
suppression of pgd2 production in the stab - wounded brain by
oral administration of at-56to investigate the effect of at-56
in vivo , we used h - pgds ko mice , which express only l - pgds in all of
their organs ( 51 ) . in a stab
wound brain injury model , the pgd2 content in the brain of the
wounded h - pgds ko mice ( 118 22 ng / brain )
was significantly increased
as compared with that of the control mice without injury ( 0.23 0.04
ng / brain ) .
when various doses of at-56 were administered orally 1 h before the
injury , the total amount of pgd2 in the brain decreased
dose - dependently to 40% with 30 mg / kg at-56
( fig .
the amounts
of pge2 and pgf2 in the brain were not
significantly changed in any conditions
( fig .
these
results indicate that orally administered at-56 inhibited the l - pgds reaction
in the brain .
a ,
composite h and n chemical shift differences
( delta ppm ) versus the amino acid sequence of recombinant
mouse l - pgds c89a / c186a mutant .
b , overall structure of l - pgds after
at-56 binding in a ribbon representation . in both panels ,
the residues with relatively large changes in chemical shift ( 0.08 )
are
represented in red , whereas residues with shifts in the middle range
( 0.06 ppm < 0.08 ) are shown in sky blue . in
. interactions of l - pgds with at-56 as examined by nmr . a ,
composite h and n chemical shift differences
( delta ppm ) versus the amino acid sequence of recombinant
mouse l - pgds c89a / c186a mutant .
b , overall structure of l - pgds after
at-56 binding in a ribbon representation . in both panels ,
the residues with relatively large changes in chemical shift ( 0.08 )
are
represented in red , whereas residues with shifts in the middle range
( 0.06 ppm < 0.08 ) are shown in sky blue .
in
b , the at-56-binding site predicted from nmr signal perturbation is
shaded in pink .
suppression of l - pgds - mediated allergic airway inflammation by
at-56we next evaluated the therapeutic effect of at-56 on
pgd2-mediated lung inflammation .
human l - pgds tg mice were used in
an ova - induced lung inflammation model
( 52 ) .
the numbers of total
cells and infiltrating eosinophils and monocytes in the bronchoalveolar lavage
fluid of the l - pgds tg mice were dose - dependently decreased to 75 , 50 , and 96%
( actual numbers : 8.7 1.9 , 2.53 0.73 , and 6.16 1.14
10 cells / ml for total cells , eosinophils , and monocytes ,
respectively ) in 1 mg / kg at-56-treated mice and to 23 , 6 , and 41% ( 2.7
0.4 , 0.31 0.14 , and 2.59 0.3 10
cells / ml , respectively ) in 10 mg / kg at-56-treated ones compared with the
numbers for the vehicle - administered mice ( 11.6 1.6 , 5.28
1.37 , and 6.36 0.72 10 cells / ml , respectively )
( fig .
these
results demonstrate that at-56 prevented the eosinophil infiltration by
inhibiting transgened human l - pgds in vivo .
7 shows the time courses of the plasma concentration of at-56
after an oral administration to mice at a dose of 10 mg / kg and an intravenous
bolus injection of 2 mg / kg .
after the oral
administration , the plasma level of at-56 reached the maximum ( 2.15 g / ml )
within 30 min and decreased with time to be lower than the detection limit
( 0.4 ng / ml ) at 12 h after the administration .
the area under the
concentration - time curve was calculated to be 2.18 and 8.95 g / ml h
after the intravenous administration of 2 mg / kg and the oral administration of
10 mg / kg , respectively .
based on these data , bioavailability of at-56 was
calculated to be 82% , indicating that orally administered at-56 was well
absorbed in mice .
table 1pharmacokinetic parameters of at-56routedoseaucacmaxbc0ctmaxdtebafmg / kggh / mlg / mlg / mlhh% intravenous
2
1.28
0.86
0.08
2.35
per os
10
8.95
2.15
0.50
1.71
82.0
aauc , area under the concentration versus time curve from 0 to the
last quantifiable time point.bcmax , maximal concentration.cc0 , initial concentration.dtmax , time to cmax.et , half-life.fba , bioavailability = ( auc p.o .
pharmacokinetic parameters of at-56 auc , area under the concentration versus time curve from 0 to the
last quantifiable time point .
in the present study , we demonstrated that at-56 is an orally active
inhibitor specific for l - pgds with a high bioavailability .
the results of the
kinetic analyses indicated that at-56 was a competitive inhibitor against the
substrate , pgh2 .
nmr titration analysis revealed that at-56 bound
to the catalytic pocket of l - pgds , in which the catalytic center
cys is located
( 49 ) , being consistent with
the competitive inhibition of l - pgds by at-56 .
the nmr solution structure is
also in good agreement with the results of the fluorescence quenching analysis
of l - pgds , in which at-56 interacted with the upper part of l - pgds containing
trp but did not affect the fluorescence of trp
located in the retinoic acid - binding pocket at the bottom of the hydrophobic
cavity of the enzyme .
our data demonstrate that at-56 inhibited the isomerization reaction of
pgh2 to pgd2 catalyzed by l - pgds in a competitive manner
against pgh2 with a ki value of 75
m ( fig .
2 ) ,
which was 5.3-fold higher than the km value of the l - pgds
activity for pgh2 ( 14 m ) in the presence of 10%
dmso .
therefore , in the enzyme assay , at-56 inhibited the enzyme activity
clearly in a high concentration range in the presence of pgh2 .
on
the other hand , in the absence of pgh2 , at-56 binds to the enzyme
and induces the fluorescence quenching even in the low concentration range .
various inorganic selenium compounds are also known to inhibit both the
purified l - pgds and the enzyme in the crude brain supernatant in a
noncompetitive manner with a ki value of 10
m ( 40 ) .
however , the inhibition mode of at-56 was quite different
from that of selenium ; i.e. this is the first competitive inhibitor
of l - pgds against pgh2 to be reported .
when the same dose of
various seleno - compounds was used in cell cultures , such compounds reduced
pgd2 production ; however , their efficacy can not be attributed
solely to the effects on the pgd2 pathway .
seleno - compounds also
inhibited the release of arachidonic acid and the production of all pgs due to
the lack of specificity of action .
in contrast , when human te-671 cells were
stimulated with the ca ionophore a23187 in the presence of 10
m at-56 , only a base level of pgd2 biosynthesis was
observed without changing the arachidonic acid release
( fig .
a , fluorescence
quenching of intrinsic tryptophan of c89a / c186a mutant ( ) and
w54a / c89a / c186a mutant ( ) of mouse l - pgds by incubation with at-56 .
b , fluorescence quenching of intrinsic tryptophan of the mouse l - pgds
c89a / c186a mutant in the absence ( ) or presence ( ) of 10
m at-56 and that for the w54a / c89a / c186a mutant in the presence
of 10 m at-56 ( ) by incubation with
13-cis - retinoic acid
a , fluorescence
quenching of intrinsic tryptophan of c89a / c186a mutant ( ) and
w54a / c89a / c186a mutant ( ) of mouse l - pgds by incubation with at-56 .
b , fluorescence quenching of intrinsic tryptophan of the mouse l - pgds
c89a / c186a mutant in the absence ( ) or presence ( ) of 10
m at-56 and that for the w54a / c89a / c186a mutant in the presence
of 10 m at-56 ( ) by incubation with
13-cis - retinoic acid . at present
, the reason why the ic50 value in the cell was lower
than the ic50 and ki values for purified l - pgds
is unknown .
l - pgds requires sulfhydryl compounds , such as reduced gsh ,
dithiothreitol , or -mercaptoethanol , for its catalytic reaction ,
although it catalyzes the isomerization of the substrate pgh2 to
the product pgd2 .
the endogenous sulfhydryl compounds have not been
identified in its reaction , and gsh or dithiothreitol have been used as a
reductant in in vitro experiments . in this present study , we used gsh
for the enzyme inhibition assay of at-56
. thus , it is possible that the
reductant for the l - pgds reaction is different from the endogenous one .
it
might be also possible that l - pgds requires some other cofactor for its
catalysis .
at-56 might effectively inhibit the l - pgds reaction in the presence
of such endogenous cofactor .
figure 5.inhibition of l - pgds activity by at-56 in te-671 cells but not in
meg-01s cells .
te-671 cells expressing l - pgds were pretreated with various
concentrations of at-56 for 15 min and then incubated with or without 5
m a23187 for 10 min to measure prompt pgd2 release .
a , the amount of pgd2 released from te-671 cells was
measured by enzyme immunoassay . at-56
data are presented
as the mean s.e . * , p < 0.05 ; * * , p < 0.01 as
compared with the value in the absence of at-56 and in the presence of a23187
.
# , p < 0.05 as compared with the value in the presence of 1
m at-56 ( dunnett 's test ) .
b , selective inhibition by
at-56 of [ c]pgd2 production in te-671 cells and in
h - pgds - expressing meg-01s cells . te-671 and meg-01s cells were prelabeled with
[ 1-c]arachidonic acid and stimulated with 5 m
a23187 for 15 min in the presence of various concentrations of at-56
( 3100 m )
. radiolabeled arachidonic acid and its
metabolites were extracted from the culture medium , separated by thin layer
chromatography , and analyzed by autoradiography .
inhibition of l - pgds activity by at-56 in te-671 cells but not in
meg-01s cells .
te-671 cells expressing l - pgds were pretreated with various
concentrations of at-56 for 15 min and then incubated with or without 5
m a23187 for 10 min to measure prompt pgd2 release .
a , the amount of pgd2 released from te-671 cells was
measured by enzyme immunoassay . at-56
data are presented
as the mean s.e . * , p < 0.05 ; * * , p < 0.01 as
compared with the value in the absence of at-56 and in the presence of a23187 .
# , p < 0.05 as compared with the value in the presence of 1
m at-56 ( dunnett 's test ) .
b , selective inhibition by
at-56 of [ c]pgd2 production in te-671 cells and in
h - pgds - expressing meg-01s cells . te-671 and meg-01s cells were prelabeled with
[ 1-c]arachidonic acid and stimulated with 5 m
a23187 for 15 min in the presence of various concentrations of at-56
( 3100 m ) .
radiolabeled arachidonic acid and its
metabolites were extracted from the culture medium , separated by thin layer
chromatography , and analyzed by autoradiography .
recently , we demonstrated that l - pgds produced pgd2 coupled with
cox-2 in te-671 cells ( 43 ) .
l - pgds coupled to cox-2 may be more sensitive to at-56 than l - pgds itself .
since at-56 is a relatively lipophilic compound , its local concentration
around the l - pgds - cox-2 complex within endoplasmic reticulum may be high
enough to efficiently inhibit the production of pgd2 within the
cell .
although both l - pgds and h - pgds became evolutionarily diversified from
quite different ancestor gene families
( 38 ,
39 ) , these enzymes can
catalyze the same isomerization reaction .
hql-79 recently has been identified
as an h - pgds inhibitor . in this study
, we found that at-56 , which is an
hql-79-derivative compound , also has an inhibitory activity against the l - pgds
reaction both in vitro and in vivo , suggesting that the
active site architecture for the substrate binding and the catalytic reaction
mechanism of l - pgds could be similar to those of h - pgds .
figure 6.inhibitory effect of at-56 on pgd2 production by stab
wounding in h - pgds ko mice and therapeutic effect on antigen - induced lung
inflammation in human l - pgds tg mice .
a , at-56 was orally
administered 1 h before the stab wounding , and brains were collected 10 min
after the wounding .
b , at-56 was orally administered 1 h before and
24 h after the antigen exposure .
the accumulated cells in the bronchoalveolar
lavage fluid were collected 48 h after the antigen exposure .
* , p < 0.05 ; * * , p
< 0.01 as compared with the vehicle - treated group ( dunnett 's test ) .
p.o . , per os .
inhibitory effect of at-56 on pgd2 production by stab
wounding in h - pgds ko mice and therapeutic effect on antigen - induced lung
inflammation in human l - pgds tg mice .
a , at-56 was orally
administered 1 h before the stab wounding , and brains were collected 10 min
after the wounding .
b , at-56 was orally administered 1 h before and
24 h after the antigen exposure .
the accumulated cells in the bronchoalveolar
lavage fluid were collected 48 h after the antigen exposure .
p < 0.05 ; * * , p
< 0.01 as compared with the vehicle - treated group ( dunnett 's test ) .
p.o . , per os .
, we demonstrated pharmacologically and biochemically that at-56 is an
orally effective inhibitor selective for l - pgds .
especially , it should be
noted that at-56 specifically inhibited the production of pgd2
catalyzed by l - pgds but only marginally affected the production of other
prostanoids . in this sense , at-56 is an even better pgd2-blocking
compound than inorganic selenium compounds .
earlier we demonstrated that
pgd2 produced by l - pgds regulates physiological sleep
( 1 ) and pain
( 7 ) and also that l - pgds acts
as an extracellular transporter for various useful or harmful hydrophobic
compounds
( 3436 ) .
thus , at-56 may be predicted to selectively suppress the drowsiness or pain
reaction mediated by l - pgds - catalyzed pgd2 without showing the
various side effects caused by the suppression of cytoprotective and
anti - inflammatory pgs .
figure 7.time courses of plasma concentrations of at-56 after oral ( 10 mg / kg )
( a ) or intravenous ( 2 mg / kg ) ( b ) administration of at-56 to
c57bl/6 mice .
time courses of plasma concentrations of at-56 after oral ( 10 mg / kg )
( a ) or intravenous ( 2 mg / kg ) ( b ) administration of at-56 to
c57bl/6 mice .
we did not detect any acute toxic effects of at-56 after its oral
administration even at a dose of 100 mg / kg .
at-56 possesses a direct and
previously unknown inhibitory effect on l - pgds in vitro and in
vivo , suggesting that at-56 might be a useful prototypic molecule to
develop selective and/or nonselective inhibitors for l - pgds and h - pgds , which
may act as anti - somnolence and anti - inflammatory drugs , respectively .
the
development of such selective and nonselective inhibitors of both enzymes
would be helpful to determine the role of pgd2 in animal models . | we report here that
4-dibenzo[a , d]cyclohepten-5-ylidene-1-[4-(2h - tetrazol-5-yl)-butyl]-piperidine
( at-56 ) is an orally active and selective inhibitor of lipocalin - type
prostaglandin ( pg ) d synthase ( l - pgds ) .
at-56 inhibited human and mouse
l - pgdss in a concentration ( 3250 m)-dependent manner but
did not affect the activities of hematopoietic pgd synthase ( h - pgds ) ,
cyclooxygenase-1 and -2 , and microsomal pge synthase-1 .
at-56 inhibited the
l - pgds activity in a competitive manner against the substrate pgh2
( km = 14 m ) with a ki
value of 75 m but did not inhibit the binding of
13-cis - retinoic acid , a nonsubstrate lipophilic ligand , to l - pgds .
nmr titration analysis revealed that at-56 occupied the catalytic pocket , but
not the retinoid - binding pocket , of l - pgds .
at-56 inhibited the production of
pgd2 by l - pgds - expressing human te-671 cells after stimulation with
ca2 + ionophore ( 5 m a23187 ) with an ic50
value of about 3 m without affecting their production of
pge2 and pgf2 but had no effect on the
pgd2 production by h - pgds - expressing human megakaryocytes .
orally
administered at-56 ( < 30 mg / kg body weight ) decreased the pgd2
production to 40% in the brain of h - pgds - deficient mice after a stab wound
injury in a dose - dependent manner without affecting the production of
pge2 and pgf2 and also suppressed the
accumulation of eosinophils and monocytes in the bronco - alveolar lavage fluid
from the antigen - induced lung inflammation model of human l - pgds - transgenic
mice . |
nephroblastoma , one of the most common solid tumours in children , constitutes 8 - 10% of all neoplasms in that group , ranking third after neuroblastoma and cns tumours .
the peak incidence occurs in pre - school children , between 1 to 5 years of age .
few as they are , there are still more reports on the tumor in children [ 13 ] . what can be defined as extrarenal wilms tumor
extrarenal nephroblastoma was first reported in 1961 by moyson et al . , who described a chest tumor in which the histological image resembled nephroblastoma .
about 300 cases of the disease have been reported around the world since then . in all of them ,
the tumor was located in the retroperitoneal space , excluding an intrarenal location [ 2 , 3 , 5 ] .
the second most common location is the area of the pelvis minor , in particular the inguinal canal , the female reproductive organs ( vagina , uterus ) , the round ligament of the uterus , the ovaries and the testicles [ 6 , 7 , 911 ] .
nephroblastoma was also found in the sacro - coccal area in children . from the embryological point of view
, extrarenal nephroblastoma is frequently reported to be located in the vicinity of the fetal urogenital ridge and mesonephron , which might account for the location of the tumor in the organs mentioned above [ 12 , 13 ] .
the retroperineal location is reported to be typical of males [ 4 , 9 , 11 , 12 ] , whereas the inguinal region is believed to predominate in females [ 6 , 7 , 14 , 15 ] . a case of extremely rare extrarenal nephroblastoma within the isthmus of the horseshoe kidney
histology of the tumor revealed an association with teratoma and three cell types which typically form nephroblastoma : blastemal , stromal and epithelial [ 8 , 9 ] .
although recent studies maintain that extrarenal wilms tumor most commonly occurs in children , according to multicentre research analyzing the data of 34 patients by cooppes et al . , the patients age varied from 2 months to 56 years .
the occurrence of the tumor in men and women was comparable in the group of 4 adults and 3 teenagers .
the remaining 27 patients were children below 10 , predominantly between 1 to 4 years of age . according to becwith et al .
, nephroblastoma in a typical location can be classified as having either favourable or unfavourable histology .
in addition , one more category has been singled out by siop [ society of pediatric oncology ] and nwts ( national wilms tumor study ) pathologists , comprising intermediate risk tumors .
the tumor is believed to arise from mesonephric remnants or metanephretic tissue [ 8 , 9 , 13 , 15 , 18 , 19 ] .
alternatively , it is assumed to originate in a teratoma , but this conception has not yet been confirmed .
however , mature teratoma was recognized in a teratoid wilms tumor found in the horseshoe kidney , even though other forms such as blastematous elements with abortive glomeruli , tubules and immature chondromatoid elements predominated .
it was the presence of these three phases blastemal , epithelial and stomal that justified the diagnosis of a teratoid extrarenal wilms tumor [ 4 , 8 , 12 , 20 , 21 ] .
it is claimed that extrarenal wilms tumor develops from mesonephric or pronephric remnants and its tissue is more primitive than the tissue of intrarenal nephroblastoma . according to kaptur et al .
, between the 6 and 7 week of fetal development , a nexus between metanephric blastema and a ureteral bud is formed .
another theory points to the role of the mesonephric duct in the pathogenesis of extrarenal nephroblastoma .
male urogenital structures such as the epididymis , vas deferens and seminal vesicles , as well as the female gartner 's duct , differentiate from the mesonephric duct .
the gartner 's duct disappears by the 4 month of gestation . yet , as was observed , it could remain beyond that time as juxtagonadal mesonephric gromeruli , which might be the cause of nephroblastoma in genitalia . on the other hand ,
identified the wt1 gene in 25% of patients with extrarenal nephroblastoma and suggested that the gene mutation might cause transformations of extrarenal mesonephric or pronephric splinters in wilms tumor .
electron microscopy of wilms tumor showed protein elements , vimentin filaments , as well as cytokeratin and epithelial antigen , which might suggest a relation between stroma , blastema and epithelium , also observed in intrarenal nephrobastoma .
the most common presentation is nonspecific abdominal pain and , as in the case of intrarenal nephroblastoma , a palpable mass ( figure 1 ) .
pelvic and retroperitoneal location is associated with gastrointestinal disorders , cachexia , haematuria , gynaecological haemorrhage and in few patients even raised temperature .
the clinical presentation depends mainly on the tumor size [ 3 , 4 , 12 , 2224 ] .
ct and mri are used to detect tumors in the retroperiteneal space , inguinal , sacro - coccal and scrotal area . however , extrarenal nephroblastoma does not show characteristic radiological features .
the treatment of extrarenal nephroblastoma , based on the guidelines for the management of intrarenal nephroblastoma , comprises of surgery , chemotherapy and radiotherapy .
the commonly shared opinion is that the surgical removal of the tumor together with the organ it originates from and adjacent lymph nodes is the most important element of the therapy [ 3 , 4 , 9 , 13 ] .
tumors in the retroperiteneal space , inguinal or sacro - coccal area must be radically resected .
surgery is the treatment of choice and should be as radical as it is for intrarenal nephroblastoma .
the whole area of resection should be carefully inspected and the enlarged lymph nodes from the area must be removed .
chemotherapy as adjuvant therapy was reported to have been used in all studies [ 12 , 17 ] coopies at al .
stage i amounted to 30% , ii to 10% , iii to 57% and iv to 3% . in all patients , two - year asymptomatic survival
postoperative treatment depends on the stage of the tumor and its histological result . both factors ( stage and histology )
it seems controversial to refer to the tnm classification in cases of tumors unrelated to the organ .
blastemal type , diffuse anaplasia , clear cell sarcoma , and rhabdoid tumor are all high risk tumors .
mesoblastic nephroma , cystic partially differentiated nephroblastoma and complete necrotic nephroblastoma belong to the low risk group . as in all reports on extrarenal nephroblastoma
, the tnm classification was referred to and the types of treatment , as well as the results , were be compared .
stage 1 organ - confined tumor , resected completely , no injury to a pseudocyst , clear surgical margin .
stage 2 regional tumor , biopsied before removal or invading blood vessels ; resected completely , clear surgical margin .
stage 3 tumor not completely resected , regional lymph node metastasis present , tumor spread to the abdominal organs and peritoneum .
, chemotherapy regimens recommended by siop or nwts have been introduced according to the stage and histological image of the tumor . in poland , the chemotherapy regimen recently recommended by siop is used . in the case of the boy with extrarenal nephroblastoma reported by the authors , a three - agent therapy [ actinomycin , vinkristine and doxorubicin ] ,
after that , the patient was treated with 20 gy radiation . according to both nwts and siop pathologists ,
diffuse anaplastic changes generally predict a poor outcome and full recovery is achieved in 30% of cases [ 16 , 17 ] .
what also confers poor prognosis is a tumor mass above 250 mg , volume above 400 cm3 and lymph nodes metastases .
extrarenal nephroblastoma was first reported in 1961 by moyson et al . , who described a chest tumor in which the histological image resembled nephroblastoma .
about 300 cases of the disease have been reported around the world since then . in all of them ,
the tumor was located in the retroperitoneal space , excluding an intrarenal location [ 2 , 3 , 5 ] .
the second most common location is the area of the pelvis minor , in particular the inguinal canal , the female reproductive organs ( vagina , uterus ) , the round ligament of the uterus , the ovaries and the testicles [ 6 , 7 , 911 ] .
nephroblastoma was also found in the sacro - coccal area in children . from the embryological point of view
, extrarenal nephroblastoma is frequently reported to be located in the vicinity of the fetal urogenital ridge and mesonephron , which might account for the location of the tumor in the organs mentioned above [ 12 , 13 ] .
the retroperineal location is reported to be typical of males [ 4 , 9 , 11 , 12 ] , whereas the inguinal region is believed to predominate in females [ 6 , 7 , 14 , 15 ] .
a case of extremely rare extrarenal nephroblastoma within the isthmus of the horseshoe kidney was described as well .
histology of the tumor revealed an association with teratoma and three cell types which typically form nephroblastoma : blastemal , stromal and epithelial [ 8 , 9 ] . although recent studies maintain that extrarenal wilms tumor most commonly occurs in children , according to multicentre research analyzing the data of 34 patients by cooppes et al . , the patients age varied from 2 months to 56 years .
the occurrence of the tumor in men and women was comparable in the group of 4 adults and 3 teenagers .
the remaining 27 patients were children below 10 , predominantly between 1 to 4 years of age .
according to becwith et al . , nephroblastoma in a typical location can be classified as having either favourable or unfavourable histology .
in addition , one more category has been singled out by siop [ society of pediatric oncology ] and nwts ( national wilms tumor study ) pathologists , comprising intermediate risk tumors .
the tumor is believed to arise from mesonephric remnants or metanephretic tissue [ 8 , 9 , 13 , 15 , 18 , 19 ] .
alternatively , it is assumed to originate in a teratoma , but this conception has not yet been confirmed .
however , mature teratoma was recognized in a teratoid wilms tumor found in the horseshoe kidney , even though other forms such as blastematous elements with abortive glomeruli , tubules and immature chondromatoid elements predominated .
it was the presence of these three phases blastemal , epithelial and stomal that justified the diagnosis of a teratoid extrarenal wilms tumor [ 4 , 8 , 12 , 20 , 21 ] .
it is claimed that extrarenal wilms tumor develops from mesonephric or pronephric remnants and its tissue is more primitive than the tissue of intrarenal nephroblastoma . according to kaptur et al .
, between the 6 and 7 week of fetal development , a nexus between metanephric blastema and a ureteral bud is formed .
another theory points to the role of the mesonephric duct in the pathogenesis of extrarenal nephroblastoma .
male urogenital structures such as the epididymis , vas deferens and seminal vesicles , as well as the female gartner 's duct , differentiate from the mesonephric duct .
the gartner 's duct disappears by the 4 month of gestation . yet , as was observed , it could remain beyond that time as juxtagonadal mesonephric gromeruli , which might be the cause of nephroblastoma in genitalia . on the other hand ,
roberts et al . identified the wt1 gene in 25% of patients with extrarenal nephroblastoma and suggested that the gene mutation might cause transformations of extrarenal mesonephric or pronephric splinters in wilms tumor .
electron microscopy of wilms tumor showed protein elements , vimentin filaments , as well as cytokeratin and epithelial antigen , which might suggest a relation between stroma , blastema and epithelium , also observed in intrarenal nephrobastoma .
the most common presentation is nonspecific abdominal pain and , as in the case of intrarenal nephroblastoma , a palpable mass ( figure 1 ) .
pelvic and retroperitoneal location is associated with gastrointestinal disorders , cachexia , haematuria , gynaecological haemorrhage and in few patients even raised temperature .
the clinical presentation depends mainly on the tumor size [ 3 , 4 , 12 , 2224 ] .
ct and mri are used to detect tumors in the retroperiteneal space , inguinal , sacro - coccal and scrotal area . however , extrarenal nephroblastoma does not show characteristic radiological features .
the treatment of extrarenal nephroblastoma , based on the guidelines for the management of intrarenal nephroblastoma , comprises of surgery , chemotherapy and radiotherapy .
the commonly shared opinion is that the surgical removal of the tumor together with the organ it originates from and adjacent lymph nodes is the most important element of the therapy [ 3 , 4 , 9 , 13 ] .
tumors in the retroperiteneal space , inguinal or sacro - coccal area must be radically resected .
surgery is the treatment of choice and should be as radical as it is for intrarenal nephroblastoma .
the whole area of resection should be carefully inspected and the enlarged lymph nodes from the area must be removed .
chemotherapy as adjuvant therapy was reported to have been used in all studies [ 12 , 17 ] coopies at al .
stage i amounted to 30% , ii to 10% , iii to 57% and iv to 3% . in all patients , two - year asymptomatic survival
postoperative treatment depends on the stage of the tumor and its histological result . both factors ( stage and histology )
it seems controversial to refer to the tnm classification in cases of tumors unrelated to the organ .
blastemal type , diffuse anaplasia , clear cell sarcoma , and rhabdoid tumor are all high risk tumors .
mesoblastic nephroma , cystic partially differentiated nephroblastoma and complete necrotic nephroblastoma belong to the low risk group .
as in all reports on extrarenal nephroblastoma , the tnm classification was referred to and the types of treatment , as well as the results , were be compared .
stage 1 organ - confined tumor , resected completely , no injury to a pseudocyst , clear surgical margin .
stage 2 regional tumor , biopsied before removal or invading blood vessels ; resected completely , clear surgical margin .
stage 3 tumor not completely resected , regional lymph node metastasis present , tumor spread to the abdominal organs and peritoneum .
, chemotherapy regimens recommended by siop or nwts have been introduced according to the stage and histological image of the tumor . in poland , the chemotherapy regimen recently recommended by siop is used . in the case of the boy with extrarenal nephroblastoma reported by the authors , a three - agent therapy [ actinomycin , vinkristine and doxorubicin ] ,
after that , the patient was treated with 20 gy radiation . according to both nwts and siop pathologists ,
diffuse anaplastic changes generally predict a poor outcome and full recovery is achieved in 30% of cases [ 16 , 17 ] .
what also confers poor prognosis is a tumor mass above 250 mg , volume above 400 cm3 and lymph nodes metastases .
the occurrence of the extrarenal nephroblastoma is exceedingly rare . in absence of typical clinical presentation or conclusive imaging tests ,
the recommended management of the extrarenal nephroblastoma is similar to the treatment used for intrarenal nephroblastoma .
| introductionnephroblastoma is one of the most common solid tumours in children .
the occurrence of extrarenal nephroblastoma is exceedingly rare . what can be defined as extrarenal wilms tumor
must satisfy the following criteria : histologically confirmed nephroblastoma and extrarenal location.material and methodscurrent data on extrarenal nephroblastoma based on a selective review of the literature.resultsthe retroperineal location is reported to be typical in males , whereas the inguinal region is believed to predominate in females .
there are no characteristic manifestations of extrarenal nephroblastoma .
the symptoms depend on the location and stage upon diagnosis . us , ct and
mri are used to detect tumours in the retroperiteneal space , inguinal , sacro - coccal and scrotal area . however , extrarenal nephroblastoma does not show characteristic radiological features.conclusionsin absence of typical clinical presentation or conclusive imaging tests , the diagnosis is based on histology after the resection of the tumor .
the recommended management of the extrarenal nephroblastoma is similar to the treatment of intrarenal nephroblastoma . |
the 67-year old , male patient ( 164 cm , 70 kg ) with chronic renal failure was supposed to undergo arteriovenous bridge graft of the upper arm for hemodialysis under high level thoracic epidural anesthesia .
patient history revealed that he underwent coronary bypass graft six years ago and was taking antihypertensive agents and insulin for hypertension and diabetes .
blood tests performed after hemodialysis on the day before the operation showed hemoglobin 11.3 g / dl , hematocrit 36.3% , glucose 202 mg / dl , na 136 mmol / l , k 5.2 mmol / l , cl 97 mmol / l , bun 43 mg / dl , and creatinine 4.5 mg / dl .
test results on the day of the operation showed that the platelet count and coagulation profile ( prothrombin time , international normalized ratio , activated partial thromboplastin time , fibrinogen ) were in the normal ranges .
when the patient arrived at the operation room , blood pressure was 135/89 mmhg , and heart rate was 64 bpm . the high level thoracic epidural anesthesia was performed in the sitting position , and an assistant supported both shoulders of the patient so that the patient could lower his head to the maximum ( fig .
1 ) . the first prominent spinous process of the cervical spine , which is the c6 spinous process , was identified . referring to that ,
local infiltration of 2% lidocaine 2 ml was performed in the middle line between the t1 and t2 spinous processes .
then , for the loss of resistance technique , a 5 ml glass syringe was connected to a 17-g tuohy needle ( arrow , arrow international inc . ,
usa ) , and the needle was moved to the epidural space by the midline approach .
when it moved into the 4.5 cm position from the skin , the plunge of the glass syringe was sucked inside , and the hanging drop method was performed at that position . as a result ,
the epidural space was positively identified , the loss of resistance technique to air was performed to verify that the loss of resistance was positive , and the drip infusion method showed that the normal saline was dropping at a rate of one drop per second or higher .
the epidural catheter was inserted without particular resistance up to 3 cm inside the epidural space .
after fixing the catheter , the patient 's position was altered to the supine position , and 1% lidocaine 3 ml containing 1:200,000 epinephrine was injected through the catheter as the test dose .
there was no change in blood pressure and heart rate at five minutes after the test injection .
the sensory change on both upper arm medial sides was not accurately verified since the patient was unable to cooperate well . for epidural anesthesia , a mixture of 0.375% ropivacaine 15 ml and fentanyl 50 g was injected through the epidural catheter .
pin - prick tests at 5 , 10 , 15 and 20 minutes after drug injection showed that pain had not been alleviated at all , and vital signs were not changed . judging that the epidural anesthesia failed ,
general anesthesia was performed under the agreement of the patient . to induce general anesthesia , 2% lidocaine 2 ml - propofol 2
mg / kg - atracurium 0.6 mg / kg was intravenously injected , and the anesthesia was maintained with o2-n2o - desflurane .
the operation was carried out for 1.5 hours , and epidural anesthesia failure was reconfirmed when the patient complained of pain in the operated region in the recovery room . to find out the causes of the epidural anesthesia failure , iohexol
5 ml was injected through the epidural catheter and radiographic images were taken ( fig .
2 ) . however , since the accurate position of the catheter was not found , cervical and thoracic computed tomography ( ct ) was performed after ensuring the patient that the hospital would cover the cost of the ct and receiving agreement from the patient and caregiver .
ct findings revealed that the catheter had entered between t1 and t2 but failed to penetrate into the ligamentum flavum , proceeded along the t2 right lamina , and was eventually positioned within the erecter spinae muscle after converting the direction backwards ( fig .
anesthesiologists sometimes experience a situation where epidural anesthesia fails even when the loss of resistance and hanging drop methods have been successful and the catheter has been inserted without any particular difficulty .
rissanen and sharrock reported that pseudo loss of resistance or false positive loss of resistance may appear when the tuohy needle is advanced to a region where a cavity has been formed due to degeneration of the interspinous ligament .
gupta et al . reported pseudo positive loss of resistance due to subcutaneous emphysema generated after chest damage .
reported that embryologically generated fissures from the lack of midline fusion of ligamentum flavum were found in the cervical spine region about 51 - 74% and thoracic vertebra region about 2 - 21% , respectively , and the mean area of fissures was 1.0 0.3 mm .
they also mentioned that the uncertain loss of resistance that takes place by such a fissure can probably cause dural puncture or spinal cord damage . to solve this problem , kil et al .
measured the depth of the epidural space by means of ultrasonic waves before operation children and infants aged seven or less , applied the drip infusion method for epidural puncture and reported that epidural puncture was successful by one - time trial in 179/180 patients ( 99.4% ) .
yamashita and tsuji applied the drip infusion method to identify the epidural space in 350 infants ( 300 in the spinal region and 50 in the thoracic vertebra region ) under the age of nine and reported that it was accurately performed in 342 infants ( 97.7% ) .
however , in our case , although we performed the drip infusion method to avoid the problems of pseudo positive loss of resistance method listed previously , the tuohy needle was unable to penetrate through the ligamentum flavum , the catheter deviated to the spinal lamina region at the entrance of the ligamentum flavum , and it proceeded into the near erecter spinae muscle , as revealed by cervical and thoracic ct .
the methods used to verify accurate needle placement - hanging drop , loss of resistance , and drip infusion - were performed in the space just before the ligamentum flavum .
thus , the operator mistakenly considered this to be the epidural space and inserted the catheter , which led to the failure of the epidural anesthesia .
the reason why the results from all three methods were found to be positive is unclear . as described previously , possible causes include the accompaniment of interspinous ligament degeneration or tissue breakdown by fluid overload due to chronic renal failure .
clinically , epidural anesthesia sometimes fails even when the loss of resistance and hanging drop tests show positive results , and the catheter is inserted without any particular difficulty .
although c - arm guidance is employed from time to time , it is undeniably true that epidural anesthesia is most often performed without an imaging instrument .
we identified the causes of epidural anesthesia failure using ct and recommend the use of c - arm guidance for epidural anesthesia , if possible , to reduce the frequency of pseudo positive cases of the loss of resistance . | we report a case of failed epidural anesthesia despite successful identification of the epidural space , loss of resistance technique , hanging drop method and drip infusion .
this case evaluated the use of computed tomography to confirm epidural catheter position , which showed the catheter accidentally positioned at the t2 lamina . because epidural anesthesia can even after successful procedure using standardized techniques such as loss of resistance , we recommend performing the procedure under fluoroscopic guidance to improve success rate and patient safety . |
pharmacopuncture refers to be in the limelight acupuncture therapy that treat diseases by using techniques such as warming ( chunghwa ) , alcohol extraction or pressing to extract drugs from one or more oriental medicines and then injecting them into specific acupoints related to the disease and adjusting meridian functions .
cathami semen is the seed of the safflower and is composed of 20%-30% fatty oil ( acids ) , whose main constituents are glycerides , linoleic acid , and oleic acid , as well as serotonin , serotonin conjugate , and serotobenin .
carthamus tinctorious l. contains safflower - yellow cathamin , which reportedly extends blood vessels , excites the uterus , and reduces blood cholesterol . in oriental medicine ,
carthamus tinctorious l. has warmness , which can affect detoxification , pain relief and blood circulation .
carthmi - flos herbal acupuncture ( cf ) , a representative meridian pharmacopuncture medicine , is an oriental medicine made by extracting and refining oil from cathami semen .
cf was prepared in a sterile laborotary at the korean pharmacopuncture institute ( kpi ) .
after the seeds had been cleaned , ground and peeled , they were screw pressed on a prepared mat .
water soluble carthmi - flos herbal acupuncture ( wcf ) was prepared by homogenizing cf , water for injection ( wfi ) and an emulsifier .
pharmacopuncture with carthamus tinctorious l. is a representative pharmacopuncture method whose efficacy was demonstrated by many studies .
various studies on the effects of pharmacopuncture with carthamus tinctorious l. in treating painful diseases , such as anti - pain effects in an arthritis model on experimental animals , pain - relief effects in degenerative knee arthritis patients , and effects in reducing backache according to the oswestry disability index , were conducted , as were studies on immune - function and blood - vessel effects , including its anti - carcinogenic activity and its effect on suppressing blood clots induced by endotoxin .
other studies addressed hematological diseases ( the treatment of alopecia areata by using pharmacopuncture with carthamus tinctorious l. ) , and gynecological diseases ( the treatment of oligomenorrhea with pharmacopuncture and carthamus tinctorious l. ) .
thus , the effects of pharmacopuncture combined with carthamus tinctorious l. have been demonstrated in a variety of different fields .
studied the safety of pharmacopuncture with carthamus tinctorious l. against skin irritation and eye irritation , and an et al .
verified its safety through acute and subacute toxicity experiments . because pharmacopuncture with carthamus tinctorious l. is expected to show gradual diversification of clinical use as an oriental medicine , studies on toxicity , dose , and side effects must be pursued because pharmacopuncture inserts foreign substances into the human body . in this study ,
single intramuscular- dose toxicity tests were performed on rats to verify the safety and to identify any side effects of wcf prepared using carthamus tinctorious l. preliminary study was performed at biotoxtech by non - good laboratory practices ( glp ) .
these tests were performed by biotoxtech according to glp and the standards of the ministry of food and drug safety as requested by the kpi .
wcf was developed to increase the treatment effects by increasing absorptivity and to reduce the side effects by reducing residue of existing cf .
wcf was prepared in three steps : in step 1 , cf , wfi and primary emulsifier were mixed together and homogenized for 30 minutes by using a high - speed homogenizer .
emulsifier was added in step 2 and homogenized at 30 - 80. in step 3 , the temperature was reduced , and the mixture was homogenized to yield wcf .
the rats , 24 males and 24 females , were 5-weeks old with body weights of 111.8 - 135.8 g and 107.4 - 127.9 g , respectively .
general symptoms and body weights were observed to verify that no problems existed with the animals . during the grace period ,
individual subjects were marked , and at the end of the grace period , 20 males and 20 females closest to the standard body weight were selected and randomly divided into 4 groups of 5 male rats and 5 female rats so that the mean weights of the four groups were uniform .
solid feed ( teklad certified irradiated global 18% protein rodent diet 2918c ) and filtered tap water ( cheongju tap water filtered using a filter water sterilizer and irradiated with ultraviolet rays ) were freely available . the breeding environment was as follows : a temperature of 20.0- 22.8 , relative humidity of 48.5%-65.8% , 10- to 15-hour ventilation , 12-hour / day lighting cycle , and illuminesence of 150 - 300 lux .
the clinical dose of wcf was 1.0 ml per application , as no fatalities had been observed at doses up to this value in preliminary tests ( biotoxtech study no . :
thus , under consultation with the test s requester , 1.0-ml/ animal was configured as the high dose .
medium and low doses were 0.5- and 0.1-ml / animal ; the same amount of saline solution , 1.0-ml / animal , was injected into the control group .
( table 1 ) injection was performed using a disposable syringe ( 1 ml , 26 g ) .
single doses were injected into the left femoral muscle for the low - dose and the medium - dose groups . for the control and the high - dose groups , single injections , 0.5 ml / site ,
were done into the left and the right femoral muscles . on the day of injection ( day 0 )
, clinical symptoms and fatalities were observed at 30 minutes and at 1 , 2 , 4 and 6 hours after injection . from day 1 to day 14 , general symptoms were observed once a day .
body weights were measured ( cp3202s scale ) on days of injection ( before injection ) and on days 3 , 7 and 14 . for the hematology test
, blood was collected from the abdominal aorta on day 15 after applying anesthesia by isoflurane .
hematological analyses were carried out by placing 1 ml of collected blood into a tube containing ethylenediaminetetraacetic acid , which was then analyzed using a blood corpuscle analyzer ( advia 120 , siemens , germany ) .
for the coagulation test , about 2 ml of collected blood was placed in a tube containing 3.2% sodium citrate and centrifuged for 10 minutes at 3,000 rpm , after which the blood plasma was collected .
measurement was done using a coagulation time analyzer ( coapresta 2000 , sekisui , japan ) . the prothrombin time and the activated partial thromboplastin time ( aptt ) were measured . after completing the hematology tests , for the clinical chemistry test , we centrifuged the remaining blood for 10 minutes at 3,000 rpm and collected the blood serum . a clinical chemistry analyzer ( 7180 ,
hitachi , japan ) and an electrolyte analyzer ( avl9181 , roche , germany ) were used .
visual inspection of all body organs and tissues was performed on all animals after necropsy .
body organs and tissues were extracted and fixed in 10% neutral buffered formalin , and histopathological observations were carried out .
body - weight , hematology and clinical chemistry results were tested using sas ( version 9.3 , sas institute inc .
bartlett tests were performed for homo - scedasticity ( significance level : 0.05 ) . for homo - scedasticity ,
one - way analysis of variance tests were performed to yield the significance ( significance level : 0.05 ) , and multiple dunnett s t - tests were carried out ( significance level : 0.05 on both sides and 0.01 ) . for hetero - scedasticity , significance ( significance level : 0.05 ) was checked using the kruskal - wallis test .
accordingly , computation of the ld50 was impossible ; however , a single intramuscular dose of wcf at 1.0 ml / animal caused no mortalities .
( table 2 ) no abnormal clinical symptoms ( type of toxicity symptom , time of expression , time of recovery , etc . ) were observed on the day of injection ( day 0 ) at 30 minutes and at 1 , 2 , 4 and 6 hours after injection , as was the case for days 1 to 14 after injection .
all groups showed a continued increase in body weight , but the differences among the groups were not significant .
tables 3 , 4 , 5 ) hematological analyses on the ratsblood showed wcf to have no effect . however , aptt ( sec ) mean of the g3 female group showed a statistically significant change ( p < 0.01),but it was a miscellaneous change with no dose dependence , clinical meaning or toxicological meaning .
clinical chemistry analyses showed no significant differences for any of the measured items between the normal saline and the wcf groups . in no male or female experimental group were visual abnormalities observed .
( tables 6 , 7 , 8) on the histopathological tests , one female in the highdose group showed infiltration of mononuclear cells and a multi - nucleated giant cell around eosinophilic materials caused by wcf in an area similar to a cross section of muscular fiber , and 8 eosinophilic materials were clustered at a local part .
wcf is prepared by homogenizing a mixture of cf , wfi and emulsifier and increases the treatment efficacy while maintaining the characteristics of existing cf .
the effects of cf have been demonstrated by various studies ; i.e. , cf can be used for pain relief , is effective for a variety of different pains , increases regional cerebral blood flow significantly , and can be used in a variety of different fields with different effects such as anti - carcinogenic [ 7 , 12 ] and anti - oxidative effects . in this experiment ,
an intramuscular - dose toxicity test of wcf was performed by biotoxtech to evaluate the safety of wcf manufactured by the kpi according to the glp .
no mortalities occurred in any group . also , observations taken after injection of wcf showed no abnormalities in the clinical symptoms of the four groups .
hematologically , a change in the aptt ( sec ) mean value of the g3 female group was observed , but had no clinical or toxicological meaning .
finally , histopathological observation showed that wcf caused a change in one female in the high - dose group .
visual examination showed the subject to have suffered infiltration of mononuclear cell and to have had a multi - nucleated giant cell around eosinophilic material .
studies on the side effects and the safety of cf are continuously being conducted . according to , pain , flare and edema
after 4 days , side effects , such as flare and edema , mostly disappeared .
they were thought to have occurred due to a mixture of highly - toxic drugs in the oil press during cf during preparation .
suppuration and pain appeared in the surgical parts in 1 patient who received cf therapy of 0.1 ml/1 time / week for 8 months and 1 patient who received cf therapy of 0.1 ml/1 - 3 times / week for 3 months .
grade - minimal unlike in , the side effects were deemed to be due to an accumulation of cf in the human body from long - term therapy .
the safety of cf was reported in based on a toxicity test of cf , but this was only a short - term study on acute and subacute toxicity .
chronic toxicity tests on cf must be carried out in the future . although histological abnormalities caused by wcf were found in a subject of the high - dose group in this experiment , according to , no histological abnormalities were observed in sprague - dawley rats treated with cf 3 times a week for 1 - 2 weeks .
however , the group with 4 weeks of therapy showed histological ambiguity regarding the boundary of muscular tissues , observation of flares , and induction of inflammations .
a histological study with a greater number of subjects and a longer period is deemed necessary to examine long - term or high - dose effects of cf or wcf .
the safety of cf was demonstrated , but its side effects were presented in several studies .
thus , the toxicity and the safety of wcf must be investigated , and long - term histological studies based on large numbers of subjects are deemed necessary .
the results of single intramuscular - dose toxicity tests with wcf on 4 groups of sprague - dawley rats , 3 experimental groups ( 0.1 ml / animal , 0.5 ml / animal and 1.0 ml / animal ) and 1 control group ( 1.0 ml / animal of saline solution ) , are as follows : in all groups no mortalities occurred .
there was no abnormalities in clinical symptoms , body - weight , hematology tests , clinical chemistry tests , necropsy , histopathological tests . in 1.0 ml / animal dose of wcf ,
this study do not show wcf s safety of human body . to examine the safety of wcf , we need to carry out testing to check whether or not the toxicity would have negative effects on human body . | objectives : this experiment was conducted to examine the toxicity of water soluble carthmi - flos herbal acupuncture ( wcf ) by administering a single intramuscular dose of wcf in 6-week - old , male and female sprague - dawley rats and to find the lethality dose for wcf.methods:the experiment was conducted at biotoxtech according to good laboratory practices under a request by the korean pharmacopuncture institute .
this experiment was performed based on the testing standards of toxicity test standards for drugs by the ministry of food and drug safety .
subjects were divided into 4 groups : 1 control group in which normal saline was administered and 3 test groups in which 0.1 , 0.5 or 1.0 ml of wcf was administered ; a single intramuscular dose was injected into 5 males and 5 females in each group .
general symptoms and body weights were observed / measured for 14 days after injection . at the end of the observation period , hematological and clinical chemistry tests were performed , followed by necropsy and histopathological examinations of the injected sections.results:no mortalities were observed in any group .
also , symptoms , body weight , hematology , clinical chemistry and necropsy were not affected
. however , histopathological examination of the injected part in one female in the 1.0-ml group showed infiltration of mononuclear cells and a multi - nucleated giant cell around eosinophilic material.conclusion:administration of single intramuscular doses of wcf in 3 groups of rats showed that the approximate lethal dose of wcf for all rats was in excess of 1.0 ml , as no mortalities were observed for injections up to and including 1.0 ml . |
a retrospective evaluation was designed to analyze indications , cosmetic results , complications , graft viability , and global patient satisfaction . from february 2010 to july 2013 , 32 consecutive patients ( 22 females and 10 males ) with a facial asymmetry of the soft tissues after trauma , tumor resection , congenital deformities , and previous surgical treatment of abscess were screened to our department ( table 1 ) .
this retrospective study was conducted in accordance to the requirements of helsinki declaration of 1975 as revised in 2008 .
the patients were verbally informed about the sample to be taken and gave their written consents .
preoperatively , a clinical and radiographic evaluation of the defect was performed ; an accurate photographic documentation was also obtained ( figs . 1 , 2 , 3 ) .
the fat was harvested from the abdomen in local anesthesia using 0.5% lidocaine with 1:200,00 epinephrine before going to the operating room . by grasping the skin ,
the surgeon lifts away the subcutis from the underlying structures , and after a small ( about 2 mm ) incision in the donor site , blunt cannulas , with a diameter of 1.5 mm , were inserted . with a gentle negative pressure ,
a different ( 70 to 180 ml ) amount of fat was harvested in relation to the 3-dimensional facial defect .
coleman emphasizes the importance of centrifugation at 3000 rpm for 3 minutes to remove the non - living components ( oil , blood , water , and lidocaine ) from the suctioned aspirate .
this procedure obtained highly purified fat tissue , preserving the integrity of the adipocyte wall but separating the fluid fat portion from the serous bloody part .
this purified body fat was put in 1-ml syringes and aseptically reinjected using a 17-gauge blunt tip cannula .
the cannula inserted through small skin incision ( 2 mm ) layered the fat in small aliquots ( 0.1 ml ) with a linear deposition into the facial area requiring enhancement working from the underlying periosteum up to the subdermis .
all fat layers were grafted slowly from the deep to superficial layers trying to preserve fat cell survival and architecture . in the treatment of the posttraumatic facial scar ,
a release with blade of the scar contracture was obtained before . in post - surgery phase , aside from systemic antibiotic prophylaxis ( 1 g of amoxicillin , twice a day , for 7 days ) in donor site , heparin ( 4000 iu ) was locally administered and a compression dressing was applied .
patient satisfaction was evaluated using a visual analogue scale ( vas ) ranging from 1 ( least satisfied possible ) to 10 ( most satisfied possible ) at 6 months after surgery .
preoperative frontal projection of a 15-year - old man affected by franceschetti syndrome with the classic bilateral facial defects .
a 30-year - old woman with romberg syndrome with the atrophy on the left side of the face .
the preoperative frontal projection . a 52-year - old woman with posttraumatic facial scar in the left hemimandibular region .
the study comprised 32 patients , but only 27 completed the postoperative follow - up and we reported only their data ; after the first follow - up , 5 ( 1 female and 4 males ) patients were not available to continue the study .
we analyzed the morphological changes by comparing the photographic presurgical facial contour and the postoperative correction of facial soft tissue deficits .
table 1 reports the indications for fat transfer . due to its ease of access and availability , in all cases
after 6 months post - surgery , in 21 cases , excellent integration of the new fat in the recipient sites was observed and a satisfactory aesthetic result was obtained ( figs . 4 , 5 ) .
in 6 patients ( 2 facial scars , 2 franceschetti syndromes , 1 post - mandibular resection , 1 zygomatic trauma ) for assuring a satisfactory aesthetic result , it was necessary to suggest a second fat transfer ( fig . 6 ) .
in fact , after 6 months , in these patients , the graft showed a progressive resorption and an unaesthetic dispersion to the neighboring tissues .
one patient did not give consent for a second surgical treatment ( post - mandibular resection ) .
the retrospective analysis of photographic documentation of all cases reported showed a progressive fat resorption for 3 months after surgery and its stable integration only after this period .
few post - surgery complications associated to autologous fat transfer were reported ; in 7 cases , the recipient site presented edema and bruising minimized with an anti - inflammatory therapy ( 400 mg ibuprofen , 2 times daily , for 10 days ) .
the low aesthetic improvement of the posttraumatic facial scar obtained 6 months after the second surgical treatment .
also , the patients affected by facial deficit due to previous surgical treatment of dental abscess were very satisfied .
several authors promoted fat as an ideal filler : autologous , biocompatible , stable , in most patients available in sufficient quantities , naturally integrated , and easily removable if necessary .
some authors add that it is potentially permanent too , but others claim results are inconsistent and uncertain . from coleman 's technique , different approaches for fat harvesting , processing , and injection were suggested for improving the cosmetic outcome and graft survival .
recently , immunohistochemical studies of the extracellular matrix of the lipoaspirate showed the presence of adipose - derived stem cells . for its volumetric qualities and regenerative capacity ,
fat harvesting was suggested in many facial asymmetries : after trauma , post - tumor resection , congenital complex , and hemifacial asymmetry ( franceschetti and romberg syndromes ) .
our best results , following the traditional coleman technique , were performed in the treatment of genetically determined syndromes , such as the franceschetti and romberg syndromes .
autologous fat transportation appears , particularly indicated in complex reconstructive surgery , as a powerful tool to improve facial aesthetics .
also , facial asymmetry after surgical therapy of dental abscess was treated with the same technique . in these clinical cases ,
the soft tissue deficit was limited and able to receive the harvested fat , improving the facial contour .
different satisfactory outcomes were obtained in the treatment of the posttraumatic facial scar , which needed more surgical procedures . in these cases , it was more difficult to assure an adequate fat subdermic reinjection and the aesthetic modeling of inextensible tissue appears more complex and unpredictable .
best results are reported in the treatment of genetically determined syndromes ( franceschetti , romberg ) and for unaesthetic cutaneous abscess cavity after incision and drainage .
unsatisfactory outcomes are reported in the treatment of the posttraumatic facial scar , which needed more surgical procedures . | abstractthe authors reported their surgical experience about structural fat grafting in the management of facial volumetric deficit .
the purpose of this study was to assess the real indications , cosmetic results , complications , and global patient satisfaction of the coleman technique in redefining facial contours in congenital and postoperative deformities .
a retrospective analysis of 32 patients grafted according to coleman 's technique was performed , and the long - term outcomes and patient satisfaction were evaluated .
the mean postoperative clinical follow - up was 14 months .
the morphological changes were analyzed by comparing the photographic presurgical facial contour and the postoperative correction of soft tissue defects .
all consecutive cases reported showed a progressive fat resorption for 3 months after surgery and its stable integration only after this period .
best results were performed in the treatment of genetically determined syndromes , such as the franceschetti and romberg syndromes .
the authors suggest this surgical technique also for the treatment of unaesthetic cutaneous abscess cavity after incision and drainage .
unsatisfactory outcomes were obtained in the treatment of the posttraumatic facial scar , which needed more surgical procedures . |
mitochondria play a central role in the energy metabolism of brain , heart , and muscle by controlling the production of adenosine triphosphate ( atp ) , and mitochondrial preparations are commonly used to evaluate the metabolic activities of these tissues in both the normal and diseased states .
however , oxidative phosphorylation ( atp synthesis ) and electron transport in oral tissues , for example , the oral mucosa and gingival tissue , were extensively studied in a period of the late 1970s to early 1980s by several investigators [ 28 ] .
mitochondria in the oral tissues of animals and humans have been isolated by differential centrifugation of tissue homogenates with or without collagenase treatment [ 25 ] .
moreover , to avoid the destruction of mitochondria or the loss of respiratory activity , chilled buffer solutions of an isotonic tension have generally been adopted .
however , those studies have yielded variable and generally low levels of respiration both in the presence and absence of substrate , and the quantitative assessment of mitochondrial atp synthesis in oral tissues has been hindered by the extreme difficulty of homogenizing these tissues without damaging mitochondrial integrity and uncoupling oxidative phosphorylation .
therefore , further refinements for the isolation method are still required to obtain mitochondria with high quality .
clarification of the role played by oxidative phosphorylation in gingival tissue metabolism would aid in the understanding of responses to local injury and periodontal disease .
for example , collagen is a primary constituent of gingival tissue , and its synthesis and remodeling during periodontal tissue repair have been reported to be affected by diabetes , scurvy , and growth factors .
the events which affect these repair activities may also reflect changes at the oxidative phosphorylation level , since atp is required for many synthetic processes associated with collagen synthesis .
we report here a procedure for the isolation of mitochondria from rat gingival tissues by an optimized combination between homogenizing time and collagenase concentration , which displayed a good respiratory control ratio ( rcr ) and adenosine diphosphate / oxygen ( adp / o ) ratio using succinic acid as the substrate .
furthermore , the effect on respiratory activity of the leukotoxin ( lx ) and lipopolysaccharide ( lps ) involved in the inflamed state was examined .
chemicals used where mannitol , sucrose , potassium chloride ( kcl ) , potassium dihydrogen phosphate ( kh2po4 ) , succinic acid , rotenone , and adenosine 5-diphosphate sodium salt ( adp ) and bovine serum albumin ( bsa ) were purchased from sigma - aldrich japan co. ( tokyo , japan ) .
collagenase from clostridium histolyticum ( type i ) , 3-n - morpholinopropanesulfonic acid ( mops ) , 4na - ethylenediaminetetraacetic acid ( edta ) , and n-2-hydroxyethylpiperazine - n-2-ethansulfonic acid ( hepes ) were purchased from sigma - aldrich co. ( st louis , mo , usa ) .
leukotoxin ( lx ) is a product of cayman chemicals co. , usa and lipopolysaccaride ( lps ) from escherichia coli is a product of difco laboratories , mich , usa .
seven - to - nine week - old male wistar rats , weighing 250300 g were purchased from seac yoshitomi ltd ( fukuoka prefecture ) . after sacrificing the rats by cervical dislocation under chloroform anesthesia , the gingival tissue specimen ( approximately 1.0 g wet weight )
was excised from the mandible and maxilla . as shown in figure 1 , tissue specimens were washed and minced with 5.0 mm mops buffer ( ph 7.4 ) containing 200 mm mannitol , 70 mm sucrose and 0.05 mm edta at 4c . minced gingival specimens were diluted 10 fold with 1.2 mm mops buffer ( ph 7.4 ) containing 53.9 mm mannitol , 17.2 mm sucrose , 0.05 mm edta and 0.1% ( w / v ) bsa , and
then intermittently homogenized at 4c using a polytron homogenizer ( rt 1035 , kinematic ag , lucerne , switzerland ) for 40 , 50 , and 60 sec .
the homogenized gingival sample was then centrifuged at 4,500 g for 10 min , the supernatant was labeled as s1 and the sediment was incubated in a hanks solution ( ph 7.4 ) containing 0.115%0.130% ( w / v ) collagenase at 20c for 20 min .
following the enzymatic treatment , the homogenized gingival sample was centrifuged at 4,500 g for 10 min . while the supernatant was labeled as s2 , the sediment was diluted with 50 mm mops buffer containing 100 mm kcl , 0.2 mm edta , and 0.2% ( w / v ) bsa and homogenized using a teflon homogenizer for one min .
the homogenate was centrifuged at 600 g for 10 min and the sediment was collected as the nuclear ( n ) fraction .
the supernatant was then centrifuged at 4,500 g for 10 min , the supernatant was labeled as s3 and the sediment was finally collected as the mitochondrial ( mt ) fraction .
the specific activity of succinate dehydrogenase ( sdh ) was measured by a modified slater method . the ability of both the supernatant fractions s1 , s2 , and s3 and the sediment fractions n and mt to reduce potassium ferricyanide was measured .
protein was determined by the lowry folin phenol reagent method using bsa as a standard .
the oxidative phosphorylation of gingival mitochondria was measured using a biological oxygen monitor system ( model 5300 : ysi inc . ,
based on the oxygen consumption of the mitochondrial factions at 25c , states 1 , 3 , and 4 , that were established by chance et al .
namely , a final concentration of 0.5 mg protein/600 l buffer of gingival mitochondria was suspended in 600 l of 10 mm hepes buffer ( ph 7.4 ) containing 0.25 m sucrose and 10 mm kh2po4 in the reaction container of an oxygen electrode apparatus , followed by the addition of 100 g / ml rotenone and 0.6 mm succinic acid ( see figure 2 ) . after measuring states 1 , 3 , and 4 , the respiration activity of gingival mitochondria was assessed by measuring ( 1 ) respiratory control ratio ( rcr ) : the respiratory rate ( state 3 ) in the presence of adp compared to the rate ( state 4 ) following the expenditure of adp and ( 2 ) the adenosine diphosphate / oxygen ( adp / o ) ratio : the ratio of adp removed from the media to the amount of oxygen consumed , according to the estabrook method . at a concentration range of 0.52.0 g / mg mitochondrial ( mt ) protein , leukotoxins ( lxs ) were added to a 600 l of 10 mm hepes buffer ( ph 7.4 ) containing 0.25 m sucrose and 10 mm kh2po4 in the reaction container of an oxygen electrode apparatus , followed by the addition of 100 g / ml rotenone and 0.6 mm succinic acid . at a concentration range of 5.025.0 g / mg mt protein , lipopolysaccharide ( lps )
after measuring states 1 , 3 , and 4 , the respiration activity of gingival mitochondria was assessed by measuring rcr in the same manner as described above .
the mitochondrial preparations from rats were carried out at the fukuoka dental college , and the study was approved by the institutional use and care of animal committee .
all procedures were in accordance with the guidelines on animal experiments in fukuoka dental college and performed following the government law concerning the protection and control of animals ( no .
the data were obtained from 5 times measurements and were expressed as the mean standard deviations .
statistical comparisons were made by anova and scheffe 's test using a statistical software program .
rat gingival tissues were processed in the course of mitochondrial isolation ( figure 1 ) .
the first , second , and third supernatant fractions were designated as s1 , s2 , and s3 , respectively , while the two precipitates were designated as the nuclear ( n ) and mitochondrial ( mt ) fractions . as shown in table 1 , when the three supernatant and two precipitated fractions were obtained in the combination of 50 sec homogenization with 0.120% ( w / v ) collagenase treatment , the specific activities of succinate dehydrogense ( sdh ) in the s1 , s2 , and s3 fractions were 0.51 0.05 , 0.72 0.05 , and 0.22 0.02 , respectively , whereas those of n and mt precipitated fractions were 0.25 0.02 and 5.67 0.32 , respectively .
as shown in table 2 , after 40 sec homogenization with 0.125% ( w / v ) collagenase treatment of the mt fraction , the values of the respiratory control ratio ( rcr ) , and adenosine diphosphate / oxygen ( adp / o ) ratio were 1.54 0.02 and 1.39 0.05 , respectively .
after 50 sec homogenization with 0.120% ( w / v ) collagenase treatment of the mt fraction , the rcr and adp / o values were 1.80 0.05 and 1.65 0.03 , respectively .
further , after homogenization for 60 sec with 0.120% ( w / v ) collagenase treatment of mt fraction , the mt fraction rcr and adp / o values were 1.57 0.03 and 1.49 0.01 , respectively .
the values of the mt fraction in the 50 sec homogenization with 0.120% ( w / w ) collagenase treatment were significantly the highest .
as shown in table 3 , at a concentration range of 0.52.0 g / mg mt protein , leukotoxin ( lx ) decreased the rcr of the mt fractions by 29% , 37% , and 42% respectively , compared to the control ( none ) .
furthermore , at a concentration range of 5.025.0 g / mg mt protein , lipopolysaccharide ( lps ) decreased the rcr of the mt fractions by 31% , 38% , and 40% respectively , compared to the control ( none ) .
there are a few reports in the literature on the preparation of mitochondria ( mt ) from epithelial tissue for the purpose of the direct measurement of respiratory activity [ 27 , 16 , 17 ] .
however , neither the damage to fibroblasts in mt disease nor the effect of nicotine on mt in periodontal tissues has ever been reportedly investigated by the measurement of respiratory activity
. moreover , rosett et al . have suggested that it is impossible to prepare mt from attached gingival tissue , because of the presence of collagen , which disturbs the isolation of mt . in the present study of gingival mt preparation ,
the changes of the duration of the homogenization time and the concentration of collagenase were investigated .
succinic acid dehydrogenase ( sdh ) is an enzyme localized within cells in the mt matrix and an important step in the krebs cycle [ 13 , 17 ] .
the specific activity of sdh from the mt fraction was higher by 7.825.8 times in the three supernatants , s1 , s2 , and s3 , and compared with the one precipitated in the n fractions ( table 1 ) .
this indicates that mt were obtained through this isolation method that is a combination of a certain specific homogenization time and collagenase concentration .
the combined conditions of 50 sec homogenization with 0.120% ( w / v ) collagenase concentration yielded 1.80 0.05 as the respiratory control ratio ( rcr ) and 1.65 0.03 as the adenosine diphosphate / oxygen ratio ( adp / o ) .
fine et al . reported that the rcr and adp / o ratio from a crude mt preparation of weanling rat attached gingiva for succinate were 4.0 0.2 and 1.6 0.1 , respectively .
mccoy also reported the rcr value in epithelial mt after collagenase dissociation of hamster cheek pouch oral mucosa for succinate to be 2.45 , without any reported value for the adp / o ratio .
our value of 1.65 0.03 for rcr is 73% of that reported by mccoy . in terms of the relationship between metabolism and the function of polymorphonuclear cells ( pmns )
, it has been established that the chemotactic , phagocytic , and microbicidal activities of these cells are strongly dependent upon their oxidative metabolic process which is driven by mt .
leukotoxins ( lxs ) are a group of exotoxins that produce their primary toxic effects against leukocytes , especially pmns .
suliman et al . reported that lipopolysaccharide ( lps ) exhibited an endotoxic damage on the respiratory function of rat heart mt .
both commercial lx and lps in this study effectively inhibited the respiratory activity of rat gingival mt ( table 3 ) .
this fact suggests that both lx and lps may be involved in the attenuated mt function of inflamed gingival tissues . in conclusion ,
rat gingival tissue mt were isolated using the conditions of 50 sec polytron homogenization and 0.120% ( w / v ) collagenase concentration .
the quality of this mt preparation was confirmed by the demonstrated higher activity of sdh .
furthermore , the quality the mt preparation was certified by both respiratory parameters such as rcr and adp / o ratio .
finally , it was found that the rcr of mt was decreased by both an exotoxin , lx , and an endotoxin , lps . | in order to establish a method of obtaining rat gingival mitochondria ( mt ) , mt fractions were prepared in various combinations of homogenizing time with collagenase concentration .
rat gingival tissues were excised , minced , treated with collagenase , homogenized , and subjected to differential centrifugation rates .
both the respiratory control ratio ( rcr ) and adenosine diphosphate / oxygen ( adp / o ) ratio of the mt fraction prepared in a combination of 40 , 50 , or 60 sec homogenization with collagenase in a concentration range of 0.115%0.130% ( w / v ) were measured .
the values for the rcr and adp / o ratio of the mt fraction obtained in an optimal condition was 1.80 0.05 and 1.65 0.03 , respectively .
these results suggest that mt of fairly high quality can be obtained through this refined combination of the homogenizing time and collagenase concentration . |
food is an integral part of life ; however , for some , it can cause allergies and may even lead to fatality .
it is necessary to appreciate the large impact that culture and ethnicity have on food choices , eating styles , and patterns , especially in defining and accepting the diagnosis of food allergies . in 1990 , food allergies were estimated to affect 1.5% of adults in the united states and 6% of children younger than 3 years of age [ 1 , 2 ] . although food allergy ( fa ) is an important health problem in western countries , its prevalence varies among geographic regions .
there is limited data on the prevalence of food allergy in the middle east ; the data from turkey and mediterranean region are even scarce . in a study done in the uae ( al - ain city ) ,
eggs , fruits , and fish were the main allergens reported . without comprehensive data on the prevalence of food allergy
, it will be impossible to develop appropriate local diagnostic tools and avoid the incidence of anaphylaxis to food .
a clear understanding of the extent of food allergies will help public health services to be reactive rather than proactive .
the main objective of our study is to assess the prevalence of self - reported food allergy in lebanon .
secondary objectives include describing the principal food allergens , reporting the symptoms of food allergy in our group , the diagnostic tools , and the presence of concomitant allergic diseases .
the survey was conducted by a questionnaire given during telephone calls through random selection of landline phone numbers from the white pages all over lebanon .
the number of phone calls performed varied between 1500 and 2000 until reaching 500 answers stating yes or no ( accepting to participate in the survey ) .
data collectors hold a b.s . degree in biology , biochemistry , public health , or pharmacy with at least 6 years of experience in the pharmaceutical domain .
they are well trained to run a professional conversation with patients and handle such surveys and any objection that might arise while answering the questionnaire . the sample for phone calls was randomly selected from white pages based on regional split , coded , and distributed to data collectors in anqors consulting .
codes assigned to each questionnaire were used during data verification , feeding , and analysis .
if there is an answer , check if the person answering is eligible to participate ( adult , the household , etc . ) .
introduce the survey to check acceptance for participation as follows : good morning / evening ; we are calling from a professional company who holds surveys in the medical domain .
we are running a survey all over lebanon to assess the prevalence of food allergy .
if the answer is yes , proceed with the questionnaire.if the answer is no ,
if there is an answer , check if the person answering is eligible to participate ( adult , the household , etc . ) .
good morning / evening ; we are calling from a professional company who holds surveys in the medical domain .
we are running a survey all over lebanon to assess the prevalence of food allergy .
no names or addresses were requested while answering the questionnaire . step 4 . if the answer is yes ,
later on , the phone calls were split per region depending on the number of landlines per region ( relative to demographic distribution ) along with the response rate per region received during the pilot phase run at the beginning of june 2014 .
the medical research was run through phone calls survey targeting houses and the results presented herein are qualitative and quantitative ( percentage estimates ) .
the only personal data about the responder and/or allergic person are his age and sex . based on previously established prevalence rate of 3% through literature review and an estimated 95% confidence interval of 1.54.5% , a sample size of 506 subjects was needed for the study . a pilot study with a sample of 100 subjects was taken from digitalized white pages to assess the response rate in order to decide on the final sample of phone numbers needed . based on a response rate of 27.6% ,
the preliminary target was 1500 call attempts , which were increased to 1832 to obtain 506 responses . adults or grownups were interviewed over the phone and asked if they or any of their kids suffered from food allergies .
the fieldwork started at the beginning of july 2014 and continued over a period of 7 weeks .
people were first asked about whether they / nonadult housemates suffer from any type of food allergy or not .
food allergy sufferers ' calls elapsed for around 10 minutes . a questionnaire addressing the main objectives of the study
self - reported food allergy is estimated to be 4.1% in infants and children and 3.2% in adults .
the majority of self - reported food allergy prevalence was reported at childhood and adulthood with only 8% below 2 years of age ( figure 1 ) .
fruits ranked first as food allergens with 35% prevalence in the open - ended question , mainly strawberry ( 16% ) and peach ( 14% ) , followed by eggs ( 19% ) and nuts ( 16% ) ( figure 2 ) .
cow 's milk and spices came fourth when answering specifically about allergen classification in the questionnaire , with 14% prevalence ( figure 3 ) .
73% of participants mentioned that they are allergic to a single food allergen and 22% mentioned that they are allergic to two food allergens , while only 5% reported allergy to three food allergens .
skin reactions , including hives , itching , and redness , are the most common symptoms among food allergy sufferers , reported in 86% of the cases .
30% of food allergy sufferers reported facial swelling and 14% suffer from shortness of breath , throat swelling , angioedema , and cough , while 11% mentioned face swelling and angioedema with nausea / vomiting .
allergists , dermatologists , gastroenterologists , or gps are consulted for medical advice ( figure 4 ) .
75% of patients suffering from nausea and vomiting are more likely to seek medical advice to diagnose food allergy .
only 5560% of patients suffering from skin reactions , face swelling , and trouble in breathing seek medical advice for food allergy .
patients suffering from throat tightness and itchy throat , lips , and mouth are the least to consult a physician ( figure 5 ) .
the most common diagnostic tool requested by medical professionals was blood test ( specific ige ) ( 55% ) followed by other options such as food elimination based on clinical history ( 25% ) and allergy skin prick testing ( 20% ) .
73% of patients suffering from food allergy ask about food ingredients in case of non - self - prepared food .
75% of patients who seek medical advice check for food ingredients in non - self - prepared food .
51% of participants with food allergy have concomitant allergic diseases , such as allergic rhinitis in 30% of the cases , drug allergies ( mainly antibiotics , aspirin , and nonsteroidal anti - inflammatories ) in 16% of cases , and asthma in 5% of the cases .
in the past 2 decades , food allergy has emerged as an important public health problem , affecting people of all ages in societies with a western lifestyle , such as the united states , canada , united kingdom , australia , and western europe [ 6 , 7 ] .
food allergy is the most common cause of anaphylaxis in the outpatient setting for all ages , and it can lead to fatalities .
prevalence and moreover incidence of food allergy are often difficult to assess because their evaluation is influenced by multiple factors such as allergy definition , study population , methodologies , geographic variation , age , and dietary exposure .
a recent meta - analysis showed that self - reported prevalence of food allergy varied from 1.2% to 17% for milk , from 0.2% to 7% for egg , from 0% to 2% for peanuts and fish , from 0% to 10% for shellfish , and from 3% to 35% for any food .
marked heterogeneity in the prevalence of food allergy was noticed and could be a result of differences in study design or methodology or differences between populations .
the authors concluded that self - reported food allergy could not give a good estimate of food allergy . in recent population - based studies in the united states , 1.3% of adults
self - reported peanut allergy , tree nut allergy , or both ; 2.8% of adults self - reported seafood allergy ; and the adult population allergic to food was estimated to be 4% .
limited data suggest that the prevalence of food allergy has increased in industrialized countries worldwide ; for example , estimates of peanut and tree nut allergy tripled in american children between 1997 and 2008 , but the reason for this increase remains unknown .
examples include sesame in the middle east , buckwheat in japan , and mustard and lupine in france [ 11 , 12 ] .
however , to our knowledge , few population - based studies in the middle east have determined the prevalence of food allergy . in the middle east ,
a recent study done in the united arab emirates showed that the most common food allergens were seafood and nuts .
the prevalence of physician - diagnosed fa in children in the uae was 8% ( 95% ci : 5.410.8% ) .
eggs , fruits , and fish were the main allergens reported . in a previous study done by our group , we identified 386 out of 1842 ( 20.95% ) patients with positive specific ige to food allergens .
the major sensitizations were to cow 's milk in infants and young children and to hazelnut and wheat flour in adults .
although specific ige was more commonly detected to peanut in infants , children , and adults than to sesame , peanut - induced allergic reactions were mild , in contrast to sesame where anaphylaxis was the only clinical manifestation .
studies that measure sensitization to food allergens can overestimate the prevalence of true allergic reactions to foods , because not all sensitized patients will develop symptoms upon ingestion .
in contrast , the rates of food allergy are significantly lower if allergy is defined by verified clinical reactivity upon ingestion . in one study of food allergy in saudi patients ,
specific ige antibodies for various food allergens were detected in 38 ( 17.5% ) out of 217 patients .
most positive reactions were detected in urticaria patients ( 9.7% ) followed by asthmatics ( 5.5% ) and allergic rhinitis patients ( 2.3% ) .
reactions to peanut ( 22.6% ) , egg white ( 14.5 ) , and cow 's milk ( 12.9% ) were very prominent .
pertinent questions along with the timing and type of manifestations are essential to differentiate the two conditions .
our questionnaire addressed this issue by excluding all cases that reported symptoms more than 2 hours after food ingestion and patients presenting with irritable bowel symptoms such as bloating .
parents and grandparents are not easily convinced to avoid certain food in their child 's diet .
education is imperatively needed in order to avoid delay in diagnosis and proper management with an action plan .
unfortunately , epinephrine autoinjectors are not available in the country , and when prescribed they are bought from other countries .
plant food allergy is more common in patients with pollinosis than in the general population .
this may explain the highest incidence of allergy to fruits in our population which is similar to the population described in the mediterranean area .
this is a pilot study of self - reported food allergy prevalence in lebanon based on a telephone survey .
self - reported prevalence is estimated to be 4.1% in infants and children and 3.2% in adults .
advocacy for proper diagnosis , food elimination , and acquisition of epinephrine autoinjectors will hopefully result from our national study . | background .
food allergy ( fa ) is an important health problem in western countries but there is limited data on the prevalence of food allergy in the middle east .
the main objective of our study is to assess the prevalence of self - reported food allergy in lebanon
. methods .
the survey was conducted by telephone calls questionnaire through random selection of landline phone numbers from the white pages all over lebanon .
a study questionnaire addressing the main objectives of the study was filled during the telephone call conversation .
results .
food allergy prevalence is estimated to be 4.1% in infants and children and 3.2% in adults .
65% of patients suffering from food allergy are females and 35% are males .
skin reactions are the most common symptoms among food allergy sufferers , reported in 86% of the cases .
signs of anaphylaxis appeared in 10.8% of cases . fruits were the most common allergens at 35% , followed by eggs ( 19% ) and nuts ( 16% ) .
cow 's milk and spices ranked fourth ( 14% ) .
only half of food allergy sufferers sought medical advice .
allergists , dermatologists , gastroenterologists , or gps ( general practitioners ) were consulted .
blood testing for specific ige was the main diagnostic tool used by physicians .
conclusion .
this is a pilot study of self - reported food allergy prevalence in lebanon based on telephone survey .
general prevalence is estimated to be 4.1% in infants and children and 3.2% in adults .
our study may improve awareness for proper diagnosis , food elimination , and acquisition of epinephrine autoinjectors in this part of the world . |
the patient had been previously healthy until he was diagnosed with gerd a month prior , and began treatment with lansoprazole .
he had a history of working at a dusty place several weeks before hospitalization , where he did not experience any respiratory symptoms . however , a few days after initiation of lansoprazole treatment , cough and dyspnea developed along with a febrile sense .
after suffering from a progressively aggravating cough and dyspnea for a month , the patient visited our hospital .
vital signs of the patient were stable and the laboratory studies including eosinophil count were all in the normal ranges .
an initial chest radiograph showed diffuse ground - glass opacities in both lungs with upper lobe predominance , and we diagnosed differentiated diffuse interstitial lung disease or interstitial pneumonia , such as pneumocystis carinii pneumoniae pneumonia ( fig .
1a ) . high - resolution computed tomographic scans ( hrct ) showed focal areas of diffuse ground - glass opacity in both lungs with upper lung predominance , similar to those of the plain radiographs ( figs .
. a transbronchial lung biopsy was performed , and the histopathological result was acute lung injury with marked type ii pneumocyte hyperplasia , interstitial edema and interstitial infiltration of lymphocytes . after only one day of symptomatic treatment
considering his recent history of working at a dusty place , we thought that the clinical , radiologic , and histopathological findings represented hypersensitivity pneumonitis and we decided to start prednisolone therapy ( 30 mg / day ) .
however , on the third day of prednisolone therapy , the patient complained of sudden aggravation of dyspnea .
blood gas analysis showed hypoxemia ( sao2 80% on room air ) , and the chest radiographic findings showed aggravation of diffuse bilateral infiltration .
we performed a video - assisted thoracoscopic lung biopsy to decide on further treatment planning .
the specimen showed a nsip pattern with frequent masson 's bodies , active type ii pneumocyte hyperplasia and mixed interstitial inflammation without hyaline membrane formation ( fig .
the next day following the operation , the respiratory symptoms and chest radiographic findings all improved spontaneously , which was difficult to explain .
it was difficult to explain the cause of the sudden aggravation of symptoms and the imaging findings during the hospitalization of the patient .
therefore , we carefully reexamined the clinical course of the patient during the hospitalization . it was noted that the patient stopped taking lansoprazole immediately after admission in preparation for the transbronchial lung biopsy , and he restarted taking the drug along with prednisolone after the biopsy .
such a temporal relationship between the ingestion of lansoprazole and the worsening of symptoms led us to conclude that the symptomatic , radiological , and histopathological findings in the patient actually represented a drug - induced interstitial disease .
the clinical symptoms and the pulmonary opacities on the follow - up chest radiographs progressively improved .
the follow - up hrct scans performed two days after the restart of prednisolone therapy showed a marked improvement of the ground glass opacities in both lungs ( fig .
drug induced interstitial lung disease ( di - ild ) shows various clinicoradiographical findings that range from non - symptomatic infiltration to severe acute respiratory distress syndrome ( ards ) .
for example , amiodarone or methotrexate treatment may lead to nonspecific interstitial pneumonia ( nsip ) , treatment with bleomycin , nitrofurantoin or sulfasalazine to acute organizing pneumonia ( alternatively called bronchiolitis obliterans organizing pneumonia [ boop ] ) , and treatment with nonsteroidal antiinflammatory drugs nsaids ( nonsteroidal antinflammatory drugs ) or some antibiotics to acute eosinophilic pneumonia .
these manifestations can lead to the clinicoradiographically gas - exchange pattern of ards ( 1 , 4 ) .
drug induced interstitial lung disease may present several hours to several weeks after the introduction of the causative drug .
the clinical findings of di - ild include very nonspecific symptoms such as a nonproductive cough , dyspnea and fever , or crackles upon auscultation .
the laboratory results can show a range of findings from normal to eosinophilia and/or leukocytosis ( 2 ) .
. although it is not pathognomic , the radiological findings are sometimes very suggestive for certain types of di - ild .
invasive diagnostic examinations ( bronchoalveolar lavage , transbronchial or thoracoscopic biopsy ) are sometimes needed to rule out other lung diseases , especially when the medication history does not clearly meet the criteria of drug - induced lung diseases ( 1 ) . among many types of di - ild
, nsip is the second most common form of a histopathological pattern , after usual interstitial pneumonia .
diffuse , heterogeneous ground - glass opacities in both lungs , predominantly in the lower lobes are a typical finding on chest radiography .
an hrct scan shows focal or diffuse areas of ground - glass opacities with interstitial fibrosis ( 4 ) . in our case , despite the histopathological findings consistent with nsip , it was difficult to diagnose our patient as having drug - induced nsip , due to the clinical and radiological differences when compared to typical cases of the disease .
in fact , although a large number of drugs are known to cause pulmonary complications , it is difficult to diagnosis drug - induced lung disease ( 5 ) .
first , the clinical and radiological findings are nonspecific and they can mimic other pulmonary diseases ( 6 ) .
many new drugs are being developed and their adverse effects are have not been fully characterized . sometimes , both patients and clinicians do not consider the adverse effects of a drug as a cause of pulmonary symptoms .
in some cases , there is no clear temporal relationship between the initiation of a drug and the onset of symptoms . to the best of our knowledge ,
the diagnosis was made by considering the radiological , histopathological and clinical findings , including the close temporal relationship between lansoprazole exposure and symptom severity .
other possible causes were excluded due to a lack of a temporal relationship between the symptoms and work history or prednisolone therapy , and no other history of specific allergen exposure . when there is diffuse interstitial lung disease with an unknown etiology , it is important to remember that drugs can be the cause of pulmonary symptoms and it is crucial to take a careful patient history . if there is a recent history of taking lansoprazole in a patient with clinical and radiological findings of diffuse interstitial lung disease , we recommend stopping the medication to see if there is clinical and radiological improvement .
that way , one can avoid using invasive procedures to diagnose a lansoprazole - induced interstitial lung disease . | lansoprazole is an acid proton - pump inhibiting drug that is used for the treatment of duodenal or gastric ulcers , h. pylori infection , gastroesophageal reflux disease or zollinger - ellison syndrome .
although lansoprazole is well known for its gastrointestinal and dermatologic adverse effects , mild pulmonary symptoms are also known to develop from taking this drug .
there have been no reports about lansoprazole - induced interstitial lung disease .
we report here a case of lansoprazole - induced interstitial lung disease that developed in a 66-year - old man . |
plant samples of p.
poilanei collected in vietnam
at different times and locations were extracted with meoh and then
partitioned with n - hexane and chcl3 . when
the cytotoxic chcl3 partitions were subjected to chromatographic
separation guided by inhibitory activity against the ht-29 cell line ,
two new [ phyllanthusmins d ( 1 ) and e ( 2 ) ]
and four known [ phyllanthusmins a ( 6 ) ,
b ( 3 ) , and c
( 4 ) and cleistanthin b ( 5 ) ] arylnaphthalene lignan lactones
were purified .
the various plant collections and the compounds isolated
from each collection are summarized in table 1 .
initial collection of the combined
leaves , twigs , flowers , and fruits of p. poilanei .
second collection of the combined
leaves , twigs , flowers , and fruits of p. poilanei .
second collection of
the stems of p. poilanei . large collection of the combined
leaves , twigs , and stems of p. poilanei . located in khanh hoa province , vietnam . located in hatinh province ,
vietnam .
compound 1 was isolated as a new compound in the form
of colorless fine needles , mp 210211 c . a sodiated molecular
ion peak at m / z 619.1444 ( calcd
619.1422 ) observed in the hresims in conjunction with c nmr spectroscopic data corresponded to a molecular formula of c30h28o13 .
the uv ( max 260 nm ) and ir [ max 3446 ( hydroxy ) , 1747 ( -lactone ) ,
1619 , 1507 , and 1481 ( aromatic ) cm ] spectra showed
the absorption characteristics of an arylnaphthalene lignan lactone .
the h nmr data of 1 ( table 2 ) exhibited resonances
for two substituted aromatic rings at h 6.81 , 6.83 ,
6.97 , 7.09 , and 7.94 , a lactone methylene group at h 5.47 and 5.56 , a methylenedioxy group at h 6.05
and 6.10 , two methoxy groups at h 3.81 and 4.03 ,
two acetyl groups at h 2.14 and 2.23 , and proton
resonances for a sugar moiety in the range h 3.604.99 .
analogous resonances consistent with the presence
of these functionalities appeared in the c nmr data of 1 ( table 2 ) .
the lactone moiety was located at the c-8 and c-8 positions ,
as supported by the hmbc correlations ( figure 1 ) between h-9/c-7 , c-8 , c-8 , and c-9 ( figure 1 )
. the methylenedioxy group could be located at
the c-3 and c-4 positions , as indicated by the hmbc
correlations between these methylene protons and c-3 and c-4.
two methoxy groups were assigned at the c-4 and c-5 positions from
the hmbc correlations between these methoxy groups and c-4 and c-5 .
the sugar unit was assigned to the c-7 position , as supported by the
hmbc correlation between h-1 and c-7 .
two acetyl groups were
placed at the c-3 and c-4 positions of the sugar residue ,
as indicated by the hmbc correlations between the h-3 and
h-4 resonances and the acetyl carbonyl groups .
the resonances
at 3.52 for h-3 and at 3.71 for h-4
appearing in the h nmr data of 4 ( table s1 , supporting information ) were deshielded to
4.99 ( h-3 ) and 5.30 ( h-4 ) in the h nmr spectrum of 1 , due to the electron - withdrawing
effects that resulted from the acetyl carbonyl groups linked at the
c-3 and c-4 positions .
this was also supported by
the molecular weight of 596 da of 1 , or 42 atomic mass
units more than that of 3 , representing the presence
of a diacetylglycosyl residue in 1 rather than a monoacetylglycosyl
unit as in 3 .
thus , compound 1 was proposed
as an o - acetyl analogue of the known compounds phyllanthusmins
b ( 3 ) and c ( 4 ) , with both being characterized
from phyllanthus oligospermus in a previous study .
cosy ( , h h ) , key hmbc ( , h c ) , and
selected noesy ( , h h ) correlations
of 1 . measured in cdcl3 and
assignments of chemical shifts are based on the analysis of 1d and
2d nmr spectra .
the overlapped signals were assigned from h h cosy , hsqc , and hmbc spectra without designating
multiplicity .
ch3 , ch2 , ch , and c multiplicities
were determined by dept 90 , dept 135 , and hsqc experiments .
data ( ) measured at 100.6
mhz and referenced to the solvent residual peak at 77.16 .
data
( ) measured at 400.1
mhz and referenced to the solvent residual peak at 7.26 .
data
( ) measured at 150.9
mhz and referenced to the solvent residual peak at 77.16 .
data
( ) measured at 600.2
mhz and referenced to the solvent residual peak at 7.26 .
the
unusual value may result from
the restricted rotation of the d ring .
comparison of the nmr data of compound 1 with those
of phyllanthusmins b ( 3 ) and c ( 4 ) ( table 2 and tables s1 and s2 , supporting
information ) showed that these compounds displayed closely
similar nmr resonances for the diphyllin aglycone unit but different
resonances for their saccharide portions .
an l - arabinopyranosyl
residue of 1 could be proposed based on the several lines
of evidence that follow .
first , both the noesy correlations and the
specific rotation value of 1 were consistent with those
of the known compound 3 , as reported and isolated in the present study .
second , the noesy correlations
and specific rotation value of 1 were consistent with
those determined for 4 ( phyllanthusmin c ) in this investigation .
the latter compound , when isolated from p. poilanei , showed a specific rotation value { [ ]d 8 ( c 0.1 , chcl3 ) } that coincided
with a synthetic version of compound 4 { [ ]d 8 ( c 1 , chcl3)}. finally , both 1 and 4 were acetylated to form the same compound , 7-o-[(2,3,4-tri - o - acetyl)--l - arabinopyranosyl)]diphyllin
( 7 ) , which exhibited the same specific rotation value
of [ ]d 12 ( c 0.1 , chcl3 ) , and were closely comparable to the same
compound synthesized from diphyllin and l - arabinose { [ ]d 13 ( c 0.3 , chcl3)}. the h-1 doublet
at h 4.86 with a coupling
constant of 7.6 hz indicated the presence of an anomeric proton in
an axial orientation in 1 .
the noesy
correlations between h-1 and h-3 and h-3 and
h-4 suggested that h-1 , h-3 , and aco-4
are all axial ( figure 1 ) .
thus , the structure
of this new compound ( phyllanthusmin d , 1 ) was assigned
as 7-o-[(3,4-di - o - acetyl)--l - arabinopyranosyl]-4,5-dimethoxy-3,4-methylenedioxy-2,7-cycloligna-7,7-dieno-9,9-lactone ,
or 7-o-[(3,4-di - o - acetyl)--l - arabinopyranosyl]diphyllin .
this was confirmed by analysis
of its single - crystal x - ray diffraction data .
as shown in figure 2 , this compound existed as an atropisomeric mixture
because of hindered rotation of ring d about the c-1c-7
bond , which resulted in duplication of the c-8 resonance at c 131.42 and 131.43 ( table 2 ) and an
optical activity indicated by its ecd spectrum ( figure s17 , supporting information ) .
the same hindered rotation would likely be observed in 35 and other arylnaphthalene lignan lactones ,
as indicated by the duplicated resonances in their nmr spectra ( tables
s1 , s2 , and s4 , supporting information ) and optical activity shown in their ecd spectra .
these atropisomers interconvert slowly , hence permitting
the two diastereomers observed in the nmr spectra , but the rotation
barrier is too small for the individual diastereomers to be isolated
at room temperature .
ortep plots for the molecular
structure of 1 drawn
with 50% probability displacement ellipsoids ( oxygen atoms are red ,
carbon atoms are blue , and the small white circles represent hydrogen
atoms , which are drawn with an artificial radius ) .
the similar uv and ir spectra to those of 1 indicated
that 2 is also an arylnaphthalene lignan lactone .
the
molecular formula of c28h26o12 deduced
from c nmr data and a sodiated molecular ion peak at m / z 577.1319 ( calcd 577.1316 ) observed
in the hresims and the similar nmr data to those of 1 demonstrated that this compound is a diphyllin monoacetylarabinoside ,
a regioisomer of phyllanthusmin b ( 3 ) .
comparison of the h and c nmr
data of 2 with those of 3 showed that the
resonances for h-3 and c-3 of 2 were
deshielded , but those for h-4 and c-4 were shielded
( table 2 and tables s1 and s2 , supporting information ) .
this indicated that
the acetyl group is attached to c-3 in 2 rather
than to c-4 in 3 , as supported by the hmbc correlation
between the h-3 and the acetyl carbonyl carbon resonance .
a doublet at h 4.84 showing a coupling constant
of 6.0 hz displayed in the h nmr spectrum of 2 supported the presence of the anomeric proton in an axial orientation .
the noesy correlations between h-1 and h-5ax and h-3 and h-4 and h-5ax suggested
that h-1 , h-3 , and oh-4 are all axial ( figure
s19 , supporting information ) . although
sample limitations precluded hydrolysis of 2 to yield
the sugar unit or acetylation of 2 into 7-o-[(2,3,4-tri - o - acetyl)--l - arabinopyranosyl)]diphyllin
( 7 ) to determine its absolute
configuration , it may be assumed that this compound has the same absolute
configuration as that of 1 , 3 , and 4 , from the consistent noesy correlations ( figure s19 , supporting information ) and specific rotation
values { [ ]d 3 ( c 0.1 , chcl3 ) for 1 , [ ]d 4 ( c 0.1 , chcl3 )
for 2 , [ ]d 6 ( c 0.1 , chcl3 ) for 3 , and [ ]d 8 ( c 0.1 , chcl3 ) for 4 ( supporting information)}. therefore , the structure of 2 ( phyllanthusmin e )
was defined as 7-o-[(3-o - acetyl)--l - arabinopyranosyl]-4,5-dimethoxy-3,4-methylenedioxy-2,7-cycloligna-7,7-dieno-9,9-lactone ,
or 7-o-[(3-o - acetyl)--l - arabinopyranosyl]diphyllin .
altogether , six arylnaphthalene
lignan lactones were characterized
from the different parts of p. poilanei collected
in different locations in vietnam .
as summarized in table 1 , the most cytotoxic isolate , phyllanthusmin d ( 1 ) , was isolated from all parts of p. poilanei , and this compound can be regarded as a major cytotoxic principle
of p. poilanei . the known arylnaphthalene lignan
lactones isolated from p. poilanei were identified
by analysis of their spectroscopic data and comparison of these data
with literature values , and full assignments of their h and c nmr
spectroscopic data are listed in tables s1s4 ( supporting information ) . to partially discern
the effects of both the arabinose unit and the acetyl group in the
mediation of cytotoxicity of the diphyllin lignans ,
7-o-[(2,3,4-tri - o - acetyl)--l - arabinopyranosyl]diphyllin
( 7 ) was produced by acetylation of 1 and 4 using a standard method and
was identified by its molecular formula of c32h30o14 , as determined by hresims and comparison of its spectroscopic
data ( supporting information ) with those
reported for a synthetic sample . the
aglycone diphyllin ( 8) was generated by hydrolysis of
phyllanthusmin c ( 4 ) , and its structure was determined
by comparison of its spectroscopic data with reference values .
all arylnaphthalene lignans isolated from p. poilanei in the present study and their semisynthetic analogues were evaluated
for their cytotoxicity against ht-29 human colon cancer cells , using
paclitaxel and etoposide as the positive controls ( table 3 ) .
compounds 14 , 7 , and 8 were found to be cytotoxic , of which 1 and 7 were the most potently active , with ic50 values of 170
and 110 nm , respectively , but compounds 5 , 6 , and etoposide were inactive .
inspection of the lignan structures
and their cytotoxicity showed that compounds containing more lipophilic
acetyl groups exhibit higher potency , so the presence of one or more
acetyl groups linked to the arabinose residue improved the resultant
cytotoxicity . compounds 2 and 3 exhibited
the same activity , indicating that the acetyl group linked to c-3
contributed to this activity equally when linked to c-4. phyllanthusmin
c ( 4 ) showed a higher cytotoxicity than diphyllin ( 8) and cleistanthin b ( 5 ) , implying that the
-l - arabinose unit at c-7 played an important role
in generating this effect and was more active than a -d - glucose unit in mediating compound cytotoxicity toward ht-29 cells .
diphyllin ( 8) was active , but phyllanthusmin a ( 6 ) was inactive , showing that the c-4 and c-5 methoxy groups
and the c-7 hydroxy group are all required for diphyllin to mediate
its cytotoxicity .
the new compound phyllanthusmin d ( 1 ) showed a much greater ic50 value than etoposide , indicating
that this compound is more potently cytotoxic against ht-29 cells .
ic50 values were calculated
using nonlinear regression analysis with measurements performed in
triplicate and representative of two independent experiments in which
the values generally agreed within 10%
investigation of the cytotoxic arylnaphthalene lignans
reported
in previous studies showed that most active compounds are analogues
of diphyllin or diphyllin glycosides .
a methylated diphyllin derivative ,
justicidin a , was highly cytotoxic , but its close analogue , chinensinaphthol
methyl ether , did not show such activity , indicating the importance of the substituents on the a and d rings
of these compounds .
cleistanthoside a tetraacetate showed potent cytotoxicity
with ig50 values in the nanomolar range , but its precursor ,
cleistanthoside a , was inactive , suggesting
the importance of acetylation of the glycose unit of cleistanthoside
a. the structure cytotoxicity relationships of arylnaphthalene
lignan lactones observed from the present study are consistent with
observations made from these previous studies .
the two cytotoxic isolates 1 and 4 were
tested for their cytotoxicity toward ccd-112con human normal colon
cells using a previous protocol .
both
compounds were found to be noncytotoxic toward this cell line ( table 3 ) , indicating some selectivity for ht-29 human colon
cancer cells .
the new cytotoxic compound , phyllanthusmin d ( 1 , ic50 , 170 nm ) , isolated from p. poilanei , was
tested further in an in vivo hollow fiber assay for its possible antitumor
efficacy .
immunodeficient ncr nu / nu mice implanted with ht-29 human colon cancer cells placed
in hollow fibers were treated once daily by 1 at doses
of 5.0 , 10.0 , 15.0 , or 20.0 mg / kg , or the vehicle control , or paclitaxel
( 5 mg / kg ) , by ip injection for 4 days .
the results showed that the
values from the treatment of 1 at 10.0 , 15.0 , or 20.0
mg / kg ( ip ) were all statistically significantly different from those
at a dose of 5 mg / kg ( ip ) , and they showed a dose - dependent tendency
( figure 3 ) .
effect of phyllanthusmin
d ( 1 ) on the growth of human
colon cancer ht-29 cells implanted in ncr nu / nu mice tested in an in vivo hollow fiber assay .
mice were
treated with the indicated doses of 1 once daily by intraperitoneal
injection from day 3 to day 6 after implantation of the ht-29 cells
facilitated in hollow fibers . on day 7 , the mice were sacrificed ,
and fibers were retrieved and analyzed ( experimental
section ) .
the results are shown as the average percentage cell
growth relative to control [ columns , mean in each group ( n = 6 for the control group and n = 3 for the treatment
group ) ; bars , se ; * * p 0.05 and * * * p 0.01 for significant differences from the 5 mg / kg
( 1 ) treatment ] .
the enzyme dna topoisomerase is an established molecular
target
of etoposide , on which this compound acts to form dna double - strand
breaks via stabilization of the intermediate topo ii - dna covalent
complex to initiate the cell death pathway . in the present study , several diphyllin arabinosides ,
including
phyllanthusmins c ( 4 ) and d ( 1 ) and 7-o-[(2,3,4-tri - o - acetyl)--l - arabinopyranosyl)]diphyllin ( 7 ) , together with etoposide ,
were tested for their ability to inhibit dna topo ii ( figure 4 ) , using a method reported previously .
consistent with a previous report that etoposide showed topo ii
inhibitory activity , this agent exhibited
similar activity in the present study ( figure 4 ) .
however , arylnaphthalene lignan lactones investigated herein neither
inhibited topo ii-mediated dna strand passage / catalytic activity
( conversion of supercoiled dna to relaxed dna ) nor induced topo ii-mediated
dna cleavage ( linearized double - strand dna ) compared to the control ,
indicating that these substances are not topo ii inhibitors .
previous reports have documented that some diphyllin glycosides inhibited
topo ii , but other close analogues of these compounds did not .
this indicates that the glycosidic moiety of these lignans plays
a key role in topo ii inhibition .
some specific diphyllin analogues
might exert their cytotoxicity through a mechanism of action different
from that of etoposide , as supported by additional
chemical and biological studies for an arylnaphthalene lignan lactone ,
daurinol , which did not induce the formation of open circular and
linear dna that originated from the topoisomerase - dna cleavable intermediate .
evaluation of arylnaphthalene lignan lactones { phyllanthusmins
c ( 4 ) and d ( 1 ) and 7-o-[(2,3,4-tri - o - acetyl)--l - arabinopyranosyl)]diphyllin
( 7 ) ] from p. poilanei for activity as
topoisomerase ii ( topo ii ) inhibitors .
topo ii - dna covalent
complexes induced by test samples and etoposide were trapped by rapidly
denaturing the complexed enzyme with sodium dodecyl sulfate ( sds ) ,
digesting the enzyme , and releasing the cleaved dna as linear dna .
the formation of linear dna was detected by separating the sds - treated
reaction products using ethidium bromide gel electrophoresis and quantified
by accounting for the relationship between fluorescence and relative
band intensity for open circular ( oc ) , linear ( lnr ) , supercoiled ( sc ) ,
and relaxed ( rlx ) configurations of dna ( experimental
section ) .
apoptosis , or programmed
cell death , occurs during normal cellular
differentiation and the development of multicellular organisms . to remain malignant , cancer cells
must evade apoptosis to avoid
elimination , and many anticancer agents induce cancer cell apoptosis .
a previous study showed that an 8-day treatment of etoposide induced
ht-29 human colon cancer cell apoptosis , but shorter term treatment
with this compound did not show this activity .
after ht-29 cells were treated with compound 1 or etoposide at different concentrations , annexin v flow cytometry
was performed following a previous protocol .
treatment of ht-29 cells with 1 or 5 m phyllanthusmin d ( 1 ) for 72 h resulted in 28.2% or 30.3% of ht-29 cells undergoing
early apoptosis , respectively , while the analogous values for the
vehicle control or 1 or 5 m etoposide treatments were 3.9% ,
12.9% , and 12.5% , respectively ( figure 5 ) .
also , 1 induced 27.3% ( at 1 m ) and 38.0% ( at 5
m ) ht-29 cell apoptosis at the late stage , while the vehicle
control or 1 or 5 m etoposide treatments induced 8.6% , 19.8% ,
or 25.3% ht-29 cell apoptosis at this stage , respectively ( figure 5 ) .
these results indicated that compound 1 showed a higher potency than etoposide in inducing ht-29 cell apoptosis .
ht-29 cells were treated with 1 or 5 m phyllanthusmin
d ( 1 ) , 1 or 5 m etoposide , or the vehicle control
for 72 h , followed by an annexin v staining method ( experimental section ) .
lower left quadrant : percentage of
viable cells ; lower right quadrant : percentage of apoptotic cells ;
upper left quadrant : percentage of necrotic cells ; upper right quadrant :
percentage of late - stage apoptotic cells or dead cells .
caspase-3 , a key effector of programmed cell death
and a well - known
anticancer drug target , is activated only during cell apoptosis and
contributes fundamentally to this process . following a previous procedure ,
both 1 and etoposide were tested for their caspase-3 activation
in ht-29 cells ( figure 6 ) .
after 24 h incubation ,
phyllanthusmin d ( 1 ) induced activation of caspase-3
at as low a dose as 1 m , as well as at 5 and 10 m . in
contrast ,
under the same experimental conditions , etoposide did not
induce caspase-3 activation , which is consistent with the known resistance
of ht-29 cells to etoposide .
these results
again indicate a fundamental difference in the mechanism(s ) of action
of these agents .
ht-29 cells
were incubated with phyllanthusmin d ( 1 ) and etoposide
with different concentrations for 24 h , and caspase-3-like activity
was determined by western blotting using rabbit monoclonal cleaved
caspase-3 ( asp175 ) antibody .
the data shown are a representative blot
from three independent experiments with similar results ( experimental section ) .
h and c , dept , hsqc , hmbc , noesy , and cosy nmr
spectra were recorded at room temperature on bruker avance drx-400 ,
drx-600 , or drx-800 mhz nmr spectrometers .
esims and hresims were
measured on an lct - tof or a q - tof mass spectrometer in the positive - ion
mode .
column chromatography was conducted using silica gel ( 65
250 or 230 400 mesh , sorbent technologies , atlanta , ga , usa ) .
analytical thin - layer chromatography ( tlc ) was performed on precoated
silica gel 60 f254 plates ( sorbent technologies ) .
sephadex lh-20 was
purchased from amersham biosciences , uppsala , sweden . for visualization
of tlc plates ,
all procedures
were carried out using anhydrous solvents purchased from commercial
sources and employed without further purification .
reagents for chemical
synthesis were purchased from sigma except where indicated , and reactions
were monitored by tlc using precoated silica gel plates .
crystallographic
data were collected through the service crystallography at advanced
light source ( scrals ) program at the small - crystal crystallography
beamline 11.3.1 at the advanced light source ( als ) , lawrence berkeley
national laboratory , with a bruker apexii ccd detector ( bruker analytical
x - ray instruments , inc . ,
initial collections of separate samples
of the combined leaves , twigs , flowers , and fruits ( acquisition number
a06024 ) and the stems ( acquisition number a06025 ) of phyllanthus
poilanei were collected from a shrub at the road transect
from suoi cat village to hon ba peak ( 1207.873 n ; 10601.532
e ) , dinh khanh district , khanh hoa province , vietnam , in november
2004 , by d.d.s .
a voucher herbarium specimen
( dds 13619 ) representing this collection was identified
as phyllanthus poilanei beille by d.d.s . and deposited
at the john g. searle herbarium of the field museum of natural history ,
chicago , il , usa , under the accession number fm-2256257 .
second
collections of separate samples of the combined leaves , twigs , flowers ,
and fruits ( acquisition number a06473 ) and the stems ( acquisition
number a06474 ) of p. poilanei were obtained from
a liana - like shrub in the forest occurring at the south end of kego
lake , across from mui tru ranger station ( 1806.530 n ;
10600.891 e ) , kego nature reserve , cam xuyen district ,
hatinh province , vietnam , in december 2008 , by d.d.s .
a voucher herbarium specimen ( dds 14308 ) representing this collection was identified as phyllanthus
poilanei beille by d.d.s . and deposited at the john g. searle
herbarium of the field museum of natural history , chicago , il , under
the accession number fm-2287526 . a larger sample of the combined
leaves , twigs , and stems ( acquisition
number aa06024 ) of p. poilanei was collected from
a liana in the hon ba mountain region , 25 km from soi cat on a peak
along roadside forest ( 1206.745 n ; 10858.80
e ) , dinh khanh district , khan hoa province , vietnam , in august 2011 ,
by d.d.s .
. a voucher herbarium specimen
( dds 14886 ) representing this collection was identified
as phyllanthus poilanei beille by d.d.s . and deposited
at the john g. searle herbarium of the field museum of natural history ,
chicago , il , under the accession number fm-2300873 .
the milled air - dried leaves ,
twigs , flowers , and fruits of p. poilanei ( sample
a06024 , 2000 g ) were extracted with meoh ( 7 l 6 ) at room temperature .
the solvent was evaporated in vacuo , and the dried meoh extract ( 170.0
g , 8.5% ) was resuspended in 10% h2o in meoh ( 1000 ml ) and
partitioned with n - hexane ( 700 ml 2 and 500
ml ) to yield an n - hexane - soluble residue ( d1 , 22.4
g , 1.1% ) .
the aqueous meoh layer was then partitioned with chcl3 ( 800 , 700 , and 600 ml ) to afford a chcl3-soluble
extract ( d2 , 3.0 g , 0.15% ) , which was washed with a 1% aqueous solution
of nacl , to partially remove tannins .
the chcl3-soluble
extract exhibited cytotoxicity toward the ht-29 cell line ( ic50 < 5.0 g / ml ) .
both the n - hexane-
and water - soluble extracts were inactive in the bioassay system used .
the chcl3-soluble extract ( 2.8 g )
was subjected to silica
gel column chromatography ( 2.5 45 cm ) , eluted with a gradient
of n - hexane acetone .
eluates were pooled by
tlc analysis to give 13 combined fractions ( d2f1d2f13 ) .
of
these , d2f4d2f6 ( ic50 < 2 g / ml ) were
combined and further chromatographed over a silica gel column ( 2.5
20 cm ) , eluted with a gradient of n - hexane
fractions
d2f11 and d2f12 ( ic50 < 5 g / ml ) were combined
and further chromatographed over a silica gel column ( 2.5 20
cm ) , eluted with a gradient of n - hexane
subfraction
d2f4f2 was chromatographed over silica gel , with a gradient of n - hexane
acetone , and purified by separation over
a sephadex lh-20 column , eluted with ch2cl2meoh
( 1:1 ) , affording phyllanthusmin d ( 1 , 20 mg ) .
the combined
subfractions d2f4f3d2f4f5 were separated by silica gel chromatography ,
eluted with n - hexane acetone ( 3:1 ) , and purified
by passage over a sephadex lh-20 column , eluted with a mixture of
ch2cl2meoh ( 1:1 ) , to afford phyllanthusmin
a ( 6 , 2.0 mg ) , phyllanthusmin b ( 3 , 1.0
mg ) , and phyllanthusmin e ( 2 , 1.5 mg ) . fractions d2f11f2d2f11f4
were combined and chromatographed over silica gel , eluted by n - hexane acetone ( 2:1 ) , and purified by separation
over a sephadex lh-20 column , using ch2cl2meoh
( 1:1 ) for elution , affording phyllanthusmin c ( 4 , 7.0
mg ) .
the milled air - dried stems of p. poilanei ( sample a06025 , 580 g ) were extracted with meoh ( 3 l 4 and
then 2
the solvent was evaporated
in vacuo , and the dried meoh extract ( 47.4 g , 8.2% ) was resuspended
in 10% h2o in meoh ( 500 ml ) and partitioned with n - hexane ( 500 , 300 , 200 ml ) , to yield an n - hexane - soluble residue ( d1 , 1.4 g , 0.24% ) .
the aqueous meoh layer
was partitioned with chcl3 ( 500 , 300 , and 300 ml ) to afford
a chcl3-soluble extract ( d2 , 2.0 g , 0.34% ) , which was followed
by washing with a 1% aqueous solution of nacl , to partially remove
tannins .
the chcl3-soluble extract exhibited cytotoxicity
toward the ht-29 cell line ( ic50 < 5.0 g / ml ) .
both the n - hexane- and water - soluble extracts were
inactive in the bioassay system used . the chcl3-soluble
extract ( 1.8 g )
was subjected to silica gel column chromatography
( 2.5 45 cm ) , eluted with a gradient of n - hexane acetone .
fractions were pooled by tlc analysis to give 13 combined fractions
( d2f1d2f13 ) .
of these , d2f4d2f6 ( ic50 <
2 g / ml ) were combined , further chromatographed over a silica
gel column , eluted with a gradient of n - hexane acetone ,
and purified by separation over a sephadex lh-20 column , eluted with
ch2cl2meoh ( 1:1 ) , affording phyllanthusmin
d ( 1 , 7.0 mg ) .
the milled air - dried combined leaves ,
twigs , flowers , and fruits
of p. poilanei ( sample a06473 , 851 g ) were extracted
with meoh ( 3
the solvent
was evaporated in vacuo , and the dried meoh extract ( 96 g , 11.3% )
was resuspended in 10% h2o in meoh ( 500 ml ) and partitioned
with n - hexane ( 500 , 300 , 200 ml ) , to yield an n - hexane - soluble residue ( d1 , 10.2 g , 1.2% ) .
the aqueous
meoh layer was then partitioned with chcl3 ( 500 , 300 , and
300 ml ) to afford a chcl3-soluble extract ( d2 , 3.0 g , 0.35% ) ,
which was followed by washing with a 1% aqueous solution of nacl ,
to partially remove tannins .
the chcl3-soluble extract
exhibited cytotoxicity toward the ht-29 cell line ( ic50 < 10.0 g / ml ) .
both the n - hexane- and
water - soluble extracts were inactive in the bioassay system used .
the chcl3-soluble extract ( 2.8 g ) was subjected to silica
gel column chromatography ( 2.5 45 cm ) , eluted with a gradient
of n - hexane acetone .
fractions were pooled
by tlc analysis to give 11 combined fractions ( d2f1d2f11 ) .
of these , fractions d2f8 and d2f9 ( ic50 < 5.0 g / ml )
were combined , further chromatographed over a silica gel column ( 2.5
20 cm ) , eluted with a gradient of n - hexane
acetone ,
and purified by separation over a sephadex lh-20 column , eluted with
ch2cl2meoh ( 1:1 ) , affording phyllanthusmins
c ( 4 , 2.0 mg ) and d ( 1 , 3.0 mg ) .
the
milled air - dried stems of p. poilanei ( sample
a06474 , 517 g ) were extracted with meoh ( 2 l 6 ) at room temperature .
the solvent was evaporated in vacuo , and the dried meoh extract ( 75
g , 14.5% ) was resuspended in 10% h2o in meoh ( 600 ml ) and
partitioned with n - hexane ( 500 , 400 , and then 300
ml ) , to yield an n - hexane - soluble residue ( d1 , 1.0
g , 0.2% ) .
the aqueous meoh layer was then partitioned with chcl3 ( 500 , 300 , and 300 ml ) to afford a chcl3-soluble
extract ( d2 , 2.0 g , 0.38% ) , which was followed by washing with a 1%
aqueous solution of nacl , to partially remove tannins . the chcl3-soluble extract exhibited cytotoxicity toward the ht-29 cell
line ( ic50 < 10.0 g / ml ) . both the n - hexane- and water - soluble extracts were inactive in the bioassay
system used .
the chcl3-soluble extract ( 1.8 g ) was subjected
to silica gel column chromatography ( 2.5 45 cm ) , eluted with
a gradient of n - hexane acetone .
fractions
were pooled by tlc analysis to give 11 combined fractions ( d2f1d2f11 ) .
of these ,
fraction d2f10 ( ic50 < 5.0 g / ml ) was
chromatographed over a silica gel column , eluted with a gradient of n - hexane acetone , and purified by separation over
a sephadex lh-20 column , eluted with ch2cl2meoh
( 1:1 ) , to afford phyllanthusmin d ( 1 , 2.0 mg ) . in an attempt to accumulate a greater quantity of phyllanthusmin
d ( 1 ) for in vivo biological evaluation , a larger re - collection
of the combined leaves , twigs , and stems of p. poilanei was made .
the milled air - dried combined leaves , twigs , and stems
of this sample ( aa06024 , 3200 g ) were extracted with meoh ( 7 l
6 ) at room temperature .
the solvent was evaporated in vacuo , and the
dried meoh extract ( 278.0 g , 8.7% ) was resuspended in 10% h2o in meoh ( 1000 ml ) and partitioned with n - hexane
( 800 ml 3 and 500 ml 3 ) , to yield an n - hexane - soluble residue ( d1 , 27.0 g , 0.84% ) .
the aqueous meoh layer
was partitioned with chcl3 ( 800 ml 3 and 500 ml
3 ) to afford a chcl3-soluble extract ( d2 , 8.5 g ,
0.27% ) , which was followed by washing with a 1% aqueous solution of
nacl , to partially remove tannins .
the aqueous meoh layer was further
partitioned with etoac ( 800 ml 3 and 500 ml 3 ) to afford
an etoac - soluble extract ( d3 , 10.0 g , 0.31% ) , which was also washed
with a 1% aqueous solution of nacl .
the chcl3-soluble extract
exhibited cytotoxicity toward the ht-29 cell line ( ic50 < 5.0 g / ml ) .
however , all of the n - hexane- ,
etoac- , and water - soluble extracts were inactive in the bioassay system
used .
the chcl3-soluble extract ( 8.0 g ) was subjected to
silica gel column chromatography ( 4.5 45 cm ) , eluted with a
gradient of n - hexane acetone .
fractions were
pooled by tlc analysis to give 11 combined fractions ( d2f1d2f11 ) .
of these , d2f4d2f6 ( ic50 < 5 g / ml ) were
combined and further chromatographed over a silica gel column ( 2.5
20 cm ) , eluted with a gradient of n - hexane
acetone ,
to yield phyllanthusmins b ( 3 , 1.0 mg ) , d ( 1 , 10.5 mg ) , and e ( 2 , 1.0 mg ) .
fraction d2f8 was separated
by silica gel chromatography , eluted with n - hexane
acetone
( 2:1 ) , and purified by passage over a sephadex lh-20 column , eluted
with a mixture of ch2cl2meoh ( 1:1 ) ,
to afford phyllanthusmin c ( 4 , 9.5 mg ) . to isolate the
polar analogues of 4 , the etoac - soluble extract ( 9.0
g )
was subjected to silica gel column chromatography ( 4.5 45
cm ) , eluted with a gradient of ch2cl2meoh .
fractions were pooled by tlc analysis to give five combined fractions
( d3f1d3f5 ) . of these ,
d3f1 and d3f2 were combined , further
chromatographed over a silica gel column ( 2.5 20 cm ) , eluted
with a gradient of ch2cl2meoh , and purified
by passage over a sephadex lh-20 column , eluted with a mixture of
ch2cl2meoh ( 1:1 ) , to afford cleistanthin
b ( 5 , 1.5 mg ) .
colorless , fine
needles ( n - hexane acetone ) , showing a blue
color under uv light at 365 nm ; mp 210211 c ; [ ]d 3 ( c 0.1 , chcl3 ) ; uv ( meoh ) max ( log ) 260 ( 4.54 )
nm ; ecd ( meoh , nm ) max ( ) 292 ( 3.65 ) ;
ir ( dried film ) max 3446 , 1747 , 1619 , 1507 , 1481 ,
767 cm ; h and c nmr data ,
see table 2 ; positive - ion hresims m / z 619.1444 , calcd for c30h28o13na , 619.1422 .
amorphous , colorless
powder showing a blue color under uv light at 365 nm ; [ ]d 4 ( c 0.1 , chcl3 ) ; uv ( meoh ) max ( log ) 260 ( 4.58 )
nm ; ecd ( meoh , nm ) max ( ) 296 ( 4.15 ) ;
ir ( dried film ) max 3419 , 1738 , 1622 , 1506 , 1481 ,
770 cm ; h and c nmr data ,
see table 2 ; positive - ion hresims m / z 577.1319 , calcd for c28h26o12na , 577.1316 .
intensity data
for a small , colorless needle ( mp
210211 c ; molecular formula c30h28o13 , mw = 596.52 , hexagonal , space group p6122 , a = 21.4292(6 ) , c = 21.4162(6 ) , v = 8517.0(4 ) , z = 12 , density(calculated ) = 1.396 mg / m , size 0.01 0.01 0.20 mm ) from 1 were collected at 150 k on a d8 goniostat equipped with
a bruker apexii ccd detector at beamline 11.3.1 using synchrotron
radiation tuned to = 1.2399 at the advanced light source
at lawrence berkeley national laboratory . for data collection
, frames
were measured for a duration of 1 s for low - angle data and 4 s for
high - angle data at 0.3 intervals of with a maximum 2
value of around 91. the data frames were collected using the
program apex2 and processed using the program saint within apex2 ,
and the data were corrected for absorption and beam corrections based
on the multiscan technique as implemented in sadabs .
full - matrix least - squares refinements based
on f were performed in shelxl-97 , as incorporated in the wingx package .
it was necessary to apply distance
restraints for this group along with restraints on the anisotropic
displacement parameters ( simu and delu ) . for each methyl group
, the
hydrogen atoms were added at calculated positions using a riding model
with u(h ) = 1.5ueq(bonded
carbon atom ) .
the torsion angle , which defines the orientation of
the methyl group about the c c or o c bond , was refined .
the hydroxy group hydrogen atom bonded to o(8 )
was refined isotropically
and is involved in an intermolecular hydrogen bond with atom o(2 ) .
the rest of the hydrogen atoms were included in the model at calculated
positions using a riding model with u(h ) = 1.2ueq(bonded atom ) .
the final refinement cycle
was based on 4507 intensities , 191 restraints , and 478 variables and
resulted in agreement factors of r1(f ) = 0.050 and wr2(f ) = 0.089 . for the subset of data with i
the final
difference electron density map contains maximum and minimum peak
heights of 0.12 and 0.16 e / .
the cif file of the x - ray data of 1 has been deposited in the cambridge crystallographic data centre
( deposition no . ccdc 981532 ) . to a
dried 25 ml flask equipped with a magnetic stirrer , containing 3.0
mg of phyllanthusmin d ( 1 ) ,
after the mixture was stirred
at 40 c for 1 h , it was cooled to room temperature .
then , 5
ml of chcl3 was transferred into the flask , and the solution
was extracted with distilled h2o .
the organic layer was
washed with distilled h2o and evaporated at reduced pressure .
acetone ( 5:1 1:1 ) , to afford 7-o-[(2,3,4-tri - o - acetyl)--l - arabinopyranosyl)]diphyllin { 7 ( 1.0 mg , [ ]d 12 ( c 0.1 , chcl3)}. using the same protocol , 5.0 mg of phyllanthusmin c ( 4 ) was reacted with 10 l of acetic anhydride and 2
ml of pyridine at 60 c for 1 h and yielded 1.0 mg of 7 { [ ]d 12 ( c 0.1 , chcl3)}. these values are very close to that of
{ [ ]d 13 ( c 0.3 , chcl3 ) } reported for synthetic 7 . to a dried 25 ml flask equipped with a water
condenser and magnetic stirrer containing phyllanthusmin c ( 4 ,
5.0 mg dissolved in 1 ml of meoh ) , was transferred 5 ml
of 37% hydrochloric acid ( hcl ) into the flask .
after the mixture was
stirred at 70 c for 30 min , the mixture was cooled to room temperature
and diluted by 0.1 n naoh to ph 7.0 .
then , 5 ml of chcl3 was transferred into the flask , and the solution was extracted with
distilled h2o .
the residue
was separated by silica gel column chromatography , using n - hexane
acetone ( 3:1 ) , to afford diphyllin ( 8 , 1.5 mg ; data obtained are shown in the supporting
information ) .
the cytotoxicity of
the test compounds was screened against ht-29 cells by a previously
reported procedure .
paclitaxel and etoposide
were used as positive controls . following a previous
procedure and the method for screening
cytotoxicity toward ht-29 cells mentioned above
, the cytotoxicity
of the samples was screened against ccd-112con normal human colon
cells .
the hollow fiber assay is
an excellent method for evaluating the potential of natural products
for activity in vivo .
the human colon cancer cell line ht-29 was used
to evaluate 1 using procedures previously described in
detail by our group .
eight- to nine - week - old immunodeficient
ncr nu / nu mice were purchased from
the jackson laboratory ( bar harbor , me , usa ) and housed in microisolation
cages at room temperature and a relative humidity of 5060%
under 12:12 h light
all animal work was approved
by university of illinois at chicago animal care and use committee
( protocol number 13 - 057 ) , and the mice were treated in accordance
with the institutional guidelines for animal care .
phyllanthusmin
d ( 1 ) was dissolved initially in dmso and subsequently
diluted with cremophor .
the mice were injected ip once daily
for 4 days with 1 or the positive control ( paclitaxel ) .
animals showed no signs
of toxicity even at the highest concentration of 1 , and
all the remaining mice were sacrificed on day 7 .
the fibers were retrieved ,
and viable cell mass was evaluated by a modified mtt [ 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide ] assay . the percentage of the net growth for the cells in
each treatment group
was calculated by subtracting the day 0 absorbance
from the day 7 absorbance and dividing this difference by the net
growth in the vehicle control ( minus the value between day 7 and day
0 ) .
data were compared by student s t test ,
and a p value less than 0.05 was considered statistically
significant ( figure 3 ) .
topo ii - dna covalent complexes
induced by topo ii poisons such as etoposide may be trapped by rapidly
denaturing the complexed enzyme with sodium dodecyl sulfate ( sds ) ,
digesting the enzyme , and releasing the cleaved dna as linear dna .
the formation of linear dna was detected by separating the sds - treated
reaction products using ethidium bromide gel electrophoresis by a
modification of a previously described procedure . in this system ,
topo ii - mediated catalytic conversion of supercoiled
pbr322 dna to the relaxed form of plasmid dna can
also be observed .
a 20 l cleavage assay reaction mixture contained
250 ng of topo ii protein , 160 ng of pbr322 plasmid dna ( neb ,
ipswich , ma , usa ) , 1.0 mm atp in assay buffer [ 10 mm tris - hcl ( ph
7.5 ) , 50 mm kcl , 50 mm nacl , 0.1 mm edta , 5 mm mgcl2 , 2.5%
glycerol ] , and 100 m test compounds or dmso solvent , as indicated .
assay buffer ( 17 l ) and test compound / dmso ( 1 l ) were
mixed and allowed to sit at room temperature for 30 min , after which
2 l of topo ii was added to initiate the reaction .
tubes
were incubated at 37 c for 15 min and then quenched with 1%
( v / v ) sds10 mm disodium edta200 mm nacl .
the mixture
was treated subsequently with 0.77 mg / ml proteinase k ( sigma ) at 55
c for 60 min to digest the protein , and dna bands were separated
by electrophoresis ( 18 h at 2 v / cm ) on an agarose gel ( 1.3% w / v ) containing
0.7 g / ml ethidium bromide in tae buffer ph 8.0 ( 40 mm tris
base , 0.114% ( v / v ) glacial acetic acid , 2 mm edta ) .
the dna in the
gel was imaged by its fluorescence on a chemi - doc xrs+ imager ( bio - rad ,
hercules , ca , usa ) .
linear dna was quantified by accounting for the
relationship between fluorescence and relative band intensity for
open circular , linear ( lnr ) , supercoiled , and relaxed configurations
of dna , then calculating the percent
of lnr from the total dna content in each lane .
results are shown
for etoposide , phyllanthusmins c ( 4 ) and d ( 1 ) , and 7-o-[(2,3,4-tri - o - acetyl)--l - arabinopyranosyl)]diphyllin ( 7 ) in replicate
experiments performed on separate days ( figure 4 ) .
as described in previous
studies , ht-29 cells were treated with
the vehicle control or etoposide ( 1 or 5 m ) or 1 ( 1 or 5 m ) for 72 h. the cells were washed with annexin v
binding buffer , centrifuged at 300 g for 10 min , and
suspended ( 1 10 ) in 100 l of 1 annexin
v binding buffer . then , 10 l of annexin v - apc was added to
the suspension .
after the suspension was mixed and incubated in a
dark room at room temperature for 15 min , the cells were centrifuged ,
and the cell pellet was resuspended in 500 l of 1 annexin
v binding buffer . then
, 5 g / ml of 7-aad solution was added
in the suspension , and flow cytometry was conducted immediately . after a 24 h treatment ,
ht-29
cells were harvested , washed once with ice - cold pbs , and lysed ( 10 cells / ml lysis buffer ) in hypertonic buffer { 1% np-40 , 10
mm hepes ( ph 7.5 ) , 0.5 m nacl , 10% glycerol supplemented with protease
and phosphatase inhibitors [ ( 1 mm phenylmethylsulfonylfluoride , 1
mm na3vo4 , 50 mm naf , 10 mm -glycerol
phosphate , 1 mm edta ] , and protease inhibitor cocktail tablet ( roche
applied science , indianapolis , in , usa]}. cell lysates , adding 4
or 2 laemmli buffer ( bio - rad ) by supplementing with 2.5% -mercaptoethanol
to give 1 sds sample buffer , were boiled for 5 min and subjected
to immunoblot analysis , as described previously .
protein samples were resolved on 415% sds - page
( bio - rad ) , and immunoblot analysis was performed using antibodies
against the indicated signaling molecules .
the antibodies used were
rabbit monoclonal cleaved caspase-3 ( asp175 ) ( cell signaling technology ,
beverly , ma , usa ) and goat polyclonal -actin ( santa cruz biotechnology ,
santa cruz , ca , usa ) . | two new ( 1 and 2 ) and four known arylnaphthalene
lignan lactones ( 36 ) were isolated
from different plant parts of phyllanthus poilanei collected in vietnam , with two further known analogues ( 7 and 8) being prepared from phyllanthusmin c ( 4 ) .
the structures of the new compounds were determined by
interpretation of their spectroscopic data and by chemical methods ,
and the structure of phyllanthusmin d ( 1 ) was confirmed
by single - crystal x - ray diffraction analysis .
several of these arylnaphthalene
lignan lactones were cytotoxic toward ht-29 human colon cancer cells ,
with compounds 1 and 7-o-[(2,3,4-tri - o - acetyl)--l - arabinopyranosyl)]diphyllin
( 7 ) found to be the most potent , exhibiting ic50 values of 170 and 110 nm , respectively .
compound 1 showed
activity when tested in an in vivo hollow fiber assay using ht-29
cells implanted in immunodeficient ncr nu / nu mice .
mechanistic studies showed that this compound mediated
its cytotoxic effects by inducing tumor cell apoptosis through activation
of caspase-3 , but it did not inhibit dna topoisomerase ii activity . |
type 1 diabetes mellitus ( t1 dm ) is one of the most common pediatric endocrine illnesses . of these ,
over half are living in developing nations , with india being home to an estimated 97,700 children with t1 dm . data were collected from hospital - based studies in 1990 from india suggest that young diabetics ( onset of diabetes before the age of 15 years ) constitute about 1%4% of the total diabetic population .
india had reported a prevalence of juvenile diabetes ( onset below 15 years ) < 1% to 3.61% , between 1964 and 1989 .
the incidence of t1 dm continues to increase worldwide , and it has serious short - term and long - term implications .
the incidences of t1 dm is rising by 3%/year and at present more than 90,000 children are affected in europe alone .
this increase in the incidence along with enhanced access to insulin and better survival rates will lead to a higher prevalence in the near future .
. a study of 30 children with insulin - dependent diabetes with age at diagnosis 15 years , conducted in 1992 , reported a prevalence of 0.26/1000 children .
this was the first population - based study of prevalence of insulin - dependent diabetes in south india and shows that insulin - dependent diabetes is not rare and is higher than that reported from many other asian countries .
the karnataka state t1 dm registry listed an incidence of 3.7/100,000 in boys and 4.0/100,000 in girls over 13 years of data collection . at karnal , in haryana ,
the prevalence of t1 dm is 26.6/100,000 in urban and 4.27/100,000 in rural areas of the district , leading to an average prevalence of 10.20/100,000 population .
more than one percent of indian children are diabetic , according to a sample survey conducted by the government in schools in three cities . under the national program for prevention and control of cancer , diabetes , cardiovascular diseases and stroke ,
a study was conducted on 92,047 school children in nainital ( uttarakhand ) , ratlam ( madhya pradesh ) , and bhilwara ( rajasthan ) . according to this study , 1,351 ( 1.467% )
an estimated 18,000 children under the age of 15 were newly diagnosed for t1 dm in the year 2011 in the above - mentioned regions .
the prevalence of t1 dm in children is 1,11,500 according to a world health organization report of the international diabetes federation for the south - east asian region .
the increase in the incidence along with enhanced access to insulin and better survival rates will lead to a higher prevalence in the near future . | it is estimated that india is housing about 97,700 children with type 1 diabetes mellitus ( t1 dm ) .
a study of 30 children with insulin - dependent diabetes with age at diagnosis 15 years , conducted in 1992 , reported a prevalence of 0.26/1000 children .
the peak age at diagnosis was 12 years .
this was the first population - based study of prevalence of insulin - dependent diabetes in south india and shows that insulin - dependent diabetes is not rare and is higher than that reported from many other asian countries .
the karnataka state t1 dm registry listed an incidence of 3.7/100,000 in boys and 4.0/100,000 in girls over 13 years of data collection . at karnal , in haryana ,
the prevalence of t1 dm is 26.6/100,000 in urban and 4.27/100,000 in rural areas of the district , leading to an average prevalence of 10.20/100,000 population .
karnal city has a relatively high prevalence of t1 dm ( 31.9/100,000 ) .
an estimated 18,000 children under the age of 15 were newly diagnosed for t1 dm in the year 2011 in the above - mentioned regions .
the prevalence of t1 dm in children is 111,500 according to a world health organization report of the international diabetes federation for the south - east asian region . |
diabetic foot is one of the serious complications associated with diabetes and affects quality of life in respective patients in all ages and races . the world health organization ( who ) reported increasing incidence of diabetes all around the world , especially in developing countries .
the prevalence of diabetes is on the rise in iran , chiefly in the southern parts [ 2 , 3 ] .
neuropathy , peripheral arterial disease , and pressure overload make the sufferers prone to ulcer .
it is estimated that approximately 1525% of diabetic patients develop diabetic foot ulcers during the course of the disease .
people with diabetes can progress into chronic ulcers often leading to amputation if not treated promptly [ 46 ] .
age , male gender , and long duration of diabetes are the other factors associated with amputation [ 4 , 7 ] .
several studies have shown different bacterial agents isolated from patients in different geographical areas in iran [ 2 , 9 , 10 ] .
the inconsistency in reports might be attributed to the varying research methods and populations . if bacterial infection is mild , it is usually monobacterial and if severe infection is present , it is polymicrobial
. the antibiotic susceptibility patterns also show variations in diverse geographical regions [ 1113 ] .
multidrug resistant ( mdr ) bacteria , methicillin resistant s. aureus ( mrsa ) , and extended - spectrum -lactamase ( esbl ) producing gram - negative bacteria and their associated complications have created a big health concern among the medical and clinical practitioners [ 9 , 14 , 15 ] . in recent decade , high rates of mdr bacteria , mrsa , and esbl positive strains have been observed in many hospitalized diabetic foot patients ( dfp ) [ 6 , 9 , 16 ] .
such conditions make the treatment more demanding and many even menacing to the respective hospitalized patients ' lives .
therefore , early diagnosis of lesions and prompt initiation of appropriate antimicrobial therapy are essential for controlling the infection and preventing complication and improving the quality of life .
antibiotic susceptibility test is a requirement for the management of infections which can help to make better therapeutic choices .
hence , this study was designed to evaluate the prevalence of microorganisms in infected diabetic foot cases and their sensitivity patterns in public hospital , in fars , shiraz , southern iran .
this cross - sectional study was carried out on 86 patients admitted with infected diabetic foot .
the study design and methodology were approved by the ethics committee of professor alborzi clinical microbiology research center and patients ' consents were also obtained .
the study population was defined as the total number of patients with type 1 diabetes mellitus ( dm ) and type 2 dm with foot ulcers at initial visit and admission to nemazee hospital .
information regarding patients ' demographic and clinical features such as age , sex , patients ' weights , type of diabetes , wound size , random blood sugar level , nature of ulcer based on wagner classification , and amputation was gathered .
data related to clinical findings such as neuropathy , vasculopathy , nephropathy , hypertension , and retinopathy were also collected .
the vascular disease and neuropathy patients were firstly assessed based on characterization and position of ulcers and their history and then determined with additional tests . for arterial disease ,
absence of peripheral pulses , presence of claudication , and ct angiography were performed . for neuropathy , nerve dysfunction , significant painful symptoms , reflex test , and light touch sensory
two specimens ( pus , wound exudates ) for microbiological studies were obtained from the infected sites .
in fact , the clinical signs of infection and also condition of patients make us use swab culture . for ulcer ,
the wound before sampling was debrided with a sterile scalpel and rinsed with sterile normal saline and then , samples were collected using sterile swabs , from the depth of the wounds to check for the presence of infective agents ( deep swab technique ) .
susceptibility of all the isolates to different antibiotics was determined by the disc diffusion methods , as recommended by the clinical and laboratory standard institute , using commercial antimicrobial discs ( mast .
mrsa was determined by using the 30 g cefoxitin disk and oxacillin agar screen plate : the oxacillin ( mrsa ) agar screen plate was developed for the detection of methicillin resistance in s. aureus .
ten microliters of the 10 cfu / ml bacterial suspension ( final concentration = 10 cfu / ml ) was inoculated onto mha plates containing 4% nacl and 6 g / ml of oxacillin .
any growth occurring within 48 h incubation at 3335c was taken to be oxacillin resistant .
esbl detection for gram - negative bacilli was done using combined disk method ceftazidime ( 30 g ) , ceftazidime / clavulanic acid ( 30 g/10 g ) , and cefotaxime ( 30 g ) and cefotaxime / clavulanic acid ( 30 g/10 g ) .
eighty - six patients with a mean age of 55.5 years hospitalized in surgery wards were studied during the abovementioned period .
dfp weights ranged from 43 to 100 kg , of which 28 cases were over 75 kg ( 32% ) . mean random blood sugar level was 288.5 mg / dl .
seventy - four ( 86% ) patients received antibiotic treatment on admission ( 3 patients : cefalexin , 6 patients : imipenem and vancomycin , and 65 patients : clindamycin and ciprofloxacin ) .
ciprofloxacin 400 mg iv twice a day and clindamycin 900 mg iv three times a day were administered .
all patients had ulcers graded as 04 in the wagner classification with grade 3 as the most prevalent .
totally , 18 patients presented with osteomyelitis and were diagnosed based on history , physical examination findings , and radiographic and other imaging studies .
there were 26 ( 30% ) patients with peripheral arterial disease diagnosed as ischemic ulcer on the day of admission .
totally , 122 aerobic microorganisms were isolated from the patients . among them , 78 were gram - positive , 7 were fungi , and others were gram - negative .
the count and percent of the organisms are presented in table 2 . according to the in vitro antibiotic susceptibility testing , linezolid was the most effective antibiotic against enterococcus isolates ( all isolates ( 100% ) were sensitive ) and ciprofloxacin was the least effective antimicrobial ( all isolates ( 100% ) were resistant ) . as revealed , 20.6% of the enterococcus were resistant to vancomycin .
all gram - negative bacteria were sensitive to colistin and polymyxin b and 53% of gram - negative bacteria were esbl positive .
resistance rates for enterobacteriaceae and nonfermenters were presented in table 3 and figure 2 , respectively . among 81 bacterial isolates for which we performed antibiotic test ,
91% were multidrug resistant ; that is , they were resistant to 3 or more antibiotics and considered as mdr .
foot ulceration is the most severe complication affecting diabetic patients which is not confined to certain superficial underlying subcutaneous tissue .
diabetic foot ulceration ( dfu ) arises from uncontrolled diabetes and incomplete health self - care [ 18 , 19 ] .
the majority of the patients with dfu were male and older than 40 years , consistent with other reported studies [ 7 , 20 ] .
this may be due to factors such as the differences in life styles and professional activities and jobs , causing the feet to tolerate more pressure . in the present study ,
vascular diseases were the main risk factor among the patients , which is also noted in other studies [ 2123 ] .
the percentage of patients involved with neuropathy is comparable to other studies in iran [ 24 , 25 ] .
of course , the prevalence varies in different studies , which could be explained by different sample sizes , different distributions of risk factors , and also habits and life styles of the patients such as eating habits and physical activities that can increase the prevalence of risk factors . the validity and accuracy of using swab versus biopsy culture were addressed in some studies . some have found that tissue specimens are more sensitive and specific than swab cultures [ 26 , 27 ] while others have reported that , with debridement , the use of a wound swab , as the most common technique , is as reliable as the use of a tissue specimen , at least for initial monitoring [ 2831 ] .
taking into account the study limitations including the lack of easy access to biopsy samples , clinical signs of infections , and patients ' conditions , we were encouraged to use deep swab culture . in the present study , 79 percent of cases had monomicrobial infection , similar to other studies [ 3234 ] , but lipsky reported in 2012 that polymicrobial strains were most common .
the point to be noted here is that we did not consider anaerobic bacteria and monobacterial infections were found to be more prevalent .
we collected 78 gram - positive bacteria , as in previous studies which reported that gram - positive strains were more isolated from dfp [ 9 , 10 , 34 ] . in contrast , gadepalli et al . found that gram - negative bacteria ( proteus species , e. coli , and pseudomonas aeruginosa ) were predominant strains .
source of infection , use of antibiotic drug for treatment , sample collection method , geographical variation , and type and severity of the infections can influence the pathogens diversity in different geographical areas including iran .
( 28 cons , 9 cops ) were the most frequent pathogens isolated from the patients , as stated in the majority of studies [ 13 , 36 ] .
were the second most frequent microorganisms which might be due to previous usage of antibiotics .
enterococci are frequently detected in compromised patients , such as diabetics , and in their foot ulcers , but their role in infections at these sites is not clearly defined .
gram - negative bacilli and mixed infection were more evident in grades 3 and 4 whereas gram - positive cocci were most common in grades 1 and 2 , indicating that gram - negative infections increase the severity and make the patients prone to amputation .
as revealed , 42 patients underwent amputation , in 32 cases of which gram - negative bacteria were detected .
, we isolated 3 c. albicans , 1 candida genus , and 3 aspergillus spp .
some studies have noted high prevalence of candida spp . [ 38 , 39 ] , whereas others reported opportunistic molds species as the causative agents of fungal infections in the dfp [ 38 , 40 ] .
most of the patients involved with fungal infections were in wagner grades 3 and 4 .
it is worth mentioning that the patients in our study with diabetic foot ulcers did not receive any antifungal agents at all .
so dfp should be examined for fungal infections and also evaluated mycologically for ulcers . nowadays , a big concern among the medical and clinical practitioners is the emerging mdr organisms and their associated complications in developing countries [ 41 , 42 ] . in the current study ,
multidrug resistance rates of isolates in 2014 were 63.4% , while the reported rate in 2004 was 18% [ 43 , 44 ] . to alleviate the rate of mdr and spread of resistance
the resistance patterns for enterobacteriaceae , nonfermenters , and s. aureus are presented in table 1 and figures 1 and 2 .
the enterobacteriaceae family was resistant to the majority of antibiotics tested , except colistin , imipenem , amikacin , and meropenem , partially consistent with the results of other studies [ 11 , 45 ] .
but among nonfermenter gram - negative bacteria , only colistin and polymyxin b were completely sensitive where 60% of strains were resistant to imipenem and meropenem .
as for staphylococcus spp . , linezolid and vancomycin were the most effective antibiotics and low resistance was seen to rifampicin but a high resistance exhibited to other antibiotics .
other studies have shown different susceptibility antibiotic patterns and approximately in most , vancomycin and linezolid have shown good activity against the strains [ 9 , 46 , 47 ] .
the high rates of antibiotic resistance shown in the present study may be due to such factors including hospitalization , recent use of broad - spectrum antibiotics , history of surgery and chronic wounds , irrational use of antibiotics , and the transfer of resistance genes by transport means .
these antibiotics were used for almost all the patients as empirical therapy in our study .
however , it should be noted that clindamycin is also used for anaerobic organisms but we did not examine such organisms in this study . in a study conducted in 2014 , it was shown that combination use of these antibiotics does not lead to the desired result .
in addition , high rate of resistance to ciprofloxacin was noted by other studies [ 34 , 49 ] .
although we can not specify an appropriate treatment regimen , considering the results it can be suggested that the best agents for enterobacteriaceae isolates are polymyxin b , colistin , carbapenem , and amikacin .
polymyxin b and colistin also seem to be the best antibiotics for nonfermenter strains . for gram - positive cocci , low rate resistance to linezolid and vancomycin
this could be explained by low prescription of such antibacterial agents for infections in the patients .
it seems that these antibiotics can serve as drugs of choice for the treatment of dfi in the abovementioned hospital . on the other hand , consumption of some drugs
is limited according to the patients clinical status . as for the alarming types of resistance ( i.e. , vancomycin resistant enterococci , mrsa , and esbl )
, our data showed that the percentages of vre , mrsa , and esbl were 20.6% , 78% , and 53% , respectively .
these rates are comparable with those in other studies from iran [ 9 , 13 , 50 ] .
infections with these isolates are more difficult to treat than ordinary ones , because the strains do not respond well to many common antibiotics used to kill bacteria .
to alleviate this situation and also reduce the rate of amputation , clinicians should prescribe antibiotics rationally , timely , and sufficiently and there should be periodic supervisions on the drug consumption by the respective organizations .
it can be concluded that culture specimens for correct management of the dfi and knowledge of the susceptibility of antimicrobial drugs are essential for the choice of appropriate antibiotics with maximum efficacy . | background . diabetic foot infections ( dfis )
are a major public health issue and identification of the microorganisms causing such polymicrobial infections is useful to find out appropriate antibiotic therapy .
meanwhile , many reports have shown antibiotic resistance rising dramatically . in the present study
, we sought to determine the prevalence of microorganisms detected on culture in complicated dfis in hospitalized patients and their antibiotic sensitivity profiles .
methods .
a cross - sectional study was conducted for a period of 24 months from 2012 to 2014 in nemazee hospital , shiraz , iran .
the demographic and clinical features of the patients were obtained .
antimicrobial susceptibility testing to different agents was carried out using the disc diffusion method .
results . during this period
, 122 aerobic microorganisms were isolated from dfis . among gram - positive and gram - negative bacteria , staphylococcus spp . and
e. coli were the most frequent organisms isolated , respectively .
of the isolates , 91% were multidrug while 78% of s. aureus isolates were methicillin resistant .
53% of gram - negative bacteria were positive for extended - spectrum -lactamase .
conclusion . given the involvement of different microorganisms and emergence of multidrug resistant strains ,
clinicians are advised to consider culture before initiation of empirical therapy . |
it is an antiplatelet agent , at least as effective as aspirin with potential additional antiatherosclerotic and antivasoconstrictive properties .
it is expected to be useful in the secondary prevention of cerebrovascular and cardiovascular events in patients with a history of ischemic stroke and recent transient ischemic attacks ( tias ) .
this is currently being evaluated in a large - scale ongoing phase iii randomized controlled trial , perform ( prevention of cerebrovascular and cardiovascular events of ischemic origin with terutroban in patients with a history of ischemic stroke or transient ischemic attack ) .
the perform study includes 19,119 patients , who are randomly allocated to treatment with either terutroban 30 mg / day or aspirin 100 mg / day , and will be followed up for at least 3 years .
the rationale and design of the perform study have been described elsewhere , as well as the characteristics of the whole population at baseline [ 3 , 4 ] .
perform is powered to detect the superiority of treatment with terutroban versus aspirin for prevention of the primary endpoint , which is a composite of fatal and nonfatal ischemic stroke , fatal and nonfatal myocardial infarction , or other vascular death . here
we describe the rationale and design of an ancillary study of perform , the perform vascular project , which has been specifically designed to study the effect of terutroban on the progression of atherosclerosis , as assessed by carotid intima - media thickness ( cimt ) , carotid plaques , and carotid stiffness in a subgroup of perform participants .
tp receptors are deeply involved in the atherosclerotic process whether they are located on platelets , immune cells ( monocytes / macrophages or lymphocytes ) , or vascular cells ( smooth muscle cells , endothelial cells ) . indeed , injury - induced vascular proliferation is reduced in mice that are genetically deficient in tp receptors .
in contrast , this response is increased in mice that have been genetically modified and overexpress tp receptors ( tpoe mice ) , but blocked when tpoe mice are treated with terutroban .
inhibition of the tp receptors with an agent such as terutroban can therefore be expected to have a broad action on atherosclerosis .
this had been shown for the first time in apoe deficient mice , in which terutroban , in contrast to aspirin , decreased atherosclerotic plaque formation most likely related to its anti - adhesive properties .
the anti - atherosclerotic activity of terutroban has further been investigated in several animal models . in apobec-1/ldl receptor double knockout mice ,
terutroban delayed atherogenesis at the arch of the aorta compared with placebo and compared with a specific cox1/cox2 inhibition by indomethacin . in cholesterol - fed new zealand rabbits , an established animal model for advanced atherosclerosis ,
terutroban induced a regression of atherosclerotic plaque , as well as a significant reduction in the markers for macrophages , apoptotic cells , metalloproteinases , and endothelin-1 , and a relative increase in vascular smooth muscle cells , suggesting that terutroban not only halts the progression of atherosclerosis , but also transforms lesions towards a more stable phenotype .
these results are in line with those from another animal studies , in which terutroban was found to enhance atherosclerotic lesion stability .
as regards terutroban s effects on vasoreactivity and endothelial function , this has been evaluated in atherosclerotic patients with endothelial dysfunction receiving treatment with aspirin .
these results strongly support beneficial vascular effects of terutroban through a platelet - independent mechanism in patients already treated with aspirin .
atherosclerosis is a dynamic and progressive inflammatory disease that precedes clinical vascular events such as myocardial infarction and ischemic stroke , and can be assessed non - invasively in a valid and reproducible manner with carotid ultrasound . in clinical trials , carotid intima - media thickness ( cimt )
the association between cimt and cardiovascular risk factors has been demonstrated , and cimt , as measured by b - mode ultrasonography , has been found to be a powerful predictor of cardiovascular and cerebrovascular outcomes [ 1115 ] .
this non - invasive technique allows sequential follow - up measurements in epidemiological and clinical trials with the best precision when using standardized methods .
moreover , vascular ultrasound can also be used to assess atherosclerotic changes in the arterial wall expressed by the occurrence of carotid plaque and by local arterial stiffness . in the perform vascular project
, cimt will be evaluated over 3 years to allow for sufficient time to detect antiproliferative and antiatherogenic activity .
this is in line with the study duration of other trials that investigated the effects of various agents on cimt [ 1821 ] .
the perform vascular project is an ancillary study of the randomized , double - blind , controlled , parallel - group , phase iii perform study , which is ongoing in 802 centers in 46 countries [ 3 , 4 ] . of these
the main perform study included patients aged 55 years , who had a cerebral or retinal infarction in the last 3 months preceding inclusion or tia in the last 8 days , and who were stable at inclusion with no intracranial hemorrhage or non - ischemic neurological disease .
the inclusion criteria for the perform vascular project were men or women participating in the main study aged between 55 and 80 years , with validated baseline ( m0 ) vascular evaluation including ( 1 ) an assessment of the quality of the images ( positioning , recording ) ; ( 2 ) confirmation that both common carotid arteries ( cca ) were visible and at least one carotid plaque was present ; and ( 3 ) at least one cimt measurement on a cca segment free of plaque was possible .
patients were excluded from the vascular project because of absence of carotid plaque , carotid stenosis 70% or complete carotid obstruction ( cca , internal carotid artery [ ica ] , or bifurcation ) , or a history of carotid surgery , including percutaneous intervention ( stent placement ) .
the trial profile of the perform vascular project is shown in fig . 1 . the first ( baseline )
ultrasonographic assessment of vascular function ( cimt ) is performed at randomization ( i.e. , the m0 visit ) prior to treatment allocation .
ultrasonographic vascular explorations will then be performed within 15 days of the m12 ( 12 months after baseline ) , m24 , m36 ( if applicable ) visits , and then at the final visit , according to a prespecified procedure .
prior to first study drug intake participants in the vascular project were fully informed and written consent was obtained according to local regulatory requirements .
collection of ultrasound data and subsequent analysis of the ultrasound images is being carried out in close agreement with the mannheim carotid intima - media thickness consensus .
b - mode scanning is being performed by sonographers trained and certified specifically for the perform vascular project .
cimt measurements are made using b - mode duplex ultrasound scanner ( linear array 7 mhz , or broadband 510 mhz or higher ) .
vascular centers have been provided with a medical dicom recorder ( mdr ) in order to transfer carotid b - mode ultrasound images in a uniform dicom format to the centralized imaging core laboratory ( bioclinica ) .
the image depth will be standardized at 4 cm or close to that , with a single focus zone and no zoom , a high frame rate , low persistence , and optimized image gain settings .
the region of interest in the cca will be imaged at baseline at an angle that displays the clearest near and far wall boundaries ( optimal angle ) and at three predetermined angles of 30 increments according to the meijer carotid arc
. the optimal angle at baseline is noted , and will be consulted on subsequent visits .
a quality control procedure regarding image quality , protocol compliance , and completeness of study data is being performed for each vascular examination . for the measurement of cimt , the region of interest ( roi )
is defined as the cca segment at least 10 mm below the bifurcation ( fig . 2 ) .
cimt will be assessed in longitudinal view on the far wall of right and left cca on a 10-mm length in a region free of plaque . for assessment of plaque ,
longitudinal and transversal images will be recorded in the right and left carotid trees ( cca , bifurcation , and ica ) from the origin of the cervical cca to the first 30 mm of the ica .
image analysis will be performed using the arterial measurement system ii and automated contour detection after positioning a measurement box ( 10 mm wide ) will be verified and manually corrected if needed .
cimt assessment will be performed by batch reading after completion of all vascular examinations for each patient .
2carotid tree : region of interest . left : internal and external carotid arteries ; middle : carotid bifurcation ; right : common carotid artery carotid tree : region of interest .
left : internal and external carotid arteries ; middle : carotid bifurcation ; right : common carotid artery if a plaque is present , ultrasound images will be recorded , as well as will information on the number of plaques present and their location .
a plaque is defined as a focal structure that encroaches into the arterial lumen of at least 0.5 mm or 50% of the surrounding cimt value or demonstrates a thickness of 1.5 mm as measured from the media - adventitia interface to the intima - lumen interface . for qualitative assessment , plaques will be graded as follows : ( 1 ) none ( complete absence , cimt thickening may be observed ) ; ( 2 ) minimal ( small isolated thickening ) ; ( 3 ) moderate ( visible plaque , causing a modest degree diameter reduction ) ; ( 4 ) severe ( significant plaque , visualized on several different scan projections , causing clear reduction in diameter ) ; or ( 5 ) occlusion [ 17 , 23 ] .
carotid stiffness will be assessed , as previously described , using ultrasound and blood pressure .
stroke changes in carotid diameter will be calculated from the 5-second video clip acquired at the optimal angle from automated boundary tracing during at least three cardiac cycles .
brachial blood pressure recordings made after completion of the left and right carotid cimt measurements will be used .
central pulse pressure will be calibrated from the diameter - time curve and brachial blood pressure .
distensibility is defined as the ratio of relative stroke change in diameter on pulse pressure .
carotid stiffness is expressed as the inverse of the square root of distensibility , to give similar information to aortic stiffness .
all ultrasound images will be evaluated and analyzed centrally by an independent imaging core laboratory ( bioclinica , leiden , the netherlands , bi ) .
the core laboratory will perform a centralized quality control for ultrasound acquisition , notably for image quality and protocol deviations , and variability .
assessment of local arterial stiffness will be evaluated and analyzed centrally at the hpital georges pompidou core centre ( hegp paris , france ) , from ultrasound images provided by bioclinica .
the quality control process included a uniform training program for the sonographers and variability studies for the central readers .
an initial reader variability study has been performed for two readers on a random selection of 58 independent images from baseline and m12 scans .
the inter - reader intraclass correlation coefficient for the mean common cimt was 0.94 ( 95% confidence interval [ ci ] : [ 0.872 ; 0.963 ] ) .
intra - reader intraclass correlation coefficients for the mean common cimt were 0.93 for reader 1 ( 95% ci : [ 0.893 ; 0.961 ] ) and 0.92 for reader 2 ( 95% ci : [ 0.875 ; 0.954 ] ) .
two additional variability assessments will be performed , one before the beginning of the batch reading to certify the central readers , and another during the batch reading .
should the reader intraclass correlation coefficient be less than 0.80 , a new training session will be held , and the reader will complete a new assessment of reproducibility . as regards plaque reporting , studies of reproducibility between the core laboratory and the sonographers have been carried out
. plaque score and count in 47 subjects with an available m0 and m12 scan were analyzed by the core laboratory and compared with the sonographers reports .
the increase in the plaque count was evaluated at + 14% by the core laboratory between m12 and m0 compared with + 13% by the sonographers .
similar results were found in a second study among 38 patients with m0 , m12 , and m24 available timepoints .
b - mode scanning is being performed by sonographers trained and certified specifically for the perform vascular project .
cimt measurements are made using b - mode duplex ultrasound scanner ( linear array 7 mhz , or broadband 510 mhz or higher ) .
vascular centers have been provided with a medical dicom recorder ( mdr ) in order to transfer carotid b - mode ultrasound images in a uniform dicom format to the centralized imaging core laboratory ( bioclinica ) .
the image depth will be standardized at 4 cm or close to that , with a single focus zone and no zoom , a high frame rate , low persistence , and optimized image gain settings .
the region of interest in the cca will be imaged at baseline at an angle that displays the clearest near and far wall boundaries ( optimal angle ) and at three predetermined angles of 30 increments according to the meijer carotid arc
. the optimal angle at baseline is noted , and will be consulted on subsequent visits .
a quality control procedure regarding image quality , protocol compliance , and completeness of study data is being performed for each vascular examination .
for the measurement of cimt , the region of interest ( roi ) is defined as the cca segment at least 10 mm below the bifurcation ( fig . 2 ) .
cimt will be assessed in longitudinal view on the far wall of right and left cca on a 10-mm length in a region free of plaque . for assessment of plaque ,
longitudinal and transversal images will be recorded in the right and left carotid trees ( cca , bifurcation , and ica ) from the origin of the cervical cca to the first 30 mm of the ica .
image analysis will be performed using the arterial measurement system ii and automated contour detection after positioning a measurement box ( 10 mm wide ) will be verified and manually corrected if needed .
cimt assessment will be performed by batch reading after completion of all vascular examinations for each patient .
2carotid tree : region of interest . left : internal and external carotid arteries ; middle : carotid bifurcation ; right : common carotid artery carotid tree : region of interest .
left : internal and external carotid arteries ; middle : carotid bifurcation ; right : common carotid artery if a plaque is present , ultrasound images will be recorded , as well as will information on the number of plaques present and their location .
a plaque is defined as a focal structure that encroaches into the arterial lumen of at least 0.5 mm or 50% of the surrounding cimt value or demonstrates a thickness of 1.5 mm as measured from the media - adventitia interface to the intima - lumen interface . for qualitative assessment ,
plaques will be graded as follows : ( 1 ) none ( complete absence , cimt thickening may be observed ) ; ( 2 ) minimal ( small isolated thickening ) ; ( 3 ) moderate ( visible plaque , causing a modest degree diameter reduction ) ; ( 4 ) severe ( significant plaque , visualized on several different scan projections , causing clear reduction in diameter ) ; or ( 5 ) occlusion [ 17 , 23 ] .
carotid stiffness will be assessed , as previously described , using ultrasound and blood pressure .
stroke changes in carotid diameter will be calculated from the 5-second video clip acquired at the optimal angle from automated boundary tracing during at least three cardiac cycles .
brachial blood pressure recordings made after completion of the left and right carotid cimt measurements will be used .
central pulse pressure will be calibrated from the diameter - time curve and brachial blood pressure .
distensibility is defined as the ratio of relative stroke change in diameter on pulse pressure .
carotid stiffness is expressed as the inverse of the square root of distensibility , to give similar information to aortic stiffness .
all ultrasound images will be evaluated and analyzed centrally by an independent imaging core laboratory ( bioclinica , leiden , the netherlands , bi ) .
the core laboratory will perform a centralized quality control for ultrasound acquisition , notably for image quality and protocol deviations , and variability .
assessment of local arterial stiffness will be evaluated and analyzed centrally at the hpital georges pompidou core centre ( hegp paris , france ) , from ultrasound images provided by bioclinica .
the quality control process included a uniform training program for the sonographers and variability studies for the central readers .
an initial reader variability study has been performed for two readers on a random selection of 58 independent images from baseline and m12 scans .
the inter - reader intraclass correlation coefficient for the mean common cimt was 0.94 ( 95% confidence interval [ ci ] : [ 0.872 ; 0.963 ] ) .
intra - reader intraclass correlation coefficients for the mean common cimt were 0.93 for reader 1 ( 95% ci : [ 0.893 ; 0.961 ] ) and 0.92 for reader 2 ( 95% ci : [ 0.875 ; 0.954 ] ) .
two additional variability assessments will be performed , one before the beginning of the batch reading to certify the central readers , and another during the batch reading .
should the reader intraclass correlation coefficient be less than 0.80 , a new training session will be held , and the reader will complete a new assessment of reproducibility . as regards plaque reporting , studies of reproducibility between the core laboratory and the sonographers have been carried out . plaque score and count in 47 subjects with an available m0 and m12 scan were analyzed by the core laboratory and compared with the sonographers reports .
the increase in the plaque count was evaluated at + 14% by the core laboratory between m12 and m0 compared with + 13% by the sonographers .
similar results were found in a second study among 38 patients with m0 , m12 , and m24 available timepoints .
the primary endpoint of the perform vascular project is the annualized rate of change in the mean common cimt ( mm per year ) , on the basis of the assessments made at baseline ( m0 ) , m12 , m24 , m36 ( if applicable ) and/or at the final visit .
the secondary endpoints are the change in mean common cimt from baseline ( m0 ) to final visit ( mm ) , the number of emergent carotid plaques in both carotid systems ( left and right ) and the change in carotid stiffness from baseline to final visits .
recruitment into the perform vascular project started in february 2006 and the last patient was randomized in march 2008 .
a total of 1,141 patients were randomized from 52 vascular centers in 16 countries ; 37% of the population were recruited in western europe , 58% in eastern europe , 3% in australia , and 2% in canada .
table 1baseline characteristics of the perform vascular project populationtotal patients1,141male , % 66mean age , years , meansd66.2 6.5age , % < 65 years44 65 to < 75 years44 75 years12ethnicity , % caucasian99 asian0.3 black0.1 other0.1smoking % never smoked44 current smoker28 stopped smoking > 6 months28medical history , % hypertension86 hypercholesterolemia54 diabetes29 prior history of cerebral infarction12 angina pectoris10 hypertriglyceridemia12 prior history of tia8 myocardial infarction8 peripheral artery disease6previous treatments , % statins62 angiotensin - converting enzyme inhibitors63recorded between index stroke and randomization baseline characteristics of the perform vascular project population recorded between index stroke and randomization the mean age of the population was 66.2 6.5 years ( range 5480 years ) , with 12% of patients over 75 years .
the most frequent risk factors were hypertension ( 86% ) , hypercholesterolemia ( 54% ) , and diabetes ( 29% ) .
twelve percent of the population reported a previous ischemic stroke and 8% a previous tia , while 8% had a history of myocardial infarction .
these data are largely comparable to the main study population characteristics , except for the geographic distribution of the recruitment , which resulted in a higher proportion of patients of caucasian origin in the vascular project ( 99% versus 83% in the main study ) and a higher proportion of patients with hypercholesterolemia ( 54% versus 48% in the main study ) .
this is most likely due to the inclusion criteria of patients in the vascular project , which require patients with at least one carotid plaque at the baseline examination .
in addition , the vascular project population is slightly more likely to be receiving angiotensin - converting enzyme inhibitor than the main study population ( 63% versus 55% ) .
the perform vascular project results will be analyzed by the robertson centre for biostatistics , university of glasgow , uk , and subsequently validated by the biometry division of the institut de recherches internationales servier .
assuming an expected standard deviation of 0.11 mm of the rate of change in common cimt and a treatment withdrawal rate of 10% per year , we estimate that 1,100 patients are necessary to detect a treatment - related cimt change of 0.025 mm ( i.e. , 0.01 mm / year ) for a statistical power of at least 90% using a two - sided test with a 5% type 1 error rate
. the analyses will be performed in all patients in the full analysis set and in the per protocol set , i.e. patients from the full analysis set who are compliant with the protocol .
the type 1 error will be set at 5% ( two - sided ) for all statistical tests and 95% cis will be provided .
the effect of terutroban versus aspirin on the primary endpoint ( rate of change of common cimt ) will be analyzed using a linear mixed - effects model adjusted for baseline value .
comparison of the treatment groups for the secondary endpoints of mean common cimt and carotid stiffness will be performed in a similar manner using a general linear model with baseline value as a covariate .
the number of emergent carotid plaques will be compared for the two groups by poisson regression .
the perform vascular project is supervised by the vascular scientific committee , comprising five members : prof m.g .
independent centralized reading of the ultrasound images is performed by bioclinica , leiden , the netherlands .
the investigators of the perform vascular project are listed at the end of this article .
the perform vascular project is part of the largest ongoing trial in secondary prevention of stroke and will study prospectively the effect of terutroban as compared to aspirin on the progression of the cimt in a large number of patients . | purposeperform is exploring the efficacy of terutroban versus aspirin for secondary prevention in patients with a history of ischemic stroke or transient ischemic attacks ( tias ) .
the perform vascular project will evaluate the effect of terutroban on progression of atherosclerosis , as assessed by change in carotid intima - media thickness ( cimt ) in a subgroup of patients.methods and resultsthe vascular project includes structural ( cimt , carotid plaques ) and functional ( carotid stiffness ) vascular studies in all patients showing at least one carotid plaque at entry .
expected mean follow - up is 36 months .
primary endpoint is rate of change of cimt .
secondary endpoints include emergent plaques and assessment of carotid stiffness .
1,100 patients are required for 90% statistical power to detect treatment - related cimt difference of 0.025 mm .
the first patient was randomized in april 2006.conclusionsthe perform vascular project will investigate terutroban s effect on vascular structure and function in patients with a history of ischemic stroke or tias . |
extracorporeal membrane oxygenation ( ecmo ) , which can support gas exchange or hemodynamics in patients with severe respiratory or cardiac failure , has demonstrated considerable evolution over the last decade , with a steady rise since 2009 in the number of ecmotreated patients and number of centers providing ecmo support [ 2 , 3 ] . with more adult patients being placed on ecmo support , there is an increased need to understand the complex changes in drug pharmacokinetics and pharmacodynamics that occur with the addition of an ecmo circuit to the management of a critically ill patient .
the relationship between the dose of a drug and the elicited response may be altered in critically ill patients as a result of pharmacokinetic and pharmacodynamic changes .
the use of extracorporeal mechanical support , such as ecmo , can further increase the variability of pharmacokinetic alterations .
therefore , the combination of critical illness and ecmo presents considerable challenges to providing optimal pharmacotherapy .
the ability to anticipate alterations in pharmacokinetics and pharmacodynamics in this patient population is essential for providing an individualized therapeutic plan that maximizes therapeutic benefit while minimizing potential toxicity . despite improvements in extracorporeal technology and resurgence in its use in respiratory and cardiac failure
this chapter summarizes our current understanding of the effects of ecmo on the pharmacokinetics and pharmacodynamics of several drug classes commonly used to manage these critically ill patients .
pharmacokinetics encompasses the absorption , distribution , metabolism and elimination of a drug , ultimately influencing the concentration at the targeted site of action .
in contrast , pharmacodynamics denotes the relationship between the drug concentration and the physiologic and biochemical effects of the drug on the body , including the intensity of therapeutic and adverse effects .
the relationship between pharmacokinetics and pharmacodynamics is influenced by the drug , the underlying disease process , and the presence of extracorporeal factors .
the culmination of all of these factors can lead to considerable and unpredictable alterations in pharmacokinetics .
figure 1 summarizes the effects of serum drug concentrations and the resultant pharmacokinetic changes influenced by critical illness and ecmo.fig .
1changes in pharmacokinetics with critical illness and extracorporeal membrane oxygenation . increased 1acid glycoprotein and decreased albumin concentrations ; mostly affecting hydrophilic drugs
changes in pharmacokinetics with critical illness and extracorporeal membrane oxygenation . increased 1acid glycoprotein and decreased albumin concentrations ; mostly affecting hydrophilic drugs the elimination of drugs from the body is highly dependent on clearance of the drugs from the body and on volume of distribution . the patient s physiology and the specific physiochemical properties of drugs , such as protein binding , hydrophilicity , molecular weight , and degree of ionization at a given physiologic ph , may influence both clearance and volume of distribution .
the presence of ecmo frequently leads to additional alterations , including an increased volume of distribution and either increased or decreased drug clearance .
the liver and the kidneys are the two major organ systems responsible for drug metabolism and elimination , with less significant elimination occurring through the biliary system , gastrointestinal tract and lungs .
critically ill patients often develop organ insufficiency or failure during the course of their illness thereby altering drug elimination rates .
decreased renal blood flow or function will lead to a decreased glomerular filtration rate , affecting drugs that are dependent on this route of elimination ( mainly hydrophilic drugs ) , whereas decreases in hepatic perfusion or function may lead to toxicity through decreased enzymatic activity or decreases in extraction efficiency .
the distribution of drug throughout the body ( volume of distribution ) is largely dependent on the drug s hydrophilicity and its acidionization constant .
drugs that are hydrophilic will have a lower volume of distribution and their concentrations will primarily be influenced by fluidshifts and largevolume fluid resuscitation .
in contrast , lipophilic drugs penetrate into the tissues , leaving lower concentrations in the blood and increasing the apparent volume of distribution .
the ecmo circuit may increase the volume of distribution through either hemodilution or sequestration of drugs [ 5 , 6 ] .
an initial increase in volume of distribution that occurs at the initiation of ecmo from the introduction of priming solutions ( plasma , saline , or albumin ) , primarily affecting hydrophilic drugs , may result in decreased plasma concentrations and , potentially , therapeutic failure of a drug .
this increased volume may also lead to the dilution of plasma proteins , notably albumin , affecting drugs that are highly proteinbound , leading to potential toxicities as a result of an increase in the proportion of the unbound fraction of a drug .
modern extracorporeal circuits typically consist of cannulae , polyvinyl chloride ( pvc ) tubing , a centrifugal pump , and an artificial membrane for gas exchange ( often termed a membrane oxygenator ) . the membrane oxygenator and
pvc tubing comprise a large surface area for potential drug sequestration , which may lead to drug loss over time , particularly for lipophilic drugs [ 5 , 7 , 8 ] .
the composition of the tubing and membrane oxygenator may play a role in the amount of drug that is sequestered .
some studies have observed that both pvc tubing and the membrane oxygenators absorb drugs to a similar extent , whereas others have shown significant differences . this may be explained by both the age of the circuit and the type of pump used [ 812 ] .
albumin and 1acid glycoprotein , both synthesized in the liver , are the two major blood proteins that bind to drugs . in critical illness , albumin concentrations decrease in response to increased vascular permeability , decreased production and increased catabolism ; whereas , 1acid glycoprotein is an acutephase reactant that may increase in response to physiologic stress .
the changes in protein concentrations could affect both the amount of free drug available and the overall volume of distribution .
additionally the deposition of protein on the inner surface of the ecmo tubing may potentially increase the sequestration of drugs that have a high affinity for protein binding .
a recent ex vivo model tested the changes in concentrations over time of highly protein bound drugs .
highly protein bound drugs in this experiment included ceftriaxone , caspofungin and thiopentone , all of which had significantly lower mean drug recoveries at 24 h ( 80 , 56 , and 12% , respectively ) compared to drugs that were not highly protein bound . since lipophilic and highly protein bound drugs are more prone to sequestration in ecmo circuits , an understanding of the physicochemical properties of drugs can assist in determining the relationship between the dose administered and the anticipated blood concentration [ 5 , 15 ] .
the octanolwater partition coefficient or log p , is a common way to report the measure of a drug s lipophilicity .
drugs with high log p values ( around 2.0 ) will have a propensity to be very soluble in organic materials such as the pvc tubing used in the ecmo circuit .
however , to date , there has been no characterization of the drugcircuit interaction beyond 24 h and , as such , little is known regarding the adsorptive capacity of the circuit over longer periods of ecmo support .
table 1 summarizes the effects of critical illness and ecmo on pharmacokinetics of drugs based on degree of lipophilicity of the drug.table 1effect of critical illness and extracorporeal membrane oxygenation ( ecmo ) on pharmacokinetics ( pk ) of drugs , based on degree of lipophilicityhydrophilic drugslipophilic drugsvolume of distribution ( vd)lowhighprimary mode of clearancerenalhepaticlog p
lowhighpotential effect of critical illness on pkincreased vdno change in vdeffect of ecmo on pkincreased vdincreased vdno change in clearanceincreased clearance
log p : octanolwater partition coefficient ( measure of drug s lipophilicity )
effect of critical illness and extracorporeal membrane oxygenation ( ecmo ) on pharmacokinetics ( pk ) of drugs , based on degree of lipophilicity
log p : octanolwater partition coefficient ( measure of drug s lipophilicity )
patients receiving ecmo often require analgesia and sedation to reduce oxygen consumption , facilitate patientventilator synchrony , diminish patient stress and discomfort , and prevent patientinitiated device dislodgement or removal .
however , achieving the desired level of sedation and preventing delirium in the critically ill patient receiving ecmo remains a challenge in icus , owing to paradigm shifts in analgosedation regimens as well as pharmacokinetic alterations of commonly used analgesics and sedatives .
medication selection should be based on the patient s needs , with titration to a predetermined goal in accordance with recently published guidelines .
limited data exist on the most appropriate opioid and sedative medication regimen to use in ecmo patients to achieve the desired level of sedation while minimizing excess sedative exposure .
commonly used intravenous opioids include fentanyl , hydromorphone and morphine , while sedatives often include propofol , dexmedetomidine and benzodiazepines .
the choice of agent used is dependent on the desired physiological endpoint while balancing unwanted adverse effects of each individual agent .
three ex vivo studies using adult ecmo circuits composed of pvc tubing and a hollow polymethylpentene fiber membrane oxygenator demonstrated significant losses of commonly used opioids and sedatives [ 6 , 18 , 19 ] .
one investigation observed as much as a 93% loss in dexmedetomidine concentrations at 24 h .
another study , measuring concentrations of morphine , fentanyl , and midazolam over a 24hour period , demonstrated that the average drug recovery relative to baseline was lower with lipophilic drugs .
only 3% of fentanyl and 13% of midazolam were detectable at 24 h ; however , the ecmo circuit did not substantially alter morphine concentrations , with 103% recovery at 24 h. of interest , in the first hour of ecmo support , up to 70 and 50% of fentanyl and midazolam , respectively , were lost in the circuit .
the most recent ex vivo study using adult ecmo circuits primed with human whole blood observed a recovery of only 30% of baseline propofol concentrations at 30 min and negligible concentrations at 24 h .
additionally , midazolam concentrations were substantially reduced with 54 and 11% of baseline concentrations measured at 30 min and 24 h , respectively .
similar findings have also been observed in neonatal circuits composed of pvc tubing and earlier generation silicone membrane oxygenators .
these investigations observed up to a 68% loss of midazolam and a 98% loss of propofol within 40120 min and up to a 30% reduction in lorazepam concentrations [ 11 , 12 ] .
adult patients receiving ecmo for respiratory failure appear to have increased requirements of analgesia and sedation over time [ 20 , 21 ] .
the first case report demonstrating increased sedation requirements was in a 30yearold man with severe respiratory failure requiring venovenous ecmo as a bridge to lung transplantation .
over 19 days of ecmo support , his requirements of morphine and propofol to maintain deep levels of sedation increased significantly .
a small , singlecenter , retrospective study observed an increase in opioid and sedative requirements over time in 29 consecutive patients requiring ecmo ( 13 venovenous , 16 venoarterial ) where the sedation protocol was to keep patients heavily sedated during the first few days of ecmo followed by daily lightening of sedation when possible .
this study reported an increase in the average daily dose of midazolam and morphine of 18 mg ( p = 0.001 ) and 29 mg ( p = 0.02 ) , respectively .
interestingly , the authors did not find any significant increase in fentanyl requirements over time .
additionally , patients receiving venovenous ecmo had a significantly higher daily midazolam dose requirement than did patients receiving venoarterial ecmo ( p = 0.005 ) . a more recent singlecenter , prospective cohort study set out to determine the median daily dose of opioids and benzodiazepines in 32 patients receiving either venovenous or venoarterial ecmo . in this mixed cohort the median daily dose of opioids and benzodiazepines , 3875 micrograms and 24 mg respectively , was found to be lower than that reported from previous trials .
additionally , the authors did not find increasing requirements throughout the duration of ecmo support .
the lower opioid and benzodiazepine requirements observed in this study could be a result of the study institution s analgosedation approach , lower goal sedation scores , and use of other nonbenzodiazepine sedatives .
the only comparative trial to date is a recent retrospective cohort study that enrolled consecutive adult patients with severe respiratory failure with ( n = 34 ) or without ( n = 60 ) venovenous ecmo support requiring at least one sedative to maintain a level of wakefulness appropriate to maintain patient comfort and safety while optimizing oxygenation and ventilator support .
the authors found that the maximum median 6hour sedative exposure was nearly twice as high in the ecmo group and was reached nearly 3 days later when compared to the group not receiving ecmo .
however , there was no significant difference in 6hour sedative exposure in adjusted analyses . therefore , this study challenges whether the increased requirements of opioids and sedatives are a result of circuitrelated factors alone or whether other factors , such as tolerance , age or pharmacogenomics , play a central role .
existing data are sparse to guide the appropriate dosing of opioids and sedatives in adult patients receiving ecmo in the context of modern extracorporeal technology .
many of the firstline agents used in the management of pain and sedation are lipophilic and therefore have a high propensity to be adsorbed or sequestered by the extracorporeal circuit [ 6 , 11 , 12 ] .
one approach to achieving adequate sedation in patients receiving ecmo would be to start with continuous infusions of both an opioid and a sedative , anticipating requirements that exceed standard doses with the ultimate goal of minimizing the deleterious effects of sedative agents , especially benzodiazepines , with daily interruptions or down titrations .
additionally , clinicians should anticipate the need for significant dose reductions at the time of ecmo discontinuation given the likely rapid decrease in volume of distribution .
the reduction in dosing may be difficult to calibrate , so it is prudent to carefully monitor for signs of withdrawal and delirium .
consideration of adjunct agents , such as subanesthetic doses of ketamine , may help facilitate achieving sedation goals .
two uncontrolled studies demonstrated reductions in sedative rates with the addition of lowdose ketamine infusions [ 24 , 25 ] .
most recently , a randomized trial did not show any differences in opioid or sedative requirements with the addition of lowdose ketamine to standard sedation practices as compared to standard sedation practices alone in patients receiving venovenous ecmo for severe respiratory failure .
standard sedation practices consisted of infusions of fentanyl or hydromorphone and midazolam to achieve a richmond agitation sedation scale ( rass ) of 5 at the initiation of ecmo .
the median cumulative amount of fentanyl and midazolam equivalents in the lowdose ketamine group were almost twice and four times as high , respectively , when compared to the control group from ecmo initiation to the decision to achieve wakefulness .
however , patients receiving lowdose ketamine infusion had similar improvements in their rass scores over the 72hours after the decision to achieve wakefulness .
the incidence of delirium in patients receiving ecmo is not well characterized ; however , given the high use of benzodiazepines in these patients , it may be reasonable to presume that the rates are as high as those reported in the critically ill patient population not receiving ecmo .
when appropriate , the use of a regimented analgosedation approach , daily interruption of sedation , and early mobilization may help minimize opioid and sedative exposure and thus reduce the incidence of delirium associated with these drugs , as appears to be the case in critically ill patients in general .
infections are commonly encountered in critically ill patients and are associated with higher mortality . in a critically ill patient , source control , in addition to timely and appropriate antimicrobial administration , remains the cornerstone of successful treatment of infection . selecting the appropriate dose of an antimicrobial can be challenging given the potential effects of critical illness and ecmo on drug concentrations , particularly considering that most antimicrobial dosing regimens have been established in healthy adults with normal physiology .
changes in volume of distribution and clearance from critical illness and the ecmo circuit may affect pharmacodynamic parameters that ultimately determine the effectiveness of the antimicrobial agent .
inappropriate antimicrobial dosing may result in substantial drug losses , leading to therapeutic failure , development of resistance , and worse outcomes in patients with lifethreating infections whereas an empiric increase in dose may potentially lead to accumulation and toxicity .
vancomycin , a moderately protein bound , hydrophilic antimicrobial agent is commonly used to treat grampositive bacterial infections .
two in vitro ecmo studies observed steady vancomycin drug concentrations over 24 and 48hour periods [ 6 , 19 ] . in a matched cohort study of adult critically ill patients , those receiving ecmo
had a similar volume of distribution and clearance of vancomycin compared to those not receiving ecmo in the first 24 h of therapy .
all patients received a 35 mg / kg loading dose over 4 h , followed by a continuous infusion targeting a serum concentration of 2030 mg / l .
linezolid , an alternative grampositive antimicrobial , was studied in three adult patients receiving ecmo , the results of which suggest that therapeutic targets may not be achieved with standard dosing when the minimum inhibitory concentration ( mic ) is greater than 1
aminoglycosides , including gentamicin and tobramycin , are hydrophilic drugs with low protein binding and with increased volume of distribution in the context of critical illness , resulting in decreased maximal concentrations .
additionally , in the context of a higher volume of distribution from the ecmo circuit , standard or higher initial doses may be needed with normal or extended intervals in order to provide sufficient peak concentrations .
the study of aminoglycoside pharmacokinetic alterations during ecmo is largely limited to the neonatal population ; however , one observational study in adult patients demonstrated comparable pharmacokinetics with amikacin in critically ill patients with or without ecmo support .
therapeutic drug monitoring is readily available for this class of antimicrobial agents , making it feasible to target effective concentrations while limiting potential toxicity .
extendedspectrum penicillins , cephalosporins and carbapenems are commonly used in the treatment of gramnegative infections in the critically ill patient population . as a class , these antimicrobials
are generally hydrophilic , largely dependent on renal elimination , and have moderate to low protein binding ; however , variability exists with certain drugs such as ceftriaxone .
optimizing the timedependent , bactericidal effect of this class will be achieved by maximizing the time concentrations above the mic .
the use of extended or continuous infusions seems to be a reasonable approach to optimize the pharmacodynamics in critically ill patients receiving ecmo .
conflicting data have been reported on meropenem , a hydrophilic carbapenem with low protein binding .
while some studies suggest a significant loss of meropenem within the ecmo circuit [ 6 , 33 , 34 ] , other investigations have found no effect in vivo compared to other critically ill patients . a recent retrospective , casecontrol study observed no differences in pharmacokinetic paramenters with either piperacillin / tazobactam or meropenem in patients receiving ecmo compared to those not receiving ecmo . of interest ,
nearly 30% of all drug levels measured for the two aformentioned drugs were subtherapeutic , which may be a consequence of other pathophysiological disturbances not controlled for in this critically ill population .
mechanical circulatory support in general can induce a systemic inflammatory response , independent of the underlying critical illness , which , in turn , may augment renal clearance .
classes of antimicrobials in which direct correlations of augmented renal clearance and lower serum drug concentrations have been observed include betalactams , aminoglycocides and glycopeptides .
regarding other antimicrobial drug classes , azithromycin pharmacokinetics appear to be similar between patients receiving ecmo and nonecmo critically ill controls and tigecycline levels in one patient were similar to expected levels based on population pharmacokinetics .
concentrations of ciprofloxicin , a fluoroquinolone that is lipophilic with low to moderate protein binding , do not seem to be affected by ecmo .
to date there are no data on pharmacokinetic changes with polymyxin b or polymyxin e ( colistin ) that are used to treat multidrug resistant gramnegative infections .
ecmo does not appear to affect oseltamivir pharmacokinetics directly ; however , patients with renal dysfunction may experience impaired drug clearance [ 3941 ] .
data on the pharmacokinetic changes of antifungal agents in adult patients receiving ecmo are limited to in vitro studies or case reports .
while fluconazole does not seem to be affected by the ecmo circuit with a mean drug recovery of 91% at 24 h , voriconazole concentrations appear to be significantly affected , with up to a 71% loss at 24 h [ 14 , 42 ] . despite adequate serum concentrations of caspofungin at recommended doses , data suggest some sequestration by the ecmo circuit .
lipophilic formulations of amphotericin b as well as posaconazole and isavuconazole , both highly protein bound , may result in significant sequestration within the ecmo circuit .
when designing an appropriate antimicrobial dosing regimen for patients receiving ecmo , the biochemical properties of each drug should be considered , generally favoring a high initial concentration while monitoring for potential toxicities .
whenever possible , monitoring of drug concentrations , including peaks and troughs as appropriate , will help inform an effective dose and interval .
further insight into pharmacokinetic changes of antimicrobials in adult ecmo patients will be provided with the ongoing analgesia , sedation , and antibiotic pharmacokinetics during extracorporeal membrane oxygenation ( asap ecmo ) trial .
although there are known pharmacokinetic changes occurring as a consequence of ecmo support , there are very limited data addressing the clinical outcomes associated with these observations . for example , agents used for sedation or blood pressure control can be titrated to predetermined clinical endpoints , permitting the bedside clinician to use a dose for which the effects may be easily observed and measured
. however , in the absence of therapeutic drug monitoring , attainment of adequate antimicrobial concentrations may not be so readily observed , instead requiring the clinician to rely on surrogate endpoints , such as white blood cell counts or temperature curves , to assess effectiveness .
much of the existing data is limited to simulated circuits that do not account for metabolism or elimination .
additionally studies have not addressed how changing blood flow rates or using different ecmo configurations could impact the amount of drug sequestered within the circuit .
finally , many of the studies do not have control subjects , have not addressed the effects of circuits over longer time intervals , and have not studied the impact of additional extracorporeal circuits , such as continuous renal replacement therapy , on pharmacokinetic parameters .
there is potential for novel strategies , such as altering the materials used in ecmo tubing or creating polymeric micelles for drug delivery , to minimize drug sequestration within the ecmo circuit .
absorption of lipophilic drugs to traditional medical grade pvc tubing containing diethylhexyl phthalate , a plasticizer , has been well established over the years .
one in vitro study observed less adsorption capacity for lipophilic drugs when alternative materials , such as teflon or siliconecaoutchouc mixture ( srt 460 ) , were used .
another method would be to encapsulate intravenous lipophilic drugs within micelles , a concept that has previously been demonstrated with gene therapy .
the idea is to solubilize appropriate portions of lipophilic drugs into the hydrophobic core , allowing attraction of the lipophilic tail to the surface of the ecmo tubing and drug release with minimal adherence to the surface of the tubing .
the pharmacokinetics and pharmacodynamics of drugs administered to critically ill patients are influenced by several factors , including the physiochemical properties of the drugs , the etiology and severity of the underlying illness , and the function of the organs responsible for drug metabolism .
the presence of ecmo has an additional impact on drug distribution and metabolism , particularly due to increases in volume of distribution and sequestration by circuit components .
data are limited regarding the optimal regimen and dosing of sedatives and analgesics for critically ill patients receiving ecmo support , with the existing literature suggesting that , in many cases , higher amounts of analgosedation may be necessary to achieve therapeutic levels than would be expected for critically ill patients not receiving ecmo .
certain classes of antimicrobials may likewise be affected by ecmo , potentially leading to subtherapeutic drug concentrations if usual dosing regimens are used .
emerging data from the asap ecmo trial should help inform the appropriate administration of many commonly used antimicrobials , sedatives and analgesics in patients receiving ecmo . | this article is one of ten reviews selected from the annual update in intensive care and emergency medicine 2017 .
other selected articles can be found online at http://ccforum.com/series/annualupdate2017 .
further information about the annual update in intensive care and emergency medicine is available from http://www.springer.com/series/8901 . |
the large sizes of conifer genomes ( 60 billion bases ) make them unlikely candidates for complete genome sequencing in the immediate future . to enable the development of genomic applications in forest trees , several large - scale expressed sequence tag ( est ) sequencing projects have been initiated worldwide [ ( 13 ) ; , ] .
the major anticipated outcomes of these and other forest genomics projects involve the development of molecular applications ranging from tree breeding to eco - physiology and the design of effective conservation strategies . to enable the development of such genomic applications in forest trees , microarrays and single nucleotide polymorphism ( snp ) resources have already been developed ( 4 ) .
the mining of expression and snp data requires a coherent annotation of the sequence resources .
functional assignations of conifer sequences are especially challenging since these species are distantly related to angiosperm plant models for which significantly more data and tools are already available ( 2 ) .
our group at the center for computational genomics and bioinformatics ( ccgb , university of minnesota ) aims to contribute to the annotation of forest tree sequences through collaborations with groups involved in forestry research .
we have developed an annotation pipeline making use of several publicly available software and sequence repositories ( 5 ) .
we applied the annotation procedure to several est collections obtained in conifer and poplar species .
unifying data related to several est projects , the foresttreedb database is dedicated to store and handle these sequence and annotation data .
the aim of this work was to produce an extensive est database for tree species with links to other related plant resources .
foresttreedb is a dynamic structure which will be continuously enriched with other sequence resources and new features in the future .
its purpose is to make sequence annotation available for the wide community of biologists involved in tree research , and to provide a flexible interface for developing queries .
the other main publicly accessible est databases that include forest tree species are the gene indices ( 6 ) and the plantgdb database ( 7 ) .
such a procedure provides a high level of confidence in the data which is critical for analyses of gene subsequently diversity , among others .
foresttreedb includes 344 878 quality sequences from loblolly pine , white spruce and poplar , derived from 243 707 cdna clones .
all in all , it currently represents est data derived from 68 cdna libraries produced by different projects .
all of the corresponding est sequences have been released to dbest . in loblolly pine ( pinus taeda l. ) ,
data collected from two projects funded through the nsf plant genome research program are represented in foresttreedb .
the first project was developed by the group of dr sederoff at north carolina state university to analyse wood development , and is very much focused on xylem cdna sequencing ( ) .
six libraries were prepared from differentiating xylem tissues collected from different organs ( stem , root ) and representing different developmental stages ( juvenile wood , mature normal wood , late wood and planings enriched for more highly differentiated xylem ) or after bending of trees ( compression wood , side wood ) .
the other loblolly pine projects are headed by dr dean at the university of georgia ( uga ) ( ) . this group has prepared a total of 34 cdna libraries .
within the project entitled transcriptome responses to environmental conditions in loblolly pine roots , libraries were prepared from roots following drought stress or various nutrient treatments ( macro or micronutrients ) .
the group also generated libraries from pine challenged with the necrotrophic fungus fusarium circinatum , the inciting agent of pitch canker disease .
sequences were obtained from both the 3 and 5 ends of the inserts and 229 867 pine ests were generated .
the arborea project ( ) has produced ests from white spruce [ picea glauca ( moench ) voss ] , a softwood species economically important in canada .
gene discovery was undertaken by producing cdna libraries from diverse spruce organs ; each library representing several developmental stages , manipulative treatments and/or time points ( 5 ) . in total
, 17 libraries were explored from which random clones were sequenced from the 3 end .
close to half of the clones , selected from among the best libraries , were also sequenced from the 5 end . at present
, the database contains 49 102 white spruce quality reads , and the project will sequence 150 000 additional ests in the coming year .
, eight libraries of cdnas were sequenced from the 5 end alone , and 10 223 est sequences have been incorporated into foresttreedb .
arborea sequences incorporated into the database represent recent assemblies ; however , the project is continuing to add new sequences and update assemblies for future addition to the database .
in addition , poplar sequences will be added from other major est projects , including those generated for the poplar genome sequencing project .
the pine and spruce sequence resource residing in foresttreedb represent a large proportion of the public domain data available for conifers .
in contrast , the current poplar data present is a small fraction of the sequences available for this genus .
the 243 707 cdna clones represented in the database offer a broad sampling of organs encompassing numerous tissue types .
their distribution across the different organs used to prepare the 68 cdna libraries is summarized in figure 1 .
sequences expressed in root tissues undergoing a wide diversity of chemical or environmental treatments sampled in pine and spruce represent 44.2% of the sequence database . the second largest sample include 41% of the sequences found in libraries from stems and vascular tissues in pine , spruce or poplar .
sequences from poplar leaves and conifer needles account for 4.7% of the overall sequence data .
the remaining sequences were derived from cdna libraries prepared from various organs including cones , strobili , buds , embryos and shoot tips . tissue sampling .
number of clones representing the different organs from pine , spruce or poplar used to prepare the cdna libraries .
the full description of the 68 cdna libraries is available in the database in the summaries section , library descriptions ( ) .
before entering the sequences into the database , they are processed starting from the trace files following a procedure developed at ccgb for base - calling , vector - trimming and removal of chimeric sequences .
this procedure assures that only quality reads are incorporated in the database . in total ,
the database currently hosts five unigene sets that represent a total of 179 300 unigene sequences .
the ccgb produced four of the unigene assemblies ( two from white spruce and one each from loblolly pine and hybrid poplar ) ; whereas , the fifth assembly was generated at uga ( loblolly pine ) .
thus , for loblolly pine , two separate unigene sets were prepared from different sequencing projects and following somewhat different procedures .
a first set was derived from all the pine ests generated by the nsf genomics project studying wood formation in loblolly pine ( 2 ) , and was prepared at the ccgb .
the other set of 122 079 loblolly pine contigs was assembled from 173 070 ests generated by dean 's laboratory at the university of georgia .
as can be seen from the comparison of the number of ests with the number of unigenes , these data were assembled with a different stringency , based upon the needs of the georgia sequencing effort , and was incorporated as their assembly at the request of our georgia collaborators . with white spruce , two assemblies were chosen from those produced in the arborea sequencing project ( release 7 and 8) , as they serve as references for key resources developed during the project .
one spruce unigene ( release 7 ) was used to design a first generation arborea spruce cdna microarray ( ) .
the other spruce unigene was analysed to describe the functional annotations of the targeted genes ( 5 ) , to generate a candidate snp resource ( 10 ) and to generate a second generation spruce microarray .
we compared the conifer unigene sets against each other by using the blastn program to determine the overlap between these sequence datasets ( table 1 ) .
the two pine assemblies share 53.45% of sequences with an overlap of > 80% of identity over > 100 nt . using the same similarity parameters , the pine_nsf and the pine_uga overlap 53.45 and 66.25% of the spruce unigenes , respectively .
sequences belonging to several unigene sets can be mined simultaneously based on go terms describing them .
number of unigenes found in the three major conifer unigenesets and number of unigenes sharing 80% of identity over at least 100 nt , in pairwise comparisons only one of the two spruce unigene is presented here because they are largely overlapping .
sequence similarities were detected using the blast program ( 11 ) against sequences from uniprot / uniref100 and the arabidopsis tair resource ( 12 ) , hidden markov model ( hmm ) searches ( 13 ) are performed against pfam ( 14 ) , tigrfams ( 15 ) , superfamily ( 16 ) and smart motifs ( 17 ) .
the resulting sequence similarity results were used to correlate the contigs to terms from the gene ontology ( go ) ( 5 ) .
we estimate that the process of correlating go terms with unigenes enabled the assignment of tentative annotations to 3.410% of the unigenes depending on the unigeneset and the go category ( table 2 ) .
the dedicated link displays a table providing for each go term , the go accession , the go definition , the number of unigeneids related to this go class , whatever the e - value associated with this functional assignation , and a link to a page that will further display the composition of these related unigenes .
compilation of some statistics about sequence annotation extracted from foresttreedb with the query go accn - blast in combination with a condition on the unigenesetid matches were filtered out based on the e - value threshold of 1e10 .
queries were completed with the following go accessions : go:0005575 ( cellular component ) , go:0003674 ( molecular function ) and go:0008150 ( biological process ) .
the number of unigenes annotated following a blast search or hmm search against several protein databases are indicated .
the go annotations were complemented with blast or hmm searches against several protein or motif databases ( see above ) .
this significantly augmented the number of annotated unigenes compared with the go assignation alone ( table 2 ) .
the number of annotated unigenes was the highest for the poplar unigeneset ; this result was expected since poplar is more closely related to angiosperm model species , which are more prevalent in the core sequence databases .
indeed , in this unigene set > 71% of the sequences were found with a match in uniref100 ( p - value < 1e10 ) . with the conifer unigene sets , our ability to assign sequence annotation was lower and varied significantly between the datasets .
for example , 61.5% of the spruce unigenes ( assembled with the same procedures as the poplar sequences ) gave significant hits with blastx , whereas hmm searches produced 64.6% hits against smart motifs and 72.4% hits against tigrfam ( p - value < 1e10 ) ( table 2 ) .
for each unigene , a specific page displays annotation results obtained from several analyses and extensively linked to external resources . first , similarity results detected using blastx and based on hmm searches are parsed to display possible similar sequences found in other databases , and are displayed in separate tables . for each blast match
, the output includes the location of the best high scoring pair , accession and description of the match , e - value , length and bit score of the alignment .
in contrast to other transcriptome databases ( e.g. the gene indices ) , we have not only loaded the best matches , but also all of them .
we have incorporated the sequence similarity level as a parameter that the user can use to personalize the query .
second , this page lists all the go terms inferred based on these similarity results . for each go term , a short description is provided as well as a web link to the quickgo page at embl - ebi which gives access to the complete description of the go category .
the annotation procedures combined with the queries available through the interface is well suited to search for candidate genes , a preliminary step which is crucial before performing genetic analyses .
also , as the user simultaneously combines several queries , the database interface enables flexibility for the mining of candidate genes .
finally , ests composing the unigene are listed as well as the clone names they are derived from est sequences and their alignment in an msf format can be downloaded . to graphically assess the quality of the est assembly ,
an alignment image is provided that displays the sequences in a colour - coded manner .
the nimbus data model provides a hosting system for multiple est projects , similar in intent to the gene indices . from the data standpoint , each project retains information on experimental data ( libraries , clones and reads ) , processed results ( finished sequences , assemblies ) and annotations of the unigenes ( e.g. blast and hmmer reports ) obtained by assembly ( figure 2 ) .
transcriptome builds occupy the focal point of the system , and information linkages between the unigenes of a build , the original experimental data , and the processed results provide a very rich representation of the transcriptome .
est and genomic resources access the same core targets and annotation support and semantic web services [ semantic biomoby ] provide the access mechanism .
a build of the transcriptome produces a set of contigs from which are selected the unigene sets . blast and hmmer generated annotations of each unigene may be retained ; likewise , available snp predictions may be retained .
an important feature of the blast and hmmer hits is that the project retains only confidence levels , scores , etc . ; actual reference information about the hit sequence is retained in a separate database shared by all projects . thus instead of storing a
defline for each sequence hit by a unigene as is common , a pointer to a shared reference database is stored .
the shared database provides functional and structural information on each hit in terms of its definition and known aspects using controlled vocabularies such as the gene ontology consortium 's .
the net result is a powerful system which can be used to identify , for example , all unigenes involved in dna binding that are unique to a particular library .
information is stored in oracle databases , and the nimbus system provides object - relational mapping apis in java and perl for data accesses .
the java api supports tiered - architecture access ; it is used by the online web tools , and can be leveraged by other webapps .
for example , it has been used to support semantic biomoby services created for the tree information network program ( figure 2 ) .
the web tools are developed using standard java technologies , and can be deployed under a tomcat server .
two menus enable the retrieval of project summaries or allow the performance of queries and retrieval of the resulting sequences .
the web interface allows multiple queries to be chained together , since the results are combined using boolean operations .
this provides the database user with the ability to create project summaries , and to identify transcripts by putative function .
an example is illustrated on figures 3 and 4 . to assist the user in mining the annotation data , we provide a page describing the protocols , parameters used to run the software as well as guidelines to perform the queries .
unigenes were searched belonging to the unigenesetid 6 ( pine unigenes derived from the uga assembly ) and correlated to the go term dna binding with p - value < 1e10 .
foresttreedb screenshot displaying the annotation assigned to one of the unigene retrieved with the query from figure 3 . for each annotation method
, all the matches are displayed . here , only the top of the screenshot is shown for each query ( to limit the size of the figure ) . ( a ) contig information including identifier , sequence , links to retrieve the sequence .
( b ) blastx matches including hit 's accession , hit location , similarity parameters .
( c ) hits found by hmmer , including accession and description of the hit , location match and similarity parameter .
the foresttreedb web application provides the means to query the database without requiring the user to be knowledgeable in database query languages ( e.g. sql ) .
the user can select one of these queries , and the web application will build an input form to allow the user to enter input parameters for the query .
these queries are not hard - coded into the web application , so new queries may be easily added as the database changes and additional information is added .
these queries are entered by an administrator , knowledgeable in the foresttreedb schema and in database query languages .
or and difference. furthermore , the input parameters to the queries are similarly categorized so that the output of a query can be used as input to the parameter of another query ; thus , complex and varied queries can be built by the user ( figure 3 ) .
these queries are more complex than those that can be provided by pre - determining and hard - coding the information that can be queried by the user .
there are several entry points to mine the database , including sequence identifiers , homolog 's accession or definition , or snps .
sequences are referenced by the unigeneid they belong to , the corresponding contig name in the biodata repository ( ) , names of the clone they are derived from and the accession of the ests deposited in dbest .
a user can start a search based on est accession number derived from a blast query made elsewhere , look for the unigeneids including this est sequence and then mine the assigned functional annotations ( figure 4b d ) .
another database entry point is a function - centred query , which can be performed in various fashions .
the annotations may be mined based on a keyword search among the go terms correlated with the foresttreedb unigenes and derived either by blast or hmm search .
furthermore , the query can be performed after selecting unigenesets or libraries to be included in the output .
the interface enables the user to download large datasets such as all the ests derived from one or several libraries , or the contigs and singletons resulting from one of the precompiled assemblies .
each query can target the libraries individually , a combination of libraries , a specified unigeneset or a series of unigenesets .
thus , it is possible to mine sequences derived from a single species or from several species in the same query .
once a query has been sent to foresttreedb , the number and a complete list of unigenes complying with the input parameters are returned .
there is the opportunity to download files containing the sequence ( fasta format ) ( figure 4a ) for a single unigene or for all of the unigenes identified by the query , which facilitates other analyses and the design of target laboratory experiments .
a summary table also provides links to related information residing either in foresttreedb or in other databases used in our annotation process .
in addition to adding new resources and analyses , a current area of development includes the development of the tree information network . this work will involve the development of semantic biomoby web services as part of an effort to make the data from this project available in a larger inter - operable framework .
services to be developed under this project include both query services , as well as some application services . | foresttreedb is intended as a resource that centralizes large - scale expressed sequence tag ( est ) sequencing results from several tree species ( ) .
it currently encompasses 344 878 quality sequences from 68 libraries , from diverse organs of conifer and hybrid poplar trees .
it utilizes the nimbus data model to provide a hosting system for multiple projects , and uses object - relational mapping apis in java and perl for data accesses within an oracle database designed to be scalable , maintainable and extendable .
transcriptome builds or unigene sets occupy the focal point of the system .
several of the five current species - specific unigenes were used to design microarrays and snp resources .
the foresttreedb web application provides the means for multiple combination database queries .
it presents the user with a list of discrete queries to retrieve and download large est datasets or sequences from precompiled unigene assemblies .
functional annotation assignment is not trivial in conifers which are distantly related to angiosperm model plants .
optimal annotations are achieved through database queries that integrate results from several procedures based open - source tools .
foresttreedb aims to facilitate sequence mining of coherent annotations in multiple species to support comparative genomic approaches .
we plan to continuously enrich foresttreedb with other resources through collaborations with other genomic projects . |
osler - weber - rendu syndrome , also known as hereditary hemorrhagic telangiectasia ( hht ) , is an autosomal dominant disorder .
hht is characterized by widespread telangiectasias , that can involve the skin , mucous membranes , lung , brain , gastrointestinal tract , and/or liver .
in addition to epistaxis , gastrointestinal hemorrhage , mucocutaneous telangiectasia , and iron deficiency anemia , there are pulmonary , brain , and hepatic arteriovenous malformations ( avms ) that can cause serious complications .
patients with pulmonary avms may have hypoxemia and/or hemorrhage and patients are at risk of hemorrhage and neurological sequelae due to paradoxical embolism .
the prevalence of hepatic involvement in hht had been estimated at 8 - 31% in retrospective studies but in more recent large prospective series the prevalence is higher , ranging between 41% and 78% . nevertheless , only 8% of the patients with liver involvement in hht present with symptoms , including high output heart failure , portal hypertension , or biliary disease .
since the symptomatic involvement of the liver in hht is an extremely infrequent entity , diagnostic imaging may play a fundamental role in the identification of hepatic vascular alterations .
case 1 : a 35-year - old female had suffered from mild pain in the right upper quadrant for 2 years . hepatic function tests showed alkaline phosphatase ( akp ) , 156iu / l ; -glutamiltranspeptidase ( -gt ) , 78iu / l ; aspartate aminotransferase ( ast ) , alanine aminotransferase ( alt ) , and hepatic bilirubin were within the normal range .
the enlarged right and middle hepatic arteries were ligated and left hepatic artery was banded .
case 2 : a 35-year - old female suffered from pain in the right upper quadrant for 8 years .
liver function tests showed akp , 183iu / l ; -gt , 106iu / l ; alt , ast and hepatic bilirubin were also within the normal range .
case 3 : a 61-year - old male had come for a routine physical examination and had no clinical symptom .
all patients were examined in the supine position on 16-slice spiral of ct siemens somatom sensation 16 .
the patients fasted for 8 hours and drank about 700 - 1000 ml warm water or iodic contrast agent ( 25% , compound meglumine diatrizoate injection ) before examination .
iohexol ( 300 mgi / m1 ) was administrated intravenously with the dose 15 ml / kg and the injection ratio 25 - 30 ml / s.images were obtained in the arterial , portal venous , and delayed phases .
original images were post - processed at a workstation ( siemens wizard vb10b or ge aw4.2 ) .
the volume of the liver was measured with three - dimensional ct reconstruction by the method introduced by hiroshige .
case 1 : before surgery , the hepatic volume was 2048.235 cm measured by 3d ct .
the volume of the left lobe to that of the right lobe was disproportionate . on arterial phase
, some tortuous and irregular arteries were observed in intra- and extra - hepatic regions , especially in porta hepatis .
there was heterogeneous enhancement in hepatic parenchyma with multiple opacified vessel masses and tortuous arteries beneath the capsule of the liver [ figure 1a ] .
on portovenous phase , the portal system enhanced slightly and the portal and splenic veins were tortuous .
the contrast agent filled the superior vena cava and right atrium and no venous varix was found .
tortuous arteries in hepatic parenchyma and vessel masses in the late arterial phase were seen [ figure 1b ] .
figure 1a is coronal mip reconstructed image in arterial phase that shows tortuous and irregular arteries in liver and portahepatis .
heterogeneity of the contrast enhancement in hepatic parenchyma with multiple opacified vessel masses is also observed .
( b ) vrt image shows two tortuous and distended arteries derived from the celiac trunk supplying the left and right lobes of the liver .
on contrast enhanced ct , mip , and vrt images [ figures 2a , b ] the amount of abnormal arteries decreased in porta hepatis .
ct images after surgery in ( a ) arterial phase and ( b ) vrt respectively .
the shape of the liver was irregular . on arterial phase and mip , vrt images [ figures 3a , b ] , many tortuous , twisted , and irregular arteries were present in liver parenchyma , porta hepatis , and in front of the abdominal aorta .
varicose veins were identified in the gastric wall , greater omentum , and anterior abdominal wall .
ct images in arterial phase and vrt respectively in case 2 . irregular and tortuous arteries in the liver parenchyma , and porta hepatis
the caudate lobe was enlarged . on the arterial phase , mip , and vrt images [ figures 4a , b ] , celiac trunk was mildly dilated and thicker vessel masses were identified in porta hepatis .
on portal venous phase , the intra- and extra - hepatic abnormal vessels were still present , while portal vein and superior vena cava were normal .
case 1 : before surgery , the hepatic volume was 2048.235 cm measured by 3d ct .
the volume of the left lobe to that of the right lobe was disproportionate . on arterial phase
, some tortuous and irregular arteries were observed in intra- and extra - hepatic regions , especially in porta hepatis .
there was heterogeneous enhancement in hepatic parenchyma with multiple opacified vessel masses and tortuous arteries beneath the capsule of the liver [ figure 1a ] .
on portovenous phase , the portal system enhanced slightly and the portal and splenic veins were tortuous .
the contrast agent filled the superior vena cava and right atrium and no venous varix was found .
tortuous arteries in hepatic parenchyma and vessel masses in the late arterial phase were seen [ figure 1b ] .
figure 1a is coronal mip reconstructed image in arterial phase that shows tortuous and irregular arteries in liver and portahepatis .
heterogeneity of the contrast enhancement in hepatic parenchyma with multiple opacified vessel masses is also observed .
( b ) vrt image shows two tortuous and distended arteries derived from the celiac trunk supplying the left and right lobes of the liver .
on contrast enhanced ct , mip , and vrt images [ figures 2a , b ] the amount of abnormal arteries decreased in porta hepatis .
ct images after surgery in ( a ) arterial phase and ( b ) vrt respectively .
the shape of the liver was irregular . on arterial phase and mip , vrt images [ figures 3a , b ] , many tortuous , twisted , and irregular arteries were present in liver parenchyma , porta hepatis , and in front of the abdominal aorta .
varicose veins were identified in the gastric wall , greater omentum , and anterior abdominal wall .
ct images in arterial phase and vrt respectively in case 2 . irregular and tortuous arteries in the liver parenchyma , and porta hepatis
the caudate lobe was enlarged . on the arterial phase , mip , and vrt images [ figures 4a , b ] , celiac trunk was mildly dilated and thicker vessel masses were identified in porta hepatis .
on portal venous phase , the intra- and extra - hepatic abnormal vessels were still present , while portal vein and superior vena cava were normal . ct images in arterial phase and vrt respectively in case 3 .
osler - rendu - weber syndrome is a relatively rare disease , which was first recognized by babington in 1865 . in 1896 , rendu confirmed its family hereditary , which was proved by osler and weber in 1901 and 1907 , respectively .
this syndrome is an autosomal dominant trait and occurs in any race without gender difference .
its morbidity is about 1/3,500 - 5,000 in the western hemisphere , 1/2,351 in france , 1/16,500 in vermont , 1/350 in julen , 1/39,216 in north england , and 1/100,000 in germany .
data suggest that by the age of 16 years , 71% of individuals will have developed some sign of hht , rising to over 90% by the age of 40 years . in the past ,
a lower morbidity has been found in asia ; however , an investigation in 2002 performed by dakeishi et al . , found the morbidity in a county in north japan , was 1/5,000 - 8,000 , which was similar to that in west .
it was reported that about 20% had no family history , two cases in our study denied their family history .
the common presentation of this syndrome is recurrent epistaxis caused by nasal mucocutaneous telangiectasia ( 90% ) , and others may present with telangiectasia of face , lips , limbs , and trunk . in our study ,
pigmentation and telangiectasia were found in the skin over the upper abdomen in one case ( case#2 ) .
hht patients may develop hemorrhage in gastric and intestinal tract in 20% , central nervous system arteriovenous malformation ( avm ) in 20% , resulting in stroke and cranial abscess .
presence of the variation of the symptoms of hht , in members of a single family , indicates that the personal phenotype depends on other factors , besides the inheritance .
the main feature of the disease are multi - telangiectasia in the skin , mucosa , and internal organs with a trend of hemorrhage .
the basic pathology of osler - rendu - weber syndrome involves the vascular wall of arteriole , veinlet , and capillaries .
the walls become brittle and thin , lack elastofibrosis and smooth muscular layer , resulting in the dilation of the vascular lumen and the avms .
there are three vascular dysplasia patterns of hht : avm ( lung , brain ) , telangiectasia ( mucosa , dermis , and visceral involvement ) , and pseudoaneurysms .
it was estimated that at least 30% of hht patients have hepatic lesions , and the morbidity from liver involvement is about 8 - 10% .
liver manifestations in hht include cirrhosis , hepatic fibrosis , and subsequent encephalopathy , esophagus varices and congestive heart failure .
the measurement of hepatic volume can be used not only to quantitatively evaluate the configuration of the liver , but also to reflect the liver function indirectly , which has a potential to be regarded as a good clinical method to assess prognosis and the preservation of hepatic function , to choose suitable surgery , especially for the transplantation .
the volume of the liver can reflect the changes of the dimension of the cells in parenchyma , and the blood perfusion and the metabolic energy .
a study proved that the dimension of the liver with ct was similar to that of the real liver .
hiroshige et al . , found that spiral multislice ct was better than normal ct due to higher accuracy for the measuring the volume of liver with the three - dimensional construction .
we also found the abnormal volume of the liver in three cases . in case 1 and 2
, we thought that the increasing volume was associated with arteriovenous shunts , telangiectasia , and hepatic congestion . in case 3 ,
surgery has limited role due to recurrent disease , but may be useful for emergency control of hemorrhage .
surgery confirmed the ct findings of aneurysm - like dilated vessels , hepatomegaly , and cirrhosis .
the left , right hepatic arteries and the vessels in porta hepatis were ligated , and a year of follow - up with clinical examination and imaging detection found that there was no recurrence .
, ct is an accurate method for diagnosis and follow - up for osler - rendu - weber syndrome . | osler - weber - rendu syndrome is characterized by widespread telangiectasias .
its clinical manifestations depend on position and scope of the abnormal vessels .
the clinical and ct data of 3 patients with osler - weber - rendu syndrome were retrospectively analyzed .
ct features reviewed include the change of volume and configuration of liver , presence of tortuous and irregular vessels , opacified vessel mass , arteriovenous shunt , and splenomegaly .
ct is helpful for diagnosis , treatment , and follow - up of osler - weber - rendu syndrome . |
a 28-year - old man presented to the emergency department with renal failure , lactate dehydrogenase ( ldh ) elevation , low complement levels ; c3 0.584 ( 0.8201.870
genetic analysis revealed a mutation on complement h factor gene ( c.3514g > t ; glu1172stop ) with low concentration levels of the protein 14.78 mg / dl ( normal 1256 mg / dl ) .
he was diagnosed with atypical haemolytic uraemic syndrome ( ahus ) , and plasma exchange therapy was administered every - other - day for 1 month with no response .
cocaine consumption was considered the only risk factor that could trigger the disease , which was also associated with severe dilated cardiomyopathy .
four years later ( august 2009 ) , the patient received a non - heart beating donor kidney graft .
renal biopsy confirmed the presence of acute tubular necrosis and absence of both acute rejection and thrombotic microangiopathy .
diuresis and renal function progressively recovered , and dialysis was stopped 25 days after transplantation .
a serum creatinine concentration of 1.8 mg / dl was reached before hospital discharge at 40 days after transplantation .
one month later , a substantial increase in serum creatinine concentration ( 2.8 mg / dl ) was detected and the patient was admitted after sporadic cocaine consumption .
blood test parameters and renal biopsy confirmed the recurrence of ahus with severe renal involvement .
intense plasma exchange ( eight every - other - day sessions ) was started , achieving mild control of haemolytic activity and renal function stabilized with a serum creatinine concentration of 3 mg / dl .
one month later , the patient was re - admitted to hospital because of uraemic syndrome , with a serum creatinine concentration of 6.4 mg / dl , ldh 1100 ui / dl , haemoglobin 7.6 g / dl and platelet count 105 000/mm .
a new renal biopsy confirmed the severity of the thrombotic microangiopathy with glomerular capillary thrombosis and grade i chronic allograft nephropathy .
the patient started chronic dialysis ( 5 weeks ) , and treatment with eculizumab ( 900 mg weekly for 4 weeks followed by 1200 mg every other week thereafter until now ) was initiated .
two months after starting dialysis and eculizumab treatment , the patient reported a progressive increase in diuresis .
dialysis was gradually reduced , and 3.5 months after restarting dialysis , the patient ceased replacement therapy with a serum creatinine concentration of 5 mg / dl [ creatinine clearance ( crcl ) 12 ml / min ] .
renal function progressively improved , with a current serum creatinine concentration of 2.6 mg / dl ( crcl 35 ml / min ) , the patient being in good health ( figure 1 ) .
eculizumab treatment ( 1200 mg per intravenous/2 weeks ) has been maintained with good tolerance .
haemolytic uraemic syndrome is characterized by non - immune haemolytic anaemia , thrombocytopaenia and renal impairment with thrombotic microangiopathy .
ahus is generally caused by mutations in genes of the alternative pathway of the complement system .
these mutations have been described in genes encoding complement factor h ( cfh ) , i ( cfi ) , b ( cfb ) , c3 and membrane cofactor protein .
recently , the presence of autoantibodies against complement factor h has been described and genes encoding thrombomodulin have been associated with ahus .
more than 50% of transplant recipients with some mutations have disease recurrence and 90% develop renal insufficiency .
patients with cfh or cfi have the least favourable prognosis after kidney transplantation [ 1 , 2 ] .
recently , tanhehco et al . reported that cocaine could increase complement protein expression in isolated rabbit hearts .
cocaine can trigger inflammation and complement activation , upregulating the expression of adhesion molecules and promoting leucocyte migration .
eculizumab is a humanized monoclonal antibody that is specific for human c5 complement protein and prevents the activation of terminal complement complex c5b-9 .
recent and sporadic cases have suggested the efficacy of eculizumab in the treatment of ahus and post - transplantation ahus recurrence .
eculizumab could be a good therapeutic alternative in patients with resistant ahus and may be effective in the prevention of ahus recurrence after renal transplantation in patients with genetic mutations .
the present case illustrates a patient with severe ahus with cfh deficiency triggered by cocaine use and recurrence after kidney transplantation .
the patient re - started haemodialysis for severe renal insufficiency and anti - c5 antibody eculizumab was used as salvage treatment .
although the patient has been on haemodialysis for > 3 months , absolute control of haemolytic parameters with the use of eculizumab allowed progressive recovery of graft function with suppression of dialysis .
ten months later , the patient is stable with acceptable kidney function and no sign of haemolytic activity .
based on this experience , eculizumab treatment should be considered in patients with severe ahus despite the presence of renal insufficiency or dialysis dependency .
renal biopsy may be required to define the viability of the renal parenchyma and reversibility of ahus and renal insufficiency .
prospective studies are mandatory to define the role of eculizumab in the treatment of ahus but preliminary experiences are highly encouraging in terms of the drug s efficacy and tolerability . | haemolytic uraemic syndrome is a clinical syndrome characterized by thrombocytopaenia , non - autoimmune haemolytic anaemia and renal impairment .
pathological alterations in kidney samples show thrombotic microangiopathy .
the underlying pathogenesis is endothelial cell injury with thrombotic occlusion of the arterioles and capillaries .
a variety of causes have been identified , associated with infection of escherichia
coli o157:h7 , environmental factors as immunosuppressive drugs and genetic deficiencies in complement regulatory factors .
the latter is called atypical haemolytic uraemic syndrome ( ahus ) . here , we present a patient with severe ahus with complement factor h deficiency triggered by cocaine use and recurrence after kidney transplantation .
the patient restarted haemodialysis for severe renal insufficiency and anti - c5 antibody eculizumab was used as salvage treatment with progressive recovery of graft function and suppression of dialysis . |
electrospray ionization ( esi ) has revolutionized mass spectrometry ( ms ) by extending its applicability to large nonvolatile molecules . although covalent bonding and , thus , molecular weight information , is usually preserved in esi , retention of the noncovalent bonding of the solution structure has been demonstrated far less frequently [ 13 ] .
esi / ms is widely used to screen for ligands that bind to target proteins ; a better understanding of the effect of esi on the noncovalent bonding in protein ligand complexes would help evaluate the reliability of screening results . unlike collisionally activated dissociation during which different conformers of the same net charge can rearrange to structurally similar transition states prior to fragmentation , electron capture dissociation ( ecd ) can provide site - specific information on the structure and stability of gaseous protein ions ; key to this is the retention of noncovalent bonds during ecd [ 2 , 3 , 710 ] .
experiments showed that solution structure is not necessarily preserved in the gas phase ; the highly stable protein cytochrome c ( g for global unfolding in solution = 42 2 kj / mol at 30 c ) unfolds on a milliseconds timescale after transfer into the gas phase , whereas the fold of the moderately stable protein kix ( g = 12 1 kj / mol at 27 c ) is preserved in the gas phase on a timescale of at least 4 s .
unfolding of cytochrome c after desolvation was also observed in ion mobility spectrometry ( ims ) studies .
the 7 + ions of ubiquitin , whose structure is believed to most closely resemble its native fold , have been studied extensively . in ims experiments , clemmer and
coworkers observed substantial unfolding of 7 + ubiquitin ions on a timescale of 0.1 s after esi , whereas a recent study by wyttenbach and bowers reports conditions under which these ions do not unfold in 0.1 s .
a previous ecd study has provided site - specific data on the gas phase structure and folding / unfolding of the 7 + ubiquitin ions , but these were probed > 40 s after desolvation and were shown to be stable gas phase structures substantially different from those in solution .
here we report ecd data that reflect the initial structural changes of ubiquitin 7 + ions after transfer into the gas phase .
experiments were performed on a 7 t fourier transform - ion cyclotron resonance ( ft - icr ) mass spectrometer ( bruker , vienna , austria ) . after esi ( 1.5 l / min ) of a 2 m ubiquitin ( sigma - aldrich , vienna , austria ) solution in 79:20:1 h2o / ch3oh / ch3cooh at ph 3 ( in which ubiquitin retains its native fold ) under conditions to minimize ion activation by collisions with background gas , ( m + 7h ) ions were accumulated in the first hexapole ( 0.1 s ) , selected by m / z in the quadrupole , accumulated in the second hexapole ( 0.1 s ) , trapped in the ft - icr cell , isolated , and irradiated with electrons ( 0.8 ev ) for 30 ms .
this experiment was repeated with 5 s ion storage in the ft - icr cell prior to ecd , and with collisional activation at the head of the second hexapole .
data analysis utilized snap2 ( bruker , vienna , austria ) and mmass software .
site - specific fragment yields were calculated as % -values relative to all ecd products , considering that backbone cleavage gives a pair of complementary c and z ions ( a , y ions were also included for normalization but not shown in the figures because of their marginal abundance totaling to < 4 % ): 100 % = 0.5[c ] + 0.5[z ] + 0.5[a ] + 0.5[y ] + [ reduced molecular ions and loss of small neutral species from the latter ] .
in ubiquitin s native structure , only residues 7276 are not involved in noncovalent bonding ( figure 1 ) .
if this fold were preserved in the gas phase , only fragments from cleavage at sites 7275 would be found in the ecd spectra because intramolecular noncovalent bonding would prevent separation of all other fragments [ 2 , 7 ] .
however , ecd of the 7 + ions shows abundant c , z fragment ions from cleavage at many other sites ( figure 2 ) , indicating substantial unfolding after desolvation .
specifically , region i ( residues 118 ) that includes -strands 1 and 2 and region iv ( residues 5976 ) that includes -strand 5 have unfolded in 57 % and 47 % of the ions after 0.2 s , respectively ( figure 2a ) . the extent of unfolding was calculated from integrated c , z fragment ion yields in each region versus those expected from random cleavage in a fully extended structure ( 100 % /75 = 1.33 % yield per cleavage site ) .
the similarity of the values for regions i and iv suggests that they have separated from the hydrophobic core in the same unfolding event . from the data in figure 2a , regions ii and iii have unfolded in just 17 % and 5 % of the 7 + ions within 0.2 s , respectively.figure 1.intramolecular electrostatic interactions of ubiquitin ( pdb entry 1d3z ) with regions i ( residues 118 ) , ii ( 1935 ) , iii ( 3658 ) , and iv ( 59 - 76 ) ; basic ( k , r , n - terminus ) and acidic ( d , e , c - terminus ) residues in blue and red , respectively ; hydrogen bonds : dashed lines , solid black lines connect sequence neighbors , green lines : possible salt bridgesfigure 2.site-specific yields ( a ) , ( b ) of c , z fragments from ecd of ubiquitin ( m + 7h ) ions 0.2 s ( a ) and 5 s ( b ) after transfer into the gas phase and yield difference ( c ) ; dashed horizontal lines illustrate calculated yields for random fragmentation intramolecular electrostatic interactions of ubiquitin ( pdb entry 1d3z ) with regions i ( residues 118 ) , ii ( 1935 ) , iii ( 3658 ) , and iv ( 59 - 76 ) ; basic ( k , r , n - terminus ) and acidic ( d , e , c - terminus ) residues in blue and red , respectively ; hydrogen bonds : dashed lines , solid black lines connect sequence neighbors , green lines : possible salt bridges site - specific yields ( a ) , ( b ) of c , z fragments from ecd of ubiquitin ( m + 7h ) ions 0.2 s ( a ) and 5 s ( b ) after transfer into the gas phase and yield difference ( c ) ; dashed horizontal lines illustrate calculated yields for random fragmentation the site - specific differences of fragment yields ( figure 2c ) from ecd 0.2 and 5.2 s after transfer into the gas phase show a pattern very similar to that from ecd after 0.2 s ( figure 2a ) , indicating that the initial unfolding during the first 0.2 s continues during the next 5 s in the same manner .
exceptions to this are the fragment yields at sites 15 , which do not increase in proportion from 0.2 to 5.2 s ( figure 2c ) , indicating that unfolding of residues 15 is largely complete after 0.2 s. after 5.2 s , 71 % , 22 % , 7 % , and 57 % of the ions have unfolded in regions i iv , respectively , suggesting a regional order of stability of iii > ii > iv > i. collisional activation of the 7 + ions 0.1 s after esi under otherwise identical experimental conditions gave the fragmentation patterns shown in figure 3a , b. the data indicate an extent of unfolding of 49 % , 13 % , 17 % , and 41 % in regions i iv after 0.2 s , respectively .
again , the fragment yield differences from ecd 0.2 and 5.2 s after transfer into the gas phase ( figure 3c ) show a pattern very similar to that from ecd after 0.2 s , indicating that the unfolding during the first 0.2 s continues during the next 5 s , with 81 % , 22 % , 27 % , and 58 % of the ions unfolded in regions i iv after 5.2 s , respectively.figure 3.as in figure 2 , but with collisional activation after 0.1 s ( 105 ev laboratory frame energy ) as in figure 2 , but with collisional activation after 0.1 s ( 105 ev laboratory frame energy ) apparently , the 26 hydrogen bonds of ubiquitin s -sheet ( figure 1 ) are insufficient to preserve the solution fold after desolvation : regions i and iv unfold in about half of the 7 + ions after just 0.2 s. on the other hand , region iii , which is the most heterogeneous in terms of secondary structure , is unfolded in only 5 % and 7 % of the ions after 0.2 and 5.2 s , respectively .
substantial collisional activation is required to increase these fractions to 17 % and 27 % , indicating extensive stabilization .
region ii that comprises the -helix is unfolded in only 20 % of the ions at 0.2 and 5.2 s without collisional activation , suggesting that ubiquitin s -helix structure is more stable than its -sheet in the absence of solvent . however , a recent study of kix showed that helix stability in the gas phase critically depends on additional stabilization by salt bridges .
salt bridges as stabilizing structural motifs have also been suggested by williams and coworkers for gaseous peptide ions . the very same collisional activation that increases the fraction of 7 + ions unfolded in regions i and iii by 10 % and 20 % after 5.2 s , respectively , does not further unfold regions ii ( 22 % at 0.2 and 5.2 s ) and iv ( 57 % at 0.2 , 58 % at 5.2 s ) . for region
ii , this is consistent with additional stabilization of the -helix by salt bridges , but structural changes are nevertheless apparent from the different ecd fragmentation patterns for region ii at 0 and 105 ev ( figure 2a , b and figure 3a , b ) .
similar rearrangements are indicated for the far less compact region iv , but not for regions i and iii , whose ecd fragmentation patterns at 0 and 105 ev are very similar ( figure 2a , b and figure 3a , b ) .
salt bridges , formed during the electrospray process or already present in solution , appear to play a dominant role in stabilizing regions of the native fold of ubiquitin after transfer into the gas phase .
six salt bridges are possible in the most stable region iii that comprises 23 residues .
the second most stable region ii ( 17 residues ) has five possible salt bridges .
only two salt bridges are possible in the least stable regions i and iv , respectively .
specifically , the n- and c - terminal -strands 1 and 5 are held together by hydrogen bonds , but no salt bridges can provide additional stabilization .
regions i and iv comprise 36 out of ubiquitin s 76 residues ; their unfolding in just 0.2 s should result in a substantial increase in collision cross section for about half of the 7 + ions , consistent with ims data that indicate unfolding of compact ions ( 1000 ) to form 50 % partially folded
. however , this study also finds 15 % elongated structures ( > 1500 ) after 0.2 s , increasing to 25 % in 5 s. the proportion of elongated structures indicated by our ecd data is smaller , with only 7 % of the 7 + ions unfolded in region iii after 5 s. the esi and ion transmission conditions of these ims experiments appear to result in more extensive unfolding than those used here .
although the timescale of unfolding of ubiquitin after transfer into the gas phase evidently depends on experimental conditions [ 17 , 18 ] , the order of unfolding established here ( region i > iv > ii
> iii ) is dictated by the extent to which the loss of hydrophobic bonding is compensated by electrostatic interactions , in particular salt bridges , in different regions of the native fold .
stabilization by salt bridges is also indicated for the 7 + ions probed 40 s after desolvation , which gave few fragments from cleavage at sites 1158 , consistent with disintegration of the native fold and folding into stable gas phase structures [ 15 , 17 , 22 ] .
the ecd data presented here complement ims data , and allow for a structural interpretation of the unfolding of ubiquitin 7 + ions after transfer into the gas phase .
solvent removal destabilizes the native fold , with regions i and iv unfolding markedly faster than regions ii and iii .
we attribute the observed regional stabilization in large part to salt bridges , consistent with recent findings for the three - helix bundle protein kix .
the extent to which electrostatic interactions and , in particular , salt bridges can compensate for the loss of hydrophobic bonding largely defines the timescale available for structural probing of a solution fold in the gas phase . | the structural evolution of ubiquitin after transfer into the gas phase was studied by electron capture dissociation .
site - specific fragment yields show that ubiquitin s solution fold is overall unstable in the gas phase , but unfolding caused by loss of solvent is slowest in regions stabilized by salt bridges . |
this work was supported by the national health and medical research council ( nhmrc ) of australia project grant 1021456 and a nhmrc senior principal research fellowship 1002863 to sk . | caspase-2 , one of the earliest discovered caspases , has emerged as a multifunctional enzyme with roles that are not limited to cell death .
it acts as a tumor suppressor , prevents genetic instability , and protects against aging by playing a crucial role in sensing alterations in cellular redox status and activating the antioxidant defense system .
these apparent non - apoptotic functions , only discovered recently , emphasize the importance of this often - neglected protease . |
diabetes is a major health problem affecting almost 8.3% ( 25.8 million ) of the u.s .
it is associated with significant morbidity and mortality , and is a major risk factor for cardiovascular disease ( cvd ) ( 1,2 ) .
type 2 diabetes accounts for 9095% of all diagnosed cases of diabetes , with higher prevalence among older adults and minority populations ( 3 ) . despite the overall increased risk of adverse outcomes associated with type 2 diabetes ( 4 )
thus , evaluation of clinical and laboratory data , imaging , and novel biomarkers may aid in the development of prediction models that can improve our ability to identify diabetes - affected individuals who are at a higher risk .
this information , in addition , may be useful for the implementation of cost - effective preventive interventions .
the electrocardiogram ( ecg ) is a simple noninvasive diagnostic test that is recommended by american heart association ( aha ) and american college of cardiology foundation ( accf ) for cvd risk stratification in patients with hypertension and diabetes ( 6 ) .
various ecg markers have been evaluated for their prognostic significance , with qt interval ( expressed in milliseconds ) , defined as the interval from the beginning of ventricular depolarization ( qrs ) to the end of ventricular repolarization ( t wave ) ( 7 ) , being the most relevant .
for clinical purposes , qt interval represents the electrical repolarization of myocardium , unless qrs is abnormally wide ( 7 ) .
prolonged qt interval reflects the lengthening of the vulnerable period and thus may increase the risk of dangerous arrhythmias .
many studies ( 810 ) , but not all ( 1113 ) , have suggested an association of prolonged qt interval with all - cause and cvd mortality in the general population . this association is less well - understood in high - risk populations such as those with type 2 diabetes .
previous studies involving participants with type 2 diabetes examined relatively small samples of diverse ethnicity , mostly used nonlinear formulas to correct qt interval for heart rate , and produced mixed results ( 1419 ) .
prolonged qt interval has also been shown to be correlated with increased risk of incident nonfatal cvd ( 20,21 ) .
therefore , readily available ecg markers may be useful for further characterizing the risk for adverse outcome in patients with type 2 diabetes . to build on existing data and to address some of the limitations of previous studies
, we sought to examine the hypothesis that heart rate corrected qt ( qtc ) interval predicts all - cause and cvd mortality in individuals with type 2 diabetes in the diabetes heart study ( dhs ) .
briefly , the dhs includes 1,443 participants ( 84.6% european americans and 15.4% african americans ) from 564 families with a predominance of type 2 diabetes ( 84.5% ) .
participants were recruited predominantly from the community and outpatient internal medicine and endocrinology clinics from 1998 through 2005 in western north carolina .
letters describing the study were sent to patients receiving care in the wake forest baptist hospital health system .
these letters contained a telephone number for individuals to call if they were interested in participating .
potential participants were first interviewed by telephone for potential eligibility and then , if appropriate , scheduled for the examination visit , where informed consent documents were reviewed and signed .
prior to the examination visit , questionnaires and a copy of the informed consent form were sent to the subjects for review .
a similar study flow was implemented with people recruited from presentations at health fairs , community outreach programs , and referrals by physicians .
all participants provided written informed consent prior to participation , and the study was approved by the institutional review board of wake forest school of medicine .
individuals represent a cross - section of diabetic patients living independently in our community . for the present investigation , and for the appropriate interpretation of qtc
, we included participants ( n = 1,020 ) with type 2 diabetes who were free of atrial fibrillation and did not have major ventricular conduction defects ( defined as qrs duration 120 ms ) ( 7 ) .
we also excluded participants who were taking antiarrhythmic therapy ( procainamide [ n = 1 ] , flecainide [ n = 1 ] , sotalol [ n = 2 ] , amiodarone [ n = 4 ] ) at baseline .
for the current analyses , the follow - up period ended in 2011 after a median time of 8.5 years ( maximum 13.9 years ) .
participant visits were conducted in the general clinical research center at wake forest baptist medical center . upon enrollment , participants were interviewed by trained personnel for demographic information ( age , sex , and race ) , medical history , medication use , and health behaviors .
type 2 diabetes was defined as a history of doctor - diagnosed diabetes after the age of 35 years that was treated with diet and exercise or oral antihyperglycemic medications .
individuals reporting treatment with insulin alone for more than the first year after diagnosis were excluded from the study .
baseline cvd was defined as a composite of self - reported history of heart attack , coronary artery bypass graft , stroke , coronary angioplasty , or carotid endarterectomy .
anthropometric measurements including height , weight , and waist circumference were measured , and bmi was calculated as weight ( in kilograms ) divided by height ( in square meters ) .
resting blood pressure was recorded ; hypertension was defined as the use of hypertensive medications or a mean resting systolic blood pressure ( sbp ) 140 mmhg or diastolic blood pressure 90 mmhg .
fasting blood samples were collected for various biochemical assays , as per the study protocol .
these assays included the determination of total cholesterol , hdl cholesterol and ldl cholesterol levels , as estimated by the friedewald equation ( 23 ) .
fasting blood glucose ( serum ) level was measured by the glucose oxidase method on a vitros analyzer ( johnson & johnson ortho clinical diagnostics , rochester , ny ) . hemoglobin a1c ( hba1c ) was measured by high - performance liquid chromatography .
estimated glomerular filtration rate ( egfr ) was calculated by using the modification of diet in renal disease equation .
a standard , resting 12-lead ecg was obtained using a ge marquette ( milwaukee , wi ) mac 5000 ecg instrument following a standardized protocol .
all ecgs were recorded in the general clinical research center at wake forest baptist medical center and were electronically transmitted to a central ecg core laboratory , located at the epidemiological cardiology research center at wake forest school of medicine , for reading and coding .
the current aha , accf , and heart rhythm society guidelines ( 7 ) for ecg interpretation recommend using methods that are based on linear regression function to calculate the heart rate qtc interval .
therefore , we used a sex - specific method described by rautaharju and zhang ( 24 ) , as follows : qtc = qt + k1*(1 rr ) , where rr = 60/heart rate , k2 = 0.5 , k1 = 0.360 for male participants and
we defined prolonged qtc as any value above the cut point of 450 ms based on the recommendations by rautaharju and zhang ( 24 ) for using 450 ms as a practical upper 5% rate - invariant normal limit when linear rather than proportional scaling of the adjusted qt values if applied ( 24 ) .
in addition , for comparability with previous studies , we also corrected qt for heart rate using bazett s formula ( qtc - baz ) [ qtc - baz = qt ( heart rate/60 ) ] ( 20,25 ) , again using a cut point of 450 ms .
for all participants , vital status was determined from the national social security death index maintained by the u.s . social security administration . for
those participants confirmed as deceased , the length of follow - up was determined from the date of the initial study visit to the date of death . for deceased participants
, copies of death certificates were obtained from relevant county vital records offices to confirm the cause of death . for all other participants ,
the length of follow - up was determined from the date of the initial study visit to the end of 2011 .
cause of death was categorized based on information contained in death certificates as cvd mortality ( myocardial infarction , congestive heart failure , cardiac arrhythmia , sudden cardiac death , peripheral vascular disease , and stroke ) , or cancer , infection , end - stage renal disease , accidental , or other ( including obstructive pulmonary disease , pulmonary fibrosis , liver failure and alzheimer s dementia ) .
baseline characteristics were described as the mean ( sd ) for continuous variables and frequency ( percentage ) for categorical variables .
unadjusted analysis for between - group comparisons was performed by unpaired t test for continuous variables and test for categorical variables .
incidence rates ( irs ) of mortality were calculated for the entire cohort and separately for groups with prolonged and normal qtc intervals .
relative risk ( rr ) was calculated for prolonged vs. normal qtc interval , and statistical significance was calculated by using the wald procedure .
kaplan - meier analysis was performed to examine survival between groups with prolonged vs. normal qtc intervals ; survival estimates were compared using a log - rank test .
using qtc as a continuous variable , mortality risk was estimated per 1-sd increase in qtc .
when the end point is all - cause mortality , censoring may occur if one is alive .
when the end point is cvd mortality , censoring may occur if one is alive or the death is due to other causes .
incremental models were constructed as follows : model 1 , unadjusted ; model 2 , adjusted for age , sex , and ethnicity ; model 3 , additionally adjusted for bmi , hba1c , diabetes duration , sbp , antihypertensive medications , total cholesterol , triglyceride , current smoking , and egfr ; and model 4 , additionally adjusted for history of cvd .
in addition , we repeated all models with qtc as a categorical variable ( prolonged vs. normal ) .
proportionality assumption ( hazard function is proportional over time for the two strata for any given values of predictor variable ) was assessed by introducing time - dependent covariates in the full model . for comparability with previous studies
all analyses were performed using sas software , version 9.2 ( sas institute , cary , nc ) .
briefly , the dhs includes 1,443 participants ( 84.6% european americans and 15.4% african americans ) from 564 families with a predominance of type 2 diabetes ( 84.5% ) .
participants were recruited predominantly from the community and outpatient internal medicine and endocrinology clinics from 1998 through 2005 in western north carolina .
letters describing the study were sent to patients receiving care in the wake forest baptist hospital health system .
these letters contained a telephone number for individuals to call if they were interested in participating .
potential participants were first interviewed by telephone for potential eligibility and then , if appropriate , scheduled for the examination visit , where informed consent documents were reviewed and signed .
prior to the examination visit , questionnaires and a copy of the informed consent form were sent to the subjects for review .
a similar study flow was implemented with people recruited from presentations at health fairs , community outreach programs , and referrals by physicians .
all participants provided written informed consent prior to participation , and the study was approved by the institutional review board of wake forest school of medicine .
individuals represent a cross - section of diabetic patients living independently in our community . for the present investigation , and for the appropriate interpretation of qtc
, we included participants ( n = 1,020 ) with type 2 diabetes who were free of atrial fibrillation and did not have major ventricular conduction defects ( defined as qrs duration 120 ms ) ( 7 ) .
we also excluded participants who were taking antiarrhythmic therapy ( procainamide [ n = 1 ] , flecainide [ n = 1 ] , sotalol [ n = 2 ] , amiodarone [ n = 4 ] ) at baseline .
for the current analyses , the follow - up period ended in 2011 after a median time of 8.5 years ( maximum 13.9 years ) .
participant visits were conducted in the general clinical research center at wake forest baptist medical center . upon enrollment ,
participants were interviewed by trained personnel for demographic information ( age , sex , and race ) , medical history , medication use , and health behaviors .
type 2 diabetes was defined as a history of doctor - diagnosed diabetes after the age of 35 years that was treated with diet and exercise or oral antihyperglycemic medications .
individuals reporting treatment with insulin alone for more than the first year after diagnosis were excluded from the study .
baseline cvd was defined as a composite of self - reported history of heart attack , coronary artery bypass graft , stroke , coronary angioplasty , or carotid endarterectomy .
anthropometric measurements including height , weight , and waist circumference were measured , and bmi was calculated as weight ( in kilograms ) divided by height ( in square meters ) .
resting blood pressure was recorded ; hypertension was defined as the use of hypertensive medications or a mean resting systolic blood pressure ( sbp ) 140 mmhg or diastolic blood pressure 90 mmhg .
fasting blood samples were collected for various biochemical assays , as per the study protocol .
these assays included the determination of total cholesterol , hdl cholesterol and ldl cholesterol levels , as estimated by the friedewald equation ( 23 ) .
fasting blood glucose ( serum ) level was measured by the glucose oxidase method on a vitros analyzer ( johnson & johnson ortho clinical diagnostics , rochester , ny ) . hemoglobin a1c ( hba1c ) was measured by high - performance liquid chromatography .
estimated glomerular filtration rate ( egfr ) was calculated by using the modification of diet in renal disease equation .
a standard , resting 12-lead ecg was obtained using a ge marquette ( milwaukee , wi ) mac 5000 ecg instrument following a standardized protocol .
all ecgs were recorded in the general clinical research center at wake forest baptist medical center and were electronically transmitted to a central ecg core laboratory , located at the epidemiological cardiology research center at wake forest school of medicine , for reading and coding .
the current aha , accf , and heart rhythm society guidelines ( 7 ) for ecg interpretation recommend using methods that are based on linear regression function to calculate the heart rate qtc interval .
therefore , we used a sex - specific method described by rautaharju and zhang ( 24 ) , as follows : qtc = qt + k1*(1 rr ) , where rr = 60/heart rate , k2 = 0.5 , k1 = 0.360 for male participants and 0.353 for female participants .
we defined prolonged qtc as any value above the cut point of 450 ms based on the recommendations by rautaharju and zhang ( 24 ) for using 450 ms as a practical upper 5% rate - invariant normal limit when linear rather than proportional scaling of the adjusted qt values if applied ( 24 ) .
in addition , for comparability with previous studies , we also corrected qt for heart rate using bazett s formula ( qtc - baz ) [ qtc - baz = qt ( heart rate/60 ) ] ( 20,25 ) , again using a cut point of 450 ms .
for all participants , vital status was determined from the national social security death index maintained by the u.s . social security administration . for those participants confirmed as deceased , the length of follow - up was determined from the date of the initial study visit to the date of death . for deceased participants , copies of death certificates
were obtained from relevant county vital records offices to confirm the cause of death . for all other participants ,
the length of follow - up was determined from the date of the initial study visit to the end of 2011 .
cause of death was categorized based on information contained in death certificates as cvd mortality ( myocardial infarction , congestive heart failure , cardiac arrhythmia , sudden cardiac death , peripheral vascular disease , and stroke ) , or cancer , infection , end - stage renal disease , accidental , or other ( including obstructive pulmonary disease , pulmonary fibrosis , liver failure and alzheimer s dementia ) .
baseline characteristics were described as the mean ( sd ) for continuous variables and frequency ( percentage ) for categorical variables .
unadjusted analysis for between - group comparisons was performed by unpaired t test for continuous variables and test for categorical variables .
incidence rates ( irs ) of mortality were calculated for the entire cohort and separately for groups with prolonged and normal qtc intervals .
relative risk ( rr ) was calculated for prolonged vs. normal qtc interval , and statistical significance was calculated by using the wald procedure .
kaplan - meier analysis was performed to examine survival between groups with prolonged vs. normal qtc intervals ; survival estimates were compared using a log - rank test . using qtc as a continuous variable
when the end point is all - cause mortality , censoring may occur if one is alive .
when the end point is cvd mortality , censoring may occur if one is alive or the death is due to other causes .
incremental models were constructed as follows : model 1 , unadjusted ; model 2 , adjusted for age , sex , and ethnicity ; model 3 , additionally adjusted for bmi , hba1c , diabetes duration , sbp , antihypertensive medications , total cholesterol , triglyceride , current smoking , and egfr ; and model 4 , additionally adjusted for history of cvd .
in addition , we repeated all models with qtc as a categorical variable ( prolonged vs. normal ) .
proportionality assumption ( hazard function is proportional over time for the two strata for any given values of predictor variable ) was assessed by introducing time - dependent covariates in the full model . for comparability with previous studies
all analyses were performed using sas software , version 9.2 ( sas institute , cary , nc ) .
at baseline , mean age , diabetes duration , qtc interval , and heart rate were 61.4 years , 10.2 years , 414.9 ms , 71 bpm , respectively ( table 1 ) .
there were more women ( 55.8% ) in the study , and the majority of participants were european americans ( 83.2% ) .
three percent of participants had a prolonged qtc interval > 450 ms , as opposed to 8.6% for qtc - baz interval ( supplementary table 1 ) .
groups with normal vs. prolonged qtc intervals were comparable except for diabetes duration and sbp , both of which were higher in participants with prolonged qtc intervals .
baseline characteristics : dhs after a median follow - up time of 8.5 years ( maximum follow - up time 13.9 years ) , 204 participants ( 20% ) were deceased . the irs and rrs of all - cause mortality are shown in table 2 .
the rr was much greater with prolonged qtc when compared with normal qtc ( rr = 1.99 ; p = 0.003 ) . in the cox regression model ,
each 1-sd increase in qtc was associated with an 18% increase in risk for all - cause mortality ( hr 1.18 [ 95% ci 1.031.36 ] ; p = 0.02 ] after controlling for ethnicity , sex , hypertension , antihypertensive medications , bmi , diabetes duration , hba1c level , current smoking status , total cholesterol level , triglyceride level , egfr , and baseline cvd status in the fully adjusted model ( table 3 ) . in kaplan - meier analysis , we observed worse survival for participants with prolonged qtc intervals ( log - rank test , p = 0.005 ) when compared with normal qtc intervals ( fig .
when used as a categorical variable , prolonged qtc interval was associated with a 73% increase risk of all - cause mortality ( 1.73 [ 0.953.15 ] ; p = 0.07 ] after adjusting for covariates , although the 95% ci overlapped the null slightly ( table 3 ) .
the interaction between qtc interval and sex was not significant ( p = 0.43 ) ; nor was the interaction between qtc interval and ethnicity ( p = 0.65 ) .
similar results were obtained when qtc interval was used as a categorical variable ( p = 0.65 and p = 0.77 , respectively , for interaction with sex and ethnicity ) .
irs of mortality : dhs association of heart rate qtc interval with mortality : dhs mortality risk associated with prolonged ( > 450 ms ) vs. normal heart rate qtc interval : dhs .
when qtc - baz interval was used as a predictor ( supplementary table 2 ) , we found similar associations of every 1-sd increase in qtc - baz with all - cause mortality ( hr 1.21 [ 95% ci 1.051.39 ] ; p = 0.008 ] .
however , the results were not significant when qtc - baz was used as a categorical variable ( 1.09 [ 0.671.76 ] ; p = 0.72 ] . in the sensitivity analysis , we did not exclude participants with prolonged qrs duration ( n = 86 ) and repeated cox regression models in the total cohort ( n = 1,106 ) to examine the association of qtc ( continuous variable ) with all - cause mortality ( total number of deaths 239 ) .
we found that the results were statistically significant in all models ( supplementary table 3 ) .
after the same follow - up period ( median follow - up 8.5 years ; maximum follow - up 13.9 years ) , 88 participants ( 43% of total deceased participants ) died as a result of cvd causes .
prolonged qtc duration carried a higher rr for cvd mortality when compared with normal qtc duration ( rr = 3.19 ; p = 0.0003 ; table 2 ) . each 1-sd increase in qtc duration
was associated with a 31% increased risk of cvd mortality ( hr 1.29 [ 95% ci 1.051.59 ] ; p = 0.02 ) after controlling for age , sex , ethnicity , diabetes duration , hba1c level , bmi , total cholesterol level , triglyceride level , hypertension , antihypertensive medications , current smoking status , egfr , and history of cvd ( table 3 ) .
kaplan - meier analysis showed worse survival for participants with prolonged qtc duration ( log - rank test , p = 0.0003 ) when compared with normal qtc duration ( fig .
1 ) . in addition , in the fully adjusted cox regression model , we found a stronger association between prolonged qtc duration and cvd death ( 2.86 [ 1.356.08 ] ; p = 0.006 ) ( table 3 ) .
we did not find any significant interaction between sex and qtc duration as a continuous variable ( p = 0.76 ) or a categorical variable ( p = 0.19 ) .
similarly , interaction with ethnicity was also not significant ( p = 0.73 for qtc as a continuous variable ; p = 0.60 for qtc as a categorical variable ) . using qtc - baz duration as a continuous variable
, we obtained similar results ( supplementary table 2 ) ; every 1-sd increase in qtc - baz duration was associated with a 31% increase in cvd mortality ( p = 0.01 ) .
however , the results were not significant when qtc - baz was used as a categorical variable ( hr 1.33 [ 95% ci 0.682.61 ] ; p = 0.40 ) . in sensitivity analysis without excluding participants with prolonged qrs duration , we observed similar results for the association of qtc with cvd mortality ( number of deaths due to cvd = 104 ) ( supplementary table 3 ) .
at baseline , mean age , diabetes duration , qtc interval , and heart rate were 61.4 years , 10.2 years , 414.9 ms , 71 bpm , respectively ( table 1 ) .
there were more women ( 55.8% ) in the study , and the majority of participants were european americans ( 83.2% ) .
three percent of participants had a prolonged qtc interval > 450 ms , as opposed to 8.6% for qtc - baz interval ( supplementary table 1 ) .
groups with normal vs. prolonged qtc intervals were comparable except for diabetes duration and sbp , both of which were higher in participants with prolonged qtc intervals .
after a median follow - up time of 8.5 years ( maximum follow - up time 13.9 years ) , 204 participants ( 20% ) were deceased .
the rr was much greater with prolonged qtc when compared with normal qtc ( rr = 1.99 ; p = 0.003 ) . in the cox regression model ,
each 1-sd increase in qtc was associated with an 18% increase in risk for all - cause mortality ( hr 1.18 [ 95% ci 1.031.36 ] ; p = 0.02 ] after controlling for ethnicity , sex , hypertension , antihypertensive medications , bmi , diabetes duration , hba1c level , current smoking status , total cholesterol level , triglyceride level , egfr , and baseline cvd status in the fully adjusted model ( table 3 ) . in kaplan - meier analysis , we observed worse survival for participants with prolonged qtc intervals ( log - rank test , p = 0.005 ) when compared with normal qtc intervals ( fig .
when used as a categorical variable , prolonged qtc interval was associated with a 73% increase risk of all - cause mortality ( 1.73 [ 0.953.15 ] ; p = 0.07 ] after adjusting for covariates , although the 95% ci overlapped the null slightly ( table 3 ) .
the interaction between qtc interval and sex was not significant ( p = 0.43 ) ; nor was the interaction between qtc interval and ethnicity ( p = 0.65 ) .
similar results were obtained when qtc interval was used as a categorical variable ( p = 0.65 and p = 0.77 , respectively , for interaction with sex and ethnicity ) .
irs of mortality : dhs association of heart rate qtc interval with mortality : dhs mortality risk associated with prolonged ( > 450 ms ) vs. normal heart rate qtc interval : dhs .
when qtc - baz interval was used as a predictor ( supplementary table 2 ) , we found similar associations of every 1-sd increase in qtc - baz with all - cause mortality ( hr 1.21 [ 95% ci 1.051.39 ] ; p = 0.008 ] .
however , the results were not significant when qtc - baz was used as a categorical variable ( 1.09 [ 0.671.76 ] ; p = 0.72 ] . in the sensitivity analysis
, we did not exclude participants with prolonged qrs duration ( n = 86 ) and repeated cox regression models in the total cohort ( n = 1,106 ) to examine the association of qtc ( continuous variable ) with all - cause mortality ( total number of deaths 239 ) .
we found that the results were statistically significant in all models ( supplementary table 3 ) .
after the same follow - up period ( median follow - up 8.5 years ; maximum follow - up 13.9 years ) , 88 participants ( 43% of total deceased participants ) died as a result of cvd causes .
prolonged qtc duration carried a higher rr for cvd mortality when compared with normal qtc duration ( rr = 3.19 ; p = 0.0003 ; table 2 ) . each 1-sd increase in qtc duration
was associated with a 31% increased risk of cvd mortality ( hr 1.29 [ 95% ci 1.051.59 ] ; p = 0.02 ) after controlling for age , sex , ethnicity , diabetes duration , hba1c level , bmi , total cholesterol level , triglyceride level , hypertension , antihypertensive medications , current smoking status , egfr , and history of cvd ( table 3 ) .
kaplan - meier analysis showed worse survival for participants with prolonged qtc duration ( log - rank test , p = 0.0003 ) when compared with normal qtc duration ( fig .
, in the fully adjusted cox regression model , we found a stronger association between prolonged qtc duration and cvd death ( 2.86 [ 1.356.08 ] ; p = 0.006 ) ( table 3 ) .
we did not find any significant interaction between sex and qtc duration as a continuous variable ( p = 0.76 ) or a categorical variable ( p = 0.19 ) .
similarly , interaction with ethnicity was also not significant ( p = 0.73 for qtc as a continuous variable ; p = 0.60 for qtc as a categorical variable ) . using qtc - baz duration as a continuous variable
, we obtained similar results ( supplementary table 2 ) ; every 1-sd increase in qtc - baz duration was associated with a 31% increase in cvd mortality ( p = 0.01 ) .
however , the results were not significant when qtc - baz was used as a categorical variable ( hr 1.33 [ 95% ci 0.682.61 ] ; p = 0.40 ) . in sensitivity analysis without excluding participants with prolonged qrs duration , we observed similar results for the association of qtc with cvd mortality ( number of deaths due to cvd = 104 ) ( supplementary table 3 ) .
in this study of mostly european american adults with type 2 diabetes living in the community , we found that qtc interval was an independently associated predictor of all - cause and cvd mortality after a maximum of 13.9 years of follow - up .
this finding suggests that this simple ecg marker may provide additional prognostic information in patients with type 2 diabetes .
this risk association with qtc interval adds to previous reports from the dhs that have identified coronary artery calcium level ( 26 ) and c - reactive protein level ( 27 ) as predictors of mortality in this high - risk cohort .
diabetes is a risk factor for incident cvd and cvd mortality , and is considered a coronary heart disease risk equivalent ( 4,28 ) .
however , excess risk of mortality in persons with type 2 diabetes can not be fully explained by cvd or known cvd risk factors ( 29,30 ) , thereby providing an opportunity to identify additional markers for better risk assessment . it is suggested that individuals with diabetes do not form a homogeneous group , and there is wide variation in individual risk profile for outcomes ( 31 ) .
stratification of type 2 diabetes affected individuals based on key clinical indicators and a risk factor profile is essential for effective patient management . in this study ,
the association of qtc interval with mortality persisted even after controlling for traditional cardiovascular risk factors and baseline cvd , suggesting that qtc interval is an additional tool for examining risk in high - risk type 2 diabetes cohorts .
we acknowledge that the finding of an association between prolonged qtc interval and all - cause and cvd mortality does not establish a causal relationship .
likewise , the hypothesis that qtc interval is a therapeutic target needs confirmation in future studies .
however , it is possible that prolonged qtc interval is merely a surrogate biomarker representing complex underlying pathophysiological processes including subclinical atherosclerosis and diabetic cardiomyopathy .
further , as the duration of diabetes is associated with prolonged qtc here , future research examining the effects of diabetes duration , severity , and treatment on qtc duration may help to further resolve the pathophysiology of qtc prolongation in individuals with diabetes .
a number of studies have assessed the role of qtc as a prognostic marker in the general population with mixed results , although the results have been somewhat more consistent in patients with underlying coronary artery disease ( 10,11,21,32,33 ) .
qtc interval was not associated with total mortality , sudden cardiac death , or fatal cad events over 30 years in the framingham heart study ( 13 ) or with all - cause and cvd mortality over 9 years in a large finnish population - based health 2000 study ( 12 ) .
in contrast , a qtc interval of > 450 ms was significantly associated with all - cause and coronary heart disease mortality in the cardiovascular heart study ( 8) , and in a meta - analysis including multiple studies , zhang et al .
( 10 ) demonstrated a positive association of prolonged qtc interval with mortality outcomes in the general population despite methodological heterogeneity across studies . from a preventative medical point of view , if prolonged qtc interval can prognosticate adverse cardiovascular outcomes in individuals with type 2 diabetes , increased emphasis can be given to primary and secondary prevention strategies to mitigate this cardiovascular risk . in patients with type 2 diabetes ,
while some of the previous studies including participants with type 2 diabetes report the qtc interval to be predictive of outcome , they were based on small sample sizes ( 15,19,34 ) , were conducted in ethnic minority groups ( 16,35 ) , and used nonlinear formulas ( mostly bazett s formula ) to correct the qt interval for heart rate , which is now discouraged by the current guidelines .
in contrast to the studies mentioned above , our study has a well - defined prospective cohort of nonhospitalized american individuals with type 2 diabetes and high - quality ecg data .
furthermore , we have used a linear formula for heart rate correction as suggested by current guidelines .
the qt interval is affected by heart rate in an inverse relationship , and a number of formulas have been developed to calculate heart rate qtc interval .
almost all of these formulas have certain limitations and do not perform very well at very high or low heart rates ( 36 ) . at present , the aha / accf / heart rhythm society recommend using a linear regression function for heart rate correction , and the use of nonlinear formulas , especially bazett s formula , which overcorrects qt interval at fast heart rates and undercorrects it at low heart rates , is discouraged ( 7 ) . in this study , we used a sex - specific linear scaling method to adjust qt interval for heart rate as per guidelines using the method described by rautaharju and zhang ( 24 ) .
however , to compare our results with previous studies , we also used bazett s formula for heart rate correction .
we observed that the results were similar when qtc and qtc - baz intervals were used as continuous variables in the cox regression models .
however , when a cut point was used to categorize heart rate qtc interval into prolonged vs. normal interval , the results became inconsistent ; the association between prolonged qtc - baz interval and mortality failed to reach statistical significance in any of the models for all - cause and cvd mortality ( supplementary table 2 ) , suggesting that here qtc - baz was not useful for detecting individuals at increased risk of adverse outcome .
our findings are similar to existing reports and underscore the problems with using cut points for qtc - baz interval ( 7 ) , including the potential for spurious estimation of qtc interval using bazett s formula and subsequent misclassification of prolonged qtc interval using the 450 ms cut point ( 20 ) .
previous studies have reported much higher prevalences of prolonged qtc interval compared with our observations in the dhs . in a study of >
3,000 chinese individuals with type 2 diabetes , 30% of the sample had prolonged qtc intervals ( 37 ) , close to 26% in an italian cohort with type 2 diabetes ( 38 ) , and > 65% in a small caucasian cohort ( 15 ) .
however , in our study of individuals with type 2 diabetes , the prevalence of prolonged qtc was 3% ( 8.6% with qtc - baz ; supplementary table 1 ) .
this low prevalence is clearly a limitation in our analyses of normal vs. prolonged qtc interval .
the reasons for these variations are not entirely clear , although technical , methodological , and varying patient characteristics may partly explain these variations . in a similar way ,
these include aging , microvascular and macrovascular ischemic heart disease , hyperglycemia , cardiac autonomic neuropathy , formation of advanced glycation end products , oxidative stress , inflammation , myocardial fibrosis , left ventricular hypertrophy , and endothelial dysfunction ( 39 ) .
clearly , in individuals with type 2 diabetes many of these processes are likely to be at play , and could be considered as underpinning the relationships between qtc and outcome that we observed . however , further research is warranted to clarify these mechanisms .
the study sample consisted only of type 2 diabetes - affected individuals with extended diabetes duration and with multiple existing cvd risk factors .
we only have a single measure of qt interval at initial enrollment , and therefore any variation during the follow - up period could not be assessed in our study .
although we have adjusted for known clinical risk factors , residual confounding may still be present as this was an observational study .
for example , neuropathy data were not collected as part of the dhs clinical assessment , and autonomic neuropathy has been reported previously to be associated with prolonged qt interval ( 40 ) .
furthermore , cause of death information was collected from death certificates , and therefore there is a chance of misclassification for cvd mortality . on the latter point , the proportion of deaths attributed to cvd ( 43% ) is relatively similar when compared with previous reports ( 41 ) .
last , our study cohort consisted mostly of european americans and only a small proportion of african americans . therefore , these results may not be applicable to other ethnic groups .
the main strength of our study is the fact that dhs is a cohort study of community - based diabetic patients with long follow - up times .
therefore , the results are likely representative of ongoing processes in a general population of patients with type 2 diabetes .
in addition , our study supports the utility of an easily available clinical measure in the risk assessment of individuals with a highly prevalent and important medical condition who are at increased risk of mortality . in conclusion , in this longitudinal study of a population with type 2 diabetes , heart rate qtc interval is independently associated with all - cause and cvd mortality after adjusting for traditional risk markers and after a maximum follow - up time of 13.9 years , suggesting that additional prognostic information may be available from this simple ecg measure .
this information may provide a clinical basis for further diagnostic testing in selected individuals ; this hypothesis , however , requires confirmation .
additional work is also warranted to examine the role of targeted interventions to lower this risk .
| objectiveheart rate
corrected qt ( qtc ) interval is associated with mortality in the general population , but this association is less clear in individuals with type 2 diabetes .
we assessed the association of qtc interval with all - cause and cardiovascular disease ( cvd ) mortality in the diabetes heart study.research design and methodswe studied 1,020 participants with type 2 diabetes ( 83% european americans ; 55% women ; mean age 61.4 years ) who were free of atrial fibrillation , major ventricular conduction defects , and antiarrhythmic therapy at baseline .
qt duration was automatically calculated from a standard 12-lead electrocardiogram ( ecg ) .
following american heart association / american college of cardiology foundation recommendations , a linear scale was used to correct the qt for heart rate . using cox regression , risk was estimated per 1-sd increase in qtc interval as well as prolonged qtc interval ( > 450 ms ) vs. normal qtc interval for mortality.resultsat baseline , the mean ( sd ) qtc duration was 414.9 ms ( 18.1 ) , and 3.0% of participants had prolonged qtc .
after a median follow - up time of 8.5 years ( maximum follow - up time 13.9 years ) , 204 participants were deceased . in adjusted multivariate models ,
a 1-sd increase in qtc interval was associated with an 18% higher risk for all - cause mortality ( hazard ratio 1.18 [ 95% ci 1.031.36 ] ) and 29% increased risk for cvd mortality ( 1.29 [ 1.051.59 ] ) .
similar results were obtained when qtc interval was used as a categorical variable ( prolonged vs. normal ) ( all - cause mortality 1.73 [ 0.953.15 ] ; cvd mortality 2.86 [ 1.356.08]).conclusionsheart rate qtc interval is an independent predictor of all - cause and cvd mortality in this population with type 2 diabetes , suggesting that additional prognostic information may be available from this simple ecg measure . |
their antitumor action has been attributed to dna crosslinking , leading to inhibition of dna synthesis and monoadduct formation and induction of apoptosis and cell death [ 25 ] .
this dna damage , as well as drug - associated adverse events such as cardiovascular and skin toxicity , may be related to the formation of reactive oxygen species ( ros ) [ 6 , 7 ] .
mitomycin c ( mmc ) is a quinone - containing antibiotic originally isolated from streptomyces caespitosus in 1958 .
although current use of mmc is limited , this agent continues to be a key element in several clinical trials due to its intrinsic efficacy against many solid tumors and preferential activity in hypoxic tumoral cells .
mmc has a synergistic effect with radiotherapy via its radiosensitizing effects , targeting hypoxic cells in radiation resistant tumors [ 10 , 11 ] . to achieve its alkylating activity
, mmc requires a bioreductive transformation to form active species that crosslink dna [ 1214 ] . depending on the biotransformation pathway , metabolism of mmc
there is indiscriminate damage to biological macromolecules such as nucleic acids , proteins , and lipids .
melatonin , n - acetyl-5-methoxytryptamine , is the chief product of the pineal gland in all vertebrates .
retinal light exposure reduces the amount of serotonin metabolized to melatonin via neural pathways connecting the retina to the pineal gland .
thus , pineal production of melatonin increases at night , and the amount of melatonin secreted into the plasma is related to the length of exposure to darkness .
melatonin is involved in the modulation of a variety of endocrine , neural , and immune functions [ 17 , 18 ] .
its protection against oxidative damage is enhanced by its amphiphilic nature , allowing the melatonin molecule to readily access all cell compartments , including the nucleus .
intensive research over the last two decades has shown the beneficial protective effects of melatonin in a multitude of pathological processes . among them ,
there is compelling evidence that melatonin may reduce the growth of established tumors . since cellular harm produced by mmc
is thought to be at least partially due to a free radical mechanism , and mmc generates micronuclei - induced genotoxic damage in animal models [ 26 , 27 ] , the aim of this work was to assess the genotoxic effect of mmc .
these effects were measured as the number of micronucleated polychromatic erythrocytes ( mn - pce ) from the peripheral blood and the ability of mmc to induce lipid peroxidation in cerebral and hepatic homogenates .
we also assessed the potential protective action of melatonin against both micronuclei formation and lipid peroxidation processes due to mmc .
the bioxytech lpo-586 kit for lipid peroxidation was obtained from cayman chemical ( ann arbor , mi , usa ) .
thirty - six sprague - dawley rats weighing 95100 g were purchased from harlan iberica ( barcelona , spain ) and received standard food and water ad libitum .
animal handling and procedures were in strict accordance with the recommendations of the european economic community committee ( 2007/526/ce ) for the care and use of laboratory animals .
the experimental protocol was approved by zaragoza 's university ethical committee for animal research ( reference pi24/09 ) .
after acclimation for two weeks with a 12-hour light / dark cycle ( lights on at 0700 and off at 1900 ) , the rats were divided to four groups of nine animals in each : control , melatonin , mmc , and mmc + melatonin .
mmc was dissolved in saline and injected intraperitoneally in a single dose of 2 mg / kg .
melatonin was dissolved in ethanol and thereafter diluted in saline ( final concentration of ethanol : 1% ) and administered intraperitoneally in a dose of 10 mg / kg .
melatonin treatment started 24 hours prior to mmc administration and was given every 8 hours .
control and mmc groups received the dose intraperitoneally and with an equal volume of ethanol / saline solution .
a 5 l peripheral blood sample was collected from the tail vein of each rat at 0 , 24 , 48 , 72 , and 96 hours after mmc treatment and mounted on two glass slides .
afterwards , the extensions were fixed with methanol for 10 minutes . following final blood extractions , at 96 hours , the animals were decapitated and the brain and liver were quickly removed , washed in cold saline solution ( 4c ) , and frozen below 30c until mda + 4-hda assay was performed .
peripheral blood slides were stained with an acridine orange ( ao ) fluorescent staining procedure according to hayashi et al . .
a volume of 0.24 mmol ao in phosphate buffer ( pbs ) was used as the working solution .
the slides were mounted with the same buffer , covered with a 24 60 mm cover slip , and sealed with paraffin . using coded slides ,
the analysis of mn - pce in each slide was done within 12 days by two independent researchers , each analyzing one thousand cells . utilizing a fluorescent microscope ( zeiss iii - rs ) ,
the number of mn - pce per 1000 polychromatic erythrocytes ( pce ) was counted and , the ratio of pce to normochromatic erythrocytes ( pce / nce ) was calculated ( from 300 erythrocytes ) .
subsequently , the code was broken and the counts from each evaluator were averaged . with the ao fluorescent staining procedure , pce containing rna can be identified by red fluorescence and micronuclei by yellow - green fluorescence .
mda + 4-hda levels were used as an index of oxidative breakdown of lipids in brain and liver tissues .
briefly , samples were homogenized ( 1 : 5 ) ( weight / volume ) in 20 mmol tris(hydroxymethyl ) aminomethane buffer ( ph 7.4 ) .
mda + 4-hda were determined using the bioxytech kit . in the assay , mda plus
4-hda reacts with n - methyl-2-phenylindole , yielding a stable chromophore with a peak of maximum absorbance at 586 nm .
protein concentrations in the tissue homogenates were assessed by the bradford method using bovine serum albumin as a standard .
student 's unpaired data t - test and anova were used for comparison of the means .
the results of the micronucleus assay obtained in peripheral blood are illustrated in figure 1 .
the number of mn - pce at 24 , 48 , 72 , and 96 hours increased significantly in the groups exposed to mmc compared to other groups .
no differences were observed in the pce / nce ratio ( table 1 ) . the maximal response
when compared to mmc alone , melatonin significantly reduced the number of mmc - induced mn - pce in peripheral blood at 24 hours ( 6.6 0.92 versus 4 0.67 ; p = .038 ) , 48 hours ( 14.3 4.77 versus 5.9 0.54 ; p = .020 ) , 72 hours ( 7.1 1.35 versus 3 0.41 ; p = .04 ) , and 96 hours ( 3.5 0.65 versus 1 0.24 ; p = .03 ) while no differences were appreciated between controls ( 1.8 0.63 versus 1.5 0.43 ; p = .6 ) . no statistically significant differences of mda + 4-hda were found in brain or liver when the averages of each group were compared ( figure 2 ) .
these results indicate the absence of lipid peroxidation due to mmc in these organs under our experimental conditions .
our results show that in vivo exposure to mmc induces genotoxicity as indicated by increases in the number of mn - pce at 24 , 48 , 72 , and 96 hours posttreatment .
this is in accordance with previous studies demonstrating mmc - induced micronuclei [ 26 , 31 , 32 ] .
several in vitro and in vivo studies have shown that different mmc metabolic pathways result in ros generation [ 3335 ] , and that some mmc metabolites may form cross - links to adjacent guanines in dna [ 3639 ] .
quinones , including mmc , streptonigrin , and adriamycin , produce ros as result of one- or two - electron reduction metabolism [ 4042 ] : firstly , they or their one - electron reduction product , semiquinones ( sq ) , may react with glutathione and protein - sh groups through a nonenzymatic and/or glutathione transferase reaction ; secondly , sq may generate superoxide anion radicals depending on the equilibrium potential and the ph [ 43 , 44 ] ; thirdly , sq and superoxide anion radicals can reduce transition - metal ions , such as iron and copper , and promote the hydroxyl radical generation via the fenton reaction [ 33 , 45 ] .
on the other hand , our results show that , after 96 hours of mmc treatment , this quinone does not induce lipid peroxidation in homogenates of brain and liver , as indicated by its inability to modify significantly mda + 4-hda concentrations .
however , free radicals involve the micronuclei formation and we have demonstrated that the antioxidant indoleamine melatonin had a protective effect against mmc genotoxicity in rat red blood cell precursors in vivo , suggesting that mmc - induced pce - mn elevation may be mediated by free radical generation .
possible explanations for the lack of lipid peroxidation induced by mmc could be that the ros generated as a consequence of mmc metabolism is insufficiently powerful to generate or propagate lipid peroxidation or that , after 96 hours , mda + 4-hda concentrations were reduced by renal clearance .
recent interest has focused on the use of molecules that may partly reduce the side effects of mmc .
several free radical scavenger agents , such as amifostine and nitroxide , prevent the cytotoxic damage mediated by mmc in different organs [ 4749 ] . in fact , the united states food and drug administration ( fda ) recently approved amifostine for use as a cytoprotectant in combination with cyclophosphamide and cisplatin for the treatment of advanced ovarian cancer and nonsmall cell lung cancer .
lipoic acid , another antioxidant , has also demonstrated an in vivo dose - dependent protective effect against cyclophosphamide - induced clastogenicity in the peripheral blood and bone marrow of rats . herein , we have extended the evidence of melatonin as a cell protector , since cotreatment of mmc and melatonin significantly reduced the number of mn - pce .
this is in accordance with the results of previous studies showing a significant reduction in micronuclei induction by different genotoxic molecules in peripheral blood and bone marrow samples [ 52 , 53 ] .
moreover , melatonin is also capable of preventing dna damage induced by not only mutagens but also different alkylating agents such as 7,12-dimethybenz()anthracene , cyclophosphamide , and benzo()pyrene .
melatonin protection against dna damage and oncogenesis is thought to be due in part to its antioxidant properties .
melatonin , an indoleamine , directly scavenges hydroxyl radicals , singlet oxygen , and peroxynitrites [ 19 , 5557 ] , increases the concentration of endogenous glutathione , and stimulates the antioxidative enzymes superoxide dismutase and glutathione peroxidase . moreover , melatonin has been shown to prevent iron - induced lipid peroxidation .
thus melatonin may also prevent carcinogenesis . additionally , once oncogenesis has occurred ; melatonin seems to control cancer growth by means other than its antioxidant activity .
melatonin might inhibit the uptake and metabolism of fatty acid signaling molecules that promote the production of tumoral growth factors , reduce telomerase activity by shortening telomer length , and modulate expression of tumor suppressor genes such as tp53 .
this peptide is usually elevated in the plasma of patient with various solid tumors and acts to protect cancer cells from apoptosis and promote endothelial and smooth muscle proliferation .
finally , the antiestrogenic activity of melatonin also seems to play a role in its ability to decrease proliferation in some hormone - responsive tumors .
physiological and pharmacological concentrations of melatonin exhibited a growth inhibitory effect on mcf-7 human breast cancer cell lines [ 66 , 67 ] .
in fact , this effect was particularly manifested in cancer cell lines possessing the estrogen receptor ( er ) ; this effect seems to be mediated by both membrane ( mt1 ) and nuclear ( rzr ) melatonin receptors .
in conclusion , the data reported herein provide evidence that melatonin reduces genotoxicity due to mmc , presumably due to its antioxidant effects .
based on our observations and previous results showing that oxidative stress participates in carcinogenesis and the role of melatonin as an anticarcinogenic agent with broad bioavailability and lack of side effects , it seems reasonable to propose that cotreatment with melatonin may be beneficial when used in combination with mmc for the treatment of some cancers . | mitomycin c ( mmc ) generates free radicals when metabolized .
we investigated the effect of melatonin against mmc - induced genotoxicity in polychromatic erythrocytes and mmc - induced lipid peroxidation in brain and liver homogenates .
rats ( n = 36 ) were classified into 4 groups : control , melatonin , mmc , and mmc + melatonin .
melatonin and mmc doses of
10 mg / kg and 2 mg / kg , respectively , were injected intraperitoneally .
peripheral blood samples were collected at 0 , 24 , 48 , 72 , and 96 hours posttreatment and homogenates were obtained at 96 hours posttreatment .
the number of micronucleated polychromatic erythrocytes ( mn - pce ) per 1000 pce was used as a genotoxic marker .
malondialdehyde ( mda ) plus 4-hydroxyalkenal ( 4-hda ) levels were used as an index of lipid peroxidation .
the mmc group showed a significant increase in mn - pce at 24 , 48 , 72 , and 96 hours that was significantly reduced with melatonin begin coadministrated .
no significant differences were found in lipid peroxidation .
our results indicate that mmc - induced genotoxicity can be reduced by melatonin . |
written patient drug information , such as drug labels and package inserts ( pis ) , is intended to instruct patients on how and when to use a medicine and to promote an understanding of the purpose , benefits and risks of the medication prescribed.1 this understanding is supposed to lead to successful therapy and enable safe medication use .
substantial regulatory efforts have been made in europe , the usa , and australia to improve written drug information.1,2 in saudi arabia , during the pharmaceutical registration stage , manufacturers must submit a summary of product characteristics ( spc ) and labeling information to the regulatory authority .
the laws mandate that medications purchased from a community pharmacy are dispensed in their original packages with an insert very similar to the spc .
the intended users of pis are health care professionals ; however , because of their visibility one could expect that many patients will turn to pis to answer their medication - related queries .
indeed , a saudi - based survey of over 2000 community pharmacy customers found that 88% of respondents claimed that they read the pis or ask somebody to read it for them.3 however , of concern is that the pis could be the main source of information for some patients for many reasons .
first , research suggests self - medication is common in saudi arabia.4 second , purchasing legally prescription - only medications without a prescription from community pharmacies is common.5 this means that the patient assumes the bulk of responsibility for medication safety not only for over - the - counter ( otc ) medications but also for medications such as antibiotics , nonsteroidal anti - inflammatories , and oral contraceptives .
third , even if patients visit physicians , information provided regarding dose and frequency , precautions , and adverse effects of their prescribed medications has been shown to be suboptimal,6 as has community pharmacists counselling.7 despite that , research on pis in saudi arabia is rare .
available evidence indicates that inserts of saudi - marketed drugs conveyed limited and incomplete information compared with their counterparts marketed in the usa8 and there is a substantial disagreement in information between the pis of generic and brand products marketed in saudi arabia.9 however , no study has evaluated whether the available pis are comprehensible and understandable by the patient , which is a very important aspect of evidence - based pis.10 a growing body of research indicates that patients frequently misinterpret prescription drug labels and pis.1117 challenges in reading and understanding labels and pis may represent one cause of the high rates of medication errors and poor adherence.11,12 therefore , this study aimed to assess the availability of key information on pis supplied with prescribed and otc medications in saudi arabia .
it also assessed whether information on pis is presented in a way that aids patient comprehension . in addition , characteristics of relevance to readability were examined .
a commercially available list of top - selling prescription - only and otc medications in saudi arabia was obtained.18 from the list of 253 medicines , each of which had sold 100,000 units or more in saudi during the year 2011 , 60 medicines were selected .
the 60 medications were chosen from the top 150 sold medications ( prescription = 37 , otc = 23 ) .
selection was done to ensure the drugs covered different therapeutic indications ( n = 15 ) , pharmaceutical forms ( tablets , capsules , syrups , suspensions , drops , ointments , and inhalers ) , from different manufacturers ( n = 19 ; four saudi , two arabic non - saudi , 13 international ) .
the legal status of each medication was verified by status information available on the saudi food and drug authority ( sfda ) website.19 if a pi was for different strengths and one of these strengths was an otc , the pi was counted with the otc .
the pis were collected and analyzed by the author from community pharmacies in may 2011 .
six characteristics were examined : dimensions , layout , type of paper , color of paper and text , transparency , use of headings , and use of pictograms or graphics .
dimensions ( length and width ) of each pi were measured to the nearest centimeter with a standard ruler .
pi content was evaluated using criteria derived from the literature specifically , the criteria used by fuchs et al20 and raynor et al.2 fuchs et al s criteria were built on european and german regulations .
many of these quality criteria referred to the content of the pi , such as contraindications , and the dosage or possible side effects .
there were also some criteria that considered additional aspects such as general comprehensibility and readability as well as layout .
these criteria had already been used to analyze german pis11 and were tested in the pi test study ( paint ) study,13 which showed that they significantly improved comprehensibility and usability of pis.12 the criteria used by raynor and colleagues was based on the us keystone criteria,2 which were developed through a structured process of consensus by a large number of stakeholders .
criteria related to readability , such as word count and font size , were excluded as they were outside the objective of this study .
yes meaning the information was provided and no meaning no such information was provided .
the data were extracted by the author twice at different times to minimize the chances of missing any information .
all statistical analysis was performed using spss ( v 15.00 ; ibm corporation , armonk , ny ) .
a commercially available list of top - selling prescription - only and otc medications in saudi arabia was obtained.18 from the list of 253 medicines , each of which had sold 100,000 units or more in saudi during the year 2011 , 60 medicines were selected .
the 60 medications were chosen from the top 150 sold medications ( prescription = 37 , otc = 23 ) .
selection was done to ensure the drugs covered different therapeutic indications ( n = 15 ) , pharmaceutical forms ( tablets , capsules , syrups , suspensions , drops , ointments , and inhalers ) , from different manufacturers ( n = 19 ; four saudi , two arabic non - saudi , 13 international ) .
the legal status of each medication was verified by status information available on the saudi food and drug authority ( sfda ) website.19 if a pi was for different strengths and one of these strengths was an otc , the pi was counted with the otc .
the pis were collected and analyzed by the author from community pharmacies in may 2011 .
six characteristics were examined : dimensions , layout , type of paper , color of paper and text , transparency , use of headings , and use of pictograms or graphics .
dimensions ( length and width ) of each pi were measured to the nearest centimeter with a standard ruler .
pi content was evaluated using criteria derived from the literature specifically , the criteria used by fuchs et al20 and raynor et al.2 fuchs et al s criteria were built on european and german regulations .
many of these quality criteria referred to the content of the pi , such as contraindications , and the dosage or possible side effects .
there were also some criteria that considered additional aspects such as general comprehensibility and readability as well as layout .
these criteria had already been used to analyze german pis11 and were tested in the pi test study ( paint ) study,13 which showed that they significantly improved comprehensibility and usability of pis.12 the criteria used by raynor and colleagues was based on the us keystone criteria,2 which were developed through a structured process of consensus by a large number of stakeholders .
criteria related to readability , such as word count and font size , were excluded as they were outside the objective of this study .
yes meaning the information was provided and no meaning no such information was provided .
the data were extracted by the author twice at different times to minimize the chances of missing any information .
all statistical analysis was performed using spss ( v 15.00 ; ibm corporation , armonk , ny ) .
all pis use uncoated paper , but in all pis the paper used was not sufficiently thick to reduce transparency .
all analyzed pis used a white background with text in black ( n = 51 , [ 85% ] ) , blue ( n = 7 , [ 12% ] ) , or red ( n = 2 , [ 3% ] ) .
the mean length of the pages on which the pis was printed was 26.6 cm ( standard deviation [ sd ] 14.7 ) , while the average width of pages was 20 cm ( sd 10.9 ) .
ml , or kg were used in 21 ( 35% ) pis .
the date of last update in 26 ( 65% ) pis was between 2005 and 2009 .
( n = 6 ; two for health care professionals , four for patients ) . however , the text targeted particular patients in another seven ( 11% ) pis , evident from the use words such as your medication ,
all the pis included the manufacturer s name ; however , four pis ( 7% ) did not include the manufacturer s address .
all pis contained information on name , active ingredients , therapeutic indications , and pharmaceutical forms .
thirty - two ( 53% ) pis were for more than one strength and/or different pharmaceutical forms . although all pis provided dosage instructions , precautions and adverse effects information , many lacked important information ( table 1 ) .
the route of administration was not explicitly indicated , such as oral route or swallow the tablet , in 24 ( 40% ) analyzed pis ( 15 otc , nine prescription ) .
dosage instructions were given as number of tablets or capsules , as volume , drops , or amount of the drug instead of in milligrams of active substance in 32 ( 52% ) pis .
thirty pis were for tablets or capsules and 16 pis were for more than one pharmaceutical form , including tablets or capsules .
the amount of solution to use with tablets or capsules was given in seven of the analyzed tablet or capsule pis .
recommendations that tablets and capsules should be taken in an upright position were not provided in any of analyzed pis .
guidance on duration of use , such as treatment should not be continued for more than four weeks without medical advice was available in 30 ( 50% ) pis .
statements on possible influence of the medication on reaction time , such as this effect may appear after 57 days , were missing in 54 ( 90% ) pis .
forty - four pis ( 73% ) did not provide information on suitable measures in case of adverse reactions even general measures such as contact your doctor or pharmacist .
there was no statistically significant difference between otc and prescription - only drug pis for most of the criteria ( table 1 ) .
information on use during pregnancy and nursing was available in 58 ( 97% ) and 52 ( 87% ) analyzed pis , respectively ( figure 1 ) .
twenty - two ( 38% ) pis included information from animal studies on the safety or potential teratogencity .
instructions on possible use in children and the elderly could only be found in 44 ( 73% ) and 18 ( 30% ) pis , respectively ( figure 1 ) . of these pis ,
only 22 ( 50% ) provided information on children by age and five ( 28% ) pis defined the age of the elderly .
all pis use uncoated paper , but in all pis the paper used was not sufficiently thick to reduce transparency .
all analyzed pis used a white background with text in black ( n = 51 , [ 85% ] ) , blue ( n = 7 , [ 12% ] ) , or red ( n = 2 , [ 3% ] ) .
the mean length of the pages on which the pis was printed was 26.6 cm ( standard deviation [ sd ] 14.7 ) , while the average width of pages was 20 cm ( sd 10.9 ) .
ml , or kg were used in 21 ( 35% ) pis .
the date of last update in 26 ( 65% ) pis was between 2005 and 2009 .
( n = 6 ; two for health care professionals , four for patients ) . however , the text targeted particular patients in another seven ( 11% ) pis , evident from the use words such as your medication ,
all the pis included the manufacturer s name ; however , four pis ( 7% ) did not include the manufacturer s address .
all pis contained information on name , active ingredients , therapeutic indications , and pharmaceutical forms .
thirty - two ( 53% ) pis were for more than one strength and/or different pharmaceutical forms .
although all pis provided dosage instructions , precautions and adverse effects information , many lacked important information ( table 1 ) .
the route of administration was not explicitly indicated , such as oral route or swallow the tablet , in 24 ( 40% ) analyzed pis ( 15 otc , nine prescription ) .
dosage instructions were given as number of tablets or capsules , as volume , drops , or amount of the drug instead of in milligrams of active substance in 32 ( 52% ) pis .
thirty pis were for tablets or capsules and 16 pis were for more than one pharmaceutical form , including tablets or capsules .
the amount of solution to use with tablets or capsules was given in seven of the analyzed tablet or capsule pis .
recommendations that tablets and capsules should be taken in an upright position were not provided in any of analyzed pis .
guidance on duration of use , such as treatment should not be continued for more than four weeks without medical advice was available in 30 ( 50% ) pis .
statements on possible influence of the medication on reaction time , such as this effect may appear after 57 days , were missing in 54 ( 90% ) pis .
forty - four pis ( 73% ) did not provide information on suitable measures in case of adverse reactions even general measures such as contact your doctor or pharmacist .
there was no statistically significant difference between otc and prescription - only drug pis for most of the criteria ( table 1 ) .
information on use during pregnancy and nursing was available in 58 ( 97% ) and 52 ( 87% ) analyzed pis , respectively ( figure 1 ) .
twenty - two ( 38% ) pis included information from animal studies on the safety or potential teratogencity .
instructions on possible use in children and the elderly could only be found in 44 ( 73% ) and 18 ( 30% ) pis , respectively ( figure 1 ) . of these pis ,
only 22 ( 50% ) provided information on children by age and five ( 28% ) pis defined the age of the elderly .
in this study , saudi pis were analyzed to assess if they contained information the patient could understand and follow to their best possible benefit . as table 1 makes clear , pis had many deficiencies .
medication errors and adverse events in the outpatient setting have been linked to patients unintentional misuse of prescribed or otc medicines due to improper understanding of pi instructions , particularly in patients with limited literacy skills and those managing multiple medication regimens.11,12 evidence suggests that patients are more likely to make an error if dosage instructions were given in milligrams of active substance instead of number of tablets.1113 patients are better able to interpret more explicit instructions , for example , every 12 hours , compared with the more implicit
twice daily.11,12 also , their ability to determine the correct dose is reduced if presented with instructions such as take 24 tablets.13 yet , approximately half of analyzed pis presented dosage instructions this way .
evidence also suggests that when taking orally administered tablets , people should drink a minimum of 60 ml of liquid and position the upper body at a minimum angle of 45 to achieve a high passage rate of tablets or capsules.21 such instructions were missing in many of the analyzed pis . of concern also
very few pis presented the likelihood of adverse effects using the recommended approach of verbal descriptions alongside natural frequencies , for example , very common ( more than 1 in 10 patients ) . the use of verbal expressions alone or percentages are misunderstood and can lead to overestimation of the risk by the user,14,15 which may deter patients from taking their medication.22 only 28% of analyzed pis presented side effects grouped in terms of frequency and severity , which is more comprehensible for patients than organ systems.16 patients are entitled to better information with their medication to enable them to make informed decisions as to whether to take the drug and to prepare them for what they might experience in response to a drug.1 however , analyzed pis were often unclear about patient actions , such as what they should do if they miss a dose , what measures should be taken if serious side effects occur , and when to consult a doctor .
the problems identified in this study largely conform to those noted by others who examined patient information leaflets.2,15,20,2327 an international research group compared five patient information leaflets from the uk with five from australia and four from the usa.2 leaflets from australia showed the best quality , closely followed by those of the uk .
the us leaflets were not only found lacking in provision of information about contraindications , precautions , and drug interactions , but also in readability and comprehensibility.2 an investigation of 68 german pis from frequently used medicines20 found that many inserts lacked key safety information , including information on daily maximum dose and adverse effects , and were difficult to comprehend .
carrigan et al15 assessed the leaflets supplied with the 50 most frequently prescribed drugs in england and found that 20 ( 40% ) of the 50 leaflets gave no indication of the likelihood of adverse effects occurring and only four leaflets ( 8% ) provided any form of numerical indication of risk .
analysis of pis accompanying marketed drug products in india ( n = 80 ) found only five of the inserts had information on the most frequent adverse drug reactions associated with the drug.24 also , information with regard to pediatric and geriatric use was present in only 44% and 13% of the pis , respectively .
other studies on pis for topical medications ( n = 15),25 geriatric medications ( n = 50),26 and antidepressants ( n = 42),27 similarly found pis lacking in adequate information about contraindications , precautions and drug interactions .
second , pi samples were not collected randomly , which raises the possibility of selection bias . as a result , it may be possible that randomly choosing the pis and increasing the sample size could lead to differences in the results found .
however , considering the diversity of pis examined with regards to indications , legal status , and manufacturers , other important findings are quite unlikely .
moreover , the number of pis examined is in the range of sample size of previous similar research .
third , there are no gold standard criteria for evaluating written patient drug information28 and criteria used in this study , although used in previous research , have advantages and disadvantages . despite these limitations
, this study represents the first attempt to evaluate pi adequacy as sources of information for patients in saudi arabia .
fortunately , from august 2011 , a patient information leaflet ( pil ) is now required to be submitted during the drug registration process.29 this does not mean , however , that the issues highlighted by this research will be fully resolved .
until the newly implemented pils are widely available , most saudi patients will receive no written information other than the pis analyzed in this study .
furthermore , legislation and guidelines in other countries have not guaranteed that pis are clear and easy to use .
the sfda guidelines state that pils should be written using patient understandable language , but provide no directions on what constitutes patient understandable language .
evidence suggests that specific content and format of prescription drug labels facilitate communication with and comprehension by patients.17,30 we recommend , therefore , that the sfda guideline demands the use of evidence - based best practices regarding how medication information should be written , designed , and delivered .
patient characteristics such as education and age have an effect on their understanding and usability of pis.11,12,16,31 thus , the sfda should also require that pils reflect the results of consultations with target patient groups , to understand fully the diverse needs of our patients .
the mode of pi delivery , whether it is computer generated as in the usa , a pi as in europe , or online via the sfda website , also requires careful consideration .
the findings of this study should stimulate further research into the effects of content and format of pis on readability , understanding , and medication use .
the current study did not assess actual patient understanding of medication instructions ; rather , it used criteria to measure comprehensibility and understandability .
research measuring actual patients abilities to understand and act upon instructions provided in pis is required .
this paper has focused on the availability of key information and its comprehensibility , with less emphasis on the readability of pis .
the effect of alternative pi design and layout on comprehension among patients across all age groups and literacy levels also needs to be investigated . as the nature of the relationship between deficits in pis and poor medication - taking behavior ( ie , adherence ) or unsafe use of medications has not been well tested,17 more studies evaluating the effects of pi content and format on adherence , medication error rates and health outcomes are needed .
the design of these studies needs to capture the true complexity of medication - taking behavior , where patients may be taking multiple medications and have numerous competing demands .
this study indicates that information relevant to the safe and appropriate use of medications was not uniformly provided in the pis analyzed . to avoid medication errors due to deficits in the current pis
, we recommend improvement in the existing pis based on best practice for information content and design . | purposethe aim of this study was to examine if package inserts ( pis ) supplied with prescribed and over - the - counter medications in saudi arabia contain information relevant for the safe and appropriate use of these medications.methodssixty pis for prescription - only medications ( n = 37 ) and over - the - counter medications ( n = 23 ) were evaluated against a set of safety criteria compiled from the literature.resultsanalyzed pis were defective in many aspects . particularly of concern were unclear dosage instructions , lack of measures to be taken when an administrative error was made , inappropriate presentation of side effects , and lack of measures to be taken if serious side effects occurred.conclusionthis study indicated that information relevant to the safe and appropriate use of medications was not uniformly mentioned in the pis analyzed . to avoid medication errors due to deficits in the current pis
, we recommend improvement in the existing pis based on best practice for information content and design . |
additional supporting information may be found in the online version of this article at the publisher 's web site . | this report describes that a regular positive electrospray ionization mass spectrometry ( ms ) analysis of terpendoles often causes unexpected oxygen additions to form [ m + h + o]+ and [ m + h + 2o]+ , which might be a troublesome in the characterization of new natural analogues .
the intensities of [ m + h + o]+ and [ m + h + 2o]+ among terpendoles were unpredictable and fluctuated largely .
simple electrochemical oxidation in electrospray ionization was insufficient to explain the phenomenon .
so we studied factors to form [ m + h + o]+ and [ m + h + 2o]+ using terpendole e and natural terpendoles together with some model indole alkaloids .
similar oxygen addition was observed for 1,2,3,4-tetrahydrocyclopent[b]indole , which is corresponding to the substructure of terpendole e. in tandem ms experiments , a major fragment ion at m / z 130 from protonated terpendole e was assigned to the substructure containing indole .
when the [ m + h + o]+ was selected as a precursor ion , the ion shifted to m / z 146 .
the same 16 da shift of fragments was also observed for 1,2,3,4-tetrahydrocyclopent[b]indole , indicating that the oxygen addition of terpendole e took place at the indole portion .
however , the oxygen addition was absent for some terpendoles , even whose structure resembles terpendole e. the breakdown curves characterized the tandem ms features of terpendoles . preferential dissociation into m / z 130 suggested the protonation tendency at the indole site .
terpendoles that are preferentially protonated at indole tend to form oxygen addition peaks , suggesting that the protonation feature contributes to the oxygen additions in some degrees .
2014 the authors .
journal of mass spectrometry published by john wiley & sons , ltd . |
staphylococcus aureus is one of the most common human pathogens that are responsible for a vast spectrum of acute and chronic community and hospital acquired infections ( 1 , 2 ) .
anterior nares are the main reservoir of s. aureus in children and adults ( 3 ) .
asymptomatic colonization is common and 20% of the healthy population have nasal cavity colonization with s. aureus that is a major risk factor for different infections ( 4 ) . during previous investigations in different communities ,
the prevalence of nasal carriage of s. aureus in healthy children has been reported as 26.6 - 52.3% ( 5 - 8 ) .
emergence of resistant s. aureus to current antibiotics and increased prevalence of methicillin resistant s. aureus ( mrsa ) are major obstacles for treatment of infections by this pathogen ( 9 ) . at first
mrsa was reported during the 1960s , while , currently it is prevalent in health - care centers . in the past ,
colonization and infections by mrsa were limited to hospitals , but since the 1990s they frequently have been reported in healthy young community members ( 10 - 13 ) .
skin and soft tissue infections and severe necrotizing pneumonias are well - known clinical syndromes of mrsa ( 14 ) .
identification of mrsa nasal carriers and use of control modalities has been recommended for prevention of community and hospital associated infections ( 15 , 16 ) . considering the substantial prevalence of antibiotic resistance , recognition of antibiotic susceptibility patterns
is imperative for decolonization and treatment of s. aureus infections . despite noticeable previous studies regarding the prevalence of nasal carriage of s. aureus and mrsa in healthy children ,
a few investigations have been carried out about their associated risk factors . in this survey ,
antibiotic susceptibility of isolated nasal s. aureus among healthy children and associated risk factors for nasal mrsa carriage were evaluated .
the goal of this investigation was to determine the prevalence , associated risk factors and antibiotic resistance patterns among healthy children who were nasal carriers of mrsa .
in this cross - sectional study , 350 one - month to 14-year - old healthy children were evaluated between july 2012 and march 2013 .
specimens were collected by cluster random sampling from four health - care centers in kashan , iran .
the children had referred to the centers for vaccination , growth monitoring or periodic examinations .
children who had acute or chronic respiratory infections , chronic medical disorders , those who needed admission or emergency care , and cases with skin infections were excluded from the study .
the questionnaire contained demographic characteristics and risk factors associated with s. aureus and mrsa nasal carriage such as age , sex , number of individuals in the family , parental smoking , sleeping with parents , antibiotic usage and hospitalization during the past three months .
the ethics committee of kashan university of medical sciences approved the study ( approval code 823 ) .
sample size was calculated by consideration of the 28.4% prevalence for s. aureus nasal isolation ( 7 ) , ( d = 0.07 , = 0.05 and design effect of 1.5 ) .
sampling was conducted by rotating a moistened sterile cotton swab with sterile saline in vestibule of both anterior nares twice .
the collected swabs were inserted in amies tube transport media with charcoal ( himedia , mumbai , india ) at a temperature between 2 - 4c and transported to the microbiology laboratory of kashan shahid beheshti hospital within four hours .
swabs were cultured on mannitol salt agar ( msa ) ( merk , germany ) at 35c for 48 hours .
yellowish colonies growing on msa were subcultured on blood agar ( merk , germany ) for 24 hours .
growing colonies were identified as s. aureus by morphology of colony , gram staining , and catalase , coagulase and dnase production in tube tests ( 17 , 18 ) .
screening test for antibiotic resistance was done on positive cultures by the kirby - bauer disc diffusion method according to the clinical and laboratory standard institute ( clsi ) ( 19 ) .
the incubated colonies on blood agar were transported by a sterile loop onto mueller - hinton agar ( merk , germany ) with the antibiotic containing discs ( mast , uk ) placed on top for 24 hours at 35c .
the discs included : cephalothin ( 30 g ) , co - trimoxazole ( 1.25/23.75 g ) , clindamycin ( 2 g ) , oxacillin ( 1 g ) , vancomycin ( 30 g ) and ciprofloxacin ( 5 g ) .
after an elapse of the mentioned time , the inhibition zones of isolates around the discs were measured and compared with standard guidelines .
if the following inhibition zones were observed the sample was considered resistant ; cephalothin 14 mm , co - trimoxazole 10 mm , clindamycin 14 mm , oxacillin 10 mm , vancomycin 14 mm and ciprofloxacin 15 mm ( 19 ) .
american type culture collection ( atcc ) 25923 s. aureus was used as the control isolate for antimicrobial susceptibility detection ( 19 ) .
minimal inhibitory concentration ( mic ) breakpoints of , cephalothin 32 g / ml , co - trimoxazole m8/152 g / ml , clindamycin 4 g / ml , ciprofloxacin 4 g / ml , oxacillin 4 g / ml and vancomycin 16 g / ml were considered resistant ( 19 ) .
e - test strips were applied to mueller - hinton agar plates , which were inoculated with a solution of strains with optical density of 0.5 mcfarland standard , using sterile loops .
the e - test mic was measured at the bottom of the inhibition zone intersected by the e - test strip .
after screening by the disc diffusion test , resistant strains were confirmed by the e - test .
however , the e - test was performed for all s. aureus positive cultures to evaluate oxacillin and vancomycin resistance .
demographic and associated risk factors for mrsa were analyzed by the chi - square and fisher 's exact tests , odds ratios and confidence intervals .
data distributions were evaluated using the kolmogorov - smirnov test . according to the abnormal distribution of age and number of individuals in the family , for their comparison with two independent groups
some variables were entered in to multivariate logistic regression if bivariate analysis resulted a p value of less than 0.1 .
all p values were two - sided and those less than 0.05 were considered significant .
in this cross - sectional study , 350 one - month to 14-year - old healthy children were evaluated between july 2012 and march 2013 .
specimens were collected by cluster random sampling from four health - care centers in kashan , iran .
the children had referred to the centers for vaccination , growth monitoring or periodic examinations .
children who had acute or chronic respiratory infections , chronic medical disorders , those who needed admission or emergency care , and cases with skin infections were excluded from the study .
the questionnaire contained demographic characteristics and risk factors associated with s. aureus and mrsa nasal carriage such as age , sex , number of individuals in the family , parental smoking , sleeping with parents , antibiotic usage and hospitalization during the past three months .
the ethics committee of kashan university of medical sciences approved the study ( approval code 823 ) .
sample size was calculated by consideration of the 28.4% prevalence for s. aureus nasal isolation ( 7 ) , ( d = 0.07 , = 0.05 and design effect of 1.5 ) .
sampling was conducted by rotating a moistened sterile cotton swab with sterile saline in vestibule of both anterior nares twice .
the collected swabs were inserted in amies tube transport media with charcoal ( himedia , mumbai , india ) at a temperature between 2 - 4c and transported to the microbiology laboratory of kashan shahid beheshti hospital within four hours .
swabs were cultured on mannitol salt agar ( msa ) ( merk , germany ) at 35c for 48 hours . yellowish colonies growing on msa were subcultured on blood agar ( merk , germany ) for 24 hours .
growing colonies were identified as s. aureus by morphology of colony , gram staining , and catalase , coagulase and dnase production in tube tests ( 17 , 18 ) .
screening test for antibiotic resistance was done on positive cultures by the kirby - bauer disc diffusion method according to the clinical and laboratory standard institute ( clsi ) ( 19 ) .
the incubated colonies on blood agar were transported by a sterile loop onto mueller - hinton agar ( merk , germany ) with the antibiotic containing discs ( mast , uk ) placed on top for 24 hours at 35c .
the discs included : cephalothin ( 30 g ) , co - trimoxazole ( 1.25/23.75 g ) , clindamycin ( 2 g ) , oxacillin ( 1 g ) , vancomycin ( 30 g ) and ciprofloxacin ( 5 g ) .
after an elapse of the mentioned time , the inhibition zones of isolates around the discs were measured and compared with standard guidelines .
if the following inhibition zones were observed the sample was considered resistant ; cephalothin 14 mm , co - trimoxazole 10 mm , clindamycin 14 mm , oxacillin 10 mm , vancomycin 14 mm and ciprofloxacin 15 mm ( 19 ) .
american type culture collection ( atcc ) 25923 s. aureus was used as the control isolate for antimicrobial susceptibility detection ( 19 ) .
minimal inhibitory concentration ( mic ) breakpoints of , cephalothin 32 g / ml , co - trimoxazole m8/152 g / ml , clindamycin 4 g / ml , ciprofloxacin 4 g / ml , oxacillin 4 g / ml and vancomycin 16 g / ml were considered resistant ( 19 ) .
e - test strips were applied to mueller - hinton agar plates , which were inoculated with a solution of strains with optical density of 0.5 mcfarland standard , using sterile loops .
the e - test mic was measured at the bottom of the inhibition zone intersected by the e - test strip . after screening by the disc diffusion test
however , the e - test was performed for all s. aureus positive cultures to evaluate oxacillin and vancomycin resistance .
data analysis was conducted by the spss statistical software , version 16 . for descriptive results ,
demographic and associated risk factors for mrsa were analyzed by the chi - square and fisher 's exact tests , odds ratios and confidence intervals .
data distributions were evaluated using the kolmogorov - smirnov test . according to the abnormal distribution of age and number of individuals in the family , for their comparison with two independent groups
some variables were entered in to multivariate logistic regression if bivariate analysis resulted a p value of less than 0.1 .
all p values were two - sided and those less than 0.05 were considered significant .
overall , 350 children with mean age of 7.06 4.25 years and age range of one month to 14 years were evaluated .
mean age was 7.29 4.08 and 6.84 4.42 years among females and males , respectively with no significant difference ( p value 0.3 ) .
frequency of 4 , 5 - 9 and 10- 14 year - old groups was 114 ( 32.6% ) , 119 ( 34% ) and 117 ( 33.4% ) , respectively . among all cases ,
92 ( 26.3% ) had positive nasal cultures for s. aureus , from which 30 ( 32.6% ) cases were female and 62 ( 67.4% ) male , with this difference being significant ( p value < 0.001 ) .
mean age of positive and negative cultures was 6.65 4.46 and 7.21 4.14 years , respectively ( p value 0.22 ) .
risk factors associated with nasal s. aureus colonization are shown in table 1 . from the positive cultures ,
26.1% were sensitive to all antibiotics , 22.8% were resistant to one , 21.7% to two , 16.3% to three , 5.4% to four , 4.3% to five and 3.3% to six antibiotics .
the most resistance rate was towards cephalothin ( 52.2% ) and the least resistance rate was towards vancomycin ( 4.3% ) .
male gender increased the odds ratio of mrsa carriage fourteen times ( p value 0.001 ) .
the mean age of mrsa and methicillin sensitive s. aureus ( mssa ) carriers did n't differ significantly ( p value 0.116 ) yet the age group of 4 years was associated with mrsa colonization ( p value 0.016 ) .
there was a significant association between antibiotic use and admission during the recent three months ( p value < 0.001 ) , number of individuals in the family ( p value < 0.001 ) , sleeping with parents ( p value 0.019 ) and parental smoking ( p value < 0.001 ) with mrsa nasal colonization .
mssa , methicillin - sensitive staphylococcus aureus , mrsa , methicillin - resistant staphylococcus aures , or , odds ratio , ci , confidence interval .
according to this study , prevalence of nasal colonization with s. aureus among one - month to fourteen - year - old children was 26.3% . in a survey by tabbarai et al .
( 19 ) on 1193 school - aged children , prevalence of nasal carriage was 16.3% , out of which 34.8% were mrsa , while peak age of nasal carriage was 6 - 12 years old and vancomycin resistance rate was 1.7% .
( 7 ) in turkey worked on four to six - year - old children and reported 28.4% for the prevalence of nasal colonization which was consistent with our investigation . in taiwan ,
prevalence of nasal colonization among two to 60-month - old children was 23.2% of which mrsa was present in 7.8% of cases and peak age of mrsa was two to six months old .
furthermore , day care attendance and family size were risk factors for mrsa nasal carriage ( 20 ) . in our study ,
mrsa carriage was more than that of the taiwanese report but risk factors were comparable .
other studies have reported the prevalence of nasal s. aureus colonization as 32.1% in south korea , 40% in tanzania and 18.1% in usa ( 5 , 6 , 21 ) , which were inconsistent with our study .
the different in prevalence of nasal carriage between our study and others may be due to the various age groups studied .
for example , two different surveys carried our during 2009 and 2010 in india , reported that nasal carriage among 5 - 15 and 1 - 5 year - old children was 52.3% and 6.3% , respectively ( 8 , 17 ) .
furthermore , other characteristics such as socioeconomic status were not determined in these studies . in the present study ,
mrsa prevalence among positive nasal cultures was 35.9% , which was compatible with the study by tabbarai et al .
mrsa prevalence among healthy s. aureus nasal carriers varied from 0.3% ( 7 ) to 18.9% ( 6 ) that was significantly lower than our survey . furthermore , even in societies with prevalence of 40% and 52.3% for nasal colonization , mrsa prevalence has been reported as 10.5% and 3.89% , respectively ( 5 , 8) . in the present study ,
the highest susceptibility of mrsa was towards vancomycin and the least sensitivity was towards cephalothin .
huang et al . ( 20 ) detected no mrsa resistance to vancomycin and teicoplanin while 99.1% resistance to penicillin and 9% sensitivity to clindamycin ( 54.5% in our study ) was reported .
concordant results have been reported by some researches ( 6 , 17 ) yet mrsa clindamycin susceptibility in the investigation of ko et al .
( 6 ) was 61.1% which was more than our study and other mentioned reports .
in this study , prevalence of vancomycin sensitive mrsa was 87.9% , while in other studies this was reported as 100% ( 6 , 17 , 20 ) .
comparison of the present research with previous studies indicates more judicious antibiotic prescription is needed for children .
although the vast majority of children with community acquired mrsa nasal colonization are self - limited during a one - year period ( 22 ) , some of them are at risk of recurrent skin and soft tissue infections thus decolonization of these cases is recommended ( 23 - 25 ) . furthermore , with regards to the high prevalence of nasal carriage of mrsa in our investigation , decolonization of healthy preschool children is prudent .
this study revealed that male gender , antibiotic use and hospitalization during the past three months , number of individuals in the family being more that four , age group of less than four years , parental smoking and sleeping with parent were associated risk factors for mrsa nasal carriage among healthy children .
a few researches have been conducted regarding the risk factors of mrsa nasal carriage among healthy children .
fritz et al . ( 22 , 23 ) identified some risk factors for nasal carriage of mrsa in healthy children that included outpatient visit in the past six months , surgery during the previous one year , history of immune deficiency and systemic infections , more than two people per bedroom ( crowded home ) , a household member working at a health care center , a household member aged 19 to 27 years old or more than 60 years old and daycare attendance .
furthermore , the relationship with close contacts such as sharing a bath towel with mrsa nasal carriage was ruled out ( 26 ) which appeared incompatible with our findings ( close contact via sleeping with parents was associated with mrsa nasal colonization ) .
some studies have claimed that the household member who works at a hospital is the only risk factor for nasal mrsa carriage ( 27 , 28 ) .
( 17 ) concluded that a large family size was associated with s. aureus nasal carriage but recent hospitalization was not .
oppositely , we found that large family size and recent admission were risk factors of carriage .
our study has some limitations , firstly , it was cross - sectional and did n't differentiate persistent from transient nasal colonization , thus obtaining another nasal culture after one year ( cohort design ) is recommended to detect persistent carriage over time , which is a major source of community infections .
secondly , it is possible that the isolated strains are not representative of the community and investigations with larger sample sizes are needed in the future .
thirdly , the family socioeconomic status was not evaluated in our research and it would be better to consider this in future studies .
fourthly , we did not confirm mrsa by meca genes and also did n't find a vancomycin - resistant s. aureus ( vrsa ) gene , thus more investigations in this field are imperative .
lastly , the impact of seasonal changes on s. aureus nasal colonization was not evaluated in our study , thus further studies are recommended . in conclusion , in the present study the prevalence of nasal s. aureus colonization was 26.3% out of which 35.9% were mrsa .
furthermore , male sex , antibiotic use and admission in the past three months , crowded family , parental smoking and sleeping with parents were factors associated with mrsa nasal carriage . | background : nasal colonization of healthy children with staphylococcus aureus is an important risk factor for different infections . detection of colonized individuals with methicillin resistant s. aureus ( mrsa ) and its eradication is the proper prevention strategy for infection spread in the community and health - care centers.objectives:the aim of this study was to determine the prevalence , associated risk factors and antibiotic resistance pattern among healthy children who were nasal carriers of s. aureus.patients and methods : this cross - sectional study was conducted on 350 one month to 14-year - old healthy children living in kashan / iran .
the nasal specimens were cultured in blood agar medium for s. aureus .
positive cultures were evaluated for cephalothin , co - trimoxazole , clindamycin , ciprofloxacin , oxacillin and vancomycin susceptibility by the disc diffusion method and e - test .
risk factors for nasal carriage of s. aureus and mrsa were evaluated.results:frequency of s. aureus nasal carriage was 92 from 350 cases ( 26.2% ) , amongst which 33 ( 35.9% ) were mrsa . isolates indicated an overall resistance of 52.2% to cephalothin , 33.7% to co - trimoxazol , 26.1% to ciprofloxacin , 26.1% to clindamycin , 35.9% to oxacillin and 4.3% to vancomycin .
factors associated with mrsa nasal carriage included gender ( p value 0.001 ) , age of less than four years ( p value 0.016 ) , number of individuals in the family ( p value < 0.001 ) , antibiotic use ( p value < 0.001 ) and admission ( p value < 0.001 ) during the previous three months , parental smoking ( p value < 0.001 ) and sleeping with parents ( p value 0.022).conclusions : age of less than four years , male sex , family size being more than four , antibiotic use and admission during the previous three months , parental smoking and sleeping with parents were independent risk factors for nasal colonization with mrsa . |
posterior reversible encephalopathy syndrome ( pres ) , first described by hinchey et al . in 1996 , is a clinical condition presenting with neurological symptoms including headache , seizures , altered sensorium , and loss of vision , and accompanied by characteristic magnetic resonance imaging ( mri ) findings which are potentially reversible . over the years , this condition has been described by various names including reversible posterior leukoencephalopathy , reversible posterior cerebral oedema , reversible occipitoparietal encephalopathy , and hypertensive encephalopathy .
the disease has been more commonly described in adult population , especially in the setting of eclampsia and organ transplantation
. postulated underlying causes include sudden rise in blood pressure , immunosuppression , chemotherapeutic agents for lymphoma and leukemia , severe hypercalcemia , thrombocytopenic syndromes , henoch schnlein purpura , vasculitis , and renal failure , of which sudden rise in blood pressure and renal failure appear to be the most common . at neuroimaging
, vasogenic oedema is seen involving the white matter of bilateral cerebral hemispheres posteriorly , most commonly parietal and occipital lobes .
the prevalence of pres among children is not well established ; however , there have been reports of pres in children following chemotherapy and tumor lysis syndrome , as well as with hypertension .
an 11-year - old boy , a known case of chronic kidney disease ( stage v ) on maintenance hemodialysis , presented with one episode of generalized tonic
there was history of high - grade fever ( upto 103f ) for 34 days . on examination
, he was found to be drowsy ; however , he was moving all four limbs .
laboratory tests revealed a serum creatinine of 4.8 mg% and blood urea of 121 mg% .
serum calcium , sodium , and potassium were 7.8 mg% , 135 meq / l , and 5.3 meq / l , respectively .
mri brain at admission showed t2w / t2 flair hyperintensities , s / o oedema , involving the subcortical white matter of bilateral frontal , parietal , and occipital lobes , with few areas of cortical involvement [ figure 1 ] .
similar lesions were also noted involving bilateral basal ganglia , left thalamus , splenium of corpus callosum , as well as brainstem [ figure 2 ] .
diffusion - weighted imaging ( dwi ) showed increased signal intensity in the lesions in bilateral occipital lobes and in the splenium of corpus callosum .
mri axial t2 flair section showing symmetrical hyperintense lesions involving subcortical and cortical locations of the bilateral frontal and parietal lobes mri axial t2 flair section showing similar lesions involving the basal ganglia and the splenium of corpus callosum the patient was started on antiepileptics , antihypertensives , and antibiotics , with daily hemodialysis .
he had four more episodes of seizures during his hospital stay ; however , he slowly improved clinically and was discharged on antiepileptics and antihypertensives on biweekly hemodialysis .
follow - up mri brain was done after 2 weeks , which showed near - total resolution of the brain lesions [ figure 3 ] .
repeat mri axial t2 flair sections after 2 weeks show almost complete resolution of the lesions in the brain
although significant elevation of the blood pressure may not always be demonstrated , pres is considered to be a variant of hypertensive encephalopathy with sudden rise in blood pressure being the most commonly associated feature although other causative factors have also been implicated .
two theories are considered in the pathophysiology of pres , the first being sudden increase in blood pressure causing vasospasm and the other being failure of autoregulatory mechanism . with sudden elevation in systolic blood pressure ,
the autoregulatory capacity of brain vasculature is exceeded which results in a region of vasodilatation and vasoconstriction , especially in the arterial boundary zone .
the preferential involvement of the posterior circulation has been postulated as being due to the sympathetic innervation protecting the brain from sudden increase in blood pressure being relatively less in the arterioles supplied by the vertebrobasilar system than in the anterior circulation . in the setting of end - stage renal disease ( esrd ) , as in our patient , both the rise in pressure beyond the ability of autoregulation of cerebral flow as well as the uremia by itself
the first was the holohemispheric watershed pattern with a linear involvement of the frontal , parietal , and occipital lobes predominantly , along a watershed distribution .
the second was the superior frontal sulcus pattern with predominant involvement of the frontal lobes , and the third was the dominant parietal
other than these patterns , asymmetrical and/or partial manifestations of the primary patterns were also described . in our patient , the pattern seen could be best described as holohemispheric watershed pattern .
atypical sites of involvement that have been described include brain stem , cerebellum , basal ganglia , thalami , internal capsule , and splenium of corpus callosum , with uremic encephalopathy sometimes described as having a propensity for central distribution . in our patient
, lesions were noted in the brainstem , bilateral basal ganglia , left thalamus , and the splenium of corpus callosum .
dwi and apparent diffusion coefficient ( adc ) have been found to be helpful in differentiating atypical presentations of pres from conditions like central pontine / extrapontine myelinolysis , non - hemorrhagic infarcts , and hypoglycemic or hypoxic encephalopathy . due to vasogenic oedema in pres
, adc shows increased values with slightly increased signal intensity on dwi , whereas the other conditions show reduced adc values due to cytotoxic edema .
our patient demonstrated increased intensity on dwi with increased adc values in the splenium and occipital lobes .
the symptoms and lesions of pres may resolve completely if the diagnosis and treatment is prompt , as was seen in our patient ; however , failure to diagnose may lead to irreversible infarction and death .
recurrence of pres is rare and may be associated with infections and rapid rise in blood pressure .
the diagnosis may be overlooked , especially in children , unless a high index of suspicion and precise clinical history is maintained .
we maintain that pres should be kept as a possibility in children presenting with encephalopathy and seizures in the setting of raised blood pressure or renal disease as delay in diagnosis and treatment may result in permanent neurological deficit . | posterior reversible encephalopathy syndrome presents with neurological and imaging features that are reversible , if prompt diagnosis and treatment is undertaken .
however , the disease has been more commonly described in adult population , especially in eclampsia . in the background of predisposing factors like renal disease or chemotherapy ,
the pediatric population is also at equal risk for this condition , as we would like to present through this case and also demonstrate the potential for complete reversal of symptoms and imaging findings if diagnosed without delay . |
the morphology of the human face varies with individuals and even more with races and ethnic group.1 the identification of aesthetic facial qualities began with ancient civilizations such as egyptians and greeks , who captured their ideals of facial beauty in artform.2 some of the classical greek canons of facial proportions , with modifications , are still embraced today as the basic foundation of aesthetic facial analysis .
variations in facial parameters ( facial anthropometry ) have been studied extensively for different ethnic groups and races .
for instance , oyinbo et al.,3 carried out normal outer and inner central measurements for the ijaws of southern nigeria and compared the result with that obtained for igbos of south eastern nigerian .
they found out that there were significant differences between the two ethnic groups at p<0.05 .
these observed variations may be favourable or unfavourable , depending on the individual 's aesthetic preferences , as well as that of the society in which he lives . in a society focused on youth and beauty ,
individuals with less visible disfigurements have higher self - esteem4 and can more effectively socialize with peers and members of the opposite sex.5 perhaps this has also informed the increased attention given to aesthetic facial analysis . besides the use of direct measurements for the determination of facial proportions , photometry , which rather involves the use of photographs , has also been employed as seen in the case of powell and humphries,6 who introduced the use of the aesthetic facial triangle .
extensive literature in this area is already available for north americans and europeans.6 similar studies have also been published for asians , especially in recent times . in our environment
one hundred and twenty subjects aged between 18 and 28 years participated in this study . included in the study were subjects whose parents and grandparents were all of igbo ethnic origin .
photographs of the front and lateral views of the subjects were taken from a distance of 1.0 - 1.5 m with 28 focus free manual camera ( prestige 280s ) .
each subject was asked to relax against a plain white background , with both hands hanging beside the trunk .
the subjects position was clearly marked on the floor , and a meter rule placed by the subject to enable measurement at life size 150 cm in front of the subject .
the subjects were asked to look straight into the camera with their lips relaxed so that both the front and side view profiles were taken in the natural head position .
clear view of the forehead , neck , and ear were ensured with the lips relaxed .
the photographs obtained were colour printed , and their facial areas were traced out using tracing paper . on the trace outs of the frontal views , the following soft - tissue points ( land marks ) were introduced as shown in figure 1 ; the nasion ( n ) , subnasale ( sn ) and menton ( mn ) . using the same trace - outs ,
landmarks on the frontal facial view n : the deepest point on the bridge of the nose overlying the centre of the suture between the nasal and frontal bones .
subnasale : the point at which the base of the nose merges with the nasal cutaneous tip .
menton : the lowest point of the soft - tissue skin in the sagittal plane overlying the bony menton .
the vertical distances shown in figure 1 , include a vertical line drawn from nto menton , and it is divided into two parts : nasion to subnasale ( n - sn)/middle face .
using the trace - outs of the right lateral views , the following landmarks and angles were noted and measured respectively .
below are the landmarks : glabella ( g ) : the smooth rounded surface of the frontal bone in the middle of the forehead , between the two eyebrows [ figure 2 ] . pogonion ( p ) : the most prominent point on the soft - tissue chin in the mid sagittal plane overlying the bony progonion [ figure 2 ] .
cervical ( c ) : the point where the neck meets with the soft tissue .
the angles : nasofrontal angle ( nfa ) : angle formed at the point where a line drawn tangent to the glabella through the nintersects with a line drawn tangent to the nasal dorsum [ figure 3 ] .
nasomental angle ( nma ) : angle formed at the point of intersection of the line drawn through the nasal dorsum and that drawn from the nasal tip to the pogonion [ figure 4 ] .
mentocervical angle ( mca ) : angle formed at the meeting point of a vertical line drawn from the glabella to the pogonion and that drawn fromthe cervical through the soft - tissue menton .
landmarks on the right lateral view computation and analysis of data from the measurements were done by microsoft excel 2007 , version 10 using some simplified mathematical relations to show the measures of dispersion .
computation and analysis of data from the measurements were done by microsoft excel 2007 , version 10 using some simplified mathematical relations to show the measures of dispersion .
the study was carried out on 120 subjects comprising adult males aged between 18 and 28 years .
table 1 shows the results of the vertical distance ( n - sn ) and ( sn - mn ) of the igbo nigerian adult male in millimeters ( mm ) .
analysis of the frontal view photographs showed that the distance from n - sn varied from 10 mm to 17 mm with a mean value of 13.2 mm while that from subnasale to menton varied from 14 mm to 22 mm with a mean value of 18.4 mm .
the results of the vertical distance , nasion to subnasale and subnasale to menton of the igbo nigerian adult male in millimeters table 2 shows vertical distance ( n - sn ) and ( sn - mn ) of the igbo nigerian adult male in percentage ratio ( % ) .
percentage ratio of these distance ( lengths ) n - sn and subnasale to menton ( sn - mn ) to n - mn varied from 37.9% to 48.3% with a mean value of 41.8% for n - sn and 51.7% to 62.1% with a mean value of 58.2% .
vertical distancenasion to subnasale and subnasale to menton of the igbo nigerian adult male in percentage ratio ( % ) table 3 shows the values of the angles of aesthetic triangle i.e. , nasofrontal ( nf ) nasofacial ( nfc ) [ figure 5 ] , nasomental ( nm ) and mentocervical ( mc ) angles of the igbo nigerian male in degrees ( ) .
angles of aesthetic triangle , i.e. , nasofrontal , nasofacial , nasomental and mentocervical angles of the igbo nigerian male in degrees ( % ) analysis of the right lateral view photograph of the subjects showed variations in the angles of aesthetic triangle , which include ; nf , nfc , nm and mentocervical ( mc ) angles [ figure 6 ] .
nfa was observed to be the largest angle with a mean value of 134 and the values ranging from 118 to 150. this is followed by the nma with a mean value of 126 and the values ranging from 115 to 140. next to nma is the mca whose values range from 90 to 110 and has a mean value of 99. the smallest angle is the nfc with a mean value of 39 ranging from 28 to 50% .
table 4 shows the comparison of mean values of vertical distances between adult nigerians and himanchali adults and north american adult males .
the n - sn shows lower values for adult nigerian males while the sn - mn is higher in adult nigerian males than for the other two races .
comparison of mean values of vertical distance of the igbo nigerianadult male and those of the himachali indian and north american adult males in percentage ratio ( % ) table 5 shows the comparison of mean values of angles of aesthetic triangle of the igbo nigerian adult male and those of the himachali indian , north american , urhobo nigerian and itsekiri nigerian adult males the results reveal that the himachali indian has the highest nf and mcas with respective values as 134 and 100 , urhobo
nigerian has the highest nfc angle at 40 , while the itsekiri nigerian has the highest nma at 129. comparison of mean values of angles of aesthetic triangle of the igbo nigerian adult male and those of the himachali indian , north american , urhobo nigerian and itsekiri nigerian adult males
photometric facial analysis has been documented by various authors.69 photometric analysis offers some advantages in terms of human profile analysis .
in contrast to cephalometric analysis , angular measurements are not affected by photographic reduction.10 the use of photometric analysis makes the employment of expensive and sophisticated instruments unnecessary .
leonardo da vinci divided the face into thirds namely ; from the frontal hair line to the root of the nose ; from the nasal root to nasal base ; and from the nasal base to the bottom of the chin , menton , but only the lower two - thirds were considered in this study , because the frontal hair line , which is a landmark for the first - third was absent in some of the subjects and this is consistent with the finding and method of powell and humphries ( 1984).6 in this study , it was discovered that the middle face ( n - sn ) was shorter than the lower face ( sn - mn ) i.e. , 41.76% vs. 59.95% , which is similar to the report by jain et al . , 2004 and powell and humphries , 1984 on the himachali indians and north americans respectively.67 our studied population , however ,
anibor and okumagba9 in their study stated that the aesthetic angles of the igbos are different from those of the urhobos , itsekiris , himachalians and north americans .
the present study shows that the nfc angle of igbo males were similar to that of the urhobos and itsekiri and different from those of the himachali indians and north americans [ table 5 ] .
the nfa was also similar to those of himachali , indians , urhobos and itsekiri but were strikingly different from those of north americans .
thus , the population under study was found to have a less prominent glabella than the north americans .
jain et al.,7 stated that the nfc angle shows the degree of nose projection from the skin of the face in an individual .
since the nfc angle of the igbo nigerian adult male is 38.68 [ table 6 ] , it shows that he has a projected nose bigger than that of the himachali and north american , but smaller compared to those of the urhobo and itsekiri of nigeria .
the nma from the present study was found to be the least among the different populations [ table 5 ] .
this study has , therefore , shown that aesthetic angles using photometric analysis may be used as a means of racial and ethnic identification .
comparison of values of the angles of aesthetic triangle of the igbo nigerian male and those of the himachali indian and north american males in degrees ( % )
the results of this photographic documentation as used here is the most convenient and helpful method for facial analysis
. it will be particularly useful in plastic surgery to compare the pre - and post - operative results , orthodontic , anatomical modeling and for identification purposes . | background : a carefully performed facial analysis can serve as a strong foundation for successful facial reconstructive and plastic surgeries , rhinoplasty or orthodontics.aim:the purpose of this study is to determine the facial features and qualities of the igbo nigerian adult male using photometry.materials and methods : one hundred and twenty subjects aged between 18 and 28 years were studied at the anambra state university , uli , nigeria .
the frontal and right lateral view photographs of their faces were taken and traced out on tracing papers . on these , two vertical distances , nasion to subnasal and subnasale to menton , and four angles , nasofrontal ( nf )
, nasofacial , nasomental ( nm ) and mentocervical , were measured.results:the result showed that the igbo nigerian adult male had a middle face that was shorter than the lower one ( 41.76% vs.58.24% ) , a moderate glabella ( nf=133.97 ) , a projected nose ( nm=38.68 ) and a less prominent chin ( nm=125.87).conclusion : this study is very important in medical practice as it can be used to compare the pre- and post - operative results of plastic surgery and other related surgeries of the face . |
sternal bone marrow biopsy belongs to invasive diagnostic methods for differential diagnosis of whole spectrum of hematological diseases . as an invasive procedure ,
local complications ( bleeding and infection from puncture site ) are considered as minor ones .
major ones are due to improper technique or instrument usage and are as follows : manubrio - sternal dehiscence , sternal fracture , pneumopericardium , pneumotorax and biopsy needle breakage .
life threatening complications are because of pericardial tamponade caused by ascending aorta or right ventricle injury .
an 80-year - old man was brought to the regional hospital because of unclear abdominal pain , diarrhea and concomitant dehydration .
later , on the basis of laboratory examination of anemia ( ery 3.7710l , hb 112 g / l , hct 0.35 ) and thrombocytopenia ( 7210l ) , sternal bone marrow aspiration biopsy was performed .
approximately 45 minutes after the procedure the patient was complaining about general weakness and backache .
because of slowly ongoing hemodynamic stability deterioration , the patient was transported to cardiac surgical facility .
transoesophageal echocardiography confirmed pericardial tamponade with right atrium and ventricle compression and dyskinesis ( figure 1a ) .
immediate surgery was indicated . before surgical field draping off , puncture site on sternum was clearly visible ( figure 1b ) .
when pericardial sac was opened , approximately 300 ml of blood were evacuated and hemodynamic stability was immediately achieved .
this location was sutured with pericardial pledgets . during postoperative course rehydration and short - time full parenteral nutrition was necessary .
overall state of health gradually improved and the patient was transferred back to regional hospital on 7 post - operative day for further rehabilitation .
aspiration may be done at several sites , but sternum is supposed to be the easiest site from which to obtain the most cellular marrow .
heart injury with pericardial tamponade due to sternal puncture bone marrow biopsy has been rarely subscribed in literature . in 2003 issue of british journal of haematology ,
overall complications were found in 26 cases , bleeding in 14 . no case of heart or aortic injury was observed .
they have studied 34 sternal aspiration death - complication cases published and have identified performing physician lack of experience and wrong location of puncture site as a cause of trouble .
german authors have published five cases of periprocedural right ventricle injury where one patient only was saved by emergent surgery .
sternal biopsy peri - procedural death was studied by american authors also . as a main cause of injury
these studies are 10 - 30 years old and probable reason for late diagnosis of pericardial tamponade was lack of bedside echocardiography examination .
midline sternotomy and direct suture of injury site is a principle of successful surgical treatment .
according to aforementioned studies , case reports and our clinical practice , several essential suggestions for sternal bone marrow biopsy arise : i ) proper indication , clinical benefit must always outweigh potential risks ; ii ) experience of performing physician ; iii ) proper biopsy needle and its length ; iv ) site of puncture , medial part of sternal manubrium at the level of first intercostal space ( should never be performed lower ) ; v ) follow up of the patient and timely echocardiography examination in case of any clinical status uncertainty ; vi ) in case of hemopericardium , fast cardiac surgery is indicated . | injury of the heart with concomitant pericardial tamponade as a result of sternal bone marrow biopsy is rare .
an 80-year - old man was admitted with dehydration and non - specified abdominal pain to the regional hospital .
sternal aspiration biopsy was performed because of anemia and thrombocytopenia .
later on , because of the back pain , general weakness and blood pressure drop , an echocardiography examination was indicated .
pericardial fluid collection was found .
anticipated ascending aortic dissection was excluded on computed tomography scan , but pericardial fluid collection was confirmed .
transfer to our cardiac surgical facility ensued .
limited heart tamponade was affirmed on echocardiography and surgery was immediately indicated .
blood effusion was found in upper mediastinal fat tissue and 300 ml of blood were evacuated from opened pericardial space .
stab wound by sternal biopsy needle at the upper part of ascending aorta was repaired by pledgeted suture .
postoperative course was uneventful . |
this can be an unusual cause of primary male infertility as a result of abnormalities in sexual function .
this report describes a 40 year old man who presented to us on account of inability to impregnate his wife after 2 years of marriage .
history revealed poor stream of urine since childhood and passage of scanty ejaculate during intercourse .
in this report , it was found that adult posterior urethral valve though uncommon may be a cause of male infertility .
posterior urethral valve ( puv ) is a congenital malformation found in males that is characterized by the presence of abnormal obstructing membranes in the posterior urethra .
the exact embryology of the condition is not completely understood but it is believed to arise mainly as a result of an anomalous insertion of the mesonephric duct into the primitive fetal cloaca ( 1 ) .
this leads to an obstruction in the flow of urine through the urethra with the classic presentation of poor stream at birth .
it is the most common cause of bladder outlet obstruction in male children and can be complicated by urinary tract infection ( uti ) , structural changes in the urinary tract and impaired renal function ( 2 , 3 ) . the diagnosis of the condition may be suggested prenatally following a maternal abdominal scan in the presence of hydronephrosis and oligohydramnios .
postnatally , diagnosis is made usually with the aid of micturating cystourethrogram during evaluation of voiding dysfunction ( 2 ) . in cases with mild obstruction
however , puv in the adult male is reported to be an unusual finding ( 5 , 6 ) .
this may occur in patients with mild obstructing valves who do not develop severe complications of the disease
. this presentation may be an unusual cause of urinary and sexual symptoms ( 7 ) .
in this paper , an attempt was made to present the management of a 40 year old man with primary infertility due to puv causing retained ejaculate during sexual intercourse .
a 40 year old presented to the urology unit of the university of benin teaching hospital , nigeria in april , 2013 with complaint of inability to impregnate his wife after 2 years of marriage .
the couple lived together with regular sexual intercourse ( 2 - 3 times weekly ) .
however , there was associated passage of scanty and sometimes absent ejaculate during intercourse with trickling of seminal fluid few minutes thereafter .
there was no history of urethral trauma but the patient had several episodes of uti which was treated in a community hospital .
an assessment of urethral stricture leading to primary male infertility was initially entertained . however , contrast studies by means of a retrograde urethrogram and a micturating cystourethrogram showed a dilated posterior urethra suggestive of puv with associated bladder trabeculations ( figure 1 ) .
the patient was not able to produce sufficient semen for proper seminal fluid analysis ( sfa ) , on the two occasions the test was requested .
urine culture did not yield any growth of organisms while serum urea , electrolytes and creatinine values were within normal limits ( na 138 meq / l , k 4.2 meq / l , urea 30 mg / dl and creatinine 1.1 mg / dl ) .
he subsequently had urethrocystoscopy which confirmed type 1 of puv that was ablated during the procedure using a diathermy bugbee electrode .
after removal of catheter the next day , there was significant improvement of the urine stream with a peak flow rate of 15 ml / s .
micturating cystourethrogram of the patient showing dilated posterior urethra four weeks later during follow up visit , the patient reported having good volume of ejaculate during intercourse with further improvement in urine stream .
his sfa report after 6 weeks of valve ablation was satisfactory , with values within normal ranges ( volume ; 3.5 ml , count ; 38x10/ml , motility ; 55% , morphology ; 40% ) .
most cases of puv are usually diagnosed either before birth with the aid of a prenatal scan or soon after birth following evaluation of a male child with poor urinary stream ( 2 ) .
though cases with mild obstructing valves may present later in child - hood , the diagnosis of the condition is uncommon in adulthood ( 5 , 6 ) .
presentation in adulthood may occur due to the presence of a mild form of the disease devoid of the life threatening complications noted in children with the severe form . in nigeria , many patients with the disease still present late ( 8) . this may be facilitated by ignorance of the symptoms of the disease by parents , guardians and affected individuals as well as paucity of specialized health - care .
our patient presented on account of inability to impregnate his wife and was found to have associated poor urinary stream and passage of scanty ejaculate in the course of evaluation .
the diagnosis was suggested with radiological finding of a dilated posterior urethra and confirmed on urethrocystoscopy .
the patient had recurrent uti but there was no associated impairment in renal function seen in severe cases ( 3 , 4 ) .
obstruction to antegrade flow at the posterior urethra occurs not only with urine but with semen after normal ejaculation . as such
, sufficient amount of semen may not be introduced within the vagina during intercourse leading to a reduction in the likelihood of fertilization .
the patient was not able to impregnate his wife after 2 years of marriage despite regular sexual intercourse .
this may have been due to retention of significant amount of seminal fluid within the posterior urethra .
satisfactory outcome following valve ablation was achieved with improvement in urine stream and ejaculate volume .
he had normal sfa values 6 weeks after valve ablation and was able to impregnate his wife in the course of follow up .
patients presenting in the fertility clinic with a history of scanty ejaculate and reduced urinary stream should be evaluated in this regard .
| backgroundposterior urethral valve presenting in adulthood is uncommon .
this can be an unusual cause of primary male infertility as a result of abnormalities in sexual function.case presentationthis report describes a 40 year old man who presented to us on account of inability to impregnate his wife after 2 years of marriage .
history revealed poor stream of urine since childhood and passage of scanty ejaculate during intercourse .
a micturating cystourethrogram revealed dilated posterior urethra in keeping with posterior urethral valves .
endoscopic valve ablation was done with subsequent improvement in ejaculate volume and urine stream .
his spouse achieved pregnancy thereafter.conclusionin this report , it was found that adult posterior urethral valve though uncommon may be a cause of male infertility .
restoration of fertility potential can be achieved following valve ablation . |
it is widely available in the bangladeshi market as an effective preparation to treat lumbago , sciatia and arthritic pain of joints .
our present studies make an attempt toward identifying probable antinociceptive and anti - inflammatory effect and its mechanisms of drk .
drk , at three doses , ( 10 ml / kg , 20 ml / kg , and 40 ml / kg ) showed no involvement of the cns in antinociceptive activity of the test drug .
both carrageenan - induced paw edema and acetic acid writhing tests gave significant results ( p < 0.05 ) , indicating possible peripheral analgesic and anti - inflammatory action .
formalin - induced paw- licking test showed that drk had significant effect in suppressing inflammatory pain ( p < 0.05 ) but not neurogenic pain .
| rationale : draksharishta ( drk ) is an ayurvedic formulation approved by the national formulary of ayurvedic medicine 2011 , of bangladesh .
it is widely available in the bangladeshi market as an effective preparation to treat lumbago , sciatia and arthritic pain of joints .
but there are very scientific evidences available to support their common uses.objectives:our present studies make an attempt toward identifying probable antinociceptive and anti - inflammatory effect and its mechanisms of drk.findings:drk , at three doses , ( 10 ml / kg , 20 ml / kg , and 40 ml / kg ) showed no involvement of the cns in antinociceptive activity of the test drug .
both carrageenan - induced paw edema and acetic acid writhing tests gave significant results ( p < 0.05 ) , indicating possible peripheral analgesic and anti - inflammatory action .
formalin - induced paw- licking test showed that drk had significant effect in suppressing inflammatory pain ( p < 0.05 ) but not neurogenic pain.conclusions:hence our study shows anti - inflammatory and peripheral analgesic action for drk . |
nosocomial hepatitis c virus ( hcv ) infection within dialysis units is well described [ 1 , 2 ] .
international guidelines advocate standard infection control precautions as the primary method of minimizing patient - to - patient hcv transmission [ 3 , 4 ] .
cohorting hcv - infected patients and segregating them from the main dialysis unit may further reduce the risk of hcv transmission [ 57 ] .
however , cross - infection between cohorted patients could lead to the superinfection of patients with another hcv genotype or the re - infection of patients whose infection had resolved naturally or following anti - viral treatment .
we describe a haemodialysis patient who was re - infected with hcv of a different genotype than his original infection .
he received an estimated 20 u of packed red blood cells for treatment of renal anaemia .
his transplant failed in 2002 due to chronic allograft nephropathy and he was tested for hcv infection as he returned to dialysis .
hcv genotype 2 with a viral load of 7 312 217 copies / ml ( 2 708 228 iu / ml ) was discovered .
this transplant failed due to recurrence of his original glomerulonephritis and he developed end - stage kidney disease within 4 years . according to local policy , he was cohorted with hcv - infected patients when he resumed haemodialysis in 2007 . in september 2009 , he commenced a 24-week course of pegylated interferon therapy .
this remained negative 6 months after completion of therapy , by definition a sustained virological response ( svr ) .
the patient was routinely tested for hcv after returning from a holiday abroad in january 2011 and was found to be weakly positive for hcv antigen ( ag ) ( 44 pg / ml ) .
retrospective testing of a serum sample collected in december 2010 confirmed that hcv ag and rna were then absent .
subsequent hcv rna testing in february 2011 detected hcv rna with a viral load of 7791 iu / ml . genotyping using the versant hcv genotype 2.0 assay ( inno - lipa ) identified this to be hcv genotype 3a .
this indicated hcv re - infection rather than a relapse of the patient 's original hcv genotype 2 infection .
there was no evidence to support hcv transmission outside the dialysis unit or within the patient 's holiday dialysis unit .
a review of the genotypes of all hcv viraemic patients within the unit identified two additional patients with hcv genotype 3a infection .
one patient ( patient x ) had received dialysis alongside the index patient ( i.e. same shift , room and nurse but different dialysis machine ) throughout the month of december , at which time his hcv viral load was > 69 000 000 iu / ml .
phylogenetic analysis of fragments of the e1/e2 region , including the hypervariable region , of hcv rna from patient x and the index patient demonstrated that there was a strong possibility that both viruses were genetically related ( see figure 2 ) .
we concluded that the index patient had been infected with hcv genotype 3a from patient x while they were being cohorted together for dialysis .
phylogenetic tree demonstrating closely related hcv genotype 3a subtypes of index patient and patient x. unrooted neighbour - joining ( nj ) tree hcv nucleotide sequences in the e1/e2 region ( 300 bp ) with outgroup d26556 ( genotype 3b ) . the nucleotide sequences of index patient and x1 , x2 and x3 of patient x are indicated ( see arrow ) . the nj tree generated by heuristic search using paup .
the tree was constructed using the gtr + g + i model of nucleotide substitution selected by jmodeltest with 1000 bootstrap replicates .
this report describes a dialysis patient with chronic hcv genotype 2 infection who achieved an svr following pegylated interferon therapy but was re - infected with hcv genotype 3a .
epidemiological and molecular investigations identified a highly viraemic patient , with whom the patient was being cohorted for dialysis , as the likely source of the re - infection .
intensive surveillance for hcv infection is practiced in the dialysis unit and only two cases of nosocomial hcv transmission have been detected among the 496 250 dialysis treatments delivered here since hcv testing became available in 1992 .
this seroconversion rate of 0.4 per 100 000 dialysis treatments compares favourably to international experience .
international guidelines [ 3 , 4 ] , supported by observational data [ 10 , 11 ] , maintain that standard infection control precautions alone are sufficient to prevent nosocomial hcv transmission .
however , breaches in infection control procedure in dialysis facilities are not infrequently described and have resulted in large hcv outbreaks [ 1 , 2 ] .
cohorting of hcv - infected patients together in dialysis units separated from main dialysis units may offer additional protection to non - infected patients .
indeed , impressive reductions in rates of hcv seroconversion have been observed to occur in many dialysis units following implementation of such a strategy [ 5 , 6 ] .
consequently , we cohort hcv - positive dialysis patients together in a unit adjacent to our main dialysis unit in the belief that this practice provides maximal protection to the majority of our patients ( i.e. the non - infected ) without placing excessive demands on hospital resources . cohorting should , however , augment standard infection control precautions and not replace them .
as illustrated by this case , lapses in the strict enforcement of standard precautions can result in hcv superinfection and re - infection , respectively , among actively infected and recently treated hcv - positive dialysis patients being cohorted together . to our knowledge
, only one previous report has described hcv re - infection occurring in a haemodialysis population . in this case series , five haemodialysis patients from three dialysis centres in brazil were re - infected with hcv .
re - infection was distinguished from relapse on the basis of a different hcv genotype .
firstly , these patients were re - infected with hcv prior to achieving an svr . secondly , an epidemiological analysis was not reported consequently , it is not clear that all infections were nosocomially acquired .
lastly , no information is provided regarding infection control policy in the referring dialysis units .
the experience of hcv re - infection in this patient directly informed a change in local policy regarding the management of hcv - infected dialysis patients who achieve an svr . in the absence of any international precedent , this revised guideline was based on the rationale that hcv relapse in a dialysis patient is extremely unlikely once an svr has been achieved . from an infection control standpoint ,
therefore , patients with an svr can be safely considered to have resolved infection. this revised local policy was reflected in a recently drafted amendment to the irish blood - borne viruses in haemodialysis , capd and renal transplantation national guidelines 2010 .
this updated guideline will be available on the irish health protection surveillance centre website in early 2012 .
the main proposed changes are as follows:if hcv rna is undetectable at the end of treatment , the patient can be dialysed in isolation until 6 months after end of treatment or be dialysed in the multibedded unit but undergo hcv ag testing every 2 weeks.if hcv rna is undetectable 6 months after treatment ( svr ) , infection can be considered to be resolved .
the patient can be dialysed in the multibedded unit and tested monthly for hcv ag.if an svr is not attained , the patient should be cohorted with hcv rna - positive patients .
hcv genotyping should be performed to distinguish relapse from re-infection.standard infection control procedure is essential to prevent cross - infection between hcv - infected patients , especially for patients with very high viral load .
if hcv rna is undetectable at the end of treatment , the patient can be dialysed in isolation until 6 months after end of treatment or be dialysed in the multibedded unit but undergo hcv ag testing every 2 weeks .
if hcv rna is undetectable 6 months after treatment ( svr ) , infection can be considered to be resolved .
the patient can be dialysed in the multibedded unit and tested monthly for hcv ag .
an svr is not attained , the patient should be cohorted with hcv rna - positive patients .
standard infection control procedure is essential to prevent cross - infection between hcv - infected patients , especially for patients with very high viral load .
it is hoped that the publication of this case and the guidelines informed by it will result in a reduction of nosocomial hcv transmission in haemodialysis units . | we report the case of a 45-year - old haemodialysis patient who achieved a sustained virological response ( svr ) following pegylated interferon therapy for hepatitis c virus ( hcv ) genotype 2 infection .
he was subsequently cohorted with other hcv - infected dialysis patients and became re - infected with hcv genotype 3a .
epidemiological and molecular investigations identified a highly viraemic hcv genotype 3a - infected dialysis patient as the likely source of this infection .
this critical incident informed a revision to local and national infection control policy regarding the dialysis management of patients who achieve an svr following anti - viral treatment . |
carpal - tunnel syndrome ( cts ) and destructive arthropathy associated with cystic bone lesions are the major clinical manifestations of dialysis - related amyloidosis in patients undergoing long - term dialysis treatment .
amyloid deposits were found in the carpal synovia and perineural tissues in long - term hemodialysis patients with cts .
previous study revealed that 2-microglobulin was the major constituent protein in dialysis - related amyloidosis .
carpal tunnel syndrome , which is one of the most frequent presentations of 2-microglobulin - associated amyloidosis , occurs with an increasing frequency in patients with end - stagerenal disease .
dialysis - related amyloidosis or 2-microglobulin - associated amyloidosis is noted much more commonly in older patients ( older than 50 years ) , patients undergoing dialysis for more than 10 years , and those who have suffered from other rheumatologic diseases before developing renal failure .
after 10 years of dialysis , approximately 50% of patients surveyed exhibited the clinical manifestations of dialysis - related amyloidosis , and among patients who had survived with hemodialysis for 20 years , the prevalence of dialysis - related amyloidosis was reported to be almost 100% .
as the symptoms and signs of peripheral neuropathy are similar to those of cts , the diagnosis of cts is often difficult and patients are sometimes misdiagnosed as having a peripheral neuropathy .
surgical management of the cts usually provides the dramatic relief of the symptoms in most patients .
however , to our best knowledge , carpal tunnel syndrome due to dialysis - related amyloidosis in patients undergoing long - term dialysis has not been reported yet in korea .
we hereby report a case of carpal tunnel syndrome due to dialysis - related amyloidosis in a patient undergoing long - term hemodialysis with a brief review of the literature .
a 55-year - old woman with end - stage renal failure due to chronic glomerulonephritis was hospitalized for severe pain , numbness and paresthesia in both wrists , with progressive paralysis of the thenar muscles and both shoulders pain for about 1 year .
dialysis had been performed for 4 hours , 3 times weekly with hollow - fiber cuprophan dialyzers that were not reused .
she had been on hemodialysis therapy since 1983 via a side to side cephalic vein - radial artery arteriovenous fistula in the left distal forearm and then , 5 years later , arteriovenous fistula in the right distal forearm due to loss of the function of the left arteriovenous fistula .
on admission , blood pressure was 90/60mmhg , body temperature 37c , pulse rate 94/min and respiration rate was 22/min . on physical examination , she was alert , obese and a chronically ill - looking appearance .
physical examination showed positive phalen s wrist flexion test and positive tinel s test at the wrist with thenar muscle atrophy .
her breathing sound was clear and no abnormal sound was heard . on abdominal palpation , liver , spleen or kidneys were not palpable .
she had not suffered from tuberculosis or diabetes mellitus , but she had a trauma history at the right knee joint and the right thumb 4 years ago .
laboratory findings were as follows : red blood cell count 2.87 10/mm , white blood cell count 5.7 10/mm , hematocrit 23.7% , hemoglobin 8.1 g / dl , platelet 179 10/mm and the reticulocyte count 3.3% .
peripheral blood smear showed microcytic and hypochromic anemia ( mcv : 80.3 fl , mchc : 32.1% ) with anisocytosis but preserved platelet and white blood cell counts .
blood chemistry studies showed serum electrolyte were normal , except for total serum calcium 8.1mg / dl and inorganic phosphate 6.6mg / dl .
the ast was 65iu / i , alt 51iu / i , alkaline phosphatase 143iu / i ( liver origin 71.7% , and bone origin 28.3% ) , total bilirubin 0.4mg / dl , total serum protein 7.1g / dl and albumin 3.5g / dl , globulin 3.6g / dl and ldh 509iu / i .
renal function test revealed serum creatinine 8.6mg / dl , and blood urea nitrogen 44mg / dl and other laboratory tests showed that rheumatoid factor was 20iu / ml , c - reactive protein 2.8mg / dl , serum ferritin 210ng / ml , the erythrocyte sedimentation rate 78 mm / hr , serum 2-microglobulin 60.5ug / l ( normal : 1.1 to 2.7mg / ml ) , intact parathyroid hormone 147pg / ml , 1 , 25(oh)2d3 8.9pg / ml ( normal : 16 to 45pg / ml ) and serum osteocalcin 13.9ng / ml ( normal : 4 to 12ng / ml ) .
radiologic examination showed bony destructive changes at right first interphalangeal joints in both hands and narrowing of joint space in right knee joint and bony destructive lesions with sclerotic border of left tibial plate , but otherwise nonspecific .
bone mineral density was examined , and the total body bone mineral density of our patient was within normal limit ( 1.1910.0 g / cm ) , compared with the normal controls ( control group : 1.15 0.10g / cm ) .
whole body bone scan showed that hot spot uptake was noted in the areas of middle phalanx of right thumb , 4th and 5th left posterior ribs , left carpal bones , right distal femur and right lower sacroiliac joint .
electromyographic examinations were performed in both median motor and sensory nerves : nerve conduction studies demonstrated delayed distal latency and conduction velocity in both median motor nerves , and sensory nerves were not evoked and these findings were compatible with compression of the median nerves within the carpal tunnels ( left side was more severely involved ) .
needle electromyography showed profusely abnormal spontaneous activities at rest and increased polyphasic voluntary motor unit action potentials ( muap ) on minimal vibration in both abductor pollicis brevis innervated by median nerves . on 7th hospital day , abdominal fat aspiration biopsy was done , and the biopsy was negative for amyloid on congo red staining . on 15th hospital day , she underwent an open surgical release and epineurolysis at the left carpal tunnel with an impression of carpal tunnel syndrome . at the time of the surgical release and exploration of the carpal tunnel in left hand , she had moderate thickening of the transverse carpal ligament , hyperemia of the median nerve epineurium and compression and narrowing of the median nerve
. flexor tenosynovial hypertrophy on the left wrist and degeneration of transverse carpal ligament and synovium were seen , and dilatation of proximal fragment of left median nerve was also seen .
histologic examinations of the transverse carpal ligament and epineurium of median nerve for amyloid deposition by congo red staining , fluorescence microscopy and electronmicroscopy were performed .
these tissues specimens showed multifocal amorphous pinkish deposits in the dense collagenous fibrous bundles in light microscopy , and red colored in hematoxylin and eosin , and congo red staining ( fig .
1 ) . the amyloid protein with congo red staining exhibited apple - green birefringence under polarized light microscopy ( fig .
2 ) and electron microscopic examination showed numerous short but thick , nonbranching curvilinear fibrills aligned in parallel and aggregated in bundles ( fig .
, she had dramatic relief of pain and numbness in left hand and wrist joint during dialysis at night , did well for the following 3 months .
carpal tunnel syndrome ( cts ) as one of the major complications in patients undergoing long - term hemodialysis was first reported by warren and otieno in 1975 . as the number of the patients and duration in hemodialysis increase
, cts has become an increasingly recognized problem in patients undergoing long - term hemodialysis . in a recent study ,
the incidence of patients who required operation for cts increased steeply from almost zero% before 8 years of maintenance hemodialysis to 50% at 14 years and almost 100% at 20 years .
the etiology of cts has not yet been firmly determined and several etiologic factors , including diabetes mellitus and rheumatoid arthritis , have been suggested .
recently cts has been reported to be associated with 2-microglobulin - associated and is now regarded as a major complication in patients undergoing maintenance hemodialysis .
cts and destructive arthropathy associated with cystic bone lesions are the major clinical manifestations of dialysis - related amyloidosis .
recent study shows that dialysis - related amyloidosis is of 2-microglobulin origin , and 2-microglobulin is an 11,800 dalton globular protein , and consists of 100 amino acids arranged in a single polypeptide chain . as the nonvariable light chain of the human class 1 major histocompatibility complex , 2-microglobulin is expressed on the surface of all nucleated cells .
postulated that 2-microglobulin could not be removed efficiently from the blood by conventional hemodialysis and accumulated in tissues resulting in the formation of amyloid fibrils which , having a relatively high affinity to the carpal tunnel area , thus caused cts .
although we did not directly examine the 2-microglobulin immunoreactivity in the amyloid deposit tissues , serum 2-microglobulin concentration markedly increased in the present case and this finding is compatible with the previous study that dialysis - related amyloid was of 2-microglobulin and conventional hemodialysis could not remove effectively the 2-microglobulin from the blood . in cts ,
amyloid fibrils are deposits in the carpal synovia , finger flexer tendon sheaths , transverse carpal ligaments and perineural tissues .
histological finding was a pericollagenous distribution of the deposits associated with hyperplasia of the synovial tissue .
our patient had very similar gross and histological findings when the carpal tunnel release operation as underwent and tissue specimens were obtained .
on congo red and hematoxylin and eosin staining , our patient s specimens showed heavy deposition of congo red positive materials that demonstrated green birefringence under polarized light microscopy , thereby characterizing the substance as amyloid .
electron microscopic examination in the present case showed the shorter and thicker nonbranching curvilinear fibirls aligned in parallel and aggregated in bundles , in contrast to the straight , longer and thinner fibrills seen in other types of amyloid , and these findings are compatible with a previous report .
radiologic examination in 2-microglobulin associated amyloidosis demonstrates erosions and marginal defects of the affected bones , mainly at synovial insertion sites .
a characteristic finding is periarticular cystic lesions , which grow in number and size with the continuity of renal replacement therapy .
commonly affected sites include the carpal bones , femoral and humoral heads , acetabulum , tibial plate and distal radius .
radiologic examination in our patient showed destructive changes in many joints and bones , but typical cystic bony lesions were not noted .
previous study reported that conventional hemodialysis using cuprophane membrane could not remove efficiently 2-microglobulin from the blood , but highly permeable biocompatible membrane including acrylonitrile , polysulfone or poly - anile membrane could more effectively remove and slow release of 2-microglobulin .
nomoto et al . recently reported that continous ambulatory peritoneal dialysis might minimize the emergence of cts , although cts was more likely to be one of the metabolic complications of end - stage renal failure itself .
renal transplantation is the most effective method in preventing dialysis - related amyloidosis including cts .
furthermore , in patients with already established dialysis - related amyloidosis , renal transplantation arrests the progression of radiologic signs of dialysis - related amyloidosis and produces an almost immediate abatement of osteoarticular origin .
operative release of cts gave a definite improvement of symptoms to almost all patients and after surgical intervention for cts , our patient had also dramatic improvement in symptoms of cts .
in conclusion , the carpal tunnel syndrome has been associated with dialysis - related amyloidosis due to 2-microglobulin deposition in patients undergoing long - term hemodialysis , and physicians should pay careful attention to the possibility of development in this major complication , especially in patients undergoing long - term hemodialysis . | carpal tunnel syndrome ( cts ) is characterized by burning pain , numbness and tingling sensation in the thumb , index and middle fingers and the lateral half of the palm and progressive atrophy of the thenar muscles by compression of the median nerve within the carpal tunnel due to a variety of etiologic factors .
surgical intervention usually successfully relieves symptoms of cts .
recently cts has been regarded as one of the major clinical manifestations of dialysis - related amyloidosis due to 2-microglobulin deposition and recognized with increasing frequency in patients undergoing long - term hemodialysis .
we report a case of carpal tunnel syndrome due to dialysis - related amyloidosis in patients undergoing long - term hemodialysis , confirmed by electromyography and biopsy in transverse carpal ligament and median nerve . |
urinary incontinence ( ui ) has been defined as the complaint of any involuntary loss of
urine .
the physiopathology of ui is
multifactorial , and it is known that weak pelvic floor muscles ( pfms ) represent a problem
encountered in patients with ui2 .
therefore , the purpose of pfm
training is to increase strength and endurance as well as to provide neuromuscular
facilitation3 .
pfm training is generally
recommended as the first choice of treatment for stress and mixed ui in women4 .
several subjective and objective methods have been used to assess pfm function in women
attending physical therapy and exercise programs .
the most commonly used tool in physical
therapy seems to be digital palpation ( modified oxford grading scale)5 . the perfect scheme ( power , endurance , repetition , fast
contractions , every contraction timed ) was developed to assess the primary components of pfm
contractility via digital palpation2 .
real - time ultrasound imaging is a rapidly developing technique that is used by physical
therapists to assess muscle structure , function , and activation patterns6,7,8 .
unlike other methods that require
intravaginal application , transabdominal ultrasonography ( taus ) has the advantages of
noninvasiveness , comfort , and appropriateness in a specific population in which vaginal
assessment may not be favorable ( children , adolescents , victims of sexual abuse , men , and
certain ethnic groups ) with quick and easy applications9 .
taus has been found to be a valid and reliable method to measure
the movement of the bladder base as an indicator of pfm activity during muscle
contraction10 .
however , only patients
with a score of 3 and above in muscle strength according to digital palpation were included
in these studies10,11,12,13 .
in addition , to our knowledge , no study has investigated the
correlation between taus measurement and the parameters of the perfect scheme .
therefore , our aim was to measure the pfm strength objectively by taus before and after pfm
training in patients with all levels of pfm strength ( 05 ) and to compare the findings of
taus with digital palpation .
this was a prospective randomized controlled clinical trial with testing performed before
and after training .
approval was obtained from the dokuz eylul university human ethics
committee ( number : a 38 goa 385 1.12.11 ) prior to this study , and written informed consent
was obtained from subjects .
the patients of this study included 282 incontinent women selected from the individuals
observed at a urogynecology unit .
the exclusion criteria were pregnancy , pelvic organ
prolapses , low back pain , spinal or pelvic fracture , urinary tract infection , vaginal
infection , known neurologic disorders , respiratory diseases , menstruation at the time of
assessment , history of spinal surgery , or history of pfm training ( pfmt ) during
physiotherapy within the last two years .
the remaining 140 patients who agreed to participate in the study were randomized
to the pfmt group ( n=70 ) or the control group ( n=70 ) and were evaluated before and after the
intervention .
randomization was carried out by the study coordinator using a
computer - generated random number table by the prelabeled sealed envelope method .
data with regard to age , body mass index , waist / hip ratio , duration of urinary
incontinence , number of pregnancies , and heaviest birth weight were collected from the
medical records at the initial visit .
all patients underwent a vaginal examination in the
lithotomy position with an empty bladder .
a preliminary assessment of pfm function was
performed by an experienced pelvic floor physiotherapist using the palpation method2 .
the perfect , perineometric , and
ultrasonographic measurements were performed three times , and the average of the three
measurements was calculated .
after these measurements , the stop test , pad test , and stress
test were performed .
the strength of the pfm was measured via palpation with one to two fingers , and pfm
function was evaluated according to the perfect scheme , which includes assessments of power ,
endurance , number of repetitions , and number of fast ( 1 s ) contractions .
power was graded from 0 to 5 , according to the oxford grading system .
the perfect scheme of pfm evaluation was recorded and used as an exercise program for the
pfmt group2 . a peritron 9300v perineometer
( cardio design , victoria , australia ) was used to measure the strength of pfm
contractions .
a diagnostic ultrasound imaging unit set in b mode ( ultrasonix es500 , ultrasonix medical
corporation , richmond , bc , canada ) with a 3.5-mhz curved array transducer was used for taus
measurement .
two investigators with at least two years of experience in using taus examined
all of the patients .
a marker ( x ) was placed on the image of the central portion of the
bladder base at the junction of the hyper- and hypoechoic structures .
the patients were
asked to perform three pfm contractions with a 10-s rest between each contraction , and each
image was captured at the point of maximal displacement and again marked with an x. the
displacement was measured as the distance between the two points marked with x ( mm ) .
a
physiotherapist confirmed the correctness of pfm contraction by examining any undesirable
movement or contraction of other muscles12 .
the stop test was performed by slowing or stopping urine flow after initiation of voiding
with a full bladder .
the one - hour pad test was performed by measuring the weight differences
of pads after completion of recommended types of exercises .
the stress test was performed by
having the individual relax and then cough vigorously while the examiner observed them for
urine loss from the urethra14 .
pfm exercises
were practiced two days per week for the first three weeks with intravaginal digital
palpation in different positions and monitoring by a physiotherapist .
the exercises were individualized
according to the degree of pelvic floor weakness , loss of proprioception , and the patient s
tolerance .
the exercise program included the positions in which the exercise would be done ,
the number of repetitions of slow and fast contractions , the duration of rest between the
contractions , and the number of repetitions in a day and in a week .
after isometric
exercises , concentric and eccentric exercises were then respectively performed with a
frequency of 27 sets per day with maximal voluntary contraction .
the data analysis was performed using a statistical analysis software ( spss , v15.0 , spss
inc , chicago , il , usa ) .
the variables were investigated with the kolmogorov - smirnov test to
determine whether they were normally distributed .
descriptive analyses are presented using
the means and standard deviations for normally distributed perfect , ultrasonography ,
perineometry , and demographic variables .
the independent samples t - test and chi - square test
were used for continuous and categorical variables , respectively , to test the difference
between the pre- and posttreatment values in the study and control groups .
the association
among taus measurements , perineometry results , and three components of the perfect scheme
( endurance , repetitions and fast ) was assessed using pearson s coefficient of correlation ,
while spearman s rho was used to determine the association between taus measurement and
digital palpation testing . a priori analysis for power indicated that 51 patients in each
group were needed to produce 80% power for detecting a large - size effect ( assuming a
correlation of 0.50 and population correlation of 0.72 ) based on a one - tailed alpha
value of 0.05 .
a post hoc statistical power analysis showed that with the effect size ( r ) of
0.47 , this study has 85% power to detect a significant correlation between the taus
measurements and perineometry with an overall 5% type - i error level .
an overall p - value of less than 0.05 was considered a statistically
significant result .
among the 282 incontinent women , 91 were excluded from the study due to the exclusion
criteria , and 51 did not agree to participate in the study .
each group initially had 70 patients , but 24 women did not
complete the study , resulting in a drop - out rate of 17.14% .
five patients in the exercise
group were excluded from the study because they did not participate in at least 75% of the
treatment sessions .
nineteen patients in the control group who did not attend their
secondary assessments due to personal reasons were also not included in the study ( one woman
had a change in her work situation , two women had other health problems , 16 women did not
accept a second vaginal evaluation ) .
ultimately , the study was completed with 65 patients
( 27 with stress ui , 23 with urge ui , and 15 with mixed type ui ) in the exercise group and 51
patients ( 21 with stress ui , 17 with urge ui , and 13 with mixed type ui ) in the control
group .
table 1table 1.baseline values of the pfmt and control groups*variablespfmt group ( n = 65)mean ( sd)control group ( n = 51)mean ( sd)age ( years)51.7 ( 9.7)49.6 ( 7.6)bmi ( kg / m)32.6 ( 14.2)33.4 ( 22.7)waist / hip ( cm)0.9 ( 0.1)0.9 ( 0.1)duration of symptoms ( months)64.3 ( 53.3)56.5(47.8)number of pregnancy3.3 ( 2.4)2.7 ( 1.4)heaviest birth weight ( gr)3,608 ( 550)3,342 ( 288)*p > 0.05 .
bmi : body mass index ; pfmt : pelvic floor muscle training ; sd : standard
deviation shows the baseline demographic and clinical characteristics of the patients .
comparison of the groups showed no significant differences at baseline for age , body mass
index , waist / hip ratio , duration of ui symptoms , number of pregnancies , and heaviest birth
weight .
there were statistically significant differences between the stress test
measurements before and after exercise in the treatment group ( 15.4% vs. 3.1% positive
stress test respectively , p<0.001 ) ( table
2table 2.stress test values of the pfmt groupstress testpfmt group ( n = 65)positive20 ( 15.4%)4 ( 3.1%)negative45 ( 34.6%)61 ( 46.9%)p = 0.001 , = 14.55 , sd = 2 , chi - square test ) .
bmi : body mass index ; pfmt : pelvic floor muscle training ; sd : standard
deviation p = 0.001 , = 14.55 , sd = 2 , chi - square test there were no significant differences among groups in terms of the baseline stop test ,
one - hour pad test , strength measurements of the perfect scheme , perineometry , or taus ( table 3table 3.strength measurements of the pelvic floor muscle ( perfect testing ,
perineometry , stop test , pad test , and taus - t / l ) before and after exercise training
between and within groups.variablespfmt group ( n = 65)control group ( n = 51)baselineafter exercise trainingbaseline12 w laterone hour pad test ( gr)3.1 ( 2.3)0.2 ( 0.5)3.4 ( 6.3)3.6 ( 6.9)stop test ( s)12.6 ( 2.3)0.9 ( 1.9)8 ( 16.9)8.3 ( 17.8)taus - t ( mm)3.1 ( 2.8)8.2 ( 4.8)4.8 ( 2.8)3.3 ( 11.4)taus - l ( mm)4.2 ( 3.7)11.4 ( 5.9)5.2 ( 3.7)6.5 ( 17.7)perineometry ( cm h2o)9.8 ( 2.8)20.3 ( 15.5)18.5 ( 13.7)16.2 ( 11.6)perfectpower2.3 ( 1.2)5 ( 1.2)3.1 ( 1.3)3.3 ( 1.3)endurance25.9 ( 18.3)57.6 ( 17.6)46.1 ( 33.3)46.2 ( 31.7)repetition13.4 ( 5)21.3 ( 5.6)13.3 ( 8.5)12.6 ( 7.6)fast12.9 ( 4.8)20 ( 5)14.4 ( 9.8)14.3 ( 10.2)results are presented as the mean ( sd ) . * p < 0.05 between baseline and post - training values of each group**p < 0.05 between values of the pfmt and control groups after 12 weeks .
l : longitudinal ; pfmt : pelvic floor muscle training ; sd : standard deviation ; t :
transverse ; taus : transabdominal ultrasonography ) .
when we compared the results for pfm strength , there was significant
improvement in pfm strength in the pmft group after treatment compared with before
treatment . in the control group ,
improvements in all pfm strength parameters were
significantly higher in the pfmt group than the control group after the 12 weeks of
treatment ( p<0.05 ) ( table 3 ) .
the percentages
of pmf strength increases were 120.3% as measured by the power , 107.1% as measured by
perineometry , 160.6% as measured by taus in the transverse plane , 169.4% as measured by taus
in the longitudinal plane , 92.9% as measured by the pad test , and 93.2% as measured by the
stop test .
results are presented as the mean ( sd ) . * p < 0.05 between baseline and post - training values of each group * * p < 0.05 between values of the pfmt and control groups after 12 weeks .
l : longitudinal ; pfmt : pelvic floor muscle training ; sd : standard deviation ; t :
transverse ; taus : transabdominal ultrasonography there was a moderate positive correlation between all the parameters of the perfect scheme
and taus results in both transverse and longitudinal planes ( taus - t and taus - l ) ( table 4table 4.correlation between the perfect scheme , perineometry , and taus ( n = pfmt group +
control group)variablestaus - l measurement ( mm ) before training n = 140taus - t measurement ( mm ) before training n = 140taus - l measurement ( mm ) after training n = 116taus - t measurement ( mm ) after training n = 116r / rhor / rhor / rhor / rhoperfectpower 0.40.40.50.4endurance ( s)0.40.40.50.4repetition ( number)0.40.60.50.5fast ( number)0.40.50.40.5perineometry ( cmh2o)0.20.40.20.5taus - t measurement ( mm)0.710.71*p < 0.05 .
data are shown as median values ( range ) , and spearman s rho was calculated for power
analysis . )
a moderate positive correlation was observed between
perineometry and taus - t measurements ( p<0.05 ) , whereas no correlation was found between
perineometry and taus - l measurements ( p>0.05 ) ( table
3 ) .
we found strong positive correlation between transverse and longitudinal taus
measurements ( p<0.05 ) .
all the results of correlation analysis for the measurement
methods were identical before and after training ( table
4 ) . *
data are shown as median values ( range ) , and spearman s rho was calculated for power
analysis . to identify whether the strength increase in the pfmt group could be detected using
ultrasound , the difference between the pre- and posttreatment values for power and the
forces measured via taus were calculated . to determine the relationship between these two
measurements ,
an increase of strength in the pfmt
group was detected by measurement of power ( average difference between pre- and
post - exercise power values : 1.730.76 ) as well as by taus ( average difference between pre-
and post - exercise taus measurements : 5.062.64 mm ) .
a statistically significant relationship
was found between the two measurement systems regarding strength increase ( p=0.014 ,
r=0.303 ) .
there was no difference between power and taus with regard to pre- and
posttreatment strength values .
when the strength values measured by power increased , the
values measured using taus also increased in the two groups ( p<0.01 , r=0.632 ; p<0.01 ,
r=0.642 ) .
our study demonstrated a statistically significant increase in the strength of the pfm
after training in patients with all levels of pfm strength .
this increase was detected by
using the perfect and perineometric measurement methods and by taus , which is a noninvasive
method .
in addition , it was found that taus could detect the difference in strength even in
pfm strengths of 02 .
regular pfm reassessment is suggested so that new exercise programs can be established and
for monitoring progress2 .
correct
assessment of pfm strength is crucial when prescribing an exercise program according to
patient needs , when determining the correct exercise load , and when demonstrating the
effectiveness of the exercise . for suitable progression
, frequent assessments must be
performed due to changes in strength related to exercise training . understanding how to
correctly perform pfm contraction and giving biofeedback to the patient via taus during an
exercise session could be helpful for women who are reluctant to receive an internal
examination as well as for a continence physiotherapist .
the effects of pelvic floor rehabilitation on pfms have been evaluated in previous reports
that measured pfm strength directly by taus .
however , there have been few studies with
two - dimensional ultrasonography that have assessed changes in pfm strength after exercise
training .
ariail et al.16 reported a case
in which taus was used for pfm rehabilitation , muscle reeducation , strength assessment , and
setting of the parameters of exercise prescriptions .
however , unlike our study , not only the
strength of the muscles but also the duration of contractions was detected using taus .
therefore , it seems that a patient s exercise prescription could be formed with the
parameters obtained from taus .
braekken et al.17 assessed the differences in pfms after pfm training with
transperineal three - dimensional ultrasonography .
the pfm thickness , levator hiatus
dimensions , and pubovisceral muscle length were measured using three - dimensional
ultrasonography at rest , during contraction , and during the valsalva maneuver . at the end of
the study
, it was determined that the effects of the training program could be easily
evaluated with three - dimensional ultrasonography18 .
the pfmt method , patient motivation method , and results of
treatment in our study were the same as those in the study by braekken et al.17 .
a significantly more detailed assessment
can be performed with three - dimensional ultrasonography ; however , two - dimensional ultrasound
that we used in our study is a cheaper and more common method that could be used in all
obstetrics and gynecology clinics .
our results are consistent with some studies that have demonstrated a significant
correlation between taus and digital palpation11 ,
18 . however , in the study by sherburne
et al.10 , no significant correlation
between these two methods was identified .
we propose that the result of that study was due
to the use of different us measuring techniques .
in addition , our results for the mean
bladder base movement do not appear to be fully comparable with those of other reports
because we had a mixed population and we accepted a contraction as correct if the pelvic
floor was elevated .
supervised , individually prepared pfmt programs are the most effective methods to relieve
the symptoms of urinary incontinence .
a significant increase in pfm strength has been observed after 12-week
programs15 , 17 .
when home program applications were compared with long - term pelvic
floor rehabilitation applications in a physiotherapy clinic , no difference was found between
the results of the two applications in terms of a pad test or strength measurements19 .
therefore , we prescribed an individual
12-week home exercise program coordinated by an experienced physiotherapist .
tsai and
liu19 taught a group pelvic floor
exercises via intravaginal digital palpation , while their other group learned them via a
brochure .
they compared the efficacy of the two methods by examining the change in the
1-hour pad test results between before and after a 12-week intervention period .
the pad test
results were significantly better in the group that received one - on - one training by
intravaginal digital palpation . confirming the findings of the study of tsai et al
. , we
observed a statistically significant decrease in the pad and stop test results of the pfmt
group , which was taught pfm exercises intravaginally .
previous studies have found that taus can be used reliably in women with some degree of pfm
activity on pfm grading with digital palpation ( pfm grade > 0)20 , 21 . in this study
,
we determined an upward bladder base displacement by taus in some women with a pfm strength
grade of 0 according to the modified oxford scale .
the mean displacement was approximately
1.2 mm to 1.3 mm and was higher than the previously reported standard error of measurement
( 0.130.57 mm ) or minimal detectable change ( 0.36 mm ) of the taus technique in both
planes10 , 11 , 20 . to the best of our
knowledge
, this study is the first to note women with a pfm strength grade of 0 in a study
population .
we assert that taus can be a valuable tool in determining minimal or no pfm
contraction and could replace or augment digital palpation .
taus can be a reliable tool in
planning an exercise program and in determining even slight progress in muscle contraction
strength , especially in women with weaker pfms .
firstly , the movement of the transducer
in both planes during taus measurement can cause measurement errors .
however , the examiner
held the us transducer firmly against the abdominal wall to control and restrict excessive
movement .
secondly , the lack of a fixed bony reference point can make taus less reliable
than transperineal ultrasonography because the measurement of the bladder base elevation
with taus is expressed relative to a movable starting point . finally , although the group
assignment was randomized , another limitation of the study was that the therapist that
carried out the evaluation and treatment was not blinded ; this could have influenced the
results . in conclusion ,
increments in force that occur with pfm training can be effectively
demonstrated via noninvasive methods such as taus as well as by invasive methods .
taus
imaging without internal examination can be an alternative objective method for pfm
assessment in ui populations in which internal or transperineal methods are not appropriate ,
in women who are reluctant to undergo an internal examination , and in women with low levels
of ( 02 ) pfm strength .
therefore , measuring pfm contraction with taus may be clinically
useful when planning an exercise program , during an exercise session , and to examine the
patient s current status objectively to observe and plan the progress of continence
therapy . | [ purpose ] the aim of this study was to evaluate whether the effect of pelvic floor
exercises on pelvic floor muscle strength could be detected via ultrasonography in
patients with urinary incontinence . [ subjects and methods ] of 282 incontinent patients ,
116 participated in the study and were randomly divided into a pelvic floor muscle
training ( n=65 ) group or control group ( n=51 ) .
the pelvic floor muscle training group was
given pelvic floor exercise training for 12 weeks .
both groups were evaluated at the
beginning of the study and after 12 weeks .
abdominal ultrasonography measurements in
transverse and longitudinal planes , the perfect scheme , perineometric evaluation , the stop
test , the stress test , and the pad test were used to assess pelvic floor muscle strength
in all cases . [ results ] after training , the perfect , perineometry and transabdominal
ultrasonography measurements were found to be significantly improved , and the stop test
and pad test results were significantly decreased in the pelvic floor muscle training
group , whereas no difference was observed in the control group . there was a positive
correlation between the perfect force measurement scale and ultrasonography force
measurement scale before and after the intervention in the control and pelvic floor muscle
training groups ( r=0.632 and r=0.642 , respectively ) .
[ conclusion ] ultrasonography can be
used as a noninvasive method to identify the change in pelvic floor muscle strength with
exercise training . |
the mucosal folds in the body of the stomach are usually less than 1 cm thick .
occasionally these folds , also referred to as rugae , may thicken and enlarge , a condition known as hypertrophic gastropathy . while mntrier 's disease is most commonly associated with hypertrophic gastric folds , a variety of other diseases have also been associated .
these include zollinger - ellison syndrome , gastric lymphoma , diffuse gastric cancer , polyposis and eosinophilic gastroenteritis . rarely , infections with human cytomegalovirus ( cmv ) or helicobacter pylori ( hp ) may cause enlargement of the gastric folds [ 3 , 4 ] . although awareness of these mimics of mntrier 's disease is crucial , it may have an important bearing on patient management and outcome .
we report a patient with hypertrophic gastropathy caused by hp who showed dramatic response to therapy .
a 52-year - old man undergoing screening for gastric cancer was found to have grossly enlarged gastric mucosal folds ( fig .
there was no history of upper abdominal pain , vomiting , anorexia or significant weight loss .
laboratory testing revealed hemoglobin 15.1 g / dl , total protein 6 g / dl , serum albumin 3.9 g / dl , total leucocyte count 9,320/l , eosinophils 5.8% , serum gastrin 87 iu / ml and lactate dehydrogenase 155 u / l .
upper gastrointestinal endoscopy showed marked thickening of the gastric folds in the gastric proximal body ( fig .
contrast - enhanced computed tomography ( cect ) was performed mainly to investigate if other intra - abdominal lesions such as neuroendocrine tumor , lymphadenopathy or metastatic disease might be responsible for the thickened gastric folds . except for the thickened upper body of the stomach ,
endoscopic ultrasonography ( eus ) was performed to determine the origin of the thickened gastric mucosal folds and whether the layers of the gastric wall were preserved .
eus showed that the thickening in the proximal body was confined to the mucosal layer and that the muscularis propria and serosal layers were normal .
whole - body gallium scan for the presence of neoplastic lesions was normal . since gastric lymphoma ,
especially mucosa - associated lymphoid tissue lymphoma , was considered in the differential diagnosis , the interleukin 2 receptor serum level was measured and found to be mildly elevated at 783 u / ml ( normal < 520 u / ml ) .
significant neutrophilic infiltration was seen in the mucosa , and there was no evidence of malignancy or cmv infection ( fig .
the ratio of gastric crypts to glands was not determined because that assessment required a deeper biopsy .
the absence of symptoms and the finding of normal serum albumin indicated that mntrier 's disease was unlikely , and the diagnosis of hypertrophic gastropathy associated with hp infection was considered .
the patient received hp eradication therapy consisting of 1 week of treatment using lansoprazole , amoxicillin and clarithromycin .
he underwent a barium examination 5 months later , which revealed normal gastric mucosal folds ( fig .
gastroscopy showed that the thickened gastric mucosal folds previously seen in the proximal body were normal ( fig .
a repeat mucosal biopsy was negative for hp organisms , and the neutrophilic infiltration seen on the initial biopsy was minimal ( fig .
infection with hp is common , with about half of the world 's population harboring this bacterium in their stomach .
since hp infection is associated with important clinical diseases such as peptic ulcer disease , gastric lymphoma and gastric carcinoma , therapy is warranted for its eradication .
other conditions sometimes linked with hp infection include idiopathic thrombocytopenic purpura , iron deficiency anemia , scleroderma , idiopathic urticaria and migraine .
eradication therapy is generally recommended only for idiopathic thrombocytopenic purpura and unexplained iron deficiency anemia because evidence for association with hp is weak for the other conditions .
recently , hypertrophic gastropathy associated with hp has been proposed as an indication for treatment .
the dramatic improvement in gastric fold morphology and histology that was seen after eradication therapy in our patient provides additional support that patients with hp - associated hypertrophic gastropathy should be treated .
these patients may be at increased risk of gastric cancer , which underlines the importance of prompt treatment .
since hypertrophic gastric mucosal folds can be associated with many conditions , a thorough clinical and diagnostic evaluation is required to exclude other causes .
patients with mntrier 's disease are usually symptomatic and present with epigastric pain , vomiting , weight loss and low serum albumin level as a result of loss of proteins from the stomach .
patients with lymphoma and carcinoma commonly have anorexia and weight loss . in patients with zollinger - ellison syndrome
, the serum gastrin levels may be very high , multiple ulcers may be seen on gastroduodenoscopy , and abdominal imaging may show a tumor . hence , serum albumin level , total and differential leukocyte count ( eosinophilia in hypereosinophilic disorders ) , serum gastrin level , cmv serology and abdominal imaging ( cect , eus ) play an important role in the evaluation of patients with hypertrophic gastropathy .
our patient was asymptomatic , had a normal serum albumin and was tumor - free on imaging , which indicated that the conditions considered in the differential diagnosis were less likely .
the definitive diagnosis is derived from histological examination of the gastric mucosa , and therefore biopsy , preferably using a sufficiently large forceps to obtain a deep sample , is crucial .
mntrier 's disease is characterized by foveolar hyperplasia and scanty parietal cells , lymphoma and carcinomas manifest infiltration by neoplastic cells , inclusion bodies may be seen with cmv infection , and eosinophilic gastroenteritis shows infiltration with eosinophils .
evidence of hp infection by itself may not be sufficient to establish a cause - effect relationship with hypertrophic gastric folds .
the significant neutrophilic infiltration of the mucosa , exclusion of other causes and the resolution of thickened gastric mucosal folds and inflammation after bacterial eradication therapy in our patient strongly suggested that hp was the cause of his hypertrophic gastropathy .
there are also a few case reports describing the association of hp with lymphocytic and granulomatous gastritis , indicating that hp can cause non - neoplastic enlarged gastric folds [ 11 , 12 ] .
bacterial components may induce a distinct cytokine profile that may promote cellular proliferation and enlargement of the gastric folds .
one report suggested that increased production of interleukin-1 beta and hepatocyte growth factor during hp infection may result in gastric fold thickening .
the mutagenicity of gastric juice is increased in patients with hp infection and enlarged gastric folds , which may explain the increased risk of cancer in these patients . in conclusion , hp infection should be considered in the differential diagnosis of patients with hypertrophic gastropathy because the infection is easy to treat and the outcome is gratifying . | infection with helicobacter pylori ( hp ) is common in many parts of the world . while most patients are asymptomatic , it causes peptic ulcer disease and malignancy in some of them .
other rare conditions have occasionally been reported in association with this infection .
we report a case of hypertrophic gastropathy caused by hp in a 52-year - old asymptomatic patient .
he was found to have marked enlargement of the gastric mucosal folds on radiological imaging and endoscopy .
a gastric mucosal biopsy showed hp colonization associated with neutrophilic inflammation .
after exclusion of neoplasia , other infections and infiltrative disorders , hp was thought to be the cause of the gastric fold hypertrophy .
the patient responded well to hp eradication therapy , with normalization of the gastric mucosal folds .
hp infection should be considered in the differential diagnosis of hypertrophic gastropathy and treated accordingly . |
the increased risk of stroke and coronary heart disease in patients with transient ischemic attack ( tia ) is well known .
transient neurological attacks ( tnas ) are attacks of transient ( < 24 hours ) nonfocal neurological symptoms .
tnas are generally considered more benign , but a recent study in unselected patients aged 55 years suggested that patients with tnas or patients with tias accompanied by nonfocal symptoms are at particularly high risk of cardiac events.1 , 2 consequently , transient nonfocal symptoms may serve as markers of cardiac dysfunction .
nterminal pro brain natriuretic peptide ( ntprobnp ) is an important biomarker of cardiac disease that is increased in patients with heart failure and atrial fibrillation.3 , 4
in this study , we aimed to assess whether serum ntprobnp levels were increased in patients with transient nonfocal symptoms .
patients were derived from the erasmus stroke study ( ess ) , which registered patients with cerebrovascular diseases who were admitted to the erasmus university medical center rotterdam from 2005 to 2010 .
we included all patients with tna , tia accompanied by nonfocal symptoms , cardioembolic tia , and tia with largevessel etiology who were admitted between march 2007 and october 2009 and 46 age and sexmatched strokefree control participants .
cardioembolic and largevessel tias were defined with the toast ( trial of org 10172 in acute stroke treatment ) classification.5
tia was defined as a focal neurologic deficit of sudden onset lasting < 24 hours without signs of recent infarction on acute brain imaging .
nonfocal symptoms were defined as decreased consciousness , confusion , unsteadiness , jerking , nonrotatory dizziness , visual phenomena , cardiac or vegetative signs , paresthesia , and bilateral weakness .
attacks with a nonvascular pathogenesis like typical migraine aura , epileptic insult , hypoglycemia , drug intoxication , traumatic injury , and mnire 's disease were excluded . all events and etiology of tia
the blood samples were collected from a peripheral vein within 1 week , with a median of 2 days ( interquartile range 1 to 3 days ) , and kept at room temperature for 20 minutes to allow clotting .
the samples were then centrifuged for 15 minutes at 4000 g , and the serum was isolated and stored at 80c until analysis .
the study was approved by the medical ethics committee and research board of the erasmus medical center .
differences between patient characteristics for different event types and controls were assessed with anova or chisquare test .
event groups were compared with anova , with patients with largevessel tia as a reference group .
adjustments for age , sex , atrial fibrillation , and history of nonischemic heart disease were made with a multiple linear regression model .
differences between patient characteristics for different event types and controls were assessed with anova or chisquare test .
event groups were compared with anova , with patients with largevessel tia as a reference group .
adjustments for age , sex , atrial fibrillation , and history of nonischemic heart disease were made with a multiple linear regression model .
a total of 174 patients with tia or tna were included . of these , 15 ( 9% ) had tna , 69 ( 40% ) had tia accompanied by nonfocal symptoms , 32 ( 18% ) had cardioembolic tia , and 58 ( 33% ) had largevessel tia .
patients with a cardioembolic tia were older and more often had a history of previous nonischemic heart disease and atrial fibrillation .
those with tia accompanied by nonfocal symptoms more frequently had a history of migraine and previous tia or ischemic stroke ( table 1 ) .
patient characteristics af indicates atrial fibrillation ; dbp , diastolic blood pressure ; oac , oral anticoagulant ; sbp , systolic blood pressure ; tia , transient ischemic attack ; tnas indicates transient neurological attacks . visual phenomena ( 29% )
were the most common nonfocal signs , followed by nonrotatory dizziness ( 16% ) and unsteadiness ( 16% ) , as shown in table 2 .
types of nonfocal symptoms mean ntprobnp levels differed significantly among event groups ( figure ) .
mean ntprobnp levels were similar in the reference group of patients with largevessel tias and in healthy control participants ( 14.2 pmol / l versus 9.3 pmol / l ; 95% ci 0.343 to 1.657 pmol / l p=0.193 ) .
compared with the reference group , the mean ntprobnp level was significantly higher in patients with cardioembolic tia ( 123.5 , 95% ci 0.1570.807
pmol / l ; p=0.004 ) and in patients with tia accompanied by nonfocal symptoms ( 40.5 , 95% ci 0.0010.349
pmol / l ; p=0.049 ) after adjustment for age , sex , atrial fibrillation , and a history of nonischemic heart disease .
patients with tna also had higher ntprobnp levels than the reference group , but this difference was not statistically significant ( 20.8 , 95% ci 0.436 to 0.168 pmol / l , p=0.38 ) .
ntprobnp indicates nterminal pro brain natriuretic peptide ; tia , transient ischemic attack ; tna , transient neurological attack .
in this study , we found that ntprobnp levels were increased in patients with tia accompanied by nonfocal symptoms and in those with cardioembolic tia .
patients with tna also had higher ntprobnp levels , but this was not statistically significant .
our results provide further proof that transient nonfocal symptoms may be associated with cardiac disease . in line with earlier studies , high ntprobnp
was significantly related to tia or stroke with cardiac origin.6 , 7 , 8 , 9 , 10 , 11 as far as we know , this study is the first that assessed ntprobnp in patients with tia accompanied by nonfocal symptoms and tna .
first , the study comprised a small number of patients , thus we were not able to perform subgroup analyses based on type of nonfocal symptoms .
second , the group of patients with tna may compose a selected group of patients .
patients with tna do not always consult a physician , and they will not always be referred to the outpatient clinic .
third , because neurologists are conditioned to look for focal symptoms , nonfocal symptoms may have been missed .
consequently , patients with tia accompanied by nonfocal symptoms could have been included in the group of patients with cardioembolic origin and largevessel disease .
this may explain the lower levels of ntprobnp found in our study compared with previous studies that assessed ntprobnp on admission.7 , 9 , 10 , 11 we considered a multivariable analysis to correct for all other significant differences among the comparison groups .
of these significant differences , only increased age , previous heart failure , and previous atrial fibrillation can cause elevated levels of natriuretic peptide.4
at present , it is unclear how transient nonfocal symptoms should be managed in clinical practice .
cardiac rhythm and conduction disorders , heart failure , or ischemic heart disease may lead directly to nonfocal symptoms by causing a sudden reduction in cerebral blood flow or indirectly cause them by anxietyinduced hyperventilation.12 , 13 furthermore , cardiac arrhythmia or a fall in blood pressure may cause a sudden reduction in blood flow in a stenosed extracranial or intracranial artery , resulting in nonfocal symptoms or a combination of nonfocal and focal changes .
| backgroundtransient nonfocal neurological symptoms may serve as markers of cardiac dysfunction .
we assessed whether serum nterminal pro brain natriuretic peptide ( ntprobnp ) levels , a biomarker of cardiac disease , are increased in patients with transient ischemic attack ( tia ) accompanied by nonfocal symptoms and in patients with attacks of nonfocal symptoms ( transient neurological attack [ tna]).methods and resultswe included 15 patients with tna , 69 with tia accompanied by nonfocal symptoms , 58 with largevessel tia , 32 with cardioembolic tia , and 46 age and sexmatched healthy control participants .
serum ntprobnp levels were determined within 1 week after the attack .
we compared logtransformed ntprobnp levels of patients with cardioembolic tias and mixed or nonfocal tnas , with those of patients with noncardioembolic tias as a reference group .
adjustments for age , sex , atrial fibrillation , and a history of nonischemic heart disease were made with a multiple linear regression model . compared with largevessel tia ( mean 14.2
pmol / l ) , mean ntprobnp levels were significantly higher in patients with tia accompanied by nonfocal symptoms ( 40.5 pmol / l , p=0.049 ) and with cardioembolic tia ( 123.5 pmol / l ; p=0.004 ) after adjustments for age , sex , atrial fibrillation , and a history of nonischemic heart disease .
patients with tna also had higher mean ntprobnp levels ( 20.8 pmol / l , p=0.38 ) than those with largevessel tia , but this difference was not statistically significant.conclusion
ntprobnp levels are increased in patients with tia accompanied by nonfocal symptoms . |
in marseille during january march 2011 , a total of 11 cases of hev infection were confirmed by anti - hev igm testing and detection of hev rna in serum samples .
eiagen assays ( adaltis italia , casalecchio di reno , italy ) were used to detect anti - hev igm and igg .
additional anti - hev igm testing was performed by using the assure hev igm rapid test ( mp biomedicals , illkirch , france ) and the recomline hev igg / igm test ( mikrogen diagnostik , neuried , germany ) .
hev rna was detected by using a real - time reverse transcription pcr targeting open reading frame ( orf ) 2 ( 2 ) .
the mean age of the case - patients was 57 years ( 11 years ) .
of the 11 case - patients , 10 were male and 3 were kidney transplant recipients ( table 1 , table 2 ) .
hev infection was clinically asymptomatic in all transplant recipients ; the infection was diagnosed after routine posttransplant laboratory tests showed elevated levels of liver enzymes .
5 ) , and an 80-year - old case - patient died 9 weeks after disease onset . * italics indicate results for contacts of case - patients .
hev , hepatitis e virus ; i d , identification ; eia , enzyme immunoassay ; ct , cycle threshold ; na , not applicable .
2 .
tested on a serum sample collected on march 3 , 2011 .
hev , hepatitis e virus ; i d , identification ; alt , alanine aminotransferase ; na , not available .
# contact ( sister ) of case - patient no.2 .
* * kidney transplant recipient .
phylogenetic analysis ( 2 ) showed that 4 patients each had hev genotype 3c or 3f ( technical appendix figure 2 ) .
, 8) showed 99.8% identity ; for other pairwise comparisons , maximal identity was 93.4% ( mean 83.6% ) .
we could not recover hev 5-orf2 rna from the serum of 3 case - patients ( nos . 1 , 2 , 6 ) .
for case - patient 6 , this could be explained by a low viral load . when targeting orf1 and 3-orf2 , we recovered hev genotype 4 ( hev-4 ) from serum samples from case - patients 1 and 2 ( figure ; technical appendix figure 3 ) ( 5,10 ) .
molecular testing results for these samples were checked in duplicate and by testing different serum samples from the same case - patients .
hev-4 rna from the 2 case - patients showed 100% identity for orf1 and 99.8% identity for orf2 .
the next closest match ( 96.7% identity ) was the first hev-4 rna in swine reported in europe ( genbank accession no .
hq857384 ) ( figure ) ( 8) . the next 2 closest matches ( 91.0%91.3% identity )
were recovered from swine in china ( genbank accession nos . eu676172 and dq279091 ) ( figure ) .
however , the sequences showed only 86.0% identity with a genotype 4f hev rna recovered from a patient in germany ( 9 ) .
phylogenetic tree based on partial ( 186 nt ) sequence of the 5 end of open reading frame 1 of the hepatitis e virus ( hev ) genome ( nt 133318 ; genbank accession no .
boldface indicates sequence with the highest blast scores ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) ; red ( italics ) indicates sequences obtained from a swine in belgium with hev genotype 4 ( 8) and a human in germany with autochthonous hev infection ( 9 ) ; blue ( underlining ) indicates sequences obtained from humans in marseille , france , during january march 2011 ; black dots indicate patients who ate uncooked pig liver sausage .
reference sequences ( rf ) with known genotypes and subtypes are indicated ( 6 ) .
numbers on right indicate genotype . for sequences from this study , nucleotide alignments were performed by using clustalx version 2.0 ( www.clustal.org/download/current ) .
the tree was constructed by using mega4 ( www.megasoftware.net ) and the neighbor - joining method as described ( 2 ) .
branches were obtained from 1,000 resamplings of the data ; those with bootstrap values > 50% are labeled on the tree .
hev sequences are labeled with genbank accession number , host , country where isolated , and collection or submission date .
hu , human ; vnm , vietnam ; bbh , best blast hit ; sw , swine ; chn , china ; bel , belgium ; pt , patient ; jpn , japan ; deu , germany ; ind , india ; rb , rabbit ; esp , spain ; nld , the netherlands ; usa , united states ; gbr , united kingdom ; av , avian .
none of the 11 case - patients had traveled abroad during the 29 weeks before hepatitis onset . of the 11 case - patients , 6 ( 55% ) , including the 2 with hev-4 , ate uncooked pig liver sausage ( figatelli ) ( table 2 ) .
the 2 patients with hev-4 were not related . because 4 contacts of the 2 hev-4infected case - patients also ate some of the figatelli eaten by the case - patients ( table 1 , table 2 ) , we investigated whether these contacts had markers for hev infection .
test results for anti - hev igm were positive for the wife of case - patient 1 and a friend of case - patient 2 ; the hev pcr result was barely positive for contact 1a , who had an elevated level of alanine aminotransferase ( 165
we report a concurrent rise in testing for and diagnoses of hev infections in marseille during january march 2011 . this rise may reflect increased clinician awareness of hev or an increased incidence of hev infection that may have resulted from the use of improved tools for hev diagnosis .
in industrialized countries , hev has increasingly been recognized as a possible cause of hepatitis in diverse clinical settings , including in solid - organ transplant recipients . in our study , 3 ( 27% ) of the case - patients were solid - organ transplant recipients .
this number suggests a high incidence of hev infection among transplant recipients in the geographic area we studied , and it is consistent with the incidence ( 3.2/100 person - years ) of hev infection among organ transplant recipients in toulouse in southwestern france ( 4 ) .
liver biochemical testing is routinely performed after organ transplantation ; such testing enabled the detection of subclinical hev infection in the 3 transplant recipients reported here .
subclinical hev infection can also occur in immunocompetent persons ( 1,11,12 ) ; thus , we question whether the incidence of hev infection among transplant recipients in southern france might reflect that in the general population . moreover ,
52% of adult blood donors sampled in southwestern france in 20032004 were retrospectively shown to be hev seropositive by using a newly available assay ( 4 ) , and hev was retrospectively shown to be an underdiagnosed cause of liver injury in the united states and united kingdom ( 13 ) .
a considerable proportion of hev infections in southern france may be linked to the consumption of uncooked figatelli , which has been identified as a source of zoonotic foodborne hev transmission ( 2,4 ) . in our study ,
55% of the hev - positive patients reported eating uncooked figatelli , and in another study in france , 2 hev - positive patients reported eating uncooked figatelli ( 11 ) .
these cases indicate insufficient prevention of hev transmission to humans through uncooked figatelli consumption ( 2 ) .
the major finding in our study was the recovery of hev-4 sequences from 2 of 6 case - patients who ate uncooked figatelli purchased in southern france .
these sequences were closely related to the sequence for the first - reported hev-4 rna in swine in europe ( 8) , which was recovered in belgium and classified as genotype 4b .
hev-4 is indigenous to asia , where it has been recovered from pigs and humans ( 1,6,14 ) .
for the 2 hev-4 rna sequences obtained in our study , the best matches among sequences from asia were from hev strains from swine in china . since its first report in china in 1999 , hev-4 has been increasingly described as endemic in pigs and involved in most sporadic cases of hepatitis e ( 1,14 ) .
several hev subtypes have been described in china , including subtype 4b ( 1,6,14 ) . in europe ,
autochthonous infection with a genotype 4f hev in a person in germany was reported in 2008 ( 9 ) , and a case of hev-4 infection acquired in india was reported for a person in england in 2010 ( 15 ) .
studies in china have shown relatedness between hev-4 sequences recovered from humans and swine in the same geographic area , which suggests zoonotic transmission ( 1 ) .
moreover , sequences for hev-4 rna recovered from a father and son in japan who ate barbecued pig meat were almost identical , and sequences were identical for hev-4 rna from packaged pig liver sold in a grocery store and from a patient in whom hev infection developed after the person ate grilled pig liver ( 1,2 ) . together with previous findings ,
our results bring up the question as to whether hev-4 was introduced into domestic pigs or whether pig meat of asian origin was introduced into france .
moreover , it prompts a study of whether hev-4 strains circulate and spread in europe as an effect of globalization of hev zoonosis .
monitoring of serum samples tested and positive anti hepatitis e virus ( hev ) igm and hev rna test results and phylogenetic trees based on a partial sequence of open reading frame 2 and a partial nucleotide sequence of the 3 end of open reading frame 2 of the hev genome . | during january march 2011 , diagnoses of hepatitis e virus ( hev ) infection increased in marseille university hospitals in southeastern france .
hev genotype 4 , which is described almost exclusively in asia , was recovered from 2 persons who ate uncooked pork liver sausage .
genetic sequences were 96.7% identical to those recently described in swine in europe . |
acute abdominal pain is one of the most common conditions encountered in the emergency department ( ed ) .
the clinical diagnosis of acute abdominal pain is unreliable , resulting in both negative laparotomies , as well as ill - advised surgical delay in a large number of patients .
new and emerging imaging techniques offer a non - invasive way to decrease both false - negative and false - positive diagnoses in this category of patients .
symptomatic isolated superior mesenteric artery dissection ( sismad ) may cause segmental ischemic enteritis ischemic enteritis .
until recently sismad in the absence of abdominal aorta dissection has been considered an exceptionally rare pathology , with only 26 cases published before 2000 . in such cases modern diagnostic imaging techniques
can identify sismad , which seems to be more frequent than previously thought and has gained more space in medical literature .
a 57-year - old male patient , with no medical history or cardiovascular risk factors presented to the emergency department ( ed ) in december 2015 with moderate ( on verbal rating scale ) diffuse abdominal pain , repeated vomiting and two non - bloody watery stools .
the physical examination revealed blood pressure of 130/70 mmhg , heart rate of 80 , respiration rate 18 , temperature 36.6c .
the abdomen was slightly distended with epigastric and left middle quadrant tenderness without peritonitic signs .
blood test showed inflammatory syndrome ( crp 11.98 mg / dl , esr 65 mm / h , fbg 759.1 mg / dl ) , the white blood cell count was 8.1109/l , hemoglobin was 14 g / dl , neutrophils were at 92% , and amylase / lipase / lactate / liver function tests were within normal limits .
thus , in this case of a middle - age man suffering from moderate abdominal pain , with no fever or leukocytosis the current guidelines for diagnosis and management of abdominal pain were applied , and further investigation was guided using american college radiology appropriateness criteria . the plain abdominal x - ray was not modified .
ultrasound of the abdomen ( ge logiq s6 with convex transducers of 3.56 mhz and linear ones of 712 mhz ) revealed a jejunal wall thickening of 7.5 mm , with a length of 6.6 cm ( figures 1 a , b , c ) and preserved bowel movements . around the thickened wall
the color duplex sonography examining abdominal vascularization showed a superior mesenteric artery ( sma ) with normal root and physiological flux vmax 0.86m / sec .
the acute onset of the clinical complaints and the ultrasound findings were suggestive for an acute enterocolitis of infectious or inflammatory origin .
the fecal occult blood test was positive . in order to exclude a neoplasia or an ischemic process contrast - enhanced computed tomography ( ct )
contrast - enhanced ct scan confirmed the small bowel circumferential thickening with no free fluid or gas and a normal appendix .
ct scan also showed a dissection of the sma starting at approximately 1.8 cm from root and extending to the origin of the first branches ; three of the jejuno - ileal branches and the right colic arteries had a contrast filling defect and were slightly dilated suggesting the presence of intraluminal thrombosis ( figure 2 ) .
we established the diagnosis of segmental ischemic jejunitis due to sismad . in the absence of peritonitis , we decided for a conservative management consisting of bowel rest with fasting until abdominal pain relief , surveillance of blood pressure , and antiplatelet therapy ( aspirin 75 mg / day ) .
given the segmental enteritis we associated a short term treatment with rifaximin ( 2200 mg / day ) and 5-asa derivate ( sulfasalazine 21g / day ) .
the patient s evolution was carefully monitored clinically , biologically and by daily abdominal ultrasound scan . during the next couple of days ,
abdominal ultrasound scan revealed the decrease of the jejunal wall thickness and physiological arterial flux in sma .
after 12 days of conservative therapy the leucocytes dropped to 4.1109/l with 70% neutrophils and inflammatory syndrome ( crp=0.53 mg / dl , esr=43 mm / h , fbg=552.7 mg / dl ) decreased significantly , occult stool blood test was negative . a month later ct angiography ( cta )
was performed showing a permeable sma until bifurcation with a non - permeable right branch ( fig 3 ) .
our case highlights the importance of correct clinical and imagistic evaluation of abdominal pain in emergency .
ischemic segmental enteritis could not have been diagnosed in the absence of abdominal ultrasound evaluation and sismad could not have been identified without contrast - enhanced ct scan to visualize the vascular pathology .
so both the accurate diagnosis and correct therapeutic intervention depend on the imaging techniques performed in the early stages of acute abdominal pain .
the dissection of sma associated with dissecting aortic aneurysm was described for the first time in 1947 by bauersfeld in autopsy reports . since then , new reports focusing on epidemiology , risk factors , clinical characteristics and treatment of this special entity have been published [ 48 ] mostly for asiatic population . if in 2013 , luan et al .
identified 296 published cases of sismad all over the world , three years later 622 cases were found in china only . from these reports
we have learned that sismad most commonly occurs in middle aged ( mean age 55.4 years , ranges from 30 to 80 years ) males ( 88% ) presenting in emergency for the sudden onset of abdominal pain .
no specific underlying cause of sismad was identified in the majority of reports , even though some authors suggested arterial wall pathology such as cystic medial necrosis , arterial mediolysis or adventitial inflammation , disruption of the internal elastic lamina might cause sismad .
park et al . hypothesized that sismad develops due to abnormal hemodynamic force caused by convex curvature of the sma .
a computer simulation model identified abnormal mechanical stresses on the anterior wall of the sma , in the transition zone from a fixed to a relatively mobile portion of the artery .
the abdominal pain resembles the one found in intestinal ischemia ( acute or chronic ) , but in the absence of cardiovascular risk factors .
yun has suggested that the distention of periarterial nerve fibers induces pain , independently of bowel ischemia . a direct correlation between severity of pain and length of dissection has been observed . in our case , marked improvement of clinical symptoms simultaneous to the reduction of jejunal wall thickness incriminates the bowel ischemia as the cause of abdominal pain . in the emergency department ,
the ultrasound revealed a thickened small bowel wall with preserved color - flow doppler signals which were suggestive for an acute enteritis .
the ultrasound examination of the ischemic bowel reveals a thickened wall and the absence of color - flow doppler signals , and a dilated lumen .
doppler ultrasound can demonstrate a proximal occlusion in the main superior mesenteric artery or vein , but is limited in assessing branch vessels , particularly in the presence of distended , gas filled and/or aperistaltic bowel loops .
acute infectious enteritis , on the other hand , rarely requires diagnostic imaging , but if performed , the ultrasound findings demonstrate a thickened small bowel wall , with preserved stratification , increased peristalsis and hypervascularity on color doppler imaging .
the wall thickening associates enlarged regional mesenteric nodes , different from mesenteric inflammatory changes seen in crohn s disease . as for the possible diagnosis of neoplasia
, the great majority of the small bowel tumors are localized in the duodenum and terminal ileum ; they are characterized by loss of stratification and sometimes dilatation of the intestine in the affected area .
although ultrasound imaging is a powerful tool to diagnose acute mesenteric ischemia , contrast - enhanced ct is the investigation of choice for sismad .
characteristic ct findings include thrombosis of the false lumen , intramural hematoma , and/or intimal flap . in our case ,
contrast enhanced ct and cta were concordant showing a dissection of the sma from the root to the origin of the first branches associating thrombosis of the three jejuno - ileal branches and of the right colic arteries .
arteriography is recommended only when endovascular treatment is required . how to determine which symptomatic patient can be treated conservatively and which requires intervention ? to ease the therapeutic decision two classifications of sismad : yun and luan and a therapeutic algorithm were proposed .
the aim of treatment for sismad is to limit the progression of the dissection , to prevent the rupture of the false lumen , and to preserve the distal blood perfusion through the true lumen .
the conservative measures include fasting , parenteral nutrition , blood pressure control , and antiplatelet therapy . in terms of anticoagulation therapy in sismad ,
some authors have advocated its use to prevent thrombus propagation , while others have not .
anticoagulation can prevent false lumen thrombosis at the dissected sma , and thus promote further propagation of dissection .
moreover , yun et al showed no significant difference between the patients who received anticoagulants and those who did nt , in terms of treatment outcomes .
thus , we decided to adopt a conservative treatment based on antiplatelet therapy continued after discharge , without the use of anticoagulants .
the contrast - enhanced ct and the cta revealing aneurysmal dilation of the sma larger than 2 cm or severe compression of the true lumen ( more than 80% compared with adjacent normal sma diameter ) are firm indications for endovascular stenting .
our patient had a favorable evolution with the relief of the symptoms within two days , explained by the presence of intestinal collateral circulation .
the collateral circulation of the gastrointestinal system can compensate for approximately a 75% acute reduction in mesenteric blood flow for up to 12 h , without substantial injury .
the presence of arterial doppler signal in the intestinal wall and the absence lactate increase and/or metabolic acidosis are witnesses of a mild ischemic jejunitis .
in conclusion , in a man in his sixth decade with acute abdominal pain and transient segmental jejunitis ( diagnosed by clinical and ultrasound criteria ) sismad should be taken into account as possible diagnosis .
contrast - enhanced ct and/or cta should be considered in the early stage for an accurate diagnosis .
we observed a benign clinical course after conservative treatment even without anticoagulant treatment , with no progression of sismad on follow - up ct . | acute abdominal pain is one of the most common conditions encountered in the emergency department .
the differential diagnosis of acute abdominal pain is extensive and identifying the underlying etiology can be challenging .
we report a case of acute transient ischemic jejunitis due to symptomatic isolated superior mesenteric artery dissection in a patient with no cardiovascular risk factors or autoimmune diseases .
symptomatic isolated superior mesenteric artery dissection is a rare cause of acute abdominal pain usually treated in the surgical department .
the patient had criteria for conservative treatment and rapidly recovered .
we highlight a rare condition which should be taken into account for the differential diagnosis of acute abdominal pain . |
the incidence , severity , and resulting mortality of clostridium difficile infection are increasing worldwide . in spite of the considerable increase in the incidence and severity of c. difficile infection ,
metronidazole is generally used for mild and moderate c. difficile infection , but treatment failure is a growing problem .
furthermore , antibiotic therapy has recurrence rates of at least 20% , which increase with each subsequent c. difficile infection .
els van nood et al . reported that in patients with recurrent c. difficile infection , fecal transplantation resulted in better treatment outcomes compared with conventional antibiotic treatment .
fecal transplantation had a cure rate of 81.3% following a single nasoenteric infusion and 93.8% following a second infusion , while standard vancomycin therapy with or without bowel lavage had a 23.1 - 30.8% cure rate .
fecal transplantation may be a treatment option for recurrent c. difficile infection ; moreover , it may be an early treatment option for severe c. difficile infection .
in korea , two cases of severe refractory c. difficile infection treated with fecal transplantation during an initial episode have been reported .
, we report the first case of severe initial c. difficile infection , refractory to antibiotics , that was treated with fecal transplantation using a nasoenteric tube in korea .
a 65-year - old man visited the emergency room with a 3-day history of bilateral leg weakness and fever .
his blood pressure was 86/43 mmhg , and his body temperature was 39.3 at presentation .
he had a history of hypertension and recent surgery for lumbar spinal stenosis three months before admission .
initial peripheral blood count showed a white blood cell count of 4,710/mm ( neutrophils , 92.2% ; lymphocytes , 5.2% ; monocytes , 1.4% ) , hemoglobin level of 11.3 g / dl and platelet count of 137,000/mm .
prothrombin time ( pt ) and activated partial thromboplastin time ( aptt ) were 13.2 sec and 34.8 sec , respectively , and c - reactive protein level was 286.06 mg / l .
blood chemistry showed a total protein level of 5.1 g / dl , albumin level of 2.9 g / dl , total bilirubin level of 0.5 mg / dl , aspartate aminotransferase / alanine aminotransferase 27/17
iu / l , bun / cr 56.6/2.42 mg / dl , na / k 138/4.1 meq / l and ca / p 7.6/2.7 mg / dl .
lumbar magnetic resonance imaging ( mri ) was performed and revealed infective spondylitis and multiple paraspinal abscesses .
the patient received empiric intravenous antibiotic treatment with 2.0 g ceftriaxone every 24 hours and 200 mg teicoplanin every 24 hours after peripheral blood culture and urine culture .
streptococcus intermedius was identified in all three initial blood cultures , and the minimal inhibitory concentration ( mic ) for penicillin g was 0.016 g / ml .
antibiotics were changed to 4 million units penicillin g every 4 hours . on the 35th hospital day , he had urinary tract infection and bacteremia from an extended - spectrum beta - lactamase ( esbl ) organism and was treated with 500 mg imipenem every 6 hours . on the 59th hospital day ,
during conservative treatment for infective spondylitis , the patient developed a fever of 38.1 and diarrhea ; his blood pressure was 89/58 mmhg .
due to suspicion of c. difficile infection , oral 500 mg metronidazole was given every 8 hours empirically .
stool c. difficile toxin a / b and culture were confirmed to be positive . on the 60th hospital day , laboratory results revealed a white blood cell count of 39,560/mm ( neutrophils , 89.4% ; lymphocytes , 6.2% ; monocytes , 2.8% ) , hemoglobin level of 11.8 g / dl , platelet count of 292,000/mm , bun / cr of 18.0/0.65 mg / dl , and albumin level of 1.8 g / dl . on the 61st hospital day , oral metronidazole
was switched to 250 mg oral vancomycin every 6 hours due to increased severity of diarrhea and the detection of paralytic ileus on abdominal x - ray despite administration of oral metronidazole .
intravenous metronidazole ( every 8 hours ) and vancomycin enema 500 mg ( every 6 hours ) were also added to the treatment course .
unfortunately , symptoms did not improve , and disseminated intravascular coagulation ( dic ) progressed although leukocytosis was improved . on the 74th hospital day
, laboratory results showed a white blood cell count of 3,240/mm ( neutrophils , 71.0% ; lymphocytes , 20.1% ; monocytes , 6.8% ) , a hemoglobin level of 7.8 g / dl , platelet count of 67,000/mm , pt / aptt of 22.6 sec/65.4 sec , albumin level of 1.9 g / dl and c - reactive protein level of 77.2 mg / l .
the patient 's wife , who had no relevant medical history and no symptoms of acute disease , was selected as the donor . on the 75th hospital day
the tip of a nasoenteric tube was placed in the third portion of the duodenum by egd .
fifty grams of stool collected from the donor was diluted with 500 ml normal saline and the supernatant was filtered out with gauze .
this solution was placed into the feeding bag and infused through a nasoenteric tube for 30 minutes ( fig .
2 ) . on the 84th hospital day , 9 days after fecal transplantation , laboratory test results were as follows : white blood cell count 6,280/mm ( neutrophils , 65.3% ; lymphocytes , 24.2% ; monocytes , 5.3% ) , hemoglobin 8.1 g / dl , platelets 224,000/mm , pt / aptt 14.8 sec/34.4 sec and albumin 2.7 g / dl .
the patient 's diet was slowly advanced , and oral vancomycin was tapered to 125 mg every 12 hours .
on the 94th hospital day , the patient was discharged with oral vancomycin after his symptoms had resolved .
when he visited outpatient clinic 12 days after discharge , he had no symptoms of pmc ; therefore , oral vancomycin was discontinued .
the destruction of normal intestinal flora after antibiotic use is the likely cause of most c. difficile infections .
reestablishment of normal gut flora makes fecal transplant a logical treatment option for c. difficile infection .
els van nood et al . reported that the decreased microbial diversity of infected patients recovered to the level of the donors after fecal transplantation .
in current clinical practice , fecal transplantation is indicated for recurrent c. difficile infection and severe infection with no response to standard antibiotic therapy . the efficacy of fecal transplantation in recurrent c. difficile infection has been established in many case reports and meta - analyses and one recent randomized controlled study .
there is a lack of data supporting fecal transplantation use in severe or fulminant c. difficile infection , but emerging data indicate that fecal transplantation is also effective in such cases .
one recent retrospective study reported the effectiveness of fecal transplantation in 14 patients with severe , refractory c. difficile infection .
patients were categorized as having severe c. difficile infection if they met two or more of the following criteria : age > 60 years , serum albumin < 2.5mg / dl , body temperature > 38.3 , or a white blood cell count > 15,000/mm within 48 hours of diagnosis ; or if they met one of the following criteria : endoscopic evidence of pseudomembranous colitis or treatment in the intensive care unit for c. difficile infection .
refractory infection was defined as non - resolution of c. difficile infection despite 7 days of therapy with oral vancomycin .
because of its cost effectiveness , high cure rate , minimal risk and reestablishment of normal flora , fecal transplantation has even been proposed as the initial treatment modality for severe c. difficile infection . in korea ,
two cases were recurrent c. difficile infections , and the other two cases were refractory c. difficile infections .
two cases used egd and infused stool via the biopsy channel of egd . the other two cases used enema . in all four cases , c. difficile infection resolved .
one patient who received egd experienced vomiting , and another patient who received enema had mild diarrhea after fecal transplantation . in our case
, we used a nasogastric tube placed in the third portion of the duodenum by egd to perform the fecal transplantation .
fecal transplantation can be performed using a nasogastric tube , nasoenteric tube , egd , colonoscopy , flexible sigmoidoscopy , or enema .
two review studies compared fecal transplantation outcomes based on the route of administration of donor feces .
one systematic review reported that fecal transplantation by egd or nasoenteric tube had a lower resolution rate than that by colonoscopy and enema ( 76.4% vs > 88.7% ) .
most patients received treatment or preparation before fecal transplantation ; therefore , estimating the effect of fecal transplantation alone was difficult .
the other review study compared colonoscopic fecal transplantation with nasogastric fecal transplantation from 12 published studies .
colonoscopic fecal transplantation had a superior resolution rate ( 93.2% ) compared with nasogastric fecal transplantation ( 85.3% ) , but the difference was statistically nonsignificant .
there has been no randomized , controlled trial comparing outcomes based upon the route of administration of fecal transplantation .
transient gi symptoms are common , including decreased bowel movement , abdominal cramping , increased bowel sounds and abdominal discomfort . in fecal transplantation via the upper gastrointestinal tract , the risks of aspiration and vomiting should be considered .
the colonoscopic approach could be dangerous in patients with severe colitis or colonic distension . a randomized controlled study by els van nood et al .
reported acute adverse events including diarrhea ( 94% ) , cramping ( 31% ) and belching ( 19% ) in nasoenteric infusion , but these symptoms improved within 3 hours .
generally , oral vancomycin is stopped before fecal transplantation ; however , oral vancomycin was continued and tapered in our case due to concerns regarding the potential failure of fecal transplantation .
nevertheless , we are confident that fecal transplantation resulted in the resolution of c. diffcile infection because the patient exhibited no improvement during the previous 14 days of oral vancomycin therapy , but recovered dramatically after fecal transplantation . in conclusion , fecal transplantation could be a viable treatment option not only for recurrent c. difficile infection , but also for severe initial infection .
further investigation is required to establish the optimal method of fecal transplantation and to ensure long - term safety . | the incidence of clostridium difficile infection is increasing worldwide , and its severity and resulting mortality are also on the rise .
metronidazole and oral vancomycin remain the treatments of choice , but there are concerns about treatment failure and the appearance of resistant strains .
furthermore , antibiotic therapy results in recurrence rates of at least 20% .
fecal transplantation may be a feasible treatment option for recurrent c. difficile infection ; moreover , it may be an early treatment option for severe c. difficile infection .
we report a case of severe c. difficile infection treated with fecal transplantation using a nasoenteric tube during an initial episode .
this is the first reported case of fecal transplantation using a nasoenteric tube during an initial episode of c. difficile infection in korea . |
extramammary paget disease ( empd ) is similar histologically to paget disease of the breast and predominantly affects external genitalia .
secondary empd disease is defined as a neoplasia of a non - cutaneous tissue , the associated malignancy is frequently anal and/or rectal adenocarcinoma with involvement of the anogenital skin .
histologically , primary or cutaneous empd is defined as a non - invasive intra - epidermal adenocarcinoma that can spread into neighbouring epithelial glandular appendices .
there are several treatment modalities described in the management of empd including surgery , chemotherapy and irradiation with variable curative rates .
surgery is the first - line treatment ; however , surgical margins are frequently positive , resulting in high recurrence rates after surgery .
imiquimod ( aldara , 3 m health care limited ) is an immune stimulator that is highly effective in the treatment of vulval intra - epithelial neoplasia .
growing evidence is beginning to suggest a role for imiquimod 5% cream in empd , particularly empd of vulval origin , in achieving disease - control or complete response .
however , limited evidence exists for the treatment of primary empd of the perianal region with imiquimod . in this case report , we present a female patient of 40 years old with perianal empd , treated with imiquimod 5% cream .
a 40-year - old woman presented to the dermatology outpatient clinic with a 2-year history of a painful rash in the perianal region associated with pruritus and erythema .
her medical history included erythema nodosum , polycystic ovary disease and a body mass index ( bmi ) > 30 . on examination ,
2b ) showed malignant cells in the epidermis , staining positively for ck7 and ema .
( b ) appearance of rash following 5 weeks and ( c ) 16 weeks of treatment with 5% imiquimod cream , demonstrating stepwise improvement .
( d ) appearance of perineum at 6-month follow - up following completion of treatment .
figure 2:(a ) initial punch biopsy of the perianal lesion demonstrated a well - demarcated erosive lesion with associated fibrin deposition and acute inflammation .
( b ) following the 16-week course of imiquimod cream , repeat biopsies demonstrated chronic inflammation with epidermal reaction and prominent vascular proliferation , but no evidence of empd . both produced with haematoxylin & eosin staining .
( b ) appearance of rash following 5 weeks and ( c ) 16 weeks of treatment with 5% imiquimod cream , demonstrating stepwise improvement .
( d ) appearance of perineum at 6-month follow - up following completion of treatment .
( a ) initial punch biopsy of the perianal lesion demonstrated a well - demarcated erosive lesion with associated fibrin deposition and acute inflammation .
( b ) following the 16-week course of imiquimod cream , repeat biopsies demonstrated chronic inflammation with epidermal reaction and prominent vascular proliferation , but no evidence of empd . both produced with haematoxylin & eosin staining .
scale bar 500 m ( a ) and 200 m ( b ) . breast and gynaecological
examinations of the patient were normal , while a colonoscopy did not identify any evidence of extramammary bowel disease . a computed tomography ( ct ) chest , abdomen and pelvis demonstrated subcutaneous inflammation of the right buttock but no evidence of disease spread beyond the perianal skin . due to her elevated bmi and the perianal location of her empd ,
it was felt that the standard option of surgical resection by performing mohs micrographic surgery or wide local excision would be associated with a high risk of perioperative morbidity . the potential for local control in a disease with a well - described pattern for local recurrence , while avoiding potentially disfiguring surgery , was felt to be a viable alternative option .
a trial of imiquimod cream ( 5% ) was commenced with a regimen of one application each night for 5 days together with 2 rest days per week .
the rest period was used to allow time for any skin inflammation caused by imiquimod to settle .
analgesia ( paracetamol , diclofenac and tramadol ) was prescribed to provide pain relief for potential local skin reactions . on review at the first 2 weeks of treatment , the patient had tolerated the imiquimod 5% cream , with only two applications missed due to vomiting secondary to a viral infection . by week 5 , the area of erythema had visibly reduced , with a 1-cm rim of granulation tissue around its edge ( fig .
the patient 's progress was reviewed at 12 and 16 weeks , with a stepwise regression of the empd identified . at 16-week examination
further multiple , random punch biopsies of the perianal skin were taken 1 month later , which demonstrated variable evidence of chronic inflammation with epidermal reaction ( fig .
2c ) , but no residual empd . a follow - up mri of the pelvis 16 weeks after the discontinuation of treatment showed residual thickening consistent with inflammation at the site of previous subcutaneous nodules . a ct chest , abdomen and pelvis did not identify any distal empd deposits .
the patient remained in remission for 18 months , however inguinal lymphadenopathy was noted at this time and a biopsy demonstrated adenocarcinoma suggesting malignant transformation of her empd .
we describe the primary local treatment of perianal empd with imiquimod 5% cream over a 16-week period initially resulting in remission prior to lymph node spread at 18 months .
this provides further evidence , both in disease response and optimal treatment time , which imiquimod might potentially be considered as a first - line treatment for perineal empd .
imiquimod induces the immune response by activating macrophages and other inflammatory cells by increasing synthesis of pro - inflammatory cytokines while also producing distinctive apoptosis in epithelial cells . a retrospective case - series of 23 patients demonstrated up to 80% clinical response with imiquimod for empd of the vulva .
the clinical response appears to be related to duration of imiquimod therapy in weeks ; however , the optimal length of treatment time remains to be defined .
surgical resection of perianal empd is an invasive procedure associated with a high perioperative morbidity .
furthermore , the potential of disfiguring surgery and permanent stoma formation may have a profound psychological impact on the patient .
close monitoring of patients during the treatment period is particularly important , both to monitor response of empd to treatment and the side - effect profile experienced by patients secondary to topical imiquimod . following the completion of imiquimod treatment , biopsies are mandatory in order to assess residual disease , as recurrence is common .
longer term data regarding recurrence following topical therapy , and adequacy of subsequent surgical resection is awaited . in this case recurrence
was noted by palpable inguinal lymph nodes , with no skin or colonic lesion found .
this highlights the importance of regular follow - up in perineal empd , with a high clinical index of suspicion for relapse or malignant change .
developing an evidence - base for the use of imiquimod , as either first - line therapy or for disease recurrence , will be limited by the potential number of new empd cases .
an international register to collate data on each patient case should be considered to determine the optimal length of imiquimod treatment , together with the long - term follow - up of patients following treatment .
in addition , it may also aid the identification of patient cohorts most likely to respond to imiquimod therapy .
| extramammary paget disease ( empd ) is a rare perineal neoplasia associated with a high rate of local recurrence .
surgical excision is the standard treatment ; however , this has high rates of post - operative morbidity in combination with potentially mutilating results .
previous literature has demonstrated good response with imiquimod 5% cream in patients with vulval empd , yet its effectiveness in primary perianal disease is unknown.we describe the case of a 40-year - old woman presenting with empd of the perianal region , providing detailed histological and pictoral evidence of its response to topical imiquimod 5% cream over a 16-week period , which initially resulted in remission prior to metastatic lymph node recurrence .
this case demonstrates the potential for topical imiquimod cream to avoid major surgery and its associated complications in patients presenting with empd of the perianal region .
we discuss the current evidence for treating this rare condition with medical therapy , how this case adds to current literature and possible future directions . |
gastrointestinal duplication cysts ( gidc ) are rare congenital malformations that predominantly present before the age of 2 years .
they are infrequently found within the colon with only a small number having been described in adults .
colonic duplication cysts most commonly cause obstruction or perforation . we present the very rare case of a colonic duplication cyst causing bowel ischaemia in an elderly female .
a 74-year - old female , with a background history of hypertension and hypothyroidism , presented to the emergency department with a 6-h history of sudden onset generalized abdominal pain .
blood tests were normal except for a mild neutrophilia ( 7.5 10/l ) and lactate of 2.5 mmol / l .
a computed tomography ( ct ) scan of her abdomen and pelvis was performed which showed abnormal loops of small bowel along the right side of the abdomen with mesenteric fat stranding .
a partially calcified structure was noted lying medial to the loops of bowel ( figs 1 and 2 ) .
intraoperative findings revealed an ischaemic loop of small bowel wrapped around a mass in the mesentery adjacent to the sigmoid colon ( fig .
the patient underwent a partial small bowel resection with primary anastomosis and en - bloc resection of the mass with the formation of an end colostomy .
the final histological revealed a 6 4 4 cm cystic colonic duplication cyst separate but adjacent to the sigmoid colon .
the wall of the cyst was sclerotic with occasional lymphoid aggregates , smooth muscle and neurovascular bundles ( fig .
figure 1:axial ct scan showing a partially calcified structure adjacent to loops of small bowel .
figure 2:coronal ct scan showing a partially calcified structure adjacent to loops of small bowel .
figure 3:intraoperative image black arrow pointing to intra - abdominal calcified structure .
figure 4:haemolysin and eosin stain showing occasional lymphoid aggregates , smooth muscle and neurovascular bundles within the duplication cyst .
haemolysin and eosin stain showing occasional lymphoid aggregates , smooth muscle and neurovascular bundles within the duplication cyst .
gastrointestinal duplication cysts are rare congenital malformations the aetiology of which is not fully understood .
they are predominantly found in childhood with 6780% presenting before the age of 2 years [ 1 , 2 ] . to the best of our knowledge ,
they can occur at any point along the gastrointestinal tract from oral cavity to anus with the majority found within the abdominal cavity ( 75% ) .
they most commonly involve in the ileum ( 60% ) but can also occur in the stomach , oesophagus and colon .
duplication cysts are found adjacent to or within the gi tract and and consist of two types , cystic duplications ( 80% ) and tubular duplications ( 20% ) .
the cysts vary in size and have been reported as large as 20 15 cm .
multiple theories have proposed the reason for the development of gidc , recanalization , split notochord , environmental factors or presence of embryologic diverticula [ 47 ] .
colonic duplication cysts are rare and account for a very small percentage of duplication cysts .
the exact percentage is not fully known but one of the largest studies of 73 patients over a 22-year period found that gi duplication cysts accounted for 6.8% .
colonic duplication cysts are often asymptomatic but can present with abdominal pain , vomiting or bleeding .
however , our case demonstrates small bowel ischaemia as a rare complication of duplication cyst . in this case
, ischaemia resulted from a segment of small bowel becoming adherent to the cyst with resulting vascular compromise .
colonic duplication cysts can be identified using endoscopic ultrasound , ct or rarely contrast enema .
other case reports describe a cystic gas filled structure that may be identified on plain abdominal x - ray .
this is due the fact that intraoperatively , it is often difficult to differentiate duplication cysts from other causes of mesenteric masses . in our case ,
surgical resection is often only considered in those that are symptomatic , however , some would advocate removal due to the potential to avoid complications including the possibility of neoplastic transformation [ 9 , 10 ] . in conclusion ,
| colonic duplication cysts are rare congenital malformations that predominantly present before the age of 2 years .
we report the case of a 74-year - old lady who presented with sudden onset abdominal pain .
a computed tomography scan noted a calcified structure adjacent to abnormal loops of bowel .
intraoperative findings revealed an ischaemic loop of small bowel wrapped around a mass in the mesentery adjacent to the sigmoid colon .
final histology revealed a colonic duplication cyst .
colonic duplication cysts are rare entities that most commonly cause obstruction or perforation .
we present the very rare case of a colonic duplication cyst causing bowel ischaemia in an elderly female . |
vestibular - dependent myogenic responses to intense sound were first described by bickford et al . , in 1964 . in 1994 ,
colebatch , halmagyi , and skuse established a reliable procedure to record myogenic potentials from the sternocleidomastoid ( scm ) muscle evoked by clicks .
a biphasic positive negativity ( p1-n1 ) occurred in normal subjects but was abolished in patients who underwent selective vestibular nerve section . in 1995 , halmagyi and colebatch reported the responses that were not of lateral canal origin and the term vestibular - evoked myogenic potentials ( vemp ) has been widely used since then .
the vcr arc includes the receptor ( the saccule ) , the afferent pathway ( the inferior vestibular nerve ) , and the efferent pathway ( the lateral vestibulospinal tract , the medial vestibulospinal tract , and the end muscle ) .
compared to the eng , vemp testing is easier to perform , less complicated for interpretation , induces less dizziness or nausea , and is more tolerable to patients .
stimuli that have been used to evoked vemp responses include air and bone - conducted tone bursts , air - conducted clicks , forehead taps , and galvanic stimulation ( short - duration transmastoid direct current stimulation ) [ 4 , 7 ] .
maintenance of tonic contraction of the scm muscle during the test is a critical factor to elicit vemp responses .
testing position to activate the scm muscle included sitting with head turned , supine , recumbent , and prone positions with head lift or head turned [ 911 ] .
target emg level to maintain tonicity of the muscle throughout the test with minimum patient discomfort is variable and depends on the test position [ 12 , 13 ] .
the authors also reviewed methodology of vemp recording and vemp response parameters , which have been reported in the literature .
the data should be beneficial to clinicians as a reference guide to set up vemp testing and the interpretation of the vemp responses in patients with vertigo or loss of balance .
fifty volunteers , whose age ranged from 18 to 60 years , with no history of hearing loss , vestibular or neurological disorders were recruited .
twelve men and thirty - eight women with age ranging from 22 to 57 years ( 44.0 9.3 ; mean sd ) enrolled in the study . after skin preparation , the active surface electrode was placed over the middle of the scm , and the reference electrode was placed over the upper sternum .
air - conducted alternating 500 hz tone bursts ( duration 5 msec ) were presented unilaterally via an er3a - inserted earphone ( etymotic research , elk grove village , il , usa . ) while the volunteer was sitting and turning his head to the contralateral side .
a constant tonic activation of the scm muscle was maintained at 3075 v with visual feedback .
the emg signals were amplified ( 5000x ) , filtered ( bandpass 101500 hz with a blackman gating function ) , and recorded ( intelligent hearing system , miami , florida , usa ) .
response thresholds were determined using a down 10 , up 5 db step procedure . a minimum of two vemp responses from 200 stimuli were averaged and calculated within 20 to 80 msec time window at 120 dbspl . the interaural amplitude difference ( iad ) ratio was calculated by dividing the inter - ear difference of p1-n1 interamplitude by the sum of the p1-n1 interamplitude of both ears [ 13 , 14 ] . the vemp response threshold , p1 latency , n1 latency
, p1-n1 interlatency , p1-n1 interamplitude , absolute inter - ear difference , and iad ratio were analyzed using spss ( spss inc . ,
the protocol was approved by the ethics committee , faculty of medicine , chiang mai university .
the duration for testing in each subject ranged from 10 to 31 minutes ( 22.5 5.1 ; mean sd ) .
the vemp responses presented in 86 of 100 ears in 50 volunteers , which elicited a response rate at 86% .
the recommended protocol of the vemp testing in this study was using air - conducted alternating 500 hz tone - bursts , starting at 120 dbspl ( 98 dbnhl ) , presented monoaurally while the subject was sitting and turning head to the contralateral side .
variety of the protocols and normative values of vemp responses from several studies are shown in tables 3 and 4 .
the differences in protocols including stimulation type , stimulus intensity , number of stimuli , testing position , method of the scm activation , electrode montage , and emg level resulted in difference normative values of the vemp testing the air - conducted tone burst at 500 hz , and clicks were the most widely used stimuli .
acoustically responsive fibers in the vestibular nerve showed to be the most responsive to frequencies between 500 and 1000 hz , with little to no responsiveness to auditory stimuli above 3000 hz .
optimal stimulus frequencies for vemp testing have been reported at 300350 hz , 500 hz , and 700 hz . with click stimulation ,
the intensity that was required to evoke vemp was higher than tone burst [ 9 , 11 , 31 ] about 95100 db above normal hearing level ( 140145 dbspl ) , which are relatively uncomfortable for subjects [ 7 , 30 ] .
tone - burst - evoked vemp responses had lower stimulus thresholds , larger amplitude than click - evoked ones [ 11 , 27 ] .
tone burst stimulation at 500 hz tone was considered as an ideal stimulation [ 13 , 30 ] , with the stimulus intensity that ranged between 95105 dbnhl or 115130 dbspl ( table 3 ) .
although the tone burst stimulation at 95 dbnhl was the most commonly used , the authors found that 98 dbnhl stimulus improved rate of the responses and was comfortable to the subjects .
the midpoint of the scm muscle is the optimal location for recording vemp . although vemp responses recorded from the upper part of the scm muscle showed the largest amplitude compared to the locations at the level of mandibular angle , the middle part of the muscle , and immediately above sternal and clavicular origins of the scm muscle , the amplitude was not consistent . in authors ' experiences , placing the electrodes over the most prominent part or at the upper half of the scm muscle was a less constant distance than placing at the midpoint of the muscle .
the distance between the mastoid tip and head of clavicle can be easily measured and divided into half .
an exact location of the electrode over the scm muscle provided a more consistent response between the right and the left side and among the subjects .
the authors suggest placing the active surface electrode over the middle of the scm . maintaining sufficient tonicity of the muscle throughout the test with
the scm muscle activation by turning the head in sitting position was sufficient to generate the vemp responses without early fatigability .
methods to activate the scm muscle bilaterally included ( 1 ) supine or recumbent position and elevation of the head and ( 2 ) sitting and pushing the forehead against a load cell ; unilaterally included ( 1 ) supine and turning the head and ( 2 ) sitting and turning the head ( table 3 ) .
directly monitored tonic emg levels for the scm muscle activation were varied : 3050 v , 40150 v , and 50200 v . in the authors ' experience , raising the head from supine position and setting the emg level higher than this study 's protocol tended to discomfort and fatigue the subjects .
the longer the scm contraction , the higher the emg level and higher the number of the stimuli ; the subjects required a longer resting time between each stimulation to get muscle relaxation .
another method to control the scm muscle contraction was pushing their chin against the inflatable cuff of a blood pressure manometer .
the cuff was inflated to a cuff pressure of 20 mmhg , and subjects were instructed to press until 40 or 45 mmhg was reached [ 16 , 33 ] . without emg monitoring available , clinicians may consider this alternative method for maintaining the scm muscle contraction .
a comparison among the studies in tables 3 and 4 showed that p1 latency and n1 latency of the tone burst stimulation were longer , the thresholds were lower , and the amplitudes were higher than of the click stimuli .
p1-n1 amplitude showed wide range of normative values and standard deviations compared to the latencies .
the response rate in this study was 86% , which is lower than the previous reports .
the response rates at 97% with 123 dbspl , at 100% with 125 dbspl , and 130 dbspl tone burst stimuli were reported .
however , response rates at 100% with 115 dbspl and 88% with 95
the lowest response rate at 33% was evoked by 90 dbnhl clicks , which is the softest stimulus level in table 4 . with 95 dbnhl
click stimulation , the response rate in older subjects ( 90% ) was lower than that in younger subjects ( 98% ) .
the fact that the response rate with 100 dbnhl ( 95% ) was lower than that with 95 dbnhl ( 100% ) , click stimulation is possibly affected by age ( ranging between 2585 years and 2733 years ) . to determine a normative value of vemp in the clinic , limitation of enrolled subject 's age is recommended . with tone
burst stimulation in a sitting , head turned position , the threshold tend to increase ( 112 ( 6 ) , 114.16 ( 6.45 ) , 115.1 ( 4.6 ) dbspl ) if the stimulus level decreased ( at 130 , 123 , and 120 dbspl stimulation ) ( [ 16 , 17 ] and this study in orderly ) .
to evoke a good response rate or threshold of vemp , the intensity of stimulus should be set at least at 125 dbspl tone burst or 95 dbnhl clicks with 200 stimuli . the amplitude ( 28.36 11.65 v ) and target emg level to maintain tonicity of the muscle ( 3075 v ) in this study were lower than other studies . one study , however , reported the amplitude at 198.53 64.64 v with target emg level at 50 v
. the higher level of amplitude was observed in the head raised position with the higher target emg level . to enhance wave amplitude ,
target emg level should be set up at least 50 v with minimum of its range in head raised position .
if the amplitude of vemp is stabilized , the latency of p1 and n1 should be less variable .
vemp parameters generally used for interpretation were the presence or absence of a vemp response , vemp threshold , latency of p1 and n1 , and p1-n1 interamplitude .
this study also reported other vemp parameters including p1-n1 interlatency , interaural difference of p1 and n1 latency , and interaural amplitude difference ( iad ) ratio .
the most helpful parameter for the interpretation of the abnormality of the vemp responses should be further studied .
the authors encourage using vemp testing as a battery of vestibular function tests in balance disorder patients using previous reports for evidence - based guidance . | vestibular - evoked myogenic potential ( vemp ) testing is a vestibular function test used for evaluating saccular and inferior vestibular nerve function
. parameters of vemp testing include vemp threshold , latencies of p1 and n1 , and p1-n1 interamplitude .
less commonly used parameters were p1-n1 interlatency , interaural difference of p1 and n1 latency , and interaural amplitude difference ( iad ) ratio .
this paper recommends using air - conducted 500 hz tone burst auditory stimulation presented monoaurally via an inserted ear phone while the subject is turning his head to the contralateral side in the sitting position and recording the responses from the ipsilateral sternocleidomastoid muscle .
normative values of vemp responses in 50 normal audiovestibular volunteers were presented .
vemp testing protocols and normative values in other literature were reviewed and compared .
the study is beneficial to clinicians as a reference guide to set up vemp testing and interpretation of the vemp responses . |
nowadays , much attention has been paid to infection and pseudomonas aeruginosa is a top three opportunistic pathogen in hospitalized , immunocompromised , and cystic fibrosis patients ( 1 ) .
infection caused by p. aeruginosa is often life - threatening and difficult to treat because of its primary limited susceptibility to commonly used antimicrobial agents ( 2 ) .
it is necessary for the utilization of alternative antibacterial therapies against p.
aeruginosa infections .
synergistic combinations of antibiotics and other antimicrobials may be effective against infections where the development of resistance and/or subsequent failure to monotherapy is prevalent associated with the prevention of the emergence of bacterial resistance ( 3 , 4 ) .
aminoglycosides are broad - spectrum antibiotics of high potency that have been traditionally used for the treatment of serious gram - negative infections ( 5 ) and vital component of antipseudomonal chemotherapy implicated in the treatment of a variety of infections ( 6 ) .
one such preference is the possible therapeutic use of probiotics as an adjunct to chemotherapy ( 7 ) .
probiotics are dietary supplements containing potentially useful yeasts or bacteria . according to the currently adopted description by food and agriculture organization of the united nations / world health organization ( fao / who ) in 2001 , probiotics are live microorganisms , which when administered in requisite amounts confer a health benefit on the host ( 4 , 8) .
supernatant of most lactobacillus bacteria ( lab ) such lactobacillus casei and l. rahmnosus contains several antimicrobials including organic acids , hydrogen peroxide , aroma components , fatty acid and low - molecular - mass compounds which kill pathogens ( 9 ) .
strains of lactobacillus bacteria can produce organic acid through hetero fermentative pathways , and these compounds may interact with cell membranes , induce intracellular acidification and diffuse passively across the membrane and protein denaturation ( 10 ) .
hydrogen peroxide ( h2o2 ) can act as a precursor to the production of bactericidal free radicals , such as superoxide ( o2 ) and hydroxyl ( oh ) radicals , which can damage dna as well as peroxidation of membrane lipids increases the permeability of the membrane ( 11 ) .
the therapeutic role of probiotics in the p. aeruginosa ( 12 - 14 ) , staphylococcus aureus ( 15 ) and salmonella ( 7 , 8 , 16 ) infections have been reported .
treatments with combination of probiotics and antibiotic have been reported to be successful in the management of helicobacter pylori infection ( 17 ) .
a combination therapy by probiotic and antibiotic may provide higher antimicrobial activity and decrease the dose of antibiotic required in addition to replenish the intestinal flora thereby providing benefit to the host and also decrease other antibiotic side effects ( 18 ) . in the present study ,
the possible synergistic interactions between the cell - free lactobacillus supernatant ( cfs ) and amikacin or gentamicin on their antibacterial potencies against p. aeruginosa were evaluated .
this study aimed to investigate the antimicrobial effect of cfs from lactobacillus strains on the growth of p. aeruginosa and evaluate synergistic interactions between cfs and amikacin or gentamicin against p. aeruginosa and also to identify some of the antimicrobial compounds that lactobacillus strains produce .
pseudomonas aeruginosa ptcc 1430 , lactobacillus casei ptcc 1608 and lactobacillus rahmnosus ptcc 1637 were procured from iranian type culture collection ( ptcc ) .
p.
aeruginosa subcultured in nutrient broth ( nb ) ( merck , germany ) for 24 hours at 37c .
l. casei and l. rahmnosus were grown in de mann rogosa sharpe ( mrs ) broth ( merck , germany ) for 48 hours at 37c under anaerobic conditions in a coy laboratory anaerobic chamber ( 19 ) .
qualitative antibacterial susceptibility of the microorganisms was determined according to the standard disk diffusion ( kirby - bauer ) method ( 20 ) . using the paper disk including ( g / disc ) : azithromycin ( 15 ) ; ceftriaxone ( 21 ) ; imipenem ( 10 ) ; amikacin ( 21 ) ; chloramphenicol ( 21 ) ; ceftazidim ( 21 ) ; tobramycin ( 10 ) ; gentamycin ( 10 ) andciprofloxacin ( 5 ) purchased from mast co ( liverpool , uk ) .
microbial suspensions with 106 colony forming units ( cfu / ml ) of each lactobacillus strain in nb were prepared on a de mann rogosa sharpe agar plate .
the plates were incubated at 37c for 48 hours in anaerobic condition and examined for the inhibition zone diameter appearing around each antibiotic disc .
inhibitory zone diameters were compared with the standards provided by the national committee for clinical laboratory standards ( nccls ) ( 19 ) .
antibiotic sensitivity of p. aeruginosa was also determined by the same method using the muller hilton agar .
lactobacillus was grown in mrs broth ( ph 5.7 ) for 48 hours at 37c in anaerobic condition .
cell - free supernatant was obtained by centrifuging the culture at 15000 rpm for 15 minutes at 4c and then filtered through 0.45 m filters ( millipore , bedford , ma ) .
antimicrobial activities of cfs were determined by the agar well diffusion assay . in this method ,
bacterial inoculum colonies from overnight nutrient agar were used to make suspension of the test organisms to be equivalent to the 0.5 mcfarland standards .
wells with a 6-mm diameter were punched in the agar plates and were filled with 100 l of different concentrations of cfs ( 10 l / ml , 50 l / ml and 100 l / ml ) .
the plates were then incubated at 37c for 24 hours and the diameter zones of inhibition were assessed ( 23 ) .
the experiments were repeated three times and the mean values of the diameter of inhibition zone with standard deviation were calculated .
the minimum inhibitory concentrations ( mics ) were determined by micro dilution assay according to the procedures recommended by the clinical and laboratory standards institute ( formerly the national committee for clinical laboratory standards 2006 ) .
dilutions of the antibiotics ( amikacin or gentamicin ) , ranging from 0.125 - 256 g / ml in muller hinton broth ( mhb ) were prepared by incorporating the antibiotic stock solution into the muller hinton broth .
dilutions of the cfs in the range of 0.12 - 250 l / ml were also prepared by incorporation of the cfs into muller hinton broth .
briefly , a bacterial inoculum ( 100 l ) , corresponding to 5 10 cfu / ml , was added to 100 l of serial two - fold dilutions of the antibiotics in the wells of microtiter plates . for negative controls ,
100 l of 256 g / ml concentration of the antibiotics was added to100 l mhb in the wells of micro titer plates .
furthermore , for positive controls 100 l bacterial inoculum was added to 100 l mhb in the wells of microtiter plates .
the final volume of each well was 200 l . the plates were incubated at 37c for 24 hours .
the mic was defined as the lowest concentration of antibiotic which can inhibit visible growth of microorganism .
afterwards , 100 l of liquid from each well without visible growth on to mueller - hinton agar ( mha ) for determination of mbc was used and incubated at 37c for 48 - 72 hours .
finally , the lowest concentration of antimicrobial agent being able to reduced 99.9% of the bacteria was assessed as mbc .
the concentrations of antimicrobial agent were typically ranged from four or five below the expected mic to twice the anticipated mic as the 45 degree line in figure 1 ( each square represents one plate ) .
the interactions were assessed using two - fold dilutions of each antimicrobial agent , concentration of mic point and dilution lower than it for each antimicrobial agent alone .
inocula were prepared spectrophotometrically and further diluted to obtain final concentrations 0.5 10 cfu / ml .
each microdilution well included 100 l of the diluted ( two times ) drug concentrations of both antimicrobials ( antibiotics and cfs ) was inoculated with 100 l of the diluted ( two times ) inoculum suspension ( final volume of each well , 200 l ) .
the trays were incubated at 37c , and the results were read at 24 hours visually using an elisa reader system ( statfax-2100 , awareness technology inc .
minimum inhibitory concentration ( mic ) of drugs a and b are considered as 1 g / ml . the fic index was then calculated using the observing equation with summing the separate fics for each drug present in that well : fic index = fica + ficb = mic ( a in presence of b ) / mic ( a alone ) + mic ( b in presence of a ) / mic ( b alone ) where a is the concentration of drug a in well that is the lowest inhibitory concentration in its row , mic a is the mic of the organism to drug a alone , and fic a is the fic of drug a. also , b is the concentration of drug b in a well that is the lowest inhibitory concentration in its column ; micb and ficb are defined in the same fashion for drug a. according to this method , synergism has traditionally been defined as an fic index of 0.5 or less and additively as a fic index of 1.0 ; antagonism has been defined as a fic index of 2.0 .
synergy was further subclassified as marked ( fic 0.50 ) and weak ( fic index , between 0.50 and 1.0 ) ( 24 ) .
cell - free supernatants of each strain of l. casei , and l. rhamnosus were prepared according to the method of ogunbanwo ( 22 ) .
the supernatant was filtered using 0.45 m millipore filters and 2 aliquots were stored at 20c until analyzed for antimicrobial compounds , including lactic acid , acetic acids and hydrogen peroxide ( h2o2 ) ( sigma ) using reversed - phase high - performance liquid chromatography ( rp - hplc ) ( 25 ) .
086 ( 5.2 mg / ml ) , acetic acid ( 5.4 mg / ml ) and h2o2 ( 35% ) were prepared in ultrapure water and stored at 4c ( 26 ) .
standard solutions of organic acids and h2o2 were determined by rp - fplc , using an akta purifier system ( ge healthcare ) equipped with ymc - triart c18 ( 250 4.6 mmi.d , s-5 um , 12 nm ) . the degassed mobile phase of 0.009 m kh2po4 adjusted by phosphoric acid to ph 2.06.filtered through a 0.45 m membrane filter was used at a flow rate of 1 ml / minutes .
the wavelength of detection was optimized at 210 nm and the sample injection was 50 l .
moreover , the cfss from lactobacillus strains were analyzed by rp - hplc under the same conditions ( 25 , 28 ) .
data were analyzed using graph pad prism version 5 ( graphpad software in , san deigo , usa ) .
pseudomonas aeruginosa ptcc 1430 , lactobacillus casei ptcc 1608 and lactobacillus rahmnosus ptcc 1637 were procured from iranian type culture collection ( ptcc ) .
p.
aeruginosa subcultured in nutrient broth ( nb ) ( merck , germany ) for 24 hours at 37c .
l. casei and l. rahmnosus were grown in de mann rogosa sharpe ( mrs ) broth ( merck , germany ) for 48 hours at 37c under anaerobic conditions in a coy laboratory anaerobic chamber ( 19 ) .
qualitative antibacterial susceptibility of the microorganisms was determined according to the standard disk diffusion ( kirby - bauer ) method ( 20 ) . using the paper disk including ( g / disc ) : azithromycin ( 15 ) ; ceftriaxone ( 21 ) ; imipenem ( 10 ) ; amikacin ( 21 ) ; chloramphenicol ( 21 ) ; ceftazidim ( 21 ) ; tobramycin ( 10 ) ; gentamycin ( 10 ) andciprofloxacin ( 5 ) purchased from mast co ( liverpool , uk ) .
microbial suspensions with 106 colony forming units ( cfu / ml ) of each lactobacillus strain in nb were prepared on a de mann rogosa sharpe agar plate .
the plates were incubated at 37c for 48 hours in anaerobic condition and examined for the inhibition zone diameter appearing around each antibiotic disc .
inhibitory zone diameters were compared with the standards provided by the national committee for clinical laboratory standards ( nccls ) ( 19 ) .
antibiotic sensitivity of p. aeruginosa was also determined by the same method using the muller hilton agar .
lactobacillus was grown in mrs broth ( ph 5.7 ) for 48 hours at 37c in anaerobic condition .
cell - free supernatant was obtained by centrifuging the culture at 15000 rpm for 15 minutes at 4c and then filtered through 0.45 m filters ( millipore , bedford , ma ) .
antimicrobial activities of cfs were determined by the agar well diffusion assay . in this method ,
bacterial inoculum colonies from overnight nutrient agar were used to make suspension of the test organisms to be equivalent to the 0.5 mcfarland standards .
wells with a 6-mm diameter were punched in the agar plates and were filled with 100 l of different concentrations of cfs ( 10 l / ml , 50 l / ml and 100 l / ml ) .
the plates were then incubated at 37c for 24 hours and the diameter zones of inhibition were assessed ( 23 ) .
the experiments were repeated three times and the mean values of the diameter of inhibition zone with standard deviation were calculated . the minimum inhibitory concentrations ( mics ) were determined by micro dilution assay according to the procedures recommended by the clinical and laboratory standards institute ( formerly the national committee for clinical laboratory standards 2006 ) .
dilutions of the antibiotics ( amikacin or gentamicin ) , ranging from 0.125 - 256 g / ml in muller hinton broth ( mhb ) were prepared by incorporating the antibiotic stock solution into the muller hinton broth .
dilutions of the cfs in the range of 0.12 - 250 l / ml were also prepared by incorporation of the cfs into muller hinton broth .
briefly , a bacterial inoculum ( 100 l ) , corresponding to 5 10 cfu / ml , was added to 100 l of serial two - fold dilutions of the antibiotics in the wells of microtiter plates . for negative controls ,
100 l of 256 g / ml concentration of the antibiotics was added to100 l mhb in the wells of micro titer plates .
furthermore , for positive controls 100 l bacterial inoculum was added to 100 l mhb in the wells of microtiter plates .
the final volume of each well was 200 l . the plates were incubated at 37c for 24 hours .
the mic was defined as the lowest concentration of antibiotic which can inhibit visible growth of microorganism . afterwards
, 100 l of liquid from each well without visible growth on to mueller - hinton agar ( mha ) for determination of mbc was used and incubated at 37c for 48 - 72 hours .
finally , the lowest concentration of antimicrobial agent being able to reduced 99.9% of the bacteria was assessed as mbc .
the concentrations of antimicrobial agent were typically ranged from four or five below the expected mic to twice the anticipated mic as the 45 degree line in figure 1 ( each square represents one plate ) .
the interactions were assessed using two - fold dilutions of each antimicrobial agent , concentration of mic point and dilution lower than it for each antimicrobial agent alone .
inocula were prepared spectrophotometrically and further diluted to obtain final concentrations 0.5 10 cfu / ml .
each microdilution well included 100 l of the diluted ( two times ) drug concentrations of both antimicrobials ( antibiotics and cfs ) was inoculated with 100 l of the diluted ( two times ) inoculum suspension ( final volume of each well , 200 l ) .
the trays were incubated at 37c , and the results were read at 24 hours visually using an elisa reader system ( statfax-2100 , awareness technology inc .
minimum inhibitory concentration ( mic ) of drugs a and b are considered as 1 g / ml . the fic index was then calculated using the observing equation with summing the separate fics for each drug present in that well : fic index = fica + ficb = mic ( a in presence of b ) / mic ( a alone ) + mic ( b in presence of a ) / mic ( b alone ) where a is the concentration of drug a in well that is the lowest inhibitory concentration in its row , mic a is the mic of the organism to drug a alone , and fic a is the fic of drug a. also , b is the concentration of drug b in a well that is the lowest inhibitory concentration in its column ; micb and ficb are defined in the same fashion for drug a. according to this method , synergism has traditionally been defined as an fic index of 0.5 or less and additively as a fic index of 1.0 ; antagonism has been defined as a fic index of 2.0 .
synergy was further subclassified as marked ( fic 0.50 ) and weak ( fic index , between 0.50 and 1.0 ) ( 24 ) .
lactobacillus was grown in mrs broth ( ph 5.7 ) for 48 hours at 37c in anaerobic condition .
cell - free supernatant was obtained by centrifuging the culture at 15000 rpm for 15 minutes at 4c and then filtered through 0.45 m filters ( millipore , bedford , ma ) .
antimicrobial activities of cfs were determined by the agar well diffusion assay . in this method ,
bacterial inoculum colonies from overnight nutrient agar were used to make suspension of the test organisms to be equivalent to the 0.5 mcfarland standards .
wells with a 6-mm diameter were punched in the agar plates and were filled with 100 l of different concentrations of cfs ( 10 l / ml , 50 l / ml and 100 l / ml ) .
the plates were then incubated at 37c for 24 hours and the diameter zones of inhibition were assessed ( 23 ) .
the experiments were repeated three times and the mean values of the diameter of inhibition zone with standard deviation were calculated .
the minimum inhibitory concentrations ( mics ) were determined by micro dilution assay according to the procedures recommended by the clinical and laboratory standards institute ( formerly the national committee for clinical laboratory standards 2006 ) .
dilutions of the antibiotics ( amikacin or gentamicin ) , ranging from 0.125 - 256 g / ml in muller hinton broth ( mhb ) were prepared by incorporating the antibiotic stock solution into the muller hinton broth .
dilutions of the cfs in the range of 0.12 - 250 l / ml were also prepared by incorporation of the cfs into muller hinton broth .
briefly , a bacterial inoculum ( 100 l ) , corresponding to 5 10 cfu / ml , was added to 100 l of serial two - fold dilutions of the antibiotics in the wells of microtiter plates . for negative controls ,
100 l of 256 g / ml concentration of the antibiotics was added to100 l mhb in the wells of micro titer plates .
furthermore , for positive controls 100 l bacterial inoculum was added to 100 l mhb in the wells of microtiter plates .
the final volume of each well was 200 l . the plates were incubated at 37c for 24 hours .
the mic was defined as the lowest concentration of antibiotic which can inhibit visible growth of microorganism .
afterwards , 100 l of liquid from each well without visible growth on to mueller - hinton agar ( mha ) for determination of mbc was used and incubated at 37c for 48 - 72 hours .
finally , the lowest concentration of antimicrobial agent being able to reduced 99.9% of the bacteria was assessed as mbc .
the concentrations of antimicrobial agent were typically ranged from four or five below the expected mic to twice the anticipated mic as the 45 degree line in figure 1 ( each square represents one plate ) .
the interactions were assessed using two - fold dilutions of each antimicrobial agent , concentration of mic point and dilution lower than it for each antimicrobial agent alone .
inocula were prepared spectrophotometrically and further diluted to obtain final concentrations 0.5 10 cfu / ml .
each microdilution well included 100 l of the diluted ( two times ) drug concentrations of both antimicrobials ( antibiotics and cfs ) was inoculated with 100 l of the diluted ( two times ) inoculum suspension ( final volume of each well , 200 l ) .
the trays were incubated at 37c , and the results were read at 24 hours visually using an elisa reader system ( statfax-2100 , awareness technology inc .
minimum inhibitory concentration ( mic ) of drugs a and b are considered as 1 g / ml . the fic index was then calculated using the observing equation with summing the separate fics for each drug present in that well : fic index = fica + ficb = mic ( a in presence of b ) / mic ( a alone ) + mic ( b in presence of a ) / mic ( b alone ) where a is the concentration of drug a in well that is the lowest inhibitory concentration in its row , mic a is the mic of the organism to drug a alone , and fic a is the fic of drug a. also , b is the concentration of drug b in a well that is the lowest inhibitory concentration in its column ; micb and ficb are defined in the same fashion for drug a. according to this method , synergism has traditionally been defined as an fic index of 0.5 or less and additively as a fic index of 1.0 ; antagonism has been defined as a fic index of 2.0 .
synergy was further subclassified as marked ( fic 0.50 ) and weak ( fic index , between 0.50 and 1.0 ) ( 24 ) .
cell - free supernatants of each strain of l. casei , and l. rhamnosus were prepared according to the method of ogunbanwo ( 22 ) .
the supernatant was filtered using 0.45 m millipore filters and 2 aliquots were stored at 20c until analyzed for antimicrobial compounds , including lactic acid , acetic acids and hydrogen peroxide ( h2o2 ) ( sigma ) using reversed - phase high - performance liquid chromatography ( rp - hplc ) ( 25 ) .
086 ( 5.2 mg / ml ) , acetic acid ( 5.4 mg / ml ) and h2o2 ( 35% ) were prepared in ultrapure water and stored at 4c ( 26 ) .
standard solutions of organic acids and h2o2 were determined by rp - fplc , using an akta purifier system ( ge healthcare ) equipped with ymc - triart c18 ( 250 4.6 mmi.d , s-5 um , 12 nm ) . the degassed mobile phase of 0.009 m kh2po4 adjusted by phosphoric acid to ph 2.06.filtered through a 0.45 m membrane filter was used at a flow rate of 1 ml / minutes .
the wavelength of detection was optimized at 210 nm and the sample injection was 50 l .
moreover , the cfss from lactobacillus strains were analyzed by rp - hplc under the same conditions ( 25 , 28 ) .
data were analyzed using graph pad prism version 5 ( graphpad software in , san deigo , usa ) .
antibiotic susceptibility pattern of the tested microorganisms was shown that p. aeruginosa was sensitive to amikacin and gentamicin , while l. casei and l. rhamnosus were resistance to the amikacin and gentamicin ( table 1 ) .
the antimicrobial activities of cfs from lactobacillus strains in different concentration were determined using the agar well diffusion assay summarized in table 2
figure 2 .
abbreviations : r , resistant;s , sensitive . abbreviations : cfs , cell - free supernatant ; mrs , de mann rogosa sharpe .
zone of inhibition , including the diameter of the well ( 6 mm ) ; mean value of three independent experiments . a , mrs ( 100 l / ml ) , b , cfs ( 10 l / ml ) , c , cfs ( 50 l / ml ) , d , cfs ( 100 l / ml ) . the activity quantitatively assessed on the basis of the inhibition zone , and their activity index was also calculated along with the minimum inhibitory concentration ( mic ) .
the results of the mic and minimum bactericidal concentration ( mbc ) of the cfs and antibiotics were determined by the microdilution method and are shown in table 3 . also , the fic value for cfs and antibiotics were shown in table 4 .
all antimicrobial combinations demonstrated synergistic actions against p. aeruginosa . only the combination of cfs from l. casei and gentamicin demonstrated indifference action .
abbreviations : cfs , cell - free supernatant ; mbc , minimum bactericidal concentration ; and mic , minimum inhibitory concentrations .
an antimicrobial compound in the cfs of lactobacillus was identified by comparison of retention times and the uv absorption spectra with those obtained from the corresponding standards .
peaks of standard solution were observed at ( 6.00 0.13 ) minutes for lactic acid , ( 6.02 0.06 ) minutes for acetic acid , and ( 3.06 0.0.6 ) minutes for h2o2 , for an average of 5 injections ( table 5 ) . as a control ,
the antimicrobial compound profile of the sterile mrs medium was analyzed ( figure 3a ) . compared with this control chromatogram ,
the cfs of l. casei and l.
rhamnosus ( figure 3b and 3c ) contained the same peaks that corresponding to acetic acid ( aa ) ( 6 . 23 minutes ) , lactic acid ( la ) ( 5.73 ) and h2o2 ( 3.02 minutes ) .
this study showed that antimicrobial compound is already present in the sterile mrs medium ; however , significant changes were observed in the amount of the compound during growth of lactobacillus strains ( p < 0 .
a , cell - free supernatant of sterile de man - rogosa sharpe medium ; b , lactobacillus casei ptcc 1608 ; c , lactobacillus rahmnosus ptcc 1637 .
the x - axis refers to the retention time of the antimicrobial compound ( in minutes ) : lactic acid ( la ) , acetic acid ( aa ) and hydrogen peroxide ( h2o2 ) .
column : ymc - triart c18 ( 250 x 4.6 mm , hp , particle size 5 m , flow rate 1 ml / minute ) detection : diode array detector set at 210 nm .
pseudomonas aeruginosa infection is one of the most difficult or impossible to eradicate infections and therefore this bacterial infection needs new therapeutic protocol and strategy ( 12 , 29 ) .
an antimicrobial combination has been utilized as an effective therapeutic strategy by using of various mechanisms of action ( 18 ) .
aminoglycosides are known frontline antibiotics in the treatment of gram - negative bacterial infections there are potent antibiotics that inhibit protein synthesis by binding to the bacterial 30s ribosomal subunit ( 30 ) . since emerging reports showed increased prevalence of resistance against these drugs as observed , it seems necessary to use combinations of aminoglycosides with other antimicrobial agents against p. aeruginosa . a synergistic combination of aminoglycosides ( gentamicin , tobramycin and amikacin ) , fluoroquinolone ( ciprofloxacin ) and penicillins ( carbenicillin ) has been used to treat p. aeruginosa infections ( 30 ) .
moreover , some p. aeruginosa strains have been reported to have resistance to aminoglycoside antibiotics ( 31 , 32 ) . in the present study ,
the possible effects of cfs on the bactericidal activities of two antibiotics from aminoglycosides were evaluated .
the study of aminoglycoside antibiotics in combination with probiotics might prove the benefit of using a combination with the lower dose of antibiotic alone . in the present study
, we put forward the hypothesis that whether treatment with combination of cell - free supernatant from l. casei and l .rahmnosus with aminoglycoside antibiotics have higher antimicrobial activity against p. aeruginosa or not .
keeping in view the application of probiotics to be used in conjunction with an antibiotic , the first criteria which a lactobacillus strains needs to fulfill is that it should be resistant to that particular antibiotic to avoid the direct killing of the probiotic strain .
after determination of resistance and sensitivity of l. casei and l. rahmnosus and p. aeruginosa to aminoglycosides , the combination of cell - free supernatant from l. casei and l. rahmnosus and aminoglycosides was further tested to evaluate the possible synergistic effect against p. aeruginosa .
aminoglycosides interfere and affect the bacterial protein synthesis through binding to the ribosomal subunits of the bacterial cell , in addition , an increase of reactive oxygen species in the bacterial cells in response to ciprofloxacin has been shown ( 33 ) . in previous studies , separation , purification and identification of antimicrobial agents produced by lab , were conducted by several techniques ( 17 , 34 - 36 ) and in this study , the presence of lactic acid , acetic acid and h2o2 in cfs of l. casei and l. rahmnosus was confirmed by rp - hplc analysis .
the organic acid acts by collapsing the electrochemical proton gradient , and h2o2 by peroxidation of membrane lipids thus altering the cell membrane permeability which results in disruption of substrate transport systems ( 37 - 39 ) .
( 40 ) also found that lactic acid , in addition to its antimicrobial property due to the lowering of the ph , also functions as a membrane - permeabilizing of the gram - negative bacterial outer membrane and may act as a potentiator of the effects of other antimicrobial substances . in the present study , synergistic interactions were observed between cfs of l. casei and l. rahmnosus with aminoglycoside antibiotics .
these antibacterial mechanisms of h2o2 and aminoglycoside antibiotics to produce reactive oxygen species ( ros ) might have acted cooperatively with each other , leads to a higher bactericidal effect of the combination in support of our findings .
( 41 ) have also reported that the involvement of superoxide anion ( o2 ) and hydrogen peroxide ( h2o2 ) in the antibacterial action of ciprofloxacin was analyzed using superoxide dismutase , catalase , and alkyl hydro peroxide reductase knockout strains of e. coli .
fractional inhibitory concentration ( fic ) index also further substantiated the synergistic effect between the two compounds . we have previously demonstrated that cfs also reduced the mics of gentamicin and amikacin .
all two aminoglycoside antibiotics had fic indices less than 0.5 , indicating synergetic interaction between cfs and the antibiotic .
given the strong evidence that the clinical efficacy of probiotics and their increasing use in the treatment of diseases , a thorough understanding of their risks and benefits is imperative ( 42 , 43 ) .
there are some theoretical adverse risks that are discussed with respect to the use of probiotics in humans ( 42 , 43 ) .
these theoretical risks include the potential for transmigration and the fact that colonization with probiotics may have a negative impact on gastrointestinal physiology and function , including metabolic and physiologic effects ( 44 , 45 ) .
some of studies have shown that a number of probiotics that have been identified as the cause bacteremia or endocarditis include : l. plantarum , l. rahmnosus , l. casei , l. salivarius , l. paracasei , and l. acidophilus ( 46 , 47 ) .
the most common side effects of lactobacillus are found in patients with short bowel syndrome ( or , sometimes , short gut syndrome ) ( 47 , 48 ) .
these side effects have been seen in a patient who had hiv infection and hodgkin disease ( 49 ) and infection after a bone - marrow transplant ( 50 ) .
the presence of transferable antibiotic resistance genes in probiotics and transfer these genes via horizontal gene transfer as a major area of concern has been the potential for antibiotic - resistance transfer in the gastrointestinal tract that might take place between probiotics and a less innocuous member of the gut microbial community ( 51 , 52 ) . | background : the indiscriminate use of antibiotics in the treatment of infectious diseases can increase the development of antibiotic resistance . therefore , there is a big demand for new sources of antimicrobial agents and alternative treatments for reduction of antibiotic dosage required to decrease the associated side effects.objectives:in this study , the synergistic action of aminoglycoside antibiotics and cell - free supernatant ( cfs ) of probiotic ( lactobacillus rahmnosus and l. casei ) against pseudomonas aeruginosa ptcc 1430 was evaluated.materials and methods : a growth medium for culturing of probiotic bacteria was separated by centrifugation .
the antimicrobial effects of cfs of probiotic bacteria were evaluated using the agar well diffusion assay .
the minimum inhibitory concentration ( mic ) and minimum bactericidal concentration ( mbc ) were evaluated using the micro dilution method . finally , an interaction between cfs and amikacin or gentamicin against p. aeruginosa ptcc 1430 was examined through the checkerboard method and fractional inhibitory concentration ( fic ) .
furthermore , cfss from lactobacillus strains were analyzed by reversed phase hplc ( rp - hplc ) for antimicrobial compounds.results:the results showed a significant effect of cfs on the growth of p. aeruginosa .
the mic and mbc of cfs from l. casei were 62.5 lml while the mic and mbc of cfs from l. rhamnosus were 62.5 lml and 125 lml , respectively . using the fic indices ,
synergistic interactions were observed in combination of cfs and antibiotics .
fractional inhibitory concentration indices of cfs from l. casei and aminoglycoside antibiotics were 0.124 and 0.312 while fic indices of cfs from l. rhamnosus and aminoglycoside antibiotics were 0.124 and 0.56 , respectively showing a synergism effect .
the results of rp - hplc showed that cfs of lactobacillus strains contained acetic acid , lactic acid and hydrogen peroxide ( h2o2).conclusions : our findings indicate that probiotic bacterial strains of lactobacillus have a significant inhibitory effect on the growth of p. aeruginosa ptcc 1430 .
the antimicrobial potency of this combination can be useful for designing and developing alternative therapeutic strategies against p. aeruginosa infections . |
direct restoration is the most commonly used technique for both anterior and posterior teeth . however , with direct restoration , excessive polymerization shrinkage increases the stress at the composite - tooth interface and can compromise the integrity of the bond . in large posterior cavities , especially in those with cervical margins located in dentin , excessive shrinkage can produce marginal defects and gaps that promote microleakage and result in marginal discoloration , post - operative sensitivity , secondary caries and pulpal irritation .
when some mistakes in placement and finishing are added to these material problems , resulting marginal leakage and poor anatomical form and proximal contacts can reduce restoration longevity .
recent developments in resin - based composite resins have made it possible to fabricate esthetic indirect adhesive restorations that aim to overcome the shortcomings of direct composite resin restorations , such as polymerization shrinkage and inadequate degree of conversion .
the high percentage by volume of inorganic fillers in indirect restorative material when compared with composite resins used in direct restorations results in improved mechanical and physical properties .
however , indirect restoration requires more dentin exposure than direct restoration and thus increases dentin sensitivity .
previous studies have shown the clinical performance of indirect composite restorations to be significantly affected by both the bonding of the luting agent to the tooth and the restorative material and the surface treatment prior to bonding . in their systematic review of materials , van meerbeek et al .
whereas , etch and rinse systems require dentin to be acid - etched , rinsed and dried before the bonding agent is applied , self - etching bonding systems require no dentin pre - conditioning .
the simultaneous etching and resin infiltration that occurs with self - etching systems provides the important advantage of reduced technical sensitivity . whereas , shortall et al . reported indirect adhesive restoration to be a better alternative to direct composite restoration for larger cavities , wakiaga et al .
reported no reliable evidence of either a direct or indirect type of veneer restoration being superior in terms of restoration longevity .
however , recent advances in indirect restoration technology may improve the clinical life of indirect restorations over direct restorations .
, schaumburg , il , usa ) claim that these products show great success for occlusal restorations .
the aim of this study was to test the null hypothesis that restoration preparation technique ( direct / indirect ) , surface conditioning ( etch and rinse / self - etch ) and curing of bonding agents ( light cure / dual cure ) had no effect on the retention strength of resin composite used with seven different adhesive systems .
this study was conducted using 112 newly extracted non - carious , human molar teeth obtained according to protocols approved by the relevant institutional review board ( atatrk university faculty of dentistry ) .
tissue remnants and debris were removed and teeth were disinfected in 1% thymol and stored in distilled water until required for use .
specimens were decoronated and embedded in self - curing acrylic resin in 3 cm diameter teflon molds .
following polymerization , teeth were sectioned using a water - cooled saw ( struers minitom , struers , copenhagen , denmark ) parallel to the occlusal surface to expose mild - coronal dentin .
standardized dentin surfaces were created by polishing specimens with waterproof polishing papers ( # 600 , # 800 # 1200 sic ) .
polished teeth were randomly divided into two groups according to restoration technique ( direct restoration vs. indirect restoration ) and subdivided into seven subgroups ( n = 8) according to surface conditioning techniques used .
direct restorations were constructed using a hybrid resin composite valux plus ( 3 m dental products , st paul , mn , usa ) and the indirect restorations were made using tescera atl system ( bisco inc .
dentin bonding agents included four etch and rinse adhesives ( scotchbond multi - purpose plus [ sbmp ] , all - bond 3 [ ab ] , adper single bond [ sb ] and prime bond nt [ pbnt ] ) and three self - etch adhesives ( clearfil liner bond [ lb ] , futurabond dc [ dc ] , g bond [ gb ] ) . of these , sbmp , sb and gb
are polymerized by light - curing , whereas ab , pbnt , lb and dc are polymerized by dual - curing .
bonding systems , surface conditioning , curing type and manufacturer composite resin cylinders were built up on the dentin surfaces using a bonding jig ( ultradent products inc . , south jordon , ut and usa ) and an incremental technique .
excess restorative material was carefully removed using a sharp explorer and the cylinders were cured for 20 s using a light - emitting diode unit ( led , elipar free light ii 3 m - espe , st .
composite resin cylinders were constructed in the same size with bonding jig 's space used in direct technique .
the specimens were light - cured and heat - cured using the tescera atl light box and heat box , respectively , in line with the manufacturer 's recommendations .
following polymerization , cylinder surfaces were sandblasted with 50 m aluminum oxide powders ( microetcher , danville engineering , san ramon , ca ) and rinsed with water .
indirect cylinders were cemented to the dentin surfaces using dual - curing luting cement duo - link ( bisco inc . ,
schaumburg , illinois , usa ) under a constant pressure of 5 kgf and then light - cured for 60 s using led .
all specimens were stored for 24 h at 37c and 100% relative humidity and then subjected to thermocycling ( 5/55c , 1,000 cycles , 30 s dwell time ) .
shear bond - strength testing was performed using a universal testing machine ( instron corporation , canton , ma , usa ) at a crosshead speed of 0.5 mm / min .
fractured surfaces were examined under a stereomicroscope ( sz - tp olympus , japan ) at 20 magnification and failure modes were classified as either adhesive ( failure at the dentin / composite interface ) , cohesive ( failure within the resin composite or dentin ) or mixed ( partial adhesive / partial cohesive fracture ) .
furthermore , two samples from each subgroup were evaluated under scanning electron microscopy to see the failing surfaces [ figure 1 ] .
scanning electron microscopy evaluation of dentin surfaces after shear testing : ( a1 , a2 ) 90 and 1500 magnification of a mix failing mode respectively in group indirect + all bond 3 ; ( b1 , b2 ) 130 and 1500 magnification of an adhesive failing mode respectively in group direct + prime and bond nt ; ( c1 , c2 ) 90 and 2500 magnification of a mix failing mode respectively in group ndirect + scotch bond multipurpose plus ; a : adhesive resin ; d : dentin ; c : composite resin mean bond strengths for direct and indirect restorations were calculated for each subgroup ( n = 8) and the data were pooled according to restoration technique ( direct / indirect ) , surface conditioning ( etch and rinse / self - etch ) and curing of bonding agents ( light cure / dual cure ) .
independent sample t - tests were used to compare mean bond strengths of pooled data according to restoration technique , surface conditioning and curing of bonding agents .
anova and tukey 's test were used to compare mean bond strengths of each dentin bonding agents ; and the chi - square test was used to analyze the distribution of fracture modes .
all statistical analysis was conducted with the level of significance set at p = 0.05 .
composite resin cylinders were built up on the dentin surfaces using a bonding jig ( ultradent products inc . ,
excess restorative material was carefully removed using a sharp explorer and the cylinders were cured for 20 s using a light - emitting diode unit ( led , elipar free light ii 3 m - espe , st .
composite resin cylinders were constructed in the same size with bonding jig 's space used in direct technique .
the specimens were light - cured and heat - cured using the tescera atl light box and heat box , respectively , in line with the manufacturer 's recommendations . following polymerization ,
cylinder surfaces were sandblasted with 50 m aluminum oxide powders ( microetcher , danville engineering , san ramon , ca ) and rinsed with water . adhesives were applied on the dentine surfaces according to the manufacturers instructions .
indirect cylinders were cemented to the dentin surfaces using dual - curing luting cement duo - link ( bisco inc . ,
schaumburg , illinois , usa ) under a constant pressure of 5 kgf and then light - cured for 60 s using led .
all specimens were stored for 24 h at 37c and 100% relative humidity and then subjected to thermocycling ( 5/55c , 1,000 cycles , 30 s dwell time ) .
shear bond - strength testing was performed using a universal testing machine ( instron corporation , canton , ma , usa ) at a crosshead speed of 0.5 mm / min .
fractured surfaces were examined under a stereomicroscope ( sz - tp olympus , japan ) at 20 magnification and failure modes were classified as either adhesive ( failure at the dentin / composite interface ) , cohesive ( failure within the resin composite or dentin ) or mixed ( partial adhesive / partial cohesive fracture ) .
furthermore , two samples from each subgroup were evaluated under scanning electron microscopy to see the failing surfaces [ figure 1 ] .
scanning electron microscopy evaluation of dentin surfaces after shear testing : ( a1 , a2 ) 90 and 1500 magnification of a mix failing mode respectively in group indirect + all bond 3 ; ( b1 , b2 ) 130 and 1500 magnification of an adhesive failing mode respectively in group direct + prime and bond nt ; ( c1 , c2 ) 90 and 2500 magnification of a mix failing mode respectively in group ndirect + scotch bond multipurpose plus ; a : adhesive resin ; d : dentin ; c : composite resin mean bond strengths for direct and indirect restorations were calculated for each subgroup ( n = 8) and the data were pooled according to restoration technique ( direct / indirect ) , surface conditioning ( etch and rinse / self - etch ) and curing of bonding agents ( light cure / dual cure ) .
independent sample t - tests were used to compare mean bond strengths of pooled data according to restoration technique , surface conditioning and curing of bonding agents .
anova and tukey 's test were used to compare mean bond strengths of each dentin bonding agents ; and the chi - square test was used to analyze the distribution of fracture modes .
all statistical analysis was conducted with the level of significance set at p = 0.05 .
mean shear bond strengths by restoration technique , surface conditioning and curing of bonding agents are given in table 2 . according to t - test
, direct restorations were found to have significantly higher shear bond strengths than indirect restorations ( p < 0.05 ) ; etch and rinse surface conditioning resulted in significantly higher shear bond strengths than self - etching ( p < 0.05 ) ; and dual - cured bonding agents resulted in significantly higher shear bond strengths than light - cured bonding agents ( p < 0.05 ) .
shear bond strength values ( mean and standard deviation ) of composite resin restorations by restoration technique , surface conditioning and curing of bonding agent mean values of shear bond strength and standard deviations by restoration technique and bonding agent are given in table 3 .
mean values ranged from a high of 26.50 6.05 mpa ( direct restoration / pbnt ) to a low of 16.96 4.09 mpa ( direct restoration / gb ) . for direct restorations , pbnt had the highest bond strength ( 26.50 6.05 mpa ) and gb had the lowest bond strength ( 16.96 4.09 mpa ) .
bond strengths of pbnt , ab and sbmp were significantly higher than bond strengths of gb .
no other significant differences in bond strengths were observed among the other subgroups for direct restorations .
shear bond strength values ( mean and standard deviation ) for restoration technique ( direct / indirect ) and bonding agent for indirect restorations , dc had the highest bond strength ( 26.15 5.59 mpa ) and gb had the lowest bond strength ( 18.07 3.41 ) and the difference between them was statistically significant ( p < 0.05 ) .
no other significant differences in bond strengths were observed among the other sub - groups for indirect restorations .
overall , direct restorations with sbmp and pbnt showed significantly higher mean shear bond strengths than indirect restorations with ab , sb , lb and gb and direct restorations with ab showed significantly higher mean shear bond strengths than both direct and indirect restorations with gb .
indirect restorations with pbnt also showed significantly higher mean shear bond strengths than direct restorations with gb .
for all groups , adhesive failure was the most common mode of fracture and no significant differences in fracture modes were observed among the groups ( p > 0.05 ) .
according to the findings of this study , the null hypothesis stating that the shear bond strength of composite resins is not affected by restoration preparation technique , surface conditioning or curing of the bonding agent must be rejected .
adhesive dentistry involves the physical bonding of restorative materials to dental substrates in order to return esthetics and functioning to previously damaged teeth .
since the introduction of acid - etching into the field of dentistry , various adhesive methods have been developed to bond composites to tooth structure .
given the importance of bond strength between the adhesive system and the dentin surface , this subject continues to remain a topic of extensive research .
studies have shown that indirect composite restorations , introduced in the 1990 's , exhibit better clinical performance than direct restorations in terms of proximal contact , occlusal anatomy and marginal adaptation . with indirect restorations , except for a thin layer of high - flow composite resin ( so - called resin cement ) used to lute the restoration to the tooth surface ,
however , it is still possible for polymerization stress to occur during the curing of the resin cement , causing a disruption between the restoration and the cavity walls that will subsequently lead to marginal leakage , particularly if the margins are located in dentin .
douglas et al . concluded that the indirect method of placement of composite restorations offers considerable improvement in microleakage performance , particularly on the dentin - restorative interface .
however , our finding that direct restoration produces higher shear bond strengths than indirect restoration is in conflict with douglas et al . , given that microleakage is directly related to the strength of the bond between the dentin surface and the adhesive system / resin cement . in clinical practice ,
thus , the clinical life of indirect restoration can be affected by the physical properties of the restorative material . in the present study
, indirect restorations were produced using the tescera atl system , according to its manufacturers , which offers improvements in terms of durability and appearance .
the present study found that the surface conditioning had a significant effect on the shear bond strength of resin composite to dentin , etch and rinse adhesives exhibited higher bond strength than self - etch adhesives .
this finding is in line with a previous study that showed etch and rinse systems resulted in higher bond strengths than self - etch systems , but conflicts with other studies that showed no differences between self - etch and total - etch adhesives in terms of bonding to dentin . in our study ,
the bond strength of direct restorations was significantly lower when gb was used as an adhesive in comparison to all the other adhesives tested .
these findings may be due to the adhesives content and the surface - etching technique of the bonding systems .
it is possible that dual - cure bonding systems can significantly increase the retention of indirect restorations .
the present study found dual - cure bonding agents to have higher shear bond strength than light - cure bonding systems .
this is in line with previous studies that showed both dual - cure bonding agents and light - cured bonding agents have sufficient bond strength to tooth structures .
further investigation is needed into the various adhesive methods used to lute indirect restorations as there seems to be no current consensus in the literature regarding which technique can best improve adhesive strength . in terms of failure mode ,
the present study found the majority of failures to be adhesive failures at the resin cement - restoration interface .
in contrast to a recent study that found a higher rate of adhesive failures at the resin cement / veneer interface for indirect restorations , our study showed no differences in failure modes between direct and indirect restorations .
despite improvements in adhesive technology used for luting indirect restorations , the results of the present study indicated direct restoration to be a more reliable method than indirect restoration .
although etch and rinse bonding systems showed higher shear bond strength to dentin than self - etch systems , both systems can be safely used for the adhesion of direct as well as indirect restorations . | objective : the aim of this study was to test the null hypothesis that different surface conditioning ( etch and rinse and self - etch ) and curing techniques ( light cure / dual cure ) had no effect on the shear bond strength of direct and indirect composite inlays.materials and methods : a total of 112 extracted human molar teeth were horizontally sectioned and randomly divided into two groups according to restoration technique ( direct and indirect restorations ) .
each group was further subdivided into seven subgroups ( n = 8) according to bonding agent ( etch and rinse adhesives scotchbond multi - purpose plus , all - bond 3 , adper single bond and prime bond nt ; and self - etch adhesives clearfil liner bond , futurabond dc and g bond ) .
indirect composites were cemented to dentin surfaces using dual - curing luting cement .
shear bond strength of specimens was tested using a universal testing machine .
two samples from each subgroup were evaluated under scanning electron microscopy to see the failing modes .
data was analyzed using independent sample t - tests and tukey 's tests.results:surface conditioning and curing of bonding agents were all found to have significant effects on shear bond strength ( p < 0.05 ) of both direct and indirect composite inlays . with direct restoration ,
etch and rinse systems and dual - cured bonding agents yielded higher bond strengths than indirect restoration , self - etch systems and light - cured bonding agents.conclusions:the results of the present study indicated that direct restoration to be a more reliable method than indirect restoration .
although etch and rinse bonding systems showed higher shear bond strength to dentin than self - etch systems , both systems can be safely used for the adhesion of direct as well as indirect restorations . |
one is unilateral pa , mainly due to aldosteroneproducing adenoma ( apa ) and the other is bilateral pa , mainly due to idiopathic hyperaldosteronism ( iha ) .
it is important to determine the pa subtype because the recommended treatment for apa is an adrenalectomy and that for iha is pharmacological therapy with a mineralocorticoid receptor antagonist 2 . adrenal venous sampling ( avs )
the catheterization of the right adrenal vein is particularly difficult because of its small diameter 4 .
by contrast , the left adrenal vein is catheterized in almost all patients because it enters the left renal vein , which can be used as a guide to the left adrenal vein .
however , in the rare case of an anomalous left adrenal vein , it is difficult to cannulate the left adrenal vein 5 . in this report , we describe the successful left adrenal vein cannulation under contrastenhanced computed tomography ( ct ) guidance in a patient with pa and left inferior vena cava ( ivc ) whose left adrenal vein drained directly into the ivc .
a 43yearold man presenting with a 6year medical history of hypertension was referred to our hospital for suspected pa .
the laboratory data were as follows : creatinine , 0.67 mg / dl ; plasma aldosterone concentration ( pac ) , 249 pg / ml ; plasma renin activity ( pra ) , 0.7 ng / ml / h ; and pac / pra ratio , 356 .
ct also revealed that the left inferior vena cava joined the left renal vein and crossed over the aorta to the right side ( fig .
abdominal ct scan showing the left ivc ( arrow ) inferior to the renal vein ( a ) .
then , the ivc crosses anterior to the aorta in the normal side ( c ) .
. however , venography showed no left adrenal vein joining the left renal vein . a coronal section of the ct indicated that the left adrenal vein directly drained into the left ivc at a point close to the center of the left renal vein ( fig .
after examining the area , it was found that the left adrenal vein could be cannulated ( fig .
however , a blood sample could not be obtained because the catheter was wedged ; therefore , a multipurpose 4.2 french catheter was used to obtain a blood sample ( fig .
the patient was diagnosed with bilateral adrenal hyperplasia ( table 1 ) and treated with mineralocorticoid receptor antagonist . a coronal ct section showing that the left adrenal vein ( red arrow ) drained into the left ivc directly at a point close to the center of the left renal vein ( white arrow ) .
panel a shows the left adrenal vein could be cannulated ( red arrow ) at a point close to the center of the left renal vein ( white arrow ) using ct guidance . because the catheter was wedged , requiring a change in catheter to obtain a blood sample ( b ) .
the ivc can present with a multitude of anatomical variations , such as double and left ivc , which are caused by complex embryonic developments .
based on the involvement of iliac and gonadal veins , several classifications have been proposed for ivc variations 6 , 7 , 8 . to perform a successful avs ,
for example , in patients with double ivc , the left adrenal vein may drain either directly into the ivc or into the left renal vein . in patients with left ivc
, the left adrenal vein drains directly into the ivc 6 . in almost all individuals ,
contrastenhanced ct is useful in planning for avs because it reveals the positions of the adrenal veins 5 . in this case ,
stack et al . reported a case where the left adrenal vein drained directly into the ivc 10 . to our knowledge
, our patient is the first reported case of avs being performed in the left ivc wherein the left adrenal vein directly into the ivc .
we report an unusual case wherein the left adrenal vein drained directly into the left ivc .
contrastenhanced ct should be routinely performed in all patients undergoing avs to rule out or clearly left any unusual anatomical variations that might complicate the procedure .
yf and ht : drafted the article and conception of this study ; yf and tu : performed the adrenal venous sampling ; yu : performed the consultation and evaluation ; yf : revised the article critically for important intellectual content .
| key clinical messageadrenal venous sampling ( avs ) , although difficult , is recommended for patients with primary aldosteronism ( pa ) to diagnose the subtype . recognizing anatomical variation is key to a successful avs .
we report on a patient with pa and left inferior vena cava ( ivc ) whose left adrenal vein drained directly into the ivc . |
matrix producing carcinoma ( mpc ) of the breast is a rare variant of metaplastic carcinoma with a total of approximately 240 cases have been reported to date .
direct transition of carcinomatous elements to cartilaginous or osseous matrix without an intervening spindle cell component make the major diagnostic histopathologic criteria .
reports dealing with cytological features of mpc are far more scarce with only a few cases reported to date .
it has been suggested that the tumor cells have the features of both epithelial and mesenchymal cells .
herein , we report a case of a mpc in a 59-year - old woman with cytological , histopathological and immunohistochemical findings .
a 59-year - old woman presented with a palpable , hard nonmobile mass in her left breast .
fna smears showed ovoid to cuboidal shaped and spindly cells with bland nuclear features embedded in a chondromyxoid background .
these cells also formed sheet - like clusters [ figure 1a ] . between these neoplastic tissue fragments ,
loosely cohesive , highly pleomorphic epithelial cells with hyperchromatic and angulated nuclei were present [ figure 1b ] . in some microscopic fields , a transition could be observed between epithelial cells and the matrix - stromal complex .
some chondrocyte like cells were found to be present in the metachromatic extracellular matrix [ figure 1c ] .
histopathological examination showed invasive carcinoma with an abrupt transition to chondromyxoid matrix without an intervening spindle cell component [ figure 2a and b ] .
( a and b ) transition from carcinoma to chondromyxoid matrix without intervening spindle cell component .
( d ) central comedo - necrosis with high grade solid undifferentiated mammary carcinoma medium to large sized chondrocyte - like tumor cells embedded in a chondromyxoid matrix sometimes formed discrete nodules [ figure 2a ] .
focal areas of the matrix ranged from mucoid appearing to hyaline cartilaginous matrix [ figure 2c ] .
the chondromyxoid matrix was multifocal and mostly of high grade and showed direct transition to a carcinomatous component , which was composed of high grade undifferentiated mammary carcinoma with necrotic areas [ figure 2d ] .
the tumor cells were negative for estrogen and progesterone receptors and were also negative for cerb - b2 .
overt carcinoma cells of the tumor diffusely stained by pancytokeratin and epithelial membrane antigen ( ema ) while focal positivity was present in matrix producing areas .
the patient was treated with six cycles of chemotherapy and local radiation therapy and is well after surgery for 30 months .
as a rare entity , cytopathological features of mpc of the breast are limited to individual case reports .
in cytological smears , cuboidal to oval and sometimes spindly shaped tumor cells as single or in sheets of cells embedded in a myxoid matrix devoid of any sarcomatous spindle cells are the hallmarks of mpc .
if fna biopsy sample shows myxoid matrix material , this should be a clue to the presence of a mesenchymal component in a breast mass .
one of the differential diagnoses is the conventional metaplastic carcinoma with myxoid chondrosarcomatous differentiation . in such cases , diagnosis depends on the identification of sarcomatous spindle cells or osteoclastic cells .
malignant phyllodes tumor should also be considered in the differential diagnosis due to the presence of various type of sarcomatous elements . however , the epithelial component , which is represented by sheets of epithelial cells and small , round / oval nuclei is benign in malignant phyllodes tumor , whereas the epithelial component of mpcs consists of moderately to poorly differentiated adenocarcinoma .
fat necrosis is another entity that can mimic metaplastic carcinoma , due to the presence of bizarre spindle and giant mesenchymal cells , as well as an atypical reactive epithelium .
the nature of the matrix component is changeable , which could be a mixture of cartilage and osteoid , mainly osseous metaplasia or mainly cartilaginous .
wargotz and norris suggested that tumor cells of mpc might be of epithelial myoepithelial derivation according to the findings on electron microscopy . on the other hand , okuyama et al . found that of the eight mpcs , none of the overt carcinoma cells stained with myoepithelial markers
metastatic breast cancer is usually regarded as triple negative breast cancer or basal - like breast cancer .
it is proposed that basal - like cancers may undergo epithelial - mesencymal transition , which also has been reported to be an etiological factor in metaplastic carcinoma .
our case was also a triple negative breast cancer with both epithelial and mesenchymal compartments staining positive with pancytokeratin , ema ( overt carcinoma cells were diffusely positive , chondromyxoid areas were focally positive ) and s100 ( both components diffusely positive ) .
histologically carcinomatous component of mpc 's consists of moderately to poorly differentiated adenocarcinoma , which usually shows central necrosis .
high grade matrix , has been shown to be an adverse prognostic factor among patients with mpc whereas downs - kelly et al .
furthermore , high proportion of matrix was found to have a more favorable clinical course .
equivalent to or more aggressive behavior than invasive ductal carcinomas matched for patient age , stage and tumor grade have been reported .
postoperative radiation therapy after breast conserving surgery seems to be important for controlling local disease as a high rate of locoregional recurrences were detected without posteroperative radiation .
since most of these tumors are hormone receptor , and her2 negative , systemic chemotherapy after surgery is the mainstay of treatment .
as is the case in our patient , axillary lymph node metastases tend to be rare in mpc .
however , aggressive systemic therapy is also thought to be necessary regarding the high rate of distant recurrences in spite of the absence of lymph node metastases .
matrix producing carcinoma is very rare but at the same time an aggressive subtype of metaplastic carcinoma .
this subtype of metaplastic carcinoma should be kept in mind when chondromyxoid ground substance is seen in cytological slides .
accurate preoperative diagnosis of this rare tumor could also be achieved when all cytologic criteria is carefully evaluated in fna biopsy samples of the breast . | matrix producing carcinoma ( mpc ) of the breast is a very rare subtype of metaplastic carcinoma with heterelogous elements , which comprises < 0.1% of invasive breast carcinomas .
there are very few reports describing the cytological features of mpc . in this article
, we aimed to discuss cytological , histopathological and immunohistochemical features of this rare entity in a 59-year - old woman . |
sinus of valsalva aneurysm ( sva ) is a rare cardiac abnormality seen in 0.09 - 0.15% of cases with cardiac anomalies
congenital svas are usually encountered in young patients and may be associated with other congenital heart diseases like ventricular septal defect , coarctation of aorta , or bicuspid aortic valve .
unruptured svas are usually asymptomatic and rarely discovered , unless they compress adjacent cardiac structures .
svas can also rupture and result in an aorto - cardiac shunt that manifests as acute congestive heart failure .
contrast - enhanced computed tomography ( ct ) can provide excellent anatomic depiction of the sva and also depict any associated complications that may arise .
a 17 year - old male presented with a 1-year history of chest pain and dyspnea on exertion . during the past 2 weeks , he had experienced an exacerbation of his symptoms with shortness of breath even at rest , palpitations , pain in the right hypochondrium , abdominal distension , and progressively increasing jaundice . on clinical examination
cardiac auscultation revealed a pansystolic cardiac murmur in the aortic region and along the left lower sternal border suggestive of aortic and tricuspid regurgitation . on transthoracic echocardiography , he was found to have a large blood - filled sac arising from the aortic root with peripheral thrombus and obstruction of the right ventricular out - flow tract ( rvot ) .
contrast - enhanced ct of the thorax was performed to delineate the anatomical relation of the aneurysmal sac and its level of origin .
ct showed a large aneurysmal vascular structure measuring 11.8 10.1 9.2 cm arising from the right coronary sinus .
the lumen of the aneurysm was partially opacified by the contrast , with a large eccentric non - enhancing thrombus noted along the dome of the aneurysmal sac [ figure 1 ] .
there was associated thin peripheral rim of calcification around the wall of the aneurysmal sac .
the aneurysmal sac was causing marked compression and attenuation of the rvot and the main pulmonary artery .
there was resultant gross asymmetric dilatation of the right atrium and ventricle and associated dilatation of the inferior vena cava and hepatic veins suggestive of congestive changes [ figure 2 ] .
17-year - old boy with unruptured right sinus of valsalva aneurysm , contrast - enhanced ct ( a ) axial image reveals a large outpouching ( an ) arising from the right coronary sinus with eccentric thrombus ( * ) and peripheral thin calcification and normal lcs and ncs .
( b ) oblique sagittal image shows partially thrombosed aneurysm ( arrow ) with normal aortic root ( ao ) .
( c ) oblique coronal image shows aneurysm with dilated pulmonary artery ( arrow ) with normal ascending aorta and aortic annulus .
ao = aortic root , lcs = left coronary sinus , lv = left ventricle , mpa = main pulmonary artery , ncs = non - coronary sinus , ra = right atrium , rv = right ventricle . 17-year - old boy with unruptured right sinus of valsalva aneurysm , contrast - enhanced ct ( a ) coronal image shows aneurysm ( an ) compressing the rvot ( arrow ) with dilatation of ra and rv .
( b ) axial image shows the aneurysm extending along right atrio - ventricular groove ( arrow ) .
( c ) oblique coronal image shows dilated right cardiac chambers , intrahepatic ivc , and hepatic veins ( arrow ) .
an = aneurysm , la = left atrium , lv = left ventricle , ra = right atrium , rv = right ventricle , rvot = right ventricular outflow tract , ivc = inferior vena cava .
the right coronary artery was seen to arise from the tip of the aneurysmal sac .
rest of the aorta , arch and its branches were normal in enhancement and morphology .
congenital aneurysm may result from localized weakness of the elastic lamina or an underlying deficiency of normal elastic tissue , with lack of continuity between the aortic media and the aortic annulus leading to weakening and subsequent aneurysm formation .
sva can sometimes be associated with congenital diseases like marfan 's syndrome , ehlers danlos syndrome , or loeys dietz syndrome .
acquired svas are more common in middle - aged and old patients , and are caused by infectious diseases like bacterial endocarditis and syphilis , or degenerative conditions like atherosclerosis and cystic medial necrosis or aortic root injury from deceleration chest trauma .
the right coronary sinus is the most commonly involved followed by non - coronary sinus .
the characteristic diagnostic features of sva include aneurysmal sac originating above the aortic annulus , saccular shape of the aneurysm , and normal diameter of the aortic root and ascending aorta .
svas are commonly detected initially by two - dimensional doppler echocardiography . in most cases ,
cross - sectional imaging modalities like ct or magnetic resonance ( mr ) imaging are performed to confirm the findings seen on echocardiography .
nowadays , ct has increasingly been used to evaluate suspected cases of svas , especially in the emergency care setting .
high spatial resolution and faster scanning have made ct the preferred imaging modality to evaluate svas .
ct can also be used to identify suspected cases of ruptured aneurysm , which appear as a jet of contrast extending from the aneurysm to the cardiac chamber , thereby delineating any aorto - cardiac fistula .
mri can also be used to assess the origin of the aneurysm and define its relationship with adjacent mediastinal structures .
they have an added advantage of evaluating the hemodynamic pattern of the left ventricle , identifying any concomitant aortic regurgitation , and quantifying the amount of blood shunting across an aorto - cardiac fistula in cases of ruptured aneurysm
. however , limited availability , and increased scan duration and cost are the prohibitive factors in mr evaluation of suspected svas .
these patients usually present with insidiously progressive heart failure with fatigue , dyspnea , palpitation , and features of volume overload .
whereas in patients with ruptured sva , the clinical presentation depends on the rapidity with which it ruptures and the cardiac chamber with which it communicates . these cases usually present with severe dyspnea , chest pain , and hemodynamic instability or with progressive heart failure .
therefore , large unruptured aneurysms of the right sinus of valsalva may compress the rvot and cause obstruction .
when this happens , patients may present with symptoms of right heart failure , similar to what we encountered in our case .
large unruptured sva causing rvot obstruction and concomitant right heart failure has usually been reported in middle - aged and old patients .
we could find only three cases of young patients with unruptured sva causing cardiac compression in the literature .
the reported cases of sva with right heart failure in young patients have usually been associated with ruptured aneurysm and resultant fistula formation with right cardiac chambers or rvot .
thus , our patient who was an adolescent boy presented with a giant partially thrombosed chronic unruptured sva causing right heart failure .
the mainstay of treating a case of symptomatic unruptured and ruptured sva is cardiopulmonary bypass surgery with closure of aneurysmal sac and repair of the defect .
percutaneous transcatheter closure can also be used for treating svas . in asymptomatic patients where the aneurysmal sac is small
, surgery can be deferred ; however , large aneurysms should undergo surgical repair to avoid complications .
svas involve right coronary , non - coronary , and left coronary sinus in decreasing order .
they are usually asymptomatic , but can rupture or become large enough to compress cardiac chambers .
the clinical presentation of patients with sva varies from incidentally discovered cardiac murmurs to chest pain , progressive heart failure , and sudden cardiac arrest .
surgical repair is the mainstay of treatment with excellent prognosis in post - operative patients .
svas are initially detected by echocardiography ; however , contrast - enhanced ct images provide excellent anatomic description and prompt diagnosis .
| aneurysm of sinus of valsalva is a rare cardiac abnormality .
unruptured aneurysm of sinus of valsalva is usually asymptomatic and often discovered incidentally .
however , a large aneurysm can , in rare cases , cause compression of the ventricular outflow tract .
we report a case of 17-year - old male with congestive right heart failure with a large , partially thrombosed unruptured aneurysm of the right sinus of valsalva .
the aneurysmal sac was compressing the right ventricular outflow tract causing marked dilatation of the right ventricle and atrium that was confirmed on contrast - enhanced computed tomography imaging .
unruptured sinus of valsalva aneurysm causing right heart failure in adolescence has been rarely reported in literature . |
a report by ovaska et al . , recently published in genome medicine , describes the use of an integrative computational infrastructure , anduril , to analyze glioblastoma multiforme data in the cancer genome atlas ( tcga ) .
the logical and logistic consistency of the framework allowed the assembly of a large analytical workflow made of hundreds of individual processes , while avoiding the reproducibility and traceability pitfalls that currently plague complex analyses for biomarker identification .
consequently , instead of being limited to a specific molecular signal , the study was able to approach the integrated analysis of a wide variety of data .
specifically , data on 338 patients with primary glioblastoma multiforme , with clinical annotations , hybridization arrays , snp , exon , gene expression and microrna , were analyzed together .
tellingly , the authors were not only able to associate novel genomic alterations with glioblastoma multiforme progression , but also , and contradicting the criticism of mechanistic inconclusiveness of ' fishing expeditions ' , proceeded to explore novel roles for moesin in cell proliferation . as the study illustrates , hypothesis - generating functional analysis still can , and maybe should , be the corollary of integrative data driven analytical workflows . after reading this report by ovaska et al .
it is not hard to imagine that even mechanistic hypothesis testing may one day be treated as an extension of a broader integrative workflow .
the promises of personalized molecular medicine are increasingly driving large - scale associative genomics projects that bring together distributed teams involving multiple disciplines . the unprecedented size and scope of initiatives such as
the problem of integration , as described in a recent report by the national academy , is quickly becoming the central challenge for the life sciences .
only a few years ago this was still the province of the visionary . however , the clamor for better formal knowledge representation frameworks is now coming from all corners , including the critical contribution of the storage infrastructure community . in that regard , the study by ovaska et al
. may be revealing of what is in store for the data analysis of large - scale genomic data generation initiatives .
anduril is not the first integrative framework proposed , and the report compares with existing frameworks such as genepattern , ergatis and taverna [ 5 - 7 ] .
in fact , genepattern is the framework where many of the analytical workflows of the tcga initiative itself are deployed .
what is particularly interesting about anduril in this regard is not so much what it does as to what extent it successfully reflects the relationship between its architecture and the team that uses it . before dwelling on that
, it is worth recalling that this framework has pushed the idea of component modularity all the way to a shared input / output ( i / o ) bus ( that is , a set of logical connections that can be shared by multiple software components in order to communicate with one another ) . as a result ,
a computational ecosystem is enabled where , instead of workflows made of components designed to define a pipeline , one has components with application programming interfaces designed for scaled - up re - usability . whereas in the conventional pipeline approach
each component is designed of as a piece of a specific analytical puzzle , in the ecosystem approach the application programming interface of each module is made sufficiently abstract as to be treated like an autonomous , generic element of many possible workflows .
this team comprises three roles : molecular biologists at both the data acquisition and the interpretation ends of the workflow , computational statisticians developing specialized data analysis modules in a variety of programming environments , and , finally , dedicated analysts assisting and articulating both groups .
the command line operation of the framework suits the analyst group as an environment to make full use of the component - based workflow framework designed from maximum re - usability and minimum administration load .
the execution of individual components by the core engine of anduril is automatically triggered by i / o dependencies that point to filenames in a shared file system .
it is also telling that the ensuing high - level abstraction led the developers of anduril to identify their own domain - specific language , releasing the whole initiative from having to choose between the many actual programming languages used for the individual components .
even if it is far from certain that anduril will find a broader community of users , it is clear that this computational framework was the critical resource that enabled this particular group to act as a team .
therefore , it appears that integrative multidisciplinary teams may respond better to computational frameworks ( plural ) designed to match them , instead of forcing existing collaborative teams into a shared workflow mold .
the latter remain the primary impulse of large - scale genomics initiatives , with very mixed results .
another provocative observation is that the authors of this study , and of the supporting computational framework , are not themselves involved in the tcga initiative .
. this may actually be the better way for large - scale genomics initiatives to be translated into biomedical applications .
if that is the case , then the global reach would become a priority feature of such initiatives , with a critical attention to streamlined programmatic access to the data generated .
some features of the integrative framework reflect the collaborative team work in ways that are less relevant to this commentary .
the physical co - location of the computational components at universities in the helsinki - turku area allow for an architecture tied together by a shared file system . at a time of widening availability of hypertext transfer protocol ( http)-mediated cloud computing resources and convergence towards semantic web formalisms , the reliance of anduril on i / o via read / write of files
. a more distributed computational ecosystem may be better served by web services , potentially extending component execution , not just reporting , to any machine connected to the web .
nevertheless , the design of anduril as a platform able to host and sustain abstract workflow representations that call arbitrary components is novel and compelling beyond the specific details of its architecture .
i / o : input / output ; snp : single nucleotide polymorphism ; tcga : the cancer genome atlas .
the author 's research is partially funded by the cancer genome atlas initiative through a genome data analysis center award : 1u24ca143883 - 01 . | in the path towards personalized medicine , the integrative bioinformatics infrastructure is a critical enabling resource .
until large - scale reference data became available , the attributes of the computational infrastructure were postulated by many , but have mostly remained unverified .
now that large - scale initiatives such as the cancer genome atlas ( tcga ) are in full swing , the opportunity is at hand to find out what analytical approaches and computational architectures are really effective . a recent report did just that : first a software development environment was assembled as part of an informatics research program , and only then was the analysis of tcga 's glioblastoma multiforme multi - omic data pursued at the multi - omic scale .
the results of this complex analysis are the focus of the report highlighted here .
however , what is reported in the analysis is also the validating corollary for an infrastructure development effort guided by the iterative identification of sound design criteria for the architecture of the integrative computational infrastructure .
the work is at least as valuable as the data analysis results themselves : computational ecosystems with their own high - level abstractions rather than rigid pipelines with prescriptive recipes appear to be the critical feature of an effective infrastructure
. only then can analytical workflows benefit from experimentation just like any other component of the biomedical research program . |
acute myeloid leukemia ( aml ) is characterized by an increase in the number of myeloid cells in the marrow .
this , together with the arrest of these cells , may result in hematopoietic insufficiency , such as granulocytopenia , thrombocytopenia or anemia .
since there is no cancer registry in pakistan , a study carried out at our center in 2002 reported 74 adult patients with acute myeloid leukemia during an 8-year study period .
most younger patients with acute myeloid leukemia achieve complete remission with induction and consolidation chemotherapy regimens .
however , these remissions are not sustainable even for patients who achieve complete remission 1 ( cr1 ) .
the invariable risk of relapse requires consolidation with allogeneic stem cell transplant . in developing countries , non - malignant diseases such as thalassemia major and aplastic anemia account for the largest number of transplant procedures
; this is in complete contrast to the situation in developed countries . here in pakistan ,
treatment of aml is managed on an individual basis , since the cost of standard uncomplicated transplant ranges from $ 25,000$30,000 .
most of the transplants performed are privately funded , but philanthropists generally prefer to invest in pathologies that have a better overall survival .
this also means that patients come to the attention of the physician late in their disease course .
the european group for blood and marrow transplantation 2004 survey reported acute myeloid leukemia to be the most common indication for allogeneic hematopoietic stem cell transplant .
the procedure offers a double benefit as the preparative regimen in myeloablative doses eradicates the leukemic cells and this is followed by the post - transplant graft - versus - leukaemia effect .
a number of retrospective and prospective studies have identified risk factors that play a role in determining post - transplant survival of patients with aml .
the most important determinants of standard , intermediate and high - risk patient populations include gender , presenting white blood cell counts , and impact of cytogenetics . from 1984 till 2001 ,
the bordeaux grenoble marseille toulouse intergroup followed a proactive strategy of performing early allogeneic stem cell transplant as part of consolidation in patients under the age of 45 years who had an hla ( human leukocyte antigen ) identical sibling donor . for patients without an hla matched donor ,
further chemotherapy courses were given and these changed over the years on the basis of the experience gained from different studies .
the results showed that allogeneic stem cell transplant ( allosct ) provided a survival advantage for an intermediate risk group .
allosct performed early in the disease course was not the optimal treatment for high - risk patients .
we report our experience of 12 patients with acute myeloid leukemia ( relapsed and cr1 ) who underwent allogeneic stem cell transplant over a 7-year period .
these results show the survival of patients from a developing country where stem cell transplant is an expensive approach that is beyond the financial means of most of the population .
this study ran from april 2004 till june 2012 and included patients with acute myeloid leukemia eligible for bone marrow transplant .
other inclusion criteria were : age up to 60 years , diagnosis of aml based on the french american british classification excluding acute promyelocytic leukemia , no history of myelodysplasia or previous cytotoxic therapy / radiation , and absence of concomitant disease .
patients received induction chemotherapy with daunorubicin 45 mg / m intravenously on days 13 and cytarabine 100 mg / m infusion on days 17 .
consolidation was given with high - dose cytarabine at a dose of 3 gm / m administered by a 2-h infusion every 12 h on days 1 , 3 and 5 .
the most frequently used salvage chemotherapy regimen included idarubicin , fludarabine , cytarabine and g - csf .
patients under the age of 60 years with an hla matched sibling donor were then admitted to the bone marrow transplant unit . after a baseline pre - transplant workup of the donor and patient ,
all donors received granulocyte colony - stimulating factor at a dose of 10 g / kg / day .
the two conditioning regimens used for patients undergoing stem cell transplant were : i ) busulfan 4 mg / kg / day for four days along with cyclophosphamide 60 mg / kg / day for two days ; ii ) cyclophosphamide 60 mg / kg / day for two days along with fractionated total body irradiation at a dose of 1.5 gy twice daily for four days .
standard prophylaxis was provided with ciprofloxacin ( 500 mg twice daily or 2030 mg / kg / two divided doses ) , fluconazole ( 200 mg once daily or 6 mg / kg / day ) and valaciclovir ( 500 mg twice daily or 10 mg / kg / twice daily ) ; this was started on day 5 in all patients .
all patients were given a neutropenic diet and admitted to a protective isolation environment equipped with a high - efficiency particulate air filter , positive pressure and laminar airflow ventilation .
graft - versus - host disease ( gvhd ) prophylaxis was given with cyclosporine starting at day -1 ( 2.5 mg / kg q12-hourly ) with regular monitoring of drug levels , methotrexate administered on day + 1 ( 15 mg / m ) , day + 3 ( 10 mg / m ) and day + 6 ( 10 mg / m ) , and irradiated blood products .
statistical analysis was performed using spss software version 19 ( chicago , il , usa ) .
from april 2004 till june 2012 , 12 patients with acute myeloid leukemia received allogeneic stem cell transplant procedure .
one patient had philadelphia positive acute myeloid leukemia while one had multiple abnormalities ( monosomy 8 and t11q ; 23 ) . laboratory parameters of these patients are listed in table 1 .
table 1laboratory parameters of 12 patients with acute myeloid leukemia.parametersmeanstandard deviation ( range)hemoglobin ( g / dl)9.61.9 ( 7.812.8)white blood cell count ( 10)127.7118 ( 1.8292)platelets ( 10)3211 ( 1945 )
two patients received gender mismatched transplant while 3 had abo blood group mismatched donors . all patients and donors
conditioning with busulfan and cyclophosphamide was given in 10 patients while the rest received total body irradiation based therapy .
one patient was under 15 years of age , while all the other patients were adults .
mean mononuclear cell count was 5.610/kg ( range 3.58.310/kg ) . stem cell source was peripheral blood progenitor cells for all patients .
median time to engraftment ( absolute neutrophil count over 0.510/l for three consecutive days ) was 15.54.5 days ( range 1026.3 days ) post - transplant complications mainly included gvhd .
grade ii acute gvhd was observed in 4 patients ; chronic limited gvhd was seen in one patient and extensive gvhd in 2 patients , respectively .
eight patients developed febrile neutropenia ; of these , 2 had blood culture positive for staphylococcus species and enterococcus .
transplant - related mortality involved one patient ; cause of death was multi - organ failure .
causes of death include transplant - related mortality ( n=1 ) , relapse of disease ( n=7 ) , fulminant hepatic failure ( n=1 ) , and acute gvhd ( n=1 ) .
over the last decade , two important observations have been made with regard to treatment of acute myeloid leukemia : i ) sustainable remission rates can be obtained with a combination of chemotherapy and allogeneic stem cell transplant ; ii ) cytogenetic abnormalities have been seen to be the most important predictor of outcome .
here we have reported the outcome of 12 patients with aml who underwent allogeneic stem cell transplant . due to the small size , firm conclusions can not be made from this study .
there was no gender predilection observed although previous studies had reported an increased frequency in males . a study carried out in 2005 by appelbaum et al . in
aml is primarily seen in adults and , although in this study we stratified patients according to age for transplant eligibility , the overall median age for aml in this region is relatively low compared to that reported in the international literature .
the median age in this study was 26.5 years ; this is in line with a previous study carried out in our center in 2005 .
similarly , another center in pakistan has reported even lower age values , i.e. 21 years , when the authors evaluated the treatment outcome of de novo aml .
data reported in two studies from developed countries now show a median age of 52 and 67 years , respectively .
the reason for this difference is difficult to ascertain ; however , it may be a true ethnic or geographical variation as seen in the presentation of other diseases from our region .
peripheral blood progenitor cells ( pbsc ) are now being used for almost all hematopoietic transplant procedures .
pbsc were used in all our patients . as a result , 11 of 12 patients engrafted . the only patient with graft failure died from multi - organ failure secondary to sepsis .
grade i acute gvhd is generally understood to be associated with an improved post - transplant outcome .
grades above this result in a worse overall survival since the beneficial effect of suppressing leukemia relapse is complicated by the morbidity and mortality associated with gvhd .
however , the cause of death in all these patients was disease relapse rather than the gvhd itself . in our group of patients ,
3 underwent transplant procedure in cr1 ( increased white blood cell counts , n=2 ; philadelphia positive aml , n=1 ) whereas the remaining patients were in cr2 .
small retrospective studies ( less than 100 patients ) have been reported for patients with aml not in remission undergoing stem cell transplant procedure .
these studies have reported long - term survival rates of 2030% . in 2000 , michallet et al .
as expected , patients who underwent re - induction therapy first and achieved a complete remission did significantly better , with an overall survival of 32% . in 2010 , the center for international blood and bone marrow transplant research reported the largest and most complete analysis of outcome of aml patients undergoing stem cell transplant .
the study included more than 2000 patients and overall survival at three years was 19% .
although our subset is small , the results are still comparable with the overall survival of aml in patients of developed countries .
median patient age at presentation in our study is relatively low compared to developed countries .
the cost of stem cell transplant procedures is beyond the means of most of the population , and this means that they come to the attention of physicians late in the disease course . in spite of this , overall survival is still comparable to that reported in the international literature . | we report a case series of 12 patients with acute myeloid leukemia who underwent allogeneic stem cell transplant with a matched related donor .
male to female ratio was 1:1 .
the main complication post - transplant was graft - versus - host disease ( n=7 patients ) .
transplant - related mortality involved one patient ; cause of death was multi - organ failure .
after a median follow up of 36.011.3 months , overall survival was 16% . |
adjusted incidence of esrd has long been known to be roughly three times more frequent in africans than in white americans in the usa . indeed , adjusted incidence of hypertensive kidney disease in african americans of sub - saharan ancestry is 12-fold higher than in whites .
when the hiv epidemic struck , it became clear that the risk of esrd in african americans was not limited to traditional causes of ckd .
rather , there was a predisposition for kidney injury to progress for several unrelated causes of kidney injury .
thus , 24% of family members of hiv patients with esrd had esrd , even though they did not have hiv infection .
the initial tentative identification of myh9 gene variants associated with a higher risk of ckd progression was followed by the identification of apol1 gene variants as the explanation for the higher sensitivity of african americans to ckd progression .
myh9 was a good candidate since mutations were known to cause a form of familiar nephropathy ( fechtner syndrome ) with deafness which could be confused with type iv collagen nephropathies ( alport syndrome ) but that was additionally characterized by platelet abnormalities .
however , myh9 variants initially associated with african american ckd were found to be in linkage disequilibrium with apol1 variants common in western africa , where they provided a genetic advantage by protecting from trypanosoma brucei infection ( sleeping sickness ) .
indeed , renal risk variants in apol1 were associated with the higher rates of esrd and progression of ckd observed in black patients as compared with white patients , regardless of diabetes status [ 13 , 18 ] .
apol1 is expressed by podocytes , tubular cells and vascular smooth muscle cells and ongoing research will hopefully result in new therapeutic approaches to ckd of different aetiologies in african americans .
these studies , originally designed to solve a usa problem , may promote advances that benefit west african populations carrying these gene variants .
furthermore , the discovery of apol1 variants linkage to ckd has shaken the concept of hypertensive nephropathy [ 21 , 22 ] .
if the most numerous group of hypertensive nephropathy patients in the usa has in fact a genetic predisposition to ckd , then how common is hypertensive nephropathy in non - africans ? do cases of ckd attributed to hypertensive nephropathy indeed result from a primary kidney injury that promotes hypertension ? and if this is the case , should blood pressure control be the mainstay of therapy in those patients or should we develop complementary therapeutic approaches ?
it was known to be an oligosymptomatic chronic nephropathy characterized by prominent tubulointerstitial damage , a need for rrt at around the sixth decade of life and a high incidence of upper urinary tract urothelial carcinoma .
epidemiological studies have established the need for at least two decades of living in certain rural areas of certain valleys of bosnia , bulgaria , croatia , romania and serbia .
however , a breakthrough came from the study of a ckd hotspot among young belgian women .
these young women had in common a rapidly progressing ckd , reaching esrd within months , with a renal biopsy characterized mainly by tubulointerstitial nephropathy and a high incidence of upper urinary tract urothelial carcinoma while on rrt .
there was also an unusual common feature between them : they were trying to lose weight by using chinese herbs ( hence the original term chinese herb nephropathy ) .
plants of the aristolochia family were components of these chinese herbs and the toxin was identified as aristolochic acid .
aristolochic acid now provides an animal model for acute kidney injury progressing to ckd . the existence of an aristolochic acid exposure fingerprint , the presence of aristolactam - dna adducts , provided the clue to the aetiology of balkan nephropathy .
thus , both balkan nephropathy and chinese herb nephropathy are now considered part of the clinical spectrum of aristolochic acid nephropathy . moreover , in taiwan one - third of the population had been prescribed herbal remedies containing aristolochia , and the recorded incidence of upper urinary tract cancers and the incidence of esrd is the highest in the world [ 8 , 25 ] . in this regard , the problem might also be present in mainland china , as supported by recent reports .
interestingly aristolochia spp are part of the traditional medicine armamentarium not only in asia , but also in mediterranean culture and south america .
aristolochia plants were used as a remedy for snake bites by the romans and south american communities .
indeed , in 2004 colombia outlawed the use of aristolochia ( commonly known in spanish as
bejuco ) , as a home remedy against rheumatism and snake bites . to what extent
the use of traditional medicine containing aristolochic acid or other toxins contributes to ckd in other cultures remains to be established .
the first review in this ckd hotspots series of ckj reviews deals with ckd in the australian aboriginal population in the northern territories .
wendy hoy reports that with the high rate of ckd and esrd in aboriginals , albuminuria is used as a marker of ckd , and glomerulomegaly and focal glomerulosclerosis used as defining histologic features . in this regard ,
renin angiotensin system targeting , improved metabolic control and improved access to healthcare appear to be effective in decreasing esrd incidence .
factors contributing to ckd may include low socioeconomic status with nutritional and developmental disadvantage , as well as an inflammatory / infectious milieu .
the importance of socioeconomic factors can not be downplayed in this and other ckd hotspots around the world .
if overall socioeconomic conditions can not be improved , and this may be the case when the global economy is in trouble , correction of specific factors may alleviate the ckd burden .
each specific problem may require a different intervention that may also differ for different economically deprived communities .
most recently , the existence of a nephropathy of unknown cause leading to esrd has been identified in central america and termed mesoamerican nephropathy .
mesoamerican nephropathy mainly affects , otherwise healthy , young men working in rural populations in central america and is characterized by asymptomatic , progressive ckd , absent or sub - nephrotic proteinuria , the absence of haematuria and , typically , no evidence of diabetes or hypertension .
four key community - based studies in nicaragua ( three studies ) and el salvador ( one study ) have shed some light on the problem [ 2831 ] . in nicaragua the overall frequency of ckd , defined as egfr < 60 ml / min/1.73 m was 20% in men and 8% in women in a study population with a mean age
these figures contrast with the 5% prevalence of ckd in the general population in us and european surveys .
el salvador has the highest overall mortality rate from ckd in the world , with 51.8 deaths per 100 000 inhabitants . .
since 1989 , increasing mortality rates from ckd have been reported in guatemala , costa rica , honduras and panama , especially in pacific coast communities .
the prevalence was higher among agricultural workers , miners and fishermen in comparison with service - oriented workers .
in particular , low altitude plantation workers , such as banana or sugarcane workers , are the most affected .
there were no significant differences between populations regarding traditional risk factors for ckd , such as hypertension , diabetes , obesity and use of nsaids .
analysis of the epidemiology of mesoamerican nephropathy has rekindled the interest on the adverse effects of dehydration .
the leading hypothesis suggests that mesoamerican nephropathy results from repeated , unrecovered episodes of pre - renal acute kidney injury due to dehydration , volume depletion and rhabdomyolysis , caused by the severe heat stress and water and solute loss during agricultural work or mining .
in addition to this , nephrotoxic agents , such as non - steroidal anti - inflammatory drugs and other nephrotoxic medication use , inorganic arsenic , leptospirosis , or pesticides , are likely to aggravate kidney damage .
animal studies suggest that recurrent dehydration may activate the local polyol pathway , resulting in the generation of endogenous fructose that might subsequently induce renal injury via metabolism by fructokinase . in this
regard , rehydration with solutions containing high fructose corn syrup , which also contains nephrotoxic compounds such as 3,4-dideoxyglucosone-3-ene ( 3,4-dge ) [ 3638 ] may also be deleterious .
access to sufficient water during the dehydration period can protect mice from developing renal injury , suggesting a potential role of vasopressin . in this
regard , vasopressin antagonists are protective in another form of progressive tubulointerstitial disease , autosomal dominant polycystic kidney disease . whether similar pathogenic events may contribute to the high prevalence of ckd in agricultural workers in sri lanka , bangladesh and central australia remains to be explored [ 33 , 40 , 41 ] .
in summary , the ckd hotspots series will devote reviews to countries , region , communities or ethnicities with higher than average incidence of ckd .
these reviews will report on the epidemiology , underlying causes or efforts to unravel the causes if unknown , provide guidance on public policy and even be extrapolated to promote kidney health in other parts of the world .
a final manuscript in the series will summarize the series and provide an online interactive map of ckd hotspots around the world , which highlights known or suspected causes as well as ongoing projects to unravel the cause .
overall , the series will provide a tool for healthcare authorities to plan public policy , for translational researchers with know - how and means to explore causes to identify ckd hotspots and contact the professionals fighting ckd in remote and not so remote regions of the world , and for these healthcare personnel to identify similarly minded professionals working on other ckd hotspot environments .
the online tool will provide a directory of public health officials , on the ground physicians and interested basic scientists involved in these efforts , that will facilitate communication and foster collaborations in search of resources to pursue research and shape policies that help curtail this scourge .
a potential hurdle to be overcome is that much of the publicly available information refers to prevalence of esrd in whole countries .
several factors may impact on incidence of esrd that do not allow an easy extrapolation to prevalence of ckd .
thus , policies for inclusion into an esrd programme differ between countries and esrd may be initiated at available facilities that may be far from the patient residence .
emerging information on ckd prevalence is also for the most part country- or region - based and efforts to compare prevalence between different regions in a country do not abound . in colombia , the cuenta del alto costo has generated detailed regional maps displaying differences in ckd prevalence ( http://www.cuentadealtocosto.org/byblos/docs/situacion_de_la_enfermedad_renal_cronica_2013.pdf ) .
an ongoing european renal association - european dialysis and transplant association registry effort [ wanner c , presented at the 49th congress of the spanish society of nephrology ( sen ) , barcelona 2014 ] is combining and homogenizing several observational studies of ckd prevalence in european countries .
however , we realize that sometimes the high incidence of ckd in a particular country , region or even town may only be known to local authorities or healthcare personnel .
this may highlight the plea of that community , be the subject of a review in ckj and facilitate the flow of resources to clarify the cause and identify potential solutions to the problem . | chronic kidney disease ( ckd ) is one of the three causes of death that has had the highest increase in the last 20 years .
the increasing ckd burden occurs in the context of lack of access of most of the world population to adequate healthcare and an incomplete understanding of the pathogenesis of ckd .
however , ckd is not homogeneously distributed .
ckd hotspots are defined as countries , region , communities or ethnicities with higher than average incidence of ckd .
analysis of ckd hotspots has the potential to provide valuable insights into the pathogenesis of kidney disease and to improve the life expectancy of the affected communities .
examples include ethnicities such as african americans in the usa or aboriginals in australia , regions such as certain balkan valleys or central america and even groups of people sharing common activities or interests such as young women trying to lose weight in belgium .
the study of these ckd hotspots has identified underlying genetic factors , such as apol1 gene variants , environmental toxins , such as aristolochic acid and socioeconomic factors leading to nutritional deprivation and inflammation / infection .
the ckd hotspots series of ckj reviews will explore the epidemiology and causes in ckd hotspots , beginning with australian aboriginals in this issue .
an online map of ckd hotspots around the world will feature the reviewed hotspots , highlighting known or suspected causes as well as ongoing projects to unravel the cause and providing a directory of public health officials , physicians and basic scientists involved in these efforts . since the high prevalence of ckd in a particular region or population
may only be known to local physicians , we encourage readers to propose further ckd hotspots to be reviewed . |
hemostats , sealants , and adhesives are gaining increasing acceptance in surgical practice in the united states and presently represent a multi - billion dollar industry .
a set of definitions and nomenclature are helpful in order to facilitate the safest and most cost effective use of these materials.13 a hemostat is designed to cause blood to clot and requires the presence of blood in the operative field to be effective .
they polymerize independently and may work best when blood is not present in the field .
finally , adhesives function as self polymerizing glues capable of causing tissue adherence and often work best in a relatively dry area .
importantly , although not hemostats , both sealants and adhesives can have major hemostatic effects when used to seal or glue blood vessels together as their application can prevent major blood loss .
the three groups : hemostats ; sealants ; and adhesives can be broken down into categories ( table 1 ) which are named to clarify the origin of the agents within each respective category .
the hemostat group for example is divided into four categories : mechanical , active , flowable , and fibrin sealant .
classes of agents can also be described.2,3 for the purposes of simplification and this review , classes for the categories of the fibrin sealants only have been provided ( table 1 ) to facilitate understanding the role of this material in rhytidectomy .
the entire classification system for all hemostats , sealants , and adhesives is available in the literature2 including a recent update.3 fibrin sealant was the first of many new agents approved by the food and drug administration ( fda ) starting in 1998 and serves as an example for several reasons .
first , as the initial approved agent it helped to establish new fda regulatory review pathways for both biologics and devices.3 second , its introduction began to educate surgeons , academics , and marketers that proper use of this type of material actually requires some skill and education.4 third , fibrin sealant is the only product which has achieved fda approval in all three groups as a hemostat , sealant , and adhesive.5 finally , the material has been demonstrated to be effective in randomized prospective multicenter clinical trials in multiple different surgical specialties . at present fibrin sealants
are derived from human pooled plasma and manufacturers take multiple steps to increase safety and eliminate the possibility of viral or prion disease transmission .
fibrin sealants come in a variety of liquid formulations which may require mixing , thawing , and applicator assembly.13 there is one new form of fibrin sealant approved as a hemostat which combines dry fibrinogen and thrombin on an equine collagen patch and is immediately available for use out of the package.3 fibrin sealants are among the more costly hemostats , sealants , and adhesives and the fibrin sealant patch is the most costly hemostat.3 laboratory68 and clinical9,10 evidence supporting the use of fibrin sealant as a means of simultaneously achieving hemostasis , sealing blood vessels and lymphatics , and attaching skin flaps to eliminate potential space and prevent seroma formation during neoplasm resections was published in the 19801990s .
clinical reports of successful use of fibrin sealant for similar indications during rhytidectomy also appeared in the plastic surgical literature at the same time.1114
multiple liquid fibrin sealants are now approved by the fda as broad label hemostats during surgical procedures ( tisseel ; baxter , westlake village , ca)15,16 ( evicel ; ethicon / j&j , somerville , nj)17 ( vitagel ; orthovita , malvern , pa)18 and a patch is approved for hemostasis during cardiac surgery only ( tachosil ; baxter).19 one fibrin sealant product is approved as sealant for colon sealing at the time of colostomy closure ( tisseel).16 in addition , one fibrin sealant is approved as an adhesive for attachment of skin grafts at the time of burn wound debridement and skin flap adherence at the time of rhytidectomy ( artiss ; baxter).20 this latter material will be presented in depth in terms of safety , efficacy , usability , and cost in this review as it is the only agent approved by the fda as an adhesive during rhytidectomy .
it is notable , however , that the other liquid fibrin sealants could potentially be used off label in this same indication by first diluting the thrombin concentration in the product to less than 5 iu / ml before combining it with fibrinogen to create a slowly polymerizing adhesive .
finally , the ability to use an individual patient s own autologous plasma in the form of platelet rich or poor plasma as a fibrinogen source should be mentioned .
this material can then be combined with free standing thrombin of bovine ( thrombin - jmi ; king pharmaceuticals , bristol , tn ) , human pooled plasma ( evithrom ; ethicon / j&j ) or recombinant ( recothrom ; zymogenetics / bms , seattle , wa ) origin to make fibrin sealant .
although not specifically approved by the fda for producing fibrin sealant or for use in rhytidectomy flap adherence , multiple device separation systems exist for obtaining the autologous plasma from the patient s blood ( amicus ; fenwal , round lake , il ; cell saver ; haemonetics , braintree , ma ; harvest ; smith and nephew , memphis , tn ; magellan ; medtronic , minneapolis , mn ; recover ; biomet biologics , warsaw , in ; symphony ; depuy , raynham , ma ) . advantages of this method include reduced cost and reduction of viral or prion disease transmission risk particularly if used with recombinant thrombin .
this choice of thrombin eliminates the risk of immune mediated coagulopathy associated with bovine thrombin and viral or prion disease transmission associated with pooled plasma products .
disadvantages of the use of the separation systems include the time and personnel needed to prepare the material and the lower fibrinogen concentration obtained as compared to commercial fibrin sealants .
again , it is important to decrease the concentration of the free standing thrombin used to < 5 iu / ml to slow the polymerization process of fibrinogen to fibrin in order to assure adequate time for flap manipulation .
artiss20 was originally approved for the attachment of skin grafts at burn wound debridement sites without the need for anchoring sutures or staples ( figure 1 ) .
expansion of the label to include the adherence of skin flaps during rhytidectomy was achieved in august of 2011.21 the key modification in this fibrin sealant designed specifically as an adhesive and not as a hemostat is the low thrombin concentration , 4.5 iu ( range 2.5 to 6.5 iu ) which allows up to 60 seconds to position grafts or flaps prior to fixation .
the product also contains fibrinogen , 86.5 mg / ml ( range 67 to 106 mg / ml ) and aprotinin , 3,000 kiu ( range 2250 to 3750 kiu / ml ) .
many of the safety issues related to the use of this product are those related to the pooled human plasma from which the fibrinogen and thrombin used in this two component adhesive are derived as well as the synthetic aprotinin which the product contains .
pooled human plasma products may be potential sources for transmission of viruses including human immunodeficiency virus , hepatitis , and parvovirus b19 as well as on at least a theoretical basis transmission of prions including creutzfeldt - jakob disease agent .
the manufacturer uses multiple strategies to reduce the risk of viral disease transmission including donor screening , testing , and pathogen reduction.22 plasma is obtained at licensed us collection centers where high risk donors are eliminated by screening for high risk behavior .
overall log viral reduction using multiple steps varies from a high of > 14.0 for human immunodeficiency virus in thrombin to a low of 3.9 for mice minute virus ( a model for parvovirus b19 ) in fibrinogen .
no cases of aids or hepatitis have been documented in the literature secondary to fibrin sealant in 20 years of use.23 there have been two different literature reports of parvovirus b19 transmission secondary to fibrin sealants.24,25 parvovirus infections may cause severe illness in patients who are pregnant , immune - compromised , or with increased erythropoiesis .
the illness is characterized by fever , drowsiness , chills , and runny nose followed in two weeks by a rash and joint pains .
it may be a source of hypersensitivity reactions and anaphylaxis that are more frequent on re - exposure , but can occur on first use.20 additional safety issues with this fibrin sealant product include : air embolism associated with use of a pressurized spray applicator ( recommended pressure < 2025 psi and distance 1015 cm with further reductions in pressure required as distance decreases ) ; graft loss secondary to application of an excessively thick layer of product ; and denaturing of the product secondary to iodine , alcohol , or heavy metal ions.20 no fibrin sealant product should ever be injected into the intravascular space to avoid the risk of thromboembolic events .
the efficacy of this fibrin sealant adhesive product has been established in two large fda sponsored multicenter randomized prospective clinical trials .
the first demonstrated that the agent could be used successfully as compared to staples to attach skin grafts ( figure 2 ) in burn wound debridement patients including adults and children.20,26 the patients served as their own controls ( intent to treat 128 patients ) and two grafts were placed per patient using fibrin sealant at one site and staples at the other site .
analysis of the primary endpoint , healing at day 28 by planimetry , revealed that 70.7% of fibrin sealant treated sites and 65.8% of stapled sites were judged to have been completely healed .
the lower limit of the 97.5% confidence interval was less than the predetermined inferiority margin ( 0.1 ) at a value of 0.029 showing that the fibrin sealant product was non inferior to staples in this indication .
additional analysis revealed superiority of fibrin sealant over staples respectively for : hematoma formation at day 1 , 29.7% versus 62.3% ( p < 0.0001 ) ; investigator judged wound quality measures including adherence quality , fixation method preference , satisfaction with method , and overall quality ( p < 0.0001 ) ; and patient assessed outcomes including pain , anxiety , and treatment preference ( p < 0.0001 ) . there were no serious adverse events .
the second large study in patients ( n = 75 ) undergoing rhytidectomy demonstrated that patients had significant ( p < 0.0001 ) reductions in serous fluid drainage volume in the first 24 hours on the randomly selected fibrin sealant treated side of the face , 7.7 7.4 ml versus the standard of care side of the face 20.0 11.3 ml.20,27 a trend towards a reduced number of hematomas was also noted on the fibrin sealant side of the face as compared to the standard of care side , 2 versus 5 patients respectively .
an example of this technique in head and neck surgery is illustrated ( figure 3 ) .
the fibrin sealant adhesive product comes in 2 , 4 , and 10 ml kits which refer to the total volume of fibrin sealant produced by the kit.20 the usability of liquid fibrin sealant in general has been an impediment to adoption in the united states as some combination of thawing , mixing , and applicator assembly has been required in the past .
the need for this preparation was often associated with the consternation of operating room nurses and circulators who were assigned the complex task of preparing the material . in response to this issue
the first is a freeze - dried product ( stored at 2c25c ) which no longer requires thawing or refrigeration , but does still need reconstitution and applicator assembly . mixing is facilitated using a supplied system which is most important in reconstituting the fibrinogen component ( figure 4 ) .
the second form of the product , a frozen liquid ( stored at 20c ) in a preassembled applicator pouch , requires no mixing and minimal assembly , but does require thawing .
thawing times vary depending on kit size and method of defrosting : room air ; incubator at 33c37c ; or sterile or unsterile water bath at 33c37c .
the fastest thawing time is 5 minutes which can be achieved using the smallest 2 ml kit in a warm sterile water bath at 33c37c .
unopened pouches thawed at room temperature may be stored in a refrigerator ( at 15c25c ) for periods of up to 2 weeks and then can be quickly available after a brief period of warming ( at 33c37c ) .
the product should never be warmed in a microwave . the applicator system ( spray set ; baxter)28 and pressure regulator ( easyspray ; baxter)29 allow for spraying a fine mist and creating a thin tissue layer of applied material .
a variety of applicators for spray or drip application are available ( figure 5 ) .
a thin layer of material should be applied to avoid formation of excess granulation tissue20 as well as to allow for skin graft nutrient diffusion.30 the graft or flap should be placed on top of the fibrin sealant immediately after application .
manipulation or repositioning is possible for only the first 60 seconds which should then be followed by 3 minutes of gentle pressure .
any further manipulations of the graft or flap need to be avoided to prevent disruption of the fibrin sealant adhesive bond .
this fibrin sealant is priced competitively to other liquid fibrin sealants on the market and costs approximately 50 per ml of final fibrin sealant product .
in addition to the fda sponsored trials already discussed , the advantages of using fibrin sealant in rhytidectomy have been described in the literature for at least 30 years.11 case reports,11,12,31 large series,13,14,3235 and randomized prospective trials27,36,37 support the value of using fibrin sealant in rhytidectomy .
several investigators question some of the reported advantages of this material.3840 the literature also contains data41 and a recent review42 supporting the use platelet gels as an alternative to fibrin sealant in rhytidectomy .
a review of tissue glue use in plastic surgery also addresses the best use of fibrin sealant and platelet gels in a variety of different facial aesthetic procedures.43 benefits of using fibrin sealant in individual patient reports include reduced : number of sutures;11 extent of swelling;11 amount of serous fluid secretions11 hematoma formation;12 operating time;12 need for drains;12,13 and recovery time.12 advantages to using fibin sealant in a large series using historical controls included statistically significant reductions in major hematomas and ecchymosis as well as the ability to use no drains at all.13 in a sequential endoscopic series using fibrin sealant for proper brow fixation , a significant improvement in the last 69 patients compared to the first 28 patients was found for eye brow positioning and muscle weakening14 highlighting the fact that there may be a learning curve for the use of fibrin sealant.4 in another sequentially controlled series of first using no fibrin sealant with drains followed by aerosolized fibrin sealant without drains in facelift surgery,32 significant reductions were found in bruising and swelling ( p < 0.0001 ) as well as operating room time by 13 minutes ( p < 0.0001 ) .
a faster recovery time was found in another sequentially controlled series of short scar face - lift procedures using fibrin sealant.33 in another historically controlled ( n = 100 ) trial with prospectively enrolled patients ( n = 100 ) undergoing rhytidectomy with fibrin sealant,34 significant reductions were seen using fibrin sealant in : hematoma rate , 1% versus 3% ( p < 0.05 ) ; and prolongued induration , edema , and ecchymosis , 0% versus 22% ( p < 0.05 ) .
no advantages were found for using fibrin sealant in pain score and patient satisfaction . in a retrospective comparison of deep - plane face - lift surgery with (
n = 459 ) and without ( n = 146 ) fibrin sealant,35 adhesive treatment was associated with a significantly reduced hematoma rate , 0.45% versus 3.4% ( p = 0.01 ) . in a prospective , randomized series with the patients ( n = 20 ) serving as their own controls by randomly varying the sides of the face treated with fibrin sealant,36 a significant reduction in 24 hours of postoperative drainage prior to drain removal
was found in the treated sides , 10 ml versus 30 ml ( p = 0.002 ) . in a small , fda sponsored , single institution , randomized , prospective trial of patients ( n = 9 ) with pressure dressings applied to all patients
, reviewers blinded to treatment , and randomly varying the side of the face treated with fibrin sealant ( crosseal ; omrix , brussels , belgium),37 a significant reduction in the treated patient sides was found for ecchymosis score , 4.5 versus 6.2 ( p < 0.01 ) .
several investigators have published data suggesting the lack of effectiveness of fibrin sealant in rhytidectomy . in a large retrospective study of 678 patients undergoing face - lifts,38 the effect of dressings , drains , and tumescence on hematoma formation
no reduction in hematoma rate was found for the use of fibrin sealant . in a randomized , prospective trial of using fibrin sealant in face - lifts,39
treated patient sides had a significant reduction in postoperative drainage volume , 26 ml versus 33.5 ml ( p = 0.037 ) , but this change of 7.5 ml was not thought to be surgically important .
no reduction in hematomas on the treated sides was found . finally , a meta - analysis of three , randomized , controlled , fibrin sealant trials40 found a strong trend towards reduction in postoperative drainage and ecchymosis at 24 hours , but no reduction in edema .
both a study41 and a recent review42 support the use of platelet gels ( patient s own plasma and platelets used as a low concentration fibrinogen source combined with a free standing thrombin to create a fibrin sealant like material thought to have augmented value as result of growth factors in platelets ) in rhytidectomy . in the retrospective ,
historically controlled study,41 the platelet gel treated patients ( n = 19 ) had a significant reduction of 35% ( p
< 0.03 ) in postoperative drainage volume at 8 hours as compared to control patients ( n = 14 ) who received no platelet gel .
clearly , the literature shows a wide variation in results for the application of fibrin sealant in rhytidectomy with the most consistent and best results demonstrated in reduction of fluid drainage while less reproducible results being reported for reduction of hematomas , ecchymoses , and edema
. some of this variation may be as a result of using different materials and application techniques .
the next section will review some of the author s suggestions for maximizing the effectiveness of fibrin sealant during rhytidectomy .
suggestions for hemostasis creation , pre sealant preparation , sealant application , post sealant treatment , and postoperative care are provided ( table 2 ) .
the single most important concept is that the use of fibrin sealant needs to be planned as an integral part of the operation and not just as a mere additional adjunct . to gain the maximum benefit from the use of this adhesive multiple other steps need to be organized in a coordinated and timely fashion .
hemostasis is critically important in order to avoid hematomas which may contribute to ecchymoses and delayed healing .
when fibrin sealant liquid is used as a hemostat employing a higher concentration of thrombin ( > 500 iu / ml ) , the material is indicated for hemostasis of bleeding which is non suturable and non cauterizable .
thus , in rhytidectomy , all bleeding that can be treated by conventional methods should be addressed prior to using the fibrin sealant as a slowly polymerizing adhesive employing a low thrombin concentration ( < 5 iu / ml ) .
any hemostatic benefits to using the fibrin sealant in this setting may be as a result of a sealing effect which may help to keep small vessels closed as vasospasm subsides after the procedure . prior to using the fibrin sealant
all preparations should be made to avoid further manipulations of the flaps or skin following adhesive application .
all sutures should be in place including anchoring sutures which then should be tied as soon as possible after application of the fibrin sealant .
any suture lines should be preplaced as a lattice work ( figure 3 , top portion ) which can be quickly tightened after sealant application .
if drains are to be placed , they should be in position prior to fibrin sealant application and should be protected so as not to be clogged by the addition of the adhesive .
the drains may become unnecessary as experience and in the method of fibrin sealant use is gained and the drains can then be omitted altogether . during the application of fibrin sealant itself ,
it is important to assure that all flaps and surfaces are covered with the adhesive using appropriate length cannulas or spray devices ( figure 5 ) .
the adhesive should be applied as an even thin layer to facilitate the maximum rate of flap healing and to facilitate nutrient diffusion in order to avoid graft tissue necrosis .
after the placement of the sealant , the flaps should be quickly positioned and adjusted as necessary so that any manipulation can be avoided after the first 60 seconds of polymerization time .
as soon as possible after application of fibrin sealant , gentle pressure should be applied to all flaps ( figure 3 , bottom portion ) for at least 3 minutes to assure bonding between the flap and underlying tissues .
it is critical not to do any further flap or skin manipulation after this period of initial bonding .
the lifting of skin for placement of additional sutures or manipulation with forceps as well as any further movement of the flaps needs to be strictly avoided .
this is necessary because breaking of the fibrin sealant bonds at this point will create a smooth non sticky polymerized fibrin sealant interface between the flap and underlying tissues which has been shown to be an excellent anti - adhesive.44 the placement of an anti - adhesive in this location may actually increase the formation of seromas and fluid drainage .
thus clearly arterial hypertension should be minimized and nausea and vomiting should be prevented if possible and treated if present to decrease the potential for venous pressure elevation .
in addition to the fda sponsored trials already discussed , the advantages of using fibrin sealant in rhytidectomy have been described in the literature for at least 30 years.11 case reports,11,12,31 large series,13,14,3235 and randomized prospective trials27,36,37 support the value of using fibrin sealant in rhytidectomy .
several investigators question some of the reported advantages of this material.3840 the literature also contains data41 and a recent review42 supporting the use platelet gels as an alternative to fibrin sealant in rhytidectomy .
a review of tissue glue use in plastic surgery also addresses the best use of fibrin sealant and platelet gels in a variety of different facial aesthetic procedures.43 benefits of using fibrin sealant in individual patient reports include reduced : number of sutures;11 extent of swelling;11 amount of serous fluid secretions11 hematoma formation;12 operating time;12 need for drains;12,13 and recovery time.12 advantages to using fibin sealant in a large series using historical controls included statistically significant reductions in major hematomas and ecchymosis as well as the ability to use no drains at all.13 in a sequential endoscopic series using fibrin sealant for proper brow fixation , a significant improvement in the last 69 patients compared to the first 28 patients was found for eye brow positioning and muscle weakening14 highlighting the fact that there may be a learning curve for the use of fibrin sealant.4 in another sequentially controlled series of first using no fibrin sealant with drains followed by aerosolized fibrin sealant without drains in facelift surgery,32 significant reductions were found in bruising and swelling ( p < 0.0001 ) as well as operating room time by 13 minutes ( p < 0.0001 ) .
a faster recovery time was found in another sequentially controlled series of short scar face - lift procedures using fibrin sealant.33 in another historically controlled ( n = 100 ) trial with prospectively enrolled patients ( n = 100 ) undergoing rhytidectomy with fibrin sealant,34 significant reductions were seen using fibrin sealant in : hematoma rate , 1% versus 3% ( p < 0.05 ) ; and prolongued induration , edema , and ecchymosis , 0% versus 22% ( p
no advantages were found for using fibrin sealant in pain score and patient satisfaction . in a retrospective comparison of deep - plane face - lift surgery with ( n = 459 ) and without ( n = 146 ) fibrin sealant,35 adhesive treatment was associated with a significantly reduced hematoma rate , 0.45% versus 3.4% ( p = 0.01 ) . in a prospective , randomized series with the patients ( n = 20 ) serving as their own controls by randomly varying the sides of the face treated with fibrin sealant,36 a significant reduction in 24 hours of postoperative drainage prior to drain removal was found in the treated sides , 10 ml versus 30 ml ( p = 0.002 ) . in a small , fda sponsored , single institution , randomized , prospective trial of patients ( n = 9 ) with pressure dressings applied to all patients , reviewers blinded to treatment , and randomly varying the side of the face treated with fibrin sealant ( crosseal ; omrix , brussels , belgium),37 a significant reduction in the treated patient sides was found for ecchymosis score , 4.5 versus 6.2 ( p < 0.01 ) .
several investigators have published data suggesting the lack of effectiveness of fibrin sealant in rhytidectomy . in a large retrospective study of 678 patients undergoing face - lifts,38 the effect of dressings , drains , and tumescence on hematoma formation
no reduction in hematoma rate was found for the use of fibrin sealant . in a randomized , prospective trial of using fibrin sealant in face - lifts,39
treated patient sides had a significant reduction in postoperative drainage volume , 26 ml versus 33.5 ml ( p = 0.037 ) , but this change of 7.5 ml was not thought to be surgically important . no reduction in hematomas on the treated sides was found .
finally , a meta - analysis of three , randomized , controlled , fibrin sealant trials40 found a strong trend towards reduction in postoperative drainage and ecchymosis at 24 hours , but no reduction in edema .
both a study41 and a recent review42 support the use of platelet gels ( patient s own plasma and platelets used as a low concentration fibrinogen source combined with a free standing thrombin to create a fibrin sealant like material thought to have augmented value as result of growth factors in platelets ) in rhytidectomy . in the retrospective , historically controlled study,41 the platelet gel treated patients ( n = 19 ) had a significant reduction of 35% ( p
< 0.03 ) in postoperative drainage volume at 8 hours as compared to control patients ( n = 14 ) who received no platelet gel .
clearly , the literature shows a wide variation in results for the application of fibrin sealant in rhytidectomy with the most consistent and best results demonstrated in reduction of fluid drainage while less reproducible results being reported for reduction of hematomas , ecchymoses , and edema .
some of this variation may be as a result of using different materials and application techniques .
the next section will review some of the author s suggestions for maximizing the effectiveness of fibrin sealant during rhytidectomy .
suggestions for hemostasis creation , pre sealant preparation , sealant application , post sealant treatment , and postoperative care are provided ( table 2 ) .
the single most important concept is that the use of fibrin sealant needs to be planned as an integral part of the operation and not just as a mere additional adjunct . to gain the maximum benefit from the use of this adhesive multiple other steps need to be organized in a coordinated and timely fashion .
hemostasis is critically important in order to avoid hematomas which may contribute to ecchymoses and delayed healing .
when fibrin sealant liquid is used as a hemostat employing a higher concentration of thrombin ( > 500 iu / ml ) , the material is indicated for hemostasis of bleeding which is non suturable and non cauterizable .
thus , in rhytidectomy , all bleeding that can be treated by conventional methods should be addressed prior to using the fibrin sealant as a slowly polymerizing adhesive employing a low thrombin concentration ( < 5 iu / ml ) .
any hemostatic benefits to using the fibrin sealant in this setting may be as a result of a sealing effect which may help to keep small vessels closed as vasospasm subsides after the procedure . prior to using the fibrin sealant
all preparations should be made to avoid further manipulations of the flaps or skin following adhesive application .
all sutures should be in place including anchoring sutures which then should be tied as soon as possible after application of the fibrin sealant .
any suture lines should be preplaced as a lattice work ( figure 3 , top portion ) which can be quickly tightened after sealant application
. if drains are to be placed , they should be in position prior to fibrin sealant application and should be protected so as not to be clogged by the addition of the adhesive .
the drains may become unnecessary as experience and in the method of fibrin sealant use is gained and the drains can then be omitted altogether . during the application of fibrin sealant itself ,
it is important to assure that all flaps and surfaces are covered with the adhesive using appropriate length cannulas or spray devices ( figure 5 ) .
the adhesive should be applied as an even thin layer to facilitate the maximum rate of flap healing and to facilitate nutrient diffusion in order to avoid graft tissue necrosis .
after the placement of the sealant , the flaps should be quickly positioned and adjusted as necessary so that any manipulation can be avoided after the first 60 seconds of polymerization time .
as soon as possible after application of fibrin sealant , gentle pressure should be applied to all flaps ( figure 3 , bottom portion ) for at least 3 minutes to assure bonding between the flap and underlying tissues .
it is critical not to do any further flap or skin manipulation after this period of initial bonding .
the lifting of skin for placement of additional sutures or manipulation with forceps as well as any further movement of the flaps needs to be strictly avoided .
this is necessary because breaking of the fibrin sealant bonds at this point will create a smooth non sticky polymerized fibrin sealant interface between the flap and underlying tissues which has been shown to be an excellent anti - adhesive.44 the placement of an anti - adhesive in this location may actually increase the formation of seromas and fluid drainage .
thus clearly arterial hypertension should be minimized and nausea and vomiting should be prevented if possible and treated if present to decrease the potential for venous pressure elevation .
fibrin sealant is an important addition to the surgeons armamentarium and is useful in rhytidectomy .
this review has characterized the material and provided a nomenclature for understanding the capabilities of this unique hemostat , sealant , and adhesive .
the use of fibrin sealant in rhytidectomy and the currently approved product for this indication have been reviewed in depth .
the author s suggestions to facilitate the most effective use of the agent have been provided and it should be emphasized that there is a gentle learning curve to master in order to use this powerful multiple capacity product most effectively . | the purpose of this review is to clarify the present use of fibrin sealant in rhyditectomy procedures and help maximize the appropriate and safe application of this material .
a set of terms and definitions for hemostats , sealants , and adhesives based on group , category , and class will be employed to highlight the specific capabilities of fibrin sealant .
fibrin sealant has now emerged as an example of maximizing the usefulness of a surgical agent and is the only product with food and drug administration approval in all three groupings : hemostats ; sealants ; and adhesives .
a variety of manufacturers fibrin sealant products are available including multiple liquids and one patch .
a single liquid product is now specifically indicated for skin flap adherence during rhytidectomy .
the unique characteristic of this particular two component fibrin sealant adhesive agent is its slower polymerization rate as a result of a low thrombin concentration which when combined with fibrinogen permits adequate time for manipulation of flaps and tissues prior to final fixation .
in addition to its flap adherence and potential space elimination capability , fibrin sealant is also an excellent blood clotting agent and can seal tissues to prevent lymphatic leak or serous fluid accumulation .
thus , it is almost ideally suited to reduce the occurrence of fluid accumulation , hematomas , ecchymoses , and swelling , as well as to possibly eliminate the need for drains following rhytidectomy . a literature review of fibrin sealant in rhytidectomy
is included to help define the current state of its clinical use .
the author s recommendations for the best use of this material during facial procedures are also provided . |
mechanical preparation of the root canal system is recognized as being one of the most important stages in root canal therapy . this process serves to optimize the shape of the canal for disinfection and obturation , giving it a uniformly tapered funnel shape , with a diameter that increases smoothly from the apex toward the coronal orifice .
however , endodontic preparation with different techniques and instruments becomes more challenging when the root canal has pronounced curvature , and in such cases there is a tendency for deviation of the prepared canal away from its natural axis .
the ability of an instrument or technique to stay centered within the natural canal path during preparation is seen as a highly positive property .
iatrogenic preparation errors such as canal transportation are clearly undesirable , and can be broadly defined as any deviation from the natural canal path .
thus , techniques and endodontic instruments should be employed that cause fewer errors , give greater precision , and decrease working time .
recently , the development of nickel - titanium ( ni - ti ) instruments has significantly improved the quality of root canal shaping , resulting in less iatrogenic damage .
their design allows ni - ti instruments to stay more centered in the canal , producing rounder preparations and reducing procedural errors .
various methods have been used to investigate the efficacy of different endodontic instruments with regard to their centering ability and tendency to produce root canal transportation .
classical in vitro methods of studying the morphologic characteristics of root canal systems produce irreversible changes in the samples and can yield only a 2-dimensional image .
more accurate information can be achieved with micro - computed tomography ( micro - ct ) , which provides quantitative and qualitative evaluation of the root canal in 3 dimensions .
micro - ct is a non - invasive experimental method that allows the comparison of pre- and post - preparation images of root canals .
the aim of this study was to use micro - ct to evaluate root canal transportation and centering ability of protaper rotary files ( dentsply , maillefer , ballaigues , switzerland ) and standard stainless steel k - files ( diadent , france ) .
a total of 60 maxillary second intact premolars with fully formed apices were selected from a pool of extracted teeth that were removed for periodontal and orthodontic reasons .
prior to the study , the teeth were washed with distilled water to remove residual formalin . before the initial micro - ct scan , each tooth was mounted in a sample holder to allow reproducible orientation in the pre- and post - preparation scans .
prior to preparation , all teeth were scanned using a skyscan 1173 micro - ct system ( bruker microct , kontich , belgium ) with an isotropic resolution of 22.86 m at 70 kv/114 microa using a 1-mm aluminum filter , or a skyscan 1174 system ( bruker microct , kontich , belgium ) with an isotropic voxel size of 24 m at 50 kv/800 microa .
initially , 2-dimensional lateral projections of the samples were created over 360 , with a rotation step of 0.4. subsequently , the projection images were reconstructed using a modified feldkamp algorithm ( nrecon with a gpu recon server version 1.6.8.0 , skyscan , kontich , belgium ) and 2-d cross - sectional images were acquired .
distance calculations were made using skyscan dataviewer software ( version 1.4.4 ; skyscan , kontich , belgium ) .
after initial scanning , the access cavities were prepared and root canals localized and explored with a size 15 k - file ( diadent , france ) until they were visible to the apical foramen .
the working length was determined by subtracting 1 mm from the length to the apical foramen . at this point ,
the root canals of teeth in the first group were instrumented with stainless steel k - files ( diadent , france ) using a step - back technique .
the root canals of teeth in the second group were prepared with the protaper rotary system ( dentsply , maillefer , ballaigues , switzerland ) using a crown - down approach . in this technique
, the sx instrument was used to relocate the canal orifice and shape the coronal part of the canal .
instrumentation of the middle and apical sectors of the canal up to working length was achieved using s1 and s2 shaping files and f1 , f2 , and f3 finishing files .
each instrument was passively introduced into the canal at a rotation rate of 250 rpm . during instrumentation ,
root canals of both groups were irrigated with 2 ml of 3% sodium hypochlorite ( ultradent products , inc .
after preparation was completed by an experienced operator , each sample was inserted into the micro - ct scanner in the same sagittal position and re - scanned using the same parameters as in the initial scan , for comparison against the pre - preparation images .
the degree of canal transportation was calculated by measuring the shortest distance from the edge of a non - instrumented canal to the periphery of the root ( mesial and distal ) and then comparing this with the same measurements made in images of instrumented canals . according to gambilli et al .
( 1996 ) , the formula for canal transportation ( in mm ) is : where x1 and x2 are the shortest distances between the mesial root periphery and the canal in non - instrumented and instrumented canals , respectively , and y1 and y2 represent the shortest distance between the distal root periphery and the canal in non - instrumented and instrumented canals , respectively ( figure 1 ) . pre- and post - operative calculations were compared to determine the existence of canal transportation in the coronal , middle , and apical sectors ( figure 2 ) . according to this formula , a
any result other than 0 shows that transportation of the root canal has occurred .
a negative value represents transportation occurring in the direction facing the furcation , whereas positive values represent transportation lateral to the curvature .
the mean centering ratio is a measure of the ability of an instrument to stay centered within the canal and can be calculated using the formulae : where x1 , x2 , y1 , and y2 are the same parameters as listed in the formula for canal transportation above . according to this formula , a centering value of
1 means perfect centering , 0.600.99 indicates good centering ability , 0.400.59 shows moderate centering ability , 0.010.39 shows poor centering ability , and a value of 0 indicates no centering .
the transportation and centering ratio results were analyzed statistically using spss for windows ( spss statistics 15.0 ) .
parametric statistical test ( one - way anova ) was used to determine any statistically significant differences amongst the groups . a 0.05 level of confidence
regarding the direction of root canal transportation , both preparation techniques caused transportation toward both the inside and outside of the curvature .
there was more frequent transportation toward the inside of the curve in the coronal and middle sectors after preparation with both stainless steel files and the protaper rotary system .
the apical third showed more canal transportation toward the outside of the curve in both experimental groups ( table 1 ) . in the analysis of the same 5 cross - sectional images ( before and after preparation ) in each of the 3 root canal sectors ( coronal , middle , and apical )
, one - way anova showed a significantly lower frequency of transportation in root canals prepared with the protaper rotary system compared with those prepared using stainless steel files ( table 2 ) .
the data describing the centering ability of each system in each of the 3 root canal sectors are shown in table 3 .
the protaper system demonstrated significantly superior centering ability in each of the 3 root canal sectors compared with stainless steel files ( p<0.00001 ) .
93.3% of protaper instruments showed good centering ability , compared with only 16.7% of hand files . in the middle sector , the rotary ni - ti instruments showed good centering ability in 50% of samples , whereas hand files exhibited poor centering .
recently , new methods for evaluating procedural errors after root canal preparation have improved our understanding of which preparation techniques are most efficient .
the present research used a model that allows quantitative and qualitative evaluations of root canals , revealing their anatomical properties and variations in 3 dimensions , increasing the success rate of endodontic treatment and the progress of research .
the crown - down technique using protaper rotary files gave less canal transportation compared with manual preparation with stainless steel files .
this may be attributed to instrumentation technique , and/or to the type and design of the instruments .
the crown - down technique improves access for subsequent files , but is somewhat dependent on the higher flexibility of ni - ti alloys compared with stainless files .
indeed , it has been shown that protaper instruments ( in the absence of major procedural errors ) may even be more effective in shaping narrow canals than wide ones .
evaluation of root canal preparation by different techniques demonstrated that rotary ni - ti instruments produced less canal transportation than stainless steel or ni - ti hand files , but similar research in a different laboratory reported contrary results , finding that canal transportation was less frequent with ni - ti hand files than with rotary techniques .
our present study shows that the direction of transportation in the apical area is toward the outside curvature , a finding that corroborates previous studies reporting that the super - elasticity of the instruments allows them to follow the canal curvature [ 2123 ] .
canal transportation of up to 0.15 mm is considered acceptable , but anything higher than 0.30 mm has a negative impact on the resultant apical seal . in the present study , we demonstrated canal transportation of less than 0.30 mm with both techniques .
the second parameter evaluated was centering ability , which gives an indication of whether the dentine removal over the prepared area is spread evenly by the instrument .
good centering ability reduces the risk of transportation , zips , elbows , and other errors .
a number of studies have shown that the centering ratio of rotary ni - ti instruments was better than stainless steel files .
a safe , non - cutting tip allows the instrument to move properly in the canal and , importantly , to remain centered within it .
centering ability is , at least in part , determined by the flexibility of ni - ti instruments .
we found that protaper rotary files had superior centering compared with stainless steel hand files , especially in apical and middle thirds of the canal .
however , neither of the systems used in the study had perfect centering , with both showing a mixture of good and poor centering ability . in the present study
, micro - ct provides images at a resolution of 22.86 m , making it an excellent method for the evaluation of procedural errors after root canal preparation .
however , more studies are required to further develop the evaluation of root canal preparation by different techniques , which should drive improvements in success rates of endodontic therapy .
according to the methodology used , and on the basis of the results of this study , we conclude that 1 ) manual preparation with stainless steel files produces more canal transportation than the protaper rotary system , and 2 ) the protaper rotary system has better centering ability than stainless steel files . | backgroundroot canal shaping without any procedural error is of the utmost preference .
therefore , the purpose of this study was to use micro - computed tomography to evaluate and compare the root canal shaping efficacy of protaper rotary files and standard stainless steel k-files.material/methodssixty extracted upper second premolars were selected and were divided into 2 groups of 30 . before preparation , all samples were scanned by micro - ct .
then , 30 teeth were prepared with stainless steel files and the remaining 30 with protaper rotary files .
canal transportation and centering ability before and after root canal shaping were assessed using micro - ct .
the amount and direction of canal transportation and the centering ratio of each instrument were determined in the coronal , middle , and apical parts of the canal .
the 2 groups were statistically compared using one - way anova.resultsprotaper rotary files gave less transportation ( p<0.001 ) and better centering ability ( p<0.00001 ) compared with stainless steel files.conclusionsthe manual technique for preparation of root canals with stainless steel files produces more canal transportation , whereas rotary files remain more centered in the canal . |
effects of temperature ( 400 - 1000 degrees c ) and rate of heating to 550 degrees c ( 100 , 1000 , 5000 degrees c / sec ) on reduction of pyrene contamination in a superfund - related soil and on yields of volatile products ( tars , co , co2 , methane , acetylene , ethylene ) have been measured .
fifty ( + /-
3)-milligram thin layers ( less than or equal to 150 micron ) of 63- to 125-micron soil particles , neat ( i.e. , without exogenous chemicals ) , or pretreated with 4.75 wt% of pyrene , were heated for about 1 to 6 sec , under 3 psig ( pounds per in.(2 ) gauge ) of helium in a 12-liter sealed chamber .
pyrene removal , defined as the difference in weight loss of neat versus contaminated soil , was virtually immune to heating rate but increased strongly with increasing temperature , approaching 100% at about 530 degrees c. however , for pyrenepolluted soil , excess soil weight loss and modified co yields were observed above about 500 degrees c for a 1000 degrees c / sec heating rate .
these observations suggest that soil chemical reactions with pyrene or pyrene decomposition products augment soil volatilization .
consequently at elevated temperatures , the difference in weight loss protocol may overestimate polycyclic aromatic hydrocarbon ( pah ) removal from soil . increasing heating rate caused yields of co , co(2 ) , and acetylene from pyrene - polluted soil to pass through maxima .
heating neat or contaminated soil resulted in at least two gaseous products of particular environmental interest : acetylene , a precursor to pah in thermal synthesis , and co , a toxin to human hemoglobin.imagesfigure 1figure 2 |
|
sarcoidosis is defined as a multisystem granulomatous disorder of unknown cause .
venous thrombosis ( vt ) in the sarcoidosis is rare .
the routine use of 18f - fluorodeoxyglucose positron emission tomography / computed tomography ( 18f - fdg pet / ct ) has resulted in clinicians detecting many incidental findings , which have proven to be clinically significant such as thrombosis . here , we present a case with vt of sarcoidosis in the inferior vena cava and portal vein as an unusual incidental finding on 18f - fdg pet / ct . |
|
with the development and maturation of vitrectomy in recent years , most incurable retinal diseases in the past , such as retinal detachment , vitreous hemorrhage , and proliferative diabetic retinopathy , obtain an effective treatment.1,2 a significant number of cases are conducted by pars plana vitrectomy using the conventional 20-gauge ( 20 g ) technique , although the sutureless 23 g and 25 g vitrectomy techniques are being increasingly used.3 in the conventional 20 g vitrectomy , three large incisions requiring a 1.20 mm wide sclerotomy are made using a microvitreoretinal blade through the sclera after conjunctival peritomy . at the end of the procedure , absorbable sutures are used to simultaneously close the scleral and conjunctival wounds.4 this may cause discomforts such as postoperative pain , foreign body sensation , itching , and dryness to patients.5 conflicting with previous studies,5,6 few patients suffer severe postoperative pain after 20 g vitrectomy in our clinical practices . but other common symptoms , such as foreign body sensation , dryness , and so on , are commonly encountered . to date , there are few studies that focus on these postoperative discomforts , which possibly affect the quality of life for patients .
therefore , in order to provide a reference to the ophthalmologists for the prevention and treatment of any irritation symptoms , we performed a prospective study to evaluate the incidence and severity of pain and other ocular irritation symptoms after 20 g pars plana vitrectomy .
this prospective case series study was approved by the institutional ethics committee and followed the tenets of the declaration of helsinki .
patients who underwent primary 20 g pars plana vitrectomy at the central hospital of wuhan ( hubei , people s republic of china ) between january 2013 and december 2013 were enrolled . the procedures were fully explained to each patient , and each provided written informed consent .
patients with monocular vitreoretinal pathology requiring pars plana vitrectomy performed under local anesthesia were enrolled .
patients with retinal detachment requiring scleral buckling , those who underwent surgery under general anesthesia , or those who had dementia or other diseases that may impair their cognitive function were excluded .
in addition , we also excluded those patients who had other diseases including keratitis , scleritis , conjunctivitis , severe cataract , and glaucoma that could affect the assessment of postoperative symptoms .
all pars plana vitrectomies in this study were performed using the same surgical technique by the same surgeon ( fxa ) .
after retrobulbar anesthesia , the 20 g vitrectomy procedure began with three triangular incisions created using curved scissors in the conjunctiva at 3 oclock and 9 oclock .
a 20 g microvitreoretinal blade , inserted through the conjunctiva at an angle of 1015 , was used to create a scleral tunnel located 3.5 mm posterior to the limbus in phakic patients .
the infusion cannula was inserted through the inferotemporal tunnel and was fixed with an 8 - 0 absorbable suture ( ethicon ; johnson & johnson , new brunswick , nj , usa ) .
the 20 g instruments were inserted into the other two tunnels that were placed at the superior quadrants .
after vitrectomy , the sclerotomies and conjunctiva were closed with the 8 - 0 absorbable sutures , and dexamethasone ( 4.0 mg ) and gentamicin ( 8.0 mg ) were subconjunctivally injected . after the surgery , patients were given drops of antibiotics like ofloxacin eye ointment ( 3.5 g ; sinqi co. , ltd . ,
shenyang , people s republic of china ) three times , once daily ; recombinant human epidermal growth factor derivative eye drops ( 15,000 iu/3 ml ; watsin genetech co. , ltd . , shenzhen , people s republic of china ) four times , once daily ; and corticosteroids like tobramycin and dexamethasone eye drops ( 5 ml:15 mg:5 mg ; alcon - couvreur nv , rijksweg , belgium ) four times , once daily .
patients were examined before surgery and 1 day , 3 days , 7 days , 1 month , and 2 months postoperatively .
the following data were collected and analyzed : patient age and sex ; indications for surgery ; type of intravitreal tamponade ( gas , silicone oil ) ; operative time ; intraocular pressure ( iop ) ocular pain ; the pain medication used ; and other irritation symptoms including itching , foreign body sensation , burning , photophobia , and dryness .
pain was evaluated using the numerical rating scale ( nrs ) with scores from 0 to 10 , where 0= no pain , 13= mild pain , 46= moderate pain , and 710= severe pain.7,8 patients were instructed and asked to select a single number that best represents the level of pain intensity that they are experiencing .
in addition , some yes / no and open - ended questions were used to ask patients to evaluate the presence and severity of the other ocular irritation symptoms mentioned earlier .
continuous variables were expressed as the mean standard deviation ( sd ) if meeting the normal distribution , or using the median .
the wilcoxon signed - rank test was used to estimate differences of iop before and after surgery . the correlation between iop and postoperative pain
statistical analysis was performed using the spss pasw statistics version 18.0 ( ibm corporation , armonk , ny , usa ) .
this prospective case series study was approved by the institutional ethics committee and followed the tenets of the declaration of helsinki .
patients who underwent primary 20 g pars plana vitrectomy at the central hospital of wuhan ( hubei , people s republic of china ) between january 2013 and december 2013 were enrolled . the procedures were fully explained to each patient , and each provided written informed consent .
patients with monocular vitreoretinal pathology requiring pars plana vitrectomy performed under local anesthesia were enrolled .
patients with retinal detachment requiring scleral buckling , those who underwent surgery under general anesthesia , or those who had dementia or other diseases that may impair their cognitive function were excluded .
in addition , we also excluded those patients who had other diseases including keratitis , scleritis , conjunctivitis , severe cataract , and glaucoma that could affect the assessment of postoperative symptoms .
all pars plana vitrectomies in this study were performed using the same surgical technique by the same surgeon ( fxa ) .
after retrobulbar anesthesia , the 20 g vitrectomy procedure began with three triangular incisions created using curved scissors in the conjunctiva at 3 oclock and 9 oclock .
a 20 g microvitreoretinal blade , inserted through the conjunctiva at an angle of 1015 , was used to create a scleral tunnel located 3.5 mm posterior to the limbus in phakic patients .
the infusion cannula was inserted through the inferotemporal tunnel and was fixed with an 8 - 0 absorbable suture ( ethicon ; johnson & johnson , new brunswick , nj , usa ) .
the 20 g instruments were inserted into the other two tunnels that were placed at the superior quadrants .
after vitrectomy , the sclerotomies and conjunctiva were closed with the 8 - 0 absorbable sutures , and dexamethasone ( 4.0 mg ) and gentamicin ( 8.0 mg ) were subconjunctivally injected . after the surgery , patients were given drops of antibiotics like ofloxacin eye ointment ( 3.5 g ; sinqi co. , ltd . , shenyang , people s republic of china ) three times , once daily ; recombinant human epidermal growth factor derivative eye drops ( 15,000 iu/3 ml ; watsin genetech co. , ltd . ,
shenzhen , people s republic of china ) four times , once daily ; and corticosteroids like tobramycin and dexamethasone eye drops ( 5 ml:15 mg:5 mg ; alcon - couvreur nv , rijksweg , belgium ) four times , once daily .
patients were examined before surgery and 1 day , 3 days , 7 days , 1 month , and 2 months postoperatively .
the following data were collected and analyzed : patient age and sex ; indications for surgery ; type of intravitreal tamponade ( gas , silicone oil ) ; operative time ; intraocular pressure ( iop ) ocular pain ; the pain medication used ; and other irritation symptoms including itching , foreign body sensation , burning , photophobia , and dryness . pain was evaluated using the numerical rating scale ( nrs ) with scores from 0 to 10 , where 0= no pain , 13= mild pain , 46= moderate pain , and 710= severe pain.7,8 patients were instructed and asked to select a single number that best represents the level of pain intensity that they are experiencing .
in addition , some yes / no and open - ended questions were used to ask patients to evaluate the presence and severity of the other ocular irritation symptoms mentioned earlier .
continuous variables were expressed as the mean standard deviation ( sd ) if meeting the normal distribution , or using the median .
the wilcoxon signed - rank test was used to estimate differences of iop before and after surgery . the correlation between iop and postoperative pain
was evaluated by pearson s correlation test . for binary dependent variables , we used mcnemar s chi - squared test .
statistical analysis was performed using the spss pasw statistics version 18.0 ( ibm corporation , armonk , ny , usa ) .
a total of 110 consecutive patients were enrolled in this study . however , for four patients , the scheduled operation was cancelled because they gave up treatment .
ten patients were further excluded because of the concurrent cataract , and thus underwent vitrectomy combined with phacoemulsification .
no complete postoperative data were available for nine patients because they gave up during the follow - up process . as a result ,
a total of 87 patients ( 41 men and 46 women ) aged between 22 and 80 years ( median : 60 years ) were included in the final analysis .
the number of patients who underwent 20 g vitrectomy with the different operation modes and different types of intravitreal injections ( gas , silicone oil ) are shown in table 2 .
the median of pre- and postoperative pain scores are shown in figure 1a . at baseline before the surgery , there were four patients ( 4.6% ) that reported ocular pain , and one of them had a pain score of 4 points ( moderate pain ) .
the other patients did not report any preoperative pain , with a pain score of 0 . before surgery ,
the average pain score was 0.08 ( sd : 0.46 ) before surgery . at 1 day after surgery ,
thirty - two patients had mild pain ( 13 points ) and eleven patients had moderate pain ( 45 points ) . however , only four patients with moderate pain needed the analgesics ( orally administered diclofenac sodium ) to alleviate the pain , while other patients could endure the pain . at
however , only two of these 39 patients with pain had taken analgesics ( orally administered diclofenac sodium ) to alleviate the pain . at 7 days after surgery
, 31 of 87 patients ( 35.6% ) reported pain , and the average pain score was 0.62 ( sd : 1.03 ) .
, none of the patients with ocular pain had taken any analgesics to alleviate the pain . at 1 month after surgery ,
20 of 87 patients ( 23.0% ) reported mild pain , and the pain score ranged from 1 to 3 points .
none of the patients had taken analgesics to alleviate the pain . at 2 months after surgery ,
eleven of 87 patients ( 12.6% ) reported mild pain , and the pain score ranged from 1 to 2 points .
the median postoperative iop values were 17 mmhg ( range : 1050 mmhg ) ( compared with preoperative ; p<0.05 ) at day 1 , 17 mmhg ( range : 850 mmhg ) ( p<0.05 ) at day 3 , 15 mmhg ( range : 1049 mmhg ) ( p<0.05 ) at day 7 , 15 mmhg ( range : 1021 mmhg ) ( p<0.05 ) at 1 month , and 14 mmhg ( range : 1025 mmhg ) ( p<0.05 ) at 2 months .
a postoperative rise of iop was noted in 25 ( 28.7% ) patients at day 1 , 18 ( 20.7% ) patients at day 3 , 12 ( 13.8% ) patients at day 7 , two ( 2.3% ) patients at 1 month , and two ( 2.3% ) patients at 2 months after surgery .
strong correlations were found between the iop and the postoperative pain at day 1 ( r=0.427 ; p<0.05 ) , day 3(r=0.493 ; p<0.05 ) , day 7 ( r=0.288 ; p<0.05 ) , and 1 month ( r=0.346 ; p<0.05 ) , but they were not found at 2 months ( r=0.022 ; p>0.05 ) . before surgery , less than 11% of patients reported ocular symptoms , such as itching , foreign body sensation , burning , photophobia , and dryness ( figure 2 ) .
however , these symptoms occurred frequently after surgery , with foreign body sensation ( 49.4% at day 1 , 47.1% at day 3 , and 46% at day 7 ) being the most common symptom to occur within 1 week after surgery ; it was then reduced significantly after 1 week ( p<0.05 ) .
other symptoms like photophobia and itching maintained a prevalence rate of approximately 20% and 10% , respectively , until the end of the follow - up .
the number of patients that experienced a burning sensation was increased within 1 week , and it significantly declined 1 week later ( p<0.05 ) .
however , the prevalence of ocular dryness was gradually increased during the follow - up period after surgery ( from 4.6% at day 1 to 30.1% at month 2 ) .
nevertheless , there were still one - quarter of patients that had foreign body sensation and dryness symptoms at month 2 after surgery .
a total of 110 consecutive patients were enrolled in this study . however , for four patients , the scheduled operation was cancelled because they gave up treatment .
ten patients were further excluded because of the concurrent cataract , and thus underwent vitrectomy combined with phacoemulsification .
no complete postoperative data were available for nine patients because they gave up during the follow - up process . as a result ,
a total of 87 patients ( 41 men and 46 women ) aged between 22 and 80 years ( median : 60 years ) were included in the final analysis .
the number of patients who underwent 20 g vitrectomy with the different operation modes and different types of intravitreal injections ( gas , silicone oil ) are shown in table 2 .
the median of pre- and postoperative pain scores are shown in figure 1a . at baseline before the surgery , there were four patients ( 4.6% ) that reported ocular pain , and one of them had a pain score of 4 points ( moderate pain ) .
the other patients did not report any preoperative pain , with a pain score of 0 . before surgery ,
the average pain score was 0.08 ( sd : 0.46 ) before surgery . at 1 day after surgery ,
thirty - two patients had mild pain ( 13 points ) and eleven patients had moderate pain ( 45 points ) . however , only four patients with moderate pain needed the analgesics ( orally administered diclofenac sodium ) to alleviate the pain , while other patients could endure the pain . at 3 days after surgery ,
however , only two of these 39 patients with pain had taken analgesics ( orally administered diclofenac sodium ) to alleviate the pain . at 7 days after surgery , 31 of 87 patients ( 35.6% ) reported pain , and the average pain score was 0.62 ( sd : 1.03 ) .
, none of the patients with ocular pain had taken any analgesics to alleviate the pain . at 1 month after surgery ,
20 of 87 patients ( 23.0% ) reported mild pain , and the pain score ranged from 1 to 3 points .
none of the patients had taken analgesics to alleviate the pain . at 2 months after surgery ,
eleven of 87 patients ( 12.6% ) reported mild pain , and the pain score ranged from 1 to 2 points .
the median postoperative iop values were 17 mmhg ( range : 1050 mmhg ) ( compared with preoperative ; p<0.05 ) at day 1 , 17 mmhg ( range : 850 mmhg ) ( p<0.05 ) at day 3 , 15 mmhg ( range : 1049 mmhg ) ( p<0.05 ) at day 7 , 15 mmhg ( range : 1021 mmhg ) ( p<0.05 ) at 1 month , and 14 mmhg ( range : 1025 mmhg ) ( p<0.05 ) at 2 months .
a postoperative rise of iop was noted in 25 ( 28.7% ) patients at day 1 , 18 ( 20.7% ) patients at day 3 , 12 ( 13.8% ) patients at day 7 , two ( 2.3% ) patients at 1 month , and two ( 2.3% ) patients at 2 months after surgery .
strong correlations were found between the iop and the postoperative pain at day 1 ( r=0.427 ; p<0.05 ) , day 3(r=0.493 ; p<0.05 ) , day 7 ( r=0.288 ; p<0.05 ) , and 1 month ( r=0.346 ; p<0.05 ) , but they were not found at 2 months ( r=0.022 ; p>0.05 ) .
before surgery , less than 11% of patients reported ocular symptoms , such as itching , foreign body sensation , burning , photophobia , and dryness ( figure 2 ) .
however , these symptoms occurred frequently after surgery , with foreign body sensation ( 49.4% at day 1 , 47.1% at day 3 , and 46% at day 7 ) being the most common symptom to occur within 1 week after surgery ; it was then reduced significantly after 1 week ( p<0.05 ) .
other symptoms like photophobia and itching maintained a prevalence rate of approximately 20% and 10% , respectively , until the end of the follow - up .
the number of patients that experienced a burning sensation was increased within 1 week , and it significantly declined 1 week later ( p<0.05 ) .
however , the prevalence of ocular dryness was gradually increased during the follow - up period after surgery ( from 4.6% at day 1 to 30.1% at month 2 ) .
nevertheless , there were still one - quarter of patients that had foreign body sensation and dryness symptoms at month 2 after surgery .
at present , sutureless 23 g and 25 g pars plana vitrectomies are increasing in popularity .
compared to the 20 g vitrectomy , sutureless 23 g and 25 g techniques can decrease patients discomfort , shorten operation times , and improve postoperative astigmatism because of no conjunctival peritomy.4,911 however , 23 g or 25 g vitrectomies also have certain disadvantages .
for example , instruments used for the smaller - gauge procedure are flexible , leading to difficulty with the clearance of dense vitreous hemorrhage.12 moreover , it is difficult to inject high - viscosity silicone oil into the vitreous body with the smaller - gauge techniques.13 furthermore , both 23 g and 25 g vitrectomies require completely different sets of instruments , making surgery costs higher than for 20 g vitrectomy.14 thus , we believe that the 20 g vitrectomy is able to show some advantages when compared with the 23 g and 25 g vitrectomies , and it provides some additional benefits .
it uses nonflexible and cheaper surgical instruments , and it is qualified for use in many complex vitreoretinal diseases.1517 with the 20 g scleral tunnel , it is possible to use high - speed cutters with high infusion / aspiration rates , giving the surgeon better control .
it is also easy to perform injections of high - viscosity silicone oil.18 meanwhile , 20 g , 23 g , and 25 g vitrectomies are equally effective for curing some retinal diseases , such as pseudophakic rhegmatogenous retinal detachment.19 therefore , although the sutureless 23 g and 25 g techniques developed well , it is still appropriate and preferable to choose 20 g vitrectomy systems for treating some vitreoretinal diseases , especially in the people s republic of china , which has a large population and is an economically underdeveloped country .
this was one of the follow - up studies featuring postoperative discomfort as a primary outcome measure among chinese people after 20 g pars plana vitrectomy .
our data showed that pain and other ocular symptoms were relatively common after 20 g pars plana vitrectomy .
however , postoperative pain and ocular irritation symptoms varied between individuals and varied in duration . in this study , approximately half of the patients reported mild and moderate pain and serious foreign body sensation within 1 week , and these symptoms were then reduced during the follow - up process . at the end of the follow - up , there was still one - quarter of patients that reported foreign body sensation and dryness symptoms , although most of the patients recovered with no discomfort .
other symptoms , such as pain , itching , burning , and photophobia , also existed in some patients at 2 months . in view of this , to prevent and alleviate postoperative discomfort , patients with continuous postoperative pain or other ocular symptoms must be identified , and appropriate counseling and drug treatment should be provided . to the best of our knowledge , many factors can make patients experience postoperative ocular pain , including corneal epithelial defects , extensive conjunctival dissection , muscle isolation , release of adhesions at reoperation , placement of large buckling elements , and choroidal effusions.20 that should also include the scleral wound and postoperative uveitis .
nevertheless , iop often increases significantly on the first day after 20 g vitrectomy , and the elevated iop will also lead to ocular pain.21 in this study , we found that high iop was commonly encountered within 1 week after surgery , and that most patients reported moderate pain with an iop greater than 30 mmhg .
this means that the postoperative ocular pain was not only related to the conjunctival scleral incisions and postoperative uveitis , but also with the occurrence of high iop .
moreover , the serious foreign body sensation may be related to the sutures of the conjunctival incisions22 that cause an inflammatory process around the sutures.5 with the absorption of the sutures , the foreign body sensation was gradually alleviated .
a previous study reported that the postoperative ocular irritation symptoms may be associated with systemic diseases , such as diabetes mellitus , hypertension , rheumatoid disease , thyroid dysfunction , cancer , and so on.23 at the same time , ocular symptoms perhaps also occur in association with advanced age , which may affect symptom perception and expression .
elderly individuals often have different severity levels of dry eye syndrome and various other ocular symptoms.24 however , in the present study , the patients were relatively young ( median : 60 years ; range : 2280 years ) and the prevalence of patients with systemic diseases such as diabetes mellitus ( 21.8% ) and hypertension ( 5.7% ) was not high . as such
, we hold the opinion that , to some extent , the ocular symptoms were related to surgery .
the 20 g vitrectomy , which requires three large incisions on the conjunctiva and sclera , features a long operation time ; it also damages the microenvironment of the ocular surface , resulting in a number of the different ocular symptoms that occurred . in the present study
, only four patients were given analgesics to alleviate ocular pain during the first postoperative week .
the number of patients were significantly lower than that reported in the data of a previous retrospective study.6 in that study , there were 64 patients taking pain medications during the first postoperative week.6 this difference may be related to the point that chinese people regard postoperative pain is a normal process after surgery , and that there is no need for oral analgesic drugs to alleviate mild and moderate pain .
the study has some limitations with respect to both the experimental design and the outcome measures .
first , the sample size was too small to confirm whether analgesics must be used .
second , the duration was limited to 2 months , meaning that we were unable to determine whether these irritation symptoms would disappear 2 months later .
furthermore , we only chose five common ocular symptoms for observation , while any other irritation symptoms were not investigated , such as lacrimation , sense of acupuncture , and so on .
in addition , we were unable to explore the dry eye symptoms adopting the methods of tear break - up time , corneal fluorescein staining , the schirmer i test , and corneal sensitivity .
in conclusion , at least half of the patients have mild and moderate ocular pain after 20 g vitrectomy , which may last up to 2 months in some patients .
other ocular irritation symptoms were also present , and they varied based on the longer duration of follow - up .
thus , the discomforts after 20 g pars plana vitrectomy must be of concern , and their timely management should be provided as part of routine postoperative care .
drugs such as analgesics , nonsteroidal anti - inflammatory drugs , and artificial tears may be helpful in alleviating the ocular pain and irritation symptoms after 20 g vitrectomy . | purposeto evaluate postoperative pain and other irritation symptoms after 20-gauge ( 20 g ) pars plana vitrectomy.materials and methodsa total of 110 consecutive patients were enrolled in our studies , and 87 patients who underwent the conventional 20 g pars plana vitrectomy were included in the final analysis .
all vitrectomies were performed using the same surgical technique by the same surgeon .
patients were examined before surgery and 1 day , 3 days , 7 days , 1 month , and 2 months postoperatively .
the main outcome measures include patient age and sex , intraocular pressure ( iop ) , ocular pain , pain score , pain medication use , and other irritation symptoms comprising itching , foreign body sensation , burning , photophobia , and dryness .
the pain was evaluated using the numerical rating scale scored from 0 to 10.resultspostoperative pain was relatively common during the first day after surgery , as it was reported by 43 ( 49.4% ) patients .
then , the prevalence gradually decreased to eleven ( 12.6% ) patients at 2 months .
most patients reported mild or moderate pain , with a pain score of 15 , but only four patients were given analgesics for ocular pain .
a postoperative rise of iop was noted in 25 patients at day 1 .
most of these patients with high iop reported moderate pain .
other ocular irritation symptoms were varied after surgery .
there was still one - quarter of patients that had foreign body sensation and dryness symptoms at month 2 after surgery.conclusionmild and moderate ocular pain were relatively common after 20 g vitrectomy , which is more often associated with elevated iop .
other irritation symptoms were also presented after surgery and could affect the life quality of patients .
therefore , the discomforts after 20 g pars plana vitrectomy should be of concern , and timely management should be provided as part of routine postoperative care . |
a 70-year - old woman visited our pain clinic with pain in the right scapular area around the t3 dermatome , which started 34 months ago .
she suffered from constant burning and throbbing pain along with intermittent electric shock - like pain .
she was diagnosed with phn and began to take several oral medications including pregabalin 150 mg- and oxycodone 10 mg -twice a day , and nortriptyline 75 mg before sleep .
additionally , she had been treated with an epidural block , pulsed radiofrequency lesioning , intravenous lidocaine and ketamine infusion , etc .
however , her symptoms were gradually aggravated in spite of all this and her pain was rated at an intensity of 7/10 on the visual analogue scales ( vas ) from 0 ( no pain ) to 10 ( worst pain imaginable ) .
it was programmed for a 50-minute daily treatment for 10 consecutive days . before the scrambler therapy was initiated , the vas score was 7/10 and total pain rating index ( t - pri ) on the short - form mcgill pain questionnaire ( sf - mpq ) was 30/45 .
after the second treatment , the vas score was 4/10 and t - pri on the sf - mpq was 20/45 .
moreover , she reported that the electric shock - like pain decreased to a tolerable range . on the last day ,
the vas score was 3/10 and t - pri on the sf - mpq was 19/45 .
in addition , the electric shock - like pain disappeared completely . during ten treatments ,
, the vas score was maintained within the range of 3 - 4 for the next 2 weeks .
four weeks later , at the patient 's follow up visit , the vas score was 4 .
a 75-year - old woman visited our pain clinic with pain around the right t5 dermatome , which started 16 months ago .
she suffered from constant dull aching pain along with intermittent electric shock - like pain .
she was diagnosed with phn and began to take oral medications including pregabalin 75 mg twice a day , andnortriptyline 25 mg before sleep in our clinic .
thus , we treated her conservatively with local intralesional injection , laser therapy and so on .
however , her symptoms became aggravated and the vas score was 6/10 . with the patient 's informed consent , we started the scrambler therapy with a 50-minute daily treatment for 10 consecutive days . at the beginning ,
the vas score was 6/10 and t - pri on the sf - mpq was 22/45 .
after the third treatment , the vas score was 3/10 and t - pri on the sf - mpq was 7/45 .
moreover , she reported that the electric shock - like pain decreased to a tolerable range . on the last day ,
the vas score was 2/10 and t - pri on the sf - mpq was 3/45 .
, the vas score was maintained within the range of 2 - 3 for the next 2 weeks .
four weeks later , at the patient 's follow - up visit , the vas score was 3 .
a 70-year - old woman visited our pain clinic with pain around the right l1 dermatome .
she suffered from constantly burning and intermittently electric shock - like pain for 15 months .
she had been diagnosed with phn and began to take oral medications including pregabalin 75 mg twice a day , and nortriptyline 25 mg before sleep in our clinic .
she was also being treated with anticoagulant therapy for ischemic heart disease , and was afraid of receiving invasive treatment .
thus we tried the scrambler therapy for pain relief . with the patient 's informed consent
, we started the scrambler therapy with a 50-minute daily treatment for 10 consecutive days . at the beginning , the vas score was 6/10 and t - pri on the sf - mpq was 18/45 .
after the fifth treatment , the vas score was 3/10 and t - pri on the sf - mpq was 5/45 .
moreover , she reported that the electric shock - like pain decreased to a tolerable range . on the last day ,
the vas score was 2/10 and t - pri on the sf - mpq was 3/45 .
in addition , the electric shock - like pain disappeared completely . on the fourth day after her last treatment
, the vas score was maintained within the range of 2 - 3 for the next 2 weeks .
four weeks later , at the patient 's follow - up visit , the vas score was 3 .
a 70-year - old woman visited our pain clinic with pain in the right scapular area around the t3 dermatome , which started 34 months ago .
she suffered from constant burning and throbbing pain along with intermittent electric shock - like pain .
she was diagnosed with phn and began to take several oral medications including pregabalin 150 mg- and oxycodone 10 mg -twice a day , and nortriptyline 75 mg before sleep .
additionally , she had been treated with an epidural block , pulsed radiofrequency lesioning , intravenous lidocaine and ketamine infusion , etc .
however , her symptoms were gradually aggravated in spite of all this and her pain was rated at an intensity of 7/10 on the visual analogue scales ( vas ) from 0 ( no pain ) to 10 ( worst pain imaginable ) .
it was programmed for a 50-minute daily treatment for 10 consecutive days . before the scrambler therapy was initiated , the vas score was 7/10 and total pain rating index ( t - pri ) on the short - form mcgill pain questionnaire ( sf - mpq ) was 30/45 .
after the second treatment , the vas score was 4/10 and t - pri on the sf - mpq was 20/45 .
moreover , she reported that the electric shock - like pain decreased to a tolerable range . on the last day ,
the vas score was 3/10 and t - pri on the sf - mpq was 19/45 .
in addition , the electric shock - like pain disappeared completely . during ten treatments ,
, the vas score was maintained within the range of 3 - 4 for the next 2 weeks .
four weeks later , at the patient 's follow up visit , the vas score was 4 .
a 75-year - old woman visited our pain clinic with pain around the right t5 dermatome , which started 16 months ago .
she suffered from constant dull aching pain along with intermittent electric shock - like pain .
she was diagnosed with phn and began to take oral medications including pregabalin 75 mg twice a day , andnortriptyline 25 mg before sleep in our clinic .
thus , we treated her conservatively with local intralesional injection , laser therapy and so on . however , her symptoms became aggravated and the vas score was 6/10 . with the patient 's informed consent , we started the scrambler therapy with a 50-minute daily treatment for 10 consecutive days . at the beginning ,
the vas score was 6/10 and t - pri on the sf - mpq was 22/45 .
after the third treatment , the vas score was 3/10 and t - pri on the sf - mpq was 7/45 .
moreover , she reported that the electric shock - like pain decreased to a tolerable range . on the last day ,
the vas score was 2/10 and t - pri on the sf - mpq was 3/45 .
in addition , the electric shock - like pain disappeared completely . from that day , the vas score was maintained within the range of 2 - 3 for the next 2 weeks .
four weeks later , at the patient 's follow - up visit , the vas score was 3 .
a 70-year - old woman visited our pain clinic with pain around the right l1 dermatome .
she suffered from constantly burning and intermittently electric shock - like pain for 15 months .
she had been diagnosed with phn and began to take oral medications including pregabalin 75 mg twice a day , and nortriptyline 25 mg before sleep in our clinic .
she was also being treated with anticoagulant therapy for ischemic heart disease , and was afraid of receiving invasive treatment .
thus we tried the scrambler therapy for pain relief . with the patient 's informed consent
, we started the scrambler therapy with a 50-minute daily treatment for 10 consecutive days . at the beginning ,
the vas score was 6/10 and t - pri on the sf - mpq was 18/45 .
after the fifth treatment , the vas score was 3/10 and t - pri on the sf - mpq was 5/45 .
moreover , she reported that the electric shock - like pain decreased to a tolerable range . on the last day ,
the vas score was 2/10 and t - pri on the sf - mpq was 3/45 .
in addition , the electric shock - like pain disappeared completely . on the fourth day after her last treatment
, the vas score was maintained within the range of 2 - 3 for the next 2 weeks .
four weeks later , at the patient 's follow - up visit , the vas score was 3 .
scrambler therapy is a neuromodulatory approach using electro - cutaneous nerve stimulation forrelieving acute and chronic pain on the basis of information theory . in this respect ,
marineo explained that the pain system consists of information content that is delivered by specific receptors includingmechanoceptors and multimodal receptors . under healthy conditions , painful information returns to a silent state by the process of homeostatic equilibrium ; however , in chronic neuropathic conditions , pain gradually tends to be changed in a refractory manner upon therapeutic modalities by the sensitization modifying the original information .
scrambler therapy synthesizes 16 different types of artificial nerve action potentials similar to normal nerve impulses , assembles them into sequences and transmits them to the patient 's nociceptors .
finally , it modulates the pain information through patient - specific cutaneous electro - stimulation .
while transcutaneous electrical nerve stimulation ( tens ) and implanted devices inhibit pain transmission through a - beta fiber excitation , scrambler therapy substitutes pain information with synthetic non - pain information with more complex processing .
mc5-a calmare consists of a multiprocessor with five channels capable of treating five painful areas in the same patient simultaneously .
additionally , each channel consists of 2 surface electrodes placed on the skin around the painful areas , but not in the painful areas .
correct position of the electrodes depends on the response of the patient and an immediate sign is the disappearance of pain in the targeted areas .
it is very important for a patient to feel a rippling sensation rather than pain during therapy . in our cases ,
all had been treated with conventional modalities for more than a year but still complained of severe pain . for the purpose of providing pain relief , they received scrambler therapy for 50 minutes daily for 10 consecutive days based on some clinical trials [ 3,4,6 - 8 ] .
all 3 patients did not complain of any previously experienced severe aching pain and tactile allodyniawhen they received the scrambler therapy . marineo suggested that this reason may be due to the feeling of new sensations around the dermatome related to the spread of non - pain information along the lines of nerve transmission , the so called " pain scramble " . in the early sessions of the treatment , the effects ofthe scrambler therapy lasted only for 3 to 6 hours in all .
however , the effects had lasted all days long after 2 sessions in one patient , after 3 sessions in another patient and after 5 sessions in the last patient , respectively . at the same time , constant aching pain and tactile allodyniadecreased to a tolerable range .
when the - tenth session was finished , constant aching pain decreased by 50% compared with the previous state and tactile allodynia had gone away ( fig .
since then , all patients have been well managed with oral medications and do not complain of any undesirable side effects .
in addition to pain relief , the fact that tactile allodynia disappeared is also worthy of notice .
we think that the disappearance of allodynia may be associated with central reorganization , but do not know exactly what this mechanism is .
several preliminary studies on the efficacy of scrambler therapy for cancer and refractory neuropathic pain have been introduced recently and reported good outcomes like in our cases [ 3 - 8 ] . in conclusion , through this report , we show that scrambler therapy can be a good option for the treatment of patients with phn , who respond poorly to previous conventional treatments or have a fear of receiving other invasive treatments due to one 's own comorbidity
. however , we suggest that more extensive investigations with a large number of patients are necessary to provide well established guidelines for scrambler therapy of phn . | postherpetic neuralgia ( phn ) is a debilitating complication of herpes zoster , especially in elderly and comorbid patients .
unfortunately , the currently available treatments have shown limited efficacy and some adverse events that are poorly tolerated in elderly patients .
scrambler therapy , proposed as an alternative treatment for chronic neuropathic pain recently , is a noninvasive approach to relieve pain by changing pain perception at the brain level . here , we report our clinical experiences on the effect of scrambler therapy for three patients with phn refractory to conventional treatment . |
this was a randomized , two - stage , 24-week , open - label , phase 2 study with an initial 12-week active - controlled period and 12-week dose - ranging period conducted at 50 centers in the u.s .
the study was approved by an appropriately constituted institutional review board and conducted in accordance with the declaration of helsinki and international conference on harmonisation of technical requirements for registration of pharmaceuticals for human use guidelines for good clinical practice .
men and women aged 1870 years with a diagnosis of type 2 diabetes mellitus 6 months on a stable dose of metformin for 3 months were eligible if they had an hba1c 7% and 10% , an fpg < 240 mg / dl , bmi 40 kg / m , and a stable body weight for 3 months prior to study entry .
women could not be pregnant or breastfeeding ; had to be surgically sterile or 1 year postmenopausal ; or , if of childbearing potential , were required to have a negative pregnancy test and practice an acceptable form of contraception during the study .
subjects were excluded if they previously received treatment with exenatide , thiazolidinediones , sulfonylureas , dipeptidyl peptidase - iv inhibitors , or acarbose ; insulin within 3 months of screening ; or treatment with an investigational drug within 30 days of screening .
subjects with type 1 diabetes , overt diabetes complications , fasting triglyceride level > 500 mg / dl , or medical conditions that could interfere with the conduct of the study were excluded .
this study consisted of a 14-week screening period , two sequential 12-week open - label treatment stages , and a 4-week follow - up visit ( fig .
i , eligible subjects were randomized in a 1:1:1 ratio to 20 or 40 g / day of itca 650 or twice - daily exenatide injections ( ex - bid ) , 5 g twice daily titrated after 4 weeks to 10 g twice daily for 8 weeks . in stage ii , subjects who received itca 650 in stage i were rerandomized to their previous dose of itca 650 or an increase in dose to either 60 or 80 g / day .
therefore , subjects initially randomized to 20 g / day of itca 650 received either 20 g / day ( 2020 ) or 60 g / day ( 2060 ) .
subjects initially receiving itca 650 40 g / day were randomized to receive either 40 g / day ( 4040 ) or 80 g / day ( 4080 ) .
subjects who received ex - bid in stage i were randomized to receive either itca 650 40 g / day ( ex - bid40 ) or 60 g / day ( ex - bid60 ) of itca 650 ( fig .
treatment group assignments were determined using a dynamic randomization algorithm within the interactive voice response system .
itca 650 study devices that delivered exenatide for 3 months were placed sc by site personnel using aseptic technique ( supplementary fig .
ex - bid was supplied as sc injection pens , and subjects were instructed in their proper use according to labeling for the marketed version of the product .
hba1c was measured at screening , baseline , and weeks 4 , 8 , 12 , 16 , 20 , and 24 .
fpg was measured at baseline , 4 , 12 , 16 , and 24 weeks .
safety assessments included aes , clinical laboratory measurements ( chemistry , hematology , and urinalysis ) measured at screening , baseline , weeks 4 , 12 , 16 , 24 , and at follow up , 12-lead electrocardiograms , vital signs , and physical examinations .
assessment of anti - exenatide antibodies in human serum samples was conducted at midwest bioresearch , llc ( skokie , il ) using a validated elisa .
approximately 400 subjects were screened to ensure that between 150 and 160 subjects were randomized in stage i. the sample size of 50 patients per stage i group afforded 93% power to detect a significant decrease in hba1c from baseline ( = 0.05 , two - sided paired t test ) in any of the groups as long as the true decrease was at least 0.5 at 12 weeks and assuming the sd of the between time point differences was 1 .
the primary end point was change from baseline for hba1c to end point for each stage ( 12 and 24 weeks ) and for the overall 24-week trial ( 024 weeks ) .
percent changes from baseline were analyzed with an ancova model with treatment as a factor and baseline as the covariate .
pairwise comparisons were reported using least square ( ls ) means and ses for each treatment and ls means , se , 95% cis , and p values .
the safety population was defined as all randomized subjects who received at least one dose of study medication .
the intent - to - treat population was defined as all randomized subjects who received at least one dose of study medication and had at least one postbaseline assessment .
men and women aged 1870 years with a diagnosis of type 2 diabetes mellitus 6 months on a stable dose of metformin for 3 months were eligible if they had an hba1c 7% and 10% , an fpg < 240 mg / dl , bmi 40 kg / m , and a stable body weight for 3 months prior to study entry .
women could not be pregnant or breastfeeding ; had to be surgically sterile or 1 year postmenopausal ; or , if of childbearing potential , were required to have a negative pregnancy test and practice an acceptable form of contraception during the study .
subjects were excluded if they previously received treatment with exenatide , thiazolidinediones , sulfonylureas , dipeptidyl peptidase - iv inhibitors , or acarbose ; insulin within 3 months of screening ; or treatment with an investigational drug within 30 days of screening .
subjects with type 1 diabetes , overt diabetes complications , fasting triglyceride level > 500 mg / dl , or medical conditions that could interfere with the conduct of the study were excluded .
this study consisted of a 14-week screening period , two sequential 12-week open - label treatment stages , and a 4-week follow - up visit ( fig .
i , eligible subjects were randomized in a 1:1:1 ratio to 20 or 40 g / day of itca 650 or twice - daily exenatide injections ( ex - bid ) , 5 g twice daily titrated after 4 weeks to 10 g twice daily for 8 weeks . in stage ii , subjects who received itca 650 in stage i were rerandomized to their previous dose of itca 650 or an increase in dose to either 60 or 80 g / day .
therefore , subjects initially randomized to 20 g / day of itca 650 received either 20 g / day ( 2020 ) or 60 g / day ( 2060 ) .
subjects initially receiving itca 650 40 g / day were randomized to receive either 40 g / day ( 4040 ) or 80 g / day ( 4080 ) . subjects who received
ex - bid in stage i were randomized to receive either itca 650 40 g / day ( ex - bid40 ) or 60 g / day ( ex - bid60 ) of itca 650 ( fig .
treatment group assignments were determined using a dynamic randomization algorithm within the interactive voice response system .
itca 650 study devices that delivered exenatide for 3 months were placed sc by site personnel using aseptic technique ( supplementary fig .
ex - bid was supplied as sc injection pens , and subjects were instructed in their proper use according to labeling for the marketed version of the product .
hba1c was measured at screening , baseline , and weeks 4 , 8 , 12 , 16 , 20 , and 24 .
fpg was measured at baseline , 4 , 12 , 16 , and 24 weeks .
safety assessments included aes , clinical laboratory measurements ( chemistry , hematology , and urinalysis ) measured at screening , baseline , weeks 4 , 12 , 16 , 24 , and at follow up , 12-lead electrocardiograms , vital signs , and physical examinations . anti - exenatide antibodies were measured at baseline and at weeks 12 and 24 .
assessment of anti - exenatide antibodies in human serum samples was conducted at midwest bioresearch , llc ( skokie , il ) using a validated elisa .
approximately 400 subjects were screened to ensure that between 150 and 160 subjects were randomized in stage i. the sample size of 50 patients per stage i group afforded 93% power to detect a significant decrease in hba1c from baseline ( = 0.05 , two - sided paired t test ) in any of the groups as long as the true decrease was at least 0.5 at 12 weeks and assuming the sd of the between time point differences was 1 .
the primary end point was change from baseline for hba1c to end point for each stage ( 12 and 24 weeks ) and for the overall 24-week trial ( 024 weeks ) .
percent changes from baseline were analyzed with an ancova model with treatment as a factor and baseline as the covariate .
pairwise comparisons were reported using least square ( ls ) means and ses for each treatment and ls means , se , 95% cis , and p values .
the safety population was defined as all randomized subjects who received at least one dose of study medication .
the intent - to - treat population was defined as all randomized subjects who received at least one dose of study medication and had at least one postbaseline assessment .
treatment groups were generally comparable at baseline for demographic and clinical characteristics ( table 1 ) .
the 40 g / day itca 650 group had a longer mean duration of diabetes ( 8.4 years ) and a higher proportion of african american subjects ( 19.6% ) compared with the other treatment groups .
baseline demographics and clinical characteristics the majority of subjects completed stage i ( n = 155 [ 91.6% ] ) . thirteen subjects discontinued prematurely ; 7.8 , 5.9 , and 11.3% from the 20 and 40 g / day itca 650 and ex - bid groups ; respectively . of the 131 subjects randomized into stage ii , 94.7% completed the additional 12 weeks of treatment .
a total of five discontinuations for an ae occurred across all doses ( supplementary table 1 ) . at week 12 , significant ( p < 0.001 ) reductions from baseline in mean hba1c were observed in all three treatment groups ( table 2 ) .
the ls mean change in hba1c from a mean baseline of 7.98.0% was 0.98 , 0.95 , and 0.72% for the 20 and 40 g / day itca 650 groups and the ex - bid group ; respectively .
hba1c 7% was achieved in 63 and 65% of subjects treated with 20 and 40 g / day itca 650 and in 50.0% with ex - bid .
significant ( p < 0.05 ) reductions from baseline in mean fpg were observed for all groups .
mean changes in hba1c and body weight at 012 weeks ( stage i ) , 1224 weeks ( stage ii ) , and overall ( 024 weeks ) during weeks 1224 , further significant ( p < 0.05 ) incremental reductions in mean hba1c were noted in subjects who were rerandomized to higher doses of itca 650 ( 2060 and 4080 ) or from exenatide injections to itca 650 ( ex - bid40 and ex - bid60 ) compared with those subjects rerandomized to remain on the same dose of itca 650 ( 20 20 or 4040 ) .
mean fpg decreased significantly ( p < 0.05 ) only in the ( 2060 ) itca 650 group .
mean body weight significantly ( p < 0.05 ) decreased in all treatment groups except the itca 650 2020 g / day group ( table 2 ) .
statistically significant ( p < 0.001 ) reductions from baseline ( day 0 ) to week 24 end point in mean hba1c were observed in all treatment groups with the greatest reductions observed in the 2060 g / day itca 650 group ( ls mean change , 1.36% ) and the 4080 g / day itca 650 group ( ls mean change , 1.4% ) ( table 2 ) . treatment with 2060 g / day itca 650 resulted in a significantly greater reduction in hba1c than 2020 or 4040 g / day itca 650 ( p < 0.001 ) .
similarly , treatment with 4080 g / day itca 650 resulted in a significantly greater reduction in hba1c than 4040 g / day itca 650 ( p < 0.001 ) .
in addition , significant incremental reductions in hba1c were noted from weeks 12 to 24 in groups initially treated with ex - bid and then switched to 40 or 60 g /day itca 650 at week 12 ( p < 0.05 ) .
the proportion of subjects at hba1c 7% at 24 weeks was 60% with itca 2020 g / day , 86% with itca 650 2060 g / day , 65% with itca 650 4040 g / day , and 78% with itca 650 4080 g / day . during the day 0 to week 24 period ,
significant ( p < 0.05 ) reductions from baseline in mean fpg were observed for all groups except the itca 650 4040 g / day group .
significant ( p < 0.005 ) reductions from baseline for mean body weight were observed for all groups except the itca 650 2020 g / day group . during stage
i , the incidence of treatment - emergent aes ( teaes ) was slightly higher in the 40 g / day than the 20 g / day itca 650 and ex - bid groups .
one subject had a serious ae of acute cholecystitis associated with cholelithiasis and mild gallstone - induced pancreatitis during stage i that was considered unrelated to study drug .
discontinuation for drug - related aes occurred in 3.9% of subjects on itca 650 compared with 5.7% of subjects on ex - bid ( table 3 ) .
the most common drug - related aes were nausea , vomiting , and administration site events .
these events were most commonly observed early in the course of treatment and improved over time .
drug - related aes occurring in > 5% overall of subjects during stages i and ii as expected with exenatide treatment , gi side effects were among the most common reported aes . during week 1 , the incidence of nausea was similar with 20 g / day itca 650 and ex - bid 5 g ( 25.5 vs. 24.5% , respectively ) but declined rapidly to < 10% from week 3 to 2.2% by the end of stage i with 20 g / day itca 650 compared with 20.8% at week 12 with ex - bid 10 g .
the incidence of vomiting was highest during week 1 ( 7.8 , 13.7 , and 3.8% with itca 650 20 g , 40 g , and ex - bid , respectively ) and declined rapidly during stage i. no episodes of vomiting were reported with the 20-g dose of itca 650 after week 4 .
most events were also mild or moderate , with only one subject in the 40 g / day itca 650 group reporting severe vomiting . during stage ii
, the lowest incidence of teaes occurred in the 2020 g / day group and was similar in the other five treatment groups .
the most common were nausea , diarrhea , vomiting , constipation , and decreased appetite ( table 3 ) .
across all dose groups , five ( 3.8% ) subjects had a teae that led to discontinuation from the study , and six ( 4.6% ) subjects had a serious ae , none of which was considered related to study drug by the investigator .
subjects who remained on the same dose of itca 650 had a lower incidence of nausea than subjects whose dose was increased to 60 or 80 g /day ; no subjects on 2060 g / day experienced vomiting or discontinued therapy during stage ii .
the highest incidence was seen in the itca 650 groups rerandomized from ex - bid ( table 3 ) .
severe nausea occurred in two subjects in the ex - bid60 g / day and one subject in the 2020 g / day groups .
one subject in the ex - bid60 g / day and 2020 g / day groups experienced severe vomiting .
several different observations were reported in about half of subjects related to the site of administration of the itca 650 that mostly reflect the result of the normal healing process .
events such as bruising , pruritis , or pain local to the site of administration were usually reported within days of the placement and were typically mild and transient , resolving without any need for intervention .
no subjects had a severe ae related to the site of administration of itca 650 during the study .
subjects taking ex - bid injections reported hematoma ( 5.9% ) , hemorrhage ( 1.9% ) , and erythema ( 1.9% ) at the injection site . no clinically meaningful safety findings or trends in safety laboratory parameters or vital signs were noted .
no clinically relevant effects on serum calcitonin , thyroid - stimulating hormone , serum amylase , or serum lipase were reported during 24 weeks of study ( supplementary table 2 ) . in stage
i ( week 12 ) , high anti - exenatide antibody titers were observed in 0 , 2.1 , and 4.5% of subjects treated with 20 and 40 mg /day of itca 650 and ex - bid , respectively . in stage ii ( week 24 ) , high titers were observed in 5.3 , 7.0 , 7.3 , and 10% of subjects receiving 20 , 40 , 60 , and 80 mg /day of itca 650 , respectively .
data from the three antibody - positive subjects with high titers ( > 7,500 ) did not reveal any apparent relationship between antibody titer and loss of activity .
two subjects with high titers had reductions in both hba1c and body weight at the end of stages i and ii , and the third subject had increases in both hba1c and body weight , even as titer levels dropped in stage ii . at the end of stage ii , nine antibody - positive subjects had high titers .
the other three subjects showed a reduction in hba1c or a reduction in body weight .
the magnitude of activity observed in the high antibody titer subjects , which was similar to that observed in antibody - negative subjects , suggests that the presence of anti - exenatide antibodies did not reduce the activity of itca 650 in this study .
at week 12 , significant ( p < 0.001 ) reductions from baseline in mean hba1c were observed in all three treatment groups ( table 2 ) . the ls mean change in hba1c from a mean baseline of 7.98.0% was 0.98 , 0.95 , and 0.72% for the 20 and 40 g / day itca 650 groups and the ex - bid group ; respectively .
hba1c 7% was achieved in 63 and 65% of subjects treated with 20 and 40 g / day itca 650 and in 50.0% with ex - bid .
significant ( p < 0.05 ) reductions from baseline in mean fpg were observed for all groups .
mean changes in hba1c and body weight at 012 weeks ( stage i ) , 1224 weeks ( stage ii ) , and overall ( 024 weeks ) during weeks 1224 , further significant ( p < 0.05 ) incremental reductions in mean hba1c were noted in subjects who were rerandomized to higher doses of itca 650 ( 2060 and 4080 ) or from exenatide injections to itca 650 ( ex - bid40 and ex - bid60 ) compared with those subjects rerandomized to remain on the same dose of itca 650 ( 20 20 or 4040 ) .
mean fpg decreased significantly ( p < 0.05 ) only in the ( 2060 ) itca 650 group .
mean body weight significantly ( p < 0.05 ) decreased in all treatment groups except the itca 650 2020 g / day group ( table 2 ) .
statistically significant ( p < 0.001 ) reductions from baseline ( day 0 ) to week 24 end point in mean hba1c were observed in all treatment groups with the greatest reductions observed in the 2060 g / day itca 650 group ( ls mean change , 1.36% ) and the 4080 g / day itca 650 group ( ls mean change , 1.4% ) ( table 2 ) . treatment with 2060 g / day itca 650 resulted in a significantly greater reduction in hba1c than 2020 or 4040 g / day itca 650 ( p < 0.001 ) . similarly , treatment with 4080 g / day itca 650 resulted in a significantly greater reduction in hba1c than 4040 g / day itca 650 ( p < 0.001 ) .
in addition , significant incremental reductions in hba1c were noted from weeks 12 to 24 in groups initially treated with ex - bid and then switched to 40 or 60 g /day itca 650 at week 12 ( p < 0.05 ) .
2020 g / day , 86% with itca 650 2060 g / day , 65% with itca 650 4040 g / day , and 78% with itca 650 4080 g / day . during the day 0 to week 24 period ,
significant ( p < 0.05 ) reductions from baseline in mean fpg were observed for all groups except the itca 650 4040 g / day group .
significant ( p < 0.005 ) reductions from baseline for mean body weight were observed for all groups except the itca 650 2020 g / day group .
at week 12 , significant ( p < 0.001 ) reductions from baseline in mean hba1c were observed in all three treatment groups ( table 2 ) . the ls mean change in hba1c from a mean baseline of 7.98.0% was 0.98 , 0.95 , and 0.72% for the 20 and 40 g / day itca 650 groups and the ex - bid group ; respectively .
hba1c 7% was achieved in 63 and 65% of subjects treated with 20 and 40 g / day itca 650 and in 50.0% with ex - bid .
significant ( p < 0.05 ) reductions from baseline in mean fpg were observed for all groups .
mean changes in hba1c and body weight at 012 weeks ( stage i ) , 1224 weeks ( stage ii ) , and overall ( 024 weeks )
during weeks 1224 , further significant ( p < 0.05 ) incremental reductions in mean hba1c were noted in subjects who were rerandomized to higher doses of itca 650 ( 2060 and 4080 ) or from exenatide injections to itca 650 ( ex - bid40 and ex - bid60 ) compared with those subjects rerandomized to remain on the same dose of itca 650 ( 20 20 or 4040 ) .
mean fpg decreased significantly ( p < 0.05 ) only in the ( 2060 ) itca 650 group .
mean body weight significantly ( p < 0.05 ) decreased in all treatment groups except the itca 650 2020 g / day group ( table 2 ) .
statistically significant ( p < 0.001 ) reductions from baseline ( day 0 ) to week 24 end point in mean hba1c were observed in all treatment groups with the greatest reductions observed in the 2060 g / day itca 650 group ( ls mean change , 1.36% ) and the 4080 g / day itca 650 group ( ls mean change , 1.4% ) ( table 2 ) . treatment with 2060 g / day itca 650 resulted in a significantly greater reduction in hba1c than 2020 or 4040 g / day itca 650 ( p < 0.001 ) . similarly , treatment with 4080 g / day itca 650 resulted in a significantly greater reduction in hba1c than 4040 g / day itca 650 ( p < 0.001 ) .
in addition , significant incremental reductions in hba1c were noted from weeks 12 to 24 in groups initially treated with ex - bid and then switched to 40 or 60 g /day itca 650 at week 12 ( p < 0.05 ) .
the proportion of subjects at hba1c 7% at 24 weeks was 60% with itca 2020 g / day , 86% with itca 650 2060 g / day , 65% with itca 650 4040 g / day , and 78% with itca 650 4080 g / day . during the day 0 to week 24 period , significant ( p < 0.05 ) reductions from baseline in mean fpg were observed for all groups except the itca 650 4040 g / day group .
significant ( p < 0.005 ) reductions from baseline for mean body weight were observed for all groups except the itca 650 2020 g / day group .
during stage i , the incidence of treatment - emergent aes ( teaes ) was slightly higher in the 40 g / day than the 20 g / day itca 650 and ex - bid groups .
one subject had a serious ae of acute cholecystitis associated with cholelithiasis and mild gallstone - induced pancreatitis during stage i that was considered unrelated to study drug .
discontinuation for drug - related aes occurred in 3.9% of subjects on itca 650 compared with 5.7% of subjects on ex - bid ( table 3 ) .
the most common drug - related aes were nausea , vomiting , and administration site events .
these events were most commonly observed early in the course of treatment and improved over time .
drug - related aes occurring in > 5% overall of subjects during stages i and ii as expected with exenatide treatment , gi side effects were among the most common reported aes . during week 1 , the incidence of nausea was similar with 20 g / day itca 650 and ex - bid 5 g ( 25.5 vs. 24.5% , respectively ) but declined rapidly to < 10% from week 3 to 2.2% by the end of stage i with 20 g / day itca 650 compared with 20.8% at week 12 with ex - bid 10 g .
the incidence of vomiting was highest during week 1 ( 7.8 , 13.7 , and 3.8% with itca 650 20 g , 40 g , and ex - bid , respectively ) and declined rapidly during stage i. no episodes of vomiting were reported with the 20-g dose of itca 650 after week 4 .
most events were also mild or moderate , with only one subject in the 40 g / day itca 650 group reporting severe vomiting . during stage ii ,
the lowest incidence of teaes occurred in the 2020 g / day group and was similar in the other five treatment groups .
the most common were nausea , diarrhea , vomiting , constipation , and decreased appetite ( table 3 ) . across all dose groups , five ( 3.8% )
subjects had a teae that led to discontinuation from the study , and six ( 4.6% ) subjects had a serious ae , none of which was considered related to study drug by the investigator .
subjects who remained on the same dose of itca 650 had a lower incidence of nausea than subjects whose dose was increased to 60 or 80 g /day ; no subjects on 2060 g / day experienced vomiting or discontinued therapy during stage ii .
the highest incidence was seen in the itca 650 groups rerandomized from ex - bid ( table 3 ) .
severe nausea occurred in two subjects in the ex - bid60 g / day and one subject in the 2020 g / day groups .
one subject in the ex - bid60 g / day and 2020 g / day groups experienced severe vomiting .
several different observations were reported in about half of subjects related to the site of administration of the itca 650 that mostly reflect the result of the normal healing process .
events such as bruising , pruritis , or pain local to the site of administration were usually reported within days of the placement and were typically mild and transient , resolving without any need for intervention .
no subjects had a severe ae related to the site of administration of itca 650 during the study .
subjects taking ex - bid injections reported hematoma ( 5.9% ) , hemorrhage ( 1.9% ) , and erythema ( 1.9% ) at the injection site . no clinically meaningful safety findings or trends in safety laboratory parameters or vital signs were noted .
no clinically relevant effects on serum calcitonin , thyroid - stimulating hormone , serum amylase , or serum lipase were reported during 24 weeks of study ( supplementary table 2 ) . in stage
i ( week 12 ) , high anti - exenatide antibody titers were observed in 0 , 2.1 , and 4.5% of subjects treated with 20 and 40 mg /day of itca 650 and ex - bid , respectively . in stage ii ( week 24 ) , high titers were observed in 5.3 , 7.0 , 7.3 , and 10% of subjects receiving 20 , 40 , 60 , and 80 mg /day of itca 650 , respectively .
data from the three antibody - positive subjects with high titers ( > 7,500 ) did not reveal any apparent relationship between antibody titer and loss of activity .
two subjects with high titers had reductions in both hba1c and body weight at the end of stages i and ii , and the third subject had increases in both hba1c and body weight , even as titer levels dropped in stage ii . at the end of stage ii , nine antibody - positive subjects had high titers .
the other three subjects showed a reduction in hba1c or a reduction in body weight .
the magnitude of activity observed in the high antibody titer subjects , which was similar to that observed in antibody - negative subjects , suggests that the presence of anti - exenatide antibodies did not reduce the activity of itca 650 in this study .
in this study , treatment for up to 24 weeks with itca 650 resulted in significant improvements in hba1c , fpg , and body weight in subjects with type 2 diabetes inadequately controlled on metformin monotherapy .
stage i of the study established that both initial doses of itca 650 ( 20 and 40 g / day ) resulted in significant hba1c reductions .
however , the itca 650 20 g / day dose resulted in less overall nausea from weeks 112 compared with 40 g / day and ex - bid . in stage ii , doses ranging up to 80 g / day of itca 650 demonstrated incremental reductions in hba1c levels at the higher doses .
the 60 g / day dose of itca 650 produced similar hba1c reductions and appeared to be better tolerated than the 80 g / day dose .
switching directly from ex - bid to higher doses of itca 650 was explored and also resulted in incremental reduction in hba1c levels with somewhat more nausea .
the most troublesome tolerability issue with glp-1 ra is the incidence and duration of gi side effects , in particular nausea and vomiting , that may account in clinical practice for the low treatment adherence and higher withdrawal rates , which are a greater problem than what has been reported in clinical trials ( 1,2,12 ) .
the reported incidence of nausea with ex - bid and once - weekly injection was 34.5 and 26.4% , respectively ( 13 ) .
vomiting has been reported in 18.6 and 10.8% with twice - daily and once - weekly dosing , respectively .
a similar incidence has been reported in other comparative trials of once - weekly and ex - bid ( 14,15 ) . however , during a 74-week open - label extension phase , nausea persisted in 12% of patients taking once - weekly exenatide ( 15 ) .
the incidence of nausea with liraglutide in phase 3 clinical trials ranged from 1040% ( 16 ) .
nausea was dose - related and occurred at higher rates within the first weeks of treatment . in this study ,
the incidence of nausea with itca 650 and ex - bid was generally comparable during the first week after treatment was initiated ; however , the incidence declined rapidly over 12 weeks with the 20-g dose of itca 650 compared with the other groups . in this study ,
local placement site aes were mild and transient , and no subjects had a severe local ae related to itca 650 .
injection site reactions including pain , induration , erythema , and bleeding have been reported with exenatide once - weekly injections ( 14,15 ) .
pruritus of mild intensity was observed in 18% of patients on exenatide once weekly versus 1.4% with ex - bid , which improved and resolved with continued treatment ( 13 ) .
another study reported injection site pruritus and erythema in 18 and 7% of patients , respectively , taking exenatide once - weekly injections during 30 weeks of treatment ( 14 ) .
these effects persisted at an incidence of 4% during a 74-week open - label extension phase .
an important barrier to optimizing glycemic control in patients with type 2 diabetes is poor adherence and persistence with chronic long - term treatment . in general ,
poor adherence to medications is known to result in poor disease control and increased health care costs ( 17 ) .
major factors contributing to poor adherence to diabetes medications are concerns about the risks of therapy , inconvenience , fear of injections , and complex dosing regimens ( 1822 ) .
rates of adherence to insulin injections in patients with type 2 diabetes were reported to range from < 6080% , and poor adherence impacts glycemic control and patient satisfaction ( 2328 ) .
examination of persistence with injectable antidiabetes drugs over 12 months from a pharmacy claims database found a mean persistence of 7.8 months among patients on ex - bid therapy ( 6 ) , and only two - thirds of subjects prescribed ex - bid persisted on treatment 1 year after initiation ( 26 ) .
the need for repeated injections of glp-1 ra creates a barrier to long - term patient adherence and compliance with therapy ( 68 ) .
itca 650 can provide continuous and controlled sc delivery of exenatide for up to 12 months ( 9,10 ) .
the potential to ensure 100% adherence with itca 650 may improve long - term therapeutic outcomes .
the limitations of this study include an open - label study design , absence of a control arm during stage ii , and small sample size .
itca 650 is an innovative delivery system for the glp-1 ra exenatide , being investigated for once- or twice - yearly administration in subjects with type 2 diabetes .
results from this phase 2 dose ranging trial showed significant dose - related effects on hba1c , fpg , and body weight that were maintained for up to 24 weeks .
itca 650 demonstrated a tolerability profile that may offer important advantages over exenatide bid injections and other long - acting injectable glp-1 ra compounds .
itca 650 was generally well tolerated , and patient acceptance and placement / removal of the delivery system were well accepted .
the most common drug - related aes were gi and administration site events that were generally observed early in the course of treatment and transient .
uniquely , itca 650 offers the potential of ensuring rapid attainment and maintenance of stable therapeutic exenatide levels , 100% compliance of drug delivery , and adherence to the prescribed regimen .
in addition , pharmacological effects can be terminated within 24 h of removal if necessitated by the presence of side effects or other clinical considerations .
the results of this study support additional clinical development of itca 650 in subjects with type 2 diabetes . | objectiveto evaluate itca 650 , a continuous subcutaneous miniature osmotic pump delivery system of exenatide versus twice - daily exenatide injections ( ex - bid ) in subjects with type 2 diabetes.research design and methodswe conducted a randomized , two - stage , 24-week , open - label , phase 2 study in type 2 diabetes inadequately controlled with metformin .
stage i : 155 subjects were randomized to 20 or 40 g / day of itca 650 or ex - bid 510 g .
stage ii : 131 subjects were rerandomized to 20 , 40 , 60 , or 80 g / day of itca 650 . change from baseline for hba1c , weight , and fasting plasma glucose were evaluated at weeks 12 and 24.resultshba1c was significantly lower in all groups after 12 and 24 weeks .
stage i : mean change in hba1c from a mean baseline of 7.98.0% was 0.98 , 0.95 , and 0.72% for the 20 and 40 g / day itca 650 and ex - bid groups , respectively , with 63 , 65 , and 50% of subjects achieving hba1c levels 7% ( p < 0.05 ) .
stage ii : significant ( p < 0.05 ) reductions in hba1c ( 1.4% from baseline ) were achieved with 60 and 80 g / day itca 650 , and 86 and 78% of subjects achieved hba1c 7% at 24 weeks ; respectively .
weight was reduced by 2.83.7 kg ( p < 0.05 ) at 24 weeks in all except the 2020 g / day group .
itca 650 was well tolerated ; nausea was lower and transient with 20 g / day relative to ex - bid ; and 60 g / day had the best profile of tolerability and hba1c lowering.conclusionsitca 650 significantly reduced hba1c and weight and was well tolerated .
the 2060 g / day regimen was considered the best dose for further examination in phase 3 . |
in recent times , droplet epitaxy ( de ) has extensively been used for the fabrication of iii v semiconductor quantum nanostructures that show a good rotational symmetry . indeed with this mbe - based technique ,
many different quantum systems with cylindrical symmetry can be grown , ranging from quantum rings ( qrs ) , to concentric multiple quantum rings ( cmqrs ) , to coupled rings / disks ( crds ) .
the interest in fabricating such structures is both fundamental , for the investigation of quantum interference phenomena and practical , in the fields of optoelectronics and quantum information technology . in gaas de ,
the fabrication of the compound semiconductor is basically achieved in two steps : first , ga molecular beam is supplied on the substrate in absence of as , for the formation of nanometre - size droplets and then , an as flux is used to transform the droplets into gaas . depending on the conditions of the crystallization step , many different shapes of the gaas nanocrystals can be obtained .
in particular , caused by the surface migration of ga atoms from the originally formed droplet during the as molecular beam supply , a lateral growth of gaas will be observed , which gives rise to the formation of outer rings or disks . by exploiting this lateral growth , here we propose a fabrication method for the formation of gaas concentric multiple rings , based on sequential short - time ( few tenth of seconds ) as molecular beam supplies at different substrate temperatures .
compared to the standard de , the innovation of our growth protocol consists in supplying only a small amount of as atoms to achieve a partial crystallization of the available ga , which is stored in the droplets ; after changing the substrate temperature , the procedure is repeated .
the growth experiments were performed on epi - ready gaas ( 001 ) wafers in a standard gen ii mbe system , equipped with a reflection high energy electron diffraction ( rheed ) system , for the in situ monitoring of the growth . for a good control of the as flux
initially , a gaas buffer layer and an al0.3ga0.7as barrier layer were grown at around 580c , after the oxide desorption .
the substrate temperature was then decreased to 400c , and the arsenic partial pressure in the chamber reduced below 1 10 torr order . at this point
equivalent , 30 mls of ga were supplied to form ga droplets with a deposition rate of 0.02 ml / s .
four crystallization steps were then performed , by using the same as flux of 5 10 torr at different temperatures : at 380c for 90 s , at 360c for 60 s , at 340c for 45 s and finally at 320c for 10 min in order to ensure the complete crystallization .
it is worth mentioning that in this case the substrate temperature sequence starts from the highest value ( 380c ) , while in our recent fabrication method for cmqrs , we used a reverse sequence , starting from the lowest temperature .
substrate temperature ( red line ) and arsenic supplies ( blue rectangles ) are plotted as a function of time just after the growth , the sample was cooled at room temperature and the surface morphology was investigated by means of atomic force microscopy ( afm ) .
after the procedure of ga molecular beam supply , numerous nearly hemispherical gallium droplets were formed , with an average diameter of around 160 nm and a density of around 1 10 cm .
it is worth noticing that inner ring diameter is nearly equal to that of the original ga droplet and that the density of the gaas structures is equal to that of the original droplets , confirming that all ga droplets transformed into gaas multiple rings at the end of the procedure . in fig .
2 , we show the afm images of a single concentric multiple rings structure obtained after the above mentioned experimental procedure .
five concentric nanometre - size gaas rings are clearly formed at the end of the procedure and even if the rings generally show a good rotational symmetry , some degree of anisotropy is surely present and more emphasized for the inner rings .
this anisotropy might arise from the different surface migration length of ga atoms along [ 110 ] and .
the rings diameter along [ 110 ] direction are 150 , 350 , 430 , 550 and 690 nm , while along are 135 , 230 , 330 , 450 and 610 nm , respectively .
inner rings heights are 7 and 3 nm while around 1 nm for the three outer rings .
bi - dimensional ( a ) and three - dimensional ( b ) afm images of a single gaas concentric multiple rings structure obtained in our experiment as already described in ref .
, in concentric multiple rings structures , the inner ring has a different origin compared to the outer ones .
indeed , the inner ring is formed just after the ga droplets formation , caused by a partial dissolution of as coming from the substrate or from the background inside the liquid gallium .
this was confirmed by fabricating a sample where no as was intentionally supplied after the formation of ga droplets and by subsequent selective chemical etching in order to remove only the metallic gallium , without damaging the gaas structure . in this sample
therefore , we can conclude that the inner ring present at the centre of the final structure is the result of the accretion of the tiny ring , marking the original droplets perimeter . on the contrary
, every outer ring was found to be formed as a result of each as supply , caused by the interplay between the adsorption of arsenic atoms on the substrate surface and the simultaneous migration of ga atoms , which depart from the original droplets .
being the surface diffusion of ga atoms a thermally activated process , depending exponentially on the substrate temperature , larger diameter for the outer rings will correspond to higher temperatures .
therefore , in our experimental procedure , the outer rings are the first to be formed , caused by the larger diffusion length of gallium atoms at 380c . in order to give a quantitative discussion of the degree of anisotropy in the gaas nanostructure
, we plotted the diffusion area d covered by the ga atoms migration from the original droplet during as adsorption as a function of temperature , where d is the surface diffusion coefficient of ga atoms and the time interval between arrival and adsorption of as atoms , that we can consider independent from the temperature , as discussed in ref . .
to calculate the diffusion area for the two perpendicular crystallographic directions , we assumed a perfectly circular area with a radius given by each ring radius along and [ 110 ] directions ( r and r[110 ] in the insets of fig .
the difference between the obtained area and the inner ring area will give the desired diffusion area ( yellow regions in the insets of fig .
3 ) , since the inner ring region is considered as the initial position of the ga atoms before the as supply .
the results are shown in fig . 3 for both ( red squares ) and [ 110 ] ( black squares ) directions , and the exponential dependence of d on the temperature
is confirmed in both cases . by the arrhenius plot , the values of 1.28 and 0.85 ev for the activation energy for the ga migration along and [ 110 ]
we stress that these values are obtained by studying the surface migration of ga in the case of the formation of our complex gaas nanostructure constituted by concentric multiple rings . since with our experimental procedure , the first structure to be formed is the outer one and the other rings are formed as a result of the ga migration on a non perfectly flat gaas ( 001 ) surface .
in fact , the surface of the outer ring has a sub - nanometre surface roughness .
although it is not clear the detailed mechanism , the roughness of the actual surface over which gallium atoms can migrate might in general affect their diffusion length . therefore , our experimental findings can not be used to obtain the universal values for the activation energy of ga atoms diffusion on gaas ( 001 ) substrate .
however , by means of these data , we can finely tune the diameter of each ring only by controlling the substrate temperature during the as supply .
operatively , this gives and important degree of freedom in the design of nanometre - size complex gaas nanostructures .
since the electronic properties descend from the size and the shape of our materials , a good control over the dimension of the nanostructure is of the outmost relevance . apart from the interest in the fundamentals of the crystal growth , these multiple rings systems can be used to investigate aharonov
bohm effect or serve as templates for the growth of ordered arrays of inas quantum dots on gaas .
each ring perimeter might be a preferential site for the nucleation of quantum dots , giving rise to circularly ordered arrays , as was already found in ref . .
arrhenius plot of the diffusion area covered by ga atoms during their migration from the ga droplets as a function of the reverse temperature . in the insets : scheme of the procedure to calculate the diffusion area ( yellow zone delimitated by the dashed line ) for both [ 110 ] ( top panel ) and ( bottom panel ) .
we have shown the fabrication method and the morphological analysis of gaas concentric multiple rings structures grown in by de .
a five ring structure was created by exploiting the lateral growth of gaas around the originally formed ga droplets . controlling the substrate temperature during the arsenic supply for the crystallization , it is possible to govern the diffusion length of ga atoms and therefore each ring diameter .
the nanostructures showed an anisotropy along and [ 110 ] directions , and two different values of the activation energy for the diffusion of gallium atoms along these directions were obtained .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited . | we present the molecular beam epitaxy fabrication of complex gaas / algaas nanostructures by droplet epitaxy , characterized by the presence of concentric multiple rings .
we propose an innovative experimental procedure that allows the fabrication of individual portions of the structure , controlling their diameter by only changing the substrate temperature .
the obtained nanocrystals show a significant anisotropy between [ 110 ] and [ 110 ] crystallographic directions , which can be ascribed to different activation energies for the ga atoms migration processes . |
implantation of multifocal intraocular lenses ( iol ) restores vision over a range of distances and reduces spectacle dependence after cataract surgery and refractive lens exchange [ 13 ] . a key factor in achieving spectacle independence and patient satisfaction is precise control of the postoperative refractive error .
distance visual acuity , intermediate visual acuity , and near visual acuity of diffractive multifocal iols can be compromised with the presence of residual astigmatism .
several approaches can be used to correct astigmatism in cataract surgery , for example , limbal relaxing incisions , bioptics , and implantation of a toric iol .
toric iol implantation represents the only viable option that provides predictable refractive outcomes and at the same time does not require additional surgery [ 510 ] .
patients with substantial corneal astigmatism and high axial myopia have limited choices of toric multifocal iols ( tmiols ) because a low or negative dioptric power is required . currently , four tmiols are commercially available and only the at lisa 909 m
this tmiol has been shown to be effective in restoring vision at various distances [ 1214 ] and correcting astigmatism [ 1217 ] .
however , studies of this tmiol included only eyes with an average axial length ( al ) ( range , 23.19 to 24.25 mm ) . in the current study
, we evaluated the monocular and binocular distance , intermediate , and near visual acuities ( vas ) under both photopic and mesopic conditions ; monocular and binocular contrast sensitivity ( cs ) under photopic condition ; visual symptoms ; patient satisfaction ; and spectacle independence in high myopes after bilateral implantation of the at lisa 909 m tmiol .
this prospective , observational case series included patients who had bilateral implantation of the at lisa 909 m tmiol after cataract surgery between may 2011 and march 2015 at the hong kong sanatorium and hospital .
the inclusion criteria were an al of 26 mm or longer [ 1822 ] , corneal astigmatism exceeding one dioptre ( d ) , and a follow - up period of six months or more .
the exclusion criteria were systemic diseases that may affect the postoperative va ( e.g. , uncontrolled diabetes mellitus ) , capsule or zonular abnormalities that may affect postoperative iol centration or tilt ( e.g. , pseudoexfoliation syndrome and marfan 's syndrome ) , and a history of corneal refractive surgery .
the 909 m is a single - piece , foldable , acrylic tmiol with + 3.75 d near addition ( ~+3.00 d at the spectacle plane ) .
the overall diameter is 11 mm and the optic diameter is 6 mm .
it has a four - haptic design with an aspheric , toric anterior surface and a posterior diffractive surface .
the aspheric surface corrects for + 0.18 m spherical aberration at 6 mm pupil ( email communication with carl zeiss meditec ag , 2015 . ) .
the energy distribution between the distance and near foci is asymmetrical ( 65% for distance focus and 35% to near focus ) and independent of pupillary size [ 12 , 14 , 15 ] .
the same surgeon ( john s. m. chang ) performed all surgeries under topical oxybuprocaine 0.4% and intracameral lidocaine 1% or 2% .
preoperatively , the surgeon used nepafenac ophthalmic suspension 0.1% ( nevanac , alcon laboratories inc . , fort worth , tx ) and tropicamide 0.5% phenylephrine hydrochloride 0.5% ( mydrin - p , santen pharmaceutical co. , ltd . ,
the vertical meridian of the eyes was marked at the limbus under the slit lamp with the patient sitting upright .
a 2.25 mm clear corneal incision was created either superiorly or temporally with a keratome .
discovisc ophthalmic viscosurgical device ( ovd ) ( alcon laboratories inc . ) was injected into the anterior chamber and continuous curvilinear capsulorhexis was created with forceps .
after hydrodissection and nucleus splitting , coaxial phacoemulsification was performed using the infiniti vision system ( alcon laboratories inc . ) .
irrigation and aspiration of the residual cortex and posterior capsule polishing were performed using a coaxial system .
next , the two vertical marks at the limbus were used to position the gimbel - mendez fixation ring ( mastel precision , rapid city , sd ) and the intended tmiol axis orientation was marked on the cornea using a coloured marker for intraoperative alignment of the tmiol .
the tmiol was implanted into the capsular bag and then manipulated until its two linear marks were aligned with the corneal marks .
the ovd was removed and the surgeon ascertained that the tmiol remained correctly orientated before the surgery concluded . during the postoperative period ,
neodymium - doped yttrium aluminium garnet ( nd : yag ) laser was performed if there was evidence of posterior capsular opacification ( pco ) that affected the vision .
a comprehensive eye examination was performed preoperatively , which included a detailed history with specific attention to the presence of dry eyes , visual distortion , and systemic diseases ; other examinations included goldmann applanation tonometry , slit - lamp biomicroscopy , and fundus examination .
corneal topography ( orbscan iiz ( bausch & lomb , rochester , ny ) or wavelight oculyzer ( alcon laboratories inc . ) ) was performed in some of the patients after the current study has commenced .
the iolmaster ( carl zeiss meditec ag ) was used to acquire all the ocular parameters ( al , corneal curvature , and anterior chamber depth ) necessary for tmiol power calculation using the manufacturer 's online calculator ( zcalc , carl zeiss meditec ag ) .
all patients were shown a video that demonstrated visual symptoms ( halo , night glare , and starbursts ) and were informed about the possibility of permanent visual symptoms .
the postoperative measurement included noncycloplegic subjective refraction , va , cs , and pupillary size .
the monocular and binocular va tests included measurement of the uncorrected distance va ( udva ) , corrected distance va ( cdva ) , uncorrected intermediate va ( uiva ) at 67 cm , distance - corrected intermediate va ( dciva ) at 67 cm , uncorrected near va ( unva ) at 30 cm , and distance - corrected near va ( dcnva ) at 30 cm under photopic and mesopic conditions .
the intermediate vision and near vision were measured using the sloan two - sided edtrs format near vision chart ( precision vision , la salle , il ) designed for use at 40 cm .
the actual va in logarithm of the minimum angle of resolution ( logmar ) at its corresponding distance was calculated by the visual angle subtended for statistical analyses .
the monocular and binocular distance - corrected photopic cs at spatial frequencies of 3 , 6 , 12 , and 18 cycles / degree ( cpd ) were recorded using the csv-1000e ( vector vision , greenville , oh ) .
the photopic and mesopic pupillary sizes were measured using the colvard pupillometer ( oasys medical inc .
photopic and mesopic assessments were performed at 85 and 3 candelas / m , respectively .
the iol rotation was evaluated under the slit lamp with reference to the orientation of the two linear marks located on the iol after pupil dilation ; the iol rotation was compared to the intended orientation .
the patients completed a questionnaire regarding visual symptoms ( halos , night glare , and starbursts ) , vision rating ( distance , intermediate , and near ) , patient satisfaction , spectacle independence ( distance , intermediate , and near ) , regrets about undergoing the surgery , and whether the patient would recommend the surgery to friends or relatives .
the patients rated the level of visual symptoms from 0 to 5 ( 0 , none ; 1 , very mild ; 2 , mild ; 3 , moderate ; 4 severe ; 5 , very severe ) ; vision rating from 1 to 5 ( 1 , very blurry ; 2 , blurry ; 3 , fair ; 4 , clear ; 5 , very clear ) , and satisfaction from 1 to 5 ( 1 , very dissatisfied ; 2 , dissatisfied ; 3 , neutral ; 4 , satisfied ; 5 , very satisfied ) .
the alpins method was used for vector analysis of the astigmatic results [ 24 , 25 ] .
the target refraction and achieved refraction were decomposed into the two principal meridian powers and then vertexed to the corneal plane with a 12 mm back vertex distance .
the difference between the vertexed powers at the two principal meridians denoted the refractive astigmatism at the corneal plane .
the astigmatic values were transformed into rectangular coordinates to derive the three fundamental vectors , namely , the target induced astigmatism ( tia ) , surgically induced astigmatism ( sia ) , and difference vector .
these values were used to compute the following parameters to describe the accuracy of the astigmatic correction [ 24 , 25 ] : the magnitude of error , which is the arithmetic difference between the magnitudes of the sia and tia , a positive value of which indicates an overcorrection and a negative value indicates undercorrection ; the angle of error , which is the angle described by the vectors of the achieved correction ( i.e. , sia ) and intended correction ( i.e. , tia ) , a positive value of which indicates that the achieved correction is counterclockwise to the intended axis and a negative value indicates the achieved correction is clockwise to the intended axis ; the correction index , which is the ratio of the sia to the tia , of which the preferred ratio is 1 , with a higher value indicating overcorrection and a lower value indicating undercorrection ; and the index of success , which is the ratio of the difference vector to the tia , of which the preferred value is 0 .
the paired t - test was performed to compare the preoperative and postoperative keratometry values .
the paired t - test and wilcoxon signed - rank test were performed to compare the postoperative photopic and mesopic va .
the paired t - test was performed to show binocular summations , defined as the difference between the binocular and better - eye distance - corrected va and cs .
all statistical analyses were performed using spss version 16.0 ( spss inc . , chicago , il ) .
table 1 shows the preoperative demographics and characteristics of the 28 eyes ( 14 patients ) .
corneal topography was measured on 10 patients ( 71% ) ; none of them had irregular astigmatism .
the mean follow - up period was 17.5 10.0 months ( range , 6 to 37 ) .
intraoperative complications occurred in two eyes ( 7% ) , which include an anterior vitrectomy due to a rounded , nonextending posterior capsular tear with vitreous loss and intraoperative cracking of iol optic requiring iol exchange . in these cases ,
the iol was implanted in the capsular bag and was well centred ; there was no loss in va .
the mean photopic and mesopic pupillary sizes were 3.76 0.50 mm ( range , 2.50 to 4.50 ) and 5.23 0.75 mm ( range , 3.00 to 6.29 ) , respectively .
the mean postoperative refractive error was 0.42 0.48 d ( range , 1.25 to 0.50 ) sphere and 0.59 0.54 d ( range , 0.00 to 2.25 ) cylinder with manifest refraction spherical equivalent ( mrse ) of 0.13 0.42 d ( range , 1.25 to 0.63 ) .
twenty - four ( 86% ) and 27 eyes ( 96% ) had mrse of 0.50 d and 1.00 d of emmetropia , respectively .
the mean error of the mrse from the target refraction was 0.24 0.34 d ( range , 0.33 to 0.82 ) .
all eyes ( 100% ) achieved mrse of 1.00 d from the target refraction ( figure 1 ) .
twenty - five eyes ( 89% ) had refractive astigmatism of 1.00 d or less ( figure 1 ) .
table 2 shows the mean monocular uncorrected and distance - corrected vas and the numbers and percentages of eyes achieving 20/40 and 20/25 under photopic and mesopic conditions .
the mean uiva , dciva , unva , and dcnva were significantly worse under mesopic condition than under photopic condition ( p < 0.001 for all comparisons ) .
one eye ( 4% ) had va loss from 20/20 to 20/25 ( figure 1 ) . both eyes ( 7% )
of one patient had mild posterior staphyloma with a bilateral cdva of 20/25 postoperatively .
table 3 shows the mean binocular uncorrected and distance - corrected vas and the numbers and percentages of patients achieving 20/40 and 20/25 under photopic and mesopic conditions .
the mean binocular udva , uiva , dciva , unva , and dcnva were significantly worse under mesopic condition than under photopic condition ( p = 0.043 , 0.001 , 0.001 , < 0.001 , and 0.001 , resp . ) .
figure 2 shows the cumulative percentages of binocular uncorrected distance , intermediate , and near vas under photopic and mesopic conditions , respectively . under photopic condition ,
the mean binocular distance - corrected vas did not significantly differ from the mean better - eye distance - corrected distance , intermediate , and near vas ( p = 0.336 , 0.120 , and 0.099 , resp . ) . under mesopic condition , the mean
binocular distance - corrected vas did not significantly differ from the mean better - eye cdva ( p = 0.165 ) but improved significantly compared to the mean better - eye distance - corrected intermediate and near vas ( p = 0.019 and 0.012 , resp . ) .
the mean absolute iol rotation away from the intended orientation was 3.5 5.0 degrees ( range , 0 to 22 ) .
twenty - one ( 84% ) and 23 eyes ( 92% ) had a rotation of 5 and 10 degrees or less , respectively .
twenty - seven eyes ( 96% ) had preoperative with - the - rule corneal astigmatism with the axis of the steep meridian ranging from 65 to 103 ; one eye ( 4% ) had oblique corneal astigmatism with steep axis at 60 .
figures 1 and 3 and table 4 show the vector analysis of the astigmatic results .
the mean absolute angle of error was 4.78 7.02 degrees ( range , 0.00 to 36.69 ) ; three eyes ( 11% ) had a large angle of error of 10.21 , 13.21 , and 36.69 degrees , respectively , which corresponded to misalignment of iol axis orientation ( figure 1 ) .
figure 4 shows the monocular ( data available in 22 eyes ) and binocular ( data available in 12 patients ) cs at spatial frequency of 3 , 6 , 12 , and 18 cpd under photopic condition .
the mean binocular photopic cs did not differ significantly from the mean better - eye cs at 3 , 6 , 12 , and 18 cpd ( p = 0.666 , 0.165 , 0.224 , and 1.000 ) .
table 5 shows the mean and median levels of visual symptoms , vision rating , and patient satisfaction .
seven ( 50% ) , five ( 36% ) , and four ( 29% ) patients reported halos , night glare , and starbursts , respectively . among the symptomatic patients , one ( 14% ) , 0 ( 0% ) , and 0 ( 0% ) reported moderate symptoms ( score , 3 ) , respectively .
fourteen ( 100% ) , nine ( 64% ) , and 13 patients ( 93% ) rated their vision as clear ( score , 4 ) or very clear ( score , 5 ) at far distance , intermediate distance , and near distance , respectively .
thirteen patients ( 93% ) were satisfied ( score , 4 ) or very satisfied ( score , 5 ) with the bilateral surgery ; no patient was dissatisfied .
this is the first prospective study of the visual outcomes and patient satisfaction after bilateral implantation of the at lisa 909 m tmiol in high myopes .
previous cataract research of high myopic eyes focused primarily on monofocal iol implantation [ 18 , 22 , 27 , 28 ] or did not report the outcomes regarding the type of iol used [ 19 , 22 , 29 , 30 ] .
the results showed that cataract surgery in highly myopic eyes was associated with worse va , poorer cs , or higher risk of retinal complications compared to eyes with an average al .
compared the distance and near vas and cs after implantation of the nontoric at lisa 809 m multifocal iol ( carl zeiss meditec ag ) between high and low - to - moderate myopic eyes and found no significant differences between the groups .
alfonso et al . reported better results for distance and near vas and cs in a group of low rather than highly myopic eyes after the implantation of the nontoric restor sn60d3 multifocal iol ( alcon laboratories inc . ) .
ogawa et al . compared the distance and near vas and cs of tecnis multifocal iol ( abbott medical optics , inc . ,
santa ana , ca ) between eyes with an al < 26 mm and 26 mm and found no significant differences between groups .
the presence of maculopathy has been associated with a poor cdva after cataract surgery in highly myopic eyes [ 27 , 29 ] , while highly myopic eyes without maculopathy could achieve similar postoperative outcomes to eyes with an average al [ 21 , 27 ] . in the current study , two of the eight eyes with a postoperative cdva worse than 20/20 had mild posterior staphyloma ; none of the 24 eyes with a postoperative cdva of 20/20 or better had posterior staphyloma .
in other words , there was a higher risk of achieving poorer cdva in eyes with maculopathy .
nevertheless , the mean cdva of 20/19 is consistent with previous studies of the 909 m in eyes with an average al ( range , 20/22 to 20/14 ) [ 1216 , 33 ] . under mesopic condition ,
the current mean cdva did not worsen and is possibly explained by the distance - dominant nature of the at lisa multifocal iols and the aspheric profile that corrects spherical aberration under dim light . regarding near vision , the 909 m provided a mean monocular dcnva of 20/35 at 30 cm in the current study , which appears to be worse than the reported value of 20/28 at 40 cm that bellucci et al .
reported and other bifocal multifocal iols with a similar near addition , at 30 to 33 cm ( range , 20/25 to 20/20 ) [ 2 , 3 , 3135 ] . under mesopic condition , the mean dcnva decreased by one line from 20/35 to 20/46 .
the distance - dominant design of the at lisa bifocal multifocal iols assumes that the patients read under normal light condition .
therefore , in dim light , 35% of refracted light to near portion would be insufficient to sustain clear near vision , not to mention the inevitable energy loss of the diffractive optic design ; however , bilateral implantation significantly improved the mesopic dcnva to 20/38 .
the current mean monocular dciva at 67 cm was 20/39 , which was not as good as the distance and near vision but was within the reported values of other studies of the 909 m ( range , 20/66 to 20/23 ) [ 1214 ] and 809 m ( range , 20/47 to 20/28 ) [ 3 , 35 ] in eyes with an average al at 60 to 80 cm . the mean mesopic dciva was 20/56 and was significantly worse than that of the photopic dciva because of insufficient light energy with the 909 m bifocal essence .
previous studies showed that highly myopic eyes had worse cs than other eyes under phakic [ 33 , 37 ] , monofocal pseudophakic , and multifocal pseudophakic conditions .
it was a general agreement that the reduced sensitivity of the postreceptoral processes [ 18 , 37 ] or morphological changes in retina [ 18 , 22 , 27 , 37 ] in highly myopic eyes may play a role . nevertheless , the current monocular photopic cs was comparable to two general populations across different spatial frequencies .
the current results were worse than those in a young population aged between 20 and 55 years at spatial frequencies of 6 , 12 , and 18 cpd ( p < 0.001 for all comparisons ; independent two - sample t - test ) but better than another population aged between 50 and 75 years [ 38 , 39 ] at spatial frequencies of 3 and 6 cpd ( p < 0.001 and = 0.019 , resp . ;
the current cs also did not differ significantly from that of eyes with an average al implanted with the 909 m at all spatial frequencies ( p > 0.05 for all comparisons ; independent two - sample t - test ) ( figure 4 ) .
three eyes in the current study had postoperative monocular cs substantially lower ( more than 40% ) than the mean value of the cohort at high spatial frequencies , among which two had posterior staphyloma
highly myopic eyes still achieved good visual quality postoperatively as long as the macula was normal .
a thorough preoperative examination on retinal status before cataract surgery for high myopes , especially with optical coherence tomography , is of paramount importance to manage patient expectations .
iol power calculation is challenging in eyes with a long al because iols of low or negative dioptric power have a different geometry from the others .
undesirable hyperopic error may occur [ 20 , 28 ] and the errors were greater with an increasing al [ 20 , 28 , 40 ] .
inaccurate al measurement in eyes with deep posterior staphyloma using ultrasound biometry also can result in postoperative hyperopic errors [ 28 , 40 ] . in the current study , we performed optical biometry in all eyes and the iol power was calculated using the manufacturer 's calculator .
sixty - three percent and 100% of eyes achieved mrse within 0.50 d and 1.00 d from the target refraction , respectively . in the two eyes diagnosed with mild staphyloma preoperatively ,
the errors from target refraction were 0.54 d and 0.11 d , respectively .
overall , no obvious trend toward hyperopia ( mean error , 0.24 d ) was observed in this group of high myopes ; the manufacturer 's online iol power calculator was reliable in achieving the targeted refraction .
the use of a 2.2 mm incision minimizes the surgically induced corneal astigmatism and improves the predictability of astigmatic correction [ 16 , 17 ] .
the refractive astigmatism decreased from 1.83 d to 0.59 d in the current study .
however , 11% of eyes had postoperative refractive astigmatism of more than 1 d because of overcorrection or iol axis misalignment . from the vector analysis ,
the manufacturer 's calculator overcorrects astigmatism ( magnitude of error , > 0.50 d ) in 12 eyes ( 43% ) .
almost all eyes in the current study had with - the - rule corneal astigmatism measured by an automated keratometer . without considering the posterior corneal astigmatism , these eyes are more prone to astigmatic overcorrection [ 41 , 42 ] . in the current study ,
the mean absolute iol rotation was 3.5 degrees and in most eyes ( 84% ) the rotation was 5 degrees or less .
previous studies have shown slightly better rotational stability of the 909 m than the current study , with mean rotations ranging from 1.5 to 3.1 degrees [ 1214 ] , and 93% to 96% of eyes had less than 5 degrees of rotation [ 12 , 14 ] .
toric iol rotation tended to occur in eyes with a longer al [ 43 , 44 ] , which are associated with a larger capsular bag [ 45 , 46 ] .
the current eyes were highly myopic , which may explain the worse rotation results compared with previous studies of the 909 m .
one goal of implanting tmiols is spectacle independence , and the postoperative uncorrected va and rate of spectacle independence reflect patients ' vision in reality . in the current study ,
the mean binocular udva , uiva , and unva were 20/20 , 20/27 , and 20/32 , respectively .
this resulted in a mean patient satisfaction score of 4.39 of 5 and a rate of complete spectacle independence of 71% .
two patients ( 14% ) had blurry or very blurry intermediate vision , among which one required spectacles for intermediate tasks and his binocular uiva was 20/38 .
this implied that good postoperative binocular uiva does not guarantee good visual quality because the bifocal design of the 909 m directs minimal light energy to the intermediate portion of the multifocal iol .
to enhance image brightness , a pair of spectacles with an addition of + 1.25 d shifts the distance focus of the tmiol for intermediate tasks .
most of the current patients reported halos and night glare and only a few perceived starbursts , but no patient rated them as severe or very severe .
visser et al . also found that more than half of the patients had visual symptoms after implantation of the 909 m but none reported severe symptoms .
this could be attributed to the soft transition of the phase zones between the main zones of the diffractive structure of the at lisa multifocal iols and the adjusted phase zones for reduction of disturbing light phenomena [ 12 , 34 ] . in eyes with a long al
, there is an increased risk of retinal detachment ( rd ) after cataract surgery [ 19 , 4749 ] .
the reported rates of rd after phacoemulsification have ranged from 0% to 1.72% six months postoperatively [ 19 , 27 , 30 ] but reached 1.9% at two to three years postoperatively [ 30 , 49 ] . in a long - term follow - up of five years , the rate increased to a range between 2.3% and 3.8% [ 30 , 50 ] .
conducted an epidemiological study and reported that 70% of postoperative rd occurred within two years after phacoemulsification .
however , no postoperative rd developed in any eyes during the mean follow - up period of 17.0 months although the current patients had a long al ( mean , 29.16 mm ) and other significant independent risk factors including young age [ 30 , 47 , 48 ] ( mean , 48.2 years ) and intraoperative complications such as posterior capsular tear with subsequent anterior vitrectomy [ 47 , 49 ] , which occurred in one eye .
previous studies of the 809 m and 909 m have reported rates between 3.1% and 14% six months postoperatively [ 3 , 12 , 13 , 17 ] .
first , the follow - up period in the current study was longer than previous studies .
second , the current patients were younger at cataract surgery than those in other studies of at lisa multifocal iols , in which their patient ages ranged from 51.1 to 58.3 years .
furthermore , the plate haptic with zero - degree angulation of the at lisa multifocal iols is also a risk factor for pco .
since a larger capsular bag size in highly myopic eyes may be more prone to epithelial cell migration , the interaction with these features requires further clarification .
although nd : yag capsulotomy is a controversial risk factor for postoperative rd in average eyes [ 30 , 47 , 48 ] , one study found it to be a risk factor in highly myopic eyes .
first , most of the current patients were female and this limited the generalizability to male population .
second , the mesopic cs was not measured for a more comprehensive description of the visual function at distance .
third , it would be ideal to measure the ocular higher - order aberrations and correlate them with the contrast sensitivity and visual symptoms .
in conclusion , the current study showed that implantation of the at lisa 909 m tmiol restored the vision of high myopes at various distances .
the visual quality at intermediate distance was not as good as that at far distance and near distance , which was reflected in the vision rating and spectacle independence .
halos and night glare were prevalent but were rated mild or moderate and did not affect patient satisfaction . | background .
the vision with diffractive toric multifocal intraocular lenses after cataract surgery in long eyes has not been studied previously . objectives . to report visual performance after bilateral implantation of a diffractive toric multifocal intraocular lens in high myopes .
methods .
prospective , observational case series to include patients with axial length of 26 mm and corneal astigmatism of > 1 dioptre who underwent bilateral at lisa 909 m implantation .
postoperative examinations included photopic and mesopic distance , intermediate , and near visual acuity ; photopic contrast sensitivity ; visual symptoms ( 05 ) ; satisfaction ( 15 ) ; and spectacle independence rate . results .
twenty - eight eyes ( 14 patients ) were included .
postoperatively , mean photopic monocular uncorrected distance , intermediate , and near visual acuities ( logmar ) were 0.12 0.20 ( standard deviation ) , 0.24 0.16 , and 0.29 0.21 , respectively .
corresponding binocular values were 0.01 0.14 , 0.13 0.12 , and 0.20 0.19 , respectively .
one eye ( 4% ) had one - line loss in vision . under mesopic condition ,
intermediate vision and near vision decreased significantly ( all p 0.001 ) .
contrast sensitivity at all spatial frequencies did not improve significantly under binocular condition ( all p > 0.05 ) .
median scores for halos , night glare , starbursts , and satisfaction were 0.50 , 0.00 , 0.00 , and 4.25 , respectively .
ten patients ( 71% ) reported complete spectacle independence .
conclusions .
bilateral implantation of the intraocular lens in high myopes appeared to be safe and achieved good visual performance and high satisfaction . |